WorldWideScience

Sample records for hno4 clo hocl

  1. Diurnal variation of stratospheric and lower mesospheric HOCl, ClO and HO2 at the equator: comparison of 1-D model calculations with measurements by satellite instruments

    M. Khosravi

    2013-08-01

    Full Text Available The diurnal variation of HOCl and the related species ClO, HO2 and HCl measured by satellites has been compared with the results of a one-dimensional photochemical model. The study compares the data from various limb-viewing instruments with model simulations from the middle stratosphere to the lower mesosphere. Data from three sub-millimetre instruments and two infrared spectrometers are used, namely from the Sub-Millimetre Radiometer (SMR on board Odin, the Microwave Limb Sounder (MLS on board Aura, the Superconducting Submillimeter-wave Limb-Emission Sounder (SMILES on the International Space Station, the Michelson Interferometer for Passive Atmospheric Sounding (MIPAS on board ENVISAT, and the Atmospheric Chemistry Experiment Fourier Transform Spectrometer (ACE-FTS on board SCISAT. Inter-comparison of the measurements from instruments on sun-synchronous satellites (SMR, MLS, MIPAS and measurements from solar occultation instruments (ACE-FTS is challenging since the measurements correspond to different solar zenith angles (or local times. However, using a model which covers all solar zenith angles and data from the SMILES instrument which measured at all local times over a period of several months provides the possibility to verify the model and to indirectly compare the diurnally variable species. The satellite data were averaged for latitudes of 20° S to 20° N for the SMILES observation period from November 2009 to April 2010 and were compared at three altitudes: 35, 45 and 55 km. Besides presenting the SMILES data, the study also shows a first comparison of the latest MLS data (version 3.3 of HOCl, ClO, and HO2 with other satellite observations, as well as a first evaluation of HO2 observations made by Odin/SMR. The MISU-1D model has been carefully initialised and run for conditions and locations of the observations. The diurnal cycle features for the species investigated here are generally well reproduced by the model. The satellite

  2. HOCl and Cl2 observations in marine air

    R. Sommariva

    2011-08-01

    Full Text Available Cl atoms in the marine atmosphere may significantly impact the lifetimes of methane and other hydrocarbons. However, the existing estimates of Cl atom levels in marine air are based on indirect evidence. Here we present measurements of the Cl precursors HOCl and Cl2 in the marine boundary layer during June of 2009 at the Cape Verde Atmospheric Observatory in the eastern tropical Atlantic. These are the first measurements of tropospheric HOCl. HOCl and Cl2 levels were low in air with open ocean back trajectories, with maximum levels always below 60 and 10 ppt (pmol/mol, respectively. In air with trajectories originating over Europe, HOCl and Cl2 levels were higher, with HOCl maxima exceeding 100 ppt each day and Cl2 reaching up to 35 ppt. The increased Cl cycling associated with long distance pollutant transport over the oceans likely impacts a wide geographic area and represents a mechanism by which human activities have increased the reactivity of the marine atmosphere. Data-constrained model simulations indicate that Cl atoms account for approximately 15 % of methane destruction on days when aged polluted air arrives at the site. A photochemical model does not adequately simulate the observed abundances of HOCl and Cl2, raising the possibility of an unknown HOCl source.

  3. CLO : The cell line ontology

    Sarntivijai, Sirarat; Lin, Yu; Xiang, Zuoshuang; Meehan, Terrence F.; Diehl, Alexander D.; Vempati, Uma D.; Schuerer, Stephan C.; Pang, Chao; Malone, James; Parkinson, Helen; Liu, Yue; Takatsuki, Terue; Saijo, Kaoru; Masuya, Hiroshi; Nakamura, Yukio; Brush, Matthew H.; Haendel, Melissa A.; Zheng, Jie; Stoeckert, Christian J.; Peters, Bjoern; Mungall, Christopher J.; Carey, Thomas E.; States, David J.; Athey, Brian D.; He, Yongqun

    2014-01-01

    Background: Cell lines have been widely used in biomedical research. The community-based Cell Line Ontology (CLO) is a member of the OBO Foundry library that covers the domain of cell lines. Since its publication two years ago, significant updates have been made, including new groups joining the CLO

  4. MLS/Aura Level 2 Hypochlorous Acid (HOCl) Mixing Ratio V003 (ML2HOCL) at GES DISC

    National Aeronautics and Space Administration — ML2HOCL is the EOS Aura Microwave Limb Sounder (MLS) standard product for hypochlorous acid derived from radiances measured primarily by the 640 GHz radiometer. The...

  5. 20 years of ClO measurements in the Antarctic lower stratosphere

    Nedoluha, Gerald E.; Connor, Brian J.; Mooney, Thomas; Barrett, James W.; Parrish, Alan; Gomez, R. Michael; Boyd, Ian; Allen, Douglas R.; Kotkamp, Michael; Kremser, Stefanie; Deshler, Terry; Newman, Paul; Santee, Michelle L.

    2016-08-01

    We present 20 years (1996-2015) of austral springtime measurements of chlorine monoxide (ClO) over Antarctica from the Chlorine Oxide Experiment (ChlOE1) ground-based millimeter wave spectrometer at Scott Base, Antarctica, as well 12 years (2004-2015) of ClO measurements from the Aura Microwave Limb Sounder (MLS). From August onwards we observe a strong increase in lower stratospheric ClO, with a peak column amount usually occurring in early September. From mid-September onwards we observe a strong decrease in ClO. In order to study interannual differences, we focus on a 3-week period from 28 August to 17 September for each year and compare the average column ClO anomalies. These column ClO anomalies are shown to be highly correlated with the average ozone mass deficit for September and October of each year. We also show that anomalies in column ClO are strongly anti-correlated with 30 hPa temperature anomalies, both on a daily and an interannual timescale. Making use of this anti-correlation we calculate the linear dependence of the interannual variations in column ClO on interannual variations in temperature. By making use of this relationship, we can better estimate the underlying trend in the total chlorine (Cly = HCl + ClONO2 + HOCl + 2 × Cl2 + 2 × Cl2O2 + ClO + Cl). The resultant trends in Cly, which determine the long-term trend in ClO, are estimated to be -0.5 ± 0.2, -1.4 ± 0.9, and -0.6 ± 0.4 % year-1, for zonal MLS, Scott Base MLS (both 2004-2015), and ChlOE (1996-2015) respectively. These trends are within 1σ of trends in stratospheric Cly previously found at other latitudes. The decrease in ClO is consistent with the trend expected from regulations enacted under the Montreal Protocol.

  6. 20 Years of ClO Measurements in the Antarctic Lower Stratosphere

    Nedoluha, Gerald E.; Connor, Brian J.; Mooney, Thomas; Barrett, James W.; Parrish, Alan; Gomez, R. Michael; Boyd, Ian; Allen, Douglas R.; Kotkamp, Michael; Kremser, Stefanie; hide

    2016-01-01

    We present 20 years (1996-2015) of austral springtime measurements of chlorine monoxide (ClO) over Antarctica from the Chlorine Oxide Experiment (ChlOEl) ground-based millimeter wave spectrometer at Scott Base, Antarctica, as well 12 years (2004-2015) of ClO measurements from the Aura Microwave Limb Sounder (MLS). From August onwards we observe a strong increase in lower stratospheric ClO, with a peak column amount usually occurring in early September. From mid-September onwards we observe a strong decrease in ClO. In order to study interannual differences, we focus on a 3-week period from 28 August to 17 September for each year and compare the average column ClO anomalies. These column ClO anomalies are shown to be highly correlated with the average ozone mass deficit for September and October of each year. We also show that anomalies in column ClO are strongly anti-correlated with 30 hPa temperature anomalies, both on a daily and an interannual timescale. Making use of this anti-correlation we calculate the linear dependence of the interannual variations in column C1O on interannual variations in temperature. By making use of this relationship, we can better estimate the underlying trend in the total chlorine (Cl(sub y) = HCl + ClONO2 + HOCl + 2 x Cl2 + 2 x Cl2+ ClO + Cl). The resultant trends in Cl(sub y), which determine the long-term trend in ClO, are estimated to be -0.5 +/-0.2, -1.40.9, and -0.60.4% per year, for zonal MLS, Scott Base MLS (both 2004-2015), and ChlOE (1996-2015) respectively. These trends are within 1sigma of trends in stratospheric Cl(sub y) previously found at other latitudes. The decrease in ClO is consistent with the trend expected from regulations enacted under the Montreal Protocol.

  7. Energy levels of Ho3+ in HoCl63-

    Tanner, P.A.

    1987-01-01

    The 5 S 2 , 5 F 4 , 5 F 2 , 3 K 8 , 5 G 6 , 5 F 1 , 5 G 5 5 I 8 absorption spectra of Cs 2 NaHoCl 6 have been recorded at temperatures down to that of liquid helium and new assignments are made for the 5 S 2 , 5 F 4 , 3 K 8 and 5 G 5 terms of HoCl 6 3- . The 5 F 3 → 5 I 8 , 5 F 4 , 5 S 2 → 5 I 7 , 5 I 8 and 5 F 5 → 5 I 7 luminescence transitions of HoCl 6 3- in various elpasolite lattices are reported and assigned, together with luminescence decay measurements. Including the previously reported data, these results enable 57 of the first 60 crystal-field levels of HoCl 6 3- , comprising 14 Lsub(j) terms, to be firmly assigned and tentative assignments are made for the remaining three levels. The agreement between the calculated and observed crystal-field splittings is reasonable. (author)

  8. Reactions UF4 - ClO2F and UF5 - ClO2F

    Benoit, Raymond; Besnard, Ginette; Hartmanshenn, Olivier; Luce, Michel; Mougin, Jacques; Pelissie, Jean

    1970-02-01

    The study of the reaction UF 4 - ClO 2 F between 0 deg. and 100 deg. C, by various techniques (micro-sublimation, isopiestic method, IR and UV spectrography, thermogravimetry and X-ray diffraction) shows that intermediate steps are possible before the production of UF 5 . The whole reaction may be schematised by two equations: (1) n UF 4 + ClO 2 F → n UF x + ClO 2 (4 4 + ClO 2 F → UF x + 1/2 Cl 2 + O 2 . The more the temperature rises, the more the second equation becomes experimentally verified. The reaction at 0 deg. C between UF 5 and ClO 2 F may be represented by: UF 5 + ClO 2 F → UF 6 ClO 2 . The reactions: UF 5 + ClO 2 F → UF 6 + ClO 2 , UF 5 + ClO 2 F → UF 6 + 1/2 Cl 2 + O 2 are verified, the first and the second at 25 deg. C., the second from 50 deg. to 150 deg. C. From the results of AGRON it is possible to predict the residual solids before complete volatilization as UF 6 . The IR spectra of ClO 2 F adsorbed on UF 4 and UF x at 60 deg. C have been compared with those of gaseous ClO 2 F and UF 6 adsorbed on UF 4 . (authors) [fr

  9. A simple rhodamine hydrazide-based turn-on fluorescent probe for HOCl detection.

    Zhang, Zhen; Zou, Yuan; Deng, Chengquan; Meng, Liesu

    2016-06-01

    Hypochlorous acid (HOCl) plays a crucial role in daily life and mediates a variety of physiological processes, however, abnormal levels of HOCl have been associated with numerous human diseases. It is therefore of significant interest to establish a simple, selective, rapid and sensitive fluorogenic method for the detection of HOCl in environmental and biological samples. A hydrazide-containing fluorescent probe based on a rhodamine scaffold was facilely developed that could selectively detect HOCl over other biologically relevant reactive oxygen species, reactive nitrogen species and most common metal ions in vitro. Via an irreversible oxidation-hydrolysis mechanism, and upon HOCl-triggered opening of the intramolecular spirocyclic ring during detection, the rhodamine hydrazide-based probe exhibited large fluorescence enhancement in the emission spectra with a fast response, low detection limit and comparatively wide pH detection range in aqueous media. The probe was further successfully applied to monitoring trace HOCl in tap water and imaging both exogenous and endogenous HOCl within living cells. It is anticipated that this simple and useful probe might be an efficient tool with which to facilitate more HOCl-related chemical and biological research. Copyright © 2015 John Wiley & Sons, Ltd. Copyright © 2015 John Wiley & Sons, Ltd.

  10. Efficacy of HOCl scavenging by sulfur-containing compounds: antioxidant activity of glutathione disulfide?

    den Hartog, G.J.M.; Haenen, G.R.M.M.; Vegt, E.; van der Vijgh, W.J.F.; Bast, A.

    2002-01-01

    Efficacy of HOCl scavenging by sulfur-containing compounds: antioxidant activity of glutathione disulfide? den Hartog GJ, Haenen GR, Vegt E, van der Vijgh WJ, Bast A. Department of Pharmacology and Toxicology, Maastricht University, The Netherlands. Hypochlorous acid (HOCl) is a bactericidal

  11. MLS/Aura Level 2 Hypochlorous Acid (HOCl) Mixing Ratio V004

    National Aeronautics and Space Administration — ML2HOCL is the EOS Aura Microwave Limb Sounder (MLS) standard product for hypochlorous acid derived from radiances measured primarily by the 640 GHz radiometer. The...

  12. MLS/Aura L2 Hypochlorous Acid (HOCL) Mixing Ratio V002

    National Aeronautics and Space Administration — ML2HOCL is the EOS Aura Microwave Limb Sounder (MLS) standard product for hypochlorous acid derived from radiances measured primarily by the 640 GHz radiometer. The...

  13. MLS/Aura L2 Hypochlorous Acid (HOCL) Mixing Ratio V003

    National Aeronautics and Space Administration — ML2HOCL is the EOS Aura Microwave Limb Sounder (MLS) standard product for hypochlorous acid derived from radiances measured primarily by the 640 GHz radiometer. The...

  14. Detection of HOCl-mediated protein oxidation products in the extracellular matrix of human atherosclerotic plaques

    Woods, Alan A; Linton, Stuart M; Davies, Michael Jonathan

    2003-01-01

    Oxidation is believed to play a role in atherosclerosis. Oxidized lipids, sterols and proteins have been detected in early, intermediate and advanced human lesions at elevated levels. The spectrum of oxidized side-chain products detected on proteins from homogenates of advanced human lesions has...... been interpreted in terms of the occurrence of two oxidative mechanisms, one involving oxygen-derived radicals catalysed by trace transition metal ions, and a second involving chlorinating species (HOCl or Cl2), generated by the haem enzyme myeloperoxidase (MPO). As MPO is released extracellularly...... for 83-96% of the total oxidized protein side-chain products detected in these plaques. Oxidation of matrix components extracted from healthy artery tissue, and model proteins, with reagent HOCl is shown to give rise to a similar pattern of products to those detected in advanced human lesions...

  15. The system HoCl3-YCl3-H2O (25 deg C)

    Sorokina, A.A.; Yudina, N.G.

    1981-01-01

    By solubility method the system HoCl 3 -YCl 3 -H 2 O at 25 deg C has been studied. It is shown that in this system the continuous serie of solid solutions is formed. The liquid solutions of this system have been investigated by the isopiestic method. The values of activity coefficients, activity, free energy formation and excess free energy of solid solutions are calculated [ru

  16. Increase vs. decrease of calcium uptake by isolated heart cells induced by H2O2 vs. HOCl

    Kaminishi, T.; Matsuoka, T.; Yanagishita, T.; Kako, K.J.

    1989-01-01

    Adult rat heart myocytes were labeled rapidly with exogenous [45Ca2+]. Addition of 2.5 mM H2O2 to the heart cell suspension raised the content of rapidly exchangeable intracellular Ca2+ twofold, whereas addition of 1-30 mM HOCl decreased the Ca2+ content. The H2O2-induced increase in Ca2+ content was dependent on the medium Na+, pH, and temperature but was not significantly affected by addition of verapamil, diltiazem, amiloride, or 3-aminobenzamide. The [3H]ouabain binding to myocytes was suppressed by H2O2, whereas the Ca2+ efflux from myocytes was not influenced. An uncoupler, carbonyl cyanide m-chlorophenylhydrazone, reduced Ca2+ content, implying that the H2O2-induced change in Ca2+ content was not directly related to ATP depletion. On the other hand, the H2O2-induced Ca2+ accumulation in myocytes was prevented by deferoxamine or o-phenanthroline. These results suggest that H2O2 inhibited Na+-K+-ATPase, resulting in an increase in intracellular Na+ concentration and stimulation of sarcolemmal Na+-Ca2+ exchange activity, which caused a transient net Ca2+ influx into myocytes. By contrast, HOCl decreased the Ca2+ content of the rapidly exchangeable pool below control levels and this action of HOCl was antagonized by 1,4-dithiothreitol. HOCl accelerated Ca2+ efflux from myocytes. Ca2+ uptake and Ca2+-ATPase of the isolated sarcoplasmic reticular (SR) fraction were highly sensitive to the action of HOCl. Ca2+ uptake by intracellular sites, studied with myocytes permeabilized with digitonin, was inhibited by both H2O2 and HOCl. Thus these results suggest that HOCl inhibits the SR Ca2+ pump, resulting in the observed acceleration of Ca2+ efflux from and decline in Ca2+ content of myocytes

  17. Electronic absorption bands of HoCl3 and SmCl3 complexes in alcohols

    Ramesh Babu, V.; Buddhudu, S.; Rangarajan, V.N.

    1987-01-01

    The normal absorption and second derivative spectra of ten alcoholic complexes of HoCl 3 and SmCl 3 were recorded. From the observed bands, energies and intensity values were measured. To fit in these measured values with the theoretical values, a set of spectroscopic parameters namely, Judd-Ofelt (T 2 , T 4 , T 6 ), intensity (Ω 2 , Ω 4 , Ω 6 ) had been computed. A good fit of intensities was obtained between the experimental and theoretical data. The environmental influences on the intensities of the hypersensitive transitions of Sm(III) and Ho(III) ions were found to be noteworthy. (author). 7 tables, 20 refs

  18. Upper limits for stratospheric H2O2 and HOCl from high resolution balloon-borne infrared solar absorption spectra

    Larsen, J. C.; Rinsland, C. P.; Goldman, A.; Murcray, D. G.; Murcray, F. J.

    1985-01-01

    Solar absorption spectra from two stratospheric balloon flights have been analyzed for the presence of H2O2 and HOCl absorption in the 1230.0 to 1255.0 per cm region. The data were recorded at 0.02 per cm resolution during sunset with the University of Denver interferometer system on October 27, 1978 and March 23, 1981. Selected spectral regions were analyzed with the technique of nonlinear least squares spectral curve fitting. Upper limits of 0.33 ppbv for H2O2 and 0.36 ppbv for HOCl near 28 km are derived from the 1978 flight data while upper limits of 0.44 ppbv for H2O2 and 0.43 ppbv for HOCl at 29.5 km are obtained from the 1981 flight data.

  19. Neutralization of X4- and R5-tropic HIV-1 NL4-3 variants by HOCl-modified serum albumins

    Schwalbe Birco

    2010-06-01

    Full Text Available Abstract Background Myeloperoxidase (MPO, an important element of the microbicidal activity of neutrophils, generates hypochlorous acid (HOCl from H2O2 and chloride, which is released into body fluids. Besides its direct microbicidal activity, HOCl can react with amino acid residues and HOCl-modified proteins can be detected in vivo. Findings This report is based on binding studies of HOCl-modified serum albumins to HIV-1 gp120 and three different neutralization assays using infectious virus. The binding studies were carried out by surface plasmon resonance spectroscopy and by standard ELISA techniques. Virus neutralization assays were carried out using HIV-1 NL4-3 virus and recombinant strains with CXCR4 and CCR5 coreceptor usage. Viral infection was monitored by a standard p24 or X-gal staining assay. Our data demonstrate that HOCl-modified mouse-, bovine- and human serum albumins all bind to the HIV-1 NL4-3 gp120 (LAV glycoprotein in contrast to non-modified albumin. Binding of HOCl-modified albumin to gp120 correlated to the blockade of CD4 as well as that of V3 loop specific monoclonal antibody binding. In neutralization experiments, HOCl-modified serum albumins inhibited replication and syncytium formation of the X4- and R5-tropic NL4-3 isolates in a dose dependent manner. Conclusions Our data indicate that HOCl-modified serum albumin veils the binding site for CD4 and the V3 loop on gp120. Such masking of the viral gp120/gp41 envelope complex might be a simple but promising strategy to inactivate HIV-1 and therefore prevent infection when HOCl-modified serum albumin is applied, for example, as a topical microbicide.

  20. Secondary radicals derived from chloramines of apolipoprotein B-100 contribute to HOCl-induced lipid peroxidation of low-density lipoproteins

    Hazell, L J; Davies, Michael Jonathan; Stocker, R

    1999-01-01

    component to be the major site of attack, whereas others describe extensive lipid peroxidation. The present study addresses this controversy. The results obtained are consistent with the hypothesis that radical-induced oxidation of LDL's lipids by HOCl is a secondary reaction, with most HOCl consumed via...... by an extended period of lipid peroxidation during which further protein oxidation does not occur. The secondary lipid peroxidation process involves EPR-detectable radicals, is attenuated by a radical trap or treatment of HOCl-oxidized LDL with methionine, and occurs less rapidly when the lipoprotein...

  1. Vibrational analysis of HOCl up to 98% of the dissociation energy with a Fermi resonance Hamiltonian

    Jost, R.; Joyeux, M.; Skokov, S.; Bowman, J.

    1999-01-01

    We have analyzed the vibrational energies and wave functions of HOCl obtained from previous ab initio calculations [J. Chem. Phys. 109, 2662 (1998); 109, 10273 (1998)]. Up to approximately 13 and h;000 cm -1 , the normal modes are nearly decoupled, so that the analysis is straightforward with a Dunham model. In contrast, above 13 and h;000 cm -1 the Dunham model is no longer valid for the levels with no quanta in the OH stretch (v 1 =0). In addition to v 1 , these levels can only be assigned a so-called polyad quantum number P=2v 2 +v 3 , where 2 and 3 denote, respectively, the bending and OCl stretching normal modes. In contrast, the levels with v 1 ≥2 remain assignable with three v i quantum numbers up to the dissociation (D 0 =19 and h;290 and h;cm -1 ). The interaction between the bending and the OCl stretch (ω 2 congruent 2ω 3 ) is well described with a simple, fitted Fermi resonance Hamiltonian. The energies and wave functions of this model Hamiltonian are compared with those obtained from ab initio calculations, which in turn enables the assignment of many additional ab initio vibrational levels. Globally, among the 809 bound levels calculated below dissociation, 790 have been assigned, the lowest unassigned level, No. 736, being located at 18 and h;885 cm -1 above the (0,0,0) ground level, that is, at about 98% of D 0 . In addition, 84 resonances located above D 0 have also been assigned. Our best Fermi resonance Hamiltonian has 29 parameters fitted with 725 ab initio levels, the rms deviation being of 5.3 cm -1 . This set of 725 fitted levels includes the full set of levels up to No. 702 at 18 and h;650 cm -1 . The ab initio levels, which are assigned but not included in the fit, are reasonably predicted by the model Hamiltonian, but with a typical error of the order of 20 cm -1 . The classical analysis of the periodic orbits of this Hamiltonian shows that two bifurcations occur at 13 and h;135 and 14 and h;059 cm -1 for levels with v 1 =0. Above each

  2. MLS/Aura L2 Chlorine Monoxide (ClO) Mixing Ratio V002

    National Aeronautics and Space Administration — ML2CLO is the EOS Aura Microwave Limb Sounder (MLS) standard product for chlorine monoxide derived from radiances measured primarily by the 640 GHz radiometer. The...

  3. Oxidation of Mixed Active Pharmaceutical Ingredients in Biologically Treated Wastewater by ClO2

    Moradas, Gerly; Fick, Jerker; Ledin, Anna

    2011-01-01

    Biologically treated wastewater containing a mixture of 53 active pharmaceutical ingredients (APIs)was treated with 0-20 mg/l chlorine dioxide (ClO2) solution. Wastewater effluents were taken from two wastewater treatment plants in Sweden, one with (low COD) and one without (high COD) extended...... removed at 5 mg/l ClO2 dose. Removal of the same APIs from the high COD effluent was observed when the ClO2 dose was increased to 1.25 mg/l and an increase in API removal only after treatment with 8 mg/l ClO2. This illustrates that treatment of wastewater effluents with chlorine dioxide has potential...

  4. Method for Estimating Evaporative Potential (IM/CLO) from ASTM Standard Single Wind Velocity Measures

    2016-08-10

    IM/CLO) FROM ASTM STANDARD SINGLE WIND VELOCITY MEASURES DISCLAIMER The opinions or assertions contained herein are the private views of the...USARIEM TECHNICAL REPORT T16-14 METHOD FOR ESTIMATING EVAPORATIVE POTENTIAL (IM/CLO) FROM ASTM STANDARD SINGLE WIND VELOCITY... ASTM STANDARD SINGLE WIND VELOCITY MEASURES Adam W. Potter Biophysics and Biomedical Modeling Division U.S. Army Research Institute of Environmental

  5. CloVR-Comparative: automated, cloud-enabled comparative microbial genome sequence analysis pipeline

    Agrawal, Sonia; Arze, Cesar; Adkins, Ricky S.; Crabtree, Jonathan; Riley, David; Vangala, Mahesh; Galens, Kevin; Fraser, Claire M.; Tettelin, Herv?; White, Owen; Angiuoli, Samuel V.; Mahurkar, Anup; Fricke, W. Florian

    2017-01-01

    Background The benefit of increasing genomic sequence data to the scientific community depends on easy-to-use, scalable bioinformatics support. CloVR-Comparative combines commonly used bioinformatics tools into an intuitive, automated, and cloud-enabled analysis pipeline for comparative microbial genomics. Results CloVR-Comparative runs on annotated complete or draft genome sequences that are uploaded by the user or selected via a taxonomic tree-based user interface and downloaded from NCBI. ...

  6. CloVR-Comparative: automated, cloud-enabled comparative microbial genome sequence analysis pipeline.

    Agrawal, Sonia; Arze, Cesar; Adkins, Ricky S; Crabtree, Jonathan; Riley, David; Vangala, Mahesh; Galens, Kevin; Fraser, Claire M; Tettelin, Hervé; White, Owen; Angiuoli, Samuel V; Mahurkar, Anup; Fricke, W Florian

    2017-04-27

    The benefit of increasing genomic sequence data to the scientific community depends on easy-to-use, scalable bioinformatics support. CloVR-Comparative combines commonly used bioinformatics tools into an intuitive, automated, and cloud-enabled analysis pipeline for comparative microbial genomics. CloVR-Comparative runs on annotated complete or draft genome sequences that are uploaded by the user or selected via a taxonomic tree-based user interface and downloaded from NCBI. CloVR-Comparative runs reference-free multiple whole-genome alignments to determine unique, shared and core coding sequences (CDSs) and single nucleotide polymorphisms (SNPs). Output includes short summary reports and detailed text-based results files, graphical visualizations (phylogenetic trees, circular figures), and a database file linked to the Sybil comparative genome browser. Data up- and download, pipeline configuration and monitoring, and access to Sybil are managed through CloVR-Comparative web interface. CloVR-Comparative and Sybil are distributed as part of the CloVR virtual appliance, which runs on local computers or the Amazon EC2 cloud. Representative datasets (e.g. 40 draft and complete Escherichia coli genomes) are processed in genomics projects, while eliminating the need for on-site computational resources and expertise.

  7. 20 years of ClO measurements in the Antarctic lower stratosphere

    G. E. Nedoluha

    2016-08-01

    Full Text Available We present 20 years (1996–2015 of austral springtime measurements of chlorine monoxide (ClO over Antarctica from the Chlorine Oxide Experiment (ChlOE1 ground-based millimeter wave spectrometer at Scott Base, Antarctica, as well 12 years (2004–2015 of ClO measurements from the Aura Microwave Limb Sounder (MLS. From August onwards we observe a strong increase in lower stratospheric ClO, with a peak column amount usually occurring in early September. From mid-September onwards we observe a strong decrease in ClO. In order to study interannual differences, we focus on a 3-week period from 28 August to 17 September for each year and compare the average column ClO anomalies. These column ClO anomalies are shown to be highly correlated with the average ozone mass deficit for September and October of each year. We also show that anomalies in column ClO are strongly anti-correlated with 30 hPa temperature anomalies, both on a daily and an interannual timescale. Making use of this anti-correlation we calculate the linear dependence of the interannual variations in column ClO on interannual variations in temperature. By making use of this relationship, we can better estimate the underlying trend in the total chlorine (Cly  =  HCl + ClONO2 + HOCl + 2  ×  Cl2 + 2  ×  Cl2O2 + ClO + Cl. The resultant trends in Cly, which determine the long-term trend in ClO, are estimated to be −0.5 ± 0.2, −1.4 ± 0.9, and −0.6 ± 0.4 % year−1, for zonal MLS, Scott Base MLS (both 2004–2015, and ChlOE (1996–2015 respectively. These trends are within 1σ of trends in stratospheric Cly previously found at other latitudes. The decrease in ClO is consistent with the trend expected from regulations enacted under the Montreal Protocol.

  8. Dipole moments of the ground and first excited vibrational states of 35ClO

    Yaron, D.J.; Peterson, K.I.; Klemperer, W.

    1985-01-01

    The v=0 and v=1 dipole moments of ClO were obtained using the molecular beam electric resonance technique. ClO is formed in a supersonically expanded discharge of 10-20% O 2 and 3-4% Cl 2 in an Ar buffer gas. Transitions within the 2 π/sub 3/2/, J=3/2 state of 35 ClO were monitored as a function of electric field up to 1600 v/cm. At zero field, this state is split into eight levels by the magnetic hyperfine structure and lambda doubling. The dipole moments obtained were 1.2980 (12) D for the v=0 state and 1.2779 (19) for the v=1 state (tentative). The difference between these two measured values is 0.0201 D which is significantly lower than the theoretically predicted result of 0.028 D. 2 references

  9. SU-F-T-350: Continuous Leaf Optimization (CLO) for IMRT Leaf Sequencing

    Long, T; Chen, M; Jiang, S; Lu, W [UT Southwestern Medical Center, Dallas, TX (United States)

    2016-06-15

    Purpose: To study a new step-and-shoot IMRT leaf sequencing model that avoids the two main pitfalls of conventional leaf sequencing: (1) target fluence being stratified into a fixed number of discrete levels and/or (2) aperture leaf positions being restricted to a discrete set of locations. These assumptions induce error into the sequence or reduce the feasible region of potential plans, respectively. Methods: We develop a one-dimensional (single leaf pair) methodology that does not make assumptions (1) or (2) that can be easily extended to a multi-row model. The proposed continuous leaf optimization (CLO) methodology takes in an existing set of apertures and associated intensities, or solution “seed,” and improves the plan without the restrictiveness of 1or (2). It then uses a first-order descent algorithm to converge onto a locally optimal solution. A seed solution can come from models that assume (1) and (2), thus allowing the CLO model to improve upon existing leaf sequencing methodologies. Results: The CLO model was applied to 208 generated target fluence maps in one dimension. In all cases for all tested sequencing strategies, the CLO model made improvements on the starting seed objective function. The CLO model also was able to keep MUs low. Conclusion: The CLO model can improve upon existing leaf sequencing methods by avoiding the restrictions of (1) and (2). By allowing for more flexible leaf positioning, error can be reduced when matching some target fluence. This study lays the foundation for future models and solution methodologies that can incorporate continuous leaf positions explicitly into the IMRT treatment planning model. Supported by Cancer Prevention & Research Institute of Texas (CPRIT) - ID RP150485.

  10. Cloud essentials CompTIA authorized courseware for exam CLO-001

    Hausman, Kirk; Sampaio, Telmo

    2013-01-01

    CompTIA-Authorized courseware for the Cloud Essentials Exam (CLO-001) What better way to get up to speed on cloud computing than with this new book in the popular Sybex Essentials series? Cloud Essentials covers the basics of cloud computing and its place in the modern enterprise. Explore public and private clouds; contrast the ""as a service"" models for PaaS, SaaS, IaaS, or XaaS platforms; plan security; and more. In addition, the book covers the exam objectives for the both the CompTIA Cloud Essentials (Exam CLO-001) exam and the EXIN Cloud Computing Foundation (EX0-1

  11. Zero-Pressure Organic Superconductor: Di-(Tetramethyltetraselenafulvalenium)-Perchlorate [(TMTSF)2ClO4

    Bechgaard, Klaus; da Costa Carneiro, Kim; Olsen, Malte

    1981-01-01

    Evidence for superconductivity in the organic conductor di-(tetramethyltetraselenafulvalenium)-perchlorate [(TMTSF)2ClO4] has been found by resistance measurements in the absence of applied pressure. For different crystals the transitions are approximately 0.3 K wide and are centered around...

  12. Sources and behavior of perchlorate ions (ClO4-) in chalk aquifer of Champagne-Ardenne, France: preliminary results

    Cao, Feifei; Jaunat, Jessy; Ollivier, Patrick; Cancès, Benjamin; Morvan, Xavier; Hubé, Daniel; Devos, Alain; Devau, Nicolas; Barbin, Vincent; Pannet, Pierre

    2018-06-01

    Perchlorate (ClO4-) is an environmental contaminant of growing concern due to its potential human health effects and widespread occurrence in surface water and groundwater. Analyses carried out in France have highlighted the presence of ClO4- in drinking water of Champagne-Ardenne (NW of France), with two potential sources suspected: a military source related to the First World War and an agricultural source related to the past use of Chilean nitrates. To determine the sources of ClO4- in groundwater, major and trace elements, 2H and 18O, ClO3- and ClO4- ions and a list of 39 explosives were analyzed from 35 surface water and groundwater sampling points in the east of the city of Reims. ClO4- ions were found in almost all sampling points (32 out of 35) with a max value of 33 µg L-1. ClO4- concentrations were highest in groundwater ranging from 0.7 to 33 µg L-1 (average value of about 6.2 µg L-1) against from 4 µg L-1) were collected near a military camp, where huge quantities of ammunitions have been used, stored and destroyed during and after the First World War.

  13. X-ray photoelectron investigation of UO2(ClO4)2 interaction with diabase

    Teterin, Yu.A.; Nefedov, V.I.; Ivanov, K.E.; Baev, A.S.; Gajpel', G.; Rajkh, T.; Niche, Kh.

    1996-01-01

    X-ray diffraction study was made on interaction of soluble uranyl perchlorate with diabase, composing rocks in regions of Chelyabinsk and Chernobyl accidents and in places of radioactive waste burials. Absence of ClO 4 - anion in analyzed products of UO 2 (ClO 4 ) 2 interaction with diabase testifies to the absence of physio- or chemosorbed UO 2 (ClO 4 ) 2 layer on its surface. Formation of uranyl compounds (uranyl hydroxides) on diabase surface was confirmed, and bond lengths for these compounds were determined. Reaction of substitution of uranium ions for calcium ions proceeds more actively in the surface layers of diabase grains. 4 refs.; 3 tabs

  14. CloVR: A virtual machine for automated and portable sequence analysis from the desktop using cloud computing

    2011-01-01

    Background Next-generation sequencing technologies have decentralized sequence acquisition, increasing the demand for new bioinformatics tools that are easy to use, portable across multiple platforms, and scalable for high-throughput applications. Cloud computing platforms provide on-demand access to computing infrastructure over the Internet and can be used in combination with custom built virtual machines to distribute pre-packaged with pre-configured software. Results We describe the Cloud Virtual Resource, CloVR, a new desktop application for push-button automated sequence analysis that can utilize cloud computing resources. CloVR is implemented as a single portable virtual machine (VM) that provides several automated analysis pipelines for microbial genomics, including 16S, whole genome and metagenome sequence analysis. The CloVR VM runs on a personal computer, utilizes local computer resources and requires minimal installation, addressing key challenges in deploying bioinformatics workflows. In addition CloVR supports use of remote cloud computing resources to improve performance for large-scale sequence processing. In a case study, we demonstrate the use of CloVR to automatically process next-generation sequencing data on multiple cloud computing platforms. Conclusion The CloVR VM and associated architecture lowers the barrier of entry for utilizing complex analysis protocols on both local single- and multi-core computers and cloud systems for high throughput data processing. PMID:21878105

  15. CloVR: a virtual machine for automated and portable sequence analysis from the desktop using cloud computing.

    Angiuoli, Samuel V; Matalka, Malcolm; Gussman, Aaron; Galens, Kevin; Vangala, Mahesh; Riley, David R; Arze, Cesar; White, James R; White, Owen; Fricke, W Florian

    2011-08-30

    Next-generation sequencing technologies have decentralized sequence acquisition, increasing the demand for new bioinformatics tools that are easy to use, portable across multiple platforms, and scalable for high-throughput applications. Cloud computing platforms provide on-demand access to computing infrastructure over the Internet and can be used in combination with custom built virtual machines to distribute pre-packaged with pre-configured software. We describe the Cloud Virtual Resource, CloVR, a new desktop application for push-button automated sequence analysis that can utilize cloud computing resources. CloVR is implemented as a single portable virtual machine (VM) that provides several automated analysis pipelines for microbial genomics, including 16S, whole genome and metagenome sequence analysis. The CloVR VM runs on a personal computer, utilizes local computer resources and requires minimal installation, addressing key challenges in deploying bioinformatics workflows. In addition CloVR supports use of remote cloud computing resources to improve performance for large-scale sequence processing. In a case study, we demonstrate the use of CloVR to automatically process next-generation sequencing data on multiple cloud computing platforms. The CloVR VM and associated architecture lowers the barrier of entry for utilizing complex analysis protocols on both local single- and multi-core computers and cloud systems for high throughput data processing.

  16. Chemometric analysis of the consumption of oral rinse chlorite (ClO2-) by human salivary biomolecules.

    Chang, Hubert; Blackburn, John; Grootveld, Martin

    2013-12-01

    Oral rinse formulations containing chlorite anion (ClO(2)(-)) as an active agent exert a range of valuable oral healthcare activities. However, salivary biomolecules which chemically react with this oxidant can, at least in principle, serve as potentially significant barriers to these therapeutic properties in the oral environment. Therefore, in this investigation, we have explored the extent of ClO(2)(-) consumption by biomolecules which scavenge this agent in human salivary supernatants (HSSs) in vitro. HSS samples were equilibrated with oral rinse formulations containing this active agent (30 s at 35 °C in order to mimic oral rinsing episodes). Differential spectrophotometric and ion-pair reversed-phase high-performance liquid chromatographic analyses were employed to determine residual ClO(2)(-) in these admixtures. Bioanalytical data acquired revealed the rapid consumption of ClO(2)(-) by biomolecular electron donors and/or antioxidants present in HSS samples. Mean ± 95 % confidence interval (CI) consumption levels of 7.14 ± 0.69 and 5.34 ± 0.69 % of the total ClO(2)(-) available were found for oral rinse products containing 0.10 and 0.40 % (w/v) ClO(2)(-), respectively. A mixed model analysis-of-variance performed on experimental data acquired demonstrated highly-significant differences between oral rinse ClO(2)(-) contents (p biomolecules for both oral rinse formulations investigated. These observations are of much clinical significance in view of the retention of these products' active agent, i.e. biomolecules within recommended 30 s oral rinsing episodes, and hence, the bulk of this oxyhalogen oxidant (>90 %) may effectively exert its essential microbicidal, anti-periodontal and oral malodour-neutralising actions.

  17. CLO Accountability.

    Caudron, Shari

    2003-01-01

    The number of chief learning officers, mostly in Fortune 500 companies, has increased significantly in recent years. The increase does not indicate that companies are committed to strategic learning; executives want proof that it helps the bottom line. (JOW)

  18. The FI-SDW formation in (TMTSF)2ClO4 investigated in the infrared

    Gerrits, A.M.; Janssen, T.J.B.M.; Brooks, J.S.; Wittlin, A.; Perenboom, J.A.A.J.; Bentum, P.J.M. van

    1993-01-01

    From a magneto-optical study on (TMTSF) 2 ClO 4 we determine the SDW gap as a function of magnetic field and temperature. The transition temperatures found for the resolved FI-SDW subphases mimic the established phase diagram. Furthermore, the data confirm the existence of a collective excitation of the SDW condensate at relatively high frequency, which implies that this mode is pinned rather strongly to the lattice. In addition, we observed an interesting relaxation effect near the N=0 phase transition. (orig.)

  19. Evolutionary and genomic analysis of the caleosin/peroxygenase (CLO/PXG) gene/protein families in the Viridiplantae.

    Rahman, Farzana; Hassan, Mehedi; Rosli, Rozana; Almousally, Ibrahem; Hanano, Abdulsamie; Murphy, Denis J

    2018-01-01

    Bioinformatics analyses of caleosin/peroxygenases (CLO/PXG) demonstrated that these genes are present in the vast majority of Viridiplantae taxa for which sequence data are available. Functionally active CLO/PXG proteins with roles in abiotic stress tolerance and lipid droplet storage are present in some Trebouxiophycean and Chlorophycean green algae but are absent from the small number of sequenced Prasinophyceaen genomes. CLO/PXG-like genes are expressed during dehydration stress in Charophyte algae, a sister clade of the land plants (Embryophyta). CLO/PXG-like sequences are also present in all of the >300 sequenced Embryophyte genomes, where some species contain as many as 10-12 genes that have arisen via selective gene duplication. Angiosperm genomes harbour at least one copy each of two distinct CLO/PX isoforms, termed H (high) and L (low), where H-forms contain an additional C-terminal motif of about 30-50 residues that is absent from L-forms. In contrast, species in other Viridiplantae taxa, including green algae, non-vascular plants, ferns and gymnosperms, contain only one (or occasionally both) of these isoforms per genome. Transcriptome and biochemical data show that CLO/PXG-like genes have complex patterns of developmental and tissue-specific expression. CLO/PXG proteins can associate with cytosolic lipid droplets and/or bilayer membranes. Many of the analysed isoforms also have peroxygenase activity and are involved in oxylipin metabolism. The distribution of CLO/PXG-like genes is consistent with an origin >1 billion years ago in at least two of the earliest diverging groups of the Viridiplantae, namely the Chlorophyta and the Streptophyta, after the Viridiplantae had already diverged from other Archaeplastidal groups such as the Rhodophyta and Glaucophyta. While algal CLO/PXGs have roles in lipid packaging and stress responses, the Embryophyte proteins have a much wider spectrum of roles and may have been instrumental in the colonisation of terrestrial

  20. The safety and efficacy of hemostasis with Clo-Sur P.A.D. after transcatheter arterial chemoembolization

    Jung, Seung Chai; Jae, Hwan Jun; Kim, Sang Youn; Lee, Whal; Chung, Jin Wook; Park, Jae Hyung

    2007-01-01

    We wanted to evaluate the safety and efficacy of a new hemostatic device, Clo-Sur P.A.D., at an arterial access site after performing femoral arterial catheterization to achieve transcatheter arterial chemoembolization (TACE). From August 2002 to March 2005, 113 patients who underwent TACE and agreed on using the Clo-Sur P.A.D. were enrolled in this study. We evaluated the mean time interval from compression to the first movement and also to the first walk. We also evaluated such complications as rebleeding, pseudoaneurysm, vascular occlusion, hematoma, infection and pain. For 92 patients who had previous experiences with manual compression, we evaluated their preference of hemostatic method by asking them. Successful hemostasis was achieved with the Clo-Sur P.A.D. in 105 subjects (92%). The mean time interval from compression to the first movement was 201 minutes, and that to the first walk was 267 minutes. There was no statistical difference between the complicated and the uncomplicated groups for the mean time, prothrombin time, Child-Pugh class and platelet count (ρ > 0.05). Rebleeding occurred in 3 patients (2.7%) and mild hematoma around puncture site was noted in 5 patients (5.4%). Eighty-seven patients (95%) preferred Clo-Sur P.A.D. to the manual compression method. The Clo-Sur P.A.D. is a safe and effective hemostatic device and it provides early ambulation after TACE

  1. EcoFlex: A Multifunctional MoClo Kit for E. coli Synthetic Biology.

    Moore, Simon J; Lai, Hung-En; Kelwick, Richard J R; Chee, Soo Mei; Bell, David J; Polizzi, Karen Marie; Freemont, Paul S

    2016-10-21

    Golden Gate cloning is a prominent DNA assembly tool in synthetic biology for the assembly of plasmid constructs often used in combinatorial pathway optimization, with a number of assembly kits developed specifically for yeast and plant-based expression. However, its use for synthetic biology in commonly used bacterial systems such as Escherichia coli has surprisingly been overlooked. Here, we introduce EcoFlex a simplified modular package of DNA parts for a variety of applications in E. coli, cell-free protein synthesis, protein purification and hierarchical assembly of transcription units based on the MoClo assembly standard. The kit features a library of constitutive promoters, T7 expression, RBS strength variants, synthetic terminators, protein purification tags and fluorescence proteins. We validate EcoFlex by assembling a 68-part containing (20 genes) plasmid (31 kb), characterize in vivo and in vitro library parts, and perform combinatorial pathway assembly, using pooled libraries of either fluorescent proteins or the biosynthetic genes for the antimicrobial pigment violacein as a proof-of-concept. To minimize pathway screening, we also introduce a secondary module design site to simplify MoClo pathway optimization. In summary, EcoFlex provides a standardized and multifunctional kit for a variety of applications in E. coli synthetic biology.

  2. CLoNe is a new method to target single progenitors and study their progeny in mouse and chick.

    García-Moreno, Fernando; Vasistha, Navneet A; Begbie, Jo; Molnár, Zoltán

    2014-04-01

    Cell lineage analysis enables us to address pivotal questions relating to: the embryonic origin of cells and sibling cell relationships in the adult body; the contribution of progenitors activated after trauma or disease; and the comparison across species in evolutionary biology. To address such fundamental questions, several techniques for clonal labelling have been developed, each with its shortcomings. Here, we report a novel method, CLoNe that is designed to work in all vertebrate species and tissues. CLoNe uses a cocktail of labelling, targeting and transposition vectors that enables targeting of specific subpopulations of progenitor types with a combination of fluorophores resulting in multifluorescence that describes multiple clones per specimen. Furthermore, transposition into the genome ensures the longevity of cell labelling. We demonstrate the robustness of this technique in mouse and chick forebrain development, and show evidence that CLoNe will be broadly applicable to study clonal relationships in different tissues and species.

  3. Retrievals of chlorine chemistry kinetic parameters from Antarctic ClO microwave radiometer measurements

    S. Kremser

    2011-06-01

    Full Text Available Key kinetic parameters governing the partitioning of chlorine species in the Antarctic polar stratosphere were retrieved from 28 days of chlorine monoxide (ClO microwave radiometer measurements made during the late winter/early spring of 2005 at Scott Base (77.85° S, 166.75° E. During day-time the loss of the ClO dimer chlorine peroxide (ClOOCl occurs mainly by photolysis. Some time after sunrise, a photochemical equilibrium is established and the ClO/ClOOCl partitioning is determined by the ratio of the photolysis frequency, J, and the dimer formation rate, kf. The values of J and kf from laboratory studies remain uncertain to a considerable extent, and as a complement to these ongoing studies, the goal of this work is to provide a constraint on that uncertainty based on observations of ClO profiles in the Antarctic. First an optimal estimation technique was used to derive J/kf ratios for a range of Keq values. The optimal estimation forward model was a photochemical box model that takes J, kf, and Keq as inputs, together with a priori profiles of activated chlorine (ClOx = ClO+2×ClOOCl, profiles of ozone, temperature, and pressure. JPL06 kinetics are used as a priori in the optimal estimation and for all other chemistry in the forward model. Using the more recent JPL09 kinetics results in insignificant differences in the retrieved value of J/kf. A complementary approach was used to derive the optimal kinetic parameters; the full parameter space of J, kf, Keq and ClOx was sampled to find the minimum in differences between measured and modelled ClO profiles. Furthermore, values of Keq up to 2.0 times larger than recommended by JPL06 were explored to test the sensitivity of the

  4. Fate of citalopram during water treatment with O3, ClO2, UV and fenton oxidation

    Hörsing, Maritha; Kosjek, Tina; Andersen, Henrik Rasmus

    2012-01-01

    In the present study we investigate the fate of citalopram (CIT) at neutral pH using advanced water treatment technologies that include O3, ClO2 oxidation, UV irradiation and Fenton oxidation. The ozonation resulted in 80% reduction after 30 min treatment. Oxidation with ClO2 removed >90% CIT...... at a dosage of 0.1 mg L−1. During UV irradiation 85% reduction was achieved after 5 min, while Fenton with addition of 14 mg L−1 (Fe2+) resulted in 90% reduction of CIT. During these treatment experiments transformation products (TPs) were formed from CIT, where five compounds were identified by using high...

  5. 40 CFR 721.9527 - Bis(1,2,2,6,6-pentamethyl-4-piperidin-4-ol) ester of cy-clo-ali-phatic spiroketal.

    2010-07-01

    ... 40 Protection of Environment 30 2010-07-01 2010-07-01 false Bis(1,2,2,6,6-pentamethyl-4-piperidin-4-ol) ester of cy-clo-ali-phatic spiroketal. 721.9527 Section 721.9527 Protection of Environment...-piperidin-4-ol) ester of cy-clo-ali-phatic spiroketal. (a) Chemical substance and significant new uses...

  6. EcoFlex: A Multifunctional MoClo Kit for E. coli Synthetic Biology.

    Lai, Hung-En; Moore, Simon; Polizzi, Karen; Freemont, Paul

    2018-01-01

    Development of advanced synthetic biology tools is always in demand since they act as a platform technology to enable rapid prototyping of biological constructs in a high-throughput manner. EcoFlex is a modular cloning (MoClo) kit for Escherichia coli and is based on the Golden Gate principles, whereby Type IIS restriction enzymes (BsaI, BsmBI, BpiI) are used to construct modular genetic elements (biological parts) in a bottom-up approach. Here, we describe a collection of plasmids that stores various biological parts including promoters, RBSs, terminators, ORFs, and destination vectors, each encoding compatible overhangs allowing hierarchical assembly into single transcription units or a full-length polycistronic operon or biosynthetic pathway. A secondary module cloning site is also available for pathway optimization, in order to limit library size if necessary. Here, we show the utility of EcoFlex using the violacein biosynthesis pathway as an example.

  7. CLO-PLA: a database of clonal and bud-bank traits of the Central European flora

    Klimešová, Jitka; Danihelka, J.; Chrtek, Jindřich; de Bello, Francesco; Herben, Tomáš

    2017-01-01

    Roč. 98, č. 4 (2017), s. 1179 ISSN 0012-9658 R&D Projects: GA ČR GB14-36079G Institutional support: RVO:67985939 Keywords : Clonal traits * Central Europe * CLO-PLA database * bud-bank traits Subject RIV: EH - Ecology, Behaviour OBOR OECD: Ecology Impact factor: 4.809, year: 2016

  8. Crystal structure and luminescence properties of the first hydride oxide chloride with divalent europium. LiEu{sub 2}HOCl{sub 2}

    Rudolph, Daniel; Schleid, Thomas [Institute for Inorganic Chemistry, University of Stuttgart (Germany); Enseling, David; Juestel, Thomas [Department of Chemical Engineering, Muenster University of Applied Sciences, Steinfurt (Germany)

    2017-11-17

    The mixed-anionic hydride oxide chloride LiEu{sub 2}HOCl{sub 2} with divalent europium was synthesized by the reduction of Eu{sub 2}O{sub 3} with LiH in a LiCl flux at 750 C for 4 d in silica-jacketed niobium capsules. According to structure determination by single-crystal X-ray diffraction the yellow compound crystallizes in the orthorhombic space group Cmcm (a = 1492.30(11) pm, b = 570.12(4) pm, c = 1143.71(8) pm, Z = 8) with a crystal structure closely related to that one of the quaternary hydride oxide LiLa{sub 2}HO{sub 3} and the hydride nitride LiSr{sub 2}H{sub 2}N. On the other hand it can also be derived from the PbFCl-type structure of EuHCl showing astonishingly short Eu{sup 2+}..Eu{sup 2+} contacts of 326 and 329 pm. Both crystallographically different Eu{sup 2+} cations have nine anionic neighbors, while all other ions (Li{sup +}, H{sup -}, O{sup 2-} and Cl{sup -}) reside in six-membered coordination spheres. LiEu{sub 2}OCl{sub 2}H exhibits a bright yellow luminescence with an emission maximum at 581 nm upon excitation at 440 nm. (copyright 2017 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

  9. HCl and ClO in activated Arctic air; first retrieved vertical profiles from TELIS submillimetre limb spectra

    A. de Lange

    2012-02-01

    Full Text Available The first profile retrieval results of the Terahertz and submillimeter Limb Sounder (TELIS balloon instrument are presented. The spectra are recorded during a 13-h balloon flight on 24 January 2010 from Kiruna, Sweden. The TELIS instrument was mounted on the MIPAS-B2 gondola and shared this platform with the Michelson Interferometer for Passive Atmospheric Sounding (MIPAS and the mini-Differential Optical Absorption Spectroscopy (mini-DOAS instruments. The flight took place within the Arctic vortex at an altitude of ≈34 km in chlorine activated air, and both active (ClO and inactive chlorine (HCl were measured over an altitude range of respectively ≈16–32 km and ≈10–32 km. In this altitude range, the increase of ClO concentration levels during sunrise has been recorded with a temporal resolution of one minute. During the daytime equilibrium, a maximum ClO level of 2.1 ± 0.3 ppbv has been observed at an altitude of 23.5 km. This equilibrium profile is validated against the ClO profile by the satellite instrument Microwave Limb Sounder (MLS aboard EOS Aura. HCl profiles have been determined from two different isotopes – H35Cl and H37Cl – and are also validated against MLS. The precision of all profiles is well below 0.01 ppbv and the overall accuracy is therefore governed by systematic effects. The total uncertainty of these effects is estimated to be maximal 0.3 ppbv for ClO around its peak value at 23.5 km during the daytime equilibrium, and for HCl it ranges from 0.05 to 0.4 ppbv, depending on altitude. In both cases the main uncertainty stems from a largely unknown non-linear response in the detector.

  10. Deposition, Accumulation, and Alteration of Cl(-), NO3(-), ClO4(-) and ClO3(-) Salts in a Hyper-Arid Polar Environment: Mass Balance and Isotopic Constraints

    Jackson, Andrew; Davila, Alfonso F.; Boehlke, J. K.; Sturchio, Neil C.; Sevanthi, Ritesh; Estrada, Nubia; Brundrette, Megan; Lacell, Denis; McKay, Christopher P.; Poghosyan, Armen; hide

    2016-01-01

    The salt fraction in permafrost soils/sediments of the McMurdo Dry Valleys (MDV) of Antarctica can be used as a proxy for cold desert geochemical processes and paleoclimate reconstruction. Previous analyses of the salt fraction in MDV permafrost soils have largely been conducted in coastal regions where permafrost soils are variably affected by aqueous processes and mixed inputs from marine and stratospheric sources. We expand upon this work by evaluating permafrost soil/sediments in University Valley, located in the ultraxerous zone where both liquid water transport and marine influences are minimal. We determined the abundances of Cl(-), NO3(-, ClO4(-)and ClO3(-)in dry and ice-cemented soil/sediments, snow and glacier ice, and also characterized Cl(-) and NO3(-) isotopically. The data are not consistent with salt deposition in a sublimation till, nor with nuclear weapon testing fall-out, and instead point to a dominantly stratospheric source and to varying degrees of post depositional transformation depending on the substrate, from minimal alteration in bare soils to significant alteration (photodegradation and/or volatilization) in snow and glacier ice. Ionic abundances in the dry permafrost layer indicate limited vertical transport under the current climate conditions, likely due to percolation of snowmelt. Subtle changes in ClO4(-)/NO3(-) ratios and NO3(-) isotopic composition with depth and location may reflect both transport related fractionation and depositional history. Low molar ratios of ClO3(-)/ClO4(-) in surface soils compared to deposition and other arid systems suggest significant post depositional loss of ClO3(-), possibly due to reduction by iron minerals, which may have important implications for oxy-chlorine species on Mars. Salt accumulation varies with distance along the valley and apparent accumulation times based on multiple methods range from approximately 10 to 30 kyr near the glacier to 70-200 kyr near the valley mouth. The relatively

  11. Coordination, non-coordination and semi-coordination of perchlorates in the lanthanide adducts Ln (CLO4)3. 6dmba

    Tfouni, E.; Giesbrecht, E.

    1983-01-01

    The coordination or not of the perchlorate anions in the previously reported Ln(CLO 4 ) 3 .6 dmba is discussed. The analysis of the infrared spectral data and molar conductance data indicate that they may be formulated as [Ln(dmba) 6 (CLO 4 )n] (CLO 4 ) sub(3-n), n=0,1,2. The individual compounds may be a mixture of species with different n values and/or pure compounds with semi-coordinated and non-coordinated perchlorates. (Author) [pt

  12. Identification of potential toxicity caused by O3 and ClO2 treatment of pharmaceuticals in wastewater

    Furuhagen, S. M.; Hörsing, Maritha; Ledin, Anna

    2011-01-01

    Chemical oxidation treatment is an effective innovative technology in wastewater treatment plants for removal of micro-pollutants in the effluent. In particular, ozonation (O3) and chlorine dioxide (ClO2) treatments are commonly used to degrade organic pollutants. By oxidation, the micro...... complemented by oxidative stress biomarkers to understand effect mechanisms in different test systems and species. All tests were complemented with chemical analysis to confirm to what degree the pharmaceuticals have been mineralized and degraded by oxidation. Early results with APIs in milli-Q water treated...... Carbamazepine by chemical oxidation were more harmful to aquatic organisms compared to the parent compound. The aim of our study is to evaluate the potential risk of oxidation treatment, using O3 and ClO2, due to formation of toxic transformation products. The ecotoxicological effects caused by the two...

  13. Classification of soft-shell materials for leisure outdoor jackets by clo defined from thermal properties testing

    Tesinova, P.; Steklova, P.; Duchacova, T.

    2017-10-01

    Materials for outdoor activities are produced in various combinations and lamination helps to combine two or more components for gaining high comfort properties and lighten the structure. Producers can choose exact suitable material for construction of part or set of so called layered clothing for expected activity. Decreasing the weight of materials when preserving of high quality of water-vapour permeability, wind resistivity and hydrostatic resistivity and other comfort and usage properties is a big task nowadays. This paper is focused on thermal properties as an important parameter for being comfort during outdoor activities. Softshell materials were chosen for testing and computation of clo. Results compared with standardised clo table helps us to classify thermal insulation of the set of fabrics when defining proper clothing category.

  14. Synthesis, solid-state structure and supramolecularity of [Cu(pyterpy2](ClO42

    Mohammed A. Al-Anber

    2015-09-01

    Full Text Available The copper(II polypyridyl complex [Cu(pyterpy2](ClO42 (3 (pyterpy = 4′-(4-pyridyl-2,2′:6,2″-terpyridine was prepared by the reaction of pyterpy (1 with stoichiometric amounts of [Cu(ClO42·6H2O] (2. The progress of the reaction was controlled by FT-IR and UV–vis spectroscopy. The title complex crystallized in the tetragonal space group I4(1/a with unit cell dimensions of a = 8.6277(1, b = 8.6277(1, c = 57.6398(10 Å, V = 4290.55(12 Å3, and Z = 4. The structure of 3 in the solid-state consists of discrete [Cu(pyterpy2]+ ions with copper(II in a distorted octahedral environment setup by two meridional coordinated tripodal 4′-(4-pyridyl-2,2′:6,2″-terpyridine ligands of which the pyridyl unit stays free. Face-to-face π-interactions between terminal coordinated terpy C5N rings link adjacent [Cu(pyterpy2]2+ units resulting in the formation of a 2D-polymer. The geometrical-to-geometrical centroid distance (d is 3.568 Å.

  15. Quasielastic neutron scattering and infra-red band contour study of H2O reorientations in [Ni(H2O)6] (ClO4)2

    Janik, J.A.; Janik, J.M.; Otnes, K.; Stanek, T.

    1980-01-01

    IR band contour measurements carried out for [Ni(H 2 O) 6 ] (ClO 4 ) 2 revealed an existence of fast H 2 O 180 deg flips around Ni-O axes at room temperatures. These flips were subjected to a more accurate study by the quasielastic neutron scattering method. Correlation times of the order of picosecond were obtained for room temperatures and the barrier to rotation of ca. 7 kcal/mole. The results are compared to those previously obtained for [Mg(H 2 O) 6 ] (ClO 4 ) 2 and also to those for [Ni(NH 3 ) 6 ] (ClO 4 ) 2 and [Mg(NH 3 ) 6 ] (ClO 4 ) 2 . (author)

  16. Phase transitions and molecular motions in [Ni(ND3)6](ClO4)2

    Migdal-Mikuli, Anna; Mikuli, Edward; Gorska, Natalia; Kowalska, Aneta; Ulanski, Jacek

    2004-01-01

    [Ni(ND 3 ) 6 ](ClO 4 ) 2 has three solid phases between 100 and 300 K. The phase transitions temperatures at heating (T C1 h =164.1 K and T C2 h =145.1 K) are shifted, as compared to the non-deuterated compound, towards the lower temperature of ca. 8 and 5 K, respectively. The ClO 4 - anions perform fast, picosecond, isotropic reorientation with the activation energy of 6.6 kJ mol -1 , which abruptly slow down at T C1 c phase transition, during sample cooling. The ND 3 ligands perform fast uniaxial reorientation around the Ni-N bond in all three detected phases, with the effective activation energy of 2.9 kJ mol -1 . The reorientational motion of ND 3 is only slightly distorted at the T C1 phase transition due to the dynamical orientational order-disorder process of anions. The low value of the activation energy for the ND 3 reorientation suggests that this reorientation undergoes the translation-rotation coupling, which makes the barrier to the rotation of the ammonia ligands not constant but fluctuating. The phase polymorphism and the dynamics of the molecular reorientations of the title compound are similar but not quite identical with these of the [Ni(NH 3 ) 6 ](ClO 4 ) 2

  17. Deposition, accumulation, and alteration of Cl−, NO3−, ClO4− and ClO3− salts in a hyper-arid polar environment: Mass balance and isotopic constraints

    Jackson, Andrew; Davila, Alfonso F.; Böhlke, John Karl; Sturchio, Neil C.; Sevanthi, Ritesh; Estrada, Nubia; Brundrett, Maeghan; Lacelle, Denis; McKay, Christopher P.; Poghosyan, Armen; Pollard, Wayne; Zacny, Kris

    2016-01-01

    The salt fraction in permafrost soils/sediments of the McMurdo Dry Valleys (MDV) of Antarctica can be used as a proxy for cold desert geochemical processes and paleoclimate reconstruction. Previous analyses of the salt fraction in MDV permafrost soils have largely been conducted in coastal regions where permafrost soils are variably affected by aqueous processes and mixed inputs from marine and stratospheric sources. We expand upon this work by evaluating permafrost soil/sediments in University Valley, located in the ultraxerous zone where both liquid water transport and marine influences are minimal. We determined the abundances of Cl−, NO3−, ClO4− and ClO3− in dry and ice-cemented soil/sediments, snow and glacier ice, and also characterized Cl− and NO3−isotopically. The data are not consistent with salt deposition in a sublimation till, nor with nuclear weapon testing fall-out, and instead point to a dominantly stratospheric source and to varying degrees of post depositional transformation depending on the substrate, from minimal alteration in bare soils to significant alteration (photodegradation and/or volatilization) in snow and glacier ice. Ionic abundances in the dry permafrost layer indicate limited vertical transport under the current climate conditions, likely due to percolation of snowmelt. Subtle changes in ClO4−/NO3− ratios and NO3− isotopic composition with depth and location may reflect both transport related fractionation and depositional history. Low molar ratios of ClO3−/ClO4− in surface soils compared to deposition and other arid systems suggest significant post depositional loss of ClO3−, possibly due to reduction by iron minerals, which may have important implications for oxy-chlorine species on Mars. Salt accumulation varies with distance along the valley and apparent accumulation times based on multiple methods range from ∼10 to 30 kyr near the glacier to 70–200 kyr near the valley mouth. The relatively young age

  18. Electron paramagnetic resonance of gamma irradiated (CH3)3NHClO4 and CH3NH3ClO4 single crystals

    Yavuz, Metin; Koeksal, Fevzi

    1999-01-01

    Gamma irradiation damage centers in (CH 3 ) 3 NHClO 4 and CH 3 NH 3 ClO 4 single crystals have been investigated at room temperature by the electron paramagnetic resonance (EPR) technique. It has been found that γ-irradiation produces the (CH 3 ) 3 N + radical in the first, and NH + 3 and ClO 3 radicals in the second compound. The EPR parameters of the observed radicals have been determined and discussed

  19. Algal toxicity of the alternative disinfectants performic acid (PFA), peracetic acid (PAA), chlorine dioxide (ClO2) and their by-products hydrogen peroxide (H2O2) and chlorite (ClO2-)

    Chhetri, Ravi Kumar; Baun, Anders; Andersen, Henrik Rasmus

    2017-01-01

    Environmental effect evaluation of disinfection of combined sewer overflow events with alternative chemical disinfectants requires that the environmental toxicity of the disinfectants and the main by-products of their use are known. Many disinfectants degrade quickly in water which should......: performic acid (PFA), peracetic acid (PAA) and chlorine dioxide (ClO2) as well as two by-products of their use: hydrogen peroxide (H2O2) and chlorite. All of the five chemicals investigated showed clear toxicity to the algae with well-defined dose response curves. The EC50 values ranged from 0.16 to 2.9 mg...

  20. The 1988 Arctic Survey, Diurnal Study (Sunrise and Sunset) and Peak Altitude (22 km) Flights for the In Situ Detection of ClO and BrO from the NASA ER-2 Aircraft

    Anderson, James G.

    1996-01-01

    Two critical areas of research were addressed successfully by this research. The first involves NASA ER-2 airborne observations of ClO and BrO radical destruction of ozone within the arctic vortex. The second involves the analysis of diurnal variations in ClO, to test the production and loss rates of ClO that constitutes the test for coupling reactions between the chlorine and nitrogen systems. We discuss results from this research in order.

  1. Pitting corrosion of Al and Al-Cu alloys by ClO4- ions in neutral sulphate solutions

    Amin, Mohammed A.; Abd El Rehim, Sayed S.; Moussa, S.O.; Ellithy, Abdallah S.

    2008-01-01

    The influence of various concentrations of NaClO 4 , as a pitting corrosion agent, on the corrosion behaviour of pure Al, and two Al-Cu alloys, namely (Al + 2.5 wt% Cu) and (Al + 7 wt% Cu) alloys in 1.0 M Na 2 SO 4 solution was investigated by potentiodynamic polarization and potentiostatic techniques at 25 deg. C. Measurements were conducted under the influence of various experimental conditions, complemented by ex situ energy dispersive X-ray (EDX) and scanning electron microscopy (SEM) examinations of the electrode surface. In free perchlorate sulphate solutions, for the three Al samples, the anodic polarization exhibits an active/passive transition. The active dissolution region involves an anodic peak (peak A) which is assigned to the formation of Al 2 O 3 passive film on the electrode surface. The passive region extends up to 1500 mV with almost constant current density (j pass ) without exhibiting a critical breakdown potential or showing any evidence of pitting attack. For the three Al samples, addition of ClO 4 - ions to the sulphate solution stimulates their active anodic dissolution and tends to induce pitting corrosion within the oxide passive region. Pitting corrosion was confirmed by SEM examination of the electrode surface. The pitting potential decreases with increasing ClO 4 - ion concentration indicating a decrease in pitting corrosion resistance. The susceptibility of the three Al samples towards pitting corrosion decreases in the order: Al > (Al + 2.5 wt% Cu) alloy > (Al + 7 wt% Cu) alloy. Potentiostatic measurements showed that the rate of pitting initiation increases with increasing ClO 4 - ion concentration and applied step anodic potential, while it decreases with increasing %Cu in the Al samples. The inhibitive effect of SO 4 2- ions was also discussed

  2. Algal toxicity of the alternative disinfectants performic acid (PFA), peracetic acid (PAA), chlorine dioxide (ClO2) and their by-products hydrogen peroxide (H2O2) and chlorite (ClO2-).

    Chhetri, Ravi Kumar; Baun, Anders; Andersen, Henrik Rasmus

    2017-05-01

    Environmental effect evaluation of disinfection of combined sewer overflow events with alternative chemical disinfectants requires that the environmental toxicity of the disinfectants and the main by-products of their use are known. Many disinfectants degrade quickly in water which should be included in the evaluation of both their toxicity as determined in standardized tests and their possible negative effect in the water environment. Here we evaluated according to the standardized ISO 8692 test the toxicity towards the green microalgae, Pseudokirchneriella subcapitata, of three disinfectants: performic acid (PFA), peracetic acid (PAA) and chlorine dioxide (ClO 2 ) as well as two by-products of their use: hydrogen peroxide (H 2 O 2 ) and chlorite. All of the five chemicals investigated showed clear toxicity to the algae with well-defined dose response curves. The EC 50 values ranged from 0.16 to 2.9mg/L based on nominal concentrations leading to the labeling of the chemicals as either toxic or very toxic. The five investigated chemicals decreased in toxicity in the order chlorine dioxide, performic acid, peracetic acid, chlorite and hydrogen peroxide. The stability of the chemicals increased in the same order as the toxicity decrease. This indicates that even though ClO 2 has the highest environmental hazard potential, it may still be suitable as an alternative disinfectant due to its rapid degradation in water. Copyright © 2016 Elsevier GmbH. All rights reserved.

  3. A novel dual-ratiometric-response fluorescent probe for SO2/ClO- detection in cells and in vivo and its application in exploring the dichotomous role of SO2 under the ClO- induced oxidative stress.

    Dou, Kun; Fu, Qiang; Chen, Guang; Yu, Fabiao; Liu, Yuxia; Cao, Ziping; Li, Guoliang; Zhao, Xianen; Xia, Lian; Chen, Lingxin; Wang, Hua; You, Jinmao

    2017-07-01

    Intracellular reactive sulfur species and reactive oxygen species play vital roles in immunologic mechanism. As an emerging signal transmitter, SO 2 can be generated as the anti-oxidant, while SO 2 is also a potential oxidative stress-inducer in organism. Aiming to elucidate in-depth the dichotomous role of SO 2 under oxidative stress, we designed a dual-response fluorescent probe that enabled the respective or successive detection of SO 2 and ClO - . The probe itself emits the red fluorescence (625 nm) which can largely switch to blue (410 nm) and green fluorescence (500 nm) respectively in response to SO 2 and ClO - , allowing the highly selective and accurate ratiometric quantification for both SO 2 and ClO - in cells. Moreover the ultrafast (SO 2 : <60 s; ClO - : within sec) and highly sensitive (detection limits: SO 2 : 3.5 nM; ClO - : 12.5 nM) detection were achieved. With the robust applicability, the developed probe was successfully used to quantify SO 2 and endogenous ClO - in respectively the HeLa cells and the RAW 264.7 cells, as well as to visualize the dynamic of SO 2 /ClO - in zebrafish. The fluorescent imaging studies and flow cytometry analysis confirmed the burst-and-depletion and meanwhile the oxidative-and-antioxidative effects of intracellular SO 2 under the NaClO induced oxidative stress. Copyright © 2017 Elsevier Ltd. All rights reserved.

  4. An explanation of the preferential formation of less stable isomers in three-body reactions - Cl + NO2 + M ClO + NO2 + M

    Chang, J.S.; Baldwin, A.C.; Golden, D.M.

    1979-01-01

    A realistic assessment of the potential depletion of stratospheric ozone due to manmade emissions requires a knowledge of the sources and sinks of the potential threat. The reactions ClO + NO 2 + M yield products and Cl + NO 2 + M yield products are of interest because they represent possible sink mechanism for both odd chlorine and odd nitrogen species. In this paper, the Troe method (1977) is used to calculate the low-pressure limit rate constants of the above three-body reactions. The result for the Cl + NO 2 + M reaction is found to be in excellent agreement with the experimental finding of Niki et al. (1978), where both nitryl chloride and chlorine nitrate are products of the cited reaction. An explanation is proposed to account for apparent discrepancy between the measured rate constants for ClO + NO 2 + M in the forward and reverse directions. Stratospheric implications are also discussed

  5. Quality and clinical supply considerations of Paediatric Investigation Plans for IV preparations-A case study with the FP7 CloSed project.

    Hanning, Sara M; Orlu Gul, Mine; Winslade, Jackie; Baarslag, Manuel A; Neubert, Antje; Tuleu, Catherine

    2016-09-25

    A Paediatric Investigation Plan (PIP) is a development plan that aims to ensure that sufficient data are obtained through studies in paediatrics to support the generation of marketing authorisation of medicines for children. This paper highlights some practical considerations and challenges with respect to PIP submissions and paediatric clinical trials during the pharmaceutical development phase, using the FP7-funded Clonidine for Sedation of Paediatric Patients in the Intensive Care Unit (CloSed) project as a case study. Examples discussed include challenges and considerations regarding formulation development, blinding and randomisation, product labelling and shipment and clinical trial requirements versus requirements for marketing authorisation. A significant quantity of information is required for PIP submissions and it is hoped that future applicants may benefit from an insight into some critical considerations and challenges faced in the CloSed project. Copyright © 2016 Elsevier B.V. All rights reserved.

  6. Mechanistic insights into Mg2+-independent prenylation by CloQ from classical molecular mechanics and hybrid quantum mechanics/molecular mechanics molecular dynamics simulations.

    Bayse, Craig A; Merz, Kenneth M

    2014-08-05

    Understanding the mechanism of prenyltransferases is important to the design of engineered proteins capable of synthesizing derivatives of naturally occurring therapeutic agents. CloQ is a Mg(2+)-independent aromatic prenyltransferase (APTase) that transfers a dimethylallyl group to 4-hydroxyphenylpyruvate in the biosynthetic pathway for clorobiocin. APTases consist of a common ABBA fold that defines a β-barrel containing the reaction cavity. Positively charged basic residues line the inside of the β-barrel of CloQ to activate the pyrophosphate leaving group to replace the function of the Mg(2+) cofactor in other APTases. Classical molecular dynamics simulations of CloQ, its E281G and F68S mutants, and the related NovQ were used to explore the binding of the 4-hydroxyphenylpyruvate (4HPP) and dimethylallyl diphosphate substrates in the reactive cavity and the role of various conserved residues. Hybrid quantum mechanics/molecular mechanics potential of mean force (PMF) calculations show that the effect of the replacement of the Mg(2+) cofactor with basic residues yields a similar activation barrier for prenylation to Mg(2+)-dependent APTases like NphB. The topology of the binding pocket for 4HPP is important for selective prenylation at the ortho position of the ring. Methylation at this position alters the conformation of the substrate for O-prenylation at the phenol group. Further, a two-dimensional PMF scan shows that a "reverse" prenylation product may be a possible target for protein engineering.

  7. Oxidation of spin-traps by chlorine dioxide (ClO2) radical in aqueous solutions: first ESR evidence of formation of new nitroxide radicals.

