International Nuclear Information System (INIS)
HAMMERS, J.S.
1999-01-01
The purpose of the test was to verify that the AN Tank Farm Encasement Leak Detector components are functionally integrated and operate in accordance with engineering design specifications The Acceptance Test Procedure HNF-4650, SN-268 Encasement Leak Detection ANA-W-LDSTA-335, was conducted between 22 June and 01 July 1999 at the 200E AN Tank Farm. The test has been completed with no open test exceptions The test was conducted prior to final engineering ''as built'' activities being completed this had no impact on the procedure or test results. All components, identified in the procedure, were found to be labeled and identified as written in the procedure
21 CFR 876.4650 - Water jet renal stone dislodger system.
2010-04-01
... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Water jet renal stone dislodger system. 876.4650... (CONTINUED) MEDICAL DEVICES GASTROENTEROLOGY-UROLOGY DEVICES Surgical Devices § 876.4650 Water jet renal stone dislodger system. (a) Identification. A water jet renal stone dislodger system is a device used to...
Directory of Open Access Journals (Sweden)
Harvey Mario
2010-01-01
Full Text Available Abstract Background UDP-glucuronosyltransferase 1A1 (UGT1A1 is a pivotal enzyme involved in metabolism of SN-38, the active metabolite of irinotecan commonly used to treat metastatic colorectal cancer. We previously demonstrated aberrant methylation of specific CpG dinucleotides in UGT1A1-negative cells, and revealed that methylation state of the UGT1A1 5'-flanking sequence is negatively correlated with gene transcription. Interestingly, one of these CpG dinucleotides (CpG -4 is found close to a HNF1 response element (HRE, known to be involved in activation of UGT1A1 gene expression, and within an upstream stimulating factor (USF binding site. Results Gel retardation assays revealed that methylation of CpG-4 directly affect the interaction of USF1/2 with its cognate sequence without altering the binding for HNF1-alpha. Luciferase assays sustained a role for USF1/2 and HNF1-alpha in UGT1A1 regulation in colon cancer cells. Based on the differential expression profiles of HNF1A gene in colon cell lines, we also assessed whether methylation affects its expression. In agreement with the presence of CpG islands in the HNF1A promoter, treatments of UGT1A1-negative HCT116 colon cancer cells with a DNA methyltransferase inhibitor restore HNF1A gene expression, as observed for UGT1A1. Conclusions This study reveals that basal UGT1A1 expression in colon cells is positively regulated by HNF1-alpha and USF, and negatively regulated by DNA methylation. Besides, DNA methylation of HNF1A could also play an important role in regulating additional cellular drug metabolism and transporter pathways. This process may contribute to determine local inactivation of drugs such as the anticancer agent SN-38 by glucuronidation and define tumoral response.
Directory of Open Access Journals (Sweden)
Wolfgang Albrecht
2017-05-01
Full Text Available The Helmholtz Nano Facility (HNF is a state-of-the-art cleanroom facility. The cleanroom has ~1100 m2 with cleanroom classes of DIN ISO 1-3. HNF operates according to VDI DIN 2083, Good Manufacturing Practice (GMP and aquivalent to Semiconductor Industry Association (SIA standards. HNF is a user facility of Forschungszentrum Jülich and comprises a network of facilities, processes and systems for research, production and characterization of micro- and nanostructures. HNF meets the basic supply of micro- and nanostructures for nanoelectronics, fluidics. micromechanics, biology, neutron and energy science, etc.. The task of HNF is rapid progress in nanostructures and their technology, offering efficient access to infrastructure and equipment. HNF gives access to expertise and provides resources in production, synthesis, characterization and integration of structures, devices and circuits. HNF covers the range from basic research to application oriented research facilitating a broad variety of different materials and different sample sizes.
Functional characterization of the HNF4α isoform (HNF4α8) expressed in pancreatic β-cells
International Nuclear Information System (INIS)
Ihara, Arisa; Yamagata, Kazuya; Nammo, Takao; Miura, Atsuko; Yuan, Ming; Tanaka, Toshiya; Sladek, Frances M.; Matsuzawa, Yuji; Miyagawa, Jun-ichiro; Shimomura, Iichiro
2005-01-01
Mutations in the hepatocyte nuclear factor (HNF) 4α gene cause a form of maturity-onset diabetes of the young (MODY1), which is a monogenic form of type 2 diabetes characterized by impaired insulin secretion by pancreatic β-cells. HNF4α is a transcription factor expressed in the liver, kidney, intestine, and pancreatic islet. Multiple splice variants of the HNF4α gene have been identified and an isoform of HNF4α8, an N-terminal splice variant, is expressed in pancreatic β-cells. However, expression levels of HNF4α protein in pancreatic β-cells and the transcriptional activity of HNF4α8 are not yet understood. In the present study, we investigated the expression of HNF4α in β-cells and examined its functional properties. Western blotting and immunohistochemical analysis revealed that the expression of HNF4α protein in pancreatic islets and INS-1 cells was much lower than in the liver. A reporter gene assay showed that the transactivation potential of HNF4α8 was significantly weaker than that of HNF4α2, which is a major isoform in the liver, suggesting that the total level of HNF4α activity is very weak in pancreatic β-cells. We also showed that the N-terminal A/B region of HNF4α8 possessed no activation function and C-terminal F region negatively regulated the transcriptional activity of HNF4α8. The information presented here would be helpful for the better understanding of MODY1/HNF4α diabetes
Kyithar, M P; Bacon, S; Pannu, K K; Rizvi, S R; Colclough, K; Ellard, S; Byrne, M M
2011-12-01
The prevalence of hepatocyte nuclear factor (HNF)-1A and HNF4A mutations, and the clinical implications following the genetic diagnosis of maturity-onset diabetes of the young (MODY) in the Irish population, remain unknown. The aim of this study was to establish the occurrence of HNF1A and HNF4A mutations in subjects classified clinically as MODY to identify novel mutations, and to determine the phenotypic features and response to therapy. A total of 36 unrelated index cases with a clinical diagnosis of MODY were analyzed for HNF1A/HNF4A mutations. OGTT was performed to determine the degree of glucose tolerance and insulin secretory response. Also, 38 relatives underwent OGTT and were tested for the relevant known mutations. HNF1A-/HNF4A-MODY subjects were compared with nine HNF1A mutation-negative relatives and 20 type 2 diabetic (T2DM) patients. Seven different HNF1A mutations were identified in 11/36 (30.5%) index cases, two of which were novel (S352fsdelG and F426X), as well as two novel HNF4A mutations (M1? and R290C; 6%). Family screening revealed 20 subjects with HNF1A and seven with HNF4A mutations. Only 51.6% of HNF1A mutation carriers were diagnosed with diabetes by age 25 years; 11 of the mutation carriers were overweight and four were obese. Insulin secretory response to glucose was significantly lower in HNF1A-MODY subjects than in T2DM patients and HNF1A mutation-negative relatives (P=0.01). Therapeutic changes occurred in 48% of mutation carriers following genetic diagnosis. There was an HNF1A-MODY pick-up rate of 30.5% and an HNF4A-MODY pick-up rate of 6% in Irish MODY families. Genetically confirmed MODY has significant therapeutic implications. Copyright © 2011 Elsevier Masson SAS. All rights reserved.
International Nuclear Information System (INIS)
Gu, Ning; Suzuki, Naoko; Takeda, Jun; Adachi, Tetsuya; Tsujimoto, Gozoh; Aoki, Norihiko; Ishihara, Akihiko; Tsuda, Kinsuke; Yasuda, Koichiro
2004-01-01
Mutations in transcription factors hepatocyte nuclear factors (HNF)-1α and HNF-1β cause maturity-onset diabetes of the young (MODY) types 3 and 5, respectively. HNF-1α and HNF-1β mutations are well studied in some tissues, but the mechanism by which HNF-1α and HNF-1β mutations affect sucrase-isomaltase (SI) transcription in the small intestine is unclear. We studied the effects of 13 HNF-1α mutants and 2 HNF-1β mutants on human SI gene transcription, which were identified in subjects with MODY3 and MODY5, respectively. Transactivation activity of 11 HNF-1α and 2 HNF-1β mutants was significantly lower than that of wild (wt)-HNF-1α and wt-HNF-1β. Furthermore, in co-expression studies with mutant (mu)-HNF-1α/ wt-HNF-1β and wt-HNF-1α/mu-HNF-1β, the combination of mu-HNF-1α (P379fsdelCT and T539fsdelC)/wt-HNF-1β impaired SI transcription, but the others were not remarkably different from wt-HNF-1α/wt-HNF-1β. Although wt-HNF-1β inhibited the transactivation activity of wt-HNF-1α on SI transcription, the inhibitory effect was reduced by 2 HNF-1β mutants. These results suggest that SI transcription might tend to be unchanged or lower in MODY3, while occurring more in MODY5
Urbanova, Jana; Andel, Michal; Potockova, Jana; Klima, Josef; Macek, Jan; Ptacek, Pavel; Mat'oska, Vaclav; Kumstyrova, Tereza; Heneberg, Petr
2015-01-01
Sulfonylurea derivatives are widely used for clinical treatment of human subjects with Maturity Onset Diabetes of the Young (MODY) caused by mutations in HNF-1α or HNF-4α despite the mechanism leading to their hypersensitivity is incompletely understood. In Hnf1a(-/-) mice, serum concentrations and half-life of sulfonylurea derivatives are strongly increased. We thus hypothesized that reduced sulfonylurea derivatives clearance stands behind their therapeutic potential in human HNF1A/HNF4A MODY subjects. Single doses of 3 mg glipizide and 5 mg glibenclamide/glyburide were administered sequentially to seven HNF1A/HNF4A MODY subjects and six control individuals matched for their age, BMI and CYP2C9 genotype. Pharmacokinetic (plasma concentration levels, Cmax, tmax, t1/2, AUC) and pharmacodynamic parameters (glycemia, C-peptide and insulin plasma levels) were followed for 24 hours after drug administration. We provide the first evidence on the pharmacokinetics and pharmacodynamics of sulfonylurea derivatives in human MODY subjects. The half-life of glipizide did not change, and reached 3.8±0.7 and 3.7±1.8 h in the MODY and control subjects, respectively. The half-life of glibenclamide was increased only in some MODY subjects (t1/2 9.5±6.7 and 5.0±1.4 h, respectively). Importantly, the intra- individual responses of MODY (but control) subjects to glipizide and glibenclamide treatment were highly correlated. With regards to pharmacodynamics, we observed a differential response of control but not MODY subjects to the doses of glipizide and glibenclamide applied. We rejected the hypothesis that all human MODY-associated mutations in HNF1A / HNF4A induce changes in the pharmacokinetics of sulfonylureas in humans analogically to the Hnf1a(-/-) mouse model.
Analysis list: Hnf4a [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Hnf4a Digestive tract,Embryo,Gonad,Kidney,Liver,Prostate + mm9 http://dbarchive.bio...sciencedbc.jp/kyushu-u/mm9/target/Hnf4a.1.tsv http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/target/Hnf4a.5....tsv http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/target/Hnf4a.10.tsv http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/colo/Hnf4...a.Digestive_tract.tsv,http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/colo/Hnf4...a.Embryo.tsv,http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/colo/Hnf4a.Gonad.tsv,http://dbar
DEFF Research Database (Denmark)
Hansen, Sara K; Párrizas, Marcelina; Jensen, Maria L
2002-01-01
Mutations in the genes encoding hepatocyte nuclear factor 4alpha (HNF-4alpha) and HNF-1alpha impair insulin secretion and cause maturity onset diabetes of the young (MODY). HNF-4alpha is known to be an essential positive regulator of HNF-1alpha. More recent data demonstrates that HNF-4alpha...... in human islets and exocrine cells is primarily mediated by the P2 promoter. Furthermore, we describe a G --> A mutation in a conserved nucleotide position of the HNF-1alpha binding site of the P2 promoter, which cosegregates with MODY. The mutation results in decreased affinity for HNF-1alpha...
Roles of HNF1α and HNF4α in pancreatic β-cells: lessons from a monogenic form of diabetes (MODY).
Yamagata, Kazuya
2014-01-01
Mutations in the genes encoding hepatocyte nuclear factor (HNF)1α and HNF4α cause a monogenic form of diabetes mellitus known as maturity-onset diabetes of the young (MODY). The primary cause of MODY is an impairment of glucose-stimulated insulin secretion by pancreatic β-cells, indicating the important roles of HNF1α and HNF4α in β-cells. Large-scale genetic studies have clarified that the common variants of HNF1α and HNF4α genes are also associated with type 2 diabetes, suggesting that they are involved in the pathogenesis of both diseases. Recent experimental studies revealed that HNF1α controls both β-cell function and growth by regulating target genes such as glucose transporter 2, pyruvate kinase, collectrin, hepatocyte growth factor activator, and HNF4α. In contrast, HNF4α mainly regulates the function of β-cells. Although direct target genes of HNF4α in β-cells are largely unknown, we recently identified Anks4b as a novel target of HNF4α that regulates β-cell susceptibility to endoplasmic reticulum stress. Studies of MODY have led to a better understanding of the molecular mechanism of glucose-stimulated insulin secretion by pancreatic β-cells. © 2014 Elsevier Inc. All rights reserved.
Lipoprotein composition in HNF1A-MODY: differentiating between HNF1A-MODY and type 2 diabetes.
McDonald, Tim J; McEneny, Jane; Pearson, Ewan R; Thanabalasingham, Gaya; Szopa, Magdalena; Shields, Beverley M; Ellard, Sian; Owen, Katharine R; Malecki, Maciej T; Hattersley, Andrew T; Young, Ian S
2012-05-18
The young-onset diabetes seen in HNF1A-MODY is often misdiagnosed as Type 2 diabetes. Type 2 diabetes, unlike HNF1A-MODY, is associated with insulin resistance and a characteristic dyslipidaemia. We aimed to compare the lipid profiles in HNF1A-MODY, Type 2 diabetes and control subjects and to determine if lipids can be used to aid the differential diagnosis of diabetes sub-type. 1) 14 subjects in each group (HNF1A-MODY, Type 2 diabetes and controls) were matched for gender and BMI. Fasting lipid profiles and HDL lipid constituents were compared in the 3 groups. 2) HDL-cholesterol was assessed in a further 267 patients with HNF1A-MODY and 297 patients with a diagnosis of Type 2 diabetes to determine its discriminative value. 1) In HNF1A-MODY subjects, plasma-triglycerides were lower (1.36 vs. 1.93 mmol/l, p = 0.07) and plasma-HDL-cholesterol was higher than in subjects with Type 2 diabetes (1.47 vs. 1.15 mmol/l, p = 0.0008), but was similar to controls. Furthermore, in the isolated HDL; HDL-phospholipid and HDL-cholesterol ester content were higher in HNF1A-MODY, than in Type 2 diabetes (1.59 vs. 1.33 mmol/L, p = 0.04 and 1.10 vs. 0.83 mmol/L, p = 0.019, respectively), but were similar to controls (1.59 vs. 1.45 mmol/L, p = 0.35 and 1.10 vs. 1.21 mmol/L, p = 0.19, respectively). 2) A plasma-HDL-cholesterol > 1.12 mmol/L was 75% sensitive and 64% specific (ROC AUC = 0.76) at discriminating HNF1A-MODY from Type 2 diabetes. The plasma-lipid profiles of HNF1A-MODY and the lipid constituents of HDL are similar to non-diabetic controls. However, HDL-cholesterol was higher in HNF1A-MODY than in Type 2 diabetes and could be used as a biomarker to aid in the identification of patients with HNF1A-MODY. Copyright © 2012 Elsevier B.V. All rights reserved.
Chemical processes in the HNF flame
Ermolin, N.E.; Zarko, V.E.; Keizers, H.L.J.
2006-01-01
Results of modeling the HNF flame structure are presented. From an analysis of literature data on the thermal decomposition and combustion of HNF, it is concluded that the dissociative vaporization of HNF proceeds via the route HNFliq → (N2H4)g + (HC(NO 2)3)g. The flame structure is modeled using a
27 CFR 20.177 - Encased containers.
2010-04-01
... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Encased containers. 20.177... Users of Specially Denatured Spirits Operations by Dealers § 20.177 Encased containers. (a) A dealer may package specially denatured spirits in unlabeled containers which are completely encased in wood...
27 CFR 20.145 - Encased containers.
2010-04-01
... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Encased containers. 20.145... Denatured Alcohol § 20.145 Encased containers. Completely denatured alcohol may be packaged by distributors in unlabeled containers which are completely encased in wood, fiberboard, or similar material so that...
An Atypical HNF4A Mutation Which Does Not Conform to the Classic Presentation of HNF4A-MODY
Directory of Open Access Journals (Sweden)
Andrew J. Spiro
2018-01-01
Full Text Available Objective. To present the case of an atypical Hepatocyte Nuclear Factor 4 Alpha (HNF4A mutation that is not consistent with the classically published presentation of HNF4A-Mature Onset Diabetes of the Young (MODY. Methods. Clinical presentation and literature review. Results. A 43-year-old nonobese man was referred to the endocrinology clinic for evaluation of elevated fasting blood glucose (FBG measurements. Laboratory review revealed prediabetes and hypertriglyceridemia for the previous decade. Testing of autoantibodies for type 1 diabetes was negative. Genetic testing showed an autosomal dominant, heterozygous missense mutation (c.991C>T; p.Arg331Cys in the HNF4A gene, which is correlated with HNF4A-MODY. Phenotypically, patients with an HNF4A-MODY tend to have early-onset diabetes, microvascular complications, low triglyceride levels, increased birth weight, fetal macrosomia, and less commonly neonatal hyperinsulinemic hypoglycemia. The patient did not demonstrate any of these features but instead presented with late-onset diabetes, an elevated triglyceride level, and a normal birth weight. Conclusion. Our patient likely represents an atypical variant of HNF4A-MODY with a milder clinical presentation. Patients with atypical, less-severe presentations of HNF4A-MODY may be largely undiagnosed or misdiagnosed, but identification is important due to implications for treatment, pregnancy, and screening of family members.
The Common HNF1A Variant I27L is a Modifier of Age at Diabetes Diagnosis in HNF1A-MODY Individuals.
Locke, Jonathan M; Saint-Martin, Cécile; Laver, Thomas W; Patel, Kashyap A; Wood, Andrew R; Sharp, Seth A; Ellard, Sian; Bellanné-Chantelot, Christine; Hattersley, Andrew T; Harries, Lorna W; Weedon, Michael N
2018-06-12
There is wide variation in the age at diagnosis of diabetes in individuals with Maturity-Onset Diabetes of the Young (MODY) due to a mutation in the HNF1A gene. We hypothesised that common variants at the HNF1A locus (rs1169288, I27L; rs1800574, A98V), which are associated with type 2 diabetes susceptibility, may modify age at diabetes diagnosis in HNF1A-MODY individuals. Meta-analysis of two independent cohorts, comprising 781 HNF1A-MODY individuals, found no significant associations between genotype and age at diagnosis. However after stratifying according to type of mutation (protein-truncating variant (PTV) or missense), we found each 27L allele to be associated with a 1.6 year decrease (95% CI -2.6, -0.7) in age at diagnosis, specifically in the subset (n=444) of HNF1A-MODY individuals with a PTV. The effect size was similar and significant across the two independent cohorts of HNF1A-MODY individuals. We report a robust genetic modifier of HNF1A-MODY age at diagnosis that further illustrates the strong effect of genetic variation within HNF1A upon diabetes phenotype. © 2018 by the American Diabetes Association.
Crystallization of hepatocyte nuclear factor 4α (HNF4α) in complex with the HNF1α promoter element
Energy Technology Data Exchange (ETDEWEB)
Lu, Peng; Liu, Jianguo; Melikishvili, Manana; Fried, Michael G.; Chi, Young-In, E-mail: ychi@uky.edu [Department of Molecular and Cellular Biochemistry and Center for Structural Biology, University of Kentucky, Lexington, KY 40536 (United States)
2008-04-01
Sample preparation, characterization, crystallization and preliminary X-ray analysis are reported for the HNF4α–DNA binary complex. Hepatocyte nuclear factor 4α (HNF4α) is a member of the nuclear receptor superfamily that plays a central role in organ development and metabolic functions. Mutations on HNF4α cause maturity-onset diabetes of the young (MODY), a dominant monogenic cause of diabetes. In order to understand the molecular mechanism of promoter recognition and the molecular basis of disease-causing mutations, the recombinant HNF4α DNA-binding domain was prepared and used in a study of its binding properties and in crystallization with a 21-mer DNA fragment that contains the promoter element of another MODY gene, HNF1α. The HNF4α protein displays a cooperative and specific DNA-binding activity towards its target gene-recognition elements. Crystals of the complex diffract to 2.0 Å using a synchrotron-radiation source under cryogenic (100 K) conditions and belong to space group C2, with unit-cell parameters a = 121.63, b = 35.43, c = 70.99 Å, β = 119.36°. A molecular-replacement solution has been obtained and structure refinement is in progress. This structure and the binding studies will provide the groundwork for detailed functional and biochemical studies of the MODY mutants.
Crystallization of hepatocyte nuclear factor 4α (HNF4α) in complex with the HNF1α promoter element
International Nuclear Information System (INIS)
Lu, Peng; Liu, Jianguo; Melikishvili, Manana; Fried, Michael G.; Chi, Young-In
2008-01-01
Sample preparation, characterization, crystallization and preliminary X-ray analysis are reported for the HNF4α–DNA binary complex. Hepatocyte nuclear factor 4α (HNF4α) is a member of the nuclear receptor superfamily that plays a central role in organ development and metabolic functions. Mutations on HNF4α cause maturity-onset diabetes of the young (MODY), a dominant monogenic cause of diabetes. In order to understand the molecular mechanism of promoter recognition and the molecular basis of disease-causing mutations, the recombinant HNF4α DNA-binding domain was prepared and used in a study of its binding properties and in crystallization with a 21-mer DNA fragment that contains the promoter element of another MODY gene, HNF1α. The HNF4α protein displays a cooperative and specific DNA-binding activity towards its target gene-recognition elements. Crystals of the complex diffract to 2.0 Å using a synchrotron-radiation source under cryogenic (100 K) conditions and belong to space group C2, with unit-cell parameters a = 121.63, b = 35.43, c = 70.99 Å, β = 119.36°. A molecular-replacement solution has been obtained and structure refinement is in progress. This structure and the binding studies will provide the groundwork for detailed functional and biochemical studies of the MODY mutants
De novo mutations of GCK, HNF1A and HNF4A may be more frequent in MODY than previously assumed.
Stanik, Juraj; Dusatkova, Petra; Cinek, Ondrej; Valentinova, Lucia; Huckova, Miroslava; Skopkova, Martina; Dusatkova, Lenka; Stanikova, Daniela; Pura, Mikulas; Klimes, Iwar; Lebl, Jan; Gasperikova, Daniela; Pruhova, Stepanka
2014-03-01
MODY is mainly characterised by an early onset of diabetes and a positive family history of diabetes with an autosomal dominant mode of inheritance. However, de novo mutations have been reported anecdotally. The aim of this study was to systematically revisit a large collection of MODY patients to determine the minimum prevalence of de novo mutations in the most prevalent MODY genes (i.e. GCK, HNF1A, HNF4A). Analysis of 922 patients from two national MODY centres (Slovakia and the Czech Republic) identified 150 probands (16%) who came from pedigrees that did not fulfil the criterion of two generations with diabetes but did fulfil the remaining criteria. The GCK, HNF1A and HNF4A genes were analysed by direct sequencing. Mutations in GCK, HNF1A or HNF4A genes were detected in 58 of 150 individuals. Parents of 28 probands were unavailable for further analysis, and in 19 probands the mutation was inherited from an asymptomatic parent. In 11 probands the mutations arose de novo. In our cohort of MODY patients from two national centres the de novo mutations in GCK, HNF1A and HNF4A were present in 7.3% of the 150 families without a history of diabetes and 1.2% of all of the referrals for MODY testing. This is the largest collection of de novo MODY mutations to date, and our findings indicate a much higher frequency of de novo mutations than previously assumed. Therefore, genetic testing of MODY could be considered for carefully selected individuals without a family history of diabetes.
DEFF Research Database (Denmark)
Ekholm, E; Shaat, N; Holst, Jens Juul
2012-01-01
eight different families. BMI-matched T2D and healthy subjects were used as two separate control groups. The early phase of insulin secretion was attenuated in HNF4A, HNF1A MODY and T2D (AUC0-30 controls: 558.2 ± 101.2, HNF4A MODY: 93.8 ± 57.0, HNF1A MODY: 170.2 ± 64.5, T2D: 211.2 ± 65.3, P ....01). Markedly reduced levels of proinsulin were found in HNF4A MODY compared to T2D and that tended to be so also in HNF1A MODY (HNF4A MODY: 3.7 ± 1.2, HNF1A MODY: 8.3 ± 3.8 vs. T2D: 26.6 ± 14.3). Patients with HNF4A MODY had similar total GLP-1 and GIP responses as controls (GLP-1 AUC: (control: 823.9 ± 703.......8, T2D: 556.4 ± 698.2, HNF4A MODY: 1,257.0 ± 999.3, HNF1A MODY: 697.1 ± 818.4) but with a different secretion pattern. The AUC insulin during the test meal was strongly correlated with the GIP secretion (Correlation coefficient 1.0, P
Mapping of HNF4alpha target genes in intestinal epithelial cells
DEFF Research Database (Denmark)
Boyd, Mette; Bressendorff, Simon; Moller, Jette
2009-01-01
ABSTRACT: BACKGROUND: The role of HNF4alpha has been extensively studied in hepatocytes and pancreatic beta-cells, and HNF4alpha is also regarded as key regulator of intestinal epithelial cell differentiation as well. The aim of the present work is to identify novel HNF4alpha target genes....... The HNF4alpha ChIP-chip data was matched with gene expression and histone H3 acetylation status of the promoters in order to identify HNF4alpha binding to actively transcribed genes with an open chromatin structure. RESULTS: 1,541 genes were identified as potential HNF4alpha targets, many of which have...
Design of buried concrete encasements
International Nuclear Information System (INIS)
Drake, R.M.
1989-01-01
The operation of many Department of Energy (DOE) sites requires the transfer of radioactive liquid products from one location to another. DOE Order 6430.1A requires that the transfer pipelines be designed and constructed so that any leakage can be detected and contained before it reaches the environment. One design option often considered to meet this requirement is to place the pipeline in a stainless steel-lined, buried concrete encasement. This provides the engineer with the design challenge to integrate standard structural design principles with unique DOE requirements. The complete design of a buried concrete encasement must consider seismic effects, leak detection, leak confinement, radiation shielding, thermal effects, pipe supports, and constructability. This paper contains a brief discussion of each of these design considerations, based on experience gained during the design of concrete encasements for the Process Facilities Modifications (PFM) project at Hanford
EnCE EnCase computer forensics : the official EnCase certified examiner : study guide
Bunting, Steve
2012-01-01
The official, Guidance Software-approved book on the newest EnCE exam! The EnCE exam tests that computer forensic analysts and examiners have thoroughly mastered computer investigation methodologies, as well as the use of Guidance Software's EnCase Forensic 7. The only official Guidance-endorsed study guide on the topic, this book prepares you for the exam with extensive coverage of all exam topics, real-world scenarios, hands-on exercises, up-to-date legal information, and sample evidence files, flashcards, and more. Guides readers through preparation for the newest EnCase Certified Examiner
Current state of the art of HNF based composite propellants
Ciucci, A.; Frota, O.; Welland, W.H.M.; Heijden, A.E.D.M. van der; Leeming, B.; Bellerby, J.M.; Brotzu, A.
2004-01-01
The main activities currently performed for the development of HNF-based propellants are presented. The objectives and approach adopted are described. The results obtained on the HNF decomposition mechanism and on the re- and co-crystallisation of HNF with potential propellant ingredients are
33 CFR 183.552 - Plastic encased fuel tanks: Installation.
2010-07-01
... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Plastic encased fuel tanks... § 183.552 Plastic encased fuel tanks: Installation. (a) Each fuel tank encased in cellular plastic foam or in fiber reinforced plastic must have the connections, fittings, and labels accessible for...
Identification of circulating microRNAs in HNF1A-MODY carriers.
Bonner, C; Nyhan, K C; Bacon, S; Kyithar, M P; Schmid, J; Concannon, C G; Bray, I M; Stallings, R L; Prehn, J H M; Byrne, M M
2013-08-01
HNF1A-MODY is a monogenic form of diabetes caused by mutations in the HNF1A gene. Here we identify, for the first time, HNF1A-MODY-associated microRNAs (miRNAs) that can be detected in the serum of HNF1A-MODY carriers. An miRNA array was carried out in rat INS-1 insulinoma cells inducibly expressing the common human Pro291fsinsC-HNF1A frame shift mutation. Differentially expressed miRNAs were validated by quantitative real-time PCR. Expression of miRNAs in the serum of HNF1A-MODY carriers (n = 31), MODY-negative family members (n = 10) and individuals with type 2 diabetes mellitus (n = 17) was quantified by absolute real-time PCR analysis. Inducible expression of Pro291fsinsC-HNF1A in INS-1 cells caused a significant upregulation of three miRNAs (miR-103, miR-224, miR-292-3p). The differential expression of two miRNAs (miR-103 and miR-224) was validated in vitro. Strongly elevated levels of miR-103 and miR-224 could be detected in the serum of HNF1A-MODY carriers compared with MODY-negative family controls. Serum levels of miR-103 distinguished HNF1A-MODY carriers from HbA1c-matched individuals with type 2 diabetes mellitus. Our study demonstrates that the pathophysiology of HNF1A-MODY is associated with the overexpression of miR-103 and miR-224. Furthermore, our study demonstrates that these miRNAs can be readily detected in the serum of HNF1A-MODY carriers.
Ekholm, E; Shaat, N; Holst, J J
2012-10-01
The aim of this study was to evaluate the beta cell and incretin function in patients with HNF4A and HNF1A MODY during a test meal. Clinical characteristics and biochemical data (glucose, proinsulin, insulin, C-peptide, GLP-1 and GIP) during a test meal were compared between MODY patients from eight different families. BMI-matched T2D and healthy subjects were used as two separate control groups. The early phase of insulin secretion was attenuated in HNF4A, HNF1A MODY and T2D (AUC0-30 controls: 558.2 ± 101.2, HNF4A MODY: 93.8 ± 57.0, HNF1A MODY: 170.2 ± 64.5, T2D: 211.2 ± 65.3, P MODY compared to T2D and that tended to be so also in HNF1A MODY (HNF4A MODY: 3.7 ± 1.2, HNF1A MODY: 8.3 ± 3.8 vs. T2D: 26.6 ± 14.3). Patients with HNF4A MODY had similar total GLP-1 and GIP responses as controls (GLP-1 AUC: (control: 823.9 ± 703.8, T2D: 556.4 ± 698.2, HNF4A MODY: 1,257.0 ± 999.3, HNF1A MODY: 697.1 ± 818.4) but with a different secretion pattern. The AUC insulin during the test meal was strongly correlated with the GIP secretion (Correlation coefficient 1.0, P MODY showed an attenuated early phase of insulin secretion similar to T2Ds. AUC insulin during the test meal was strongly correlated with GIP secretion, whereas no such correlation was seen for insulin and GLP-1. Thus, GIP may be a more important factor for insulin secretion than GLP-1 in MODY patients.
International Nuclear Information System (INIS)
Shaw, C.P.
1998-01-01
HNF-SD-WM-TRD-O07, System Specification for the Double-Shell Tank System, (hereafter referred to as DST Specification), defines the requirements of the double-shell tank system at the Hanford Site for Phase 1 privatization. Many of the sections in this document reference other documents for design guidance and requirements. Referenced documents include Project Hanford Management Contract (PHMC) procedures (HNF-PROS), Codes of Federal Regulation (CFRs), DOE Orders, and Washington Administrative Codes (WACs). This document provides rationale for the selection and inclusion of HNF-PROS, CFRs, DOE Orders and WACs
Determination of Secondary Encasement Pipe Design Pressure
Energy Technology Data Exchange (ETDEWEB)
TEDESCHI, A.R.
2000-10-26
This document published results of iterative calculations for maximum tank farm transfer secondary pipe (encasement) pressure upon failure of the primary pipe. The maximum pressure was calculated from a primary pipe guillotine break. Results show encasement pipeline design or testing pressures can be significantly lower than primary pipe pressure criteria.
33 CFR 183.516 - Cellular plastic used to encase fuel tanks.
2010-07-01
... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Cellular plastic used to encase....516 Cellular plastic used to encase fuel tanks. (a) Cellular plastic used to encase metallic fuel...-polyurethane cellular plastic used to encase metallic fuel tanks must have a compressive strength of at least...
Circulating CD36 is reduced in HNF1A-MODY carriers.
Bacon, Siobhan; Kyithar, Ma P; Schmid, Jasmin; Costa Pozza, Andre; Handberg, Aase; Byrne, Maria M
2013-01-01
Premature atherosclerosis is a significant cause of morbidity and mortality in type 2 diabetes mellitus. Maturity onset diabetes of the young (MODY) accounts for approximately 2% of all diabetes, with mutations in the transcription factor; hepatocyte nuclear factor 1 alpha (HNF1A) accounting for the majority of MODY cases. There is somewhat limited data available on the prevalence of macrovascular disease in HNF1A-MODY carriers with diabetes. Marked insulin resistance and the associated dyslipidaemia are not clinical features of HNF1A-MODY carriers. The scavenger protein CD36 has been shown to play a substantial role in the pathogenesis of atherosclerosis, largely through its interaction with oxidised LDL. Higher levels of monocyte CD36 and plasma CD36(sCD36) are seen to cluster with insulin resistance and diabetes. The aim of this study was to determine levels of sCD36 in participants with HNF1A-MODY diabetes and to compare them with unaffected normoglycaemic family members and participants with type 2 diabetes mellitus. We recruited 37 participants with HNF1A-MODY diabetes and compared levels of sCD36 with BMI-matched participants with type 2 diabetes mellitus and normoglycaemic HNF1A-MODY negative family controls. Levels of sCD36 were correlated with phenotypic and biochemical parameters. HNF1A-MODY participants were lean, normotensive, with higher HDL and lower triglyceride levels when compared to controls and participants with type 2 diabetes mellitus. sCD36 was also significantly lower in HNF1A-MODY participants when compared to both the normoglycaemic family controls and to lean participants with type 2 diabetes mellitus. In conclusion, sCD36 is significantly lower in lean participants with HNF1A-MODY diabetes when compared to weight-matched normoglycaemic familial HNF1A-MODY negative controls and to lean participants with type 2 diabetes mellitus. Lower levels of this pro-atherogenic marker may result from the higher HDL component in the lipid profile of
Cystatin C is not a good candidate biomarker for HNF1A-MODY.
Nowak, Natalia; Szopa, Magdalena; Thanabalasingham, Gaya; McDonald, Tim J; Colclough, Kevin; Skupien, Jan; James, Timothy J; Kiec-Wilk, Beata; Kozek, Elzbieta; Mlynarski, Wojciech; Hattersley, Andrew T; Owen, Katharine R; Malecki, Maciej T
2013-10-01
Cystatin C is a marker of glomerular filtration rate (GFR). Its level is influenced, among the others, by CRP whose concentration is decreased in HNF1A-MODY. We hypothesized that cystatin C level might be altered in HNF1A-MODY. We aimed to evaluate cystatin C in HNF1A-MODY both as a diagnostic marker and as a method of assessing GFR. We initially examined 51 HNF1A-MODY patients, 56 subjects with type 1 diabetes (T1DM), 39 with type 2 diabetes (T2DM) and 43 non-diabetic individuals (ND) from Poland. Subjects from two UK centres were used as replication panels: including 215 HNF1A-MODY, 203 T2DM, 39 HNF4A-MODY, 170 GCK-MODY, 17 HNF1B-MODY and 58 T1DM patients. The data were analysed with additive models, adjusting for gender, age, BMI and estimated GFR (creatinine). In the Polish subjects, adjusted cystatin C level in HNF1A-MODY was lower compared with T1DM, T2DM and ND (p MODY, while the two GFR estimates were similar or cystatin C-based lower in the other groups. In the UK subjects, there were no differences in cystatin C between HNF1A-MODY and the other diabetic subgroups, except HNF1B-MODY. In UK HNF1A-MODY, cystatin C-based GFR estimate was higher than the creatinine-based one (p MODY. In HNF1A-MODY, the cystatin C-based GFR estimate is higher than the creatinine-based one.
High-sensitivity CRP discriminates HNF1A-MODY from other subtypes of diabetes.
McDonald, Tim J; Shields, Beverley M; Lawry, Jane; Owen, Katharine R; Gloyn, Anna L; Ellard, Sian; Hattersley, Andrew T
2011-08-01
Maturity-onset diabetes of the young (MODY) as a result of mutations in hepatocyte nuclear factor 1-α (HNF1A) is often misdiagnosed as type 1 diabetes or type 2 diabetes. Recent work has shown that high-sensitivity C-reactive protein (hs-CRP) levels are lower in HNF1A-MODY than type 1 diabetes, type 2 diabetes, or glucokinase (GCK)-MODY. We aim to replicate these findings in larger numbers and other MODY subtypes. hs-CRP levels were assessed in 750 patients (220 HNF1A, 245 GCK, 54 HNF4-α [HNF4A], 21 HNF1-β (HNF1B), 53 type 1 diabetes, and 157 type 2 diabetes). hs-CRP was lower in HNF1A-MODY (median [IQR] 0.3 [0.1-0.6] mg/L) than type 2 diabetes (1.40 [0.60-3.45] mg/L; P MODY (1.45 [0.46-2.88] mg/L; P MODY (0.60 [0.30-1.80] mg/L; P MODY (0.60 [0.10-2.8] mg/L; P = 0.07). hs-CRP discriminated HNF1A-MODY from type 2 diabetes with hs-CRP MODY than other forms of diabetes and may be used as a biomarker to select patients for diagnostic HNF1A genetic testing.
Genetic basis of prune belly syndrome: screening for HNF1β gene.
Granberg, Candace F; Harrison, Steven M; Dajusta, Daniel; Zhang, Shaohua; Hajarnis, Sachin; Igarashi, Peter; Baker, Linda A
2012-01-01
Although the cause of prune belly syndrome is unknown, familial evidence suggests a genetic component. Recently 2 nonfamilial cases of prune belly syndrome with chromosome 17q12 deletions encompassing the HNF1β gene have made this a candidate gene for prune belly syndrome. To date, there has been no large-scale screening of patients with prune belly syndrome for HNF1β mutations. We assessed the role of HNF1β in prune belly syndrome by screening for genomic mutations with functional characterization of any detected mutations. We studied patients with prune belly syndrome who were prospectively enrolled in our Pediatric Genitourinary DNA Repository since 2001. DNA from patient samples was amplified by polymerase chain reaction, sequenced for coding and splice regions of the HNF1β gene, and compared to control databases. We performed functional assay testing of the ability of mutant HNF1β to activate a luciferase construct with an HNF1β DNA binding site. From 32 prune belly syndrome probands (30 males, 2 females) HNF1β sequencing detected a missense mutation (V61G) in 1 child with prune belly syndrome. Absent in control databases, V61G was previously reported in 2 patients without prune belly syndrome who had congenital genitourinary anomalies. Functional testing showed similar luciferase activity compared to wild-type HNF1β, suggesting the V61G substitution does not disturb HNF1β function. One genomic HNF1β mutation was detected in 3% of patients with prune belly syndrome but found to be functionally normal. Thus, functionally significant HNF1β mutations are uncommon in prune belly syndrome, despite case reports of HNF1β deletions. Further genetic study is necessary, as identification of the genetic basis of prune belly syndrome may ultimately lead to prevention and improved treatments for this rare but severe syndrome. Copyright © 2012 American Urological Association Education and Research, Inc. Published by Elsevier Inc. All rights reserved.
Circulating CD36 is reduced in HNF1A-MODY carriers.
Directory of Open Access Journals (Sweden)
Siobhan Bacon
Full Text Available INTRODUCTION: Premature atherosclerosis is a significant cause of morbidity and mortality in type 2 diabetes mellitus. Maturity onset diabetes of the young (MODY accounts for approximately 2% of all diabetes, with mutations in the transcription factor; hepatocyte nuclear factor 1 alpha (HNF1A accounting for the majority of MODY cases. There is somewhat limited data available on the prevalence of macrovascular disease in HNF1A-MODY carriers with diabetes. Marked insulin resistance and the associated dyslipidaemia are not clinical features of HNF1A-MODY carriers. The scavenger protein CD36 has been shown to play a substantial role in the pathogenesis of atherosclerosis, largely through its interaction with oxidised LDL. Higher levels of monocyte CD36 and plasma CD36(sCD36 are seen to cluster with insulin resistance and diabetes. The aim of this study was to determine levels of sCD36 in participants with HNF1A-MODY diabetes and to compare them with unaffected normoglycaemic family members and participants with type 2 diabetes mellitus. METHODS: We recruited 37 participants with HNF1A-MODY diabetes and compared levels of sCD36 with BMI-matched participants with type 2 diabetes mellitus and normoglycaemic HNF1A-MODY negative family controls. Levels of sCD36 were correlated with phenotypic and biochemical parameters. RESULTS: HNF1A-MODY participants were lean, normotensive, with higher HDL and lower triglyceride levels when compared to controls and participants with type 2 diabetes mellitus. sCD36 was also significantly lower in HNF1A-MODY participants when compared to both the normoglycaemic family controls and to lean participants with type 2 diabetes mellitus. CONCLUSION: In conclusion, sCD36 is significantly lower in lean participants with HNF1A-MODY diabetes when compared to weight-matched normoglycaemic familial HNF1A-MODY negative controls and to lean participants with type 2 diabetes mellitus. Lower levels of this pro-atherogenic marker may
Mutations in HNF1A Result in Marked Alterations of Plasma Glycan Profile
Thanabalasingham, Gaya; Huffman, Jennifer E.; Kattla, Jayesh J.; Novokmet, Mislav; Rudan, Igor; Gloyn, Anna L.; Hayward, Caroline; Adamczyk, Barbara; Reynolds, Rebecca M.; Muzinic, Ana; Hassanali, Neelam; Pucic, Maja; Bennett, Amanda J.; Essafi, Abdelkader; Polasek, Ozren; Mughal, Saima A.; Redzic, Irma; Primorac, Dragan; Zgaga, Lina; Kolcic, Ivana; Hansen, Torben; Gasperikova, Daniela; Tjora, Erling; Strachan, Mark W.J.; Nielsen, Trine; Stanik, Juraj; Klimes, Iwar; Pedersen, Oluf B.; Njølstad, Pål R.; Wild, Sarah H.; Gyllensten, Ulf; Gornik, Olga; Wilson, James F.; Hastie, Nicholas D.; Campbell, Harry; McCarthy, Mark I.; Rudd, Pauline M.; Owen, Katharine R.; Lauc, Gordan; Wright, Alan F.
2013-01-01
A recent genome-wide association study identified hepatocyte nuclear factor 1-α (HNF1A) as a key regulator of fucosylation. We hypothesized that loss-of-function HNF1A mutations causal for maturity-onset diabetes of the young (MODY) would display altered fucosylation of N-linked glycans on plasma proteins and that glycan biomarkers could improve the efficiency of a diagnosis of HNF1A-MODY. In a pilot comparison of 33 subjects with HNF1A-MODY and 41 subjects with type 2 diabetes, 15 of 29 glycan measurements differed between the two groups. The DG9-glycan index, which is the ratio of fucosylated to nonfucosylated triantennary glycans, provided optimum discrimination in the pilot study and was examined further among additional subjects with HNF1A-MODY (n = 188), glucokinase (GCK)-MODY (n = 118), hepatocyte nuclear factor 4-α (HNF4A)-MODY (n = 40), type 1 diabetes (n = 98), type 2 diabetes (n = 167), and nondiabetic controls (n = 98). The DG9-glycan index was markedly lower in HNF1A-MODY than in controls or other diabetes subtypes, offered good discrimination between HNF1A-MODY and both type 1 and type 2 diabetes (C statistic ≥0.90), and enabled us to detect three previously undetected HNF1A mutations in patients with diabetes. In conclusion, glycan profiles are altered substantially in HNF1A-MODY, and the DG9-glycan index has potential clinical value as a diagnostic biomarker of HNF1A dysfunction. PMID:23274891
Hydrodynamic and Sediment Responses of Open Channels to Exposed Pipe Encasements.
Directory of Open Access Journals (Sweden)
J Q Mao
Full Text Available The effects of exposed pipe encasements on the local variation of hydrodynamic and sediment conditions in a river channel are examined. Laboratory experiments are performed to assess the response of water level, flow regime and bed deformation to several representative types of concrete encasements. The experimental conditions considered are: three types of exposed pipe encasements exposed on the bed, including trapezoidal shape, circular-arc shape and polygonal shape, and three sets of discharges, including annual discharge, once-in-3-year flood, and once-in-50-year flood. Our experiments show that: (1 the amount of backwater definitely depends on the encasement geometric shape and the background discharge; (2 smaller discharges generally tend to induce local scour of river bed downstream of the encasement, and the order of sensitivity of bed deformation to the encasement geometric shape is trapezoidal > circular-arc > polygonal; (3 comparatively speaking, the polygonal encasement may be considered as a suitable protective structure for pipelines across alluvial rivers, with relatively modest effects on the local hydrodynamic conditions and bed stabilization.
Hydrodynamic and Sediment Responses of Open Channels to Exposed Pipe Encasements.
Mao, J Q; Zhang, H Q; Dai, H C; Yuan, B H; Hu, T F
2015-01-01
The effects of exposed pipe encasements on the local variation of hydrodynamic and sediment conditions in a river channel are examined. Laboratory experiments are performed to assess the response of water level, flow regime and bed deformation to several representative types of concrete encasements. The experimental conditions considered are: three types of exposed pipe encasements exposed on the bed, including trapezoidal shape, circular-arc shape and polygonal shape, and three sets of discharges, including annual discharge, once-in-3-year flood, and once-in-50-year flood. Our experiments show that: (1) the amount of backwater definitely depends on the encasement geometric shape and the background discharge; (2) smaller discharges generally tend to induce local scour of river bed downstream of the encasement, and the order of sensitivity of bed deformation to the encasement geometric shape is trapezoidal > circular-arc > polygonal; (3) comparatively speaking, the polygonal encasement may be considered as a suitable protective structure for pipelines across alluvial rivers, with relatively modest effects on the local hydrodynamic conditions and bed stabilization.
Repression of HNF1α-mediated transcription by amino-terminal enhancer of split (AES)
Energy Technology Data Exchange (ETDEWEB)
Han, Eun Hee [Section of Structural Biology, Hormel Institute, University of Minnesota, Austin, MN 55912 (United States); Gorman, Amanda A. [Department of Molecular and Cellular Biochemistry, University of Kentucky, Lexington, KY 40536 (United States); Singh, Puja [Section of Structural Biology, Hormel Institute, University of Minnesota, Austin, MN 55912 (United States); Chi, Young-In, E-mail: ychi@hi.umn.edu [Section of Structural Biology, Hormel Institute, University of Minnesota, Austin, MN 55912 (United States)
2015-12-04
HNF1α (Hepatocyte Nuclear Factor 1α) is one of the master regulators in pancreatic beta-cell development and function, and the mutations in Hnf1α are the most common monogenic causes of diabetes mellitus. As a member of the POU transcription factor family, HNF1α exerts its gene regulatory function through various molecular interactions; however, there is a paucity of knowledge in their functional complex formation. In this study, we identified the Groucho protein AES (Amino-terminal Enhancer of Split) as a HNF1α-specific physical binding partner and functional repressor of HNF1α-mediated transcription, which has a direct link to glucose-stimulated insulin secretion in beta-cells that is impaired in the HNF1α mutation-driven diabetes. - Highlights: • We identified AES as a transcriptional repressor for HNF1α in pancreatic beta-cell. • AES's repressive activity was HNF1α-specific and was not observed with HNF1β. • AES interacts with the transactivation domain of HNF1α. • Small molecules can be designed or discovered to disrupt this interaction and improve insulin secretion and glucose homeostasis.
Repression of HNF1α-mediated transcription by amino-terminal enhancer of split (AES)
International Nuclear Information System (INIS)
Han, Eun Hee; Gorman, Amanda A.; Singh, Puja; Chi, Young-In
2015-01-01
HNF1α (Hepatocyte Nuclear Factor 1α) is one of the master regulators in pancreatic beta-cell development and function, and the mutations in Hnf1α are the most common monogenic causes of diabetes mellitus. As a member of the POU transcription factor family, HNF1α exerts its gene regulatory function through various molecular interactions; however, there is a paucity of knowledge in their functional complex formation. In this study, we identified the Groucho protein AES (Amino-terminal Enhancer of Split) as a HNF1α-specific physical binding partner and functional repressor of HNF1α-mediated transcription, which has a direct link to glucose-stimulated insulin secretion in beta-cells that is impaired in the HNF1α mutation-driven diabetes. - Highlights: • We identified AES as a transcriptional repressor for HNF1α in pancreatic beta-cell. • AES's repressive activity was HNF1α-specific and was not observed with HNF1β. • AES interacts with the transactivation domain of HNF1α. • Small molecules can be designed or discovered to disrupt this interaction and improve insulin secretion and glucose homeostasis.
HNF1 alpha activates the aminopeptidase N promoter in intestinal (Caco-2) cells
DEFF Research Database (Denmark)
Olsen, Jørgen; Laustsen, Lotte; Troelsen, J
1994-01-01
The importance of HNF1 binding proteins for intestinal aminopeptidase N expression was investigated using the Caco-2 cell-line. Aminopeptidase N promoter activity in Caco-2 cells depends on the HNF1 element (positions -85 to -58) and co-transfection with an HNF1 alpha expression vector demonstrates...... a direct activation of the promoter by HNF1 alpha through this element. Electrophoretic mobility shift assays using nuclear extracts from Caco-2 cells show the presence of high amounts of HNF1 binding proteins irrespective of their state of differentiation....
DOUBLE-SHELL TANK WASTE TRANSFER LINE ENCASEMENT INTEGRITY ASSESSMENT TECHNOLOGY STUDY
International Nuclear Information System (INIS)
BOWER, R.R.
2006-01-01
The report provides various alternative methods of performing integrity assessment inspections of buried Hanford Double Shell Tank waste transfer line encasements, and provides method recommendations as an alternative to costly encasement pneumatic leak testing. A schedule for future encasement integrity assessments is also included
Trichloroethylene perturbs HNF4a expression and activity in the developing chick heart.
Harris, Alondra P; Ismail, Kareem A; Nunez, Martha; Martopullo, Ira; Lencinas, Alejandro; Selmin, Ornella I; Runyan, Raymond B
2018-03-15
Exposure to trichloroethylene (TCE) is linked to formation of congenital heart defects in humans and animals. Prior interactome analysis identified the transcription factor, Hepatocyte Nuclear Factor 4 alpha (HNF4a), as a potential target of TCE exposure. As a role for HNF4a is unknown in the heart, we examined developing avian hearts for HNF4a expression and for sensitivity to TCE and the HNF4a agonist, Benfluorex. In vitro analysis using a HNF4a reporter construct showed both TCE and HFN4a to be antagonists of HNF4a-mediated transcription at the concentrations tested. HNF4a mRNA is expressed transiently in the embryonic heart during valve formation and cardiac development. Embryos were examined for altered gene expression in the presence of TCE or Benfluorex. TCE altered expression of selected mRNAs including HNF4a, TRAF6 and CYP2C45. There was a transition between inhibition and induction of marker gene expression in embryos as TCE concentration increased. Benfluorex was largely inhibitory to selected markers. Echocardiography of exposed embryos showed reduced cardiac function with both TCE and Benfluorex. Cardiac contraction was reduced by 29% and 23%, respectively at 10 ppb. The effects of TCE and Benfluorex on autocrine regulation of HNF4a, selected markers and cardiac function argue for a functional interaction of TCE and HNF4a. Further, the dose-sensitive shift between inhibition and induction of marker expression may explain the nonmonotonic-like dose response observed with TCE exposure in the heart. Copyright © 2018 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Ewan R Pearson
2007-04-01
Full Text Available Macrosomia is associated with considerable neonatal and maternal morbidity. Factors that predict macrosomia are poorly understood. The increased rate of macrosomia in the offspring of pregnant women with diabetes and in congenital hyperinsulinaemia is mediated by increased foetal insulin secretion. We assessed the in utero and neonatal role of two key regulators of pancreatic insulin secretion by studying birthweight and the incidence of neonatal hypoglycaemia in patients with heterozygous mutations in the maturity-onset diabetes of the young (MODY genes HNF4A (encoding HNF-4alpha and HNF1A/TCF1 (encoding HNF-1alpha, and the effect of pancreatic deletion of Hnf4a on foetal and neonatal insulin secretion in mice.We examined birthweight and hypoglycaemia in 108 patients from families with diabetes due to HNF4A mutations, and 134 patients from families with HNF1A mutations. Birthweight was increased by a median of 790 g in HNF4A-mutation carriers compared to non-mutation family members (p < 0.001; 56% (30/54 of HNF4A-mutation carriers were macrosomic compared with 13% (7/54 of non-mutation family members (p < 0.001. Transient hypoglycaemia was reported in 8/54 infants with heterozygous HNF4A mutations, but was reported in none of 54 non-mutation carriers (p = 0.003. There was documented hyperinsulinaemia in three cases. Birthweight and prevalence of neonatal hypoglycaemia were not increased in HNF1A-mutation carriers. Mice with pancreatic beta-cell deletion of Hnf4a had hyperinsulinaemia in utero and hyperinsulinaemic hypoglycaemia at birth.HNF4A mutations are associated with a considerable increase in birthweight and macrosomia, and are a novel cause of neonatal hypoglycaemia. This study establishes a key role for HNF4A in determining foetal birthweight, and uncovers an unanticipated feature of the natural history of HNF4A-deficient diabetes, with hyperinsulinaemia at birth evolving to decreased insulin secretion and diabetes later in life.
Chen, M; Hieng, S; Qian, X; Costa, R; Ou, J H
1994-11-15
Hepatitis B virus (HBV) ENI enhancer can activate the expression of HBV and non-HBV genes in a liver-specific manner. By performing the electrophoretic mobility-shift assays, we demonstrated that the three related, liver-enriched, transcription factors, HNF3 alpha, HNF3 beta, and HNF3 gamma could all bind to the 2c site of HBV ENI enhancer. Mutations introduced in the 2c site to abolish the binding by HNF3 reduced the enhancer activity approximately 15-fold. Moreover, expression of HNF3 antisense sequences to suppress the expression of HNF3 in Huh-7 hepatoma cells led to reduction of the ENI enhancer activity. These results indicate that HNF3 positively regulates the ENI enhancer activity and this regulation is most likely mediated through the 2c site. The requirement of HNF3 for the ENI enhancer activity could explain the liver specificity of this enhancer element.
Pongratz, Rebecca L.; Kibbey, Richard G.; Kirkpatrick, Clare L.; Zhao, Xiaojian; Pontoglio, Marco; Yaniv, Moshe; Wollheim, Claes B.; Shulman, Gerald I.; Cline, Gary W.
2009-01-01
Maturity Onset Diabetes of the Young-type 3 (MODY-3) has been linked to mutations in the transcription factor hepatic nuclear factor (HNF)-1α, resulting in deficiency in glucose-stimulated insulin secretion. In INS-1 cells overexpressing doxycycline-inducible HNF-1α dominant-negative (DN-) gene mutations, and islets from Hnf-1α knock-out mice, insulin secretion was impaired in response to glucose (15 mm) and other nutrient secretagogues. Decreased rates of insulin secretion in response to glutamine plus leucine and to methyl pyruvate, but not potassium depolarization, indicate defects specific to mitochondrial metabolism. To identify the biochemical mechanisms responsible for impaired insulin secretion, we used 31P NMR measured mitochondrial ATP synthesis (distinct from glycolytic ATP synthesis) together with oxygen consumption measurements to determine the efficiency of mitochondrial oxidative phosphorylation. Mitochondrial uncoupling was significantly higher in DN-HNF-1α cells, such that rates of ATP synthesis were decreased by approximately one-half in response to the secretagogues glucose, glutamine plus leucine, or pyruvate. In addition to closure of the ATP-sensitive K+ channels with mitochondrial ATP synthesis, mitochondrial production of second messengers through increased anaplerotic flux has been shown to be critical for coupling metabolism to insulin secretion. 13C-Isotopomer analysis and tandem mass spectrometry measurement of Krebs cycle intermediates revealed a negative impact of DN-HNF-1α and Hnf-1α knock-out on mitochondrial second messenger production with glucose but not amino acids. Taken together, these results indicate that, in addition to reduced glycolytic flux, uncoupling of mitochondrial oxidative phosphorylation contributes to impaired nutrient-stimulated insulin secretion with either mutations or loss of HNF-1α. PMID:19376774
Pongratz, Rebecca L.; Kibbey, Richard G.; Kirkpatrick, Clare L.; Zhao, Xiaojian; Pontoglio, Marco; Yaniv, Moshe; Wollheim, Claes B.; Shulman, Gerald I.; Cline, Gary W.
2009-01-01
Maturity Onset Diabetes of the Young-type 3 (MODY-3) has been linked to mutations in the transcription factor hepatic nuclear factor (HNF)-1α, resulting in deficiency in glucose-stimulated insulin secretion. In INS-1 cells overexpressing doxycycline-inducible HNF-1α dominant-negative (DN-) gene mutations, and islets from Hnf-1α knock-out mice, insulin secretion was impaired in response to glucose (15 mm) and other nutrient secretagogues. Decreased rates of insulin secretion in response to glu...
Apolipoprotein M can discriminate HNF1A-MODY from Type 1 diabetes.
Mughal, S A; Park, R; Nowak, N; Gloyn, A L; Karpe, F; Matile, H; Malecki, M T; McCarthy, M I; Stoffel, M; Owen, K R
2013-02-01
Missed diagnosis of maturity-onset diabetes of the young (MODY) has led to an interest in biomarkers that enable efficient prioritization of patients for definitive molecular testing. Apolipoprotein M (apoM) was suggested as a biomarker for hepatocyte nuclear factor 1 alpha (HNF1A)-MODY because of its reduced expression in Hnf1a(-/-) mice. However, subsequent human studies examining apoM as a biomarker have yielded conflicting results. We aimed to evaluate apoM as a biomarker for HNF1A-MODY using a highly specific and sensitive ELISA. ApoM concentration was measured in subjects with HNF1A-MODY (n = 69), Type 1 diabetes (n = 50), Type 2 diabetes (n = 120) and healthy control subjects (n = 100). The discriminative accuracy of apoM and of the apoM/HDL ratio for diabetes aetiology was evaluated. Mean (standard deviation) serum apoM concentration (μmol/l) was significantly lower for subjects with HNF1A-MODY [0.86 (0.29)], than for those with Type 1 diabetes [1.37 (0.26), P = 3.1 × 10(-18) ) and control subjects [1.34 (0.22), P = 7.2 × 10(-19) ). There was no significant difference in apoM concentration between subjects with HNF1A-MODY and Type 2 diabetes [0.89 (0.28), P = 0.13]. The C-statistic measure of discriminative accuracy for apoM was 0.91 for HNF1A-MODY vs. Type 1 diabetes, indicating high discriminative accuracy. The apoM/HDL ratio was significantly lower in HNF1A-MODY than other study groups. However, this ratio did not perform well in discriminating HNF1A-MODY from either Type 1 diabetes (C-statistic = 0.79) or Type 2 diabetes (C-statistic = 0.68). We confirm an earlier report that serum apoM levels are lower in HNF1A-MODY than in controls. Serum apoM provides good discrimination between HNF1A-MODY and Type 1 diabetes and warrants further investigation for clinical utility in diabetes diagnostics. © 2012 The Authors. Diabetic Medicine © 2012 Diabetes UK.
Mutations in HNF1A result in marked alterations of plasma glycan profile
DEFF Research Database (Denmark)
Thanabalasingham, Gaya; Huffman, Jennifer E; Kattla, Jayesh J
2013-01-01
A recent genome-wide association study identified hepatocyte nuclear factor 1-α (HNF1A) as a key regulator of fucosylation. We hypothesized that loss-of-function HNF1A mutations causal for maturity-onset diabetes of the young (MODY) would display altered fucosylation of N-linked glycans on plasma...... proteins and that glycan biomarkers could improve the efficiency of a diagnosis of HNF1A-MODY. In a pilot comparison of 33 subjects with HNF1A-MODY and 41 subjects with type 2 diabetes, 15 of 29 glycan measurements differed between the two groups. The DG9-glycan index, which is the ratio of fucosylated...... to nonfucosylated triantennary glycans, provided optimum discrimination in the pilot study and was examined further among additional subjects with HNF1A-MODY (n = 188), glucokinase (GCK)-MODY (n = 118), hepatocyte nuclear factor 4-α (HNF4A)-MODY (n = 40), type 1 diabetes (n = 98), type 2 diabetes (n = 167...
Directory of Open Access Journals (Sweden)
Ying Yang
2016-01-01
Full Text Available Maturity-onset diabetes of the young (MODY is characterized by the onset of diabetes before the age of 25 years, positive family history, high genetic predisposition, monogenic mutations, and an autosomal dominant mode of inheritance. Here, we aimed to investigate the mutations and to characterize the phenotypes of a Han Chinese family with early-onset maternally inherited type 2 diabetes. Detailed clinical assessments and genetic screening for mutations in the HNF4α, GCK, HNF-1α, IPF-1, HNF1β, and NEUROD1 genes were carried out in this family. One HNF4A mutation (p.T130I and two HNF1A polymorphisms (p.I27L and p.S487N were identified. Mutation p.T130I was associated with both early-onset and late-onset diabetes and caused downregulated HNF4A expression, whereas HNF1A polymorphisms p.I27L and p.S487N were associated with the age of diagnosis of diabetes. We demonstrated that mutation p.T130I in HNF4A was pathogenic as were the predicted polymorphisms p.I27L and p.S487N in HNF1A by genetic and functional analysis. Our results show that mutations in HNF4A and HNF1A genes might account for this early-onset inherited type 2 diabetes.
Data report for the integrity assessment report HNF-4589
Energy Technology Data Exchange (ETDEWEB)
MCSHANE, D.S.
1999-10-27
The purpose of this document is to compile supporting documentation for the Integrity Assessment Report (HNF 4589) for Tanks 101 and 102 in the 2194 Facility. This approach minimizes the size of the Integrity Assessment Report (IAR) (HNF-4589) and still provide a path to detailed information. This IAR addresses the evaluation of Tanks 101 and 102 and other existing components located in the 219-5 Waste Handling Facility.
Natural gas encasement for highway crossings.
2015-03-01
The University Transportation Center for Alabama researchers examined the Alabama Department of : Transportations current policy regarding the encasement of natural gas and hazardous liquid pipelines at roadway : crossings. The group collected inf...
HNF1B mutations associate with hypomagnesemia and renal magnesium wasting
Adalat, Shazia; Woolf, Adrian S.; Johnstone, Karen A.; Wirsing, Andrea; Harries, Lorna W.; Long, David A.; Hennekam, Raoul C.; Ledermann, Sarah E.; Rees, Lesley; van't Hoff, William; Marks, Stephen D.; Trompeter, Richard S.; Tullus, Kjell; Winyard, Paul J.; Cansick, Janette; Mushtaq, Imran; Dhillon, Harjeeta K.; Bingham, Coralie; Edghill, Emma L.; Shroff, Rukshana; Stanescu, Horia; Ryffel, Gerhart U.; Ellard, Sian; Bockenhauer, Detlef
2009-01-01
Mutations in hepatocyte nuclear factor 1B (HNF1B), which is a transcription factor expressed in tissues including renal epithelia, associate with abnormal renal development. While studying renal phenotypes of children with HNF1B mutations, we identified a teenager who presented with tetany and
Phenotypic screening of hepatocyte nuclear factor (HNF) 4-γ receptor knockout mice
International Nuclear Information System (INIS)
Gerdin, Anna Karin; Surve, Vikas V.; Joensson, Marie; Bjursell, Mikael; Bjoerkman, Maria; Edenro, Anne; Schuelke, Meint; Saad, Alaa; Bjurstroem, Sivert; Lundgren, Elisabeth Jensen; Snaith, Michael; Fransson-Steen, Ronny; Toernell, Jan; Berg, Anna-Lena; Bohlooly-Y, Mohammad
2006-01-01
Using the mouse as a model organism in pharmaceutical research presents unique advantages as its physiology in many ways resembles the human physiology, it also has a relatively short generation time, low breeding and maintenance costs, and is available in a wide variety of inbred strains. The ability to genetically modify mouse embryonic stem cells to generate mouse models that better mimic human disease is another advantage. In the present study, a comprehensive phenotypic screening protocol is applied to elucidate the phenotype of a novel mouse knockout model of hepatocyte nuclear factor (HNF) 4-γ. HNF4-γ is expressed in the kidneys, gut, pancreas, and testis. First level of the screen is aimed at general health, morphologic appearance, normal cage behaviour, and gross neurological functions. The second level of the screen looks at metabolic characteristics and lung function. The third level of the screen investigates behaviour more in-depth and the fourth level consists of a thorough pathological characterisation, blood chemistry, haematology, and bone marrow analysis. When compared with littermate wild-type mice (HNF4-γ +/+ ), the HNF4-γ knockout (HNF4-γ -/- ) mice had lowered energy expenditure and locomotor activity during night time that resulted in a higher body weight despite having reduced intake of food and water. HNF4-γ -/- mice were less inclined to build nest and were found to spend more time in a passive state during the forced swim test
Data report for the integrity assessment report HNF-4589
International Nuclear Information System (INIS)
MCSHANE, D.S.
1999-01-01
Supporting data for the Integrity Assessment Report of Tanks TK-101 and TK-102. The purpose of this document is to compile supporting documentation for the Integrity Assessment Report (HNF 4589) for Tanks 101 and 102 in the 2194 Facility. This approach minimizes the size of the Integrity Assessment Report (IAR) (HNF-4589) and still provide a path to detailed information. This IAR addresses the evaluation of Tanks 101 and 102 and other existing components located in the 219-5 Waste Handling Facility
Circulating CD36 Is Reduced in HNF1A-MODY Carriers.
LENUS (Irish Health Repository)
Bacon, Siobhan
2013-01-01
Premature atherosclerosis is a significant cause of morbidity and mortality in type 2 diabetes mellitus. Maturity onset diabetes of the young (MODY) accounts for approximately 2% of all diabetes, with mutations in the transcription factor; hepatocyte nuclear factor 1 alpha (HNF1A) accounting for the majority of MODY cases. There is somewhat limited data available on the prevalence of macrovascular disease in HNF1A-MODY carriers with diabetes. Marked insulin resistance and the associated dyslipidaemia are not clinical features of HNF1A-MODY carriers. The scavenger protein CD36 has been shown to play a substantial role in the pathogenesis of atherosclerosis, largely through its interaction with oxidised LDL. Higher levels of monocyte CD36 and plasma CD36(sCD36) are seen to cluster with insulin resistance and diabetes. The aim of this study was to determine levels of sCD36 in participants with HNF1A-MODY diabetes and to compare them with unaffected normoglycaemic family members and participants with type 2 diabetes mellitus.
Intima-media thickness and endothelial dysfunction in GCK and HNF1A-MODY patients.
Szopa, Magdalena; Osmenda, Grzegorz; Wilk, Grzegorz; Matejko, Bartłomiej; Skupien, Jan; Zapala, Barbara; Młynarski, Wojciech; Guzik, Tomasz; Malecki, Maciej T
2015-03-01
Mutations in the glucokinase (GCK) gene, along with hepatocyte nuclear factor 1A (HNF1A) gene mutations, are the most frequent cause of maturity-onset diabetes of the young (MODY). GCK-MODY patients are typically characterized by a moderate fasting hyperglycemia; however, little is known about atherosclerosis and intermediate-related phenotypes in these subjects. To examine carotid artery intima-media thickness (IMT) and endothelial function assessed by brachial artery flow-mediated dilatation (FMD) in GCK gene mutations carriers and HNF1A-MODY. A total of 64 subjects with GCK gene mutations, and 52 HNF1A gene mutation carriers as well as 53 nondiabetic controls were examined. IMT and FMD were assessed by ultrasonography. Appropriate statistical tests were performed to assess differences between the groups, and multivariate linear regression was done for the association with IMT and FMD. The clinical characteristics of all groups were similar with the mean age at examination of 35.1, 41.1, and 39.5 years for GCK, HNF1A and the control group respectively. The highest mean IMT value was in the HNF1A-MODY group: 7.0±1.4 mm, whereas it reached 6.3±1.4 mm in GCK mutation carriers and 6.3±1.3 mm in controls (P=0.008). After adjustment for possible clinical and biochemical cofounders, IMT remained higher in HNF1A-MODY patients as compared with GCK-MODY patients (P=0.02) and controls (P=0.0003). FMD was significantly lower in HNF1A (9.9±4.6%) and GCK-MODY (11.1±4.6%) patients in comparison with controls (13.9±4.7%; P=0.0001). After adjustment, FMD remained lower in HNF1A-MODY (P=0.0005) and GCK-MODY patients (P=0.01) as compared with controls. Both examined MODY groups demonstrated evidence of endothelial dysfunction. In addition, HNF1-MODY patients seem to be more prone to an early atherosclerotic phenotype. © 2015 European Society of Endocrinology.
Nitric oxide and TGF-β1 inhibit HNF-4α function in HEPG2 cells
International Nuclear Information System (INIS)
Lucas, Susana de; Lopez-Alcorocho, Juan Manuel; Bartolome, Javier; Carreno, Vicente
2004-01-01
This study analyzes if the profibrogenic factors nitric oxide and transforming growth factor-β1 (TGF-β1) affect hepatocyte nuclear factor-4α (HNF-4α) function. For this purpose, HepG2 cells were treated with TGF-β1 or with a nitric oxide donor to determine mRNA levels of coagulation factor VII and HNF-4α. Treatment effect on factor VII gene promoter was assessed by chloramphenicol acetyl-transferase assays in cells transfected with the pFVII-CAT plasmid. HNF-4α binding and protein levels were determined by gel shift assays and Western blot. TGF-β1 and nitric oxide downregulated factor VII mRNA levels by inhibiting its gene promoter activity. This inhibition is caused by a decrease in the DNA binding of HNF-4α. TGF-β1 induces degradation of HNF-4α in the proteasome while nitric oxide provokes nitrosylation of cysteine residues in this factor. TGF-β1 and nitric oxide inhibit HNF-4α activity. These findings may explain the loss of liver functions that occurs during fibrosis progression
HNF4alpha dysfunction as a molecular rational for cyclosporine induced hypertension.
Niehof, Monika; Borlak, Jürgen
2011-01-27
Induction of tolerance against grafted organs is achieved by the immunosuppressive agent cyclosporine, a prominent member of the calcineurin inhibitors. Unfortunately, its lifetime use is associated with hypertension and nephrotoxicity. Several mechanism for cyclosporine induced hypertension have been proposed, i.e. activation of the sympathetic nervous system, endothelin-mediated systemic vasoconstriction, impaired vasodilatation secondary to reduction in prostaglandin and nitric oxide, altered cytosolic calcium translocation, and activation of the renin-angiotensin system (RAS). In this regard the molecular basis for undue RAS activation and an increased signaling of the vasoactive oligopeptide angiotensin II (AngII) remain elusive. Notably, angiotensinogen (AGT) is the precursor of AngII and transcriptional regulation of AGT is controlled by the hepatic nuclear factor HNF4alpha. To better understand the molecular events associated with cyclosporine induced hypertension, we investigated the effect of cyclosporine on HNF4alpha expression and activity and searched for novel HNF4alpha target genes among members of the RAS cascade. Using bioinformatic algorithm and EMSA bandshift assays we identified angiotensin II receptor type 1 (AGTR1), angiotensin I converting enzyme (ACE), and angiotensin I converting enzyme 2 (ACE2) as genes targeted by HNF4alpha. Notably, cyclosporine represses HNF4alpha gene and protein expression and its DNA-binding activity at consensus sequences to AGT, AGTR1, ACE, and ACE2. Consequently, the gene expression of AGT, AGTR1, and ACE2 was significantly reduced as evidenced by quantitative real-time RT-PCR. While RAS is composed of a sophisticated interplay between multiple factors we propose a decrease of ACE2 to enforce AngII signaling via AGTR1 to ultimately result in vasoconstriction and hypertension. Taken collectively we demonstrate cyclosporine to repress HNF4alpha activity through calcineurin inhibitor mediated inhibition of nuclear
HNF4alpha dysfunction as a molecular rational for cyclosporine induced hypertension.
Directory of Open Access Journals (Sweden)
Monika Niehof
Full Text Available Induction of tolerance against grafted organs is achieved by the immunosuppressive agent cyclosporine, a prominent member of the calcineurin inhibitors. Unfortunately, its lifetime use is associated with hypertension and nephrotoxicity. Several mechanism for cyclosporine induced hypertension have been proposed, i.e. activation of the sympathetic nervous system, endothelin-mediated systemic vasoconstriction, impaired vasodilatation secondary to reduction in prostaglandin and nitric oxide, altered cytosolic calcium translocation, and activation of the renin-angiotensin system (RAS. In this regard the molecular basis for undue RAS activation and an increased signaling of the vasoactive oligopeptide angiotensin II (AngII remain elusive. Notably, angiotensinogen (AGT is the precursor of AngII and transcriptional regulation of AGT is controlled by the hepatic nuclear factor HNF4alpha. To better understand the molecular events associated with cyclosporine induced hypertension, we investigated the effect of cyclosporine on HNF4alpha expression and activity and searched for novel HNF4alpha target genes among members of the RAS cascade. Using bioinformatic algorithm and EMSA bandshift assays we identified angiotensin II receptor type 1 (AGTR1, angiotensin I converting enzyme (ACE, and angiotensin I converting enzyme 2 (ACE2 as genes targeted by HNF4alpha. Notably, cyclosporine represses HNF4alpha gene and protein expression and its DNA-binding activity at consensus sequences to AGT, AGTR1, ACE, and ACE2. Consequently, the gene expression of AGT, AGTR1, and ACE2 was significantly reduced as evidenced by quantitative real-time RT-PCR. While RAS is composed of a sophisticated interplay between multiple factors we propose a decrease of ACE2 to enforce AngII signaling via AGTR1 to ultimately result in vasoconstriction and hypertension. Taken collectively we demonstrate cyclosporine to repress HNF4alpha activity through calcineurin inhibitor mediated inhibition
A role for coding functional variants in HNF4A in type 2 diabetes susceptibility
DEFF Research Database (Denmark)
Jafar-Mohammadi, B; Groves, C J; Gjesing, A P
2011-01-01
Rare mutations in the gene HNF4A, encoding the transcription factor hepatocyte nuclear factor 4α (HNF-4A), account for ~5% of cases of MODY and more frequent variants in this gene may be involved in multifactorial forms of diabetes. Two low-frequency, non-synonymous variants in HNF4A (V255M, minor...... allele frequency [MAF] ~0.1%; T130I, MAF ~3.0%)-known to influence downstream HNF-4A target gene expression-are of interest, but previous type 2 diabetes association reports were inconclusive. We aimed to evaluate the contribution of these variants to type 2 diabetes susceptibility through large...
International Nuclear Information System (INIS)
Huang, Jianmin; Levitsky, Lynne L.; Rhoads, David B.
2009-01-01
Hepatocyte nuclear factor 4α (HNF4α) is a critical transcription factor for pancreas and liver development and functions in islet β cells to maintain glucose homeostasis. Mutations in the human HNF4A gene lead to maturity onset diabetes of the young (MODY1) and polymorphisms are associated with increased risk for type 2 diabetes mellitus (T2DM). Expression of six HNF4α variants, three each from two developmentally regulated promoters, has been firmly established. We have now detected a new set of HNF4α variants designated HNF4α10-12 expressed from distal promoter P2. These variants, generated by inclusion of previously undetected exon 1E (human = 222 nt, rodent = 136 nt) following exon 1D have an altered N-terminus but identical remaining reading frame. HNF4α10-α12 are expressed in pancreatic islets (and liver) and exhibit transactivation potentials similar to the corresponding α7-α9 isoforms. DNA-binding analyses implied much higher protein levels of HNF4α10-α12 in liver than expected from the RT-PCR data. Our results provide evidence for a more complex expression pattern of HNF4α than previously appreciated. We recommend inclusion of exon 1E and nearby DNA sequences in screening for HNF4α mutations and polymorphisms in genetic analyses of MODY1 and T2DM.
Energy Technology Data Exchange (ETDEWEB)
Huang, Jianmin, E-mail: jmhuang@partners.org [Pediatric Endocrine Unit, MassGeneral Hospital for Children and Harvard Medical School, Boston, Massachusetts, 02114-2696 (United States); Levitsky, Lynne L. [Pediatric Endocrine Unit, MassGeneral Hospital for Children and Harvard Medical School, Boston, Massachusetts, 02114-2696 (United States); Rhoads, David B., E-mail: rhoads@helix.mgh.harvard.edu [Pediatric Endocrine Unit, MassGeneral Hospital for Children and Harvard Medical School, Boston, Massachusetts, 02114-2696 (United States)
2009-04-15
Hepatocyte nuclear factor 4{alpha} (HNF4{alpha}) is a critical transcription factor for pancreas and liver development and functions in islet {beta} cells to maintain glucose homeostasis. Mutations in the human HNF4A gene lead to maturity onset diabetes of the young (MODY1) and polymorphisms are associated with increased risk for type 2 diabetes mellitus (T2DM). Expression of six HNF4{alpha} variants, three each from two developmentally regulated promoters, has been firmly established. We have now detected a new set of HNF4{alpha} variants designated HNF4{alpha}10-12 expressed from distal promoter P2. These variants, generated by inclusion of previously undetected exon 1E (human = 222 nt, rodent = 136 nt) following exon 1D have an altered N-terminus but identical remaining reading frame. HNF4{alpha}10-{alpha}12 are expressed in pancreatic islets (and liver) and exhibit transactivation potentials similar to the corresponding {alpha}7-{alpha}9 isoforms. DNA-binding analyses implied much higher protein levels of HNF4{alpha}10-{alpha}12 in liver than expected from the RT-PCR data. Our results provide evidence for a more complex expression pattern of HNF4{alpha} than previously appreciated. We recommend inclusion of exon 1E and nearby DNA sequences in screening for HNF4{alpha} mutations and polymorphisms in genetic analyses of MODY1 and T2DM.
HNF1B-associated clinical phenotypes: the kidney and beyond.
Bockenhauer, Detlef; Jaureguiberry, Graciana
2016-05-01
Mutations in HNF1B, the gene encoding hepatocyte nuclear factor 1β are the most commonly identified genetic cause of renal malformations. HNF1B was first identified as a disease gene for diabetes (MODY5) in 1997, and its involvement in renal disease was subsequently noted through clinical observations in pedigrees affected by MODY5. Since then, a whole spectrum of associated phenotypes have been reported, including genital malformations, autism, epilepsy, gout, hypomagnesaemia, primary hyperparathyroidism, liver and intestinal abnormalities and a rare form of kidney cancer. The most commonly identified mutation, in approximately 50 % of patients, is an entire gene deletion occurring in the context of a 17q12 chromosomal microdeletion that also includes several other genes. Some of the associated phenotypes, especially the neurologic ones, appear to occur only in the context of this microdeletion and thus may not be directly linked to HNF1B. Here we review the spectrum of associated phenotypes and discuss potential implications for clinical management.
Structure effects in the elastic scattering for the 16O + 46,50Ti systems
International Nuclear Information System (INIS)
Werner, J.C.; Leal, L.A.S.; Munhoz, M.G.; Carlin, N.; Chamon, L.C.; Added, N.; Brage, J.A.P.; Liguori Neto, R.; Coimbra, M.M.; Moura, M.M. de; Souza, F.A.; Suaide, A.A.P.; Szanto, E.M.; Szanto de Toledo, A.; Takahashi, J.
2007-01-01
Nuclear structure effects observed in the sub-Coulomb fusion of heavy-ions demand a careful investigation of the reaction cross section and optical potentials near the Coulomb barrier. The elastic scattering for the 16 O + 46,50 Ti systems was investigated in the bombarding energy range 30= lab = 46 Ti and the neutron magic 50 Ti targets. This result is in agreement with the observation of no significant structure effects in the fusion cross section study for the same systems
Bacon, S; Kyithar, M P; Condron, E M; Vizzard, N; Burke, M; Byrne, M M
2016-12-01
HNF4A is an established cause of maturity onset diabetes of the young (MODY). Congenital hyperinsulinism can also be associated with mutations in the HNF4A gene. A dual phenotype is observed in HNF4A-MODY with hyperinsulinaemic hypoglycaemia in the neonatal period progressing to diabetes in adulthood. The nature and timing of the transition remain poorly defined. We performed an observational study to establish changes in glycaemia and insulin secretion over a 6-year period. We investigated glycaemic variability and hypoglycaemia in HNF4A-MODY using a continuous glucose monitoring system (CGMS). An OGTT with measurement of glucose, insulin and C-peptide was performed in HNF4A participants with diabetes mellitus (DM) (n = 14), HNF4A-IGT (n = 7) and age- and BMI-matched MODY negative family members (n = 10). Serial assessment was performed in the HNF4A-IGT cohort. In a subset of HNF4A-MODY mutation carriers (n = 10), CGMS was applied over a 72-h period. There was no deterioration in glycaemic control in the HNF4A-IGT cohort. The fasting glucose-to-insulin ratio was significantly lower in the HNF4A-IGT cohort when compared to the normal control group (0.13 vs. 0.24, p = 0.03). CGMS profiling demonstrated prolonged periods of hypoglycaemia in the HNF4A-IGT group when compared to the HNF4A-DM group (432 vs. 138 min p = 0.04). In a young adult HNF4A-IGT cohort, we demonstrate preserved glucose, insulin and C-peptide secretory responses to oral glucose. Utilising CGMS, prolonged periods of hypoglycaemia are evident despite a median age of 21 years. We propose a prolonged hyperinsulinaemic phase into adulthood is responsible for the notable hypoglycaemic episodes.
Review of design codes of concrete encased steel short columns under axial compression
Directory of Open Access Journals (Sweden)
K.Z. Soliman
2013-08-01
Full Text Available In recent years, the use of encased steel concrete columns has been increased significantly in medium-rise or high-rise buildings. The aim of the present investigation is to assess experimentally the current methods and codes for evaluating the ultimate load behavior of concrete encased steel short columns. The current state of design provisions for composite columns from the Egyptian codes ECP203-2007 and ECP-SC-LRFD-2012, as well as, American Institute of Steel Construction, AISC-LRFD-2010, American Concrete Institute, ACI-318-2008, and British Standard BS-5400-5 was reviewed. The axial capacity portion of both the encased steel section and the concrete section was also studied according to the previously mentioned codes. Ten encased steel concrete columns have been investigated experimentally to study the effect of concrete confinement and different types of encased steel sections. The measured axial capacity of the tested ten composite columns was compared with the values calculated by the above mentioned codes. It is concluded that non-negligible discrepancies exist between codes and the experimental results as the confinement effect was not considered in predicting both the strength and ductility of concrete. The confining effect was obviously influenced by the shape of the encased steel section. The tube-shaped steel section leads to better confinement than the SIB section. Among the used codes, the ECP-SC-LRFD-2012 led to the most conservative results.
DEFF Research Database (Denmark)
Ek, J; Grarup, N; Urhammer, S A
2001-01-01
Mutations in the homeodomain-containing transcription factor hepatocyte nuclear factor-1beta (HNF-1beta) are known to cause a rare subtype of maturity-onset diabetes of the young (MODY5), which is associated with early-onset progressive non-diabetic renal dysfunction. To investigate whether...... mutations in HNF-1 are implicated in the pathogenesis of MODY or late-onset diabetes with and without nephropathy in Danish Caucasians we examined the HNF-1beta (TCF2) and the dimerization cofactor of HNF-1 (DCoH, PCBD) genes for mutations in 11 MODY probands, 28 type 2 diabetic patients with nephropathy...... comprising the DCoH gene revealed a previously described A-->G polymorphism located in the 3' untranslated region, which was not investigated further. In conclusion, mutations in HNF-1beta and DCoH are not a major cause of MODY or late onset type 2 diabetes in Danish Caucasian subjects....
Directory of Open Access Journals (Sweden)
W. L. Lodder
2013-01-01
Full Text Available Objective. This study was conducted to assess the value of CT and MR imaging in the preoperative evaluation of ICA encasement. Methods. Based upon three patient groups this study was performed. Retrospective analysis of 260 neck dissection reports from 2001 to 2010 was performed to determine unexpected peroperative-diagnosed encasement. Two experienced head and neck radiologists reviewed 12 scans for encasement. Results. In four out of 260 (1.5% patients undergoing neck dissection, preoperative imaging was false negative as there was peroperative encasement of the ICA. Of 380 patients undergoing preoperative imaging, the radiologist reported encasement of the ICA in 25 cases. In 342 cases no encasement was described, 125 of these underwent neck dissection, and 2 had encasement peroperatively. The interobserver variation kappa varied from 0.273 to 1 for the different characteristics studied. Conclusion. These retrospectively studied cohorts demonstrate that preoperative assessment of encasement of the ICA using MRI and/or CT was of value in evaluation of ICA encasement and therefore contributively in selecting operable patients (without ICA encasement, since in only 1.5% encasement was missed. However, observer variation affects the reliability of this feature.
Prevalence of Retinopathy in Adult Patients with GCK-MODY and HNF1A-MODY.
Szopa, M; Wolkow, J; Matejko, B; Skupien, J; Klupa, T; Wybrańska, I; Trznadel-Morawska, I; Kiec-Wilk, B; Borowiec, M; Malecki, M T
2015-10-01
We aimed to assess the prevalence of diabetic retinopathy (DR) in adult patients with GCK-MODY and HNF1A-MODY in Poland and to identify biochemical and clinical risk factors associated with its occurrence.We examined 74 GCK mutation carriers, 51 with diabetes and 23 with prediabetes, respectively, and 63 patients with HNF1A-MODY. Retinal photographs, 12 for each patient, were done by a fundus camera. Signs of DR were graded according to the DR disease severity scale. Statistical tests were performed to assess differences between the groups and logistic regression was done for the association with DR.The mean age at examination was 34.5±14.8 and 39.9±15.2 in the GCK-MODY and HNF1A-MODY groups, respectively. Mild nonproliferative DR (NPDR) was found in one patient with the GCK mutation and likely concomitant type 1 diabetes, whereas DR was diagnosed in 15 HNF1A-MODY patients: 9 with proliferative, 3 with moderate NPDR and 2 with mild NPDR. In univariate logistic regression analysis in the HNF1A-MODY group, significant results were found for diabetes duration, fasting glycemia, HbA1c, arterial hypertension, age at the examination, and eGFR. The strongest independent predictors of DR in HNF1A-MODY were markers of glucose control: HbA1c (OR: 2.05, CL%95: 1.2-3.83, p=0.01) and glucose (p=0.006, OR: 1.40, CL%95: 1.12-1.83) analyzed in 2 separated models. Additionally, arterial hypertension independently predicted DR (OR: 9.06, CL%95: 1.19-98.99, p=0.04) in the model with HbA1c as glycaemic control marker.In conclusion, DR of any degree was not present in our GCK-MODY group, while in spite of young age almost every fourth subject with HNF1A-MODY showed signs of this complication. © Georg Thieme Verlag KG Stuttgart · New York.
2010-01-01
... 12 Banks and Banking 3 2010-01-01 2010-01-01 false Employment. 268.705 Section 268.705 Banks and... Physical or Mental Disability § 268.705 Employment. No qualified individual with a disability shall, on the basis of a disability, be subjected to discrimination in employment under any program or activity...
International Nuclear Information System (INIS)
Hu, Xiaojun; Xie, Peiyi; Li, Weiqiang; Li, Zhengran; Shan, Hong
2016-01-01
Hepatocytes from human bone marrow-derived mesenchymal stem cells (hBM-MSCs) are expected to be a useful source for cell transplantation. However, relatively low efficiency and repeatability of hepatic differentiation of human BM-MSCs remains an obstacle for clinical translation. Hepatocyte nuclear factor 4 alpha (HNF4α), a critical transcription factor, plays an essential role in the entire process of liver development. In this study, immortalized hBM-MSCs, UE7T-13 cells were transduced with a lentiviral vector containing HNF4α. The typical fibroblast-like morphology of the MSCs changed, and polygonal, epithelioid cells grew out after HNF4α transduction. In hepatocyte culture medium, HNF4α-transduced MSCs (E7-hHNF4α cells) strongly expressed the albumin (ALB), CYP2B6, alpha-1 antitrypsin (AAT), and FOXA2 mRNA and exhibited morphology markedly similar to that of mature hepatocytes. The E7-hHNF4α cells showed hepatic functions such as Indocyanine green (ICG) uptake and release, glycogen storage, urea production and ALB secretion. Approximately 28% of E7-hHNF4α cells expressed both ALB and AAT. Furthermore, these E7-hHNF4α cells via superior mesenteric vein (SMV) injection expressed human ALB in mouse chronic injured liver. In conclusion, this study represents a novel strategy by directly inducing hepatocyte-like cells from MSCs. - Highlights: • We overexpressed HNF4α in immortalized BM-MSCs by lentiviral transduction. • HNF4α-transduced MSCs transdifferentiated into hepatocytes with mature hepatic metabolic functions. • Our study represents a novel strategy by direct induction of hepatocyte-like cells from MSCs.
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLH268 (Link to dictyBase) - - - - SLH268Z (Link to Original site) - - SLH2...68Z 640 - - - - Show SLH268 Library SL (Link to library) Clone ID SLH268 (Link to dictyBase) At...las ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLH2-C/SLH2...68Q.Seq.d/ Representative seq. ID SLH268Z (Link to Original site) R...epresentative DNA sequence >SLH268 (SLH268Q) /CSM/SL/SLH2-C/SLH268Q.Seq.d/ XXXXXXXXXXCTGGTGGTTATATTTCTCGTACT
Application of single pan thermal analysis to Cu-Sn peritectic alloys
International Nuclear Information System (INIS)
Kohler, F.; Campanella, T.; Nakanishi, S.; Rappaz, M.
2008-01-01
Single pan thermal analyses (SPTA) have been performed on Cu-14.5 wt.% Sn, Cu-21.3 wt.% Sn and Cu-26.8 wt.% Sn peritectic alloys. For this purpose, a SPTA assembly has been built and calibrated. As the latent heat is a function of temperature and composition during solidification of alloys, a new heat flow model coupled to a Cu-Sn thermodynamic database has been defined for the calculation of the corresponding evolutions of the solid mass fraction, f s (T). To verify the accuracy of this model, a close comparison with a microsegregation model that includes back-diffusion in the primary α-solid phase has also been conducted successfully. The thermal analyses have finally shown that the Cu-Sn phase diagram recently assessed in the review of Liu et al. is the most reliable
Energy Technology Data Exchange (ETDEWEB)
Ferre, Silvia [Department of Physiology, Radboud University Nijmegen Medical Centre (Netherlands); Veenstra, Gert Jan C. [Department of Molecular Biology, Faculty of Science, Nijmegen Centre for Molecular Life Sciences, Radboud University Nijmegen (Netherlands); Bouwmeester, Rianne; Hoenderop, Joost G.J. [Department of Physiology, Radboud University Nijmegen Medical Centre (Netherlands); Bindels, Rene J.M., E-mail: r.bindels@fysiol.umcn.nl [Department of Physiology, Radboud University Nijmegen Medical Centre (Netherlands)
2011-01-07
Research highlights: {yields} Defects in HNF-1B transcription factor affect Mg{sup 2+} handling in the distal kidney. {yields} {gamma}a- and {gamma}b- subunits of the Na{sup +}/K{sup +}-ATPase colocalize in the distal convoluted tubule of the nephron. {yields} HNF-1B specifically activates {gamma}a expression. {yields} HNF-1B mutants have a dominant negative effect on wild type HNF-1B activity. {yields} Defective transcription of {gamma}a may promote renal Mg{sup 2+} wasting. -- Abstract: Hepatocyte nuclear factor-1B (HNF-1B) is a transcription factor involved in embryonic development and tissue-specific gene expression in several organs, including the kidney. Recently heterozygous mutations in the HNF1B gene have been identified in patients with hypomagnesemia due to renal Mg{sup 2+} wasting. Interestingly, ChIP-chip data revealed HNF-1B binding sites in the FXYD2 gene, encoding the {gamma}-subunit of the Na{sup +}/K{sup +}-ATPase. The {gamma}-subunit has been described as one of the molecular players in the renal Mg{sup 2+} reabsorption in the distal convoluted tubule (DCT). Of note, the FXYD2 gene can be alternatively transcribed into two main variants, namely {gamma}a and {gamma}b. In the present study, we demonstrated via two different reporter gene assays that HNF-1B specifically acts as an activator of the {gamma}a-subunit, whereas the {gamma}b-subunit expression was not affected. Moreover, the HNF-1B mutations H69fsdelAC, H324S325fsdelCA, Y352finsA and K156E, previously identified in patients with hypomagnesemia, prevented transcription activation of {gamma}a-subunit via a dominant negative effect on wild type HNF1-B. By immunohistochemistry, it was shown that the {gamma}a- and {gamma}b-subunits colocalize at the basolateral membrane of the DCT segment of mouse kidney. On the basis of these data, we suggest that abnormalities involving the HNF-1B gene may impair the relative abundance of {gamma}a and {gamma}b, thus affecting the transcellular Mg{sup 2
Dietrich, Christoph G; Martin, Ina V; Porn, Anne C; Voigt, Sebastian; Gartung, Carsten; Trautwein, Christian; Geier, Andreas
2007-09-01
Fasting induces numerous adaptive changes in metabolism by several central signaling pathways, the most important represented by the HNF4alpha/PGC-1alpha-pathway. Because HNF4alpha has been identified as central regulator of basolateral bile acid transporters and a previous study reports increased basolateral bile acid uptake into the liver during fasting, we hypothesized that HNF4alpha is involved in fasting-induced bile acid uptake via upregulation of basolateral bile acid transporters. In rats, mRNA of Ntcp, Oatp1, and Oatp2 were significantly increased after 48 h of fasting. Protein expression as determined by Western blot showed significant increases for all three transporters 72 h after the onset of fasting. Whereas binding activity of HNF1alpha in electrophoretic mobility shift assays remained unchanged, HNF4alpha binding activity to the Ntcp promoter was increased significantly. In line with this result, we found significantly increased mRNA expression of HNF4alpha and PGC-1alpha. Functional studies in HepG2 cells revealed an increased endogenous NTCP mRNA expression upon cotransfection with either HNF4alpha, PGC-1alpha, or a combination of both. We conclude that upregulation of the basolateral bile acid transporters Ntcp, Oatp1, and Oatp2 in fasted rats is mediated via the HNF4alpha/PGC-1alpha pathway.
The human intestinal fatty acid binding protein (hFABP2) gene is regulated by HNF-4α
International Nuclear Information System (INIS)
Klapper, Maja; Boehme, Mike; Nitz, Inke; Doering, Frank
2007-01-01
The cytosolic human intestinal fatty acid binding protein (hFABP2) is proposed to be involved in intestinal absorption of long-chain fatty acids. The aim of this study was to investigate the regulation of hFABP2 by the endodermal hepatocyte nuclear factor 4α (HNF-4α), involved in regulation of genes of fatty acid metabolism and differentiation. Electromobility shift assays demonstrated that HNF-4α binds at position -324 to -336 within the hFABP2 promoter. Mutation of this HNF-4 binding site abolished the luciferase reporter activity of hFABP2 in postconfluent Caco-2 cells. In HeLa cells, this mutation reduced the activation of the hFABP2 promoter by HNF-4α by about 50%. Thus, binding element at position -336/-324 essentially determines the transcriptional activity of promoter and may be important in control of hFABP2 expression by dietary lipids and differentiation. Studying genotype interactions of hFABP2 and HNF-4α, that are both candidate genes for diabetes type 2, may be a powerful approach
The human intestinal fatty acid binding protein (hFABP2) gene is regulated by HNF-4{alpha}
Energy Technology Data Exchange (ETDEWEB)
Klapper, Maja [Molecular Nutrition, Institute of Human Nutrition and Food Science, Christian-Albrechts-University of Kiel, Heinrich-Hecht-Platz 10, D-24118 Kiel (Germany); Boehme, Mike [Molecular Nutrition, Institute of Human Nutrition and Food Science, Christian-Albrechts-University of Kiel, Heinrich-Hecht-Platz 10, D-24118 Kiel (Germany); Nitz, Inke [Molecular Nutrition, Institute of Human Nutrition and Food Science, Christian-Albrechts-University of Kiel, Heinrich-Hecht-Platz 10, D-24118 Kiel (Germany); Doering, Frank [Molecular Nutrition, Institute of Human Nutrition and Food Science, Christian-Albrechts-University of Kiel, Heinrich-Hecht-Platz 10, D-24118 Kiel (Germany)
2007-04-27
The cytosolic human intestinal fatty acid binding protein (hFABP2) is proposed to be involved in intestinal absorption of long-chain fatty acids. The aim of this study was to investigate the regulation of hFABP2 by the endodermal hepatocyte nuclear factor 4{alpha} (HNF-4{alpha}), involved in regulation of genes of fatty acid metabolism and differentiation. Electromobility shift assays demonstrated that HNF-4{alpha} binds at position -324 to -336 within the hFABP2 promoter. Mutation of this HNF-4 binding site abolished the luciferase reporter activity of hFABP2 in postconfluent Caco-2 cells. In HeLa cells, this mutation reduced the activation of the hFABP2 promoter by HNF-4{alpha} by about 50%. Thus, binding element at position -336/-324 essentially determines the transcriptional activity of promoter and may be important in control of hFABP2 expression by dietary lipids and differentiation. Studying genotype interactions of hFABP2 and HNF-4{alpha}, that are both candidate genes for diabetes type 2, may be a powerful approach.
FoxO1 and HNF-4 are involved in regulation of hepatic glucokinase gene expression by resveratrol.
Ganjam, Goutham Kumar; Dimova, Elitsa Y; Unterman, Terry G; Kietzmann, Thomas
2009-11-06
Resveratrol, a polyphenol derived from grapes, exerts important effects on glucose and lipid metabolism, yet detailed mechanisms mediating these effects remain unknown. The liver plays a central role in energy homeostasis, and glucokinase (GK) is a key enzyme involved in glucose utilization. Resveratrol activates SIRT1 (sirtuin 1), which promotes deacetylation of the forkhead transcription factor FoxO1. Previously, we reported that FoxO1 can suppress and that HNF-4 can stimulate GK expression in the liver. Here, we examined the role of FoxO1 and HNF-4 in mediating resveratrol effects on liver GK expression. Resveratrol suppressed hepatic GK expression in vivo and in isolated hepatocytes, and knocking down FoxO1 with shRNAs disrupted this effect. Reporter gene, gel shift, supershift assay, and chromatin immunoprecipitation studies show that FoxO1 binds to the GK promoter and that the interplay between FoxO1 and HNF-4 within the GK promoter is essential for mediating the effects of resveratrol. Resveratrol promotes deacetylation of FoxO1 and enhances its recruitment to the FoxO-binding element. Conversely, resveratrol suppresses recruitment of HNF-4 to its binding site, and knockdown of FoxO1 blocks this effect of resveratrol. Coprecipitation and chromatin immunoprecipitation studies show that resveratrol enhances interaction between FoxO1 and HNF-4, reduces binding of HNF-4 to its own site, and promotes its recruitment to the FoxO site in a FoxO1-dependent manner. These results provide the first evidence that resveratrol represses GK expression via FoxO1 and that the interaction between FoxO1 and HNF-4 contributes to these effects of resveratrol.
Bacon, S; Kyithar, M P; Rizvi, S R; Donnelly, E; McCarthy, A; Burke, M; Colclough, K; Ellard, S; Byrne, M M
2016-07-01
HNF1A gene mutations are the most common cause of maturity-onset diabetes of the young (MODY) in the UK. Persons with HNF1A-MODY display sensitivity to sulphonylurea therapy; however, the long-term efficacy is not established. There is limited literature as to the prevalence of micro- and macrovascular complications in this unique cohort. The aim of this study was to determine the natural progression and clinical management of HNF1A-MODY diabetes in a dedicated MODY clinic. Sixty patients with HNF1A-MODY and a cohort of 60 BMI-, age-, ethnicity- and diabetes duration-matched patients with Type 1 diabetes mellitus participated in the study. All patients were phenotyped in detail. Clinical follow-up of the HNF1A-MODY cohort occurred on a bi-annual basis. Following a genetic diagnosis of MODY, the majority of the cohort treated with sulphonylurea therapy remained insulin independent at 84-month follow-up (80%). The HbA1c in the HNF1A-MODY group treated with sulphonylurea therapy alone improved significantly over the study period [from 49 (44-63) mmol/mol, 6.6 (6.2-7.9)% to 41 (31-50) mmol/mol, 5.9 (5-6.7)%; P = 0.003]. The rate of retinopathy was significantly lower than that noted in the Type 1 diabetes mellitus group (13.6 vs. 50%; P = 0.0001).There was also a lower rate of microalbuminuria and cardiovascular disease in the HNF1A-MODY group compared with the Type 1 diabetes mellitus group. This study demonstrates that the majority of patients with HNF1A-MODY can be maintained successfully on sulphonylurea therapy with good glycaemic control. We note a significantly lower rate of micro- and macrovascular complications than reported previously. The use of appropriate therapy at early stages of the disorder may decrease the incidence of complications. © 2015 Diabetes UK.
Nowak, Natalia; Hohendorff, Jerzy; Solecka, Iwona; Szopa, Magdalena; Skupien, Jan; Kiec-Wilk, Beata; Mlynarski, Wojciech; Malecki, Maciej T
2015-12-01
Ghrelin is a hormone that regulates appetite. It is likely to be involved in the pathophysiology of varying forms of diabetes. In animal studies, the ghrelin expression was regulated by the hepatocyte nuclear factor 1 alpha (HNF1A). Mutations of the HNF1A gene cause maturity onset diabetes of the young (MODY). We aimed to assess the circulating ghrelin levels in HNF1A-MODY and in other types of diabetes and to evaluate its association with HNF1A mutation status. Our cohort included 46 diabetic HNF1A gene mutation carriers, 55 type 2 diabetes (T2DM) subjects, 42 type 1 diabetes (T1DM) patients, and 31 glucokinase (GCK) gene mutation carriers with diabetes as well as 51 healthy controls. Plasma ghrelin concentration was measured using the immunoenzymatic assay with polyclonal antibody against the C-terminal fragment of its acylated and desacylated forms. Ghrelin concentrations were 0.75 ± 0.32, 0.70 ± 0.21, 0.50 ± 0.20, and 0.40 ± 0.16 ng/ml in patients with HNF1A-MODY, GCK-MODY, T1DM, and T2DM, respectively. The ghrelin levels were higher in HNF1A-MODY and GCK-MODY than in T1DM and T2DM (p MODY groups and common diabetes types remained significant. Analysis by a HNF1A mutation type indicated that ghrelin concentration is similar in patients with different types of sequence differences. Plasma ghrelin level is higher in HNF1A-MODY and GCK-MODY than in the common polygenic forms of diabetes.
Clinical application of ACMG-AMP guidelines in HNF1A and GCK variants in a cohort of MODY families.
Santana, L S; Caetano, L A; Costa-Riquetto, A D; Quedas, E P S; Nery, M; Collett-Solberg, P; Boguszewski, M C S; Vendramini, M F; Crisostomo, L G; Floh, F O; Zarabia, Z I; Kohara, S K; Guastapaglia, L; Passone, C G B; Sewaybricker, L E; Jorge, A A L; Teles, M G
2017-10-01
Maturity-onset diabetes of the young (MODY) is a form of monogenic diabetes with autosomal dominant inheritance. GCK -MODY and HNF1A -MODY are the prevalent subtypes. Currently, there is growing concern regarding the correct interpretation of molecular genetic findings. The American College of Medical Genetics and Genomics (ACMG) updated guidelines to interpret and classify molecular variants. This study aimed to determine the prevalence of MODY ( GCK / HNF1A ) in a large cohort of Brazilian families, to report variants related to phenotype, and to classify them according to ACMG guidelines. One hundred and nine probands were investigated, 45% with clinical suspicion of GCK -MODY and 55% with suspicion of HNF1A -MODY. Twenty-five different variants were identified in GCK gene (30 probands-61% of positivity), and 7 variants in HNF1A (10 probands-17% of positivity). Fourteen of them were novel (12- GCK /2- HNF1A ). ACMG guidelines were able to classify a large portion of variants as pathogenic (36%- GCK /86%- HNF1A ) and likely pathogenic (44%- GCK /14%- HNF1A ), with 16% (5/32) as uncertain significance. This allows us to determine the pathogenicity classification more efficiently, and also reinforces the suspected associations with the phenotype among novel variants. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
International Nuclear Information System (INIS)
WHITE, W.F.
1999-01-01
This document specifies the critical characteristics for Commercial Grade Items (CGI) procured for PFP's criticality alarm system as required by HNF-PRO-268 and HNF-PRO-1819. These are the minimum specifications that the equipment must meet in order to properly perform its safety function. There may be several manufacturers or models that meet the critical characteristics for any one item. PFP's Criticality Alarm System includes the nine criticality alarm system panels and their associated hardware. This includes all parts up to the first breaker in the electrical distribution system. Specific system boundaries and justifications are contained in HNF-SD-CP-SDD-003, ''Definition and Means of Maintaining the Criticality Detectors and Alarms Portion of the PFP Safety Envelope.'' The procurement requirements associated with the system necessitates procurement of some system equipment as Commercial Grade Items in accordance with HNF-PRO-268, ''Control of Purchased Items and Services.''
Laron Dwarfism and Non-Insulin-Dependent Diabetes Mellitus in the Hnf-1α Knockout Mouse
Lee, Ying-Hue; Sauer, Brian; Gonzalez, Frank J.
1998-01-01
Mice deficient in hepatocyte nuclear factor 1 alpha (HNF-1α) were produced by use of the Cre-loxP recombination system. HNF-1α-null mice are viable but sterile and exhibit a phenotype reminiscent of both Laron-type dwarfism and non-insulin-dependent diabetes mellitus (NIDDM). In contrast to an earlier HNF-1α-null mouse line that had been produced by use of standard gene disruption methodology (M. Pontoglio, J. Barra, M. Hadchouel, A. Doyen, C. Kress, J. P. Bach, C. Babinet, and M. Yaniv, Cell 84:575–585, 1996), these mice exhibited no increased mortality and only minimal renal dysfunction during the first 6 months of development. Both dwarfism and NIDDM are most likely due to the loss of expression of insulin-like growth factor I (IGF-I) and lower levels of insulin, resulting in stunted growth and elevated serum glucose levels, respectively. These results confirm the functional significance of the HNF-1α regulatory elements that had previously been shown to reside in the promoter regions of both the IGF-I and the insulin genes. PMID:9566924
PFP Commercial Grade Food Pack Cans for Plutonium Handling and Storage Critical Characteristics
International Nuclear Information System (INIS)
BONADIE, E.P.
1999-01-01
This document specifies the critical characteristics for Commercial Grade Items (CGI) procured for PFP's Vault Operations system as required by HNF-PRO-268 and HNF-PRO-1819. These are the minimum specifications that the equipment must meet in order to perform its safety function
PFP vault operations containers for Plutonium Handling and Storage Critical Characteristics
International Nuclear Information System (INIS)
BONADIE, E.P.
2000-01-01
This document specifies the critical characteristics for containers procured for Plutonium Finishing Plant's (PFP's) Vault Operations system as required by HNF-PRO-268 and HNF-PRO-1819. These are the minimum specifications that the equipment must meet in order to perform its safety function
FoxO1 and HNF-4 Are Involved in Regulation of Hepatic Glucokinase Gene Expression by Resveratrol*
Ganjam, Goutham Kumar; Dimova, Elitsa Y.; Unterman, Terry G.; Kietzmann, Thomas
2009-01-01
Resveratrol, a polyphenol derived from grapes, exerts important effects on glucose and lipid metabolism, yet detailed mechanisms mediating these effects remain unknown. The liver plays a central role in energy homeostasis, and glucokinase (GK) is a key enzyme involved in glucose utilization. Resveratrol activates SIRT1 (sirtuin 1), which promotes deacetylation of the forkhead transcription factor FoxO1. Previously, we reported that FoxO1 can suppress and that HNF-4 can stimulate GK expression in the liver. Here, we examined the role of FoxO1 and HNF-4 in mediating resveratrol effects on liver GK expression. Resveratrol suppressed hepatic GK expression in vivo and in isolated hepatocytes, and knocking down FoxO1 with shRNAs disrupted this effect. Reporter gene, gel shift, supershift assay, and chromatin immunoprecipitation studies show that FoxO1 binds to the GK promoter and that the interplay between FoxO1 and HNF-4 within the GK promoter is essential for mediating the effects of resveratrol. Resveratrol promotes deacetylation of FoxO1 and enhances its recruitment to the FoxO-binding element. Conversely, resveratrol suppresses recruitment of HNF-4 to its binding site, and knockdown of FoxO1 blocks this effect of resveratrol. Coprecipitation and chromatin immunoprecipitation studies show that resveratrol enhances interaction between FoxO1 and HNF-4, reduces binding of HNF-4 to its own site, and promotes its recruitment to the FoxO site in a FoxO1-dependent manner. These results provide the first evidence that resveratrol represses GK expression via FoxO1 and that the interaction between FoxO1 and HNF-4 contributes to these effects of resveratrol. PMID:19740748
39 CFR 268.1 - General principles.
2010-07-01
... 39 Postal Service 1 2010-07-01 2010-07-01 false General principles. 268.1 Section 268.1 Postal Service UNITED STATES POSTAL SERVICE ORGANIZATION AND ADMINISTRATION PRIVACY OF INFORMATION-EMPLOYEE RULES OF CONDUCT § 268.1 General principles. In order to conduct its business, the Postal Service has the...
12 CFR 268.105 - Individual complaints.
2010-01-01
... 12 Banks and Banking 3 2010-01-01 2010-01-01 false Individual complaints. 268.105 Section 268.105... RULES REGARDING EQUAL OPPORTUNITY Board Program To Promote Equal Opportunity § 268.105 Individual... individual and the Board and to describe generally the action(s) or practice(s) that form the basis of the...
Directory of Open Access Journals (Sweden)
Reini F Luco
2008-05-01
Full Text Available DNA binding transcriptional activators play a central role in gene-selective regulation. In part, this is mediated by targeting local covalent modifications of histone tails. Transcriptional regulation has also been associated with the positioning of genes within the nucleus. We have now examined the role of a transcriptional activator in regulating the positioning of target genes. This was carried out with primary beta-cells and hepatocytes freshly isolated from mice lacking Hnf1alpha, an activator encoded by the most frequently mutated gene in human monogenic diabetes (MODY3. We show that in Hnf1a-/- cells inactive endogenous Hnf1alpha-target genes exhibit increased trimethylated histone H3-Lys27 and reduced methylated H3-Lys4. Inactive Hnf1alpha-targets in Hnf1a-/- cells are also preferentially located in peripheral subnuclear domains enriched in trimethylated H3-Lys27, whereas active targets in wild-type cells are positioned in more central domains enriched in methylated H3-Lys4 and RNA polymerase II. We demonstrate that this differential positioning involves the decondensation of target chromatin, and show that it is spatially restricted rather than a reflection of non-specific changes in the nuclear organization of Hnf1a-deficient cells. This study, therefore, provides genetic evidence that a single transcriptional activator can influence the subnuclear location of its endogenous genomic targets in primary cells, and links activator-dependent changes in local chromatin structure to the spatial organization of the genome. We have also revealed a defect in subnuclear gene positioning in a model of a human transcription factor disease.
Directory of Open Access Journals (Sweden)
Pierre-Benoit Ancey
2017-07-01
Full Text Available Understanding the processes that govern liver progenitor cell differentiation has important implications for the design of strategies targeting chronic liver diseases, whereby regeneration of liver tissue is critical. Although DNA methylation (5mC and hydroxymethylation (5hmC are highly dynamic during early embryonic development, less is known about their roles at later stages of differentiation. Using an in vitro model of hepatocyte differentiation, we show here that 5hmC precedes the expression of promoter 1 (P1-dependent isoforms of HNF4A, a master transcription factor of hepatocyte identity. 5hmC and HNF4A expression from P1 are dependent on ten-eleven translocation (TET dioxygenases. In turn, the liver pioneer factor FOXA2 is necessary for TET1 binding to the P1 locus. Both FOXA2 and TETs are required for the 5hmC-related switch in HNF4A expression. The epigenetic event identified here may be a key step for the establishment of the hepatocyte program by HNF4A.
Maturity Onset Diabetes of the Young (MODY) in Tunisia: Low frequencies of GCK and HNF1A mutations.
Ben Khelifa, S; Martinez, R; Dandana, A; Khochtali, I; Ferchichi, S; Castaño, L
2018-04-20
Maturity Onset Diabetes of the Young (MODY) is a monogenic form of diabetes characterized by autosomal dominant inheritance, an early clinical onset and a primary defect in β-cell function. Mutations in the GCK and HNF1A genes are the most common cause of MODY among Caucasians. The etiology of MODY in Tunisia stills a challenge for researchers. The aim of this study was to screen for mutations in GCK, HNF1A, HNF4A and INS genes in North African Tunisians subjects, in whom the clinical profile was very suggestive of MODY. A total of 23 unrelated patients, with clinical presentation of MODY were tested for mutations in GCK, HNF1A, HNF4A and INS genes, using Denaturing High Performance Liquid Chromatography (DHPLC), Multiplex Ligation-depend Probe Amplification (MLPA) and sequencing analysis. We identified the previously reported mutation c-169C > T in one patient as well as a new mutation c-457C > T in two unrelated patients. No mutations were detected in the HNF1A and INS genes. Despite restrictive clinical criteria used for selecting patients in this study, the most common genes known for MODY do not explain the majority of cases in Tunisians. This suggests that there are others candidate or unidentified genes contributing to the etiology of MODY in Tunisians families. Copyright © 2018 Elsevier B.V. All rights reserved.
A model for steady-state HNF combustion
Energy Technology Data Exchange (ETDEWEB)
Louwers, J.; Gadiot, G.M.H.J.L. [TNO Prins Maurits Lab., Rijswijk (Netherlands); Brewster, M.Q. [Univ. of Illinois, Urbana, IL (United States); Son, S.F. [Los Alamos National Lab., NM (United States)
1997-09-01
A simple model for the combustion of solid monopropellants is presented. The condensed phase is treated by high activation energy asymptotics. The gas phase is treated by two limit cases: high activation energy, and low activation energy. This results in simplification of the gas phase energy equation, making an (approximate) analytical solution possible. The results of the model are compared with experimental results of Hydrazinium Nitroformate (HNF) combustion.
40 CFR 268.4 - Treatment surface impoundment exemption.
2010-07-01
... residues may not be placed in any other surface impoundment for subsequent management. (iv) Recordkeeping... exemption. 268.4 Section 268.4 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SOLID...), the residues from treatment are analyzed, as specified in § 268.7 or § 268.32, to determine if they...
Najmi, Laeya Abdoli; Aukrust, Ingvild; Flannick, Jason; Molnes, Janne; Burtt, Noel; Molven, Anders; Groop, Leif; Altshuler, David; Johansson, Stefan; Njølstad, Pål Rasmus
2017-01-01
Variants in HNF1A encoding hepatocyte nuclear factor 1α (HNF-1A) are associated with maturity-onset diabetes of the young form 3 (MODY 3) and type 2 diabetes. We investigated whether functional classification of HNF1A rare coding variants can inform models of diabetes risk prediction in the general population by analyzing the effect of 27 HNF1A variants identified in well-phenotyped populations (n = 4,115). Bioinformatics tools classified 11 variants as likely pathogenic and showed no association with diabetes risk (combined minor allele frequency [MAF] 0.22%; odds ratio [OR] 2.02; 95% CI 0.73–5.60; P = 0.18). However, a different set of 11 variants that reduced HNF-1A transcriptional activity to diabetes in the general population (combined MAF 0.22%; OR 5.04; 95% CI 1.99–12.80; P = 0.0007). Our functional investigations indicate that 0.44% of the population carry HNF1A variants that result in a substantially increased risk for developing diabetes. These results suggest that functional characterization of variants within MODY genes may overcome the limitations of bioinformatics tools for the purposes of presymptomatic diabetes risk prediction in the general population. PMID:27899486
Measuring Humidity in the Charters of Freedom Encasements Using a Moisture Condensation Method
Burkett, Cecil G.; West, James W.; Levine, Joel S.
2004-01-01
The relative humidity of the atmosphere in the encasements containing the U.S. Constitution Pages 1 and 4, the Declaration of Independence, and the Bill of Rights was measured to be in the range of 55% to 61%. This value is significantly higher than the presumed relative humidity between 25 to 35 %, but is consistent with the measured samples extracted from Pages 2 and 3 of the U.S. Constitution. The cooling/condensation measurement technique used at NARA on July 23, 2001, and described in this paper to measure the water vapor content of the atmosphere in the hermetically sealed encasements containing the U. S. Constitution, the Declaration of Independence, and the Bill of Rights, proved to be a powerful new measurement technique. The cooling/condensation technique developed at NASA LaRC and utilized at NARA has important applications in the non-invasive measurement of relative humidity in the atmospheres of sealed encasements and could become a standard measurement technique in this type of analysis.
12 CFR 268.202 - Equal Pay Act.
2010-01-01
... 12 Banks and Banking 3 2010-01-01 2010-01-01 false Equal Pay Act. 268.202 Section 268.202 Banks... REGARDING EQUAL OPPORTUNITY Provisions Applicable to Particular Complaints § 268.202 Equal Pay Act. Complaints alleging violations of the Equal Pay Act shall be processed under this part. ...
12 CFR 268.601 - EEO group statistics.
2010-01-01
... 12 Banks and Banking 3 2010-01-01 2010-01-01 false EEO group statistics. 268.601 Section 268.601... RULES REGARDING EQUAL OPPORTUNITY Matters of General Applicability § 268.601 EEO group statistics. (a... solely statistical purpose for which the data is being collected, the need for accuracy, the Board's...
Developments on HNF based high performance and green solid propellants
Keizers, H.L.J.; Heijden, A.E.D.M. van der; Vliet, L.D. van; Welland-Veltmans, W.H.M.; Ciucci, A.
2001-01-01
Worldwide developments are ongoing to develop new and more energetic composite solid propellant formulations for space transportation and military applications. Since the 90's, the use of HNF as a new high performance oxidiser is being reinvestigated. Within European development programmes,
12 CFR 268.302 - Mixed case complaints.
2010-01-01
... 12 Banks and Banking 3 2010-01-01 2010-01-01 false Mixed case complaints. 268.302 Section 268.302... RULES REGARDING EQUAL OPPORTUNITY Related Processes § 268.302 Mixed case complaints. A mixed case... discrimination or it may contain additional allegations that the MSPB has jurisdiction to address. A mixed case...
Hippo Signaling Influences HNF4A and FOXA2 Enhancer Switching during Hepatocyte Differentiation
Directory of Open Access Journals (Sweden)
Olivia Alder
2014-10-01
Full Text Available Summary: Cell fate acquisition is heavily influenced by direct interactions between master regulators and tissue-specific enhancers. However, it remains unclear how lineage-specifying transcription factors, which are often expressed in both progenitor and mature cell populations, influence cell differentiation. Using in vivo mouse liver development as a model, we identified thousands of enhancers that are bound by the master regulators HNF4A and FOXA2 in a differentiation-dependent manner, subject to chromatin remodeling, and associated with differentially expressed target genes. Enhancers exclusively occupied in the embryo were found to be responsive to developmentally regulated TEAD2 and coactivator YAP1. Our data suggest that Hippo signaling may affect hepatocyte differentiation by influencing HNF4A and FOXA2 interactions with temporal enhancers. In summary, transcription factor-enhancer interactions are not only tissue specific but also differentiation dependent, which is an important consideration for researchers studying cancer biology or mammalian development and/or using transformed cell lines. : It is unclear how key transcription factors are critical for both lineage specification during embryonic development and maintenance of a differentiated, adult phenotype. By profiling the enhancer occupancy of the key transcription factors HNF4A and FOXA2 during mouse liver development, Alder et al. have found that YAP1 can influence enhancer interactions and target gene expression levels. Enhancer switching enables HNF4A and FOXA2 to fulfill distinct roles during organ development.
DEFF Research Database (Denmark)
Shen, Hui; Fridley, Brooke L; Song, Honglin
2013-01-01
HNF1B is overexpressed in clear cell epithelial ovarian cancer, and we observed epigenetic silencing in serous epithelial ovarian cancer, leading us to hypothesize that variation in this gene differentially associates with epithelial ovarian cancer risk according to histological subtype. Here we...... comprehensively map variation in HNF1B with respect to epithelial ovarian cancer risk and analyse DNA methylation and expression profiles across histological subtypes. Different single-nucleotide polymorphisms associate with invasive serous (rs7405776 odds ratio (OR)=1.13, P=3.1 × 10(-10)) and clear cell (rs......11651755 OR=0.77, P=1.6 × 10(-8)) epithelial ovarian cancer. Risk alleles for the serous subtype associate with higher HNF1B-promoter methylation in these tumours. Unmethylated, expressed HNF1B, primarily present in clear cell tumours, coincides with a CpG island methylator phenotype affecting numerous...
Directory of Open Access Journals (Sweden)
Hualian Hang
Full Text Available To investigate the differentiation potential of human umbilical mesenchymal stem cells (HuMSCs and the key factors that facilitate hepatic differentiation.HuMSCs were induced to become hepatocyte-like cells according to a previously published protocol. The differentiation status of the hepatocyte-like cells was examined by observing the morphological changes under an inverted microscope and by immunofluorescence analysis. Hepatocyte nuclear factor 4 alpha (HNF4α overexpression was achieved by plasmid transfection of the hepatocyte-like cells. The expression of proteins and genes of interest was then examined by Western blotting and reverse transcription-polymerase chain reaction (RT-PCR or real-time RT-PCR methods.Our results demonstrated that HuMSCs can easily be induced into hepatocyte-like cells using a published differentiation protocol. The overexpression of HNF4α in the induced HuMSCs significantly enhanced the expression levels of hepatic-specific proteins and genes. HNF4α overexpression may be associated with liver-enriched transcription factor networks and the Wnt/β-Catenin pathway.The overexpression of HNF4α improves the hepatic differentiation of HuMSCs and is a simple way to improve cellular sources for clinical applications.
12 CFR 268.710 - Compliance procedures.
2010-01-01
... 12 Banks and Banking 3 2010-01-01 2010-01-01 false Compliance procedures. 268.710 Section 268.710 Banks and Banking FEDERAL RESERVE SYSTEM (CONTINUED) BOARD OF GOVERNORS OF THE FEDERAL RESERVE SYSTEM... Women's Program Manager, the Hispanic Employment Program Coordinator, or the People with Disabilities...
Directory of Open Access Journals (Sweden)
Huaibin Sun
2015-01-01
Full Text Available miR-34a is a member of the miR-34 family and acts as a tumor suppressor in bladder cancer. This study explored the regulative role of miR-34a on an orphan nuclear receptor HNF4G, which has a well-confirmed role in bladder tumor growth and invasion. qRT-PCR analysis was applied to measure miR-34a expression in two tumorigenic bladder cancer cell lines 5637 and T24 and one normal human urothelial cell line SV-HUC-1. Luciferase assay was performed to verify the putative binding between miR-34a and HNF4G. The influence of miR-34a-HNF4G axis on cell viability, colony formation, and invasion was assessed with loss- and gain-of-function analysis. This study observed that the miR-34a expressions in 5637 and T24 cells were significantly lower than in SV-HUC-1, while the muscle invasive cell sublines 5637-M and T24-M had even lower miR-34a expression than in the nonmuscle invasive sublines. HNF4G has a 3′-UTR binding site with miR-34a and is a direct downstream target of miR-34a. miR-34a can directly downregulate the expression of HNF4G and thus inhibit tumor cell viability, colony formation, and invasion. Therefore, miR-34a-HNF4G axis is an important pathway modulating cell viability, proliferation, and invasion of bladder cancer cells.
International Nuclear Information System (INIS)
Satohisa, Seiro; Chiba, Hideki; Osanai, Makoto; Ohno, Shigeo; Kojima, Takashi; Saito, Tsuyoshi; Sawada, Norimasa
2005-01-01
We previously reported that expression of tight-junction molecules occludin, claudin-6 and claudin-7, as well as establishment of epithelial polarity, was triggered in mouse F9 cells expressing hepatocyte nuclear factor (HNF)-4α [H. Chiba, T. Gotoh, T. Kojima, S. Satohisa, K. Kikuchi, M. Osanai, N. Sawada. Hepatocyte nuclear factor (HNF)-4α triggers formation of functional tight junctions and establishment of polarized epithelial morphology in F9 embryonal carcinoma cells, Exp. Cell Res. 286 (2003) 288-297]. Using these cells, we examined in the present study behavior of tight-junction, adherens-junction and cell polarity proteins and elucidated the molecular mechanism behind HNF-4α-initiated junction formation and epithelial polarization. We herein show that not only ZO-1 and ZO-2, but also ZO-3, junctional adhesion molecule (JAM)-B, JAM-C and cell polarity proteins PAR-3, PAR-6 and atypical protein kinase C (aPKC) accumulate at primordial adherens junctions in undifferentiated F9 cells. In contrast, CRB3, Pals1 and PATJ appeared to exhibit distinct subcellular localization in immature cells. Induced expression of HNF-4α led to translocation of these tight-junction and cell polarity proteins to beltlike tight junctions, where occludin, claudin-6 and claudin-7 were assembled, in differentiated cells. Interestingly, PAR-6, aPKC, CRB3 and Pals1, but not PAR-3 or PATJ, were also concentrated on the apical membranes in differentiated cells. These findings indicate that HNF-4α provokes not only expression of tight-junction adhesion molecules, but also modulation of subcellular distribution of junction and cell polarity proteins, resulting in junction formation and epithelial polarization
International Nuclear Information System (INIS)
THOMAS, R.J.
2000-01-01
This document specifies the critical characteristics for Commercial Grade Items (CGI) procured for use in the Plutonium Finishing Plant as required by HNF-PRO-268 and HNF-PRO-1819. These are the minimum specifications that the equipment must meet in order to properly perform its safety function. There may be several manufacturers or models that meet the critical characteristics of any one item
12 CFR 268.203 - Rehabilitation Act.
2010-01-01
... 12 Banks and Banking 3 2010-01-01 2010-01-01 false Rehabilitation Act. 268.203 Section 268.203... Rehabilitation Act. (a) Model employer. The Board shall be a model employer of individuals with disabilities. The... Rehabilitation Act of 1973, as amended (29 U.S.C. 791), has been violated in a complaint alleging nonaffirmative...
Surgical management of giant sphenoid wing meningiomas encasing major cerebral arteries.
Champagne, Pierre-Olivier; Lemoine, Emile; Bojanowski, Michel W
2018-04-01
OBJECTIVE Sphenoid wing meningiomas are a heterogeneous group of tumors with variable surgical risks and prognosis. Those that have grown to a very large size, encasing the major cerebral arteries, are associated with a high risk of stroke. In reviewing the authors' series of giant sphenoid wing meningiomas, the goal was to evaluate how the extent of the tumor's invasion of surrounding structures affected the ability to safely remove the tumor and restore function. METHODS The authors conducted a retrospective study of a series of giant sphenoid wing meningiomas operated on between 1996 and 2016. Inclusion criteria were meningiomas with a globoid component ≥ 6 cm, encasing at least 1 major intradural cerebral artery. Extent of resection was measured according to Simpson grade. RESULTS This series included 12 patients, with a mean age of 59 years. Visual symptoms were the most common clinical presentation. There was complete or partial encasement of all 3 major cerebral arteries except for 3 cases in which only the anterior cerebral artery was not involved. The lateral wall of the cavernous sinus was invaded in 8 cases (67%) and the optic canal in 6 (50%). Complete resection was achieved in 2 cases (Simpson grades 2 and 3). In the remaining 10 cases of partial resection (Simpson grade 4), radical removal (> 90%) was achieved in 7 cases (70%). In the immediate postoperative period, there were no deaths. Four of 9 patients with visual deficits improved, while the 5 others remained unchanged. Two patients experienced transient neurological deficits. Other than an asymptomatic lacuna of the internal capsule, there were no ischemic lesions following surgery. Tumor recurrence occurred in 5 patients, between 24 and 168 months (mean 61 months) following surgery. CONCLUSIONS Although these giant lesions encasing major cerebral arteries are particularly treacherous for surgery, this series demonstrates that it is possible to safely achieve radical removal and at times even
Closure report for Building 875 sump encased in concrete
International Nuclear Information System (INIS)
Montemayor, W.
1991-08-01
This report will document the post-closure activities for the 875-R1U1 Waste-Solvent Underground Storage Tank located at Lawrence Livermore National Laboratory (LLNL), Site 300. The aforementioned tank waspreviously identified and registered with the California Water Resources Control Board as 875-31R. The underground tank system consists of a 55-gallon steel drum encased in concrete. The underground tank was used to collect dripping and spillage from the above-concrete drum rack storage area. The closure of this underground tank was permitted as Tank Identification No. 39-1945-21 by W.R. Snavely of SJCPHS-EHS. The last tank test, performed on February 1988, showed that the underground tank was leak tight. On May 1988, the sludge at the bottom of the tank was removed and disposed of as hazardous waste. The residual 1.5 inches of oily water in the tank was removed and the tank was washed with soap and water on December 11, 1989. The rinsate and residual sludge was disposed of as hazardous waste. The empty tank and the encasing concrete were extracted from the ground on November 5, 1990. No underground piping was associated with the removal of this underground tank since the tank was used to collect the dripping and spillage from the above-concrete drum rack. Three soil samples were collected in split tubes from approximately 1 foot below the bottom of the tank. The soil samples were collected and analyzed for Total Petroleum Hydrocarbon (TPH)-Gasoline, TPH-Diesel, Total Extractable Petroleum, Benzene, Toluene, Xylene, Ethyl Benzene, Tetraethyl Lead, Metals, Polychlorinated Biphenyls (PCB), and Ethylene Dibromide. Results indicated that the underground tank was leak tight. The concrete encasing was removed from the 55-gallon tank and disposed of as a municipal waste. The 55-gallon tank is currently stored at the Hazardous Waste Storage Area located in Lawrence Livermore National Laboratory, Livermore, California and is waiting as a hazardous waste
Shen, Hui; Fridley, Brooke L.; Song, Honglin; Lawrenson, Kate; Cunningham, Julie M.; Ramus, Susan J.; Cicek, Mine S.; Tyrer, Jonathan; Stram, Douglas; Larson, Melissa C.; Köbel, Martin; Ziogas, Argyrios; Zheng, Wei; Yang, Hannah P.; Wu, Anna H.
2013-01-01
HNF1B is overexpressed in clear cell epithelial ovarian cancer, and we observed epigenetic silencing in serous epithelial ovarian cancer, leading us to hypothesize that variation in this gene differentially associates with epithelial ovarian cancer risk according to histological subtype. Here we comprehensively map variation in HNF1B with respect to epithelial ovarian cancer risk and analyse DNA methylation and expression profiles across histological subtypes. Different single-nucleotide poly...
Bellanné-Chantelot, C; Coste, J; Ciangura, C; Fonfrède, M; Saint-Martin, C; Bouché, C; Sonnet, E; Valéro, R; Lévy, D-J; Dubois-Laforgue, D; Timsit, J
2016-02-01
Low plasma levels of high-sensitivity C-reactive protein (hs-CRP) have been suggested to differentiate hepatocyte nuclear factor 1 alpha-maturity-onset diabetes of the young (HNF1A-MODY) from type 2 diabetes (T2D). Yet, differential diagnosis of HNF1A-MODY and familial young-onset type 2 diabetes (F-YT2D) remains a difficult challenge. Thus, this study assessed the added value of hs-CRP to distinguish between the two conditions. This prospective multicentre study included 143 HNF1A-MODY patients, 310 patients with a clinical history suggestive of HNF1A-MODY, but not confirmed genetically (F-YT2D), and 215 patients with T2D. The ability of models, including clinical characteristics and hs-CRP to predict HNF1A-MODY was analyzed, using the area of the receiver operating characteristic (AUROC) curve, and a grey zone approach was used to evaluate these models in clinical practice. Median hs-CRP values were lower in HNF1A-MODY (0.25mg/L) than in F-YT2D (1.14mg/L) and T2D (1.70mg/L) patients. Clinical parameters were sufficient to differentiate HNF1A-MODY from classical T2D (AUROC: 0.99). AUROC analyses to distinguish HNF1A-MODY from F-YT2D were 0.82 for clinical features and 0.87 after including hs-CRP. For the grey zone analysis, the lower boundary was set to missMODY with F-YT2D, 65% of patients were classified in between these categories - in the zone of diagnostic uncertainty - even after adding hs-CRP to clinical parameters. hs-CRP does not improve the differential diagnosis of HNF1A-MODY and F-YT2D. Copyright © 2015 Elsevier Masson SAS. All rights reserved.
Directory of Open Access Journals (Sweden)
Eun Hee Han
Full Text Available Unique nuclear receptor Hepatocyte Nuclear Factor 4α (HNF4α is an essential transcriptional regulator for early development and proper function of pancreatic ß-cells, and its mutations are monogenic causes of a dominant inherited form of diabetes referred to as Maturity Onset Diabetes of the Young 1 (MODY1. As a gene-specific transcription factor, HNF4α exerts its function through various molecular interactions, but its protein recruiting network has not been fully characterized. Here we report the identification of MED25 as one of the HNF4α binding partners in pancreatic ß-cells leading to insulin secretion which is impaired in MODY patients. MED25 is one of the subunits of the Mediator complex that is required for induction of RNA polymerase II transcription by various transcription factors including nuclear receptors. This HNF4α-MED25 interaction was initially identified by a yeast-two-hybrid method, confirmed by in vivo and in vitro analyses, and proven to be mediated through the MED25-LXXLL motif in a ligand-independent manner. Reporter-gene based transcription assays and siRNA/shRNA-based gene silencing approaches revealed that this interaction is crucial for full activation of HNF4α-mediated transcription, especially expression of target genes implicated in glucose-stimulated insulin secretion. Selected MODY mutations at the LXXLL motif binding pocket disrupt these interactions and cause impaired insulin secretion through a 'loss-of-function' mechanism.
International Nuclear Information System (INIS)
Harries, Lorna W; Perry, John RB; McCullagh, Paul; Crundwell, Malcolm
2010-01-01
Genome wide association studies (GWAS) have identified several genetic variants that are associated with prostate cancer. Most of these variants, like other GWAS association signals, are located in non-coding regions of potential candidate genes, and thus could act at the level of the mRNA transcript. We measured the expression and isoform usage of seven prostate cancer candidate genes in benign and malignant prostate by real-time PCR, and correlated these factors with cancer status and genotype at the GWAS risk variants. We determined that levels of LMTK2 transcripts in prostate adenocarcinomas were only 32% of those in benign tissues (p = 3.2 × 10 -7 ), and that an independent effect of genotype at variant rs6465657 on LMTK2 expression in benign (n = 39) and malignant tissues (n = 21) was also evident (P = 0.002). We also identified that whilst HNF1B(C) and MSMB2 comprised the predominant isoforms in benign tissues (90% and 98% of total HNF1B or MSMB expression), HNF1B(B) and MSMB1 were predominant in malignant tissue (95% and 96% of total HNF1B or MSMB expression; P = 1.7 × 10 -7 and 4 × 10 -4 respectively), indicating major shifts in isoform usage. Our results indicate that the amount or nature of mRNA transcripts expressed from the LMTK2, HNF1B and MSMB candidate genes is altered in prostate cancer, and provides further evidence for a role for these genes in this disorder. The alterations in isoform usage we detect highlights the potential importance of alternative mRNA processing and moderation of mRNA stability as potentially important disease mechanisms
Energy Technology Data Exchange (ETDEWEB)
Rho, H.; Jones, C.N.; Rose, R.B. (NCSU)
2010-12-07
The two disparate functions of DCoH1 (dimerization cofactor of HNF-1)/PCD (pterin-4a-carbinolamine dehydratase) are associated with a change in oligomeric state. DCoH dimers enhance the activity of the diabetes-associated transcription factor HNF-1{alpha} (hepatocyte nuclear factor-1{alpha}), while the PCD activity of DCoH1 homotetramers aids in aromatic amino acid metabolism. These complexes compete for the same interface of the DCoH dimer. Formation of the DCoH1/HNF-1{alpha} complex requires cofolding. The homotetramer of the DCoH1 paralogue, DCoH2, interacts with HNF-1{alpha} through simple mixing. To further investigate regulation of DCoH/HNF-1{alpha} complex formation, we measured the stability of the DCoH1 homotetramer through unfolding studies by intrinsic tryptophan fluorescence. DCoH2 unfolding is reversible. Surprisingly, the DCoH1 homotetramer is resistant to guanidine unfolding but refolds at a much lower guanidine concentration. We show that a point mutation at the DCoH1 tetramer interface, Thr 51 Ser, overcomes the dissociation barrier of the homotetramer and increases the interaction with HNF-1{alpha}. The 1.8 {angstrom} resolution crystal structure of DCoH1 T51S shows the presence of an ordered water molecule at the tetramer interface, as in DCoH2, which may destabilize the homotetramer. The equilibrium unfolding data were fit to a two-state model with no apparent intermediate. Folding intermediates were detectable by size exclusion chromatography. For wild-type DCoH1 the intermediates changed with time, suggesting a kinetic origin for the unfolding barrier of the homotetramer. We propose an unfolding pathway in which the tetramer unfolds slowly, but the dimer folds reversibly. Implications for regulation of DCoH1/HNF-1{alpha} complex formation are discussed.
Directory of Open Access Journals (Sweden)
Gordan Lauc
2010-12-01
Full Text Available Over half of all proteins are glycosylated, and alterations in glycosylation have been observed in numerous physiological and pathological processes. Attached glycans significantly affect protein function; but, contrary to polypeptides, they are not directly encoded by genes, and the complex processes that regulate their assembly are poorly understood. A novel approach combining genome-wide association and high-throughput glycomics analysis of 2,705 individuals in three population cohorts showed that common variants in the Hepatocyte Nuclear Factor 1α (HNF1α and fucosyltransferase genes FUT6 and FUT8 influence N-glycan levels in human plasma. We show that HNF1α and its downstream target HNF4α regulate the expression of key fucosyltransferase and fucose biosynthesis genes. Moreover, we show that HNF1α is both necessary and sufficient to drive the expression of these genes in hepatic cells. These results reveal a new role for HNF1α as a master transcriptional regulator of multiple stages in the fucosylation process. This mechanism has implications for the regulation of immunity, embryonic development, and protein folding, as well as for our understanding of the molecular mechanisms underlying cancer, coronary heart disease, and metabolic and inflammatory disorders.
Cai, Wang-Yu; Lin, Ling-Yun; Hao, Han; Zhang, Sai-Man; Ma, Fei; Hong, Xin-Xin; Zhang, Hui; Liu, Qing-Feng; Ye, Guo-Dong; Sun, Guang-Bin; Liu, Yun-Jia; Li, Sheng-Nan; Xie, Yuan-Yuan; Cai, Jian-Chun; Li, Bo-An
2017-04-01
Great progress has been achieved in the study of Hippo signaling in regulating tumorigenesis; however, the downstream molecular events that mediate this process have not been completely defined. Moreover, regulation of Hippo signaling during tumorigenesis in hepatocellular carcinoma (HCC) remains largely unknown. In the present study, we systematically investigated the relationship between Yes-associated protein/TEA domain family member (YAP-TEAD) and hepatocyte nuclear factor 4-alpha (HNF4α) in the hepatocarcinogenesis of HCC cells. Our results indicated that HNF4α expression was negatively regulated by YAP1 in HCC cells by a ubiquitin proteasome pathway. By contrast, HNF4α was found to directly associate with TEAD4 to compete with YAP1 for binding to TEAD4, thus inhibiting the transcriptional activity of YAP-TEAD and expression of their target genes. Moreover, overexpression of HNF4α was found to significantly compromise YAP-TEAD-induced HCC cell proliferation and stem cell expansion. Finally, we documented the regulatory mechanism between YAP-TEAD and HNF4α in rat and mouse tumor models, which confirmed our in vitro results. There is a double-negative feedback mechanism that controls TEAD-YAP and HNF4α expression in vitro and in vivo, thereby regulating cellular proliferation and differentiation. Given that YAP acts as a dominant oncogene in HCC and plays a crucial role in stem cell homeostasis and tissue regeneration, manipulating the interaction between YAP, TEADs, and HNF4α may provide a new approach for HCC treatment and regenerative medicine. (Hepatology 2017;65:1206-1221). © 2016 by the American Association for the Study of Liver Diseases.
Wei, Shengnan; Zhang, Ming; Yu, Yang; Xue, Huan; Lan, Xiaoxin; Liu, Shuping; Hatch, Grant; Chen, Li
2016-11-15
Hepatocyte Nuclear Factor-4α (HNF-4α) is a key nuclear receptor protein required for liver development. miR-122 is a predominant microRNA expressed in liver and is involved in the regulation of cholesterol and fatty acid metabolism. HNF-4α is know to regulate expression of miR-122 in liver. We examined how HNF-4α regulated gluconeogenesis and lipid metabolism through miR-122 in vivo and in vitro. Expression of miR-122, HNF-4α, phosphoenolpyruvate carboxykinase (PEPCK), glucose-6-phosphatase (G6Pase), sterol response elementary binding protein-1 (SREBP-1), fatty acid synthase-1 (FAS-1), carnitine palmitoyltransferase-1 (CPT-1) and acetyl Coenzyme A carboxylase alpha (ACCα) were determined in livers of Type 2 diabetic mice and in insulin resistant palmitate-treated HepG2 cells. CPT-1 and phosphorylated ACCα expression were significantly decreased in livers of Type 2 diabetic mice and in palmitate-treated HepG2 cells compared to controls. In contrast, expression of miR-122, HNF-4α, PEPCK, G6Pase, SREBP-1, FAS-1 and ACCα were significantly elevated in liver of Type 2 diabetic mice and in palmitate-treated HepG2 cells compared to controls. Expression of HNF-4α increased whereas siRNA knockdown of HNF-4α decreased miR-122 levels in HepG2 cells compared to controls. In addition, expression of HNF-4α in HepG2 cells increased PEPCK, G6Pase, SREBP-1, FAS-1, ACCα mRNA and protein expression and decreased CPT-1 and p-ACCα mRNA and protein expression compared to controls. Addition of miR-122 inhibitors attenuated the HNF-4α mediated effect on expression of these gluconeogenic and lipid metabolism proteins. The results indicate that HNF-4α regulated miR-122 contributes to development of the gluconeogenic and lipid metabolism alterations observed in Type 2 diabetic mice and in palmitate-treated HepG2 cells. Copyright © 2016 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
McCullagh Paul
2010-06-01
Full Text Available Abstract Background Genome wide association studies (GWAS have identified several genetic variants that are associated with prostate cancer. Most of these variants, like other GWAS association signals, are located in non-coding regions of potential candidate genes, and thus could act at the level of the mRNA transcript. Methods We measured the expression and isoform usage of seven prostate cancer candidate genes in benign and malignant prostate by real-time PCR, and correlated these factors with cancer status and genotype at the GWAS risk variants. Results We determined that levels of LMTK2 transcripts in prostate adenocarcinomas were only 32% of those in benign tissues (p = 3.2 × 10-7, and that an independent effect of genotype at variant rs6465657 on LMTK2 expression in benign (n = 39 and malignant tissues (n = 21 was also evident (P = 0.002. We also identified that whilst HNF1B(C and MSMB2 comprised the predominant isoforms in benign tissues (90% and 98% of total HNF1B or MSMB expression, HNF1B(B and MSMB1 were predominant in malignant tissue (95% and 96% of total HNF1B or MSMB expression; P = 1.7 × 10-7 and 4 × 10-4 respectively, indicating major shifts in isoform usage. Conclusions Our results indicate that the amount or nature of mRNA transcripts expressed from the LMTK2, HNF1B and MSMB candidate genes is altered in prostate cancer, and provides further evidence for a role for these genes in this disorder. The alterations in isoform usage we detect highlights the potential importance of alternative mRNA processing and moderation of mRNA stability as potentially important disease mechanisms.