    Ozawa, T; Miura, Y; Ueda, J

    1996-01-01

    The reactivities of the chlorine dioxide (ClO2), which is a stable free radical towards some water-soluble spin-traps were investigated in aqueous solutions by an electron spin resonance (ESR) spectroscopy. The ClO2 radical was generated from the redox reaction of Ti3+ with potassium chlorate (KClO3) in aqueous solutions. When one of the spin-traps, 5,5-dimethyl-1-pyrroline N-oxide (DMPO), was included in the Ti3+-KClO3 reaction system, ESR spectrum due to the ClO2 radical completely disappeared and a new ESR spectrum [aN(1) = 0.72 mT, aH(2) = 0.41 mT], which is different from that of DMPO-ClO2 adduct, was observed. The ESR parameters of this new ESR signal was identical to those of 5,5-dimethylpyrrolidone-(2)-oxyl-(1) (DMPOX), suggesting the radical species giving the new ESR spectrum is assignable to DMPOX. The similar ESR spectrum consisting of a triplet [aN(1) = 0.69 mT] was observed when the derivative of DMPO, 3,3,5,5-tetramethyl-1-pyrroline N-oxide (M4PO) was included in the Ti3+-KClO3 reaction system. This radical species is attributed to the oxidation product of M4PO, 3,3,5,5-tetramethylpyrrolidone-(2)-oxyl-(1) (M4POX). When another nitrone spin-trap, alpha-(4-pyridyl-1-oxide)-N-t-butylnitrone (POBN) was used as a spin-trap, the ESR signal intensity due to the ClO2 radical decreased and a new ESR signal consisting of a triplet [aN(1) = 0.76 mT] was observed. The similar ESR spectrum was observed when N-t-butyl-alpha- nitrone (PBN) was used as a spin-trap. This ESR parameter [a(N)(1) = 0.85 mT] was identical to the oxidation product of PBN, PBNX. Thus, the new ESR signal observed from POBN may be assigned to the oxidation product of POBN, POBNX. These results suggest that the ClO2, radical does not form the stable spin adducts with nitrone spin-traps, but oxidizes these spin-traps to give the corresponding nitroxyl radicals. On the other hand, nitroso spin-traps, 5,5-dibromo-4-nitrosobenzenesulfonate (DBNBS), and 2-methyl-2-nitrosopropane (MNP) did not trap

  8. Splenectomy attenuates murine liver fibrosis with hypersplenism stimulating hepatic accumulation of Ly-6C(lo) macrophages.

    Yada, Akito; Iimuro, Yuji; Uyama, Naoki; Uda, Yugo; Okada, Toshihiro; Fujimoto, Jiro

    2015-10-01

    Splenectomy in cirrhotic patients has been reported to improve liver function; however the underlying mechanism remains obscure. In the present study, we investigated the mechanism using a murine model, which represents well the compensated liver cirrhosis. C57BL/6 male mice were allowed to drink water including thioacetamide (TAA: 300 mg/L) ad libitum for 32 weeks. After splenectomy at 32 weeks, mice were sacrificed on days one, seven, and 28, respectively, while TAA-administration was continued. Perioperative changes in peripheral blood and liver tissues were analyzed. TAA treatment of mice for 32 weeks reproducibly achieved advanced liver fibrosis with splenomegaly, thrombocytopenia, and leukocytopenia. After splenectomy, liver fibrosis was attenuated, and macrophages/monocytes were significantly increased in peripheral blood, as well as in the liver. Progenitor-like cells expressing CK-19, EpCAM, or CD-133 appeared in the liver after TAA treatment, and gradually disappeared after splenectomy. Macrophages/monocytes accumulated in the liver, most of which were negative for Ly-6C, were adjacent to the hepatic progenitor-like cells, and quantitative RT-PCR indicated increased canonical Wnt and decreased Notch signals. As a result, a significant amount of β-catenin accumulated in the progenitor-like cells. Moreover, relatively small Ki67-positive hepatic cells were significantly increased. Protein expression of MMP-9, to which Ly-6G-positive neutrophils contributed, was also increased in the liver after splenectomy. The hepatic accumulation of macrophages/monocytes, most of which are Ly-6C(lo), the reduction of fibrosis, and the gradual disappearance of hepatic progenitor-like cells possibly play significant roles in the tissue remodeling process in cirrhotic livers after splenectomy. Copyright © 2015 European Association for the Study of the Liver. Published by Elsevier B.V. All rights reserved.

  9. THE USE OF STABILIZED LIQUIDE CHLORINE DIOXIDE (ClO2 FOR INTERNAL WATER SUPPLY SYSTEM SANITATION OF FARM WITH LAYING FLOCK AFFECTED BY COLISEPTICEMIA

    Abdulah Gagić

    2014-03-01

    Full Text Available A successful and harmless method for rehabilitation of hygienic status of water and its supply system using a stabilized liquid chlorine dioxide solution on a farm of the laying hens affected by severe colisepticemia is described. Source of infection was drinking water contaminated by slurry from two pig facilities located above the water tank. The contaminated water caused the emergence of biofilm consisting mainly of coliform bacteria on the interior surfaces of the plastic pipes. Through drinking the contaminated water the infection of the laying flocks occurred. With the aim of improving the flocks’ health status, a programme of sanitary treatment of external and internal water supply system and water was created and implemented. In order to prevent biofilm formation and improve sanitation prescribed was the use of stabilized liquid chlorine dioxide (ClO2 in the 4‰ concentration for so-called night "shock" treatments, and 2‰ concentration for prophylactic daily disinfection of drinking water. With the improvement of the flocks’ health status, the "shock" treatments with ClO2 were repeated in the upcoming months. As an add-on therapy, 40 mg per bird of vitamin C through drinking water for three days was prescribed. The use of non-resorptive antibiotics, AD3E vitamins and amino acid supplements was excluded because they had failed to improve the flocks’ health status in the acute phase. Therefore, the sanitation programme based on the use of stabilized liquid ClO2 in the water supply system of the laying flocks affected by severe colisepticemia resulted in radical decrease of mortality during the next three months. Key words: chlorine dioxide, biofilm, sanitation, disinfection, colisepticemia

  10. Reorientations in [Mg(H2O)6](CLO4)2 studied by the proton magnetic resonance and the quasielastic neutron scattering methods

    Svare, I.; Fimland, B.O.; Janik, J.A.; Janik, J.M.; Mikuli, E.; Migdal-Mikuli, A.

    1980-01-01

    Proton magnetic relaxation measurements carried out for [Mg(H 2 O)XL6](CLO 4 ) 2 revealed two processes responsible for T 1 vs temperature dependence: one connected with H 2 O 180deg flips about the symmetry axes and second connected with a tumbling of the complex cation. Quasielastic neutron scattering measurements gave another evidence of H 2 O 180deg flips. The reorientational corelation times, which in the 273 K - 325 K region are of the order of picoseconds, as derived from NMR coincide perfectly well with those derived from QNS. (author)

  11. Tuning of magnetic frustration in S = 1 / 2 Kagomé lattices {[Cu3(CO3)2(bpe)3](CLO4)2}n and {[Cu3(CO3)2(bpy)3](CLO4)2}n through rigid and flexible ligands

    Ajeesh, M. O.; Yogi, A.; Padmanabhan, M.; Nath, R.

    2015-04-01

    Single crystalline and polycrystalline samples of S = 1 / 2 Kagomé lattices { [Cu3(CO3)2(bpe)3 ](CLO4)2 } n and { [Cu3(CO3)2(bpy)3 ](CLO4)2 } n, respectively were synthesized. Their structural and magnetic properties were characterized by means of x-ray diffraction and magnetization measurements. Both compounds crystalize in a hexagonal structure (space group P-6) consisting of CuO4 Kagomé layers in the ab-plane but linked along c direction through either rigid bpy or flexible bpe ligands to form 3D frame works. Magnetic measurements reveal that both the compounds undergo ferromagnetic ordering (TC) at low temperatures and the TC and the extent of frustration could be tuned by changing the nature of the pillar ligands. {[Cu3(CO3)2(bpe)3](CLO4)2}n which is made up of flexible bpe ligands has a TC of 5.7 K and a Curie-Weiss temperature (θCW) of -39.7 K giving rise to a frustration parameter of |θCW | /TC ≃ 6.96. But the replacement of bpe by a more rigid and electronically delocalized bpy ligand leads to an enhanced TC ≃ 9.3 K and a reduced frustration parameter of |θCW | /TC ≃ 3.54.

  12. Investigations into the fast ionic conductors γ-CuBr, Li2S, Na2S, Ba2NH, NaTaN2 and Li3HoCl6 by means of neutron scattering

    Altorfer, F.

    1994-01-01

    The main topic of this work was the investigation of ionic diffusion in solids by means of neutron scattering. Experiments were carried out on the antifluorites Li 2 S, Na 2 S and γ-CuBr (zinc-blende type) as well as on Barium-Nitride-Hydride Ba 2 NH, NaTaN 2 and Li 3 HoCl 6 which represent three-and two-dimensional ionic conductors, respectively. In the sulphur based antifluorites Li 2 S and Na 2 S the occupation of the interstitial empty cube site by cations occurs at elevated temperatures. The temperature-dependence of the diffusion process has been investigated by quasielastic, incoherent neutron scattering. The cations hop between their regular lattice sites and the interstitial empty cube site, whereas the sulphur ions vibrate in good approximation harmonically even at high temperatures. The jump vectors define a three-dimensional net of possible cation paths through the crystal. The analysis of quasielastic scattering experiments on a Li 2 S single crystal enabled us to determine the jump vectors and the jump rates 1/τ. The temperature dependence of the anharmonic contributions to the copper structure factor was the main point in our neutron diffraction experiments on γ-CuBr. It could be shown that the copper density function deviates strongly from the isotropic form with increasing temperature. Barium-Nitride-Hydride is one of the few documented H - -ionic conductors. The electronic part of the ds-conductivity is only 1/10000 of the ionic contribution. Since Ba 2 NH is a layer compound, where H - and N 3- layers alternate along the c-axis, the probability of jumps out of the plane is suppressed in favour of in plane jumps. This compound is therefore a model system in which two-dimensional diffusion can be studied and in fact the analysis of the quasielastic data proved that the H-diffusion is caused by jumps between regular H - lattice sites. (author) figs., tabs., refs

  13. In-Plane Angular Effect of Magnetoresistance of Quasi-One-Dimensional Organic Metals, (DMET) 2AuBr 2 and (TMTSF) 2ClO 4

    Yoshino, Harukazu; Saito, Kazuya; Nishikawa, Hiroyuki; Kikuchi, Koichi; Kobayashi, Keiji; Ikemoto, Isao

    1997-08-01

    Comparative study is presented for the in-plane angular effect of magnetoresistance of quasi-one-dimensional organic conductors, (DMET)2AuBr2 and (TMTSF)2ClO4. The magnetoresistance for the magnetic and electrical fields parallel and perpendicular to the most conducting plane, respectively, was measured at 4.2 K and up to 7.0 T. (DMET)2AuBr2 shows an anomalous hump in the field-orientation dependence of the magnetoresistance for the magnetic field nearly parallel to the most conducting axis and this is very similar to what previously reported for (DMET)2I3. Weak anomaly was detected for the magnetoresistance of (TMTSF)2ClO4 in the Relaxed state, while no anomaly was observed in the SDW phase in the Quenched state. By comparing the numerical angular derivatives of the magnetoresistance, it is shown that the anomaly in the in-plane angular effect continuously develops from zero magnetic field and is closely related to the quasi-one-dimensional Fermi surface. A simple method is proposed to estimate the anisotropy of the transfer integral from the width of the hump anomaly.

  14. Characteristics of 36ClO3 and 36Cl- uptake into pisum sativum L. seedlings: Limitations and uses of 36CPO3- as an analogue for NO3

    Deane-Drummond, C.E.

    1985-01-01

    The characteristics of 36 Cl 3 - influx and 36 ClO 3 - influx into pisum sativum L.cv. Feltham First seedlings have been investigated. The kinetics of these fluxes at different external substrate concentrations were generated by computer fits to the data, and for 36 Cl - influx apparent Vsub(maxCl - ) and Ksub(m.Cl - ) were 1.62 u mol g - 1 fresh wt. h - l and 0.135 mol m -3 , respectively, (r 2 = 0.90); for 36 ClO 3 - influx apparent Vsub(max ClO 3 - ) and Ksub(m ClO 3 - ) were 15.29 u mol g -1 fresh wt. h - l and 0.69 mol m -3 respectively (r 2 =0.95). When a range of nitrate concentrations were added to 36 ClO 3 - there was no significant difference between NO 3 - or ClO 3 - at low concentrations (0.25 mol m -3 ), but some divergence at higher concentrations. Initial 36 ClO 3 - /NO 3 - influx into P. sativum seedlings was higher than that following extended incubation, which approached that of steady state net nitrate uptake. The difference between 36 ClO 3 - accumulation (J) was used to measure nitrate efflux (E). There was no detectable 36 Cl - efflux when a similar procedure was adopted using 36 Cl - efflux when a similar procedure for J was set by 1, and was stimulated in conditions of N starvation or innoculation with Rhizobium. The rate of substrate cycling (E/1) and the parameter (1 + E/J) were increased in the former case and when a mixed source of N was used in the culture medium, 36 Cl - influx was inhibited by NH 4 + regimes in these experiments. The purported anion blocker diisothiocyanostilbene-2-2' disulphonate (DIDS) inhibited 36 Cl - influx, but in the latter case only that 'induced' by N-starvation. The results are discussed in terms of current models for nitrate uptake. (author)

  15. Scanning tunneling microscopy/scanning tunneling spectroscopy of the organic superconductors (TNTSF)2-PF6 and (TMTSF)2-ClO4

    Fainchtein, R.; Murphy, J.C.

    1991-01-01

    This paper reports on direct observations of the organic superconductors (tetramethyltetraselenafulvalene) (TMTSF) 2 -PF 6 and (TMTSF) 2 -ClO 4 made in air at room temperature. The samples consisted of single crystals electrochemically grown. Images revealing the molecular structural arrangement along different crystallographic orientations will be presented as well as spectroscopic data related to the electronic density of states. The images reveal a structure made up of flat molecules that stack on top of one another to form columns and are responsible for the quasi-one-dimensional nature of the electrical conductivity. Although both materials have similar crystal structure the differences in the symmetry and orientation of the counter anions are not resolved. Tunneling spectroscopy data at room temperature shows no apparent difference in the electronic density of states of both materials

  16. Autun (Saône-et-Loire. Étude archéologique du cloître canonial de Saint-Nazaire

    Walter Berry

    2004-12-01

    Full Text Available L’année 2003, qui marquait à la fois les 20 ans de recherches entreprises à l’initiative de Christian Sapin et la fin des investigations de terrain, fut très fructueuse. En effet, outre une étude complémentaire de la zone occidentale du cloître, riche en découvertes, la galerie orientale qui a particulièrement retenu notre attention, recelait des informations capitales pour comprendre de façon plus précise l’histoire du site. À l’est, justement, d’autres parties d’une vaste habitation de l’An...

  17. Solute activity coefficients in dilute aqueous electrolyte mixutes. III. The ternary system HCLO4 + UO2(CLO4)2 + H2O at 250C

    Boyd, G.E.

    1977-01-01

    Isopiestic vapor pressure comparison measurements were conducted with the three-component system HClO 4 + UO 2 (ClO 4 ) 2 + H 2 O in the concentration range between I = 0.05 and 1.9 m. Analysis of the mixture composition and concentration dependence of the osmotic coefficients with the Scatchard neutral-electrolyte and ion-component methods and with the Pitzer ion-component methods gave equally satisfactory results. Prediction of the observed osmotic coefficients by two-component approximations was satisfactory, and the data agreed well with values estimated with a model based on the osmolal fraction. A fair concordance was also found between predicted solute activity coefficients from simple models and values derived from complete treatments which included interaction terms

  18. Spectroscopic and quantum-chemical investigation of association of ions in acetonitrile - LiX (X=I, ClO4, NCS) systems

    Semenov, S.G.; Solov'eva, L.A.; Akopyan, S.Kh.

    1995-01-01

    Data on association constants of ions in acetonitrile-salt binary systems, obtained from the data on intensity of IR absorption bands of acetonitrile (Acn) molecules contained in solvate shells of Li + cations, have been analyzed. Using the CCP MO LCAO semiempirical method in the PPDP approximation, electronic structure of acetonitrile molecule and Acn k Li + and Acn m Li + X - complexes has been studied. It is ascertained that relative stability of ionic pairs Acn 3 Li + X - , estimated by the squares of their dipole momenta (characterizing solvation energy) increases in the series X=I, ClO 4 , NCS in agreement with data of spectroscopic experiment, according to which the constant of ion association for LiNCS solution in acetonitrile is much higher than for the systems CH 3 CN-LiI and CH 3 CN-LiClO 4 . 13 refs.,2 figs., 2 tabs.64

  19. Design and Fabrication of a 200N Thrust Rocket Motor Based on NH4ClO4+Al+HTPB as Solid Propellant

    Wahid, Mastura Ab; Ali, Wan Khairuddin Wan

    2010-06-01

    The development of rocket motor using potassium nitrate, carbon and sulphur mixture has successfully been developed by researchers and students from UTM and recently a new combination for solid propellant is being created. The new solid propellant will combine a composition of Ammonium perchlorate, NH4ClO4 with aluminium, Al and Hydroxyl Terminated Polybutadiene, HTPB as the binder. It is the aim of this research to design and fabricate a new rocket motor that will produce a thrust of 200N by using this new solid propellant. A static test is done to obtain the thrust produced by the rocket motor and analyses by observation and also calculation will be done. The experiment for the rocket motor is successful but the thrust did not achieve its required thrust.

  20. Synthesis, crystal structure and properties of [Co(L2](ClO42 (L=1,3-bis(1H-benzimidazol-2-yl-2-oxapropane

    Tavman Aydin

    2015-01-01

    Full Text Available The reaction of 1,3-bis(1H-benzimidazol-2-yl-2-oxapropane (L with Co(ClO42•6H2O in absolute ethanol produces di[1,3-bis(1H-benzimidazol-2-yl-2-oxapropane-k2N,N’]cobalt(IIdiperchlorate chelate complex ([Co(L2](ClO42, 1. The complex 1 was characterized by elemental analysis, magnetic moment, molar conductivity, thermogravimetric analysis, FT-IR, UV-visible, mass spectrometry, and its solid state structure was determined by single crystal X-ray diffraction. According to the thermogravimetric analysis data, there is no any water coordinated or uncoordinated in 1 as well as elemental analysis. The complex 1 has 1:2 M:L ionic characteristic according to the molar conductivity. In the complex, the distances between the cobalt and the ethereal oxygen atoms (Co1-O2: 2.805(3; Co2-O1: 2.752(2 Å show the semi-coordination bonding and the Co(II ion is six-coordinated with a N4O2 ligand set, resulting in a distorted octahedron.

  1. Infrared and Raman spectroscopic studies of interlayer CO32-, NO3-, SO42- and ClO4-in layered double hydroxides (LDHs)

    Kloprogge, J.T.; Wharton, D.; Frost, R.L.

    1998-01-01

    Full text: Hydrotalcites (HTs) are also described as layered double hydroxides or anionic clays, due to their layered structure with a charge opposite to that of cationic clays. The number of counterbalancing anions or anionic complexes is essentially unlimited provided that the anion does not form a complex with the cations in the octahedral sheets during the formation. The majority of especially the synthetic but also naturally occurring HTs contain CO 3 2- as the interlayer anion. Other regularly used anions include NO 3 - , OH - , SO 4 2- and Cl - in addition to ClO 4 - and CrO 4 2- . When CO 3 2- is present as a free ion it will exhibit a space group of D 3h . As a result the bending non-planar mode ν 2 (A'2), the antisymmetrical stretching mode ν 3 (E') and the bending angular mode ν 4 (E'), will be observed in the IR spectrum at 880, 1415 and 680 cm -1 , while the symmetric stretching mode ν 1 (A'1) is IR inactive. In the Raman spectrum one will observe ν 1 (A'1), ν 3 (E') and ν 4 (E') (Nakamoto, 1997; Farmer, 1974). In comparison to free CO 3 2- a shift towards lower wavenumbers is generally observed. A band around 3000-3100 cm -1 has been attributed to the bridging mode H 2 O-CO 3 2- . The shift towards lower wavenumbers indicates a lowering of the symmetry from D 3h , to probably C 2s or C ν . As a result the IR inactive ν 1 mode will be activated. Indeed, a weak band has been observed around 1050-1060 cm -1 . In addition, the ν 3 mode shows a small splitting in the order of 30-60 cm -1 . In accordance to the findings of Moroz and Arkhipenko (1991), Kloprogge and Frost (1999) and Hickey et al. (2000) observed weak Raman ν 3 and νv 4 modes at 1053 and 1403 cm -1 . Like in the IR spectra, both ν 3 and νv 4 show a minor shift of 10 to 15 cm -1 . Like free CO 3 2- free nitrate NO 3 - will exhibit a spacegroup of D 3h with A 1 ' Raman actively only, A 2 '' IR active only and 2E' Raman and IR active. This means that the out-of-plane symmetric

  2. Removal of APIs and bacteria from hospital wastewater by MBR plus O(3), O(3) + H(2)O(2), PAC or ClO(2).

    Nielsen, U; Hastrup, C; Klausen, M M; Pedersen, B M; Kristensen, G H; Jansen, J L C; Bak, S N; Tuerk, J

    2013-01-01

    The objective of this study has been to develop technologies that can reduce the content of active pharmaceutical ingredients (APIs) and bacteria from hospital wastewater. The results from the laboratory- and pilot-scale testings showed that efficient removal of the vast majority of APIs could be achieved by a membrane bioreactor (MBR) followed by ozone, ozone + hydrogen peroxide or powdered activated carbon (PAC). Chlorine dioxide (ClO(2)) was significantly less effective. MBR + PAC (450 mg/l) was the most efficient technology, while the most cost-efficient technology was MBR + ozone (156 mg O(3)/l applied over 20 min). With MBR an efficient removal of Escherichia coli and enterococci was measured, and no antibiotic resistant bacteria were detected in the effluent. With MBR + ozone and MBR + PAC also the measured effluent concentrations of APIs (e.g. ciprofloxacin, sulfamethoxazole and sulfamethizole) were below available predicted no-effect concentrations (PNEC) for the marine environment without dilution. Iodinated contrast media were also reduced significantly (80-99% for iohexol, iopromide and ioversol and 40-99% for amidotrizoateacid). A full-scale MBR treatment plant with ozone at a hospital with 900 beds is estimated to require an investment cost of €1.6 mill. and an operating cost of €1/m(3) of treated water.

  3. Ultrasonically-enhanced preparation, characterization of CaFe-layered double hydroxides with various interlayer halide, azide and oxo anions (CO32-, NO3-, ClO4-).

    Szabados, Márton; Varga, Gábor; Kónya, Zoltán; Kukovecz, Ákos; Carlson, Stefan; Sipos, Pál; Pálinkó, István

    2018-01-01

    An ultrasonically-enhanced mechanochemical method was developed to synthesize CaFe-layered double hydroxides (LDHs) with various interlayer anions (CO 3 2- , NO 3 - , ClO 4 - , N 3 - , F - , Cl - , Br - and I - ). The duration of pre-milling and ultrasonic irradiation and the variation of synthesis temperature in the wet chemical step were investigated to obtain the optimal parameters of preparation. The main method to characterize the products was X-ray diffractometry, but infrared and synchrotron-based X-ray absorption spectroscopies as well as thermogravimetric measurements were also used to learn about fine structural details. The synthesis method afforded successful intercalation of the anions, among others the azide anion, a rarely used counter ion providing a system, which enables safe handling the otherwise highly reactive anion. The X-ray absorption spectroscopic measurements revealed that the quality of the interlayered anions could modulate the spatial arrangement of the calcium ions around the iron(III) ions, but only in the second coordination sphere. Copyright © 2017 Elsevier B.V. All rights reserved.

  4. Apparent molar volumes for dilute solutions of NaClO4 and [Co(en) 3](ClO4)3 in D2O and H2O at 278-318 K

    Bottomley, G.A.; Glossop, L.G.

    1981-01-01

    Apparent molar volumes for dilute solutions of NaClO 4 and [Co(en) 3 ](ClO 4 ) 3 in D 2 O and H 2 O were measured by using a dilatometry technique at 278, 298 and 318K. Comparison of limiting slopes with the Debye-Huckel predictions from the dielectric constant and compressibility of H 2 O and D 2 O is complicated by ion pairing. The apparent molar volumes for NaClO 4 were less in D 2 O than in H 2 O. The complex [Co(en) 3 ](ClO 4 ) 3 when studied in D 2 O had its amine protons exchanged by deuterium; this did not allow a direct comparison of the apparent molar volumes of the protonated complex in each solvent system, but revealed a large isotope effect. The apparent molar volumes of the [Co(en) 3 ](ClO 4 ) 3 showed a much larger temperature dependence than that of NaClO 4

  5. A Sequential Method to Prepare Polymorphs and Solvatomorphs of [Fe(1,3-bpp)2 ](ClO4 )2 ⋅nH2 O (n=0, 1, 2) with Varying Spin-Crossover Behaviour.

    Bartual-Murgui, Carlos; Codina, Carlota; Roubeau, Olivier; Aromí, Guillem

    2016-08-26

    Two polymorphs of the spin crossover (SCO) compound [Fe(1,3-bpp)2 ](ClO4 )2 (1 and 2; 1,3-bpp=2-(pyrazol-1-yl)-6-(pyrazol-3-yl)pyridine) were prepared using a novel, stepwise procedure. Crystals of 1 deposit from dry solvents, while 2 is obtained from a solid-state procedure, by sequentially removing lattice H2 O molecules from the solvatomorph [Fe(1,3-bpp)2 ](ClO4 )2 ⋅2 H2 O (2⋅2 H2 O), using single-crystal-to-single-crystal (SCSC) transformations. Hydrate 2⋅2 H2 O is obtained through the same reaction as 1, now with 2.5 % of water added. Compounds 2 and 2⋅2 H2 O are unstable in the atmosphere and absorb or lose one equivalent of water, respectively, to both yield the stable solvatomorph [Fe(1,3-bpp)2 ](ClO4 )2 ⋅H2 O (2⋅H2 O), also following SCSC processes. The four derivatives have been characterised by single-crystal X-ray diffraction (SCXRD). Furthermore, the homogeneity of the various compounds as well as their SCSC interconversions have been confirmed by powder X-ray diffraction (PXRD). Polymorphs 1 and 2 exhibit abrupt SCO behaviour near room temperature with T1/2↑ =279/316 K and T1/2↓ =276/314 K (near 40 K of shift) and different cooperativity. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. First remote sensing measurements of ClOOCl along with ClO and ClONO2 in activated and deactivated Arctic vortex conditions using new ClOOCl IR absorption cross sections

    M. Birk

    2010-02-01

    Full Text Available Active chlorine species play a dominant role in the catalytic destruction of stratospheric ozone in the polar vortices during the late winter and early spring seasons. Recently, the correct understanding of the ClO dimer cycle was challenged by the release of new laboratory absorption cross sections (Pope et al., 2007 yielding significant model underestimates of observed ClO and ozone loss (von Hobe et al., 2007. Under this aspect, nocturnal Arctic stratospheric limb emission measurements carried out by the balloon version of the Michelson Interferometer for Passive Atmospheric Sounding (MIPAS-B from Kiruna (Sweden on 11 January 2001 and 20/21 March 2003 have been reanalyzed with regard to the chlorine reservoir species ClONO2 and the active species, ClO and ClOOCl (Cl2O2. New laboratory measurements of IR absorption cross sections of ClOOCl for various temperatures and pressures allowed for the first time the retrieval of ClOOCl mixing ratios from remote sensing measurements. High values of active chlorine (ClOx of roughly 2.3 ppbv at 20 km were observed by MIPAS-B in the cold mid-winter Arctic vortex on 11 January 2001. While nighttime ClOOCl shows enhanced values of nearly 1.1 ppbv at 20 km, ClONO2 mixing ratios are less than 0.1 ppbv at this altitude. In contrast, high ClONO2 mixing ratios of nearly 2.4 ppbv at 20 km have been observed in the late winter Arctic vortex on 20 March 2003. No significant ClOx amounts are detectable on this date since most of the active chlorine has already recovered to its main reservoir species ClONO2. The observed values of ClOx and ClONO2 are in line with the established polar chlorine chemistry. The thermal equilibrium constants between the dimer formation and its dissociation, as derived from the balloon measurements, are on the lower side of reported data and in good agreement with values recommended by von Hobe et al. (2007. Calculations with the ECHAM/MESSy Atmospheric Chemistry model (EMAC using

  7. Microscopic theory of the superconducting gap in the quasi-one-dimensional organic conductor (TMTSF) 2ClO4 : Model derivation and two-particle self-consistent analysis

    Aizawa, Hirohito; Kuroki, Kazuhiko

    2018-03-01

    We present a first-principles band calculation for the quasi-one-dimensional (Q1D) organic superconductor (TMTSF) 2ClO4 . An effective tight-binding model with the TMTSF molecule to be regarded as the site is derived from a calculation based on maximally localized Wannier orbitals. We apply a two-particle self-consistent (TPSC) analysis by using a four-site Hubbard model, which is composed of the tight-binding model and an onsite (intramolecular) repulsive interaction, which serves as a variable parameter. We assume that the pairing mechanism is mediated by the spin fluctuation, and the sign of the superconducting gap changes between the inner and outer Fermi surfaces, which correspond to a d -wave gap function in a simplified Q1D model. With the parameters we adopt, the critical temperature for superconductivity estimated by the TPSC approach is approximately 1 K, which is consistent with experiment.

  8. Systematic study of spin crossover and structure in [Co(terpyRX)2](Y)2 systems (terpyRX = 4'-alkoxy-2,2':6',2''-terpyridine, X = 4, 8, 12, Y = BF4(-), ClO4(-), PF6(-), BPh4(-))

    Nielsen, Pia; Nielsen, Hans Toftlund; Bond, Andrew

    2009-01-01

    A family of spin crossover cobalt(II) complexes of the type [Co(terpyRX)(2)](Y)(2) x nH(2)O (X = 4, 8, 12 and Y = BF(4)(-), ClO(4)(-), PF(6)(-), BPh(4)(-)) has been synthesized, whereby the alkyl chain length, RX, and counteranion, Y, have been systematically varied. The structural (single crystal...

  9. Primary retention following nuclear recoil in β-decay: Proposed synthesis of a metastable rare gas oxide ((38)ArO4) from ((38)ClO4(-)) and the evolution of chemical bonding over the nuclear transmutation reaction path.

    Timm, Matthew J; Matta, Chérif F

    2014-12-01

    Argon tetroxide (ArO4) is the last member of the N=50 e(-) isoelectronic and isosteric series of ions: SiO4(4-), PO4(3-), SO4(2-), and ClO4(-). A high level computational study demonstrated that while ArO4 is kinetically stable it has a considerable positive enthalpy of formation (of ~298kcal/mol) (Lindh et al., 1999. J. Phys. Chem. A 103, pp. 8295-8302) confirming earlier predictions by Pyykkö (1990. Phys. Scr. 33, pp. 52-53). ArO4 can be expected to be difficult to synthesize by traditional chemistry due to its metastability and has not yet been synthesized at the time of writing. A computational investigation of the changes in the chemical bonding of chlorate (ClO4(-)) when the central chlorine atom undergoes a nuclear transmutation from the unstable artificial chlorine isotope (38)Cl to the stable rare argon isotope (38)Ar through β-decay, hence potentially leading to the formation of ArO4, is reported. A mathematical model is presented that allows for the prediction of yields following the recoil of a nucleus upon ejecting a β-electron. It is demonstrated that below a critical angle between the ejected β-electron and that of the accompanying antineutrino their respective linear momentums can cancel to such an extent as imparting a recoil to the daughter atom insufficient for breaking the Ar-O bond. As a result, a primary retention yield of ~1% of ArO4 is predicted following the nuclear disintegration. The study is conducted at the quadratic configuration interaction with single and double excitations [QCISD/6-311+G(3df)] level of theory followed by an analysis of the electron density by the quantum theory of atoms in molecules (QTAIM). Crossed potential energy surfaces (PES) were used to construct a PES from the metastable ArO4 ground singlet state to the Ar-O bond dissociation product ArO3+O((3)P) from which the predicted barrier to dissociation is ca. 22kcal/mol and the exothermic reaction energy is ca. 28kcal/mol [(U)MP2/6-311+G(d)]. Copyright © 2014

  10. Single-molecule magnets: structure and properties of [Mn18O14(O2CMe)18(hep)4(hepH)2(H2O)2](ClO4)2 with spin S = 13.

    Brechin, E K; Sañudo, E C; Wernsdorfer, W; Boskovic, C; Yoo, J; Hendrickson, D N; Yamaguchi, A; Ishimoto, H; Concolino, T E; Rheingold, A L; Christou, G

    2005-02-07

    The reaction of 2-(hydroxyethyl)pyridine (hepH) with a 2:1 molar mixture of [Mn3O(O2CMe)6(py)3]ClO4 and [Mn3O(O2CMe)6(py)3] in MeCN afforded the new mixed-valent (16Mn(III), 2Mn(II)), octadecanuclear complex [Mn18O14(O2CMe)18(hep)4(hepH)2(H2O)2](ClO4)2 (1) in 20% yield. Complex 1 crystallizes in the triclinic space group P. Direct current magnetic susceptibility studies in a 1.0 T field in the 5.0-300 K range, and variable-temperature variable-field dc magnetization studies in the 2.0-4.0 K and 2.0-5.0 T ranges were obtained on polycrystalline samples. Fitting of magnetization data established that complex 1 possesses a ground-state spin of S = 13 and D = -0.18 K. This was confirmed by the value of the in-phase ac magnetic susceptibility signal. Below 3 K, the complex exhibits a frequency-dependent drop in the in-phase signal, and a concomitant increase in the out-of-phase signal, consistent with slow magnetization relaxation on the ac time scale. This suggests the complex is a single-molecule magnet (SMM), and this was confirmed by hysteresis loops below 1 K in magnetization versus dc field sweeps on a single crystal. Alternating current and direct current magnetization data were combined to yield an Arrhenius plot from which was obtained the effective barrier (U(eff)) for magnetization reversal of 21.3 K. Below 0.2 K, the relaxation becomes temperature-independent, consistent with relaxation only by quantum tunneling of the magnetization (QTM) through the anisotropy barrier via the lowest-energy MS = +/-13 levels of the S = 13 spin manifold. Complex 1 is thus the SMM with the largest ground-state spin to display QTM.

  11. Electrochemical quartz crystal microbalance analysis of the oxygen reduction reaction on Pt-based electrodes. Part 2: adsorption of oxygen species and ClO4(-) anions on Pt and Pt-Co alloy in HClO4 solutions.

    Omura, J; Yano, H; Tryk, D A; Watanabe, M; Uchida, H

    2014-01-14

    To gain deeper insight into the role of adsorbed oxygenated species in the O2 reduction reaction (ORR) kinetics on platinum and platinum-cobalt alloys for fuel cells, we carried out a series of measurements with the electrochemical quartz crystal microbalance (EQCM) and the rotating disk electrode (RDE) in acid solution. The effects of anion adsorption on the activities for the ORR were first assessed in HClO4 and HF electrolyte solutions at various concentrations. In our previous work (Part 1), we reported that the perchlorate anion adsorbs specifically on bulk-Pt, with a Frumkin-Temkin isotherm, that is, a linear relationship between Δm and log[HClO4]. Here, we find that the specific adsorption on the Pt-skin/Pt3Co alloy was significantly stronger than that on bulk-Pt, in line with its modified electronic properties. The kinetically controlled current density j(k) for the O2 reduction at the Pt-skin/Pt3Co-RDE was about 9 times larger than that of the bulk-Pt-RDE in 0.01 M HClO4 saturated with air, but the j(k) values on Pt-skin/Pt3Co decreased with increasing [HClO4] more steeply than in the case of Pt, due to the blocking of the active sites by the specifically adsorbed ClO4(-). We have detected reversible mass changes for one or more adsorbed oxygen-containing species (Ox = O2, O, OH, H2O) on the Pt-skin/Pt3Co-EQCM and Pt-EQCM in O2-saturated and He-purged 0.01 M HClO4 solutions, in which the specific adsorption of ClO4(-) anions was negligible. The coverages of oxygen species θ(Ox) on the Pt-skin/Pt3Co in the potential range from 0.86 to 0.96 V in the O2-saturated solution were found to be larger than those on pure Pt, providing strong evidence that the higher O2 reduction activity on the Pt3Co is correlated with higher θ(Ox), contrary to the conventional view.

  12. Low-temperature heat capacity and thermodynamic properties of [Re2(Ile)4(H2O)8](ClO4)6 (Re=Nd, Er, Ile=isoleucine)

    Lan Xiaozheng; Tan Zhicheng; Liu Beiping; Nan Zhaodong; Sun Lixian; Xu Fen

    2003-01-01

    The heat capacities of two kinds of rare-earth element solid complexes with isoleucine [Re 2 (Ile) 4 (H 2 O) 8 ](ClO 4 ) 6 (where Re=Nd, Er, and Ile=isoleucine) have been measured by an automatic adiabatic calorimeter in the temperature range from 80 to 370 K. Two solid-solid phase transitions were found from the C p curve of Nd formed complex in the range of 165-175 K with a peak temperature of 167.88 K and in the range of 195-210 K with a peak temperature of 202.13 K. The corresponding molar enthalpies of these phase transitions were determined to be 404.61 J mol -1 and 2.955 kJ mol -1 , respectively. One solid-solid phase transition was found for the Er formed complex in the range of 190-205 K with a peak temperature of 193.42 K. The corresponding molar enthalpy of this transition was 14.11 kJ mol -1 . Smooth heat capacities and thermodynamic functions relative to the standard state (298.15 K), H T -H 298.15 , S T -S 298.15 and -[G T -G 298.15 ], of the two compounds, were calculated on basis of experimental heat capacity data. Possible mechanisms of thermal decompositions for the pair of compounds were suggested according to the thermogravimetric (TG) analysis

  13. Composition Changes After the "Halloween" Solar Proton Event: The High-Energy Particle Precipitation in the Atmosphere (HEPPA) Model Versus MIPAS Data Intercomparison Study

    Funke, B.; Baumgaertner, A.; Calisto, M.; Egorova, T.; Jackman, C. H.; Kieser, J.; Krivolutsky, A.; Lopez-Puertas, M.; Marsh. D. R.; Reddmann, T.; hide

    2010-01-01

    We have compared composition changes of NO, NO2, H2O2,O3, N2O, HNO3 , N2O5, HNO4, ClO, HOCl, and ClONO2 as observed by the Michelson Interferometer for Passive Atmospheric Sounding (MIPAS) on Envisat in the aftermath of the "Halloween" solar proton event (SPE) in October/November 2003 at 25-0.01 hPa in the Northern hemisphere (40-90 N) and simulations performed by the following atmospheric models: the Bremen 2D model (B2dM) and Bremen 3D Chemical Transport Model (B3dCTM), the Central Aerological Observatory (CAO) model, FinROSE, the Hamburg Model of the Neutral and Ionized Atmosphere (HAMMONIA), the Karlsruhe Simulation Model of the Middle Atmosphere (KASIMA), the ECHAM5/MESSY Atmospheric Chemistry (EMAC) model, the modeling tool for SO1ar Climate Ozone Links studies (SOCOL and SOCOLi), and the Whole Atmosphere Community Climate Model (WACCM4). The large number of participating models allowed for an evaluation of the overall ability of atmospheric models to reproduce observed atmospheric perturbations generated by SPEs, particularly with respect to NOS, and ozone changes. We have further assessed the meteorological conditions and their implications on the chemical response to the SPE in both the models and observations by comparing temperature and tracer (CH4 and CO) fields. Simulated SPE-induced ozone losses agree on average within 5% with the observations. Simulated NO(y) enhancements around 1 hPa, however, are typically 30% higher than indicated by the observations which can be partly attributed to an overestimation of simulated electron-induced ionization. The analysis of the observed and modeled NO(y) partitioning in the aftermath of the SPE has demonstrated the need to implement additional ion chemistry (HNO3 formation via ion-ion recombination and water cluster ions) into the chemical schemes. An overestimation of observed H2O2 enhancements by all models hints at an underestimation of the OH/HO2 ratio in the upper polar stratosphere during the SPE. The

  14. EDITORIAL MANAGEMENT OF INFECTIOUS DISEASES IN CLO

    admin

    The term 'closed community' is used to refer to a population of people living together continuously with ... option and yet many prisons in African countries hold more than 10 times the numbers they were built for. ... information was manipulated to boost sales of swine flu vaccine, a fact alluded to obliquely by the World ...

  15. Synthesis, characterization, structure and properties of heterobimetallic complexes [CuNi(μ-OAc) (μ-OH) (μ-OH2) (bpy)2] (BF4)2 and [CuNi(bz)3(bpy)2] ClO4 from 2,2‧ bipyridine

    Kurbah, Sunshine D.; Kumar, A.; Syiemlieh, I.; Dey, A. K.; Lal, R. A.

    2018-02-01

    Heterobimetallic complexes of the composition [CuNi(bpy)2 (μ-OAc) (μ-OH) (μ-OH2)](BF4)2 (1) and [CuNi(bz)3 (bpy)2]ClO4 (2) were synthesized in moderate yield through solid state reaction and have been characterized by elemental analyses, molar conductance, mass spectra, magnetic moment, EPR, UV-Vis, IR spectroscopies and cyclic voltammetry. The ground state in complex (1) is doublet while that in complex (2), the ground state is a mixture of doublet and quartet, respectively. The structure of the complexes has been established by X-ray crystallography. The electron transfer reactions of the complexes have been investigated by cyclic voltammetry.

  16. Study of the hydrolysis of protactinium (V), at tracer scale, by solvent extraction method with thenoyl-tri-fluoro-acetone (TTA) as chelating agent. Characterization of the partition of TTA in the system TTA / H2O / toluene / Na+ / H+ / ClO4-

    Jaussaud, Ch.

    2003-01-01

    Hydrolysis of protactinium (V) according to the reactions: PaO(OH) 2+ +H 2 O ↔ PaO(OH) 2 + + H + (K 2 ] PaO(OH) 2+ +2H 2 O ↔ PaO(OH) 5 + H + (K 3 ) has been studied, at tracer scale, by solvent extraction method, with thenoyl-tri-fluoro-acetone (TTA) as chelating agent. A previous study concerning the partition of TTA between two immiscible phases (corresponding to TTA/toluene/Na + /H + /ClO 4 - system) has allowed a complete characterization of this system (partition constants, standard thermodynamic values, TTA hydration degree in toluene). Owing to specific properties of protactinium (V) (sorption onto various materials, formation of colloids), an extremely rigorous protocol has been established, protocol which could be used for other hydrolysable elements. Hydrolysis constants were deduced from a systematic study of partition of Pa(V) as a function TTA and proton concentration, ionic strength and temperature. Extrapolations to zero ionic strength were performed using SIT model and the specific interaction coefficients ε (i,j) as well as the Pitzer parameters β (0) and β (1) were determined. Standard thermodynamic data relative to hydrolysis equilibriums of Pa(V) were also estimated. (author)

  17. Wigner-Smith delay times and the non-Hermitian Hamiltonian for the HOCl molecule

    Barr, A.M.; Reichl, L.E.

    2013-01-01

    We construct the scattering matrix for a two-dimensional model of a Cl atom scattering from an OH dimer. We show that the scattering matrix can be written in terms of a non-Hermitian Hamiltonian whose complex energy eigenvalues can be used to compute Wigner-Smith delay times for the Cl-OH scattering process. We compute the delay times for a range of energies, and show that the scattering states with the longest delay times are strongly influenced by unstable periodic orbits in the classical dynamics. (Copyright copyright 2013 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

  18. Reactions of copper macrocycles with antioxidants and HOCl: potential for biological redox sensing.

    Sowden, Rebecca J; Trotter, Katherine D; Dunbar, Lynsey; Craig, Gemma; Erdemli, Omer; Spickett, Corinne M; Reglinski, John

    2013-02-01

    A series of simple copper N(2)S(2) macrocycles were examined for their potential as biological redox sensors, following previous characterization of their redox potentials and crystal structures. The divalent species were reduced by glutathione or ascorbate at a biologically relevant pH in aqueous buffer. A less efficient reduction was also achieved by vitamin E in DMSO. Oxidation of the corresponding univalent copper species by sodium hypochlorite resulted in only partial (~65 %) recovery of the divalent form. This was concluded to be due to competition between metal oxidation and ligand oxidation, which is believed to contribute to macrocycle demetallation. Electrospray mass spectrometry confirmed that ligand oxidation had occurred. Moreover, the macrocyclic complexes could be demetallated by incubation with EDTA and bovine serum albumin, demonstrating that they would be inappropriate for use in biological systems. The susceptibility to oxidation and demetallation was hypothesized to be due to oxidation of the secondary amines. Consequently these were modified to incorporate additional oxygen donor atoms. This modification led to greater resistance to demetallation and ligand oxidation, providing a better platform for further development of copper macrocycles as redox sensors for use in biological systems.

  19. Chlorination of iodide-containing waters in the presence of CuO: Formation of periodate

    Liu, Chao; Salhi, Elisabeth; Croue, Jean-Philippe; von Gunten, Urs

    2014-01-01

    It has been shown previously that the disproportionation of halogen-containing oxidants (e.g., HOCl, HOBr, and ClO2) is enhanced by a CuO-catalyzed process. In this study, the transformation of iodine during chlorination in the presence of CuO was investigated. There is no significant enhancement of the disproportionation of hypoiodous acid (HOI) in the presence of CuO. The formation rate of iodate (IO3 -) in the CuO-HOCl-I- system significantly increased when compared to homogeneous solutions, which was ascribed to the activation of HOCl by CuO enhancing its reactivity toward HOI. In this reaction system, iodate formation rates increase with increasing CuO (0-0.5 g L-1) and bromide (0-2 μM) doses and with decreasing pH (9.6-6.6). Iodate does not adsorb to the CuO surfaces used in this study. Nevertheless, iodate concentrations decreased after a maximum was reached in the CuO-HOCl-I-(-Br-) systems. Similarly, the iodate concentrations decrease as a function of time in the CuO-HOCl-IO3 - or CuO-HOBr-IO3 - system, and the rates increase with decreasing pH (9.6-6.6) due to the enhanced reactivity of HOCl or HOBr in the presence of CuO. It could be demonstrated that iodate is oxidized to periodate by a CuO-activated hypohalous acid, which is adsorbed on the CuO surface. No periodate could be measured in filtered solutions because it was mainly adsorbed to CuO. The adsorbed periodate was identified by scanning electron microscopy plus energy dispersive spectroscopy and X-ray photoelectron spectroscopy.

  20. Chlorination of iodide-containing waters in the presence of CuO: Formation of periodate

    Liu, Chao

    2014-11-18

    It has been shown previously that the disproportionation of halogen-containing oxidants (e.g., HOCl, HOBr, and ClO2) is enhanced by a CuO-catalyzed process. In this study, the transformation of iodine during chlorination in the presence of CuO was investigated. There is no significant enhancement of the disproportionation of hypoiodous acid (HOI) in the presence of CuO. The formation rate of iodate (IO3 -) in the CuO-HOCl-I- system significantly increased when compared to homogeneous solutions, which was ascribed to the activation of HOCl by CuO enhancing its reactivity toward HOI. In this reaction system, iodate formation rates increase with increasing CuO (0-0.5 g L-1) and bromide (0-2 μM) doses and with decreasing pH (9.6-6.6). Iodate does not adsorb to the CuO surfaces used in this study. Nevertheless, iodate concentrations decreased after a maximum was reached in the CuO-HOCl-I-(-Br-) systems. Similarly, the iodate concentrations decrease as a function of time in the CuO-HOCl-IO3 - or CuO-HOBr-IO3 - system, and the rates increase with decreasing pH (9.6-6.6) due to the enhanced reactivity of HOCl or HOBr in the presence of CuO. It could be demonstrated that iodate is oxidized to periodate by a CuO-activated hypohalous acid, which is adsorbed on the CuO surface. No periodate could be measured in filtered solutions because it was mainly adsorbed to CuO. The adsorbed periodate was identified by scanning electron microscopy plus energy dispersive spectroscopy and X-ray photoelectron spectroscopy.

  1. The role of computational chemistry in the science and measurements of the atmosphere

    Phillips, D. H.

    1978-01-01

    The role of computational chemistry in determining the stability, photochemistry, spectroscopic parameters, and parameters for estimating reaction rates of atmospheric constituents is discussed. Examples dealing with the photolysis cross sections of HOCl and (1 Delta g) O2 and with the stability of gaseous NH4Cl and asymmetric ClO3 are presented. It is concluded that computational chemistry can play an important role in the study of atmospheric constituents, particularly reactive and short-lived species which are difficult to investigate experimentally.

  2. Comparative reactivity of the myeloperoxidase-derived oxidants HOCl and HOSCN with low-density lipoprotein (LDL)

    Ismael, Fahd O; Proudfoot, Julie M; Brown, Bronwyn E

    2015-01-01

    Atherosclerosis is characterised by the accumulation of lipids within macrophages in the artery wall. Low-density lipoprotein (LDL) is the source of this lipid, owing to the uptake of oxidised LDL by scavenger receptors. Myeloperoxidase (MPO) released by leukocytes during inflammation produces ox...

  3. Kinetics and mechanism of styrene epoxidation by chlorite: role of chlorine dioxide.

    Leigh, Jessica K; Rajput, Jonathan; Richardson, David E

    2014-07-07

    An investigation of the kinetics and mechanism for epoxidation of styrene and para-substituted styrenes by chlorite at 25 °C in the pH range of 5-6 is described. The proposed mechanism in water and water/acetonitrile includes seven oxidation states of chlorine (-I, 0, I, II, III, IV, and V) to account for the observed kinetics and product distributions. The model provides an unusually detailed quantitative mechanism for the complex reactions that occur in mixtures of chlorine species and organic substrates, particularly when the strong oxidant chlorite is employed. Kinetic control of the reaction is achieved by the addition of chlorine dioxide to the reaction mixture, thereby eliminating a substantial induction period observed when chlorite is used alone. The epoxidation agent is identified as chlorine dioxide, which is continually formed by the reaction of chlorite with hypochlorous acid that results from ClO produced by the epoxidation reaction. The overall stoichiometry is the result of two competing chain reactions in which the reactive intermediate ClO reacts with either chlorine dioxide or chlorite ion to produce hypochlorous acid and chlorate or chloride, respectively. At high chlorite ion concentrations, HOCl is rapidly eliminated by reaction with chlorite, minimizing side reactions between HOCl and Cl2 with the starting material. Epoxide selectivity (>90% under optimal conditions) is accurately predicted by the kinetic model. The model rate constant for direct reaction of styrene with ClO2(aq) to produce epoxide is (1.16 ± 0.07) × 10(-2) M(-1) s(-1) for 60:40 water/acetonitrile with 0.20 M acetate buffer. Rate constants for para substituted styrenes (R = -SO3(-), -OMe, -Me, -Cl, -H, and -NO2) with ClO2 were determined. The results support the radical addition/elimination mechanism originally proposed by Kolar and Lindgren to account for the formation of styrene oxide in the reaction of styrene with chlorine dioxide.

  4. Electrochemical disinfection of groundwater for civil use - An example of an effective endogenous advanced oxidation process.

    De Battisti, Achille; Formaglio, Paolo; Ferro, Sergio; Al Aukidy, Mustafa; Verlicchi, Paola

    2018-09-01

    Lab-scale experiments using real groundwater were carried out using the CabECO ® reactor system in order to evaluate its suitability for producing safe water, acceptable for civil purposes. Trials were carried out in discontinuous and in continuous mode, analyzing the influence of electrical and hydraulic process parameters on the quality of treated water. The use of highly boron-doped diamond electrodes in the reactor allowed the electrosynthesis of considerable amounts of ozone. Because of the relatively high amount of chloride in the groundwater samples, a mixture of HOCl/ClO - was also synthesized. Somewhat unexpectedly, the increase in the current density in the explored range 100-1000 A m -2 was accompanied by an increase in the faradaic yield of the electrosynthesis of oxidants, which was more pronounced for ozone than for free chlorine. As reported in literature, the main radical intermediate in the relevant reactions is OH, which can lead to different oxidation products, namely ozone and HOCl/ClO - . The electrolytic treatment also caused a decrease in the concentration of minor components, including NH 4 + and Br - . Other byproducts were ClO 3 - and ClO 4 - , although their concentration levels were low. Moreover, due to alkali formation at the cathode surface, the precipitation of calcium and magnesium carbonates was also observed. In addition, the experimental investigation showed that even Pseudomonas aeruginosa and Legionella could be completely removed in the treated stream, due to the unique capacity of the reactor to synthesize biocidal agents like ozone, HOCl/ClO - , and chloramines. These effects were particularly evident during batch experiments. Copyright © 2018 The Authors. Published by Elsevier Ltd.. All rights reserved.

  5. A review of perchlorate (ClO4-) occurrence in fruits and vegetables.

    Calderón, R; Godoy, F; Escudey, M; Palma, P

    2017-02-01

    Since the 1990s, a large number of studies around the world have reported the presence of perchlorate in different types of environmental matrices. In view of their inherent characteristics, such as high solubility, mobility, persistence, and low affinity for the surface of soil, perchlorates are mobilized through the water-soil system and accumulate in edible plant species of high human consumption. However, the ingestion of food products containing perchlorate represents a potential health risk to people due to their adverse effects on thyroid, hormone, and neuronal development, mainly in infants and fetuses. At present, research has been centered on determining sources, fates, and remediation methods and not on its real extension in vegetables under farming conditions. This review presents a comprehensive overview and update of the frequent detection of perchlorate in fruits and vegetables produced and marketed around the world. Additionally, the impact of fertilizer on the potential addition of perchlorate to soil and its mobility in the water-soil-plant system is discussed. This review is organized into the following sections: sources of perchlorate, mobility in the water-soil system, presence in fruits and vegetables in different countries, international regulations, and toxicological studies. Finally, recommendations for future studies concerning perchlorate in fruits and vegetables are presented.

  6. CLO-PLA: the database of clonal and bud bank traits of Central European flora

    Klimešová, Jitka; de Bello, F.

    2009-01-01

    Roč. 20, č. 3 (2009), s. 511-516 ISSN 1100-9233 R&D Projects: GA ČR(CZ) GA526/06/0723 Institutional research plan: CEZ:AV0Z60050516 Keywords : bud bank * clonal traits * database Subject RIV: EF - Botanics Impact factor: 2.376, year: 2009

  7. Molecular cloing and bioinformatics analysis of lactate dehydrogenase from Taenia multiceps.

    Guo, Cheng; Wang, Yu; Huang, Xing; Wang, Ning; Yan, Ming; He, Ran; Gu, Xiaobin; Xie, Yue; Lai, Weimin; Jing, Bo; Peng, Xuerong; Yang, Guangyou

    2017-10-01

    Coenurus cerebralis, the larval stage (metacestode or coenurus) of Taenia multiceps, parasitizes sheep, goats, and other ruminants and causes coenurosis. In this study, we isolated and characterized complementary DNAs that encode lactate dehydrogenase A (Tm-LDHA) and B (Tm-LDHB) from the transcriptome of T. multiceps and expressed recombinant Tm-LDHB (rTm-LDHB) in Escherichia coli. Bioinformatic analysis showed that both Tm-LDH genes (LDHA and LDHB) contain a 996-bp open reading frame and encode a protein of 331 amino acids. After determination of the immunogenicity of the recombinant Tm-LDHB, an indirect enzyme-linked immunosorbent assay (ELISA) was developed for preliminary evaluation of the serodiagnostic potential of rTm-LDHB in goats. However, the rTm-LDHB-based indirect ELISA developed here exhibited specificity of only 71.42% (10/14) and sensitivity of 1:3200 in detection of goats infected with T. multiceps in the field. This study is the first to describe LDHA and LDHB of T. multiceps; meanwhile, our results indicate that rTm-LDHB is not a specific antigen candidate for immunodiagnosis of T. multiceps infection in goats.

  8. ENERGY METABOLISM OF THE CATTLE EGRET clo P.F.l.A.O. ...

    multivitamin supplement was added to the meat at weekly intervals. The food was ..... In horses and cattle. energy demands for varying loads of work vary from three to eight times standard levels ... ment of Nature Conservation. REFERENCES.

  9. REGISTRATION OF OVERLAPPING 3D POINT CLO UDS USING EXTRACTED LINE SEGMENTS

    Poręba Martyna

    2014-12-01

    Full Text Available The registration of 3D point clouds collected from different scanner positions is necessary in order to avoid occlusions, ensure a full coverage of areas, and collect useful data for analyzing an d documenting the surrounding environment. This procedure involves three main stages: 1 choosing appropriate features, which can be reliably extracted; 2 matching conjugate primitives; 3 estimating the transformation parameters. Currently, points and spheres are most frequently chosen as the registration features. However, due to limited point cloud resolution, proper identification and precise measurement of a common point within the overlapping laser data is almost impossible. One possible solution to this problem may be a registration process based on the Iterative Closest Point (ICP algorithm or its variation. Alternatively, planar and linear feature - based registration techniques can also be applied. In this paper, we propose the use of line segments obtained from intersecting planes modelled within individual scans. Such primitives can be easily extracted even from low - density point clouds. Working with synthetic data, several existing line - based registration methods are evaluated according to their robustness to noise and the precision of the estimated transformation parameters. For the purpose of quantitative assessment, an accuracy criterion based on a modified Hausdorff distance is defined. Since a n automated matching of segments is a challenging task that influences the correctness of the transformation parameters, a correspondence - finding algorithm is developed. The tests show that our matching algorithm provides a correct pairing with an accuracy of 99 % at least, and about 8% of omitted line pairs.

  10. Use of ClO2 for removal of estrogenic substances in wastewater

    2010-01-01

    The present invention pertains to wastewater treatment. More particularly, the invention concerns inactivation of biologically active compounds, such as estrogenic compounds, present in wastewater comprising sewage by the use of an oxidant, such as CIO2. A method is disclosed for inactivating one...... or more estrogenic substance(s) in wastewater, such as in a wastewater treatment plant, said method comprising a step of adding a dose of CIO2 to the water to be discharged, and said CIO2-dose being less than the CIO2- demand of the water to be discharged....

  11. Interactions of ClO2 and H2O2 Fumigants with Dirt and Grime ...

    Report The primary objective of this research was to evaluate the impact that dirt and grime, as present on unpainted subway concrete, may have on fumigation efficacy. Other objectives include determining which sampling procedure provides better recovery from grimed and cleaned concrete, and characterizing subway material before and after cleaning using a prescribed method from the New York City Metropolitan Transportation Authority (MTA).

  12. Impacts of the January 2005 solar particle events on middle atmospheric chlorine species

    Winkler, Holger; Sinnhuber, Miriam; Notholt, Justus; Maik Wissing, Jan; Kallenrode, May-Britt; Santee, Michelle

    It is well established that solar particle events (SPEs) are sources of significant chemical dis-turbances in the Earth's polar atmosphere. The observed SPE effects on nitrogen, hydrogen and oxygen compounds have been investigated in some detail in recent years, and they can be reproduced by atmospheric models using basic parametrizations for NOx and HOx produc-tion as a funtion of the particle impact ionisation. However, there are considerable differences between model predictions and measurements concerning several other trace gases including chlorine species. Two major SPEs occurred on January 17, and January 20, 2005. The latter had an exceptionally hard energy spectrum which caused maximum particle impact ionization at stratospheric altitudes. The Microwave Limb Sounder (MLS) instrument on-board the Aura satellite has measured a short-term decrease of HCl in the northern polar region corresponding to January 2005 SPEs. The peak HCl depletion is ˜300 ppt at 35-40 km. This is comparable to the depletion of messopheric HCl observed by the HALOE instrument during the July 2000 SPE. We will present simulation results of the University of Bremen Ion Chemistry (UBIC) model for the SPEs in January 2005 focusing on chlorine species. The simulations indicate that the observed short-term decrease of middle atmospheric HCl is due to a conversion into active chlorine species such as Cl, ClO and HOCl. The magnitude of the observed HCl loss can only be reproduced if reactions of negative chlorine species and the production of O(1 D) from the reaction N(2 D) + O2 are taken into account. The model results will be compared to MLS/Aura data of HCl, HOCl and ClO. Additionally, the impacts of the observed chlorine activation, e.g. on ozone, will be assessed.

  13. Hydrolase stabilization via entanglement in poly(propylene sulfide) nanoparticles: stability towards reactive oxygen species

    Allen, Brett L; Johnson, Jermaine D; Walker, Jeremy P

    2012-01-01

    In the advancement of green syntheses and sustainable reactions, enzymatic biocatalysis offers extremely high reaction rates and selectivity that goes far beyond the reach of chemical catalysts; however, these enzymes suffer from typical environmental constraints, e.g. operational temperature, pH and tolerance to oxidative environments. A common hydrolase enzyme, diisopropylfluorophosphatase (DFPase, EC 3.1.8.2), has demonstrated a pronounced efficacy for the hydrolysis of a variety of substrates for potential toxin remediation, but suffers from the aforementioned limitations. As a means to enhance DFPase’s stability in oxidative environments, enzymatic covalent immobilization within the polymeric matrix of poly(propylene sulfide) (PPS) nanoparticles was performed. By modifying the enzyme’s exposed lysine residues via thiolation, DFPase is utilized as a comonomer/crosslinker in a mild emulsion polymerization. The resultant polymeric polysulfide shell acts as a ‘sacrificial barrier’ by first oxidizing to polysulfoxides and polysulfones, rendering DFPase in an active state. DFPase–PPS nanoparticles thus retain activity upon exposure to as high as 50 parts per million (ppm) of hypochlorous acid (HOCl), while native DFPase is observed as inactive at 500 parts per billion (ppb). This trend is also confirmed by enzyme-generated (chloroperoxidase (CPO), EC 1.11.1.10) reactive oxygen species (ROS) including both HOCl (3 ppm) and ClO 2 (100 ppm). (paper)

  14. FATE OF REVERSE OSMOSIS (RO) MEMBRANES DURING OXIDATION BY DISINFECTANTS USED IN WATER TREATMENT: IMPACT ON MEMBRANE STRUCTURE AND PERFORMANCES

    Maugin, Thomas

    2013-12-01

    Providing pretreatment prior RO filtration is essential to avoid biofouling and subsequent loss of membrane performances. Chlorine is known to degrade polymeric membrane, improving or reducing membrane efficiency depending on oxidation conditions. This study aimed to assess the impact of alternative disinfectant, NH2Cl, as well as secondary oxidants formed during chloramination of seawater, e.g. HOBr, HOI, or used in water treatment e.g. ClO2, O3, on membrane structure and performances. Permeability, total and specific rejection (Cl-, SO4 2-, Br-, Boron), FTIR profile, elemental composition were analyzed. Results showed that each oxidant seems to react differently with the membrane. HOCl, HOBr, ClO2 and O3 improved membrane permeability but decreased rejection in different extent. In comparison, chloramines resulted in identical trends but oxidized membrane very slowly. On the contrary, iodine improved membrane rejection e.g. boron, but decreased permeability. Reaction conducted with chlorine, bromine, iodine and chloramines resulted in the incorporation of halogen in the membrane structure. All oxidant except iodine were able to break amide bonds of the membrane structure in our condition. In addition, chloramine seemed to react with membrane differently, involving a potential addition of nitrogen. Chloramination of seawater amplified membrane performances evolutions due to generation of bromochloramine. Moreover, chloramines reacted both with NOM and membrane during oxidation in natural seawater, leading to additional rejection drop.

  15. Influence of the human reliability in the assessment of the impact on the risk of changes of CLO; Influencia de la fiabilidad humana en la evaluacion del impacto en el riesgo de cambios de CLO

    Martorell, P.; Martorell, S.; Marton, I.; Saiz, M.

    2014-07-01

    Treatment and study of epistemic uncertainties is of special importance in the application of the analysis of probabilistic security to informed decision-making in risk, as points out the guide regulatory 1,174 [1] (Regulatory Guide 1,174, RG1.174). Specifically, the RG 1.177 [2] details of the impact on risk assessment concerning changes in the technical operating specifications (ETF). Based on the framework defined by such regulatory guides, will be assessed the effect of uncertainties epistemic associated with the analysis of human reliability in the context of the limit conditions of operation. As an example of application, will be held a sensitivity study of the time of inoperability Completion Time, the Residual heat removal system. (Author)

  16. LETHALITY OF PSEUDOMONAS FLUORESCENS STRAIN CLO145A TO THE 2 ZEBRA MUSSEL SPECIES PRESENT IN NORTH AMERICA

    Molloy, Daniel P.

    2001-01-01

    These experiments indicated that bacterial strain CL0145A of Pseudomonas fluorescens is equally lethal to the 2 zebra mussel species present in North America, Dreissena polymorpha and Dreissena bugensis. Thus, this bacterial strain should be equally effective at killing zebra mussels in power plant pipes, irrespective of which species is present

  17. Influence of the human reliability in the assessment of the impact on the risk of changes of CLO

    Martorell, P.; Martorell, S.; Marton, I.; Saiz, M.

    2014-01-01

    Treatment and study of epistemic uncertainties is of special importance in the application of the analysis of probabilistic security to informed decision-making in risk, as points out the guide regulatory 1,174 [1] (Regulatory Guide 1,174, RG1.174). Specifically, the RG 1.177 [2] details of the impact on risk assessment concerning changes in the technical operating specifications (ETF). Based on the framework defined by such regulatory guides, will be assessed the effect of uncertainties epistemic associated with the analysis of human reliability in the context of the limit conditions of operation. As an example of application, will be held a sensitivity study of the time of inoperability Completion Time, the Residual heat removal system. (Author)

  18. CLO-PLA: a database of clonal and bud-bank traits of the Central European flora.

    Klimešová, Jitka; Danihelka, Jiří; Chrtek, Jindřich; de Bello, Francesco; Herben, Tomáš

    2017-04-01

    This dataset presents comprehensive and easy-to-use information on 29 functional traits of clonal growth, bud banks, and lifespan of members of the Central European flora. The source data were compiled from a number of published sources (see the reference file) and the authors' own observations or studies. In total, 2,909 species are included (2,745 herbs and 164 woody species), out of which 1,532 (i.e., 52.7% of total) are classified as possessing clonal growth organs (1,480, i.e., 53.9%, if woody plants are excluded). This provides a unique, and largely unexplored, set of traits of clonal growth that can be used in studies on comparative plant ecology, plant evolution, community assembly, and ecosystem functioning across the large flora of Central Europe. It can be directly imported into a number of programs and packages that perform trait-based and phylogenetic analyses aimed to answer a variety of open and pressing ecological questions. © 2017 by the Ecological Society of America.

  19. LETHALITY OF PSEUDOMONAS FLUORESCENS STRAIN CLO145A TO THE 2 ZEBRA MUSSEL SPECIES PRESENT IN NORTH AMERICA

    Daniel P. Molloy

    2001-10-28

    These experiments indicated that bacterial strain CL0145A of Pseudomonas fluorescens is equally lethal to the 2 zebra mussel species present in North America, Dreissena polymorpha and Dreissena bugensis. Thus, this bacterial strain should be equally effective at killing zebra mussels in power plant pipes, irrespective of which species is present.

  20. The maintenance of elevated active chlorine levels in the Antarctic lower stratosphere through HCl null cycles

    Müller, Rolf; Grooß, Jens-Uwe; Mannan Zafar, Abdul; Robrecht, Sabine; Lehmann, Ralph

    2018-03-01

    The Antarctic ozone hole arises from ozone destruction driven by elevated levels of ozone destroying (active) chlorine in Antarctic spring. These elevated levels of active chlorine have to be formed first and then maintained throughout the period of ozone destruction. It is a matter of debate how this maintenance of active chlorine is brought about in Antarctic spring, when the rate of formation of HCl (considered to be the main chlorine deactivation mechanism in Antarctica) is extremely high. Here we show that in the heart of the ozone hole (16-18 km or 85-55 hPa, in the core of the vortex), high levels of active chlorine are maintained by effective chemical cycles (referred to as HCl null cycles hereafter). In these cycles, the formation of HCl is balanced by immediate reactivation, i.e. by immediate reformation of active chlorine. Under these conditions, polar stratospheric clouds sequester HNO3 and thereby cause NO2 concentrations to be low. These HCl null cycles allow active chlorine levels to be maintained in the Antarctic lower stratosphere and thus rapid ozone destruction to occur. For the observed almost complete activation of stratospheric chlorine in the lower stratosphere, the heterogeneous reaction HCl + HOCl is essential; the production of HOCl occurs via HO2 + ClO, with the HO2 resulting from CH2O photolysis. These results are important for assessing the impact of changes of the future stratospheric composition on the recovery of the ozone hole. Our simulations indicate that, in the lower stratosphere, future increased methane concentrations will not lead to enhanced chlorine deactivation (through the reaction CH4 + Cl → HCl + CH3) and that extreme ozone destruction to levels below ≈ 0.1 ppm will occur until mid-century.

  1. Short- and medium-term atmospheric constituent effects of very large solar proton events

    C. H. Jackman

    2008-02-01

    Full Text Available Solar eruptions sometimes produce protons, which impact the Earth's atmosphere. These solar proton events (SPEs generally last a few days and produce high energy particles that precipitate into the Earth's atmosphere. The protons cause ionization and dissociation processes that ultimately lead to an enhancement of odd-hydrogen and odd-nitrogen in the polar cap regions (>60° geomagnetic latitude. We have used the Whole Atmosphere Community Climate Model (WACCM3 to study the atmospheric impact of SPEs over the period 1963–2005. The very largest SPEs were found to be the most important and caused atmospheric effects that lasted several months after the events. We present the short- and medium-term (days to a few months atmospheric influence of the four largest SPEs in the past 45 years (August 1972; October 1989; July 2000; and October–November 2003 as computed by WACCM3 and observed by satellite instruments. Polar mesospheric NOx (NO+NO2 increased by over 50 ppbv and mesospheric ozone decreased by over 30% during these very large SPEs. Changes in HNO3, N2O5, ClONO2, HOCl, and ClO were indirectly caused by the very large SPEs in October–November 2003, were simulated by WACCM3, and previously measured by Envisat Michelson Interferometer for Passive Atmospheric Sounding (MIPAS. WACCM3 output was also represented by sampling with the MIPAS averaging kernel for a more valid comparison. Although qualitatively similar, there are discrepancies between the model and measurement with WACCM3 predicted HNO3 and ClONO2 enhancements being smaller than measured and N2O5 enhancements being larger than measured. The HOCl enhancements were fairly similar in amounts and temporal variation in WACCM3 and MIPAS. WACCM3 simulated ClO decreases below 50 km, whereas MIPAS mainly observed increases, a very perplexing difference. Upper stratospheric

  2. A ratiometric fluorescent probe based on boron dipyrromethene and rhodamine Förster resonance energy transfer platform for hypochlorous acid and its application in living cells

    Liu, Ying; Zhao, Zhi-Min; Miao, Jun-Ying; Zhao, Bao-Xiang

    2016-01-01

    We have developed a ratiometric fluorescent probe BRT based on boron dipyrromethene (BODIPY) and rhodamine-thiohydrazide Förster resonance energy transfer (FRET) platform for sensing hypochlorous acid (HOCl) with high selectivity and sensitivity. The probe can detect HOCl in 15 s with the detection limit of 38 nM. Upon mixing with HOCl the fluorescence colour of probe BRT changed from green to orange. Moreover, probe BRT was applied to successfully monitor HOCl in living RAW 264.7 cells. - Highlights: • A probe based on BODIPY and rhodamine was developed for sensing HOCl. • The probe could sense HOCl in a ratiometric manner based on the FRET platform in PBS buffer solution. • The probe can detect HOCl in 15 s accompanied with a fluorescence colour change. • This probe was successfully used to monitor HOCl in living RAW 264.7 cells.

  3. Stratospheric ozone - Impact of human activity

    Mcelroy, Michael B.; Salawitch, Ross J.

    1989-01-01

    The current knowledge of the chemistry of the stratosphere is reviewed, with particular consideration given to the measurements from the Atmospheric Trace Molecule Spectroscopy (ATMOS) experiment and from the Airborne Antarctic Ozone Experiment. Analysis of the ATMOS data at 30 deg N suggests that the current understanding of the contemporary-stratosphere chemistry at mid-latitudes is relatively complete, except for possible problems with the diurnal variations of N2O5 at low altitudes, and with ClNO3 at higher altitudes. Except for some difficulties with these two compounds, the data from ATMOS agree well with the gas phase models for nitrogen and chlorine species at 30 deg N in spring. It is emphasized that, in addition to the HOCl mechanism proposed by Solomon et al. (1986), the ClO-BrO scheme proposed by McElroy et al. (1986), and the ClO dimer mechanism introduced by Molina and Molina (1987), other processes exist that are responsible for ozone removal.

  4. Taurine modulation of hypochlorous acid-induced lung epithelial cell injury in vitro. Role of anion transport.

    Cantin, A M

    1994-01-01

    Airway secretions of cystic fibrosis patients were found to contain high concentrations of taurine, which decreased with antibiotic therapy during acute respiratory exacerbations. Taurine, in a 1:1 molar ratio with HOCl/OCl-, caused a 10-fold increase in the amount of HOCl/OCl- needed to induce cytotoxicity to the cat lung epithelial cell line, AKD. Although DMSO protected cells against HOCl/OCl(-)-mediated injury, the presence of an equimolar concentration of taurine with HOCl/OCl- prevented...

  5. Physical Properties of (NH4)2Pt(CN)4[Clo.42].3H2O: A new Quasi-One-Dimensional Conductor

    Carneiro, Kim; Petersen, A. S.; Underhill, A. E.

    1979-01-01

    The quasi-one-dimensional conductor (NH4)2[Pt(CN)4]Cl0.42·3H2O, ACP(Cl), has been studied experimentally by means of electrical conduction measurements, x-ray diffuse scattering, and neutron inelastic scattering. This allows the determination of all the physical parameters of interest for the the......The quasi-one-dimensional conductor (NH4)2[Pt(CN)4]Cl0.42·3H2O, ACP(Cl), has been studied experimentally by means of electrical conduction measurements, x-ray diffuse scattering, and neutron inelastic scattering. This allows the determination of all the physical parameters of interest...

  6. Demonstration and Validation of a Portable Raman Sensor for In-Situ Detection and Monitoring of Perchlorate (ClO4 )

    2017-03-01

    Huntsville in Madison County (Fig. 4.3). The current Redstone Arsenal originated as the Huntsville Arsenal in 1941, a facility built to produce chemical...topographically high ground surrounded by wetlands on three sides. The far northern boundary of the OB/OD Area is adjacent to a creek and wetland area. The...far western boundary of the OB/OD Area is adjacent to wetlands and is approximately 250 feet from a lake located farther to the west. The OB/OD Area

  7. Relação entre a temperatura e o molhamento foliar no monocíclo da Sigatoka-negra

    Cleilson do Nascimento Uchôa

    2012-06-01

    Full Text Available A influência da temperatura (21, 24, 27 e 30 °C e da duração do tempo de molhamento foliar (0, 12, 24, 48 e 72 horas na penetração do agente causal da Sigatoka-negra (Mycosphaerella fijiensis foi quantificada em ambiente controlado. A área abaixo da curva do progresso da doença (AACPD e a incidência foram influenciadas pela temperatura e pela duração do tempo de molhamento foliar. Foram constatadas diferenças significativas (P=0,05 nos valores da AACPD para as diferentes temperaturas, bem como verificada a interação significativa (P=0,05 entre temperaturas e o molhamento foliar. Em todas as temperaturas foi possível a observação de sintomas, entretanto, a maior AACPD foi observada em folhas inoculadas que permaneceram na temperatura de 24 e 27°C, a partir de 48 horas de molhamento foliar. Nas temperaturas de 21ºC e 30°C a incidência de Sigatoka-negra foi menor. O período de molhamento foliar mínimo para o progresso da doença foi de 24 horas. Não foram observados sintomas de Sigatoka-negra em folhas inoculados com o molhamento foliar de 0 hora e 12 horas em todas as temperaturas. As folhas assintomáticas, após 5 dias em câmara úmida apresentavam sintomas característicos de Sigatoka-negra, demonstrando que os conídios inoculados nas folhas permaneceram viáveis por um período na ausência de água livre na folha.

  8. Synthesis and Crystal Structure of an Unprecedented Supramolecular Complex[Co(μ2-ClO4)2(H2O)2]·2MA

    XU,Jing; BAI,Zhengshuai; SUN,Weiyin

    2009-01-01

    A new supramolecular framework[Co(μ2-C104)2(H2O)2]·2MA(1)[MA=melamine(C3H6N6)]has been syn-thesized by a hydrothermal method.Interestingly,there ale inorganic and organic building blocks with two different supramolecular synthons:(a)2D(4,4)network constructed by infinite inorganic 1D chains through interchain hy-drogen bonding interactions;(b)1D zigzag organic chains formed by hydrogen bonds, which further stack up through,ππ-interactions between the two adjacent MA molecules.The entire structure of 1 is a 3D supramolecular framework resulting from the presence of abundant hydrogen bonds between infinite[CO(μ2-C1O4)2(H2O)2]n chains and zigzag MA chains in different sheets.1 gives a nice example of supramolecular framework based on non-covalent interactions including hydrogen bonding and π-π interactions.