Measurements of fusion cross sections of 16O+46,50Ti systems
International Nuclear Information System (INIS)
Liguori Neto, R.
1986-01-01
Excitation functions for complete fusion of the systems 16 O + 46,50 Ti, with50)Ti, energies near and below the Coulomb barrier, were measured. With the use of the in-beam and out of beam γ spectroscopy, the formation of the compound nucleus was experimentally detected. The fusion cross was then attained by the sum of all observed compound nucleus decay channels. The limitation and advantages of measurements methods are discussed. Theoretical analysis of the experimental results using the semi-classical barrier penetration model allowed us to obtain the fusion barrier height and radius for the studied systems. These values are in good agreement with others reported for this mass range. Using the unidimensional barrier penetration model with different nuclear potentials, describing the heavy ion interactions gave theoretical fusion cross section values systematically smaller than our measured values in the energy region below the Coulomb barrier. The introduction of the nuclear surface zero point vibrations enhances the theoretical fusion cross sections in the sub-Coulomb region, but simultaneoulsy introduces an isotopic difference in the fusion excitation functions that is not observed experimentally. The statistical model predictions for the compound nucleous decay (calculated by the CASCADE program) show reasonable agreement for the more intense decay channels. (author) [pt
Could FISH on buccal smears become a new method of screening in children suspect of HNF1B anomaly?
Laffargue, Fanny; Bourthoumieu, Sylvie; Bellanné-Chantelot, Christine; Guigonis, Vincent; Yardin, Catherine
2013-02-01
HNF1B gene anomalies include renal development defects associated with cysts and are well known by pediatric nephrologists that ask for molecular analysis of this gene. Two types of genomic rearrangements are reported: mutation and more frequently deletion. Using microsatellites or CGH array the size of the deletion was found to be at least of 1.2 Mb including 15 genes among which HNF1B, leading to the diagnosis of chromosomal microdeletion. Fluorescent In Situ Hybridization (FISH) is a simple routinely performed technique, considered as the referring tool to diagnose microdeletion in genetic practice. We performed interphasic FISH on buccal smears from 6 patients known to have HNF1B deletion to valid our technique and to determine the size of the 17q12 deletion. All the patients were found to present a 17q12 microdeletion. Our results showed that FISH is a rapid, reliable and specific technique to diagnose 17q12 microdeletion and might be performed as non invasive sampling procedure useful in pediatric practice. In conclusion we propose to use interphasic FISH to screen pediatric patients presenting with renal abnormalities possibly linked to HNF1B anomaly. Molecular analysis and MLPA (Multiplex Ligand Probe Analysis) could be performed in cases with normal interphasic FISH to detect a point mutation of the gene or more rarely a single exon deletion. Copyright © 2013 Elsevier Masson SAS. All rights reserved.
40 CFR 268.49 - Alternative LDR treatment standards for contaminated soil.
2010-07-01
... 40 Protection of Environment 26 2010-07-01 2010-07-01 false Alternative LDR treatment standards for contaminated soil. 268.49 Section 268.49 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SOLID WASTES (CONTINUED) LAND DISPOSAL RESTRICTIONS Treatment Standards § 268.49 Alternative LDR treatment standards for contaminated...
Terreehorst, I; Duivenvoorden, H J; Tempels-Pavlica, Z; Oosting, A J; de Monchy, J G R; Bruijnzeel-Koomen, C A F M; van Wijk, R Gerth
2005-07-01
Environmental control has been put forward as an integral part of the management of house dust mite (HDM) allergy in sensitized patients. To validate this statement allergic disorders involved in HDM allergy--allergic asthma, rhinitis and atopic eczema/dermatitis syndrome (AEDS)--should be taken together and studied in terms of the efficacy of environmental control. Because a generic quality of life questionnaire exceeds the border of disease, this may be used as major outcome parameter. To study the effects of bedding encasings in HDM allergic patients with asthma, rhinitis and AEDS. A total of 224 adult HDM allergic patients with rhinitis and/or asthma and/or dermatitis were randomly allocated impermeable or nonimpermeable encasings for mattress, pillow and duvet. Short form 36 (SF-36) was filled in at baseline and after 12 months. Lower physical (P = 0.01) and emotional (P effect was seen of encasings on either sumscore. Bedding encasings do not improve quality of life in a mixed population of subjects with combinations with rhinitis, asthma and atopic dermatitis and sensitized to HDMs.
Measurements of fusion cross sections of the 16O+46,50Ti systems
International Nuclear Information System (INIS)
Liguori Neto, R.
1986-01-01
Excitation functions for complete fusion of the systems 16 O + 46,50 Ti, with energies near and below the Coulomb barrier, were measured. With the use of the in-beam and out of beam γ spectroscopy, the formation of the compound nucleus was experimentally detected. The fusion cross section was then attained by the sum of all observed compound nucleus decay channels. The limitation and advantages of measurements methods are discussed. Theoretical analysis of the experimental results using the semi-classical barrier penetration model allowed us to obtain the fusion barrier height and radius for the studied systems. These values are in good agreement with others reported for this mass range. Using the unidimensional barrier penetration model with different nuclear potentials, describing the heavy ion interactions gave theoretical fusion cross section values systematically smaller than our measured values in the energy region below the Coulomb barrier. The introduction of the nuclear surface zero point vibrations enhances the theoretical fusion cross sections in the sub-Coulomb region, but simultaneously introduces an isotopic difference in the fusion excitation functions that is not observed experimentally. The statistical model predictions for the compound nucleus decay (calculated by the CASCADE program) show reasonable agreement for the more intense decay channels [pt
Directory of Open Access Journals (Sweden)
Bahram Jafar-Mohammadi
2009-08-01
Full Text Available There is considerable interest in the hypothesis that low frequency, intermediate penetrance variants contribute to the proportion of Type 2 Diabetes (T2D susceptibility not attributable to the common variants uncovered through genome-wide association approaches. Genes previously implicated in monogenic and multifactorial forms of diabetes are obvious candidates in this respect. In this study, we focussed on exons 8-10 of the HNF1A gene since rare, penetrant mutations in these exons (which are only transcribed in selected HNF1A isoforms are associated with a later age of diagnosis of Maturity onset diabetes of the young (MODY than mutations in exons 1-7. The age of diagnosis in the subgroup of HNF1A-MODY individuals with exon 8-10 mutations overlaps with that of early multifactorial T2D, and we set out to test the hypothesis that these exons might also harbour low-frequency coding variants of intermediate penetrance that contribute to risk of multifactorial T2D.We performed targeted capillary resequencing of HNF1A exons 8-10 in 591 European T2D subjects enriched for genetic aetiology on the basis of an early age of diagnosis ( or =1 affected sibling. PCR products were sequenced and compared to the published HNF1A sequence. We identified several variants (rs735396 [IVS9-24T>C], rs1169304 [IVS8+29T>C], c.1768+44C>T [IVS9+44C>T] and rs61953349 [c.1545G>A, p.T515T] but no novel non-synonymous coding variants were detected.We conclude that low frequency, nonsynonymous coding variants in the terminal exons of HNF1A are unlikely to contribute to T2D-susceptibility in European samples. Nevertheless, the rationale for seeking low-frequency causal variants in genes known to contain rare, penetrant mutations remains strong and should motivate efforts to screen other genes in a similar fashion.
Cervical chordoma with vertebral artery encasement mimicking neurofibroma: MRI findings
Energy Technology Data Exchange (ETDEWEB)
Mortele, B.; Lemmerling, M.; Mortele, K.; Verstraete, K.; Defreyne, L.; Kunnen, M. [Department of Radiology, University Hospital, Gent (Belgium); Vandekerckhove, T. [Department of Neurosurgery, University Hospital, Gent (Belgium)
2000-06-01
A case of cervical chordoma in a 36-year-old white man with hypoesthesia in the neck and right shoulder, neck pain, and restricted neck mobility is presented. Plain radiographs of the cervical spine showed radiolucency of the body of C2 on the right side and enlargement of the right intervertebral foramen at C2-C3 level. Tumor encasement of the vertebral artery was demonstrated by MR imaging and confirmed by conventional arteriography. This proved to be particularly important for preoperative assessment. (orig.)
Cervical chordoma with vertebral artery encasement mimicking neurofibroma: MRI findings
International Nuclear Information System (INIS)
Mortele, B.; Lemmerling, M.; Mortele, K.; Verstraete, K.; Defreyne, L.; Kunnen, M.; Vandekerckhove, T.
2000-01-01
A case of cervical chordoma in a 36-year-old white man with hypoesthesia in the neck and right shoulder, neck pain, and restricted neck mobility is presented. Plain radiographs of the cervical spine showed radiolucency of the body of C2 on the right side and enlargement of the right intervertebral foramen at C2-C3 level. Tumor encasement of the vertebral artery was demonstrated by MR imaging and confirmed by conventional arteriography. This proved to be particularly important for preoperative assessment. (orig.)
Implementation guide for Hanford Tanks Initiative C-106 heel retrieval contract management HNF-2511
International Nuclear Information System (INIS)
McDaniel, L.B.
1998-01-01
This report is an Implementation Guide for Hanford Tanks Initiative C-106 heel retrieval contract management HNF-2511 to provide a set of uniform instructions for managing the two contractors selected. The primary objective is to produce the necessary deliverables and services for the HTI project within schedule and budget
Pinés Corrales, Pedro José; López Garrido, María P; Aznar Rodríguez, Silvia; Louhibi Rubio, Lynda; López Jiménez, Luz M; Lamas Oliveira, Cristina; Alfaro Martínez, Jose J; Lozano García, Jose J; Hernández López, Antonio; Requejo Castillo, Ramón; Escribano Martínez, Julio; Botella Romero, Francisco
2010-01-01
The aim of our study was to describe and evaluate the clinical and metabolic characteristics of patients with MODY-3, MODY-2 or type 2 diabetes who presented I27L polymorphism in the HNF1alpha gene. The study included 31 previously diagnosed subjects under follow-up for MODY-3 (10 subjects from 5 families), MODY-2 (15 subjects from 9 families), or type 2 diabetes (6 subjects) with I27L polymorphism in the HNF1alpha gene. The demographic, clinical, metabolic, and genetic characteristics of all patients were analyzed. No differences were observed in distribution according to sex, age of onset, or form of diagnosis. All patients with MODY-2 or MODY-3 had a family history of diabetes. In contrast, 33.3% of patients with type 2 diabetes mellitus and I27L polymorphism in the HNF1alpha gene had no family history of diabetes (p MODY-3 patients, but not required by 100% of MODY-2 patients or 16.7% of patients with type 2 diabetes mellitus and I27L polymorphism in the HNF1alpha gene (p MODY-2, MODY-3 or type 2 diabetes of atypical characteristics, in this case patients who present I27L polymorphism in the HNF1alpha gene. Copyright 2010 Sociedad Española de Endocrinología y Nutrición. Published by Elsevier Espana. All rights reserved.
Tatsi, Christina; Kanaka-Gantenbein, Christina; Vazeou-Gerassimidi, Adriani; Chrysis, Dionysios; Delis, Dimitrios; Tentolouris, Nikolaos; Dacou-Voutetakis, Catherine; Chrousos, George P; Sertedaki, Amalia
2013-11-01
Maturity-Onset Diabetes of the Young (MODY) is the most common type of monogenic diabetes accounting for 1-2% of the population with diabetes. The relative incidence of HNF1A-MODY (MODY3) is high in European countries; however, data are not available for the Greek population. The aims of this study were to determine the relative frequency of MODY3 in Greece, the type of the mutations observed, and their relation to the phenotype of the patients. Three hundred ninety-five patients were referred to our center because of suspected MODY during a period of 15 yr. The use of Denaturing Gradient Gel Electrophoresis of polymerase chain reaction amplified DNA revealed 72 patients carrying Glucokinase gene mutations (MODY2) and 8 patients carrying HNF1A gene mutations (MODY3). After using strict criteria, 54 patients were selected to be further evaluated by direct sequencing or by multiplex ligation probe amplification (MLPA) for the presence of HNF1A gene mutations. In 16 unrelated patients and 13 of their relatives, 15 mutations were identified in the HNF1A gene. Eight of these mutations were previously reported, whereas seven were novel. Clinical features, such as age of diabetes at diagnosis or severity of hyperglycemia, were not related to the mutation type or location. In our cohort of patients fulfilling strict clinical criteria for MODY, 12% carried an HNF1A gene mutation, suggesting that defects of this gene are responsible for a significant proportion of monogenic diabetes in the Greek population. No clear phenotype-genotype correlations were identified. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
12 CFR 268.101 - General policy for equal opportunity.
2010-01-01
... Discrimination in Employment Act (ADEA) (29 U.S.C. 621 et seq.), the Equal Pay Act (29 U.S.C. 206(d)), or the... 12 Banks and Banking 3 2010-01-01 2010-01-01 false General policy for equal opportunity. 268.101... RESERVE SYSTEM RULES REGARDING EQUAL OPPORTUNITY Board Program To Promote Equal Opportunity § 268.101...
2010-10-01
... TRANSPORTATION MAGNETIC LEVITATION TRANSPORTATION TECHNOLOGY DEPLOYMENT PROGRAM Overview § 268.1 Definitions. As used in this part— CMAQ means Congestion Mitigation and Air Quality Improvement Program (23 U.S.C. 149... Stat. 1978). Under that usage any corridor exhibiting Partnership Potential must at least meet the...
Waste Analysis Plan for the Low-Level Burial Grounds [CANCELLED] Reissued as HNF-5841
International Nuclear Information System (INIS)
ELLEFSON, M.D.
2000-01-01
Canceled see HNF-5841 Rev 0. This waste analysis plan (WAP) has been prepared for the Low-Level Burial Grounds which are located in the 200 East and West Areas of the Hanford Facility, Richland, Washington. This WAP documents the methods used to characterize, obtain and analyze representative samples of waste managed at this unit
40 CFR 268.35 - Waste specific prohibitions-petroleum refining wastes.
2010-07-01
... 40 Protection of Environment 26 2010-07-01 2010-07-01 false Waste specific prohibitions-petroleum refining wastes. 268.35 Section 268.35 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED... generator may use knowledge of the waste. If the waste contains constituents in excess of the applicable...
40 CFR 268.36 - Waste specific prohibitions-inorganic chemical wastes
2010-07-01
... 40 Protection of Environment 26 2010-07-01 2010-07-01 false Waste specific prohibitions-inorganic chemical wastes 268.36 Section 268.36 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED... generator may use knowledge of the waste. If the waste contains regulated constituents in excess of the...
Fernandez, Naiara; Duffy, Oliver B.; Hudec, Michael R.; Jackson, Christopher A.-L.; Dooley, Tim P.; Jackson, Martin P. A.; Burg, George
2017-04-01
The SE Precaspian Basin is characterized by an assemblage of Upper Permian to Triassic minibasins. A recently acquired borehole-constrained 3D reflection dataset reveals the existence of abundant intrasalt reflection packages lying in between the Permo-Triassic minibasins. We propose that most of the mapped intrasalt reflection packages in the study area are minibasins originally deposited on top of salt that were later incorporated into salt by encasement processes. This makes the SE Precaspian Basin a new example of a salt province populated by encased minibasins, which until now had been mainly described from the Gulf of Mexico. Identifying salt-encased sediment packages in the study area has been crucial, not only because they provide a new exploration target, but also because they can play a key role on improving seismic imaging of adjacent or deeper stratigraphic sections. Another remarkable feature observed in the seismic dataset is the widespread occurrence of distinct seismic sequences in the Permo-Triassic minibasins. Bowl- and wedge-shaped seismic sequences define discrete periods of vertical and asymmetric minibasin subsidence. In the absence of shortening, the bowl-to-wedge transition is typically associated with the timing of basal welding and subsequent rotation of the minibasins. Timing of minibasin welding has important implications when addressing the likelihood of suprasalt reservoir charging. We performed a set of 2D numerical simulations aimed at investigating what drives the tilting of minibasins and how it relates to welding. A key observation from the numerical models is that the bowl-to-wedge transition can predate the time of basal welding.
The Of emission lines near 4650 A
International Nuclear Information System (INIS)
Underhill, A.B.; Gilroy, K.K.; Hill, G.M.
1989-01-01
Rectified, normalized, high S/N intensity tracings of nine Of stars were obtained from Reticon spectra in the 4550-4800-A region. The well-known relatively sharp Of emission lines are seen to stand on pedestals of broad weak emission somewhat like the broad emission lines from WR stars. It is suggested that cascades following dielectronic recombination may be an important process driving some lines of N III, C III, and C IV into the emission of Of stars, and that the sharp Of lines come from plasma that is stationary with respect to the star. The broad emission features show an extensive low-density wind from each star. The results imply that the detection of two, more or less equal, broad jumps in the rest spectra of galaxies at about 4640 and 4686 A is more indicative of Of stars than of WR stars. 32 refs
Mrozinska, Sandra; Radkowski, Piotr; Gosiewski, Tomasz; Szopa, Magdalena; Bulanda, Malgorzata; Ludwig-Galezowska, Agnieszka H; Morawska, Iwona; Sroka-Oleksiak, Agnieszka; Matejko, Bartlomiej; Kapusta, Przemyslaw; Salamon, Dominika; Malecki, Maciej T; Wolkow, Pawel; Klupa, Tomasz
2016-01-01
Background . Type 2 diabetes mellitus (T2DM) is determined by genetic and environmental factors. There have been many studies on the relationship between the composition of the gastrointestinal bacterial flora, T2DM, and obesity. There are no data, however, on the gut microbiome structure in monogenic forms of the disease including Maturity Onset Diabetes of the Young (MODY). Methods . The aim of the investigation was to compare the qualitative parameters of the colonic flora in patients with HNF1A - MODY and T2DM and healthy individuals. 16S sequencing of bacterial DNA isolated from the collected fecal samples using the MiSeq platform was performed. Results . There were significant between-group differences in the bacterial profile. At the phylum level, the amount of Proteobacteria was higher ( p = 0.0006) and the amount of Bacteroidetes was lower ( p = 0.0005) in T2DM group in comparison to the control group. In HNF1A-MODY group, the frequency of Bacteroidetes was lower than in the control group ( p = 0.0143). At the order level, Turicibacterales was more abundant in HNF1A-MODY group than in T2DM group. Conclusions . It appears that there are differences in the gut microbiome composition between patients with HNF1A-MODY and type 2 diabetes. Further investigation on this matter should be conducted.
Directory of Open Access Journals (Sweden)
Sandra Mrozinska
2016-01-01
Full Text Available Background. Type 2 diabetes mellitus (T2DM is determined by genetic and environmental factors. There have been many studies on the relationship between the composition of the gastrointestinal bacterial flora, T2DM, and obesity. There are no data, however, on the gut microbiome structure in monogenic forms of the disease including Maturity Onset Diabetes of the Young (MODY. Methods. The aim of the investigation was to compare the qualitative parameters of the colonic flora in patients with HNF1A-MODY and T2DM and healthy individuals. 16S sequencing of bacterial DNA isolated from the collected fecal samples using the MiSeq platform was performed. Results. There were significant between-group differences in the bacterial profile. At the phylum level, the amount of Proteobacteria was higher (p=0.0006 and the amount of Bacteroidetes was lower (p=0.0005 in T2DM group in comparison to the control group. In HNF1A-MODY group, the frequency of Bacteroidetes was lower than in the control group (p=0.0143. At the order level, Turicibacterales was more abundant in HNF1A-MODY group than in T2DM group. Conclusions. It appears that there are differences in the gut microbiome composition between patients with HNF1A-MODY and type 2 diabetes. Further investigation on this matter should be conducted.
Huang, Tao; Wang, Tiange; Heianza, Yoriko; Sun, Dianjianyi; Ivey, Kerry; Durst, Ronen; Schwarzfuchs, Dan; Stampfer, Meir J; Bray, George A; Sacks, Frank M; Shai, Iris; Qi, Lu
2018-06-01
To determine whether weight-loss diets varying in macronutrients modulate the genetic effect of hepatocyte nuclear factor 1α (HNF1A) rs7957197 on weight loss and improvement of insulin resistance. We analysed the interaction between HNF1A rs7957197 and weight-loss diets with regard to weight loss and insulin resistance improvement among 722 overweight/obese adults from a 2-year randomized weight-loss trial, the POUNDS Lost trial. The findings were replicated in another independent 2-year weight-loss trial, the Dietary Intervention Randomized Controlled Trial (DIRECT), in 280 overweight/obese adults. In the POUNDS Lost trial, we found that a high-fat diet significantly modified the genetic effect of HNF1A on weight loss and reduction in waist circumference (P for interaction = .006 and .005, respectively). Borderline significant interactions for fasting insulin and insulin resistance (P for interaction = .07 and .06, respectively) were observed. We replicated the results in DIRECT. Pooled results showed similar significant interactions with weight loss, waist circumference reduction, and improvement in fasting insulin and insulin resistance (P values for interaction = .001, .005, .02 and .03, respectively). Greater decreases in weight, waist circumference, fasting insulin level and insulin resistance were observed in participants with the T allele compared to those without the T allele in the high-fat diet group (P = .04, .03 and .01, respectively). Our replicable findings provide strong evidence that individuals with the HNF1A rs7957197 T allele might obtain more benefits in weight loss and improvement of insulin resistance by choosing a hypocaloric and high-fat diet. © 2018 John Wiley & Sons Ltd.
Energy Technology Data Exchange (ETDEWEB)
Mattigod, Shas V.; Wellman, Dawn M.; Bovaird, Chase C.; Parker, Kent E.; Clayton, Libby N.; Powers, Laura; Recknagle, Kurtis P.; Wood, Marcus I.
2011-08-31
One of the methods being considered for safely disposing of Category 3 low-level radioactive wastes is to encase the waste in concrete. Such concrete encasement would contain and isolate the waste packages from the hydrologic environment and would act as an intrusion barrier. The current plan for waste isolation consists of stacking low-level waste packages on a trench floor, surrounding the stacks with reinforced steel, and encasing these packages in concrete. These concrete-encased waste stacks are expected to vary in size with maximum dimensions of 6.4 m long, 2.7 m wide, and 4 m high. The waste stacks are expected to have a surrounding minimum thickness of 15 cm of concrete encasement. These concrete-encased waste packages are expected to withstand environmental exposure (solar radiation, temperature variations, and precipitation) until an interim soil cover or permanent closure cover is installed, and to remain largely intact thereafter. Any failure of concrete encasement may result in water intrusion and consequent mobilization of radionuclides from the waste packages. The mobilized radionuclides may escape from the encased concrete by mass flow and/or diffusion and move into the surrounding subsurface environment. Therefore, it is necessary to assess the performance of the concrete encasement structure and the ability of the surrounding soil to retard radionuclide migration. The retardation factors for radionuclides contained in the waste packages can be determined from measurements of diffusion coefficients for these contaminants through concrete and fill material. Some of the mobilization scenarios include (1) potential leaching of waste form before permanent closure cover is installed; (2) after the cover installation, long-term diffusion of radionuclides from concrete waste form into surrounding fill material; (3) diffusion of radionuclides from contaminated soils into adjoining concrete encasement and clean fill material. Additionally, the rate of
Whisker and Hillock formation on Sn, Sn-Cu and Sn-Pb electrodeposits
International Nuclear Information System (INIS)
Boettinger, W.J.; Johnson, C.E.; Bendersky, L.A.; Moon, K.-W.; Williams, M.E.; Stafford, G.R.
2005-01-01
High purity bright Sn, Sn-Cu and Sn-Pb layers, 3, 7 and 16 μm thick were electrodeposited on phosphor bronze cantilever beams in a rotating disk apparatus. Beam deflection measurements within 15 min of plating proved that all electrodeposits had in-plane compressive stress. In several days, the surfaces of the Sn-Cu deposits, which have the highest compressive stress, develop 50 μm contorted hillocks and 200 μm whiskers, pure Sn deposits develop 20 μm compact conical hillocks, and Sn-Pb deposits, which have the lowest compressive stress, remain unchanged. The differences between the initial compressive stresses for each alloy and pure Sn is due to the rapid precipitation of Cu 6 Sn 5 or Pb particles, respectively, within supersaturated Sn grains produced by electrodeposition. Over longer time, analysis of beam deflection measurements indicates that the compressive stress is augmented by the formation of Cu 6 Sn 5 on the bronze/Sn interface, while creep of the electrodeposit tends to decrease the compressive stress. Uniform creep occurs for Sn-Pb because it has an equi-axed grain structure. Localized creep in the form of hillocks and whiskers occurs for Sn and Sn-Cu because both have columnar structures. Compact hillocks form for the Sn deposits because the columnar grain boundaries are mobile. Contorted hillocks and whiskers form for the Sn-Cu deposits because the columnar grain boundary motion is impeded
40 CFR 268.20 - Waste specific prohibitions-Dyes and/or pigments production wastes.
2010-07-01
... 40 Protection of Environment 26 2010-07-01 2010-07-01 false Waste specific prohibitions-Dyes and/or pigments production wastes. 268.20 Section 268.20 Protection of Environment ENVIRONMENTAL... Disposal § 268.20 Waste specific prohibitions—Dyes and/or pigments production wastes. (a) Effective August...
Babeu, Jean-Philippe; Jones, Christine; Geha, Sameh; Carrier, Julie C; Boudreau, François
2018-06-13
HNF4α is a key nuclear receptor for regulating gene expression in the gut. While both P1 and P2 isoform classes of HNF4α are expressed in colonic epithelium, specific inhibition of P1 isoforms is commonly found in colorectal cancer. Previous studies have suggested that P1 and P2 isoforms may regulate different cellular functions. Despite these advances, it remains unclear whether these isoform classes are functionally divergent in the context of human biology. Here, the consequences of specific inhibition of P1 or P2 isoform expression was measured in a human colorectal cancer cell transcriptome. Results indicate that P1 isoforms were specifically associated with the control of cell metabolism while P2 isoforms globally supported aberrant oncogenic signalization, promoting cancer cell survival and progression. P1 promoter-driven isoform expression was found to be repressed by β-catenin, one of the earliest oncogenic pathways to be activated during colon tumorigenesis. These findings identify a novel cascade by which the expression of P1 isoforms are rapidly shut down in the early stages of colon tumorigenesis, allowing a change in HNF4α-dependent transcriptome thereby promoting colorectal cancer progression. © 2018. Published by The Company of Biologists Ltd.
Directory of Open Access Journals (Sweden)
Magdalena Szopa
2015-01-01
Full Text Available Introduction. We previously showed that in HNF1A-MODY the cystatin C-based glomerular filtration rate (GFR estimate is higher than the creatinine-based estimate. Currently, we aimed to replicate this finding and verify its clinical significance. Methods. The study included 72 patients with HNF1A-MODY, 72 with GCK-MODY, 53 with type 1 diabetes (T1DM, 70 with type 2 diabetes (T2DM, and 65 controls. Serum creatinine and cystatin C levels were measured. GFR was calculated from creatinine and cystatin C using the CKD-EPI creatinine equation (eGRF-cr and CKD-EPI cystatin C equation (eGFR-cys, respectively. Results. Cystatin C levels were lower (p<0.001 in the control (0.70±0.13 mg/L, HNF1A (0.75±0.21, and GCK (0.72±0.16 mg/L groups in comparison to those with either T1DM (0.87±0.15 mg/L or T2DM (0.9±0.23 mg/L. Moreover, eGFR-cys was higher than eGRF-cr in HNF1A-MODY, GCK-MODY, and the controls (p=0.004; p=0.003; p<0.0001. This corresponded to 8.9 mL/min/1.73 m2, 9.7 mL/min/1.73 m2, and 16.9 mL/min/1.73 m2 of difference. Additionally, T1DM patients had higher eGFR-cr than eGFR-cys (11.6 mL/min/1.73 m2; p=0.0004; no difference occurred in T2DM (p=0.91. Conclusions. We confirmed that eGFR-cys values in HNF1A-MODY patients are higher compared to eGFR-cr. Some other differences were also described in diabetic groups. However, none of them appears to be clinically relevant.
Effect of mattress and pillow encasings on children with asthma and house dust mite allergy
DEFF Research Database (Denmark)
Halken, Susanne; Høst, Arne; Niklassen, Ulla
2003-01-01
BACKGROUND: House dust mite (HDM) allergy is a frequent cause of allergic asthma in children. Reduction of exposure seems to be the most logical way to treat these patients. OBJECTIVE: Our aim was to investigate whether mattress and pillow encasings resulted in an effective long-term control of H...
López-Garrido, M P; Herranz-Antolín, S; Alija-Merillas, M J; Giralt, P; Escribano, J
2013-09-01
To determine the genetic basis of dominant early-onset diabetes mellitus in two families. Molecular analysis by PCR sequencing of the promoter, the 5' untranslated region (UTR) and exons of both GCK and HNF1A genes was carried out in two families with clinically diagnosed dominant diabetes mellitus. The novel HNF1A c.-154_-160TGGGGGT mutation, located in the 5' UTR, was present in several members of the two families in the heterozygous state. Interestingly, the GCK p.Y61X mutation was also identified in three members of one of the families, and two of them carried both mutations in heterozygosis. To the best of our knowledge, this is the first report of the co-inheritance of GCK and HNF1A mutations and the coexistence of maturity-onset diabetes of the young (MODY) 2, MODY 3 and unusual MODY 2-3 genotypes in the same family. Carriers of both GCK and HNF1A mutations manifested a typical MODY 3 phenotype and showed that the presence of a second mutation in the GCK gene apparently did not modify the clinical outcome, at least at the time of this study. Our data show that co-inheritance of MODY 2 and MODY 3 mutations should be considered, at least in some cases, for accurate genetic testing. © 2012 John Wiley & Sons Ltd.
International Nuclear Information System (INIS)
BLACK, D.M.
1999-01-01
This document presents the Project's position on compliance with the SNF Project NRC Equivalency Criteria - HNF-SD-SNF-DE-003, Spent Nuclear Fuel Project Path Forward Additional NRC Requirements. No non-compliances are shown. The compliance statements have been reviewed and approved by DOE. Open items are scheduled to be closed prior to project completion
MiR-495 and miR-218 regulate the expression of the Onecut transcription factors HNF-6 and OC-2
Energy Technology Data Exchange (ETDEWEB)
Simion, Alexandru; Laudadio, Ilaria; Prevot, Pierre-Paul; Raynaud, Peggy; Lemaigre, Frederic P. [Universite catholique de Louvain, de Duve Institute, 75 Avenue Hippocrate 7529, B-1200 Brussels (Belgium); Jacquemin, Patrick, E-mail: patrick.jacquemin@uclouvain.be [Universite catholique de Louvain, de Duve Institute, 75 Avenue Hippocrate 7529, B-1200 Brussels (Belgium)
2010-01-01
MicroRNAs are small, non-coding RNAs that posttranscriptionally regulate gene expression mainly by binding to the 3'UTR of their target mRNAs. Recent data revealed that microRNAs have an important role in pancreas and liver development and physiology. Using cloning and microarray profiling approaches, we show that a unique repertoire of microRNAs is expressed at the onset of liver and pancreas organogenesis, and in pancreas and liver at key stages of cell fate determination. Among the microRNAs that are expressed at these stages, miR-495 and miR-218 were predicted to, respectively, target the Onecut (OC) transcription factors Hepatocyte Nuclear Factor-6 (HNF-6/OC-1) and OC-2, two important regulators of liver and pancreas development. MiR-495 and miR-218 are dynamically expressed in developing liver and pancreas, and by transient transfection, we show that they target HNF-6 and OC-2 3'UTRs. Moreover, when overexpressed in cultured cells, miR-495 and miR-218 decrease the endogenous levels of HNF-6 and OC-2 mRNA. These results indicate that the expression of regulators of liver and pancreas development is modulated by microRNAs. They also suggest a developmental role for miR-495 and miR-218.
MiR-495 and miR-218 regulate the expression of the Onecut transcription factors HNF-6 and OC-2
International Nuclear Information System (INIS)
Simion, Alexandru; Laudadio, Ilaria; Prevot, Pierre-Paul; Raynaud, Peggy; Lemaigre, Frederic P.; Jacquemin, Patrick
2010-01-01
MicroRNAs are small, non-coding RNAs that posttranscriptionally regulate gene expression mainly by binding to the 3'UTR of their target mRNAs. Recent data revealed that microRNAs have an important role in pancreas and liver development and physiology. Using cloning and microarray profiling approaches, we show that a unique repertoire of microRNAs is expressed at the onset of liver and pancreas organogenesis, and in pancreas and liver at key stages of cell fate determination. Among the microRNAs that are expressed at these stages, miR-495 and miR-218 were predicted to, respectively, target the Onecut (OC) transcription factors Hepatocyte Nuclear Factor-6 (HNF-6/OC-1) and OC-2, two important regulators of liver and pancreas development. MiR-495 and miR-218 are dynamically expressed in developing liver and pancreas, and by transient transfection, we show that they target HNF-6 and OC-2 3'UTRs. Moreover, when overexpressed in cultured cells, miR-495 and miR-218 decrease the endogenous levels of HNF-6 and OC-2 mRNA. These results indicate that the expression of regulators of liver and pancreas development is modulated by microRNAs. They also suggest a developmental role for miR-495 and miR-218.
Hohendorff, J; Szopa, M; Skupien, J; Kapusta, M; Zapala, B; Platek, T; Mrozinska, S; Parpan, T; Glodzik, W; Ludwig-Galezowska, A; Kiec-Wilk, B; Klupa, T; Malecki, M T
2017-08-01
SGLT2 inhibitors are a new class of oral hypoglycemic agents used in type 2 diabetes (T2DM). Their effectiveness in maturity onset diabetes of the young (MODY) is unknown. We aimed to assess the response to a single dose of 10 mg dapagliflozin in patients with Hepatocyte Nuclear Factor 1 Alpha (HNF1A)-MODY, Glucokinase (GCK)-MODY, and type 2 diabetes. We examined 14 HNF1A-MODY, 19 GCK-MODY, and 12 type 2 diabetes patients. All studied individuals received a single morning dose of 10 mg of dapagliflozin added to their current therapy of diabetes. To assess the response to dapagliflozin we analyzed change in urinary glucose to creatinine ratio and serum 1,5-Anhydroglucitol (1,5-AG) level. There were only four patients with positive urine glucose before dapagliflozin administration (one with HNF1A-MODY, two with GCK-MODY, and one with T2DM), whereas after SGLT-2 inhibitor use, glycosuria occurred in all studied participants. Considerable changes in mean glucose to creatinine ratio after dapagliflozin administration were observed in all three groups (20.51 ± 12.08, 23.19 ± 8.10, and 9.84 ± 6.68 mmol/mmol for HNF1A-MODY, GCK-MODY, and T2DM, respectively, p MODY, respectively), but not between the two MODY forms (p = 0.7231). Significant change in serum 1,5-AG was noticed only in T2DM and it was -6.57 ± 7.34 mg/ml (p = 0.04). A single dose of dapagliflozin, an SGLT-2 inhibitor, induces higher glycosuria in GCK- and HNF1A-MODY than in T2DM. Whether flozins are a valid therapeutic option in these forms of MODY requires long-term clinical studies.
International Nuclear Information System (INIS)
HAMMERS, J.S.
1999-01-01
The purpose of the test was to verify that the AN Tank Farm B Pit Leak Detector components are functionally integrated and operate in accordance with engineering design specifications. The Acceptance Test Procedure HNF-4646,241-AN-B-Pit Leak Detection ANB-WT-LDSTA-231 was conducted between 26 June and 02 July 1999 at the 200E AN Tank Farm. The test has been completed with no open test exceptions. The test was conducted prior to final engineering ''as built'' activities being completed this had no impact on the procedure or test results. All components, identified in the procedure were found to be labeled and identified as written in the procedure
Wei, Shengnan; Zhang, Ming; Yu, Yang; Lan, Xiaoxin; Yao, Fan; Yan, Xin; Chen, Li; Hatch, Grant M
2016-01-01
Berberine (BBR) has been shown to exhibit protective effects against diabetes and dyslipidemia. Previous studies have indicated that BBR modulates lipid metabolism and inhibits hepatic gluconeogensis by decreasing expression of Hepatocyte Nuclear Factor-4α (HNF-4α). However, the mechanism involved in this process was unknown. In the current study, we examined the mechanism of how BBR attenuates hepatic gluconeogenesis and the lipid metabolism alterations observed in type 2 diabetic (T2D) mice and in palmitate (PA)-incubated HepG2 cells. Treatment with BBR for 4 weeks improve all biochemical parameters compared to T2D mice. Treatment of T2D mice for 4 weeks or treatment of PA-incubated HepG2 cells for 24 h with BBR decreased expression of HNF-4α and the microRNA miR122, the key gluconeogenesis enzymes Phosphoenolpyruvate carboxykinase (PEPCK) and Glucose-6-phosphatase (G6Pase) and the key lipid metabolism proteins Sterol response element binding protein-1 (SREBP-1), Fatty acid synthase-1 (FAS-1) and Acetyl-Coenzyme A carboxylase (ACCα) and increased Carnitine palmitoyltransferase-1(CPT-1) compared to T2D mice or PA-incubated HepG2 cells. Expression of HNF-4α in HepG2 cells increased expression of gluconeogenic and lipid metabolism enzymes and BBR treatment or knock down of miR122 attenuated the effect of HNF-4α expression. In contrast, BBR treatment did not alter expression of gluconeogenic and lipid metabolism enzymes in HepG2 cells with knockdown of HNF-4α. In addition, miR122 mimic increased expression of gluconeogenic and lipid metabolism enzymes in HepG2 cells with knockdown of HNF-4α. These data indicate that miR122 is a critical regulator in the downstream pathway of HNF-4α in the regulation of hepatic gluconeogenesis and lipid metabolism in HepG2 cells. The effect of BBR on hepatic gluconeogenesis and lipid metabolism is mediated through HNF-4α and is regulated downstream of miR122. Our data provide new evidence to support HNF-4α and miR122
PFP Commercial Grade Food Pack Cans for Plutonium Handling and Storage Critical Characteristics
International Nuclear Information System (INIS)
BONADIE, E.P.
1999-01-01
This document specifies the critical characteristics for Commercial Grade Items (CGI) procured for PFP's Vault Operations system as required by HNF-PRO-268 and HNF-PRO-1819. These are the minimum specifications that the equipment must meet in order to perform its safety function. The changes in these specifications have no detrimental effect on the descriptions and parameters related to handling plutonium solids in the authorization basis. Because no parameters or sequences exceed the limits described in the authorization bases, no accident or abnormal conditions are affected. The specifications prescribed in this critical characteristics document do not represent an unreviewed safety question
Plutonium Finishing Plant (PFP) HVAC System Component Index; FINAL
International Nuclear Information System (INIS)
DICK, J.D.
1999-01-01
This document identities the components, design media, procedures and defines the critical characteristics of Commercial Grade Items necessary to ensure the HVAC system provides these functions. This document lists safety class (SC) and safety significant (SS) components for the Heating Ventilation Air Conditioning (HVAC) and specifies the critical characteristics for Commercial Grade Items (CGI), as required by HNF-PRO-268 and HNF-PRO-1819. These are the minimum specifications that the equipment must meet in order to properly perform its safety function. There may be several manufacturers or models that meet the critical characteristics for any one item
Growth of intermetallics between Sn/Ni/Cu, Sn/Ag/Cu and Sn/Cu layered structures
International Nuclear Information System (INIS)
Horváth, Barbara; Illés, Balázs; Shinohara, Tadashi
2014-01-01
Intermetallic growth mechanisms and rates are investigated in Sn/Ni/Cu, Sn/Ag/Cu and Sn/Cu layer systems. An 8–10 μm thick Sn surface finish layer was electroplated onto a Cu substrate with a 1.5–2 μm thick Ni or Ag barrier layer. In order to induce intermetallic layer growth, the samples were aged in elevated temperatures: 50 °C and 125 °C. Intermetallic layer growth was checked by focused ion beam–scanning ion microscope. The microstructures and chemical compositions of the intermetallic layers were observed with a transmission electron microscope. It has been found that Ni barrier layers can effectively block the development of Cu 6 Sn 5 intermetallics. The intermetallic growth characteristics in the Sn/Cu and Sn/Ni/Cu systems are very similar. The intermetallic layer grows towards the Sn layer and forms a discrete layer. Differences were observed only in the growth gradients and surface roughness of the intermetallic layer which may explain the different tin whiskering properties. It was observed that the intermetallic layer growth mechanisms are completely different in the Ag barrier layers compared to the Ni layers. In the case of Sn/Ag/Cu systems, the Sn and Cu diffused through the Ag layer, formed Cu 6 Sn 5 intermetallics mainly at the Sn/Ag interface and consumed the Ag barrier layer. - Highlights: • Intermetallic growth was characterised in Sn/Ni/Cu, Sn/Ag/Cu and Sn/Cu layer systems. • Intermetallic growth rates and roughness are similar in the Sn/Cu and Sn/Ni/Cu systems. • Sn/Ni/Cu system contains the following intermetallic layer structure Sn–Ni3Sn4–Ni3Sn2–Ni3Sn–Ni. • In the case of Sn/Ag/Cu systems the Sn and Cu diffusion consumes the Ag barrier layer. • When Cu reaches the Sn/Ag interface a large amount of Cu 6 Sn 5 forms above the Ag layer
Time-Dependent Expression of Arc and Zif268 after Acquisition of Fear Conditioning
Directory of Open Access Journals (Sweden)
Mary E. Lonergan
2010-01-01
Full Text Available Memory consolidation requires transcription and translation of new protein. Arc, an effector immediate early gene, and zif268, a regulatory transcription factor, have been implicated in synaptic plasticity underlying learning and memory. This study explored the temporal expression profiles of these proteins in the rat hippocampus following fear conditioning. We observed a time-dependent increase of Arc protein in the dorsal hippocampus 30-to-90-minute post training, returning to basal levels at 4 h. Zif268 protein levels, however, gradually increased at 30-minute post training before peaking in expression at 60 minute. The timing of hippocampal Arc and zif268 expression coincides with the critical period for protein synthesis-dependent memory consolidation following fear conditioning. However, the expression of Arc protein appears to be driven by context exploration, whereas, zif268 expression may be more specifically related to associative learning. These findings suggest that altered Arc and zif268 expression are related to neural plasticity during the formation of fear memory.
Comparison of the electrochemical performance of mesoscopic Cu2Sb, SnSb and Sn/SnSb alloy powders
International Nuclear Information System (INIS)
Zhang Ge; Huang Kelong; Liu Suqin; Zhang Wei; Gong Benli
2006-01-01
Cu 2 Sb, SnSb and Sn/SnSb mesoscopic alloy powders were prepared by chemical reduction, respectively. The crystal structures and particle morphology of Cu 2 Sb, SnSb and Sn/SnSb were characterized by X-ray diffraction (XRD), scanning electron microscopy (SEM). The electrochemical performances of the Cu 2 Sb, SnSb and Sn/SnSb electrodes were investigated by galvanostatic charge and discharge cycling and electrochemical impedance spectroscopy (EIS). The results showed the first charge and discharge capacities of SnSb and Sn/SnSb were higher than Cu 2 Sb, but after 15 cycles, the charge capacity fading rates of Cu 2 Sb, Sn/SnSb and Sn/SnSb were 26.16%, 55.33% and 47.39%, respectively. Cu 2 Sb had a better cycle performance, and Sn/SnSb multiphase alloy was prior to pure SnSb due to the existence of excessive Sn in Sn/SnSb system
Pruhova, Stepanka; Dusatkova, Petra; Neumann, David; Hollay, Erik; Cinek, Ondrej; Lebl, Jan; Sumnik, Zdenek
2013-09-01
Hepatocyte nuclear factor-1A maturity-onset diabetes of the young (HNF1A-MODY) is a monogenic form of diabetes caused by heterozygous mutations in HNF1A. Currently, a history of diabetic ketoacidosis (DKA) is an exclusion criterion for genetic testing for MODY. In this article, we describe two unrelated patients aged 17 and 24 years with severe DKA developed several years after the diagnosis of HNF1A-MODY. Both patients were treated with insulin, but their metabolic control was poor (HbA1c 15%, 140 mmol/mol and 13%, 119 mmol/mol, respectively) due to noncompliance and missed insulin injections. In both patients, DKA followed a course of recurrent vomiting with dehydration and prerenal acute kidney injury. Their glycemia, blood pH, and base excess at admission were 97 mmol/L [1,748 mg/dL], 6.80, and -33 mmol/L (patient 1) and 34 mmol/L [613 mg/dL], 7.03, and -14 mmol/L (patient 2). This anecdotal observation supports the notion that a history of DKA does not exclude MODY.
Ternary SnO2@PANI/rGO nanohybrids as excellent anode materials for lithium-ion batteries
International Nuclear Information System (INIS)
Ding, Hongmei; Jiang, Hao; Zhu, Zhengju; Hu, Yanjie; Gu, Feng; Li, Chunzhong
2015-01-01
Highlights: • A three-dimensional ternary SnO 2 @PANI/rGO nanohybrids has been synthesized via dip-coating method. • PANI acts as the conductive matrix as well as a good binding agent of SnO 2 nanoparticles and graphene sheets, greatly improving the electrochemical performance. • The nanohybtrids, when applied as LIBs,exhibit a high reversible specific capacity of 772 mA h g −1 at 100 mA g −1 with excellent rate capability and high cycling stability. - Abstract: A three-dimensional (3D) nanostructure composed of ternary polyaniline/SnO 2 /graphene (SnO 2 @PANI/rGO) nanohybrids were successfully developed and prepared as anode materials for lithium ion batteries (LIBs) by a simple dip-coating of SnO 2 @polyaniline (SnO 2 @PANI) and graphene dispersion on Cu foam. In such smart nanostructures, polyaniline (PANI) acts as the conductive matrix as well as a good binding agent of SnO 2 nanoparticles and graphene sheets, greatly improving the rate performance to a great extent. The as-prepared ternary nanohybrids exhibit a high reversible specific capacity of 772 mA h g −1 at 100 mA g −1 with excellent rate capability (268 mA h g −1 at 1000 mA g −1 ), more significantly, after 100 cycles at 100 mA g −1 , our ternary nanohybrids still maintain a high specific capacity of 749 mA h g −1 , which is much better than SnO 2 /rGO(458 mA h g −1 at 100 mA g −1 ), SnO 2 @PANI (480 mA h g −1 at 100 mA g −1 ) and pure SnO 2 nanoparticles (300 mA h g −1 at 100 mA g −1 ). Such intriguing electrochemical performance is mainly attributed to the strong synergistic effects among SnO 2 , polyaniline and graphene. It is reckoned that the present 3D SnO 2 @PANI/rGO nanohybrids can serve as a promising anode material for LIBs
Oosting, Albert Jan
2002-01-01
This thesis shows the results and patient characteristics of three studies. One study was part of the Dutch Mite Avoidance Study (DUMAS): Effectiveness and effect modification of encasings in house dust mite allergy. The two other studies were two different studies with asthmatic patients recruited
Directory of Open Access Journals (Sweden)
Sneha P
Full Text Available Maturity-onset diabetes of the young type 3 (MODY3 is a non-ketotic form of diabetes associated with poor insulin secretion. Over the past years, several studies have reported the association of missense mutations in the Hepatocyte Nuclear Factor 1 Alpha (HNF1A with MODY3. Missense mutations in the POU homeodomain (POUH of HNF1A hinder binding to the DNA, thereby leading to a dysfunctional protein. Missense mutations of the HNF1A were retrieved from public databases and subjected to a three-step computational mutational analysis to identify the underlying mechanism. First, the pathogenicity and stability of the mutations were analyzed to determine whether they alter protein structure and function. Second, the sequence conservation and DNA-binding sites of the mutant positions were assessed; as HNF1A protein is a transcription factor. Finally, the biochemical properties of the biological system were validated using molecular dynamic simulations in Gromacs 4.6.3 package. Two arginine residues (131 and 203 in the HNF1A protein are highly conserved residues and contribute to the function of the protein. Furthermore, the R131W, R131Q, and R203C mutations were predicted to be highly deleterious by in silico tools and showed lower binding affinity with DNA when compared to the native protein using the molecular docking analysis. Triplicate runs of molecular dynamic (MD simulations (50ns revealed smaller changes in patterns of deviation, fluctuation, and compactness, in complexes containing the R131Q and R131W mutations, compared to complexes containing the R203C mutant complex. We observed reduction in the number of intermolecular hydrogen bonds, compactness, and electrostatic potential, as well as the loss of salt bridges, in the R203C mutant complex. Substitution of arginine with cysteine at position 203 decreases the affinity of the protein for DNA, thereby destabilizing the protein. Based on our current findings, the MD approach is an important
43 CFR 30.268 - May I demand a hearing regarding the tribal purchase option decision?
2010-10-01
... tribal purchase option decision? 30.268 Section 30.268 Public Lands: Interior Office of the Secretary of the Interior INDIAN PROBATE HEARINGS PROCEDURES Tribal Purchase of Interests Under Special Statutes § 30.268 May I demand a hearing regarding the tribal purchase option decision? Yes. You may file with...
Quintero-Rivera, Fabiola; Woo, Jennifer S; Bomberg, Eric M; Wallace, W Dean; Peredo, Jane; Dipple, Katrina M
2014-12-01
Deletions of chromosome 17q12 [OMIM 614527] encompass a wide range of phenotypes, including renal cysts, diabetes mellitus, pancreatic structural abnormalities, genital tract anomalies, developmental delay, learning difficulties, and more recently, autism spectrum disorder and schizophrenia. To date, gastrointestinal malformations have not been fully characterized in this syndrome. In this case report, we describe a four-year-old girl with a 17q12 microdeletion who was born with duodenal atresia, bilateral renal cysts, left kidney dysplasia, a midline cystic structure at the conus medullaris, and dysmorphic features. Both the patient and her affected father were found to have a deletion of 17q12, which encompasses the HNF1B (hepatocyte nuclear factor beta). It is hypothesized that HNF1B may play a role in intestinal differentiation and development. Our clinical report further expands the pre-and post-natal presentation of this rare microdeletion syndrome. © 2014 Wiley Periodicals, Inc.
Huckleberry, Kylie A.; Kane, Gary A.; Mathis, Rita J.; Cook, Sarah G.; Clutton, Jonathan E.; Drew, Michael R.
2015-01-01
Thousands of neurons are born each day in the dentate gyrus (DG), but many of these cells die before reaching maturity. Both death and survival of adult-born neurons are regulated by neuronal activity in the DG. The immediate-early gene (IEG) zif268 appears to be an important mediator of these effects, as its expression can be induced by neural activity and knockout of zif268 impairs survival of adult-born neurons (Richardson et al., 1992; Veyrac et al., 2013). Despite the apparent importance of zif268 for adult neurogenesis, its behavior-induced expression has not been fully characterized in adult-born neurons. Here we characterize behavior-evoked expression of zif268 in mature and newborn dentate granule cells (DGCs). We first quantified zif268 expression in doublecortin-positive (DCX+) immature neurons and in the general granule cell population after brief exposure to a novel environment (NE). In the general granule cell population, zif268 expression peaked 1 h after NE exposure and returned to baseline by 8 h post-exposure. However, in the DCX+ cells, zif268 expression was suppressed relative to home cage for at least 8 h post-exposure. We next asked whether suppression of zif268 in DCX+ immature cells occurs in other behavioral paradigms that recruit the hippocampus. Exposure to Morris water maze (MWM) training, an enriched environment, or a NE caused approximately equal suppression of zif268 expression in DCX+ cells and approximately equal activation of zif268 expression among the general granule cell population. The same behavioral procedures activated zif268 expression in 6-week-old BrdU-labeled adult-born neurons, indicating that zif268 suppression is specific to immature neurons. Finally, we asked whether zif268 suppression varied as a function of age within the DCX+ population, which ranges in age from 0 to approximately 4 weeks. NE exposure had no significant effect on zif268 expression in 2- or 4-week-old BrdU-labeled neurons, but it significantly
Directory of Open Access Journals (Sweden)
Malgorzata Grzanka
2016-01-01
Full Text Available The most common form of maturity-onset diabetes of the young (MODY is caused by mutations in the hepatocyte nuclear factor 1A (HNF1A gene. However, most HNF1A mutation-carriers are initially misdiagnosed with type 1 (T1DM or type 2 (T2DM diabetes mellitus; hence, they often receive nonoptimal treatment. The aim of our study was to test newly proposed clinical criteria for the identification of HNF1A MODY in patients with a diagnosis of T1DM or T2DM. To achieve this, the following criteria to preselect patients for screening were used: for T1DM: TDIR (total daily insulin requirement > 0.3 IU of insulin/kg and the percentage of basal insulin > 30% of TDIR; for T2DM: sulphonylurea- (SU- based oral treatment (monotherapy or combined with Metformin > 15 years and BMI < 30 kg/m2. We reviewed the clinical data of 140 patients with T1DM and 524 clinically diagnosed with T2DM. On the basis of these criteria, we found a HNF1A mutation in 1 out of 2 individuals with a diagnosis of T1DM and 1 out of 11 selected individuals with a diagnosis of T2DM. We believe that the simplicity of the proposed criteria might prove useful in clinical practice, as an alternative to more time-consuming classical diagnostic techniques.
Grzanka, Malgorzata; Matejko, Bartlomiej; Szopa, Magdalena; Kiec-Wilk, Beata; Malecki, Maciej T; Klupa, Tomasz
2016-01-01
The most common form of maturity-onset diabetes of the young (MODY) is caused by mutations in the hepatocyte nuclear factor 1A (HNF1A) gene. However, most HNF1A mutation-carriers are initially misdiagnosed with type 1 (T1DM) or type 2 (T2DM) diabetes mellitus; hence, they often receive nonoptimal treatment. The aim of our study was to test newly proposed clinical criteria for the identification of HNF1A MODY in patients with a diagnosis of T1DM or T2DM. To achieve this, the following criteria to preselect patients for screening were used: for T1DM: TDIR (total daily insulin requirement) > 0.3 IU of insulin/kg and the percentage of basal insulin > 30% of TDIR; for T2DM: sulphonylurea- (SU-) based oral treatment (monotherapy or combined with Metformin) > 15 years and BMI < 30 kg/m(2). We reviewed the clinical data of 140 patients with T1DM and 524 clinically diagnosed with T2DM. On the basis of these criteria, we found a HNF1A mutation in 1 out of 2 individuals with a diagnosis of T1DM and 1 out of 11 selected individuals with a diagnosis of T2DM. We believe that the simplicity of the proposed criteria might prove useful in clinical practice, as an alternative to more time-consuming classical diagnostic techniques.
Directory of Open Access Journals (Sweden)
Frank Griscelli
2018-05-01
Full Text Available Heterozygous non-synonymous (p.S142F mutation in HNF1A leads to maturity-onset diabetes of the young (MODY type 3, which is a subtype of dominant inherited young-onset non-autoimmune diabetes due to the defect of insulin secretion from pancreatic beta cells. We generated induced pluripotent stem cells (iPSCs from a patient with HNF1A p.S142F mutation. Cells from this patient, which were reprogrammed by non-integrative viral transduction had normal karyotype, harboured the HNF1A p.S142F mutation, expressed pluripotency hallmarks.
International Nuclear Information System (INIS)
Furukawa, Hiroyoshi; Iwata, Ryoko; Moriyama, Noriyuki
2001-01-01
Purpose: To evaluate the usefulness of right anterior oblique (RAO) arteriography for evaluating encasement of the right hepatic artery (RHA) by hilar cholangiocarcinoma.Methods: Celiac arteriography was performed in both the antero-posterior (AP) and RAO projection in ten patients with cholangiocarcinoma. The lengths of the arteries between the bifurcation of the anterior and posterior branch of the liver and the following points were measured: (a) the bifurcation of the left and right hepatic artery (AP-LR), (b) the bifurcation of the proper hepatic artery and the gastroduodenal artery (AP-PG). Additionally, image quality in investigating the invasion of the RHA was evaluated.Results: On the AP images, the average lengths of AP-LR and AP-PG were 24.5 ± 5.1 mm and 30.0 ± 4.9 mm, respectively. On RAO images, the lengths were 28.2 ± 4.6 mm and 32.7 ± 4.8 mm, respectively. Every length was different between the two projections (p < 0.01). In 6 of 10 patients with hilar cholangiocarcinoma, images in RAO projections were superior to AP images for evaluation of encasement.Conclusion: We conclude that angiography obtained in the RAO projection yields images that are superior to those obtained in the conventional AP projection for assessment of RHA encasement
Directory of Open Access Journals (Sweden)
Kylie A. Huckleberry
2015-08-01
Full Text Available Thousands of neurons are born each day in the dentate gyrus (DG, but many of these cells die before reaching maturity. Both death and survival of adult-born neurons are regulated by neuronal activity in DG. The immediate-early gene (IEG zif268 is an important mediator of these effects, as its expression is induced by neural activity and knockout of zif268 impairs survival of adult-born neurons (Veyrac et al., 2013. Despite the apparent importance of zif268 for adult neurogenesis, its behavior-induced expression has not been fully characterized in adult-born neurons. Here we characterize behavior-evoked expression of zif268 in mature and newborn dentate granule cells (DGCs. In the general granule cell population, zif268 expression peaked 1 hour after novel environment exposure and returned to baseline by 8 hours post-exposure. However, in the doublecortin-positive (DCX+ immature neurons, zif268 expression was suppressed relative to home cage for at least 8 hours post-exposure. We next determined that exposure to water maze training, an enriched environment, or a novel environment caused approximately equal suppression of zif268 expression in DCX+ cells and approximately equal activation of zif268 in the general DGC population and in 6-week-old adult-born neurons. Finally, we asked whether zif268 suppression varied as a function of age within the DCX+ population, which ranges in age from 0 to approximately 4 weeks. Novel environment exposure had no significant effect on zif268 expression in 2- or 4-week-old BrdU-labeled neurons, but it significantly suppressed zif268 expression in 3-week-old neurons. In summary, behavioral experience transiently activated expression of zif268 in mature DGCs but caused a more long-lasting suppression of zif268 expression in immature, adult-born DGCs. We hypothesize that zif268 suppression inhibits memory-related synaptic plasticity in immature DGCs or mediates learning-induced apoptosis of immature adult
de Vries, Aleida G. M.; Bakker-van Waarde, Willie M.; Dassel, Anne C. M.; Losekoot, Monique; Duiker, Evelien W.; Gouw, Annette S. H.; Bodewes, Frank A. J. A.
We report a novel phenotype of a hepatocyte nuclear factor homeobox A (HNF1A) mutation (heterozygote c.130dup, p.Leu44fs) presenting with transient neonatal cholestasis, subsequently followed by persistent elevation of transaminases, maturity-onset diabetes of the young (MODY) type 3 and
DEFF Research Database (Denmark)
Ek, Jakob; Hansen, Sara P; Lajer, Maria
2006-01-01
Recently, it has been shown that mutations in the P2 promoter of the hepatocyte nuclear factor (HNF)-4 alpha gene (HNF4A) cause maturity-onset diabetes of the young (MODY), while single nucleotide polymorphisms in this locus are associated with type 2 diabetes. In this study, we examined 1,189 bp...... of the P2 promoter and the associated exon 1D of HNF4A for variations associated with diabetes in 114 patients with type 2 diabetes, 72 MODYX probands, and 85 women with previous gestational diabetes mellitus. A -192c/g mutation was found in five patients. We screened 1,587 diabetic subjects and 4......,812 glucose-tolerant subjects for the -192c/g mutation and identified 5 diabetic and 1 glucose-tolerant mutation carriers (P=0.004). Examination of the families showed that carriers of the -192c/g mutation had a significantly impaired glucose-stimulated insulin release and lower levels of serum total...
DEFF Research Database (Denmark)
Kelly, P. L.; Brammer, G.; Selsing, J.
2016-01-01
(SNe), and we find strong evidence for a broad H-alpha P-Cygni profile in the HST grism spectrum at the redshift (z = 1.49) of the spiral host galaxy. SNe IIn, powered by circumstellar interaction, could provide a good match to the light curve of SN Refsdal, but the spectrum of a SN IIn would not show...... in the rest frame, provide additional evidence that supports the SN 1987A-like classification. In comparison with other examples of SN 1987A-like SNe, SN Refsdal has a blue B-V color and a high luminosity for the assumed range of potential magnifications. If SN Refsdal can be modeled as a scaled version of SN...
Park, Sin Young; Cheong, Won Jo
2015-09-01
This study introduces a preparation method for polymer-encased monolith frits with improved durability for liquid chromatography columns. The inner surface of the polyether ether ketone tubing is pretreated with sulfuric acid in the presence of catalysts (vanadium oxide and sodium sulfate). The tubing was rinsed with water and acetone, flushed with nitrogen, and treated with glycidyl methacrylate. After washing, the monolith reaction mixture composed of lauryl methacrylate, ethylene glycol dimethacrylate, initiator, and porogenic solvent was filled in the tubing and subjected to in situ polymerization. The tubing was cut into thin slices and used as frits for microcolumns. To check their durability, the frit slices were placed in a vial and a heavy impact was applied on the vial by a vortex mixer for various periods. The frits made in the presence of catalysts were found to be more durable than those made without catalysts. Furthermore, when the monolith-incorporated tubing was used as a chromatography column, the column prepared in the presence of catalysts resulted in a better separation efficiency. The separation performance of the columns installed with the polyether ether ketone encased monolith frits was comparable to that of the columns installed with the commercial stainless-steel screen frits. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Penke, Zsuzsa; Morice, Elise; Veyrac, Alexandra; Gros, Alexandra; Chagneau, Carine; LeBlanc, Pascale; Samson, Nathalie; Baumgärtel, Karsten; Mansuy, Isabelle M; Davis, Sabrina; Laroche, Serge
2014-01-05
It is well established that Zif268/Egr1, a member of the Egr family of transcription factors, is critical for the consolidation of several forms of memory; however, it is as yet uncertain whether increasing expression of Zif268 in neurons can facilitate memory formation. Here, we used an inducible transgenic mouse model to specifically induce Zif268 overexpression in forebrain neurons and examined the effect on recognition memory and hippocampal synaptic transmission and plasticity. We found that Zif268 overexpression during the establishment of memory for objects did not change the ability to form a long-term memory of objects, but enhanced the capacity to form a long-term memory of the spatial location of objects. This enhancement was paralleled by increased long-term potentiation in the dentate gyrus of the hippocampus and by increased activity-dependent expression of Zif268 and selected Zif268 target genes. These results provide novel evidence that transcriptional mechanisms engaging Zif268 contribute to determining the strength of newly encoded memories.
Karunakaran, Chockalingam; Vinayagamoorthy, Pazhamalai
2016-11-01
Fe2O3-encased ZnO nanoframework was obtained by hydrothermal method and was doped with Ag through photoreduction process. Energy dispersive x-ray spectroscopy, transmission electron microscopy (TEM), high resolution TEM, selected area electron diffractometry, x-ray diffractometry and Raman spectroscopy were employed for the structural characterization of the synthesized material. While the charge transfer resistance of the prepared nanomaterial is larger than those of Fe2O3 and ZnO the coercivity of the nanocomposite is less than that of hydrothermally obtained Fe2O3 nanostructures. Although Fe2O3/Ag-ZnO exhibits weak visible light absorption its band gap energy does not differ from that of ZnO. The photoluminescence of the fabricated nanoframework is similar to that of ZnO. The radiative recombination of charge carriers is slightly slower in Fe2O3/Ag-ZnO than in ZnO. The synthesized Fe2O3-encased Ag-doped ZnO, under UV A light, exhibits sustainable photocatalytic activity to degrade dye and is magnetically recoverable. Also, the Fe2O3/Ag-ZnO nanocomposite disinfects bacteria effectively in absence of direct illumination.
Energy Technology Data Exchange (ETDEWEB)
Heying, B.; Rodewald, U.C.; Hermes, W.; Schappacher, F.M.; Riecken, J.F.; Poettgen, R. [Muenster Univ. (Germany). Inst. fuer Anorganische und Analytische Chemie; Heymann, G.; Huppertz, H. [Muenchen Univ. (Germany). Dept. fuer Chemie und Biochemie; Sebastian, C.P. [Max-Planck-Institut fuer Chemische Physik Fester Stoffe, Dresden (Germany)
2008-02-15
The high-temperature modification of LuAgSn was obtained by arc-melting an equiatomic mixture of the elements followed by quenching the melt on a water-cooled copper crucible. HT-LuAgSn crystallizes with the NdPtSb-type structure, space group P6{sub 3}mc: a = 463.5(1), c = 723.2(1) pm, wR2 = 0.0270, 151 F{sup 2}, and 11 variables. The silver and tin atoms build up two-dimensional, puckered [Ag{sub 3}Sn{sub 3}] networks (276 pm Ag-Sn) that are charge-balanced and separated by the lutetium atoms. The Ag-Sn distances between the [Ag{sub 3}Sn{sub 3}] layers of 294 pm are much longer. Single crystals of isotypic DyAgSn (a = 468.3(1), c = 734.4(1) pm, wR2 = 0.0343, 411 F{sup 2}, and 11 variables) and HoAgSn (a = 467.2(1), c = 731.7(2) pm, wR2 = 0.0318, 330 F{sup 2}, and 11 variables) were obtained from arc-melted samples. Under high-pressure (up to 12.2 GPa) and high-temperature (up to 1470 K) conditions, no transitions to a ZrNiAl-related phase have been observed for DyAgSn, HoAgSn, and YbAgSn. HT-TmAgSn shows Curie-Weiss paramagnetism with {mu}{sub eff} = 7.53(1) {mu}{sub B}/Tm atom and {theta}P = -15.0(5) K. No magnetic ordering was evident down to 3 K. HT-LuAgSn is a Pauli paramagnet. Room-temperature {sup 119}Sn Moessbauer spectra of HT-TmAgSn and HT-LuAgSn show singlet resonances with isomer shifts of 1.78(1) and 1.72(1) mm/s, respectively. (orig.)
Carrillo, Elena; Lomas, Amparo; Pinés, Pedro J; Lamas, Cristina
2017-01-01
Mutations in hepatocyte nuclear factor 1β gene ( HNF1B ) are responsible for a multisystemic syndrome where monogenic diabetes (classically known as MODY 5) and renal anomalies, mostly cysts, are the most characteristic findings. Urogenital malformations, altered liver function tests, hypomagnesemia or hyperuricemia and gout are also part of the syndrome. Diabetes in these patients usually requires early insulinization. We present the case of a young non-obese male patient with a personal history of renal multicystic dysplasia and a debut of diabetes during adolescence with simple hyperglycemia, negative pancreatic autoimmunity and detectable C-peptide levels. He also presented epididymal and seminal vesicle cysts, hypertransaminasemia, hyperuricemia and low magnesium levels. In the light of these facts we considered the possibility of a HNF1B mutation. The sequencing study of this gene confirmed a heterozygous mutation leading to a truncated and less functional protein. Genetic studies of his relatives were negative; consequently, it was classified as a de novo mutation. In particular, our patient maintained good control of his diabetes on oral antidiabetic agents for a long period of time. He eventually needed insulinization although oral therapy was continued alongside, allowing reduction of prandial insulin requirements. The real prevalence of mutations in HNF1B is probably underestimated owing to a wide phenotypical variability. As endocrinologists, we should consider this possibility in young non-obese diabetic patients with a history of chronic non-diabetic nephropathy, especially in the presence of some of the other characteristic manifestations. HNF1B mutations are a rare cause of monogenic diabetes, often being a part of a multisystemic syndrome.The combination of young-onset diabetes and genitourinary anomalies with slowly progressive nephropathy of non-diabetic origin in non-obese subjects should rise the suspicion of such occurrence. A family history
HNF1B and endometrial cancer risk: results from the PAGE study.
Directory of Open Access Journals (Sweden)
Veronica Wendy Setiawan
Full Text Available We examined the association between HNF1B variants identified in a recent genome-wide association study and endometrial cancer in two large case-control studies nested in prospective cohorts: the Multiethnic Cohort Study (MEC and the Women's Health Initiative (WHI as part of the Population Architecture using Genomics and Epidemiology (PAGE study. A total of 1,357 incident cases of invasive endometrial cancer and 7,609 controls were included in the analysis (MEC: 426 cases/3,854 controls; WHI: 931 cases/3,755 controls. The majority of women in the WHI were European American, while the MEC included sizable numbers of African Americans, Japanese and Latinos. We estimated the odds ratios (ORs per allele and 95% confidence intervals (CIs of each SNP using unconditional logistic regression adjusting for age, body mass index, and four principal components of ancestry informative markers. The combined ORs were estimated using fixed effect models. Rs4430796 and rs7501939 were associated with endometrial cancer risk in MEC and WHI with no heterogeneity observed across racial/ethnic groups (P ≥ 0.21 or between studies (P ≥ 0.70. The OR(per allele was 0.82 (95% CI: 0.75, 0.89; P = 5.63 × 10(-6 for rs4430796 (G allele and 0.79 (95% CI: 0.73, 0.87; P = 3.77 × 10(-7 for rs7501939 (A allele. The associations with the risk of Type I and Type II tumors were similar (P ≥ 0.19. Adjustment for additional endometrial cancer risk factors such as parity, oral contraceptive use, menopausal hormone use, and smoking status had little effect on the results. In conclusion, HNF1B SNPs are associated with risk of endometrial cancer and that the associated relative risks are similar for Type I and Type II tumors.
Pseudomorphic GeSiSn, SiSn and Ge layers in strained heterostructures
Timofeev, V. A.; Nikiforov, A. I.; Tuktamyshev, A. R.; Mashanov, V. I.; Loshkarev, I. D.; Bloshkin, A. A.; Gutakovskii, A. K.
2018-04-01
The GeSiSn, SiSn layer growth mechanisms on Si(100) were investigated and the kinetic diagrams of the morphological GeSiSn, SiSn film states in the temperature range of 150 °C-450 °C at the tin content from 0% to 35% were built. The phase diagram of the superstructural change on the surface of Sn grown on Si(100) in the annealing temperature range of 0 °C-850 °C was established. The specular beam oscillations were first obtained during the SiSn film growth from 150 °C to 300 °C at the Sn content up to 35%. The transmission electron microscopy and x-ray diffractometry data confirm the crystal perfection and the pseudomorphic GeSiSn, SiSn film state, and also the presence of smooth heterointerfaces between GeSiSn or SiSn and Si. The photoluminescence for the multilayer periodic GeSiSn/Si structures in the range of 0.6-0.8 eV was detected. The blue shift with the excitation power increase is observed suggesting the presence of a type II heterostructure. The creation of tensile strained Ge films, which are pseudomorphic to the underlying GeSn layer, is confirmed by the results of the formation and analysis of the reciprocal space map in the x-ray diffractometry. The tensile strain in the Ge films reached the value in the range of 0.86%-1.5%. The GeSn buffer layer growth in the Sn content range from 8% to 12% was studied. The band structure of heterosystems based on pseudomorphic GeSiSn, SiSn and Ge layers was calculated and the valence and conduction band subband position dependences on the Sn content were built. Based on the calculation, the Sn content range in the GeSiSn, SiSn, and GeSn layers, which corresponds to the direct bandgap GeSiSn, SiSn, and Ge material, was obtained.