  9. THE EFFECTS OF 1‰ STABILIZED LIQUID SOLUTION OF CHLORINE DIOXIDE (ClO2 ON SOME FOOD-BORN BACTERIA

    Sead Hadziabdić

    2014-03-01

    Full Text Available The conducted research gives an overview of the results obtained after the application of 1‰ solution of stabilized liquid chlorine dioxide on some food-born related bacteria - E. coli, Staphylococcus aureus, S. Enteritidis and C. jejuni.  For this purpose,  reference strains of the aforementioned pathogens in decimal dilutions were exposed to 1 ml of 1‰ solution of stabilized liquid chlorine dioxide for one hour. Reduction of bacteria counts per mililitre (CFU/ml has been noticed for all bacteria, with total reduction of C. jejuni and Staphylococcus aureus in the fourth (1:104, and for S. Enteritidis and E. coli in the sixth (1:106 decimal dilution. Key words: chlorine dioxide, E. coli, S. aureus, S. Enteritidis, C. jejuni

  10. The role of electrolyte anions (ClO4-, NO3-, and Cl-) in divalent metal (M2+) adsorption on oxide and hydroxide surfaces in salt solutions

    Criscenti, L.J.; Sverjensky, D.A.

    1999-01-01

    Adsorption of divalent metal ions (M 2+ ) onto oxide and hydroxide surfaces from solutions of strong electrolytes has typically been inferred to take place without the involvement of the electrolyte anion. Only in situations where M 2+ forms a strong enough aqueous complex with the electrolyte anion (for example, CdCl + or PbCl + ) has it been frequently suggested that the metal and the electrolyte anion adsorb simultaneously. A review of experimental data for the adsorption of Cd 2+ , Pb 2+ , Co 2+ , UO 2 2+ , Zn 2+ , Cu 2+ , Ba 2+ , Sr 2+ , and Ca 2+ onto quartz, silica, goethite, hydrous ferric oxide, corundum, γ-alumina, anatase, birnessite, and magnetite, from NaNO 3 , KNO 3 , NaCl, and NaClO 4 solutions over a wide range of ionic strengths (0.0001 M-1.0 M), reveals that transition and heavy metal adsorption behavior with ionic strength is a function of the type of electrolyte. In NaNO 3 solutions, metal adsorption exhibits little or no dependence on the ionic strength of the solution. However, in NaCl solutions, transition and heavy metal adsorption decreases strongly with increasing ionic strength. In NaClO 4 solutions, metal adsorption decreases strongly with increasing ionic strength. In NaClO 4 solutions, metal adsorption exhibits little dependence on ionic strength but is often suggestive of an increase in metal adsorption with increasing ionic strength. Analysis of selected adsorption edges was carried out using the extended triple-layer model and aqueous speciation models that included metal-nitrate, metal-chloride, and metal-hydroxide complexes

  11. Hypochlorite-induced oxidation of proteins in plasma

    Hawkins, C L; Davies, Michael Jonathan

    1999-01-01

    Activated phagocyte cells generate hypochlorite (HOCl) via the release of H2O2 and the enzyme myeloperoxidase. Plasma proteins are major targets for HOCl, although little information is available about the mechanism(s) of oxidation. In this study the reaction of HOCl (at least 50 microM) with dil......Activated phagocyte cells generate hypochlorite (HOCl) via the release of H2O2 and the enzyme myeloperoxidase. Plasma proteins are major targets for HOCl, although little information is available about the mechanism(s) of oxidation. In this study the reaction of HOCl (at least 50 micro......M) with diluted fresh human plasma has been shown to generate material that oxidizes 5-thio-2-nitrobenzoic acid; these oxidants are believed to be chloramines formed from the reaction of HOCl with protein amine groups. Chloramines have also been detected with isolated plasma proteins treated with HOCl. In both...... more efficient. The reaction of fresh diluted plasma with HOCl also gives rise to protein-derived nitrogen-centred radicals in a time- and HOCl-concentration-dependent manner; these have been detected by EPR spin trapping. Identical radicals have been detected with isolated HOCl-treated plasma proteins...

  12. Hypochlorite-induced damage to proteins

    Hawkins, C L; Davies, Michael Jonathan

    1998-01-01

    Stimulated monocytes and neutrophils generate hypochlorite (HOCl) via the release of the enzyme myeloperoxidase and hydrogen peroxide. HOCl damages proteins by reaction with amino acid side-chains or backbone cleavage. Little information is available about the mechanisms and intermediates involved...... in these reactions. EPR spin trapping has been employed to identify radicals on proteins, peptides and amino acids after treatment with HOCl. Reaction with HOCl gives both high- and low-molecular-mass nitrogen-centred, protein-derived radicals; the yield of the latter increases with both higher HOCl:protein ratios...... and enzymic digestion. These radicals, which arise from lysine side-chain amino groups, react with ascorbate, glutathione and Trolox. Reaction of HOCl-treated proteins with excess methionine eliminates radical formation, which is consistent with lysine-derived chloramines (via homolysis of N-Cl bonds) being...

  13. Superoxide radicals can act synergistically with hypochlorite to induce damage to proteins

    Hawkins, Clare Louise; Rees, Martin D; Davies, Michael Jonathan

    2002-01-01

    Activated phagocytes generate both superoxide radicals via a respiratory burst, and HOCl via the concurrent release of the haem enzyme myeloperoxidase. Amine and amide functions on proteins and carbohydrates are major targets for HOCl, generating chloramines (RNHCl) and chloramides (RC(O)NClR'), ......Activated phagocytes generate both superoxide radicals via a respiratory burst, and HOCl via the concurrent release of the haem enzyme myeloperoxidase. Amine and amide functions on proteins and carbohydrates are major targets for HOCl, generating chloramines (RNHCl) and chloramides (RC...

  14. Hypochlorous acid turn-on boron dipyrromethene probe based on oxidation of methyl phenyl sulfide

    Liu, Shi-Rong; Vedamalai, Mani; Wu, Shu-Pao

    2013-01-01

    Graphical abstract: -- Highlights: •A BODIPY-based green fluorescent probe for sensing HOCl was developed. •The probe utilizes HOCl-promoted oxidation of methyl phenyl sulfide to produce a proportional fluorescence response to the concentration of HOCl. •Confocal fluorescence microscopy imaging of RAW264.7 cells demonstrated that the HCS probe might have application in the investigation of HOCl roles in biological systems. -- Abstract: A boron dipyrromethene (BODIPY)-based fluorometric probe, HCS, has been successfully developed for the highly sensitive and selective detection of hypochlorous acid (HOCl). The probe is based on the specific HOCl-promoted oxidation of methyl phenyl sulfide. The reaction is accompanied by a 160-fold increase in the fluorescent quantum yield (from 0.003 to 0.480). The fluorescent turn-on mechanism is accomplished by suppression of photoinduced electron transfer (PET) from the methyl phenyl sulfide group to BODIPY. The fluorescence intensity of the reaction between HOCl and HCS shows a good linearity in the HOCl concentration range 1–10 μM. The detection limit is 23.7 nM (S/N = 3). In addition, confocal fluorescence microscopy imaging using RAW264.7 macrophages demonstrates that the HCS probe could be an efficient fluorescent detector for HOCl in living cells

  15. Hypochlorous acid turn-on boron dipyrromethene probe based on oxidation of methyl phenyl sulfide

    Liu, Shi-Rong; Vedamalai, Mani; Wu, Shu-Pao, E-mail: spwu@mail.nctu.edu.tw

    2013-10-24

    Graphical abstract: -- Highlights: •A BODIPY-based green fluorescent probe for sensing HOCl was developed. •The probe utilizes HOCl-promoted oxidation of methyl phenyl sulfide to produce a proportional fluorescence response to the concentration of HOCl. •Confocal fluorescence microscopy imaging of RAW264.7 cells demonstrated that the HCS probe might have application in the investigation of HOCl roles in biological systems. -- Abstract: A boron dipyrromethene (BODIPY)-based fluorometric probe, HCS, has been successfully developed for the highly sensitive and selective detection of hypochlorous acid (HOCl). The probe is based on the specific HOCl-promoted oxidation of methyl phenyl sulfide. The reaction is accompanied by a 160-fold increase in the fluorescent quantum yield (from 0.003 to 0.480). The fluorescent turn-on mechanism is accomplished by suppression of photoinduced electron transfer (PET) from the methyl phenyl sulfide group to BODIPY. The fluorescence intensity of the reaction between HOCl and HCS shows a good linearity in the HOCl concentration range 1–10 μM. The detection limit is 23.7 nM (S/N = 3). In addition, confocal fluorescence microscopy imaging using RAW264.7 macrophages demonstrates that the HCS probe could be an efficient fluorescent detector for HOCl in living cells.

  16. Chemistry, Dynamics, and Radiation of Ozone Loss: Airborne Measurements of OH, HO2, NO2, ClO, BrO, IO, ClONO2, BrONO2, ClOOCl, and H2O

    Anderson, James G.

    2005-01-01

    This grant continued the research initially funded under NAG1-01095. This research addresses, through a combination of in situ and remote aircraft-borne instruments, the following scientific questions: Which mechanisms are responsible for the continuing erosion of ozone over midlatitudes of the Northern Hemisphere? Will the rapid loss of ozone over the Arctic in late winter continue to worsen over the next two decades? Are these large losses dynamically coupled to midlatitudes? Which mechanisms dictate the rate of exchange of material between the troposphere and stratosphere? How will these processes change in response to changes in climate? Will regional scale pollution episodes, that are emerging as predictable seasonal events, significantly affect the middle-to-upper troposphere chemical composition. If so, how will these changes alter the chemical composition of the middle world? What changes are predicted for the overworld? Why has the arctic stratosphere become colder in the late winter phase in recent years? Have increases in tropical upper troposphere temperatures increased the temperature gradient such as to change the trajectories of vertically propagating waves, thus reducing the effectiveness of the meridional circulation for transport of heat, momentum and ozone from the tropics to high latitudes?

  17. A highly selective turn-on fluorescent probe for hypochlorous acid based on hypochlorous acid-induced oxidative intramolecular cyclization of boron dipyrromethene-hydrazone

    Chen, Wei-Chieh; Venkatesan, Parthiban; Wu, Shu-Pao

    2015-01-01

    Highlights: • A BODIPY-based fluorescent probe for sensing HOCl was developed. • The probe utilizes the HOCl-promoted cyclization in response to the amount of HOCl. • The probe might have application in the investigation of HOCl in biological systems. - Abstract: A BODIPY-based fluorescent probe, HBP, was developed for the detection of hypochlorous acid based on the specific hypochlorous acid-promoted oxidative intramolecular cyclization of heterocyclic hydrazone in response to the amount of HOCl. The reaction is accompanied by a 41-fold increase in the fluorescent quantum yield (from 0.004 to 0.164). The fluorescence intensity of the reaction between HOCl and HBP is linear in the HOCl concentration range of 1–8 μM with a detection limit of 2.4 nM (S/N = 3). Confocal fluorescence microscopy imaging using RAW264.7 cells showed that the new probe HBP could be used as an effective fluorescent probe for detecting HOCl in living cells

  18. Degradation of hyaluronic acid, poly- and monosaccharides, and model compounds by hypochlorite

    Hawkins, C L; Davies, Michael Jonathan

    1998-01-01

    the site(s) of HOCl/ClO- attack, the intermediates formed, or the mechanism(s) of polymer degradation. In this study reaction of HOCl/ClO- with amides, sugars, polysaccharides, and hyaluronic acid has been monitored by UV-visible (220-340 nm) and EPR spectroscopy. UV-visible experiments have shown...

  19. Hypochlorous Acid - Analytical Methods and Antimicrobial Activity ...

    Hypochlorous acid (HOCl) is produced by the human body's immune cells to fight infections. It is effective against a broad range of microorganisms. It is non-toxic, non-irritant and non-corrosive at proper usage concentrations. There are some available commercial products that contain HOCl. However, its low storage ...

  20. Reaction of hypochlorite with amino acids and peptides : EPR evidence for rapid rearrangement and fragmentation of nitrogen-centred radicals

    Hawkins, C.L.; Davies, M.J.

    1998-01-01

    Various amino acid side chains have been shown to be particularly susceptible to attack and modification by hypochlorite (HOCl). It is known that tyrosine is readily chlorinated by HOCl to give 3-chlorotyrosine and this product has been employed as a marker of HOCl-mediated damage to proteins. Cysteine and methionine react rapidly with HOCl to give oxy acids and cystine (from cysteine) and sulphoxides (from methionine). Lysine and amino acids which lack the above functional groups also react with HOCl via the free amino group which results in the generation of unstable chloramine intermediates; subsequent decomposition of these species gives NH 3 , CO 2 and aldehydes. While the products of reaction of HOCl with amino acids and peptides are reasonably well characterised, the mechanism(s) by which these products arise is less well understood. Electron paramagnetic resonance (EPR) spectroscopy with spin trapping and UV/visible spectroscopy has been employed to examine the reaction of HOCl with amino acids and some small peptides. Reaction of HOCl with N-acetyl amino acids or small peptides gives radicals predominantly at α-carbon sites via reaction at N-terminal free amino groups or amide (peptide) bonds. It is proposed that these carbon-centred radicals are produced as a result of the rearrangement of initial nitrogen-centred radicals formed on cleavage of the N-CI bond of the chloramine/chloramide species by a 1,2-shift reaction

  1. Hypochlorite-induced oxidation of amino acids, peptides and proteins

    Hawkins, C L; Pattison, D I; Davies, Michael Jonathan

    2003-01-01

    Activated phagocytes generate the potent oxidant hypochlorite (HOCl) via the release of the enzyme myeloperoxidase and hydrogen peroxide. HOCl is known to react with a number of biological targets including proteins, DNA, lipids and cholesterol. Proteins are likely to be major targets for reactio...

  2. Do pH and flavonoids influence hypochlorous acid-induced catalase inhibition and heme modification?

    Krych-Madej, Justyna; Gebicka, Lidia

    2015-09-01

    Hypochlorous acid (HOCl), highly reactive oxidizing and chlorinating species, is formed in the immune response to invading pathogens by the reaction of hydrogen peroxide with chloride catalyzed by the enzyme myeloperoxidase. Catalase, an important antioxidant enzyme, catalyzing decomposition of hydrogen peroxide to water and molecular oxygen, hampers in vitro HOCl formation, but is also one of the main targets for HOCl. In this work we have investigated HOCl-induced catalase inhibition at different pH, and the influence of flavonoids (catechin, epigallocatechin gallate and quercetin) on this process. It has been shown that HOCl-induced catalase inhibition is independent on pH in the range 6.0-7.4. Preincubation of catalase with epigallocatechin gallate and quercetin before HOCl treatment enhances the degree of catalase inhibition, whereas catechin does not affect this process. Our rapid kinetic measurements of absorption changes around the heme group have revealed that heme modification by HOCl is mainly due to secondary, intramolecular processes. The presence of flavonoids, which reduce active catalase intermediate, Compound I to inactive Compound II have not influenced the kinetics of HOCl-induced heme modification. Possible mechanisms of the reaction of hypochlorous acid with catalase are proposed and the biological consequences are discussed. Copyright © 2015 Elsevier B.V. All rights reserved.

  3. Use of commercial sodium hypochlorite solutions in respect to the quality of the products

    Gjorgjeska, Biljana; Kovacevska, Ivona; Dimova, Cena

    2012-01-01

    Sodium hypochlorite is the most popular solution for root canal irrigation in stomatology practice. NaOCl ionizes in water into hypochlorite ion OCl-, establishing an equilibrium with hypochlorous acid (HOCl). At acidic and neutral pH, chlorine exists predominantly as HOCl, whereas at high pH of 9 and above, OCl- predominates.

  4. A highly selective turn-on fluorescent probe for hypochlorous acid based on hypochlorous acid-induced oxidative intramolecular cyclization of boron dipyrromethene-hydrazone

    Chen, Wei-Chieh; Venkatesan, Parthiban; Wu, Shu-Pao, E-mail: spwu@mail.nctu.edu.tw

    2015-07-02

    Highlights: • A BODIPY-based fluorescent probe for sensing HOCl was developed. • The probe utilizes the HOCl-promoted cyclization in response to the amount of HOCl. • The probe might have application in the investigation of HOCl in biological systems. - Abstract: A BODIPY-based fluorescent probe, HBP, was developed for the detection of hypochlorous acid based on the specific hypochlorous acid-promoted oxidative intramolecular cyclization of heterocyclic hydrazone in response to the amount of HOCl. The reaction is accompanied by a 41-fold increase in the fluorescent quantum yield (from 0.004 to 0.164). The fluorescence intensity of the reaction between HOCl and HBP is linear in the HOCl concentration range of 1–8 μM with a detection limit of 2.4 nM (S/N = 3). Confocal fluorescence microscopy imaging using RAW264.7 cells showed that the new probe HBP could be used as an effective fluorescent probe for detecting HOCl in living cells.

  5. Hypochlorite-induced oxidation of thiols

    Davies, Michael Jonathan; Hawkins, C L

    2000-01-01

    -molecular-weight thiols such as reduced glutathione (GSH), and sulfur-containing amino acids in proteins, are major targets for HOCl. Radicals have not generally been implicated as intermediates in thiol oxidation by HOCl, though there is considerable literature evidence for the involvement of radicals in the metal ion......-, thermal- or UV light-catalysed decomposition of sulfenyl or sulfonyl chlorides which are postulated intermediates in thiol oxidation. In this study we show that thiyl radicals are generated on reaction of a number of low-molecular-weight thiols with HOCl. With sub-stoichiometric amounts of HOCl, relative...... to the thiol, thiyl radicals are the major species detected by EPR spin trapping. When the HOCl is present in excess over the thiol, additional radicals are detected with compounds which contain amine functions; these additional radicals are assigned to nitrogen-centered species. Evidence is presented...

  6. Activation of Nrf2-mediated oxidative stress response in macrophages by hypochlorous acid

    Pi Jingbo; Zhang Qiang; Woods, Courtney G.; Wong, Victoria; Collins, Sheila; Andersen, Melvin E.

    2008-01-01

    Hypochlorous acid (HOCl), a potent oxidant generated when chlorine gas reacts with water, is important in the pathogenesis of many disorders. Transcription factor Nrf2-mediated antioxidant response represents a critical cellular defense mechanism that serves to maintain intracellular redox homeostasis and limit oxidative damage. In the present study, the effect of HOCl on Nrf2 activation was investigated in macrophages, one of the target cells of chlorine gas exposure. Exposure of RAW 264.7 macrophages to HOCl resulted in increased protein levels of Nrf2 in nuclear extractions, as well as a time- and dose-dependent increase in the expression of Nrf2 target genes, including heme oxygenase-1, NAD(P)H:quinone oxidoreductase 1 (NQO-1), glutamate cysteine ligase catalytic subunit (GCLC), and glutathione synthetase (GS). Additionally, intracellular glutathione (GSH), which is the prime scavenger for HOCl in cells, decreased within the first hour of HOCl exposure. The decline was followed by a GSH rebound that surpassed the initial basal levels by up to 4-fold. This reversal in GSH levels closely correlated with the gene expression profile of GCLC and GS. To study the mechanisms of Nrf2 activation in response to HOCl exposure, we examined the effects of several antioxidants on Nrf2-mediated response. Pretreatment with cell-permeable catalase, N-acetyl-L-cysteine or GSH-monoethyl ester markedly reduced expression of NQO-1 and GCLC under HOCl challenge conditions, suggesting intracellular ROS-scavenging capacity affects HOCl-induced Nrf2 activation. Importantly, pre-activation of Nrf2 with low concentrations of pro-oxidants protected the cells against HOCl-induced cell damage. Taken together, we provide direct evidence that HOCl activates Nrf2-mediated antioxidant response, which protects cells from oxidative damage

  7. Kinetic studies on the reaction of cob(II)alamin with hypochlorous acid: Evidence for one electron oxidation of the metal center and corrin ring destruction.

    Dassanayake, Rohan S; Farhath, Mohamed M; Shelley, Jacob T; Basu, Soumitra; Brasch, Nicola E

    2016-10-01

    Kinetic and mechanistic studies on the reaction of a major intracellular vitamin B 12 form, cob(II)alamin (Cbl(II)), with hypochlorous acid/hypochlorite (HOCl/OCl - ) have been carried out. Cbl(II) (Co(II)) is rapidly oxidized by HOCl to predominately aquacobalamin/hydroxycobalamin (Cbl(III), Co(III)) with a second-order rate constant of 2.4×10 7 M -1 s -1 (25.0°C). The stoichiometry of the reaction is 1:1. UHPLC/HRMS analysis of the product mixture of the reaction of Cbl(II) with 0.9mol equiv. HOCl provides support for HOCl being initially reduced to Cl and subsequent H atom abstraction from the corrin macrocycle occurring, resulting in small amounts of corrinoid species with two or four H atoms fewer than the parent cobalamin. Upon the addition of excess (H)OCl further slower reactions are observed. Finally, SDS-PAGE experiments show that HOCl-induced damage to bovine serum albumin does not occur in the presence of Cbl(II), providing support for Cbl(II) being an efficient HOCl trapping agent. Copyright © 2016 Elsevier Inc. All rights reserved.

  8. Dissection of the mechanism of manganese porphyrin-catalyzed chlorine dioxide generation.

    Umile, Thomas P; Wang, Dong; Groves, John T

    2011-10-17

    Chlorine dioxide, an industrially important biocide and bleach, is produced rapidly and efficiently from chlorite ion in the presence of water-soluble, manganese porphyrins and porphyrazines at neutral pH under mild conditions. The electron-deficient manganese(III) tetra-(N,N-dimethyl)imidazolium porphyrin (MnTDMImP), tetra-(N,N-dimethyl)benzimidazolium (MnTDMBImP) porphyrin, and manganese(III) tetra-N-methyl-2,3-pyridinoporphyrazine (MnTM23PyPz) were found to be the most efficient catalysts for this process. The more typical manganese tetra-4-N-methylpyridiumporphyrin (Mn-4-TMPyP) was much less effective. Rates for the best catalysts were in the range of 0.24-32 TO/s with MnTM23PyPz being the fastest. The kinetics of reactions of the various ClO(x) species (e.g., chlorite ion, hypochlorous acid, and chlorine dioxide) with authentic oxomanganese(IV) and dioxomanganese(V)MnTDMImP intermediates were studied by stopped-flow spectroscopy. Rate-limiting oxidation of the manganese(III) catalyst by chlorite ion via oxygen atom transfer is proposed to afford a trans-dioxomanganese(V) intermediate. Both trans-dioxomanganese(V)TDMImP and oxoaqua-manganese(IV)TDMImP oxidize chlorite ion by 1-electron, generating the product chlorine dioxide with bimolecular rate constants of 6.30 × 10(3) M(-1) s(-1) and 3.13 × 10(3) M(-1) s(-1), respectively, at pH 6.8. Chlorine dioxide was able to oxidize manganese(III)TDMImP to oxomanganese(IV) at a similar rate, establishing a redox steady-state equilibrium under turnover conditions. Hypochlorous acid (HOCl) produced during turnover was found to rapidly and reversibly react with manganese(III)TDMImP to give dioxoMn(V)TDMImP and chloride ion. The measured equilibrium constant for this reaction (K(eq) = 2.2 at pH 5.1) afforded a value for the oxoMn(V)/Mn(III) redox couple under catalytic conditions (E' = 1.35 V vs NHE). In subsequent processes, chlorine dioxide reacts with both oxomanganese(V) and oxomanganese(IV)TDMImP to afford chlorate

  9. Dose-dependent transitions in Nrf2-mediated adaptive response and related stress responses to hypochlorous acid in mouse macrophages

    Woods, Courtney G.; Fu Jingqi; Xue Peng; Hou Yongyong; Pluta, Linda J.; Yang Longlong; Zhang Qiang; Thomas, Russell S.; Andersen, Melvin E.; Pi Jingbo

    2009-01-01

    Hypochlorous acid (HOCl) is potentially an important source of cellular oxidative stress. Human HOCl exposure can occur from chlorine gas inhalation or from endogenous sources of HOCl, such as respiratory burst by phagocytes. Transcription factor Nrf2 is a key regulator of cellular redox status and serves as a primary source of defense against oxidative stress. We recently demonstrated that HOCl activates Nrf2-mediated antioxidant response in cultured mouse macrophages in a biphasic manner. In an effort to determine whether Nrf2 pathways overlap with other stress pathways, gene expression profiling was performed in RAW 264.7 macrophages exposed to HOCl using whole genome mouse microarrays. Benchmark dose (BMD) analysis on gene expression data revealed that Nrf2-mediated antioxidant response and protein ubiquitination were the most sensitive biological pathways that were activated in response to low concentrations of HOCl (< 0.35 mM). Genes involved in chromatin architecture maintenance and DNA-dependent transcription were also sensitive to very low doses. Moderate concentrations of HOCl (0.35 to 1.4 mM) caused maximal activation of the Nrf2 pathway and innate immune response genes, such as IL-1β, IL-6, IL-10 and chemokines. At even higher concentrations of HOCl (2.8 to 3.5 mM) there was a loss of Nrf2-target gene expression with increased expression of numerous heat shock and histone cluster genes, AP-1-family genes, cFos and Fra1 and DNA damage-inducible Gadd45 genes. These findings confirm an Nrf2-centric mechanism of action of HOCl in mouse macrophages and provide evidence of interactions between Nrf2, inflammatory, and other stress pathways.

  10. Synergistic Roles of Helicobacter pylori Methionine Sulfoxide Reductase and GroEL in Repairing Oxidant-damaged Catalase*

    Mahawar, Manish; Tran, ViLinh; Sharp, Joshua S.; Maier, Robert J.

    2011-01-01

    Hypochlorous acid (HOCl) produced via the enzyme myeloperoxidase is a major antibacterial oxidant produced by neutrophils, and Met residues are considered primary amino acid targets of HOCl damage via conversion to Met sulfoxide. Met sulfoxide can be repaired back to Met by methionine sulfoxide reductase (Msr). Catalase is an important antioxidant enzyme; we show it constitutes 4–5% of the total Helicobacter pylori protein levels. msr and katA strains were about 14- and 4-fold, respectively, more susceptible than the parent to killing by the neutrophil cell line HL-60 cells. Catalase activity of an msr strain was much more reduced by HOCl exposure than for the parental strain. Treatment of pure catalase with HOCl caused oxidation of specific MS-identified Met residues, as well as structural changes and activity loss depending on the oxidant dose. Treatment of catalase with HOCl at a level to limit structural perturbation (at a catalase/HOCl molar ratio of 1:60) resulted in oxidation of six identified Met residues. Msr repaired these residues in an in vitro reconstituted system, but no enzyme activity could be recovered. However, addition of GroEL to the Msr repair mixture significantly enhanced catalase activity recovery. Neutrophils produce large amounts of HOCl at inflammation sites, and bacterial catalase may be a prime target of the host inflammatory response; at high concentrations of HOCl (1:100), we observed loss of catalase secondary structure, oligomerization, and carbonylation. The same HOCl-sensitive Met residue oxidation targets in catalase were detected using chloramine-T as a milder oxidant. PMID:21460217

  11. A Population-Based Study of Effects of Genetic Loci on Orofacial Clefts

    Moreno Uribe, L M; Fomina, T; Munger, R G

    2017-01-01

    , and MAFB and isolated cleft lip only (CLO) and cleft lip and palate (CLP). Significant associations were observed between isolated CLO and fetal SNPs near TPM1 and NOG1 and between CLP and fetal SNPs at ABCA4-ARHGAP29, THADA, FOXE1, and SPRY2. Overall, effects were similar for isolated CLO and CLP, except...

  12. Caleosins: Ca+2 binding proteins associated with oil-bodies

    Næsted, Henrik; Frandsen, Gitte Inselmann; Jauh, G.Y.

    2000-01-01

    -5). Northern hybridization demonstrated that AtClo2-4 mRNAs levels were low in various tissues, while AtClo1 mRNA levels were high in developing embryos and mature seeds. Analysis of transgenic Arabidopsis plants expressing the GUS reporter under control of the AtClo1 promoter showed strong levels...

  13. Hypochlorite-induced damage to nucleosides

    Hawkins, C L; Davies, Michael Jonathan

    2001-01-01

    HOCl damage to DNA bases. We show that reaction of HOCl with the exocyclic -NH(2) groups of cytidine, adenosine, and guanosine, and the ring NH groups of all bases, yields chloramines (RNHCl/RR'NCl). These are the major initial products. Chloramine decay can be accelerated by UV light and metal ions...... for radical formation is cytidine > adenosine = guanosine > uridine = thymidine. These data are inconsistent with the selectivity of HOCl attack and the stability of the resulting chloramines, but can be rationalized if chlorine transfer between bases is rapid and yields the most stable chloramine...

  14. Composition changes after the "Halloween" solar proton event: the High Energy Particle Precipitation in the Atmosphere (HEPPA model versus MIPAS data intercomparison study

    B. Funke

    2011-09-01

    Full Text Available We have compared composition changes of NO, NO2, H2O2, O3, N2O, HNO3, N2O5, HNO4, ClO, HOCl, and ClONO2 as observed by the Michelson Interferometer for Passive Atmospheric Sounding (MIPAS on Envisat in the aftermath of the "Halloween" solar proton event (SPE in late October 2003 at 25–0.01 hPa in the Northern Hemisphere (40–90° N and simulations performed by the following atmospheric models: the Bremen 2-D model (B2dM and Bremen 3-D Chemical Transport Model (B3dCTM, the Central Aerological Observatory (CAO model, FinROSE, the Hamburg Model of the Neutral and Ionized Atmosphere (HAMMONIA, the Karlsruhe Simulation Model of the Middle Atmosphere (KASIMA, the ECHAM5/MESSy Atmospheric Chemistry (EMAC model, the modeling tool for SOlar Climate Ozone Links studies (SOCOL and SOCOLi, and the Whole Atmosphere Community Climate Model (WACCM4. The large number of participating models allowed for an evaluation of the overall ability of atmospheric models to reproduce observed atmospheric perturbations generated by SPEs, particularly with respect to NOy and ozone changes. We have further assessed the meteorological conditions and their implications for the chemical response to the SPE in both the models and observations by comparing temperature and tracer (CH4 and CO fields.

    Simulated SPE-induced ozone losses agree on average within 5 % with the observations. Simulated NOy enhancements around 1 hPa, however, are typically 30 % higher than indicated by the observations which are likely to be related to deficiencies in the used ionization rates, though other error sources related to the models' atmospheric background state and/or transport schemes cannot be excluded. The analysis of the observed and modeled NOy partitioning in the aftermath of the SPE has demonstrated the need to implement

  15. Atacama perchlorate as an agricultural contaminant in groundwater: Isotopic and chronologic evidence from Long Island, New York

    Böhlke, J.K.; Hatzinger, P.B.; Sturchio, N.C.; Gu, B.; Abbene, I.; Mroczkowski, S.J.

    2009-01-01

    Perchlorate (ClO4-) is a common groundwater constituent with both synthetic and natural sources. A potentially important source of ClO4- is past agricultural application of ClO4--bearing natural NO3- fertilizer imported from the Atacama Desert, Chile, but evidence for this hasbeenlargely circumstantial. Here we report ClO4- stable isotope data (??37Cl, ??18O, and ??17O), along with other supporting chemical and isotopic environmental tracer data, to document groundwater ClO4- contamination sources and history in parts of Long Island, New York. Sampled groundwaters were oxic and ClO4- apparently was not affected by biodegradation within the aquifers. Synthetic ClO4- was indicated by the isotopic method in groundwater near a fireworks disposal site at a former missile base. Atacama ClO4- was indicated in agricultural and urbanizing areas in groundwaters with apparent ages >20 years. In an agricultural area, ClO4- concentrations and ClO4-/NO3- ratios increased withgroundwaterage, possiblybecauseof decreasing application rates of Atacama NO3- fertilizers and/or decreasing ClO4- concentrations in Atacama NO 3- fertilizers in recent years. Because ClO 4-/NO3- ratios of Atacama NO 3- fertilizers imported in the past (???2 ?? 10-3 mol mol-1) were much higher than the ClO 4-/NO3- ratio of recommended drinking-water limits (7 ?? 10-5 mol mol-1 in New York), ClO4- could exceed drinkingwater limits even where NO3- does not, and where Atacama NO3- was only a minor source of N. Groundwater ClO4- with distinctive isotopic composition was a sensitive indicator of past Atacama NO3- fertilizer use on Long Island and may be common in other areas that received NO3- fertilizers from the late 19th century through the 20th century. ?? 2009 American Chemical Society.

  16. Hypochlorite- and hypobromite-mediated radical formation and its role in cell lysis

    Hawkins, C L; Brown, B E; Davies, Michael Jonathan

    2001-01-01

    . In this study it is shown that HOBr induces red blood cell lysis at approximately 10-fold lower concentrations than HOCl, whereas with monocyte (THP1) and macrophage (J774) cells HOCl and HOBr induce lysis at similar concentrations. The role of radical formation during lysis has been investigated by EPR spin...... trapping, and it is shown that reaction of both oxidants with each cell type generates cell-derived radicals. Red blood cells exposed to nonlytic doses of HOCl generate novel nitrogen-centered radicals whose formation is GSH dependent. In contrast, HOBr gives rise to nitrogen-centered, membrane......-derived protein radicals. With lytic doses of either oxidant, protein (probably hemoglobin)-derived, nitrogen-centered radicals are observed. Unlike the red blood cells, treatment of monocytes and macrophages with HOCl gives significant radical formation only under conditions where cell lysis occurs concurrently...

  17. Hypochlorous acid-mediated oxidation of lipid components and antioxidants present in low-density lipoproteins

    Pattison, David I; Hawkins, Clare Louise; Davies, Michael Jonathan

    2003-01-01

    Oxidation of low-density lipoproteins (LDL) is believed to contribute to the increased uptake of LDL by macrophages, which is an early event in atherosclerosis. Hypochlorous acid (HOCl) has been implicated as one of the major oxidants involved in these processes. In a previous study, the rates...... of reaction of HOCl with the reactive sites in proteins were investigated (Pattison, D. I., and Davies, M. J. (2001) Chem. Res. Toxicol. 14, 1453-1464). The work presented here expands on those studies to determine absolute second-order rate constants for the reactions of HOCl with various lipid components...... nitrogen- and carbon-centered radicals. Subsequent reactions of these species may induce oxidation of the LDL lipid component. In contrast, phosphoryl-choline reacted much more slowly (k Reaction of HOCl with 3-pentenoic acid was used as a model of lipid double bonds...

  18. Kinetics and Mechanism of the Oxidation of Coomassie Brilliant Blue ...

    , in aqueous solution by hypochlorite as a function of pH was investigated. While the degradation of dye obeyed pseudo-first-order kinetics, the oxidation of the dye occurred through two competitive reactions facilitated by [OCl–] and [HOCl].

  19. Probing Kill Mechanisms and Tuning Energetic Biocides

    2018-02-01

    could be obtained (Fig. S5). The temperature decaying trace was calculated from a radial heat transfer model by assuming that most heat loss occurred...data- base of exposure vs. effect that can be imported to a CFD formulation so that the combined effects of fluid entrainment, heat transfer and...biological molecules, we propose a model in which HOCl is formed from reaction between Cl2 and water vapor and heat activates the reactions between HOCl and

  20. Potent Antioxidative Activity of Lycopene: A Potential Role in Scavenging Hypochlorous Acid †

    Pennathur, Subramaniam; Maitra, Dhiman; Byun, Jaeman; Sliskovic, Inga; Abdulhamid, Ibrahim; Saed, Ghassan M.; Diamond, Michael P.; Abu-Soud, Husam M.

    2010-01-01

    Lycopene, a carotenoid found in tomatoes, is a proven anti-oxidant that may lower the risk of certain disorders including heart disease and cancer. Hypochlorous acid (HOCl) is an oxidant linked to tissue oxidation in cardiovascular disease and other inflammatory disorders through its ability to modify proteins, deoxyribonucleic acid, ribonucleic acid and lipids. Here we show that lycopene can function as a potent scavenger of HOCl at a wide range of concentrations that span various pathophysi...

  1. Evaluation of sprayed hypochlorous acid solutions for their virucidal activity against avian influenza virus through in vitro experiments

    HAKIM, Hakimullah; THAMMAKARN, Chanathip; SUGURO, Atsushi; ISHIDA, Yuki; KAWAMURA, Akinobu; TAMURA, Miho; SATOH, Keisuke; TSUJIMURA, Misato; HASEGAWA, Tomomi; TAKEHARA, Kazuaki

    2014-01-01

    Hypochlorous acid (HOCl) solutions were evaluated for their virucidal ability against a low pathogenic avian influenza virus (AIV), H7N1. HOCl solutions containing 50, 100 and 200 ppm chlorine (pH 6) or their sprayed solutions (harvested in dishes placed at 1 or 30 cm distance between the spray nozzle and dish) were mixed with the virus with or without organic materials (5% fetal bovine serum: FBS). Under plain diluent conditions (without FBS), harvested solutions of HOCl after spraying could decrease the AIV titer by more than 1,000 times, to an undetectable level (< 2.5 log10TCID50/ml) within 5 sec, with the exception of the 50 ppm solution harvested after spraying at the distance of 30 cm. Under the dirty conditions (in the presence of 5% FBS), they lost their virucidal activity. When HOCl solutions were sprayed directly on the virus on rayon sheets for 10 sec, the solutions of 100 and 200 ppm could inactivate AIV immediately after spraying, while 50 ppm solution required at least 3 min of contact time. In the indirect spray form, after 10 sec of spraying, the lids of the dishes were opened to expose the virus on rayon sheets to HOCl. In this form, the 200 ppm solution inactivated AIV within 10 min of contact, while 50 and 100 ppm could not inactivate it. These data suggest that HOCl can be used in spray form to inactivate AIV at the farm level. PMID:25421399

  2. Evaluation of sprayed hypochlorous acid solutions for their virucidal activity against avian influenza virus through in vitro experiments.

    Hakim, Hakimullah; Thammakarn, Chanathip; Suguro, Atsushi; Ishida, Yuki; Kawamura, Akinobu; Tamura, Miho; Satoh, Keisuke; Tsujimura, Misato; Hasegawa, Tomomi; Takehara, Kazuaki

    2015-02-01

    Hypochlorous acid (HOCl) solutions were evaluated for their virucidal ability against a low pathogenic avian influenza virus (AIV), H7N1. HOCl solutions containing 50, 100 and 200 ppm chlorine (pH 6) or their sprayed solutions (harvested in dishes placed at 1 or 30 cm distance between the spray nozzle and dish) were mixed with the virus with or without organic materials (5% fetal bovine serum: FBS). Under plain diluent conditions (without FBS), harvested solutions of HOCl after spraying could decrease the AIV titer by more than 1,000 times, to an undetectable level (< 2.5 log10TCID50/ml) within 5 sec, with the exception of the 50 ppm solution harvested after spraying at the distance of 30 cm. Under the dirty conditions (in the presence of 5% FBS), they lost their virucidal activity. When HOCl solutions were sprayed directly on the virus on rayon sheets for 10 sec, the solutions of 100 and 200 ppm could inactivate AIV immediately after spraying, while 50 ppm solution required at least 3 min of contact time. In the indirect spray form, after 10 sec of spraying, the lids of the dishes were opened to expose the virus on rayon sheets to HOCl. In this form, the 200 ppm solution inactivated AIV within 10 min of contact, while 50 and 100 ppm could not inactivate it. These data suggest that HOCl can be used in spray form to inactivate AIV at the farm level.

  3. Characterization of a Weak Allele of Zebrafish cloche Mutant

    Ma, Ning; Huang, Zhibin; Chen, Xiaohui; He, Fei; Wang, Kun; Liu, Wei; Zhao, Linfeng; Xu, Xiangmin; Liao, Wangjun; Ruan, Hua; Luo, Shenqiu; Zhang, Wenqing

    2011-01-01

    Hematopoiesis is a complicated and dynamic process about which the molecular mechanisms remain poorly understood. Danio rerio (zebrafish) is an excellent vertebrate system for studying hematopoiesis and developmental mechanisms. In the previous study, we isolated and identified a cloche 172 (clo 172) mutant, a novel allele compared to the original cloche (clo) mutant, through using complementation test and initial mapping. Here, according to whole mount in-situ hybridization, we report that the endothelial cells in clo 172 mutant embryos, although initially developed, failed to form the functional vascular system eventually. In addition, further characterization indicates that the clo 172 mutant exhibited weaker defects instead of completely lost in primitive erythroid cells and definitive hematopoietic cells compared with the clo s5 mutant. In contrast, primitive myeloid cells were totally lost in clo 172 mutant. Furthermore, these reappeared definitive myeloid cells were demonstrated to initiate from the remaining hematopoietic stem cells (HSCs) in clo 172 mutant, confirmed by the dramatic decrease of lyc in clo 172 runx1w84x double mutant. Collectively, the clo 172 mutant is a weak allele compared to the clo s5 mutant, therefore providing a model for studying the early development of hematopoietic and vascular system, as well as an opportunity to further understand the function of the cloche gene. PMID:22132109

  4. Validation of chlorine and oxygen isotope ratio analysis to differentiate perchlorate sources and to document perchlorate biodegradation

    Paul B. Hatzinger,; Böhlke, John Karl; Sturchio, Neil C.; Gu, Baohua

    2013-01-01

    Increased health concerns about perchlorate (ClO4-) during the past decade and subsequent regulatory considerations have generated appreciable interest in source identification. The key objective of the isotopic techniques described in this guidance manual is to provide evidence concerning the origin of ClO4- in soils and groundwater and, more specifically, whether that ClO4- is synthetic or natural. Chlorine and oxygen isotopic analyses of ClO4- provide the primary direct approach whereby different sources of ClO4- can be distinguished from each other. These techniques measure the relative abundances of the stable isotopes of chlorine (37Cl and 35Cl) and oxygen (18O, 17O, and 16O) in ClO4- using isotope-ratio mass spectrometry (IRMS). In addition, the relative abundance of the radioactive chlorine isotope 36Cl is measured using accelerator mass spectrometry (AMS). Taken together, these measurements provide four independent quantities that can be used to distinguish natural and synthetic ClO4- sources, to discriminate different types of natural ClO4-, and to detect ClO4- biodegradation in the environment. Other isotopic, chemical, and geochemical techniques that can be applied in conjunction with isotopic analyses of ClO4- to provide supporting data in forensic studies are also described.

  5. Inactivation of Prions and Amyloid Seeds with Hypochlorous Acid.

    Andrew G Hughson

    2016-09-01

    Full Text Available Hypochlorous acid (HOCl is produced naturally by neutrophils and other cells to kill conventional microbes in vivo. Synthetic preparations containing HOCl can also be effective as microbial disinfectants. Here we have tested whether HOCl can also inactivate prions and other self-propagating protein amyloid seeds. Prions are deadly pathogens that are notoriously difficult to inactivate, and standard microbial disinfection protocols are often inadequate. Recommended treatments for prion decontamination include strongly basic (pH ≥~12 sodium hypochlorite bleach, ≥1 N sodium hydroxide, and/or prolonged autoclaving. These treatments are damaging and/or unsuitable for many clinical, agricultural and environmental applications. We have tested the anti-prion activity of a weakly acidic aqueous formulation of HOCl (BrioHOCl that poses no apparent hazard to either users or many surfaces. For example, BrioHOCl can be applied directly to skin and mucous membranes and has been aerosolized to treat entire rooms without apparent deleterious effects. Here, we demonstrate that immersion in BrioHOCl can inactivate not only a range of target microbes, including spores of Bacillus subtilis, but also prions in tissue suspensions and on stainless steel. Real-time quaking-induced conversion (RT-QuIC assays showed that BrioHOCl treatments eliminated all detectable prion seeding activity of human Creutzfeldt-Jakob disease, bovine spongiform encephalopathy, cervine chronic wasting disease, sheep scrapie and hamster scrapie; these findings indicated reductions of ≥103- to 106-fold. Transgenic mouse bioassays showed that all detectable hamster-adapted scrapie infectivity in brain homogenates or on steel wires was eliminated, representing reductions of ≥~105.75-fold and >104-fold, respectively. Inactivation of RT-QuIC seeding activity correlated with free chlorine concentration and higher order aggregation or destruction of proteins generally, including prion

  6. Manufacturers’ Closed-Loop Orientation for Green Supply Chain Management

    Shumin Liu

    2017-02-01

    Full Text Available The concept of green supply chain management (GSCM is still in its infancy and has been implemented only to a limited extent. Strategic orientation is an important factor affecting its implementation. No reliable and valid strategic orientation construct has been developed for greening a supply chain. This study proposes closed-loop orientation (CLO as the appropriate strategic orientation to implement GSCM practices successfully and develops a valid measurement of CLO. Data collected from 296 Chinese manufacturers were analyzed using the structural equation modeling method to examine the relationships among CLO, GSCM practice and environmental and economic performance. The results show that both CLO and GSCM have positive effects on the environmental performance and economic performance and that CLO positively impacts the level of implementation of GSCM. The results also show that GSCM completely mediates the relationships between CLO and environmental and economic performance.

  7. A dual-emission and large Stokes shift fluorescence probe for real-time discrimination of ROS/RNS and imaging in live cells.

    Guo, Ting; Cui, Lei; Shen, Jiaoning; Wang, Rui; Zhu, Weiping; Xu, Yufang; Qian, Xuhong

    2013-03-04

    A novel dual-emission fluorescence probe has been developed for specific and sensitive detection of hypochlorite (ClO(-)). Upon addition of ClO(-), significant changes in fluorescence emission intensity at two discrete wavelengths were observed. Meanwhile OONO(-) led to only a single-channel fluorescence enhancement. This feature makes it a clear advantage in distinguishing ClO(-), RNS from other ROS.

  8. Natural chlorate in the environment: Application of a new IC-ESI/MS/MS method with a Cl18O3- internal standard

    Rao, Balaji; Hatzinger, Paul B.; Böhlke, John Karl; Sturchio, Neil C.; Andraski, Brian J.; Eckardt, Frank D.; Jackson, W. Andrew

    2010-01-01

    A new ion chromatography electrospray tandem mass spectrometry (IC-ESI/MS/MS) method has been developed for quantification and confirmation of chlorate (ClO3−) in environmental samples. The method involves the electro-chemical generation of isotopically labeled chlorate internal standard (Cl18O3−) using 18O water (H218O). The standard was added to all samples prior to analysis thereby minimizing the matrix effects that are associated with common ions without the need for expensive sample pretreatments. The method detection limit (MDL) for ClO3− was 2 ng L−1 for a 1 mL volume sample injection. The proposed method was successfully applied to analyze ClO3− in difficult environmental samples including soil and plant leachates. The IC-ESI/MS/MS method described here was also compared to established EPA method 317.0 for ClO3− analysis. Samples collected from a variety of environments previously shown to contain natural perchlorate (ClO4−) occurrence were analyzed using the proposed method and ClO3− was found to co-occur with ClO4− at concentrations ranging from 500 mg kg−1 in caliche salt deposits from the Atacama Desert in Chile. Relatively low concentrations of ClO3− in some natural groundwater samples (<0.1 μg L−1) analyzed in this work may indicate lower stability when compared to ClO4− in the subsurface. The high concentrations of ClO3− in caliches and soils (3−6 orders of magnitude greater) as compared to precipitation samples indicate that ClO3−, like ClO4−, may be atmospherically produced and deposited, then concentrated in dry soils, and is possibly a minor component in the biogeochemical cycle of chlorine.

  9. Isovalent and Mixed-Valent Diruthenium Complexes [(acac)(2)Ru-II (.mu.-bpytz)Ru-II(acac)(2)] and [(acac)(2)Ru-II(.mu.-bpytz)Ru-III(acac)(2)](ClO4) (acac= Acetylacetonate and bpytz=3,6-Bis(3,5-dimethylpyrazolyi)-1,2,4,5-tetrazine): Synthesis, Spectroelectrochemical, and EPR Investigation

    Patra, S.; Sarkar, B.; Ghumaan, S.; Fiedler, Jan; Kaim, W.; Lahiri, G. K.

    2004-01-01

    Roč. 43, č. 19 (2004), s. 6108-6113 ISSN 0020-1669 R&D Projects: GA MŠk OC D15.10; GA MŠk OC D14.20 Institutional research plan: CEZ:AV0Z4040901 Keywords : electron-transfer * bridging ligand * ruthenium complexes Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 3.454, year: 2004

  10. Stable isotopic composition of perchlorate and nitrate accumulated in plants: Hydroponic experiments and field data.

    Estrada, Nubia Luz; Böhlke, J K; Sturchio, Neil C; Gu, Baohua; Harvey, Greg; Burkey, Kent O; Grantz, David A; McGrath, Margaret T; Anderson, Todd A; Rao, Balaji; Sevanthi, Ritesh; Hatzinger, Paul B; Jackson, W Andrew

    2017-10-01

    Natural perchlorate (ClO 4 - ) in soil and groundwater exhibits a wide range in stable isotopic compositions (δ 37 Cl, δ 18 O, and Δ 17 O), indicating that ClO 4 - may be formed through more than one pathway and/or undergoes post-depositional isotopic alteration. Plants are known to accumulate ClO 4 - , but little is known about their ability to alter its isotopic composition. We examined the potential for plants to alter the isotopic composition of ClO 4 - in hydroponic and field experiments conducted with snap beans (Phaseolus vulgaris L.). In hydroponic studies, anion ratios indicated that ClO 4 - was transported from solutions into plants similarly to NO 3 - but preferentially to Cl - (4-fold). The ClO 4 - isotopic compositions of initial ClO 4 - reagents, final growth solutions, and aqueous extracts from plant tissues were essentially indistinguishable, indicating no significant isotope effects during ClO 4 - uptake or accumulation. The ClO 4 - isotopic composition of field-grown snap beans was also consistent with that of ClO 4 - in varying proportions from irrigation water and precipitation. NO 3 - uptake had little or no effect on NO 3 - isotopic compositions in hydroponic solutions. However, a large fractionation effect with an apparent ε ( 15 N/ 18 O) ratio of 1.05 was observed between NO 3 - in hydroponic solutions and leaf extracts, consistent with partial NO 3 - reduction during assimilation within plant tissue. We also explored the feasibility of evaluating sources of ClO 4 - in commercial produce, as illustrated by spinach, for which the ClO 4 - isotopic composition was similar to that of indigenous natural ClO 4 - . Our results indicate that some types of plants can accumulate and (presumably) release ClO 4 - to soil and groundwater without altering its isotopic characteristics. Concentrations and isotopic compositions of ClO 4 - and NO 3 - in plants may be useful for determining sources of fertilizers and sources of ClO 4 - in their growth

  11. Inflaming the diseased brain: a role for tainted melanins.

    Jeitner, T M; Kalogiannis, M; Patrick, P A; Gomolin, I; Palaia, T; Ragolia, L; Brand, D; Delikatny, E J

    2015-05-01

    Inflammation plays a crucial role in neurodegenerative diseases, but the irritants responsible for this response remain largely unknown. This report addressed the hypothesis that hypochlorous acid reacts with dopamine to produce melanic precipitates that promote cerebral inflammation. Spectrophotometric studies demonstrated that nM amounts of HOCl and dopamine react within seconds. A second-order rate constant for the reaction of HOCl and dopamine of 2.5 × 10(4)M(-1)s(-1) was obtained by measuring loss of dopaminergic fluorescence due to HOCl. Gravimetric measurements, electron microscopy, elemental analysis, and a novel use of flow cytometry confirmed that the major product of this reaction is a precipitate with an average diameter of 1.5 μm. Flow cytometry was also used to demonstrate the preferential reaction of HOCl with dopamine rather than albumin. Engulfment of the chlorodopamine particulates by phagocytes in vitro caused these cells to release TNFα and die. Intrastriatal administration of 10(6) particles also increased the content of TNFα in the brain and led to a 50% loss of the dopaminergic neurons in the nigra. These studies indicate that HOCl and dopamine react quickly and preferentially with each other to produce particles that promote inflammation and neuronal death in the brain. Copyright © 2015 Elsevier B.V. All rights reserved.

  12. Thermodynamic properties of the neutral and ionic components of the holmium trichloride vapor

    Kuznetsov, A.Yu.; Kudin, L.S.; Pogrebnoj, A.M.; Butman, M.F.; Burdukovskaya, G.G.

    1999-01-01

    The composition of saturated vapor above holmium trichloride in the temperature range of 887 - 1051 K is studied by the method of high-temperature mass spectrometry. Neutral components are presented by molecules of Ho n Cl 3n , n = 1 - 4 charged ones - by Cl - , HoCl 4 - , Ho 2 Cl 7 - ions. Sublimation enthalpies and formation enthalpies of gaseous molecules and ions (298 K): Δ s H Deg (HoCl 3 ) = 284 ±6, Δ s H Deg (Ho 2 Cl 6 ) = 352 ± 20; ΔH Deg (HoCl 3 ) = -722 ± 6; Δ f H Deg (Ho 2 Cl 6 ) = -1661 ± 20; Δ f H Deg (HoCl 4 - ) ≤ - 1191 ± 20, Δ f H Deg (Ho-2Cl 7 - ) ≤ -2127 ± 30 kJ/mol are determined. The value of electron affinity for HoCl 4 radical (A 0 ≥ 3.6 eV) is estimated [ru

  13. Operational Level 2 Data Processing System for the JEM/SMILES

    Takahashi, C.; Mitsuda, C.; Suzuki, M.; Iwata, Y.; Horikawa, M.; Matsumoto, T.; Hayashi, H.; Imai, K.; Sano, T.; Takayanagi, M.

    2009-12-01

    To measure the thermal emission from stratospheric minor species with high sensitivity, the Superconducting Submillimeter-wave Limb-Emission Sounder (SMILES) aboard the Japanese Experiment Module (JEM) of the International Space Station (ISS) carries 4 K cooled Superconductor-Insulator-Superconductor (SIS) mixers. The major feature of the SMILES is its high-sensitive measurement ability with low system noise temperature less than 700 K. The SMILES measures the atmospheric limb emission from stratospheric minor constituents in the submillimeter-wave range, which are band A (624.3-625.5 GHz), band B (625.1-626.3 GHz), and band C (649.1-650.3 GHz). The target species of the SMILES are O3, ClO, HCl, HNO3, HOCl, CH3CN, HO2, BrO, and O3 isotopes (18OOO, 17OOO, and O17OO). Since a complete vertical scan takes 53 s and the orbital period of the ISS is approximately 93 min, approximately 105 scans per orbit give 1630 scans per day. There are 68 individual limb rays in a single scan, and the nominal altitude coverage is from 10 to 60 km. The spatial coverage is on a near global (38S - 65N). It is expected that it will be possible to make measurements within the elongated polar vortex in the Northern Hemisphere. As a part of the ground system for the SMILES, a level 2 data processing system (DPS-L2) designed to use a highly portable software working on a general Linux operating system has been developed. It retrieves the density distributions of the target species (level 2 data) from calibrated spectra (level 1B data) in near-real-time. The level 2 data are converted into the HDF-EOS format and are distributed to users accompanied with the ancillary data on the SMILES status through a web server. To support the analysis of the level 2 data, it is implemented on the Gfdnavi (geophysical fluid data navigator), which is a suite of software that facilitates databasing, analysis, data publication, and visualization of geophysical fluid data. This paper presents the development of

  14. Tunable Far Infrared Studies in Support of Stratospheric Measurements

    Chance, Kelly V.; Park, K.; Nolt, I. G.; Evenson, K. M.

    2001-01-01

    This report summarizes research done under NASA Grant NAG5-4653. The research performed under this grant has been a collaboration between institutions including the Smithsonian Astrophysical Observatory, the National Institute of Standards and Technology, the University of Oregon, and the NASA Langley Research Center. The program has included fully line-resolved measurements of submillimeter and far infrared spectroscopic line parameters (pressure broadening coefficients and their temperature dependences, and line positions) for the analysis of field measurements of stratospheric constituents, far infrared database improvements, and studies for improved satellite measurements of the Earth's atmosphere. This research program is designed to enable the full utilization of spectra obtained in far infrared/submillimeter field measurements, such as FIRS-2, FILOS, IBEX, SLS, EosMLS, and proposed European Space Agency measurements of OH (e.g., PIRAMHYD and SFINX) for the retrieval of accurate stratospheric altitude profiles of key trace gases involved in ozone layer photochemistry. For the analysis of the spectra obtained in the stratosphere from far infrared measurements it is necessary to have accurate values of the molecular parameters (line positions, strengths, and pressure broadening coefficients) for the measured molecules and for possible interfering species. Knowledge of line positions is in increasingly good shape, with some notable exceptions. The increase in position information includes research that has been performed in the present program of research on HO2, H2O, H2O2, O3, HCl, HF, HBr, HI, CO, OH, and ClO. Examples where further line position studies are necessary include hot band and minor isotopomer lines of some of the major trace species (H2O, O3) and normal lines of some triatomic and larger molecules (NO2). Knowledge of strengths is in generally good shape, since most of the lines are from electric dipole transitions whose intensities are well

  15. Is the 'Bromine Explosion' generated from the reaction BrO HO2 alone?

    Behnke, Wolfgang; Zetzsch, Cornelius

    2010-05-01

    We observed bromine explosions (a fast production of atomic Br and Cl under tropospheric conditions) in various smog chamber experiments in Teflon bags at room temperature at a relative humidity of about 80% in the presence of NaCl/NaBr-aerosol, simulated sunlight and ozone (200 - 400 ppb). Time profiles of ozone and hydrocarbons (HCs: n-butane, 2,2-dimethylbutane, tetramethylbutane and toluene, initially about 2 ppb each) were monitored to determine concentrations and source strengths of OH radicals, atomic Cl and Br and the corresponding time profiles of BrCl and Br2 as their photolytic precursors. The number and size of aerosols are measured as well as their chemical composition (Br-, Cl- and oxalic acid). Full records of raw data from the smog chamber runs are available at www.eurochamp.org for potential users. Chemical box model calculations deliver concentrations of various intermediates, such as aldehydes, HO2 and RO2 radicals and the inorganic halogen compounds ClO, BrO, HOCl and HOBr, where HOBr from O3 + Br- => BrO- + O2 in the aqueous/adsorbed phase induces the following gas-phase/ heterogeneous chain reaction Br + O3 => BrO + O2(1) BrO + HO2 => HOBr + O2(2a) HOBr + (Aerosol) => HOBrad(3) Surface-adsorbed HOBr reacts with Br- or Cl- to produce Br2 or BrCl, both of which are released and photolysed. Formation of Br2 should prevail up to Cl-/Br- -ratios of about 104 (Fickert, S., J.W. Adams, J.N. Crowley, J. Geophys. Res., D104, 23719-23727, 1999). A maximum of this ratio is reached about 30 minutes after the beginning and decreases during the next hours - probably by reaction of Br2 with oxalate and absorption of HBr, formed from the reaction of Br with aldehydes. Parallel to chain reaction (1)-(3) a chain reaction replacing Br by Cl seems possible but can not be realized, since the main sink of atomic Cl is its reaction with hydrocarbons - leading to chain termination - in contrast to atomic Br (ratio of rates: kCl[O3]/kCl[HC] ~ 0.1; kBr[O3]/k

  16. 1,5-Diamido-9,10-anthraquinone, a Centrosymmetric Redox-Active Bridge with Two Coupled β-Ketiminato Chelate Functions: Symmetric and Asymmetric Diruthenium Complexes.

    Ansari, Mohd Asif; Mandal, Abhishek; Paretzki, Alexa; Beyer, Katharina; Fiedler, Jan; Kaim, Wolfgang; Lahiri, Goutam Kumar

    2016-06-06

    The dinuclear complexes {(μ-H2L)[Ru(bpy)2]2}(ClO4)2 ([3](ClO4)2), {(μ-H2L)[Ru(pap)2]2}(ClO4)2 ([4](ClO4)2), and the asymmetric [(bpy)2Ru(μ-H2L)Ru(pap)2](ClO4)2 ([5](ClO4)2) were synthesized via the mononuclear species [Ru(H3L)(bpy)2]ClO4 ([1]ClO4) and [Ru(H3L)(pap)2]ClO4 ([2]ClO4), where H4L is the centrosymmetric 1,5-diamino-9,10-anthraquinone, bpy is 2,2'-bipyridine, and pap is 2-phenylazopyridine. Electrochemistry of the structurally characterized [1]ClO4, [2]ClO4, [3](ClO4)2, [4](ClO4)2, and [5](ClO4)2 reveals multistep oxidation and reduction processes, which were analyzed by electron paramagnetic resonance (EPR) of paramagnetic intermediates and by UV-vis-NIR spectro-electrochemistry. With support by time-dependent density functional theory (DFT) calculations the redox processes could be assigned. Significant results include the dimetal/bridging ligand mixed spin distribution in 3(3+) versus largely bridge-centered spin in 4(3+)-a result of the presence of Ru(II)-stabilizig pap coligands. In addition to the metal/ligand alternative for electron transfer and spin location, the dinuclear systems allow for the observation of ligand/ligand and metal/metal site differentiation within the multistep redox series. DFT-supported EPR and NIR absorption spectroscopy of the latter case revealed class II mixed-valence behavior of the oxidized asymmetric system 5(3+) with about equal contributions from a radical bridge formulation. In comparison to the analogues with the deprotonated 1,4-diaminoanthraquinone isomer the centrosymmetric H2L(2-) bridge shows anodically shifted redox potentials and weaker electronic coupling between the chelate sites.

  17. Isotopic tracing of perchlorate in the environment

    Sturchio, Neil C.; Böhlke, John Karl; Gu, Baohua; Hatzinger, Paul B.; Jackson, W. Andrew; Baskaran, Mark

    2012-01-01

    Isotopic measurements can be used for tracing the sources and behavior of environmental contaminants. Perchlorate (ClO 4 − ) has been detected widely in groundwater, soils, fertilizers, plants, milk, and human urine since 1997, when improved analytical methods for analyzing ClO 4 −concentration became available for routine use. Perchlorate ingestion poses a risk to human health because of its interference with thyroidal hormone production. Consequently, methods for isotopic analysis of ClO 4 − have been developed and applied to assist evaluation of the origin and migration of this common contaminant. Isotopic data are now available for stable isotopes of oxygen and chlorine, as well as 36Cl isotopic abundances, in ClO 4 − samples from a variety of natural and synthetic sources. These isotopic data provide a basis for distinguishing sources of ClO 4 − found in the environment, and for understanding the origin of natural ClO 4 − . In addition, the isotope effects of microbial ClO 4 − reduction have been measured in laboratory and field experiments, providing a tool for assessing ClO 4 − attenuation in the environment. Isotopic data have been used successfully in some areas for identifying major sources of ClO 4 − contamination in drinking water supplies. Questions about the origin and global biogeochemical cycle of natural ClO 4 − remain to be addressed; such work would benefit from the development of methods for preparation and isotopic analysis of ClO 4 − in samples with low concentrations and complex matrices.

  18. The Stability of CI02 as a Product of Gas Phase Decontamination Treatments

    Simmons, D. W.

    1994-01-01

    The gas phase decontamination project is investigating the use of chlorine trifluoride (ClF 3 ) to fluorinate nonvolatile uranium deposits to produce uranium hexafluoride (UF 6 ) gas. The potential existence of chlorine dioxide (ClO 2 ) during gas phase decontamination with ClF 3 has been the subject of recent safety discussions. Some of the laboratory data collected during feasibility studies of the gas phase process has been evaluated for the presence of ClO 2 in the product gas stream. The preliminary evidence to date can be summarized as follows: (1) ClO 2 was not detected in the flow loop in the absence of ClF 3 ; (2) ClO 2 was not detected in the static reactors in the absence of both ClF 3 and ClF; and (3) ClO 2 was detected in a static reactor in the absence of all fluorinating gases. The experimental evidence suggests that ClO 2 will not exist in the presence of ClF 3 , ClF, or UF 6 . The data analyzed to date is insufficient to determine the stability of ClO 2 in the presence of ClO 2 F. Thermodynamic calculations of the ClF 3 + H 2 O system support the experimental evidence, and suggest that ClO 2 will not exist in the presence of ClO 2 F. Additional experimental efforts are needed to provide a better understanding of the gas phase ClF 3 treatments and the product gases. However, preliminary evidence to date suggests that ClO 2 should not be present as a product during the normal operations of the gas phase decontamination project

  19. Chlorine dioxide is a size-selective antimicrobial agent.

    Zoltán Noszticzius

    Full Text Available BACKGROUND / AIMS: ClO2, the so-called "ideal biocide", could also be applied as an antiseptic if it was understood why the solution killing microbes rapidly does not cause any harm to humans or to animals. Our aim was to find the source of that selectivity by studying its reaction-diffusion mechanism both theoretically and experimentally. METHODS: ClO2 permeation measurements through protein membranes were performed and the time delay of ClO2 transport due to reaction and diffusion was determined. To calculate ClO2 penetration depths and estimate bacterial killing times, approximate solutions of the reaction-diffusion equation were derived. In these calculations evaporation rates of ClO2 were also measured and taken into account. RESULTS: The rate law of the reaction-diffusion model predicts that the killing time is proportional to the square of the characteristic size (e.g. diameter of a body, thus, small ones will be killed extremely fast. For example, the killing time for a bacterium is on the order of milliseconds in a 300 ppm ClO2 solution. Thus, a few minutes of contact time (limited by the volatility of ClO2 is quite enough to kill all bacteria, but short enough to keep ClO2 penetration into the living tissues of a greater organism safely below 0.1 mm, minimizing cytotoxic effects when applying it as an antiseptic. Additional properties of ClO2, advantageous for an antiseptic, are also discussed. Most importantly, that bacteria are not able to develop resistance against ClO2 as it reacts with biological thiols which play a vital role in all living organisms. CONCLUSION: Selectivity of ClO2 between humans and bacteria is based not on their different biochemistry, but on their different size. We hope initiating clinical applications of this promising local antiseptic.

  20. Absolute rate constants for the reaction of hypochlorous acid with protein side chains and peptide bonds

    Pattison, D I; Davies, Michael Jonathan

    2001-01-01

    , absolute second-order rate constants for the reactions of HOCl with protein side chains, model compounds, and backbone amide (peptide) bonds have been determined at physiological pH values. The reactivity of HOCl with potential reactive sites in proteins is summarized by the series: Met (3.8 x 10(7) M(-1......Hypochlorous acid (HOCl) is a potent oxidant, which is produced in vivo by activated phagocytes. This compound is an important antibacterial agent, but excessive or misplaced production has been implicated in a number of human diseases, including atherosclerosis, arthritis, and some cancers....... Proteins are major targets for this oxidant, and such reaction results in side-chain modification, backbone fragmentation, and cross-linking. Despite a wealth of qualitative data for such reactions, little absolute kinetic data is available to rationalize the in vitro and in vivo data. In this study...

  1. Determination of Optimum Sanitizer Levels for Prevention of Salmonella Cross-Contamination of Mature Round Tomatoes in a Laboratory Model Flume System.

    Sreedharan, Aswathy; Li, You; De, Jaysankar; Gutierrez, Alan; Silverberg, Rachael; Schneider, Keith R

    2017-09-01

    Salmonella has been reported to be involved in several foodborne illness outbreaks, many of which resulted from consumption of raw tomatoes. This research aimed to optimize and evaluate the concentration of free chlorine (hypochlorous acid [HOCl]) used as a sanitizer to prevent cross-contamination of tomatoes inoculated with a cocktail of five rifampin-resistant Salmonella enterica serovars in a laboratory-based model flume system. Organic load, prepared using sterilized Scotts Premium Topsoil, was added in different quantities to the flume wash water to simulate real-world packinghouse conditions. In a typical packinghouse operation utilizing a recirculating flume system, the organic matter washed from tomato surfaces accumulates over time. In this study, different concentrations (0, 25, 50, 75, and 100 ppm) of HOCl were used as sanitizers under three organic load conditions (0, 650, and 1,000 mg/L chemical oxygen demand). Results showed that 100 ppm of HOCl was necessary to prevent Salmonella cross-contamination of uninoculated tomatoes in the model flume system in the presence of organic loading. Also, when treated with 100 ppm of HOCl, Salmonella levels were reduced by >4.5 log CFU per tomato from inoculated tomatoes in the presence of organic load. At 75 ppm of HOCl, Salmonella cross-contamination was prevented, but only in the absence of organic loading. In studies in which plate counts were negative, whole tomato enrichment studies were performed. No cross-contamination of uninoculated tomatoes was recorded when 100 ppm of HOCl was used, even in the presence of high organic load (1,000 mg/L chemical oxygen demand). Although sanitizer application reduces contamination on tomato surfaces, the primary function of sanitizers in the wash water is to prevent cross-contamination.

  2. TrpA1 Regulates Defecation of Food-Borne Pathogens under the Control of the Duox Pathway.

    Eun Jo Du

    2016-01-01

    Full Text Available Pathogen expulsion from the gut is an important defense strategy against infection, but little is known about how interaction between the intestinal microbiome and host immunity modulates defecation. In Drosophila melanogaster, dual oxidase (Duox kills pathogenic microbes by generating the microbicidal reactive oxygen species (ROS, hypochlorous acid (HOCl in response to bacterially excreted uracil. The physiological function of enzymatically generated HOCl in the gut is, however, unknown aside from its anti-microbial activity. Drosophila TRPA1 is an evolutionarily conserved receptor for reactive chemicals like HOCl, but a role for this molecule in mediating responses to gut microbial content has not been described. Here we identify a molecular mechanism through which bacteria-produced uracil facilitates pathogen-clearing defecation. Ingestion of uracil increases defecation frequency, requiring the Duox pathway and TrpA1. The TrpA1(A transcript spliced with exon10b (TrpA1(A10b that is present in a subset of midgut enteroendocrine cells (EECs is critical for uracil-dependent defecation. TRPA1(A10b heterologously expressed in Xenopus oocytes is an excellent HOCl receptor characterized with elevated sensitivity and fast activation kinetics of macroscopic HOCl-evoked currents compared to those of the alternative TRPA1(A10a isoform. Consistent with TrpA1's role in defecation, uracil-excreting Erwinia carotovora showed higher persistence in TrpA1-deficient guts. Taken together, our results propose that the uracil/Duox pathway promotes bacteria expulsion from the gut through the HOCl-sensitive receptor, TRPA1(A10b, thereby minimizing the chances that bacteria adapt to survive host defense systems.

  3. Formation of chlorinated breakdown products during degradation of sunscreen agent, 2-ethylhexyl-4-methoxycinnamate in the presence of sodium hypochlorite.

    Gackowska, Alicja; Przybyłek, Maciej; Studziński, Waldemar; Gaca, Jerzy

    2016-01-01

    In this study, a new degradation path of sunscreen active ingredient, 2-ethylhexyl-4-methoxycinnamate (EHMC) and 4-methoxycinnamic acid (MCA) in the presence of sodium hypochlorite (NaOCl), was discussed. The reaction products were detected using gas chromatography-mass spectrometry (GC-MS). Since HOCl treatment leads to more polar products than EHMC, application of polar extracting agents, dichloromethane and ethyl acetate/n-hexane mixture, gave better results in terms of chlorinated breakdown products identification than n-hexane. Reaction of EHMC with HOCl lead to the formation of C=C bridge cleavage products such as 2-ethylhexyl chloroacetate, 1-chloro-4-methoxybenzene, 1,3-dichloro-2-methoxybenzene, and 3-chloro-4-methoxybenzaldehyde. High reactivity of C=C bond attached to benzene ring is also characteristic for MCA, since it can be converted in the presence of HOCl to 2,4-dichlorophenole, 2,6-dichloro-1,4-benzoquinone, 1,3-dichloro-2-methoxybenzene, 1,2,4-trichloro-3-methoxybenzene, 2,4,6-trichlorophenole, and 3,5-dichloro-2-hydroxyacetophenone. Surprisingly, in case of EHMC/HOCl/UV, much less breakdown products were formed compared to non-UV radiation treatment. In order to describe the nature of EHMC and MCA degradation, local reactivity analysis based on the density functional theory (DFT) was performed. Fukui function values showed that electrophilic attack of HOCl to the C=C bridge in EHMC and MCA is highly favorable (even more preferable than phenyl ring chlorination). This suggests that HOCl electrophilic addition is probably the initial step of EHMC degradation.

  4. New packaging design for fresh produce with effective distribution of antimicrobial gaseous chlorine dioxide

    In the last decade, the potential use of chlorine dioxide (ClO2) as an antimicrobial agent for vapor-phase decontamination to extend the shelf-life of fresh produce has been widely studied. Most of the works focused on the dose of gaseous ClO2 for particular food product and/or specific microorganis...

  5. Influences of packaging design on antimicrobial effects of gaseous chlorine dioxide

    Chlorine dioxide (ClO2) gas is an effective surface disinfectant, for it has the ability to reach and inactivate bacterial cells in biofilms which are attached to inaccessible sites on produce surfaces. One of the most promising applications of gaseous ClO2 is to be included in the headspace of foo...

  6. A mitochondrial targeted two-photon iridium(III) phosphorescent probe for selective detection of hypochlorite in live cells and in vivo.

    Li, Guanying; Lin, Qian; Sun, Lingli; Feng, Changsheng; Zhang, Pingyu; Yu, Bole; Chen, Yu; Wen, Ya; Wang, Hui; Ji, Liangnian; Chao, Hui

    2015-01-01

    Endogenous hypochlorite ion (ClO(-)) is a highly reactive oxygen species (ROS) that is produced from hydrogen peroxide and chloride ions catalyzed by myeloperoxidase (MPO). And mitochondrion is one of the major sources of ROS including ClO(-). In the present work, a two-photon phosphorescent probe for ClO(-) in mitochondria was developed. An iridium(III) complex bearing a diaminomaleonitrile group as ClO(-) reactive moiety specifically responded to ClO(-) over other ions and ROSs. When the probe was reacted with ClO(-) to form an oxidized carboxylate product, a significant enhancement in phosphorescence intensity was observed under one-photon (402 nm) and two-photon (750 nm) excitation, with a two-photon absorption cross-section of 78.1 GM at 750 nm. More importantly, ICP-MS results and cellular images co-stained with Mito-tracker Green demonstrated that this probe possessed high specificity for mitochondria. This probe was applied in the one- and two-photon imaging of ClO(-) in vitro and in vivo. The results suggested endotoxin lipopolysaccharide (LPS) induced ClO(-) mostly generated in the liver of zebrafish. Copyright © 2015 Elsevier Ltd. All rights reserved.

  7. Relationship between field resistance to Phytophthora ramorum and constitutive phenolic chemistry of coast live oak

    A.M. Nagle; B.A. McPherson; D.L. Wood; M. Garbelotto; A.O. Conrad; S. Opiyo; P. Bonello

    2012-01-01

    Sudden oak death, caused by Phytophthora ramorum, has resulted in high levels of coast live oak (Quercus agrifolia Nee (CLO) mortality. However, some CLO survive in areas with high disease pressure and may thus be resistant. We tested the hypothesis that such field resistant trees contain constitutively higher levels of...

  8. Bioremediation of the neonicotinoid insecticide clothianidin by the white-rot fungus Phanerochaete sordida.

    Mori, Toshio; Wang, Jianqiao; Tanaka, Yusuke; Nagai, Kaoru; Kawagishi, Hirokazu; Hirai, Hirofumi

    2017-01-05

    Clothianidin (CLO) is a member of the neonicotinoid pesticides, which have been widely used worldwide over the last two decades. However, its toxicity for bees and neurological toxicity for humans are urgent problems. Here, the degradation of CLO by the white-rot fungus Phanerochaete sordida was examined in nitrogen-limited liquid medium. After incubation for 20days at 30°C, 37% of CLO was degraded in the cultures. High-resolution ESI-MS and NMR analyses of the culture supernatant identified N-(2-chlorothiazol-5-yl-methyl)-N'-methylurea (TZMU) as a metabolite of CLO degradation. The addition of cytochrome P450 inhibitors to the culture medium markedly reduced the degradation of CLO by P. sordida. And manganese peroxidase, a major ligninolytic enzyme secreted by this fungus, were not carried out CLO degradation. The effects of CLO and TZMU on the viability of the neuronal cell line Neuro2a demonstrated that P. sordida effectively degrades CLO into a metabolite that lacks neurotoxicity. Copyright © 2016 Elsevier B.V. All rights reserved.

  9. Enzymes and Inhibitors in Neonicotinoid Insecticide Metabolism

    Shi, Xueyan; Dick, Ryan A.; Ford, Kevin A.; Casida, John E.

    2009-01-01

    Neonicotinoid insecticide metabolism involves considerable substrate specificity and regioselectivity of the relevant CYP450, aldehyde oxidase, and phase II enzymes. Human CYP450 recombinant enzymes carry out the following conversions: CYP3A4, 2C19 and 2B6 for thiamethoxam (TMX) to clothianidin (CLO); 3A4, 2C19 and 2A6 for CLO to desmethyl-CLO; 2C19 for TMX to desmethyl-TMX. Human liver aldehyde oxidase reduces the nitro substituent of CLO to nitroso much more rapidly than that of TMX. Imidacloprid (IMI), CLO and several of their metabolites do not give detectable N-glucuronides but 5-hydroxy-IMI, 4,5-diol-IMI and 4-hydroxy-thiacloprid are converted to O-glucuronides in vitro with mouse liver microsomes and UDP-glucuronic acid or in vivo in mice. Mouse liver cytosol with S-adenosylmethionine converts desmethyl-CLO to CLO but not desmethyl-TMX to TMX. Two organophosphorus CYP450 inhibitors partially block IMI, thiacloprid and CLO metabolism in vivo in mice, elevating the brain and liver levels of the parent compounds while reducing amounts of the hydroxylated metabolites. PMID:19391582

  10. Moderate effects of apple juice consumption on obesity-related markers in obese men: impact of diet-gene interaction on body fat content.

    Barth, Stephan W; Koch, Tatiana C L; Watzl, Bernhard; Dietrich, Helmut; Will, Frank; Bub, Achim

    2012-10-01

    The effect of polyphenol-rich cloudy apple juice (CloA) consumption on plasma parameters related to the obesity phenotype and potential effects of interactions between CloA and allelic variants in obesity candidate genes were assessed in obese men. In this controlled, randomized, and parallel study, n = 68, non-smoking, non-diabetic men with a BMI ≥27 kg/m(2) received 750 mL/day CloA (802.5 mg polyphenols) or 750 mL/day control beverage (CB, isocaloric equivalent to CloA) for 4 weeks. Further, study participants were genotyped for single-nucleotide polymorphisms in PPARγ (rs1801282), UCP3 (rs1800849), IL-6 (rs1800795), FABP2 (rs1799883), INSIG2 (rs7566605), and PGC1 (rs8192678) genes. At the beginning and at the end of intervention plasma lipids, distinct adipokines and cytokines as well as anthropometric parameters were determined. CloA compared to CB had no significant effect on plasma lipids, plasma adipokine and cytokine levels, BMI, and waist circumference. However, CloA consumption significantly reduced percent body fat compared to CB (∆ % body fat: CloA: -1.0 ± 1.3 vs. CB: -0.2 ± 0.9, p diet-gene interaction might be a first indication for the impact of individual genetic background on CloA-mediated bioactivity on obesity-associated comorbidities.

  11. Cloud-point extraction and spectrophotometric determination of ...

    Aneco-friendly, simple and very sensitive method was developed for preconcentration and determination of clonazepam (CLO) in pharmaceutical dosage forms using cloud point extraction (CPE) technique. The method is based on cloud point extraction of product from oxidative coupling between reduced CLO and ...

  12. Chlorine dioxide content of chlorine obtained by electrolysis of sodium chloride

    Westen, P.G.; Hoogland, J.G.

    1967-01-01

    Cl obtained by discharge of Cl- at a graphite anode contains a small amt. of ClO2 if chlorate is present in the electrolyte. Measurements of the rates of the reactions involved show that this ClO2 is not formed by a chem. reaction in the bulk of the electrolyte nor in the diffusion layer. Whether it

  13. Chemical disinfection of combined sewer overflows

    Chhetri, Ravi Kumar

    of the residual disinfectants PFA, PAA and chlorine dioxide (ClO2), and their degradation products hydrogen peroxide and chlorite, in relation to organisms in the aquatic ecosystem was studied. With the help of ecotoxicity data, a preliminary environmental risk assessment of PFA, PAA and ClO2 for CSO disinfection...

  14. Effect of ionic environment on the inactivation of poliovirus in water by chlorine.

    Sharp, D G; Young, D C; Floyd, R; Johnson, J D

    1980-01-01

    The rate of inactivation of poliovirus in water by chlorine is strongly influenced by the pH, which in turn influences the relative amounts of HOCl and OCl- that are present and acting on the virus in the region of pH 6 to 10. The distribution of HOCl and OCl- is influenced to a lesser extent by the addition of NaCl. The major part of the sharp increase in disinfection rate seen with this salt is thought to be due to its effect on the virus itself resulting in an increased chlorine sensitivit...

  15. Oxidative stress induced by chlorine dioxide as an insecticidal factor to the Indian meal moth, Plodia interpunctella.

    Kumar, Sunil; Park, Jiyeong; Kim, Eunseong; Na, Jahyun; Chun, Yong Shik; Kwon, Hyeok; Kim, Wook; Kim, Yonggyun

    2015-10-01

    A novel fumigant, chlorine dioxide (ClO2) is a commercial bleaching and disinfection agent. Recent study indicates its insecticidal activity. However, its mode of action to kill insects is yet to be understood. This study set up a hypothesis that an oxidative stress induced by ClO2 is a main factor to kill insects. The Indian meal moth, Plodia interpunctella, is a lepidopteran insect pest infesting various stored grains. Larvae of P. interpunctella were highly susceptible to ClO2 gas, which exhibited an acute toxicity. Physiological damages by ClO2 were observed in hemocytes. At high doses, the larvae of P. interpunctella suffered significant reduction of total hemocytes. At low doses, ClO2 impaired hemocyte behaviors. The cytotoxicity of ClO2 was further analyzed using two insect cell lines, where Sf9 cells were more susceptible to ClO2 than High Five cells. The cells treated with ClO2 produced reactive oxygen species (ROS). The produced ROS amounts increased with an increase of the treated ClO2 amount. However, the addition of an antioxidant, vitamin E, significantly attenuated the cytotoxicity of ClO2 in a dose-dependent manner. To support the oxidative stress induced by ClO2, two antioxidant genes (superoxide dismutase (SOD) and thioredoxin-peroxidase (Tpx)) were identified from P. interpunctella EST library using ortholog sequences of Bombyx mori. Both SOD and Tpx were expressed in larvae of P. interpunctella especially under oxidative stress induced by bacterial challenge. Exposure to ClO2 gas significantly induced the gene expression of both SOD and Tpx. RNA interference of SOD or Tpx using specific double stranded RNAs significantly enhanced the lethality of P. interpunctella to ClO2 gas treatment as well as to the bacterial challenge. These results suggest that ClO2 induces the production of insecticidal ROS, which results in a fatal oxidative stress in P. interpunctella. Copyright © 2015 Elsevier Inc. All rights reserved.

  16. Infrared line intensities of chlorine monoxide

    Kostiuk, T.; Faris, J. L.; Mumma, M. J.; Deming, D.; Hillman, J. J.

    1986-01-01

    Absolute infrared line intensities of several ClO lines in the rotational-vibrational (1-0) band were measured using infrared heterodyne spectroscopy near 12 microns. A measurement technique using combined ultraviolet absorption and infrared line measurements near 9.5 microns and 12 microns permitted an accurate determination of the column densities of O3 and ClO in the absorption cell and thus improved ClO line intensities. Results indicate ClO line and band intensities approximately 2.4 times lower than previous experimental results. Effects of possible failure of local thermodynamic equilibrium conditions in the absorption cell and the implication of the results for stratospheric ClO measurements in the infrared are discussed.

  17. Clotrimazole nanoparticle gel for mucosal administration

    Esposito, Elisabetta, E-mail: ese@unife.it [Department of Pharmaceutical Sciences, University of Ferrara, I-44121 Ferrara (Italy); Ravani, Laura [Department of Pharmaceutical Sciences, University of Ferrara, I-44121 Ferrara (Italy); Contado, Catia [Department of Chemistry, University of Ferrara, Ferrara (Italy); Costenaro, Andrea [Department of Pharmaceutical Sciences, University of Ferrara, I-44121 Ferrara (Italy); Drechsler, Markus [Macromolecular Chemistry II, University of Bayreuth (Germany); Rossi, Damiano [Department of Biology and Evolution, LT Terra and Acqua Tech UR7, University of Ferrara, Ferrara (Italy); Menegatti, Enea [Department of Pharmaceutical Sciences, University of Ferrara, I-44121 Ferrara (Italy); Grandini, Alessandro [Department of Biology and Evolution, LT Terra and Acqua Tech UR7, University of Ferrara, Ferrara (Italy); Cortesi, Rita [Department of Pharmaceutical Sciences, University of Ferrara, I-44121 Ferrara (Italy)

    2013-01-01

    In this study a formulation suitable to be applied on oral and/or vaginal mucosa has been developed for the treatment of fungal infections. The aim of the research is a comparison between clotrimazole (CLO) containing semisolid formulations based on monoolein aqueous dispersion (MAD) or nanostructured lipid carrier (NLC). MAD and NLC have been characterized in terms of morphology and dimensional distribution by cryogenic Transmission Electron Microscopy (cryo-TEM) and Photon Correlation Spectroscopy (PCS). CLO was encapsulated with high entrapment efficiency both in MAD and in NLC, according to Sedimentation Field Flow Fractionation (SdFFF) combined with HPLC. CLO recovery in MAD and NLC has been investigated by time. In order to obtain formulations with suitable viscosity for mucosal application, MAD was diluted with a carbomer gel, while NLC was directly viscosized by the addition of poloxamer 407 in the dispersion. The rheological properties of MAD and NLC after viscosizing have been investigated. Franz cell has been employed to study CLO diffusion from the different vehicles, evidencing diffusion rates from MAD and NLC superimposable to that obtained using Canesten{sup Registered-Sign }. An anticandidal activity study demonstrated that both CLO-MAD and CLO-NLC were more active against Candida albicans with respect to the pure drug. Highlights: Black-Right-Pointing-Pointer Comparison between monoolein aqueous dispersion (MAD) and nanostructured lipid carrier (NLC). Black-Right-Pointing-Pointer Clotrimazole (CLO) encapsulated with high entrapment efficiency both in MAD and in NLC. Black-Right-Pointing-Pointer The solid matrix of NLC controls CLO degradation better than MAD. Black-Right-Pointing-Pointer CLO containing MAD and NLC exhibits a higher anticandidal activity than the free drug. Black-Right-Pointing-Pointer Simple production of CLO-NLC based poloxamer gel, suitable for industry scaling up.

  18. Unique and common metabolites of thiamethoxam, clothianidin, and dinotefuran in mice.

    Ford, Kevin A; Casida, John E

    2006-11-01

    The established neonicotinoid insecticides have chloropyridylmethyl (imidacloprid, thiacloprid, acetamiprid, and nitenpyram), chlorothiazolylmethyl (thiamethoxam or TMX and clothianidin or CLO) or tetrahydrofuranylmethyl (dinotefuran or DIN) substituents. We recently reported the metabolic fate of the chloropyridylmethyl neonicotinoids in mice as the first half of a comparative study that now considers the chlorothiazolylmethyl and tetrahydrofuranylmethyl analogues. TMX, CLO, two desmethyl derivatives (TMX-dm and CLO-dm), and DIN were administered ip to mice at 20 mg/kg for characterization of metabolites and pharmacokinetic analysis of brain, liver, plasma, and urine by HPLC/DAD and LC/MSD. Each compound is excreted 19-55% unmetabolized in urine within 24 h, and tissue residues are largely dissipated by 4 h. Thirty-seven metabolites of TMX, TMX-dm, CLO, and CLO-dm are identified by comparison with synthetic standards or their structures are proposed by molecular weights and 35Cl:37Cl ratios often supplemented by previous reports or sequence studies in which intermediates are readministered. A facile reaction sequence involves TMX --> TMX-dm or CLO --> CLO-dm. CLO-dm, reported to be a contributor to TMX hepatocarcinogenesis in mice, is unexpectedly remethylated in part to CLO in brain. The nitrosoguanidine, aminoguanidine, and urea derivatives of the parent compounds are detected in the tissues and methylnitroguanidine, methylguanidine, and nitroguanidine in the urine. Chlorothiazolecarboxaldehyde from oxidative cleavage of TMX and CLO is quite persistent in brain, liver, and particularly plasma compared with chloropyridinecarboxaldehyde and tetrahydrofurancarboxaldehyde from the other neonicotinoids. Chlorothiazolecarboxylic acid is conjugated with glycine or glucuronic acid or converted to S-methyl and mercapturate derivatives. DIN metabolism involves nitro reduction, N-demethylation, N-methylene hydroxylation, and amine cleavage, and tetrahydrofuranylmethyl

  19. Clotrimazole nanoparticle gel for mucosal administration

    Esposito, Elisabetta; Ravani, Laura; Contado, Catia; Costenaro, Andrea; Drechsler, Markus; Rossi, Damiano; Menegatti, Enea; Grandini, Alessandro; Cortesi, Rita

    2013-01-01

    In this study a formulation suitable to be applied on oral and/or vaginal mucosa has been developed for the treatment of fungal infections. The aim of the research is a comparison between clotrimazole (CLO) containing semisolid formulations based on monoolein aqueous dispersion (MAD) or nanostructured lipid carrier (NLC). MAD and NLC have been characterized in terms of morphology and dimensional distribution by cryogenic Transmission Electron Microscopy (cryo-TEM) and Photon Correlation Spectroscopy (PCS). CLO was encapsulated with high entrapment efficiency both in MAD and in NLC, according to Sedimentation Field Flow Fractionation (SdFFF) combined with HPLC. CLO recovery in MAD and NLC has been investigated by time. In order to obtain formulations with suitable viscosity for mucosal application, MAD was diluted with a carbomer gel, while NLC was directly viscosized by the addition of poloxamer 407 in the dispersion. The rheological properties of MAD and NLC after viscosizing have been investigated. Franz cell has been employed to study CLO diffusion from the different vehicles, evidencing diffusion rates from MAD and NLC superimposable to that obtained using Canesten ® . An anticandidal activity study demonstrated that both CLO-MAD and CLO-NLC were more active against Candida albicans with respect to the pure drug. Highlights: ► Comparison between monoolein aqueous dispersion (MAD) and nanostructured lipid carrier (NLC). ► Clotrimazole (CLO) encapsulated with high entrapment efficiency both in MAD and in NLC. ► The solid matrix of NLC controls CLO degradation better than MAD. ► CLO containing MAD and NLC exhibits a higher anticandidal activity than the free drug. ► Simple production of CLO-NLC based poloxamer gel, suitable for industry scaling up

  20. Environmental Chemistry Update

    1995-08-01

    the OH/HOO reaction chain is responsible for 30-50% of the ozone loss in the low stratosphere. Chains involving nitrogen radicals are less important in this region than previously thought. Almost one-third of the loss is due to cycles involving halogens, including that initiated by collision of ClO with Br. Equally important is the following cycle, reminiscent of the "dimer" mechanism that operates in ozone holes, for the 2O3 --> 3O2 process. Cl + O3 --> ClO + O2 OH + O3 --> HOO + O2 ClO + HOO --> HOCl + O2 HOCl + sunlight --> OH + Cl The same mechanism with bromine replacing chlorine is also important. The greatest removal rate for ozone at these latitudes should occur in spring and fall, when ozone production is minimal. Although the sunlight then is not sufficient to dissociate much O2, it is adequate to drive the free radical processes (7). The feasibility of A. Y. Wong's scheme to reduce stratospheric ozone destruction due to reactions involving chlorine has been questioned. The scheme involves the introduction of electrons into the stratosphere, which would allow the conversion of chlorine to chloride ion and its hydrates and potentially the subsequent removal of the chloride ions. A. A. Viggiano and colleagues have noted that chloride ions react quickly after their formation (to reform chlorine radicals) and never amount to more than a tiny fraction of the anions present. The dominant ions are NO3- and CO3-. Viggiano et al. also note the very large energy requirements for the electron production and for removal of the 2.4 X 10^9 kg of chlorine from the stratosphere (8). Pesticides and DioxinGreat LakesThe herbicide atrazine and its metabolite, in which the nitrogen-based ethyl group is removed, were found in all 490 samples of water from the Great Lakes in a 1990-1992 study. Highest concentrations of atrazine were found in Lakes Ontario and Erie (70-110 parts per trillion (ppt)), with lower levels (20-35 ppt) in Lakes Huron and Michigan. It was estimated that

  1. Enhanced bromate formation during chlorination of bromide-containing waters in the presence of CuO: Catalytic disproportionation of hypobromous acid

    Liu, Chao; von Gunten, Urs; Croue, Jean-Philippe

    2012-01-01

    of bromide-containing waters in the presence of cupric oxide (CuO). CuO was effective to catalyze hypochlorous acid (HOCl) or hypobromous acid (HOBr) decay (e.g., at least 104 times enhancement for HOBr at pH 8.6 by 0.2 g L-1 CuO). Significant halate

  2. Levels of inflammation and oxidative stress, and a role for taurine in dystropathology of the Golden Retriever Muscular Dystrophy dog model for Duchenne Muscular Dystrophy

    Jessica R. Terrill

    2016-10-01

    Full Text Available Duchenne Muscular Dystrophy (DMD is a fatal skeletal muscle wasting disease presenting with excessive myofibre necrosis and increased inflammation and oxidative stress. In the mdx mouse model of DMD, homeostasis of the amino acid taurine is altered, and taurine administration drastically decreases muscle necrosis, dystropathology, inflammation and protein thiol oxidation. Since the severe pathology of the Golden Retriever Muscular Dystrophy (GRMD dog model more closely resembles the human DMD condition, we aimed to assess the generation of oxidants by inflammatory cells and taurine metabolism in this species. In muscles of 8 month GRMD dogs there was an increase in the content of neutrophils and macrophages, and an associated increase in elevated myeloperoxidase, a protein secreted by neutrophils that catalyses production of the highly reactive hypochlorous acid (HOCl. There was also increased chlorination of tyrosines, a marker of HOCl generation, increased thiol oxidation of many proteins and irreversible oxidative protein damage. Taurine, which functions as an antioxidant by trapping HOCl, was reduced in GRMD plasma; however taurine was increased in GRMD muscle tissue, potentially due to increased muscle taurine transport and synthesis. These data indicate a role for HOCl generated by neutrophils in the severe dystropathology of GRMD dogs, which may be exacerbated by decreased availability of taurine in the blood. These novel data support continued research into the precise roles of oxidative stress and taurine in DMD and emphasise the value of the GRMD dogs as a suitable pre-clinical model for testing taurine as a therapeutic intervention for DMD boys.

  3. Peracetic acid oxidation of saline waters in the absence and presence of H ₂O ₂: secondary oxidant and disinfection byproduct formation.

    Shah, Amisha D; Liu, Zheng-Qian; Salhi, Elisabeth; Höfer, Thomas; von Gunten, Urs

    2015-02-03

    Peracetic acid (PAA) is a disinfectant considered for use in ballast water treatment, but its chemical behavior in such systems (i.e., saline waters) is largely unknown. In this study, the reactivity of PAA with halide ions (chloride and bromide) to form secondary oxidants (HOCl, HOBr) was investigated. For the PAA-chloride and PAA-bromide reactions, second-order rate constants of (1.47 ± 0.58) × 10(-5) and 0.24 ± 0.02 M(-1) s(-1) were determined for the formation of HOCl or HOBr, respectively. Hydrogen peroxide (H2O2), which is always present in PAA solutions, reduced HOCl or HOBr to chloride or bromide, respectively. As a consequence, in PAA-treated solutions with [H2O2] > [PAA], the HOBr (HOCl) steady-state concentrations were low with a limited formation of brominated (chlorinated) disinfection byproducts (DBPs). HOI (formed from the PAA-iodide reaction) affected this process because it can react with H2O2 back to iodide. H2O2 is thus consumed in a catalytic cycle and leads to less efficient HOBr scavenging at even low iodide concentrations (acid (MBAA), dibromoacetic acid (DBAA), and tribromoacetic acid (TBAA) formed at up to 260, 106, 230, and 89 μg/L, respectively for doses of 2 mM (ca. 150 mg/L) PAA and [H2O2] acid concentrations.

  4. Spectrophotometric study of holmium complexation in KOH solutions at 25 Deg C

    Stepanchikova, S.A.; Bitejkina, R.P.

    2006-01-01

    Complexation of Ho 3+ in solutions of HoCl 3 and KOH at 25 Deg C is studied by indicator spectrophotometric method. Within the range of pH 9.25-10.10 and μ≤4 x 10 -4 stability constants of Ho 3+ hydroxocomplexes are measured and are extrapolated on zero ion strength [ru

  5. TYPE A VIRAL HEPATITIS: EFFECT OF CHLORINE ON INFECTIVITY

    The objective of this study was to determine the effect of (HOCl) treatment on the infectivity of hepatitis A virus (HAV). Prodromal chimpanzee feces, shown to induce hepatitis in marmosets (Saginus sp.), was clarified (JA 20/8K/30 min/5C), the virus precipitated with 7% PEG 6000...

  6. Role of Myeloperoxidase Oxidants in the Modulation of Cellular Lysosomal Enzyme Function

    Ismael, Fahd O; Barrett, Tessa J; Sheipouri, Diba

    2016-01-01

    with the development of atherosclerosis. In this study, we examined the effect of HOCl, HOSCN and LDL pre-treated with these oxidants on the function of lysosomal enzymes responsible for protein catabolism and lipid hydrolysis in murine macrophage-like J774A.1 cells. In each case, the cells were exposed to HOCl...... or HOSCN or LDL pre-treated with these oxidants. Lysosomal cathepsin (B, L and D) and acid lipase activities were quantified, with cathepsin and LAMP-1 protein levels determined by Western blotting. Exposure of J774A.1 cells to HOCl or HOSCN resulted in a significant decrease in the activity of the Cys......-dependent cathepsins B and L, but not the Asp-dependent cathepsin D. Cathepsins B and L were also inhibited in macrophages exposed to HOSCN-modified, and to a lesser extent, HOCl-modified LDL. No change was seen in cathepsin D activity or the expression of the cathepsin proteins or lysosomal marker protein LAMP-1...

  7. Kinetic studies on the reaction between dicyanocobinamide and hypochlorous acid.

    Dhiman Maitra

    Full Text Available Hypochlorous acid (HOCl is a potent oxidant generated by myeloperoxidase (MPO, which is an abundant enzyme used for defense against microbes. We examined the potential role of HOCl in corrin ring destruction and subsequent formation of cyanogen chloride (CNCl from dicyanocobinamide ((CN2-Cbi. Stopped-flow analysis revealed that the reaction consists of at least three observable steps, including at least two sequential transient intermediates prior to corrin ring destruction. The first two steps were attributed to sequential replacement of the two cyanide ligands with hypochlorite, while the third step was the destruction of the corrin ring. The formation of (OCl(CN-Cbi and its conversion to (OCl2-Cbi was fitted to a first order rate equation with second order rate constants of 0.002 and 0.0002 µM(-1 s(-1, respectively. The significantly lower rate of the second step compared to the first suggests that the replacement of the first cyanide molecule by hypochlorite causes an alteration in the ligand trans effects changing the affinity and/or accessibility of Co toward hypochlorite. Plots of the apparent rate constants as a function of HOCl concentration for all the three steps were linear with Y-intercepts close to zero, indicating that HOCl binds in an irreversible one-step mechanism. Collectively, these results illustrate functional differences in the corrin ring environments toward binding of diatomic ligands.

  8. Chlorinative stress in age-related diseases: a literature review.

    Casciaro, Marco; Di Salvo, Eleonora; Pace, Elisabetta; Ventura-Spagnolo, Elvira; Navarra, Michele; Gangemi, Sebastiano

    2017-01-01

    Aging is an agglomerate of biological long-lasting processes that result being inevitable. Main actors in this scenario are both long-term inflammation and oxidative stress. It has been proved that oxidative stress induce alteration in proteins and this fact itself is critically important in the pathophysiological mechanisms leading to diseases typical of aging. Among reactive species, chlorine ones such as hypochlorous acid (HOCl) are cytotoxic oxidants produced by activated neutrophils during chronic inflammation processes. HOCl can also cause damages by reacting with biological molecules. HOCl is generated by myeloperoxidase (MPO) and augmented serum levels of MPO have been described in acute and chronic inflammatory conditions in cardiovascular patients and has been implicated in many inflammatory diseases such as atherosclerosis, neurodegenerative conditions, and some cancers. Due to these data, we decided to conduct an up-to-date review evaluating chlorinative stress effects on every age-related disease linked; potential anti-oxidant countermeasures were also assessed. Results obtained associated HOCl generation to the aging processes and confirmed its connection with diseases like neurodegenerative and cardiovascular pathologies, atherosclerosis and cancer; chlorination was mainly linked to diseases where molecular (protein) alteration constitute the major suspected cause: i.e. inflammation, tissue lesions, DNA damages, apoptosis and oxidative stress itself. According data collected, a healthy lifestyle together with some dietary suggestion and/or the administration of nutracetical antioxidant integrators could balance the effects of chlorinative stress and, in some cases, slow down or prevent the onset of age-releated diseases.

  9. Evaluation of perchlorate sources in the Rialto-Colton and Chino California subbasins using chlorine and oxygen isotope ratio analysis

    Hatzinger, Paul B.; Böhlke, John Karl; Izbicki, John; Teague, Nicholas F.; Sturchio, Neil C.

    2015-01-01

    Perchlorate (ClO4-) in groundwater can be from synthetic or natural sources, the latter of which include both historical application of imported nitrate fertilizers from the Atacama Desert of Chile and naturally deposited ClO4- that forms atmospherically and accumulates in arid regions such as the southwestern US. The objective of this study was to evaluate the use of isotopic data to distinguish sources of ClO4- in groundwater in a specific region of the Rialto-Colton and Chino, CA groundwater subbasins (Study Area). This region includes two groundwater ClO4- plumes emanating from known military/industrial source areas, and a larger area outside of these plumes having measurable ClO4-. Perchlorate extracted from wells in this region was analyzed for chlorine and oxygen stable isotope ratios (δ37Cl, δ18O, δ17O) and radioactive chlorine-36 (36Cl) isotopic abundance, along with other geochemical, isotopic, and hydrogeologic data. Isotope data indicate synthetic, Atacama, and indigenous natural ClO4- were present in the Study Area. Stable isotope data from nearly all sampled wells within the contours of the two characterized plumes, including those located in a perched zone and within the regional groundwater aquifer, were consistent with a dominant synthetic ClO4- source. In wells downgradient from the synthetic plumes and in the Chino subbasin to the southwest, isotopic data indicate the dominant source of ClO4- largely was Atacama, presumably from historical application of nitrate fertilizer in this region. Past agricultural land use and historical records are consistent with this source being present in groundwater. The 36Cl and δ18O data indicate that wells having predominantly synthetic or Atacama ClO4- also commonly contained small fractions of indigenous natural ClO4-. The indigenous ClO4- was most evident isotopically in wells having the lowest overall ClO4- concentrations (< 1 μg/L), consistent with its occurrence as a low-level background constituent

  10. Synthesis, X-ray and Mössbauer study of iron(II) complexes with trithiocyanuric acid (ttcH3). The X-ray structures of [Fe(bpy)3](ttcH) • 2bpy • 7H2O and [Fe(phen)3](ttcH2)(ClO4) • 2CH3OH • 2H2O

    Kopel, P.; Trávníček, Zdeněk; Zbořil, R.; Mrozinski, J.

    2004-01-01

    Roč. 23, č. 14 (2004), s. 2193-2202 ISSN 0277-5387 R&D Projects: GA ČR(CZ) GA203/02/0436 Grant - others:GA MŠk1(CZ) MSM 153100007 Institutional research plan: CEZ:AV0Z5038910 Keywords : Iron(II) complexes * Trithiocyanuric acid * Mössbauer spectra * Crystal structures Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 1.586, year: 2004

  11. Cod Liver Oil Supplement Consumption and Health: Cross‑sectional Results from the EPIC-Norfolk Cohort Study

    Marleen A.H. Lentjes

    2014-10-01

    Full Text Available Supplement users (SU make healthy lifestyle choices; on the other hand, SU report more medical conditions. We hypothesised that cod liver oil (CLO consumers are similar to non-supplement users, since CLO use might originate from historical motives, i.e., rickets prevention, and not health consciousness. CLO consumers were studied in order to identify possible confounders, such as confounding by indication. The European Prospective Investigation into Cancer (EPIC investigates causes of chronic disease. The participants were 25,639 men and women, aged 40–79 years, recruited from general practices in Norfolk, East-Anglia (UK. Participants completed questionnaires and a health examination between 1993 and 1998. Supplement use was measured using 7-day diet diaries. CLO was the most common supplement used, more prevalent among women and associated with not smoking, higher physical activity level and more favourable eating habits. SU had a higher occurrence of benign growths and bone-related diseases, but CLO was negatively associated with cardiovascular-related conditions. Although the results of SU characteristics in EPIC-Norfolk are comparable with studies worldwide, the CLO group is different from SU in general. Confounding by indication takes place and will need to be taken into account when analysing prospective associations of CLO use with fracture risk and cardiovascular diseases.

  12. Reduction of excess sludge production in sequencing batch reactor through incorporation of chlorine dioxide oxidation

    Wang Guanghua; Sui Jun; Shen Huishan; Liang Shukun; He Xiangming; Zhang Minju; Xie Yizhong; Li Lingyun; Hu Yongyou

    2011-01-01

    In this study, chlorine dioxide (ClO 2 ) instead of chlorine (Cl 2 ) was proposed to minimize the formation of chlorine-based by-products and was incorporated into a sequencing batch reactor (SBR) for excess sludge reduction. The results showed that the sludge disintegrability of ClO 2 was excellent. The waste activated sludge at an initial concentration of 15 g MLSS/L was rapidly reduced by 36% using ClO 2 doses of 10 mg ClO 2 /g dry sludge which was much lower than that obtained using Cl 2 based on similar sludge reduction efficiency. Maximum sludge disintegration was achieved at 10 mg ClO 2 /g dry sludge for 40 min. ClO 2 oxidation can be successfully incorporated into a SBR for excess sludge reduction without significantly harming the bioreactor performance. The incorporation of ClO 2 oxidation resulted in a 58% reduction in excess sludge production, and the quality of the effluent was not significantly affected.

  13. Challenges in using allylthiourea and chlorate as specific nitrification inhibitors

    Tatari, Karolina; Gülay, Arda; Thamdrup, B.

    2017-01-01

    Allylthiourea (ATU) and chlorate (ClO3-) are often used to selectively inhibit nitritation and nitratation. In this work we identified challenges with use of these compounds in inhibitory assays with filter material from a biological rapid sand filter for groundwater treatment. Inhibition...... was stronger at higher ATU levels and resulted in no NH4+ detection at 0.5 mM ATU. ClO3- at typical concentrations for inhibition assays (1-10 mM) inhibited nitratation by less than 6%, while nitritation was instead inhibited by 91% when NH4+ was supplied. On the other hand, nitratation was inhibited by 67......-71% at 10-20 mM ClO3- when NO2- was supplied, suggesting significant nitratation inhibition at higher NO2- concentrations. No chlorite (ClO2-) was detected in the effluent, and thus we could not confirm that nitritation inhibition was caused by ClO3- reduction to ClO2-. In conclusion, ATU and ClO3- should...

  14. Effect of citrus lemon oil on growth and adherence of Streptococcus mutans.

    Liu, Ying; Zhang, Xiangyu; Wang, Yuzhi; Chen, Feifei; Yu, Zhifen; Wang, Li; Chen, Shuanglu; Guo, Maoding

    2013-07-01

    In order to exploit novel anticaries agents, we investigated the effects of citrus lemon oil (CLO), a type of natural product, on growth and adherence of the primary oral cariogenic bacteria Streptococcus mutans (S. mutans). The growth inhibitory effect was explored with a micro-dilution assay. Adherence was analyzed by colony counts on the respective surfaces and the adherence inhibition rate (AIR). Real time-PCR was used to investigate the effects of CLO on transcription of glucosyltransferase (Gtf) encoding genes, gtfB, C and D. Neson-Somogyi method was used to measure the effects of CLO on Gtf activity. The minimum inhibitory concentration of CLO against S. mutans was 4.5 mg/ml. The CLO effectively reduced the adherence of S. mutans on glass surface (the AIR were from 98.3 to 100 %, P > 0.05) and saliva-coated enamel surface (the AIR were from 54.8 to 79.2 %, P < 0.05). CLO effectively reduced the activity of Gtf and the transcription of gtfs in a dose dependent manner (P < 0.05). In conclusion, CLO can effectively inhibit the growth and the adherence to glass and saliva-coated enamel surfaces of S. mutans. It can also inhibit the transcription of gtfs, as well as the Gtf enzyme activity.

  15. Enhanced bromate formation during chlorination of bromide-containing waters in the presence of CuO: Catalytic disproportionation of hypobromous acid

    Liu, Chao

    2012-10-16

    Bromate (BrO3 -) in drinking water is traditionally seen as an ozonation byproduct from the oxidation of bromide (Br-), and its formation during chlorination is usually not significant. This study shows enhanced bromate formation during chlorination of bromide-containing waters in the presence of cupric oxide (CuO). CuO was effective to catalyze hypochlorous acid (HOCl) or hypobromous acid (HOBr) decay (e.g., at least 104 times enhancement for HOBr at pH 8.6 by 0.2 g L-1 CuO). Significant halate concentrations were formed from a CuO-catalyzed hypohalite disproportionation pathway. For example, the chlorate concentration was 2.7 ± 0.2 μM (225.5 ± 16.7 μg L-1) after 90 min for HOCl (Co = 37 μM, 2.6 mg L-1 Cl2) in the presence of 0.2 g L-1 CuO at pH 7.6, and the bromate concentration was 6.6 ± 0.5 μM (844.8 ± 64 μg L -1) after 180 min for HOBr (Co = 35 μM) in the presence of 0.2 g L-1 CuO at pH 8.6. The maximum halate formation was at pHs 7.6 and 8.6 for HOCl or HOBr, respectively, which are close to their corresponding pKa values. In a HOCl-Br--CuO system, BrO3 - formation increases with increasing CuO doses and initial HOCl and Br- concentrations. A molar conversion (Br - to BrO3 -) of up to (90 ± 1)% could be achieved in the HOCl-Br--CuO system because of recycling of Br - to HOBr by HOCl, whereas the maximum BrO3 - yield in HOBr-CuO is only 26%. Bromate formation is initiated by the formation of a complex between CuO and HOBr/OBr-, which then reacts with HOBr to generate bromite. Bromite is further oxidized to BrO3 - by a second CuO-catalyzed process. These novel findings may have implications for bromate formation during chlorination of bromide-containing drinking waters in copper pipes. © 2012 American Chemical Society.

  16. Perchlorate in Lake Water from an Operating Diamond Mine.

    Smith, Lianna J D; Ptacek, Carol J; Blowes, David W; Groza, Laura G; Moncur, Michael C

    2015-07-07

    Mining-related perchlorate [ClO4(-)] in the receiving environment was investigated at the operating open-pit and underground Diavik diamond mine, Northwest Territories, Canada. Samples were collected over four years and ClO4(-) was measured in various mine waters, the 560 km(2) ultraoligotrophic receiving lake, background lake water and snow distal from the mine. Groundwaters from the underground mine had variable ClO4(-) concentrations, up to 157 μg L(-1), and were typically an order of magnitude higher than concentrations in combined mine waters prior to treatment and discharge to the lake. Snow core samples had a mean ClO4(-) concentration of 0.021 μg L(-1) (n=16). Snow and lake water Cl(-)/ClO4(-) ratios suggest evapoconcentration was not an important process affecting lake ClO4(-) concentrations. The multiyear mean ClO4(-) concentrations in the lake were 0.30 μg L(-1) (n = 114) in open water and 0.24 μg L(-1) (n = 107) under ice, much below the Canadian drinking water guideline of 6 μg L(-1). Receiving lake concentrations of ClO4(-) generally decreased year over year and ClO4(-) was not likely [biogeo]chemically attenuated within the receiving lake. The discharge of treated mine water was shown to contribute mining-related ClO4(-) to the lake and the low concentrations after 12 years of mining were attributed to the large volume of the receiving lake.

  17. Effects of clofibric acid on mRNA expression profiles in primary cultures of rat, mouse and human hepatocytes

    Richert, Lysiane; Lamboley, Christelle; Viollon-Abadie, Catherine; Grass, Peter; Hartmann, Nicole; Laurent, Stephane; Heyd, Bruno; Mantion, Georges; Chibout, Salah-Dine; Staedtler, Frank

    2003-01-01

    The mRNA expression profile in control and clofibric acid (CLO)-treated mouse, rat, and human hepatocytes was analyzed using species-specific oligonucleotide DNA microarrays (Affymetrix). A statistical empirical Bayes procedure was applied in order to select the significantly differentially expressed genes. Treatment with the peroxisome proliferator CLO induced up-regulation of genes involved in peroxisome proliferation and in cell proliferation as well as down-regulation of genes involved in apoptosis in hepatocytes of rodent but not of human origin. CLO treatment induced up-regulation of microsomal cytochrome P450 4a genes in rodent hepatocytes and in two of six human hepatocyte cultures. In addition, genes encoding phenobarbital-inducible cytochrome P450s were also up-regulated by CLO in rodent and human hepatocyte cultures. Up-regulation of phenobarbital-inducible UDP-glucuronosyl-transferase genes by CLO was observed in both rat and human but not in mouse hepatocytes. CLO treatment induced up-regulation of L-fatty acid binding protein (L-FABP) gene in hepatocytes of both rodent and human origin. However, while genes of the cytosolic, microsomal, and mitochondrial pathways involved in fatty acid transport and metabolism were up-regulated by CLO in both rodent and human hepatocyte cultures, genes of the peroxisomal pathway of lipid metabolism were up-regulated in rodents only. An up-regulation of hepatocyte nuclear factor 1α (HNF1α) by CLO was observed only in human hepatocyte cultures, suggesting that this trans-activating factor may play a key role in the regulation of fatty acid metabolism in human liver as well as in the nonresponsiveness of human liver to CLO-induced regulation of cell proliferation and apoptosis

  18. Genome-wide identification and functional annotation of miRNAs in anti-inflammatory plant and their cross-kingdom regulation in Homo sapiens.

    Sharma, Ankita; Sahu, Sarika; Kumari, Pooja; Gopi, Soundhara Rajan; Malhotra, Rajesh; Biswas, Sagarika

    2017-05-01

    MicroRNAs (miRNAs) are newly discovered non-coding small (~17-24 nucleotide) RNAs that regulate gene expression of its target mRNA at the post-transcriptional levels. In this study, total 12,593 ESTs of Curcuma longa were taken from database of expressed sequence tags (dbEST) and clustered into 2821 contigs using EGassembler web server. Precursor miRNAs (pre-miRNAs) were predicted from these contigs that folded into stem-loop structure using MFold server. Thirty-four mature C. longa miRNAs (clo-miRNAs) were identified from pre-miRNAs having targets involved in various important functions of plant such as self-defence, growth and development, alkaloid metabolic pathway and ethylene signalling process. Sequence analysis of identified clo-miRNAs indicated that 56% miRNAs belong to ORF and 44% belong to non-ORF region. clo-mir-5 and clo-mir-6 were established as the conserved miRNAs, whereas clo-mir-20 was predicted to be the most stable miRNA. Phylogenetic analysis carried out by molecular evolutionary genetics analysis (MEGA) software indicated close evolutionary relationship of clo-mir-5075 with osa-MIR5075. Further, identified clo-miRNAs were checked for their cross-kingdom regulatory potential. clo-mir-14 was found to regulate various gene transcripts in humans that has been further investigated for its biostability in foetal bovine serum (FBS). The results indicated higher degree of stability of clo-mir-14 (48 h) in FBS. Thus, contribution of this miRNA to the cellular immune response during the inflamed condition of rheumatoid arthritis and adequate stability may make it a good choice for the therapeutic agent in near future.

  19. Diethylnitrosamine initiation does not alter clofibric acid-induced hepatocarcinogenesis in the rat.

    Michel, Cecile; Desdouets, Chantal; Slaoui, Mohamed; Isaacs, Kevin Robert; Roberts, Ruth Angela; Boitier, Eric

    2007-09-01

    Clofibric acid (CLO) is a nongenotoxic hepatocarcinogen in rodents that causes altered hepatocellular foci and/or neoplasms. Initiation by DNA-damaging agents such as diethylnitrosamine (DEN) accelerates focus and tumor appearance and could therefore significantly contribute to shortening of the regulatory 2-year rodent carcinogenicity bioassays. However, it is crucial to evaluate the histological and molecular impact of initiation with DEN on hepatocarcinogenesis promoted by CLO. Male F344 rats were given a single nonnecrogenic injection of DEN (0 or 30 mg/kg) followed by Control diet or CLO (5000 ppm) in diet for up to 20 months. Histopathology and gene expression profiling were performed in liver tumors and surrounding nontumoral liver tissues. The molecular signature of DEN was characterized and its histopathological and immunohistopathological effects on focus and tumor types were also determined. Although foci and tumors appeared earlier in the DEN+CLO-treated group compared to the group treated with CLO alone, DEN had little impact on gene expression in nontumoral tissues since the gene expression profiles were highly similar between Control and DEN-treated rats, and DEN+CLO- and CLO-treated rats. Finally, tumors obtained from DEN+CLO and CLO-treated groups displayed highly correlated gene expression profiles (r>0.83, independently of the time-point). The pathways involved in tumor development revealed by Gene Ontology functional analysis are similar when driven either by spontaneous initiation or by a chemically induced initiation step. Our work described here may contribute to the design optimization of shorter preclinical tests for the evaluation of the nongenotoxic hepatocarcinogenic potential of drugs under development.

  20. Effects of clofibric acid on mRNA expression profiles in primary cultures of rat, mouse and human hepatocytes.

    Richert, Lysiane; Lamboley, Christelle; Viollon-Abadie, Catherine; Grass, Peter; Hartmann, Nicole; Laurent, Stephane; Heyd, Bruno; Mantion, Georges; Chibout, Salah-Dine; Staedtler, Frank

    2003-09-01

    The mRNA expression profile in control and clofibric acid (CLO)-treated mouse, rat, and human hepatocytes was analyzed using species-specific oligonucleotide DNA microarrays (Affymetrix). A statistical empirical Bayes procedure was applied in order to select the significantly differentially expressed genes. Treatment with the peroxisome proliferator CLO induced up-regulation of genes involved in peroxisome proliferation and in cell proliferation as well as down-regulation of genes involved in apoptosis in hepatocytes of rodent but not of human origin. CLO treatment induced up-regulation of microsomal cytochrome P450 4a genes in rodent hepatocytes and in two of six human hepatocyte cultures. In addition, genes encoding phenobarbital-inducible cytochrome P450s were also up-regulated by CLO in rodent and human hepatocyte cultures. Up-regulation of phenobarbital-inducible UDP-glucuronosyl-transferase genes by CLO was observed in both rat and human but not in mouse hepatocytes. CLO treatment induced up-regulation of L-fatty acid binding protein (L-FABP) gene in hepatocytes of both rodent and human origin. However, while genes of the cytosolic, microsomal, and mitochondrial pathways involved in fatty acid transport and metabolism were up-regulated by CLO in both rodent and human hepatocyte cultures, genes of the peroxisomal pathway of lipid metabolism were up-regulated in rodents only. An up-regulation of hepatocyte nuclear factor 1alpha (HNF1alpha) by CLO was observed only in human hepatocyte cultures, suggesting that this trans-activating factor may play a key role in the regulation of fatty acid metabolism in human liver as well as in the nonresponsiveness of human liver to CLO-induced regulation of cell proliferation and apoptosis.

  1. Uric acid disrupts hypochlorous acid production and the bactericidal activity of HL-60 cells.

    Carvalho, Larissa A C; Lopes, João P P B; Kaihami, Gilberto H; Silva, Railmara P; Bruni-Cardoso, Alexandre; Baldini, Regina L; Meotti, Flavia C

    2018-06-01

    Uric acid is the end product of purine metabolism in humans and is an alternative physiological substrate for myeloperoxidase. Oxidation of uric acid by this enzyme generates uric acid free radical and urate hydroperoxide, a strong oxidant and potentially bactericide agent. In this study, we investigated whether the oxidation of uric acid and production of urate hydroperoxide would affect the killing activity of HL-60 cells differentiated into neutrophil-like cells (dHL-60) against a highly virulent strain (PA14) of the opportunistic pathogen Pseudomonas aeruginosa. While bacterial cell counts decrease due to dHL-60 killing, incubation with uric acid inhibits this activity, also decreasing the release of the inflammatory cytokines interleukin-1β (IL-1β) and tumor necrosis factor-α (TNF- α). In a myeloperoxidase/Cl - /H 2 O 2 cell-free system, uric acid inhibited the production of HOCl and bacterial killing. Fluorescence microscopy showed that uric acid also decreased the levels of HOCl produced by dHL-60 cells, while significantly increased superoxide production. Uric acid did not alter the overall oxidative status of dHL-60 cells as measured by the ratio of reduced (GSH) and oxidized (GSSG) glutathione. Our data show that uric acid impairs the killing activity of dHL-60 cells likely by competing with chloride by myeloperoxidase catalysis, decreasing HOCl production. Despite diminishing HOCl, uric acid probably stimulates the formation of other oxidants, maintaining the overall oxidative status of the cells. Altogether, our results demonstrated that HOCl is, indeed, the main relevant oxidant against bacteria and deviation of myeloperoxidase activity to produce other oxidants hampers dHL-60 killing activity. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.

  2. A combined theoretical and experimental investigation about the influence of the dopant in the anodic electropolymerization of α-tetrathiophene

    Aleman, Carlos; Oliver, Ramon; Brillas, Enric; Casanovas, Jordi; Estrany, Francesc

    2006-01-01

    This work presents an experimental and theoretical investigation about the influence of the dopant in the electropolymerization of α-tetrathiophene. The results derived from anodic polymerization of α-tetrathiophene using SCN - , Cl - , Br - , NO 3 - ClO 3 - andClO 4 - as dopant agents are compared with theoretical results provided by quantum mechanical calculations on 1:1 charge-transfer complexes formed by α-tetrathiophene and X=SCN, Cl, Br, NO 3 , ClO 3 and ClO 4 . The consistency between experimental and theoretical results allows explain and rationalize the influence of the dopant in the electropolymerization of α-tetrathiophene

  3. Disinfection efficiency of chlorine dioxide gas in student cafeterias in Taiwan.

    Hsu, Ching-Shan; Huang, Da-Ji

    2013-07-01

    In Taiwan, the food and drink requirements of students and faculty members are met by student cafeterias. The air quality within these cafeterias should satisfy the guidelines laid down by the Taiwan Environmental Protection Agency (Taiwan EPA). Accordingly, this study performed an experimental investigation into the efficiency of two different gaseous chlorine dioxide (ClO2) treatments in disinfecting a local student cafeteria, namely a single, one-off application and a twice-daily application. In both cases, the ClO2 was applied using strategically placed aerosol devices. The air quality before and after disinfection was evaluated by measuring the bioaerosol levels of bacteria and fungi. Moreover, a stepwise discriminant analysis method was applied for predicting the residual concentrations of bacteria and fungi, as a function of the environmental parameters and the ClO2 concentration. The experimental results showed that the average background levels of bacteria and fungi prior to ClO2 disinfection were 972.5 +/- 623.6 and 1534.1 +/- 631.8 colony-forming units (CFU)/m3, respectively. A single ClO2 application was found to reduce the bacterial and fungal concentration levels by as much as 65% and 30%, respectively. By contrast, a twice-daily ClO2 application was found to reduce the bacterial and fungal concentration levels by as much as 74% and 38%, respectively. The statistical analysis results showed that the residual bacterial concentration level was determined primarily by the number of individuals present in the cafeteria, the temperature, and the ClO2 concentration, whereas the residual fungal concentration level was determined mainly by the temperature, the total number of suspended particles, and the ClO2 concentration. Thus, the integrated results suggest that the air quality guidelines prescribed by the Taiwan EPA for student cafeteria can best be achieved by applying ClO2 twice daily using an appropriate deployment of aerosol devices. ClO2 gas can

  4. New Approaches for Prostate Cancer Combination Therapy

    2009-04-01

    Freemont AJ, et al. E - cadherin and h-catenin are down-regulated in prostatic bone metastases. BJU Int 2002;89:400–3. ...ola r Di clo fen ac 20 Di clo fen ac 10 Di clo fen ac 5 Su lin da c S ulf on e 2 00 Su lin da c S ulf on e 1 00 Su lin da c S ulf on e 5 0 Su...lin da c S ulf on e 2 5 Flu rb ipr ofe n 2 0 Flu rb ipr ofe n 1 0 Flu rb ipr ofe n 5 Flu rb ipr ofe n 2 As pir

  5. Efecto tóxico del DDT, clordano y agua de la presa Ignacio Ramírez (México), sobre Daphnia magna (Crustacea: Daphnidae)

    Laura Martínez-Tabche; Martha Romero Solís; Eugenia López López; Marcela Galar Martínez

    1999-01-01

    Actualmente en México son empleados los plaguicidas diclorodifeniltricloroetano (DDT) y clordano (CLO) para combatir la malaria y termitas. De 1990 a 1996 un total de 27 ton de DDT y 508 de CLO, en forma de productos técnicos, fueron importados. El objetivo de este estudio fue establecer una metodología para determinar el impacto ambiental que pueden producir estos compuestos sobre un embalse. El efecto tóxico del DDT y CLO fue evaluado sobre la actividad de la o-demetilasa (OD) y del acetilc...

  6. Relationship between resistance to Phytophthora ramorum and constitutive phenolic chemistry in coast live oaks and northern red oaks

    Annemarie M. Nagle; Matteo Garbelotto; Brice McPherson; David L. Wood; Pierluigi. Bonello

    2010-01-01

    Phytophthora ramorum causes lethal canker diseases and extensive mortality in coast live oak (CLO) (Quercus agrifolia) and tanoak (Lithocarpus densiflorus). No practical controls are available for this disease in non-urban environments. Therefore, characterization of natural resistance is highly...

  7. Retinal nerve fibre layer thickness values and their associations with ...

    prevalent amongst Black African people, while angle clo- ... shown that RNFL varies with age, gender, race and eth- nicity ... SD-OCT (Optovue Inc. Fremont, CA, USA) device was .... and White populations.11,13-16. .... Conflict of interest.

  8. Variations in the free chlorine content of the stratosphere (1991-1997): Anthropogenic, volcanic, and methane influences

    Froidevaux, L.; Waters, J. W.; Read, W. G.; Connell, P. S.; Kinnison, D. E.; Russell, J. M. III

    2000-01-01

    Remote sensing of chlorine monoxide (ClO) by the Microwave Limb Sounder experiment aboard the Upper Atmosphere Research Satellite (UARS) has provided global measurements of variations in stratospheric free chlorine for 1991-1997. Linear trends were obtained from a multiple regression analysis of this data set at low latitudes and midlatitudes. ClO increases in the upper stratosphere (2 hPa) are significantly larger than expected from trends in chlorine source gases alone. Much of the upper stratospheric ClO variability can be explained by changes in CH 4 , as measured by the UARS Halogen Occultation Experiment. Decreasing ClO in the lower stratosphere is consistent with a relaxation from a chemically perturbed state attributed to the 1991 Mt. Pinatubo eruption. (c) 2000 American Geophysical Union

  9. PARALLEL IMPLEMENTATION OF CROSS-LAYER OPTIMIZATION - A PERFORMANCE EVALUATION BASED ON SWARM INTELLIGENCE

    Vanaja Gokul

    2012-01-01

    Full Text Available In distributed systems real time optimizations need to be performed dynamically for better utilization of the network resources. Real time optimizations can be performed effectively by using Cross Layer Optimization (CLO within the network operating system. This paper presents the performance evaluation of Cross Layer Optimization (CLO in comparison with the traditional approach of Single-Layer Optimization (SLO. In the parallel implementation of the approaches the experimental study carried out indicates that the CLO results in a significant improvement in network utilization when compared to SLO. A variant of the Particle Swarm Optimization technique that utilizes Digital Pheromones (PSODP for better performance has been used here. A significantly higher speed up in performance was observed from the parallel implementation of CLO that used PSODP on a cluster of nodes.

  10. Monitoring of Legionella pneumophila viability after chlorine dioxide treatment using flow cytometry.

    Mustapha, Pascale; Epalle, Thibaut; Allegra, Séverine; Girardot, Françoise; Garraud, Olivier; Riffard, Serge

    2015-04-01

    The viability of three Legionella pneumophila strains was monitored after chlorine dioxide (ClO2) treatment using a flow cytometric assay. Suspensions of L. pneumophila cells were submitted to increasing concentrations of ClO2. Culturable cells were still detected when using 4 mg/L, but could no longer be detected after exposure to 6 mg/L of ClO2, although viable but not culturable (VBNC) cells were found after exposure to 4-5 mg/L of ClO2. When testing whether these VBNC were infective, two of the strains were resuscitated after co-culture with Acanthamoeba polyphaga, but neither of them could infect macrophage-like cells. Copyright © 2015 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

  11. Is there any chlorine monoxide in the stratosphere?

    Mumma, M. J.; Rogers, J. D.; Kostiuk, T.; Deming, D.; Hillman, J. J.; Zipoy, D.

    1983-01-01

    A ground-based search for stratospheric 35-ClO was carried out using an infrared heterodyne spectrometer in the solar absorption mode. Lines due to stratospheric HNO3 and tropospheric OCS were detected at about 0.2 percent absorptance levels, but the expected 0.1 percent lines of ClO in this same region were not seen. We find that stratospheric ClO is at least a factor of seven less abundant than is indicated by in situ measurements, and we set an upper limit of 2.3 x 10 to the 13th molecules/sq cm at the 95 percent confidence level for the integrated vertical column density of ClO. Our results imply that the release of chlorofluorocarbons may be significantly less important for the destruction of stratospheric ozone (O3) than is currently thought. Previously announced in STAR as N83-27518

  12. Functional analyses of a flavonol synthase–like gene from Camellia ...

    ACAATCCAGGGCAAGGTC 172-190. ACAATCAGGGCATTAGGG 815-833. CLoning (JF343560). CnFLS-FL. AGGAGTGAGAAGGGGAAAAA 43-62. CAAGACAATGAAACGAGTGAGT. 1106-1127. Full Length cloing. (JF343560). CnFLS-Q. TGGAAGGCAAGAAAGGATGGG. 407-427. CCACCGGAACAACTTGTCTGC 566-585.

  13. A rapid, naked-eye detection of hypochlorite and bisulfite using a robust and highly-photostable indicator dye Quinaldine Red in aqueous medium

    Dutta, Tanoy; Chandra, Falguni; Koner, Apurba L.

    2018-02-01

    A ;naked-eye; detection of health hazardous bisulfite (HSO3-) and hypochlorite (ClO-) using an indicator dye (Quinaldine Red, QR) in a wide range of pH is demonstrated. The molecule contains a quinoline moiety linked to an N,N-dimethylaniline moiety with a conjugated double bond. Treatment of QR with HSO3- and ClO-, in aqueous solution at near-neutral pH, resulted in a colorless product with high selectivity and sensitivity. The detection limit was 47.8 μM and 0.2 μM for HSO3- and ClO- respectively. However, ClO- was 50 times more sensitive and with 2 times faster response compared to HSO3-. The detail characterization and related analysis demonstrate the potential of QR for a rapid, robust and highly efficient colorimetric sensor for the practical applications to detect hypochlorite in water samples.

  14. In-situ synchrotron x-ray study of the crystallization behavior of Ce0.9La0.1O2−x thin films deposited on NiW alloy substrates by chemical solution method

    Yue, Zhao; Grivel, Jean-Claude; Abrahamsen, Asger Bech

    2011-01-01

    The phase and texture formation of La doped CeO2 (CLO) films deposited by the chemical solution method are studied by in situ synchrotron x-ray diffraction. It is found that the CLO crystallites forms excellent in-plane texture as soon as the phase appears at 860°C, indicating that interfacial nu...... by diffusion. The success of this work demonstrates the possibility of studying crystallization behaviors of solution derived films using a non-destructive method, which has the potential of being applicable to most types of thin film samples.......The phase and texture formation of La doped CeO2 (CLO) films deposited by the chemical solution method are studied by in situ synchrotron x-ray diffraction. It is found that the CLO crystallites forms excellent in-plane texture as soon as the phase appears at 860°C, indicating that interfacial...

  15. Perchlorate exposure is associated with oxidative stress and indicators of serum iron homeostasis among NHANES 2005-2008 subjects

    ABSTRACT Perchlorate (ClO4-), an oxidizing agent, is a ubiquitous environmental pollutant. Several studies have investigated its thyroid hormone disrupting properties. Its associations with other biological measures are largely unknown. This study, combining 2005-2008 National H...

  16. Global patterns and environmental controls of perchlorate and nitrate co-occurrence in arid and semi-arid environments

    Jackson, W. Andrew; Böhlke, J. K.; Andraski, Brian J.; Fahlquist, Lynne; Bexfield, Laura; Eckardt, Frank D.; Gates, John B.; Davila, Alfonso F.; McKay, Christopher P.; Rao, Balaji; Sevanthi, Ritesh; Rajagopalan, Srinath; Estrada, Nubia; Sturchio, Neil; Hatzinger, Paul B.; Anderson, Todd A.; Orris, Greta; Betancourt, Julio; Stonestrom, David; Latorre, Claudio; Li, Yanhe; Harvey, Gregory J.

    2015-09-01

    Natural perchlorate (ClO4-) is of increasing interest due to its wide-spread occurrence on Earth and Mars, yet little information exists on the relative abundance of ClO4- compared to other major anions, its stability, or long-term variations in production that may impact the observed distributions. Our objectives were to evaluate the occurrence and fate of ClO4- in groundwater and soils/caliche in arid and semi-arid environments (southwestern United States, southern Africa, United Arab Emirates, China, Antarctica, and Chile) and the relationship of ClO4- to the more well-studied atmospherically deposited anions NO3- and Cl- as a means to understand the prevalent processes that affect the accumulation of these species over various time scales. ClO4- is globally distributed in soil and groundwater in arid and semi-arid regions on Earth at concentrations ranging from 10-1 to 106 μg/kg. Generally, the ClO4- concentration in these regions increases with aridity index, but also depends on the duration of arid conditions. In many arid and semi-arid areas, NO3- and ClO4- co-occur at molar ratios (NO3-/ClO4-) that vary between ∼104 and 105. We hypothesize that atmospheric deposition ratios are largely preserved in hyper-arid areas that support little or no biological activity (e.g. plants or bacteria), but can be altered in areas with more active biological processes including N2 fixation, N mineralization, nitrification, denitrification, and microbial ClO4- reduction, as indicated in part by NO3- isotope data. In contrast, much larger ranges of Cl-/ClO4- and Cl-/NO3- ratios indicate Cl- varies independently from both ClO4- and NO3-. The general lack of correlation between Cl- and ClO4- or NO3- implies that Cl- is not a good indicator of co-deposition and should be used with care when interpreting oxyanion cycling in arid systems. The Atacama Desert appears to be unique compared to all other terrestrial locations having a NO3-/ClO4- molar ratio ∼103. The relative

  17. ANALYSIS OF HYDROPONIC FERTILIZER MATRIXES FOR PERCHLORATE: COMPARISON OF ANALYTICAL TECHNIQUES

    Seven retail hydroponic nitrate fertilizer products, two liquid and five solid, were comparatively analyzed for the perchlorate anion (ClO4-) by ion chromatography (IC) with suppressed conductivity detection, complexation electrospray ionization mass spectrometry (cESI-MS), norma...

  18. A randomized double blind crossover placebo-controlled clinical trial to assess the effects of a mouthwash containing chlorine dioxide on oral malodor

    Yokoyama Sayaka

    2008-12-01

    Full Text Available Abstract Background Previous research has shown the oxidizing properties and microbiological efficacies of chlorine dioxide (ClO2, however, its clinical efficacies on oral malodor have been evaluated only with organoleptic measurements (OM or sulphide monitors. No clinical studies have investigated the inhibitory effects of ClO2 on volatile sulfur compounds (VSCs using gas chromatography (GC. The aim of this study was to assess the inhibitory effects of a mouthwash containing ClO2 on morning oral malodor using OM and GC. Methods A randomized, double blind, crossover, placebo-controlled clinical trial was conducted among 15 healthy male volunteers, who were divided into 2 groups. In the first test phase, the group 1 subjects (N = 8 were instructed to rinse with the experimental mouthwash containing ClO2, and those in group 2 (N = 7 to rinse with the placebo mouthwash without ClO2. In the second test, phase after a one week washout period, each group used the opposite mouthwash. Oral malodor was evaluated before rinsing, right after rinsing and every 30 minutes up to 4 hours with OM, and concentrations of hydrogen sulfide (H2S, methyl mercaptan (CH3SH and dimethyl sulfide ((CH32S, the main VSCs of human oral malodor, were evaluated with GC. Results The baseline oral condition in the subjects in the 2 groups did not differ significantly. The mouthwash containing ClO2 improved morning bad breath according to OM and reduced concentrations of H2S, CH3SH and (CH32S according to GC up to 4 hours after rinsing. OM scores with ClO2 were significantly lower than those without ClO2 at all examination times. Significant reductions in the concentrations of the three kinds of VSCs measured by GC were also evident at all examination times. The concentrations of the three gases with ClO2 were significantly lower than those without ClO2 at most examination times. Conclusion In this explorative study, ClO2 mouthwash was effective at reducing morning malodor for 4

  19. A comparison of disinfection by-products formation during sequential or simultaneous disinfection of surface waters with chlorine dioxide and chlor(am)ine.

    Shi, Yanwei; Ling, Wencui; Qiang, Zhimin

    2013-01-01

    The effect of chlorine dioxide (ClO2) oxidation on the formation of disinfection by-products (DBPs) during sequential (ClO2 pre-oxidation for 30 min) and simultaneous disinfection processes with free chlorine (FC) or monochloramine (MCA) was investigated. The formation of DBPs from synthetic humic acid (HA) water and three natural surface waters containing low bromide levels (11-27 microg/L) was comparatively examined in the FC-based (single FC, sequential ClO2-FC, and simultaneous ClO2/FC) and MCA-based (single MCA, ClO2-MCA, and ClO2/MCA) disinfection processes. The results showed that much more DBPs were formed from the synthetic HA water than from the three natural surface waters with comparative levels of dissolved organic carbon. In the FC-based processes, ClO2 oxidation could reduce trihalomethanes (THMs) by 27-35% and haloacetic acids (HAAs) by 14-22% in the three natural surface waters, but increased THMs by 19% and HAAs by 31% in the synthetic HA water after an FC contact time of 48 h. In the MCA-based processes, similar trends were observed although DBPs were produced at a much lower level. There was an insignificant difference in DBPs formation between the sequential and simultaneous processes. The presence of a high level of bromide (320 microg/L) remarkably promoted the DBPs formation in the FC-based processes. Therefore, the simultaneous disinfection process of ClO2/MCA is recommended particularly for waters with a high bromide level.

  20. Deactivation of wastewater-derived N-nitrosodimethylamine precursors with chlorine dioxide oxidation and the effect of pH.

    Uzun, Habibullah; Kim, Daekyun; Karanfil, Tanju

    2018-09-01

    In this study, the effect of chlorine dioxide (ClO 2 ) oxidation on the deactivation of wastewater (WW)-derived N-nitrosodimethylamine (NDMA) precursors was investigated under various conditions (i.e., ClO 2 application pH, dose and contact time). At pH 6.0, decreases in NDMA formation potentials (FPs) or occurrences (under uniform formation conditions [UFC]) were relatively low (NDMA FP removals were significant (up to ~85%) under the same oxidation conditions in WW-impacted waters at pH 7.8. This indicates that the majority of WW-derived NDMA precursors can be deactivated with ClO 2 oxidation above neutral pH. This was attributed to the better oxidative reaction of ClO 2 with amines that have lone pair electrons to be shared at higher oxidation pH conditions. In addition, relatively short oxidation periods with ClO 2 (i.e., ≤10 min) or low Ct (concentration × time, ~10 mg ∗ min/L) values were sufficient for the deactivation of WW-derived NDMA precursors. ClO 2 oxidation was effective in freshly WW-impacted waters. Natural attenuation processes (e.g., sorption, biodegradation, etc.) can change the reactivity of WW-derived NDMA precursors for oxidation with ClO 2 . The effect of ClO 2 on the removal of THM precursors was low (NDMA and regulated DBP formation during water treatment, especially for utilities treating WW-impacted water sources. Copyright © 2018 Elsevier B.V. All rights reserved.

  1. Effects of body-mapping-designed clothing on heat stress and running performance in a hot environment.

    Jiao, Jiao; Li, Yi; Yao, Lei; Chen, Yajun; Guo, Yueping; Wong, Stephen H S; Ng, Frency S F; Hu, Junyan

    2017-10-01

    To investigate clothing-induced differences in human thermal response and running performance, eight male athletes participated in a repeated-measure study by wearing three sets of clothing (CloA, CloB, and CloC). CloA and CloB were body-mapping-designed with 11% and 7% increased capacity of heat dissipation respectively than CloC, the commonly used running clothing. The experiments were conducted by using steady-state running followed by an all-out performance running in a controlled hot environment. Participants' thermal responses such as core temperature (T c ), mean skin temperature ([Formula: see text]), heat storage (S), and the performance running time were measured. CloA resulted in shorter performance time than CloC (323.1 ± 10.4 s vs. 353.6 ± 13.2 s, p = 0.01), and induced the lowest [Formula: see text], smallest ΔT c , and smallest S in the resting and running phases. This study indicated that clothing made with different heat dissipation capacities affects athlete thermal responses and running performance in a hot environment. Practitioner Summary: A protocol that simulated the real situation in running competitions was used to investigate the effects of body-mapping-designed clothing on athletes' thermal responses and running performance. The findings confirmed the effects of optimised clothing with body-mapping design and advanced fabrics, and ensured the practical advantage of developed clothing on exercise performance.

  2. The Alchemy of CDO Credit Ratings

    Efraim Benmelech; Jennifer Dlugosz

    2009-01-01

    Collateralized Loan Obligations (CLOs) were one of the largest and fastest growing segments of the structured finance market, fueling the 2003-2007 boom in syndicated loans and leveraged buyouts. The credit crisis brought CLO issuance to a halt, and as a result the leveraged loan market dried up. Similar to other structured finance products, investors in CLOs rely heavily on credit rating provided by the rating agencies, yet little is known about CLO rating practices. This paper attempts to f...

  3. Effects of the neonicotinoids thiametoxam and clothianidin on in vivo dopamine release in rat striatum.

    de Oliveira, Iris Machado; Nunes, Brenda Viviane Ferreira; Barbosa, Durán Rafael; Pallares, Alfonso Miguel; Faro, Lilian Rosana Ferreira

    2010-02-15

    Thiamethoxam (TMX) and clothianidin (CLO) are neonicotinoids insecticides. The main characteristic of these pesticides is their agonist action on nicotinic acetylcholine receptors (nAChRs). In the present work it was studied and characterized the effects of TMX and CLO, in different concentrations, on dopaminergic system of rat striatum using in vivo brain microdialysis coupled to HPLC-EC. Intrastriatal administration of 1mM or 5mM TMX has not produced significant increases on dopamine (DA) levels, nonetheless the infusion of 10mM TMX increases the DA output to 841+/-132%, when compared to basal levels. Infusion of 1mM CLO has not induced a significant increase in DA levels, even so 2, 3.5 and 5mM CLO have produced an increase of 438+/-8%, 2778+/-598% and 4604+/-516%, respectively, every compared to basal levels. Mecamylamine (MEC), a non-competitive nAChRs antagonist, was used to investigate the role of nAChRs on DA release induced by TMX and CLO. The increases in extracellular DA levels induced by TMX and CLO when associated to MEC are 80% and 68% lower than the effect produced by CLO and TMX isolated. These results confirm that TMX and CLO appear to induce in vivo DA increased release in striatum of rats and it seems to be concentration dependent. Moreover, these results indicate that this effect might be related to nAChRs. Copyright 2009 Elsevier Ireland Ltd. All rights reserved.

  4. Characterization of the metabolic transformation of thiamethoxam to clothianidin in Helicoverpa armigera larvae by SPE combined UPLC-MS/MS and its relationship with the toxicity of thiamethoxam to Helicoverpa armigera larvae.

    Fan, Yinjun; Shi, Xueyan

    2017-09-01

    In order to characterize the metabolic transformation of thiamethoxam (TMX) to clothianidin (CLO) in Helicoverpa armigera larvae and clarify its relationship with the insecticidal toxicity of TMX, method for determination of TMX and its metabolite clothianidin (CLO) residues in H. armigera larvae by solid phase extraction (SPE) combined UPLC-MS/MS was established. Following acetonitrile extraction and purification by SPE on florisil cartridge and C 18 cartridge sequently, and cleanup by PSA adsorption, TMX and CLO residues in H. armigera larvae were successfully determined by UPLC-MS/MS. By using the established method, the concentration-time curves of TMX and its metabolite CLO in H. armigera larvae in vivo and metabolism of TMX by microsome of H. armigera larvae midguts in vitro were studied. TMX was quickly eliminated from H. armigera larvae with the elimination half-life as 4.2h. Meanwhile, only a small amount of CLO was formed from TMX metabolism, with the maximum CLO level in H. armigera larvae only accounts for the metabolic transformation of 7.99% of TMX, at 10h after intravenous TMX administration. Our results suggested that the low insecticidal efficacy of TMX against H. armigera larvae was related with the rapidly elimination of TMX from H. armigera larvae, meanwhile, CLO as TMX metabolite at a very low level in vivo didn't contribute to TMX toxicity to H. armigera larvae. In H. armigera larvae, TMX didn't act as proinsecticide for CLO in insecticidal efficacy of TMX. Copyright © 2017 Elsevier B.V. All rights reserved.

  5. An i.r. investigation on some calcium aluminate hydrates, Ca2Al(OH)6+X-.yH2O (= 3CaO.Al2O3.CaX2.nH2O, X- = univalent anion)

    Houtepen, C.J.M.; Stein, H.N.

    1976-01-01

    The i.r. spectra of some hydrated and dehydrated calcium aluminate hydrates of the type Ca2Al(OH)6+X-·yH2O with X- = Cl-, Br-, J-, ClO3-, NO3-, ClO4- (y = 2) and X- = BrO3-, JO3- (2

  6. Synthesis and characterisation of some lanthanide perchlorate complexes of 4-nitrosoantipyrine

    Jayasankar, H.; Indrasenan, P.

    1988-01-01

    Seven lanthanide perchlorate complexes of 4-nitrosoantipyrine (NAP) of the general formula [Ln(NAP) 4 ClO 4 ](ClO 4 ) 2 (where Ln=La, Pr, Nd, Sm, Gd, Dy and Y), have been synthesised and characterised by elemental analyses, molecular weights, conductances, magnetic moments and infrared and electronic spectral data. In these nine-coordinated complexes, all the four NAP molecules are coordinated bidentately and one of the perchlorate groups is coordinated monodentately. (author). 12 refs

  7. Synthesis, characterization, X-ray crystal structure and conductometry studying of a number of new Schiff base complexes; a new example of binuclear square pyramidal geometry of Cu(II) complex bridged with an oxo group

    Golbedaghi, Reza; Alavipour, Ehsan

    2015-11-01

    Three new binuclear Cu(II), Mn(II), Co(II) complexes [Cu2(L) (ClO4)](ClO4)2 (1), [Mn2(L) (ClO4)](ClO4)2 (2), and [Co2(L) (ClO4)](ClO4)2 (3), {L = 1,3-bis(2-((Z)-(2-aminopropylimino)methyl)phenoxy)propan-2-ol} have been synthesized. Single crystal X-ray structure analysis of complex 1 showed that the complex is binuclear and all nitrogen and oxygen atoms of ligand (N4O3) are coordinated to two Cu(II) center ions. In addition, the crystal structure studying shows, a perchlorate ion has been bridged to the Cu(II) metal centers. However, two distorted square pyramidal Cu(II) ions are bridged asymmetrically by a perchlorate ion and oxygen of hydroxyl group of Schiff base ligand. In addition, the conductometry behaviors of all complexes were studied in acetonitrile solution.

  8. In vivo neurochemical characterization of clothianidin induced striatal dopamine release.

    Faro, L R F; Oliveira, I M; Durán, R; Alfonso, M

    2012-12-16

    Clothianidin (CLO) is a neonicotinoid insecticide with selective action on nicotinic acetylcholine receptors. The aim of this study was to determine the neurochemical basis for CLO-induced striatal dopamine release using the microdialysis technique in freely moving and conscious rats. Intrastriatal administration of CLO (3.5mM), produced an increase in both spontaneous (2462 ± 627% with respect to basal values) and KCl-evoked (4672 ± 706% with respect to basal values) dopamine release. This effect was attenuated in Ca(2+)-free medium, and was prevented in reserpine pre-treated animals or in presence of tetrodotoxin (TTX). To investigate the involvement of dopamine transporter (DAT), the effect of CLO was observed in presence of nomifensine. The coadministration of CLO and nomifensine produced an additive effect on striatal dopamine release. The results suggest that the effect of CLO on striatal dopamine release is predominantly mediated by an exocytotic mechanism, Ca(2+), vesicular and TTX-dependent and not by a mechanism mediated by dopamine transporter. Published by Elsevier Ireland Ltd.

  9. Removal of sulfamethoxazole, ibuprofen and nitrobenzene by UV and UV/chlorine processes: A comparative evaluation of 275 nm LED-UV and 254 nm LP-UV.

    Kwon, Minhwan; Yoon, Yeojoon; Kim, Seonbaek; Jung, Youmi; Hwang, Tae-Mun; Kang, Joon-Wun

    2018-05-15

    The aim of this study is to evaluate the micropollutant removal capacity of a 275 nm light-emitting diode (LED)-UV/chlorine system. The sulfamethoxazole, ibuprofen, and nitrobenzene removal efficiencies of this system were compared with those of a conventional 254 nm low-pressure (LP)-UV system as a function of the UV dose. In a direct photolysis system, the photon reactivity of sulfamethoxazole is higher than that of nitrobenzene and ibuprofen at both wavelengths. The molar absorption coefficients and quantum yields of each micropollutant were as follows: sulfamethoxazole (ε SMX, 275 nm protonated  = 17,527 M -1  cm -1 , Φ SMX, 275 nm protonated  = 0.239, ε SMX, 275 nm deprotonated  = 8430 M -1  cm -1 , and Φ SMX, 275 nm deprotonated  = 0.026), nitrobenzene (ε NB, 275 nm  = 7176 M -1  cm -1 and Φ NB, 275 nm  = 0.057), and ibuprofen (ε NB, 275 nm  = 200 M -1  cm -1 and Φ IBF, 275 nm  = 0.067). The photon reactivity of chlorine species, i.e., HOCl and OCl-, were determined at 275 nm (ε HOCl, 275 nm  = 28 M -1  cm -1 , Φ HOCl, 275 nm  = 1.97, ε OCl-, 275 nm  = 245 M -1  cm -1 , and Φ OCl-, 275 nm  = 0.8), which indicate that the decomposition rate of OCl - is higher and that of HOCl is lower by 275 nm photolysis than that by 254 nm photolysis (ε HOCl, 254 nm  = 60 M -1  cm -1 , Φ HOCl, 254 nm  = 1.46, ε OCl-, 254 nm  = 58 M -1  cm -1 , and Φ OCl-, 254 nm  = 1.11). In the UV/chlorine system, the removal rates of ibuprofen and nitrobenzene were increased by the formation of OH and reactive chlorine species. The 275-nm LED-UV/chlorine system has higher radical yields at pH 7 and 8 than the 254 nm LP-UV/chlorine system. Copyright © 2018 Elsevier B.V. All rights reserved.