Dobosz, Alexandra; Gancarz, Tomasz
2018-03-01
The data for the physicochemical properties viscosity, density, and surface tension obtained by different experimental techniques have been analyzed for liquid Al-Zn, Ag-Sn, Bi-Sn, Cu-Sn, and Sn-Zn eutectic alloys. All experimental data sets have been categorized and described by the year of publication, the technique used to obtain the data, the purity of the samples and their compositions, the quoted uncertainty, the number of data in the data set, the form of data, and the temperature range. The proposed standard deviations of liquid eutectic Al-Zn, Ag-Sn, Bi-Sn, Cu-Sn, and Sn-Zn alloys are 0.8%, 0.1%, 0.5%, 0.2%, and 0.1% for the density, 8.7%, 4.1%, 3.6%, 5.1%, and 4.0% for viscosity, and 1.0%, 0.5%, 0.3%, N/A, and 0.4% for surface tension, respectively, at a confidence level of 95%.
Directory of Open Access Journals (Sweden)
Elena Carrillo
2017-06-01
Full Text Available Mutations in hepatocyte nuclear factor 1β gene (HNF1B are responsible for a multisystemic syndrome where monogenic diabetes (classically known as MODY 5 and renal anomalies, mostly cysts, are the most characteristic findings. Urogenital malformations, altered liver function tests, hypomagnesemia or hyperuricemia and gout are also part of the syndrome. Diabetes in these patients usually requires early insulinization. We present the case of a young non-obese male patient with a personal history of renal multicystic dysplasia and a debut of diabetes during adolescence with simple hyperglycemia, negative pancreatic autoimmunity and detectable C-peptide levels. He also presented epididymal and seminal vesicle cysts, hypertransaminasemia, hyperuricemia and low magnesium levels. In the light of these facts we considered the possibility of a HNF1B mutation. The sequencing study of this gene confirmed a heterozygous mutation leading to a truncated and less functional protein. Genetic studies of his relatives were negative; consequently, it was classified as a de novo mutation. In particular, our patient maintained good control of his diabetes on oral antidiabetic agents for a long period of time. He eventually needed insulinization although oral therapy was continued alongside, allowing reduction of prandial insulin requirements. The real prevalence of mutations in HNF1B is probably underestimated owing to a wide phenotypical variability. As endocrinologists, we should consider this possibility in young non-obese diabetic patients with a history of chronic non-diabetic nephropathy, especially in the presence of some of the other characteristic manifestations.
Szopa, Magdalena; Kapusta, Maria; Matejko, Bartlomiej; Klupa, Tomasz; Koblik, Teresa; Kiec-Wilk, Beata; Borowiec, Maciej; Malecki, Maciej T
2015-01-01
We previously showed that in HNF1A-MODY the cystatin C-based glomerular filtration rate (GFR) estimate is higher than the creatinine-based estimate. Currently, we aimed to replicate this finding and verify its clinical significance. The study included 72 patients with HNF1A-MODY, 72 with GCK-MODY, 53 with type 1 diabetes (T1DM), 70 with type 2 diabetes (T2DM), and 65 controls. Serum creatinine and cystatin C levels were measured. GFR was calculated from creatinine and cystatin C using the CKD-EPI creatinine equation (eGRF-cr) and CKD-EPI cystatin C equation (eGFR-cys), respectively. Cystatin C levels were lower (p MODY, GCK-MODY, and the controls (p = 0.004; p = 0.003; p MODY patients are higher compared to eGFR-cr. Some other differences were also described in diabetic groups. However, none of them appears to be clinically relevant.
Isomer shifts and chemical bonding in crystalline Sn(II) and Sn(IV) compounds
International Nuclear Information System (INIS)
Terra, J.; Guenzburger, D.
1991-01-01
First-principles self-consistent Local Density calculations of the electronic structure of clusters representing Sn(II) (SnO, SnF 2 , SnS, SnSe) and Sn(IV) (SnO 2 , SnF 4 ) crystalline compounds were performed. Values of the electron density at the Sn nucleus were obtained and related to measured values of the Moessbauer Isomer Shifts reported in the literature. The nuclear parameter of 119 Sn derived was ΔR/R=(1.58±0.14)x10 -4 . The chemical bonding in the solids was analysed and related to the electron densities obtained. (author)
States in 118Sn from 117Sn(d,p) 118Sn at 12 MeV
International Nuclear Information System (INIS)
Frota-Pessoa, E.
1983-01-01
118 Sn energy levels up to = 5.2 MeV excitation energy are studied in the reaction 117 Sn (d,p) 118 Sn. Deuterons had a bombarding energy of 12 MeV. The protons were analized by a magnetic spectrograph. The detector was nuclear emulsion and the resolution in energy about 10 KeV. The distorted-wave analysis was used to determine l values and spectroscopic strengths. Centers of gravity and the sums of reduced spectroscopic factors are presented for the levels when it was possible to determine the S' value. 66 levels of excitation energy were found which did not appear in previous 117 Sn (d,p) reactions. 40 levels were not found previously in any reaction giving 118 Sn. The results are compared with the known ones. (Author) [pt
Directory of Open Access Journals (Sweden)
Bacon Siobhan
2012-07-01
Full Text Available Abstract Background Mutations in the transcription factor hepatocyte nuclear factor-1-alpha (HNF1A result in the commonest type of maturity onset diabetes of the young (MODY. HNF1A-MODY carriers have reduced pancreatic beta cell mass, partially due to an increased rate of apoptosis. To date, it has not been possible to determine when apoptosis is occurring in HNF1A-MODY.We have recently demonstrated that beta cell apoptosis stimulates the expression of the pancreatic stone protein/regenerating (PSP/reg gene in surviving neighbour cells, and that PSP/reg1A protein is subsequently secreted from these cells. The objective of this study was to determine whether serum levels of PSP/reg1A are elevated during disease progression in HNF1A-MODY carriers, and whether it may provide information regarding the onset of beta-cell apoptosis. Methods We analysed serum PSP/reg1A levels and correlated with clinical and biochemical parameters in subjects with HNF1A-MODY, glucokinase (GCK-MODY, and type 1 diabetes mellitus. A control group of normoglycaemic subjects was also analysed. Results PSP/reg1A serum levels were significantly elevated in HNF1A-MODY (n = 37 subjects compared to controls (n = 60 (median = 12.50 ng/ml, IQR = 10.61-17.87 ng/ml versus median = 10.72 ng/ml, IQR = 8.94-12.54 ng/ml, p = 0.0008. PSP/reg1A correlated negatively with insulin levels during OGTT, (rho = −0.40, p = 0.02. Interestingly we noted a significant positive correlation of PSP/reg1A with age of the HNF1A-MODY carriers (rho = 0.40 p = 0.02 with an age of 25 years separating carriers with low and high PSP/reg1A levels. Patients with type 1 diabetes mellitus also had elevated serum levels of PSP/reg1A compared to controls, however this was independent of the duration of diabetes. Conclusion Our data suggest that beta cell apoptosis contributes increasingly to the pathophysiology of HNF1A-MODY in patients 25 years and over
LENUS (Irish Health Repository)
Bacon, Siobhan
2012-07-18
AbstractBackgroundMutations in the transcription factor hepatocyte nuclear factor-1-alpha (HNF1A) result in the commonest type of maturity onset diabetes of the young (MODY). HNF1A-MODY carriers have reduced pancreatic beta cell mass, partially due to an increased rate of apoptosis. To date, it has not been possible to determine when apoptosis is occurring in HNF1A-MODY.We have recently demonstrated that beta cell apoptosis stimulates the expression of the pancreatic stone protein\\/regenerating (PSP\\/reg) gene in surviving neighbour cells, and that PSP\\/reg1A protein is subsequently secreted from these cells. The objective of this study was to determine whether serum levels of PSP\\/reg1A are elevated during disease progression in HNF1A-MODY carriers, and whether it may provide information regarding the onset of beta-cell apoptosis.MethodsWe analysed serum PSP\\/reg1A levels and correlated with clinical and biochemical parameters in subjects with HNF1A-MODY, glucokinase (GCK-MODY), and type 1 diabetes mellitus. A control group of normoglycaemic subjects was also analysed.ResultsPSP\\/reg1A serum levels were significantly elevated in HNF1A-MODY (n = 37) subjects compared to controls (n = 60) (median = 12.50 ng\\/ml, IQR = 10.61-17.87 ng\\/ml versus median = 10.72 ng\\/ml, IQR = 8.94-12.54 ng\\/ml, p = 0.0008). PSP\\/reg1A correlated negatively with insulin levels during OGTT, (rho = −0.40, p = 0.02). Interestingly we noted a significant positive correlation of PSP\\/reg1A with age of the HNF1A-MODY carriers (rho = 0.40 p = 0.02) with an age of 25 years separating carriers with low and high PSP\\/reg1A levels. Patients with type 1 diabetes mellitus also had elevated serum levels of PSP\\/reg1A compared to controls, however this was independent of the duration of diabetes.ConclusionOur data suggest that beta cell apoptosis contributes increasingly to the pathophysiology of HNF1A-MODY in patients 25 years and
Cytoskeletal actin genes function downstream of HNF-3beta in ascidian notochord development.
Jeffery, W R; Ewing, N; Machula, J; Olsen, C L; Swalla, B J
1998-11-01
We have examined the expression and regulation of cytoskeletal actin genes in ascidians with tailed (Molgula oculata) and tailless larvae (Molgula occulta). Four cDNA clones were isolated representing two pairs of orthologous cytoskeletal actin genes (CA1 and CA2), which encode proteins differing by five amino acids in the tailed and tailless species. The CA1 and CA2 genes are present in one or two copies, although several related genes may also be present in both species. Maternal CA1 and CA2 mRNA is present in small oocytes but transcript levels later decline, suggesting a role in early oogenesis. In the tailed species, embryonic CA1 and CA2 mRNAs first appear in the presumptive mesenchyme and muscle cells during gastrulation, subsequently accumulate in the presumptive notochord cells, and can be detected in these tissues through the tadpole stage. CA1 mRNAs accumulate initially in the same tissues in the tailless species but subsequently disappear, in concert with the arrest of notochord and tail development. In contrast, CA2 mRNAs were not detected in embryos of the tailless species. Fertilization of eggs of the tailless species with sperm of the tailed species, which restores the notochord and the tail, also results in the upregulation of CA1 and CA2 gene expression in hybrid embryos. Antisense oligodeoxynucleotide experiments suggest that CA1 and CA2 expression in the notochord, but not in the muscle cells, is dependent on prior expression of Mocc FHI, an ascidian HNF-3beta-like gene. The expression of the CA1 and CA2 genes in the notochord in the tailed species, downregulation in the tailless species, upregulation in interspecific hybrids, and dependence on HNF-3beta activity is consistent with a role of these genes in development of the ascidian notochord.
40 CFR Appendix Viii to Part 268 - LDR Effective Dates of Injected Prohibited Hazardous Wastes
2010-07-01
... 40 Protection of Environment 26 2010-07-01 2010-07-01 false LDR Effective Dates of Injected Prohibited Hazardous Wastes VIII Appendix VIII to Part 268 Protection of Environment ENVIRONMENTAL PROTECTION... to Part 268—LDR Effective Dates of Injected Prohibited Hazardous Wastes National Capacity LDR...
Effects of interlayer Sn-Sn lone pair interaction on the band gap of bulk and nanosheet SnO
Umezawa, Naoto; Zhou, Wei
2015-03-01
Effects of interlayer lone-pair interactions on the electronic structure of SnO are firstly explored by the density-functional theory. Our comprehensive study reveals that the band gap of SnO opens as increase in the interlayer Sn-Sn distance. The effect is rationalized by the character of band edges which consists of bonding and anti-bonding states from interlayer lone pair interactions. The band edges for several nanosheets and strained double-layer SnO are estimated. We conclude that the double-layer SnO is a promising material for visible-light driven photocatalyst for hydrogen evolution. This work is supported by the Japan Science and Technology Agency (JST) Precursory Research for Embryonic Science and Technology (PRESTO) program.
International Nuclear Information System (INIS)
Jeffree, Ross A. . E-mail R.Jeffree@iaea.org; Warnau, Michel; Oberhansli, Francois; Teyssie, Jean-Louis
2006-01-01
Encased embryos of spotted dogfish Scyliorhinus canicula absorbed six radio-isotopes ( 241 Am, 109 Cd, 57 Co, 134 Cs, 54 Mn and 65 Zn) directly from seawater during short-term experimental exposure, demonstrating the permeability of the egg-case to these contaminants. Embryo to water concentration factors (CFs) ranged from 0.14 for 134 Cs to 7.4 for 65 Zn. The 65 Zn and 57 Co CFs increased exponentially with embryo length, whereas the CF for 109 Cd declined with length. Among different components of the encased embryo the egg case was the major repository (69-99%) of all six radio-isotopes that were distributed throughout its wall. Egg-case CFs were as high as 10 3 for 57 Co and 65 Zn, making it the major source of gamma radiation exposure to the embryo and potentially of radio-isotopes for continued absorption by the embryo, following the uptake phase of the experiment. The patterns of uptake by the egg-case approximated linearity for most isotopes and loss rates were isotope-specific; egg-case biokinetics were not greatly affected by the viability of the contained embryo. Within the embryo initial data on radio isotopic distribution show that the skin is their major site of uptake, as previously demonstrated for juveniles
Oxidation of Pb-Sn and Pb-Sn-In alloys
International Nuclear Information System (INIS)
Sluzewski, D.A.; Chang, Y.A.; Marcotte, V.C.
1990-01-01
Air oxidized Pb-Sn and Pb-Sn-In single phase alloys have been studied with scanning Auger microscopy. Line scans across grain boundaries combined with argon ion sputter etching revealed grain boundary oxidation. In the Pb-Sn samples, tin is preferentially oxidized with the grain boundary regions having a much higher percentage of tin oxide than the bulk surface oxide. In the Pb-Sn-In alloys, both tin and indium are preferentially oxidized with the grain boundary regions being enriched with tin and indium oxides
Analyses of the Sn IX-Sn XII spectra in the EUV region
International Nuclear Information System (INIS)
Churilov, S S; Ryabtsev, A N
2006-01-01
The Sn IX-Sn XII spectra excited in a vacuum spark have been analysed in the 130-160 A wavelength region. The analysis was based on the energy parameter extrapolation in the isonuclear Sn VI-VIII and Sn XIII-XIV sequence. 266 spectral lines belonging to the 4d m -(4d m-1 4f+4p 5 4d m+1 ) (m=6-3) transition arrays were classified in the Sn IX-Sn XII spectra for the first time. All 18 level energies of the 4d 3 configuration and 39 level energies of the strongly interacting 4d 2 4f and 4p 5 4d 4 configurations were established in the Sn XII spectrum. The energy differences between the majority of the 4d m levels and about 40 levels of the 4d m-1 4f+4p 5 4d m+1 configurations were determined in each of the Sn IX, Sn X and Sn XI spectra (m=6-4). As a result, all intense lines were classified in the 130-140 A region relevant to the extreme ultraviolet (EUV) lithography. It was shown that the most of the intense lines in the 2% bandwidth at 135 A belong to the transitions in the Sn XI-Sn XIII spectra
Rod-like hierarchical Sn/SnOx@C nanostructures with enhanced lithium storage properties
Yang, Juan; Chen, Sanmei; Tang, Jingjing; Tian, Hangyu; Bai, Tao; Zhou, Xiangyang
2018-03-01
Rod-like hierarchical Sn/SnOx@C nanostructures have been designed and synthesized via calcining resorcinol-formaldehyde (RF) resin coated Sn-based metal-organic frameworks. The rod-like hierarchical Sn/SnOx@C nanostructures are made of a great number of carbon-wrapped primary Sn/SnOx nanospheres of 100-200 nm in diameter. The as-prepared hierarchical Sn/SnOx@C nanocomposite manifests a high initial reversible capacity of 1177 mAh g-1 and remains 1001 mAh g-1 after 240 cycles at a current density of 200 mA g-1. It delivers outstanding high-rate performance with a reversible capacity of 823 mAh g-1 even at a high current density of 1000 mA g-1. The enhanced electrochemical performances of the Sn/SnOx@C electrode are mainly attributed to the synergistic effect of the unique hierarchical micro/nanostructures and the protective carbon layer.
Lopez, Ariel Pablo; Foscaldi, Sabrina Andrea; Perez, Maria Silvia; Rodriguez, Martín; Traversa, Mercedes; Puchulu, Félix Miguel; Bergada, Ignacio; Frechtel, Gustavo Daniel
2011-02-01
There are at least six subtypes of Maturity Onset Diabetes of the Young (MODY) with distinctive genetic causes. MODY 3 is caused by mutations in HNF1A gene, an insulin transcription factor, so mutations in this gene are associated with impaired insulin secretion. MODY 3 prevalence differs according to the population analyzed, but it is one of the most frequent subtypes. Therefore, our aims in this work were to find mutations present in the HNF1A gene and provide information on their prevalence. Mutations screening was done in a group of 80 unrelated patients (average age 17.1 years) selected by clinical characterization of MODY, by SSCP electrophoresis followed by sequenciation. We found eight mutations, of which six were novel and four sequence variants, which were all novel. Therefore the prevalence of MODY 3 in this group was 10%. Compared clinical data between the non-MODY 3 patients and the MODY 3 diagnosed patients did not show any significant difference. Eight patients were diagnosed as MODY 3 and new data about the prevalence of that subtype is provided. Our results contribute to reveal novel mutations, providing new data about the prevalence of that subtype. Copyright © 2010 Elsevier Ireland Ltd. All rights reserved.
Tjora, E; Wathle, G; Erchinger, F; Engjom, T; Molven, A; Aksnes, L; Haldorsen, I S; Dimcevski, G; Raeder, H; Njølstad, P R
2013-08-01
To examine the exocrine pancreatic function in carriers of the hepatocyte nuclear factor 1β gene (HNF1B) mutation by direct testing. Patients with HNF1B mutations and control subjects were assessed using rapid endoscopic secretin tests and secretin-stimulated magnetic resonance imaging. Seven patients and 25 controls underwent endoscopy, while eight patients and 20 controls had magnetic resonance imaging. Ductal function was assessed according to peak bicarbonate concentrations and acinar function was assessed according to peak digestive enzyme activities in secretin-stimulated duodenal juice. The association of pancreatic exocrine function and diabetes status with pancreatic gland volume was examined. The mean increase in secretin-stimulated duodenal fluid was smaller in patients than controls (4.0 vs 6.4 ml/min; P = 0.003). We found lower ductal function in patients than controls (median peak bicarbonate concentration: 73 vs 116 mEq/L; P function (median peak lipase activity: 6.4 vs 33.5 kU/ml; P = 0.01; median peak elastase activity: 0.056 vs 0.130 U/ml; P = 0.01). Pancreatic fluid volume outputs correlated significantly with pancreatic gland volumes (r² = 0.71, P = 0.008) in patients. The total fluid output to pancreatic gland volume ratios were higher in patients than controls (4.5 vs 1.3 ml/cm³; P = 0.03), suggesting compensatory hypersecretion in the remaining gland. Carriers of the HNF1B mutation have lower exocrine pancreatic function involving both ductal and acinar cells. Compensatory hypersecretion suggests that the small pancreas of HNF1B mutation carriers is attributable to hypoplasia, not atrophy. © 2013 The Authors. Diabetic Medicine © 2013 Diabetes UK.
Energy Technology Data Exchange (ETDEWEB)
Cheng, Li; Li, Dan; Dong, Xiangting; Ma, Qianli; Yu, Wensheng; Wang, Xinlu; Yu, Hui; Wang, Jinxian; Liu, Guixia, E-mail: dongxiangting888@163.com [Key Laboratory of Applied Chemistry and Nanotechnology at Universities of Jilin Province, Changchun University of Science and Technology, Changchun (China)
2017-11-15
SnO{sub 2} nanofibers were fabricated by calcination of the electrospun PVP/SnCl{sub 4} composite nanofibers. For the first time, SnS nanofibers and SnSe nanofibers were successfully synthesized by double crucible sulfurization and selenidation methods via inheriting the morphology of SnO{sub 2} nanofibers used as precursors, respectively. X-ray diffraction (XRD) analysis shows SnS nanofibers and SnSe nanofibers are respectively pure orthorhombic phase with space group of Pbnm and Cmcm. Scanning electron microscope (SEM) observation indicates that the diameters of SnS nanofibers and SnSe nanofibers are respectively 140.54±12.80 nm and 96.52±14.17 nm under the 95 % confidence level. The photocatalytic activities of samples were studied by using rhodamine B (Rh B) as degradation agent. When SnS or SnSe nanofibers are employed as the photocatalysts, the respective degradation rates of Rh B solution under the ultraviolet light irradiation after 200 min irradiation are 92.55 % and 92.86 %. The photocatalytic mechanism and formation process of SnS and SnSe nanofibers are also provided. More importantly, this preparation technique is of universal significance to prepare other metal chalcogenides nanofibers. (author)
Kimoto, Sohei; Bazmi, H Holly; Lewis, David A
2014-09-01
Cognitive deficits of schizophrenia may be due at least in part to lower expression of the 67-kDa isoform of glutamic acid decarboxylase (GAD67), a key enzyme for GABA synthesis, in the dorsolateral prefrontal cortex of individuals with schizophrenia. However, little is known about the molecular regulation of lower cortical GAD67 levels in schizophrenia. The GAD67 promoter region contains a conserved Zif268 binding site, and Zif268 activation is accompanied by increased GAD67 expression. Thus, altered expression of the immediate early gene Zif268 may contribute to lower levels of GAD67 mRNA in the dorsolateral prefrontal cortex in schizophrenia. The authors used polymerase chain reaction to quantify GAD67 and Zif268 mRNA levels in dorsolateral prefrontal cortex area 9 from 62 matched pairs of schizophrenia and healthy comparison subjects, and in situ hybridization to assess Zif268 expression at laminar and cellular levels of resolution. The effects of potentially confounding variables were assessed in human subjects, and the effects of antipsychotic treatments were tested in antipsychotic-exposed monkeys. The specificity of the Zif268 findings was assessed by quantifying mRNA levels for other immediate early genes. GAD67 and Zif268 mRNA levels were significantly lower and were positively correlated in the schizophrenia subjects. Both Zif268 mRNA-positive neuron density and Zif268 mRNA levels per neuron were significantly lower in the schizophrenia subjects. These findings were robust to the effects of the confounding variables examined and differed from other immediate early genes. Deficient Zif268 mRNA expression may contribute to lower cortical GAD67 levels in schizophrenia, suggesting a potential mechanistic basis for altered cortical GABA synthesis and impaired cognition in schizophrenia.
Sn-In-Ag phase equilibria and Sn-In-(Ag)/Ag interfacial reactions
International Nuclear Information System (INIS)
Chen Sinnwen; Lee Wanyu; Hsu Chiaming; Yang Chingfeng; Hsu Hsinyun; Wu Hsinjay
2011-01-01
Research highlights: → Thermodynamic models of Sn-In and Sn-In-Ag are developed using the CALPHAD approach. → Reaction layer in the Sn-In-(Ag)/Ag couples at 100 deg. C is thinner than those at 25 deg. C, 50 deg. C, and 75 deg. C. → Reactions in the Sn-20 wt%In-2.8 wt%Ag/Ag couples are faster than those in the Sn-20 wt%In/Ag couples. - Abstract: Experimental verifications of the Sn-In and Sn-In-Ag phase equilibria have been conducted. The experimental measurements of phase equilibria and thermodynamic properties are used for thermodynamic modeling by the CALPHAD approach. The calculated results are in good agreement with experimental results. Interfacial reactions in the Sn-In-(Ag)/Ag couples have been examined. Both Ag 2 In and AgIn 2 phases are formed in the Sn-51.0 wt%In/Ag couples reacted at 100 and 150 deg. C, and only the Ag 2 In phase is formed when reacted at 25, 50 and 75 deg. C. Due to the different growth rates of different reaction phases, the reaction layer at 100 deg. C is thinner than those at 25 deg. C, 50 deg. C, and 75 deg. C. In the Sn-20.0 wt%In/Ag couples, the ζ phase is formed at 250 deg. C and ζ/AgIn 2 phases are formed at 125 deg. C. Compared with the Sn-20 wt%In/Ag couples, faster interfacial reactions are observed in the Sn-20.0 wt%In-2.8 wt%Ag/Ag couples, and minor Ag addition to Sn-20 wt%In solder increases the growth rates of the reaction phases.
Magnetic behaviour of cerium in Ce2 Sn5 and Ce3 Sn7, surstructures of Ce Sn3
International Nuclear Information System (INIS)
Stunault, A.
1988-07-01
The compound studied, Ce 2 Sn 5 and Ce 3 Sn 7 are both orthorhombic, surstructure of cubic Ce Sn 3 . Magnetic susceptibility measurements show in both compounds an antiferromagnetic order at low temperature and magnetization shows a high anisotropy. Magnetization densities are determined by polarized neutron diffraction. The cerium site which has two Ce atoms as nearest neighbourgs carries all the magnetism in both structures. For Ce 2 Sn 5 moments are directed as the high magnetization axis and structure is modulated. Ce 3 Sn 7 presents a simple antiferromagnetic order but moment are directed as low magnetization axis. Various transitions towards a ferromagnetic order are presented. Results are interpreted by measuring the difference between energy levels of crystalline field. A model of crystalline field and isotrope exchange agrees well with Ce 3 Sn 7 , but for Ce 2 Sn 7 it is necessary to reduce the magnetic moment which is typical of the Kondo effect [fr
2010-07-01
... 40 Protection of Environment 26 2010-07-01 2010-07-01 false LDR Effective Dates of Surface Disposed Prohibited Hazardous Wastes VII Appendix VII to Part 268 Protection of Environment ENVIRONMENTAL... VII to Part 268—LDR Effective Dates of Surface Disposed Prohibited Hazardous Wastes Table 1—Effective...
Ethanol electrooxidation on Pt-Sn and Pt-Sn-W bulk alloys
Energy Technology Data Exchange (ETDEWEB)
Anjos, D.M. dos; Hahn, F.; Leger, J.M.; Kokoh, K.B. [Universite de Poitiers, Poitiers Cedex (France). Centre National de la Recherche Scientifique (CNRS). Equipe Electrocatalyse; Tremiliosi-Filho, G. [Universidade de Sao Paulo (USP), Sao Carlos, SP (Brazil). Inst. de Quimica
2008-07-01
Ethanol oxidation has been studied on Pt-Sn and Pt-Sn-W electrodes prepared in an arc-melting furnace. Different electrochemical techniques like cyclic voltammetry and chronoamperometry were used to evaluate the catalytic activity of these materials. The electro-oxidation process was also investigated by in situ infrared reflectance spectroscopy in order to determine adsorbed intermediates and reaction products. Experimental results indicated that Pt-Sn and Pt-Sn-W alloys are able to oxidize ethanol mainly to acetaldehyde and acetic acid. Adsorbed CO was also detected, demonstrating the viability of splitting the C-C bond in the ethanol molecule during the oxidation process. The adsorbed CO was further oxidized to CO{sub 2}.This reaction product was clearly detected by SNIFTIRS. Pt-Sn-W catalyst showed a better electrochemical performance than Pt-Sn that, in it turn, is better than Pt-alone. (author)
49 CFR 268.7 - Federal/State share and restrictions on the uses of Federal Maglev Funds.
2010-10-01
... of Federal Maglev Funds. 268.7 Section 268.7 Transportation Other Regulations Relating to... Federal Maglev Funds. (a) Federal share. The Federal share of Full Projects Costs shall be not more than 2...) Restrictions on the uses of Federal Maglev Funds. (1) Federal Maglev Funds may be applied only to Eligible...
Ultraviolet emission from low resistance Cu2SnS3/SnO2 and CuInS2/Sn:In2O3 nanowires
Directory of Open Access Journals (Sweden)
E. Karageorgou
2014-11-01
Full Text Available SnO2 and Sn:In2O3 nanowires were grown on Si(001, and p-n junctions were fabricated in contact with p-type Cu2S which exhibited rectifying current–voltage characteristics. Core-shell Cu2SnS3/SnO2 and CuInS2/Sn:In2O3 nanowires were obtained by depositing copper and post-growth processing under H2S between 100 and 500 °C. These consist mainly of tetragonal rutile SnO2 and cubic bixbyite In2O3. We observe photoluminescence at 3.65 eV corresponding to band edge emission from SnO2 quantum dots in the Cu2SnS3/SnO2 nanowires due to electrostatic confinement. The Cu2SnS3/SnO2 nanowires assemblies had resistances of 100 Ω similar to CuInS2/In2O3 nanowires which exhibited photoluminescence at 3.0 eV.
International Nuclear Information System (INIS)
Al-Nbaheen, M.; Pourzand, C.; Tyrrell, R.M.
2006-01-01
One way of targeting gene expression in vivo is to control transcription using a tissue-specific regulatory system. Tissue specific promoters or enhancers are in use in transgenic animals and could be utilized in medical for gene therapy. At present the usual method for selection of a tissue-specific promoter is to identify a gene, which is expressed at unusually high level in the target tissue, and then to use the promoter for this gene to drive expression of another therapeutic gene in the target tissue. This approach is logical but does not always lead to high levels of gene expression. A second approach is to investigate the scope for discovery of synthetic specific promoters using a target tissue. The objective of the work described in this paper was to use both approach to design plasmid DNA expression vectors that would carry liver-specific promoter/enhancer linked to reporter gene (i.e. luciferase). Then transfect these vectors to both liver-derived and non-liver cell lines. This is followed by evaluation of the liver-specificity of each construct by measuring the basal level expression of the reporter gene (i.e. luciferase activity) in both cell lines. Hepatocyte nuclear factor-4 (HNF-4) is liver-enriched transcription factor used to design new synthetic enhancers by inserting a tandem array of 1', 3' or 5' repeats of the HNF-4 binding site upstream of the SV40 promoter linked to the luciferase reporter gene within an Epstein-Barr virus (EBV)-based vector, p 706. The results of transfection revealed that unexpectedly the HNF-4 binding sites in these constructs act as a repressor rather than enhancer of the liver-specific expression of the luciferase gene. (author)
Phase diagram of SnTe-CdSe cross-section of SnTe+CdSe reversible SnSe+CdTe ternary reciprocal system
International Nuclear Information System (INIS)
Dubrovin, I.V.; Budennaya, L.D.; Mizetskaya, I.B.; Sharkina, Eh.V.
1986-01-01
Phase equilibrium diagram of SnTe-CdSe cross-section of Sn, Cd long Te, Se ternary reciprocal system is investigated using the methods of differential thermal, X-ray phase, and microstructural analyses. Maximum length of solid solutions on the base of SnTe corresponds to approximately 14 mol.% at 1050 K and approximately 3 mol.% of CdSe at 670 K. Region of solid solutions on the base of CdSe corresponds to less than 1 mol.% of SnTe at room temperature. SnTe-CdSe cross-section is not a quasibinar one. Equilibrium is shifted to the left in the SnTe+CdSe reversible SnSe+CdTe reciprocal system
Technical and Clinical Outcomes Following Colonic Stenting: A Seven-Year Analysis of 268 Procedures
Energy Technology Data Exchange (ETDEWEB)
Little, M. W.; Oakley, T.; Briggs, J. H.; Sutcliffe, J. A.; Allouni, A. K.; Makris, G.; Bratby, M. J.; Tapping, C. R.; Patel, R.; Wigham, A.; Anthony, S.; Phillips-Hughes, J.; Uberoi, R., E-mail: Raman.uberoi@ouh.nhs.uk [Oxford University Hospitals NHS Foundation Trust, Department of Interventional Radiology, John Radcliffe Hospital (United Kingdom)
2016-10-15
AimsTo assess the factors contributing to the technical and clinical success of colorectal stenting for large bowel obstruction.Methodology268 cases of colonic stenting for large bowel obstruction were performed in 249 patients of mean age of 72 years (28–98) between 2006 and 2013. The majority of strictures were due to malignant disease, 244/268 (91 %). Diverticular strictures accounted for 24/268 (9 %).ResultsOverall technical success rate was 81 % (217/268), with a clinical success rate of 65 % (174/268). Duration of symptoms ranged from 0 to 180 days (mean 8 days). Technical success rate was seen to decrease with increasing symptom duration. For symptom duration of less than 1 week, technical success was 85.4 % (181/212) versus 69.6 % (39/56) for those with symptoms of greater than a week (p < 0.05). Clinical success rates fell from 71.3 % (107/150) to 59.3 % (70/118) (p < 0.05) when attempting to stent lesions of greater than 5 cm. There was also a significant reduction in clinical success when stenting lesions on a bend rather than a straight segment of colon 75.7 % (109/144) versus 59.7 % (74/124) (p < 0.05). A total of 20 (7.46 %) perforations were identified during the study. Stent migration occurred in 6.6 % of cases. In-stent stenosis occurred in 3.3 %. The overall 30-day all cause mortality rate was 9 %.ConclusionLesion size, location and duration of obstructive symptoms are statistically significant determinants of patient outcome. These factors could be used to advise patient selection for colonic stenting or direct progression to surgical intervention.
Technical and Clinical Outcomes Following Colonic Stenting: A Seven-Year Analysis of 268 Procedures
International Nuclear Information System (INIS)
Little, M. W.; Oakley, T.; Briggs, J. H.; Sutcliffe, J. A.; Allouni, A. K.; Makris, G.; Bratby, M. J.; Tapping, C. R.; Patel, R.; Wigham, A.; Anthony, S.; Phillips-Hughes, J.; Uberoi, R.
2016-01-01
AimsTo assess the factors contributing to the technical and clinical success of colorectal stenting for large bowel obstruction.Methodology268 cases of colonic stenting for large bowel obstruction were performed in 249 patients of mean age of 72 years (28–98) between 2006 and 2013. The majority of strictures were due to malignant disease, 244/268 (91 %). Diverticular strictures accounted for 24/268 (9 %).ResultsOverall technical success rate was 81 % (217/268), with a clinical success rate of 65 % (174/268). Duration of symptoms ranged from 0 to 180 days (mean 8 days). Technical success rate was seen to decrease with increasing symptom duration. For symptom duration of less than 1 week, technical success was 85.4 % (181/212) versus 69.6 % (39/56) for those with symptoms of greater than a week (p < 0.05). Clinical success rates fell from 71.3 % (107/150) to 59.3 % (70/118) (p < 0.05) when attempting to stent lesions of greater than 5 cm. There was also a significant reduction in clinical success when stenting lesions on a bend rather than a straight segment of colon 75.7 % (109/144) versus 59.7 % (74/124) (p < 0.05). A total of 20 (7.46 %) perforations were identified during the study. Stent migration occurred in 6.6 % of cases. In-stent stenosis occurred in 3.3 %. The overall 30-day all cause mortality rate was 9 %.ConclusionLesion size, location and duration of obstructive symptoms are statistically significant determinants of patient outcome. These factors could be used to advise patient selection for colonic stenting or direct progression to surgical intervention.
Technical and Clinical Outcomes Following Colonic Stenting: A Seven-Year Analysis of 268 Procedures.
Little, M W; Oakley, T; Briggs, J H; Sutcliffe, J A; Allouni, A K; Makris, G; Bratby, M J; Tapping, C R; Patel, R; Wigham, A; Anthony, S; Phillips-Hughes, J; Uberoi, R
2016-10-01
To assess the factors contributing to the technical and clinical success of colorectal stenting for large bowel obstruction. 268 cases of colonic stenting for large bowel obstruction were performed in 249 patients of mean age of 72 years (28-98) between 2006 and 2013. The majority of strictures were due to malignant disease, 244/268 (91 %). Diverticular strictures accounted for 24/268 (9 %). Overall technical success rate was 81 % (217/268), with a clinical success rate of 65 % (174/268). Duration of symptoms ranged from 0 to 180 days (mean 8 days). Technical success rate was seen to decrease with increasing symptom duration. For symptom duration of less than 1 week, technical success was 85.4 % (181/212) versus 69.6 % (39/56) for those with symptoms of greater than a week (p < 0.05). Clinical success rates fell from 71.3 % (107/150) to 59.3 % (70/118) (p < 0.05) when attempting to stent lesions of greater than 5 cm. There was also a significant reduction in clinical success when stenting lesions on a bend rather than a straight segment of colon 75.7 % (109/144) versus 59.7 % (74/124) (p < 0.05). A total of 20 (7.46 %) perforations were identified during the study. Stent migration occurred in 6.6 % of cases. In-stent stenosis occurred in 3.3 %. The overall 30-day all cause mortality rate was 9 %. Lesion size, location and duration of obstructive symptoms are statistically significant determinants of patient outcome. These factors could be used to advise patient selection for colonic stenting or direct progression to surgical intervention.
Shen, Chunhong; Zhang, Bijun; Liu, Zhirong; Tang, Yelei; Zhang, Yinxi; Wang, Shan; Guo, Yi; Ding, Yao; Wang, Shuang; Ding, Meiping
2017-10-01
The aim of the study is to investigate the effects of ABCB1, ABCC2, UGT2B7 and HNF4α genetic polymorphisms on plasma oxcarbazepine (OXC) concentrations and therapeutic efficacy in Han Chinese patients with epilepsy. We recruited 116 Han Chinese patients with epilepsy who were receiving OXC monotherapy. Blood samples were taken and OXC levels were measured. The polymorphisms of ABCB1 rs1045642, ABCC2 rs2273697, UGT2B7 rs7439366, and HNF4α rs2071197 were determined. The therapeutic efficacy of OXC at the 1-year time-point was assessed. Data analysis was performed using IBM SPSS Statistics 22.0. The genetic polymorphism of ABCB1 rs1045642 was found to be associated with normalized OXC concentration and therapeutic efficacy in patients with epilepsy (P<0.05). As for UGT2B7 rs7439366, the allele polymorphism exhibited a correlation with treatment outcome, but not OXC concentration. The polymorphisms of ABCC2 rs2273697 and HNF4α rs2071197 was not associated with OXC concentrations and therapeutic efficacy. These results suggested that ABCB1 rs1045642 and UGT2B7 rs7439366 may affect OXC pharmacokinetics and therapeutic efficacy in Han Chinese patients with epilepsy. However, further studies in larger populations and other ethnic groups are required. Copyright © 2017 British Epilepsy Association. Published by Elsevier Ltd. All rights reserved.
24 CFR 203.268 - Pro rata payment of periodic MIP.
2010-04-01
... HOUSING AND URBAN DEVELOPMENT MORTGAGE AND LOAN INSURANCE PROGRAMS UNDER NATIONAL HOUSING ACT AND OTHER AUTHORITIES SINGLE FAMILY MORTGAGE INSURANCE Contract Rights and Obligations Mortgage Insurance Premiums-Periodic Payment § 203.268 Pro rata payment of periodic MIP. (a) If the insurance contract is terminated...
Energy Technology Data Exchange (ETDEWEB)
Toko, K., E-mail: toko@bk.tsukuba.ac.jp; Oya, N.; Suemasu, T. [Institute of Applied Physics, University of Tsukuba, 1-1-1 Tennodai, Tsukuba, Ibaraki 305-8573 (Japan); Saitoh, N.; Yoshizawa, N. [Electron Microscope Facility, TIA, AIST, 16-1 Onogawa, Tsukuba 305-8569 (Japan)
2015-02-23
Polycrystalline GeSn thin films are fabricated on insulating substrates at low temperatures by using Sn-induced crystallization of amorphous Ge (a-Ge). The Sn layer stacked on the a-Ge layer (100-nm thickness each) had two roles: lowering the crystallization temperature of a-Ge and composing GeSn. Slow annealing at an extremely low temperature of 70 °C allowed for a large-grained (350 nm) GeSn layer with a lattice constant of 0.590 nm, corresponding to a Sn composition exceeding 25%. The present investigation paves the way for advanced electronic optical devices integrated on a flexible plastic substrate as well as on a Si platform.
12 CFR 268.503 - Enforcement of final EEOC decisions.
2010-01-01
... the decision pursuant to title VII, the ADEA, the Equal Pay Act or the Rehabilitation Act and to seek... RESERVE SYSTEM RULES REGARDING EQUAL OPPORTUNITY Remedies and Enforcement § 268.503 Enforcement of final... Procedures Act, 5 U.S.C. 701 et seq., and the mandamus statute, 28 U.S.C. 1361, or to commence de novo...
12 CFR 268.407 - Civil action: Equal Pay Act.
2010-01-01
... 12 Banks and Banking 3 2010-01-01 2010-01-01 false Civil action: Equal Pay Act. 268.407 Section... Civil action: Equal Pay Act. A complainant is authorized under section 16(b) of the Fair Labor Standards..., if the violation is willful, three years of the date of the alleged violation of the Equal Pay Act...
Controlling the antibacterial activity of CuSn thin films by varying the contents of Sn
Energy Technology Data Exchange (ETDEWEB)
Kang, Yujin; Park, Juyun; Kim, Dong-Woo; Kim, Hakjun; Kang, Yong-Cheol, E-mail: yckang@pknu.ac.kr
2016-12-15
Highlights: • We deposit CuSn thin films on a Si substrate with various Cu/Sn ratio. • Antibacterial activities of CuSn thin films increased as the ratio of Cu and the contact time increased. • XPS was utilized to assign the chemical environment of CuSn thin films before and after antibacterial test. - Abstract: We investigated antibacterial activity of CuSn thin films against Gram positive Staphylococcus aureus (S. aureus). CuSn thin films with different Cu to Sn ratios were deposited on Si(100) by radio frequency (RF) magnetron sputtering method using Cu and Sn metal anodes. The film thickness was fixed at 200 nm by varying the sputtering time and RF power on the metal targets. The antibacterial test was conducted in various conditions such as different contact times and Cu to Sn ratios in the CuSn films. The antibacterial activities of CuSn thin films increased as the ratio of Cu and the contact time between the film and bacteria suspension increased execpt in the case of CuSn-83. The oxidation states of Cu and Sn and the chemical composition of CuSn thin films before and after the antibacterial test were investigated by X-ray photoelectron spectroscopy (XPS). When the contact time was fixed, the Cu species was further oxidized as the RF power on Cu target increased. The intensity of Sn 3d decreased with increasing Cu ratio. When the sample was fixed, the peak intensity of Sn 3d decreased as the contact time increased due to the permeation of Sn into the cell.
Spectral and ion emission features of laser-produced Sn and SnO2 plasmas
Hui, Lan; Xin-Bing, Wang; Du-Luo, Zuo
2016-03-01
We have made a detailed comparison of the atomic and ionic debris, as well as the emission features of Sn and SnO2 plasmas under identical experimental conditions. Planar slabs of pure metal Sn and ceramic SnO2 are irradiated with 1.06 μm, 8 ns Nd:YAG laser pulses. Fast photography employing an intensified charge coupled device (ICCD), optical emission spectroscopy (OES), and optical time of flight emission spectroscopy are used as diagnostic tools. Our results show that the Sn plasma provides a higher extreme ultraviolet (EUV) conversion efficiency (CE) than the SnO2 plasma. However, the kinetic energies of Sn ions are relatively low compared with those of SnO2. OES studies show that the Sn plasma parameters (electron temperature and density) are lower compared to those of the SnO2 plasma. Furthermore, we also give the effects of the vacuum degree and the laser pulse energy on the plasma parameters. Project supported by the National Natural Science Foundation of China (Grant No. 11304235) and the Director Fund of WNLO, China.
Fabrication of textured SnO2 transparent conductive films using self-assembled Sn nanospheres
Fukumoto, Michitaka; Nakao, Shoichiro; Hirose, Yasushi; Hasegawa, Tetsuya
2018-06-01
We present a novel method to fabricate textured surfaces on transparent conductive SnO2 films by processing substrates through a bottom-up technique with potential for industrially scalable production. The substrate processing consists of three steps: deposition of precursor Sn films on glass substrates, formation of a self-assembled Sn nanosphere layer with reductive annealing, and conversion of Sn to SnO2 by oxidative annealing. Ta-doped SnO2 films conformally deposited on the self-assembled nanospherical SnO2 templates exhibited attractive optical and electrical properties, namely, enhanced haze values and low sheet resistances, for applications as transparent electrodes in photovoltaics.
Ordered CoSn-type ternary phases in Co3Sn3-xGex
DEFF Research Database (Denmark)
Allred, Jared M.; Jia, Shuang; Bremholm, Martin
2012-01-01
. By taking advantage of the chemical differences between the two crystallographically inequivalent Sn sites in the structure, we observe ordered ternary phases, nominally Co3SnGe2 and Co3Sn2Ge. The electron count and unit cell configuration remain unchanged from CoSn; these observations thus help to clarify...
Growth of highly textured SnS on mica using an SnSe buffer layer
International Nuclear Information System (INIS)
Wang, S.F.; Fong, W.K.; Wang, W.; Surya, C.
2014-01-01
We report the growth of SnS thin films on mica substrates by molecular beam epitaxy. Excellent 2D layered structure and strong (001) texture were observed with a record low rocking curve full width at half maximum of ∼ 0.101° for the SnS(004) diffraction. An interface model is used to investigate the nucleation of SnS on mica which indicates the co-existence of six pairs of lateral growth orientations and is in excellent agreement with the experimental Φ-scan measurements indicating 12 peaks separated by 30° from each other. To control the lateral growth of the SnS epilayers we investigate the utilization of a thin SnSe buffer layer deposited on the mica substrate prior to the growth of the SnS thin film. The excellent lattice match between SnSe and mica enhances the alignment of the nucleation of SnS and suppresses the minor lateral orientations along the mica[110] direction and its orthogonal axis. Detailed low-frequency noise measurement was performed to characterize the trap density in the films and our results clearly demonstrate substantial reduction in the density of the localized states in the SnS epilayer with the use of an SnSe buffer layer. - Highlights: • A record low rocking curve FWHM for deposited SnS on mica • Investigation of the nucleation of SnS on mica using the interface model • Investigation of nucleation mechanism by phi-scan measurement • Grain boundary formation from crystallites of various nucleation orientations • Suppression of nucleation orientations using an SnSe buffer layer
Electrical and optical properties of SnEuTe and SnSrTe films
Ishida, Akihiro; Tsuchiya, Takuro; Yamada, Tomohiro; Cao, Daoshe; Takaoka, Sadao; Rahim, Mohamed; Felder, Ferdinand; Zogg, Hans
2010-06-01
The SnTe, Sn1-xEuxTe and Sn1-xSrxTe (x<0.06) films were prepared by hot wall epitaxy. The ternary alloy films prepared in cation rich condition had hole concentration around 1×1019 cm-3 with high mobility exceeding 2000 cm2/V s at room temperature. Optical transmission spectra were also measured in the temperature range from 100 to 400 K and compared with theoretical calculations. Optical transmission spectra of the SnTe were simulated successfully assuming bumped band edge structures. A band inversion model was proposed for the Sn1-xEuxTe and Sn1-xSrxTe systems, and the optical transmission spectra were also simulated successfully assuming the band inversion model.
Sex Differences in Social Interaction in Rats: Role of the Immediate-Early Gene zif268
Stack, Ashley; Carrier, Nicole; Dietz, David; Hollis, Fiona; Sorenson, Jamie; Kabbaj, Mohamed
2009-01-01
Given both the high prevalence of anxiety disorders in women and the fact that little is known about the mechanisms of gender differences in anxiety, our primary aim in this study was to investigate the neurobiological mechanisms underlying sex differences in social anxiety-like behavior in rats. Through the use of zif268 antisense oligodeoxynucleotides (zif ASO), we induced a temporary downregulation of zif268 expression in the medial prefrontal cortex of male and female rats and found that ...
Laser soldering of Sn-Ag-Cu and Sn-Zn-Bi lead-free solder pastes
Takahashi, Junichi; Nakahara, Sumio; Hisada, Shigeyoshi; Fujita, Takeyoshi
2004-10-01
It has reported that a waste of an electronics substrate including lead and its compound such as 63Sn-37Pb has polluted the environment with acid rain. For that environment problem the development of lead-free solder alloys has been promoted in order to find out the substitute for Sn-Pb solders in the United States, Europe, and Japan. In a present electronics industry, typical alloys have narrowed down to Sn-Ag-Cu and Sn-Zn lead-free solder. In this study, solderability of Pb-free solder that are Sn-Ag-Cu and Sn-Zn-Bi alloy was studied on soldering using YAG (yttrium aluminum garnet) laser and diode laser. Experiments were peformed in order to determine the range of soldering parameters for obtaining an appropriate wettability based on a visual inspection. Joining strength of surface mounting chip components soldered on PCB (printed circuit board) was tested on application thickness of solder paste (0.2, 0.3, and 0.4 mm). In addition, joining strength characteristics of eutectic Sn-Pb alloy and under different power density were examined. As a result, solderability of Sn-Ag-Cu (Pb-free) solder paste are equivalent to that of coventional Sn-Pb solder paste, and are superior to that of Sn-Zn-Bi solder paste in the laser soldering method.
DEFF Research Database (Denmark)
Pastorello...[], A.; Pumo, M.L.; Navasardyan, H.
2012-01-01
. In this paper we investigate the properties of SN 2009E, which exploded in a relatively nearby spiral galaxy (NGC 4141) and that is probably the faintest 1987A-like supernova discovered so far. We also attempt to characterize this subgroup of core-collapse supernovae with the help of the literature and present...... observations which started about 2 months after the supernova explosion, highlight significant differences between SN 2009E and the prototypical SN 1987A. Modelling the data of SN 2009E allows us to constrain the explosion parameters and the properties of the progenitor star, and compare the inferred estimates...... 2009E ejected about 0.04 M⊙ of 56Ni, which is the smallest 56Ni mass in our sample of 1987A-like events. Modelling the observations with a radiation hydrodynamics code, we infer for SN 2009E a kinetic plus thermal energy of about 0.6 foe, an initial radius of ~7 × 1012 cm and an ejected mass of ~19 M...
International Nuclear Information System (INIS)
HAMMERS, J.S.
1999-01-01
The purpose of the test was to verify that the AN Tank Farm Manifold Valves can be manually manipulated to the required operating position and that the electrical and visual indications accurately reflect that position. Physical locking devices were also verified to function. The Acceptance Test Procedure HNF-4642, 241-AN-A Valve Pit Manifold Valves and Position Indication was conducted between 23 June and 10 August 1999 at the 200E AN Tank Farm. The test has no open test exceptions. The test was conducted prior to final engineering ''as built'' activities being completed, this had an impact on the procedure and test results, ECN 653752 was written to correct the mismatch between the procedure and actual field conditions. P and ID H-14-100941 was changed via ECN-W-314-4C-120. All components, identified in the procedure, were not found to be labeled and identified as written in the procedure, temporary tags were used for operational identification. A retest of valve ANA-WT-V 318 was required because it was removed from its installed position and modified after testing was completed
Preparation, deformation, and failure of functional Al-Sn and Al-Sn-Pb nanocrystalline alloys
Noskova, N. I.; Vil'Danova, N. F.; Filippov, Yu. I.; Churbaev, R. V.; Pereturina, I. A.; Korshunov, L. G.; Korznikov, A. V.
2006-12-01
Changes in the structure, hardness, mechanical properties, and friction coefficient of Al-30% Sn, Al-15% Sn-25% Pb, and Al-5% Sn-35% Pb (wt %) alloys subjected to severe plastic deformation by equal-channel angular pressing (with a force of 40 tonne) and by shear at a pressure of 5 GPa have been studied. The transition into the nanocrystalline state was shown to occur at different degrees of plastic deformation. The hardness exhibits nonmonotonic variations, namely, first it increases and subsequently decreases. The friction coefficient of the Al-30% Sn, Al-15% Sn-25% Pb, and Al-5% Sn-35% Pb alloys quenched from the melt was found to be 0.33; the friction coefficients of these alloys in the submicrocrystalline state (after equal-channel angular pressing) equal 0.24, 0.32, and 0.35, respectively. The effect of disintegration into nano-sized powders was found to occur in the Al-15% Sn-25% Pb, and Al-5% Sn-35% Pb alloys after severe plastic deformation to ɛ = 6.4 and subsequent short-time holding.
Study of neutron-deficient Sn isotopes
International Nuclear Information System (INIS)
Auger, G.
1982-05-01
The formation of neutron deficient nuclei by heavy ion reactions is investigated. The experimental technique is presented, and the results obtained concerning Sn et In isotopes reported: first excited states of 106 Sn, high spin states in 107 Sn and 107 In; Yrast levels of 106 Sn, 107 Sn, 108 Sn; study of neutron deficient Sn and In isotopes formed by the desintegration of the compound nucleus 112 Xe. All these results are discussed [fr
Electrochemical properties of Ti-Ni-Sn materials predicted by {sup 119}Sn Mössbauer spectroscopy
Energy Technology Data Exchange (ETDEWEB)
Ladam, A., E-mail: alix.ladam@univ-montp2.fr; Aldon, L.; Lippens, P.-E.; Olivier-Fourcade, J.; Jumas, J.-C. [Université de Montpellier, Institut Charles Gerhardt, UMR 5253 CNRS (France); Cenac-Morthe, C. [CNES, Service DCT/TV/El (France)
2016-12-15
The electrochemical activity of TiNiSn, TiNi {sub 2}Sn and Ti {sub 6}Sn {sub 5} compounds considered as negative electrode materials for Li-ion batteries has been predicted from the isomer shift- Hume-Rothery electronic density correlation diagram. The ternary compounds were obtained from solid-state reactions and Ti {sub 6}Sn {sub 5} by ball milling. The {sup 119}Sn Mössbauer parameters were experimentally determined and used to evaluate the Hume-Rothery electronic density [e {sub av}]. The values of [e {sub av}] are in the region of Li-rich Li-Sn alloys for Ti {sub 6}Sn {sub 5} and outside this region for the ternary compounds, suggesting that the former compound is electrochemically active but not the two latter ones. Electrochemical tests were performed for these different materials confirming this prediction. The close values of [e {sub av}] for Ti {sub 6}Sn {sub 5} and Li-rich Li-Sn alloys indicate that the observed good capacity retention could be related to small changes in the global structures during cycling.
Zhu, Xiaolei
2007-01-01
Ground and excited states of mixed gallium stannide tetramers (Ga 3Sn, Ga 3Sn +, Ga 3Sn -, GaSn 3, GaSn 3+, and GaSn 3-) are investigated employing the complete active space self-consistent-field (CASSCF), density function theory (DFT), and the coupled-cluster single and double substitution (including triple excitations) (CCSD(T)) methods. The ground states of Ga 3Sn, Ga 3Sn +, and Ga 3Sn - are found to be the 2A 1, 3B 1, and 1A 1 states in C2v symmetry with a planar quadrilateral geometry, respectively. The ground states of GaSn 3 and GaSn 3- is predicted to be the 2A 1 and 1A 1 states in C2v point group with a planar quadrilateral structure, respectively, while the ground state of GaSn 3+ is the 1A 1 state with ideal triangular pyramid C3v geometry. Equilibrium geometries, vibrational frequencies, binding energies, electron affinities, ionization energies, and other properties of Ga 3Sn and GaSn 3 are computed and discussed. The anion photoelectron spectra of Ga 3Sn - and GaSn 3- are also predicted. It is interesting to find that the amount of charge transfer between Ga and Sn 2 atoms in the 1A 1 state of GaSn 3+ greatly increases upon electron ionization from the 2A 1 state of GaSn 3, which may be caused by large geometry change. On the other hand, the results of the low-lying states of Ga 3Sn and GaSn 3 are compared with those of Ga 3Si and GaSi 3.
Electro-oxidation of Ethanol on Carbon Supported PtSn and PtSnNi Catalysts
Directory of Open Access Journals (Sweden)
Nur Hidayati
2016-03-01
Full Text Available Even though platinum is known as an active electro-catalyst for ethanol oxidation at low temperatures (< 100 oC, choosing the electrode material for ethanol electro-oxidation is a crucial issue. It is due to its property which easily poisoned by a strong adsorbed species such as CO. PtSn-based electro-catalysts have been identified as better catalysts for ethanol electro-oxidation. The third material is supposed to improved binary catalysts performance. This work presents a study of the ethanol electro-oxidation on carbon supported Pt-Sn and Pt-Sn-Ni catalysts. These catalysts were prepared by alcohol reduction. Nano-particles with diameters between 2.5-5.0 nm were obtained. The peak of (220 crystalline face centred cubic (fcc Pt phase for PtSn and PtSnNi alloys was repositioned due to the presence of Sn and/or Ni in the alloy. Furthermore, the modification of Pt with Sn and SnNi improved ethanol and CO electro-oxidation. Copyright © 2016 BCREC GROUP. All rights reserved Received: 10th November 2015; Revised: 1st February 2016; Accepted: 1st February 2016 How to Cite: Hidayati, N., Scott, K. (2016. Electro-oxidation of Ethanol on Carbon Supported PtSn and PtSnNi Catalysts. Bulletin of Chemical Reaction Engineering & Catalysis, 11 (1: 10-20. (doi:10.9767/bcrec.11.1.394.10-20 Permalink/DOI: http://dx.doi.org/10.9767/bcrec.11.1.394.10-20
CONSTRUÇÕES BINOMINAIS DO TIPO SN1 DE SN2
Directory of Open Access Journals (Sweden)
Karen Sampaio Braga Alonso
2017-04-01
Full Text Available Este artigo tem por objetivo investigar a flutuação de sentido quantidade-qualidade licenciada pelo uso de construtos binominais do tipo SN1 de SN2, como xícara de chá, no Português do Brasil.A pesquisa é baseada na perspectiva teórica da Linguística Funcional Centrada no Uso (BYBEE, 2010; BARLOW E KEMMER, 2000; TOMASELLO, 2003, TRAUGOTT, 2008 e busca descrever as propriedades morfossintáticas, semântico-pragmáticas e cognitivas dos usos das construções que favorecem uma leitura ora qualitativa ora quantitativa, no que se refere à relação entre SN1 e SN2.
SN 2013fs and SN 2013fr: exploring the circumstellar-material diversity in Type II supernovae
Bullivant, Christopher; Smith, Nathan; Williams, G. Grant; Mauerhan, Jon C.; Andrews, Jennifer E.; Fong, Wen-Fai; Bilinski, Christopher; Kilpatrick, Charles D.; Milne, Peter A.; Fox, Ori D.; Cenko, S. Bradley; Filippenko, Alexei V.; Zheng, WeiKang; Kelly, Patrick L.; Clubb, Kelsey I.
2018-05-01
We present photometry and spectroscopy of SN 2013fs and SN 2013fr in the first ˜100 d post-explosion. Both objects showed transient, relatively narrow H α emission lines characteristic of SNe IIn, but later resembled normal SNe II-P or SNe II-L, indicative of fleeting interaction with circumstellar material (CSM). SN 2013fs was discovered within 8 h of explosion; one of the earliest SNe discovered thus far. Its light curve exhibits a plateau, with spectra revealing strong CSM interaction at early times. It is a less luminous version of the transitional SN IIn PTF11iqb, further demonstrating a continuum of CSM interaction intensity between SNe II-P and SNe IIn. It requires dense CSM within 6.5 × 1014 cm of the progenitor, from a phase of advanced pre-SN mass loss beginning shortly before explosion. Spectropolarimetry of SN 2013fs shows little continuum polarization (˜0.5 per cent, consistent with zero), but noticeable line polarization during the plateau phase. SN 2013fr morphed from an SN IIn at early times to an SN II-L. After the first epoch, its narrow lines probably arose from host-galaxy emission, but the bright, narrow H α emission at early times may be intrinsic to the SN. As for SN 2013fs, this would point to a short-lived phase of strong CSM interaction if proven to be intrinsic, suggesting a continuum between SNe IIn and SNe II-L. It is a low-velocity SN II-L like SN 2009kr, but more luminous. SN 2013fr also developed an infrared excess at later times, due to warm CSM dust that requires a more sustained phase of strong pre-SN mass loss.
SnO and SnO·CoO nanocomposite as high capacity anode materials for lithium ion batteries
Energy Technology Data Exchange (ETDEWEB)
Das, B., E-mail: bijoy822000@gmail.com; Reddy, M.V.; Chowdari, B.V.R, E-mail: phychowd@nus.edu.sg
2016-02-15
Highlights: • The preparation methods are simple, low cost and can be scaled up for large production. • SnO is cheap, non-toxic and eco-friendly. • SnO shows high reversible capacity (Theoretical reversible capacity: 875 mA h g{sup −1}). • We showed high reversible capacity and columbic efficiency for SnO and SnO based composites. • We addressed the capacity degradation by introducing secondary phase (CoO and CNT etc.) - Abstract: We prepared SnO nanoparticles (SnO–S) and SnO·CoO nanocomposites (SnO·CoO–B) as anodes for lithium ion batteries (LIBs) by chemical and ball-milling approaches, respectively. They are characterized by X-ray diffraction and TEM techniques. The Li- storage performance are evaluated by galvanostatic cycling and cyclic voltammetry. The SnO–S and SnO·CoO–B showed improved cycling performance due to their finite particle size (i.e. nano-size) and presence of secondary phase (CoO). Better cycling stability is noticed for SnO·CoO–B with the expense of their reversible capacity. Also, addition of carbon nanotubes (CNT) to SnO–S further improved the cycling performance of SnO–S. When cycled at 60 mA g{sup −1}, the first-cycle reversible capacities of 635, 590 and 460 (±10) mA h g{sup −1} are noticed for SnO–S, SnO@CNT and SnO·CoO–B, respectively. The capacity fading observed are 3.7 and 1.8 mA h g{sup −1} per cycle for SnO–S and SnO@CNT, respectively; whereas 1–1.2 mA h g{sup −1} per cycle for SnO·CoO–B. All the samples show high coulombic efficiency, 96–98% in the range of 5–50 cycles.
The Tubular Sheaths Encasing Methanosaeta thermophila Filaments Are Functional Amyloids.
Dueholm, Morten S; Larsen, Poul; Finster, Kai; Stenvang, Marcel R; Christiansen, Gunna; Vad, Brian S; Bøggild, Andreas; Otzen, Daniel E; Nielsen, Per Halkjær
2015-08-14
Archaea are renowned for their ability to thrive in extreme environments, although they can be found in virtually all habitats. Their adaptive success is linked to their unique cell envelopes that are extremely resistant to chemical and thermal denaturation and that resist proteolysis by common proteases. Here we employ amyloid-specific conformation antibodies and biophysical techniques to show that the extracellular cell wall sheaths encasing the methanogenic archaea Methanosaeta thermophila PT are functional amyloids. Depolymerization of sheaths and subsequent MS/MS analyses revealed that the sheaths are composed of a single major sheath protein (MspA). The amyloidogenic nature of MspA was confirmed by in vitro amyloid formation of recombinant MspA under a wide range of environmental conditions. This is the first report of a functional amyloid from the archaeal domain of life. The amyloid nature explains the extreme resistance of the sheath, the elastic properties that allow diffusible substrates to penetrate through expandable hoop boundaries, and how the sheaths are able to split and elongate outside the cell. The archaeal sheath amyloids do not share homology with any of the currently known functional amyloids and clearly represent a new function of the amyloid protein fold. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.
Chen, Mingxi; Zhang, Congcong; Li, Lingzhi; Liu, Yu; Li, Xichuan; Xu, Xiaoyang; Xia, Fengling; Wang, Wei; Gao, Jianping
2013-12-26
A facile approach to prepare SnO2/rGO (reduced graphene oxide) hybrid nanoparticles by a direct redox reaction between graphene oxide (GO) and tin powder was developed. Since no acid was used, it is an environmentally friendly green method. The SnO2/rGO hybrid nanoparticles were characterized by ultraviolet-visible spectroscopy, Raman spectroscopy, thermogravimetric analysis, X-ray diffraction analysis, and X-ray photoelectron spectroscopy. The microstructure of the SnO2/rGO was observed with scanning electron microscopy and transmission electron microscopy. The tin powder efficiently reduced GO to rGO, and the Sn was transformed to SnO2 nanoparticles (∼45 nm) that were evenly distributed on the rGO sheets. The SnO2/rGO hybrid nanoparticles were then coated on an interdigital electrode to fabricate a humidity sensor, which have an especially good linear impedance response from 11% to 85% relative humidity.
Behavior of Sn atoms in GeSn thin films during thermal annealing: Ex-situ and in-situ observations
Takase, Ryohei; Ishimaru, Manabu; Uchida, Noriyuki; Maeda, Tatsuro; Sato, Kazuhisa; Lieten, Ruben R.; Locquet, Jean-Pierre
2016-12-01
Thermally induced crystallization processes for amorphous GeSn thin films with Sn concentrations beyond the solubility limit of the bulk crystal Ge-Sn binary system have been examined by X-ray photoelectron spectroscopy, grazing incidence X-ray diffraction, and (scanning) transmission electron microscopy. We paid special attention to the behavior of Sn before and after recrystallization. In the as-deposited specimens, Sn atoms were homogeneously distributed in an amorphous matrix. Prior to crystallization, an amorphous-to-amorphous phase transformation associated with the rearrangement of Sn atoms was observed during heat treatment; this transformation is reversible with respect to temperature. Remarkable recrystallization occurred at temperatures above 400 °C, and Sn atoms were ejected from the crystallized GeSn matrix. The segregation of Sn became more pronounced with increasing annealing temperature, and the ejected Sn existed as a liquid phase. It was found that the molten Sn remains as a supercooled liquid below the eutectic temperature of the Ge-Sn binary system during the cooling process, and finally, β-Sn precipitates were formed at ambient temperature.
A facile inexpensive route for SnS thin film solar cells with SnS{sub 2} buffer
Energy Technology Data Exchange (ETDEWEB)
Gedi, Sreedevi [School of Chemical Engineering, Yeungnam University, 280Daehak-ro, Gyeongsan 712-749, Republic of Korea (Korea, Republic of); Solar Photovoltaic Laboratory, Department of Physics, Sri Venkateswasra University, Tirupati 517 502 (India); Minna Reddy, Vasudeva Reddy, E-mail: drmvasudr9@gmail.com [School of Chemical Engineering, Yeungnam University, 280Daehak-ro, Gyeongsan 712-749, Republic of Korea (Korea, Republic of); Solar Photovoltaic Laboratory, Department of Physics, Sri Venkateswasra University, Tirupati 517 502 (India); Pejjai, Babu [School of Chemical Engineering, Yeungnam University, 280Daehak-ro, Gyeongsan 712-749, Republic of Korea (Korea, Republic of); Solar Photovoltaic Laboratory, Department of Physics, Sri Venkateswasra University, Tirupati 517 502 (India); Jeon, Chan-Wook [School of Chemical Engineering, Yeungnam University, 280Daehak-ro, Gyeongsan 712-749, Republic of Korea (Korea, Republic of); Park, Chinho, E-mail: chpark@ynu.ac.kr [School of Chemical Engineering, Yeungnam University, 280Daehak-ro, Gyeongsan 712-749, Republic of Korea (Korea, Republic of); Ramakrishna Reddy, K.T., E-mail: ktrkreddy@gmail.com [Solar Photovoltaic Laboratory, Department of Physics, Sri Venkateswasra University, Tirupati 517 502 (India)
2016-05-30
Graphical abstract: PYS spectra of SnS/SnS{sub 2} interface and the related band diagram. - Highlights: • A low cost SnS solar cell is developed using chemical bath deposition. • We found E{sub I} & χ of SnS (5.3 eV & 4.0 eV) and SnS{sub 2} (6.9 eV & 4.1 eV) films from PYS. • Band offsets of 0.1 eV (E{sub c}) and 1.6 eV (E{sub v}) are estimated for SnS/SnS{sub 2} junction. • SnS based solar cell showed a conversion efficiency of 0.51%. - Abstract: Environment-friendly SnS based thin film solar cells with SnS{sub 2} as buffer layer were successfully fabricated from a facile inexpensive route, chemical bath deposition (CBD). Layer studies revealed that as-grown SnS and SnS{sub 2} films were polycrystalline; (1 1 1)/(0 0 1) peaks as the preferred orientation; 1.3 eV/2.8 eV as optical band gaps; and showed homogeneous microstructure with densely packed grains respectively. Ionization energy and electron affinity values were found by applying photoemission yield spectroscopy (PYS) to the CBD deposited SnS and SnS{sub 2} films for the first time. These values obtained as 5.3 eV and 4.0 eV for SnS films; 6.9 eV and 4.1 eV for SnS{sub 2} films. The band alignment of SnS/SnS{sub 2} junction showed TYPE-II heterostructure. The estimated conduction and valance band offsets were 0.1 eV and 1.6 eV respectively. The current density–voltage (J–V) measurements of the cell showed open circuit voltage (V{sub oc}) of 0.12 V, short circuit current density (J{sub sc}) of 10.87 mA cm{sup −2}, fill factor (FF) of 39% and conversion efficiency of 0.51%.
Takayama, Kazuo; Inamura, Mitsuru; Kawabata, Kenji; Katayama, Kazufumi; Higuchi, Maiko; Tashiro, Katsuhisa; Nonaka, Aki; Sakurai, Fuminori; Hayakawa, Takao; Kusuda Furue, Miho; Mizuguchi, Hiroyuki
2012-01-01
Hepatocyte-like cells from human embryonic stem cells (ESCs) and induced pluripotent stem cells (iPSCs) are expected to be a useful source of cells drug discovery. Although we recently reported that hepatic commitment is promoted by transduction of SOX17 and HEX into human ESC- and iPSC-derived cells, these hepatocyte-like cells were not sufficiently mature for drug screening. To promote hepatic maturation, we utilized transduction of the hepatocyte nuclear factor 4α (HNF4α) gene, which is kn...
49 CFR 268.3 - Different phases of the Maglev Deployment Program.
2010-10-01
... 49 Transportation 4 2010-10-01 2010-10-01 false Different phases of the Maglev Deployment Program... DEPLOYMENT PROGRAM Overview § 268.3 Different phases of the Maglev Deployment Program. (a) The Maglev... deadlines—based on the progress of the Maglev Deployment Program; grantees will be notified accordingly. (b...
The FUSE satellite is encased in a canister before being moved to the Launch Pad.
1999-01-01
At Hangar AE, Cape Canaveral Air Station (CCAS), the last segment is lifted over the top of NASA's Far Ultraviolet Spectroscopic Explorer (FUSE) satellite already encased in a protective canister. The satellite will next be moved to Launch Pad 17A, CCAS, for its scheduled launch June 23 aboard a Boeing Delta II rocket. FUSE was developed by The Johns Hopkins University under contract to Goddard Space Flight Center, Greenbelt, Md., to investigate the origin and evolution of the lightest elements in the universe - hydrogen and deuterium. In addition, the FUSE satellite will examine the forces and process involved in the evolution of the galaxies, stars and planetary systems by investigating light in the far ultraviolet portion of the electromagnetic spectrum.
The 7SK snRNP associates with the little elongation complex to promote snRNA gene expression.
Egloff, Sylvain; Vitali, Patrice; Tellier, Michael; Raffel, Raoul; Murphy, Shona; Kiss, Tamás
2017-04-03
The 7SK small nuclear RNP (snRNP), composed of the 7SK small nuclear RNA (snRNA), MePCE, and Larp7, regulates the mRNA elongation capacity of RNA polymerase II (RNAPII) through controlling the nuclear activity of positive transcription elongation factor b (P-TEFb). Here, we demonstrate that the human 7SK snRNP also functions as a canonical transcription factor that, in collaboration with the little elongation complex (LEC) comprising ELL, Ice1, Ice2, and ZC3H8, promotes transcription of RNAPII-specific spliceosomal snRNA and small nucleolar RNA (snoRNA) genes. The 7SK snRNA specifically associates with a fraction of RNAPII hyperphosphorylated at Ser5 and Ser7, which is a hallmark of RNAPII engaged in snRNA synthesis. Chromatin immunoprecipitation (ChIP) and chromatin isolation by RNA purification (ChIRP) experiments revealed enrichments for all components of the 7SK snRNP on RNAPII-specific sn/snoRNA genes. Depletion of 7SK snRNA or Larp7 disrupts LEC integrity, inhibits RNAPII recruitment to RNAPII-specific sn/snoRNA genes, and reduces nascent snRNA and snoRNA synthesis. Thus, through controlling both mRNA elongation and sn/snoRNA synthesis, the 7SK snRNP is a key regulator of nuclear RNA production by RNAPII. © 2017 The Authors.
International Nuclear Information System (INIS)
Flukiger, R.
1983-01-01
A method is disclosed for producing a superconductive wire of multifilaments having components comprising niobium and aluminum encased in copper or a copper alloy, wherein the multifilament configuration and the formation of a superconductive A15 phase are positively developed from the components disposed in a copper or copper alloy tube having an interior metallic coating serving as a diffusion barrier, by cold forming and subsequent heat treatment
Effect of Sn addition on the microstructure and superelasticity in Ti-Nb-Mo-Sn alloys.
Zhang, D C; Yang, S; Wei, M; Mao, Y F; Tan, C G; Lin, J G
2012-09-01
Ti-7.5Nb-4Mo-xSn (x=0-4at%) alloys were developed as the biomedical materials. The effect of the Sn content on the microstructure and superelasticity of the alloys was investigated. It is found that Sn is a strong stabilizer of the β phase, which is effective in suppressing the formation of α″ and ω phases in the alloys. Moreover, the Sn addition has a significant impact on the mechanical properties of the alloys. With the increase of Sn addition, the yield stress of the alloys increase, but their elastic modulus, the fracture strength and the ductility decrease, and the deformation mode of the alloys changes from (322) twining to α″ transformation and then to slip. The Ti-7.5Nb-4Mo-1Sn and Ti-7.5Nb-4Mo-3Sn alloys exhibit a good superelasticity with a high σ(SIM) due to the relatively high athermal ω phases containing or the solution hardening at room temperature. Under the maximum strain of 5%, Ti-7.5Nb-4Mo-3Sn (at%) alloy exhibits higher super elastic stability than that of Ti-7.5Nb-4Mo-1Sn alloy. Copyright © 2012 Elsevier Ltd. All rights reserved.
Fabrication of high crystalline SnS and SnS2 thin films, and their switching device characteristics
Choi, Hyeongsu; Lee, Jeongsu; Shin, Seokyoon; Lee, Juhyun; Lee, Seungjin; Park, Hyunwoo; Kwon, Sejin; Lee, Namgue; Bang, Minwook; Lee, Seung-Beck; Jeon, Hyeongtag
2018-05-01
Representative tin sulfide compounds, tin monosulfide (SnS) and tin disulfide (SnS2) are strong candidates for future nanoelectronic devices, based on non-toxicity, low cost, unique structures and optoelectronic properties. However, it is insufficient for synthesizing of tin sulfide thin films using vapor phase deposition method which is capable of fabricating reproducible device and securing high quality films, and their device characteristics. In this study, we obtained highly crystalline SnS thin films by atomic layer deposition and obtained highly crystalline SnS2 thin films by phase transition of the SnS thin films. The SnS thin film was transformed into SnS2 thin film by annealing at 450 °C for 1 h in H2S atmosphere. This phase transition was confirmed by x-ray diffractometer and x-ray photoelectron spectroscopy, and we studied the cause of the phase transition. We then compared the film characteristics of these two tin sulfide thin films and their switching device characteristics. SnS and SnS2 thin films had optical bandgaps of 1.35 and 2.70 eV, and absorption coefficients of about 105 and 104 cm‑1 in the visible region, respectively. In addition, SnS and SnS2 thin films exhibited p-type and n-type semiconductor characteristics. In the images of high resolution-transmission electron microscopy, SnS and SnS2 directly showed a highly crystalline orthorhombic and hexagonal layered structure. The field effect transistors of SnS and SnS2 thin films exhibited on–off drain current ratios of 8.8 and 2.1 × 103 and mobilities of 0.21 and 0.014 cm2 V‑1 s‑1, respectively. This difference in switching device characteristics mainly depends on the carrier concentration because it contributes to off-state conductance and mobility. The major carrier concentrations of the SnS and SnS2 thin films were 6.0 × 1016 and 8.7 × 1013 cm‑3, respectively, in this experiment.
Energy Technology Data Exchange (ETDEWEB)
Li, Xiaojia [Tianjin International Joint Research Centre of Surface Technology for Energy Storage Materials, College of Physics and Materials Science, Tianjin Normal University, Tianjin 300387 (China); Li, Xifei, E-mail: xfli2011@hotmail.com [Tianjin International Joint Research Centre of Surface Technology for Energy Storage Materials, College of Physics and Materials Science, Tianjin Normal University, Tianjin 300387 (China); Center for Advanced Energy Materials and Devices, Xi’an University of Technology, Xi’an 710048 (China); Key Laboratory of Advanced Energy Materials Chemistry (Ministry of Education), Collaborative Innovation Center of Chemical Science and Engineering, College of Chemistry, Nankai University, Tianjin 300071 (China); Fan, Linlin; Yu, Zhuxin; Yan, Bo; Xiong, Dongbin; Song, Xiaosheng; Li, Shiyu [Tianjin International Joint Research Centre of Surface Technology for Energy Storage Materials, College of Physics and Materials Science, Tianjin Normal University, Tianjin 300387 (China); Adair, Keegan R. [Nanomaterials and Energy Lab., Department of Mechanical and Materials Engineering, Western University, London, Ontario N6A 5B9 (Canada); Li, Dejun, E-mail: dejunli@mail.tjnu.edu.cn [Tianjin International Joint Research Centre of Surface Technology for Energy Storage Materials, College of Physics and Materials Science, Tianjin Normal University, Tianjin 300387 (China); Sun, Xueliang, E-mail: xsun9@uwo.ca [Nanomaterials and Energy Lab., Department of Mechanical and Materials Engineering, Western University, London, Ontario N6A 5B9 (Canada); Tianjin International Joint Research Centre of Surface Technology for Energy Storage Materials, College of Physics and Materials Science, Tianjin Normal University, Tianjin 300387 (China)
2017-08-01
Highlights: • Sn/SnO{sub 2}/porous carbon nanocomposites are rationally designed via a facile strategy. • The porous carbon mitigates the volume change and poor conductivity of Sn/SnO{sub 2}. • The nanocomposites exhibit the enhanced sodium storage performance. - Abstract: Sodium-ion batteries (SIBs) have successfully attracted considerable attention for application in energy storage, and have been proposed as an alternative to lithium ion batteries (LIBs) due to the abundance of sodium resources and low price. Sn has been deemed as a promising anode material in SIBs which holds high theoretical specific capacity of 845 mAh g{sup −1}. In this work we design nanocomposite materials consisting of porous carbon (PC) with SnO{sub 2} and Sn (Sn/SnO{sub 2}/PC) via a facile reflux method. Served as an anode material for SIBs, the Sn/SnO{sub 2}/PC nanocomposite delivers the primary discharge and charge capacities of 1148.1 and 303.0 mAh g{sup −1}, respectively. Meanwhile, it can preserve the discharge capacity approximately of 265.4 mAh g{sup −1} after 50 cycles, which is much higher than those of SnO{sub 2}/PC (138.5 mAh g{sup −1}) and PC (92.2 mAh g{sup −1}). Furthermore, the Sn/SnO{sub 2}/PC nanocomposite possesses better cycling stability with 77.8% capacity retention compared to that of SnO{sub 2}/PC (61.88%) over 50 cycles. Obviously, the Sn/SnO{sub 2}/PC composite with excellent electrochemical performance shows the great possibility of application in SIBs.
Xu, Wangwang; Xie, Zhiqiang; Cui, Xiaodan; Zhao, Kangning; Zhang, Lei; Dietrich, Grant; Dooley, Kerry M; Wang, Ying
2015-10-14
Complex hierarchical structures have received tremendous attention due to their superior properties over their constitute components. In this study, hierarchical graphene-encapsulated hollow SnO2@SnS2 nanostructures are successfully prepared by in situ sulfuration on the backbones of hollow SnO2 spheres via a simple hydrothermal method followed by a solvothermal surface modification. The as-prepared hierarchical SnO2@SnS2@rGO nanocomposite can be used as anode material in lithium ion batteries, exhibiting excellent cyclability with a capacity of 583 mAh/g after 100 electrochemical cycles at a specific current of 200 mA/g. This material shows a very low capacity fading of only 0.273% per cycle from the second to the 100th cycle, lower than the capacity degradation of bare SnO2 hollow spheres (0.830%) and single SnS2 nanosheets (0.393%). Even after being cycled at a range of specific currents varied from 100 mA/g to 2000 mA/g, hierarchical SnO2@SnS2@rGO nanocomposites maintain a reversible capacity of 664 mAh/g, which is much higher than single SnS2 nanosheets (374 mAh/g) and bare SnO2 hollow spheres (177 mAh/g). Such significantly improved electrochemical performance can be attributed to the unique hierarchical hollow structure, which not only effectively alleviates the stress resulting from the lithiation/delithiation process and maintaining structural stability during cycling but also reduces aggregation and facilitates ion transport. This work thus demonstrates the great potential of hierarchical SnO2@SnS2@rGO nanocomposites for applications as a high-performance anode material in next-generation lithium ion battery technology.
In situ 119Sn Moessbauer spectroscopy used to study lithium insertion in c-Mg2Sn
International Nuclear Information System (INIS)
Aldon, L.; Ionica, C. M.; Lippens, P. E.; Larcher, D.; Tarascon, J.-M.; Olivier-Fourcade, J.; Jumas, J.-C.
2006-01-01
The electrochemical reactions of Li with c-Mg 2 Sn have been investigated by in situ Moessbauer spectroscopy of 119 Sn and X-ray diffraction. The lithiation transforms initially c-Mg 2 Sn part into Li x Mg 2 Sn alloy (x 2 MgSn ternary alloy. In situ Moessbauer spectroscopy provides valuable information on local environment of tin and swelling behavior and cracking of the particles during discharge and charge processes.
12 CFR 268.205 - Employment of aliens; Access to sensitive information.
2010-01-01
... 12 Banks and Banking 3 2010-01-01 2010-01-01 false Employment of aliens; Access to sensitive... Complaints § 268.205 Employment of aliens; Access to sensitive information. (a) Definitions. The definitions...— (i) A citizen or National of the United States, (ii) An alien who: (A) Meets the conditions set forth...
Stable and metastable equilibria in PbSe + SnI2=SnSe + PbI2
International Nuclear Information System (INIS)
Odin, I.N.; Grin'ko, V.V.; Kozlovskij, V.F.; Demidova, E.D.
2003-01-01
T-x-y phase diagrams of the PbSe + SnI 2 =SnSe + PbI 2 mutual system (stable states) are plotted for the first time. It is shown that melt, solid solutions on the base of components of the mutual system and phase on the base of Sn 2 SeI 4 take part in phase equilibria. Transformations in the PbSe + SnI 2 =SnSe + PbI 2 mutual system leading to crystallization of metastable polytype modifications of lead iodides and metastable ternary compound forming in PbSe-PbI 2 system are investigated for the first time [ru
International Nuclear Information System (INIS)
Abrahamsson, Anna; Gustafsson, Ulf; Ellis, Ewa; Nilsson, Lisa-Mari; Sahlin, Staffan; Bjoerkhem, Ingemar; Einarsson, Curt
2005-01-01
A great number of nuclear factors are involved in the negative feedback mechanism regulating bile acid synthesis. There are two major ways for the negative feedback to effect the synthesis; the SHP-dependent, involving FXR, and the SHP-independent way, affecting HNF-4α. We studied 23 patients with gallstone disease. Eight patients were treated with chenodeoxycholic acid, 7 with cholestyramine prior to operation, and 8 served as controls. Liver biopsies were analyzed with Real-time-PCR. In the cholestyramine-treated group mRNA levels of CYP7A1 were increased about 10-fold. Treatment with CDCA decreased the mRNA levels of CYP7A1 by about 70%. The mRNA levels of CYP8B1, CYP27A1, and CYP7B1 were not significantly altered in the treated groups. The analysis of mRNA levels for HNF-4α showed 64% higher levels in the cholestyramine-treated group compared to the controls. These levels showed positive and highly significant correlation to the levels of mRNA of CYP7A1 when studied in all three groups together. FXR, SHP, and LRH-1/FTF were not significantly affected by the different treatments. Our results indicate that when bile acid synthesis is upregulated by cholestyramine treatment the SHP-independent pathway for controlling CYP7A1 transcription dominates over the SHP-dependent pathway
Perinel, J; Nappo, G; El Bechwaty, M; Walter, T; Hervieu, V; Valette, P J; Feugier, P; Adham, M
2016-12-01
Pancreatectomy with arterial resection for locally advanced pancreatic duct adenocarcinoma (PDA) is associated with high morbidity and is thus considered as a contraindication. The aim of our study was to report our experience of pancreatectomy with planned arterial resection for locally advanced PDA based on specific selection criteria. All patients receiving pancreatectomy for PDA between October 2008 and July 2014 were reviewed. The patients were classified into group 1, pancreatectomy without vascular resection (66 patients); group 2, pancreatectomy with isolated venous resection (31 patients), and group 3, pancreatectomy with arterial resection for locally advanced PDA (14 patients). The primary selection criteria for arterial resection was the possibility of achieving a complete resection based on the extent of axial encasement, the absence of tumor invasion at the origin of celiac trunk (CT) and superior mesenteric artery (SMA), and a free distal arterial segment allowing reconstruction. Patient outcomes and survival were analyzed. Six SMA, two CT, four common hepatic artery, and two replaced right hepatic artery resections were undertaken. The preferred arterial reconstruction was splenic artery transposition. Group 3 had a higher preoperative weight loss, a longer operative time, and a higher incidence of intraoperative blood transfusion. Ninety-day mortality occurred in three patients in groups 1 and 2. There were no statistically significant differences in the incidence, grade, and type of complications in the three groups. Postoperative pancreatic fistula and postpancreatectomy hemorrhage were also comparable. In group 3, none had arterial wall invasion and nine patients had recurrence (seven metastatic and two loco-regional). Survival and disease-free survival were comparable between groups. Planned arterial resection for PDA can be performed safely with a good outcome in highly selected patients. Key elements for defining the resectability is based on
Whittles, TJ; Burton, LA; Skelton, JM; Walsh, A; Veal, TD; Dhanak, VR
2016-01-01
Tin sulfide solar cells show relatively poor efficiencies despite attractive photovoltaic properties, and there is difficulty in identifying separate phases, which are also known to form during Cu2ZnSnS4 depositions. We present X-ray photoemission spectroscopy (XPS) and inverse photoemission spectroscopy measurements of single crystal SnS, SnS2, and Sn2S3, with electronic-structure calculations from density functional theory (DFT). Differences in the XPS spectra of the three phases, including...
Comparative study of SnS recrystallization in molten CdI{sub 2}, SnCl{sub 2}and KI
Energy Technology Data Exchange (ETDEWEB)
Timmo, Kristi; Kauk-Kuusik, Marit; Pilvet, Maris; Mikli, Valdek; Kaerber, Erki; Raadik, Taavi; Leinemann, Inga; Altosaar, Mare; Raudoja, Jaan [Department of Materials Science, Tallinn University of Technology, Tallinn (Estonia)
2016-01-15
In the present study, the recrystallization of polycrystalline SnS in different molten salts CdI{sub 2}, SnCl{sub 2} and KI as flux materials are presented. The recrystallization and growth of polycrystalline material in molten salts produces unique SnS monograin powders usable in monograin layer solar cells. XRD and Raman analysis revealed that single phase SnS powder can be obtained in KI at 740 C and in SnCl{sub 2} at 500 C. Long time heating of SnS in molten CdI{sub 2} was accompanied by chemical interaction between SnS and CdI{sub 2} that resulted in a mixture of CdS and Sn{sub 2}S{sub 3} crystals. SEM images showed that morphology of crystals can be controlled by the nature of the flux materials: needle-like Sn{sub 2}S{sub 3} together with round edged crystals of CdS in CdI{sub 2}, flat crystals of SnS with smooth surfaces in SnCl{sub 2} and well-formed SnS crystals with rounded edges in KI had been formed. The temperatures of phase transitions and/or the interactions of SnS and flux materials were determined by differential thermal analysis. (copyright 2015 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)
Energy Technology Data Exchange (ETDEWEB)
Shemon, Emily R. [Argonne National Lab. (ANL), Argonne, IL (United States); Smith, Micheal A. [Argonne National Lab. (ANL), Argonne, IL (United States); Lee, Changho [Argonne National Lab. (ANL), Argonne, IL (United States)
2016-02-16
PROTEUS-SN is a three-dimensional, highly scalable, high-fidelity neutron transport code developed at Argonne National Laboratory. The code is applicable to all spectrum reactor transport calculations, particularly those in which a high degree of fidelity is needed either to represent spatial detail or to resolve solution gradients. PROTEUS-SN solves the second order formulation of the transport equation using the continuous Galerkin finite element method in space, the discrete ordinates approximation in angle, and the multigroup approximation in energy. PROTEUS-SN’s parallel methodology permits the efficient decomposition of the problem by both space and angle, permitting large problems to run efficiently on hundreds of thousands of cores. PROTEUS-SN can also be used in serial or on smaller compute clusters (10’s to 100’s of cores) for smaller homogenized problems, although it is generally more computationally expensive than traditional homogenized methodology codes. PROTEUS-SN has been used to model partially homogenized systems, where regions of interest are represented explicitly and other regions are homogenized to reduce the problem size and required computational resources. PROTEUS-SN solves forward and adjoint eigenvalue problems and permits both neutron upscattering and downscattering. An adiabatic kinetics option has recently been included for performing simple time-dependent calculations in addition to standard steady state calculations. PROTEUS-SN handles void and reflective boundary conditions. Multigroup cross sections can be generated externally using the MC2-3 fast reactor multigroup cross section generation code or internally using the cross section application programming interface (API) which can treat the subgroup or resonance table libraries. PROTEUS-SN is written in Fortran 90 and also includes C preprocessor definitions. The code links against the PETSc, METIS, HDF5, and MPICH libraries. It optionally links against the MOAB library and
Energy Technology Data Exchange (ETDEWEB)
Balkin, Ethan R.; Gagnon, Katherine; Dorman, Eric [Washington Univ., Seattle, WA (United States). Dept. of Radiation Oncology; and others
2017-07-01
Production of high specific activity {sup 186g}Re is of interest for development of theranostic radiopharmaceuticals. Previous studies have shown that high specific activity {sup 186g}Re can be obtained by cyclotron irradiation of enriched {sup 186}W via the {sup 186}W(d,2n){sup 186g}Re reaction, but most irradiations were conducted at low beam currents and for short durations. In this investigation, enriched {sup 186}W metal targets were irradiated at high incident deuteron beam currents to demonstrate production rates and contaminants produced when using thick targets. Full-stopping thick targets, as determined using SRIM, were prepared by uniaxial pressing of powdered natural abundance W metal or 96.86% enriched {sup 186}W metal encased between two layers of graphite flakes for target material stabilization. An assessment of structural integrity was made on each target preparation. To assess the performance of graphite-encased thick {sup 186}W metal targets, along with the impact of encasing on the separation chemistry, targets were first irradiated using a 22 MeV deuteron beam for 10 min at 10, 20, and 27 μA, with an estimated nominal deuteron energy of 18.7 MeV on the {sup 186}W target material (after energy degradation correction from top graphite layer). Gamma-ray spectrometry was performed post EOB on all targets to assess production yields and radionuclidic byproducts. The investigation also evaluated a method to recover and recycle enriched target material from a column isolation procedure. Material composition analyses of target materials, pass-through/wash solutions and recycling process isolates were conducted with SEM, FTIR, XRD, EDS and ICP-MS spectrometry. To demonstrate scaled-up production, a graphite-encased {sup 186}W target made from recycled {sup 186}W was irradiated for ∝2 h with 18.7 MeV deuterons at a beam current of 27 μA to provide 0.90 GBq (24.3 mCi) of {sup 186g}Re, decay-corrected to the end of bombardment. ICP-MS analysis of the
A PRECISE PHYSICAL ORBIT FOR THE M-DWARF BINARY GLIESE 268
Energy Technology Data Exchange (ETDEWEB)
Barry, R. K.; Danchi, W. C. [NASA Goddard Space Flight Center, Laboratory for Exoplanets and Stellar Astrophysics, Code 667, Greenbelt, MD 20771 (United States); Demory, B.-O.; Segransan, D.; Di Folco, E.; Queloz, D.; Udry, S. [Massachusetts Institute of Technology, Cambridge, MA 02139 (United States); Forveille, T.; Delfosse, X.; Mayor, M.; Perrier, C. [Geneva Observatory, Geneva University, 51 Ch.des Maillettes, CH-1290 Versoix (Switzerland); Spooner, H. R. [University of Maryland, College Park, MD 20742 (United States); Torres, G. [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02136 (United States); Traub, W. A., E-mail: Richard.K.Barry@nasa.gov [Jet Propulsion Laboratory, California Institute of Technology, Pasadena, CA 91109 (United States)
2012-11-20
We report high-precision interferometric and radial velocity (RV) observations of the M-dwarf binary Gl 268. Combining measurements conducted using the IOTA interferometer and the ELODIE and Harvard Center for Astrophysics RV instruments leads to a mass of 0.22596 {+-} 0.00084 M {sub Sun} for component A and 0.19230 {+-} 0.00071 M {sub Sun} for component B. The system parallax as determined by these observations is 0.1560 {+-} 0.0030 arcsec-a measurement with 1.9% uncertainty in excellent agreement with Hipparcos (0.1572 {+-} 0.0033). The absolute H-band magnitudes of the component stars are not well constrained by these measurements; however, we can place an approximate upper limit of 7.95 and 8.1 for Gl 268A and B, respectively. We test these physical parameters against the predictions of theoretical models that combine stellar evolution with high fidelity, non-gray atmospheric models. Measured and predicted values are compatible within 2{sigma}. These results are among the most precise masses measured for visual binaries and compete with the best adaptive optics and eclipsing binary results.
GeSn growth kinetics in reduced pressure chemical vapor deposition from Ge2H6 and SnCl4
Aubin, J.; Hartmann, J. M.
2018-01-01
We have investigated the low temperature epitaxy of high Sn content GeSn alloys in a 200 mm industrial Reduced Pressure - Chemical Vapor Deposition tool from Applied Materials. Gaseous digermane (Ge2H6) and liquid tin tetrachloride (SnCl4) were used as the Ge and Sn precursors, respectively. The impact of temperature (in the 300-350 °C range), Ge2H6 and SnCl4 mass-flows on the GeSn growth kinetics at 100 Torr has been thoroughly explored. Be it at 300 °C or 325 °C, a linear GeSn growth rate increase together with a sub-linear Sn concentration increase occurred as the SnCl4 mass-flow increased, irrespective of the Ge2H6 mass flow (fixed or varying). The Sn atoms seemed to catalyze H desorption from the surface, resulting in higher GeSn growth rates for high SnCl4 mass-flows (in the 4-21 nm min-1 range). The evolution of the Sn content x with the F (SnCl4) 2 ·/F (Ge2H6) mass-flow ratio was fitted by x2/(1 - x) = n ·F (SnCl4) 2 ·/F (Ge2H6), with n = 0.25 (325 °C) and 0.60 (300 °C). We have otherwise studied the impact of temperature, in the 300-350 °C range, on the GeSn growth kinetics. The GeSn growth rate exponentially increased with the temperature, from 15 up to 32 nm min-1. The associated activation energy was low, i.e. Ea = 10 kcal mol-1. Meanwhile, the Sn content decreased linearly as the growth temperature increased, from 15% at 300 °C down to 6% at 350 °C.
Xuan, Tong; Zhang, J Allen; Ahmad, Imran
2006-05-03
A simple HPLC method was developed for quantification of SN-38, 7-ethyl-10-hydroxycamptothecin, in a novel liposome-based formulation (LE-SN38). The chromatographic separation was achieved on an Agilent Zorbax SB-C18 (4.6 mmx250 mm, 5 microm) analytical column using a mobile phase consisting of a mixture of NaH2PO4 (pH 3.1, 25 mM) and acetonitrile (50:50, v/v). SN-38 was detected at UV wavelength of 265 nm and quantitatively determined using an external calibration method. The limit of detection (LOD) and limit of quantitation (LOQ) were found to be 0.05 and 0.25 microg/mL, respectively. The individual spike recovery of SN-38 ranged from 100 to 101%. The percent of relative standard deviation (%R.S.D.) of intra-day and inter-day analyses were less than 1.6%. The method validation results confirmed that the method is specific, linear, accurate, precise, robust and sensitive for its intended use. The current method was successfully applied to the determination of SN-38 content and drug entrapment efficiency in liposome-based formulation, LE-SN38 during early stage formulation development.
Cheong, Jun Young; Chang, Joon Ha; Kim, Sung Joo; Kim, Chanhoon; Seo, Hyeon Kook; Shin, Jae Won; Yuk, Jong Min; Lee, Jeong Yong; Kim, Il-Doo
2017-12-01
We trace Sn nanoparticles (NPs) produced from SnO2 nanotubes (NTs) during lithiation initialized by high energy e-beam irradiation. The growth dynamics of Sn NPs is visualized in liquid electrolytes by graphene liquid cell transmission electron microscopy. The observation reveals that Sn NPs grow on the surface of SnO2 NTs via coalescence and the final shape of agglomerated NPs is governed by surface energy of the Sn NPs and the interfacial energy between Sn NPs and SnO2 NTs. Our result will likely benefit more rational material design of the ideal interface for facile ion insertion.
Lithium insertion mechanism in SnS2
International Nuclear Information System (INIS)
Lefebvre-Devos, I.; Olivier-Fourcade, J.; Jumas, J.C.; Lavela, P.
2000-01-01
We study lithium insertion in SnS 2 by means of 119 Sn Moessbauer spectroscopy, x-ray absorption spectroscopy at Sn L I,III , and S K edges, and theoretical electronic structures (calculated in the density-functional theory framework). An insertion mechanism is derived according to the Li amount. It shows the influence of the SnS 2 -layered structure on the Sn reduction, particularly the possibility of an intermediate oxidation state between Sn IV and Sn II , which is not observed during Li insertion in three-dimensional sulfides
Sandwich-like C@SnO2/Sn/void@C hollow spheres as improved anode materials for lithium ion batteries
Wang, Huijun; Jiang, Xinya; Chai, Yaqin; Yang, Xia; Yuan, Ruo
2018-03-01
As lithium ion batteries (LIBs) anode, SnO2 suffers fast capacity fading due to its large volume expansion during discharge/charge process. To overcome the problem, sandwich-like C@SnO2/Sn/void@C hollow spheres (referred as C@SnO2/Sn/void@C HSs) are prepared by in-situ polymerization and carbonization, using hollow SnO2 as self-template and dopamine as carbon source. The C@SnO2/Sn/void@C HSs possesses the merits of hollow and core/void/shell structure, so that they can accommodate the volume change under discharge/charge process, shorten the transmission distance of Li ions, own more contact area for the electrolyte. Thanks to these advantages, C@SnO2/Sn/void@C HSs display excellent electrochemical performance as anode materials for LIBs, which deliver a high capacity of 786.7 mAh g-1 at the current density of 0.5 A g-1 after 60 cycles. The simple synthesis method for C@SnO2/Sn/void@C HSs with special structure will provide a promising method for preparing other anode materials for LIBs.
Zhu, Haibo
2014-12-01
A new one pot, surfactant-free, synthetic route based on the surface organometallic chemistry (SOMC) concept has been developed for the synthesis of Sn surface-enriched Pt-Sn nanoparticles. Bu3SnH selectively reacts with [Pt]-H formed in situ at the surface of Pt nanoparticles, Pt NPs, obtained by reduction of K2PtCl4 by LiB(C2H5)3H. Chemical analysis, 1H MAS and 13C CP/MAS solid-state NMR as well as two-dimensional double-quantum (DQ) and triple-quantum (TQ) experiments show that organo-tin moieties Sn(n-C4H9) are chemically linked to the surface of Pt NPs to produce, in fine, after removal of most of the n-butyl fragment, bimetallic Pt-Sn nanoparticles. The Sn(n-CH2CH2CH2CH3) groups remaining at the surface are believed to stabilize the as-synthesized Pt-Sn NPs, enabling the bimetallic NPs to be well dispersed in THF. Additionally, the Pt-Sn nanoparticles can be supported on MgAl2O4 during the synthesis of the nanoparticles. Some of the Pt-Sn/MgAl2O4 catalyst thus prepared exhibits high activity in PROX of CO and an extremely high selectivity and stability in propane dehydrogenation to propylene. The enhanced activity in propane dehydrogenation is associated with the high concentration of inactive Sn at the surface of Pt nanoparticles which ”isolates” the active Pt atoms. This conclusion is confirmed by XRD, NMR, TEM, and XPS analysis.
Microstructural investigation and SnO nanodefects in spray-pyrolyzed SnO2 thin films
DEFF Research Database (Denmark)
Thanachayanont, Chanchana; Yordsri, Visittapong; Boothroyd, Chris
2011-01-01
Spray pyrolysis is one of the most cost-effective methods to prepare SnO2 films due to its ability to deposit large uniform area, low fabrication cost, simplicity and low deposition temperature. Conventionally, scanning electron microscopy (SEM) and X-Ray Diffraction (XRD) are routinely used...... diffraction (CBED). It was found that large grain-size vertically-aligned columnar SnO2 grains were formed after a few layers of small grain-size randomly oriented SnO2 grains. Moreover, CBED showed the presence of SnO nanodefects that had not been reported before and could not be detected by SEM or XRD....
Boström, Mathias; Dou, Maofeng; Malyi, Oleksandr I.; Parashar, Prachi; Parsons, Drew F.; Brevik, Iver; Persson, Clas
2018-01-01
We analyze the Lifshitz pressure between silica and tin separated by a liquid mixture of bromobenzene and chlorobenzene. We show that the phase transition from semimetallic α−Sn to metallic β−Sn can switch Lifshitz forces from repulsive to attractive. This effect is caused by the difference in dielectric functions of α−Sn and β−Sn, giving both attractive and repulsive contributions to the total Lifshitz pressure in different frequency regions controlled by the composition of the intervening l...
40 CFR 268.9 - Special rules regarding wastes that exhibit a characteristic.
2010-07-01
... 40 Protection of Environment 26 2010-07-01 2010-07-01 false Special rules regarding wastes that... (CONTINUED) SOLID WASTES (CONTINUED) LAND DISPOSAL RESTRICTIONS General § 268.9 Special rules regarding wastes that exhibit a characteristic. (a) The initial generator of a solid waste must determine each EPA...
International Nuclear Information System (INIS)
Kroesbergen, J.
1986-01-01
This thesis describes a comparison of the preparation, composition and properties of three bone scanning agents: 99m Tc(Sn)pyrophosphate, 99m Tc(Sn)MDP and 99m Tc(Sn)HMDP. This study has been performed for two reasons: First to investigate the preparation and composition of the radiopharmaceuticals as a function of experimental conditions. Together with previously reported results for 99m Tc(Sn)EHDP, obtained in a similar way, this enables to use well-defined preparations of the bone scanning agents. Secondly to gain an insight in the mechanism in which the agents behave 'in vivo'. Because the 'in vivo' process is too complicated to study directly, it seemed more appropriate to perform 'in vitro' investigations as simplifications of the 'in vivo' situation. 304 refs.; 26 figs.; 31 tabs
Crowdus, Carolyn A; Marsh, Antoinette E; Saville, Willliam J; Lindsay, David S; Dubey, J P; Granstrom, David E; Howe, Daniel K
2008-11-25
Sarcocystis neurona is an obligate intracellular parasite that causes equine protozoal myeloencephalitis (EPM). Previous work has identified a gene family of paralogous surface antigens in S. neurona called SnSAGs. These surface proteins are immunogenic in their host animals, and are therefore candidate molecules for development of diagnostics and vaccines. However, SnSAG diversity exists in strains of S. neurona, including the absence of the major surface antigen gene SnSAG1. Instead, sequence for an alternative SnSAG has been revealed in two of the SnSAG1-deficient strains. Herein, we present data characterizing this new surface protein, which we have designated SnSAG5. The results indicated that the protein encoded by the SnSAG5 sequence is indeed a surface-associated molecule that has characteristics consistent with the other SAGs identified in S. neurona and related parasites. Importantly, Western blot analyses of a collection of S. neurona strains demonstrated that 6 of 13 parasite isolates express SnSAG5 as a dominant surface protein instead of SnSAG1. Conversely, SnSAG5 was not detected in SnSAG1-positive strains. One strain, which was isolated from the brain of a sea otter, did not express either SnSAG1 or SnSAG5. Genetic analysis with SnSAG5-specific primers confirmed the presence of the SnSAG5 gene in Western blot-positive strains, while also suggesting the presence of a novel SnSAG sequence in the SnSAG1-deficient, SnSAG5-deficient otter isolate. The findings provide further indication of S. neurona strain diversity, which has implications for diagnostic testing and development of vaccines against EPM as well as the population biology of Sarcocystis cycling in the opossum definitive host.
Electronic and magnetic properties of rare earth-Sn3 compounds for 119Sn Moessbauer spectroscopy
International Nuclear Information System (INIS)
Sanchez, J.P.; Friedt, J.M.; Shenoy, G.K.; Percheron, A.; Achard, J.C.
1975-01-01
The electronic and magnetic properties of RESn 3 compounds (RE=La, Ce, Pr, Nd, Sm, Eu, Gd, Yb) have been investigated using the 23.8keV Moessbauer resonance of 119 Sn. The isomer shifts and quadrupole interactions are nearly the same in all compounds. The transferred magnetic fields and their orientation with respect to the principal electric field gradient axis at various Sn sites in the magnetically ordered state of RESn 3 (RE=Pr, Nd, Sm, Eu, Gd) have been utilized to get information about the magnetic structure. An evaluation of the transferred fields in PrSn 3 and NdSn 3 shows that the spin density at the Sn nucleus is nearly the same in both compounds [fr
The tin-rich copper lithium stannides: Li3Cu6Sn4 and Li2CuSn2
International Nuclear Information System (INIS)
Fuertauer, Siegfried; Flandorfer, Hans; Effenberger, Herta S.
2015-01-01
The Sn rich ternary intermetallic compounds Li 3 Cu 6 Sn 4 (CSD-427097) and Li 2 CuSn 2 (CSD-427098) were synthesized from the pure elements by induction melting and annealing at 400 C. Structural investigations were performed by powder- and single-crystal XRD. Li 3 Cu 6 Sn 4 crystallizes in space group P6/mmm; it is structurally related to but not isotypic with MgFe 6 Ge 6 (a = 5.095(2) Aa, c = 9.524(3) Aa; wR 2 = 0.059; 239 unique F 2 -values, 17 free variables). Li 3 Cu 6 Sn 4 is characterized by two sites with a mixed Cu:Sn occupation. In contrast to all other Cu-Li-Sn compounds known so far, any mixed occupation was found for Cu-Li pairs only. In addition, one Li site is only half occupied. The second Sn rich phase is Li 2 CuSn 2 (space group I4 1 /amd, a = 4.4281(15) Aa, c = 19.416(4) Aa; wR 2 = 0.033; 213 unique F 2 -values, 12 atom free variables); it is the only phase in the Cu-Li-Sn system which is noted for full ordering. Both crystal structures exhibit 3D-networks which host Li atoms in channels. They are important for understanding the lithiation mechanism in Cu-Sn electrodes for Li-ion batteries.
SN REFSDAL: CLASSIFICATION AS A LUMINOUS AND BLUE SN 1987A-LIKE TYPE II SUPERNOVA
Energy Technology Data Exchange (ETDEWEB)
Kelly, P. L.; Filippenko, A. V.; Graham, M. L. [Department of Astronomy, University of California, Berkeley, CA 94720-3411 (United States); Brammer, G.; Strolger, L.-G.; Riess, A. G. [Space Telescope Science Institute, 3700 San Martin Drive, Baltimore, MD 21218 (United States); Selsing, J.; Hjorth, J.; Christensen, L. [Dark Cosmology Centre, Niels Bohr Institute, University of Copenhagen, Juliane Maries Vej 30, DK-2100 Copenhagen (Denmark); Foley, R. J. [Department of Physics, University of Illinois at Urbana-Champaign, 1110 W. Green Street, Urbana, IL 61801 (United States); Rodney, S. A. [Department of Physics and Astronomy, University of South Carolina, 712 Main St., Columbia, SC 29208 (United States); Treu, T. [University of California, Los Angeles, CA 90095 (United States); Steidel, C. C.; Strom, A.; Zitrin, A. [California Institute of Technology, 1200 East California Boulevard, Pasadena, CA 91125 (United States); Schmidt, K. B.; McCully, C. [Department of Physics, University of California, Santa Barbara, CA 93106-9530 (United States); Bradač, M. [University of California, Davis, 1 Shields Avenue, Davis, CA 95616 (United States); Jha, S. W. [Department of Physics and Astronomy, Rutgers, The State University of New Jersey, Piscataway, NJ 08854 (United States); Graur, O., E-mail: pkelly@astro.berkeley.edu [Center for Cosmology and Particle Physics, New York University, New York, NY 10003 (United States); and others
2016-11-10
We have acquired Hubble Space Telescope (HST) and Very Large Telescope near-infrared spectra and images of supernova (SN) Refsdal after its discovery as an Einstein cross in fall 2014. The HST light curve of SN Refsdal has a shape consistent with the distinctive, slowly rising light curves of SN 1987A-like SNe, and we find strong evidence for a broad H α P-Cygni profile and Na I D absorption in the HST grism spectrum at the redshift ( z = 1.49) of the spiral host galaxy. SNe IIn, largely powered by circumstellar interaction, could provide a good match to the light curve of SN Refsdal, but the spectrum of a SN IIn would not show broad and strong H α and Na I D absorption. From the grism spectrum, we measure an H α expansion velocity consistent with those of SN 1987A-like SNe at a similar phase. The luminosity, evolution, and Gaussian profile of the H α emission of the WFC3 and X-shooter spectra, separated by ∼2.5 months in the rest frame, provide additional evidence that supports the SN 1987A-like classification. In comparison with other examples of SN 1987A-like SNe, photometry of SN Refsdal favors bluer B - V and V - R colors and one of the largest luminosities for the assumed range of potential magnifications. The evolution of the light curve at late times will provide additional evidence about the potential existence of any substantial circumstellar material. Using MOSFIRE and X-shooter spectra, we estimate a subsolar host-galaxy metallicity (8.3 ± 0.1 dex and <8.4 dex, respectively) near the explosion site.
Energy Technology Data Exchange (ETDEWEB)
Crisafulli, Rudy
2013-06-01
PtSnCu/C (with different Pt:Sn:Cu atomic ratios) and PtSn/C (50:50) electrocatalysts were prepared by borohydride (BR) and alcohol-reduction (AR) processes using H{sub 2}PtCl{sub 6}.6H{sub 2}O, SnCl{sub 2}.2H{sub 2}O and CuCl{sub 2}.2H{sub 2}O as metal sources, NaBH{sub 4} and ethylene glycol as reducing agents, 2-propanol and ethylene glycol/water as solvents and carbon black as support. In a further step, these electrocatalysts were activated by chemical (CD) and electrochemical (ED) dealloying processes through acid treatment and thin porous coating technique, respectively. These materials were characterized by energy dispersive X-ray, Xray diffraction, transmission electron microscopy, line scan energy dispersive Xray and cyclic voltammetry. Electrochemical studies for ethanol electro-oxidation were performed by cyclic voltammetry, chronoamperometry and in single Direct Ethanol Fuel Cell using Membrane Electrode Assembly (MEA). The anodic effluents were analysed by gas chromatography. The X-ray diffractograms of the as-synthesized electrocatalysts showed the typical face-centered cubic structure (FCC) of platinum and its alloys. After dealloying, the X-ray diffractograms showed that the Pt FCC structure was preserved. The crystallite sizes of the assynthesized electrocatalysts were in the range of <=2 nm to 3 nm and after dealloying there were no significant variations in sizes. The energy dispersive Xray analysis of the as-synthesized electrocatalysts showed a Pt:Sn and Pt:Sn:Cu atomic ratios similar to the nominal values. After chemical and electrochemical dealloying of the electrocatalysts the ranged Pt:Sn and Pt:Sn:Cu atomic ratios showed that Cu and Sn atoms were removed. However, chemical dealloying process proved to be more efficient for removing Cu and electrochemical dealloying for removing Sn. The line scan energy dispersive X-ray analysis showed that acid and electrochemical treatments were efficient to dealloying Cu and/or Sn superficial atoms of
Polarographic determination of Sn (II) and total Sn in PYRO and MDP radiopharmaceutical kits
International Nuclear Information System (INIS)
Sebastian, Maria V.A.; Lugon, Marcelo Di M.V.; Silva, Jose L. da; Fukumori, Neuza T.O.; Pereira, Nilda P.S. de; Silva, Constancia P.G. da; Matsuda, Margareth M.N.
2007-01-01
A sensitive, alternative method to atom absorption spectrometry, fluorimetry or potentiometry for the evaluation of tin(II) ions (0.1- 10 mg) and total tin in radiopharmaceutical kits was investigated. Differential pulse polarography was chosen. The supporting electrolyte was H 2 SO 4 3 mol L -1 and HCl 3 mol L -1 solution. The potential was swept from -250 to -800 mV vs Ag/AgCl/saturated KCl, using a dropping mercury electrode with 1 s drop time, 50 mV s -1 scan rate, -50 mV pulse amplitude, 40 ms pulse time and 10 mV step amplitude. Pure nitrogen was used to deaerate the polarographic cell solution for 5 min, before and after each sample introduction. Oxidation of Sn(II) was made in the same sample vial by adding H 2 O 2 (hydrogen peroxide) 10 mol L -1 , at 37 deg C, in order to quantify the total Sn. The calibration curve for Sn(II) and Sn(IV) was obtained in the concentration range of 0-10 ppm from a 1000 ppm standard solution. The detection limit of Sn(II) is 0.5 ppm and for Sn(IV) is 0.6 ppm. Differential pulse polarography was performed in the pyrophosphate (PYRO) and methylenediphosphonic acid (MDP) radiopharmaceutical kits, containing 2 mg and 1 mg of SnCl 2 .2H 2 O per vial, respectively. The described method for determination of stannous ion (Sn(II)), is selective, reproducible and adequate to be used in the quality control of lyophilized reagents and it shall be performed for other cold kits produced at IPEN. (author)
49 CFR 268.5 - Federal funding sources for the Maglev Deployment Program.
2010-10-01
... 49 Transportation 4 2010-10-01 2010-10-01 false Federal funding sources for the Maglev Deployment... TECHNOLOGY DEPLOYMENT PROGRAM Overview § 268.5 Federal funding sources for the Maglev Deployment Program. (a) Federal Maglev Funds. Section 322 of Title 23 provides for the following funds for the Maglev Deployment...
Internal friction behavior of liquid Bi-Sn alloys
International Nuclear Information System (INIS)
Wu Aiqing; Guo Lijun; Liu Changsong; Jia Erguang; Zhu Zhengang
2005-01-01
Pure Bi and Sn and four Bi-Sn alloys distributed on the entire concentration range were selected for internal-friction investigation over a wide temperature range. There exist two peaks in the plots of internal friction versus temperature for liquid Sn, Bi-Sn60 and Bi-Sn90 alloys, one peak being located at about 480 - bar Cand another at about 830 - bar C. Only a single internal-friction peak at about 830 - bar C occurs in liquid Bi-Sn43 (eutectic composition). No internal-friction peak appears in liquid Bi-Sn20 alloy and pure Bi. The height of the internal-friction peaks depends on the content of Sn. The present finding suggests that Sn-rich Bi-Sn alloys may inherit the internal-friction behaviors of pure Sn, whereas Bi-rich Bi-Sn alloy seems to be like pure Bi. The position of the internal-friction peaks is frequency dependent, which resembles the internal-friction feature in structure transition in solids
Internal friction behavior of liquid Bi-Sn alloys
Energy Technology Data Exchange (ETDEWEB)
Wu Aiqing [Key Laboratory of Materials Physics, Institute of Solid State Physics, Chinese Academy of Sciences, P.O. Box 1129, Hefei 230031 (China); Guo Lijun [Key Laboratory of Materials Physics, Institute of Solid State Physics, Chinese Academy of Sciences, P.O. Box 1129, Hefei 230031 (China); Liu Changsong [Key Laboratory of Materials Physics, Institute of Solid State Physics, Chinese Academy of Sciences, P.O. Box 1129, Hefei 230031 (China); Jia Erguang [Key Laboratory of Materials Physics, Institute of Solid State Physics, Chinese Academy of Sciences, P.O. Box 1129, Hefei 230031 (China); Zhu Zhengang [Key Laboratory of Materials Physics, Institute of Solid State Physics, Chinese Academy of Sciences, P.O. Box 1129, Hefei 230031 (China)]. E-mail: zgzhu@issp.ac.cn
2005-12-01
Pure Bi and Sn and four Bi-Sn alloys distributed on the entire concentration range were selected for internal-friction investigation over a wide temperature range. There exist two peaks in the plots of internal friction versus temperature for liquid Sn, Bi-Sn60 and Bi-Sn90 alloys, one peak being located at about 480{sup -}bar Cand another at about 830{sup -}bar C. Only a single internal-friction peak at about 830{sup -}bar C occurs in liquid Bi-Sn43 (eutectic composition). No internal-friction peak appears in liquid Bi-Sn20 alloy and pure Bi. The height of the internal-friction peaks depends on the content of Sn. The present finding suggests that Sn-rich Bi-Sn alloys may inherit the internal-friction behaviors of pure Sn, whereas Bi-rich Bi-Sn alloy seems to be like pure Bi. The position of the internal-friction peaks is frequency dependent, which resembles the internal-friction feature in structure transition in solids.
Wang, Chao-hong; Kuo, Chun-yi; Yang, Nian-cih
2015-11-01
The isothermal section of the ternary Sn-Pb-Co system at 250°C was experimentally determined through a series of the equilibrated Sn-Pb-Co alloys of various compositions. The equilibrium phases were identified on the basis of compositional analysis. For the Sn-Co intermetallic compounds (IMCs), CoSn3, CoSn2, CoSn and Co3Sn2, the Pb solubility was very limited. There exist five tie-triangle regions. The Co-Pb system involves one monotectic reaction, so the phase separation of liquid alloys near the Co-Pb side occurred prior to solidification. The immiscibility field was also determined. Additionally, interfacial reactions between Co and Sn-Pb alloys were conducted. The reaction phase for the Sn-48 at.%Pb and Sn-58 at.%Pb at 250°C was CoSn3 and CoSn2, respectively. Both of them were simultaneously formed in the Sn-53 at.%Pb/Co. The formed IMCs were closely associated to the phase equilibria relationship of the liquid-CoSn3-CoSn2 tie-triangle. Furthermore, with increasing temperatures, the phase formed in equilibrium with Sn-37 wt.%Pb was found to transit from CoSn3 to CoSn2 at 275°C. We propose a simple method of examining the phase transition temperature in the interfacial reactions to determine the boundaries of the liquid-CoSn3-CoSn2 tie-triangles at different temperatures.
Botticella, M. T.
We performed the Southern inTermediate Redshift ESO Supernova Search (STRESS), a survey specifically designed to measure the rate of both SNe Ia and CC SNe, in order to obtain a direct comparison of the high redshift and local rates and to investigate the dependence of the rates on specific galaxy properties, most notably their colour. We found that the type Ia SN rate, at mean redshift z = 0.3, is 0.22+0.10+0.16-0.08-0.14 h270 SNu, while the CC SN rate, at z = 0.21, is 0.82+0.31+0.300.24-0.26 h270 SNu. The quoted errors are the statistical and systematic uncertainties. With respect to the local value, the CC SN rate at z = 0.2 is higher by a factor of ˜ 2, whereas the type Ia SN rate remains almost constant. We also measured the SN rates in the red and blue galaxies and found that the SN Ia rate seems to be constant in galaxies of different colour, whereas the CC SN rate seems to peak in blue galaxies, as in the local Universe. Finally we exploited the link between SFH and SN rates to predict the evolutionary behaviour of the SN rates and compare it with the path indicated by observations.
A Precise Physical Orbit For The M-Dwarf Binary Gliese 268
Barry, R. K.; Demory, B. -O.; Segransan, D.; Forveille, T.; Danchi, W. C.; Di Folco, E.; Queloz, D.; Spooner, H. R.; Torres, G.; Traub, W. A.;
2012-01-01
We report high-precision interferometric and radial velocity (RV) observations of the M-dwarf binary Gl 268. Combining measurements conducted using the IOTA interferometer and the ELODIE and Harvard Center for Astrophysics RV instruments leads to a mass of 0.22596 plus-minus 0.00084 Mass compared to the sun for component A and 0.19230 plus-minus 0.00071 Mass compared to the sun for component B. The system parallax as determined by these observations is 0.1560 plus-minus 0.0030 arcsec - a measurement with 1.9% uncertainty in excellent agreement with Hipparcos (0.1572 plus-minus 0.0033). The absolute H-band magnitudes of the component stars are not well constrained by these measurements; however, we can place an approximate upper limit of 7.95 and 8.1 for Gl 268A and B, respectively.We test these physical parameters against the predictions of theoretical models that combine stellar evolution with high fidelity, non-gray atmospheric models. Measured and predicted values are compatible within 2sigma. These results are among the most precise masses measured for visual binaries and compete with the best adaptive optics and eclipsing binary results.
Sn whiskers removed by energy photo flashing
International Nuclear Information System (INIS)
Jiang, N.; Yang, M.; Novak, J.; Igor, P.; Osterman, M.
2012-01-01
Highlights: ► Sn whiskers were sintered by intense light flashing (Photosintering). ► Photosintering can effectively eliminate Sn whiskers. ► Photosintering would not damage electronic devices. ► Photosintering is a very promising approach to improve Sn-based electronic surface termination. - Abstract: Sn whiskers have been known to be the major issue resulting in electronic circuit shorts. In this study, we present a novel energy photo flashing approach (photosintering) to shorten and eliminate Sn whiskers. It has been found that photosintering is very effective to modify and remove Sn whiskers; only a sub-millisecond duration photosintering can amazingly get rid of over 90 vol.% of Sn whiskers. Moreover, this photosintering approach has also been proved to cause no damages to electronic devices, suggesting it is a potentially promising way to improve Sn-based electronic surface termination.
Li2SnO3 derived secondary Li-Sn alloy electrode for lithium-ion batteries
International Nuclear Information System (INIS)
Zhang, D.W.; Zhang, S.Q.; Jin, Y.; Yi, T.H.; Xie, S.; Chen, C.H.
2006-01-01
As a possible high-capacity Li-ion battery anode material, Li 2 SnO 3 was prepared via a solid-state reaction route and a sol-gel route, separately. Its electrochemical performance was tested in coin-type cells with metallic Li as the counter electrode. The results show that the sol-gel derived Li 2 SnO 3 has uniform nano-sized particles (200-300 nm) and can deliver a better reversible capacity (380 mAh/g after 50 cycles in the voltage window of 0-1 V) than that from the solid-state reaction route. The characterizations by means of galvanostatic cycling, cyclic voltammetry and ex situ X-ray diffraction indicate that the electrochemical process of the Li 2 SnO 3 lithiation proceeds with an initial structural reduction of the composite oxide into Sn-metal and Li 2 O followed by a reversible Li-Sn alloy formation in the Li 2 O matrix. Due to the buffer role of the Li 2 O matrix, the reversibility of the secondary Li-Sn alloy electrode is largely secured
Improving cycle stability of SnS anode for sodium-ion batteries by limiting Sn agglomeration
Wang, Wenhui; Shi, Liang; Lan, Danni; Li, Quan
2018-02-01
Flower-like SnS nanostructures are obtained by a simple solvothermal method for anode applications in Na-ion batteries. We show experimental evidence of progressive Sn agglomeration and crystalline Na2S enrichment at the end of de-sodiation process of the SnS electrode, both of which contribute to the capacity decay of the electrode upon repeated cycles. By replacing the commonly adopted acetylene black conductive additive with multi-wall carbon nanotubes (MWCNT), the cycle stability of the SnS electrode is largely improved, which correlates well with the observed suppression of both Sn agglomeration and Na2S enrichment at the end of de-sodiation cycle. A full cell is assembled with the SnS/MWCNT anode and the P2-Na2/3Ni1/3Mn1/2Ti1/6O2 cathode. An initial energy density of 262 Wh/kg (normalized to the total mass of cathode and anode) is demonstrated for the full cell, which retains 71% of the first discharge capacity after 40 cycles.
Directory of Open Access Journals (Sweden)
Jianmei Wang
2017-09-01
Full Text Available To investigate the performance of bonding on the interface between ZChSnSb/Sn and steel body, the interfacial bonding energy on the interface of a ZChSnSb/Sn alloy layer and the steel body with or without Sn as an intermediate layer was calculated under the same loadcase using the molecular dynamics simulation software Materials Studio by ACCELRYS, and the interfacial bonding energy under different Babbitt thicknesses was compared. The results show that the bonding energy of the interface with Sn as an intermediate layer is 10% larger than that of the interface without a Sn layer. The interfacial bonding performances of Babbitt and the steel body with Sn as an intermediate layer are better than those of an interface without a Sn layer. When the thickness of the Babbitt layer of bushing is 17.143 Å, the interfacial bonding energy reaches the maximum, and the interfacial bonding performance is optimum. These findings illustrate the bonding mechanism of the interfacial structure from the molecular level so as to ensure the good bonding properties of the interface, which provides a reference for the improvement of the bush manufacturing process from the microscopic point of view.
Wang, Jianmei; Xia, Quanzhi; Ma, Yang; Meng, Fanning; Liang, Yinan; Li, Zhixiong
2017-09-25
To investigate the performance of bonding on the interface between ZChSnSb/Sn and steel body, the interfacial bonding energy on the interface of a ZChSnSb/Sn alloy layer and the steel body with or without Sn as an intermediate layer was calculated under the same loadcase using the molecular dynamics simulation software Materials Studio by ACCELRYS, and the interfacial bonding energy under different Babbitt thicknesses was compared. The results show that the bonding energy of the interface with Sn as an intermediate layer is 10% larger than that of the interface without a Sn layer. The interfacial bonding performances of Babbitt and the steel body with Sn as an intermediate layer are better than those of an interface without a Sn layer. When the thickness of the Babbitt layer of bushing is 17.143 Å, the interfacial bonding energy reaches the maximum, and the interfacial bonding performance is optimum. These findings illustrate the bonding mechanism of the interfacial structure from the molecular level so as to ensure the good bonding properties of the interface, which provides a reference for the improvement of the bush manufacturing process from the microscopic point of view.
Electronic structure and isomer shifts of Sn halides
International Nuclear Information System (INIS)
Terra, J.; Guenzburger, D.
1988-01-01
The all-electron first-principles Discrete Variational method was employed to study the electronic structure of SnF 4 , SnCl 4 , SnBr 4 and SnI 4 . Values of the electronic density at the Sn nucleus were derived and related to 119 Sn Isomer Shifts to obtain the nuclear constant Δ 2 >. Differences in values of ρ(o) area discussed in terms of the chemical bonding between Sn and halogen atoms. (author) [pt
195Pt and 119Sn Knight shifts of U3Pt3Sn4
International Nuclear Information System (INIS)
Kojima, K.; Takabatake, T.; Harada, A.; Hihara, T.
1995-01-01
The 195 Pt and 119 Sn Knight shifts in U 3 Pt 3 Sn 4 have been measured in the temperature range 4.2-298K. They exhibit Curie-Weiss like behaviors above about 50K and remain constant below about 10K. This suggests that the deviation of χ(T) from the modified Curie-Weiss law is an intrinsic property of U 3 Pt 3 Sn 4 . ((orig.))
[Monogenic form of diabetes mellitus due to HNF4α mutation (MODY-1) - the first case in Hungary].
Jermendy, György; Balogh, István; Gaál, Zsolt
2016-03-20
The classification of diabetes mellitus in adolescents and young adults is often difficult. The diagnosis of the monogenic form of diabetes may have substantial influence on quality of life, prognosis and the choice of the appropriate treatment of affected patients. Among MODY (maturity-onset of diabetes in the young) MODY-1 is rarely detected, only 13 families were described in 2000, and 103 different mutations in 173 families were known in 2013 worldwide. The authors present the first Hungarian case of a monogenic form of diabetes due to HNF4α mutation (MODY-1). The diabetes of the index patient No. 1 (42-year-old woman with insulin treated diabetes) was diagnosed as gestational diabetes at age of 20 when she was treated with diet only. Later, insulin treatment has been initiated when marked hyperglycaemia was detected during an episode of acute pneumonia at age of 26. The diabetes of the index patient No. 2 (20-year-old daughter of the index patient No. 1, treated also with insulin) was diagnosed as type 2 diabetes at age of 13 and the patient was treated with diet only. Later the classification was modified to type 1 and insulin therapy was initiated at age of 14. The manifestation of diabetes, the familial occurrence and the low dose insulin requirement were suggestive for monogenic diabetes. Using molecular genetic method a mutation (c.869G>A, p.R290H) of HNF4α gene was found and MODY-1 was diagnosed in both cases. Insulin therapy was switched to treatment with low dose sulfanylurea and an excellent glycaemic control was achieved and sustained at follow-up of 1-year. No further positive cases were found during screening of other family members.
Docena, Maricor K; Faiman, Charles; Stanley, Christine M; Pantalone, Kevin M
2014-02-01
An estimated 1 to 2% of cases of diabetes mellitus have a monogenic basis; however, delayed diagnosis and misdiagnosis as type 1 and 2 diabetes are common. Correctly identifying the molecular basis of an individual's diabetes may significantly alter the management approach to both the patient and his or her relatives. We describe a case of mature onset diabetes of the young (MODY) with sufficient evidence to support the classification of a novel HNF1A (hepatocyte nuclear factor-1-α) mutation as a cause of MODY-3. A 21-year-old Caucasian female presented to our office with a diagnosis of noninsulin-dependent diabetes mellitus (NIDDM) at age 10; glycemia was initially managed with oral antidiabetic (OAD) agents and insulin detemir. The patient reported a strong family history of early-onset NIDDM in both her mother and maternal grandmother, both of whom eventually required insulin therapy to control glycemia. The patient's medical and family history were highly suggestive of maturity-onset diabetes of the young (MODY), and genetic testing was performed. Genetic screening detected a mutation p. Arg200Trp in the HNF1A gene in the patient, her mother, and maternal grandmother, suggesting a diagnosis of MODY-3. This finding resulted in a change of antidiabetic therapy in all 3 patients, including the addition of once-daily liraglutide therapy, which helped improve their glycemic control. Our case report supports the classification of the p. Arg200Trp mutation as a cause of MODY-3. The findings also suggest that glucagon-like peptide-1 (GLP-1) receptor agonist therapy may be of value in managing glycemia in patients with MODY-3.
Chuang, T. H.; Lin, H. J.; Chuang, C. H.; Yeh, W. T.; Hwang, J. D.; Chu, H. S.
2014-12-01
A (Pb, Sn)Te thermoelectric element plated with a Ni barrier layer and a Ag reaction layer has been joined with a Cu electrode coated with Ag and Sn thin films using a solid-liquid interdiffusion bonding method. This method allows the interfacial reaction between Ag and Sn such that Ag3Sn intermetallic compounds form at low temperature and are stable at high temperature. In this study, the bonding strength was about 6.6 MPa, and the specimens fractured along the interface between the (Pb, Sn)Te thermoelectric element and the Ni barrier layer. Pre-electroplating a film of Sn with a thickness of about 1 μm on the thermoelectric element and pre-heating at 250°C for 3 min ensures the adhesion between the thermoelectric material and the Ni barrier layer. The bonding strength is thus increased to a maximal value of 12.2 MPa, and most of the fractures occur inside the thermoelectric material. During the bonding process, not only the Ag3Sn intermetallics but also Cu6Sn5 forms at the Ag3Sn/Cu interface, which transforms into Cu3Sn with increases in the bonding temperature or bonding time.
Boström, Mathias; Dou, Maofeng; Malyi, Oleksandr I.; Parashar, Prachi; Parsons, Drew F.; Brevik, Iver; Persson, Clas
2018-03-01
We analyze the Lifshitz pressure between silica and tin separated by a liquid mixture of bromobenzene and chlorobenzene. We show that the phase transition from semimetallic α -Sn to metallic β -Sn can switch Lifshitz forces from repulsive to attractive. This effect is caused by the difference in dielectric functions of α -Sn and β -Sn , giving both attractive and repulsive contributions to the total Lifshitz pressure in different frequency regions controlled by the composition of the intervening liquid mixture. In this way, one may be able to produce phase-transition-controlled quantum levitation in a liquid medium.
α-Sn and β-Sn precipitates in annealed epitaxial Si0.95Sn0.05
DEFF Research Database (Denmark)
Fyhn, M.F.; Chevallier, J.; Larsen, A.N.
1999-01-01
-Sn and beta-Sn crystallites. The presence of alpha-Sn at temperatures far above the bulk alpha beta transition temperature is explained by interface and pressure effects; the latter is likely to be due to the difference in thermal expansion of the precipitates and the matrix.......-temperature molecular-beam epitaxy on Si (001) and relaxed Si1-xGex substrates. Two different phases of solid Sn were identified in the annealed layers: the semiconductor phase, alpha-Sn, and the metallic phase beta-Sn The precipitates were found to consist of either only beta-Sn or to contain crystallites of both...... solid Sn phases. The orientations, the sizes and the relative number densities of the alpha-Sn and beta-Sn crystallites were investigated. in situ heating and cooling experiments were performed in the transmission electron microscope to study the melting and solidification characteristics of the alpha...
International Nuclear Information System (INIS)
Crisafulli, Rudy
2013-01-01
PtSnCu/C (with different Pt:Sn:Cu atomic ratios) and PtSn/C (50:50) electrocatalysts were prepared by borohydride (BR) and alcohol-reduction (AR) processes using H 2 PtCl 6 .6H 2 O, SnCl 2 .2H 2 O and CuCl 2 .2H 2 O as metal sources, NaBH 4 and ethylene glycol as reducing agents, 2-propanol and ethylene glycol/water as solvents and carbon black as support. In a further step, these electrocatalysts were activated by chemical (CD) and electrochemical (ED) dealloying processes through acid treatment and thin porous coating technique, respectively. These materials were characterized by energy dispersive X-ray, Xray diffraction, transmission electron microscopy, line scan energy dispersive Xray and cyclic voltammetry. Electrochemical studies for ethanol electro-oxidation were performed by cyclic voltammetry, chronoamperometry and in single Direct Ethanol Fuel Cell using Membrane Electrode Assembly (MEA). The anodic effluents were analysed by gas chromatography. The X-ray diffractograms of the as-synthesized electrocatalysts showed the typical face-centered cubic structure (FCC) of platinum and its alloys. After dealloying, the X-ray diffractograms showed that the Pt FCC structure was preserved. The crystallite sizes of the assynthesized electrocatalysts were in the range of PtSnCu/C (50:40:10) AR/ED > PtSnCu/C (50:10:40) BR/CD. PtSn/C (50:50) BR/CD, PtSnCu/C (50:10:40) BR/CD, PtSnCu/C (50:40:10) AR/CD electrocatalysts and Pt/C BASF, PtSn/C (75:25) BASF commercial electrocatalysts were tested in single Direct Ethanol Fuel Cell. The results showed the following performance for ethanol electro-oxidation: PtSn/C (50:50) BR/CD > PtSnCu/C (50:40:10) AR/CD > PtSnCu/C > PtSn/C (75:25) BASF > PtSnCu/C (50:10:40) BR/CD > Pt/C BASF. (author)
Anomalous temperature behavior of Sn impurities
International Nuclear Information System (INIS)
Haskel, D.; Shechter, H.; Stern, E.A.; Newville, M.; Yacoby, Y.
1993-01-01
Sn impurities in Pb and Ag hosts have been investigated by Moessbauer effect and in Pb by x-ray-absorption fine-structure (XAFS) studies. The Sn atoms are dissolved up to at least 2 at. % in Pb and up to at least 8 at. % in Ag for the temperature ranges investigated. The concentration limit for Sn-Sn interactions is 1 at. % for Pb and 2 at. % for Ag as determined experimentally by lowering the Sn concentration until no appreciable change occurs in the Moessbauer effect. XAFS measurements verify that the Sn impurities in Pb are dissolved and predominantly at substitutional sites. For both hosts the temperature dependence of the spectral intensities of isolated Sn impurities below a temperature T 0 is as expected for vibrating about a lattice site. Above T 0 the Moessbauer spectral intensity exhibits a greatly increased rate of drop-off with temperature without appreciable broadening. This drop-off is too steep to be explained by ordinary anharmonic effects and can be explained by a liquidlike rapid hopping of the Sn, localized about a lattice site. Higher-entropy-density regions of radii somewhat more than an atomic spacing surround such impurities, and can act as nucleation sites for three-dimensional melting
Kil, Yeon-Ho; Kang, Sukill; Jeong, Tae Soo; Shim, Kyu-Hwan; Kim, Dae-Jung; Choi, Yong-Dae; Kim, Mi Joung; Kim, Taek Sung
2018-05-01
The Ge1- x Sn x layers were grown by using rapid thermal chemical-vapor deposition (RTCVD) on boron-doped p-type Si (100) substrates with Sn compositions up to x = 0.83%. In order to obtain effect of the Sn composition on the structural and the optical characteristics, we utilized highresolution X-ray diffraction (HR-XRD), etch pit density (EPD), atomic force microscopy (AFM), Raman spectroscopy, and photocurrent (PC) spectra. The Sn compositions in the Ge1- x Sn x layers were found to be of x = 0.00%, 0.51%, 0.65%, and 0.83%. The root-mean-square (RMS) of the surface roughness of the Ge1- x Sn x layer increased from 2.02 nm to 3.40 nm as the Sn composition was increased from 0.51% to 0.83%, and EPD was on the order of 108 cm-2. The Raman spectra consist of only one strong peak near 300 cm-1, which is assigned to the Ge-Ge LO peaks and the Raman peaks shift to the wave number with increasing Sn composition. Photocurrent spectra show near energy band gap peaks and their peak energies decrease with increasing Sn composition due to band-gap bowing in the Ge1- x Sn x layer. An increase in the band gap bowing parameter was observed with increasing Sn composition.
Directory of Open Access Journals (Sweden)
Tiekun Jia
2014-01-01
Full Text Available Zn-doped SnO2/Zn2SnO4 nanocomposites were prepared via a two-step hydrothermal synthesis method. The as-prepared samples were characterized by X-ray diffraction (XRD, field-emission scanning electron microscopy (FESEM, transmission electron microscopy (TEM, UV-vis diffuse reflection spectroscopy, and adsorption-desorption isotherms. The results of FESEM and TEM showed that the as-prepared Zn-doped SnO2/Zn2SnO4 nanocomposites are composed of numerous nanoparticles with the size ranging from 20 nm to 50 nm. The specific surface area of the as-prepared Zn-doped SnO2/Zn2SnO4 nanocomposites is estimated to be 71.53 m2/g by the Brunauer-Emmett-Teller (BET method. The photocatalytic activity was evaluated by the degradation of methylene blue (MB, and the resulting showed that Zn-doped SnO2/Zn2SnO4 nanocomposites exhibited excellent photocatalytic activity due to their higher specific surface area and surface charge carrier transfer.
The recruitment of the U5 snRNP to nascent transcripts requires internal loop 1 of U5 snRNA.
Kim, Rebecca; Paschedag, Joshua; Novikova, Natalya; Bellini, Michel
2012-12-01
In this study, we take advantage of the high spatial resolution offered by the nucleus and lampbrush chromosomes of the amphibian oocyte to investigate the mechanisms that regulate the intranuclear trafficking of the U5 snRNP and its recruitment to nascent transcripts. We monitor the fate of newly assembled fluorescent U5 snRNP in Xenopus oocytes depleted of U4 and/or U6 snRNAs and demonstrate that the U4/U6.U5 tri-snRNP is not required for the association of U5 snRNP with Cajal bodies, splicing speckles, and nascent transcripts. In addition, using a mutational analysis, we show that a non-functional U5 snRNP can associate with nascent transcripts, and we further characterize internal loop structure 1 of U5 snRNA as a critical element for licensing U5 snRNP to target both nascent transcripts and splicing speckles. Collectively, our data support the model where the recruitment of snRNPs onto pre-mRNAs is independent of spliceosome assembly and suggest that U5 snRNP may promote the association of the U4/U6.U5 tri-snRNP with nascent transcripts.
DEFF Research Database (Denmark)
Kuhmann, Jochen Friedrich; Preuss, A.; Adolphi, B.
1998-01-01
: (1) SnPb; (2) InSn; (3) AuSn. The studies of the oxidation kinetics show that the growth of the native oxide, which covers the solder surfaces from the start of all soldering operations is self-limiting. The rate of oxidation on the molten, metallic solder surfaces is significantly reduced...... and reduction kinetics, are applied to flip-chip (FC) bonding experiments in vacuum with and without the injection of H2. Wetting in vacuum is excellent but the self-alignment during flip-chip soldering is restricted. The desired, perfectly self-aligned FC-bonds have been only achieved, using evaporated...
Zn{sub 2}SnO{sub 4}-SnO{sub 2} heterojunction nanocomposites for dye-sensitized solar cells
Energy Technology Data Exchange (ETDEWEB)
Li Bihui; Luo Lijuan; Xiao Ting; Hu Xiaoyan [Institute of Nano-science and Technology, Central China Normal University, Wuhan, 430079 (China); Lu Lu; Wang, Jianbo [Department of Physics, Wuhan University, Wuhan 430072 (China); Tang Yiwen, E-mail: ywtang@phy.ccnu.edu.cn [Institute of Nano-science and Technology, Central China Normal University, Wuhan, 430079 (China)
2011-02-03
Graphical abstract: Display Omitted Research highlights: > The ZTO-SnO{sub 2} based DSSC shows superior photovoltaic performance than single phase ZTO or Pm-ZTO-SnO{sub 2} (physical mixture of ZTO and SnO{sub 2} nanoparticles having the same ZTO/SnO{sub 2} composition) based DSSC. > The obvious improvement in the photovoltaic performance is mainly ascribed to the efficient injected electrons transfer between the two materials via heterojunctions and consequent suppress the recombination. - Abstract: Zn{sub 2}SnO{sub 4}-SnO{sub 2} heterojunction nanocomposites (ZTO-SnO{sub 2}) with high mass amount of ZTO were synthesized by a two-step technique. The route involves firstly the synthesis of monodispersed ZnSn(OH){sub 6} nanocubes with a 50-60 nm edge length as precursors by simple coprecipitation of Na{sub 2}SnO{sub 3}.3H{sub 2}O and ZnCl{sub 2} aqueous solution, assisted by ultrasonic treatment and then followed by calcination of the precursors at 800 deg. C under N{sub 2} atmosphere. The as-synthesized nanoparticles were characterized by X-ray diffractometer (XRD), scanning electron microscopy (SEM) and transmission electron microscopy (TEM). Heterojunction between ZTO and SnO{sub 2} nanoparticle was confirmed by the electron energy loss spectroscopy (EELS) elemental mapping and high-resolution TEM (HRTEM). The photovoltaic performance of the ZTO-SnO{sub 2} based DSSC was examined by measuring the J-V curves both in dark and under illumination. The results show that the ZTO-SnO{sub 2} based DSSC exhibits superior photovoltaic performance as compared to the single phase ZTO based DSSCs. Under illumination of AM 1.5 simulated sunlight (100 mW/cm{sup 2}), the open circuit voltage of the cell based on ZTO-SnO{sub 2} is 706 mV, the short-current density is 2.85 mA/cm{sup 2}, and the efficiency is 1.29% which is increased by 43% from 0.90% to 1.29% compared with pure ZTO. The formation of the heterojunctions between ZTO and SnO{sub 2} nanoparticles is believed to reduce
Physical properties of some Sn-based melts
Directory of Open Access Journals (Sweden)
Ilinykh N.