  10. Evidence of martian perchlorate, chlorate, and nitrate in Mars meteorite EETA79001: Implications for oxidants and organics

    Kounaves, Samuel P.; Carrier, Brandi L.; O'Neil, Glen D.; Stroble, Shannon T.; Claire, Mark W.

    2014-02-01

    The results from the Viking mission in the mid 1970s provided evidence that the martian surface contained oxidants responsible for destroying organic compounds. In 2008 the Phoenix Wet Chemistry Lab (WCL) found perchlorate (ClO4-) in three soil samples at concentrations from 0.5 to 0.7 wt%. The detection of chloromethane (CH3Cl) and dichloromethane (CH2Cl2) by the Viking pyrolysis gas chromatograph-mass spectrometer (GC-MS) may have been a result of ClO4- at that site oxidizing either terrestrial organic contaminates or, if present, indigenous organics. Recently, the Sample Analysis at Mars (SAM) instrument on the Mars Science Laboratory (MSL) Curiosity directly measured the presence of CH3Cl, CH2Cl2 and, along with measurements of HCl and oxygen, indirectly indicate the presence of ClO4-. However, except for Phoenix, no other direct measurement of the ClO4- anion in martian soil or rock has been made. We report here ion chromatographic (IC) and isotopic analyses of a unique sawdust portion of the martian meteorite EETA79001 that show the presence by mass of 0.6 ± 0.1 ppm ClO4-, 1.4 ± 0.1 ppm ClO3-, and 16 ± 0.2 ppm NO3- at a quantity and location within the meteorite that is difficult to reconcile with terrestrial contamination. The sawdust sample consists of basaltic material with a minor salt-rich inclusion in a mass ratio of ∼300:1, thus the salts may be 300 times more concentrated within the inclusion than the whole sample. The molar ratios of NO3-:ClO4- and Cl:ClO4-, are very different for EETA79001 at ∼40:1 and 15:1, respectively, than the Antarctic soils and ice near where the meteorite was recovered at ∼10,000:1 and 5000:1, respectively. In addition, the isotope ratios for EETA79001 with δ15N = -10.48 ± 0.32‰ and δ18O = +51.61 ± 0.74‰ are significantly different from that of the nearby Miller Range blue ice with δ15N = +102.80 ± 0.14‰ and δ18O = +43.11 ± 0.64‰. This difference is notable, because if the meteorite had been

  11. Enhanced chlorine dioxide decay in the presence of metal oxides: Relevance to drinking water distribution systems

    Liu, Chao; von Gunten, Urs; Croue, Jean-Philippe

    2013-01-01

    Chlorine dioxide (ClO2) decay in the presence of typical metal oxides occurring in distribution systems was investigated. Metal oxides generally enhanced ClO2 decay in a second-order process via three pathways: (1) catalytic disproportionation with equimolar formation of chlorite and chlorate, (2) reaction to chlorite and oxygen, and (3) oxidation of a metal in a reduced form (e.g., cuprous oxide) to a higher oxidation state. Cupric oxide (CuO) and nickel oxide (NiO) showed significantly stronger abilities than goethite (α-FeOOH) to catalyze the ClO2 disproportionation (pathway 1), which predominated at higher initial ClO2 concentrations (56-81 μM). At lower initial ClO2 concentrations (13-31 μM), pathway 2 also contributed. The CuO-enhanced ClO2 decay is a base-assisted reaction with a third-order rate constant of 1.5 × 10 6 M-2 s-1 in the presence of 0.1 g L -1 CuO at 21 ± 1 C, which is 4-5 orders of magnitude higher than in the absence of CuO. The presence of natural organic matter (NOM) significantly enhanced the formation of chlorite and decreased the ClO 2 disproportionation in the CuO-ClO2 system, probably because of a higher reactivity of CuO-activated ClO2 with NOM. Furthermore, a kinetic model was developed to simulate CuO-enhanced ClO 2 decay at various pH values. Model simulations that agree well with the experimental data include a pre-equilibrium step with the rapid formation of a complex, namely, CuO-activated Cl2O4. The reaction of this complex with OH- is the rate-limiting and pH-dependent step for the overall reaction, producing chlorite and an intermediate that further forms chlorate and oxygen in parallel. These novel findings suggest that the possible ClO2 loss and the formation of chlorite/chlorate should be carefully considered in drinking water distribution systems containing copper pipes. © 2013 American Chemical Society.

  12. Structural modeling and intermolecular correlation of liquid chlorine dioxide

    Ogata, Norio; Hironori, Shimakura; Kawakita, Yukinobu; Ohara, Yukoji; Kohara, Shinji; Takeda, Shinichi

    2009-01-01

    Chlorine dioxide (ClO 2 ) is water-soluble yellow gas at room temperature. It has long been used as a disinfectant of tap water and various commodities owing to its strong oxidizing activity against various microbial proteins. The oxidizing activity is believed to be due to the presence of unpaired electron in its molecular orbital. Despite wealth of physicochemical studies of gaseous ClO 2 , little is known about liquid ClO 2 , especially about fine molecular structure and intermolecular interactions of liquid ClO 2 . The purpose of this study is to elucidate the fine structure and intermolecular orientations of ClO 2 molecules in its liquid state using a high-energy X-ray diffraction technique. The measurements of liquid ClO 2 were carried out at -50 to 0 degree Celsius using a two-axis diffractometer installed at the BL04B2 beamline in the third-generation synchrotron radiation facility SPring-8 (Hyogo, Japan). The incident X-ray beamline was 113.4 keV in energy and 0.1093 Armstrong in wavelength from a Si(111) monochromator with the third harmonic reflection. Liquid ClO 2 held in a quartz capillary tube was placed in a temperature-controlled vacuum chamber. We obtained a structure factor S(Q) to a range of Q = 0.3-30 Amstrong -1 and a pair distribution function g(r) upon Fourier transform of the S(Q). The total g(r) showed peaks at 1.46, 2.08, 2.48, 3.16 and 4.24 Armstrong. From intramolecular bond lengths of 1.46 Armstrong for Cl-O and 2.48 Armstrong for O-O, O-Cl-O bond angle was estimated to be 116.1 degrees. Peaks at 3.16 and 4.24 Armstrong in the total g(r) strongly indicate presence of specific intermolecular orientations of ClO 2 molecules that are distinct from those observed as a dimer in the solid phase ClO 2 . This view was further supported by molecular simulation using a reverse Monte Carlo method (RMC). (author)

  13. Enhanced chlorine dioxide decay in the presence of metal oxides: Relevance to drinking water distribution systems

    Liu, Chao

    2013-07-19

    Chlorine dioxide (ClO2) decay in the presence of typical metal oxides occurring in distribution systems was investigated. Metal oxides generally enhanced ClO2 decay in a second-order process via three pathways: (1) catalytic disproportionation with equimolar formation of chlorite and chlorate, (2) reaction to chlorite and oxygen, and (3) oxidation of a metal in a reduced form (e.g., cuprous oxide) to a higher oxidation state. Cupric oxide (CuO) and nickel oxide (NiO) showed significantly stronger abilities than goethite (α-FeOOH) to catalyze the ClO2 disproportionation (pathway 1), which predominated at higher initial ClO2 concentrations (56-81 μM). At lower initial ClO2 concentrations (13-31 μM), pathway 2 also contributed. The CuO-enhanced ClO2 decay is a base-assisted reaction with a third-order rate constant of 1.5 × 10 6 M-2 s-1 in the presence of 0.1 g L -1 CuO at 21 ± 1 C, which is 4-5 orders of magnitude higher than in the absence of CuO. The presence of natural organic matter (NOM) significantly enhanced the formation of chlorite and decreased the ClO 2 disproportionation in the CuO-ClO2 system, probably because of a higher reactivity of CuO-activated ClO2 with NOM. Furthermore, a kinetic model was developed to simulate CuO-enhanced ClO 2 decay at various pH values. Model simulations that agree well with the experimental data include a pre-equilibrium step with the rapid formation of a complex, namely, CuO-activated Cl2O4. The reaction of this complex with OH- is the rate-limiting and pH-dependent step for the overall reaction, producing chlorite and an intermediate that further forms chlorate and oxygen in parallel. These novel findings suggest that the possible ClO2 loss and the formation of chlorite/chlorate should be carefully considered in drinking water distribution systems containing copper pipes. © 2013 American Chemical Society.

  14. Inactivation characteristics of ozone and electrolysis process for ballast water treatment using B. subtilis spores as a probe.

    Jung, Youmi; Yoon, Yeojoon; Hong, Eunkyung; Kwon, Minhwan; Kang, Joon-Wun

    2013-07-15

    Since ballast water affects the ocean ecosystem, the International Maritime Organization (IMO) sets a standard for ballast water management and might impose much tighter regulations in the future. The aim of this study is to evaluate the inactivation efficiency of ozonation, electrolysis, and an ozonation-electrolysis combined process, using B. subtilis spores. In seawater ozonation, HOBr is the key active substance for inactivation, because of rapid reactivity of ozone with Br(-) in seawater. In seawater electrolysis, it is also HOBr, but not HOCl, because of the rapid reaction of HOCl with Br(-), which has not been recognized carefully, even though many electrolysis technologies have been approved by the IMO. Inactivation pattern was different in ozonation and electrolysis, which has some limitations with the tailing or lag-phase, respectively. However, each deficiency can be overcome with a combined process, which is most effective as a sequential application of ozonation followed by electrolysis. Copyright © 2013 Elsevier Ltd. All rights reserved.

  15. Low-density lipoprotein modified by myeloperoxidase oxidants induces endothelial dysfunction

    Abdo, Adrian; Rayner, B.S.; van Reyk, D.M.

    2017-01-01

    Low-density lipoprotein (LDL) modified by hypochlorous acid (HOCl) produced by myeloperoxidase (MPO) is present in atherosclerotic lesions, where it is implicated in the propagation of inflammation and acceleration of lesion development by multiple pathways, including the induction of endothelial......, although emerging evidence suggests that these particles have distinct biological properties. This is important because elevated plasma SCN- is linked with both the propagation and prevention of atherosclerosis. In this study, we demonstrate that both HOSCN- and HOCl-modified LDL inhibit endothelium......-mediated vasorelaxation ex vivo in rat aortic ring segments. In vitro experiments with human coronary artery endothelial cells show that HOSCN-modified LDL decreases in the production of nitric oxide (NO•) and induces the loss of endothelial nitric oxide synthase (eNOS) activity. This occurs to a similar extent...

  16. Preformulation study and influence of DMSO and propylene glycol on the antioxidant action of isocoumarin paepalantine isolated from Paepalanthus bromelioides

    João Paulo Loureiro Damasceno

    Full Text Available AbstractCoumarins are phenolic compounds and have various biological properties, including antioxidant activity. The isocoumarin paepalantine, isolated from of Paepalanthus bromelioides Silveira, Eriocaulaceae, exhibits a wide range of biological activities, including antimicrobial, anti-inflammatory, antioxidant and cytotoxic properties. Studies on paepalantine often use dimethylsulfoxide as a solvent. However the dimethylsulfoxide interferes with antimicrobial, cytotoxic and antioxidant assays. Thus, this study aims to evaluate alternative solvents for paepalantine and evaluate their potential to interfere with antioxidant assays (ABTS•+, O2•-, HOCl. Of the selected solvents, propylene glycol had good solubility and remained stable throughout the study period. The results suggested that there is no interference from propylene glycol in antioxidant assays, while dimethylsulfoxide significantly interfered with the HOCl assay. The antioxidant assays showed that paepalantine demonstrated similar or even better antioxidant activity than Trolox. Thus, propylene glycol may be the solvent of choice for paepalantine, a compound that has significant biological potential.

  17. Determinants of disinfectant pretreatment efficacy for nitrosamine control in chloraminated drinking water.

    McCurry, Daniel L; Krasner, Stuart W; von Gunten, Urs; Mitch, William A

    2015-11-01

    Utilities using chloramines need strategies to mitigate nitrosamine formation to meet potential future nitrosamine regulations. The ability to reduce NDMA formation under typical post-chloramination conditions of pretreatment with ultraviolet light from a low pressure mercury lamp (LPUV), free chlorine (HOCl), ozone (O3), and UV light from a medium pressure mercury lamp (MPUV) were compared at exposures relevant to drinking water treatment. The order of efficacy after application to waters impacted by upstream wastewater discharges was O3 > HOCl ≈ MPUV > LPUV. NDMA precursor abatement generally did not correlate well between oxidants, and waters exhibited different behaviors with respect to pH and temperature, suggesting a variety of source-dependent NDMA precursors. For wastewater-impacted waters, the observed pH dependence for precursor abatement suggested the important role of secondary or tertiary amine precursors. Although hydroxyl radicals did not appear to be important for NDMA precursor abatement during O3 or MPUV pretreatment, the efficacy of MPUV correlated strongly with dissolved organic carbon concentration (p = 0.01), suggesting alternative indirect photochemical pathways. The temperature dependences during pre- and post-disinfection indicated that NDMA formation is likely to increase during warm seasons for O3 pretreatment, decrease for HOCl pretreatment, and remain unchanged for MPUV treatment, although seasonal changes in source water quality may counteract the temperature effects. For two waters impacted by relatively high polyDADMAC coagulant doses, pretreatment with HOCl, O3, and MPUV increased NDMA formation during post-chloramination. For O3 pretreatment, hydroxyl radicals likely led to precursor formation from the polymer in the latter tests. MPUV treatment of polymer-impacted water increased subsequent NDMA formation through an indirect photochemical process. Many factors may mitigate the importance of this increased NDMA formation

  18. Myeloperoxidase amplified high glucose-induced endothelial dysfunction in vasculature: Role of NADPH oxidase and hypochlorous acid.

    Tian, Rong; Ding, Yun; Peng, Yi-Yuan; Lu, Naihao

    2017-03-11

    Nicotinamide adenine dinucleotide phosphate (NADPH) oxidase-derived reactive oxygen species (ROS) such as superoxide and hydrogen peroxide (H 2 O 2 ), have emerged as important molecules in the pathogenesis of diabetic endothelial dysfunction. Additionally, neutrophils-derived myeloperoxidase (MPO) and MPO-catalyzed hypochlorous acid (HOCl) play important roles in the vascular injury. However, it is unknown whether MPO can use vascular-derived ROS to induce diabetic endothelial dysfunction. In the present study, we demonstrated that NADPH oxidase was the main source of ROS formation in high glucose-cultured human umbilical vein endothelial cells (HUVECs), and played a critical role in high glucose-induced endothelial dysfunction such as cell apoptosis, loss of cell viability and reduction of nitric oxide (NO). However, the addition of MPO could amplify the high glucose-induced endothelial dysfunction which was inhibited by the presence of apocynin (NADPH oxidase inhibitor), catalase (H 2 O 2 scavenger), or methionine (HOCl scavenger), demonstrating the contribution of NADPH oxidase-H 2 O 2 -MPO-HOCl pathway in the MPO/high glucose-induced vascular injury. In high glucose-incubated rat aortas, MPO also exacerbated the NADPH oxidase-induced impairment of endothelium-dependent relaxation. Consistent with these in vitro data, in diabetic rat aortas, both MPO expresion and NADPH oxidase activity were increased while the endothelial function was simultaneously impaired. The results suggested that vascular-bound MPO could amplify high glucose-induced vascular injury in diabetes. MPO-NADPH oxidase-HOCl may represent an important pathogenic pathway in diabetic vascular diseases. Copyright © 2017 Elsevier Inc. All rights reserved.

  19. White line structure in the x-ray Lsub(III) absorption edge of holmium

    Agarwal, B.K.; Agarwal, B.R.K.

    1978-01-01

    The white line at the Ho Lsub(III) absorption edge has been recorded in Ho metal, Ho 2 O 3 and HoCl 3 . The white line structure in Ho 2 O 3 has been analysed by regarding it as due to the transition into bound states of the Lsub(III) excited ion. The extended fine structure has been used to obtain information on the bond lengths in the compounds. (author)

  20. N-acetyl lysyltyrosylcysteine amide inhibits myeloperoxidase, a novel tripeptide inhibitor1[S

    Zhang, Hao; Jing, Xigang; Shi, Yang; Xu, Hao; Du, Jianhai; Guan, Tongju; Weihrauch, Dorothee; Jones, Deron W.; Wang, Weiling; Gourlay, David; Oldham, Keith T.; Hillery, Cheryl A.; Pritchard, Kirkwood A.

    2013-01-01

    Myeloperoxidase (MPO) plays important roles in disease by increasing oxidative and nitrosative stress and oxidizing lipoproteins. Here we report N-acetyl lysyltyrosylcysteine amide (KYC) is an effective inhibitor of MPO activity. We show KYC inhibits MPO-mediated hypochlorous acid (HOCl) formation and nitration/oxidation of LDL. Disulfide is the major product of MPO-mediated KYC oxidation. KYC (⩽4,000 μM) does not induce cytotoxicity in bovine aortic endothelial cells (BAECs). KYC inhibits HO...

  1. Cytotoxicity towards human endothelial cells, induced by neutrophil myeloperoxidase: protection by ceftazidime

    M. Mathy-Hartert

    1995-01-01

    Full Text Available We investigated the effects of the antibiotic ceftazidime (CAZ on the cytolytic action of the neutrophil myeloperoxidase–hydrogen peroxide–chloride anion system (MPO/H2O2/Cl−. In this system, myeloperoxidase catalyses the conversion of H2O2 and CI− to the cytotoxic agent HOCl. Stimulated neutrophils can release MPO into the extracellular environment and then may cause tissue injury through direct endothelial cells lysis. We showed that human umbilical vein endothelial cells (HUVEC were capable of taking up active MPO. In presence of H2O2 (10−4 M, this uptake was accompanied by cell lysis. The cytolysis was estimated by the release of 51Cr from HUVEC and expressed as an index of cytotoxicity (IC. Dose dependent protection was obtained for CAZ concentrations ranging from 10−5 to 10−3 M;this can be attributed to inactivation of HOCl by the drug. This protection is comparable to that obtained with methionine and histidine, both of which are known to neutralize HOCl. This protection by CAZ could also be attributed to inactivation of H2O2, but when cytolysis was achieved with H2O2 or O2− generating enzymatic systems, no protection by CAZ was observed. Moreover, the peroxidation activity of MPO (action on H2O2 was not affected by CAZ, while CAZ prevented the chlorination activity of MPO (chlorination of monochlorodimedon. So, we concluded that CAZ acts via HOCl inactivation. These antioxidant properties of CAZ may be clinically useful in pathological situations where excessive activation of neutrophils occurs, such as in sepsis.

  2. Formation of chlorinated breakdown products during degradation of sunscreen agent, 2-ethylhexyl-4-methoxycinnamate in the presence of sodium hypochlorite

    Gackowska , Alicja; Przybyłek , Maciej; Studziński , Waldemar; Gaca , Jerzy

    2016-01-01

    International audience; In this study, a new degradation path of sunscreen active ingredient, 2-ethylhexyl-4-methoxycinnamate (EHMC) and 4-methoxycinnamic acid (MCA) in the presence of sodium hypochlorite (NaOCl), was discussed. The reaction products were detected using gas chromatography–mass spectrometry (GC-MS). Since HOCl treatment leads to more polar products than EHMC, application of polar extracting agents, dichloromethane and ethyl acetate/n-hexane mixture, gave better results in term...

  3. Formation of chlorinated breakdown products during degradation of sunscreen agent, 2-ethylhexyl-4-methoxycinnamate in the presence of sodium hypochlorite

    Gackowska, Alicja; Przybyłek, Maciej; Studziński, Waldemar; Gaca, Jerzy

    2018-01-01

    In this study, a new degradation path of sunscreen active ingredient, 2-ethylhexyl-4-methoxycinnamate (EHMC) and 4-methoxycinnamic acid (MCA) in the presence of sodium hypochlorite (NaOCl), was discussed. The reaction products were detected using gas chromatography-mass spectrometry (GC-MS). Since HOCl treatment leads to more polar products than EHMC, application of polar extracting agents, dichloromethane and ethyl acetate/n-hexane mixture, gave better results in terms of chlorinated breakdo...

  4. Formation of chlorinated breakdown products during degradation of sunscreen agent, 2-ethylhexyl-4-methoxycinnamate in the presence of sodium hypochlorite

    Gackowska, Alicja; Przyby?ek, Maciej; Studzi?ski, Waldemar; Gaca, Jerzy

    2015-01-01

    In this study, a new degradation path of sunscreen active ingredient, 2-ethylhexyl-4-methoxycinnamate (EHMC) and 4-methoxycinnamic acid (MCA) in the presence of sodium hypochlorite (NaOCl), was discussed. The reaction products were detected using gas chromatography?mass spectrometry (GC-MS). Since HOCl treatment leads to more polar products than EHMC, application of polar extracting agents, dichloromethane and ethyl acetate/n-hexane mixture, gave better results in terms of chlorinated breakdo...

  5. Levels of inflammation and oxidative stress, and a role for taurine in dystropathology of the Golden Retriever Muscular Dystrophy dog model for Duchenne Muscular Dystrophy.

    Terrill, Jessica R; Duong, Marisa N; Turner, Rufus; Le Guiner, Caroline; Boyatzis, Amber; Kettle, Anthony J; Grounds, Miranda D; Arthur, Peter G

    2016-10-01

    Duchenne Muscular Dystrophy (DMD) is a fatal skeletal muscle wasting disease presenting with excessive myofibre necrosis and increased inflammation and oxidative stress. In the mdx mouse model of DMD, homeostasis of the amino acid taurine is altered, and taurine administration drastically decreases muscle necrosis, dystropathology, inflammation and protein thiol oxidation. Since the severe pathology of the Golden Retriever Muscular Dystrophy (GRMD) dog model more closely resembles the human DMD condition, we aimed to assess the generation of oxidants by inflammatory cells and taurine metabolism in this species. In muscles of 8 month GRMD dogs there was an increase in the content of neutrophils and macrophages, and an associated increase in elevated myeloperoxidase, a protein secreted by neutrophils that catalyses production of the highly reactive hypochlorous acid (HOCl). There was also increased chlorination of tyrosines, a marker of HOCl generation, increased thiol oxidation of many proteins and irreversible oxidative protein damage. Taurine, which functions as an antioxidant by trapping HOCl, was reduced in GRMD plasma; however taurine was increased in GRMD muscle tissue, potentially due to increased muscle taurine transport and synthesis. These data indicate a role for HOCl generated by neutrophils in the severe dystropathology of GRMD dogs, which may be exacerbated by decreased availability of taurine in the blood. These novel data support continued research into the precise roles of oxidative stress and taurine in DMD and emphasise the value of the GRMD dogs as a suitable pre-clinical model for testing taurine as a therapeutic intervention for DMD boys. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

  6. Chlorination of tramadol: Reaction kinetics, mechanism and genotoxicity evaluation.

    Cheng, Hanyang; Song, Dean; Chang, Yangyang; Liu, Huijuan; Qu, Jiuhui

    2015-12-01

    Tramadol (TRA) is one of the most detected analgesics in environmental matrices, and it is of high significance to study the reactivity of TRA during chlorination considering its potential toxicity to the environment. The chlorine/TRA reaction is first order with respect to the TRA concentration, and a combination of first-order and second-order with respect to chlorine concentration. The pH dependence of the observed rate constants (kobs) showed that the TRA oxidation reactivity increased with increasing pH. kobs can be quantitatively described by considering all active species including Cl2, Cl2O and HOCl, and the individual rate constants of HOCl/TRA(0), HOCl/TRAH(+), Cl2/TRA and Cl2O/TRA reactions were calculated to be (2.61±0.29)×10(3)M(-1)s(-1), 14.73±4.17M(-1)s(-1), (3.93±0.34)×10(5)M(-1)s(-1) and (5.66±1.83)×10(6)M(-1)s(-1), respectively. Eleven degradation products were detected with UPLC-Q-TOF-MS, and the corresponding structures of eight products found under various pH conditions were proposed. The amine group was proposed to be the initial attack site under alkaline pH conditions, where reaction of the deprotonated amine group with HOCl is favorable. Under acidic and neutral pH conditions, however, two possible reaction pathways were proposed. One is an electrophilic substitution on the aromatic ring, and another is an electrophilic substitution on the nitrogen, leading to an N-chlorinated intermediate, which can be further oxidized. Finally, the SOS/umu test showed that the genotoxicity of TRA chlorination products increased with increasing dosage of chlorine, which was mostly attributed to the formation of some chlorine substitution products. Copyright © 2015 Elsevier Ltd. All rights reserved.

  7. A New Bioinspired Perchlorate Reduction Catalyst with Significantly Enhanced Stability via Rational Tuning of Rhenium Coordination Chemistry and Heterogeneous Reaction Pathway.

    Liu, Jinyong; Han, Mengwei; Wu, Dimao; Chen, Xi; Choe, Jong Kwon; Werth, Charles J; Strathmann, Timothy J

    2016-06-07

    Rapid reduction of aqueous ClO4(-) to Cl(-) by H2 has been realized by a heterogeneous Re(hoz)2-Pd/C catalyst integrating Re(O)(hoz)2Cl complex (hoz = oxazolinyl-phenolato bidentate ligand) and Pd nanoparticles on carbon support, but ClOx(-) intermediates formed during reactions with concentrated ClO4(-) promote irreversible Re complex decomposition and catalyst deactivation. The original catalyst design mimics the microbial ClO4(-) reductase, which integrates Mo(MGD)2 complex (MGD = molybdopterin guanine dinucleotide) for oxygen atom transfer (OAT). Perchlorate-reducing microorganisms employ a separate enzyme, chlorite dismutase, to prevent accumulation of the destructive ClO2(-) intermediate. The structural intricacy of MGD ligand and the two-enzyme mechanism for microbial ClO4(-) reduction inspired us to improve catalyst stability by rationally tuning Re ligand structure and adding a ClOx(-) scavenger. Two new Re complexes, Re(O)(htz)2Cl and Re(O)(hoz)(htz)Cl (htz = thiazolinyl-phenolato bidentate ligand), significantly mitigate Re complex decomposition by slightly lowering the OAT activity when immobilized in Pd/C. Further stability enhancement is then obtained by switching the nanoparticles from Pd to Rh, which exhibits high reactivity with ClOx(-) intermediates and thus prevents their deactivating reaction with the Re complex. Compared to Re(hoz)2-Pd/C, the new Re(hoz)(htz)-Rh/C catalyst exhibits similar ClO4(-) reduction activity but superior stability, evidenced by a decrease of Re leaching from 37% to 0.25% and stability of surface Re speciation following the treatment of a concentrated "challenge" solution containing 1000 ppm of ClO4(-). This work demonstrates the pivotal roles of coordination chemistry control and tuning of individual catalyst components for achieving both high activity and stability in environmental catalyst applications.

  8. Disinfection of Penicillium-infected Wheat Seed by Gaseous Chlorine Dioxide

    Young-ah Jeon

    2015-06-01

    Full Text Available Seeds of wheat (Triticum aestivum L. cv. Olgeurumil were infected with Penicillium sp. at mean infection rate of 83%. Penicillium sp. was detected in endosperm with bran but not in embryo. Gaseous chlorine dioxide (ClO2 effectively inhibited growth of Penicillium sp. at concentration of 5 to 20 mg/ml. As treatment duration was extended from 1 to 3 h, growth of Penicillium sp. was completely suppressed even at 10 mg/ml. There was no significant reduction in the incidence of Penicillium sp. at 30% relative humidity (RH. However, the incidence of Penicillium sp. was 27.7% at 50% RH, further those were 3.5% and 0.2% at 70% and 80% RH, respectively. Seed germination was not affected by ClO2 treatment at all the RH conditions. Water-soaked seeds (30% seed moisture content showed a drastic reduction in the incidence of Penicillium sp. when treated at more than 10 mg/ml of ClO2. The incidences of Penicillium sp. were 3.3, 1.8 and 1.2% at 10, 15 and 20 mg/ml, respectively. The incidence of Penicillium sp. in dry seeds with 9.7% seed moisture content did not reduce when treated with 5 and 10 mg/ml at 50% RH although it tended to decrease as ClO2 concentration increased to 20 mg/ml. Seed germination was not affected by ClO2 treatment at the tested concentrations. These results indicated that gaseous ClO2 was effective disinfectant to wheat seeds infected with Penicillium sp. and that the effectiveness of ClO2 strongly increased when moisture content around or inside of the seed was increased.

  9. Oxidation of fluoroquinolone antibiotics and structurally related amines by chlorine dioxide: Reaction kinetics, product and pathway evaluation.

    Wang, Pei; He, Yi-Liang; Huang, Ching-Hua

    2010-12-01

    Fluoroquinolones (FQs) are a group of widely prescribed antibiotics and have been frequently detected in the aquatic environment. The reaction kinetics and transformation of seven FQs (ciprofloxacin (CIP), enrofloxacin (ENR), norfloxacin (NOR), ofloxacin (OFL), lomefloxacin (LOM), pipemidic acid (PIP) and flumequine (FLU)) and three structurally related amines (1-phenylpiperazine (PP), N-phenylmorpholine (PM) and 4-phenylpiperidine (PD)) toward chlorine dioxide (ClO(2)) were investigated to elucidate the behavior of FQs during ClO(2) disinfection processes. The reaction kinetics are highly pH-dependent, can be well described by a second-order kinetic model incorporating speciation of FQs, and follow the trend of OFL > ENR > CIP ∼ NOR ∼ LOM > > PIP in reactivity. Comparison among FQs and related amines and product characterization indicate that FQs' piperazine ring is the primary reactive center toward ClO(2). ClO(2) likely attacks FQ's piperazinyl N4 atom followed by concerted fragmentation involving piperazinyl N1 atom, leading to dealkylation, hydroxylation and intramolecular ring closure at the piperazine moiety. While FQs with tertiary N4 react faster with ClO(2) than FQs with secondary N4, the overall reactivity of the piperazine moiety also depends strongly on the quinolone ring through electronic effects. The reaction rate constants obtained in clean water matrix can be used to model the decay of CIP by ClO(2) in surface water samples, but overestimate the decay in wastewater samples. Overall, transformation of FQs, particularly for those with tertiary N4 amines, could be expected under typical ClO(2) disinfection conditions. However, the transformation may not eliminate antibacterial activity because of little destruction at the quinolone ring. Copyright © 2010 Elsevier Ltd. All rights reserved.

  10. Factors affecting the roles of reactive species in the degradation of micropollutants by the UV/chlorine process.

    Wu, Zihao; Guo, Kaiheng; Fang, Jingyun; Yang, Xueqin; Xiao, Hong; Hou, Shaodong; Kong, Xiujuan; Shang, Chii; Yang, Xin; Meng, Fangang; Chen, Liwei

    2017-12-01

    The UV/chlorine process is an emerging advanced oxidation process (AOP) that produces various reactive species, such as hydroxyl radicals (HO) and reactive chlorine species (RCS). The effects of the treatment conditions, such as chlorine dosage and pH, and the water matrix components of natural organic matter (NOM), alkalinity, ammonia and halides, on the kinetics and reactive species in the degradation of four micropollutants, metronidazole (MDZ), nalidixic acid (NDA), diethyltoluamide (DEET) and caffeine (CAF), by the UV/chlorine process were investigated. The degradation of MDZ and CAF was primarily attributable to HO and ClO, respectively, while that of NDA was primarily attributable to both ClO and CO 3 - . HO, Cl and CO 3 - are important for the degradation of DEET. The second-order rate constants for ClO with CAF and CO 3 - with NDA were determined to be 5.1 (±0.2) × 10 7  M -1 s -1 and 1.4 (±0.1) × 10 7  M -1 s -1 , respectively. Increasing chlorine dosage slightly changed the contribution of HO but linearly increased that of ClO to micropollutant degradation. Increasing pH decreased the contribution of either HO or Cl but not that of ClO. Both NOM and bicarbonate decreased the contributions of HO and Cl, whereas NOM but not bicarbonate significantly decreased that of ClO. The contribution of either HO or Cl first rose and then fell as the molar ratio of ammonia to chlorine increased from 0 to 1:1, while that of ClO decreased. The co-presence of high concentrations of Cl - and Br - enhanced the contribution of ClBr - and BrCl. Copyright © 2017 Elsevier Ltd. All rights reserved.

  11. Chlorinated Phospholipids and Fatty Acids: (Pathophysiological Relevance, Potential Toxicity, and Analysis of Lipid Chlorohydrins

    Jenny Schröter

    2016-01-01

    Full Text Available Chlorinated phospholipids are formed by the reaction of hypochlorous acid (HOCl, generated by the enzyme myeloperoxidase under inflammatory conditions, and the unsaturated fatty acyl residues or the head group. In the first case the generated chlorohydrins are both proinflammatory and cytotoxic, thus having a significant impact on the structures of biomembranes. The latter case leads to chloramines, the properties of which are by far less well understood. Since HOCl is also widely used as a disinfecting and antibacterial agent in medicinal, industrial, and domestic applications, it may represent an additional source of danger in the case of abuse or mishandling. This review discusses the reaction behavior of in vivo generated HOCl and biomolecules like DNA, proteins, and carbohydrates but will focus on phospholipids. Not only the beneficial and pathological (toxic effects of chlorinated lipids but also the importance of these chlorinated species is discussed. Some selected cleavage products of (chlorinated phospholipids and plasmalogens such as lysophospholipids, (chlorinated free fatty acids and α-chloro fatty aldehydes, which are all well known to massively contribute to inflammatory diseases associated with oxidative stress, will be also discussed. Finally, common analytical methods to study these compounds will be reviewed with focus on mass spectrometric techniques.

  12. A Modern Approach to Disinfection, as Old as the Evolution of Vertebrates

    Franco Migliarina

    2014-12-01

    Full Text Available The immune system of vertebrates “naturally” produces hypochlorous acid (HOCl to fight against bacteria and pathogens. A patented electrochemical technology mirrors the above defense system, allowing the synthesis of HOCl solutions through the electrolysis of water enriched in salts, at the level of a few grams per liter. The system allows for the careful control of the pH of produced solutions, with consequent optimization of their activity. Once the HOCl is introduced into the water system; it is able to remove the biofilm from pipe network; significantly decreasing the level of Legionella colonization; within 8–10 weeks from the beginning of the disinfection approach. The technology has been applied in a variety of healthcare facilities, both in Italy and in neighboring European countries. In the present paper, two successful case studies are briefly presented: Data were obtained from experiences in two different healthcare facilities, one in Italy and the other in Germany. Destruction of biofilm was indirectly testified by an increase of total organic carbon content of water; as a consequence, and because of the dosing of the disinfecting agent, some μg/L of total halomethanes were also formed. However, both compositional features were only observed during the initial stages of the disinfection treatment.

  13. N-acetyl lysyltyrosylcysteine amide inhibits myeloperoxidase, a novel tripeptide inhibitor1[S

    Zhang, Hao; Jing, Xigang; Shi, Yang; Xu, Hao; Du, Jianhai; Guan, Tongju; Weihrauch, Dorothee; Jones, Deron W.; Wang, Weiling; Gourlay, David; Oldham, Keith T.; Hillery, Cheryl A.; Pritchard, Kirkwood A.

    2013-01-01

    Myeloperoxidase (MPO) plays important roles in disease by increasing oxidative and nitrosative stress and oxidizing lipoproteins. Here we report N-acetyl lysyltyrosylcysteine amide (KYC) is an effective inhibitor of MPO activity. We show KYC inhibits MPO-mediated hypochlorous acid (HOCl) formation and nitration/oxidation of LDL. Disulfide is the major product of MPO-mediated KYC oxidation. KYC (⩽4,000 μM) does not induce cytotoxicity in bovine aortic endothelial cells (BAECs). KYC inhibits HOCl generation by phorbol myristate acetate (PMA)-stimulated neutrophils and human promyelocytic leukemia (HL-60) cells but not superoxide generation by PMA-stimulated HL-60 cells. KYC inhibits MPO-mediated HOCl formation in BAEC culture and protects BAECs from MPO-induced injury. KYC inhibits MPO-mediated lipid peroxidation of LDL whereas tyrosine (Tyr) and tryptophan (Trp) enhance oxidation. KYC is unique as its isomers do not inhibit MPO activity, or are much less effective. Ultraviolet-visible spectral studies indicate KYC binds to the active site of MPO and reacts with compounds I and II. Docking studies show the Tyr of KYC rests just above the heme of MPO. Interestingly, KYC increases MPO-dependent H2O2 consumption. These data indicate KYC is a novel and specific inhibitor of MPO activity that is nontoxic to endothelial cell cultures. Accordingly, KYC may be useful for treating MPO-mediated vascular disease. PMID:23883583

  14. N-acetyl lysyltyrosylcysteine amide inhibits myeloperoxidase, a novel tripeptide inhibitor.

    Zhang, Hao; Jing, Xigang; Shi, Yang; Xu, Hao; Du, Jianhai; Guan, Tongju; Weihrauch, Dorothee; Jones, Deron W; Wang, Weiling; Gourlay, David; Oldham, Keith T; Hillery, Cheryl A; Pritchard, Kirkwood A

    2013-11-01

    Myeloperoxidase (MPO) plays important roles in disease by increasing oxidative and nitrosative stress and oxidizing lipoproteins. Here we report N-acetyl lysyltyrosylcysteine amide (KYC) is an effective inhibitor of MPO activity. We show KYC inhibits MPO-mediated hypochlorous acid (HOCl) formation and nitration/oxidation of LDL. Disulfide is the major product of MPO-mediated KYC oxidation. KYC (≤4,000 μM) does not induce cytotoxicity in bovine aortic endothelial cells (BAECs). KYC inhibits HOCl generation by phorbol myristate acetate (PMA)-stimulated neutrophils and human promyelocytic leukemia (HL-60) cells but not superoxide generation by PMA-stimulated HL-60 cells. KYC inhibits MPO-mediated HOCl formation in BAEC culture and protects BAECs from MPO-induced injury. KYC inhibits MPO-mediated lipid peroxidation of LDL whereas tyrosine (Tyr) and tryptophan (Trp) enhance oxidation. KYC is unique as its isomers do not inhibit MPO activity, or are much less effective. Ultraviolet-visible spectral studies indicate KYC binds to the active site of MPO and reacts with compounds I and II. Docking studies show the Tyr of KYC rests just above the heme of MPO. Interestingly, KYC increases MPO-dependent H₂O₂ consumption. These data indicate KYC is a novel and specific inhibitor of MPO activity that is nontoxic to endothelial cell cultures. Accordingly, KYC may be useful for treating MPO-mediated vascular disease.

  15. Reaction of protein chloramines with DNA and nucleosides

    Hawkins, Clare Louise; Pattison, David I; Davies, Michael Jonathan

    2002-01-01

    Stimulated phagocyte cells produce the oxidant HOCl, via the release of the enzyme myeloperoxidase and hydrogen peroxide. HOCl is important in bacterial cell killing, but excessive or misplaced generation can damage the host tissue and may lead to the development of certain diseases such as cance......, 50-80% of the HOCl is predicted to react with histone lysine and histidine residues to yield chloramines. The yield and stability of such chloramines predicted by these modelling studies agrees well with experimental data. Decomposition of these species gives protein-derived, nitrogen......-centred radicals, probably on the lysine side chains, as characterized by the EPR and spin-trapping experiments. It is shown that isolated lysine, histidine, peptide and protein chloramines can react with plasmid DNA to cause strand breaks. The protection against such damage afforded by the radical scavengers...... to give nucleobase radicals. Further evidence for the formation of such covalent cross-links has been obtained from experiments performed using (3)H-lysine and (14)C-histidine chloramines. These results are consistent with the predictions of the kinetic model and suggest that histones are major targets...

  16. Global patterns and environmental controls of perchlorate and nitrate co-occurrence in arid and semi-arid environments

    Jackson, W Andrew; Böhlke, John Karl; Andraski, Brian J.; Fahlquist, Lynne S.; Bexfield, Laura M.; Eckardt, Frank D.; Gates, John B.; Davila, Alfonso F.; McKay, Christopher P.; Rao, Balaji; Sevanthi, Ritesh; Rajagopalan, Srinath; Estrada, Nubia; Sturchio, Neil C.; Hatzinger, Paul B.; Anderson, Todd A.; Orris, Greta J.; Betancourt, Julio L.; Stonestrom, David A.; Latorre, Claudio; Li, Yanhe; Harvey, Gregory J.

    2015-01-01

    Natural perchlorate (ClO4−) is of increasing interest due to its wide-spread occurrence on Earth and Mars, yet little information exists on the relative abundance of ClO4− compared to other major anions, its stability, or long-term variations in production that may impact the observed distributions. Our objectives were to evaluate the occurrence and fate of ClO4− in groundwater and soils/caliche in arid and semi-arid environments (southwestern United States, southern Africa, United Arab Emirates, China, Antarctica, and Chile) and the relationship of ClO4− to the more well-studied atmospherically deposited anions NO3−and Cl− as a means to understand the prevalent processes that affect the accumulation of these species over various time scales. ClO4− is globally distributed in soil and groundwater in arid and semi-arid regions on Earth at concentrations ranging from 10−1to 106 μg/kg. Generally, the ClO4− concentration in these regions increases with aridity index, but also depends on the duration of arid conditions. In many arid and semi-arid areas, NO3− and ClO4− co-occur at molar ratios (NO3−/ClO4−) that vary between ∼104and 105. We hypothesize that atmospheric deposition ratios are largely preserved in hyper-arid areas that support little or no biological activity (e.g. plants or bacteria), but can be altered in areas with more active biological processes including N2 fixation, N mineralization, nitrification, denitrification, and microbial ClO4− reduction, as indicated in part by NO3− isotope data. In contrast, much larger ranges of Cl−/ClO4− and Cl−/NO3−ratios indicate Cl− varies independently from both ClO4− and NO3−. The general lack of correlation between Cl− and ClO4− or NO3− implies that Cl− is not a good indicator of co-deposition and should be used with care when interpreting oxyanion cycling in arid systems. The Atacama Desert appears to be unique compared to all other terrestrial locations having a

  17. Stable isotope analyses of oxygen (18O:17O:16O) and chlorine (37Cl:35Cl) in perchlorate: reference materials, calibrations, methods, and interferences

    Böhlke, John Karl; Mroczkowski, Stanley J.; Sturchio, Neil C.; Heraty, Linnea J.; Richman, Kent W.; Sullivan, Donald B.; Griffith, Kris N.; Gu, Baohua; Hatzinger, Paul B.

    2017-01-01

    RationalePerchlorate (ClO4−) is a common trace constituent of water, soils, and plants; it has both natural and synthetic sources and is subject to biodegradation. The stable isotope ratios of Cl and O provide three independent quantities for ClO4− source attribution and natural attenuation studies: δ37Cl, δ18O, and δ17O (or Δ17O or 17Δ) values. Documented reference materials, calibration schemes, methods, and interferences will improve the reliability of such studies.MethodsThree large batches of KClO4 with contrasting isotopic compositions were synthesized and analyzed against VSMOW-SLAP, atmospheric O2, and international nitrate and chloride reference materials. Three analytical methods were tested for O isotopes: conversion of ClO4− to CO for continuous-flow IRMS (CO-CFIRMS), decomposition to O2 for dual-inlet IRMS (O2-DIIRMS), and decomposition to O2 with molecular-sieve trap (O2-DIIRMS+T). For Cl isotopes, KCl produced by thermal decomposition of KClO4 was reprecipitated as AgCl and converted into CH3Cl for DIIRMS.ResultsKClO4 isotopic reference materials (USGS37, USGS38, USGS39) represent a wide range of Cl and O isotopic compositions, including non-mass-dependent O isotopic variation. Isotopic fractionation and exchange can affect O isotope analyses of ClO4− depending on the decomposition method. Routine analyses can be adjusted for such effects by normalization, using reference materials prepared and analyzed as samples. Analytical errors caused by SO42−, NO3−, ReO42−, and C-bearing contaminants include isotope mixing and fractionation effects on CO and O2, plus direct interference from CO2 in the mass spectrometer. The results highlight the importance of effective purification of ClO4− from environmental samples.ConclusionsKClO4 reference materials are available for testing methods and calibrating isotopic data for ClO4− and other substances with widely varying Cl or O isotopic compositions. Current ClO4−extraction, purification

  18. The identification of four histidine kinases that influence sporulation in Clostridium thermocellum.

    Mearls, Elizabeth B; Lynd, Lee R

    2014-08-01

    In this study, we sought to identify genes involved in the onset of spore formation in Clostridium thermocellum via targeted gene deletions, gene over-expression, and transcriptional analysis. We determined that three putative histidine kinases, clo1313_0286, clo1313_2735 and clo1313_1942 were positive regulators of sporulation, while a fourth kinase, clo1313_1973, acted as a negative regulator. Unlike Bacillus or other Clostridium species, the deletion of a single positively regulating kinase was sufficient to abolish sporulation in this organism. Sporulation could be restored in these asporogenous strains via overexpression of any one of the positive regulators, indicating a high level of redundancy between these kinases. In addition to having a sporulation defect, deletion of clo1313_2735 produced L-forms. Thus, this kinase may play an additional role in repressing L-form formation. This work suggests that C. thermocellum enters non-growth states based on the sensory input from multiple histidine kinases. The ability to control the development of non-growth states at the genetic level has the potential to inform strategies for improved strain development, as well as provide valuable insight into C. thermocellum biology. Copyright © 2014 Elsevier Ltd. All rights reserved.

  19. Determination of the effects on learning and memory performance and related gene expressions of clothianidin in rat models.

    Ozdemir, Hasan Hüseyin; Kara, Murat; Yumrutas, Onder; Uckardes, Fatih; Eraslan, Ersin; Demir, Caner F; Bal, Ramazan

    2014-10-01

    Clothianidin (CLO) is one of the pesticides used to protect against insects, and its potential toxic effects on cognitive functions are not clearly known. This study aims to evaluate the possible effects of dose-dependent CLO on learning and memory in infant and adult male rats and the expression of related genes in the hippocampus. Doses of 2, 8 and 24 mg/kg of CLO were administered to newborn infant and adult albino Winstar rats in the form of gavage and dissolved in vehicle matter. Their cognitive and learning functions were evaluated by the Morris water maze and probe tests. Expression levels of N-methyl D-aspartate 1 (GRIN1), muscuranic receptor M1, synoptophysin (SYP) and growth-associated protein 43 (GAP-43) of tissues isolated from the hippocampus were determined using the real-time PCR method. In the Morris water maze test, no change (p > 0.05) was exhibited in the adult and infant rats after CLO was applied, although there was a significant difference (p  0.05). Our study shows that exposure to high doses of CLO causes deterioration of cognitive functions in infant rats.

  20. Reducing the chlorine dioxide demand in final disinfection of drinking water treatment plants using activated carbon.

    Sorlini, Sabrina; Biasibetti, Michela; Collivignarelli, Maria Cristina; Crotti, Barbara Marianna

    2015-01-01

    Chlorine dioxide is one of the most widely employed chemicals in the disinfection process of a drinking water treatment plant (DWTP). The aim of this work was to evaluate the influence of the adsorption process with granular activated carbon (GAC) on the chlorine dioxide consumption in final oxidation/disinfection. A first series of tests was performed at the laboratory scale employing water samples collected at the outlet of the DWTP sand filter of Cremona (Italy). The adsorption process in batch conditions with seven different types of GAC was studied. A second series of tests was performed on water samples collected at the outlet of four GAC columns installed at the outlet of the DWTP sand filter. The results showed that the best chlorine dioxide demand (ClO2-D) reduction yields are equal to 60-80% and are achieved in the first 30 min after ClO2 addition, during the first 16 days of the column operation using a mineral, coal-based, mesoporous GAC. Therefore, this carbon removes organic compounds that are more rapidly reactive with ClO2. Moreover, a good correlation was found between the ClO2-D and UV absorbance at wavelength 254 nm using mineral carbons; therefore, the use of a mineral mesoporous GAC is an effective solution to control the high ClO2-D in the disinfection stage of a DWTP.

  1. Liver gene expression profiles of rats treated with clofibric acid: comparison of whole liver and laser capture microdissected liver.

    Michel, Cécile; Desdouets, Chantal; Sacre-Salem, Béatrice; Gautier, Jean-Charles; Roberts, Ruth; Boitier, Eric

    2003-12-01

    Clofibric acid (CLO) is a peroxisome proliferator (PP) that acts through the peroxisome proliferator activated receptor alpha, leading to hepatocarcinogenesis in rodents. CLO-induced hepatocarcinogenesis is a multi-step process, first transforming normal liver cells into foci. The combination of laser capture microdissection (LCM) and genomics has the potential to provide expression profiles from such small cell clusters, giving an opportunity to understand the process of cancer development in response to PPs. To our knowledge, this is the first evaluation of the impact of the successive steps of LCM procedure on gene expression profiling by comparing profiles from LCM samples to those obtained with non-microdissected liver samples collected after a 1 month CLO treatment in the rat. We showed that hematoxylin and eosin (H&E) staining and laser microdissection itself do not impact on RNA quality. However, the overall process of the LCM procedure affects the RNA quality, resulting in a bias in the gene profiles. Nonetheless, this bias did not prevent accurate determination of a CLO-specific molecular signature. Thus, gene-profiling analysis of microdissected foci, identified by H&E staining may provide insight into the mechanisms underlying non-genotoxic hepatocarcinogenesis in the rat by allowing identification of specific genes that are regulated by CLO in early pre-neoplastic foci.

  2. Liver Gene Expression Profiles of Rats Treated with Clofibric Acid

    Michel, Cécile; Desdouets, Chantal; Sacre-Salem, Béatrice; Gautier, Jean-Charles; Roberts, Ruth; Boitier, Eric

    2003-01-01

    Clofibric acid (CLO) is a peroxisome proliferator (PP) that acts through the peroxisome proliferator activated receptor α, leading to hepatocarcinogenesis in rodents. CLO-induced hepatocarcinogenesis is a multi-step process, first transforming normal liver cells into foci. The combination of laser capture microdissection (LCM) and genomics has the potential to provide expression profiles from such small cell clusters, giving an opportunity to understand the process of cancer development in response to PPs. To our knowledge, this is the first evaluation of the impact of the successive steps of LCM procedure on gene expression profiling by comparing profiles from LCM samples to those obtained with non-microdissected liver samples collected after a 1 month CLO treatment in the rat. We showed that hematoxylin and eosin (H&E) staining and laser microdissection itself do not impact on RNA quality. However, the overall process of the LCM procedure affects the RNA quality, resulting in a bias in the gene profiles. Nonetheless, this bias did not prevent accurate determination of a CLO-specific molecular signature. Thus, gene-profiling analysis of microdissected foci, identified by H&E staining may provide insight into the mechanisms underlying non-genotoxic hepatocarcinogenesis in the rat by allowing identification of specific genes that are regulated by CLO in early pre-neoplastic foci. PMID:14633594

  3. Application of Highly Purified Electrolyzed Chlorine Dioxide for Tilapia Fillet Disinfection

    Chen-Hsing Yu

    2014-01-01

    Full Text Available This research aimed to develop an electrolysis method to generate high-concentration chlorine dioxide (ClO2 for tilapia fillet disinfection. The designed generator produced up to 3500 ppm of ClO2 at up to 99% purity. Tilapia fillets were soaked in a 400 ppm ClO2 solution for 5, 10, and 25 min. Results show that total plate counts of tilapia, respectively, decreased by 5.72 to 3.23, 2.10, and 1.09 log CFU/g. In addition, a 200 ppm ClO2 solution eliminated coliform bacteria and Escherichia coli in 5 min with shaking treatment. Furthermore, ClO2 and trihalomethanes (THMs residuals on tilapia fillets were analyzed by GC/MS and were nondetectable (GC-MS detection limit was 0.12 ppb. The results conform to Taiwan’s environmental protection regulations and act governing food sanitation.

  4. Comparative Study of Univariate Spectrophotometry and Multivariate Calibration for the Determination of Levamisole Hydrochloride and Closantel Sodium in a Binary Mixture.

    Abdel-Aziz, Omar; Hussien, Emad M; El Kosasy, Amira M; Ahmed, Neven

    2016-07-01

    Six simple, accurate, reproducible, and selective derivative spectrophotometric and chemometric methods have been developed and validated for the determination of levamisole HCl (Lev) either alone or in combination with closantel sodium (Clo) in the pharmaceutical dosage form. Lev was determined by first-derivative, first-derivative ratio, and mean-centering methods by measuring the peak amplitude at 220.8, 243.8, and 210.4 nm, respectively. The methods were linear over the concentration range 2.0-10.0 μg/mL Lev. The methods exhibited a high accuracy, with recovery data within ±1.9% and RSD <1.3% (n = 9) for the determination of Lev in the presence of Clo. Fortunately, Lev showed no significant UV absorbance at 370.6 nm, which allowed the determination of Clo over the concentration range 16.0-80.0 μg/mL using zero-order spectra, with a high precision (RSD <1.5%, n = 9). Furthermore, principal component regression and partial least-squares with optimized parameters were used for the determination of Lev in the presence of Clo. The recovery was within ±1%, with RSD <1.0% (n = 9) and root mean square error of prediction ≤1.0. The proposed methods were validated according to the International Conference on Harmonization guidelines. The proposed methods were used in the determination of Lev and Clo in a binary mixture and a pharmaceutical formulation, with high accuracy and precision.

  5. Biological perchlorate reduction in packed bed reactors using elemental sulfur.

    Sahu, Ashish K; Conneely, Teresa; Nüsslein, Klaus R; Ergas, Sarina J

    2009-06-15

    Sulfur-utilizing perchlorate (ClO4-)-reducing bacteria were enriched from a denitrifying wastewater seed with elemental sulfur (S0) as an electron donor. The enrichment was composed of a diverse microbial community, with the majority identified as members of the phylum Proteobacteria. Cultures were inoculated into bench-scale packed bed reactors (PBR) with S0 and crushed oyster shell packing media. High ClO4-concentrations (5-8 mg/L) were reduced to PBR performance decreased when effluent recirculation was applied or when smaller S0 particle sizes were used, indicating that mass transfer of ClO4- to the attached biofilm was not the limiting mechanism in this process, and that biofilm acclimation and growth were key factors in overall reactor performance. The presence of nitrate (6.5 mg N/L) inhibited ClO4- reduction. The microbial community composition was found to change with ClO4- availability from a majority of Beta-Proteobacteria near the influent end of the reactor to primarily sulfur-oxidizing bacteria near the effluent end of the reactor.

  6. Role of Chlorine Dioxide in N-Nitrosodimethylamine Formation from Oxidation of Model Amines.

    Gan, Wenhui; Bond, Tom; Yang, Xin; Westerhoff, Paul

    2015-10-06

    N-Nitrosodimethylamine (NDMA) is an emerging disinfection byproduct, and we show that use of chlorine dioxide (ClO2) has the potential to increase NDMA formation in waters containing precursors with hydrazine moieties. NDMA formation was measured after oxidation of 13 amines by monochloramine and ClO2 and pretreatment with ClO2 followed by postmonochloramination. Daminozide, a plant growth regulator, was found to yield 5.01 ± 0.96% NDMA upon reaction with ClO2, although no NDMA was recorded during chloramination. The reaction rate was estimated to be ∼0.0085 s(-1), and on the basis of our identification by mass spectrometry of the intermediates, the reaction likely proceeds via the hydrolytic release of unsymmetrical dimethylhydrazine (UDMH), with the hydrazine structure a key intermediate in NDMA formation. The presence of UDMH was confirmed by gas chromatography-mass spectrometry analysis. For 10 of the 13 compounds, ClO2 preoxidation reduced NDMA yields compared with monochloramination alone, which is explained by our measured release of dimethylamine. This work shows potential preoxidation strategies to control NDMA formation may not impact all organic precursors uniformly, so differences might be source specific depending upon the occurrence of different precursors in source waters. For example, daminozide is a plant regulator, so drinking water that is heavily influenced by upstream agricultural runoff could be at risk.

  7. Cross-Resistance of UV- or Chlorine Dioxide-Resistant Echovirus 11 to Other Disinfectants

    Qingxia Zhong

    2017-10-01

    Full Text Available The emergence of waterborne viruses with resistance to disinfection has been demonstrated in the laboratory and in the environment. Yet, the implications of such resistance for virus control remain obscure. In this study we investigate if viruses with resistance to a given disinfection method exhibit cross-resistance to other disinfectants. Chlorine dioxide (ClO2- or UV-resistant populations of echovirus 11 were exposed to five inactivating treatments (free chlorine, ClO2, UV radiation, sunlight, and heat, and the extent of cross-resistance was determined. The ClO2-resistant population exhibited cross-resistance to free chlorine, but to none of the other inactivating treatments tested. We furthermore demonstrated that ClO2 and free chlorine act by a similar mechanism, in that they mainly inhibit the binding of echovirus 11 to its host cell. As such, viruses with host binding mechanisms that can withstand ClO2 treatment were also better able to withstand oxidation by free chlorine. Conversely, the UV-resistant population was not significantly cross-resistant to any other disinfection treatment. Overall, our results indicate that viruses with resistance to multiple disinfectants exist, but that they can be controlled by inactivating methods that operate by a distinctly different mechanism. We therefore suggest to utilize two disinfection barriers that act by different mechanisms in order to control disinfection-resistant viruses.

  8. Photodecomposition of iodinated contrast media and subsequent formation of toxic iodinated moieties during final disinfection with chlorinated oxidants.

    Allard, Sébastien; Criquet, Justine; Prunier, Anaïs; Falantin, Cécilia; Le Person, Annaïg; Yat-Man Tang, Janet; Croué, Jean-Philippe

    2016-10-15

    Large amount of iodinated contrast media (ICM) are found in natural waters (up to μg.L(-)(1) levels) due to their worldwide use in medical imaging and their poor removal by conventional wastewater treatment. Synthetic water samples containing different ICM and natural organic matter (NOM) extracts were subjected to UV254 irradiation followed by the addition of chlorine (HOCl) or chloramine (NH2Cl) to simulate final disinfection. In this study, two new quantum yields were determined for diatrizoic acid (0.071 mol.Einstein(-1)) and iotalamic acid (0.038 mol.Einstein(-1)) while values for iopromide (IOP) (0.039 mol.Einstein(-1)), iopamidol (0.034 mol.Einstein(-1)) and iohexol (0.041 mol.Einstein(-1)) were consistent with published data. The photodegradation of IOP led to an increasing release of iodide with increasing UV doses. Iodide is oxidized to hypoiodous acid (HOI) either by HOCl or NH2Cl. In presence of NOM, the addition of oxidant increased the formation of iodinated disinfection by-products (I-DBPs). On one hand, when the concentration of HOCl was increased, the formation of I-DBPs decreased since HOI was converted to iodate. On the other hand, when NH2Cl was used the formation of I-DBPs was constant for all concentration since HOI reacted only with NOM to form I-DBPs. Increasing the NOM concentration has two effects, it decreased the photodegradation of IOP by screening effect but it increased the number of reactive sites available for reaction with HOI. For experiments carried out with HOCl, increasing the NOM concentration led to a lower formation of I-DBPs since less IOP are photodegraded and iodate are formed. For NH2Cl the lower photodegradation of IOP is compensated by the higher amount of NOM reactive sites, therefore, I-DBPs concentrations were constant for all NOM concentrations. 7 different NOM extracts were tested and almost no differences in IOP degradation and I-DBPs formation was observed. Similar behaviour was observed for the 5 ICM

  9. Myeloperoxidase-catalyzed incorporation of amines into proteins: role of hypochlorous acid and dichloramines.

    Thomas, E L; Jefferson, M M; Grisham, M B

    1982-11-23

    Myeloperoxidase-catalyzed oxidation of chloride (Cl-) to hypochlorous acid (HOCl) resulted in formation of mono- and dichloramine derivatives (RNHCl and RNCl2) of primary amines. The RNCl2 derivatives could undergo a reaction that resulted in incorporation of the R moiety into proteins. The probable mechanism was attack of RNCl2 or an intermediate formed in the decomposition of RNCl2 on histidine, tyrosine, and cystine residues and on lysine residues at high pH. Incorporation of radioactivity from labeled amines into stable, high molecular weight derivatives of proteins was measured by acid or acetone precipitation and by gel chromatography and electrophoresis. Whereas formation of RNCl2 was favored at low pH, the subsequent incorporation reaction was favored at high pH. Up to several hours were required for the maximum amount of incorporation, which was less than 10% of the label in RNCl2. For the amines tested, incorporation was in the order histamine greater than 1,2-diaminoethane greater than putrescine greater than taurine greater than lysine greater than glucosamine greater than leucine greater than methylamine. Initiation of the reaction required HOCl, and oxidized forms of bromide, iodide, or thiocyanate did not substitute. Inhibitors of incorporation fell into three classes. First, ammonia or amines competed with the labeled amine for reaction with HOCl, so that larger amounts of HOCl were required. Second, readily oxidized substances such as sulfhydryl or diketo compounds or thioethers (methionine) reduced RNCl2. Third, certain compounds competed with protein as the acceptor for the incorporation reaction. The amount required to block incorporation into protein depended on protein concentration. Among these inhibitors were imidazole compounds (histidine), phenols (tyrosine), and disulfides (glutathione disulfide, GSSG). Low yields of derivatives of histidine, tyrosine, and GSSG were detected by thin-layer chromatography. Acid-precipitable derivatives were

  10. Transformation of aminopyrine in the presence of free available chlorine: Kinetics, products, and reaction pathways.

    Cai, Mei-Quan; Feng, Li; Zhang, Li-Qiu

    2017-03-01

    Aminopyrine (AMP) has been frequently detected in the aquatic environment. In this study, the transformation mechanism of AMP by free available chlorine (FAC) oxidation was investigated. The results showed that FAC reacted with AMP rapidly, and a 74% elimination was achieved for 1.30 μM AMP after 2 min at 14.08 μM FAC dose. AMP chlorination was strongly pH-dependent, and its reaction included second- and third-order kinetic processes. Three active FAC species, including chlorine monoxide (Cl 2 O), molecular chlorine (Cl 2 ), and hypochlorous acid (HOCl), were observed to contribute to AMP degradation. The intrinsic rate constants of each FAC species with neutral (AMP 0 ) and cation (AMP + ) species were obtained by kinetic fitting. Cl 2 O exhibited the highest reactivity with AMP 0 (k AMP0, Cl2O  = (4.33 ± 1.4) × 10 9  M -1 s -1 ). In addition, Cl 2 showed high reactivity (10 6 -10 7  M -1 s -1 ) in the presence of chloride, compared with HOCl (k AMP+, HOCl  = (5.73 ± 0.23) × 10 2  M -1 s -1 , k AMP0, HOCl  = (9.68 ± 0.96) × 10 2  M -1 s -1 ). At pH 6.15 and 14.08 μM FAC dose without chloride addition, the contribution of Cl 2 O reached to the maximum (33.3%), but in the whole pH range, HOCl was the main contributor (>66.6%) for AMP degradation. The significance of Cl 2 was noticeable in water containing chloride. Moreover, 11 transformation products were identified, and the main transformation pathways included pyrazole ring breakage, hydroxylation, dehydrogenation, and halogenation. Copyright © 2016 Elsevier Ltd. All rights reserved.

  11. PEGylated single-walled carbon nanotubes activate neutrophils to increase production of hypochlorous acid, the oxidant capable of degrading nanotubes

    Vlasova, Irina I., E-mail: irina.vlasova@yahoo.com [Research Institute for Physico-Chemical Medicine, Federal Medico-Biological Agency, Moscow (Russian Federation); Vakhrusheva, Tatyana V. [Research Institute for Physico-Chemical Medicine, Federal Medico-Biological Agency, Moscow (Russian Federation); Sokolov, Alexey V.; Kostevich, Valeria A. [Research Institute for Physico-Chemical Medicine, Federal Medico-Biological Agency, Moscow (Russian Federation); Research Institute for Experimental Medicine, Russian Academy of Medical Science, Saint Petersburg (Russian Federation); Gusev, Alexandr A.; Gusev, Sergey A. [Research Institute for Physico-Chemical Medicine, Federal Medico-Biological Agency, Moscow (Russian Federation); Melnikova, Viktoriya I. [Institute of Developmental Biology, Russian Academy of Science, Moscow (Russian Federation); Lobach, Anatolii S. [Institute of Problems of Chemical Physics, Russian Academy of Science, Chernogolovka (Russian Federation)

    2012-10-01

    Perspectives for the use of carbon nanotubes in biomedical applications depend largely on their ability to degrade in the body into products that can be easily cleared out. Carboxylated single-walled carbon nanotubes (c-SWCNTs) were shown to be degraded by oxidants generated by peroxidases in the presence of hydrogen peroxide. In the present study we demonstrated that conjugation of poly(ethylene glycol) (PEG) to c-SWCNTs does not interfere with their degradation by peroxidase/H{sub 2}O{sub 2} system or by hypochlorite. Comparison of different heme-containing proteins for their ability to degrade PEG-SWCNTs has led us to conclude that the myeloperoxidase (MPO) product hypochlorous acid (HOCl) is the major oxidant that may be responsible for biodegradation of PEG-SWCNTs in vivo. MPO is secreted mainly by neutrophils upon activation. We hypothesize that SWCNTs may enhance neutrophil activation and therefore stimulate their own biodegradation due to MPO-generated HOCl. PEG-SWCNTs at concentrations similar to those commonly used in in vivo studies were found to activate isolated human neutrophils to produce HOCl. Both PEG-SWCNTs and c-SWCNTs enhanced HOCl generation from isolated neutrophils upon serum-opsonized zymosan stimulation. Both types of nanotubes were also found to activate neutrophils in whole blood samples. Intraperitoneal injection of a low dose of PEG-SWCNTs into mice induced an increase in percentage of circulating neutrophils and activation of neutrophils and macrophages in the peritoneal cavity, suggesting the evolution of an inflammatory response. Activated neutrophils can produce high local concentrations of HOCl, thereby creating the conditions favorable for degradation of the nanotubes. -- Highlights: ► Myeloperoxidase (MPO) product hypochlorous acid is able to degrade CNTs. ► PEGylated SWCNTs stimulate isolated neutrophils to produce hypochlorous acid. ► SWCNTs are capable of activating neutrophils in blood samples. ► Activation of

  12. Analogos sinteticos para a estrutura do sitio ativo das Fosfatases Acidas Purpuras

    Brito, Marcos Aires de

    1994-01-01

    Tese (doutorado) - Universidade Federal de Santa Catarina, Centro de Ciencias Fisicas e Matematicas Foram sintetizados e caracterizados cinco novos complexos, binucleares de ferro como análogos sintéticos para a estrutura do sítio ativo das Fosfatases Ácidas Púrpuras: [Fe2III(BBPMP)(OAC)2][ClO4],(1). [Fe2III(BBPMP)(OAC)(OH)][ClO4],(2); [Fe2III/II(BBPMP)(OAC)2],(3); [Fe2III(BPBPMP)(OAC)2][ClO4]2,(4); e [Fe2III/II(BPBPMP)(OAC)2][ClO4],(5), onde OAC = acetato e BBPMP e BPBPMP representam, res...

  13. Structural study of some halogen oxyfluorides

    Tantot, Georges.

    1976-12-01

    Some halogen oxyfluorides are studied from a structural point of view by vibrational spectroscopy and nuclear magnetic resonance. Force constant and molecular orbital calculations are added to the experimental data. The pyramidal shape of ClO 2 F under its three physical states is confirmed. In the gas and liquid phases an intermolecular association is observed. A similar interaction takes place in ClOF 3 . ClO 3 F has only a solid state transition above 10K. The structures of ClO 2 F and KBrO 2 F 2 are partly determined. The theoretical calculations are well correlated with the experimental data. They suggest a major influence of the ligands [fr

  14. Structural study of chloryl fluoride in its three states

    Tantot, Georges

    1974-01-01

    This research thesis reports the study of the ClO 2 F chloryl fluoride molecule in its three physical states by using different methods, and by highlighting the structural aspect. Observations confirm the pyramidal structure of the compound in its three states. The structure of the single solid phase is partially elucidated in terms of four-molecule monoclinic cell. In the liquid phase, the author shows the existence of a phenomenon of association which seems to be related with a partial local order phenomenon. This phenomenon is also characterized. The interaction force is compared for various compounds (ClO 3 F and ClO 2 F, ClF 3 and BrF 3 , ClF 5 and BrF 5 , BrF 5 and IF 5 ). It appears that interactions do not have an electrostatic origin, but are based on a partial overlapping of two molecular orbitals [fr

  15. Nickel(II) Complexes with [2 sup4.3sup1]Adamanzane, 1,4,7,10-Tetraazabicyclo[5.5.3]pentadecane

    Sanzenbacher, Ralf; Søtofte, Inger; Springborg, Johan

    1999-01-01

    this crude product pure {Ni(L)}sub2 (mu-Br)sub2](ClO sub4)sub2 and {Ni(L)}sub 2 (mu-Cl)sub 2](ClO sub4)sub2 have been obtained. In aqueous solution these dinuclear species hydrolyse to the parent mononuclear diaqua species, which was isolated as [Ni(L)(H sub2O)sub2]S sub2O sub6 x 2H sub2O. The reaction......)sub2]S sub2O sub6 x 2H sub2O, [Ni(L)(NO sub2)]PF sub6 and Ni(L) (NO sub3)]ClO sub4 have been determined by X-ray diffraction techniques. The coordination geometry about the nickel(II) ion is a distorted octahedron in all the structures....

  16. Efficacy of chlorine dioxide against Listeria monocytogenes in brine chilling solutions.

    Valderrama, W B; Mills, E W; Cutter, C N

    2009-11-01

    Chilled brine solutions are used by the food industry to rapidly cool ready-to-eat meat products after cooking and before packaging. Chlorine dioxide (ClO(2)) was investigated as an antimicrobial additive to eliminate Listeria monocytogenes. Several experiments were performed using brine solutions made of sodium chloride (NaCl) and calcium chloride (CaCl(2)) inoculated with L. monocytogenes and/or treated with 3 ppm of ClO(2). First, 10 and 20% CaCl(2) and NaCl solutions (pH 7.0) were inoculated with a five-strain cocktail of L. monocytogenes to obtain approximately 7 log CFU/ml and incubated 8 h at 0 degrees C. The results demonstrated that L. monocytogenes survived in 10% CaCl(2), 10 and 20% NaCl, and pure water. L. monocytogenes levels were reduced approximately 1.2 log CFU/ml in 20% CaCl(2). Second, inoculated ( approximately 7 log CFU/ml) brine solutions (10 and 20% NaCl and 10% CaCl(2)) treated with 3 ppm of ClO(2) resulted in a approximately 4-log reduction of the pathogen within 90 s. The same was not observed in a solution of 20% CaCl(2); further investigation demonstrated that high levels of divalent cations interfere with the disinfectant. Spent brine solutions from hot dog and ham chilling were treated with ClO(2) at concentrations of 3 or 30 ppm. At these concentrations, ClO(2) did not reduce L. monocytogenes. Removal of divalent cations and organic material in brine solutions prior to disinfection with ClO(2) should be investigated to improve the efficacy of the compound against L. monocytogenes. The information from this study may be useful to processing establishments and researchers who are investigating antimicrobials in chilling brine solutions.

  17. Development and field testing of a mobile chlorine dioxide generation system for the decontamination of buildings contaminated with Bacillus anthracis

    Wood, Joseph P.; Blair Martin, G.

    2009-01-01

    The numerous buildings that became contaminated with Bacillus anthracis (the bacterium causing the disease anthrax) in 2001, and more recent B. anthracis - related events, point to the need to have effective decontamination technologies for buildings contaminated with biological threat agents. The U.S. Government developed a portable chlorine dioxide (ClO 2 ) generation system to decontaminate buildings contaminated with B. anthracis spores, and this so-called mobile decontamination trailer (MDT) prototype was tested through a series of three field trials. The first test of the MDT was conducted at Fort McClellan in Anniston, AL. during October 2004. Four test attempts occurred over two weekends; however, a number of system problems resulted in termination of the activity prior to any ClO 2 introduction into the test building. After making several design enhancements and equipment changes, the MDT was subjected to a second test. During this test, extensive leak checks were made using argon and nitrogen in lieu of chlorine gas; each subsystem was checked for functionality, and the MDT was operated for 24 h. This second test demonstrated the MDT flow and control systems functioned satisfactorily, and thus it was decided to proceed to a third, more challenging field trial. In the last field test, ClO 2 was generated and routed directly to the scrubber in a 12-h continuous run. Measurement of ClO 2 levels at the generator outlet showed that the desired production rate was not achieved. Additionally, only one of the two scrubbers performed adequately with regard to maintaining ClO 2 emissions below the limit. Numerous lessons were learned in the field trials of this ClO 2 decontamination technology.

  18. Corrigendum to “Widespread occurrence of (per)chlorate in the Solar System” [Earth Planet. Sci. Lett. 430 (2015) 470–476

    Jackson, W. Andrew; Davila, Alfonso F.; Sears, Derek W. G.; Coates, John D.; McKay, Christopher P.; Brundrett, Maeghan; Estrada, Nubia; Böhlke, John Karl

    2016-01-01

    The authors regret that two sets of data (Atacama (Rao et al., 2010) and Mars Meteorite Range (Kounaves et al., 2014)) in Fig. 2 of our article were plotted in the wrong units. The correction does not change the relationship between ClO3−">ClO3− and ClO4−">ClO4−; it only shifts the magnitude of the concentrations. The conclusions of the article are not affected. The corrected Fig. 2 appears below.

  19. Modelando a coordenação de fosfato com o sítio ativo das fosfatases ácidas púrpuras Modeling the coordination of phosphate to the active site of purple acid phosphatases

    Marcos Aires de Brito; Ademir Neves; Luiz R. Zilli

    1997-01-01

    We present a new binuclear complex, Fe2III(BBPMP)(OH)(O2 P(OPh)2) ClO4.CH3OH, 3, where BBPMP is the anion of 2,6-bis(2-hydroxybenzyl)(2-pyridylmethyl) aminomethyl-4-methylphenol, as a suitable model for the chromophoric site of purple acid phosphatases coordinated to phosphate. The complex was obtained by the reaction of complex 2, Fe2III(BBPMP)(O2P(OPh) 2)2 ClO4.H2O, in CH3CN with one equivalent of triethylamine. Based on the chromophoric properties of the model complex, lmax = 560 nm/ e = 4...

  20. Influence of the ammonium salt anion on the synergistic solvent extraction of lanthanides with mixtures of thenoyltrifluoroacetone and tridecylamine

    Dukov, I.L.; Jordanov, V.M.

    1998-01-01

    The synergistic solvent extraction of Pr, Gd and Yb with mixtures of thenoyltrifluoroacetone (HTTA) and primary ammonium salt (tridecylammonium chloride or perchlorate, TDAH(Cl, ClO 4 )) in C 6 H 6 has been studied. The composition of the extracted species have been determined as Ln(TTA) 3 TDAHA(A - = Cl - or ClO 4 - ). The values of the equilibrium constant K T,S have been calculated. The influence of the ammonium salt anion on the extraction process has been discussed. The separation factors of the pairs Gd/Pr and Yb/Gd have been determined

  1. A vacuum ultraviolet photoionization study on the thermal decomposition of ammonium perchlorate

    Góbi, Sándor; Zhao, Long; Xu, Bo; Ablikim, Utuq; Ahmed, Musahid; Kaiser, Ralf I.