2011-05-01
Full Text Available The physical properties (viscosity, density, electroresistivity and magnetic susceptibility of pure tin, copper, silver, some binary (Sn - Ag, Sn - Cu, Sn - Bi, Sn - Zn and ternary (Sn-Ag-Cu, Sn-BiAg, Sn-Bi-Zn alloys with near eutectic compositions are investigated in wide temperature ranges. The irreversible decrease of viscosity in pure tin melt is discovered at 820 °С during heating. The similar anomaly with the following hysteresis of dynamic viscosity was fixed for binary and ternary alloys but at higher temperatures – 900 °С and 950 °С respectively. For all the systems it was shown that the alloys with eutectic compositions differ significantly in their electric and magnetic properties from hypo- and hypereutectic ones. Qualitative and quantitative metallographic analysis for Sn-3.8wt.%Ag-0.7wt.%Cu samples, heated low and above characteristic temperatures, showed the influence of melt overheating on crystallization kinetics.
DEFF Research Database (Denmark)
Orum, H; Nielsen, Henrik; Engberg, J
1991-01-01
We have identified and characterized the full set of spliceosomal small nuclear RNAs (snRNAs; U1, U2, U4, U5 and U6) from the ciliated protozoan Tetrahymena thermophila. With the exception of U4 snRNA, the sizes of the T. thermophila snRNAs are closely similar to their metazoan homologues. The T....... thermophila snRNAs all have unique 5' ends, which start with an adenine residue. In contrast, with the exception of U6, their 3' ends show some size heterogeneity. The primary sequences of the T. thermophila snRNAs contain the sequence motifs shown, or proposed, to be of functional importance in other...
International Nuclear Information System (INIS)
Saatci, B; Cimen, S; Pamuk, H; Guenduez, M
2007-01-01
Equilibrated grain boundary groove shapes for solid Sn in equilibrium with Cd-Sn liquid were directly observed after annealing a sample at the eutectic temperature for about 8 days. The thermal conductivities of the solid phase, K S , and the liquid phase, K L , for the groove shapes were measured. From the observed groove shapes, the Gibbs-Thomson coefficients were obtained with a numerical method, using the measured G, K S and K L values. The solid-liquid interfacial energy of solid Sn in equilibrium with Cd-Sn liquid was determined from the Gibbs-Thomson equation. The grain boundary energy for solid Sn was also calculated from the observed groove shapes
Microstructural evolution and tensile properties of Sn-Ag-Cu mixed with Sn-Pb solder alloys
Energy Technology Data Exchange (ETDEWEB)
Wang Fengjiang [Department of Materials Science and Engineering and Materials Research Center, Missouri University of Science and Technology, Rolla, MO 65401 (United States); O' Keefe, Matthew [Department of Materials Science and Engineering and Materials Research Center, Missouri University of Science and Technology, Rolla, MO 65401 (United States)], E-mail: mjokeefe@mst.edu; Brinkmeyer, Brandon [Department of Materials Science and Engineering and Materials Research Center, Missouri University of Science and Technology, Rolla, MO 65401 (United States)
2009-05-27
The effect of incorporating eutectic Sn-Pb solder with Sn-3.0Ag-0.5Cu (SAC) Pb-free solder on the microstructure and tensile properties of the mixed alloys was investigated. Alloys containing 100, 75, 50, 25, 20, 15, 10, 5 and 0 wt% SAC, with the balance being Sn-37Pb eutectic solder alloy, were prepared and characterized. Optical and scanning electron microscopy were used to analyze the microstructures while 'mini-tensile' test specimens were fabricated and tested to determine mechanical properties at the mm length scale, more closely matching that of the solder joints. Microstructural analysis indicated that a Pb-rich phase formed and was uniformly distributed at the boundary between the Sn-rich grains or between the Sn-rich and the intermetallic compounds in the solder. Tensile results showed that mixing of the alloys resulted in an increase in both the yield and the ultimate tensile strength compared to the original solders, with the 50% SAC-50% Sn-Pb mixture having the highest measured strength. Initial investigations indicate the formation and distribution of a Pb-rich phase in the mixed solder alloys as the source of the strengthening mechanism.
El Alaoui, Meddy; Soulère, Laurent; Noiriel, Alexandre; Queneau, Yves; Abousalham, Abdelkarim
2017-08-01
Lipases are essentially described as sn-1 and sn-3 regio-selective. Actually few methods are available to measure this lipase regio-selectivity, moreover they require chiral chromatography analysis or specific derivations which are discontinuous and time consuming. In this study we describe a new, convenient, sensitive and continuous spectrophotometric method to screen lipases regio-selectivity using synthetic triglycerides (TG) containing α-eleostearic acid (9Z, 11E, 13E-octadecatrienoic acid) either at the sn-1 position [1-α-eleostearoyl-2,3-octadecyl-sn-glycerol (sn-EOO)] or at the sn-3 position [1,2-octadecyl-3-α-eleostearoyl-sn-glycerol (sn-OOE)] and coated onto the wells of microtiter plates. A non-hydrolysable ether bond, with a non UV-absorbing alkyl chain, was introduced at the other sn positions to prevent acyl chain migration during TG synthesis or lipolysis. The synthesis of TG containing α-eleostearic acid was performed from S-glycidol in six steps to obtain sn-EOO and in five steps to sn-OOE. The α-eleostearic acid conjugated triene constitutes an intrinsic chromophore and, consequently, confers the strong UV absorption properties of this free fatty acid as well as of the TG harboring it. The lipase activity on coated sn-EOO or sn-OOE was measured by the increase in the absorbance at 272nm due to the transition of α-eleostearic acid from the adsorbed to the soluble state. Human and porcine pancreatic lipases, guinea pig pancreatic lipase related protein 2, Thermomyces lanuginosus lipase, Candida antarctica lipase A and Candida antarctica lipase B were all used to validate the assay. This continuous high-throughput screening method could determine directly without any processes after lipolysis the regio-selectivity of various lipases. Copyright © 2017 Elsevier B.V. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Silva, Dionisio F.; Oliveira Neto, Almir; Pino, Eddy S.; Linardi, Marcelo; Spinace, Estevam V., E-mail: dfsilva@ipen.b, E-mail: espinace@ipen.b [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), Sao Paulo, SP (Brazil)
2009-07-01
PtSn/C electrocatalysts were prepared with Pt:Sn atomic ratios of 3:1, 1:1 and 1:3 in water/2-propanol using electron beam irradiation. The obtained materials were characterized by EDX, XRD and cyclic voltammetry. The ethanol electro-oxidation was studied by chronoamperometry. The XRD diffractograms of the PtSn/C electrocatalysts showed typical face-centered cubic (fcc) structure of platinum and the presence of a SnO{sub 2} phase (cassiterite). The mean crystallite sizes of Pt fcc phase was in the range of 3.0-3.5 nm. The PtSn/C electrocatalysts were active for ethanol electro-oxidation at room temperature and the material prepared with Pt:Sn atomic ratio of 1:1 showed the best activity. (author)
International Nuclear Information System (INIS)
Silva, Dionisio F.; Oliveira Neto, Almir; Pino, Eddy S.; Linardi, Marcelo; Spinace, Estevam V.
2009-01-01
PtSn/C electrocatalysts were prepared with Pt:Sn atomic ratios of 3:1, 1:1 and 1:3 in water/2-propanol using electron beam irradiation. The obtained materials were characterized by EDX, XRD and cyclic voltammetry. The ethanol electro-oxidation was studied by chronoamperometry. The XRD diffractograms of the PtSn/C electrocatalysts showed typical face-centered cubic (fcc) structure of platinum and the presence of a SnO 2 phase (cassiterite). The mean crystallite sizes of Pt fcc phase was in the range of 3.0-3.5 nm. The PtSn/C electrocatalysts were active for ethanol electro-oxidation at room temperature and the material prepared with Pt:Sn atomic ratio of 1:1 showed the best activity. (author)
Alaf, M; Gultekin, D; Akbulut, H
2012-12-01
In this study, tin/tinoxide/multi oxide/multi walled carbon nano tube (Sn/SnO2/MWCNT) composites were produced by thermal evaporation and then subsequent plasma oxidation. Buckypapers having controlled porosity were prepared by vacuum filtration from functionalized MWCNTs. Pure metallic tin was thermally evaporated on the buckypapers in argon atmosphere with different thicknesses. It was determined that the evaporated pure tin nano crystals were mechanically penetrated into pores of buckypaper to form a nanocomposite. The tin/MWCNT composites were subjected to plasma oxidation process at oxygen/argon gas mixture. Three different plasma oxidation times (30, 45 and 60 minutes) were used to investigate oxidation and physical and microstructural properties. The effect of coating thickness and oxidation time was investigated to understand the effect of process parameters on the Sn and SnO2 phases after plasma oxidation. Quantitative phase analysis was performed in order to determine the relative phase amounts. The structural properties were studied by field-emission gun scanning electron microscopy (FEG-SEM), atomic force microscopy (AFM) and X-ray diffraction (XRD).
Properties of second phase (BaSnO3, Sn) added-YBCO thick films
International Nuclear Information System (INIS)
Ban, E.; Matsuoka, Y.
1997-01-01
The improvement of the critical current density J c of YBCO thick films has been attempted by adding BaSnO 3 powder and ultrafine Sn particles, whose diameter is about 2 μm and 7 x 10 -2 μm, respectively. It was found that the addition of a small amount of these particles was effective for the enhancement of J c of thick films prepared by a liquid-phase processing method. The 1 wt.% BaSnO 3 films fired at T s =1040-1060 C and the 3 wt.% Sn films (T s =1030-1060 C) showed J c values (77 K, 0 T) of about 2.1-2.4 x 10 3 Acm -2 and 3.1-3.5 x 10 3 Acm -2 , respectively, as compared to 2.0 x 10 3 Acm -2 for the undoped films. (orig.)
Jerkstrand, A.; Ergon, M.; Smartt, S. J.; Fransson, C.; Sollerman, J.; Taubenberger, S.; Bersten, M.; Spyromilio, J.
2015-01-01
We investigate line formation processes in Type IIb supernovae (SNe) from 100 to 500 days post-explosion using spectral synthesis calculations. The modelling identifies the nuclear burning layers and physical mechanisms that produce the major emission lines, and the diagnostic potential of these. We compare the model calculations with data on the three best observed Type IIb SNe to-date - SN 1993J, SN 2008ax, and SN 2011dh. Oxygen nucleosynthesis depends sensitively on the main-sequence mass of the star and modelling of the [O I] λλ6300, 6364 lines constrains the progenitors of these three SNe to the MZAMS = 12-16 M⊙ range (ejected oxygen masses 0.3-0.9 M⊙), with SN 2011dh towards the lower end and SN 1993J towards the upper end of the range. The high ejecta masses from MZAMS ≳ 17 M⊙ progenitors give rise to brighter nebular phase emission lines than observed. Nucleosynthesis analysis thus supports a scenario of low-to-moderate mass progenitors for Type IIb SNe, and by implication an origin in binary systems. We demonstrate how oxygen and magnesium recombination lines may be combined to diagnose the magnesium mass in the SN ejecta. For SN 2011dh, a magnesium mass of 0.02-0.14 M⊙ is derived, which gives a Mg/O production ratio consistent with the solar value. Nitrogen left in the He envelope from CNO burning gives strong [N II] λλ6548, 6583 emission lines that dominate over Hα emission in our models. The hydrogen envelopes of Type IIb SNe are too small and dilute to produce any noticeable Hα emission or absorption after ~150 days, and nebular phase emission seen around 6550 Å is in many cases likely caused by [N II] λλ6548, 6583. Finally, the influence of radiative transport on the emergent line profiles is investigated. Significant line blocking in the metal core remains for several hundred days, which affects the emergent spectrum. These radiative transfer effects lead to early-time blueshifts of the emission line peaks, which gradually
Zhu, Haibo; Anjum, Dalaver H.; Wang, Qingxiao; Abou-Hamad, Edy; Emsley, Lyndon; Dong, Hailin; Laveille, Paco; Li, Lidong; Samal, Akshaya Kumar; Basset, Jean-Marie
2014-01-01
Sn(n-C4H9) are chemically linked to the surface of Pt NPs to produce, in fine, after removal of most of the n-butyl fragment, bimetallic Pt-Sn nanoparticles. The Sn(n-CH2CH2CH2CH3) groups remaining at the surface are believed to stabilize the as
Cheng, Deliang; Liu, Jiangwen; Li, Xiang; Hu, Renzong; Zeng, Meiqing; Yang, Lichun; Zhu, Min
2017-05-01
The (SnOx-Sn)@few layered graphene ((SnOx-Sn)@FLG) composite has been synthesized by oxygen plasma-assisted milling. Owing to the synergistic effect of rapid plasma heating and ball mill grinding, SnOx (1 ≤ x ≤ 2) nanoparticles generated from the reaction of Sn with oxygen are tightly wrapped by FLG nanosheets which are simultaneously exfoliated from expanded graphite, forming secondary micro granules. Inside the granules, the small size of the SnOx nanoparticles enables the fast kinetics for Na+ transfer. The in-situ formed FLG and residual Sn nanoparticles improve the electrical conductivity of the composite, meanwhile alleviate the aggregation of SnOx nanoparticles and relieve the volume change during the cycling, which is beneficial for the cyclic stability for the Na+ storage. As an anode material for sodium-ion batteries, the (SnOx-Sn)@FLG composite exhibits a high reversible capacity of 448 mAh g-1 at a current density of 100 mA g-1 in the first cycle, with 82.6% capacity retention after 250 cycles. Even when the current density increases to 1000 mA g-1, this composite retains 316.5 mAh g-1 after 250 cycles. With superior Na+ storage stability, the (SnOx-Sn)@FLG composite can be a promising anode material for high performance sodium-ion batteries.
Electronic structure and electric fields gradients of crystalline Sn(II) and Sn(IV) compounds
International Nuclear Information System (INIS)
Terra, J.; Guenzburger, D.
1991-01-01
The electronic structures of clusters representing crystalline compounds of Sn(II) and Sn(IV) were investigated, employing the first-principles Discrete Variational method and Local Density theory. Densities of states and related parameters were obtained and compared with experimental measurements and with results from band structure calculations. Effects of cluster size and of cluster truncated bonds are discussed. Electric field gradients at the Sn nucleus were calculated; results are analysed in terms of charge distribution and chemical bonding in the crystals. (author)
Energy Technology Data Exchange (ETDEWEB)
Tabet-Aoul, Amel [Institut National de la Recherche Scientifique (INRS)-Énergie, Matériaux et Télécommunications (EMT), 1650 Boulevard Lionel Boulet, Varennes, Québec, Canada J3X 1S2 (Canada); Mohamedi, Mohamed, E-mail: mohamedi@emt.inrs.ca [Institut National de la Recherche Scientifique (INRS)-Énergie, Matériaux et Télécommunications (EMT), 1650 Boulevard Lionel Boulet, Varennes, Québec, Canada J3X 1S2 (Canada)
2013-03-15
Highlights: ► A pulsed laser synthesis is used for the deposition of Pt, SnO{sub 2} and PtSn alloy thin films onto carbon nanotubes. ► These nanoscaled materials were characterized by FESEM, TEM, XRD and XPS. ► Enhanced electrocatalytic properties toward ethanol oxidation. -- Abstract: With the objective of lowering the potential oxidation of ethanol at PtSn nanocatalyst, we present the synthesis of free-standing catalyst layer comprising a current collector/carbon nanotubes (catalyst support)/SnO{sub 2}/Pt{sub 75}Sn{sub 25} (catalyst) nanostructured layers, each layer constructed upon the one below it. The CNTs are grown by chemical vapor deposition (CVD), whereas SnO{sub 2} and Pt{sub 75}Sn{sub 25} are synthesized by pulsed laser deposition and cross-beam laser deposition, respectively. FESEM revealed that Pt{sub 75}Sn{sub 25} nanoparticles assemble into cauliflower-like arrangement. TEM and HR-TEM showed that the Pt{sub 75}Sn{sub 25} layer thickness is of ca. 25 nm with a particle mean diameter of 4.3 nm. It was found that addition of SnO{sub 2} to Pt{sub 75}Sn{sub 25} promotes significantly the oxidation of ethanol at Pt{sub 75}Sn{sub 25} nanoparticles relative to a carbon nanotubes support. Indeed, the electrooxidation of ethanol at CNTs/SnO{sub 2}/Pt{sub 75}Sn{sub 25} electrode starts at about 100 mV negative with respect to that at CNT/Pt{sub 75}Sn{sub 25}. This decreased overpotential required to oxidize ethanol is very significant and has profound implications to developing high performing anodes for direct ethanol fuel cells technology.
Massive stars dying alone: Extremely remote environments of SN2009ip and SN2010jp
Smith, Nathan
2014-10-01
We propose an imaging study of the astonishingly remote environments of two recent supernovae (SNe): SN2009ip and SN2010jp. Both were unusual Type IIn explosions that crashed into dense circumstellar material (CSM) ejected by the star shortly before explosion. The favored progenitors of these SNe are very massive luminous blue variable (LBV) stars. In fact, SN2009ip presents an extraordinay case where the LBV-like progenitor was actually detected directly in archival HST data, and where we obtained spectra and photometry for numerous pre-SN eruptions. No other SN has this treasure trove of detailed information about the progenitor (not even SN1987A). SN2010jp represents a possible collapsar-powered event, since it showed evidence of a fast bipolar jet in spectra and a low 56Ni mass; this would be an analog of the black-hole forming explosions that cause gamma ray bursts, but where the relativistic jet is damped by a residual H envelope on the star. In both cases, the only viable models for these SNe involve extremely massive (initial masses of 40-100 Msun) progenitor stars. This seems at odds with their extremely remote environments in the far outskirts of their host galaxies, with no detected evidence for an underlying massive star population in ground-based data (nor in the single shallow WFPC2/F606W image of SN2009ip). Here we propose deep UV HST images to search for any mid/late O-type stars nearby, deep red images to detect any red supergiants, and an H-alpha image to search for any evidence of ongoing star formation in the vicinity. These observations will place important and demanding constraints on the initial masses and ages of these progenitors.
International Nuclear Information System (INIS)
Sauterer, R.A.; Feeney, R.J.; Zieve, G.W.
1988-01-01
Newly synthesized snRNAs appear transiently in the cytoplasm where they assemble into ribonucleoprotein particles, the snRNP particles, before returning permanently to the interphase nucleus. In this report, bona fide cytoplasmic fractions, prepared by cell enucleation, are used for a quantitative analysis of snRNP assembly in growing mouse fibroblasts. The half-lives and abundances of the snRNP precursors in the cytoplasm and the rates of snRNP assembly are calculated in L929 cells. With the exception of U6, the major snRNAs are stable RNA species; U1 is almost totally stable while U2 has a half-life of about two cell cycles. In contrast, the majority of newly synthesized U6 decays with a half-life of about 15 h. The relative abundances of the newly synthesized snRNA species U1, U2, U3, U4 and U6 in the cytoplasm are determined by Northern hybridization using cloned probes and are approximately 2% of their nuclear abundance. The half-lives of the two major snRNA precursors in the cytoplasm (U1 and U2) are approximately 20 min as determined by labeling to steady state. The relative abundance of the snRNP B protein in the cytoplasm is determined by Western blotting with the Sm class of autoantibodies and is approximately 25% of the nuclear abundance. Kinetic studies, using the Sm antiserum to immunoprecipitate the methionine-labeled snRNP proteins, suggest that the B protein has a half-life of 90 to 120 min in the cytoplasm. These data are discussed and suggest that there is a large pool of more stable snRNP proteins in the cytoplasm available for assembly with the less abundant but more rapidly turning-over snRNAs
Polymer-SnO2 composite membranes
DEFF Research Database (Denmark)
Nørgaard, Casper Frydendal; Skou, Eivind Morten
. This work utilizes the latter approach and makes use of particles of tin dioxide (SnO2). Polymer-SnO2 composite membranes were successfully prepared using an ion-exchange method. SnO2 was incorporated into membranes by ion-exchange in solutions of SnCl2 ∙ 2 H2O in methanol, followed by oxidation to SnO2...... in air. The content of SnO2 proved controllable by adjusting the concentration of the ion-exchange solution. The prepared nanocomposite membranes were characterized by powder XRD, 119Sn MAS NMR, electrochemical impedance spectroscopy, water uptake and tensile stress-strain measurements. For Nafion 117...
Improvements in the critical current densities of Nb3Sn by solid solution additions of Sn in Nb
International Nuclear Information System (INIS)
Luhman, T.; Suenaga, M.
1975-01-01
The effectiveness of solid solution additions of Sn to Nb in improving the superconducting properties of diffusion processed Nb 3 Sn conductors was examined. It was found that an increase in the superconducting critical current density, Jc, as function of layer thickness (d) may be obtained for thick Nb 3 Sn layers by solid solution additions of Sn in Nb. A large increase in J/sub c/ (d) is also achieved by increasing the Sn content in the bronze matrix material. In addition to uses of this material in magnet fabrications a potential application of these improved J/sub c/(d) values may lie in the use of Nb 3 Sn in power transmission lines. Here, a high superconducting critical current density is necessary throughout the material to carry the increased current during fault conditions. The magnetic field dependence of J/sub c/ is a function of alloy content but the alloying changes studied here do not increase the high field critical current capability of Nb 3 Sn. (auth)
Production of superconducting Nb3Sn wire using Nb or Nb(Ti) and Sn(Ga) solid solution powders
International Nuclear Information System (INIS)
Thieme, C.L.H.; Foner, S.
1991-01-01
This paper reports on superconducting Nb 3 Sn wire produced by the powder metallurgy method using Nb or Nb-2.9 at% Ti powder in combination with Sn-x at% Ga powders (x = 3, 4.2, 6.2 and 9.0). Ga additions to the Sn caused considerable solid solution hardening which improved its workability. It made the Nb-Sn(Ga) powder combinations convenient for swaging and extensive wire drawing. Anneals at 950 degrees C produced wires with an overall J c of 10 4 A/cm 2 at 21.9 T for wires with both Ti in the Nb and 6.2 at% Ga in the Sn. Comparison of this wire with the best Nb(Ti)-Cu-internal Sn(Ti) shows a higher J c per A15 areas, especially in fields of 22T and above
Kinetics of plasma oxidation of germanium-tin (GeSn)
Wang, Wei; Lei, Dian; Dong, Yuan; Zhang, Zheng; Pan, Jisheng; Gong, Xiao; Tok, Eng-Soon; Yeo, Yee-Chia
2017-12-01
The kinetics of plasma oxidation of GeSn at low temperature is investigated. The oxidation process is described by a power-law model where the oxidation rate decreases rapidly from the initial oxidation rate with increasing time. The oxidation rate of GeSn is higher than that of pure Ge, which can be explained by the higher chemical reaction rate at the GeSn-oxide/GeSn interface. In addition, the Sn atoms at the interface region exchange positions with the underlying Ge atoms during oxidation, leading to a SnO2-rich oxide near the interface. The bandgap of GeSn oxide is extracted to be 5.1 ± 0.2 eV by XPS, and the valence band offset at the GeSn-oxide/GeSn heterojunction is found to be 3.7 ± 0.2 eV. Controlled annealing experiments demonstrate that the GeSn oxide is stable with respect to annealing temperatures up to 400 °C. However, after annealing at 450 °C, the GeO2 is converted to GeO, and desorbs from the GeSn-oxide/GeSn, leaving behind Sn oxide.
Fatigue and thermal fatigue of Pb-Sn solder joints
International Nuclear Information System (INIS)
Frear, D.; Grivas, D.; McCormack, M.; Tribula, D.; Morris, J.W. Jr.
1987-01-01
This paper presents a fundamental investigation of the fatigue and thermal fatigue characteristics, with an emphasis on the microstructural development during fatigue, of Sn-Pb solder joints. Fatigue tests were performed in simple shear on both 60Sn-40Pb and 5Sn-95Pb solder joints. Isothermal fatigue tests show increasing fatigue life of 60Sn-40Pb solder joints with decreasing strain and temperature. In contrast, such behavior was not observed in the isothermal fatigue of 5Sn-95Pb solder joints. Thermal fatigue results on 60Sn-40Pb solder cycled between -55 0 C and 125 0 C show that a coarsened region develops in the center of the joint. Both Pb-rich and Sn-rich phases coarsen, and cracks form within these coarsened regions. The failure mode 60Sn-40Pb solder joints in thermal and isothermal fatigue is similar: cracks form intergranularly through the Sn-rich phase or along Sn/Pb interphase boundaries. Extensive cracking is found throughout the 5Sn-95Pb joint for both thermal and isothermal fatigue. In thermal fatigue the 5Sn-95Pb solder joints failed after fewer cycles than 60Sn-40Pb
DO22-(Cu,Ni)3Sn intermetallic compound nanolayer formed in Cu/Sn-nanolayer/Ni structures
International Nuclear Information System (INIS)
Liu Lilin; Huang, Haiyou; Fu Ran; Liu Deming; Zhang Tongyi
2009-01-01
The present work conducts crystal characterization by High Resolution Transmission Electron Microscopy (HRTEM) on Cu/Sn-nanolayer/Ni sandwich structures associated with the use of Energy Dispersive X-ray (EDX) analysis. The results show that DO 22 -(Cu,Ni) 3 Sn intermetallic compound (IMC) ordered structure is formed in the sandwich structures at the as-electrodeposited state. The formed DO 22 -(Cu,Ni) 3 Sn IMC is a homogeneous layer with a thickness about 10 nm. The DO 22 -(Cu,Ni) 3 Sn IMC nanolayer is stable during annealing at 250 deg. C for 810 min. The formation and stabilization of the metastable DO 22 -(Cu,Ni) 3 Sn IMC nanolayer are attributed to the less strain energy induced by lattice mismatch between the DO 22 IMC and fcc Cu crystals in comparison with that between the equilibrium DO 3 IMC and fcc Cu crystals.
Liquidus Projection and Isothermal Section of the Sb-Se-Sn System
Chang, Jui-shen; Chen, Sinn-wen
2017-12-01
Sb-Se-Sn ternary alloys are promising chalcogenide materials. The liquidus projection and 673.2 K (400 °C) isothermal section of the Sb-Se-Sn ternary system are determined. Numerous Sb-Se-Sn alloys are prepared, and their primary solidification phases are examined. In addition to the three terminal phases, (Sb), (Se) and (Sn), there are Sb2Sn3, SbSn, SnSe, SnSe2, Sb2Se3, Sn2Sb9Se9, and SnSb2Se4 phases. In addition, there are two miscibility gaps along the Sb-Se and Se-Sn and sides. There are ten invariant reactions in the Sb-Se-Sn ternary system, and seven of them are experimentally determined in this study. The lowest reaction temperature of determined invariant reaction is L + SbSn = (Sn) + SnSe at 515.4 K ± 5 K (242.2 °C ± 5 °C). There are nine tie-triangles, which are Liquid + SbSn + SnSe, SbSn + SnSe + (Sb), SnSe + (Sb) + Sn2Sb9Se9, (Sb) + Sb2Se3 + Sn2Sb9Se9, SnSe + Sn2Sb9Se9 + SnSb2Se4, Sb2Se3 + Sn2Sb9Se9 + SnSb2Se4, SnSe + SnSe2 + SnSb2Se4, SnSe2 + SnSb2Se4 + Sb2Se3, and SnSe2 + Sb2Se3 + Liquid in the 673.2 K (400 °C) isothermal section of the Sb-Se-Sn ternary system.
0(gs)+ -->2(1)+ transition strengths in 106Sn and 108Sn.
Ekström, A; Cederkäll, J; Fahlander, C; Hjorth-Jensen, M; Ames, F; Butler, P A; Davinson, T; Eberth, J; Fincke, F; Görgen, A; Górska, M; Habs, D; Hurst, A M; Huyse, M; Ivanov, O; Iwanicki, J; Kester, O; Köster, U; Marsh, B A; Mierzejewski, J; Reiter, P; Scheit, H; Schwalm, D; Siem, S; Sletten, G; Stefanescu, I; Tveten, G M; Van de Walle, J; Van Duppen, P; Voulot, D; Warr, N; Weisshaar, D; Wenander, F; Zielińska, M
2008-07-04
The reduced transition probabilities, B(E2; 0(gs)+ -->2(1)+), have been measured in the radioactive isotopes (108,106)Sn using subbarrier Coulomb excitation at the REX-ISOLDE facility at CERN. Deexcitation gamma rays were detected by the highly segmented MINIBALL Ge-detector array. The results, B(E2;0(gs)+ -->2(1)+)=0.222(19)e2b2 for 108Sn and B(E2; 0(gs)+-->2(1)+)=0.195(39)e2b2 for 106Sn were determined relative to a stable 58Ni target. The resulting B(E2) values are approximately 30% larger than shell-model predictions and deviate from the generalized seniority model. This experimental result may point towards a weakening of the N=Z=50 shell closure.
International Nuclear Information System (INIS)
Schurr, R.; Hoelzing, A.; Jost, S.; Hock, R.; Voss, T.; Schulze, J.; Kirbs, A.; Ennaoui, A.; Lux-Steiner, M.; Weber, A.; Koetschau, I.; Schock, H.-W.
2009-01-01
The best CZTS solar cell so far was produced by co-sputtering continued with vapour phase sulfurization method. Efficiencies of up to 5.74% were reached by Katagiri et al. The one step electrochemical deposition of copper, zinc, tin and subsequent sulfurization is an alternative fabrication technique for the production of Cu 2 ZnSnS 4 based thin film solar cells. A kesterite based solar cell (size 0.5 cm 2 ) with a conversion efficiency of 3.4% (AM1.5) was produced by vapour phase sulfurization of co-electroplated Cu-Zn-Sn films. We report on results of in-situ X-ray diffraction (XRD) experiments during crystallisation of kesterite thin films from electrochemically co-deposited metal films. The kesterite crystallisation is completed by the solid state reaction of Cu 2 SnS 3 and ZnS. The measurements show two different reaction paths depending on the metal ratios in the as deposited films. In copper-rich metal films Cu 3 Sn and CuZn were found after electrodeposition. In copper-poor or near stoichiometric precursors additional Cu 6 Sn 5 and Sn phases were detected. The formation mechanism of Cu 2 SnS 3 involves the binary sulphides Cu 2-x S and SnS 2 in the absence of the binary precursor phase Cu 6 Sn 5 . The presence of Cu 6 Sn 5 leads to a preferred formation of Cu 2 SnS 3 via the reaction educts Cu 2-x S and SnS 2 in the presence of a SnS 2 (Cu 4 SnS 6 ) melt. The melt phase may be advantageous in crystallising the kesterite, leading to enhanced grain growth in the presence of a liquid phase
Gerbi, Susan A.; Lange, Thilo Sascha
2002-01-01
Previously, we showed that spliceosomal U6 small nuclear RNA (snRNA) transiently passes through the nucleolus. Herein, we report that all individual snRNAs of the [U4/U6.U5] tri-snRNP localize to nucleoli, demonstrated by fluorescence microscopy of nucleolar preparations after injection of fluorescein-labeled snRNA into Xenopus oocyte nuclei. Nucleolar localization of U6 is independent from [U4/U6] snRNP formation since sites of direct interaction of U6 snRNA with U4 snRNA are not nucleolar localization elements. Among all regions in U6, the only one required for nucleolar localization is its 3′ end, which associates with the La protein and subsequently during maturation of U6 is bound by Lsm proteins. This 3′-nucleolar localization element of U6 is both essential and sufficient for nucleolar localization and also required for localization to Cajal bodies. Conversion of the 3′ hydroxyl of U6 snRNA to a 3′ phosphate prevents association with the La protein but does not affect U6 localization to nucleoli or Cajal bodies. PMID:12221120
Energy Technology Data Exchange (ETDEWEB)
Saji, Kachirayil J. [Nanostructured Materials Research Laboratory, Department of Materials Science & Engineering, University of Utah, Salt Lake City, UT 84112 (United States); Department of Physics, Govt. Victoria College, University of Calicut, Palakkad 678 001 (India); Venkata Subbaiah, Y.P. [Nanostructured Materials Research Laboratory, Department of Materials Science & Engineering, University of Utah, Salt Lake City, UT 84112 (United States); Department of Physics, Yogi Vemana University, Kadapa, Andhra Pradesh 516003 (India); Tian, Kun [Nanostructured Materials Research Laboratory, Department of Materials Science & Engineering, University of Utah, Salt Lake City, UT 84112 (United States); Tiwari, Ashutosh, E-mail: tiwari@eng.utah.edu [Nanostructured Materials Research Laboratory, Department of Materials Science & Engineering, University of Utah, Salt Lake City, UT 84112 (United States)
2016-04-30
Tin monoxide (SnO) is considered as one of the most important p-type oxides available to date. Thin films of SnO have been reported to possess both an indirect bandgap (~ 0.7 eV) and a direct bandgap (~ 2.8 eV) with quite high hole mobility (~ 7 cm{sup 2}/Vs) values. Moreover, the hole density in these films can be tuned from 10{sup 15}–10{sup 19} cm{sup −3} just by controlling the thin film deposition parameters. Because of the above attributes, SnO thin films offer great potential for fabricating modern electronic and optoelectronic devices. In this article, we are reviewing the most recent developments in this field and also presenting some of our own results on SnO thin films grown by pulsed laser deposition technique. We have also proposed a p–n heterostructure comprising of p-type SnO and n-type ZnO which can pave way for realizing next-generation, all-oxide transparent electronic devices. - Highlights: • We reviewed recent developments on p-type SnO thin film research. • Discussed the optical and electrical properties of SnO thin films • Bipolar conduction in SnO is discussed. • Optoelectronic properties of SnO–ZnO composite system are discussed. • Proposed SnO–ZnO heterojunction band structure.
Janicek, Petr; Niang, Kham M.; Mistrik, Jan; Palka, Karel; Flewitt, Andrew J.
2017-11-01
ZnO:Sn thin films were deposited onto thermally oxidized silicon substrates using a remote plasma reactive sputtering. Their optical constants (refractive index n and extinction coefficient k) were determined from ellipsometric data recorded over a wide spectral range (0.05-6 eV). Parametrization of ZnO:Sn complex dielectric permittivity consists of a parameterized semiconductor oscillator function describing the short wavelength absorption edge, a Drude oscillator describing free carrier absorption in near-infrared part of spectra and a Lorentz oscillator describing the long wavelength absorption edge and intra-band absorption in the ultra-violet part of the spectra. Using a Mott-Davis model, the increase in local disorder with increasing Sn doping is quantified from the short wavelength absorption edge onset. Using the Wemple-DiDomenico single oscillator model for the transparent part of the optical constants spectra, an increase in the centroid distance of the valence and conduction bands with increasing Sn doping is shown and only slight increase in intensity of the inter-band optical transition due to Sn doping occurs. The Drude model applied in the near-infrared part of the spectra revealed the free carrier concentration and mobility of ZnO:Sn. Results show that the range of transparency of prepared ZnO:Sn layers is not dramatically affected by Sn doping whereas electrical conductivity could be controlled by Sn doping. Refractive index in the transparent part is comparable with amorphous Indium Gallium Zinc Oxide allowing utilization of prepared ZnO:Sn layers as an indium-free alternative.
Crystal structure of R.E. NiSn and R.E. PdSn equiatomic compounds
International Nuclear Information System (INIS)
Dwight, A.E.
1983-03-01
Call constants and volume per formula weight are tabulated for RE NiSn (RE = La to Lu, Y) and RE PdSn (RE = Nd to Ho). The unit cell constants are also plotted versus ionic radius of the RE; trends are noted
Tice, Jesse B; Chizmeshya, Andrew V G; Groy, Thomas L; Kouvetakis, John
2009-07-06
The compounds Ph(3)SnSiH(3) and Ph(3)SnGeH(3) (Ph = C(6)H(5)) have been synthesized as colorless solids containing Sn-MH(3) (M = Si, Ge) moieties that are stable in air despite the presence of multiple and highly reactive Si-H and Ge-H bonds. These molecules are of interest since they represent potential model compounds for the design of new classes of IR semiconductors in the Si-Ge-Sn system. Their unexpected stability and high solubility also makes them a safe, convenient, and potentially useful delivery source of -SiH(3) and -GeH(3) ligands in molecular synthesis. The structure and composition of both compounds has been determined by chemical analysis and a range of spectroscopic methods including multinuclear NMR. Single crystal X-ray structures were determined and indicated that both compounds condense in a Z = 2 triclinic (P1) space group with lattice parameters (a = 9.7754(4) A, b = 9.8008(4) A, c = 10.4093(5) A, alpha = 73.35(10)(o), beta = 65.39(10)(o), gamma = 73.18(10)(o)) for Ph(3)SnSiH(3) and (a = 9.7927(2) A, b = 9.8005(2) A, c = 10.4224(2) A, alpha = 74.01(3)(o), beta = 65.48(3)(o), gamma = 73.43(3)(o)) for Ph(3)SnGeH(3). First principles density functional theory simulations are used to corroborate the molecular structures of Ph(3)SnSiH(3) and Ph(3)SnGeH(3), gain valuable insight into the relative stability of the two compounds, and provide correlations between the Si-Sn and Ge-Sn bonds in the molecules and those in tetrahedral Si-Ge-Sn solids.
Far-infrared spectrophotometry of SN 1987A - Days 265 and 267
Moseley, S. H.; Dwek, E.; Silverberg, R. F.; Glaccum, W.; Graham, J. R.; Loewenstein, R. F.
1989-01-01
The paper presents 16-66-micron spectra of SN 1987A taken on days 266 and 268 after core collapse. The spectrum consists of a nearly flat continuum, strong emission lines of hydrogen, and fine-structure lines of Fe II, Fe III, Co II, S I, and possibly Fe I, Ni II, and S III. From the relative strength of three lines which arise from transitions within the ground and excited states of Fe II, the temperature and a lower limit on the density of the line-emitting region are derived. From the line strengths, the abundances of Fe and S I, the end products of explosive nucleosynthesis in the supernova are estimated. An upper limit is also set to the amount of Co II remaining in the mantle. The low measured mass of Fe suggests that the ejecta are clumpy. The flat continuum is most likely free-free emission from the expanding supernova ejecta. About 35 percent of this emission arises from the ionized metals in the mantle; the rest arises from ionized hydrogen. At the time of these observations, there is no evidence for any emission from dust that may have formed in the supernova ejecta or from preexisting dust in the surrounding medium.
Energy Technology Data Exchange (ETDEWEB)
Diaz, Aaron A. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Baldwin, David L. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Cinson, Anthony D. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Jones, Anthony M. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Larche, Michael R. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Mathews, Royce [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Mullen, Crystal A. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Pardini, Allan F. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Posakony, Gerald J. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Prowant, Matthew S. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Hartman, Trenton S. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Edwards, Matthew K. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States)
2014-08-06
This Technical Letter Report satisfies the M3AR-14PN2301022 milestone, and is focused on identifying and quantifying the mechanistic sources of sensor performance variation between individual 22-element, linear phased-array sensor prototypes, SN1 and SN2. This effort constitutes an iterative evolution that supports the longer term goal of producing and demonstrating a pre-manufacturing prototype ultrasonic probe that possesses the fundamental performance characteristics necessary to enable the development of a high-temperature sodium-cooled fast reactor inspection system. The scope of the work for this portion of the PNNL effort conducted in FY14 includes performing a comparative evaluation and assessment of the performance characteristics of the SN1 and SN2 22 element PA-UT probes manufactured at PNNL. Key transducer performance parameters, such as sound field dimensions, resolution capabilities, frequency response, and bandwidth are used as a metric for the comparative evaluation and assessment of the SN1 and SN2 engineering test units.
Cheng, Yayi; Huang, Jianfeng; Qi, Hui; Cao, Liyun; Luo, Xiaomin; Li, Jiayin; Xu, Zhanwei; Yang, Jun
2017-12-07
The Sn-C bonding content between the SnO 2 and CNTs interface was controlled by the hydrothermal method and subsequent heat treatment. Electrochemical analysis found that the SnO 2 @CNTs with high Sn-C bonding content exhibited much higher capacity contribution from alloying and conversion reaction compared with the low content of Sn-C bonding even after 200 cycles. The high Sn-C bonding content enabled the SnO 2 nanoparticles to stabilize on the CNTs surface, realizing an in situ pulverization process of SnO 2 . The in situ pulverized structure was beneficial to maintain the close electrochemical contact of the working electrode during the long-term cycling and provide ultrafast transfer paths for lithium ions and electrons, which promoted the alloying and conversion reaction kinetics greatly. Therefore, the SnO 2 @CNTs composite with high Sn-C bonding content displayed highly reversible alloying and conversion reaction. It is believed that the composite could be used as a reference for design chemically bonded metal oxide/carbon composite anode materials in lithium-ion batteries.
Nano-grain SnO{sub 2} electrodes for high conversion efficiency SnO{sub 2}-DSSC
Energy Technology Data Exchange (ETDEWEB)
Lee, Jung-Hoon; Shin, Yu-Ju [Department of Chemistry, the Catholic University of Korea, Bucheon, Gyeonggi-do 422-743 (Korea, Republic of); Park, Nam-Gyu [School of Chemical Engineering, Sungkyunkwan University, Suwon, Gyeonggi-do 440-746 (Korea, Republic of)
2011-01-15
The nano-grain ZnO/SnO{sub 2} composite electrode was prepared by adding 5 w% of the 200-250 nm ZnO particles to the 5 nm SnO{sub 2} colloid in the presence of hydroxypropylcellulose (M.W.=80,000). The nano-grain SnO{sub 2} electrode was obtained by removing the ZnO particles from the composite electrode using acetic acid. The FE-SEM micrographs revealed that both electrodes consisted of interconnected nano-grains that were ca. 800 nm in size, and the large pores between the grains furnished the wide electrolyte diffusion channels within the electrodes. The photovoltaic properties of the nano-grain electrodes were investigated by measuring the I-V behaviors, the IPCE spectra and the ac-impedance spectra. The nano-grain electrodes exhibited remarkably improved conversion efficiencies of 3.96% for the composite and 2.98% for the SnO{sub 2} electrode compared to the value of 1.66% for the usual nano-particle SnO{sub 2} electrode. The improvement conversion efficiencies were mainly attributed to the formation of nano-grains, which facilitated the electron diffusion within the grains. The improved electrolyte diffusion as well as the light-scattering effects enhanced the photovoltaic performance of the SnO{sub 2} electrode. (author)
Energy Technology Data Exchange (ETDEWEB)
Hart, John; Hazbun, Ramsey; Gupta, Jay; Kolodzey, James [Department of Electrical Engineering, University of Delaware, 140 Evans Hall, Newark, Delaware 19716 (United States); Adam, Thomas [College of Nanoscale Science and Engineering, SUNY, Albany, New York 12203 (United States); Kim, Yihwan; Huang, Yi-Chiau [Applied Materials, Sunnyvale, California 94085 (United States); Reznicek, Alexander [IBM Research at Albany Nanotech, Albany, New York 12203 (United States)
2016-03-07
Pseudomorphic GeSn layers with Sn atomic percentages between 4.5% and 11.3% were grown by chemical vapor deposition using digermane and SnCl{sub 4} precursors on Ge virtual substrates grown on Si. The layers were characterized by x-ray diffraction rocking curves and reciprocal space maps. Photoconductive devices were fabricated, and the dark current was found to increase with Sn concentration. The responsivity of the photoconductors was measured at a wavelength of 1.55 μm using calibrated laser illumination at room temperature and a maximum value of 2.7 mA/W was measured for a 4.5% Sn device. Moreover, the responsivity for higher Sn concentration was found to increase with decreasing temperature. Spectral photoconductivity was measured using Fourier transform infrared spectroscopy. The photoconductive absorption edge continually increased in wavelength with increasing tin percentage, out to approximately 2.4 μm for an 11.3% Sn device. The direct band gap was extracted using Tauc plots and was fit to a bandgap model accounting for layer strain and Sn concentration. This direct bandgap was attributed to absorption from the heavy-hole band to the conduction band. Higher energy absorption was also observed, which was thought to be likely from absorption in the light-hole band. The band gaps for these alloys were plotted as a function of temperature. These experiments show the promise of GeSn alloys for CMOS compatible short wave infrared detectors.
International Nuclear Information System (INIS)
Hart, John; Hazbun, Ramsey; Gupta, Jay; Kolodzey, James; Adam, Thomas; Kim, Yihwan; Huang, Yi-Chiau; Reznicek, Alexander
2016-01-01
Pseudomorphic GeSn layers with Sn atomic percentages between 4.5% and 11.3% were grown by chemical vapor deposition using digermane and SnCl 4 precursors on Ge virtual substrates grown on Si. The layers were characterized by x-ray diffraction rocking curves and reciprocal space maps. Photoconductive devices were fabricated, and the dark current was found to increase with Sn concentration. The responsivity of the photoconductors was measured at a wavelength of 1.55 μm using calibrated laser illumination at room temperature and a maximum value of 2.7 mA/W was measured for a 4.5% Sn device. Moreover, the responsivity for higher Sn concentration was found to increase with decreasing temperature. Spectral photoconductivity was measured using Fourier transform infrared spectroscopy. The photoconductive absorption edge continually increased in wavelength with increasing tin percentage, out to approximately 2.4 μm for an 11.3% Sn device. The direct band gap was extracted using Tauc plots and was fit to a bandgap model accounting for layer strain and Sn concentration. This direct bandgap was attributed to absorption from the heavy-hole band to the conduction band. Higher energy absorption was also observed, which was thought to be likely from absorption in the light-hole band. The band gaps for these alloys were plotted as a function of temperature. These experiments show the promise of GeSn alloys for CMOS compatible short wave infrared detectors.
Hart, John; Adam, Thomas; Kim, Yihwan; Huang, Yi-Chiau; Reznicek, Alexander; Hazbun, Ramsey; Gupta, Jay; Kolodzey, James
2016-03-01
Pseudomorphic GeSn layers with Sn atomic percentages between 4.5% and 11.3% were grown by chemical vapor deposition using digermane and SnCl4 precursors on Ge virtual substrates grown on Si. The layers were characterized by x-ray diffraction rocking curves and reciprocal space maps. Photoconductive devices were fabricated, and the dark current was found to increase with Sn concentration. The responsivity of the photoconductors was measured at a wavelength of 1.55 μm using calibrated laser illumination at room temperature and a maximum value of 2.7 mA/W was measured for a 4.5% Sn device. Moreover, the responsivity for higher Sn concentration was found to increase with decreasing temperature. Spectral photoconductivity was measured using Fourier transform infrared spectroscopy. The photoconductive absorption edge continually increased in wavelength with increasing tin percentage, out to approximately 2.4 μm for an 11.3% Sn device. The direct band gap was extracted using Tauc plots and was fit to a bandgap model accounting for layer strain and Sn concentration. This direct bandgap was attributed to absorption from the heavy-hole band to the conduction band. Higher energy absorption was also observed, which was thought to be likely from absorption in the light-hole band. The band gaps for these alloys were plotted as a function of temperature. These experiments show the promise of GeSn alloys for CMOS compatible short wave infrared detectors.
Electrodeposition of nanostructured Sn-Zn coatings
Salhi, Y.; Cherrouf, S.; Cherkaoui, M.; Abdelouahdi, K.
2016-03-01
The electrodeposition of Sn-Zn coating at ambient temperature was investigated. The bath consists of metal salts SnCl2·2H2O and ZnSO4·7H2O and sodium citrate (NaC6H5Na3O7·2H2O) as complexing agent. To prevent precipitation, the pH is fixed at 5. Reducing tin and zinc through Sncit2- and ZnHcit- complex respectively is confirmed by the presence of two cathodic peaks on the voltammogram. The kinetic of tin (II) reduction process is limited by the SnCit2- dissociation. The SEM and TEM observations have showed that the coating consists of a uniform Sn-Zn layer composed of fine grains on which tin aggregates grow up. XRD revealed peaks corresponding to the hexagonal Zn phase and the tetragonal β-Sn phase.
DEFF Research Database (Denmark)
Leloudas, Georgios; Chatzopoulos, E.; Dilday, B.
2012-01-01
to contribute to a better understanding of these objects by studying SN 2006oz, a newly-recognized member of this class. Methods. We present multi-color light curves of SN 2006oz from the SDSS-II SN Survey that cover its rise time, as well as an optical spectrum that shows that the explosion occurred at z ~ 0.......376. We fitted black-body functions to estimate the temperature and radius evolution of the photosphere and used the parametrized code SYNOW to model the spectrum. We constructed a bolometric light curve and compared it with explosion models. In addition, we conducted a deep search for the host galaxy...... to a recombination wave in a circumstellar medium (CSM) and discuss whether this is a common property of all similar explosions. The subsequent rise can be equally well described by input from a magnetar or by ejecta-CSM interaction, but the models are not well constrained owing to the lack of post...
Phase Equilibria of Sn-Co-Cu Ternary System
Chen, Yu-Kai; Hsu, Chia-Ming; Chen, Sinn-Wen; Chen, Chih-Ming; Huang, Yu-Chih
2012-10-01
Sn-Co-Cu ternary alloys are promising lead-free solders, and isothermal sections of Sn-Co-Cu phase equilibria are fundamentally important for the alloys' development and applications. Sn-Co-Cu ternary alloys were prepared and equilibrated at 523 K, 1073 K, and 1273 K (250 °C, 800 °C, and 1000 °C), and the equilibrium phases were experimentally determined. In addition to the terminal solid solutions and binary intermetallic compounds, a new ternary compound, Sn3Co2Cu8, was found. The solubilities of Cu in the α-CoSn3 and CoSn2 phases at 523 K (250 °C) are 4.2 and 1.6 at. pct, respectively, while the Cu solubility in the α-Co3Sn2 phase is as high as 20.0 at. pct. The Cu solubility increases with temperature and is around 30.0 at. pct in the β-Co3Sn2 at 1073 K (800 °C). The Co solubility in the η-Cu6Sn5 phase is also significant and is 15.5 at. pct at 523 K (250 °C).
International Nuclear Information System (INIS)
Romaka, L.; Stadnyk, Yu.; Romaka, V.V.; Demchenko, P.; Stadnyshyn, M.; Konyk, M.
2011-01-01
Highlights: → {Gd, Er}-V-Sn ternary systems at 870 K are characterized by formation of stannides with general compositions RV 6 Sn 6 . → Isostructural RV 6 Sn 6 compounds were also found with Y, Dy, Ho, Tm, and Lu. → The crystal structure of RV 6 Sn 6 compounds was determined by powder diffraction method. → Structural analysis showed that RV 6 Sn 6 compounds (R = Gd, Dy-Tm, Lu) are disordered; YV 6 Sn 6 is characterized by structure ordering. - Abstract: The phase equilibria in the Gd-V-Sn and Er-V-Sn ternary systems were studied at 870 K by means of X-ray and metallographic analyses in the whole concentration range. Both Gd-V-Sn and Er-V-Sn systems are characterized by formation of one ternary compound at investigated temperature, with stoichiometry RV 6 Sn 6 (SmMn 6 Sn 6 -type, space group P6/mmm, a = 0.55322(3) nm, c = 0.91949(7) nm for Gd, a = 0.55191(2) nm, c = 0.91869(8) nm for Er). Solubility of the third component in the binary compounds was not observed. Compounds with the SmMn 6 Sn 6 -type were also found with Dy, Ho, Tm, and Lu, while YV 6 Sn 6 compound crystallizes in HfFe 6 Ge 6 structure type. All investigated compounds are the first ternary stannides with rare earth elements and vanadium.
Energy Technology Data Exchange (ETDEWEB)
Huang, M.L., E-mail: huang@dlut.edu.cn; Zhao, J.F.; Zhang, Z.J.; Zhao, N.
2016-09-05
The effect of high diffusivity anisotropy in β-Sn grain on electromigration behavior of micro-bumps was clearly demonstrated using Sn-3.0Ag-0.5Cu solder interconnects with only two β-Sn grains. The orientation of β-Sn grain (θ is defined as the angle between the c-axis of β-Sn grain and the electron flow direction) is becoming the most crucial factor to dominate the different electromigration-induced failure modes: 1) the excessive dissolution of the cathode Cu, blocking at the grain boundary and massive precipitation of columnar Cu{sub 6}Sn{sub 5} intermetallic compounds (IMCs) in the small angle θ β-Sn grain occur when electrons flow from a small angle θ β-Sn grain to a large one; 2) void formation and propagation occur at the cathode IMC/solder interface and no Cu{sub 6}Sn{sub 5} IMCs precipitate within the large angle θ β-Sn grain when electrons flow in the opposite direction. The EM-induced failure mechanism of the two β-Sn grain solder interconnects is well explained in viewpoint of atomic diffusion flux in β-Sn. - Highlights: • High anisotropy in β-Sn dominates different electromigration-induced failure mode. • Excessive dissolution of cathode Cu occurs if electrons flow in forward direction. • Voids initiate and propagate at cathode if electrons flow in reverse direction. • Failure modes are well explained in viewpoint of atomic diffusion flux in β-Sn.
Ethanol electrooxidation on novel carbon supported Pt/SnOx/C catalysts with varied Pt:Sn ratio
International Nuclear Information System (INIS)
Jiang, L.; Colmenares, L.; Jusys, Z.; Sun, G.Q.; Behm, R.J.
2007-01-01
Novel carbon supported Pt/SnO x /C catalysts with Pt:Sn atomic ratios of 5:5, 6:4, 7:3 and 8:2 were prepared by a modified polyol method and characterized with respect to their structural properties (X-ray diffraction (XRD) and transmission electron microscopy (TEM)), chemical composition (XPS), their electrochemical properties (base voltammetry, CO ad stripping) and their electrocatalytic activity and selectivity for ethanol oxidation (ethanol oxidation reaction (EOR)). The data show that the Pt/SnO x /C catalysts are composed of Pt and tin oxide nanoparticles with an average Pt particle diameter of about 2 nm. The steady-state activity of the Pt/SnO x /C catalysts towards the EOR decreases with tin content at room temperature, but increases at 80 deg. C. On all Pt/SnO x /C catalysts, acetic acid and acetaldehyde represent dominant products, CO 2 formation contributes 1-3% for both potentiostatic and potentiodynamic reaction conditions. With increasing potential, the acetaldehyde yield decreases and the acetic acid yield increases. The apparent activation energies of the EOR increase with tin content (19-29 kJ mol -1 ), but are lower than on Pt/C (32 kJ mol -1 ). The somewhat better performance of the Pt/SnO x /C catalysts compared to alloyed PtSn x /C catalysts is attributed to the presence of both sufficiently large Pt ensembles for ethanol dehydrogenation and C-C bond splitting and of tin oxide for OH generation. Fuel cell measurements performed for comparison largely confirm the results obtained in model studies
International Nuclear Information System (INIS)
Yohannan, Jinu P.; Vidyasagar, Kanamaluru
2016-01-01
Ten AInM′S 4 (A=alkali metals, Tl; M′= Ge, Sn) compounds with diverse structure types have been synthesized and characterized by single crystal and powder X-ray diffraction and a variety of spectroscopic methods. They are wide band gap semiconductors. KInGeS 4 (1-β), RbInGeS 4 (2), CsInGeS 4 (3-β), TlInGeS 4 (4-β), RbInSnS 4 (8-β) and CsInSnS 4 (9) compounds with three-dimensional BaGa 2 S 4 structure and CsInGeS 4 (3-α) and TlInGeS 4 (4-α) compounds with a layered TlInSiS 4 structure have tetrahedral [InM′S 4 ] − frameworks. On the other hand, LiInSnS 4 (5) with spinel structure and NaInSnS 4 (6), KInSnS 4 (7), RbInSnS 4 (8-α) and TlInSnS 4 (10) compounds with layered structure have octahedral [InM′S 4 ] − frameworks. NaInSnS 4 (6) and KInSnS 4 (7) compounds undergo facile topotactic ion-exchange, at room temperature, with various mono-, di- and tri-valent cations in aqueous medium to give rise to metastable layered phases. - Graphical abstract: NaInSnS 4 and KInSnS 4 compounds undergo, in aqueous medium at room temperature, facile topotactic ion-exchange with mono, di and trivalent cations. Display Omitted - Highlights: • Ten AInM′S 4 compounds with diverse structure types were synthesized. • They are wide band gap semiconductors. • NaInSnS 4 and KInSnS 4 compounds undergo facile topotactic ion-exchange at room temperature.
Effect of Nb on the Growth Behavior of Co3Sn2 Phase in Undercooled Co-Sn Melts
Kang, Jilong; Xu, Wanqiang; Wei, Xiuxun; Ferry, Michael; Li, Jinfu
2016-12-01
The growth behavior of the primary β-Co3Sn2 phase in (Co67Sn33)100- x Nb x ( x = 0, 0.5, 0.8, 1.0) hypereutectic alloys at different melt undercoolings was investigated systematically. The growth pattern of the β-Co3Sn2 phase at low undercooling changes with the Nb content from fractal seaweed ( x = 0, 0.5) into dendrite ( x = 0.8) and then returns to fractal seaweed ( x = 1.0) as a response to the changes in interface energy anisotropy and interface kinetic anisotropy. As undercooling increases, the dendritic growth of the β-Co3Sn2 phase in (Co67Sn33)99.2Nb0.8 alloy gives way to fractal seaweed growth at an undercooling of 32 K (-241 °C). At larger undercooling, the fractal seaweed growth is further replaced by compact seaweed growth, which occurred in the other three alloys investigated. The growth velocity of the β-Co3Sn2 phase slightly increases at low and intermediate undercooling but clearly decreases at larger undercooling due to the Nb addition. The growth velocity sharply increases as the growth pattern of the Co3Sn2 phase transits from fractal seaweed into compact seaweed.
High field-effect mobility at the (Sr,Ba)SnO{sub 3}/BaSnO{sub 3} interface
Energy Technology Data Exchange (ETDEWEB)
Fujiwara, Kohei, E-mail: kfujiwara@imr.tohoku.ac.jp; Nishihara, Kazuki; Shiogai, Junichi; Tsukazaki, Atsushi [Institute for Materials Research, Tohoku University, Sendai 980-8577 (Japan)
2016-08-15
A perovskite oxide, BaSnO{sub 3}, has been classified as one of transparent conducting materials with high electron mobility, and its application for field-effect transistors has been the focus of recent research. Here we report transistor operation in BaSnO{sub 3}-based heterostructures with atomically smooth surfaces, fabricated on SrTiO{sub 3} substrates by the (Sr,Ba)SnO{sub 3} buffer technique. Indeed, modulation of band profiles at the channel interfaces with the insertion of wide bandgap (Sr,Ba)SnO{sub 3} as a barrier layer results in a significant improvement of field-effect mobility, implying effective carrier doping at the regulated heterointerface. These results provide an important step towards realization of high-performance BaSnO{sub 3}-based field-effect transistors.
Zr-Sn-Nb alloys. Preliminary studies
International Nuclear Information System (INIS)
Danon, C.A.; Arias, D.E.
1993-01-01
Studies of the Zr-Sn-Nb diagram have been started, focussing on the Zr-rich corner, near the composition of Zirlo commercial alloy, Zr-1Sn-1Nb, and with Fe and O contents usual in nuclear grade materials. Three alloys were melted, namely Zr-4Sn-2.4Nb (A), Zr-1Sn-3Nb (B) and Zr-2.1Sn-1Nb (C). α/β transformation temperatures were measured through the variation of electrical resistivity(p) vs temperature (T). Values of 560 deg C, 670 deg C and 750 deg C were measured for the α→α+β reaction and 980 deg C, 910 deg C and 1000 deg C for the α+β→β reaction, for the A, B and C alloys, respectively in that order. Some samples were submitted to heat treatments (62 and 216 hours at 825 deg C, 120 hours at 875 deg C). Optical and scanning electronic microscopy of those samples confirmed our resistivity results. (Author)
Changes of electronic structure of SnTe due to high concentration of Sn vacancies
International Nuclear Information System (INIS)
Masek, J.; Nuzhnyj, D.N.
1997-01-01
Non-stoichiometric Sn 1-y Te is a strongly degenerated n-type semiconductor. This is important for understanding unusual features of magnetic behaviour of Sn 1-x Gd x Te where the relative positions of the Fermi energy and the atomic d-level of Gd govern the exchange coupling.The influence of the Sn vacancies on the band structure cannot be neglect if their concentration reaches a few atomic percent. We address this problem by using a tight-binding coherent potential approach and show that although the character of the bands remains unchanged, they are modified so that ε d can come out above the heavy-hole band. (author)
Energy Technology Data Exchange (ETDEWEB)
Yang, Yi-Shan; Yang, Chia-Jung; Ouyang, Fan-Yi, E-mail: fyouyang@ess.nthu.edu.tw
2016-07-25
The growth of Ni{sub 3}Sn{sub 4} intermetallic compound (IMC) between liquid–solid interface in micro-scale Ni/SnAg/Ni system was investigated under a temperature gradient of 160 °C/cm at 260 °C on a hot plate. In contrast to a symmetrical growth of Ni{sub 3}Sn{sub 4} on both interfaces under isothermally annealed at 260 °C, the interfacial Ni{sub 3}Sn{sub 4} IMC exhibited asymmetric growth under a temperature gradient; the growth of Ni{sub 3}Sn{sub 4} at cold interface was faster than that at hot side because of temperature gradient induced mass migration of Ni atoms from the hot end toward the cold end. It was found that two-stage growth behavior of Ni{sub 3}Sn{sub 4} IMC under a temperature gradient. A growth model was established and growth kinetic analysis suggested that the chemical potential gradient controlled the growth of Ni{sub 3}Sn{sub 4} at stage I (0–120 min) whereas the dynamic equilibrium between chemical potential gradient and temperature gradient forces was attained at the hot end at stage II (120–210 min). When dynamic equilibrium was achieved at 260 °C, the critical length-temperature gradient product at the hot end was experimentally estimated to be 489.18 μm × °C/cm and the moving velocity of Ni{sub 3}Sn{sub 4} interface due to Ni consumption was calculated to be 0.134 μm/h. The molar heat of transport (Q*) of Ni atoms in molten SnAg solder was calculated to be +0.76 kJ/mol. - Highlights: • Interfacial reaction in Ni/SnAg solder/Ni system under thermal gradient. • Growth rate of Ni{sub 3}Sn{sub 4} at cold end is faster than that at hot end. • Critical length-temperature gradient product at hot end is 489.2 μm°C/cm at 260 °C. • Velocity of Ni{sub 3}Sn{sub 4} moving interface is 0.134 μm/h during dynamic equilibrium. • Molar heat of transport (Q*) of Ni in molten SnAg was +0.76 kJ/mol.
The crystal structure of (Nb$_{0.75}$Cu$_{0.25}$)Sn$_{2}$ in the Cu-Nb-Sn system
Martin, Stefan; Nolze, Gert; Leineweber, Andreas; Leaux, Floriane; Scheuerlein, Christian
2017-01-01
During the processing of superconducting Nb$_{3}$Sn wire, several intermediate intermetallic phases including a previously encountered Cu-Nb-Sn phase show up. The yet unknown crystal structure of this phase is now identified by a combination of different experimental techniques and database search to be of the hexagonal NiMg2 type with a proposed composition of about (Nb0.75Cu0.25)Sn2. The structure determination started from an evaluation of the lattice parameters from EBSD Kikuchi patterns from quenched material suggesting hexagonal or orthorhombic symmetry. A database search then led to the hexagonal NiMg2 type structure, the presence of which was confirmed by a Rietveld analysis on the basis of high energy synchrotron X-ray powder diffraction data. Assuming a partial substitution of Nb in orthorhombic NbSn2 by Cu, the change of the valence electron concentration provokes a structural transformation from the CuMg2 type for NbSn2 to the NiMg2 type for (Nb0.75Cu0.25)Sn2. In the previous literature the (Nb0.7...
Coulomb excitation of {sup 107}Sn
Energy Technology Data Exchange (ETDEWEB)
DiJulio, D.D.; Cederkall, J.; Fahlander, C. [Lund University, Physics Department, 118, Lund (Sweden); Ekstroem, A. [University of Oslo, Department of Physics and Center of Mathematics for Applications, Oslo (Norway); Hjorth-Jensen, M. [University of Oslo, Department of Physics and Center of Mathematics for Applications, Oslo (Norway); Michigan State University, National Superconducting Cyclotron Laboratory and Department of Physics and Astronomy, East Lansing, MI (United States); Albers, M.; Blazhev, A.; Fransen, C.; Geibel, K.; Hess, H.; Reiter, P.; Seidlitz, M.; Taprogge, J.; Warr, N. [University of Cologne, Institute of Nuclear Physics, Cologne (Germany); Bildstein, V.; Gernhaeuser, R.; Wimmer, K. [Technische Universitaet Muenchen, Physik Department E12, Garching (Germany); Darby, I.; Witte, H. de [Instituut voor Kern- en Stralingsfysica, Leuven (Belgium); Davinson, T. [University of Edinburgh, Department of Physics and Astronomy, Edinburgh (United Kingdom); Diriken, J. [Instituut voor Kern- en Stralingsfysica, Leuven (Belgium); Studiecentrum voor Kernenergie/Centre d' Etude de l' energie Nucleaire (SCK CEN), Mol (Belgium); Goergen, A.; Siem, S.; Tveten, G.M. [University of Oslo, Department of Physics, Oslo (Norway); Iwanicki, J. [University of Warsaw, Heavy Ion Laboratory, Warsaw (Poland); Lutter, R. [Ludwig-Maximilians-Universitaet Muenchen, Fakultaet fuer Physik, Garching (Germany); Scheck, M. [University of Liverpool, Oliver Lodge Laboratory, Liverpool (United Kingdom); Walle, J.V. de [PH Department, Geneva 23 (Switzerland); Voulot, D.; Wenander, F. [AB Department, Geneva 23 (Switzerland)
2012-07-15
The radioactive isotope {sup 107}Sn was studied using Coulomb excitation at the REX-ISOLDE facility at CERN. This is the lightest odd-Sn nucleus examined using this technique. The reduced transition probability of the lowest-lying 3/2{sup +} state was measured and is compared to shell-model predictions based on several sets of single-neutron energies relative to {sup 100}Sn. Similar to the transition probabilities for the 2{sup +} states in the neutron-deficient even-even Sn nuclei, the measured value is underestimated by shell-model calculations. Part of the strength may be recovered by considering the ordering of the d{sub 5/2} and g{sub 7/2} single-neutron states. (orig.)
Effect of Cooling Rate on the Longitudinal Modulus of Cu3Sn Phase of Ag-Sn-Cu Amalgam Alloy (Part II
Directory of Open Access Journals (Sweden)
R. H. Rusli
2015-10-01
Full Text Available Effects of cooling rate (at the time of solidification on the elastic constants of Cu3Sn phase of Ag-Sn-Cu dental amalgam alloy were studied. In this study, three types of alloys were made, with the composition Cu-38-37 wt% Sn by means of casting, where each alloy was subjected to different cooling rate, such as cooling on the air (AC, air blown (AB, and quenched in the water (WQ. X-ray diffraction, metallography, and Scanning Electron Microscopy with Energy Dispersive Spectroscopy studies of three alloys indicated the existence of Cu3Sn phase. Determination of the modulus of elasticity of Cu3Sn (ε phase was carried out by the measurement of longitudinal and transversal waves velocity using ultrasonic technique. The result shows that Cu3Sn (ε phase on AC gives higher modulus of elasticity values than those of Cu3Sn (ε on AB and WQ. The high modulus of elasticity value will produce a strong Ag-Sn-Cu dental amalagam alloy.
Controlling Cu–Sn mixing so as to enable higher critical current densities in RRP® Nb3Sn wires
Sanabria, Charlie; Field, Michael; Lee, Peter J.; Miao, Hanping; Parrell, Jeff; Larbalestier, David C.
2018-06-01
Dipole magnets for the proposed Future Circular Collider (FCC) demand specifications significantly beyond the limits of all existing Nb3Sn wires, in particular a critical current density (J c) of more than 1500 A mm‑2 at 16 T and 4.2 K with an effective filament diameter (D eff) of less than 20 μm. The restacked-rod-process (RRP®) is the technology closest to meeting these demands, with a J c (16 T) of up to 1400 A mm‑2, residual resistivity ratio > 100, for a sub-element size D s of 58 μm (which in RRP® wires is essentially the same as D eff). An important present limitation of RRP® is that reducing the sub-element size degrades J c to as low as 900 A mm‑2 at 16 T for D s = 35 μm. To gain an understanding of the sources of this J c degradation, we have made a detailed study of the phase evolution during the Cu–Sn ‘mixing’ stages of the wire heat treatment that occur prior to Nb3Sn formation. Using extensive microstructural quantification, we have identified the critical role that the Sn–Nb–Cu ternary phase (Nausite) can play. The Nausite forms as a well-defined ring between the Sn source and the Cu/Nb filament pack, and acts as an osmotic membrane in the 300 °C–400 °C range—greatly inhibiting Sn diffusion into the Cu/Nb filament pack while supporting a strong Cu counter-diffusion from the filament pack into the Sn core. This converts the Sn core into a mixture of the low melting point (408 °C) η phase (Cu6Sn5) and the more desirable ε phase (Cu3Sn), which decomposes at 676 °C. After the mixing stages, when heated above 408 °C towards the Nb3Sn reaction, any residual η liquefies to form additional irregular Nausite on the inside of the membrane. All Nausite decomposes into NbSn2 on further heating, and ultimately transforms into coarse-grain (and often disconnected) Nb3Sn which has little contribution to current transport. Understanding this critical Nausite reaction pathway has allowed us to simplify the mixing heat treatment to
Lead-free soldering: Investigation of the Cu-Sn-Sb system along the Sn:Sb = 1:1 isopleth
Energy Technology Data Exchange (ETDEWEB)
Yuan, Y. [State Key Laboratory of Powder Metallurgy, Central South University, Changsha, Hunan 410083 (China); Department of Chemistry and Industrial Chemistry, University of Genoa, INSTM UdR Genoa, Via Dodecaneso 31, I-16146 Genoa (Italy); Borzone, G., E-mail: borzone@chimica.unige.it [Department of Chemistry and Industrial Chemistry, University of Genoa, INSTM UdR Genoa, Via Dodecaneso 31, I-16146 Genoa (Italy); Zanicchi, G.; Delsante, S. [Department of Chemistry and Industrial Chemistry, University of Genoa, INSTM UdR Genoa, Via Dodecaneso 31, I-16146 Genoa (Italy)
2011-02-03
Research highlights: > In the electronics industry, the solder alloys commonly used for assembly belong to the Sn-Pb system. Fulfilment of the EU RoHS (reduction of hazardous substances) requires the development of new lead-free alloys for applications in electronics, with the same or possibly better characteristics than the traditional Sn-Pb alloys. > This research concerns the investigation of the constitutional properties of the Cu-Sn-Sb system which is considered as lead-free replacement for high-temperature applications. - Abstract: The Cu-Sn-Sb system has been experimentally investigated by a combination of optical microscopy, differential scanning calorimetry (DSC) and electron probe microanalysis (EPMA). DSC was used to identify a total number of five invariant ternary reactions and the Sn:Sb = 1:1 isopleth section up to 65 at.% Cu was constructed by combining the DSC data with the EPMA analyses of annealed alloys and literature information. The composition limits of the binary phases were detected.