    2018-01-01

    Pyrolysis products of ammonium perchlorate (NH4ClO4) at 483 K were monitored on line and in situ via single photon photoionization reflectron time-of-flight spectrometry (PI-ReTOF-MS) in the photon energy range of 9.00-17.50 eV. The photoionization efficiency curves (PIE) of the subliming product molecules were collected and allowed for detection of three class of products containing chlorine, nitrogen, and oxygen including atoms and free radicals. These results suggest a new insight into possible low-temperature decomposition pathways of NH4ClO4.

  2. Oxidation of pharmaceuticals by chlorine dioxide in biologically treated wastewater

    Hey, G.; Grabic, R.; Ledin, A.

    2012-01-01

    Biologically treated wastewater spiked with a mixture of 56 active pharmaceutical ingredients (APIs) was treated with 0–20mg/L chlorine dioxide (ClO2) solution in laboratory-scale experiments. Wastewater effluents were collected from two wastewater treatment plants in Sweden, one with extended......O2, while in high COD effluent a significant increase in API oxidation was observed after treatment with 8mg/L ClO2. This study illustrates the successful degradation of several APIs during treatment of wastewater effluents with chlorine dioxide....

  3. Studies on 4-[N-(furfural) amino] antipyrine complexes of thorium (IV) and dioxouranium (VI)

    Agarwal, R.K.; Arora, Kishore; Dutt, Prashant

    1997-01-01

    Thorium (IV) and dioxouranium (VI) complexes of Schiff base 4-[N-(furfural) amino] antipyrine (FFAP) derived from furfural and 4-aminoantipyrine having general composition ThX 4 .nL (X = Cl - , Br - , NCS - or NO 3 - , n = 2; x = I - or ClO 4 - n = 3, L = FFAP) and UO 2 X 2. nL (X Br - , I - , NCS - ,NO 3 - or CH 3 COO - , n = 2; X = ClO 4 - n = 3, L = FFAP) have been synthesized and characterized by molecular weight, conductivity, IR spectral and thermoanalytical studies. (author)

  4. Molecular beam studies of stratospheric photochemistry

    Moore, Teresa Anne

    1998-12-01

    Photochemistry of chlorine oxide containing species plays a major role in stratospheric ozone depletion. This thesis discusses two photodissociation studies of the key molecules ClONO2 and ClOOCl which were previously thought to only produce Cl-atom (ozone depleting) products at wavelengths relevant to the stratosphere. The development of a molecular beam source of ClOOCl and the photodissociation dynamics of the model system Cl2O are also discussed. In the first chapter, the photochemistry of ClONO2 is examined at 308 nm using the technique of photofragment translational spectroscopy. Two primary decomposition pathways, leading to Cl + NO3 and ClO + NO2, were observed, with a lower limit of 0.33 for the relative yield of ClO. The angular distributions for both channels were anisotropic, indicating that the dissociation occurs within a rotational period. Chapter two revisits the photodissociation dynamics of Cl2O at 248 and 308 nm, on which we had previously reported preliminary findings. At 248 nm, three distinct dissociation pathways leading to Cl + ClO products were resolved. At 308 nm, the angular distribution was slightly more isotropic that previously reported, leaving open the possibility that Cl2O excited at 308 nm lives longer than a rotational period. Chapter three describes the development and optimization of a molecular beam source of ClOOCl. We utilized pulsed laser photolysis of ClA2O to generate ClO radicals, and cooled the cell to promote three body recombination to form ClOOCl. The principal components in the beam were Cl2, Cl2O, and ClOOCl. In the fourth chapter, the photodissociation dynamics of ClOOCl are investigated at 248 and 308 nm. We observed multiple dissociation pathways which produced ClO + ClO and 2Cl + O2 products. The relative Cl:ClO product yields are 1.0:0.13 and 1.0:0.20 for ClOOCl photolysis at 248 and 308 nm, respectively. The upper limit for the relative yield of the ClO + ClO channel was 0.19 at 248 nm and 0.31 at 308 nm

  5. Efecto del número de aplicaciones de cloprostenol sobre la regresión de cuerpos lúteos, el retorno al celo y la ovulación, después de un tratamiento superovulatorio en donantes de embriones bovinos

    C. Jiménez; R. Mapletoft; A. Tribulo; J. V. Garzón; Cabra C.; G. Bo

    2011-01-01

    El objetivo del presente trabajo fue evaluar la respuesta de la aplicación doble o triple de prostaglandina sobre la regresión de CL, ovulación y retorno al celo después de un tratamiento superovulatorio en vacas donantes de embriones. Para este experimento se tomaron 44 vacas asignadas al azar a dos grupos de tratamiento. Al primero (n = 23; CLO 0 & 7) se le aplicó una dosis de 500 μg de cloprostenol los días 0 (denominado día de la colecta) y 7; al segundo grupo (n = 21; CLO 0, 1 & 7) se le...

  6. Synthesis, characterisation and antibacterial activity of [(p-cym)RuX(L)](+/2+) (X = Cl, H2O; L = bpmo, bpms) complexes.

    Tripathy, Suman Kumar; Taviti, Ashoka Chary; Dehury, Niranjan; Sahoo, Anupam; Pal, Satyanaryan; Beuria, Tushar Kant; Patra, Srikanta

    2015-03-21

    Mononuclear half-sandwiched complexes [(p-cym)RuCl(bpmo)](ClO4) {[1](ClO4)} and [(p-cym)RuCl(bpms)](PF6) {[2](PF6)} have been prepared by reacting heteroscorpionate ligands bpmo = 2-methoxyphenyl-bis(3,5-dimethylpyrazol-1-yl)methane and bpms = 2-methylthiophenyl-bis(3,5-dimethylpyrazol-1-yl)methane, respectively, with a dimeric precursor complex [(p-cym)RuCl(μ-Cl)]2 (p-cym = 1-isopropyl-4-methylbenzene) in methanol. The corresponding aqua derivatives [(p-cym)Ru(H2O)(bpmo)](ClO4)2 {[3](ClO4)2} and [(p-cym)Ru(H2O)(bpms)](PF6)2 {[4](PF6)2} are obtained from {[1](ClO4)} and {[2](PF6)}, respectively, via Cl(-)/H2O exchange process in the presence of appropriate equivalents of AgClO4/AgNO3 + KPF6 in a methanol-water mixture. The molecular structures of the complexes {[1]Cl, [3](ClO4)2 and [4](PF6)(NO3)} are authenticated by their single crystal X-ray structures. The complexes show the expected piano-stool geometry with p-cym in the η(6) binding mode. The aqua complexes [3](ClO4)2 and [4](PF6)2 show significantly good antibacterial activity towards E. coli (gram negative) and B. subtilis (gram positive) strains, while chloro derivatives ({[1](ClO4)} and {[2](PF6)} are found to be virtually inactive. The order of antibacterial activity of the complexes according to their MIC values is [1](ClO4) (both 1000 μg mL(-1)) < [2](PF6) (580 μg mL(-1) and 750 μg mL(-1)) < [3](ClO4)2 (both 100 μg mL(-1)) < [4](PF6)2 (30 μg mL(-1) and 60 μg mL(-1)) for E. coli and B. subtilis strains, respectively. Further, the aqua complexes [3](ClO4)2 and [4](PF6)2 show clear zones of inhibition against kanamycin, ampicillin and chloramphenicol resistant E. coli strains. The detailed mechanistic aspects of the aforesaid active aqua complexes [3](ClO4)2 and [4](PF6)2 have been explored, and it reveals that both the complexes inhibit the number of nucleoids per cell in vivo and bind to DNA in vitro. The results indeed demonstrate that both [3](ClO4)2 and [4](PF6)2 facilitate the inhibition of

  7. The effect of oxidation on the enzyme-catalyzed hydrolytic biodegradation of poly(urethane)s.

    Labow, Rosalind S; Tang, Yiwen; McCloskey, Christopher B; Santerre, J Paul

    2002-01-01

    Although the biodegradation of polyurethanes (PU) by oxidative and hydrolytic agents has been studied extensively, few investigations have reported on the combination of their effects. Since neutrophils (PMN) arrive at an implanted device first and release HOCl, followed by monocyte-derived macrophages (MDM) which have potent esterase activities and oxidants of their own, the combined effect of oxidative and hydrolytic degradation on radiolabeled polycarbonate-polyurethanes (PCNU)s was investigated and compared to that of a polyester-PU (PESU) and a polyether-PU (PEU). The PCNUs were synthesized with PCN (MW = 1,000), and butanediol (14C-BD) and one of two diisocyanates, hexane-1,6-diisocyanate (14C-HDI) or methylene bis-p-phenyl diisocyanate (MDI). The PESU and PEU were synthesized using toluene-diisocyanate (14C-TDI), with polycaprolactone and polytetramethylene oxide as soft segments respectively, and ethylene diamine as the chain extender. The effect of pre-treatment with 0.1 mM HOC1 for 1 week on the HDI-based PCNUs and both TDI-based PUs resulted in a significant inhibition of radiolabel release (RR) elicited by cholesterol esterase (CE), when compared to buffer alone, whereas the MDI-based PCNU showed a small but significant increase. When PMN were activated on the HDI-based PCNU surface with phorbol myristate acetate (PMA), HOCl was released for 3 h, and was almost completely abolished by sodium azide (AZ). Simultaneously, the PMN-elicited RR, shown previously to be due to the esterolytic cleavage by serine proteases, was inhibited approximately 75% by PMA-activation of the cells, but significantly increased relative to the latter when AZ was added. Both in vitro oxidation by HOCl and the release of HOCI by PMN were associated with the inhibition of RR and suggest perturbations between oxidative and hydrolytic mechanisms of biodegradation.

  8. Synthetic secoisolariciresinol diglucoside (LGM2605) inhibits myeloperoxidase activity in inflammatory cells.

    Mishra, Om P; Popov, Anatoliy V; Pietrofesa, Ralph A; Nakamaru-Ogiso, Eiko; Andrake, Mark; Christofidou-Solomidou, Melpo

    2018-06-01

    Myeloperoxidase (MPO) generates hypochlorous acid (HOCl) during inflammation and infection. We showed that secoisolariciresinol diglucoside (SDG) scavenges radiation-induced HOCl in physiological solutions. However, the action of SDG and its synthetic version, LGM2605, on MPO-catalyzed generation of HOCl is unknown. The present study evaluated the effect of LGM2605 on human MPO, and murine MPO from macrophages and neutrophils. MPO activity was determined fluorometrically using hypochlorite-specific 3'-(p-aminophenyl) fluorescein (APF). The effect of LGM2605 on (a) the peroxidase cycle of MPO was determined using Amplex Red while the effect on (b) the chlorination cycle was determined using a taurine chloramine assay. Using electron paramagnetic resonance (EPR) spectroscopy we determined the effect of LGM2605 on the EPR signals of MPO. Finally, computational docking of SDG was used to identify energetically favorable docking poses to enzyme's active site. LGM2605 inhibited human and murine MPO activity. MPO inhibition was observed in the absence and presence of Cl - . EPR confirmed that LGM2605 suppressed the formation of Compound I, an oxoiron (IV) intermediate [Fe(IV)O] containing a porphyrin π-radical of MPO's catalytic cycle. Computational docking revealed that SDG can act as an inhibitor by binding to the enzyme's active site. We conclude that LGM2605 inhibits MPO activity by suppressing both the peroxidase and chlorination cycles. EPR analysis demonstrated that LGM2605 inhibits MPO by decreasing the formation of the highly oxidative Compound I. This study identifies a novel mechanism of LGM2605 action as an inhibitor of MPO and indicates that LGM2605 may be a promising attenuator of oxidant-dependent inflammatory tissue damage. Copyright © 2018 Elsevier B.V. All rights reserved.

  9. Mechanism of inhibition of myeloperoxidase by anti-inflammatory drugs.

    Kettle, A J; Winterbourn, C C

    1991-05-15

    Hypochlorous acid (HOCl) is the most powerful oxidant produced by human neutrophils, and should therefore be expected to contribute to the damage caused by these inflammatory cells. It is produced from H2O2 and Cl- by the heme enzyme myeloperoxidase (MPO). We used a H2O2-electrode to assess the ability of a variety of anti-inflammatory drugs to inhibit conversion of H2O2 to HOCl. Dapsone, mefenamic acid, sulfapyridine, quinacrine, primaquine and aminopyrine were potent inhibitors, giving 50% inhibition of the initial rate of H2O2 loss at concentrations of about 1 microM or less. Phenylbutazone, piroxicam, salicylate, olsalazine and sulfasalazine were also effective inhibitors. Spectral investigations showed that the inhibitors acted by promoting the formation of compound II, which is an inactive redox intermediate of MPO. Ascorbate reversed inhibition by reducing compound II back to the active enzyme. The characteristic properties that allowed the drugs to inhibit MPO reversibly were ascertained by determining the inhibitory capacity of related phenols and anilines. Inhibition increased as substituents on the aromatic ring became more electron withdrawing, until an optimum reduction potential was reached. Beyond this optimum, their inhibitory capacity declined. The best inhibitor was 4-bromoaniline which had an I50 of 45 nM. An optimum reduction potential enables inhibitors to reduce MPO to compound II, but prevents them from reducing compound II back to the active enzyme. Exploitation of this optimum reduction potential will help in targeting drugs against HOCl-dependent tissue damage.

  10. Effect of Probiotics on Serum Biochemical and Blood Constituents in ...

    Purpose: To examine the effects of two commercial probiotics (Toyocerin and CloSTAT) on serum enzyme activities, and hematological and biochemical indices of broiler chickens challenged with Salmonella enterica serovars Typhimurium (ST). Methods: The chicks received one of the following treatments at 0 day of age: ...

  11. World Reference Center for Arboviruses.

    1981-02-01

    Aride Ken T 100 Barur Hanawa Boraceia Malakal Bov.Eph.Fever N.S.D. Bimbo Nodamura Clo-Mor Pahayokee - *Gomoka Sakhalin Ippy Shark River Kolongo Swan P...of the index case, a resident physician and an auxiliary nurse , both of whom died on September 19th. From that time until September 20, 1980, a total

  12. Parental care in Hemisus (Anura: Hemisotidae)

    Parental care in Hemisus (Anura: Hemisotidae). DE van Dijk clo Department of Zoology, University of Stelienbosch,. Stelienbosch, 7600 South Africa. Received 18 December 1996; accepted J J February 1997. Accounts of parental care in Anura frequently include mention of the South African frog genus Hemisus and derive ...

  13. Osmium and cobalt complexes incorporating facially coordinated N ...

    The ligands which bind the transition metal ion in a predictable way play ... was purified by thin-layer chromatography on silica gel. A green band ..... gands, L. −. , (X-ray structure). The unipositive charge of the complex cation, [(L)2Co]. +. , 7, was satisfied by one. ClO. −. 4 ion. These complexes are soluble in common ...

  14. Synthetic, structural, spectroscopic and theoretical study of a Mn(III)-Cu(II) dimer containing a Jahn-Teller compressed Mn ion

    Berg, Nelly; Hooper, Thomas N.; Liu, Junjie

    2013-01-01

    The heterobimetallic complex [Cu(II)Mn(III)(L)(2)(py)(4)](ClO(4))·EtOH (1) built using the pro-ligand 2,2'-biphenol (LH(2)), contains a rare example of a Jahn-Teller compressed Mn(III) centre. Dc magnetic susceptibility measurements on 1 reveal a strong antiferromagnetic exchange between the Cu...

  15. Effect of perchlorate in fertilisers on lettuce and fruit vegetables : Uptake and distribution of perchlorate in greenhouse soil-grown butterhead lettuce and solless-grown cucumber, sweet pepper, round and cherry tomate

    Voogt, W.; Eveleens, B.A.; Steenhuizen, J.W.; Vandevelde, I.; Vis, de R.; Lommel, van J.

    2014-01-01

    In 2013 traces of perchlorate were detected in fruits and vegetable samples. Because perchlorate (ClO4 -) is part of a group of substances (goitrogens) that may inhibit the uptake of iodine by the thyroid, these findings caused commotion in the markets. Fertilizers were named as one of the sources

  16. Application of chlorine dioxide to lessen bacterial contamination during broiler defeathering

    Due to escape of contaminated gut contents, the number of Campylobacter spp. recovered from broiler carcasses increases during feather removal. Chlorine dioxide (ClO2) is approved for use as an antimicrobial treatment during poultry processing. A study was designed to test if application of 50 ppm...

  17. Variable selection in multivariate calibration based on clustering of variable concept.

    Farrokhnia, Maryam; Karimi, Sadegh

    2016-01-01

    Recently we have proposed a new variable selection algorithm, based on clustering of variable concept (CLoVA) in classification problem. With the same idea, this new concept has been applied to a regression problem and then the obtained results have been compared with conventional variable selection strategies for PLS. The basic idea behind the clustering of variable is that, the instrument channels are clustered into different clusters via clustering algorithms. Then, the spectral data of each cluster are subjected to PLS regression. Different real data sets (Cargill corn, Biscuit dough, ACE QSAR, Soy, and Tablet) have been used to evaluate the influence of the clustering of variables on the prediction performances of PLS. Almost in the all cases, the statistical parameter especially in prediction error shows the superiority of CLoVA-PLS respect to other variable selection strategies. Finally the synergy clustering of variable (sCLoVA-PLS), which is used the combination of cluster, has been proposed as an efficient and modification of CLoVA algorithm. The obtained statistical parameter indicates that variable clustering can split useful part from redundant ones, and then based on informative cluster; stable model can be reached. Copyright © 2015 Elsevier B.V. All rights reserved.

  18. Dietary (n-6 : n-3 Fatty Acids Alter Plasma and Tissue Fatty Acid Composition in Pregnant Sprague Dawley Rats

    Amira Abdulbari Kassem

    2012-01-01

    Full Text Available The objective of this paper is to study the effects of varying dietary levels of n-6 : n-3 fatty acid ratio on plasma and tissue fatty acid composition in rat. The treatment groups included control rats fed chow diet only, rats fed 50% soybean oil (SBO: 50% cod liver oil (CLO (1 : 1, 84% SBO: 16% CLO (6 : 1, 96% SBO: 4% CLO (30 : 1. Blood samples were taken at day 15 of pregnancy, and the plasma and tissue were analyzed for fatty acid profile. The n-3 PUFA in plasma of Diet 1 : 1 group was significantly higher than the other diet groups, while the total n-6 PUFA in plasma was significantly higher in Diet 30 : 1 group as compared to the control and Diet 1 : 1 groups. The Diet 1 : 1 group showed significantly greater percentages of total n-3 PUFA and docosahexaenoic acid in adipose and liver tissue, and this clearly reflected the contribution of n-3 fatty acids from CLO. The total n-6 PUFA, linoleic acid, and arachidonic acid were significantly difference in Diet 30 : 1 as compared to Diet 1 : 1 and control group. These results demonstrated that the dietary ratio of n-6 : n-3 fatty acid ratio significantly affected plasma and tissue fatty acids profile in pregnant rat.

  19. Synthesis, physical characterization, antibacterial activity and ...

    Some five-coordinated cobalt(III) complexes were synthesized and characterized using elemental analysis, 1H NMR and IR spectra. The formation constants and the thermodynamic parameters were measured spectrophotometrically for the 1:1 adduct formation of [Co(Chel)(PBu3)]ClO4.H2O where Chel = cd3OMesalen, ...

  20. Electrochemical properties and electrochemical impedance spectroscopy of polypyrrole-coated platinum electrodes

    M. Fall

    2006-12-01

    Full Text Available Polypyrrole (PPy films of different thickness were characterized by electrochemical impedance spectroscopy (EIS measurements in acetonitrile and aqueous solutions, containing 0.1 M NaClO4 or sodium dodecylsulfate as the dopant. The PPy films were electrochemically deposited on Pt, and their electrochemical properties studied by cyclic voltammetry. Impedance spectra were obtained at potentials ranging from 0 to 0.8 V/SCE. The EIS data were fitted using two different equivalent electrical circuits (depending on the nature of the dopant. They involve a diffusive capacitance, which increased with the passing charge during electrosynthesis (i.e. film thickness for ClO4--doped PPy, but was practically unaffected by the film thickness in the case of SDS-doped PPy. Also, a double-layer capacitance was found only in the circuit of ClO4--doped PPy. It increased with the film thickness, and showed a minimum near the open-circuit potential. Finally the charge-transfer resistance (Rct obtained with SDS is nearly 200-fold higher than that obtained with ClO4- in the same solvent (H2O. With the same dopant (ClO4-, Rct is about five times higher in acetonitrile relative to water. All these EIS results of the different types of PPy suggest a relation with the wettability of the polymer.

  1. Dicty_cDB: Contig-U16217-1 [Dicty_cDB

    Full Text Available ometrium gilt D6 of estrou... 38 2.3 2 ( BX322617 ) Zebrafish DNA sequence from clo...93A2 in l... 44 2.3 7 ( CT349010 ) Sus scrofa genomic clone CH242-333G11, genomic su... 38 2.3 2 ( CO992400 ) UMC-pd6end2-001-e11 End

  2. Antioxidant and Anti-Inflammatory Activities in Extracts from Minke Whale (Balaenoptera acutorostrata Blubber

    Mari Johannessen Walquist

    2017-01-01

    Full Text Available Intake of long-chain omega-3 polyunsaturated fatty acids (LC-n3-PUFA is commonly recognized to reduce cardiovascular disease (CVD. In previous studies, cold-pressed whale oil (CWO and cod liver oil (CLO were given as a dietary supplement to healthy volunteers. Even though CWO contains less than half the amount of LC-n3-PUFA of CLO, CWO supplement resulted in beneficial effects on anti-inflammatory and CVD risk markers compared to CLO. In the present study, we prepared virtually lipid-free extracts from CWO and CLO and evaluated the antioxidative capacity (AOC and anti-inflammatory effects. Oxygen radical absorbance capacity (ORAC and ferric reducing antioxidant power (FRAP assays were used to test the AOC, and the results indicated high levels of antioxidants present in all extracts. The anti-inflammatory effects of the extracts were tested with lipopolysaccharide- (LPS- treated THP-1 cells, measuring its ability to reduce cytokine and chemokine secretion. Several CWO extracts displayed anti-inflammatory activity, and a butyl alcohol extract of CWO most effectively reduced TNF-α (50%, p<0.05 and MCP-1 (85%, p<0.001 secretion. This extract maintained a stable effect of reducing MCP-1 secretion (60%, p<0.05 even after long-term storage. In conclusion, CWO has antioxidant and anti-inflammatory activities that may act in addition to its well-known LC-n3-PUFA effects.

  3. RAMAN SPECTROSCOPIC ANALYSIS OF FERTILIZERS AND PLANT TISSUE FOR PERCHLORATE

    Raman spectroscopy, without the need for prior chromatographic separation, was used for qualitative and quantitative analysis of 59 samples of fertilizers for perchlorate (ClO4-). These primarily lawn and garden products had no known link to Chile saltpeter, which is known to con...

  4. RAMAN SPECTRAL ANALYSIS OF PERCHLORATE CONTAMINATION IN COMMONLY-USED FERTILIZERS

    Raman spectroscopy (RS) was used for qualitative and quantitative analysis of perchlorate (ClO4-1) in 30+ commonly-used fertilizers. Perchlorate contamination is emerging as an important environmental issue since its discovery in water resources that are widely used for drinking...

  5. Selenium-Water Treatment Residual Adsorption And Characterization

    Aluminum-based water treatment residuals (WTR) have the ability to adsorb tremendous quantities of soil-borne P, and have been shown to adsorb other anions, such as As (V), As (III), and ClO4-. Environmental issues associated with Se in the Western US led us to study W...

  6. Pramana – Journal of Physics | Indian Academy of Sciences

    We study changes in microstructure and resulting changes in the properties of PEO(1 − )–NH4 ClO4 () samples where = 0.18, when irradiated with gamma doses varying up to 50 kGy. Viscosities of aqueous solutions of the irradiated samples give an idea of the change in molecular weight and show correlation with ...

  7. Branched polymeric media: Perchlorate-selective resins from hyperbranched polyethyleneimine

    Chen, Dennis P.; Yu, Changjun; Chang, ChingYu; Wan, Yanjian; Frechet, Jean; Goddard, William A.; Diallo, Mamadou S.

    2012-01-01

    prohibitive when treating groundwater with higher concentration of ClO4 - (e.g., 100-1000 ppb). In this article, we describe a new perchlorate-selective resin with high exchange capacity. This new resin was prepared by alkylation of branched polyethyleneimine

  8. HIGH-RATE DISINFECTION TECHNIQUES FOR COMBIND SEWER OVERFLOW

    This paper presents high-rate disinfection technologies for combined sewer overflow (CSO). The high-rate disinfection technologies of interest are: chlorination/dechlorination, ultraviolet light irradiation (UV), chlorine dioxide (ClO2 ), ozone (O3), peracetic acid (CH3COOOH )...

  9. High-Rate Disinfection Techniques for Combined Sewer Overflow (Proceedings Paper)

    This paper presents high-rate disinfection technologies for combined sewer overflow (CSO). The high-rate disinfection technologies of interest are: chlorination/dechlorination, ultraviolet light irradiation (UV), chlorine dioxide (ClO2 ), ozone (O3), peracetic acid (CH3COOOH ), a...

  10. Long Term Performance of an Arsenite-Oxidizing-Chlorate-Reducing Microbial Consortium in an Upflow Anaerobic Sludge Bed (UASB) Bioreactor

    Sun, Wenjie; Sierra-Alvarez, Reyes; Field, Jim A.

    2011-01-01

    A chlorate (ClO3−) reducing microbial consortium oxidized arsenite (As(III)) to arsenate (As(V)) in an upflow anaerobic sludge-bed bioreactor over 550 d operation. As(III) was converted with high conversion efficiencies (>98%) at volumetric loadings ranging from 0.45 to 1.92 mmol As/(Lreactor d). The oxidation of As(III) was linked to the complete reduction of ClO3− to Cl− and H2O, as demonstrated by a molar ratio of approximately 3.0 mol As(III) oxidized per mole of Cl− formed and by the greatly lowered ClO3−-reducing capacity without As(III) feeding. An autotrophic enrichment culture was established from the bioreactor biofilm. A 16S rRNA gene clone library indicated that the culture was dominated by Dechloromonas, and Stenotrophomonas as well as genera within the family Comamonadaceae. The results indicate that the oxidation of As(III) to less mobile As(V) utilizing ClO3− as a terminal electron acceptor provides a sustainable bioremediation strategy for arsenic contamination in anaerobic environments. PMID:21333531

  11. Dietary (n-6 : n-3) fatty acids alter plasma and tissue fatty acid composition in pregnant Sprague Dawley rats.

    Kassem, Amira Abdulbari; Abu Bakar, Md Zuki; Yong Meng, Goh; Mustapha, Noordin Mohamed

    2012-01-01

    The objective of this paper is to study the effects of varying dietary levels of n-6 : n-3 fatty acid ratio on plasma and tissue fatty acid composition in rat. The treatment groups included control rats fed chow diet only, rats fed 50% soybean oil (SBO): 50% cod liver oil (CLO) (1 : 1), 84% SBO: 16% CLO (6 : 1), 96% SBO: 4% CLO (30 : 1). Blood samples were taken at day 15 of pregnancy, and the plasma and tissue were analyzed for fatty acid profile. The n-3 PUFA in plasma of Diet 1 : 1 group was significantly higher than the other diet groups, while the total n-6 PUFA in plasma was significantly higher in Diet 30 : 1 group as compared to the control and Diet 1 : 1 groups. The Diet 1 : 1 group showed significantly greater percentages of total n-3 PUFA and docosahexaenoic acid in adipose and liver tissue, and this clearly reflected the contribution of n-3 fatty acids from CLO. The total n-6 PUFA, linoleic acid, and arachidonic acid were significantly difference in Diet 30 : 1 as compared to Diet 1 : 1 and control group. These results demonstrated that the dietary ratio of n-6 : n-3 fatty acid ratio significantly affected plasma and tissue fatty acids profile in pregnant rat.

  12. Immunohistochemical/histochemical double staining method in the study of the columnar metaplasia of the oesophagus

    D. Cabibi

    2014-03-01

    Full Text Available Intestinal metaplasia in Barrett’s oesophagus (BO represents an important risk factor for oesophageal adenocarcinoma. Instead, few and controversial data are reported about the progression risk of columnar-lined oesophagus without intestinal metaplasia (CLO, posing an issue about its clinical management. The aim was to evaluate if some immunophenotypic changes were present in CLO independently of the presence of the goblet cells. We studied a series of oesophageal biopsies from patients with endoscopic finding of columnar metaplasia, by performing some immunohistochemical stainings (CK7, p53, AuroraA combined with histochemistry (Alcian-blue and Alcian/PAS, with the aim of simultaneously assess the histochemical features in cells that shows an aberrant expression of such antigens. We evidenced a cytoplasmic expression of CK7 and a nuclear expression of Aurora A and p53,  both in goblet cells of BO and in non-goblet cells of CLO, some of which showing mild dysplasia. These findings suggest that some immunophenotypic changes are present in CLO and they can precede the appearance of the goblet cells or can be present independently of them, confirming the conception of BO as the condition characterized by any extention of columnar epithelium. This is the first study in which a combined immunohistochemical/histochemical method has been applied to Barrett pathology.

  13. Investigating the mechanism of clofibric acid removal in Fe(0)/H2O systems.

    Ghauch, Antoine; Abou Assi, Hala; Tuqan, Almuthanna

    2010-04-15

    Since the introduction of iron wall technology, the inherent relationship between contaminant removal and iron corrosion has been mostly attributed to electron transfer from the metal body (direct reduction). This thermodynamically founded premise has failed to explain several experimental facts. Recently, a new concept considering adsorption and co-precipitation as fundamental contaminant removal mechanisms was introduced. This consistent concept has faced very skeptic views and necessarily needs experimental validation. The present work was the first independent attempt to validate the new concept using clofibric acid (CLO) as model compound. For this purpose, a powdered Fe(0) material (Fe(0)) was used in CLO removal experiments under various experimental conditions. Additional experiments were performed with plated Fe(0) (mFe(0): Fe(0)/Pd(0), Fe(0)/Ni(0)) to support the discussion of removal mechanism. Main investigated experimental variables included: abundance of O(2), abundance of iron corrosion products (ICPs) and shaking operations. Results corroborated the concept that quantitative contaminant removal in Fe(0)/H(2)O systems occurs within the oxide-film in the vicinity of Fe(0). Additionally, mixing type and shaking intensity significantly influenced the extent of CLO removal. More importantly, HPLC/MS revealed that the identity of reaction products depends on the extent of iron corrosion or the abundance of ICPs. The investigation of the CLO/Fe(0)/H(2)O system disproved the popular view that direct reduction mediates contaminant removal in the presence of Fe(0). 2009 Elsevier B.V. All rights reserved.

  14. Investigating the mechanism of clofibric acid removal in Fe0/H2O systems

    Ghauch, Antoine; Abou Assi, Hala; Tuqan, Almuthanna

    2010-01-01

    Since the introduction of iron wall technology, the inherent relationship between contaminant removal and iron corrosion has been mostly attributed to electron transfer from the metal body (direct reduction). This thermodynamically founded premise has failed to explain several experimental facts. Recently, a new concept considering adsorption and co-precipitation as fundamental contaminant removal mechanisms was introduced. This consistent concept has faced very skeptic views and necessarily needs experimental validation. The present work was the first independent attempt to validate the new concept using clofibric acid (CLO) as model compound. For this purpose, a powdered Fe 0 material (Fe 0 ) was used in CLO removal experiments under various experimental conditions. Additional experiments were performed with plated Fe 0 (mFe 0 : Fe 0 /Pd 0 , Fe 0 /Ni 0 ) to support the discussion of removal mechanism. Main investigated experimental variables included: abundance of O 2 , abundance of iron corrosion products (ICPs) and shaking operations. Results corroborated the concept that quantitative contaminant removal in Fe 0 /H 2 O systems occurs within the oxide-film in the vicinity of Fe 0 . Additionally, mixing type and shaking intensity significantly influenced the extent of CLO removal. More importantly, HPLC/MS revealed that the identity of reaction products depends on the extent of iron corrosion or the abundance of ICPs. The investigation of the CLO/Fe 0 /H 2 O system disproved the popular view that direct reduction mediates contaminant removal in the presence of Fe 0 .

  15. Dicty_cDB: Contig-U04524-1 [Dicty_cDB

    Full Text Available 06281 ) Plasmodium falciparum chromosome 12 clone PFYACB8... 36 6.5 7 ( BV433064 ) S237P691RD10.T0 Portugu...eseWaterDog Canis familiar... 36 6.5 2 ( BX119923 ) Zebrafish DNA sequence from clo

  16. Dicty_cDB: AFM791 [Dicty_cDB

    Full Text Available ts) Value AB170103_1( AB170103 |pid:none) Macaca fascicularis brain cDNA clo... 246 e-130 EU684308_1( EU6843...08 |pid:none) Exorista civilis heat shock protei... 275 e-125 ( P36415 ) RecName: Full=Heat shock cognate 70

  17. Fock-space multi-reference coupled-cluster response with the effect ...

    of the doublet SF and ClO radicals is useful due to their importance in atmospheric chemistry. The dipole ... contributes to the energy from fourth order onwards. ... variation approach (CVA), involves construction of a ... method was first formulated within the CCSD approxi- ... In this paper, we will analyse the effect and impor-.

  18. Perchlorate exposure and association with iron homeostasis and other biological functions among NHANES 2005-2008 subjects

    Perchlorate exposure and association with iron homeostasis and other biological functions among NHANES 2005-2008 subjects Schreinemachers DM, Ghio AJ, Cascio WE, Sobus JR. U.S. EPA, RTP, NC, USA Perchlorate (ClO4-), an environmental pollutant, is a known thyroid toxicant and...

  19. Correlation between DNA interactions and cytotoxic activity of four new ternary compounds of copper(II) with N-donor heterocyclic ligands.

    Silva, Priscila P; Guerra, Wendell; Dos Santos, Geandson Coelho; Fernandes, Nelson G; Silveira, Josiane N; da Costa Ferreira, Ana M; Bortolotto, Tiago; Terenzi, Hernán; Bortoluzzi, Adailton João; Neves, Ademir; Pereira-Maia, Elene C

    2014-03-01

    Four new ternary complexes of copper(II) were synthesized and characterized: [Cu(hyd)(bpy)(acn)(ClO4)](ClO4)] (1), [Cu(hyd)(phen)(acn)(ClO4)](ClO4)] (2), [Cu(Shyd)(bpy)(acn)(ClO4)](ClO4)] (3) and [Cu(Shyd)(phen)(acn)(ClO4)](ClO4)] (4), in which acn=acetonitrile; hyd=2-furoic acid hydrazide, bpy=2,2-bipyridine; phen=1,10-phenanthroline and Shyd=2-thiophenecarboxylic acid hydrazide. The cytotoxic activity of the complexes in a chronic myelogenous leukemia cell line was investigated. All complexes are able to enter cells and inhibit cellular growth in a concentration-dependent manner, with an activity higher than that of the corresponding free ligands. The substitution of Shyd for hyd increases the activity, while the substitution of bpy for phen renders the complex less active. Therefore, the most potent complex is 4 with an IC50 value of 1.5±0.2μM. The intracellular copper concentration needed to inhibit 50% of cell growth is approximately 7×10(-15)mol/cell. It is worth notifying that a correlation between cytotoxic activity, DNA binding affinity and DNA cleavage was found: 1<3<2<4. © 2013.

  20. Application of chemical oxidation for removal of pharmaceuticals in wastewater effluents

    Hey, G.; Ledin, A.; la Cour Jansen, J.

    2012-01-01

    treatment dose is comparable to ClO2. Nevertheless, ozonation significantly enhanced the removal of most APIs including carbamazepine, metoprolol, flutamide, bupropion and beclomethasone. In addition, ozonation allows removal of ibuprofen at higher oxidant dose. APIs that possess the reactive electron...

  1. OPEN HEART SURGERY UNDER HYPOTHERMIA

    pulmonary blood flow by operation under hypothermia; open heart surgery ... po ition with the right arm abducted and the left arm at the ideo The ... pulmonary valve stenosis is pre ent. Mobilization ... The anaesthetist must try and prevent shivering,. 2. HOURS .... The exploratory inci ion into the right atrial cavity is then clo ed ...

  2. Study on Soil Mobility of Two Neonicotinoid Insecticides

    Mária Mörtl

    2016-01-01

    Full Text Available Movement of two neonicotinoid insecticide active ingredients, clothianidin (CLO and thiamethoxam (TMX, was investigated in different soil types (sand, clay, or loam and in pumice. Elution profiles were determined to explore differences in binding capacity. Soil characterized by high organic matter content retained the ingredients, whereas high clay content resulted in long release of compounds. Decrease in concentration was strongly influenced by soil types: both CLO and TMX were retained in loam and clay soils and showed ready elution through sandy soil and pumice. Elution capability of the active ingredients in sandy soil correlated with their water solubility, indicating approximately 30% higher rapidity for TMX than for CLO. Soil organic carbon-water partitioning coefficients (Koc determined were in good agreement with literature values with somewhat lower value for CLO in sandy soil and substantially higher values for TMX in clay soil. High mobility of these neonicotinoid active ingredients in given soil types urges stronger precautionary approach taken during their application.

  3. Survival of Salmonella Typhimurium on soybean sprouts after treatment with gaseous chlorine dioxide and biocontrol Pseudomonas bacteria

    Control of Salmonella Typhimurium on sprouts and minimally processed produce is crucial for food and consumer safety. The aim of this research was to assess natural microflora populations on soybean and evaluate the effects of gaseous chlorine dioxide (ClO2) and biocontrol Pseudomonas on the surviva...

  4. Dietary (n-6 : n-3) Fatty Acids Alter Plasma and Tissue Fatty Acid Composition in Pregnant Sprague Dawley Rats

    Kassem, Amira Abdulbari; Abu Bakar, Md Zuki; Yong Meng, Goh; Mustapha, Noordin Mohamed

    2012-01-01

    The objective of this paper is to study the effects of varying dietary levels of n-6 : n-3 fatty acid ratio on plasma and tissue fatty acid composition in rat. The treatment groups included control rats fed chow diet only, rats fed 50% soybean oil (SBO): 50% cod liver oil (CLO) (1 : 1), 84% SBO: 16% CLO (6 : 1), 96% SBO: 4% CLO (30 : 1). Blood samples were taken at day 15 of pregnancy, and the plasma and tissue were analyzed for fatty acid profile. The n-3 PUFA in plasma of Diet 1 : 1 group was significantly higher than the other diet groups, while the total n-6 PUFA in plasma was significantly higher in Diet 30 : 1 group as compared to the control and Diet 1 : 1 groups. The Diet 1 : 1 group showed significantly greater percentages of total n-3 PUFA and docosahexaenoic acid in adipose and liver tissue, and this clearly reflected the contribution of n-3 fatty acids from CLO. The total n-6 PUFA, linoleic acid, and arachidonic acid were significantly difference in Diet 30 : 1 as compared to Diet 1 : 1 and control group. These results demonstrated that the dietary ratio of n-6 : n-3 fatty acid ratio significantly affected plasma and tissue fatty acids profile in pregnant rat. PMID:22489205

  5. DETERMINATION OF PERCHLORATE BY ION CHROMATOGRAPHY, SUPPRESSED CONDUCTIVITY AND MASS SPECTROMETRIC DETECTION USING AN OXYGEN-18 ENRICHED ISOTROPIC INTERNAL STANDARD

    Perchlorate (ClO4 -) is a drinking water contaminant originating from the dissolution of the salts of ammonium, potassium, magnesium, or sodium in water. It is used primarily as an oxidant in solid propellant for rockets, missiles, pyrotechnics, as a component in air bag infla...

  6. MEASUREMENT OF PERCHLORATE IN WATER BY USE OF AN 18O-ENRICHED ISOTOPIC STANDARD AND ION CHROMATOGRAPHY WITH MASS SPECTROMETRIC DETECTION

    Perchlorate (ClO4-) is a drinking water contaminant originating from the dissolution of the salts of ammonium, potassium, magnesium, or sodium in water. It is used primarily as an oxidant in solid propellant for rockets, missiles, pyrotechnics, as a compone...

  7. MEASUREMENT OF PERCHLORATE IN WATER USING AN OXYGEN-18 ENRICHED ISOTOPE STANDARD AND ION CHROMATOGRAPHY MASS SPECTROMETRIC DETECTION

    Perchlorate (ClO4 -) is a drinking water contaminant originating from the dissolution of the salts of ammonium, potassium, magnesium, or sodium in water. It is used primarily as an oxidant in solid propellant for rockets, missiles, pyrotechnics, as a component in air bag infla...

  8. SUB-PPB QUANTITATION AND CONFIRMATION OF PERCHLORATE IN DRINKING WATERS CONTAINING HIGH TOTAL DISSOLVED SOLIDS USING ION CHROMATOGRAPHY WITH MASS SPECTROMETRIC DETECTION

    Perchlorate (ClO4 -) is a drinking water contaminant originating from the dissolution of the salts of ammonium, potassium, magnesium, or sodium in water. It is used primarily as an oxidant in solid propellant for rockets, missiles, pyrotechnics, as a component in air bag infla...

  9. Experimental Study of Closed System in the Chlorine Dioxide-Iodide-Sulfuric Acid Reaction by UV-Vis Spectrophotometric Method

    Na Li

    2011-01-01

    Full Text Available The mole ratio r(r=[I−]0/[ClO2]0 has great influence on ClO2-I−-H2SO4 closed reaction system. By changing the initiate concentration of potassium iodide, the curve of absorbance along with the reaction time was obtained at 350 nm and 297 nm for triiodide ion, and 460 nm for iodine. The changing point of the absorbance curve's shape locates at r=6.00. For the reaction of ClO2-I− in the absence of H2SO4, the curve of absorbance along with the reaction time can be obtained at 350 nm for triiodide ion, 460 nm for iodine. The mole ratio r is equal to 1.00 is the changing point of the curve's shape no matter at which wavelength to determine the reaction. For the reaction of ClO2-I−-H+ in different pH buffer solution, the curve of absorbance along with the reaction time was recorded at 460 nm for iodine. When r is greater than 1.00, the transition point of the curve's shape locates at pH 2.0, which is also the point of producing chlorite or chloride for chlorine dioxide at different pH. When r is less than 1.00, the transition point locates at pH 7.0.

  10. Improving Storability of Strawberries with Gaseous Chlorine Dioxide in Perforated Clamshell Packaging

    Chiabrando Valentina

    2018-06-01

    Full Text Available A chlorine dioxide generating pad has been used as postharvest treatment to maintain the quality and safety of strawberries in two different storage conditions. During the short storage time (3 days at 4°C + 2 days at 20°C fruit treated with ClO2 maintained better quality parameters, as color, titratable acidity, total soluble solids, anthocyanins, antioxidant capacity and lower values of weight loss. During the long storage time (12 days at 2°C, the parameters related to postharvest quality were generally preserved and the effect of ClO2 was positive to reduce the total yeast and mold, except the last period of the experiment when the ClO2 gas-generating pad was probably exhausted. The sensory evaluation revealed that the sanitization with ClO2 maintained a global positive acceptance in particular during the short storage time. The results suggest that this treatment may be suitable to maintain the quality during short storage and long storage until 8 days and it may be an important alternative sanitizer thanks to the positive action against the yeast and mold without modifying the quality of the strawberries.

  11. Intracellular pH Campylobacter jejuni when treated with aqueous chlorine dioxide

    Smigic, Nada; Rajkovic, Andreja; Arneborg, Nils

    2011-01-01

    The aim of this study was to investigate the response of Campylobacter jejuni at single-cell level when exposed to different concentrations of chlorine dioxide (ClO2). The parameter of choice, intracellular pH (pHi), was determined by using fluorescence ratio imaging microscopy with a p...

  12. Efficacy of chlorine dioxide on Escherichia coli inactivation during pilot-scale fresh-cut lettuce processing

    Banach, J.L.; Overbeek, van L.S.; Nierop Groot, M.N.; Zouwen, van der P.S.; Fels-Klerx, van der H.J.

    2018-01-01

    Controlling water quality is critical in preventing cross-contamination during fresh produce washing. Process wash water (PWW) quality can be controlled by implementing chemical disinfection strategies. The aim of this study was to evaluate the pilot-scale efficacy of chlorine dioxide (ClO2) during

  13. Fetal genetic risk of isolated cleft lip only versus isolated cleft lip and palate: A subphenotype analysis using two population-based studies of orofacial clefts in scandinavia

    Jugessur, Astanand; Shi, Min; Gjessing, Håkon Kristian

    2010-01-01

    BACKGROUND: Cleft lip only (CLO) and cleft lip and palate (CLP) are commonly regarded as variants of the same defect and are traditionally combined to form the single group of cleft lip with or without cleft palate (CL/P) prior to analysis. However, recent data have suggested that at least a subg...

  14. All Metal Organic Deposited High-Tc Superconducting Transition Edge Bolometer on Yttria-Stabilized Zirconia Substrate

    Mohajeri, Roya; Opata, Yuri Aparecido; Wulff, Anders Christian

    2016-01-01

    of voltage amplitude and phase was analysed and measured through four-probe technique in a liquid nitrogen cooling system. An increase in voltage amplitude response was observed for the fabricated YBCO/CLO/YSZ bolometer compared to previously reported TEBs with similarly deposited YBCO thin film on a SrTiO3...

  15. Chlorine dioxide reaction with selected amino acids in water

    Navalon, Sergio; Alvaro, Mercedes; Garcia, Hermenegildo

    2009-01-01

    Chlorine dioxide is a hypochlorite alternative disinfectant agent. In this context, we have determined the products formed in the reaction of ClO 2 with selected amino acids as model compounds that can be present in natural waters. The reaction of tryptophane, histidine and tyrosine (10 ppm each) with ClO 2 were studied at molar ratios ranging from 0.25 to 4 in the presence or absence of oxygen. It was found that in the absence of oxygen adding substoichiometric amounts of ClO 2 creates products that are structurally similar to the starting amino acids. Through a series of cascade reactions the initial product distribution gradually evolves toward simple, small carbon chain products that are far from the starting amino acid. The reaction product distribution revealed that chlorine dioxide can attack the electron-rich aromatic moieties as well as the nitrogen atom lone electron pair. Our study is relevant to gain knowledge on the reaction mechanism of ClO 2 with ubiquitous amino acids present in natural waters.

  16. Dicty_cDB: AFO458 [Dicty_cDB

    Full Text Available . 44 1.3 1 T09643 |T09643.1 0215m7 gmbPfHB3.1, G. Roman Reddy Plasmodium falciparum genomic clone 0215m, DNA... sequence. 38 1.5 2 AA550553 |AA550553.1 1716m3 gmbPfHB3.1, G. Roman Reddy Plasmodium falciparum genomic clo

  17. 3-(4-Chlorophenyl-1-[(2R,4aR,8aR-4a,8-dimethyl-1,2,3,4,4a,5,6,8a-octahydronaphthalen-2-yl]prop-2-en-1-one

    Mohamed Tebbaa

    2011-06-01

    Full Text Available The title compound, C21H25ClO, was semi-synthesized from isocostic acid, isolated from the aerial part of Inula Viscosa (L Aiton [or Dittrichia Viscosa (L Greuter]. The cyclohexene ring has a half-chair conformation, whereas the cyclohexane ring displays a chair conformation.

  18. ORF Alignment: NC_004557 [GENIUS II[Archive

    Full Text Available NC_004557 gi|28211518 >1v7zA 1 255 3 250 2e-62 ... ref|NP_782462.1| creatininase [Clo...stridium tetani E88] gb|AAO36399.1| creatininase ... [Clostridium tetani E88] ... Length = 248

  19. Influence of processes of structure formation in mixed solvent and anion nature on cadmium ions discharge kinetics from water-dimethylformamide electrolyte

    Kuznetsov, V.V.; Bozhenko, L.G.; Kucherenko, S.S.; Fedorova, O.V.

    1986-01-01

    Electrochemical reaction of cadmium ion discharge in water-dimethylformamide (DMF) solutions is studied. The influence of DMF concentration in the presence of different anions (ClO 4 - , F - , I - ) on both reaction kinetics and mechanism is discussed on the basis of structural transformations in the mixed solvent and near the surface electrode processes

  20. Drug: D07730 [KEGG MEDICUS

    Full Text Available D07730 Drug Cloprostenol (INN); Dalmazin [veterinary] (TN) ... C22H29ClO6 D07730.gif ... ... Prostaglandin derivative veterinary medicine ... CAS: 40665-92-7 PubChem: 51092026 LigandBox: D07730 NIKKAJI: J299.284A ...

  1. Earth Pressure at rest of Søvind Marl – a highly overconsolidated Eocene clay

    Grønbech, Gitte Lyng; Ibsen, Lars Bo; Nielsen, Benjaminn Nordahl

    2016-01-01

    The present study evaluated earth pressure at rest, K0, in highly overconsolidated Eocene clay called Søvind Marl, which exhibits extremely high plasticity indices of up to 300%, a highly fissured structure, and preconsolidation stresses up to 6,800 kPa. Continuous Loading Oedometer (CLO) tests...

  2. Bulletin of Materials Science | Indian Academy of Sciences

    (II) carbonate, CdCO3, respectively, were synthesis by a new simple unusual route during the reaction of aqueous solutions of MnX2, CoX2, ZnX2 and CdX2, where (X = Br- and ClO 4 − ) with urea at high temperature within ∼ 90°C for 6 h.

  3. Hypochlorite and superoxide radicals can act synergistically to induce fragmentation of hyaluronan and chondroitin sulphates

    Rees, Martin D; Hawkins, Clare Louise; Davies, Michael Jonathan

    2004-01-01

    at pH 7.4). Exposure of glycosaminoglycans to a MPO-H2O2-Cl- system or reagent HOCl generates long-lived chloramides [R-NCl-C(O)-R'] derived from the glycosamine N-acetyl functions. Decomposition of these species by transition metal ions gives polymer-derived amidyl (nitrogen-centred) radicals [R......-carboxybenzyl)hyponitrite] was demonstrated to be entirely chloramide dependent as no fragmentation occurred with the native polymers or when the chloramides were quenched by prior treatment with methionine. EPR spin-trapping experiments using 5,5-dimethyl1-pyrroline-N-oxide and 2-methyl-2-nitrosopropane have...

  4. Reaction of chlorine nitrate with hydrogen chloride and water at Antarctic stratospheric temperatures

    Tolbert, Margaret A.; Rossi, Michel J.; Malhotra, Ripudaman; Golden, David M.

    1987-01-01

    Laboratory studies of heterogeneous reactions important for ozone depletion over Antarctica are reported. The reaction of chlorine nitrate (ClONO2) with H2O and HCl on surfacers that simulate polar stratospheric clouds are studied at temperatures relevant to the Antarctic stratosphere. The gaseous products of the resulting reactions, HOCl, Cl2O, and Cl2, could readily photolyze in the Antarctic spring to produce active chlorine for ozone depletion. Furthermore, the additional formation of condensed-phase HNO3 could serve as a sink for odd nitrogen species that would otherwise scavenge the active chlorine.

  5. Neurotransmitter Mechanisms in the Nucleus Accumbens Septi and Related Regions in the Rat Brain.

    1981-06-30

    Brain Res 77, 507-12. Palkovits XI (1973): Isolated removal of hypothalamic or other brain nuclei of the rat, Brain Res 59, 449-50. Phillipson O T...and operated animals were killed by decapitation, the lesioned animals 6-14 days after operation. The brain was rapidly removed and frozen on a... electrocoagulation with 2 mA for 20 s. This led to a the pH adjusted to 7.2 with NaOH A hocle was made lesion centered in the parafascicular and

  6. Hypochlorite-induced damage to DNA, RNA, and polynucleotides

    Hawkins, Clare Louise; Davies, Michael Jonathan

    2002-01-01

    favored exocyclic amines. EPR experiments have also provided evidence for the rapid addition of pyrimidine-derived nitrogen-centered radicals to other nucleobases to give dimers and the oxidation of DNA by radicals derived from preformed nucleoside chloramines. Direct reaction of HOCl with plasmid DNA...... on the nature of the nucleobase on which they are formed, with chloramines formed from ring heterocyclic amine groups being less stable than those formed on exocyclic amines (RNH2 groups). Evidence is presented for chlorine transfer from the former, kinetically favored, sites to the more thermodynamically...

  7. Combination treatment of chlorine dioxide gas and aerosolized sanitizer for inactivating foodborne pathogens on spinach leaves and tomatoes.

    Park, Sang-Hyun; Kang, Dong-Hyun

    2015-08-17

    The objective of this study was to evaluate the antimicrobial effect of chlorine dioxide (ClO2) gas and aerosolized sanitizer, when applied alone or in combination, on the survival of Escherichia coli O157:H7, Salmonella Typhimurium, and Listeria monocytogenes inoculated onto spinach leaves and tomato surfaces. Spinach leaves and tomatoes were inoculated with a cocktail of three strains each of the three foodborne pathogens. ClO2 gas (5 or 10 ppmv) and aerosolized peracetic acid (PAA) (80 ppm) were applied alone or in combination for 20 min. Exposure to 10 ppmv of ClO2 gas for 20 min resulted in 3.4, 3.3, and 3.4 log reductions of E. coli O157:H7, S. Typhimurium, and L. monocytogenes on spinach leaves, respectively. Treatment with 80 ppm of aerosolized PAA for 20 min caused 2.3, 1.9, and 0.8 log reductions of E. coli O157:H7, S. Typhimurium, and L. monocytogenes, respectively. Combined treatment of ClO2 gas (10 ppmv) and aerosolized PAA (80 ppm) for 20 min caused 5.4, 5.1, and 4.1 log reductions of E. coli O157:H7, S. Typhimurium, and L. monocytogenes, respectively. E. coli O157:H7, S. Typhimurium, and L. monocytogenes on tomatoes experienced similar reduction patterns to those on spinach leaves. As treatment time increased, most combinations of ClO2 gas and aerosolized PAA showed additive effects in the inactivation of the three pathogens. Combined treatment of ClO2 gas and aerosolized PAA produced injured cells of three pathogens on spinach leaves while generally did not produce injured cells of these pathogens on tomatoes. Combined treatment of ClO2 gas (10 ppmv) and aerosolized PAA (80 ppm) did not significantly (p>0.05) affect the color and texture of samples during 7 days of storage. Copyright © 2015. Published by Elsevier B.V.

  8. Evaluation of disinfection efficiency in pet's hospital by using chlorine dioxide

    Ching-Shan Hsu

    2016-07-01

    Full Text Available Microbial aerosols could cause various human and animal health problems and their control is becoming a significant scientific and technological topic for consideration. The main objectives of this study were to monitor bioaerosol levels of the pet's hospital and then to perform disinfection efficiency by applying chlorine dioxide. The air quality within these pet's hospitals should satisfy the guidelines specified by the Taiwan Environmental Protection Administration (TEPA. Accordingly, this study performed an experimental investigation into the efficiency of two different gaseous chlorine dioxide (0.3 mg m−3 treatments in disinfecting a local pet's hospital, namely a single, one-off application and a multiple-daily application. In both cases, the ClO2 was applied using strategically-placed aerosol devices. The air quality before and after disinfection was evaluated by measuring the bioaerosol levels of bacteria and fungi. The experimental results found that the average background levels of bacteria and fungi prior to ClO2 disinfection were found to be 2014 ± 1350 and 1002 ± 669 CFU m−3, respectively. A single ClO2 application was found to total disinfected bacteria and fungi concentration levels by as much as 57.3 and 57.6%. By contrast, a multiple-daily ClO2 application was found to total disinfected bacteria and fungi concentration levels by as much as 65.1 and 57.6%. Among the two disinfection methods, the multiple-daily ClO2 application method was found to yield a higher disinfection efficiency for bacteria, i.e., 16.28 ± 0.92%. Thus, using a ClO2 disinfectant to maintain the air quality is of great importance to reduce infectious diseases in the pet's hospital. Therefore, the results suggest that the air quality guidelines prescribed by the TEPA for pet's hospital and other animal facilities can best be achieved by applying chlorine dioxide at regular intervals. The ClO2 aerosol devices can effectively restrain or

  9. Lethality of chlorine, chlorine dioxide, and a commercial fruit and vegetable sanitizer to vegetative cells and spores of Bacillus cereus and spores of Bacillus thuringiensis.

    Beuchat, Larry R; Pettigrew, Charles A; Tremblay, Mario E; Roselle, Brian J; Scouten, Alan J

    2004-08-01

    Chlorine, ClO2, and a commercial raw fruit and vegetable sanitizer were evaluated for their effectiveness in killing vegetative cells and spores of Bacillus cereus and spores of Bacillus thuringiensis. The ultimate goal was to use one or both species as a potential surrogate(s) for Bacillus anthracis in studies that focus on determining the efficacy of sanitizers in killing the pathogen on food contact surfaces and foods. Treatment with alkaline (pH 10.5 to 11.0) ClO2 (200 microg/ml) produced by electrochemical technologies reduced populations of a five-strain mixture of vegetative cells and a five-strain mixture of spores of B. cereus by more than 5.4 and more than 6.4 log CFU/ml respectively, within 5 min. This finding compares with respective reductions of 4.5 and 1.8 log CFU/ml resulting from treatment with 200 microg/ml of chlorine. Treatment with a 1.5% acidified (pH 3.0) solution of Fit powder product was less effective, causing 2.5- and 0.4-log CFU/ml reductions in the number of B. cereus cells and spores, respectively. Treatment with alkaline ClO2 (85 microg/ml), acidified (pH 3.4) ClO2 (85 microg/ml), and a mixture of ClO2 (85 microg/ml) and Fit powder product (0.5%) (pH 3.5) caused reductions in vegetative cell/spore populations of more than 5.3/5.6, 5.3/5.7, and 5.3/6.0 log CFU/ml, respectively. Treatment of B. cereus and B. thuringiensis spores in a medium (3.4 mg/ml of organic and inorganic solids) in which cells had grown and produced spores with an equal volume of alkaline (pH 12.1) ClO2 (400 microg/ml) for 30 min reduced populations by 4.6 and 5.2 log CFU/ml, respectively, indicating high lethality in the presence of materials other than spores that would potentially react with and neutralize the sporicidal activity of ClO2.

  10. Efficacy of chlorine dioxide on Escherichia coli inactivation during pilot-scale fresh-cut lettuce processing.

    Banach, J L; van Overbeek, L S; Nierop Groot, M N; van der Zouwen, P S; van der Fels-Klerx, H J

    2018-03-23

    Controlling water quality is critical in preventing cross-contamination during fresh produce washing. Process wash water (PWW) quality can be controlled by implementing chemical disinfection strategies. The aim of this study was to evaluate the pilot-scale efficacy of chlorine dioxide (ClO 2 ) during processing on the reduction of Escherichia coli in the PWW and on processed fresh-cut 'Lollo Rossa' lettuce. The objective was to have a residual target concentration of either 5 or 3 mg/L ClO 2 in the washing tank (3.5 m 3 ) before and during 800 kg of lettuce processing (90 min). After 90 min., a nonpathogenic, non-Extended Spectrum Beta-Lactamase (ESBL) E. coli inoculum from an overnight culture broth (37 °C) was added to the tank resulting in an approximate final level of 10 6  CFU/mL. PWW and lettuce samples for microbiological and chemical analyses were taken before and after the input and supply halted. ClO 2 concentrations quickly decreased after ClO 2 input halted, yet a residual concentration of ≥2.5 mg/L and ≥2.1 mg/L ClO 2 , respectively for 5 and 3 mg/L pilots, was present 12 min after the supply halted. No detectable levels of E. coli (limit of detection 5 log) were determined in the water within 1 min after E. coli was added to the ClO 2 containing wash water. Results demonstrated that ClO 2 use at the semi-commercial pilot scale was able to reduce the E. coli peak contamination in the PWW. After storage (5 days, 4 °C), background microbial communities (i.e., fluorescent Pseudomonads and total heterotrophic bacteria) grew out on lettuce. Overall, ClO 2 decreased the potential for cross-contamination between batches compared to when no sanitizer was used. Chlorate levels of the lettuce sampled before entering the wash water ranged from 7.3-11.6 μg/kg. The chlorate levels of the lettuce sampled after being washed in the ClO 2 containing wash water, as well as after rinsing and centrifugation, ranged from 22.8-60.4

  11. Flash photolysis of chlorine dioxide in aqueous solution

    Mialocq, Jean-Claude

    1972-01-01

    The primary process when aqueous solutions of chlorine dioxide are flash photo-lysed by light with a wave length greater than 270 nm is: OClO → hν ClO ( 2 Π) + O ( 3 P). The photochemical decomposition is characterized by the formation of small quantities of O ( 3 P) atoms and of equal amounts of chlorine atoms and molecular oxygen, the latter originating in the reaction: ClOO → Cl + O 2 . The isomer ClOO is formed by the germinate recombination of ClO and O, a process which is twice as important as diffusion of the fragments into the mass of the solution and one which represents 30 per cent of the decomposition of the chlorine dioxide. Under our experimental conditions, the lifetime of the ClOO is less than one microsecond. Chlorine atoms are precursors of Cl 2 O 2 , whose UV absorption spectrum has been determined, and which is formed by the reactions: Cl + OClO → Cl 2 O 2 ; Cl + Cl - → Cl 2- ; Cl 2- + OClO → Cl 2 O 2 + Cl - k = (1,0 ±0,1) 10 9 M -1 s -1 . Cl 2 O 2 disappears by a first-order process which leads to the formation of the ions Cl - and ClO 3 - . Competition between the reactions: O ( 3 P) + O 2 → O 3 ; O ( 3 P) + OClO → ClO 3 . ( k OClO + O)/( k O 2 + O) = 1.85±0.25 has been studied and the molar extinction coefficient of ClO 3 determined at its absorption maximum (255 nm): ε 255 nm = (920 ± 90) M -1 cm -1 . (author) [fr

  12. Population pharmacokinetics of proguanil in patients with acute P. falciparum malaria after combined therapy with atovaquone.

    Hussein, Z; Eaves, C J; Hutchinson, D B; Canfield, C J

    1996-11-01

    1. The pharmacokinetics of proguanil were evaluated in patients with acute P. falciparum malaria receiving concomitantly proguanil hydrochloride and atovaquone. The population consisted of 203 Blacks, 112 Orientals and 55 Malays; 274 males and 96 females. Of the 370 patients, 114 and 256 patients were classified as 'poor' and 'extensive' metabolizers of proguanil, respectively. Body weight and age ranged between 11-110 kg and 3-65 years, respectively. 2. A one compartment model with first-order absorption and elimination was fitted to proguanil plasma concentration-time profiles, using non-linear mixed effect modelling (NONMEM). 3. Oral clearance (CLo) showed a 0.785 power relationship with body weight and was 13% higher in Orientals than Blacks and Malays and 17% lower in 'poor' than 'extensive' metabolizers. According to the mean weight of each population, the final population estimates of CLo in Blacks, Orientals and Malays who are 'extensive' metabolizers were 54.0, 61.5 and 64.3 l h-1, respectively. Age, gender and dose had no significant effects on CLo. 4. Apparent volume of distribution (V/F) showed a 0.88 power relationship with body weight. The final population estimates were 562 and 1629 l in children ( 15 years, respectively, who had a mean body weight of 22.6 and 54.8 kg, respectively. The effect of other covariates on V/F was not examined. 5. The final magnitudes of interpatient variability in CLo and V/F were relatively low at 22.5 and 17.0%, respectively. 6. Population pharmacokinetic parameter estimates in Black, Oriental and Malay patients with acute P. falciparum malaria are in good agreement with results of pharmacokinetic studies in healthy Caucasian volunteers. In view of the 30-50% residual variability in proguanil plasma concentrations, the slight effects of Orientals and 'poor' metabolizers on CLo are unlikely to be clinically significant. Hence, dose recommendation will be solely based on body weight.

  13. Characterization of an acute molecular marker of nongenotoxic rodent hepatocarcinogenesis by gene expression profiling in a long term clofibric acid study.

    Michel, Cécile; Roberts, Ruth A; Desdouets, Chantal; Isaacs, Kevin R; Boitier, Eric

    2005-04-01

    Evaluation of the nongenotoxic potential early during the development of a drug presents a major challenge. Recently, two genes were identified as potential molecular markers of rodent hepatic carcinogenesis: transforming growth factor-beta stimulated clone 22 (TSC-22) and NAD(P)H cytochrome P450 oxidoreductase (CYP-R) (1). They were identified after comparing the gene expression profiles obtained from the livers of Sprague-Dawley rats treated with different genotoxic and nongenotoxic compounds in a 5 day repeat dose in vivo study. To assess the potential of these two genes as acute markers of carcinogenesis, we investigated their modulation during a long-term nongenotoxic study in the rat using a classic initiation-promotion regime. Clofibric acid (CLO), which belongs to the broad class of chemicals known as peroxisome proliferators, was used as a nongenotoxic hepatocarcinogen. Male F344 rats were given a single nonnecrogenic injection of diethylnitrosamine (0 or 30 mg/kg) and fed a diet containing none or 5000 ppm CLO for up to 20 months. Necropsies of five rats per groups were performed at 18, 46, 102, 264, 377, 447 (control, DEN, and DEN + CLO rats), 524, and 608 days (for the CLO and control rats). Gross macroscopic and microscopic evaluation and gene expression profiling (on Affymetrix microarrays) were performed in peritumoral and tumoral liver tissues. Bioanalysis of the liver gene expression data revealed that TSC-22 was strongly down-regulated early in the study. Its underexpression was maintained throughout the study but disappeared upon CLO withdrawal. These modulations were confirmed by real-time polymerase chain reaction. However, CYP-R gene expression was not significantly altered in our study. Taken together, our results showed that TSC-22, but not CYP-R, has the potential to be an acute early molecular marker for nongenotoxic hepatocarcinogenesis in rodents.

  14. Assessing the phototransformation of diclofenac, clofibric acid and naproxen in surface waters: Model predictions and comparison with field data.

    Avetta, Paola; Fabbri, Debora; Minella, Marco; Brigante, Marcello; Maurino, Valter; Minero, Claudio; Pazzi, Marco; Vione, Davide

    2016-11-15

    Phototransformation is important for the fate in surface waters of the pharmaceuticals diclofenac (DIC) and naproxen (NAP) and for clofibric acid (CLO), a metabolite of the drug clofibrate. The goal of this paper is to provide an overview of the prevailing photochemical processes, which these compounds undergo in the different conditions found in freshwater environments. The modelled photochemical half-life times of NAP and DIC range from a few days to some months, depending on water conditions (chemistry and depth) and on the season. The model indicates that direct photolysis is the dominant degradation pathway of DIC and NAP in sunlit surface waters, and potentially toxic cyclic amides were detected as intermediates of DIC direct phototransformation. With modelled half-life times in the month-year range, CLO is predicted to be more photostable than DIC or NAP and to be degraded mainly by reaction with the • OH radical and with the triplet states of chromophoric dissolved organic matter ( 3 CDOM*). The CLO intermediates arising from these processes and detected in this study (hydroquinone and 4-chlorophenol) are, respectively, a chronic toxicant to aquatic organisms and a possible carcinogen for humans. Hydroquinone is formed with only ∼5% yield upon CLO triplet-sensitised transformation, but it is highly toxic for algae and crustaceans. In contrast, the formation yield of 4-chlorophenol reaches ∼50% upon triplet sensitisation and ∼10% by · OH reaction. The comparison of model predictions with field data from a previous study yielded a very good agreement in the case of DIC and, when using 4-carboxybenzophenone as proxy for triplet sensitisation by CDOM, a good agreement was found for CLO as well. In the case of NAP, the comparison with field data suggests that its direct photolysis quantum yield approaches or even falls below the lower range of literature values. Copyright © 2016 Elsevier Ltd. All rights reserved.

  15. Comparative protective effects of royal jelly and cod liver oil against neurotoxic impact of tartrazine on male rat pups brain.

    Mohamed, Amany Abdel-Rahman; Galal, Azza A A; Elewa, Yaser H A

    2015-09-01

    This study is aimed to evaluate the possible neurotoxic effect of tartrazine (T), an extensively used synthetic azo dye, as well as to determine the potential modulatory role of cod liver oil (CLO) or royal jelly (RJ) against such effects. For this purpose, thirty-six male rat pups were allocated into six groups. The 1st group received distilled water (control group), the 2nd group was given 300 mg RJ/kg bw (RJ group), the 3rd group was given 0.4 ml CLO/kg bw (CLO group), the 4th was given 500 mg T/kg bw (T group). The 5th group was given T concurrently with RJ (TRJ group) and the 6th group was given T concurrently with CLO (TCLO group), at the same doses as the former groups. All treatments were given orally for 30 consecutive days. The concentrations of different brain neurotransmitters, gamma amino butyric acid (GABA), dopamine (DA) and serotonin (5HT) as well as the antioxidant and oxidative stress biomarkers were measured in the brain homogenates. An immunohistochemical staining of the cerebral cortex was applied with the anti-ssDNA antibody (an apoptotic cell marker) to reveal the changes in brain structure. The T group revealed a significant decrease in the concentration of the brain neurotransmitters, a sharp shortage in the level of antioxidant biomarkers (super oxide dismutase, catalase and the reduced glutathione), a marked increase in malondialdehyde levels, and numerous apoptotic cells in the brain cortex compared with the other groups. Interestingly, all the previously mentioned parameters were almost retrieved in both the TRJ and TCLO groups compared to the T group. These results conclusively demonstrate that RJ and CLO administration provides sufficient protection against the ruinous effects of T on rat pups brain tissue function and structure. Copyright © 2015 Elsevier GmbH. All rights reserved.

  16. Factors affecting the formation of iodo-trihalomethanes during oxidation with chlorine dioxide.

    Guo, Wanhong; Shan, Yingchun; Yang, Xin

    2014-01-15

    Effects of water characteristics, reaction time, temperature, bromide and iodide ion concentrations, oxidant doses, and pH on formation of iodinated trihalomethanes (I-THM) during oxidation of iodide-containing water with chlorine dioxide (ClO2) were investigated. Among the water samples collected from ten water sources, iodoform (CHI3) was the predominant I-THM and trace amount of chlorodiiodomethane (CHClI2) was occasionally found. CHI3 yields correlated moderately with specific UV absorbance (SUVA) (R(2)=0.79), indicating that hydrophobic aromatic content were important precursors. Longer reaction time led to continued formation of CHI3. I-THM containing bromide was also found in waters containing both bromide and iodide, but CHI3 was dominant. The formation of CHI3 was higher at 25°C than 5°C and 35°C. CHI3 formation showed an increase followed by a decrease trend with increasing ClO2 doses and iodide concentrations and the highest yields occurred at iodide to ClO2 molar ratios of 1-2. pH 8 resulted in the highest CHI3 formation. It should be noted that a high iodide concentration was spiked to waters before adding ClO2 and the results may not reflect the formation yields of iodinated THMs in real conditions, but they provide information about formation trend of I-THM during oxidation of ClO2. Copyright © 2013 Elsevier B.V. All rights reserved.

  17. Ametryn degradation by aqueous chlorine: Kinetics and reaction influences

    Xu Bin; Gao Naiyun; Cheng Hefa; Hu Chenyan; Xia Shengji; Sun Xiaofeng; Wang Xuejiao; Yang Shaogui

    2009-01-01

    The chemical oxidation of the herbicide ametryn was investigated by aqueous chlorination between pH 4 and 10 at a temperature of 25 deg. C. Ametryn was found to react very rapidly with aqueous chlorine. The reaction kinetics can be well described by a second-order kinetic model. The apparent second-order rate constants are greater than 5 x 10 2 M -1 s -1 under acidic and neutral conditions. The reaction proceeds much more slowly under alkaline conditions. The predominant reactions were found to be the reactions of HOCl with neutral ametryn and the charged ametryn, with rate constants equal to 7.22 x 10 2 and 1.58 x 10 3 M -1 s -1 , respectively. The ametryn degradation rate increases with addition of bromide and decreases with addition of ammonia during the chlorination process. Based on elementary chemical reactions, a kinetic model of ametryn degradation by chlorination in the presence of bromide or ammonia ion was also developed. By employing this model, we estimate that the rate constants for the reactions of HOBr with neutral ametryn and charged ametryn were 9.07 x 10 3 and 3.54 x 10 6 M -1 s -1 , respectively. These values are 10- to 10 3 -fold higher than those of HOCl, suggesting that the presence of bromine species during chlorination could significantly accelerate ametryn degradation.

  18. Production, Quality Control and Biological Evaluation of 166Ho-PDTMP as a Possible Bone Palliation Agent

    Samaneh Zolghadri

    2013-05-01

    Full Text Available Objective(s:In this study, 166Ho-1,2-propylene di-amino tetra(methy1enephosphonicAcid (166Ho-PDTMP complex  was prepared as a bone palliation agent. Materials and Methods:The complex was successfully prepared using an in-house synthesized EDTMP ligand and 166HoCl3. Ho-166 chloride was obtained by thermal neutron irradiation (1 × 1013 n.cm-2.s-1 of natural Ho(NO33 samples  followed by radiolabeling and stability studies. Biodistribution in wild type rats was also peformed. Results: The complex was prepared with thespecific activity of 278 GBq/mg and high radiochemical purity (>99%, checked by ITLC. 166Ho-PDTMP complex was stabilized in the final preparation and in the presence of human serum (>90% up to 72 hr. The biodistribution of 166Ho-PDTMP in wild-type rats demonstrated significant bone uptake was up to 48 hr compared to 166HoCl3. Conclusion: The produced 166Ho-PDTMP properties suggest a possible new bone palliative therapeutic to overcome the metastatic bone pains.  

  19. The vapour pressure of americium(III) chloride

    Schuster, W.

    1983-01-01

    Based on the method described by Fischer, an ultramicro-size appratus was developed for static determination of the saturation vapour pressure of highly radioactive materials. The apparatus was tested with MgCl 2 , MnCl 2 , HoCl 3 and ScF 3 . The vapour pressure curves of MgCl 2 and MnCl 2 were in good agreement with other publications and thus proved the efficiency of the apparatus in spite of its difficulties of handling. The values measured for HoCl 3 and ScF 3 differed from those of earlier publications. However, these deviations have been observed before and may be the result of the different measuring principles of static and dynamic methods. For AmCl 3 , the following vapour pressure equation was established: log psub(Torr)=-(11826/T)+10.7. The thermodynamic parameters of the evaporation process were calculated on this basis, and the values for AmBr 3 and PnCl 3 were determined by extrapolation. (orig.) [de

  20. Toxic impact of bromide and iodide on drinking water disinfected with chlorine or chloramines.

    Yang, Yang; Komaki, Yukako; Kimura, Susana Y; Hu, Hong-Ying; Wagner, Elizabeth D; Mariñas, Benito J; Plewa, Michael J

    2014-10-21

    Disinfectants inactivate pathogens in source water; however, they also react with organic matter and bromide/iodide to form disinfection byproducts (DBPs). Although only a few DBP classes have been systematically analyzed for toxicity, iodinated and brominated DBPs tend to be the most toxic. The objectives of this research were (1) to determine if monochloramine (NH2Cl) disinfection generated drinking water with less toxicity than water disinfected with free chlorine (HOCl) and (2) to determine the impact of added bromide and iodide in conjunction with HOCl or NH2Cl disinfection on mammalian cell cytotoxicity and genomic DNA damage induction. Water disinfected with chlorine was less cytotoxic but more genotoxic than water disinfected with chloramine. For both disinfectants, the addition of Br(-) and I(-) increased cytotoxicity and genotoxicity with a greater response observed with NH2Cl disinfection. Both cytotoxicity and genotoxicity were highly correlated with TOBr and TOI. However, toxicity was weakly and inversely correlated with TOCl. Thus, the forcing agents for cytotoxicity and genotoxicity were the generation of brominated and iodinated DBPs rather than the formation of chlorinated DBPs. Disinfection practices need careful consideration especially when using source waters containing elevated bromide and iodide.

  1. Inactivation of thiol-dependent enzymes by hypothiocyanous acid: role of sulfenyl thiocyanate and sulfenic acid intermediates

    Barrett, Tessa J.; Pattison, David I.; Leonard, Stephen E.; Carroll, Kate S.; Davies, Michael J.; Hawkins, Clare L.

    2012-01-01

    Myeloperoxidase (MPO) forms reactive oxidants including hypochlorous and hypothiocyanous acids (HOCl and HOSCN) under inflammatory conditions. HOCl causes extensive tissue damage and plays a role in the progression of many inflammatory-based diseases. Although HOSCN is a major MPO oxidant, particularly in smokers, who have elevated plasma thiocyanate, the role of this oxidant in disease is poorly characterized. HOSCN induces cellular damage by targeting thiols. However, the specific targets and mechanisms involved in this process are not well defined. We show that exposure of macrophages to HOSCN results in the inactivation of intracellular enzymes, including creatine kinase (CK) and glyceraldehyde-3-phosphate dehydrogenase (GAPDH). In each case, the active-site thiol residue is particularly sensitive to oxidation, with evidence for reversible inactivation and the formation of sulfenyl thiocyanate and sulfenic acid intermediates, on treatment with HOSCN (less than fivefold molar excess). Experiments with DAz-2, a cell-permeable chemical trap for sulfenic acids, demonstrate that these intermediates are formed on many cellular proteins, including GAPDH and CK, in macrophages exposed to HOSCN. This is the first direct evidence for the formation of protein sulfenic acids in HOSCN-treated cells and highlights the potential of this oxidant to perturb redox signaling processes. PMID:22248862

  2. Helicobacter Catalase Devoid of Catalytic Activity Protects the Bacterium against Oxidative Stress*♦

    Benoit, Stéphane L.; Maier, Robert J.

    2016-01-01

    Catalase, a conserved and abundant enzyme found in all domains of life, dissipates the oxidant hydrogen peroxide (H2O2). The gastric pathogen Helicobacter pylori undergoes host-mediated oxidant stress exposure, and its catalase contains oxidizable methionine (Met) residues. We hypothesized catalase may play a large stress-combating role independent of its classical catalytic one, namely quenching harmful oxidants through its recyclable Met residues, resulting in oxidant protection to the bacterium. Two Helicobacter mutant strains (katAH56A and katAY339A) containing catalase without enzyme activity but that retain all Met residues were created. These strains were much more resistant to oxidants than a catalase-deletion mutant strain. The quenching ability of the altered versions was shown, whereby oxidant-stressed (HOCl-exposed) Helicobacter retained viability even upon extracellular addition of the inactive versions of catalase, in contrast to cells receiving HOCl alone. The importance of the methionine-mediated quenching to the pathogen residing in the oxidant-rich gastric mucus was studied. In contrast to a catalase-null strain, both site-change mutants proficiently colonized the murine gastric mucosa, suggesting that the amino acid composition-dependent oxidant-quenching role of catalase is more important than the well described H2O2-dissipating catalytic role. Over 100 years after the discovery of catalase, these findings reveal a new non-enzymatic protective mechanism of action for the ubiquitous enzyme. PMID:27605666

  3. Kinetics and mechanism of the oxidation of uranium (IV) by hypochlorous acid in aqueous acidic perchlorate media

    Silverman, R.A.; Gordon, G.

    1976-01-01

    The oxidation of uranium(IV) by hypochlorous acid has been studied in aqueous sodium perchlorate--perchloric acid solutions. The reaction U 4 + + 2HOCl = UO 2 2 + + Cl 2 (aq) + 2H + proceeds appropriate to the rate law --d[U(IV)]/dt = k 0 . [U 4+ ][HOCl][H + ] -1 . At 25 0 and 3 M ionic strength, k 0 is 1.08 +- 0.07 sec -1 . Over the 1--25 0 temperature range, ΔH 2+ is 18.4 +- 0.1 kcal mole -1 , and ΔS 2+ is 3.1 +- 0.4 eu. The inverse hydrogen ion dependence of the rate law is explained by a rapid preequilibrium, in which a proton is lost from one of the reactants. A uranyl-like activated complex, [H 2 UO 2 Cl 3+ ] 2+ , is suggested, with one proton likely to be residing on each oxygen atom. Evidence is presented that the mechanism involves a two-electron transfer, with the intermediate chloride ion rapidly reacting with hypochlorous acid to form chlorine. The uranium(IV)-hypochlorous acid reaction plays an important role in the oxidation of uranium(IV) by aqueous chlorine solutions. The magnitude of this role was seriously underestimated by previous investigators

  4. [Critical assessment of a new endoscopic anatomic concept for the so-called cardia in the sense of the notions of Parmenides and Martin Heidegger].

    Riegler, M; Asari, R; Cosentini, E P; Wrba, F; Schoppmann, S F

    2014-04-01

    Current endoscopic anatomy interposes the gastric cardia between the tubular oesophagus and the proximal stomach. In contrast to that, recent evidence unfolds a different view. Using "PubMed" and "Scopus" searches, we examined if the novel understanding regarding the cardia goes in line with the concept of unfolding, as described by Heidegger based on the ancient didactic poetry of Parmenides. What has been taken as gastric cardia in fact represents reflux-damaged, dilated, columnar lined oesophagus (CLO): dilated distal oesophagus (DDO). Due to its macroscopic gastric appearance it cannot be discriminated from the stomach by endoscopy. Differentiation between DDE and proximal stomach requires the histopathology of measured multi-level biopsies obtained from the DDO and the proximal stomach. Cardaic, onxytocardiac mucosa and intestinal metaplasia (IM; Barrett's oesophagus) define CLO and thus the oesophageal location, while oxyntic mucosa (OM) of the proximal stomach verifies a gastric biopsy location. Endoscopically visible CLO and DDO define the morphological manifestation of reflux: the squamo-oxyntic gap (SOG). Biopsies obtained from the level of the diaphragmatic impressions allow differentiation between an enlarged hiatus with normal anatomic content (CLO; oesophagus) vs. hernia with abnormal content (OM; stomach). Non-dysplastic Barrett's oesophagus exists in 10 %-17 % of asymptomatic and in 20 %-100 % (with increasing CLO length) of reflux symptom-positive individuals (annual cancer risk: 0.2 %-0.7 %). These data justify biopsy of an endoscopically normal appearing squamocolumnar junction for the exclusion of Barrett's oesophagus and cancer risk. In the absence of contraindications, cancer risk-based therapy of dysplastic Barrett's oesophagus includes radiofrequency ablation (RFA) ± endoscopic resection. The perception of the cardia as reflux damaged DDO mirrors the concept of unfolding, as described by the interpretation of the didactic poem

  5. Atomic absorption spectrophotometry of europium using an enhancing effect of ammonium perchlorate

    Oguro, Hiroshi

    1976-01-01

    In the atomic absorption spectrophotometry of europium in air-acetylene flame, ammonium perchlorate (NH 4 ClO 4 ) increases the absorption of europium. In the case of 0.5 M NH 4 ClO 4 , the increase is by about 1.5 times. In this paper, a method for eliminating the interferences of many coexisting compounds using an enhancing effect and a method for determining Eu 2 O 3 in La 2 O 3 were investigated. The working conditions using Nippon Jarrell-Ash model AA-1 atomic absorption/flame emission spectrophotometer were as follows; wavelength 4594 A, lamp current 15 mA, burner height 10 mm, air flow-rate 6.51/min, acetylene flow-rate 1.81/min. Though the enhancing or depressing effects of HCl, HNO 3 , HBr and HClO 4 in concentrations below 0.1 M were eliminated by 0.5 M NH 4 ClO 4 , the remarkable depressing effects of H 2 SO 4 and H 3 PO 4 on europium could not be eliminated. The interferences of Na + , K + , Cs + and Al 3+ in the concentration of 200 ppm were not eliminated, but those of other cations including rare earth elements were completely eliminated. Lanthanum in the range of (2000--10000) ppm increased the absorption of europium by about 1.4 times. But the effect of lanthanum in the range of (0--9000) ppm was also eliminated by NH 4 ClO 4 . The calibration curve for europium in the presence of NH 4 ClO 4 was linear in the range of (0--400) ppm with a sensitivity larger by about 1.5 times than that for europium alone. The analytical procedure is as follows. A sample is dissolved in HCl and NH 4 ClO 4 is added. Europium in the sample solution is determined by atomic absorption method using air-acetylene flame. For practical samples, the values obtained were in fair agreement with those by the flame emission method using a nitrous oxide-acetylene flame. The coefficients of variation by the present method were (3.7--2.4)% (Eu 2 O 3 content (1--3)%). (auth.)

  6. The roles of nematodes in nitrogen and phosphorous availability, plant uptake and growth in organically amended soils

    Gebremikael, Mesfin; Buchan, David; De Neve, Stefaan

    2017-04-01

    Several studies have shown that soil biota contributes significantly to the crucial ecosystem functions and services such as organic matter decomposition and nutrient cycling. The contribution of each group of soil organisms may vary depending primarily on their feeding behavior. The magnitude of the ecosystem services by the biota may also depend on the interactions amongst the soil biota groups and their surrounding environment, for instance, biochemical characteristics of the externally added organic material. However, only a few studies considered these interactions concurrently. Here, we investigated the effects of fauna-microbe-plant interactions on organic matter decomposition and nutrient cycling by applying different organic materials spanning a range of C:N ratios and presumed N availability. Nematodes were selected as model fauna because they are the most abundant soil metazoans that have a diversified feeding strategy and interact very intimately with microbes, other fauna, and plants. A series of incubation experiments were conducted in bare and planted microcosms under controlled conditions using fresh soil collected from an agricultural field and defaunated by gamma irradiation. In the first experiment without plants, the defaunated soil cores were either left unamended (UNA) or received lignin-rich low N compost (COI), N-rich compost (COV), fresh manure (MAN) or chopped clover (CLO). The entire free-living soil nematode community was extracted from unirradiated fresh soil and reinoculated into half of the soil cores that had been defaunated by gamma irradiation. Two treatments: with (+Nem) and without (-Nem) nematodes were compared for soil nitrogen and phosphorus availability, plant uptake, and PLFA signatures over time during a 105-days incubation. The same experimental setup was used to investigate further the CLO amendment in the presence of plants (rye grass was used as a model plant). Nematodes were extracted and assigned to feeding groups

  7. Effects of a mouthwash with chlorine dioxide on oral malodor and salivary bacteria: a randomized placebo-controlled 7-day trial

    Ohnuki Mari

    2010-02-01

    Full Text Available Abstract Background Previous research has shown the oxidizing properties and microbiological efficacies of chlorine dioxide (ClO2. Its clinical efficacies on oral malodor have been evaluated and reported only in short duration trials, moreover, no clinical studies have investigated its microbiological efficacies on periodontal and malodorous bacteria. Thus, the aim of this study was to assess the inhibitory effects of a mouthwash containing ClO2 used for 7 days on morning oral malodor and on salivary periodontal and malodorous bacteria. Methods/Design A randomized, double blind, crossover, placebo-controlled trial was conducted among 15 healthy male volunteers, who were divided into 2 groups. Subjects were instructed to rinse with the experimental mouthwash containing ClO2 or the placebo mouthwash, without ClO2, twice per day for 7 days. After a one week washout period, each group then used the opposite mouthwash for 7 days. At baseline and after 7 days, oral malodor was evaluated with Organoleptic measurement (OM, and analyzed the concentrations of hydrogen sulfide (H2S, methyl mercaptan (CH3SH and dimethyl sulfide ((CH32S, the main VSCs of human oral malodor, were assessed by gas chromatography (GC. Clinical outcome variables included plaque and gingival indices, and tongue coating index. The samples of saliva were microbiologically investigated. Quantitative and qualitative analyses were performed using the polymerase chain reaction-Invader method. Results and Discussion The baseline oral condition in healthy subjects in the 2 groups did not differ significantly. After rinsing with the mouthwash containing ClO2 for 7 days, morning bad breath decreased as measured by the OM and reduced the concentrations of H2S, CH3SH and (CH32S measured by GC, were found. Moreover ClO2 mouthwash used over a 7-day period appeared effective in reducing plaque, tongue coating accumulation and the counts of Fusobacterium nucleatum in saliva. Future research is

  8. Radical Chemistry and Structural Relationships of PPCP Degradation by UV/Chlorine Treatment in Simulated Drinking Water.

    Guo, Kaiheng; Wu, Zihao; Shang, Chii; Yao, Bo; Hou, Shaodong; Yang, Xin; Song, Weihua; Fang, Jingyun

    2017-09-19

    The UV/chlorine process is an emerging advanced oxidation process (AOP) used for the degradation of micropollutants. However, the radical chemistry of this AOP is largely unknown for the degradation of numerous structurally diverse micropollutants in water matrices of varying quality. These issues were addressed by grouping 34 pharmaceuticals and personal care products (PPCPs) according to the radical chemistry of their degradation in the UV/chlorine process at practical PPCP concentrations (1 μg L -1 ) and in different water matrices. The contributions of HO • and reactive chlorine species (RCS), including Cl • , Cl 2 •- , and ClO • , to the degradation of different PPCPs were compound specific. RCS showed considerable reactivity with olefins and benzene derivatives, such as phenols, anilines, and alkyl-/alkoxybenzenes. A good linear relationship was found between the RCS reactivity and negative values of the Hammett ∑σ p + constant for aromatic PPCPs, indicating that electron-donating groups promote the attack of benzene derivatives by RCS. The contribution of HO • , but not necessarily RCS, to PPCP removal decreased with increasing pH. ClO • showed high reactivity with some PPCPs, such as carbamazepine, caffeine, and gemfibrozil, with second-order rate constants of 9.2 × 10 7 , 1.03 × 10 8 , and 4.16 × 10 8 M -1 s -1 , respectively, which contributed to their degradation. Natural organic matter (NOM) induced significant scavenging of ClO • and greatly decreased the degradation of PPCPs that was attributable to ClO • , with a second-order rate constant of 4.5 × 10 4 (mg L -1 ) -1 s -1 . Alkalinity inhibited the degradation of PPCPs that was primarily attacked by HO • and Cl • but had negligible effects on the degradation of PPCPs by ClO • . This is the first study on the reactivity of RCS, particularly ClO • , with structurally diverse PPCPs under simulated drinking water condition.

  9. Degradation of lipid regulators by the UV/chlorine process: Radical mechanisms, chlorine oxide radical (ClO•)-mediated transformation pathways and toxicity changes.

    Kong, Xiujuan; Wu, Zihao; Ren, Ziran; Guo, Kaiheng; Hou, Shaodong; Hua, Zhechao; Li, Xuchun; Fang, Jingyun

    2018-06-15

    Degradation of three lipid regulators, i.e., gemfibrozil, bezafibrate and clofibric acid, by a UV/chlorine treatment was systematically investigated. The chlorine oxide radical (ClO • ) played an important role in the degradation of gemfibrozil and bezafibrate with second-order rate constants of 4.2 (±0.3) × 10 8  M -1  s -1 and 3.6 (±0.1) × 10 7  M -1  s -1 , respectively, whereas UV photolysis and the hydroxyl radical (HO • ) mainly contributed to the degradation of clofibric acid. The first-order rate constants (k') for the degradation of gemfibrozil and bezafibrate increased linearly with increasing chlorine dosage, primarily due to the linear increase in the ClO • concentration. The k' values for gemfibrozil, bezafibrate, and clofibric acid degradation decreased with increasing pH from 5.0 to 8.4; however, the contribution of the reactive chlorine species (RCS) increased. Degradation of gemfibrozil and bezafibrate was enhanced in the presence of Br - , whereas it was inhibited in the presence of natural organic matter (NOM). The presence of ammonia at a chlorine: ammonia molar ratio of 1:1 resulted in decreases in the k' values for gemfibrozil and bezafibrate of 69.7% and 7%, respectively, but led to an increase in that for clofibric acid of 61.8%. Degradation of gemfibrozil by ClO • was initiated by hydroxylation and chlorine substitution on the benzene ring. Then, subsequent hydroxylation, bond cleavage and chlorination reactions led to the formation of more stable products. Three chlorinated intermediates were identified during ClO • oxidation process. Formation of the chlorinated disinfection by-products chloral hydrate and 1,1,1-trichloropropanone was enhanced relative to that of other by-products. The acute toxicity of gemfibrozil to Vibrio fischeri increased significantly when subjected to direct UV photolysis, whereas it decreased when oxidized by ClO • . This study is the first to report the transformation pathway of a

  10. Efecto tóxico del DDT, clordano y agua de la presa Ignacio Ramírez (México, sobre Daphnia magna (Crustacea: Daphnidae

    Laura Martínez-Tabche

    1999-12-01

    Full Text Available Actualmente en México son empleados los plaguicidas diclorodifeniltricloroetano (DDT y clordano (CLO para combatir la malaria y termitas. De 1990 a 1996 un total de 27 ton de DDT y 508 de CLO, en forma de productos técnicos, fueron importados. El objetivo de este estudio fue establecer una metodología para determinar el impacto ambiental que pueden producir estos compuestos sobre un embalse. El efecto tóxico del DDT y CLO fue evaluado sobre la actividad de la o-demetilasa (OD y del acetilcolinesterasa (AchA del cladócero Daphnia magna al exponerla a diferentes concentraciones de los insecticidas disueltos en el agua de tres sitios de la presa Ignacio Ramírez (PIR. El efecto del agua contaminada con los insecticidas sobre la actividad de la AChA y OD, así como la CL50, fueron utilizadas como indicadores de exposición para determinar los lugares más contaminadas de la PIR. Las características fisicoquímicas del agua así como la biodiversidad de los sitios en estudio de la presa fueron considerados. Los resultados obtenidos demuestran que la estación cercana a la compuerta exhibe un potencial de toxicidad, ya que las actividades enzimáticas fueron modificadas. Se sugiere utilizar las actividades de AchA y OD del cladócero para evaluar la toxicidad de un cuerpo de agua contaminado por insecticidas organoclorados.Chlorodiphenylnitrichloroethane (DDT and chlordane (CLO are currently used in Mexico to control malaria and termites. From 1990 to 1996 a total of 27 ton of DDT and 508 of CLO were imported. We establish a methodology to determine their environmental impact in a Mexican dam (Ignacio Ramírez. The toxic effect of DDT and CLO were evaluated on the o-demethylase (OD and acethycholinesterase activities (AchA of the cladoceran Daphnia magna exposed to different concentrations of the insecticides solved in water from three sites. Their effect on the AchA and OD activities, and so the CL50 were used as exposure bioindicators to

  11. The Detection of Evolved Oxygen from the Rocknest Eolian Bedform Material by the Sample Analysis at Mars(SAM) instrument at the Mars Curiosity Landing Site

    Sutter, B.; Archer, D.; Ming, D.; Eigenbrode, J. L.; Franz, H.; Glavin, D. P.; McAdam, A.; Mahaffy, P.; Stern, J.; Navarro-Gonzalex, R.; hide

    2013-01-01

    The Sample Analysis at Mars (SAM) instrument onboard the Curiosity rover detected an O2 gas release from the Rocknest eolain bedform (Fig. 1). The detection of perchlorate (ClO4-) by the Mars Phoenix Lander s Wet Chemistry Laboratory (WCL) [1] suggests that perchlorate is a possible candidate for evolved O2 release detected by SAM. The perchlorate would also serve as a source of chlorine in the chlorinated hydrocarbons detected by the SAM quadrupole mass spectrometer (QMS) and gas chromatography/mass spectrometer (GCMS) [2,3]. Chlorates (ClO3-) [4,5] and/or superoxides [6] may also be sources of evolved O2 from the Rocknest materials. The work objectives are to 1) evaluate the O2 release temperatures from Rocknest materials, 2) compare these O2 release temperatures with a series of perchlorates and chlorates, and 3) evaluate superoxide O2- sources and possible perchlorate interactions with other Rocknest phases during QMS analysis.

  12. Three new superconducting members of the family of tetramethyltetraselenafulvalene (TMTSF) salts: TMTSF2Cl04, TMTSF2SbF6, TMTSF2TaF6

    Parkin, S.S.P.; Ribault, M.; Jerome, D.; Bechgaard, K.

    1981-01-01

    Resistivity against temperature measurements are reported along the high-conductivity a axis of TMTSF 2 ClO 4 , TMTSF 2 SbF 6 and TMTSF 2 TaF 6 , under pressure and as a function of applied magnetic field, that show that all three compounds exhibit superconducting phase transitions near 1 K, when sufficient pressure is applied. TMTSF 2 SbF 6 and TMTSF 2 TaF 6 become superconducting above critical pressures of the order of 10 and 11 kbar respectively whereas a superconducting phase transition in TMTSF 2 ClO 4 is observed at much lower pressures (<3 kbar). The critical pressure above which the sc phase is stabilised can be correlated with the separation between the sheets of TMTSF molecules and anions. (author)

  13. Oxygen formation in gamma-ray irradiation of Fe2+ -Cu2+ solutions

    Bjergbakke, Erling; Hart, E.J.

    1971-01-01

    value diminishes slightly and is displaced toward higher ${\\rm CuSO}_{4}/{\\rm FeSO}_{4}$ ratios with increasing acidity. The perchlorate system differs from the sulfate only at high ${\\rm Cu}({\\rm ClO}_{4})/{\\rm Fe}({\\rm ClO}_{4})_{2}$ ratios where $G({\\rm O}_{2})$ rises to 0.10. The O2 yield of 0.......02 is not derived from "spur" HO2, OH, H2 O2 or O2, although the increase in $G({\\rm O}_{2})$ above this level in the perchlorate system is attributed to H2 O2. "Spur" O atoms are postulated as the source of O2 with the yield, $G({\\rm O}_{2})$ = 0.02....

  14. Mathematical modeling of the radiation-chemical oxidation of U(IV) in HClO4

    Vladimirova, M.V.

    1995-01-01

    Mathematical modeling of U(IV) oxidation in 0.5-12 M HClO 4 upon α, γ-radiolysis, based on the proposed scheme of radiation-chemical reactions, has been performed. The rate constants of the U(VI) + HO 2 , U(IV) + HO 2 , U(IV) + ClO 2 , and U(IV) + ClO 2 - reactions have been determined by the comparison of the calculated and experimental kinetic and dose curves and radiation-chemical yields of U(IV) oxidation or U(VI) formation. General equations for uranium (IV) oxidation constants at various HClO 4 concentrations, based on the analysis of the rates of particular radiation-chemical reactions composing oxidation process, have been obtained

  15. Synthesis, characterization and magnetic properties of novel μ-oxamido heterodinuclear copper(II) - lanthanide(III) complexes

    Li, Y.T.; Miao, M.M.; Liao, D.Z.; Jiang, Z.H.; Wang, G.L.

    1995-01-01

    Six novel μ-oxamido heterobinuclear complexes have been prepared and identified as Cu(oxpn)Ln(L) 2 (ClO 4 ) 3 , where oxpn denotes the N, N'-bis(3-aminopropyl)oxamido dianion, L, 1,10-phenanthroline (phen) and Ln stands for La, Nd, Gd, Tb, Ho, Er. The complexes Cu(oxpn)Gd(oxpn)Gd(phen) 2 (ClO 4 ) 3 were characterized with variable temperature magnetic susceptibility (4-300 K). The exchange integral J (Cu-Gd) was found to be 2.03 cm -1 . The result is commensurate with ferromagnetic interaction between the adjacent metal ions. One plausible mechanism that can cause a ferromagnetic coupling between Gd(III) and Cu(II) is also discussed in terms of spin polarized. (author). 32 refs, 3 figs, 3 tabs

  16. Performance assessment of oxidants as a biocide for biofouling control in industrial seawater cooling towers

    Al-Bloushi, Mohammed; Saththasivam, Jayaprakash; Jeong, Sanghyun; Amy, Gary L.; Leiknes, TorOve

    2017-01-01

    Biofouling can significantly hamper the efficiency of seawater cooling towers. The aim of this study was to investigate the effectiveness of alternative oxidants (i.e. ozone (O3) and chlorine dioxide (ClO2)) comparing with commonly being used chlorine in biofouling control. Effects of cycle of concentration, temperature and oxidant dosage along with residual decay and kinetics were studied. Even at lower oxidant dosage (total residual oxidant equivalent=0.1mg/L Cl2), ClO2 showed a better disinfection effect compared to chlorine and O3. Results of bench-scale studies will be helpful in the selection of appropriate oxidant for seawater cooling tower operation.

  17. A comparison of suit dresses and summer clothes in the terms of thermal comfort.

    Ekici, Can; Atilgan, Ibrahim

    2013-12-19

    Fanger's PMV equation is the result of the combined quantitative effects of the air temperature, mean radiant temperature, relative air velocity, humidity, activity level and clothing insulation. This paper contains a comparison of suit dresses and summer clothes in terms of thermal comfort, Fanger's PMV equation. Studies were processed in the winter for an office, which locates in Ankara, Turkey. The office was partitioned to fifty square cells. Humidity, relative air velocity, air temperature and mean radiant temperature were measured on the centre points of these cells. Thermal comfort analyses were processed for suit dressing (Icl = 1 clo) and summer clothing (Icl = 0.5 clo). Discomfort/comfort in an environment for different clothing types can be seen in this study. The relationship between indoor thermal comfort distribution and clothing type was discussed. Graphics about thermal comfort were sketched according to cells. Conclusions about the thermal comfort of occupants were given by PMV graphics.

  18. Anthelmintic-resistant strains of Haemonchus contortus and Trichostrongylus colubriformis isolated from an organic sheep and goat farm in Denmark

    Pena-Espinoza, Miguel Angel; Enemark, Heidi L.; Thansborg, Stig M.

    2013-01-01

    A suspected case of anthelmintic resistance (AR) was investigated in an organic dairy sheep and goat farm. The herd was established in 2007 by purchase of animals from a number of other farms. Selection for the study was based on history of anthelmintic-treatment failure. Forty-eight lambs and 48......) or 10 mg/kg closantel (CLO). Kids were treated with 10 mg/kg FBZ, 0.3 mg/kg MOX, 14 mg/kg LEV, 0.2 mg/kg IVM or 10 mg/kg CLO. FECs were performed at day of treatment and 14 days post treatment. In a subsequent investigation, faeces from adult goats were cultured to obtain 3rd-stage nematode larvae (L3...... %. This is the first isolation of BZ-resistant H. contortus and T. colubriformis in Denmark and highlights the need for continuous surveillance of AR in conventional and organic farms....

  19. Absolute rate constants for the reaction of NO with a series of peroxy radicals in the gas at 295 K

    Sehested, J.; Nielsen, O.J.; Wallington, T.J.

    1993-01-01

    The rate constants for the reaction of NO with a series of peroxy radicals: CH3O2, C2H5O2, (CH3)3CCH2O2, (CH3)3CC(CH3)2CH2O2, CH2FO2, CH2ClO2, CH2BrO2, CHF2O2, CF2ClO2, CHF2CF2O2, CF3CF2O2, CFCl2CH2O2 and CF2ClCH2O2 were measured at 298 K and a total pressure of 1 atm. The rate constants were...

  20. Desinfecção de efluentes sanitários através de dióxido de cloro Disinfection of domestic wastewater using chlorine dioxide

    Flávio Rubens Lapolli

    2005-09-01

    Full Text Available A desinfecção dos esgotos deve ser considerada quando se pretende reduzir os riscos de transmissão de doenças infecto-contagiosas. Nesse sentido, os requisitos de qualidade de uma água devem ser avaliados em função dos usos previstos para a mesma. O dióxido de cloro (ClO2 possui excelentes propriedades bactericidas, virucidas, esporocidas e algicidas e, devido a isso, é usado como desinfetante de água de abastecimento e efluente doméstico, bem como inibidor de crescimento de algas. O objetivo do trabalho foi estudar a melhor dosagem para uma boa desinfecção de efluentes sanitários previamente tratados mediante lodos ativados por aeração prolongada, avaliar a inativação de coliformes e o residual de dióxido de cloro remanescente. Foram realizados ensaios para diferentes dosagens de dióxido de cloro e diferentes tempos de contato. Os resultados obtidos mostraram que a dosagem mais indicada para desinfecção do efluente estudado foi 2,0 mg ClO2/L com um tempo de contato de 20 minutos, condições sob as quais é atingido 100% de remoção de coliformes fecais e oxidada parcialmente a matéria orgânica remanescente, em tanto que os valores de pH e residual de ClO2 do efluente mantêm-se dentro dos admitidos pelas normativas brasileira e estadunidense em vigor. O estudo econômico levado a cabo permitiu concluir que a desinfecção de efluente doméstico mediante dióxido de cloro pode ser economicamente viável.Disinfection of sewage must be considered when reduction of infect-contagious disease transmission risks is intended. Thus, water quality requirements have to be evaluated in function of its predetermined uses. Chlorine dioxide (ClO2 has excellent bactericide, viruscide, sporicide and algaecide properties and, by these reasons, it is used as a disinfectant for drinking water and municipal sewage and as an algal growing inhibitor. The objective of this work was to investigate the most adequate ClO2 doses for an adequate

  1. Candidatus Renichlamydia lutjani, a Gram-negative bacterium in internal organs of blue striped snapper Lutjanus kasmira from Hawaii

    Corsaro, Daniele; Work, Thierry M.

    2012-01-01

    The blue-striped snapper Lutjanus kasmira (Perciformes, Lutjanidae) are cosmopolitan in the Indo-Pacific but were introduced into Oahu, Hawaii, USA, in the 1950s and have since colonized most of the archipelago. Studies of microparasites in blue-striped snappers from Hawaii revealed chlamydia-like organisms (CLO) infecting the spleen and kidney, characterized by intracellular basophilic granular inclusions containing Gram-negative and Gimenez-positive bacteria similar in appearance to epitheliocysts when seen under light microscopy. We provide molecular evidence that CLO are a new member of Chlamydiae, i.e. Candidatus Renichlamydia lutjani, that represents the first reported case of chlamydial infection in organs other than the gill in fishes.

  2. catena-Poly[[[trans-diaquabis(pyridine-κNcobalt(II]-μ-(4-{N′-[1-(3-acetyl-4-methyl-1H-pyrazol-5-ylethylidene]hydrazino}benzoato-κ3O:N,N′-[bis(pyridine-κNcobalt(III]-μ-(4-{N′-[1-(3-acetyl-4-methyl-1H-pyrazol-5-ylethylidene]hydrazino}benzoato-κ3N,N′:O]perchlorate 3.66-hydrate

    Igor O. Fritsky

    2008-02-01

    Full Text Available The title compound, {[Co2(C15H14N4O32(C5H5N4(H2O2]ClO4·3.66H2O}n, is a one-dimensional coordination polymer, with both CoII and CoIII centres in its structure. The ligand environment surrounding CoIII is formed by two N,N-chelating pyrazole-containing ligands and two pyridine molecules in axial positions. The high-spin CoII ions, situated at crystallographic centres of inversion, exhibit a distorted octahedral coordination mode. The ClO4− anion is linked to the polymer chain via hydrogen bonds. The chains are connected by hydrogen bonds to produce a three-dimensional structure.

  3. Performance assessment of oxidants as a biocide for biofouling control in industrial seawater cooling towers

    Al-Bloushi, Mohammed

    2017-10-14

    Biofouling can significantly hamper the efficiency of seawater cooling towers. The aim of this study was to investigate the effectiveness of alternative oxidants (i.e. ozone (O3) and chlorine dioxide (ClO2)) comparing with commonly being used chlorine in biofouling control. Effects of cycle of concentration, temperature and oxidant dosage along with residual decay and kinetics were studied. Even at lower oxidant dosage (total residual oxidant equivalent=0.1mg/L Cl2), ClO2 showed a better disinfection effect compared to chlorine and O3. Results of bench-scale studies will be helpful in the selection of appropriate oxidant for seawater cooling tower operation.

  4. Use of global assays to understand clinical phenotype in congenital factor VII deficiency.

    Greene, L A; Goldenberg, N A; Simpson, M L; Villalobos-Menuey, E; Bombardier, C; Acharya, S S; Santiago-Borrero, P J; Cambara, A; DiMichele, D M

    2013-09-01

    Congenital factor VII (FVII) deficiency is characterized by genotypic variability and phenotypic heterogeneity. Traditional screening and factor assays are unable to reliably predict clinical bleeding phenotype and guide haemorrhage prevention strategy. Global assays of coagulation and fibrinolysis may better characterize overall haemostatic balance and aid in haemorrhagic risk assessment. We evaluated the ability of novel global assays to better understand clinical bleeding severity in congenital FVII deficiency. Subjects underwent central determination of factor VII activity (FVII:C) as well as clot formation and lysis (CloFAL) and simultaneous thrombin and plasmin generation (STP) global assay analysis. A bleeding score was assigned to each subject through medical chart review. Global assay parameters were analysed with respect to bleeding score and FVII:C. Subgroup analyses were performed on paediatric subjects and subjects with FVII ≥ 1 IU dL(-1). CloFAL fibrinolytic index (FI2 ) inversely correlated with FVII:C while CloFAL maximum amplitude (MA) and STP maximum velocity of thrombin generation (VT max) varied directly with FVII:C. CloFAL FI2 directly correlated with bleeding score among subjects in both the total cohort and paediatric subcohort, but not among subjects with FVII ≥ 1 IU dL(-1) . Among subjects with FVII ≥ 1 IU dL(-1), STP time to maximum velocity of thrombin generation and time to maximum velocity of plasmin generation inversely correlated with bleeding score. These preliminary findings suggest a novel potential link between a hyperfibrinolytic state in bleeding severity and congenital FVII deficiency, an observation that should be further explored. © 2013 John Wiley & Sons Ltd.

  5. H3O2-, O22- and O2•- bridging ligands in cobalt(III) complexes of an acyclic phenolate-hinged dinucleating ligand

    Ghiladi, Morten; Gomez, Jonnes T.; Hazell, A.

    2003-01-01

    The dicobalt(III) complex, [Co2(bpbp)(μ-H3O2)2](ClO4)3 (bpbp− = 2,6-bis[bis(2-pyridylmethyl)aminomethyl]-4-tert-butylphenolate), obtained by reaction of cobalt(II) perchlorate with Hbpbp under ambient conditions contains two μ-H3O2− bridging ligands. The H-bonded O⋯O distances in this motif are 2...

  6. cis-Difluoridobis(1,10-phenanthroline)chromium(III) perchlorate monohydrate

    Birk, Torben; Bendix, Jesper; Weihe, Högni

    2008-01-01

    The title complex, [CrF(2)(C(12)H(8)N(2))(2)]ClO(4)·H(2)O, displays a slightly distorted octa-hedral coordination geometry around the central chromium(III) ion. The Cr environment is composed of a cis arrangement of two 1,10-phenanthroline [average Cr(III)-N = 2.0726 (10) Å] and two fluoride [ave...

  7. Drug: D10008 [KEGG MEDICUS

    Full Text Available D10008 Drug Fispemifene (USAN/INN) ... C26H27ClO3 D10008.gif ... Other ... DG01619 ... Clomi...ary tract symptoms NR3A1 (ESR1) [HSA:2099] [KO:K08550]; NR3A2 (ESR2) [HSA:2100] [KO:K08551] ... CAS: 341524-89-8 PubChem: 135626729 ChEMBL: CHEMBL2107341 LigandBox: D10008 ...

  8. Lymphocyte interactions with the extracellular matrix of malignant cells in vítro: A morphological and immunocytochemical study

    Logothetou-Rella, H.

    1993-01-01

    The interactions of lymphocytes with the glycosaminoglycans-protease-membrane extracellular matrix, produced by mixed cell cultures of normal with malignant cell clones, were examined. Pre-activated and activated heterologous peripheral lymphocytes were used. Co-cultures of activated lymphocytes with al1 cell types used, formed identical cell nodules. Histology of cell nodules showed that activated lymphocytes were cytolytic to pure normal or malignant cell clo...

  9. Business process transformation

    Grover, Varun

    2015-01-01

    Featuring contributions from prominent thinkers and researchers, this volume in the ""Advances in Management Information Systems"" series provides a rich set of conceptual, empirical, and introspective studies that epitomize fundamental knowledge in the area of Business Process Transformation. Processes are interpreted broadly to include operational and managerial processes within and between organizations, as well as those involved in knowledge generation. Transformation includes radical and incremental change, its conduct, management, and outcome. The editors and contributing authors pay clo

  10. Improved stability of a metallic state in benzothienobenzothiophene-based molecular conductors: an effective increase of dimensionality with hydrogen bonds.

    Higashino, Toshiki; Ueda, Akira; Yoshida, Junya; Mori, Hatsumi

    2017-03-25

    A dihydroxy-substituted benzothienobenzothiophene, BTBT(OH) 2 , was synthesized, and its charge-transfer (CT) salt, β-[BTBT(OH) 2 ] 2 ClO 4 , was successfully obtained. Thanks to the introduced hydroxy groups, a hydrogen-bonded chain structure connecting the BTBT molecules and counter anions was formed in the CT salt, which effectively increases the dimensionality of the electronic structure and consequently leads to a stable metallic state.

  11. Laser-Induced Breakdown Spectroscopy: A Review of Applied Explosive Detection

    2013-09-01

    ammonium nitrate (AN)), and explosive primers and propellants ( potassium chlorate and ammonium perchlorate...trinitrotoulene, DNT = 2,4-dinitrotoluene, PETN = pentaerythritol tetranitrate, TATP = triacetone triperoxide, AN = ammonium nitrate, KClO3 = potassium chlorate ...Sucrose C12H22O11 Precursor Material Chlorate KClO3, NH4ClO4 Primer, Propellant Note: EGDM = ethylene glycol dinitrate, TNT = 2,4,6

  12. Enhancing Information Security in Cloud Computing Services using SLA based metrics

    , Nia; Mganga, Ramadianti Putri;; Charles, Medard

    2011-01-01

    Context: Cloud computing is a prospering technology that most organizations are considering for adoption as a cost effective strategy for managing IT. However, organizations also still consider the technology to be associated with many business risks that are not yet resolved. Such issues include security, privacy as well as legal and regulatory risks. As an initiative to address such risks, organizations can develop and implement SLA to establish common expectations and goals between the clo...

  13. Identification, duplication, evolution and expression analyses of caleosins in Brassica plants and Arabidopsis subspecies.

    Shen, Yue; Liu, Mingzhe; Wang, Lili; Li, Zhuowei; Taylor, David C; Li, Zhixi; Zhang, Meng

    2016-04-01

    Caleosins are a class of Ca(2+) binding proteins that appear to be ubiquitous in plants. Some of the main proteins embedded in the lipid monolayer of lipid droplets, caleosins, play critical roles in the degradation of storage lipids during germination and in lipid trafficking. Some of them have been shown to have histidine-dependent peroxygenase activity, which is believed to participate in stress responses in Arabidopsis. In the model plant Arabidopsis thaliana, caleosins have been examined extensively. However, little is known on a genome-wide scale about these proteins in other members of the Brassicaceae. In this study, 51 caleosins in Brassica plants and Arabidopsis lyrata were investigated and analyzed in silico. Among them, 31 caleosins, including 7 in A. lyrata, 11 in Brassica oleracea and 13 in Brassica napus, are herein identified for the first time. Segmental duplication was the main form of gene expansion. Alignment, motif and phylogenetic analyses showed that Brassica caleosins belong to either the H-family or the L-family with different motif structures and physicochemical properties. Our findings strongly suggest that L-caleosins are evolved from H-caleosins. Predicted phosphorylation sites were differentially conserved in H-caleosin and L-caleosins, respectively. 'RY-repeat' elements and phytohormone-related cis-elements were identified in different caleosins, which suggest diverse physiological functions. Gene structure analysis indicated that most caleosins (38 out of 44) contained six exons and five introns and their intron phases were highly conserved. Structurally integrated caleosins, such as BrCLO3-3 and BrCLO4-2, showed high expression levels and may have important roles. Some caleosins, such as BrCLO2 and BoCLO8-2, lost motifs of the calcium binding domain, proline knot, potential phosphorylation sites and haem-binding sites. Combined with their low expression, it is suggested that these caleosins may have lost function.

  14. Development of all chemical solution derived Ce0.9La0.1O2 − y/Gd2Zr2O7 buffer layer stack for coated conductors: influence of the post-annealing process on surface crystallinity

    Yue, Zhao; Li, Xiaofen; Khoryushin, Alexey

    2012-01-01

    Preparation and characterization of a biaxially textured Gd2Zr2O7 and Ce0.9La0.1O2 − y (CLO, cap)/Gd2Zr2O7 (GZO, barrier) buffer layer stack by the metal–organic deposition route are reported. YBa2Cu3O7 − d (YBCO) superconductor films were deposited by the pulsed-laser deposition (PLD) technique ...

  15. Experience Catalysts: Understanding How They Can Help Fill the Acquisition Experience Gap for the Department of Defense?

    2011-04-30

    involvement before and after the training can have a significant impact on whether trainees use their newly developed skills” (Bassi & Russ- Eft , 1997). Other...motivation, cultural realities, learning self-efficacy, age, etc., that make a deterministic forecast more difficult (Bassi & Russ- Eft , 1997). Other...clo=fkclojba=`e^kdb==== - 280 - = = personnel can tap into freely. Give personnel easy access to key information sources of expertise. It

  16. 4-(2-Azaniumylethylpiperazin-1-ium bis(perchlorate

    Mohammad Reza Reisi

    2011-09-01

    Full Text Available In the title compound, C6H17N32+·2ClO4−, the piperazine ring adopts a chair conformation with the ethylammonium fragment occupying an equatorial position. In the crystal, the dications and perchlorate anions are linked through N—H...O hydrogen bonding and weak C—H...O hydrogen bonding into a three-dimensional supramolecular network.

  17. Perchlorate Destruction and Potable Water Production Using Membrane Biofilm Reduction and Membrane Filtration

    2013-09-01

    fraction of SRB could be active in O2 respiration, fermentation of organics, and even NO3- respiration. Therefore, the metabolic diversity of SRB...the case with PRB, which are able to reduce NO3- and ClO4-. To evaluate the model, we simulated effluent H2, UAP, and BAP concentrations, along with...effluent_experiment 56 Figure 36. Model- simulated concentrations of H2, UAP, and BAP in the effluent. Figure 37. Model- simulated

  18. Neonicotinoid insecticides induce salicylate-associated plant defense responses

    Ford, Kevin A.; Casida, John E.; Chandran, Divya; Gulevich, Alexander G.; Okrent, Rachel A.; Durkin, Kathleen A.; Sarpong, Richmond; Bunnelle, Eric M.; Wildermuth, Mary C.

    2010-01-01

    Neonicotinoid insecticides control crop pests based on their action as agonists at the insect nicotinic acetylcholine receptor, which accepts chloropyridinyl- and chlorothiazolyl-analogs almost equally well. In some cases, these compounds have also been reported to enhance plant vigor and (a)biotic stress tolerance, independent of their insecticidal function. However, this mode of action has not been defined. Using Arabidopsis thaliana, we show that the neonicotinoid compounds, imidacloprid (IMI) and clothianidin (CLO), via their 6-chloropyridinyl-3-carboxylic acid and 2-chlorothiazolyl-5-carboxylic acid metabolites, respectively, induce salicylic acid (SA)-associated plant responses. SA is a phytohormone best known for its role in plant defense against pathogens and as an inducer of systemic acquired resistance; however, it can also modulate abiotic stress responses. These neonicotinoids effect a similar global transcriptional response to that of SA, including genes involved in (a)biotic stress response. Furthermore, similar to SA, IMI and CLO induce systemic acquired resistance, resulting in reduced growth of a powdery mildew pathogen. The action of CLO induces the endogenous synthesis of SA via the SA biosynthetic enzyme ICS1, with ICS1 required for CLO-induced accumulation of SA, expression of the SA marker PR1, and fully enhanced resistance to powdery mildew. In contrast, the action of IMI does not induce endogenous synthesis of SA. Instead, IMI is further bioactivated to 6-chloro-2-hydroxypyridinyl-3-carboxylic acid, which is shown here to be a potent inducer of PR1 and inhibitor of SA-sensitive enzymes. Thus, via different mechanisms, these chloropyridinyl- and chlorothiazolyl-neonicotinoids induce SA responses associated with enhanced stress tolerance. PMID:20876120

  19. Conditioning of renewable silver amalgam film electrode for the characterization of clothianidin and its determination in selected samples by adsorptive square-wave voltammetry.

    Brycht, Mariola; Skrzypek, Sławomira; Guzsvány, Valéria; Berenji, Janoš

    2013-12-15

    A new square-wave adsorptive stripping voltammetric (SWAdSV) method was developed for the determination of the neonicotinoid insecticide clothianidin (Clo), based on its reduction at a renewable silver amalgam film electrode (Hg(Ag)FE). The key point of the procedure is the pretreatment of the Hg(Ag)FE by applying the appropriate conditioning potential (-1.70 V vs. Ag/AgCl reference electrode). Under the optimized voltammetric conditions, such pretreatment resulted in the peak for the Clo reduction in Britton-Robinson buffer pH 9.0 at about -0.60 V, which was used for the analytical purpose. The developed SWAdSV procedure made it possible to determine Clo in the concentration range of 6.0×10(-7)-7.0×10(-6) mol L(-1) (LOD=1.8×10(-7) mol L(-1), LOQ=6.0×10(-7) mol L(-1)) and 7.0×10(-6)-4.0×10(-5) mol L(-1) (LOD=1.3×10(-6) mol L(-1), LOQ=4.2×10(-6) mol L(-1)). The repeatability, precision, and the recovery of the method were determined. The effect of common interfering pesticides was also investigated. Standard addition method was successfully applied and validated for the determination of Clo in spiked Warta River water, corn seeds samples, and in corn seeds samples treated with the commercial formulation PONCHO 600 FS. © 2013 Elsevier B.V. All rights reserved.

  20. Journal of Chemical Sciences | Indian Academy of Sciences

    Two Ag(I) complexes, [Ag(HL)2]ClO4 (1) and [Ag(HL)2]NO3·H2O (2), where HL is pyridine 2– carboxamide, have been synthesized and characterized by various spectroscopic techniques. The X-ray crystal structural analyses indicate that both the complexes consist of slightly distorted square planar silver(I) ions and ...

  1. Supply Chain Resilience: Assessing Resilience over the Life Cycle of Capital Equipment

    2014-07-09

    Purposes): [] CRADA (Cooperative Research and Development Agreement) exists [] Photo/ Video Opportunities [] STEM -outreach Related [] New Invention...Recovery C9 10.6 / 0.7 9.8 / -1.1 Dispersion ClO 8.4 13.4 15.3 /11.0 Collaboration Cll -0.1 I -10.5 3.6 / -9.0 Organization Cl2 6.3 / -3.2 Security C l3

  2. Distributed Problem Solving: Adaptive Networks with a Computer Intermediary Resource. Part 1. Group Problem-Solving Performance in a Simulated Military Situation Assessment Task under Varying Environmental Conditions. Part 2. Group Acquisition of Dynamic Control Skills in a Fluid Level Adjustment Problem

    1991-06-01

    Army position, policy , or decision, unless so designated by other authorized documents. SECLRITY ~ JNU Hs~i REPORT DOCUMENTATION PAGE fom N o- Ia...ol CLo ruo 0 I 0 0) .0 0K0 a Eo Co E o c: Cuu >.vo CD E ~ v) CnCD CCo 0Lt Co jo 0) 0 0 0 0 C)(w r- wCul S6UiueuwoejP~P~IOUIIE 8OULUJIJ~dPUBPEONMLi

  3. Efecto del número de aplicaciones de cloprostenol sobre la regresión de cuerpos lúteos, el retorno al celo y la ovulación, después de un tratamiento superovulatorio en donantes de embriones bovinos

    C. Jiménez

    2011-06-01

    Full Text Available El objetivo del presente trabajo fue evaluar la respuesta de la aplicación doble o triple de prostaglandina sobre la regresión de CL, ovulación y retorno al celo después de un tratamiento superovulatorio en vacas donantes de embriones. Para este experimento se tomaron 44 vacas asignadas al azar a dos grupos de tratamiento. Al primero (n = 23; CLO 0 & 7 se le aplicó una dosis de 500 μg de cloprostenol los días 0 (denominado día de la colecta y 7; al segundo grupo (n = 21; CLO 0, 1 & 7 se le aplicó una inyección adicional el día 1. Los animales fueron examinados por ultrasonografía los días 0, 4, 7, 10 y 13 para evaluar la regresión de cuerpos lúteos y la ovulación. Se realizó observación del celo dos veces al día (mañana y tarde. El 0,8 y 52,3% de los grupos CLO 0 & 7 y CLO 0, 1 & 7, respectivamente, presentaron signos de celo. No se presentaron diferencias en el día del celo entre los grupos (7,2 ± 0,3, 7,3 ± 0,5 días. Tampoco hubodiferencia para la variable ovulación (8,5 ± 0,9 y 9,8± 0,9 días. Todas las vacas tratadas regresaron los cuerpos lúteos antes de finalizar el experimento. Cuando se analizó el tiempo de ovulación, se encontró que las vacas con 4 o menos cuerpos lúteos ovulan en un tiempo menor (P

  4. Investigating the mechanism of clofibric acid removal in Fe{sup 0}/H{sub 2}O systems

    Ghauch, Antoine, E-mail: ag23@aub.edu.lb [American University of Beirut, Faculty of Arts and Sciences, Department of Chemistry, P.O. Box 11-0236, Riad El Solh - 1107-2020, Beirut (Lebanon); Abou Assi, Hala; Tuqan, Almuthanna [American University of Beirut, Faculty of Arts and Sciences, Department of Chemistry, P.O. Box 11-0236, Riad El Solh - 1107-2020, Beirut (Lebanon)

    2010-04-15

    Since the introduction of iron wall technology, the inherent relationship between contaminant removal and iron corrosion has been mostly attributed to electron transfer from the metal body (direct reduction). This thermodynamically founded premise has failed to explain several experimental facts. Recently, a new concept considering adsorption and co-precipitation as fundamental contaminant removal mechanisms was introduced. This consistent concept has faced very skeptic views and necessarily needs experimental validation. The present work was the first independent attempt to validate the new concept using clofibric acid (CLO) as model compound. For this purpose, a powdered Fe{sup 0} material (Fe{sup 0}) was used in CLO removal experiments under various experimental conditions. Additional experiments were performed with plated Fe{sup 0} (mFe{sup 0}: Fe{sup 0}/Pd{sup 0}, Fe{sup 0}/Ni{sup 0}) to support the discussion of removal mechanism. Main investigated experimental variables included: abundance of O{sub 2}, abundance of iron corrosion products (ICPs) and shaking operations. Results corroborated the concept that quantitative contaminant removal in Fe{sup 0}/H{sub 2}O systems occurs within the oxide-film in the vicinity of Fe{sup 0}. Additionally, mixing type and shaking intensity significantly influenced the extent of CLO removal. More importantly, HPLC/MS revealed that the identity of reaction products depends on the extent of iron corrosion or the abundance of ICPs. The investigation of the CLO/Fe{sup 0}/H{sub 2}O system disproved the popular view that direct reduction mediates contaminant removal in the presence of Fe{sup 0}.

  5. Perchlorate Detection at Nanomolar Concentrations by Surface-Enhanced Raman Scattering

    2009-01-01

    grooves/mm grating light path controlled by Renishaw WiRE software and analyzed by Galactic GRAMS software. RESULTS AND DISCUSSION Quantitative... Federal Rights License 14. ABSTRACT Perchlorate (ClO4 ) has emerged as a widespread environmental contaminant and has been detected in various food...by means of dynamic light scattering using a ZetaPlus particle size analyzer (Brookhaven Instruments, Holtsville, NY). Data were collected for every

  6. A spin-crossover complex based on a 2,6-bis(pyrazol-1-yl)pyridine (1-bpp) ligand functionalized with a carboxylate group.

    Abhervé, Alexandre; Clemente-León, Miguel; Coronado, Eugenio; Gómez-García, Carlos J; López-Jordà, Maurici

    2014-07-07

    Combining Fe(ii) with the carboxylate-functionalized 2,6-bis(pyrazol-1-yl)pyridine (bppCOOH) ligand results in the spin-crossover compound [Fe(bppCOOH)2](ClO4)2 which shows an abrupt spin transition with a T1/2 of ca. 380 K and a TLIESST of 60 K due to the presence of a hydrogen-bonded linear network of complexes.

  7. Ethyl (Z-2-(4-chlorobenzylidene-3-oxobutanoate

    Shaaban K. Mohamed

    2011-02-01

    Full Text Available The C=C double-bond in the title compound, C13H13ClO3, has a Z configuration. The aliphatic substituents at one end of the double bond, i.e. the CH3CO– and C2H5O2C– groups, are aligned at 82.1 (3° with respect to each other.

  8. Ethyl (Z)-2-(4-chloro­benzyl­idene)-3-oxobutano­ate

    Mohamed, Shaaban K.; Abdelhamid, Antar A.; Gurbanov, Atash V.; Maharramov, A. M.; Ng, Seik Weng

    2011-01-01

    The C=C double-bond in the title compound, C13H13ClO3, has a Z configuration. The aliphatic substituents at one end of the double bond, i.e. the CH3CO– and C2H5O2C– groups, are aligned at 82.1 (3)° with respect to each other. PMID:21523043

  9. Population genetic analysis of Colombian Trypanosoma cruzi isolates revealed by enzyme electrophoretic profiles

    Ruiz-Garcia, Manuel; Montilla, Marleny; Nicholls, Sebastian; Alvarez, Diana

    2001-01-01

    Although Colombia presents an enormous biological diversity, few studies have been conducted on the population genetics of Trypanosoma cruzi. This study was carried out with 23 Colombian stocks of this protozoa analyzed for 13 isoenzymatic loci. The Hardy-Weinberg equilibrium, the genetic diversity and heterogeneity, the genetic relationships and the possible spatial structure of these 23 Colombian stocks of T. cruzi were estimated. The majority of results obtained are in agreement with a clo...

  10. Aircraft Ship Operations (Le Couple Aeronef-Navire dan les Operations)

    1991-11-01

    The Netherlands Patuxent Riser Ml) 20670-530)4 United States HOST NATION COORDINATOR Prof. 3.1.. Lopez Ruiz SENER. Ingeniera & Sistemas S.A. C Raimundo...transports. The companion unmanned air vehicle for the LAMPS 2030 The CLO will need an air superiority aircraft that will might be the Tipjet concept...desired, the wing may be swept, as in the oblique wing A possible companion UAV for the ASTOVL fighter/attack concept, allowing operation at much higher

  11. Estimation of some comfort parameters for sleeping environments in dry-tropical sub-Saharan Africa region

    Djongyang, Noël; Tchinda, René; Njomo, Donatien

    2012-01-01

    Highlights: ► Thermal comfort in sleeping environments in the sub-Saharan Africa is presented. ► Comfort charts for the dry-tropical regions were established. ► Total insulation values for bedding systems range between 0.81 clo and 0.94 clo. ► Thermoneutral operative temperature ranges between 29.5 °C and 31.7 °C. ► Thermoneutral air temperature ranges between 27.1 °C and 29.6 °C. - Abstract: A human being spends approximately one-third of his/her life in sleep. For an efficient and peaceful rest, he/she therefore needs some level of comfort. This includes acceptable environmental parameters as well as suitable bedding systems. While the theories of thermal comfort in workplaces at daytime are currently well established, research on thermal comfort for sleeping environment at night is limited. Further studies in relation with sleep are needed. This paper presents an investigation on thermal comfort in sleeping environments in the sub-Saharan Africa region. The comfort equation used is based on the energy balance of the human body derived from Fanger’s comfort model. Comfort charts for the dry-tropical sub-Saharan Africa region were established using indoor climatic conditions collected over five years in Ouagadougou (12°22′N, 1°32′W). Results obtained show that the suitable monthly total insulation values for bedding systems in the dry-tropical regions range between 0.81 clo and 0.94 clo. The thermoneutral operative temperature range between 29 °C and 32 °C, while the thermoneutral air temperature range between 27 °C and 30 °C.

  12. Survey on the spirilar flora of Lagomorphs

    Revez, Joana Marreiros Cabrita

    2010-01-01

    Members of the genera Campylobacter and Helicobacter have been in the spotlight in recent decades because of their status as animals and/or humans pathogens, both confirmed and emerging, and because of their association with food-borne and zoonotic diseases. First observations of spiral shaped bacteria or Campylobacter-like organisms (CLO) date back to the end of the 19th century, however the lack of adequate isolation methods hampered further research. With the introduction of methods suc...

  13. Accounting for clonality in comparative plant demography – growth or reproduction?

    Janovský, Zdeněk; Herben, Tomáš; Klimešová, Jitka

    2017-01-01

    Roč. 52, 3-4 (2017), s. 433-442 ISSN 1211-9520 R&D Projects: GA ČR GB14-36079G; GA ČR(CZ) GA16-19245S Institutional support: RVO:67985939 Keywords : Population matrices * Clo-Pla * Compadre Subject RIV: EH - Ecology, Behaviour OBOR OECD: Ecology Impact factor: 1.017, year: 2016

  14. Chlorine dioxide oxidation of Escherichia coli in water - A study of the disinfection kinetics and mechanism.

    Ofori, Isaac; Maddila, Suresh; Lin, Johnson; Jonnalagadda, Sreekantha B

    2017-06-07

    This study investigated the kinetics and mechanism of chlorine dioxide (ClO 2 ) inactivation of a Gram-negative bacteria Escherichia coli (ATCC 35218) in oxidant demand free (ODF) water in detail as a function of disinfectant concentration (0.5-5.0 mg/L), water pH (6.5-8.5), temperature variations (4-37°C) and bacterial density (10 5 -10 7 cfu/mL). The effects of ClO 2 on bacterial cell morphology, outer membrane permeability, cytoplasmic membrane disruption and intracellular enzymatic activity were also studied to elucidate the mechanism of action on the cells. Increasing temperature and disinfectant concentration were proportional to the rate of cell killing, but efficacy was found to be significantly subdued at 0.5 mg/L and less dependent on the bacterial density. The bactericidal efficiency was higher at alkaline pH of 8 or above as compared to neutral and slightly acidic pH of 7 and 6.5 respectively. The disinfection kinetic curves followed a biphasic pattern of rapid inactivation within the initial 2 min which were followed by a tailing even in the presence of residual biocide. The curves were adequately described by the C avg Hom model. Transmission Electron Microscopy images of the bacteria cells exposed to lethal concentrations of ClO 2 indicated very little observable morphological damage to the outer membranes of the cells. ClO 2 however was found to increase the permeability of the outer and cytoplasmic membranes leading to the leakage of membrane components such as 260 nm absorbing materials and inhibiting the activity of the intracellular enzyme β-D-galactosidase. It is suggested that the disruption of the cytoplasmic membrane and subsequent efflux of intracellular components result in the inactivation of the Gram-negative bacteria.

  15. The Krafft temperature of surfactant solutions

    Manojlović Jelena Ž.

    2012-01-01

    Our main motivation to revisit the solution properties of cetyltrimethylammonium bromide is related to the clear requirement for better control of the adsorption parameters to form uniform self-assembled monolayers on muscovite mica substrates. To readily monitor the temporal evolution of structural details in cetyltrimethylammonium bromide solutions, we realized a rather simple conductivity experiment. Conductivity measurements were carried out as a function of temperature, to look clo...

  16. A Fuzzy Galois Lattices Approach to Requirements Elicitation for Cloud Services

    Todoran Koitz Irina; Glinz Martin

    2015-01-01

    The cloud paradigm has become increasingly attractive throughout the recent years due to its both technical and economic foreseen impact. Therefore, researchers’ and practitioners’ attention has been drawn to enhancing the technological characteristics of cloud services, such as performance, scalability or security. However, the topic of identifying and understanding cloud consumers’ real needs has largely been ignored. Existing requirements elicitation methods are not appropriate for the clo...

  17. Dicty_cDB: VHB821 [Dicty_cDB

    Full Text Available ence. 34 0.17 3 CR103667 |CR103667.1 Forward strand read from insert in 3'HPRT insertion targeting and chromosome engineering... read from insert in 3'HPRT insertion targeting and chromosome engineering clone MHPP186g09. 50 0.17 1 CR034...434 |CR034434.1 Forward strand read from insert in 3'HPRT insertion targeting and chromosome engineering clo

  18. Cloud Computing:Strategies for Cloud Computing Adoption

    Shimba, Faith

    2010-01-01

    The advent of cloud computing in recent years has sparked an interest from different organisations, institutions and users to take advantage of web applications. This is a result of the new economic model for the Information Technology (IT) department that cloud computing promises. The model promises a shift from an organisation required to invest heavily for limited IT resources that are internally managed, to a model where the organisation can buy or rent resources that are managed by a clo...

  19. A compact, high resolution Michelson interferometer for atmospheric spectroscopy in the near ultraviolet

    Sander, Stanley P.; Cageao, Richard P.; Friedl, Randall R.

    1993-01-01

    A new, compact Fourier Transform Michelson interferometer (FTUV) with an apodized resolving power greater than 300,000 at 300 nm, high throughput and wide spectral coverage has been developed. The objectives include atmospheric spectroscopy (direct solar absorption and solar scattering) and laboratory spectroscopy of transient species. In this paper, we will briefly describe the prototype FTUV instrument and the results of preliminary laboratory investigations of OH and ClO spectra in emission and absorption.

  20. Eutrophic lichens respond to multiple forms of N: implications for critical levels and critical loads research

    Sarah Jovan; Jennifer Riddell; Pamela E Padgett; Thomas Nash

    2012-01-01

    Epiphytic lichen communities are highly sensitive to excess nitrogen (N), which causes the replacement of native floras by N-tolerant, ‘‘weedy’’ eutrophic species. This shift is commonly used as the indicator of ecosystem ‘‘harm’’ in studies developing empirical critical levels (CLE) for ammonia (NH3) and critical loads (CLO) for N. To be most...

  1. Branched polymeric media: Perchlorate-selective resins from hyperbranched polyethyleneimine

    Chen, Dennis P.

    2012-10-02

    Perchlorate (ClO4 -) is a persistent contaminant found in drinking groundwater sources in the United States. Ion exchange (IX) with selective and disposable resins based on cross-linked styrene divinylbenzene (STY-DVB) beads is currently the most commonly utilized process for removing low concentrations of ClO4 - (10-100 ppb) from contaminated drinking water sources. However, due to the low exchange capacity of perchlorate-selective STY-DVB resins (∼0.5-0.8 eq/L), the overall cost becomes prohibitive when treating groundwater with higher concentration of ClO4 - (e.g., 100-1000 ppb). In this article, we describe a new perchlorate-selective resin with high exchange capacity. This new resin was prepared by alkylation of branched polyethyleneimine (PEI) beads obtained from an inverse suspension polymerization process. Batch and column studies show that our new PEI resin with mixed hexyl/ethyl quaternary ammonium chloride exchange sites can selectively extract trace amounts of ClO4 - from a makeup groundwater (to below detection limit) in the presence of competing ions. In addition, this resin has a strong-base exchange capacity of 1.4 eq/L, which is 1.75-2.33 times larger than those of commercial perchlorate-selective STY-DVB resins. The overall results of our studies suggest that branched PEI beads provide versatile and promising building blocks for the preparation of perchlorate-selective resins with high exchange capacity. © 2012 American Chemical Society.

  2. Retail Productivity: Investigating the Influence of Market Size and Regional Hierarchy

    Öner, Özge

    2014-01-01

    This paper investigates the determinants of the productivity of independent retail stores in Sweden by focusing on the impact of market size and regional hierarchy while controlling for several store and employee characteristics over time. The analysis utilizes Swedish store-level data for the years 2002–2008. To capture the urban-periphery interaction in retail markets, the analysis (i) uses an accessible market potential measure, which captures the impact of the potential demand both in clo...

  3. Properties of poly(lactic acid nanocomposites based on montmorillonite, sepiolite and zirconium phosphonate

    K. Fukushima

    2012-11-01

    Full Text Available Poly(lactic acid (PLA based nanocomposites based on 5 wt.% of an organically modified montmorillonite (CLO, unmodified sepiolite (SEP and organically modified zirconium phosphonate (ZrP were obtained by melt blending. Wide angle X-ray scattering (WAXS and scanning electron microscopy (SEM analysis showed a different dispersion level depending on the type and functionalisation of nanoparticles. Differenctial scanning calorimetric (DSC analysis showed that PLA was able to crystallize on heating, and that the addition of ZrP could promote extent of PLA crystallization, whereas the presence of CLO and SEP did not significantly affect the crystallization on heating and melting behaviour of PLA matrix. Dynamic Mechanical Thermoanalysis (DMTA results showed that addition of all nanoparticles brought considerable improvements in E' of PLA, resulting in a remarkable increase of elastic properties for PLA nanocomposites. The melt viscosity and dynamic shear moduli (G',G" of PLA nanocomposites were also enhanced significantly by the presence of CLO and SEP, and attributed to the formation of a PLA/nanoparticle interconnected structure within the polymer matrix. The oxygen permeability of PLA did not significantly vary upon addition of SEP and ZrP nanoparticles. Only addition of CLO led to about 30% decrease compared to PLA permeability, due to the good clay dispersion and clay platelet-like morphology. The characteristic high transparency of PLA in the visible region was kept upon addition of the nanoparticles. Based on these achievements, a high potential of these PLA nanocomposites in sustainable packaging applications could be envisaged.

  4. Disinfection of indoor air microorganisms in stack room of university library using gaseous chlorine dioxide.

    Hsu, Ching-Shan; Lu, Ming-Chun; Huang, Da-Ji

    2015-02-01

    As with all indoor public spaces in Taiwan, the stack rooms in public libraries should meet the air quality guidelines laid down by the Taiwan Environmental Protection Administration. Accordingly, utilizing a university library in Taiwan for experimental purposes, this study investigates the efficiency of gaseous chlorine dioxide (ClO2) as a disinfection agent when applied using three different treatment modes, namely a single-daily disinfection mode (SIM), a twice-daily disinfection mode (TWM), and a triple-daily disinfection mode (TRM). For each treatment mode, the ClO2 is applied using an ultrasonic aerosol device and is performed both under natural lighting conditions and under artificial lighting conditions. The indoor air quality is evaluated before and after each treatment session by measuring the bioaerosol levels of bacteria and fungi. The results show that for all three disinfection modes, the application of ClO2 reduces the indoor bacteria and fungi concentrations to levels lower than those specified by the Taiwan EPA (i.e., bacteria <1500 CFU/m(3), fungi <1000 CFU/m(3)), irrespective of the lighting conditions under which the disinfection process is performed. For each disinfection mode, a better disinfection efficiency is obtained under natural lighting conditions since ClO2 readily decomposes under strong luminance levels. Among the three treatment modes, the disinfection efficiencies of the TWM and TRM modes are very similar under natural lighting conditions and are significantly better than that of the SIM mode. Thus, overall, the results suggest that the TWM treatment protocol represents the most cost-effective and efficient method for meeting the indoor air quality requirements of the Taiwan EPA.

  5. Characterization of halogenated DBPs and identification of new DBPs trihalomethanols in chlorine dioxide treated drinking water with multiple extractions.

    Han, Jiarui; Zhang, Xiangru; Liu, Jiaqi; Zhu, Xiaohu; Gong, Tingting

    2017-08-01

    Chlorine dioxide (ClO 2 ) is a widely used alternative disinfectant due to its high biocidal efficiency and low-level formation of trihalomethanes and haloacetic acids. A major portion of total organic halogen (TOX), a collective parameter for all halogenated DBPs, formed in ClO 2 -treated drinking water is still unknown. A commonly used pretreatment method for analyzing halogenated DBPs in drinking water is one-time liquid-liquid extraction (LLE), which may lead to a substantial loss of DBPs prior to analysis. In this study, characterization and identification of polar halogenated DBPs in a ClO 2 -treated drinking water sample were conducted by pretreating the sample with multiple extractions. Compared to one-time LLE, the combined four-time LLEs improved the recovery of TOX by 2.3 times. The developmental toxicity of the drinking water sample pretreated with the combined four-time LLEs was 1.67 times higher than that pretreated with one-time LLE. With the aid of ultra-performance liquid chromatography/electrospray ionization-triple quadrupole mass spectrometry, a new group of polar halogenated DBPs, trihalomethanols, were detected in the drinking water sample pretreated with multiple extractions; two of them, trichloromethanol and bromodichloromethanol, were identified with synthesized standard compounds. Moreover, these trihalomethanols were found to be the transformation products of trihalomethanes formed during ClO 2 disinfection. The results indicate that multiple LLEs can significantly improve extraction efficiencies of polar halogenated DBPs and is a better pretreatment method for characterizing and identifying new polar halogenated DBPs in drinking water. Copyright © 2017. Published by Elsevier B.V.

  6. Short-term memory in olfactory network dynamics

    Stopfer, Mark; Laurent, Gilles

    1999-01-01

    Neural assemblies in a number of animal species display self-organized, synchronized oscillations in response to sensory stimuli in a variety of brain areas. In the olfactory system of insects, odour-evoked oscillatory synchronization of antennal lobe projection neurons (PNs) is superimposed on slower and stimulus-specific temporal activity patterns. Hence, each odour activates a specific and dynamic projection neuron assembly whose evolution during a stimulus is locked to the oscillation clo...

  7. Vaporous Decontamination Methods: Potential Uses and Research Priorities for Chemical and Biological Contamination Control

    2006-06-01

    over time. Ammonia gas is typically used to neutralise formaldehyde forming a white precipitate, hexamethylene- tetramine, which is then washed down...sulphite scrubbers DSTO-GD-0465 4 and a carbon bed to prevent any leakage of the ClO2 gas into the environment. The decontamination period (12...of ammonia gas) produces a broad-spectrum decontaminant against C agents [7]. However, initial studies have shown that the modified vaporous

  8. Infrared spectroscopy of some organocobalt (III) compounds

    Benedetti, A.V.; Mauro, A.E.

    1982-01-01

    The compounds [MeCo(DH) 2 py], [MeCo(DH) 2 H 2 O] (M = methyl; DH = dimethyl-glyoxymate; py = pyridine) and others of general formulae [Co(L)(H 2 O) 2 ] ClO 4 , where L = SALOPHEN = bis (salicylaldehyde)-o-phenylenediimine; SALCN = 1,2-bis (salicylaldehyde) cyclohexylenediimine; SALEN = bis (salicylaldehyde) ethylenediimine; BAE = bis (acetylacetone)-ethylenediimine were synthesized and studied by infrared spectroscopy. The frequencies observed have been assigned to specific group vibrations. (Author) [pt

  9. Dicty_cDB: SHH264 [Dicty_cDB

    Full Text Available sertion targeting and chromosome engineering clone MHPP142o16. 50 0.13 1 CR023465 |CR023465.1 Forward strand... read from insert in 3'HPRT insertion targeting and chromosome engineering clone MHPP421e10. 50 0.13 1 CR044...130 |CR044130.1 Forward strand read from insert in 3'HPRT insertion targeting and chromosome engineering clo

  10. Dicty_cDB: SHJ732 [Dicty_cDB

    Full Text Available (bits) Value N CR022830 |CR022830.1 Forward strand read from insert in 3'HPRT insertion targeting andchromosome engineering... read from insert in 3'HPRT insertion targeting and chromosome engineering clone MHPP10i04. 38 0.010 2 CR019...573 |CR019573.1 Forward strand read from insert in 3'HPRT insertion targeting and chromosome engineering clo

  11. Simple spectrophotometric methods for determination of fluoxetine and clomipramine hydrochlorides in dosage forms and in some post-mortem biological fluids samples

    Emam A. Ali

    2016-12-01

    Full Text Available Sensitive, simple and rapid spectrophotometric methods for micro determination of fluoxetine hydrochloride (FLU and clomipramine hydrochloride (CLO. The methods are based on the reaction between the examined drugs and acid dyes, namely; bromocresol green (BCG, phenol red (PhR and metanil yellow (MY producing yellow ion-pair complexes followed by their extraction with methylene chloride and measured at 412, 407 and 409 nm for FLU with BCG, PhR and MY, respectively; whereas for CLO at 409, 406 and 407 nm, respectively. All variables that affect the performance of the proposed methods were carefully studied and optimized. Beer’s law was obeyed in the concentration ranges 0.86–24.32 μg/mL, 8.64–41.30 μg/mL, 0.86–34.76 μg/mL for FLU and 1.75–24.55 μg/mL, 7.0–50 μg/mL, 1.65–34.78 μg/mL for CLO using BCG, PhR and MY respectively. The methods were validated in terms of accuracy and precision. The proposed methods were successfully applied to the determination of fluoxetine hydrochloride and clomipramine hydrochloride in pure samples, pharmaceutical formulations, spiked post-mortem urine and blood samples.

  12. Stopped-flow injection spectrophotometric method for determination of chlorate in soil

    Jaroon Jakmunee

    2008-06-01

    Full Text Available A stopped-flow injection (FI spectrophotometric procedure based on iodometric reaction for the determination of chlorate has been developed. Standard/sample was injected into a stream of potassium iodide solution and then merged with a stream of hydrochloric acid solution to produce triiodide. By stopping the flow while the sample zone is being in a mixing coil, a slow reaction of chlorate with iodide in acidic medium was promoted to proceed with minimal dispersion of the triiodide product zone. When the flow started again, a concentrated product zone was pushed into a flow cell and a signal profile due to light absorption of the product was recorded. Employing a lab-built semi-automatic stopped-FI analyser, the analysis can be performed with higher degree of automation and low chemical consumption. Linear calibration graph in the range of 5-50 mg ClO3- L-1 was obtained, with detection limit of 1.4 mg ClO3- L-1. Relative standard deviation of 2.2% (30 mg ClO3- L-1, n=10 and sample throughput of about 20 h-1 were achieved. The system was applied to soil samples and validated by batch spectrophotometric and standard titrimetric methods.

  13. Mechanistic aspects of ingested chlorine dioxide on thyroid function: impact of oxidants on iodide metabolism

    Bercz, J.P.; Jones, L.L.; Harrington, R.M.; Bawa, R.; Condie, L.

    1986-01-01

    Toxicological studies dealing with recent findings of health effects of drinking water disinfectants are reviewed. Experiments with monkeys and rodents indicate that the biological activity of ingested disinfectants is expressed via their chemical interaction with the mucosal epithelia, secretory products, and nutritional contents of the alimentary tract. Evidence exists that a principal partner of this redox interaction is the iodide of nutritional origin that is ubiquitous in the gastrointestinal tract. Thus the observation that subchronic exposure to chlorine dioxide (ClO 2 ) in drinking water decreases serum thyroxine levels in mammalian species can be best explained with changes produced in the chemical form of the bioavailable iodide. Ongoing and previously reported mechanistic studies indicate that oxidizing agents such as chlorine-based disinfectants oxidize the basal iodide content of the gastrointestinal tract. The resulting reactive iodine species readily attaches to organic matter by covalent bonding. Evidence suggests that the extent to which such iodinated organics are formed is proportional to the magnitude of the electromotive force and stoichiometry of the redox couple between iodide and the disinfectant. Because the extent of thyroid uptake of the bioavailable iodide does not decrease during ClO 2 ingestion, it seems that ClO 2 does not cause iodide deficiency of sufficient magnitude to account for the decease in hormonogenesis. Absorption of one or more of iodinated molecules, e.g., nutrient, hormones, or cellular constituents of the alimentary tract having thyromimetic or thyroid inhibitory properties, is a better hypothesis for the effects seen

  14. Guaifenesin Pharmacokinetics Following Single‐Dose Oral Administration in Children Aged 2 to 17 Years

    Thompson, Gary A.; Solomon, Gail; Albrecht, Helmut H.; Reitberg, Donald P.