Laser spectroscopy of neutron deficient Sn isotopes
We propose to study the ground state properties of neutron-deficient Sn isotopes towards the doubly-magic nucleus $^{100}$Sn. Nuclear spins, changes in the rms charge radii and electromagnetic moments of $^{101-121}$Sn will be measured by laser spectroscopy using the CRIS experimental beam line. These ground-state properties will help to clarify the evolution of nuclear structure properties approaching the $\\textit{N = Z =}$ 50 shell closures. The Sn isotopic chain is currently the frontier for the application of state-of-the-art ab-initio calculations. Our knowledge of the nuclear structure of the Sn isotopes will set a benchmark for the advances of many-body methods, and will provide an important test for modern descriptions of the nuclear force.
Alaf, Mirac; Akbulut, Hatem
2014-02-01
Recent development of electrode materials for Li-ion batteries is driven mainly by hybrid nanocomposite structures consisting of Li storage compounds and CNTs. In this study, tin/tinoxide (Sn/SnO2) films and tin/tinoxide/multi walled carbon nanotube (Sn/SnO2/MWCNT) nanocomposites are produced by a two steps process; thermal evaporation and subsequent plasma oxidation as anode materials for Li-ion batteries. The physical, structural, and electrochemical behaviors of the nanocomposite electrodes containing MWCNTs are discussed. The ratio between metallic tin (Sn) and tinoxide (SnO2) is controlled with plasma oxidation time and effects of the ratio are investigated on the structural and electrochemical properties. The greatly enhanced electrochemical performance is mainly due to the morphological stability and reduced diffusion resistance, which are induced by MWCNT core and deposited Sn/SnO2 double phase shell. The outstanding long-term cycling stability is a result of the two layers Sn and SnO2 phases on MWCNTs. The nanoscale Sn/SnO2/MWCNT network provides good electrical conductivity, and the creation of open spaces that buffer a large volume change during the Li-alloying/de-alloying reaction.
Michalak, William D.
2014-04-01
The barrier to CO oxidation on Pt catalysts is the strongly bound adsorbed CO, which inhibits O2 adsorption and hinders CO2 formation. Using reaction studies and in situ X-ray spectroscopy with colloidally prepared, monodisperse ∼2 nm Pt and PtSn nanoparticle catalysts, we show that the addition of Sn to Pt provides distinctly different reaction sites and a more efficient reaction mechanism for CO oxidation compared to pure Pt catalysts. To probe the influence of Sn, we intentionally poisoned the Pt component of the nanoparticle catalysts using a CO-rich atmosphere. With a reaction environment comprised of 100 Torr CO and 40 Torr O2 and a temperature range between 200 and 300 C, Pt and PtSn catalysts exhibited activation barriers for CO2 formation of 133 kJ/mol and 35 kJ/mol, respectively. While pure Sn is readily oxidized and is not active for CO oxidation, the addition of Sn to Pt provides an active site for O2 adsorption that is important when Pt is covered with CO. Sn oxide was identified as the active Sn species under reaction conditions by in situ ambient pressure X-ray photoelectron spectroscopy measurements. While chemical signatures of Pt and Sn indicated intermixed metallic components under reducing conditions, Pt and Sn were found to reversibly separate into isolated domains of Pt and oxidic Sn on the nanoparticle surface under reaction conditions of 100 mTorr CO and 40 mTorr O2 between temperatures of 200-275 C. Under these conditions, PtSn catalysts exhibited apparent reaction orders in O2 for CO 2 production that were 0.5 and lower with increasing partial pressures. These reaction orders contrast the first-order dependence in O 2 known for pure Pt. The differences in activation barriers, non-first-order dependence in O2, and the presence of a partially oxidized Sn indicate that the enhanced activity is due to a reaction mechanism that occurs at a Pt/Sn oxide interface present at the nanoparticle surface. © 2014 Published by Elsevier Inc.
Development of a 117mSn preparation method
International Nuclear Information System (INIS)
Moraes, Vanessa; Osso Junior, Joao Alberto
2000-01-01
117m Sn is a radioisotope with suitable characteristics to be used in nuclear medicine as radiotherapy, when labeled with DTPA. The aim of this work is the preparation of 117m Sn from irradiation of the natural tin with proton beam at the cyclotron CV-28 of IPEN-CNEN/SP via the nuclear reaction nat Sn (p, xn) 117 Sb to 117m Sn. Due to the formation of the Sb precursor it is necessary to perform a chemical separation for Sb-Sn. The separation method used was the ion exchange, due to its utilization facilities for radioactive material. Chemical, radiochemical and radionuclidic methods were also developed for the quality control of the final product, the 117m Sn. (author)
Exploration work function and optical properties of monolayer SnSe allotropes
Cui, Zhen; Wang, Xia; Ding, Yingchun; Li, Meiqin
2018-02-01
The work function and optical properties are investigated with density functional theory for three monolayer SnSe allotropes. The calculated results indicate that the α-SnSe, δ-SnSe, ε-SnSe are semiconductor with the band gaps of 0.90, 1.25, and 1.50 eV, respectively. Meanwhile, the work function of δ-SnSe is lower than α-SnSe and ε-SnSe, which indicates that the δ-SnSe can be prepared of photoemission and field emission nanodevices. More importantly, the α-SnSe, δ-SnSe, ε-SnSe with the large static dielectric constants are 4.22, 5.48, and 3.61, which demonstrate that the three monolayer SnSe allotropes can be fabricated the capacitor. In addition, the static refractive index of δ-SnSe is larger than α-SnSe and ε-SnSe. The different optical properties with three monolayer SnSe allotropes reveal that the allotropes can regulate the properties of the materials. Moreover, our researched results show that the three monolayer SnSe allotropes are sufficient for fabrication of optoelectronic nanodevices.
Variants of the HNF1α gene: a molecular approach concerning diabetic patients from southern Brazil
Directory of Open Access Journals (Sweden)
Naieli Bonatto
2012-01-01
Full Text Available Maturity Onset Diabetes of the Young (MODY presents monogenic inheritance and mutation factors which have already been identified in six different genes. Given the wide molecular variation present in the hepatocyte nuclear factor-1α gene (HNF1α MODY3, the aimof this study was to amplify and sequence the coding regions of this gene in seven patients from the Campos Gerais region, Paraná State, Brazil, presenting clinical MODY3 features. Besides the synonymous variations, A15A, L17L, Q141Q, G288G and T515T, two missense mutations, I27L and A98V, were also detected. Clinical and laboratory data obtained from patients were compared with the molecular findings, including the I27L polymorphism that was revealed in some overweight/obese diabetic patients of this study, this corroborating with the literature. We found certain DNA variations that could explain the hyperglycemic phenotype of the patients.
Local atomic structure inheritance in Ag50Sn50 melt
International Nuclear Information System (INIS)
Bai, Yanwen; Bian, Xiufang; Qin, Jingyu; Hu, Lina; Yang, Jianfei; Zhang, Kai; Zhao, Xiaolin; Yang, Chuncheng; Zhang, Shuo; Huang, Yuying
2014-01-01
Local structure inheritance signatures were observed during the alloying process of the Ag 50 Sn 50 melt, using high-temperature X-ray diffraction and ab initio molecular dynamics simulations. The coordination number N m around Ag atom is similar in the alloy and in pure Ag melts (N m ∼ 10), while, during the alloying process, the local structure around Sn atoms rearranges. Sn-Sn covalent bonds were substituted by Ag-Sn chemical bonds, and the total coordination number around Sn increases by about 70% as compared with those in the pure Sn melt. Changes in the electronic structure of the alloy have been studied by Ag and Sn K-edge X-ray absorption spectroscopy, as well as by calculations of the partial density of states. We propose that a leading mechanism for local structure inheritance in Ag 50 Sn 50 is due to s-p dehybridization of Sn and to the interplay between Sn-s and Ag-d electrons
Energy Technology Data Exchange (ETDEWEB)
Sousa, M.G., E-mail: martasousa@ua.pt [AIN, I3N and Departamento de Física, Universidade de Aveiro, Campus Universitário de Santiago, 3810-193 Aveiro (Portugal); Cunha, A.F. da, E-mail: antonio.cunha@ua.pt [AIN, I3N and Departamento de Física, Universidade de Aveiro, Campus Universitário de Santiago, 3810-193 Aveiro (Portugal); Fernandes, P.A., E-mail: pafernandes@ua.pt [AIN, I3N and Departamento de Física, Universidade de Aveiro, Campus Universitário de Santiago, 3810-193 Aveiro (Portugal); Departamento de Física, Instituto Superior de Engenharia do Porto, Instituto Politécnico do Porto, Rua Dr. António Bernardino de Almeida 431, 4200-072 Porto (Portugal)
2014-04-01
Tin sulphide thin films have been grown on soda-lime glass substrates through the annealing of RF-magnetron sputtered SnS{sub 2} precursors. Three different approaches to the annealing were compared and the resulting films thoroughly studied. One series of precursors was annealed in a tubular furnace directly exposed to a flux of sulphur vapour plus forming gas, N{sub 2} + 5%H{sub 2}, and at a constant pressure of 500 mbar. The other two series of identical precursors were annealed in the same furnace but inside a graphite box with and without elemental sulphur evaporation again in the presence of N{sub 2} + 5%H{sub 2} and at the same pressure as for the sulphur flux experiments. Different maximum annealing temperatures for each set of samples, in the range of 300–570 °C, were tested to study their effects on the properties of the final films. The resulting phases were structurally investigated by X-Ray Diffraction (XRD) and Raman spectroscopy. Annealing of SnS{sub 2} precursors in sulphur flux produced films where SnS{sub 2} was dominant for temperatures up to 480 °C. Increasing the temperature to 530 °C and 570 °C led to films where the dominant phase became Sn{sub 2}S{sub 3}. Annealing of SnS{sub 2} precursors in a graphite box with sulphur vapour at temperatures in the range between 300 °C and 480 °C the films are multi-phase, containing Sn{sub 2}S{sub 3}, SnS{sub 2} and SnS. For high annealing temperatures of 530 °C and 570 °C the films have SnS as the dominant phase. Annealing of SnS{sub 2} precursors in a graphite box without sulphur vapour at 300 °C and 360 °C the films are essentially amorphous, at 420 °C SnS{sub 2} is the dominant phase. For temperatures of 480 °C and 530 °C SnS is the dominant phase but also same residual SnS{sub 2} and Sn{sub 2}S{sub 3} phases are observed. For annealing at 570 °C, according to the XRD results the films appear to be single phase SnS. The composition was studied using energy dispersive spectroscopy being
Enhanced hydrogen storage capacity of Ni/Sn-coated MWCNT nanocomposites
Varshoy, Shokufeh; Khoshnevisan, Bahram; Behpour, Mohsen
2018-02-01
The hydrogen storage capacity of Ni-Sn, Ni-Sn/multi-walled carbon nanotube (MWCNT) and Ni/Sn-coated MWCNT electrodes was investigated by using a chronopotentiometry method. The Sn layer was electrochemically deposited inside pores of nanoscale Ni foam. The MWCNTs were put on the Ni-Sn foam with nanoscale porosities using an electrophoretic deposition method and coated with Sn nanoparticles by an electroplating process. X-ray diffraction and energy dispersive spectroscopy results indicated that the Sn layer and MWCNTs are successfully deposited on the surface of Ni substrate. On the other hand, a field-emission scanning electron microscopy technique revealed the morphology of resulting Ni foam, Ni-Sn and Ni-Sn/MWCNT electrodes. In order to measure the hydrogen adsorption performed in a three electrode cell, the Ni-Sn, Ni-Sn/MWCNT and Ni/Sn-coated MWCNT electrodes were used as working electrodes whereas Pt and Ag/AgCl electrodes were employed as counter and reference electrodes, respectively. Our results on the discharge capacity in different electrodes represent that the Ni/Sn-coated MWCNT has a maximum discharge capacity of ˜30 000 mAh g-1 for 20 cycles compared to that of Ni-Sn/MWCNT electrodes for 15 cycles (˜9500 mAh g-1). By increasing the number of cycles in a constant current, the corresponding capacity increases, thereby reaching a constant amount for 20 cycles.
Energy Technology Data Exchange (ETDEWEB)
Schurr, R. [Chair for Crystallography and Structural Physics, University of Erlangen-Nuernberg, Staudtstrasse 3, D-91058 Erlangen (Germany)], E-mail: schurr@krist.uni-erlangen.de; Hoelzing, A.; Jost, S.; Hock, R. [Chair for Crystallography and Structural Physics, University of Erlangen-Nuernberg, Staudtstrasse 3, D-91058 Erlangen (Germany); Voss, T.; Schulze, J.; Kirbs, A. [Atotech Deutschland GmbH, Erasmusstrasse 20, D-10553 Berlin (Germany); Ennaoui, A.; Lux-Steiner, M. [Heterogeneous Material Systems SE II, Hahn-Meitner-Institut, Glienickerstr.100, D-14109 Berlin (Germany); Weber, A.; Koetschau, I.; Schock, H.-W. [Technology SE III, Hahn-Meitner-Institut, Glienickerstr.100, D-14109 Berlin (Germany)
2009-02-02
The best CZTS solar cell so far was produced by co-sputtering continued with vapour phase sulfurization method. Efficiencies of up to 5.74% were reached by Katagiri et al. The one step electrochemical deposition of copper, zinc, tin and subsequent sulfurization is an alternative fabrication technique for the production of Cu{sub 2}ZnSnS{sub 4} based thin film solar cells. A kesterite based solar cell (size 0.5 cm{sup 2}) with a conversion efficiency of 3.4% (AM1.5) was produced by vapour phase sulfurization of co-electroplated Cu-Zn-Sn films. We report on results of in-situ X-ray diffraction (XRD) experiments during crystallisation of kesterite thin films from electrochemically co-deposited metal films. The kesterite crystallisation is completed by the solid state reaction of Cu{sub 2}SnS{sub 3} and ZnS. The measurements show two different reaction paths depending on the metal ratios in the as deposited films. In copper-rich metal films Cu{sub 3}Sn and CuZn were found after electrodeposition. In copper-poor or near stoichiometric precursors additional Cu{sub 6}Sn{sub 5} and Sn phases were detected. The formation mechanism of Cu{sub 2}SnS{sub 3} involves the binary sulphides Cu{sub 2-x}S and SnS{sub 2} in the absence of the binary precursor phase Cu{sub 6}Sn{sub 5}. The presence of Cu{sub 6}Sn{sub 5} leads to a preferred formation of Cu{sub 2}SnS{sub 3} via the reaction educts Cu{sub 2-x}S and SnS{sub 2} in the presence of a SnS{sub 2}(Cu{sub 4}SnS{sub 6}) melt. The melt phase may be advantageous in crystallising the kesterite, leading to enhanced grain growth in the presence of a liquid phase.
Diffusion couple studies of the Ni-Bi-Sn system
Directory of Open Access Journals (Sweden)
Vassilev G.
2012-01-01
Full Text Available Investigations of Ni-Bi-Sn system were performed in order to inquire the phase diagram and to assess some diffusion kinetic parameters. For this purpose diffusion couples consisting of solid nickel (preliminary electroplated with tin and liquid Bi-Sn phase were annealed at 370 °C. Three compositions (0.8, 0.6 and 0.4 mole fractions Sn of the Bi-Sn melts were chosen. Annealing times from 24 to 216 h were applied. The phase and chemical compositions of the contact zone were determined by means of electron scanning microscope. It was confirmed that the diffusion layers consist mainly of Ni3Sn4 but other intermetallic phases grow as well. For the first time metastable Ni-Sn phases as NiSn and NiSn8 (NiSn9 were observed in metallurgical alloys (i.e. not in electroplated samples. The existence of a ternary compound previously reported in the literature was confirmed. More than one ternary Ni-Bi-Sn compounds might possibly be admitted. A growth coefficient of (2.29 ± 0.02 x 10-15 m2 s-1 was obtained. It was found that the apparent activation energy for diffusion layers growth (18 ± 8 kJ mol-1 is inferior to that one assessed at growth from solid state Bi-Sn mixtures (88 ± 12 kJ mol-1.
Wang, Hongjuan; Han, Genquan; Wang, Yibo; Peng, Yue; Liu, Yan; Zhang, Chunfu; Zhang, Jincheng; Hu, Shengdong; Hao, Yue
2016-04-01
In this work, a lattice-matched SiGeSn/GeSn heterostructure p-channel tunneling field-effect transistor (hetero-PTFET) with a type-II staggered tunneling junction (TJ) is investigated theoretically. Lattice matching and type-II band alignment at the Γ-point is obtained at the SiGeSn/GeSn interface by tuning Sn and Si compositions. A steeper subthreshold swing (SS) and a higher on state current (I ON) are demonstrated in SiGeSn/GeSn hetero-PTFET than in GeSn homo-PTFET. Si0.31Ge0.49Sn0.20/Ge0.88Sn0.12 hetero-PTFET achieves a 2.3-fold higher I ON than Ge0.88Sn0.12 homo-PTFET at V DD of 0.3 V. Hetero-PTFET achieves a more abrupt hole profile and a higher carrier density near TJ than the homo-PTFET, which contributes to the significantly enhanced band-to-band tunneling (BTBT) rate and tunneling current in hetero-PTFET.
Fendler, Wojciech; Borowiec, Maciej; Antosik, Karolina; Szadkowska, Agnieszka; Deja, Grazyna; Jarosz-Chobot, Przemyslawa; Mysliwiec, Malgorzata; Wyka, Krystyna; Pietrzak, Iwona; Skupien, Jan; Malecki, Maciej T; Mlynarski, Wojciech
2011-09-01
Confirmation of monogenic diabetes caused by glucokinase mutations (GCK-MODY) allows pharmacogenetic intervention in the form of insulin discontinuation. This is especially important among paediatric and young adult populations where GCK-MODY is most prevalent. The study evaluated the utility of lipid parameters in screening for patients with GCK-MODY. Eighty-nine children with type 1 diabetes and 68 with GCK-MODY were screened for triglyceride (TG), total and HDL cholesterol levels. Standardization against a control group of 171 healthy children was applied to eliminate the effect of development. Clinical applicability and cut-off value were evaluated in all available patients with GCK-MODY (n = 148), hepatocyte nuclear factor 1-alpha-MODY (HNF1A MODY) (n = 37) or type 1 diabetes (n = 221). Lower lipid parameter values were observed in GCK-MODY than in patients with type 1 diabetes. Standard deviation scores were -0·22 ± 2·24 vs 1·31 ± 2·17 for HDL cholesterol (P MODY selection [sensitivity 87%, specificity 54%, negative predictive value (NPV) 86%, positive PV 56%]. A threshold HDL concentration of 1·56 mm offered significantly better diagnostic efficiency than total cholesterol (cut-off value 4·51 mm; NPV 80%; PPV 38%; P MODY and differentiation from T1DM and HNF1A-MODY, regardless of treatment or metabolic control. © 2011 Blackwell Publishing Ltd.
Numerical analysis of In_xGa_1_−_xN/SnS and Al_xGa_1_−_xN/SnS heterojunction solar cells
International Nuclear Information System (INIS)
Lin, Shuo; Li, Xirong; Pan, Huaqing; Chen, Huanting; Li, Xiuyan; Li, Yan; Zhou, Jinrong
2016-01-01
Highlights: • In_xGa_1_−_xN/SnS and Al_xGa_1_−_xN/SnS solar cells are studied by numerical analysis. • Performances of In_xGa_1_−_xN/SnS solar cells enhanced with decreasing In content. • The electron barrier leads to the degraded efficiency of Al_xGa_1_−_xN/SnS solar cells. • GaN/SnS solar cell exhibits the highest efficiency 26.34%. - Abstract: In this work the photovoltaic properties of In_xGa_1_−_xN/SnS and Al_xGa_1_−_xN/SnS heterojunction solar cells are studied by numerical analysis. The photovoltaic performances of In_xGa_1_−_xN/SnS solar cells are enhanced with the decreasing In content and the GaN/SnS solar cell exhibits the highest efficiency. The efficiencies of GaN/SnS solar cell improve with the increased SnS thickness and the reduced GaN thickness. For the Al_xGa_1_−_xN/SnS solar cells, there is electron barrier in the Al_xGa_1_−_xN/SnS interface. The electron barrier becomes larger with increasing Al content and lead to the degraded efficiency of Al_xGa_1_−_xN/SnS solar cells. The simulation contributes to designing and fabricating SnS solar cells.
Dossat, Amanda M; Jourdi, Hussam; Wright, Katherine N; Strong, Caroline E; Sarkar, Ambalika; Kabbaj, Mohamed
2017-01-06
In humans, some males experience reductions in testosterone levels, as a natural consequence of aging or in the clinical condition termed hypogonadism, which are associated with impaired cognitive performance and mood disorder(s). Some of these behavioral deficits can be reversed by testosterone treatment. Our previous work in rats reported that sex differences in the expression of the transcription factor Zif268, a downstream target of testosterone, within the medial prefrontal cortex (mPFC) mediates sex differences in social interaction. In the present study, we aimed to examine the effects of gonadectomy (GNX) in male rats on mPFC Zif268 expression, mood and cognitive behaviors. We also examined whether reinstitution of Zif268 in GNX rats will correct some of the behavioral deficits observed following GNX. Our results show that GNX induced a downregulation of Zif268 protein in the mPFC, which was concomitant with impaired memory in the y-maze and spontaneous object recognition test, reduced social interaction time, and depression-like behaviors in the forced swim test. Reinstitution of mPFC Zif268, using a novel adeno-associated-viral (AAV) construct, abrogated GNX-induced working memory and long-term memory impairments, and reductions in social interaction time, but not GNX-induced depression-like behaviors. These findings suggest that mPFC Zif268 exerts beneficial effects on memory and social interaction, and could be a potential target for novel treatments for behavioral impairments observed in hypogonadal and aged men with declining levels of gonadal hormones. Copyright © 2016 IBRO. Published by Elsevier Ltd. All rights reserved.
Noncollinear antiferromagnetic Mn3Sn films
Markou, A.; Taylor, J. M.; Kalache, A.; Werner, P.; Parkin, S. S. P.; Felser, C.
2018-05-01
Noncollinear hexagonal antiferromagnets with almost zero net magnetization were recently shown to demonstrate giant anomalous Hall effect. Here, we present the structural and magnetic properties of noncollinear antiferromagnetic Mn3Sn thin films heteroepitaxially grown on Y:ZrO2 (111) substrates with a Ru underlayer. The Mn3Sn films were crystallized in the hexagonal D 019 structure with c -axis preferred (0001) crystal orientation. The Mn3Sn films are discontinuous, forming large islands of approximately 400 nm in width, but are chemical homogeneous and characterized by near perfect heteroepitaxy. Furthermore, the thin films show weak ferromagnetism with an in-plane uncompensated magnetization of M =34 kA/m and coercivity of μ0Hc=4.0 mT at room temperature. Additionally, the exchange bias effect was studied in Mn3Sn /Py bilayers. Exchange bias fields up to μ0HEB=12.6 mT can be achieved at 5 K. These results show Mn3Sn films to be an attractive material for applications in antiferromagnetic spintronics.
51Cr diffusion in Zr-Sn alloys
International Nuclear Information System (INIS)
Nicolai, L.I.; Migoni, R.L.; Hojvat de Tendler, Ruth
1982-01-01
The 51 Cr volume diffusion in Zr-Sn alloys is measured in polycrystals with big grains by the thin-film method. The Sn content in the alloys ranges from 0.39% at to 6.66 % at. In the beta-phase the analysed temperature range is 982 deg C-1240 deg C. The Sn dehances the 51 Cr diffusion in beta-Zr, the effect being small but well defined. Assuming the formation of Sn-Cr dimers, the linear dehancement coefficient b and the parameters for the variation of b with temperature were calculated. The parameters Q and D o were calculated for the more diluted alloys and, upon application of the Zener theory for D o , a negative contribution to the activation entropy is found. Three experiments at different temperatures were performed in the alpha-phase. 51 Cr diffuses very fast in alpha-Zr-Sn. No definite correlation is found between the 51 Cr diffusivity and the increasing Sn concentration, probably due to the anisotropy of the alfa-phase. (M.E.L.) [es
Thermodynamic assessment of the Sn-Co lead-free solder system
Liu, Libin; Andersson, Cristina; Liu, Johan
2004-09-01
The Sn-Co-Cu eutectic alloy can be a less expensive alternative for the Sn-Ag-Cu alloy. In order to find the eutectic solder composition of the Sn-Co-Cu system, the Sn-Co binary system has been thoroughly assessed with the calculation of phase diagram (CALPHAD) method. The liquid phase, the FCC and HCP Co-rich solid solution, and the BCT Sn-rich solid solution have been described by the Redlich-Kister model. The Hillert-Jarl-Inden model has been used to describe the magnetic contributions to Gibbs energy in FCC and HCP. The CoSn2, CoSn, Co3Sn2_β, and Co3Sn2_α phases have been treated as stoichiometric phases. A series of thermodynamic parameters have been obtained. The calculated phase diagram and thermodynamic properties are in good agreement with the experimental data. The obtained thermodynamic data was used to extrapolate the ternary Sn-Co-Cu phase diagram. The composition of the Sn-rich eutectic point of the Sn-Co-Cu system was found to be 224°C, 0.4% Co, and 0.7% Cu.
Phase analysis of superconducting Nb-Sn materials by Moessbauer spectroscopy
International Nuclear Information System (INIS)
Sitek, J.; Tomasich, M.; Cirak, J.; Prejsa, M.; Kruzliak, J.
1978-01-01
Moessbauer spectroscopy is used for the optimalization of superconducting Nb-Sn samples preparation in the form of foils. Pure phases of Nb 3 Sn, Nb 6 Sn 5 , and NbSn 2 are determined. Two series of samples are studied at 750 and 900 0 C tinning temperature respectively, and at 750, 860, 900, and 960 0 C heating temperatures. In the samples the phases Nb 3 Sn, Nb 6 Sn 5 , NbSn 2 , and the solid solution Nb-Sn phase are observed. The results from the phase analysis lead to the assumption that the percentage amount of the phases is preferentially dependent on the tinning temperature. (author)
International Nuclear Information System (INIS)
Zhang, Chaowu
2007-07-01
Superconductors Nb 3 Sn wires are one of the most applicable cryogenic superconducting materials and the best choice for high-field magnets exceeding 10 T. One of the most significant utilization is the ITER project which is regarded as the hope of future energy source. The high-Cu composite designs with smaller number of sub-element and non-reactive diffusion barrier, and the RRP (Restacked Rod Process) internal-Sn technology are usually applied for the wire manufacturing. Such designed and processed wires were supplied by MSA/Alstom and WST/NIN in this research. The systematic investigation on internal-Sn superconducting wires includes the optimization of heat treatment (HT) conditions, phase formation and its relation with superconductivity, microstructure analysis, and the phase formation kinetics. Because of the anfractuosity of the configuration design and metallurgical processing, the MF wires are not sufficient for studying a sole factor effect on superconductivity. Therefore, four sets of mono-element (ME) wires with different Sn ratios and different third-element addition were designed and fabricated in order to explore the relationship between phase formation and superconducting performances, particularly the A15 layer growth kinetics. Different characterization technic have been used (magnetization measurements, neutron diffraction and SEM/TEM/EDX analysis). The A15 layer thicknesses of various ME samples were measured and carried out linear and non-linear fits by means of two model equations. The results have clearly demonstrated that the phase formation kinetics of Nb 3 Sn solid-state reaction is in accordance with an n power relation and the n value is increased with the increase of HT temperature and the Sn ratio in the wire composite. (author)
Directional Solidification and Liquidus Projection of the Sn-Co-Cu System
Chen, Sinn-Wen; Chang, Jui-Shen; Pan, Kevin; Hsu, Chia-Ming; Hsu, Che-Wei
2013-04-01
This study investigates the Sn-Co-Cu ternary system, which is of interest to the electronics industry. Ternary Sn-Co-Cu alloys were prepared, their as-solidified microstructures were examined, and their primary solidification phases were determined. The primary solidification phases observed were Cu, Co, Co3Sn2, CoSn, CoSn2, Cu6Sn5, Co3Sn2, γ, and β phases. Although there are ternary compounds reported in this ternary system, no ternary compound was found as the primary solidification phase. The directional solidification technique was applied when difficulties were encountered using the conventional quenching method to distinguish the primary solidification phases, such as Cu6Sn5, Cu3Sn, and γ phases. Of all the primary solidification phases, the Co3Sn2 and Co phases have the largest compositional regimes in which alloys display them as the primary solidification phases. There are four class II reactions and four class III reactions. The reactions with the highest and lowest reaction temperatures are both class III reactions, and are L + CoSn2 + Cu6Sn5 = CoSn3 at 621.5 K (348.3 °C) and L + Co3Sn2 + CoSn = Cu6Sn5 at 1157.8 K (884.6 °C), respectively.
2010-07-01
... 40 Protection of Environment 26 2010-07-01 2010-07-01 false Waste specific prohibitions-Soils... Prohibitions on Land Disposal § 268.32 Waste specific prohibitions—Soils exhibiting the toxicity characteristic... from land disposal: any volumes of soil exhibiting the toxicity characteristic solely because of the...
Carbon supported Pd-Sn and Pd-Ru-Sn nanocatalysts for ethanol electro-oxidation in alkaline medium
CSIR Research Space (South Africa)
Modibedi, RM
2011-04-01
Full Text Available Carbon supported Pd-Sn and Pd-Ru-Sn nanocatalysts were prepared by the chemical reduction method, using sodium borohydride and ethylene glycol mixture as the reducing agent. The catalytic activity towards ethanol electro-oxidation in alkaline medium...
International Nuclear Information System (INIS)
Rykaczewski, Krzysztof Piotr; Karny, M.; Batist, L.; Banu, A.; Becker, F.; Blazhev, A.; Burkard, K.; Bruchle, W.; Doring, J.; Faestermann, T.; Gorska, M.; Grawe, H.; Janas, Z.; Jungclaus, A.; Kavatsyuk, M.; Kavatsyuk, O.; Kirchner, R.; La Commara, M.; Mandal, S.; Mazzocchi, C.; Miernik, K.; Mukha, I.; Muralithar, S.; Plettner, C.; Plochocki, A.; Roeckl, E.; Romoli, M.; Schadel, M.; Schmidt, K.; Schwengner, R.; Zylicz, J.
2005-01-01
The β-decay of 102 Sn was studied by using high-resolution germanium detectors as well as a Total Absorption Spectrometer (TAS). A decay scheme has been constructed based on the γ-γ coincidence data. The total experimental Gamow-Teller strength B GT exp of 102 Sn was deduced from the TAS data to be 4.2(9). A search for β-delayed γ-rays of 100 Sn decay remained unsuccessful. However, a Gamow-Teller hindrance factor h = 2.2(3), and a cross-section of about 3nb for the production of 100 Sn in fusion-evaporation reaction between 58 Ni beam and 50 Cr target have been estimated from the data on heavier tin isotopes. The estimated hindrance factor is similar to the values derived for lower shell nuclei
DEFF Research Database (Denmark)
Yakimov, Alexander V.; G. Kolyagin, Yury; Tolborg, Søren
2016-01-01
and weak Lewis acidity, respectively. The adsorption of acetonitrile and methanol resulted in observation of pentacoordinated tin species, due to the formation of 1:1 adsorption complexes over both Sn-sites. Water adsorption led first to formation of pentacoordinated tin species, which were further...... by the formation of pentacoordinated Sn species in the case of weak sites and hexacoordinated Sn over sites with strong Lewis acidity, pointing to the possibility of dissociative adsorption of secondary alcohols over strong Sn-sites....
Highly Active, Carbon-supported, PdSn Nano-core, Partially ...
African Journals Online (AJOL)
Carbon-supported, Pt partially covered, PdSn alloy nanoparticles (Pt-PdSn/C) were synthesized via a metathetical reaction of PdSn alloy nanoparticles, and a platinum precursor. The electrochemical activity was evaluated by methanol oxidation. The Pt-PdSn/C catalysts were characterized by transmission electron ...
DO{sub 22}-(Cu,Ni){sub 3}Sn intermetallic compound nanolayer formed in Cu/Sn-nanolayer/Ni structures
Energy Technology Data Exchange (ETDEWEB)
Liu Lilin [School of Physics and Engineering, Sun Yat-Sen University, Guangzhou 510275 (China); Huang, Haiyou [Department of Mechanical Engineering, Hong Kong University of Science and Technology (HKUST) (Hong Kong); Hong Kong - Beijing Joint Research Center, HKUST Fok Ying Tung Graduate School, Nansha, Guangzhou (China); Fu Ran; Liu Deming [ASM Assembly Automation Ltd. (Hong Kong); Zhang Tongyi, E-mail: mezhangt@ust.h [Department of Mechanical Engineering, Hong Kong University of Science and Technology (HKUST) (Hong Kong); Hong Kong - Beijing Joint Research Center, HKUST Fok Ying Tung Graduate School, Nansha, Guangzhou (China)
2009-11-03
The present work conducts crystal characterization by High Resolution Transmission Electron Microscopy (HRTEM) on Cu/Sn-nanolayer/Ni sandwich structures associated with the use of Energy Dispersive X-ray (EDX) analysis. The results show that DO{sub 22}-(Cu,Ni){sub 3}Sn intermetallic compound (IMC) ordered structure is formed in the sandwich structures at the as-electrodeposited state. The formed DO{sub 22}-(Cu,Ni){sub 3}Sn IMC is a homogeneous layer with a thickness about 10 nm. The DO{sub 22}-(Cu,Ni){sub 3}Sn IMC nanolayer is stable during annealing at 250 deg. C for 810 min. The formation and stabilization of the metastable DO{sub 22}-(Cu,Ni){sub 3}Sn IMC nanolayer are attributed to the less strain energy induced by lattice mismatch between the DO{sub 22} IMC and fcc Cu crystals in comparison with that between the equilibrium DO{sub 3} IMC and fcc Cu crystals.
Energy Technology Data Exchange (ETDEWEB)
Sun, Wenming; Liu, Jing; Wang, Hong [China Building Materials Academy, Beijing (China); Zhang, Zhenwei [Linyi Academy of Technology Cooperation and Application, Linyi (China); Zhang, Liang [NeoTrident Technology Ltd., Shanghai (China); Bu, Yuxiang [Shandong University, Jinan (China)
2017-02-15
For guidance for developing Fe/Co-Sn-based anode materials for lithium-ion batteries, the mechanical, thermodynamic and electronic properties of FeSn{sub 5} and CoSn{sub 5} intermetallic phases under pressures ranging from 0 to 30 GPa have been investigated systematically using first-principles total-energy calculations within the framework of the generalized gradient approximation. The pressure was found to have significant effects on the mechanical, thermodynamic and electronic properties of these compounds. In the selected pressure range, CoSn{sub 5} has a more negative formation enthalpy than FeSn{sub 5}. Based on the calculated elastic constants, the bulk modulus, shear modulus, and Young's modulus were determined via the Viogt-Reuss-Hill averaging scheme. The variations of specific heats at constant volume for FeSn{sub 5} and CoSn{sub 5} in a wide pressure (0 - 30 GPa) and temperature (0 - 1000 K) range are also predicted from phonon density of states calculation. The calculated results suggested that both FeSn{sub 5} and CoSn{sub 5} are mechanically stable at pressure from 0 to 30 GPa. FeSn{sub 5} is dynamically stable at pressure up to, 30 GPa, at least, however, CoSn{sub 5} is dynamically stable no higher than 15 GPa.
Study of Sn100-xMnx amorphous system by 119Sn Moessbauer spectroscopy
International Nuclear Information System (INIS)
Drago, V.
1986-01-01
Thin films of Sn 100-x Mn x amorphous alloys with large range of concentrations were procedure by vapor condensation technique on substrates at temperatures near to liquid helium. The magnetic and paramagnetic hyperfine spectra, and the ordering temperatures were measured by 119 Sn Moessbauer effect. The electrical resistivity was used for characterizing the amorphous state. All the measurements were done 'in situ'. A magnetic phase diagram is proposed. (M.C.K.) [pt
Jang, Guh-Yaw; Duh, Jenq-Gong
2005-01-01
The eutectic Sn-Ag solder alloy is one of the candidates for the Pb-free solder, and Sn-Pb solder alloys are still widely used in today’s electronic packages. In this tudy, the interfacial reaction in the eutectic Sn-Ag and Sn-Pb solder joints was investigated with an assembly of a solder/Ni/Cu/Ti/Si3N4/Si multilayer structures. In the Sn-3.5Ag solder joints reflowed at 260°C, only the (Ni1-x,Cux)3Sn4 intermetallic compound (IMC) formed at the solder/Ni interface. For the Sn-37Pb solder reflowed at 225°C for one to ten cycles, only the (Ni1-x,Cux)3Sn4 IMC formed between the solder and the Ni/Cu under-bump metallization (UBM). Nevertheless, the (Cu1-y,Niy)6Sn5 IMC was observed in joints reflowed at 245°C after five cycles and at 265°C after three cycles. With the aid of microstructure evolution, quantitative analysis, and elemental distribution between the solder and Ni/Cu UBM, it was revealed that Cu content in the solder near the solder/IMC interface played an important role in the formation of the (Cu1-y,Niy)6Sn5 IMC. In addition, the diffusion behavior of Cu in eutectic Sn-Ag and Sn-Pb solders with the Ni/Cu UBM were probed and discussed. The atomic flux of Cu diffused through Ni was evaluated by detailed quantitative analysis in an electron probe microanalyzer (EPMA). During reflow, the atomic flux of Cu was on the order of 1016-1017 atoms/cm2sec in both the eutectic Sn-Ag and Sn-Pb systems.
Li, Yunyong; Zhang, Haiyan; Chen, Yiming; Shi, Zhicong; Cao, Xiaoguo; Guo, Zaiping; Shen, Pei Kang
2016-01-13
A peculiar nanostructure consisting of nitrogen-doped, carbon-encapsulated (N-C) SnO2@Sn nanoparticles grafted on three-dimensional (3D) graphene-like networks (designated as N-C@SnO2@Sn/3D-GNs) has been fabricated via a low-cost and scalable method, namely an in situ hydrolysis of Sn salts and immobilization of SnO2 nanoparticles on the surface of 3D-GNs, followed by an in situ polymerization of dopamine on the surface of the SnO2/3D-GNs, and finally a carbonization. In the composites, three-layer core-shell N-C@SnO2@Sn nanoparticles were uniformly grafted onto the surfaces of 3D-GNs, which promotes highly efficient insertion/extraction of Li(+). In addition, the outermost N-C layer with graphene-like structure of the N-C@SnO2@Sn nanoparticles can effectively buffer the large volume changes, enhance electronic conductivity, and prevent SnO2/Sn aggregation and pulverization during discharge/charge. The middle SnO2 layer can be changed into active Sn and nano-Li2O during discharge, as described by SnO2 + Li(+) → Sn + Li2O, whereas the thus-formed nano-Li2O can provide a facile environment for the alloying process and facilitate good cycling behavior, so as to further improve the cycling performance of the composite. The inner Sn layer with large theoretical capacity can guarantee high lithium storage in the composite. The 3D-GNs, with high electrical conductivity (1.50 × 10(3) S m(-1)), large surface area (1143 m(2) g(-1)), and high mechanical flexibility, tightly pin the core-shell structure of the N-C@SnO2@Sn nanoparticles and thus lead to remarkably enhanced electrical conductivity and structural integrity of the overall electrode. Consequently, this novel hybrid anode exhibits highly stable capacity of up to 901 mAh g(-1), with ∼89.3% capacity retention after 200 cycles at 0.1 A g(-1) and superior high rate performance, as well as a long lifetime of 500 cycles with 84.0% retention at 1.0 A g(-1). Importantly, this unique hybrid design is expected to be
Beyhan, Seden; Léger, Jean-Michel; Kadırgan, Figen
2013-11-01
The adsorption and oxidation of acetaldehyde on carbon supported Pt, Pt90Sn10 and Pt80Sn10M10 (M = Ni, Co, Rh, Pd) catalysts have been investigated by using in situ Fourier transform infrared (FTIR) spectroscopy. The result revealed that Pt90Sn10/C catalyst is not very efficient for the conversion of acetaldehyde to CO2 due to the weak adsorption of acetaldehyde in the presence of Sn. However, the addition of a third metal to Pt--Sn facilitates the C-C bond cleavage of acetaldehyde. It seems that acetaldehyde is adsorbed dissociatively on the surface of Pt80Sn10Ni10/C, Pt80Sn10Co10/C, Pt80Sn10Rh10/C catalysts, producing CH3 and CHO adsorbate species, which can be further oxidized to CO2. However, the pathway forming CO2 for Pt80Sn10Pd10/C catalyst mainly originates from the oxidation of CH3CO species. Thus, the presence of third metal in the PtSn catalyst has a strong impact upon the acetaldehyde adsorption behaviour and its reaction products.
Tin (Sn) for enhancing performance in silicon CMOS
Hussain, Aftab M.; Fahad, Hossain M.; Singh, Nirpendra; Sevilla, Galo T.; Schwingenschlö gl, Udo; Hussain, Muhammad Mustafa
2013-01-01
We study a group IV element: tin (Sn) by integrating it into silicon lattice, to enhance the performance of silicon CMOS. We have evaluated the electrical properties of the SiSn lattice by performing simulations using First-principle studies, followed by experimental device fabrication and characterization. We fabricated high-κ/metal gate based Metal-Oxide-Semiconductor capacitors (MOSCAPs) using SiSn as channel material to study the impact of Sn integration into silicon. © 2013 IEEE.
Tin (Sn) for enhancing performance in silicon CMOS
Hussain, Aftab M.
2013-10-01
We study a group IV element: tin (Sn) by integrating it into silicon lattice, to enhance the performance of silicon CMOS. We have evaluated the electrical properties of the SiSn lattice by performing simulations using First-principle studies, followed by experimental device fabrication and characterization. We fabricated high-κ/metal gate based Metal-Oxide-Semiconductor capacitors (MOSCAPs) using SiSn as channel material to study the impact of Sn integration into silicon. © 2013 IEEE.
Phase formation in Mg-Sn-Si and Mg-Sn-Si-Ca alloys
Energy Technology Data Exchange (ETDEWEB)
Kozlov, A.; Groebner, J. [Institute of Metallurgy, Clausthal University of Technology, Robert-Koch-Str. 42, D-38678 Clausthal-Zellerfeld (Germany); Schmid-Fetzer, R., E-mail: schmid-fetzer@tu-clausthal.de [Institute of Metallurgy, Clausthal University of Technology, Robert-Koch-Str. 42, D-38678 Clausthal-Zellerfeld (Germany)
2011-02-17
Research highlights: > The solidification paths of ternary and quaternary alloys are analyzed in detail, using the tool of thermodynamic calculations. > The precipitation sequence of phases and their amounts compare well with the microstructure of alloys. > The most efficient comparison to the experimental thermal analysis data is done by calculation of the enthalpy variation with temperature. > The viability of a procedure for the selection of multicomponent key samples is demonstrated for the development of the Mg-Ca-Si-Sn phase diagram. - Abstract: Experimental work is done and combined with the Calphad method to generate a consistent thermodynamic description of the Mg-Ca-Si-Sn quaternary system, validated for Mg-rich alloys. The viability of a procedure for the selection of multicomponent key samples is demonstrated for this multicomponent system. Dedicated thermal analysis with DTA/DSC on sealed samples is performed and the microstructure of slowly solidified alloys is analyzed using SEM/EDX. The thermodynamic description and phase diagram of the ternary Mg-Si-Sn system, developed in detail also in this work, deviates significantly from a previous literature proposal. The phase formation in ternary and quaternary alloys is analyzed using the tool of thermodynamic equilibrium and Scheil calculations for the solidification paths and compared with present experimental data. The significant ternary/quaternary solid solubilities of pertinent intermetallic phases are quantitatively introduced in the quaternary Mg-Ca-Si-Sn phase diagram and validated by experimental data.
Semiconducting ZnSnN{sub 2} thin films for Si/ZnSnN{sub 2} p-n junctions
Energy Technology Data Exchange (ETDEWEB)
Qin, Ruifeng [Hebei Engineering Laboratory of Photoelectronic Functional Crystals, Hebei University of Technology (HEBUT), Tianjin 300401 (China); Ningbo Institute of Material Technology and Engineering, Chinese Academy of Sciences, and Key Laboratory of Additive Manufacturing Materials of Zhejiang Province, Ningbo 315201 (China); Cao, Hongtao; Liang, Lingyan, E-mail: lly@nimte.ac.cn, E-mail: swz@hebut.edu.cn; Xie, Yufang; Zhuge, Fei; Zhang, Hongliang; Gao, Junhua; Javaid, Kashif [Ningbo Institute of Material Technology and Engineering, Chinese Academy of Sciences, and Key Laboratory of Additive Manufacturing Materials of Zhejiang Province, Ningbo 315201 (China); Liu, Caichi; Sun, Weizhong, E-mail: lly@nimte.ac.cn, E-mail: swz@hebut.edu.cn [Hebei Engineering Laboratory of Photoelectronic Functional Crystals, Hebei University of Technology (HEBUT), Tianjin 300401 (China)
2016-04-04
ZnSnN{sub 2} is regarded as a promising photovoltaic absorber candidate due to earth-abundance, non-toxicity, and high absorption coefficient. However, it is still a great challenge to synthesize ZnSnN{sub 2} films with a low electron concentration, in order to promote the applications of ZnSnN{sub 2} as the core active layer in optoelectronic devices. In this work, polycrystalline and high resistance ZnSnN{sub 2} films were fabricated by magnetron sputtering technique, then semiconducting films were achieved after post-annealing, and finally Si/ZnSnN{sub 2} p-n junctions were constructed. The electron concentration and Hall mobility were enhanced from 2.77 × 10{sup 17} to 6.78 × 10{sup 17 }cm{sup −3} and from 0.37 to 2.07 cm{sup 2} V{sup −1} s{sup −1}, corresponding to the annealing temperature from 200 to 350 °C. After annealing at 300 °C, the p-n junction exhibited the optimum rectifying characteristics, with a forward-to-reverse ratio over 10{sup 3}. The achievement of this ZnSnN{sub 2}-based p-n junction makes an opening step forward to realize the practical application of the ZnSnN{sub 2} material. In addition, the nonideal behaviors of the p-n junctions under both positive and negative voltages are discussed, in hope of suggesting some ideas to further improve the rectifying characteristics.
Structural properties and hyperfine characterization of Sn-substituted goethites
Energy Technology Data Exchange (ETDEWEB)
Larralde, A.L. [INQUIMAE, Departamento de Quimica Inorganica, Analitica y Quimica Fisica, Facultad de Ciencias Exactas y Naturales, Universidad de Buenos Aires (Argentina); Ramos, C.P. [Departamento de Fisica de la Materia Condensada, GIyA - CAC - CNEA, Av. Gral. Paz 1499 (1650), San Martin, Bs. As. (Argentina); Arcondo, B. [Departamento de Fisica, Facultad de Ingenieria, Universidad de Buenos Aires, Av. Paseo Colon 850 (C1063ACV), Bs. As. (Argentina); Tufo, A.E. [INQUIMAE, Departamento de Quimica Inorganica, Analitica y Quimica Fisica, Facultad de Ciencias Exactas y Naturales, Universidad de Buenos Aires (Argentina); Saragovi, C. [Departamento de Fisica de la Materia Condensada, GIyA - CAC - CNEA, Av. Gral. Paz 1499 (1650), San Martin, Bs. As. (Argentina); Sileo, E.E., E-mail: sileo@qi.fcen.uba.ar [INQUIMAE, Departamento de Quimica Inorganica, Analitica y Quimica Fisica, Facultad de Ciencias Exactas y Naturales, Universidad de Buenos Aires (Argentina)
2012-04-16
Highlights: Black-Right-Pointing-Pointer Pure and tin-doped goethites were synthesized from Sn(II) solutions at ambient pressure and 70 Degree-Sign C. Black-Right-Pointing-Pointer The Rietveld refinement of PXRD data indicated that Sn partially substituted the Fe(III) ions. Black-Right-Pointing-Pointer The substitution provoked unit cell expansion, and a distortion of the coordination polyhedron. Black-Right-Pointing-Pointer {sup 119}Sn Moessbauer spectroscopy revealed that Sn(II) is incorporated as Sn(IV). Black-Right-Pointing-Pointer {sup 57}Fe Moessbauer spectroscopy showed a lower magnetic coupling as tin concentration increased. - Abstract: Tin-doped goethites obtained by a simple method at ambient pressure and 70 Degree-Sign C were characterized by inductively coupled plasma atomic emission spectrometry, scanning electron microscopy, Rietveld refinement of powder X-ray diffraction data, and {sup 57}Fe and {sup 119}Sn Moessbauer spectroscopy. The particles size and the length to width ratios decreased with tin-doping. Sn partially substituted the Fe(III) ions provoking unit cell expansion and increasing the crystallinity of the particles with enlarged domains that grow in the perpendicular and parallel directions to the anisotropic broadening (1 1 1) axis. Intermetallic E, E Prime and DC distances also change although the variations are not monotonous, indicating different variations in the coordination polyhedron. In general, the Sn-substituted samples present larger intermetallic distances than pure goethite, and the greatest change is shown in the E Prime distance which coincides with the c-parameter. {sup 119}Sn Moessbauer spectroscopy revealed that Sn(II) is incorporated as Sn(IV) in the samples. On the other hand, Fe(II) presence was not detected by {sup 57}Fe Moessbauer spectroscopy, suggesting the existence of vacancies in the Sn-doped samples. A lower magnetic coupling is also evidenced from the average magnetic hyperfine field values obtained as tin
SiSn diodes: Theoretical analysis and experimental verification
Hussain, Aftab M.; Wehbe, Nimer; Hussain, Muhammad Mustafa
2015-01-01
We report a theoretical analysis and experimental verification of change in band gap of silicon lattice due to the incorporation of tin (Sn). We formed SiSn ultra-thin film on the top surface of a 4 in. silicon wafer using thermal diffusion of Sn
Single-Particle States in $^{133}$Sn
Huck, A
2002-01-01
% IS338 \\\\ \\\\ It is suggested to investigate the $\\beta^- $-decay of $^{133}$In and $^{134}$In in order to determine the single-particle states in $^{133}$Sn, which are so far unknown and needed for the shell-model description of the region close to $^{132}$Sn. Large hyper-pure Ge-detectors will be used for the $\\gamma$-ray spectroscopy. In the experiments with $^{134}$In, delayed neutrons in coincidence with $\\gamma$-rays from excited states in $^{133}$Sn provide the opportunity for a very selective detection of the states in question.
The tin-rich copper lithium stannides: Li{sub 3}Cu{sub 6}Sn{sub 4} and Li{sub 2}CuSn{sub 2}
Energy Technology Data Exchange (ETDEWEB)
Fuertauer, Siegfried; Flandorfer, Hans [Vienna Univ. (Austria). Inst. of Inorganic Chemistry (Materials Chemisrty); Effenberger, Herta S. [Vienna Univ. (Austria). Inst. of Mineralogy and Crystallography
2015-05-01
The Sn rich ternary intermetallic compounds Li{sub 3}Cu{sub 6}Sn{sub 4} (CSD-427097) and Li{sub 2}CuSn{sub 2} (CSD-427098) were synthesized from the pure elements by induction melting and annealing at 400 C. Structural investigations were performed by powder- and single-crystal XRD. Li{sub 3}Cu{sub 6}Sn{sub 4} crystallizes in space group P6/mmm; it is structurally related to but not isotypic with MgFe{sub 6}Ge{sub 6} (a = 5.095(2) Aa, c = 9.524(3) Aa; wR{sub 2} = 0.059; 239 unique F{sup 2}-values, 17 free variables). Li{sub 3}Cu{sub 6}Sn{sub 4} is characterized by two sites with a mixed Cu:Sn occupation. In contrast to all other Cu-Li-Sn compounds known so far, any mixed occupation was found for Cu-Li pairs only. In addition, one Li site is only half occupied. The second Sn rich phase is Li{sub 2}CuSn{sub 2} (space group I4{sub 1}/amd, a = 4.4281(15) Aa, c = 19.416(4) Aa; wR{sub 2} = 0.033; 213 unique F{sup 2}-values, 12 atom free variables); it is the only phase in the Cu-Li-Sn system which is noted for full ordering. Both crystal structures exhibit 3D-networks which host Li atoms in channels. They are important for understanding the lithiation mechanism in Cu-Sn electrodes for Li-ion batteries.
Origin of low thermal conductivity in SnSe
Xiao, Yu; Chang, Cheng; Pei, Yanling; Wu, Di; Peng, Kunling; Zhou, Xiaoyuan; Gong, Shengkai; He, Jiaqing; Zhang, Yongsheng; Zeng, Zhi; Zhao, Li-Dong
2016-09-01
We provide direct evidence to understand the origin of low thermal conductivity of SnSe using elastic measurements. Compared to state-of-the-art lead chalcogenides Pb Q (Q =Te , Se, S), SnSe exhibits low values of sound velocity (˜1420 m /s ) , Young's modulus (E ˜27.7 GPa ) , and shear modulus (G ˜9.6 GPa ) , which are ascribed to the extremely weak Sn-Se atomic interactions (or bonds between layers); meanwhile, the deduced average Grüneisen parameter γ of SnSe is as large as ˜3.13, originating from the strong anharmonicity of the bonding arrangement. The calculated phonon mean free path (l ˜ 0.84 nm) at 300 K is comparable to the lattice parameters of SnSe, indicating little room is left for further reduction of the thermal conductivity through introducing nanoscale microstructures and microscale grain boundaries. The low elastic properties indicate that the weak chemical bonding stiffness of SnSe generally causes phonon modes softening which eventually slows down phonon propagation. This work provides insightful data to understand the low lattice thermal conductivity of SnSe.
Energy Technology Data Exchange (ETDEWEB)
Kawaguchi, S; Iio, M; Yamada, H; Murata, H; Chiba, K [Tokyo Metropolitan Geriatric Medical Center (Japan)
1978-12-01
The purpose of this study is to evaluate the hepatobiliary scanning using sup(99m)Tc-(Sn)-PI in clinical diagnosis of various hepatobiliary disorders. Nineteen patients were scanned with sup(99m)Tc-(Sn)-PI. The results were as follows: 1) The stability of sup(99m)Tc-(Sn)-PI examined by paper chromatography using saline as a solvent showed satisfied result at scanning time. sup(99m)Tc-(Sn)-PI in the blood was assumed to be bound to serum proteins immediately after injection. sup(99m)Tc-(Sn)-PI in the urine was assumed to keep the form of sup(99m)Tc-(Sn)-PI. 2) The appearance times of kidney, liver, bile duct, gallbladder, and intestine in the normal case were 5, 5, 10 and 15 minutes respectively after injection. The peak times of hepatogram in the normal case, drug induced hepatitis and obstructive jaundice were 12, 15 and 18 minutes respectively after injection. The images obtained by sup(99m)Tc-(Sn)-PI was superior to the images obtained by /sup 131/I-BSP. 3) The blood clearance and urinary excretion rate of sup(99m)Tc-(Sn)-PI also provided us clinical usefulness. 4) The scanning of Dubin-Johnson syndrome of sup(99m)Tc-(Sn)-PI showed almost normal hepatobiliary image similar to the sequential scan by /sup 131/I-RB as was reported previously by authors. In conclusion, the hepatobiliary scan using sup(99m)Tc-(Sn)-PI provided clear hepatobiliary images. Other parameters such as blood clearance, urinary excretion rate and diameter of choledochus were also favorable. By combining it with sup(99m)Tc-HIDA a differential diagnosis of congenital jaundice is also expected.
International Nuclear Information System (INIS)
Kawaguchi, Schinichiro; Iio, Masahiro; Yamada, Hideo; Murata, Hajime; Chiba, Kazuo
1978-01-01
The purpose of this study is to evaluate the hepatobiliary scanning using sup(99m)Tc-(Sn)-PI in clinical diagnosis of various hepatobiliary disorders. Nineteen patients were scanned with sup(99m)Tc-(Sn)-PI. The results were as follows: 1) The stability of sup(99m)Tc-(Sn)-PI examined by paper chromatography using saline as a solvent showed satisfied result at scanning time. sup(99m)Tc-(Sn)-PI in the blood was assumed to be bound to serum proteins immediately after injection. sup(99m)Tc-(Sn)-PI in the urine was assumed to keep the form of sup(99m)Tc-(Sn)-PI. 2) The appearance times of kidney, liver, bile duct, gallbladder, and intestine in the normal case were 5, 5, 10 and 15 minutes respectively after injection. The peak times of hepatogram in the normal case, drug induced hepatitis and obstructive jaundice were 12, 15 and 18 minutes respectively after injection. The images obtained by sup(99m)Tc-(Sn)-PI was superior to the images obtained by 131 I-BSP. 3) The blood clearance and urinary excretion rate of sup(99m)Tc-(Sn)-PI also provided us clinical usefulness. 4) The scanning of Dubin-Johnson syndrome of sup(99m)Tc-(Sn)-PI showed almost normal hepatobiliary image similar to the sequential scan by 131 I-RB as was reported previously by authors. In conclusion, the hepatobiliary scan using sup(99m)Tc-(Sn)-PI provided clear hepatobiliary images. Other parameters such as blood clearance, urinary excretion rate and diameter of choledochus were also favorable. By combining it with sup(99m)Tc-HIDA a differential diagnosis of congenital jaundice is also expected. (author)
LED Die-Bonded on the Ag/Cu Substrate by a Sn-BiZn-Sn Bonding System
Tang, Y. K.; Hsu, Y. C.; Lin, E. J.; Hu, Y. J.; Liu, C. Y.
2016-12-01
In this study, light emitting diode (LED) chips were die-bonded on a Ag/Cu substrate by a Sn-BixZn-Sn bonding system. A high die-bonding strength is successfully achieved by using a Sn-BixZn-Sn ternary system. At the bonding interface, there is observed a Bi-segregation phenomenon. This Bi-segregation phenomenon solves the problems of the brittle layer-type Bi at the joint interface. Our shear test results show that the bonding interface with Bi-segregation enhances the shear strength of the LED die-bonding joints. The Bi-0.3Zn and Bi-0.5Zn die-bonding cases have the best shear strength among all die-bonding systems. In addition, we investigate the atomic depth profile of the deposited Bi-xZn layer by evaporating Bi-xZn E-gun alloy sources. The initial Zn content of the deposited Bi-Zn alloy layers are much higher than the average Zn content in the deposited Bi-Zn layers.
{sup 119}Sn NMR investigations on superconducting Ca{sub 3}Ir{sub 4}Sn{sub 13}
Energy Technology Data Exchange (ETDEWEB)
Sarkar, Rajib; Brueckner, Felix; Guenther, Marco; Klauss, Hans-Henning [IFP, TU Dresden (Germany); Petrovic, Cedomir; Wang, Kefeng [CMPMS, BNL, Upton, NY (United States); Luetkens, Hubertus; Biswas, Pabitra; Morenzoni, Elvezio; Amato, Alex [PSI, Villigen (Switzerland)
2014-07-01
Ca{sub 3}Ir{sub 4}Sn{sub 13} was found to exhibit superconducting transition with T{sub c} ∼ 7 K. It received considerable attention due to the possible coexistence of superconductivity and ferromagnetic spin fluctuation as well as the three-dimensional charge density wave (CDW) from the superlattice transition. While thermal, transport, and thermodynamic characterization of Ca{sub 3}Ir{sub 4}Sn{sub 13} single crystals suggest that it is a weakly correlated nodeless superconductor, recent μSR investigation reveals that the electron-phonon pairing interaction is in the strong-coupling limit. Here we present {sup 119}Sn NMR investigations on Ca{sub 3}Ir{sub 4}Sn{sub 13} polycrystalline samples and discuss the symmetry of the superconducting order parameter together with the normal state properties. Our preliminary results of spin-lattice relaxation rate (1/T{sub 1}) indicate that this is a BCS superconductor with weak-coupling limit.
Voids, nanochannels and formation of nanotubes with mobile Sn fillings in Sn doped ZnO nanorods
International Nuclear Information System (INIS)
Ortega, Y; Dieker, Ch; Jaeger, W; Piqueras, J; Fernandez, P
2010-01-01
ZnO nanorods containing different hollow structures have been grown by a thermal evaporation-deposition method with a mixture of ZnS and SnO 2 powders as precursor. Transmission electron microscopy shows rods with rows of voids as well as rods with empty channels along the growth axis. The presence of Sn nanoprecipitates associated with the empty regions indicates, in addition, that these are generated by diffusion processes during growth, probably due to an inhomogeneous distribution of Sn. The mechanism of forming voids and precipitates appears to be based on diffusion processes similar to the Kirkendall effect, which can lead to void formation at interfaces of bulk materials or in core-shell nanostructures. In some cases the nanorods are ZnO tubes partially filled with Sn that has been found to melt and expand by heating the nanotubes under the microscope electron beam. Such metal-semiconductor nanostructures have potential applications as thermal nanosensors or as electrical nanocomponents.
Effects of annealing on evaporated SnS thin films
International Nuclear Information System (INIS)
Samsudi Sakrani; Bakar Ismail
1994-01-01
The effects of annealing of evaporated tin sulphide thin films (SnS) are described. The films were initially deposited onto glass substrate, followed by annealing in an encapsulated carbon block under the running argon gas at 310 degree Celsius. Short time annealing of the films results in a slight change of the compositions to a mix SnS/SnS sub 2 compound, and the tendency of increasing SnS sub 2 formation was observed on the films annealed for longer periods up to 20 hours. X-ray results showed the transformation of SnS peaks (040) and (080) to predominantly SnS sub 2 peaks - (001), (100), (101), and (110). The associated absorption coefficients measured on the films were found to be greater than 10 sup 5 cm sup -1, with indication of higher photon energy leading to the formation of SnS sub 2 compound
Effects of annealing on evaporated SnS thin films
Energy Technology Data Exchange (ETDEWEB)
Sakrani, Samsudi; Ismail, Bakar [Universiti Teknologi Malaysia, Skudai, Johor Bahru (Malaysia). Dept. of Physics
1994-12-31
The effects of annealing of evaporated tin sulphide thin films (SnS) are described. The films were initially deposited onto glass substrate, followed by annealing in an encapsulated carbon block under the running argon gas at 310 degree Celsius. Short time annealing of the films results in a slight change of the compositions to a mix SnS/SnS sub 2 compound, and the tendency of increasing SnS sub 2 formation was observed on the films annealed for longer periods up to 20 hours. X-ray results showed the transformation of SnS peaks (040) and (080) to predominantly SnS sub 2 peaks - (001), (100), (101), and (110). The associated absorption coefficients measured on the films were found to be greater than 10 sup 5 cm sup -1, with indication of higher photon energy leading to the formation of SnS sub 2 compound.
Energy Technology Data Exchange (ETDEWEB)
Yohannan, Jinu P.; Vidyasagar, Kanamaluru, E-mail: kvsagar@iitm.ac.in
2016-06-15
Ten AInM′S{sub 4} (A=alkali metals, Tl; M′= Ge, Sn) compounds with diverse structure types have been synthesized and characterized by single crystal and powder X-ray diffraction and a variety of spectroscopic methods. They are wide band gap semiconductors. KInGeS{sub 4}(1-β), RbInGeS{sub 4}(2), CsInGeS{sub 4}(3-β), TlInGeS{sub 4}(4-β), RbInSnS{sub 4}(8-β) and CsInSnS{sub 4}(9) compounds with three-dimensional BaGa{sub 2}S{sub 4} structure and CsInGeS{sub 4}(3-α) and TlInGeS{sub 4}(4-α) compounds with a layered TlInSiS{sub 4} structure have tetrahedral [InM′S{sub 4}]{sup −} frameworks. On the other hand, LiInSnS{sub 4}(5) with spinel structure and NaInSnS{sub 4}(6), KInSnS{sub 4}(7), RbInSnS{sub 4}(8-α) and TlInSnS{sub 4}(10) compounds with layered structure have octahedral [InM′S{sub 4}]{sup −} frameworks. NaInSnS{sub 4}(6) and KInSnS{sub 4}(7) compounds undergo facile topotactic ion-exchange, at room temperature, with various mono-, di- and tri-valent cations in aqueous medium to give rise to metastable layered phases. - Graphical abstract: NaInSnS{sub 4} and KInSnS{sub 4} compounds undergo, in aqueous medium at room temperature, facile topotactic ion-exchange with mono, di and trivalent cations. Display Omitted - Highlights: • Ten AInM′S{sub 4} compounds with diverse structure types were synthesized. • They are wide band gap semiconductors. • NaInSnS{sub 4} and KInSnS{sub 4} compounds undergo facile topotactic ion-exchange at room temperature.
Insight into the Effect of Sn on CO and Formic Acid Oxidation at PtSn Catalysts
DEFF Research Database (Denmark)
Stevanović, S.; Tripković, D.; Tripkovic, Vladimir
2014-01-01
The role of Sn on the catalytic activity for CO and formic acid oxidation is studied by comparing the activities of differently treated PtSn/C and Pt/C catalysts. The catalysts are prepared by a microwave-assisted polyol synthesis method. As revealed by scanning tunneling and transmission electron...
Structural, magnetic and transport properties of Mn3.1Sn0.9 and Mn3.1Sn0.9N compounds
International Nuclear Information System (INIS)
Feng, W.J.; Li, D.; Ren, W.J.; Li, Y.B.; Li, W.F.; Li, J.; Zhang, Y.Q.; Zhang, Z.D.
2007-01-01
The cubic anti-perovskite Mn 3.1 Sn 0.9 N compound is prepared via nitrogenation of the hexagonal Mn 3.1 Sn 0.9 compound. A magnetic phase diagram of Mn 3.1 Sn 0.9 compound is constructed by analysis of data of its magnetic properties. For Mn 3.1 Sn 0.9 N compound, parasitic ferromagnetism exists in the temperature range of 5-370 K, besides a spin-reorientation at about 280 K. Mn 3.1 Sn 0.9 compound exhibits a metallic conducting behavior, while Mn 3.1 Sn 0.9 N displays a metal-nonmetal transition due to the electron localization caused by the static disorder. The differences of the physical properties between the both compounds, are discussed, in terms of the correlation of the hexagonal DO 19 and the cubic anti-perovskite structures, the reduction of the distances between Mn atoms, and the spin-pairing or charge transfer effect due to the electron donation by N 2p to Mn 3d states after introduction of N atoms into the interstitial sites of Mn 3.1 Sn 0.9 compound
Studying superconducting Nb3Sn wire
AUTHOR|(CDS)2099575
2015-01-01
Studying superconducting Nb3Sn wire. From the current experience from LHC and HL-LHC we know that the performance requirements for Nb3Sn conductor for future circular collider are challenging and should exceed that of present state-of-the-art materials.
Studying superconducting Nb$_{3}$Sn wire
AUTHOR|(CDS)2099575
2015-01-01
Studying superconducting Nb$_{3}$Sn wire. From the current experience from LHC and HL-LHC we know that the performance requirements for Nb$_{3}$Sn conductor for future circular collider are challenging and should exceed that of present state-of-the-art materials.
Energy Technology Data Exchange (ETDEWEB)
Zhang, Chaowu
2007-07-15
Superconductors Nb{sub 3}Sn wires are one of the most applicable cryogenic superconducting materials and the best choice for high-field magnets exceeding 10 T. One of the most significant utilization is the ITER project which is regarded as the hope of future energy source. The high-Cu composite designs with smaller number of sub-element and non-reactive diffusion barrier, and the RRP (Restacked Rod Process) internal-Sn technology are usually applied for the wire manufacturing. Such designed and processed wires were supplied by MSA/Alstom and WST/NIN in this research. The systematic investigation on internal-Sn superconducting wires includes the optimization of heat treatment (HT) conditions, phase formation and its relation with superconductivity, microstructure analysis, and the phase formation kinetics. Because of the anfractuosity of the configuration design and metallurgical processing, the MF wires are not sufficient for studying a sole factor effect on superconductivity. Therefore, four sets of mono-element (ME) wires with different Sn ratios and different third-element addition were designed and fabricated in order to explore the relationship between phase formation and superconducting performances, particularly the A15 layer growth kinetics. Different characterization technic have been used (magnetization measurements, neutron diffraction and SEM/TEM/EDX analysis). The A15 layer thicknesses of various ME samples were measured and carried out linear and non-linear fits by means of two model equations. The results have clearly demonstrated that the phase formation kinetics of Nb{sub 3}Sn solid-state reaction is in accordance with an n power relation and the n value is increased with the increase of HT temperature and the Sn ratio in the wire composite. (author)
GeSn-on-insulator substrate formed by direct wafer bonding
Energy Technology Data Exchange (ETDEWEB)
Lei, Dian; Wang, Wei; Gong, Xiao, E-mail: elegong@nus.edu.sg, E-mail: yeo@ieee.org; Yeo, Yee-Chia, E-mail: elegong@nus.edu.sg, E-mail: yeo@ieee.org [Department of Electrical and Computer Engineering, National University of Singapore, Singapore 117576 (Singapore); Lee, Kwang Hong; Wang, Bing [Low Energy Electronic Systems (LEES), Singapore MIT Alliance for Research and Technology (SMART), 1 CREATE Way, #10-01 CREATE Tower, Singapore 138602 (Singapore); Bao, Shuyu [Low Energy Electronic Systems (LEES), Singapore MIT Alliance for Research and Technology (SMART), 1 CREATE Way, #10-01 CREATE Tower, Singapore 138602 (Singapore); School of Electrical and Electronic Engineering, Nanyang Technological University, 50 Nanyang Avenue, Singapore 639798 (Singapore); Tan, Chuan Seng [School of Electrical and Electronic Engineering, Nanyang Technological University, 50 Nanyang Avenue, Singapore 639798 (Singapore)
2016-07-11
GeSn-on-insulator (GeSnOI) on Silicon (Si) substrate was realized using direct wafer bonding technique. This process involves the growth of Ge{sub 1-x}Sn{sub x} layer on a first Si (001) substrate (donor wafer) followed by the deposition of SiO{sub 2} on Ge{sub 1-x}Sn{sub x}, the bonding of the donor wafer to a second Si (001) substrate (handle wafer), and removal of the Si donor wafer. The GeSnOI material quality is investigated using high-resolution transmission electron microscopy, high-resolution X-ray diffraction (HRXRD), atomic-force microscopy, Raman spectroscopy, and spectroscopic ellipsometry. The Ge{sub 1-x}Sn{sub x} layer on GeSnOI substrate has a surface roughness of 1.90 nm, which is higher than that of the original Ge{sub 1-x}Sn{sub x} epilayer before transfer (surface roughness is 0.528 nm). The compressive strain of the Ge{sub 1-x}Sn{sub x} film in the GeSnOI is as low as 0.10% as confirmed using HRXRD and Raman spectroscopy.