    2016-01-01

    Abstract This study characterized guaifenesin pharmacokinetics in children aged 2 to 17 years (n = 40) who received a single oral dose of guaifenesin (age‐based doses of 100‐400 mg) 2 hours after breakfast. Plasma samples were obtained before and for 8 hours after dosing and analyzed for guaifenesin using liquid chromatography‐tandem mass spectrometry. Pharmacokinetic parameters were estimated using noncompartmental methods, relationships with age were assessed using linear regression, and dose proportionality was assessed on 95% confidence intervals. Based on the upper dose recommended in the monograph (for both children and adolescents), area under the curve from time zero to infinity and maximum plasma concentration both increased with age. However, when comparing the upper dose for children aged 2 to 11 years with the lower dose for adolescents aged 12 to 17 years, similar systemic exposure was observed. As expected due to increasing body size, oral clearance (CLo) and terminal volume of distribution (Vz/F) increased with age. Due to a larger increase in Vz/F than CLo, an increase in terminal exponential half‐life was also observed. Allometric scaling indicated no maturation‐related changes in CLo and Vz/F. PMID:26632082

  15. Oxidation of diclofenac by aqueous chlorine dioxide: identification of major disinfection byproducts and toxicity evaluation.

    Wang, Yingling; Liu, Haijin; Liu, Guoguang; Xie, Youhai

    2014-03-01

    Diclofenac (DCF), a synthetic non-steroidal anti-inflammatory drug, is one of the most frequently detected pharmaceuticals in the aquatic environment. In this work, the mechanism and toxicity of DCF degradation by ClO2 under simulated water disinfection conditions were investigated. Experimental results indicate that rapid and significant oxidation of DCF occurred within the first few minutes; however, its mineralization process was longer than its degradation process. UPLC-MS and (1)H NMR spectroscopy were performed to identify major disinfection byproducts that were generated in three tentative degradation routes. The two main routes were based on initial decarboxylation of DCF on the aliphatic chain and hydroxylation of the phenylacetic acid moiety at the C-4 position. Subsequently, the formed aldehyde intermediates were the starting point for further multistep degradation involving decarboxylation, hydroxylation, and oxidation reactions of CN bond cleavage. The third route was based on transient preservation of chlorinated derivatives resulting from electrophilic attack by chlorine on the aromatic ring, which similarly underwent CN bond cleavage. Microtox bioassay was employed to evaluate the cytotoxicity of solutions treated by ClO2. The formation of more toxic mid-byproducts during the ClO2 disinfection process poses a potential risk to consumers. Copyright © 2013 Elsevier B.V. All rights reserved.

  16. Mucoadhesive in situ gel formulation for vaginal delivery of clotrimazole: formulation, preparation, and in vitro/in vivo evaluation.

    Rençber, Seda; Karavana, Sinem Yaprak; Şenyiğit, Zeynep Ay; Eraç, Bayri; Limoncu, Mine Hoşgör; Baloğlu, Esra

    2017-06-01

    The purpose of this study was to develop a suitable mucoadhesive in situ gel formulation of clotrimazole (CLO) for the treatment of vaginal candidiasis. For this aim, the mixture of poloxamer (PLX) 407 and 188 were used to prepare in situ gels. Hydroxypropyl methylcellulose (HPMC) K100M or E50 was added to in situ gels in 0.5% ratio to improve the mucoadhesive and mechanical properties of formulations and to prolong the residence time in vaginal cavity. After the preparation of mucoadhesive in situ gels; gelation temperature/time, viscosity, mechanical, mucoadhesive, syringeability, spreadibility and rheological properties, in vitro release behavior, and anticandidal activities were determined. Moreover vaginal retention of mucoadhesive in situ gels was investigated with in vivo distribution studies in rats. Based on the obtained results, it was found that gels prepared with 20% PLX 407, 10% PLX 188 and 0.5% HPMC K100M/E50 might be suitable for vaginal administration of CLO. In addition, the results of in vivo distribution studies showed that gel formulations remained on the vaginal mucosa even 24 h after application. In conclusion, the mucoadhesive in situ gels of CLO would be alternative candidate for treatment of vaginal candidiasis since it has suitable gel properties with good vaginal retention.

  17. Removal of NO from flue gas by aqueous chlorine-dioxide scrubbing solution in a lab-scale bubbling reactor.

    Deshwal, Bal Raj; Jin, Dong Seop; Lee, Si Hyun; Moon, Seung Hyun; Jung, Jong Hyeon; Lee, Hyung Keun

    2008-02-11

    The present study attempts to clean up nitric oxide from the simulated flue gas using aqueous chlorine-dioxide solution in the bubbling reactor. Chlorine-dioxide is generated by chloride-chlorate process. Experiments are carried out to examine the effect of various operating variables like input NO concentration, presence of SO(2), pH of the solution and NaCl feeding rate on the NO(x) removal efficiency at 45 degrees C. Complete oxidation of nitric oxide into nitrogen dioxide occurred on passing sufficient ClO(2) gas into the scrubbing solution. NO is finally converted into nitrate and ClO(2) is reduced into chloride ions. A plausible reaction mechanism concerning NO(x) removal by ClO(2) is suggested. DeNO(x) efficiency increased slightly with the increasing input NO concentration. The presence of SO(2) improved the NO(2) absorption but pH of solution showed marginal effect on NO(2) absorption. NO(x) removal mechanism changed when medium of solution changed from acidic to alkaline. A constant NO(x) removal efficiency of about 60% has been achieved in the wide pH range of 3-11 under optimized conditions.

  18. The phase diagram of KNO3-KClO3

    Zhang Xuejun; Tian Jun; Xu Kangcheng; Gao Yici

    2004-01-01

    The binary phase diagram of KNO 3 -KClO 3 is studied by means of differential scanning calorimetry (DSC) and high-temperature X-ray diffraction. The limited solid solutions, K(NO 3 ) 1-x (ClO 3 ) x (0 3 ) 1-x (ClO 3 ) x (0.90 3 -based solid solutions and KClO 3 -based solid solutions phase, respectively. For KNO 3 -based solid solutions, KNO 3 ferroelectric phase can be stable from 423 to 223 K as a result of substituting of NO 3 by ClO 3 -radicals. The temperatures for solidus and liquidus have been determined based on limited solid solutions. Two models, Henrian solution and regular solution theory for KNO 3 -based (α) phase and KClO 3 -based (β) phase, respectively, are employed to reproduce solidus and liquidus of the phase diagram. The results are in good agreement with the DSC data. The thermodynamic properties for α and β solid solutions have been derived from an optimization procedure using the experimental data. The calculated phase diagram and optimized thermodynamic parameters are thermodynamically self-consistent

  19. Electrochemical corrosion studies on a selected carbon steel for application in nuclear waste disposal containers: Influence of radiolytic products on corrosion in brines

    Farvaque-Bera, A.M.; Smailos, E.

    1994-07-01

    In previous corrosion studies, carbon steels were identified as promising materials for the manufacturing of long-lived high-level waste containers that could act as a radionuclide barrier in a rock-salt repository. In the present work, the influence of some important oxidizing radiolytic products generated in gamma irradiated brines on the electrochemical corrosion behaviour of the preselected fine-grained steel TStE 355 was studied. The steel was examined by potentiodynamic and potentiostatic polarization methods at 90 C in a disposal relevant NaCl-rich brine containing radiolytic products such as H 2 O 2 , ClO - , ClO 3 - and ClO 4 - at concentrations between 10 -4 and 10 -2 M/l. The significance of the radiolytic products to steel corrosion depends on their concentration at the metal-brine interface, which in turn, depends on many factors such as the dose rate, the amount of water present in the disposal area, the escape of gases (e.g. H 2 )

  20. Synthesis, structures and properties of Cu(II) and Mn(II) complexes with 1,10-phenanthroline-2-carboxylic acid and 2,2'-bipyridine ligands.

    Sun, Jingya; Xu, Huanzhi

    2010-11-15

    Four new 2,2'-bipyridine and 1,10-phenanthroline complexes, namely [Mn(phenca)(2)]·(H(2)O)(2) (1), [Cu(4)(phen)(4)(OH-)(4)(H(2)O)(2)](DMF)(4)(ClO(4)-)(4)(H(2)O) (2), [Cu(2)(2,2-bipy)(2)(C(2)O(4)2-)(H(2)O)(2)(NO(3))(2)] (3) and [Cu(2,2-bipy)(2)(ClO(4)-)](ClO(4)-) (4) (2,2'-bpy = 2,2'-bipyridine, Hphenca = 1,10-phenanthroline-2-carboxylic acid) have been synthesized by a hydrothermal reaction. The products were characterized by elemental analysis, infrared spectroscopy and X-ray crystal diffraction. While strong hydrogen bonds play central roles in the formation of the 3D structure, the combined influence of the weak interactions such as π···π interactions is also evident in the structures. A preliminary investigation on the ion exchange properties of the complexes is presented.

  1. Synthesis, Structures and Properties of Cu(II and Mn(II Complexes with 1,10-Phenanthroline-2-carboxylic acid and 2,2’-Bipyridine Ligands

    Huanzhi Xu

    2010-11-01

    Full Text Available Four new 2,2’-bipyridine and 1,10-phenanthroline complexes, namely [Mn(phenca2]·(H2O2 (1, [Cu4(phen4(OH-4(H2O2](DMF4(ClO4-4(H2O (2, [Cu2(2,2-bipy2(C2O42-(H2O2(NO32] (3 and [Cu(2,2-bipy2(ClO4-](ClO4- (4 (2,2’-bpy = 2,2’-bipyridine, Hphenca = 1,10-phenanthroline-2-carboxylic acid have been synthesized by a hydrothermal reaction. The products were characterized by elemental analysis, infrared spectroscopy and X-ray crystal diffraction. While strong hydrogen bonds play central roles in the formation of the 3D structure, the combined influence of the weak interactions such as π···π interactions is also evident in the structures. A preliminary investigation on the ion exchange properties of the complexes is presented.

  2. Properties of Enzyme Pretreated Wikstroemia sikokiana and Broussonetia papyrifera Bast Fiber Pulps

    Lang-Dong Lin

    2015-04-01

    Full Text Available Xylanase, pectinase complex, and BL11 pectinase were employed for the pretreatment of gampi and paper mulberry bast fiber pulps prior to chlorine dioxide bleaching. The bleaching efficiencies of the pulps with different enzymatic pretreatments were investigated. Accelerated aging by heat-humidity treatment was also conducted to evaluate yellowing phenomena and to estimate the prevention of brightness reversion (brightness retention by enzymatic pretreatment. The order of active chlorine required with respect to pretreatment was pectinase complex > xylanase > BL11 pectinase for soda and soda/oxalate gampi pulps and pectinase complex > BL11 pectinase > xylanase for soda and soda/oxalate paper mulberry pulps. Higher brightness retention values were observed for soda/oxalate pulps compared to soda pulps. The brightness retention levels for gampi pulps and mulberry pulps after ClO2 bleaching with enzymatic pretreatment were higher than the levels of ClO2 and NaClO bleaching pulps. Enzymatic treatments were thus able to reduce the usage of ClO2 and to assist in producing photo-stable paper materials for art and artifact-repairing applications. Thus, enzymatic pretreatment of the pulp has the potential to meet world trends and environmental sustainability for pulp and paper industries.

  3. Potential biodefense model applications for portable chlorine dioxide gas production.

    Stubblefield, Jeannie M; Newsome, Anthony L

    2015-01-01

    Development of decontamination methods and strategies to address potential infectious disease outbreaks and bioterrorism events are pertinent to this nation's biodefense strategies and general biosecurity. Chlorine dioxide (ClO2) gas has a history of use as a decontamination agent in response to an act of bioterrorism. However, the more widespread use of ClO2 gas to meet current and unforeseen decontamination needs has been hampered because the gas is too unstable for shipment and must be prepared at the application site. Newer technology allows for easy, onsite gas generation without the need for dedicated equipment, electricity, water, or personnel with advanced training. In a laboratory model system, 2 unique applications (personal protective equipment [PPE] and animal skin) were investigated in the context of potential development of decontamination protocols. Such protocols could serve to reduce human exposure to bacteria in a decontamination response effort. Chlorine dioxide gas was capable of reducing (2-7 logs of vegetative and spore-forming bacteria), and in some instances eliminating, culturable bacteria from difficult to clean areas on PPE facepieces. The gas was effective in eliminating naturally occurring bacteria on animal skin and also on skin inoculated with Bacillus spores. The culturable bacteria, including Bacillus spores, were eliminated in a time- and dose-dependent manner. Results of these studies suggested portable, easily used ClO2 gas generation systems have excellent potential for protocol development to contribute to biodefense strategies and decontamination responses to infectious disease outbreaks or other biothreat events.

  4. Cadmium (II) macrocyclic Schiff-base complexes containing piperazine moiety: Synthesis, spectroscopic, X-ray structure, theoretical and antibacterial studies

    Keypour, Hassan; Mahmoudabadi, Masoumeh; Shooshtari, Amir; Bayat, Mehdi; Mohsenzadeh, Fariba; Gable, Robert William

    2018-03-01

    The new Cd(II) macrocyclic Schiff-base complexes were prepared via the metal templated [1 + 1] cyclocondensation of 2,2'-(piperazine-1,4-diylbis (methylene))dianiline (A) and 2,6-pyridinedicarbaldehyde or 2,6-diacetylpyridine. The products were characterized by elemental analysis, mass spectrometry and spectroscopic methods such as: FT-IR, 1H and 13C-NMR, the crystal structure of [CdL1(ClO4)2](CH3CN) (1) complex was also obtained by single-crystal X-ray crystallography. The complexes were tested for in vitro antibacterial properties against some bacteria. The complexes had antibacterial properties and in some cases were active even more than standards. The geometries of the [CdLn (ClO4)2], (n = 1,2) complexes have been optimized at the BP86/def2-SVP level of theory. Also the nature of Cd←Ln (n = 1, 2) bonds in [CdLn (ClO4)2], (n = 1,2) complexes are studied with the help of NBO and Energy decomposition analysis (EDA). Results showed that the nature of metal-ligand bond in the complexes is slightly more electrostatic with a contribution of about 52% in total interaction energy.

  5. The Investigation of Chlorates as a Possible Source of Oxygen and Chlorine Detected by the Sample Analysis at Mars (SAM) Instrument in Gale Crater, Mars

    Sutter, B.; Archer, D. P.; Ming, D. W.; Niles, P. B.; Eigenbrode, J. L.; Franz, H.; Glavin, D. P.; McAdam, A. C.; Mahaffy, P; Stern, J. C.; hide

    2014-01-01

    The Sample Analysis at Mars (SAM) instrument onboard the Curiosity rover detect-ed O2 and HCl gas releases from the Rocknest (RN) eolian bedform and the John Klein (JK) and Cumberland (CB) drill hole materials in Gale Crater. Chlorinated hydrocarbons have also been detected by the SAM quadrupole mass spectrometer (QMS) and gas chromatography/mass spectrometer (GCMS). These detections along with the detection of perchlorate (ClO4-) by the Mars Phoenix Lander’s Wet Chemistry Laboratory (WCL) suggesting perchlorate is a possible candidate for evolved O2 and chlorine species. Laboratory thermal analysis of perchlorates has yet to provide an unequivocal temperature match to the SAM O2 and HCl release data. Iron mineralogy found in the Rocknest materials when mixed with Ca-perchlorate does cause O2 release temperatures to be closer match to the SAM O2 release data but more work is required in evaluating the catalytic effects of Fe mineralogy on perchlorate decomposition. Chlorates (ClO3-) are relevant Mars materials and potential O2 and Cl sources. The objective of this work is to evaluate the thermal decomposition of select chlorate (ClO3-) salts as possible sources of the O2 and HCl releases in the Gale Crater materials.

  6. Epidural anesthesia and postoperatory analgesia with alpha-2 adrenergic agonists and lidocaine for ovariohysterectomy in bitches

    Pohl, Virgínia H.; Carregaro, Adriano B.; Lopes, Carlize; Gehrcke, Martielo I.; Muller, Daniel C.M.; Garlet, Clarissa D.

    2012-01-01

    The aim of this study was to determine the viability and cardiorespiratory effects of the association of epidural alpha-2 adrenergic agonists and lidocaine for ovariohysterectomy (OH) in bitches. Forty-two bitches were spayed under epidural anesthesia with 2.5 mg/kg body weight (BW) of 1% lidocaine with adrenaline (CON) or in association with 0.25 mg/kg BW of xylazine (XYL), 10 μg/kg BW of romifidine (ROM), 30 μg/kg BW of detomidine (DET), 2 μg/kg BW of dexmedetomidine (DEX), or 5 μg/kg BW of clonidine (CLO). Heart rate (HR), respiratory rate (fR) and arterial pressures were monitored immediately before and every 10 min after the epidural procedure. Blood gas and pH analysis were done before, and at 30 and 60 min after the epidural procedure. Animals were submitted to isoflurane anesthesia if they presented a slightest sign of discomfort during the procedure. Time of sensory epidural block and postoperative analgesia were evaluated. All animals in CON and DEX, 5 animals in ROM and CLO, 4 animals in XYL, and 3 in DET required supplementary isoflurane. All groups, except CLO, showed a decrease in HR. There was an increase in arterial pressures in all groups. Postoperative analgesia lasted the longest in XYL. None of the protocols were totally efficient to perform the complete procedure of OH; however, xylazine provided longer postoperative analgesia than the others. PMID:23277701

  7. Chemical behaviour of plutonium in aqueous chloride solutions

    Bueppelmann, K.; Kim, J.I.

    1988-06-01

    The chemical behaviour of Plutonium has been investigated in concentrated NaCl solutions in the neutral pH range. The α-radiation induced radiolysis reactions oxidize the Cl - -ion to Cl 2 , HClO, ClO - and other species, which produce a strongly oxidizing medium. Under these conditions the Pu ions of lower oxidation states are readily oxidized to Pu(VI), which then undergo depending on the pH of the solution, various chemical reactions to produce PuO 2 Cl n , PuO 2 (ClO) m or PuO 2 (OH) x species. In addition to primary radiolysis reactions taking place in NaCl solutions, the reactions leading to the PuO 2 (Cl) n and PuO 2 (ClO) m species have been characterized and quantified systematically by spectroscopic and thermodynamic evaluation. The redox and complexation reactions of Pu ions under varying NaCl concentration, specific α-activity and pH are discussed. (orig.) [de

  8. Development of all chemical solution derived Ce0.9La0.1O2−y/Gd2Zr2O7 buffer layer stack for coated conductors: influence of the post-annealing process on surface crystallinity

    Zhao, Y; Li, X-F; He, D; Andersen, N H; Grivel, J-C; Khoryushin, A; Hansen, J B

    2012-01-01

    Preparation and characterization of a biaxially textured Gd 2 Zr 2 O 7 and Ce 0.9 La 0.1 O 2−y (CLO, cap)/Gd 2 Zr 2 O 7 (GZO, barrier) buffer layer stack by the metal–organic deposition route are reported. YBa 2 Cu 3 O 7−d (YBCO) superconductor films were deposited by the pulsed-laser deposition (PLD) technique to assess the efficiency of such a novel buffer layer stack. Biaxial texture quality and morphology of the buffer layers and the YBCO superconductor films were fully characterized. The surface crystallinity of the buffer layers is studied by the electron backscatter diffraction technique. It is revealed that post-annealing GZO films in 2% H 2 in Ar is an effective way to improve the surface crystallinity. As a result, a highly textured CLO film can grow directly on the GZO film at a lower crystallization temperature. The critical current density of a YBCO PLD film is higher than 1 MA cm −2 (77 K, in self-field), demonstrating that the novel CLO/GZO stack is very promising for further development of low cost buffer layer architectures for coated conductors.

  9. Clay based polymeric composites: Preparation and quality characterization

    Aloisi, G.G.; Elisei, F.; Nocchetti, M.; Camino, G.; Frache, A.; Costantino, U.; Latterini, L.

    2010-01-01

    Commercial clays Cloisites Na + , 30B and 20A were labelled with the fluorescent dye Rhodamine B and used as fillers of polypropylene in order to prepare composites to be studied with confocal fluorescence microscopy. The dye uptake by clays was monitored by X-ray powder diffraction and spectroscopic analyses and clear evidences of intercalated dye in the organically modified montmorillonites Clo30B and Clo20A were obtained. Clay-Rhodamine B hybrids were investigated by steady-state absorption and emission spectroscopy to explore the effect of dye arrangement on the optical properties. The obtained information was used to rationalize fluorescence behaviour of composites. Confocal fluorescence imaging gave rise to bright fluorescent images of Cloisite aggregated labelled with the dye allowing to easily and directly visualize the 3-D dispersion of the labelled fillers in the polymer matrix in a non-invasive manner. The images were analyzed in terms of size distribution of the fluorescence grains to quantify the dispersion degree. The data indicate that Clo20A is able to homogeneously distribute in the polymer matrix forming a composite material.

  10. Taurine Bromamine: Reactivity of an Endogenous and Exogenous Anti-Inflammatory and Antimicrobial Amino Acid Derivative.

    De Carvalho Bertozo, Luiza; Morgon, Nelson Henrique; De Souza, Aguinaldo Robinson; Ximenes, Valdecir Farias

    2016-04-21

    Taurine bromamine (Tau-NHBr) is produced by the reaction between hypobromous acid (HOBr) and the amino acid taurine. There are increasing number of applications of Tau-NHBr as an anti-inflammatory and microbicidal drug for topical usage. Here, we performed a comprehensive study of the chemical reactivity of Tau-NHBr with endogenous and non-endogenous compounds. Tau-NHBr reactivity was compared with HOBr, hypochlorous acid (HOCl) and taurine chloramine (Tau-NHCl). The second-order rate constants (k₂) for the reactions between Tau-NHBr and tryptophan (7.7 × 10² M(-1)s(-1)), melatonin (7.3 × 10³ M(-1)s(-1)), serotonin (2.9 × 10³ M(-1)s(-1)), dansylglycine (9.5 × 10¹ M(-1)s(-1)), tetramethylbenzidine (6.4 × 10² M(-1)s(-1)) and H₂O₂ (3.9 × M(-1)s(-1)) were obtained. Tau-NHBr demonstrated the following selectivity regarding its reactivity with free amino acids: tryptophan > cysteine ~ methionine > tyrosine. The reactivity of Tau-NHBr was strongly affected by the pH of the medium (for instance with dansylglycine: pH 5.0, 1.1 × 10⁴ M(-1)s(-1), pH 7.0, 9.5 × 10 M(-1)s(-1) and pH 9.0, 1.7 × 10 M(-1)s(-1)), a property that is related to the formation of the dibromamine form at acidic pH (Tau-NBr₂). The formation of singlet oxygen was observed in the reaction between Tau-NHBr and H₂O₂. Tau-NHBr was also able to react with linoleic acid, but with low efficiency compared with HOBr and HOCl. Compared with HOBr, Tau-NHBr was not able to react with nucleosides. In conclusion, the following reactivity sequence was established: HOBr > HOCl > Tau-NHBr > Tau-NHCl. These findings can be very helpful for researchers interested in biological applications of taurine haloamines.

  11. Crystal Structure and Magnetic Behavior of Two New Dinuclear Carbonato-Bridged Copper(II) Compounds. Superexchange Pathway for the Different Coordination Modes of the Carbonato Bridge in Polynuclear Copper(II) Compounds.

    Escuer, Albert; Mautner, Franz A.; Peñalba, Evaristo; Vicente, Ramon

    1998-08-24

    Four new &mgr;-CO(3)(2-) copper(II) complexes with different coordination modes for the carbonato bridge have been obtained by fixation of atmospheric CO(2): {(&mgr;(3)-CO(3))[Cu(3)(ClO(4))(3)(Et(3)dien)(3)]}(ClO(4)) (1), Et(3)dien = N,N',N"-triethylbis(2-aminoethane)amine; {(&mgr;-CO(3))[Cu(2)(H(2)O)(Et(4)dien)(2)]}(ClO(4))(2).H(2)O (2), Et(4)dien = N,N,N",N"-tetraethyl-bis(2-aminoethane)amine; {(&mgr;-CO(3))[Cu(2)(H(2)O)(2)(EtMe(4)dien)(2)]} (ClO(4))(2).2H(2)O (3), EtMe(4)dien = N'-ethyl-N,N,N",N"-tetramethylbis(2-aminoethane)amine; and {(&mgr;-CO(3))[Cu(2)(H(2)O)(Me(5)dien)(2)]}(ClO(4))(2).H(2)O (4), Me(5)dien = N,N,N',N",N"-pentamethylbis(2-aminoethane)amine. The crystal structures have been solved for 2, monoclinic system, space group P2(1)/n, formula [C(25)H(62)Cl(2)Cu(2)N(6)O(13)] with a = 12.763(6) Å, b = 25.125(8) Å, c = 13.261(4) Å, beta = 111.85(3) degrees, Z = 4, and for 3, triclinic system, space group P&onemacr;, formula [C(21)H(58)Cl(2)Cu(2)N(6)O(15)] with a = 8.412(3) Å, b = 14.667(4) Å, c = 16.555(5) Å, alpha = 99.66(2) degrees, beta = 102.14(2) degrees, gamma = 104.72(2) degrees, Z = 2. Susceptibility measurements show ferromagnetic behavior (J = +6.7(6) cm(-)(1)) for the trinuclear compound 1 whereas 2-4 are antiferromagnetically coupled with J = -17.8(8), -125.5(9), and -21.2(3) cm(-)(1) respectively. Certain synthetic aspects that may be related to the nuclearity of the copper(II) &mgr;-CO(3)(2-) compounds and the superexchange pathway for the different coordination modes of the carbonato bridge are discussed.

  12. Fighting Ebola with novel spore decontamination technologies for the military.

    Doona, Christopher J; Feeherry, Florence E; Kustin, Kenneth; Olinger, Gene G; Setlow, Peter; Malkin, Alexander J; Leighton, Terrance

    2015-01-01

    Recently, global public health organizations such as Doctors without Borders (MSF), the World Health Organization (WHO), Public Health Canada, National Institutes of Health (NIH), and the U.S. government developed and deployed Field Decontamination Kits (FDKs), a novel, lightweight, compact, reusable decontamination technology to sterilize Ebola-contaminated medical devices at remote clinical sites lacking infra-structure in crisis-stricken regions of West Africa (medical waste materials are placed in bags and burned). The basis for effectuating sterilization with FDKs is chlorine dioxide (ClO2) produced from a patented invention developed by researchers at the US Army Natick Soldier RD&E Center (NSRDEC) and commercialized as a dry mixed-chemical for bacterial spore decontamination. In fact, the NSRDEC research scientists developed an ensemble of ClO2 technologies designed for different applications in decontaminating fresh produce; food contact and handling surfaces; personal protective equipment; textiles used in clothing, uniforms, tents, and shelters; graywater recycling; airplanes; surgical instruments; and hard surfaces in latrines, laundries, and deployable medical facilities. These examples demonstrate the far-reaching impact, adaptability, and versatility of these innovative technologies. We present herein the unique attributes of NSRDEC's novel decontamination technologies and a Case Study of the development of FDKs that were deployed in West Africa by international public health organizations to sterilize Ebola-contaminated medical equipment. FDKs use bacterial spores as indicators of sterility. We review the properties and structures of spores and the mechanisms of bacterial spore inactivation by ClO2. We also review mechanisms of bacterial spore inactivation by novel, emerging, and established non-thermal technologies for food preservation, such as high pressure processing, irradiation, cold plasma, and chemical sanitizers, using an array of Bacillus

  13. The Effects of Perchlorate and its Precursors on Organic Molecules under Simulated Mars Conditions

    Carrier, B. L.; Beegle, L. W.; Bhartia, R.; Abbey, W. J.

    2016-12-01

    Perchlorate (ClO4-) was first detected on Mars by the Phoenix Lander in 2008 [1] and has subsequently been detected by Curiosity in Gale Crater [2], in Mars meteorite EETA79001 [3], and has been proposed as a possible explanation for results obtained by Viking [4]. Perchlorate has also been shown to be formed under current Mars conditions via the oxidation of mineral chlorides, further supporting the theory that perchlorate is present globally on Mars [5]. The discovery of perchlorate on Mars has raised important questions about its effects on the survival and detection of organic molecules. Although it has been shown that pyrolysis in the presence of perchlorate results in the alteration or destruction of organic molecules [2, 4], few studies have been conducted on the potential effects of perchlorate and its precursors on organic molecules prior to analysis. Perchlorate is typically inert under Mars temperatures and pressures, but it has been shown to decompose to form reactive oxychlorine species such as chlorite (ClO2-), hypochlorite (ClO-) and chlorine dioxide (ClO2) when exposed to Mars conditions including ionizing radiation [6]. The oxidation of chloride to perchlorate also results in the formation of reactive oxychlorine species such as chlorate (ClO3-) [5]. Here we investigate the effects of perchlorate and its oxychlorine precursors on organic molecules. Experiments are performed in a Mars Simulation Chamber (MSC) capable of reproducing the temperature, pressure, atmospheric composition and UV flux found on Mars. Soil simulants are prepared consisting of Mojave Mars Simulant (MMS) [7] and each organic, as well as varying concentrations of perchlorate and/or chloride salts, and exposed in the MSC. Subsequent to exposure in the MSC samples are leached and the leachate analyzed by HPLC and LC-MS to determine the degree of degradation of the original organic and the identity of any potential decomposition products formed by oxidation or chlorination

  14. Quality assessment of ground-based microwave measurements of chlorine monoxide, ozone, and nitrogen dioxide from the NDSC radiometer at the Plateau de Bure

    P. Ricaud

    2004-06-01

    Full Text Available A ground-based microwave radiometer dedicated to chlorine monoxide (ClO measurements around 278GHz has been in operation from December 1993-June 1996 at the Plateau de Bure, France (45° N, 5.9° E, 2500m altitude. It belongs to the international Network for the Detection of Stratospheric Change. A detailed study of both measurements and retrieval schemes has been undertaken. Although dedicated to the measurements of ClO, simultaneous profiles of O3, ClO and NO2, together with information about the instrumental baseline, have been retrieved using the optimal estimation method. The vertical profiles have been compared with other ground-based microwave data, satellite-borne data and model results. Data quality shows: 1 the weak sensitivity of the instrument that obliges to make time averages over several hours; 2 the site location where measurements of good opacities are possible for only a few days per year; 3 the baseline undulation affecting all the spectra, an issue common to all the microwave instruments; 4 the slow drift of some components affecting frequencies by 3-4MHz within a couple of months. Nevertheless, when temporally averaging data over a few days, ClO temporal variations (diurnal and over several weeks in winter 1995 from 35-50km are consistent with model results and satellite data, particularly at the peak altitude around 40km, although temporal coincidences are infrequent in winter 1995. In addition to ClO, it is possible to obtain O3 information from 30-60km whilst the instrument is not optimized at all for this molecule. Retrievals of O3 are reasonable when compared with model and another ground-based data set, although the lowermost layers are affected by the contamination of baseline remnants. Monthly-averaged diurnal variations of NO2 are detected at 40km and appear in agreement with photochemical model results and satellite zonally-averaged data, although the amplitude

  15. The photochemistry and kinetics of chlorine compounds important to stratospheric mid-latitude ozone destruction

    Goldfarb, Leah

    1997-09-01

    The catalytic destruction of stratospheric ozone via chlorinated species was first proposed in the 1970's. Since that time a decline in column ozone abundance in the polar regions as well as at mid-latitudes has been observed. Much of this reduction has been attributed to the increases in anthropogenic chlorine compounds such as CFCs. This study summarizes experimental results obtained using pulsed-photolysis resonance fluorescence and pulsed- photolysis long-path absorption methods to study processes important to chlorine-catalyzed ozone destruction: the quantum yields of the products in the dissociation of ClONO2 and the reactions of free radicals with ClONO2 and ClO. The quantum yields for the production of O, Cl and ClO from ClONO2 were studied at specific laser wavelengths (193, 222, 248, and 308 nm). Cl and ClO yields were comparable at nearly all the wavelengths, expect for 193 nm, where the O atom yield was appreciable. The yields at 308 nm (a wavelength available in the stratosphere) were 0.64 ± 0.17 for Cl, 0.37 ± 0.18 for ClO and product yield for the former reaction, previously unreported, was determined to be ~1. The kinetics of the reaction of O atoms with ClO were measured using a new experimental system built specifically to investigate such radical-radical reactions. A slight negative temperature dependence (E/B = -90 ± 30) was observed over the temperature range (227-363 K). From the measured Arrhenius equation the rate constant at 240 K is 4.1 × 10-11 cm3molecule-1s-1 which is in excellent agreement (l.4% greater) with the currently recommended value. This observation is significant, since this reaction is the rate limiting the dominate chlorine catalytic cycle that destroys O3 near 40 km. To analyze the implications of the kinetic and photochemical information from this work, a box model was constructed. The vertical profile of ozone concentrations and loss rates calculated by this simple model compare well with atmospheric measurements and

  16. Micelle-assisted signaling of peracetic acid by the oxidation of pyreneboronic acid via monomer-excimer switching.

    Choi, Jiyoung; Lee, Hyo Jin; Cho, Min Jeoung; Chang, Suk-Kyu

    2015-08-15

    A simple fluorescent probe for the industrial oxidant peracetic acid (PAA) was investigated. PAA-assisted oxidative conversion of pyrene-1-boronic acid into 1-hydroxypyrene was used as the signaling tool. Pyreneboronic acid was found to display selective signaling behavior, being more responsive to PAA than to other commonly used practical oxidants such as H2O2 and HOCl. The changes in pyrene monomer fluorescence to excimer were used in the quantitative analysis of PAA. When using the surfactant hexadecyltrimethylammonium bromide as a micellar additive, the signaling of PAA was markedly enhanced. Selective fluorescence signaling of PAA by pyrene-1-boronic acid with a detection limit of 1.5×10(-6)M in aqueous environment was successfully achieved. Copyright © 2015 Elsevier B.V. All rights reserved.

  17. Degradation kinetics of organic chloramines and formation of disinfection by-products during chlorination of creatinine.

    Zhang, Tianyang; Xu, Bin; Wang, Anqi; Cui, Changzheng

    2018-03-01

    Organic chloramines can interfere with the measurement of effective combined chlorine in chlorinated water and are potential intermediate products of highly toxic disinfection by-products (DBPs). In order to know more about the degradation and transformation of organic chloramines, a typical organic chloramine precursor creatinine was selected for investigation and a corresponding individual organic chloramine chlorocreatinine was prepared in this study. The preparation condition of chlorocreatinine by chlorination was established as chlorine/creatinine = 1 M/M, reaction time = 2 h and pH = 7.0. Then the degradation kinetics of chlorocreatinine during further chlorination was studied, and a second-order rate constant of 1.16 (±0.14) M -1 s -1 was obtained at pH 7.0. Solution pH significantly influenced the degradation rate, and the elementary rate constants of chlorocreatinine with HOCl+H + , HOCl, OCl - and chlorocreatinine - with OCl - were calculated as 2.43 (±1.55) × 10 4  M -2  s -1 , 1.05 (±0.09) M -1 s -1 , 2.86 (±0.30) M -1 s -1 and 3.09 (±0.24) M -1 s -1 , respectively. Besides, it was found that chlorocreatinine could be further converted into several C-DBPs (chloroform and trichloroacetone) and N-DBPs (dichloroacetonitrile (DCAN) and trichloronitromethane (TCNM)) during chlorination. The total yield of DBPs increased obviously with increasing pH, especially for TCNM. In addition, the presence of humic acid in creatinine solution could increase the formation of DCAN obviously during chlorination. Based on the UPLC-Q-TOF-MS analysis, the conversion pathways of chlorocreatinine were proposed. Several kinds of intermediate products were also identified as organic chloramines and some of them could even exist stably during the further chlorination. Copyright © 2017 Elsevier Ltd. All rights reserved.

  18. Mechanism of interaction of betanin and indicaxanthin with human myeloperoxidase and hypochlorous acid

    Allegra, Mario; Furtmueller, Paul Georg; Jantschko, Walter; Zederbauer, Martina; Tesoriere, Luisa; Livrea, Maria A.; Obinger, Christian

    2005-01-01

    Hypochlorous acid (HOCl) is the most powerful oxidant produced by human neutrophils and contributes to the damage caused by these inflammatory cells. It is produced from H 2 O 2 and chloride by the heme enzyme myeloperoxidase (MPO). Based on findings that betalains provide antioxidant and anti-inflammatory effects, we performed the present kinetic study on the interaction between the betalains, betanin and indicaxanthin, with the redox intermediates, compound I and compound II of MPO, and its major cytotoxic product HOCl. It is shown that both betalains are good peroxidase substrates for MPO and function as one-electron reductants of its redox intermediates, compound I and compound II. Compound I is reduced to compound II with a second-order rate constant of (1.5 ± 0.1) x 10 6 M -1 s -1 (betanin) and (1.1 ± 0.2) x 10 6 M -1 s -1 (indicaxanthin), respectively, at pH 7.0 and 25 deg C. Formation of ferric (native) MPO from compound II occurs with a second-order rate constant of (1.1 ± 0.1) x 10 5 M -1 s -1 (betanin) and (2.9 ± 0.1) 10 5 M -1 s -1 (indicaxanthin), respectively. In addition, both betalains can effectively scavenge hypochlorous acid with determined rates of (1.8 ± 0.2) x 10 4 M -1 s -1 (betanin) and (7.7 ± 0.1) x 10 4 M -1 s -1 (indicaxanthin) at pH 7.0 and 25 deg C. At neutral pH and depending on their concentration, both betalains can exhibit a stimulating and inhibitory effect on the chlorination activity of MPO, whereas at pH 5.0 only inhibitory effects were observed even at micromolar concentrations. These findings are discussed with respect to our knowledge of the enzymatic mechanisms of MPO

  19. A taurine-supplemented vegan diet may blunt the contribution of neutrophil activation to acute coronary events.

    McCarty, Mark F

    2004-01-01

    Neutrophils are activated in the coronary circulation during acute coronary events (unstable angina and myocardial infarction), often prior to the onset of ischemic damage. Moreover, neutrophils infiltrate coronary plaque in these circumstances, and may contribute to the rupture or erosion of this plaque, triggering thrombosis. Activated neutrophils secrete proteolytic enzymes in latent forms which are activated by the hypochlorous acid (HOCl) generated by myeloperoxidase. These phenomena may help to explain why an elevated white cell count has been found to be an independent coronary risk factor. Low-fat vegan diets can decrease circulating leukocytes--neutrophils and monocytes--possibly owing to down-regulation of systemic IGF-I activity. Thus, a relative neutropenia may contribute to the coronary protection afforded by such diets. However, vegetarian diets are devoid of taurine - the physiological antagonist of HOCl--and tissue levels of this nutrient are relatively low in vegetarians. Taurine has anti-atherosclerotic activity in animal models, possibly reflecting a role for macrophage-derived myeloperoxidase in the atherogenic process. Taurine also has platelet-stabilizing and anti-hypertensive effects that presumably could reduce coronary risk. Thus, it is proposed that a taurine-supplemented low-fat vegan diet represents a rational strategy for diminishing the contribution of activated neutrophils to acute coronary events; moreover, such a regimen would work in a number of other complementary ways to promote cardiovascular health. Moderate alcohol consumption, the well-tolerated drug pentoxifylline, and 5-lipoxygenase inhibitors--zileuton, boswellic acids, fish oil--may also have potential in this regard. Copyright 2004 Elsevier Ltd.

  20. Effect of smear layer deproteinization on bonding of self-etch adhesives to dentin: a systematic review and meta-analysis

    Alshaikh, Khaldoan H.; Mahmoud, Salah H.

    2018-01-01

    Objectives The aim of this systematic review was to critically analyze previously published studies of the effects of dentin surface pretreatment with deproteinizing agents on the bonding of self-etch (SE) adhesives to dentin. Additionally, a meta-analysis was conducted to quantify the effects of the above-mentioned surface pretreatment methods on the bonding of SE adhesives to dentin. Materials and Methods An electronic search was performed using the following databases: Scopus, PubMed and ScienceDirect. The online search was performed using the following keywords: ‘dentin’ or ‘hypochlorous acid’ or ‘sodium hypochlorite’ and ‘self-etch adhesive.’ The following categories were excluded during the assessment process: non-English articles, randomized clinical trials, case reports, animal studies, and review articles. The reviewed studies were subjected to meta-analysis to quantify the effect of the application time and concentration of sodium hypochlorite (NaOCl) and hypochlorous acid (HOCl) deproteinizing agents on bonding to dentin. Results Only 9 laboratory studies fit the inclusion criteria of this systematic review. The results of the meta-analysis revealed that the pooled average microtensile bond strength values to dentin pre-treated with deproteinizing agents (15.71 MPa) was significantly lower than those of the non-treated control group (20.94 MPa). Conclusions In light of the currently available scientific evidence, dentin surface pretreatment with deproteinizing agents does not enhance the bonding of SE adhesives to dentin. The HOCl deproteinizing agent exhibited minimal adverse effects on bonding to dentin in comparison with NaOCl solutions. PMID:29765895

  1. Degradation of methyl and ethyl mercury into inorganic mercury by other reactive oxygen species besides hydroxyl radical

    Suda, Ikuo; Takahashi, Hitoshi (Kumamoto Univ. Medical School (Japan). Inst. for Medical Immunology)

    1992-01-01

    Degradation of methyl mercury (MeHg) and ethyl Hg (EtHg) with reactive oxygens was studied in vitro by using peroxidase-hydrogen peroxide (H{sub 2}O{sub 2})-halide and rose bengal-ultraviolet light A systems. For this purpose, the direct determination method for inorganic Hg was employed. Both systems could effectively degrade EtHg, and MeHg to some extent. Degradation of MeHg and EtHg with the myeloperoxidase (MPO)-H{sub 2}O{sub 2}-chloride system was inhibited by MPO inhibitors (cyanide and azide), catalase, hypochlorous acid (HOCl) scavengers (glycine, alanine, serine and taurine), 1,4-diazabicyclo(2,2,2)octane and 2,5-dimethylfuran, but not by hydroxyl radical scavengers (ethanol and mannitol). Iodide was more effective than chloride as the halide component. Lactoperoxidase (LPO) could substitute for MPO in the iodide, but not the chloride system. With MPO-H{sub 2}O{sub 2}-chloride, MPO-H{sub 2}O{sub 2}-iodide and LPO-H{sub 2}O{sub 2}-iodide systems, we observed the increased degradation of EtHg in deuterium oxide (D{sub 2}O) medium better than that in H{sub 2}O medium. The D{sub 2}O effect upon MeHg degradation was extremely weak. These results suggested that HOCl (or HOI) might be also capable of degrading MeHg and EtHg, besides the hydroxyl radical already reported by us. Singlet oxygen could degrade EtHg but not MeHg. (orig.).

  2. Quercetin-Rich Guava (Psidium guajava) Juice in Combination with Trehalose Reduces Autophagy, Apoptosis and Pyroptosis Formation in the Kidney and Pancreas of Type II Diabetic Rats.

    Lin, Chia-Fa; Kuo, Yen-Ting; Chen, Tsung-Ying; Chien, Chiang-Ting

    2016-03-10

    We explored whether the combination of anti-oxidant and anti-inflammatory guava (Psidium guajava) and trehalose treatment protects the kidney and pancreas against Type II diabetes (T2DM)-induced injury in rats. We measured the active component of guava juice by HPLC analysis. T2DM was induced in Wistar rats by intraperitoneal administration of nicotinamide and streptozotocin and combination with high fructose diets for 8 weeks. The rats fed with different dosages of guava juice in combination with or without trehalose for 4 weeks were evaluated the parameters including OGTT, plasma insulin, HbA1c, HOMA-IR (insulin resistance) and HOMA-β (β cell function and insulin secretion). We measured oxidative and inflammatory degrees by immunohistochemistry stain, fluorescent stain, and western blot and serum and kidney reactive oxygen species (ROS) by a chemiluminescence analyzer. High content of quercetin in the guava juice scavenged H2O2 and HOCl, whereas trehalose selectively reduced H2O2, not HOCl. T2DM affected the levels in OGTT, plasma insulin, HbA1c, HOMA-IR and HOMA-β, whereas these T2DM-altered parameters, except HbA1c, were significantly improved by guava and trehalose treatment. The levels of T2DM-enhanced renal ROS, 4-hydroxynonenal, caspase-3/apoptosis, LC3-B/autophagy and IL-1β/pyroptosis were significantly decreased by guava juice and trehalose. The combination with trehalose and guava juice protects the pancreas and kidney against T2DM-induced injury.

  3. Helicobacter Catalase Devoid of Catalytic Activity Protects the Bacterium against Oxidative Stress.

    Benoit, Stéphane L; Maier, Robert J

    2016-11-04

    Catalase, a conserved and abundant enzyme found in all domains of life, dissipates the oxidant hydrogen peroxide (H 2 O 2 ). The gastric pathogen Helicobacter pylori undergoes host-mediated oxidant stress exposure, and its catalase contains oxidizable methionine (Met) residues. We hypothesized catalase may play a large stress-combating role independent of its classical catalytic one, namely quenching harmful oxidants through its recyclable Met residues, resulting in oxidant protection to the bacterium. Two Helicobacter mutant strains ( katA H56A and katA Y339A ) containing catalase without enzyme activity but that retain all Met residues were created. These strains were much more resistant to oxidants than a catalase-deletion mutant strain. The quenching ability of the altered versions was shown, whereby oxidant-stressed (HOCl-exposed) Helicobacter retained viability even upon extracellular addition of the inactive versions of catalase, in contrast to cells receiving HOCl alone. The importance of the methionine-mediated quenching to the pathogen residing in the oxidant-rich gastric mucus was studied. In contrast to a catalase-null strain, both site-change mutants proficiently colonized the murine gastric mucosa, suggesting that the amino acid composition-dependent oxidant-quenching role of catalase is more important than the well described H 2 O 2 -dissipating catalytic role. Over 100 years after the discovery of catalase, these findings reveal a new non-enzymatic protective mechanism of action for the ubiquitous enzyme. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  4. 2-Chlorohexadecanoic acid induces ER stress and mitochondrial dysfunction in brain microvascular endothelial cells

    Eva Bernhart

    2018-05-01

    Full Text Available Peripheral leukocytes induce blood-brain barrier (BBB dysfunction through the release of cytotoxic mediators. These include hypochlorous acid (HOCl that is formed via the myeloperoxidase-H2O2-chloride system of activated phagocytes. HOCl targets the endogenous pool of ether phospholipids (plasmalogens generating chlorinated inflammatory mediators like e.g. 2-chlorohexadecanal and its conversion product 2-chlorohexadecanoic acid (2-ClHA. In the cerebrovasculature these compounds inflict damage to brain microvascular endothelial cells (BMVEC that form the morphological basis of the BBB. To follow subcellular trafficking of 2-ClHA we synthesized a ‘clickable’ alkyne derivative (2-ClHyA that phenocopied the biological activity of the parent compound. Confocal and superresolution structured illumination microscopy revealed accumulation of 2-ClHyA in the endoplasmic reticulum (ER and mitochondria of human BMVEC (hCMEC/D3 cell line. 2-ClHA and its alkyne analogue interfered with protein palmitoylation, induced ER-stress markers, reduced the ER ATP content, and activated transcription and secretion of interleukin (IL−6 as well as IL-8. 2-ClHA disrupted the mitochondrial membrane potential and induced procaspase-3 and PARP cleavage. The protein kinase R-like ER kinase (PERK inhibitor GSK2606414 suppressed 2-ClHA-mediated activating transcription factor 4 synthesis and IL-6/8 secretion, but showed no effect on endothelial barrier dysfunction and cleavage of procaspase-3. Our data indicate that 2-ClHA induces potent lipotoxic responses in brain endothelial cells and could have implications in inflammation-induced BBB dysfunction.

  5. Hypochlorite oxidation of morpholine-borane

    Wilson, I.; Kelly, H.

    1982-01-01

    Morpholine-borane reacts with sodium hypochlorite in a 1:4 mole ratio wherein three OCl - species are utilized for hydride oxidation and a fourth is consumed in the chlorination of morpholine. The determination of kinetic parameters, based upon the stopped-flow spectrophotometric measurement of the rate of disappearance of OCl - at 290 nm (pH9-11), is complicated by these consecutive competitive reactions of hypochlorite. At a given pH, the second-order rate constant for the reaction of OCl - with morpholine is about 10 3 times greater than that for attack of hypochlorite on amine-borane; thus, a reliable determination of the latter constant was based upon ''initial rate'' studies under pseudo-first-order conditions involving a large stoichiometric excess of morpholine-borane. The rate of reaction of hypochlorite with amine-borane is also first order in hydrogen ion and is subject to a normal substrate isotope effect with O(CH 2 ) 4 NH.BH 3 reacting about 1.6 times more rapidly than O(CH 2 ) 4 NH.BD 3 . At a given lyonium ion concentration, the reaction is enhanced by a factor of about 3.5 in D 2 O. It is proposed that the rate-limiting step involves oxidative attack of hypochlorous acid at a boron-hydrogen bond in the amine-borane and that subsequent oxidation of the two remaining hydridic hydrogen atoms is rapid relative to the chlorination of morpholine. The inverse solvent isotope effect is attributed to a higher concentration of DOCl in D 2 O relative to that of HOCl in normal water at a given pD (pH), but is likely that this influence is partially offset by a normal secondary isotope effect associated with attack of HOCl (DOCl) at the B-H bond

  6. Smear layer-deproteinizing improves bonding of one-step self-etch adhesives to dentin.

    Thanatvarakorn, Ornnicha; Prasansuttiporn, Taweesak; Thittaweerat, Suppason; Foxton, Richard M; Ichinose, Shizuko; Tagami, Junji; Hosaka, Keiichi; Nakajima, Masatoshi

    2018-03-01

    Smear layer deproteinizing was proved to reduce the organic phase of smear layer covered on dentin surface. It was shown to eliminate hybridized smear layer and nanoleakage expression in resin-dentin bonding interface of two-step self-etch adhesive. This study aimed to investigate those effects on various one-step self-etch adhesives. Four different one-step self-etch adhesives were used in this study; SE One (SE), Scotchbond™ Universal (SU), BeautiBond Multi (BB), and Bond Force (BF). Flat human dentin surfaces with standardized smear layer were prepared. Smear layer deproteinizing was carried out by the application of 50ppm hypochlorous acid (HOCl) on dentin surface for 15s followed by Accel ® (p-toluenesulfinic acid salt) for 5s prior to adhesive application. No surface pretreatment was used as control. Microtensile bond strength (μTBS) and nanoleakage under TEM observation were investigated. The data were analyzed by two-way ANOVA and Tukey's post-hoc test and t-test at the significant level of 0.05. Smear layer deproteinizing significantly improved μTBS of SE, SU, and BB (player observed in control groups of SE, BB, and BF, and reticular nanoleakage presented throughout the hybridized complex in control groups of BB and BF were eliminated upon the smear layer deproteinizing. Smear layer deproteinizing by HOCl and Accel ® application could enhance the quality of dentin for bonding to one-step self-etch adhesives, resulting in the improving μTBS, eliminating hybridized smear layer and preventing reticular nanoleakage formation in resin-dentin bonding interface. Copyright © 2018 The Academy of Dental Materials. Published by Elsevier Ltd. All rights reserved.

  7. Parâmetros físico-químicos incomuns em água de abastecimento público de um município da região nordeste do Estado de São Paulo (Brasil | Unusual physico-chemical parameters in the public water supply of a town in the northeast of the São Paulo State (Brazil

    Sergio Dovidauskas

    2017-02-01

    Full Text Available Amostras de águas de abastecimento público (n = 4347 de 88 municípios do nordeste do Estado de São Paulo (Brasil foram analisadas em 21 parâmetros físico-químicos: temperatura, condutividade (por condutimetria, cloro residual livre (colorimetria com N,N-dietil-p-fenilenodiamina, pH (potenciometria, cor aparente (espectrofotometria, turbidez (nefelometria, e concentrações de Li+, Na+, NH4+, K+, Ca2+, Mg2+, F-, ClO2-, BrO3-, Cl-, Br-, ClO3-, NO3-, PO43- e SO42- (cromatografia de íons. Os resultados foram submetidos à análise multivariada de dados. A análise de componentes principais das medianas de 12 variáveis (pH, condutividade, Li+, Na+, K+, Ca2+, Mg2+, Cl-, ClO3-, NO3-, PO43-, SO42- dos 88 municípios indicou Ibitinga como local com água de características físico-químicas únicas, caracterizada pelas concentrações relativas mais altas de sulfato, cloreto, lítio e sódio, e aos valores maiores de pH e condutividade. Em adição, Ibitinga foi o único município que apresentou sistematicamente brometo na composição da água. Uma segunda análise de componentes principais envolvendo as amostras de Ibitinga indicou uma amostra com concentrações mais altas de cloreto e sulfato, e quatro amostras nas quais a presença de nitrato foi característica. Análises de agrupamento hierárquico exibiram a formação dos mesmos grupos produzidos nas duas análises de componentes. A validação dos métodos cromatográficos também é apresentada. ================================================ Public water supply samples (n = 4347 from 88 municipalities in the northeast of the State of São Paulo (Brazil were analysed in 21 physico-chemical parameters: temperature, conductivity (by conductimetry, free residual chlorine (colorimetry with N,N-diethyl-p-phenylenediamine, pH (potentiometry, apparent color (spectrophotometry, turbidity (nephelometry, and concentrations of Li+, Na+, NH4+, K+, Ca2+, Mg2+, F-, ClO2-, BrO3-, Cl-, Br-, ClO3

  8. Issues in Stratospheric Ozone Depletion.

    Lloyd, Steven Andrew

    Following the announcement of the discovery of the Antarctic ozone hole in 1985 there have arisen a multitude of questions pertaining to the nature and consequences of polar ozone depletion. This thesis addresses several of these specific questions, using both computer models of chemical kinetics and the Earth's radiation field as well as laboratory kinetic experiments. A coupled chemical kinetic-radiative numerical model was developed to assist in the analysis of in situ field measurements of several radical and neutral species in the polar and mid-latitude lower stratosphere. Modeling was used in the analysis of enhanced polar ClO, mid-latitude diurnal variation of ClO, and simultaneous measurements of OH, HO_2, H_2 O and O_3. Most importantly, such modeling was instrumental in establishing the link between the observed ClO and BrO concentrations in the Antarctic polar vortex and the observed rate of ozone depletion. The principal medical concern of stratospheric ozone depletion is that ozone loss will lead to the enhancement of ground-level UV-B radiation. Global ozone climatology (40^circS to 50^ circN latitude) was incorporated into a radiation field model to calculate the biologically accumulated dosage (BAD) of UV-B radiation, integrated over days, months, and years. The slope of the annual BAD as a function of latitude was found to correspond to epidemiological data for non-melanoma skin cancers for 30^circ -50^circN. Various ozone loss scenarios were investigated. It was found that a small ozone loss in the tropics can provide as much additional biologically effective UV-B as a much larger ozone loss at higher latitudes. Also, for ozone depletions of > 5%, the BAD of UV-B increases exponentially with decreasing ozone levels. An important key player in determining whether polar ozone depletion can propagate into the populated mid-latitudes is chlorine nitrate, ClONO_2 . As yet this molecule is only indirectly accounted for in computer models and field

  9. Hydrolysis constants of tetravalent neptunium by using solvent extraction method

    Fujiwara, K.; Kohara, Y.

    2008-01-01

    The hydrolysis constants of tetravalent neptunium (Np(IV)) were determined by solvent extraction method using thenoyltrifluoroacetone(TTA). In order to avoid colloid formation, a stock solution of carrier-free 239 Np(V) was from 243 Am milked. The valence of Np in the solution was then reduced to Np(IV) by using zinc amalgam. The hydrolysis constants (β m ) of the reactions, Np 4+ + mOH - = Np(OH) m (4-m)+ was evaluated by using distribution ratios at ionic strengths (I) = 0.1, 0.5 and 1.0. All experiments were performed in oxygen-free 0.5% H 2 -N 2 atmosphere (below 1.0 ppm of O 2 ) in a glove-box at room temperature (23 ± 2 C) to avoid oxidation of Np(IV). The β m values were extrapolated to the standard state (I = 0) by using the specific ion interaction theory (SIT), and the formation constants at I = 0 were determined to be log β 1 = 13.91 ± 0.23, log β 2 = 27.13 ± 0.15, log β 3 = 37.70 ± 0.30 and log β 4 = 46.16 ± 0.30. The ion interaction coefficients were also evaluated to be ε(NpOH 3+ , ClO 4 - ) = 0.49 ± 0.15, ε(Np(OH) 2 2+ , ClO 4 - ) = 0.35 ± 0.11, and ε(Np(OH) 3 + , ClO 4 - ) = 0.29 ± 0.15. (orig.)

  10. The chemiluminescence of luminol in aqueous solutions, a pulse radiolytic study

    Lind, J.

    1980-01-01

    The mechanism of chemiluminescence was studied when the luminol radical and superoxide were generated simultaneously. Hydroperoxide was formed at the first reaction step with a pKa value between 11 and 12. The dissociated form was found to undergo a monomolecular reaction leading to light generation and having a rate constant > 2 x 10 5 s -1 . The protonated form had the rate constant of approx. 2000 s -1 and formed a product which absorbed around 390 nm without light emission. The reaction of the two-electron oxidation product of luminol, 5-aminophthalazine-1, 4 dione (azaquinone), with hydrogenperoxide was stoichiometrically equivalent to the recombination of superoxide with the luminol radical. The pulseradiolytic generation of the chlorinedioxide radical ClO 2 in aqueous solution of sodium chlorite is described, and the oxidation of luminol by ClO 2 in two steps is reported: 1. Radical adducts are formed. 2. The reaction of ClO 2 x radical with the adduct to form azaquinone. The chemiluminescent reaction between the azaquinone and hydrogenperoxide consists of a second order reaction between HO 2 and the azaquinone to form a hydroperoxide followed by a monomolecular rearrangement of the dissociated form of the latter. Its acidbase equilibrium has a pKa of 10.6. A nitrogencentered structure is ascribed to the hydroperoxide formed by cross-recombination of the luminolradical and superoxide while the reaction between HO 2 and azaquinone yields a carboncentered hydroperoxide. The existence of two different emitters is evidenced by the following observations. 1. A slight difference in chemiluminescence spectra. 2. The formation of an endproduct with pKa approx. 10.2 in the luminolradical superoxide system. 3. The formation of an endproduct which acts as an efficient radial scavenger in the luminol radical superoxide system. (G.B.)

  11. Electron oxidation of graphite by fluorospecies

    Rosenthal, G.L.

    1984-09-01

    The fluoride-ion affinity (A/sub F - /) of phosphorus pentafluoride was determined to be 100 kcal/mole from the heats of reaction of the Lewis bases SF 4 and ClO 2 F with PF 5 near room temperature. The fluoride-ion affinity of boron trifluoride was determined to be 92 kcal/mole from the heat of reaction of ClO 2 F with BF 3 . The crystal structure of ClO 2 BF 4 was determined and a precise lattice energy was calculated from this structure and used to determined A/sub F - /. Both PF 5 and BF 3 were found to react with graphite in the presence of fluorine gas to yield a variety of non-stoichiometric compounds. The fluoride-ion affinity of silicon tetrafluoride is not known, but it does not react with graphite and F 2 except at high pressures. These and previous results suggested a threshold in oxidizing power of intercalating species below which the oxidative intercalation reaction would not occur. The reduction of C/sub x/PF 6 by PF 3 proved that the reaction is thermodynamically controlled to some extent. The displacement of PF 5 in C/sub x/PF 6 by BF 3 (with a smaller A/sub F - /) suggested that two BF 3 molecules may have a larger fluoride-ion affinity than one PF 5 and that B 2 F 7 - may be a stable anion in graphite. Conductivity studies of PF/sub x/ and BF/sub y/ salts showed that a large drop in conductivity when the reaction reaches first stage is due in the most part to direct fluorination of carbon in graphite

  12. A win for the patient: Direct patient notification improves treatment rates of active Helicobacter pylori infection.

    Selvaratnam, Sriharan; Yeoh, Joey; Hsiang, John; Patrick, Alasdair B

    2014-01-01

    Current international guidelines recommend the commencement of effective eradication therapy as soon as active Helicobacter pylori (H. pylori) infection is confirmed. At our institution, all positive Campylobacter-like Organism (CLO) test results were automatically communicated to general practitioners (GPs) via a standardised letter, which also advised the commencement of eradication therapy. Despite this endeavour, a clinical audit conducted in 2011 demonstrated that only 66 per cent of confirmed H. pylori-positive South Auckland patients received eradication treatment and only 83 per cent of these patients received treatment within one month. Improve the timely initiation of H. pylori eradication therapy through direct patient notification. A prospective clinical audit of 109 consecutive outpatients with a positive CLO test identified at gastroscopy. In addition to standard general practitioner notification, patients were also directly notified of their positive CLO test result via a standardised letter, which provided information about H. pylori and its disease associations as well as advising patients to seek consultation with their GP to commence eradication therapy. Dispensing data was examined using Test Safe electronic records to determine the total uptake and timing of treatment compared to data from a preliminary 2011 audit. Ninety-five per cent of H. pylori-positive patients received standard triple therapy; therefore, treatment of active H. pylori infection was significantly higher when patients were directly notified in addition to standard GP notification, when compared to GP notification alone (95 per cent vs 66 per cent, paudit in 2011 (100 per cent vs. 83 per cent, pstrategy that significantly improves the timely initiation of eradication therapy for active H. pylori infection. This has since been integrated into standard practice at our District Health Board (DHB).

  13. Pretreatment of algae-laden and manganese-containing waters by oxidation-assisted coagulation: Effects of oxidation on algal cell viability and manganese precipitation.

    Lin, Jr-Lin; Hua, Lap-Cuong; Wu, Yuting; Huang, Chihpin

    2016-02-01

    Preoxidation is manipulated to improve performance of algae and soluble manganese (Mn) removal by coagulation-sedimentation for water treatment plants (WTPs) when large amount of soluble Mn presents in algae-laden waters. This study aimed to investigate the effects of preoxidation on the performance of coagulation-sedimentation for the simultaneous removal of algae and soluble Mn, including ionic and complexed Mn. NaOCl, ClO2, and KMnO4 were used to pretreat such algae-laden and Mn containing waters. The variation of algal cell viability, residual cell counts, and concentrations of Mn species prior to and after coagulation-sedimentation step were investigated. Results show that NaOCl dosing was effective in reducing the viability of algae, but precipitated little Mn. ClO2 dosing had a strongest ability to lower algae viability and oxidize ionic and complexed soluble Mn, where KMnO4 dosing oxidized ionic and complexed Mn instead of reducing the viability of cells. Preoxidation by NaOCl only improved the algae removal by sedimentation, whereas most of soluble Mn still remained. On the other hand, ClO2 preoxidation substantially improved the performance of coagulation-sedimentation for simultaneous removal of algae and soluble Mn. Furthermore, KMnO4 preoxidation did improve the removal of algae by sedimentation, but left significant residual Mn in the supernatant. Images from FlowCAM showed changes in aspect ratio (AR) and transparency of algae-Mn flocs during oxidation-assisted coagulation, and indicates that an effective oxidation can improve the removal of most compact algae-Mn flocs by sedimentation. It suggests that an effective preoxidation for reducing algal cell viability and the concentration of soluble Mn is a crucial step for upgrading the performance of coagulation-sedimentation. Copyright © 2015 Elsevier Ltd. All rights reserved.

  14. Spin dynamics in mesoscopic size magnetic systems: A 1HNMR study in rings of iron (III) ions

    Lascialfari, A.; Gatteschi, D.; Borsa, F.; Cornia, A.

    1997-01-01

    Two magnetic molecular clusters containing almost coplanar rings of iron (III) ions with spinS=5/2 have been investigated by 1 H NMR and relaxation measurements. The first system, which will be referred to as Fe6, is a molecule of general formula [NaFe 6 (OCH 3 ) 12 (C 17 O 4 H 15 ) 6 ] + ClO 4 - or [NaFe 6 (OCH 3 ) 12 (C 15 H 11 O 2 ) 6 ] + ClO 4 - or [LiFe 6 (OCH 3 ) 12 (C 15 H 11 O 2 ) 6 ] + ClO 4 - while the second type of ring, denoted Fe10, corresponds to the molecule [Fe 10 (OCH 3 ) 20 (C 2 H 2 O 2 Cl) 10 ]. The 1 H NMR linewidth is broadened by the nuclear dipolar interaction and by the dipolar coupling of the protons with the iron (III) paramagnetic moment. It is found that the nuclear spin-lattice relaxation rate, T 1 -1 , of the proton is a sensitive probe of the Fe spin dynamics. In both clusters, T 1 -1 decreases with decreasing temperatures from room temperature, goes through a peak just below about 30 K in Fe6 and 10 K in Fe10, and it drops exponentially to very small values at helium temperature. The temperature dependence of the relaxation rate is discussed in terms of the fluctuations of the local spins within the allowed total spin configurations in the framework of the weak collision theory to describe the nuclear relaxation. We use the calculated energy levels for the Fe6 ring based on a Heisenberg Hamiltonian and the value of J obtained from the fit of the magnetic susceptibility to describe semiquantitatively the behavior of T 1 -1 vs T. The exponential drop of T 1 -1 at low temperature is consistent with a nonmagnetic singlet ground state separated by an energy gap from the first excited triplet state. (Abstract Truncated)

  15. XAFS study of copper(II) complexes with square planar and square pyramidal coordination geometries

    Gaur, A.; Klysubun, W.; Nitin Nair, N.; Shrivastava, B. D.; Prasad, J.; Srivastava, K.

    2016-08-01

    X-ray absorption fine structure of six Cu(II) complexes, Cu2(Clna)4 2H2O (1), Cu2(ac)4 2H2O (2), Cu2(phac)4 (pyz) (3), Cu2(bpy)2(na)2 H2O (ClO4) (4), Cu2(teen)4(OH)2(ClO4)2 (5) and Cu2(tmen)4(OH)2(ClO4)2 (6) (where ac, phac, pyz, bpy, na, teen, tmen = acetate, phenyl acetate, pyrazole, bipyridine, nicotinic acid, tetraethyethylenediamine, tetramethylethylenediamine, respectively), which were supposed to have square pyramidal and square planar coordination geometries have been investigated. The differences observed in the X-ray absorption near edge structure (XANES) features of the standard compounds having four, five and six coordination geometry points towards presence of square planar and square pyramidal geometry around Cu centre in the studied complexes. The presence of intense pre-edge feature in the spectra of four complexes, 1-4, indicates square pyramidal coordination. Another important XANES feature, present in complexes 5 and 6, is prominent shoulder in the rising part of edge whose intensity decreases in the presence of axial ligands and thus indicates four coordination in these complexes. Ab initio calculations were carried out for square planar and square pyramidal Cu centres to observe the variation of 4p density of states in the presence and absence of axial ligands. To determine the number and distance of scattering atoms around Cu centre in the complexes, EXAFS analysis has been done using the paths obtained from Cu(II) oxide model and an axial Cu-O path from model of a square pyramidal complex. The results obtained from EXAFS analysis have been reported which confirmed the inference drawn from XANES features. Thus, it has been shown that these paths from model of a standard compound can be used to determine the structural parameters for complexes having unknown structure.

  16. Accuracy of non-invasive 13C-urea breath test compared to invasive tests for helicobacter pylori detection

    Bilal, R.; Khaar, B.; Omar, M.; Qureshi, T.Z.; Ahmed, T.; Latif, Z.; Jaffery, I.; Omar, M.

    2007-01-01

    To compare the sensitivity, specificity and Positive Predictive Value (PPV) of histology, Campylobacter-Like Organism (CLO) test, culture and 13C-Urea Breath Test (UBT) for the diagnosis of Helicobacter pylori infection. District Headquarter Hospital, Rawalpindi, Military Hospital, Rawalpindi and Pakistan Institute of Science and Technology (PINSTECH), Nilore, Islamabad from June 2002 to 2003. Three mucosal biopsy specimens were obtained during endoscopy of 90 symptomatic patients. Histology, CLO test and culture were performed on these specimens. Breath samples for 13C-UBT were collected and sent to RIAD, PINSTECH on the same day for isotope ratio mass spectrometry. For analysis purpose, each of the tests was fixed as the gold standard in turn and the others were then compared against it. In addition, any two as well as any three positive tests were then set as the gold standard and the other tests compared against them to calculate the sensitivity, specificity, accuracy and PPV of other tests. Urea breath test had the highest sensitivity, ranging from 95 to 100%, against all the gold standards with specificity ranging from 55 to 100%, whereas the sensitivity of histological examination was around 98% but it had comparatively lower specificity (49-89%). The CLO test had a sensitivity range of 86-100% and specificity of 67-100%. Culture had the minimum sensitivity (59-70%) but had highest specificity (96-100%) against all the gold standards. Age and gender had no effect on p-value of each test or in combination. The urea breath test has shown the highest ability to detect the organism with 95-100% sensitivity in symptomatic individuals and specificity, which is comparable to other tests. (author)

  17. The effect of spectroscopic parameter inaccuracies on ground-based millimeter wave remote sensing of the atmosphere

    Ryan, Niall J.; Walker, Kaley A.

    2015-01-01

    A sensitivity study was performed to assess the impact that uncertainties in the spectroscopic parameters of atmospheric species have on the retrieval of gas concentrations using the 265–280 GHz region of the electromagnetic spectrum. Errors in the retrieval of O 3 , N 2 O, HNO 3 , and ClO from spectra measured by ground-based radiometers were investigated. The goal of the study was to identify the spectroscopic parameters of these target species, and other interfering species, available in the JPL and HITRAN 2008 catalogues, which contribute the largest error to retrieved atmospheric concentration profiles in order to provide recommendations for new laboratory measurements. The parameters investigated were the line position, line strength, broadening coefficients and their temperature dependence, and pressure shift. Uncertainties in the air broadening coefficients of gases tend to contribute the largest error to retrieved atmospheric concentration profiles. For O 3 and N 2 O, gases with relatively strong spectral signatures, the retrieval is sensitive to uncertainties in the parameters of the main spectral line that is observed. For HNO 3 , the uncertainties in many closely spaced HNO 3 lines can cause large errors in the retrieved profile, and for ClO, the error in the profile is dominated by uncertainties in nearby, stronger O 3 lines. Fourteen spectroscopic parameters are identified, for which updated measurements would have the most impact on the accuracy of ground-based remote sensing of the target species at 265–280 GHz. - Highlights: • The sensitivity of retrievals to spectroscopic parameters is assessed. • Air broadening parameters contribute the most to the error budget. • O 3 and N 2 O retrievals are sensitive to parameters of the target spectral lines. • Many HNO 3 lines in close proximity can cause large errors in HNO 3 retrievals. • ClO retrievals are sensitive to uncertainties in parameters of nearby O 3 lines

  18. Role of MbtH-like Proteins in the Adenylation of Tyrosine during Aminocoumarin and Vancomycin Biosynthesis*

    Boll, Björn; Taubitz, Tatjana; Heide, Lutz

    2011-01-01

    MbtH-like proteins consist of ∼70 amino acids and are encoded in the biosynthetic gene clusters of non-ribosomally formed peptides and other secondary metabolites derived from amino acids. Recently, several MbtH-like proteins have been shown to be required for the adenylation of amino acid in non-ribosomal peptide synthesis. We now investigated the role of MbtH-like proteins in the biosynthesis of the aminocoumarin antibiotics novobiocin, clorobiocin, and simocyclinone D8 and of the glycopeptide antibiotic vancomycin. The tyrosine-adenylating enzymes CloH, SimH, and Pcza361.18, involved in the biosynthesis of clorobiocin, simocyclinone D8, and vancomycin, respectively, required the presence of MbtH-like proteins in a 1:1 molar ratio, forming heterotetrameric complexes. In contrast, NovH, involved in novobiocin biosynthesis, showed activity in the absence of MbtH-like proteins. Comparison of the active centers of CloH and NovH showed only one amino acid to be different, i.e. Leu-383 versus Met-383. Mutation of this amino acid in CloH (L383M) indeed led to MbtH-independent adenylating activity. All investigated tyrosine-adenylating enzymes exhibited remarkable promiscuity for MbtH-like proteins from different pathways and organisms. YbdZ, the MbtH-like protein from the expression host Escherichia coli, was found to bind to adenylating enzymes during expression and to influence their biochemical properties markedly. Therefore, the use of ybdZ-deficient expression hosts is important in biochemical studies of adenylating enzymes. PMID:21890635

  19. Peritoneal clearances in hypertensive CAPD patients after oral administration of clonidine, enalapril, and nifedipine.

    Favazza, A; Motanaro, D; Messa, P; Antonucci, F; Gropuzzo, M; Mioni, G

    1992-01-01

    The authors investigated whether the reduction of arterial pressure, induced by the oral administration of clonidine (CLO), enalapril (EN), and nifedipine (NIF), has any effect on peritoneal transport rates. The study was performed in nine hypertensive patients undergoing continuous ambulatory peritoneal dialysis (CAPD). The patients were submitted to administration of CLO, EN, and NIF, each in randomized succession for two weeks, after withdrawal of any hypotensive therapy for eight days (washout period). The nine patients underwent a four-hour dwell exchange using a 2.27 g/dL glucose two-liter bag after washout and after each hypotensive period. The following parameters were analyzed: mean arterial pressure (MAP), performed in the sitting position; net ultrafiltration; effluent/initial dialysate glucose ratio (GL D/Do); peritoneal clearance of K, BUN, creatinine (Cr), phosphate, beta-2 microglobulin (beta 2), total proteins, and the ratio between beta 2 and Cr clearance. Moreover, residual renal Cr and beta 2 clearances were analyzed. The three drugs significantly reduced MAP at a similar rate. The peritoneal transport parameters after CLO were similar to the results in the washout period. On the contrary, after EN and NIF therapy, Cr and beta 2 clearances were significantly increased, and GL D/Do decreased in comparison to the washout period. The other peritoneal transport parameters after EN and NIF were similar to the washout period. Residual renal Cr and beta 2 clearances after the three drugs were similar to those in the washout. these data suggest that after two weeks of therapy with EN and NIF, glucose, Cr, and beta 2 peritoneal transports are influenced by these hypotensive drugs irrespective of the effect on the arterial pressure.(ABSTRACT TRUNCATED AT 250 WORDS)

  20. Structural, thermal and photomagnetic properties of spin crossover [Fe(bpp)2]2+ salts bearing [Cr(L)(ox)2]- anions.

    Clemente-León, Miguel; Coronado, Eugenio; Giménez-López, M Carmen; Romero, Francisco M; Asthana, Saket; Desplanches, Cédric; Létard, Jean-François

    2009-10-14

    This paper is divided into two parts: in the first part, the influence of solvate molecules on the magnetic properties of spin crossover salts of [Fe(bpp)(2)][Cr(L)(ox)(2)]ClO(4) x nS (bpp = 2,6-bis(pyrazol-3yl)pyridine; L = 2,2'-bipyridine (bpy) or 1,10-phenanthroline (phen); ox = oxalate dianion; S = solvent) is analyzed. The second part is devoted to the photomagnetic properties of the previously reported [Fe(bpp)(2)][Cr(L)(ox)(2)](2) family of compounds. The study describes the crystal structure, differential scanning calorimetry (DSC) and magnetic properties of [Fe(bpp)(2)][Cr(bpy)(ox)(2)]ClO(4) x EtOH x 4 H(2)O (1) and [Fe(bpp)(2)][Cr(phen)(ox)(2)]ClO(4) x 1.5 EtOH x 4 H(2)O (2). Both salts are high-spin (HS) compounds. Desolvation of 1 yields a material exhibiting a gradual spin crossover that involves 50% of the Fe(2+) cations. Rehydration of this desolvated salt induces a significant increase in the low-spin (LS) population. Desolvation of 2 affords a material showing a more abrupt spin crossover with thermal hysteresis (T(1/2)(increasing) = 286 K and T(1/2)(decreasing) = 273 K). This material is not very sensitive to rehydration. The anhydrous compounds [Fe(bpp)(2)][Cr(bpy)(ox)(2)](2) (3) and [Fe(bpp)(2)][Cr(phen)(ox)(2)](2) (4) display some quantitative photomagnetic conversion with T(LIESST) values of 41 and 51 K, respectively. Kinetic parameters governing the photo-induced HS-LS relaxation process have been determined and used to reproduce the T(LIESST) curves.