Phase composition of rapidly solidified Ag-Sn-Cu dental alloys
International Nuclear Information System (INIS)
Lecong Dzuong; Do Minh Nghiep; Nguyen van Dzan; Cao the Ha
1996-01-01
The phase composition of some rapidly solidified Ag-Sn-Cu dental alloys with different copper contents (6.22 wtpct) has been studied by XRD, EMPA and optical microscopy. The samples were prepared from melt-spun ribbons. The microstructure of the as-quenched ribbons was microcrystalline and consisted of the Ag sub 3 Sn, Ag sub 4 Sn, Cu sub 3 Sn and Cu sub 3 Sn sub 8 phases. Mixing with mercury (amalgamation) led to formation of the Ag sub 2 Hg sub 3, Sn sub 7 Hg and Cu sub 6 Sn sub 5 phases. The amount of copper atoms in the alloys played an important role in phase formation in the amalgams
Phase Equilibria of the Sn-Ni-Si Ternary System and Interfacial Reactions in Sn-(Cu)/Ni-Si Couples
Fang, Gu; Chen, Chih-chi
2015-07-01
Interfacial reactions in Sn/Ni-4.5 wt.%Si and Sn-Cu/Ni-4.5 wt.%Si couples at 250°C, and Sn-Ni-Si ternary phase equilibria at 250°C were investigated in this study. Ni-Si alloys, which are nonmagnetic, can be regarded as a diffusion barrier layer material in flip chip packaging. Solder/Ni-4.5 wt.%Si interfacial reactions are crucial to the reliability of soldered joints. Phase equilibria information is essential for development of solder/Ni-Si materials. No ternary compound is present in the Sn-Ni-Si ternary system at 250°C. Extended solubility of Si in the phases Ni3Sn2 and Ni3Sn is 3.8 and 6.1 at.%, respectively. As more Si dissolves in these phases their lattice constants decrease. No noticeable ternary solubility is observed for the other intermetallics. Interfacial reactions in solder/Ni-4.5 wt.%Si are similar to those for solder/Ni. Si does not alter the reaction phases. No Si solubility in the reaction phases was detected, although rates of growth of the reaction phases were reduced. Because the alloy Ni-4.5 wt.%Si reacts more slowly with solders than pure Ni, the Ni-4.5 wt.%Si alloy could be a potential new diffusion barrier layer material for flip chip packaging.
Yu, Ming'e.; Li, Caiting; Zeng, Guangming; Zhou, Yang; Zhang, Xunan; Xie, Yin'e.
2015-07-01
A series of novel catalysts (CexSny) for the selective catalytic reduction of NO by NH3 were prepared by the inverse co-precipitation method. The aim of this novel design was to improve the NO removal efficiency of CeTi by the introduction of SnO2. It was found that the Ce-Sn-Ti catalyst was much more active than Ce-Ti and the best Ce:Sn molar ratio was 2:1. Ce2Sn1 possessed a satisfied NO removal efficiency at low temperature (160-280 °C), while over 90% NO removal efficiency maintained in the temperature range of 280-400 °C at the gas hourly space velocity (GHSV) of 50,000 h-1. Besides, Ce2Sn1 kept a stable NO removal efficiency within a wide range of GHSV and a long period of reacting time. Meanwhile, Ce2Sn1 exhibited remarkable resistance to both respectively and simultaneously H2O and SO2 poisoning due to the introduction of SnO2. The promotional effect of SnO2 was studied by N2 adsorption-desorption, X-ray diffraction (XRD), Raman spectra, X-ray photoelectron spectroscopy (XPS) and H2 temperature programmed reduction (H2-TPR) for detail information. The characterization results revealed that the excellent catalytic performance of Ce2Sn1 was associated with the higher specific surface area, larger pore volume and poorer crystallization. Besides, the introduction of SnO2 could result in not only greater conversion of Ce4+ to Ce3+ but also the increase amount of chemisorbed oxygen, which are beneficial to improve the SCR activity. More importantly, a novel peak appearing at lower temperatures through the new redox equilibrium of 2Ce4+ + Sn2+ ↔ 2Ce3+ + Sn4+ and higher total H2 consumption can be obtained by the addition of SnO2. Finally, the possible reaction mechanism of the selective catalytic reduction over Ce2Sn1 was also proposed.
Ethanol electrooxidation on novel carbon supported Pt/SnO{sub x}/C catalysts with varied Pt:Sn ratio
Energy Technology Data Exchange (ETDEWEB)
Jiang, L. [Institute of Surface Chemistry and Catalysis, Ulm University, D-89069 Ulm (Germany); Dalian Institute of Chemical Physics, Chinese Academy of Sciences, 116023 Dalian (China); Colmenares, L.; Jusys, Z. [Institute of Surface Chemistry and Catalysis, Ulm University, D-89069 Ulm (Germany); Sun, G.Q. [Dalian Institute of Chemical Physics, Chinese Academy of Sciences, 116023 Dalian (China)], E-mail: gqsun@dicp.ac.cn; Behm, R.J. [Institute of Surface Chemistry and Catalysis, Ulm University, D-89069 Ulm (Germany)], E-mail: juergen.behm@uni-ulm.de
2007-12-01
Novel carbon supported Pt/SnO{sub x}/C catalysts with Pt:Sn atomic ratios of 5:5, 6:4, 7:3 and 8:2 were prepared by a modified polyol method and characterized with respect to their structural properties (X-ray diffraction (XRD) and transmission electron microscopy (TEM)), chemical composition (XPS), their electrochemical properties (base voltammetry, CO{sub ad} stripping) and their electrocatalytic activity and selectivity for ethanol oxidation (ethanol oxidation reaction (EOR)). The data show that the Pt/SnO{sub x}/C catalysts are composed of Pt and tin oxide nanoparticles with an average Pt particle diameter of about 2 nm. The steady-state activity of the Pt/SnO{sub x}/C catalysts towards the EOR decreases with tin content at room temperature, but increases at 80 deg. C. On all Pt/SnO{sub x}/C catalysts, acetic acid and acetaldehyde represent dominant products, CO{sub 2} formation contributes 1-3% for both potentiostatic and potentiodynamic reaction conditions. With increasing potential, the acetaldehyde yield decreases and the acetic acid yield increases. The apparent activation energies of the EOR increase with tin content (19-29 kJ mol{sup -1}), but are lower than on Pt/C (32 kJ mol{sup -1}). The somewhat better performance of the Pt/SnO{sub x}/C catalysts compared to alloyed PtSn{sub x}/C catalysts is attributed to the presence of both sufficiently large Pt ensembles for ethanol dehydrogenation and C-C bond splitting and of tin oxide for OH generation. Fuel cell measurements performed for comparison largely confirm the results obtained in model studies.
Ariswan; Sutrisno, H.; Prasetyawati, R.
2017-05-01
Thin films of SnSe and SnS semiconductors had been prepared by vacuum evaporation techniques. All prepared samples were characterized on their structure, optical, and electrical properties in order to know their application in technology. The crystal structure of SnSe and SnS was determined by X-Ray Diffraction (XRD) instrument. The morphology and chemical composition were obtained by Scanning Electron Microscopy (SEM) coupled with Energy Dispersive of X-Ray Analysis (EDAX). The optical property such as band gap was determined by DR-UV-Vis (Diffuse Reflectance-Ultra Violet-Visible) spectroscopy, while the electrical properties were determined by measuring the conductivity by four probes method. The characterization results indicated that both SnSe and SnS thin films were polycrystalline. SnSe crystallized in an orthorhombic crystal system with the lattice parameters of a = 11.47 Å, b = 4.152 Å and c = 4.439 Å, while SnS had an orthorhombic crystal system with lattice parameters of a = 4.317 Å, b = 11.647 Å and c = 3.981 Å. Band gaps (Eg) of SnSe and SnS were 1.63 eV and 1.35 eV, respectively. Chemical compositions of both thin films were non-stoichiometric. Molar ratio of Sn : S was close to ideal which was 1 : 0.96, while molar ratio of Sn : S was 1 : 0.84. The surface morphology described the arrangement of the grains on the surface of the thin film with sizes ranging from 0.2 to 0.5 microns. Color similarity on the surface of the SEM images proved a homogenous thin layer.
Boualleg, Malika; Baudouin, David; Basset, Jean-Marie; Bayard, Franç ois; Candy, Jean Pierre; Jumas, Jean Claude; Veyre, Laurent; Thieuleux, Chloé
2010-01-01
The facile and selective synthesis of small crystalline Pt3Sn alloy nanoparticles was performed at room temperature under H2, using a colloidal approach without the use of extra-stabilizing ligands. The Pt 3Sn alloy was found to be obtained
Directory of Open Access Journals (Sweden)
Zhiguo Wu
2015-01-01
Full Text Available Sn chalcogenides, including SnS, Sn2S3, and SnS2, have been extensively studied as anode materials for lithium batteries. In order to obtain one kind of high capacity, long cycle life lithium batteries anode materials, three-dimensional (3D flower-like hierarchitectures constructed by SnS/SnS2 heterostructure nanosheets with thickness of ~20 nm have been synthesized via a simple one-pot solvothermal method. The obtained samples exhibit excellent electrochemical performance as anode for Li-ion batteries (LIBs, which deliver a first discharge capacity of 1277 mAhg−1 and remain a reversible capacity up to 500 mAhg−1 after 50 cycles at a current of 100 mAg−1.
Liquidus Projection and Thermodynamic Modeling of a Sn-Ag-Zn System
Chen, Sinn-wen; Chiu, Wan-ting; Gierlotka, Wojciech; Chang, Jui-shen; Wang, Chao-hong
2017-12-01
Sn-Ag-Zn alloys are promising Pb-free solders. In this study, the Sn-Ag-Zn liquidus projection was determined, and the Sn-Ag-Zn thermodynamic modeling was developed. Various Sn-Ag-Zn alloys were prepared. Their as-cast microstructures and primary solidification phases were examined. The invariant reaction temperatures of the ternary Sn-Ag-Zn system were determined. The liquidus projection of the Sn-Ag-Zn ternary system was constructed. It was found that the Sn-Ag-Zn ternary system has eight primary solidification phases: ɛ2-AgZn3, γ-Ag5Zn8, β-AgZn, ζ-Ag4Sn, (Ag), ɛ1-Ag3Sn, β-(Sn) and (Zn) phases. There are eight ternary invariant reactions, and the liquid + (Ag) = β-AgZn + ζ-Ag4Sn reaction is of the highest temperature at 935.5 K. Thermodynamic modeling of the ternary Sn-Ag-Zn system was also carried out in this study based on the thermodynamic models of the three constituent binary systems and the experimentally determined liquidus projection. The liquidus projection and the isothermal sections are calculated. The calculated and experimentally determined liquidus projections are in good agreement.
The 20th anniversary of SN1987A
Energy Technology Data Exchange (ETDEWEB)
Suzuki, A [KEK, High Energy Accelerator Research Organization, Oho 1-1, Tsukuba, Ibaragi, 305-0801 (Japan)], E-mail: atsuto.suzuki@kek.jp
2008-07-15
Observation of a neutrino burst from the supernova, SN1987A opened a new window of observational astronomy by neutrinos. And the history showed that the SN1987A neutrino burst observation was the vanguard of successive discoveries of neutrino properties by Super-Kamiokande, SNO, K2K, KamLAND and so on. On the occasion of the SN1987A 20th anniversary, the backstage story up to the discovery of the SN1987A neutrino bursts is summarized, tracing the Kamiokande log-note and including the IMB, LSD and Baksan data.
`Pd20Sn13' revisited: crystal structure of Pd6.69Sn4.31
Directory of Open Access Journals (Sweden)
Wilhelm Klein
2015-07-01
Full Text Available The crystal structure of the title compound was previously reported with composition `Pd20Sn13' [Sarah et al. (1981. Z. Metallkd, 72, 517–520]. For the original structure model, as determined from powder X-ray data, atomic coordinates from the isostructural compound Ni13Ga3Ge6 were transferred. The present structure determination, resulting in a composition Pd6.69Sn4.31, is based on single crystal X-ray data and includes anisotropic displacement parameters for all atoms as well as standard uncertainties for the atomic coordinates, leading to higher precision and accuracy for the structure model. Single crystals of the title compound were obtained via a solid-state reaction route, starting from the elements. The crystal structure can be derived from the AlB2 type of structure after removing one eighth of the atoms at the boron positions and shifting adjacent atoms in the same layer in the direction of the voids. One atomic site is partially occupied by both elements with a Pd:Sn ratio of 0.38 (3:0.62 (3. One Sn and three Pd atoms are located on special positions with site symmetry 2. (Wyckoff letter 3a and 3b.
The Incredibly Long-Lived SN 2005ip
Fox, Ori
2016-10-01
Type IIn supernovae (SNe IIn) are defined by their relatively narrow spectral line features associated with a dense circumstellar medium (CSM) formed by the progenitor star. The nature of the progenitor and mass loss remains relatively unknown. Shock interaction with the dense CSM can often result in significant UV emission for several years post-explosion, thereby probing the CSM characteristics, progenitor mass loss history and, ultimately, the progenitor itself. The Type IIn SN 2005ip proves to be one of the most interesting and well-studied targets within this subclass. Compared to all other supernovae, SN 2005ip is the most luminous for its age. Now more than 11 years post-explosion, the SN has released >10^51 erg throughout its lifetime as the forward shock continues to collide with a dense CSM. Here we propose HST/STIS-MAMA UV observations of SN 2005ip to investigate the massive CSM. When accounting for the shock travel time, these observations will probe material lost from the progenitor more than 1000 years prior to the explosion. We already have a single HST/STIS spectrum of SN 2005ip from 2014, which was obtained while the shock was still within a higher mass regime. With just 5 orbits, a second spectrum will allow us to directly trace the evolution of the CSM and produce new constraints on the pre-SN mass-loss history. Coinciding with Cycle 24's UV Initiative, this program offers new insight regarding both the progenitor and explosion characteristics of the SN IIn subclass.
[Hyp-Au-Sn9(Hyp)3-Au-Sn9(Hyp)3-Au-Hyp]-: the longest intermetalloid chain compound of tin.
Binder, Mareike; Schrenk, Claudio; Block, Theresa; Pöttgen, Rainer; Schnepf, Andreas
2017-10-12
The reaction of the metalloid tin cluster [Sn 10 (Hyp) 4 ] 2- with (Ph 3 P)Au-SHyp (Hyp = Si(SiMe 3 ) 3 ) gave an intermetalloid cluster [Au 3 Sn 18 (Hyp) 8 ] - 1, which is the longest intermetalloid chain compound of tin to date. 1 shows a structural resemblance to binary AuSn phases, which is expected for intermetalloid clusters.
A review and prospects for Nb3Sn superconductor development
Xu, Xingchen
2017-09-01
Nb3Sn superconductors have significant applications in constructing high-field (>10 T) magnets. This article briefly reviews development of Nb3Sn superconductor and proposes prospects for further improvement. It is shown that significant improvement of critical current density (J c) is needed for future accelerator magnets. After a brief review of the development of Nb3Sn superconductors, the factors controlling J c are summarized and correlated with their microstructure and chemistry. The non-matrix J c of Nb3Sn conductors is mainly determined by three factors: the fraction of current-carrying Nb3Sn phase in the non-matrix area, the upper critical field B c2, and the flux line pinning capacity. Then prospects to improve the three factors are discussed respectively. An analytic model was developed to show how the ratios of precursors determine the phase fractions after heat treatment, based on which it is predicted that the limit of current-carrying Nb3Sn fraction in subelements is ∼65%. Then, since B c2 is largely determined by the Nb3Sn stoichiometry, a thermodynamic/kinetic theory is presented to show what essentially determines the Sn content of Nb3Sn conductors. This theory explains the influences of Sn sources and Ti addition on stoichiometry and growth rate of Nb3Sn layers. Next, to improve flux pinning, previous efforts in this community to introduce additional pinning centers to Nb3Sn wires are reviewed, and an internal oxidation technique is described. Finally, prospects for further improvement of non-matrix J c of Nb3Sn conductors are discussed, and it is seen that the only opportunity for further significantly improving J c lies in improving flux pinning.
The complex structure of liquid Cu{sub 6}Sn{sub 5} alloy
Energy Technology Data Exchange (ETDEWEB)
Qin Jingyu; Gu Tingkun; Bian Xiufang [Key Laboratory of Liquid Structure and Heredity of Materials, Ministry of Education, Shandong University, Southern Campus, Jinan 250061 (China); Liu Hui [Shandong High Performance Computing Center, Shandong University, Southern Campus, Jinan 250061 (China)
2009-04-15
By applying ab initio molecular dynamics simulation to liquid Cu{sub 6}Sn{sub 5} alloy, the hetero-coordination tendency is discovered by Bathia-Thornton partial correlation functions and a chemical short-range parameter. However the local structural environment of Sn in l-Cu{sub 6}Sn{sub 5} alloy resembles that of liquid Sn by Voronoi analysis. A new feature, i.e. a subpeak in between the first and second peaks, is discovered by the present method which implies that topologically disordered {beta}-Sn-type structural units may exist in l-Cu{sub 6}Sn{sub 5} alloy. The local density states of electrons show that both Cu-Sn and Sn-Sn bonding exist in l-Cu{sub 6}Sn{sub 5} alloy. This work suggests that chemical short-range order between unlike atoms and self-coordination between Sn atoms coexists in l-Cu{sub 6}Sn{sub 5} alloy.
Prediction of activities of all components in the lead-free solder systems Bi-In-Sn and Bi-In-Sn-Zn
International Nuclear Information System (INIS)
Tao Dongping
2008-01-01
The activities of components of the ternary lead-free solder systems Al-Sn-Zn at 973 K, Zn-Cu-Sn at 1023 K and Bi-In-Sn at 1000 and 1050 K have been predicted by a novel molecular interaction volume model-MIVM and the results are in good agreement with experimental data. Then the activities of all components of the Bi-In-Sn at 550 K and the Bi-In-Sn-Zn quaternary system at 700 K have been further predicted and the results are reasonable and reliable. This shows that the model may be a superior alternative for describing interfacial chemical reactions between lead-free solder alloys and common base materials and for the calculation of their phase diagrams because MIVM has certain physical meaning from the viewpoint of statistical thermodynamics and requires only two infinite dilute activity coefficients for each sub-binary system
Electromigration in 3D-IC scale Cu/Sn/Cu solder joints
Energy Technology Data Exchange (ETDEWEB)
Ho, Cheng-En, E-mail: ceho1975@hotmail.com; Lee, Pei-Tzu; Chen, Chih-Nan; Yang, Cheng-Hsien
2016-08-15
The electromigration effect on the three-dimensional integrated circuits (3D-IC) scale solder joints with a Cu/Sn(25–50 μm)/Cu configuration was investigated using a field-emission scanning electron microscope (FE–SEM) combined with electron backscatter diffraction (EBSD) analysis system. Electron current stressing for a few days caused the pronounced accumulation of Cu{sub 6}Sn{sub 5} in specific Sn grain boundaries (GBs). The EBSD analysis indicated that both the β-Sn crystallographic orientation and GB orientation play dominant roles in this accumulation. The dependencies of the Cu{sub 6}Sn{sub 5} accumulation on the two above factors (i.e., Sn grain orientation and GB orientation) can be well rationalized via a proposed mathematic model based on the Huntington and Grone's electromigration theory with the Cu anisotropic diffusion data in a β-Sn lattice. - Highlights: • Anisotropic Cu electromigration in the 3D-IC scale microelectronic solder joints. • Pronounced accumulation of Cu{sub 6}Sn{sub 5} intermetallic in specific Sn grain boundaries. • A linear dependence of Cu{sub 6}Sn{sub 5} accumulation over the current stressing time. • β-Sn and grain boundary orientations are the dominant factors in Cu{sub 6}Sn{sub 5} accumulation.
Single-Crystal Growth of Cl-Doped n-Type SnS Using SnCl2 Self-Flux.
Iguchi, Yuki; Inoue, Kazutoshi; Sugiyama, Taiki; Yanagi, Hiroshi
2018-06-05
SnS is a promising photovoltaic semiconductor owing to its suitable band gap energy and high optical absorption coefficient for highly efficient thin film solar cells. The most significant carnage is demonstration of n-type SnS. In this study, Cl-doped n-type single crystals were grown using SnCl 2 self-flux method. The obtained crystal was lamellar, with length and width of a few millimeters and thickness ranging between 28 and 39 μm. X-ray diffraction measurements revealed the single crystals had an orthorhombic unit cell. Since the ionic radii of S 2- and Cl - are similar, Cl doping did not result in substantial change in lattice parameter. All the elements were homogeneously distributed on a cleaved surface; the Sn/(S + Cl) ratio was 1.00. The crystal was an n-type degenerate semiconductor with a carrier concentration of ∼3 × 10 17 cm -3 . Hall mobility at 300 K was 252 cm 2 V -1 s -1 and reached 363 cm 2 V -1 s -1 at 142 K.
Ionic liquid-assisted sonochemical synthesis of SnS nanostructures
Energy Technology Data Exchange (ETDEWEB)
García-Gómez, Nora A.; Parra-Arcieniega, Salomé M. de la; Garza-Tovar, Lorena L.; Torres-González, Luis C.; Sánchez, Eduardo M., E-mail: eduardo.sanchezcv@uanl.edu.mx
2014-03-05
Highlight: • Obtention of SnS nanostructures using novel ionic liquid assisted sonochemical method. • Influence of the (BMImBF{sub 4}) ionic liquid in SnS morphology. • Inhibitory effect in SnS crystallinity by structuring agents in ionic environments. -- Abstract: SnS nanoparticles have been successfully synthesized by the ionic liquid-assisted sonochemical method (ILASM). The starting reagents were anhydrous SnCl{sub 2}, thioacetamide, dissolved in ethanol and ionic liquid (IL)1-butyl-3-methylimidazolium tetrafluoroborate (BMImBF{sub 4}) mixtures. Our experiments showed that IL plays an important role in the morphology of SnS. A 1:1 ethanol:IL mixture was found to yield the more interesting features. The lower concentration of Sn (II) in solution favored the presence of nanoplatelets. An increase in ultrasonic time favored crystalline degree and size as well. Also, the effect of additives as 3-mercaptopropionic acid, diethanolamine, ethylene glycol, and trioctyl phosphine oxide is reported. X-ray diffraction (XRD) and ultraviolet–visible diffuse reflectance spectroscopy (UV–Vis-DRS) were used to characterize the obtained products.
International Nuclear Information System (INIS)
McDonald, W.K.
1981-01-01
A method is described of producing composite rod or wire of increased strength and fineness wherein the composite is formed by reducing a lamina of two metals which have been rolled to form a cylindrical billet in which one of the metals is in expanded form. The composite produced can be encased in copper and fabricated to produce a superconductor. Alloys contemplated for producing superconductors are Nb 3 Sn, Nb 3 Ga, Nb 3 Ge, Nb 3 Si, Nb-Ti, V 3 Ga, V 3 Si, V 3 Sn, V 3 Al, and V 3 Ge laminated on bronze, Al, Cu, Ta, or combinations thereof. (author)
Multifilamentary Cu-Nb3Sn superconductor wires
International Nuclear Information System (INIS)
Rodrigues, D.; Pinatti, D.G.
1990-01-01
This paper reports on one of the main technological problems concerning Nb 3 Sn superconducting wires production which is the optimization of heat treatments for the formation of the A-15 intermetallic compound. At the present work, Nb 3 Sn superconducting wire is produced by solid-liquid diffusion method which increases considerably the critical current values of the superconductor. Through this method, niobium, copper and Sn 7% wt Cu alloy are kept in the pure state. Thus, the method dispenses intermediate heat treatments of recrystallization during the manufacturing process of the wire. After the wire was ready, optimization work of heat treatments was accomplished aiming to obtain its best superconducting characteristics, Measurement of critical temperature, critical current versus magnetic field, normal and at room temperature resistivity were performed, as well as scanning electron microscopy for determination of Nb 3 Sn layers and transmission electron microscopy measurements of redetermining the grain sizes in Nb 3 Sn formed in each treatment. It was obtained critical current densities of 1.8 x 10 6 A/cm 2 in the Nb 3 Sn layer, at 10 Teslas and 4.2 K. The samples were analyzed by employing the superconducting collective flux pinning theories and a satisfactory agreement between the experimental and theoretical data was attained. The production process and the small size of the filaments used made a successful optimization of the wire possible
Properties of Sn-doped TiO2 nanotubes fabricated by anodization of co-sputtered Ti–Sn thin films
International Nuclear Information System (INIS)
Kyeremateng, Nana Amponsah; Hornebecq, Virginie; Knauth, Philippe; Djenizian, Thierry
2012-01-01
Self-organized Sn-doped TiO 2 nanotubes (nts) were fabricated for the first time, by anodization of co-sputtered Ti and Sn thin films. This nanostructured material was characterized by scanning electron microscopy, energy dispersive X-ray spectroscopy, X-ray diffraction, UV–vis spectroscopy and transmission electron microscopy. Due to their remarkable properties, Sn-doped TiO 2 nts can find potential applications in Li-ion microbatteries, photovoltaics, and catalysis. Particularly, the electrochemical performance as an anode material for Li-ion microbatteries was evaluated in Li test cells. With current density of 70 μA cm −2 (1 C) and cut-off potential of 1 V, Sn-doped TiO 2 nts showed improved performance compared to simple TiO 2 nts, and differential capacity plots revealed that the material undergoes full electrochemical reaction as a Rutile-type TiO 2 .
Quaternary chalcogenides La{sub 3}Sn{sub 0.5}InS{sub 7} and La{sub 3}Sn{sub 0.5}InSe{sub 7}
Energy Technology Data Exchange (ETDEWEB)
Iyer, Abishek K.; Lee, Emma J.; Bernard, Guy M.; Michaelis, Vladimir K.; Mar, Arthur [Department of Chemistry, University of Alberta, Edmonton, AB (Canada); Yin, Wenlong [Department of Chemistry, University of Alberta, Edmonton, AB (Canada); Institute of Chemical Materials, China Academy of Engineering Physics, Mianyang (China)
2017-12-13
The quaternary chalcogenides La{sub 3}Sn{sub 0.5}InS{sub 7} and La{sub 3}Sn{sub 0.5}InSe{sub 7} were prepared by reactions of the elements at 1050 C and 950 C, respectively. They adopt noncentrosymmetric structures [hexagonal, space group P6{sub 3}, Z = 2; a = 10.2993(11) Aa, c = 6.0921(6) Aa for La{sub 3}Sn{sub 0.5}InS{sub 7}; a = 10.6533(7) Aa, c = 6.4245(4) Aa for La{sub 3}Sn{sub 0.5}InSe{sub 7}] in which the half-occupancy of Sn atoms within octahedral sites classifies them as belonging to the La{sub 3}Mn{sub 0.5}SiS{sub 7}-type branch of the large family of quaternary rare-earth chalcogenides RE{sub 3}M{sub 1-x}M{sup '}Ch{sub 7}. The site distribution in La{sub 3}Sn{sub 0.5}InCh{sub 7}, with higher-valent Sn atoms occupying octahedral instead of tetrahedral sites, is reversed from the typical situation observed in other RE{sub 3}M{sub 1-x}M{sup '}Ch{sub 7} compounds. The ordered distribution of Sn atoms in octahedral sites and In atoms in tetrahedral sites was evaluated by bond valence sum analyses. Moreover, {sup 119}Sn solid-state nuclear magnetic resonance (NMR) spectroscopy confirms the occupation of Sn{sup 4+} species exclusively within octahedral sites. An optical bandgap of 1.45 eV was found for La{sub 3}Sn{sub 0.5}InS{sub 7}. Band structure calculations on an ordered superstructure model of La{sub 3}Sn{sub 0.5}InS{sub 7} reveal that avoidance of strongly Sn-S antibonding levels is an important driving force for the Sn deficiency. (copyright 2017 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)
First-principles study of ZnSnAs2-based dilute magnetic semiconductors
Kizaki, Hidetoshi; Morikawa, Yoshitada
2018-02-01
The electronic structure and magnetic properties of chalcopyrite Zn(Sn,TM)As2 and (Zn,TM)SnAs2 have been investigated by the Korringa-Kohn-Rostoker method combined with the coherent potential approximation within the local spin density approximation, where TM denotes a 3d transition metal element. We find that the half-metallic and high-spin ferromagnetic state can be obtained in Zn(Sn,V)As2, Zn(Sn,Cr)As2, Zn(Sn,Mn)As2, (Zn,V)SnAs2, and (Zn,Cr)SnAs2. The calculated result of Zn(Sn,Mn)As2 is in good agreement with the experimentally observed room-temperature ferromagnetism if we can control selective Mn doping at Sn sites. In addition, (Zn,V)SnAs2 and (Zn,Cr)SnAs2 are predicted to exhibit high-Curie-temperature ferromagnetism.
Corrosion Behaviour of Sn-based Lead-Free Solders in Acidic Solution
Nordarina, J.; Mohd, H. Z.; Ahmad, A. M.; Muhammad, F. M. N.
2018-03-01
The corrosion properties of Sn-9(5Al-Zn), Sn-Cu and SAC305 were studied via potentiodynamic polarization method in an acidic solution of 1 M hydrochloric acid (HCl). Sn-9(5Al-Zn) produced different polarization profile compared with Sn-Cu and SAC305. The morphological analysis showed that small, deep grooves shaped of corrosion product formed on top of Sn-9(5Al-Zn) solder while two distinctive structures of closely packed and loosely packed corrosion product formed on top of Sn-Cu and SAC305 solder alloys. Phase analysis revealed the formations of various corrosion products such as SnO and SnO2 mainly dominant on surface of solder alloys after potentiodynamic polarization in 1 M hydrochloric acid (HCl).
Energy Technology Data Exchange (ETDEWEB)
Kim, Jae Hong; Choi, Sung Mook; Nam, Sang Hoon; Seo, Min Ho; Kim, Won Bae [Department of Materials Science and Engineering, Gwangju Institute of Science and Technology (GIST), 261 Cheomdan-gwagiro, Buk-gu, Gwangju 500-712 (Korea); Choi, Sun Hee [Pohang Accelerator Laboratory, San-31 Hyoja-dong, Pohang, Kyungbuk 790-984 (Korea)
2008-07-16
A series of carbon-supported bimetallic PtSn catalysts for the electrooxidation of C{sub 1}-C{sub 3} alcohols (i.e., methanol (C{sub 1}), ethanol (C{sub 2}), and 1-propanol (C{sub 3})) were prepared with different Pt:Sn atomic ratios using borohydride reduction method combined with freeze-drying procedure at room temperature. The catalysts were investigated by employing various physicochemical analyses: X-ray diffraction (XRD), transmission electron microscopy (TEM) and extended X-ray absorption fine structure (EXAFS) to investigate the structural modification, and X-ray photoelectron spectroscopy (XPS) and X-ray absorption-near-edge spectroscopy (XANES) to characterize the change in electronic features. The variation of Sn content by forming PtSn alloys causes significant structural and electronic modifications of Pt crystallites, resulting in increases of lattice parameter and decreases of the Pt 5d band vacancies with Sn content. Cyclic voltammetry (CV) measurements showed that the addition of Sn into the Pt catalyst promotes the electro-catalytic activities for the electrooxidations of C{sub 1}, C{sub 2}, and C{sub 3} alcohols, in which the maximum activities appeared at different Sn contents for the C{sub 1}-C{sub 3} alcohols. In particular, a shift in optimum Pt:Sn composition was observed in that the Sn content required to reach the maximum peak current density was increased with the increasing number of carbon atoms in the C{sub 1}-C{sub 3} alcohols. Both the geometric and electronic effects with variation of Sn content are in close relationship in the bimetallic PtSn catalysts, consequently affecting the electrocatalytic activities by showing volcano-type behaviors over the electrooxidation of the individual alcohol. (author)
Energy Technology Data Exchange (ETDEWEB)
Van Maaren, M H
1969-06-01
Superconductivity is reported for Sn/sub 4/P/sub 2.65/ at T/sub c/ 1.2/sup 0/K. Hall constant and reflectivity measurements indicate a mixed type of conduction for Sn/sub 4/P/sub 2.65/ and Sn/sub 3.80/ As/sub 3/. The ionic model of Geller and Hull is not applicable.
Characteristics and heat treatment of cold-sprayed Al-Sn binary alloy coatings
International Nuclear Information System (INIS)
Ning, Xian-Jin; Kim, Jin-Hong; Kim, Hyung-Jun; Lee, Changhee
2009-01-01
In this study, Al-Sn binary alloy coatings were prepared with Al-5 wt.% Sn (Al-5Sn) and Al-10 wt.% Sn (Al-10Sn) gas atomized powders by low pressure and high pressure cold spray process. The microstructure and microhardness of the coatings were characterized. To understand the coarsening of tin in the coating, the as-sprayed coatings were annealed at 150, 200, 250 and 300 o C for 1 h, respectively. The effect of annealing on microstructure and the bond strength of the coatings were investigated. The results show that Al-5Sn coating can be deposited by high pressure cold spray with nitrogen while Al-10Sn can only be deposited by low pressure cold spray with helium gas. Both Al-5Sn and Al-10Sn coatings present dense structures. The fraction of Sn in as-sprayed coatings is consistent with that in feed stock powders. The coarsening and/or migration of Sn phase in the coatings were observed when the annealing temperature exceeds 200 deg. C. Furthermore, the microhardness of the coatings decreased significantly at the annealing temperature of 250 deg. C. EDXA analysis shows that the heat treatment has no significant effect on fraction of Sn phase in Al-5Sn coatings. Bonding strength of as-sprayed Al-10Sn coating is slightly higher than that of Al-5Sn coating. Annealing at 200 o C can increase the bonding strength of Al-5Sn coatings.
The crystallographic growth directions of Sn whiskers
International Nuclear Information System (INIS)
Stein, J.; Welzel, U.; Leineweber, A.; Huegel, W.; Mittemeijer, E.J.
2015-01-01
The growth directions of 55 Sn whiskers, i.e. the crystallographic orientation parallel to the whisker-growth axes, were determined using (i) a focused ion beam microscope for the determination of the physical growth angles of the whiskers with respect to a specimen (reference) coordinate system and (ii) an electron backscatter detector in a scanning electron microscope for the determination of the crystallographic orientation of the whiskers. The Sn whiskers were found to grow preferentially along low-index directions of the β-Sn crystal structure. The experimental findings of this study (and most of the results presented in the literature as well) were explained by applying, in a modified way, the Hartman–Perdok concept of periodic bond chains, i.e. chains of strong bonds running uninterruptedly through the structure, to the Sn whisker-growth phenomenon
Maeda, M.; Yamamoto, K.; Mizokawa, T.; Saini, N. L.; Arita, M.; Namatame, H.; Taniguchi, M.; Tan, G.; Zhao, L. D.; Kanatzidis, M. G.
2018-03-01
We have studied the electronic structure of SnSe and Na-doped SnSe by means of angle-resolved photoemission spectroscopy. The valence-band top reaches the Fermi level by the Na doping, indicating that Na-doped SnSe can be viewed as a degenerate semiconductor. However, in the Na-doped system, the chemical potential shift with temperature is unexpectedly large and is apparently inconsistent with the degenerate semiconductor picture. The large chemical potential shift and anomalous spectral shape are key ingredients for an understanding of the novel metallic state with the large thermoelectric performance in Na-doped SnSe.
Effect of indium and antimony doping in SnS single crystals
Energy Technology Data Exchange (ETDEWEB)
Chaki, Sunil H., E-mail: sunilchaki@yahoo.co.in; Chaudhary, Mahesh D.; Deshpande, M.P.
2015-03-15
Highlights: • Single crystals growth of pure SnS, indium doped SnS and antimony doped SnS by direct vapour transport (DVT) technique. • Doping of In and Sb occurred in SnS single crystals by cation replacement. • The replacement mechanism ascertained by EDAX, XRD and substantiated by Raman spectra analysis. • Dopants concentration affects the optical energy bandgap. • Doping influences electrical transport properties. - Abstract: Single crystals of pure SnS, indium (In) doped SnS and antimony (Sb) doped SnS were grown by direct vapour transport (DVT) technique. Two doping concentrations of 5% and 15% each were employed for both In and Sb dopants. Thus in total five samples were studied viz., pure SnS (S1), 5% In doped SnS (S2), 15% In doped SnS (S3), 5% Sb doped SnS (S4) and 15% Sb doped SnS (S5). The grown single crystal samples were characterized by evaluating their surface microstructure, stoichiometric composition, crystal structure, Raman spectroscopy, optical and electrical transport properties using appropriate techniques. The d.c. electrical resistivity and thermoelectric power variations with temperature showed semiconducting and p-type nature of the as-grown single crystal samples. The room temperature Hall Effect measurements further substantiated the semiconducting and p-type nature of the as-grown single crystal samples. The obtained results are deliberated in detail.
Growth and photovoltaic performance of SnS quantum dots
Energy Technology Data Exchange (ETDEWEB)
Deepa, K.G., E-mail: deepachaithanya@gmail.com [Department of Instrumentation and Applied Physics, Indian Institute of Science, Bangalore (India); Nagaraju, J. [Department of Instrumentation and Applied Physics, Indian Institute of Science, Bangalore (India)
2012-08-01
Highlights: Black-Right-Pointing-Pointer Orthorhombic SnS quantum dots are synthesized by chemical method. Black-Right-Pointing-Pointer HOMO-LUMO level alignments confirmed the electron transport from SnS to TiO{sub 2}. Black-Right-Pointing-Pointer Cell characteristics are analyzed with different size quantum dots. Black-Right-Pointing-Pointer FF increased drastically from 15 to 51% on adding a buffer layer to the structure. Black-Right-Pointing-Pointer The SnS QDSSC showed highest V{sub oc} of 504 mV and 2.3 mA/cm{sup 2}. - Abstract: Tin sulphide (SnS) quantum dots of size ranging from 2.4 to 14.4 nm are prepared by chemical precipitation method in aqueous media. Growth of the SnS particles is monitored by controlling the deposition time. Both XRD and SAED patterns confirm that the particles possess orthorhombic structure. The uncapped SnS particles showed secondary phases like Sn{sub 2}S{sub 3} and SnS{sub 2} which is visible in the SAED pattern. From the electrochemical characterization, HOMO-LUMO levels of both TiO{sub 2} and SnS are determined and the band alignment is found to be favorable for electron transfer from SnS to TiO{sub 2}. Moreover, the HOMO-LUMO levels varied for different particle sizes. Solar cell is fabricated by sensitizing porous TiO{sub 2} thin film with SnS QDs. Cell structure is characterized with and without buffer layer between FTO and TiO{sub 2}. Without the buffer layer, cell showed an open circuit voltage (V{sub oc}) of 504 mV and short circuit current density (J{sub sc}) of 2.3 mA/cm{sup 2} under AM1.5 condition. The low fill factor of this structure (15%) is seen to be increased drastically to 51%, on the incorporation of the buffer layer. The cell characteristics are analyzed using two different size quantum dots.
Directory of Open Access Journals (Sweden)
Celso Takashi Nakano
2009-08-01
Full Text Available Purpose: Compare the OPD-scan results and the contrast sensitivity in patients who had implantation of the AcrySof SN60D3 multifocal IOL, the AcrySof SA60AT spheric monofocal IOL and the AcrySof SN60AT aspheric monofocal IOL. Methods: Thirty-two eyes received the multifocal IOL, 32 eyes received the spheric monofocal IOL and 32 eyes received the aspheric monofocal IOL. They were closely paired in age, sex, pre-operative wavefront analysis and contrast sensitivity. All patients was tested with the OPD-scan aberrometer, ETDRS chart at 100% and 9% contrasts and contrast sensitivity. Results: Statistically significant differences were detected more total aberration in SN60AT group (KW = 9.42; p=0.009 when compared to SN60D3 group (p=0.016 and SN60WF group (p=0.0047. The SN60AT group (KW = 16.20; p=0.0003 showed with high spherical aberration values compared to the SN60WF (p=0.00046 and SN60D3 (p=0.0014 group. No significant differences were found between groups in far-distance VA measured using ETDRS at 100% and 9% contrast. The SN60D3 group compared to SN60AT group (p=0.016 had low contrast sensitivity (log units with statistical difference in 6.0 cpd (KW = 7.84; p=0.0199, but no statistical difference between SN60WF and SN60AT group (p=0.91 and SN60WF and SN60D3 group (p=0.051. The SN60D3 group had low contrast sensitivity performed under mesopic conditions (KW = 10.79; p=0,0045 in 6cpd spatial frequency compared to the SN60AT group (p=0.011 and to the SN60WF group (p=0.007 with statistical significant differences. Conclusion: In all analyzed parameters of OPD-scan aberrometry the aspheric and the multifocal IOLs provided less total and spherical aberrations than spheric IOLs. All IOLs provided an excellent high and low contrasts vision, the multifocal IOL was as good as the spheric and aspheric monofocal IOLs.Objetivo: Comparar a sensibilidade ao contraste e análise de "wavefront" com OPD-scan em pacientes submetidos a cirurgia de facoemulsifica
Premaximum observations of the type Ia SN 1990N
International Nuclear Information System (INIS)
Leibundgut, B.; Kirshner, R.P.; Filippenko, A.V.; Shields, J.C.; Foltz, C.B.; Phillips, M.M.; Sonneborn, G.
1991-01-01
Spectroscopic and photometric observations of SN 1990N were obtained at ultraviolet and optical wavelengths, beginning 14 days before maximum light. The early observations reveal important differences from spectra of SN Ia's around maximum light. Photometry and spectroscopy obtained after maximum show that SN 1990N is a typical SN Ia and that most of the observed differences are due to the early epoch of the observations. The most significant characteristics are (1) the high velocities of Ca and Si up to 22,000 km/s; (2) the presence of Co and Fe 2 weeks before maximum; and (3) the more rapid increase in the UV flux compared to the optical. The most popular models for white dwarf deflagration that have provided the standard interpretation for SN Ia's at maximum light do not reproduce the high velocities of Ca II and Si II lines observed in SN 1990N. 37 refs
Gamma spectroscopy of multiple nucleon transfer reactions in Sn
International Nuclear Information System (INIS)
Grabowski, Z.W.; Mayer, R.H.; Fornal, B.; Nisius, D.T.; Bearden, I.G.; Daly, P.J.; Broda, R.; Carpenter, M.P.; Janssens, R.V.F.; Khoo, T.L.; Lauritsen, T.
1992-01-01
The decay of (πh 11/2 ) n yrast isomers was studied in a series of proton-rich N = 82 isotones culminating in determination of B(E2) values in 153 Lu and 154 Hf. In the N = 82 isotones however, it seems unlikely that the measurements could be extended beyond 154 Hf (n = 8). The opportunity to investigate the (h 11/2 ) n ) isomers across the whole h 11/2 subshell exists, at least in principle, in Sn isotopes where the counterpart νh 11/2 subshell is being filled with neutrons starting at 116 Sn. Before our measurements were initiated, the (νh 11/2 ) n 10 + isomers were known to exist in 116, 118, 120 Sn, where the νh 11/2 subshell begins to fill, and in 128,130 Sn at the other end. Important information, however, was missing about the 10 + isomers in 122,124,126 Sn where the long lifetimes are expected. The υ = 3 (h 11/2 ) isomers in odd tin isomers for A ≥ 119 were also not identified. A serious experimental difficulty in populating high spin states in heavier Sn isotopes is that they are not accessible by fusion-evaporation reactions. We decided to search for these missing tin isotopes among the products of heavy ion reactions on 122,124 Sn targets. Using this approach we were able to identify the isomeric decays and measure the lifetimes of the (νh 11/2 n ) υ = 2 isomeric states in 122,124 Sn. In odd tin isotopes we identified new I = 19/2 + yrast isomers in 119,121,123 Sn and measured their lifetimes. In addition (νh 11/2 ) n υ = 3, I = 27/2 - isomers in 119,121 Sn were observed for the first time
On possibility of superconductivity in SnSb: A first principle study
Energy Technology Data Exchange (ETDEWEB)
Dabhi, Shweta D. [Department of Physics, M. K. Bhavnagar University, Bhavnagar 364001 (India); Shrivastava, Deepika [Department of Physics, Barkatullah University, Bhopal 462026 (India); Jha, Prafulla K., E-mail: prafullaj@yahoo.com [Department of Physics, Faculty of Science, The M. S. University of Baroda, Vadodara 390002 (India); Sanyal, Sankar P. [Department of Physics, Barkatullah University, Bhopal 462026 (India)
2016-09-15
Highlights: • Superconducting property of SnSb is predicted by ab-initio calculations. • Electronic properties of SnSb in RS phase shows metallic behaviour similar to SnAs. • Phonon dispersion confirms the dynamical stability of SnSb in RS phase. • Superconducting transition temperature is 3.1 K, slightly lower than that of SnAs. • Calculated thermodynamic properties are also reported. - Abstract: The electronic, phonon structure and superconducting properties of tin antimonide (SnSb) in rock-salt (RS) structure are calculated using first-principles density functional theory. The electronic band structure and density of states show metallic behavior. The phonon frequencies are positive throughout the Brillouin zone in rock-salt structure indicating its stability in that phase. Superconductivity of SnSb in RS phase is discussed in detail by calculating phonon linewidths, Eliashberg spectral function, electron-phonon coupling constant and superconducting transition temperature. SnSb is found to have a slightly lower T{sub C} (3.1 K), as compared to SnAs.
Synthesis and characterization of different morphological SnS nanomaterials
International Nuclear Information System (INIS)
Chaki, Sunil H; Chaudhary, Mahesh D; Deshpande, M P
2014-01-01
SnS in three nano forms possessing different morphologies such as particles, whiskers and ribbons were synthesised by chemical route. The morphology variation was brought about in the chemical route synthesis by varying a synthesis parameter such as temperature and influencing the synthesis by use of surfactant. The elemental composition determination by energy dispersive analysis of x-rays (EDAX) showed that all three synthesized SnS nanomaterials were tin deficient. The x-ray diffraction (XRD) study of the three SnS nanomaterials showed that all of them possess orthorhombic structure. The Raman spectra of the three SnS nanomaterials showed that all three samples possess three common distinguishable peaks. In them two peaks lying at 98 ± 1 cm −1 and 224 ± 4 cm −1 are the characteristic A g mode of SnS. The third peak lying at 302 ± 1 cm −1 is associated with secondary Sn 2 S 3 phase. The transmission electron microscopy (TEM) confirmed the respective morphologies. The optical analysis showed that they possess direct as well as indirect optical bandgap. The electrical transport properties study on the pellets prepared from the different nanomaterials of SnS showed them to be semiconducting and p-type in nature. The current–voltage (I–V) plots of the silver (Ag)/SnS nanomaterials pellets for dark and incandescent illumination showed that all configurations showed good ohmic behaviour except Ag/SnS nanoribbons pellet configuration under illumination. All the obtained results are discussed in detail. (paper)
International Nuclear Information System (INIS)
Meng Fanli; Li Huihua; Kong Lingtao; Liu Jinyun; Jin Zhen; Li Wei; Jia Yong; Liu Jinhuai; Huang Xingjiu
2012-01-01
Graphical abstract: SnO 2 /graphene nanocomposite composed of 4–5 nm SnO 2 nanoparticles was synthesized by one-step wet chemical method and the form mechanism of the nanocomposite is clearly interpreted. The detection limit of the nanocomposite was as low as 5 ppb to toxic benzene. Highlights: ► We synthesized SnO 2 /graphene nanocomposite using a simple one-step wet chemical method. ► The nanocomposite composed of 4–5 nm SnO 2 nanoparticles. ► Toxic benzene was detected by such kind of nanocomposite. ► The detection limit to toxic benzene was as low as 5 ppb. - Abstract: In the present work, the SnO 2 /graphene nanocomposite composed of 4–5 nm SnO 2 nanoparticles was synthesized using a simple wet chemical method for ppb-level detection of benzene. The formation mechanism of the nanocomposite was investigated systematically by means of simultaneous thermogravimetry analysis, X-ray diffraction, and X-ray photoelectron spectroscopy cooperated with transmission electron microscopy observations. The SnO 2 /graphene nanocomposite showed a very attractive improved sensitivity to toxic volatile organic compounds, especially to benzene, compared to a traditional SnO 2 . The responses of the nanocomposite to benzene were a little higher than those to ethanol and the detection limit reached 5 ppb to benzene which is, to our best knowledge, far lower than those reported previously.
Phase transitions in thin films of Sn-Sb-Se system
International Nuclear Information System (INIS)
Samsudi Sakrani; Abdalla Belal Adam; Yussof Wahab
1998-01-01
The preparation and formation of covalent ternary Sn-Sb-Se system were investigated. A solid state reaction technique was employed whereby the evaporated multilayers of Sn/Se/Sb/Sn reacted chemically at a fixed temperature of 240 o C and were allowed to a room temperature slow-cooling. X-ray diffraction analysis showed that phase changes occurred in the system, with indication of amorphization for the predicted Sn 9 .3Sb 8 .1Se 4 4.9 and Sn 1 3.2Sb 4 3.4Se 4 3.4 compositions. These enabled the preliminary topological phase transitions of Sn-Sb-Se system according to the Gibb's triangle in which the areas of crystalline-amorphous were located. (Author)
SiSn diodes: Theoretical analysis and experimental verification
Hussain, Aftab M.
2015-08-24
We report a theoretical analysis and experimental verification of change in band gap of silicon lattice due to the incorporation of tin (Sn). We formed SiSn ultra-thin film on the top surface of a 4 in. silicon wafer using thermal diffusion of Sn. We report a reduction of 0.1 V in the average built-in potential, and a reduction of 0.2 V in the average reverse bias breakdown voltage, as measured across the substrate. These reductions indicate that the band gap of the silicon lattice has been reduced due to the incorporation of Sn, as expected from the theoretical analysis. We report the experimentally calculated band gap of SiSn to be 1.11 ± 0.09 eV. This low-cost, CMOS compatible, and scalable process offers a unique opportunity to tune the band gap of silicon for specific applications.
The Low Temperature Epitaxy of Strained GeSn Layers Using RTCVD System
Kil, Yeon-Ho; Yuk, Sim-Hoon; Jang, Han-Soo; Lee, Sang-Geul; Choi, Chel-Jong; Shim, Kyu-Hwan
2018-03-01
We have investigated the low temperature (LT) growth of GeSn-Ge-Si structures using rapid thermal chemical vapor deposition system utilizing Ge2H6 and SnCl4 as the reactive precursors. Due to inappropriate phenomena, such as, Ge etch and Sn segregation, it was hard to achieve high quality GeSn epitaxy at the temperature > 350 °C. On the contrary, we found that the SnCl4 promoted the reaction of Ge2H6 precursors in a certain process condition of LT, 240-360 °C. In return, we could perform the growth of GeSn epi layer with 7.7% of Sn and its remaining compressive strain of 71.7%. The surface propagated defects were increased with increasing the Sn content in the GeSn layer confirmed by TEM analysis. And we could calculate the activation energies at lower GeSn growth temperature regime using by Ge2H6 and SnCl4 precursors about 0.43 eV.
Li, Z L; Dong, H J; Song, X G; Zhao, H Y; Tian, H; Liu, J H; Feng, J C; Yan, J C
2018-04-01
Homogeneous (Cu, Ni) 6 Sn 5 intermetallic compound (IMC) joints were rapidly formed in asymmetrical Ni/Sn/Cu system by an ultrasound-induced transient liquid phase (TLP) soldering process. In the traditional TLP soldering process, the intermetallic joints formed in Ni/Sn/Cu system consisted of major (Cu, Ni) 6 Sn 5 and minor Cu 3 Sn IMCs, and the grain morphology of (Cu, Ni) 6 Sn 5 IMCs subsequently exhibited fine rounded, needlelike and coarse rounded shapes from the Ni side to the Cu side, which was highly in accordance with the Ni concentration gradient across the joints. However, in the ultrasound-induced TLP soldering process, the intermetallic joints formed in Ni/Sn/Cu system only consisted of the (Cu, Ni) 6 Sn 5 IMCs which exhibited an uniform grain morphology of rounded shape with a remarkably narrowed Ni concentration gradient. The ultrasound-induced homogeneous intermetallic joints exhibited higher shear strength (61.6 MPa) than the traditional heterogeneous intermetallic joints (49.8 MPa). Copyright © 2017 Elsevier B.V. All rights reserved.
Mechanical properties of high-current multifilamentary Nb3Sn conductors
International Nuclear Information System (INIS)
Scanlan, R.M.; Hoard, R.W.; Cornish, D.N.; Zbasnik, J.P.
1980-01-01
Nb 3 Sn is a strain-sensitive superconductor which exhibits large changes in properties for strains of less than 1 percent. The critical current density at 12 T undergoes a reversible degradation of a factor of two for compressive strains of about 1 percent and undergoes an irreversible degradation for tensile strains on the Nb 3 Sn greater than 0.2 percent. Consequently, the successful application of Nb 3 Sn in large high-field magnets requires a complete understanding of the mechanical properties of the conductor. One conductor which is being used for many applications consists of filaments of Nb 3 Sn in a bronze matrix, and much progress has been made in understanding the mechanical behavior of this composite. The Nb 3 Sn filaments are placed in compression due to the differential thermal contraction between Nb 3 Sn and bronze which occurs when the composite is cooled from the Nb 3 Sn formation temperature (typically 700 0 C) to the 4.2 0 K operating temperature. The general behavior of the critical current when this conductor is subjected to a tensile stress is an increase to a maximum when the compressive strain on the Nb 3 Sn is relieved, followed by a decrease as the Nb 3 Sn filemants are placed in tension. The degree of precompression is controlled largely by the ratio of bronze to Nb 3 Sn in the conductor
DEFF Research Database (Denmark)
Ríos-Tamayo, Rafael; Lupiañez, Carmen Belén; Campa, Daniele
2016-01-01
Diabetogenic single nucleotide polymorphisms (SNPs) have recently been associated with multiple myeloma (MM) risk but their impact on overall survival (OS) of MM patients has not been analysed yet. In order to investigate the impact of 58 GWAS-identified variants for type 2 diabetes (T2D) on OS...... of patients with MM, we analysed genotyping data of 936 MM patients collected by the International Multiple Myeloma rESEarch (IMMENSE) consortium and an independent set of 700 MM patients recruited by the University Clinic of Heidelberg. A meta-analysis of the cox regression results of the two sets showed...... that rs7501939 located in the HNF1B gene negatively impacted OS (HRRec= 1.44, 95% CI = 1.18-1.76, P = 0.0001). The meta-analysis also showed a noteworthy gender-specific association of the SLC30A8rs13266634 SNP with OS. The presence of each additional copy of the minor allele at rs13266634 was associated...
Void formation and its impact on Cu−Sn intermetallic compound formation
International Nuclear Information System (INIS)
Ross, Glenn; Vuorinen, Vesa; Paulasto-Kröckel, Mervi
2016-01-01
Void formation in the Cu−Sn system has been identified as a major reliability issue with small volume electronic interconnects. Voids form during the interdiffusion of electrochemically deposited Cu and Sn, with varying magnitude and density. Electroplating parameters include the electrolytic chemistry composition and the electroplating current density, all of which appear to effect the voiding characteristics of the Cu−Sn system. In addition, interfacial voiding affects the growth kinetics of the Cu_3Sn and Cu_6Sn_5 intermetallic compounds of the Cu−Sn system. The aim here is to present voiding data as a function of electroplating chemistry and current density over a duration (up to 72 h) of isothermal annealing at 423 K (150 °C). Voiding data includes the average interfacial void size and average void density. Voids sizes grew proportionally as a function of thermal annealing time, whereas the void density grew initially very quickly but tended to saturate at a fixed density. A morphological evolution analysis called the physicochemical approach is utilised to understand the processes that occur when a voided Cu/Cu_3Sn interface causes changes to the IMC phase growth. The method is used to simulate the intermetallic thickness growths' response to interfacial voiding. The Cu/Cu_3Sn interface acts as a Cu diffusion barrier disrupting the diffusion of Cu. This resulted in a reduction in the Cu_3Sn thickness and an accelerated growth rate of Cu_6Sn_5. - Highlights: • Average void size is proportional linearly to thermal annealing time. • Average void density grows initially very rapidly followed by saturation. • Voids located close to the Cu/Cu_3Sn interface affect IMC growth rates. • Voids act as a diffusion barrier inhibiting Cu diffusion towards Sn. • Voids located at the interface cause Cu_3Sn to be consumed by Cu_6Sn_5.
Energy Technology Data Exchange (ETDEWEB)
Munoz, E. L., E-mail: munoz@fisica.unlp.edu.ar [Universidad Nacional de La Plata, Departamento de Fisica-IFLP (CCT-La Plata, CONICET-UNLP), Facultad de Ciencias Exactas (Argentina); Carbonari, A. W. [Instituto de Pesquisas Energeticas y Nucleares-IPEN-CNEN/SP (Brazil); Errico, L. A. [Universidad Nacional de La Plata, Departamento de Fisica-IFLP (CCT-La Plata, CONICET-UNLP), Facultad de Ciencias Exactas (Argentina); Bibiloni, A. G. [Universidad Nacional de La Plata, Departamento de Fisica, Facultad de Ciencias Exactas (Argentina); Petrilli, H. M. [Universidade de Sao Paulo, Instituto de Fisica (Brazil); Renteria, M. [Universidad Nacional de La Plata, Departamento de Fisica-IFLP (CCT-La Plata, CONICET-UNLP), Facultad de Ciencias Exactas (Argentina)
2007-07-15
The combination of hyperfine techniques and ab initio calculations has been shown to be a powerful tool to unravel structural and electronic characterizations of impurities in solids. A recent example has been the study of Cd-doped SnO, where ab initio calculations questioned previous TDPAC assignments of the electric-field gradient (EFG) in {sup 111}In-implanted Sn-O thin films. Here we present new TDPAC experiments at {sup 111}In-diffused polycrystalline SnO. A reversible temperature dependence of the EFG was observed in the range 295-900 K. The TDPAC results were compared with theoretical calculations performed with the full-potential linearized augmented plane wave (FP-LAPW) method, in the framework of the density functional theory. Through the comparison with the theoretical results, we infer that different electronic surroundings around Cd impurities can coexist in the SnO sample.
International Nuclear Information System (INIS)
Munoz, E. L.; Carbonari, A. W.; Errico, L. A.; Bibiloni, A. G.; Petrilli, H. M.; Renteria, M.
2007-01-01
The combination of hyperfine techniques and ab initio calculations has been shown to be a powerful tool to unravel structural and electronic characterizations of impurities in solids. A recent example has been the study of Cd-doped SnO, where ab initio calculations questioned previous TDPAC assignments of the electric-field gradient (EFG) in 111 In-implanted Sn-O thin films. Here we present new TDPAC experiments at 111 In-diffused polycrystalline SnO. A reversible temperature dependence of the EFG was observed in the range 295-900 K. The TDPAC results were compared with theoretical calculations performed with the full-potential linearized augmented plane wave (FP-LAPW) method, in the framework of the density functional theory. Through the comparison with the theoretical results, we infer that different electronic surroundings around Cd impurities can coexist in the SnO sample.
Directory of Open Access Journals (Sweden)
Rubén Rizo
2016-09-01
Full Text Available PtSn-based catalysts are one of the most active materials toward that contribute ethanol oxidation reaction (EOR. In order to gain a better understanding of the Sn influence on the carbon monoxide (principal catalyst poison and ethanol oxidation reactions in acidic media, a systematic spectroelectrochemical study was carried out. With this end, carbon-supported PtSnx (x = 0, 1/3 and 1 materials were synthesized and employed as anodic catalysts for both reactions. In situ Fourier transform infrared spectroscopy (FTIRS and differential electrochemical mass spectrometry (DEMS indicate that Sn diminishes the amount of bridge bonded CO (COB and greatly improves the CO tolerance of Pt-based catalysts. Regarding the effect of Sn loading on the EOR, it enhances the catalytic activity and decreases the onset potential. FTIRS and DEMS analysis indicate that the C-C bond scission occurs at low overpotentials and at the same potential values regardless of the Sn loading, although the amount of C-C bond breaking decreases with the rise of Sn in the catalytic material. Therefore, the elevated catalytic activity toward the EOR at PtSn-based electrodes is mainly associated with the improved CO tolerance and the incomplete oxidation of ethanol to form acetic acid and acetaldehyde species, causing the formation of a higher amount of both C2 products with the rise of Sn loading.
Some physico-chemical properties of liquid Ag-Sn-Zn
International Nuclear Information System (INIS)
Terzieff, P.
2010-01-01
The mean square concentration fluctuations in the long wavelength limit, the surface tension, the segregation behavior and the viscosity of the liquid system Ag-Sn-Zn are calculated in a semi-empirical manner based on experimental thermodynamic data. The increased intensity of fluctuations in the concentration of Sn extending over an wide range of composition is the dominant feature of the system. In a likewise manner, the tendency of segregation into the surface layer is observed to be most noticeable for Sn-atoms. As a consequence, even at massive additions of Ag or Zn up to 60 at% the surface tension is expected not to exceed the value of pure Sn by more than 15%. The viscosities are indicated to increase markedly but in a non-linear manner with the content of Ag. The excess viscosity is found to be negative throughout the system being more pronounced on the Ag-Sn side than on the Ag-Zn or the Sn-Zn side of the system.
Energy Technology Data Exchange (ETDEWEB)
Naveen Kumar, P.; Sahaya Selva Mary, J.; Chandrakala, V.; Jothi Jeyarani, W.; Merline Shyla, J., E-mail: jmshyla@gmail.com
2017-06-01
A comparative investigation of SnO{sub 2}/SiO{sub 2} nanocomposite with SnO{sub 2} nanoparticles has been conducted in the present study with the intent of learning the probable enhancement of the properties of the nanocomposite over those of the bare nanoparticles which has not been widely reported before. SnO{sub 2} nanoparticles and SnO{sub 2}/SiO{sub 2} nanocomposite have been synthesized via the facile and versatile sol-gel method. The samples were characterized with X-Ray Diffraction (XRD), High Resolution Scanning Electron Microscopy (HRSEM), Brunauer Emmett Teller (BET) studies, Fourier Transform Infra-Red spectroscopy (FT-IR), UV–Visible (UV–Vis) spectroscopy and Field-dependent photo conductivity technique for the evaluation of their crystallite size, structure & morphology, surface, chemical, optical and electrical properties respectively. Scherrer’s equation was used to determine the crystallite size of the as-synthesized samples from the XRD data. The particle size of SnO{sub 2}/SiO{sub 2} nanocomposite as observed through HRSEM was found to be reduced when compared with the bare SnO{sub 2} nanoparticles suggesting a possible increase in the optical band gap of the former which has been further confirmed in the optical studies. The surface area of SnO{sub 2}/SiO{sub 2} nanocomposite revealed a remarkable enrichment by approximately 5 folds in comparison with that of SnO{sub 2} nanoparticles which suggests an enhancement in its corresponding optical and electrical properties. The SnO{sub 2}/SiO{sub 2} nanocomposite recorded appreciated values of field-dependent photo and dark currents with several folds of augmentation thereby qualifying as an efficient photoconducting material. Attributed with an improved surface area and increased photoconducting nature, the SnO{sub 2}/SiO{sub 2} nanocomposite could be presented as an excellent photoanode material for nanomaterials based Dye Sensitized Solar Cells (DSSCs). - Highlights: • SnO{sub 2}/SiO{sub 2
Influences of the quantity of Mg2Sn phase on the corrosion behavior of Mg-7Sn magnesium alloy
International Nuclear Information System (INIS)
Liu Xianbin; Shan Dayong; Song Yingwei; Chen Rongshi; Han Enhou
2011-01-01
The influence of the quantity of the Mg 2 Sn phase on the corrosion behavior of different solution temperature treated Mg-7Sn magnesium alloy has been investigated by electrochemical measurements, scanning electron microscope (SEM) observation, X-ray diffraction (XRD) and X-ray photoelectron spectroscopy (XPS) analysis. With the increase of solution temperature, the quantity of Mg 2 Sn phase decreased and the tin concentration of matrix increased. The dissolved tin in Mg matrix took part in the film formation and the constituent of film was magnesium oxide and stannic oxide. The corrosion mode and corrosion rate were associated with the quantity of Mg 2 Sn phases and tin concentration of the matrix. If most of tin was present as Mg 2 Sn, the corrosion mode was pitting corrosion and it accelerated the corrosion rate. If most of tin was dissolved in matrix, the corrosion mode was filiform corrosion and it decreased the corrosion rate. The experiment evidences demonstrated that the corrosion resistance can be improved by increasing the tin concentration of matrix and the lowest corrosion rate was observed for sample solution treated at 540 o C.
Effect of various SnO2 pH on ZnO/SnO2-composite film via immersion technique
Malek, M. F.; Mohamed, R.; Mamat, M. H.; Ismail, A. S.; Yusoff, M. M.; Rusop, M.
2018-05-01
ZnO/SnO2-composite film has been synthesized via immersion technique with various pH of SnO2. The pH of SnO2 were varied between 4.5 and 6.5. The optical measurements of the samples were carried out using Varian Cary 5000 UV-Vis spectrophotometer within the range from 350 nm to 800 nm at room temperature in air with a data interval of 1 nm. On the other hand, the optical photoluminescence properties were measured by a photoluminescence spectrometer (PL, model: Horiba Jobin Yvon - 79 DU420A-OE-325) using a He-Cd laser as the excitation source at 325 nm. These highly oriented ZnO/SnO2-composite film are potential for the creation of functional materials, such as the sensors, solar cells and etc.
Structure and chemical composition of supported Pt-Sn electrocatalysts for ethanol oxidation
International Nuclear Information System (INIS)
Jiang Luhua; Sun Gongquan; Sun Shiguo; Liu Jianguo; Tang Shuihua; Li Huanqiao; Zhou Bing; Xin Qin
2005-01-01
Carbon supported PtSn alloy and PtSnO x particles with nominal Pt:Sn ratios of 3:1 were prepared by a modified polyol method. High resolution transmission electron microscopy (HRTEM) and X-ray microchemical analysis were used to characterize the composition, size, distribution, and morphology of PtSn particles. The particles are predominantly single nanocrystals with diameters in the order of 2.0-3.0 nm. According to the XRD results, the lattice constant of Pt in the PtSn alloy is dilated due to Sn atoms penetrating into the Pt crystalline lattice. While for PtSnO x nanoparticles, the lattice constant of Pt only changed a little. HRTEM micrograph of PtSnO x clearly shows that the change of the spacing of Pt (1 1 1) plane is neglectable, meanwhile, SnO 2 nanoparticles, characterized with the nominal 0.264 nm spacing of SnO 2 (1 0 1) plane, were found in the vicinity of Pt particles. In contrast, the HRTEM micrograph of PtSn alloy shows that the spacing of Pt (1 1 1) plane extends to 0.234 nm from the original 0.226 nm. High resolution energy dispersive X-ray spectroscopy (HR-EDS) analyses show that all investigated particles in the two PtSn catalysts represent uniform Pt/Sn compositions very close to the nominal one. Cyclic voltammograms (CV) in sulfuric acid show that the hydrogen ad/desorption was inhibited on the surface of PtSn alloy compared to that on the surface of the PtSnO x catalyst. PtSnO x catalyst showed higher catalytic activity for ethanol electro-oxidation than PtSn alloy from the results of chronoamperometry (CA) analysis and the performance of direct ethanol fuel cells (DEFCs). It is deduced that the unchanged lattice parameter of Pt in the PtSnO x catalyst is favorable to ethanol adsorption and meanwhile, tin oxide in the vicinity of Pt nanoparticles could offer oxygen species conveniently to remove the CO-like species of ethanolic residues to free Pt active sites
The function of Sn(II)-apatite as a Tc immobilizing agent
Energy Technology Data Exchange (ETDEWEB)
Asmussen, R. Matthew, E-mail: matthew.asmussen@pnnl.gov [Energy and Environment Directorate, Pacific Northwest National Laboratory, 902 Battelle Blvd, Richland, WA, 99352 (United States); Neeway, James J.; Lawter, Amanda R.; Levitskaia, Tatiana G. [Energy and Environment Directorate, Pacific Northwest National Laboratory, 902 Battelle Blvd, Richland, WA, 99352 (United States); Lukens, Wayne W. [Chemical Sciences Division, Lawrence Berkeley National Laboratory, Berkeley, CA, 94720 (United States); Qafoku, Nikolla P. [Energy and Environment Directorate, Pacific Northwest National Laboratory, 902 Battelle Blvd, Richland, WA, 99352 (United States)
2016-11-15
At the U.S. Department of Energy Hanford Site, Tc-99 is a component of low-activity waste (LAW) fractions of the nuclear tank waste and removal of Tc from LAW streams would greatly benefit the site remediation process. In this study, we investigated the removal of Tc(VII), as pertechnetate, from deionized water (DIW) and a LAW simulant through batch sorption testing and solid phase characterization using tin (II) apatite (Sn-A) and SnCl{sub 2}. Sn-A showed higher levels of Tc removal from both DIW and LAW simulant. Scanning electron microscopy/energy dispersive X-ray spectroscopy (SEM/XEDS) and X-ray absorption spectroscopy (XAS) of reacted Sn-A in DIW showed that TcO4- is reduced to Tc(IV) on the Sn-A surface. The performance of Sn-A in the LAW simulant was lowered due to a combined effect of the high alkalinity, which lead to an increased dissolution of Sn from the Sn-A, and a preference for the reduction of Cr(VI). - Highlights: • Sn(II)-Apatite shows high proficiency in removing Tc(VII) from neutral solutions. • The removal of the Tc(VII) by Sn(II)-apatite is done via reduction to Tc(IV)O{sub 2} × H{sub 2}O. • In LAW Sn(II)-apatite is less efficient in removing Tc(VII). • Interference in LAW due to a preference for the reduction of Cr(VI) and the high pH. • Sn(II)-apatite can remove Tc(VII) from LAW effectively through increasing material added.
Directory of Open Access Journals (Sweden)
Zhou Zhi-Hua
2009-01-01
Full Text Available Abstract SnO2nanowire arrays were synthesized by fast heating a mixture of SnO2and the carbon nanotubes waste soot by high-frequency induction heating. The resultant SnO2nanowires possess diameters from 50 to 100 nm and lengths up to tens of mircrometers. The field-effect transistors based on single SnO2nanowire exhibit that as-synthesized nanowires have better transistor performance in terms of transconductance and on/off ratio. This work demonstrates a simple technique to the growth of nanomaterials for application in future nanoelectronic devices.
Nanocrystalline SnO2 by liquid pyrolysis
Directory of Open Access Journals (Sweden)
Morante, J. R.
2000-08-01
Full Text Available Liquid pyrolysis is presented as a new production method of SnO2 nanocrystalline powders suitable for gas sensor devices. The method is based on a pyrolytic reaction of high tensioned stressed drops of an organic solution of SnCl4•5(H2O. The main advantages of the method are its capability to produce SnO2 nanopowders with high stability, its accurate control over the grain size and other structural characteristics, its high level of repeatability and its low industrialization implementation cost. The characterization of samples of SnO2 nanoparticles obtained by liquid pyrolysis in the range between 200ºC and 900ºC processing temperature is carried out by X-ray diffraction, transmission electron microscopy, Raman and X-ray photoelectron spectroscopy. Results are analyzed and discussed so as to validate the advantages of the liquid pyrolysis method.La pirólisis líquida se presenta como un nuevo método para producir SnO2 nanocristalino en polvo ideal para sensores de gas. El método se basa en una reacción pirolítica de gotas altamente tensionadas procedentes de una solución orgánica de SnCl4•5(H2O. Las principales ventajas del método son la capacidad para producir nanopartículas de SnO2 con una gran estabilidad, el preciso control sobre el tamaño de grano y sobre otras características estructurales, el alto nivel de repetibilidad y el bajo coste en su implementación industrial.La caracterización de las muestras de las nanopartículas de SnO2 obtenidas por pirólisis líquida en un rango de temperatura de procesado que va de 200ºC a 900ºC se ha realizado mediante difracción de rayos X, microscopía electrónica de transmisión, espectroscopía Raman y espectroscopía fotoelectrónica de rayos X. Los resultados se han analizado y discutido. Éstos validan las ventajas del método de la pirólisis líquida.
Energy Technology Data Exchange (ETDEWEB)
Straub, Katrin
2011-01-24
This thesis concentrates on nuclear properties of very neutron deficient nuclei near the proton dripline in the neighbourhood of doubly-magic {sup 100}Sn. In an experiment performed in March 2008 at the GSI in Darmstadt, the exotic nuclei were produced in a projectile fragmentation reaction using a {sup 124}Xe primary beam with an energy of 100 AMeV impinging on a 4000 Beryllium target, separated and identified in the FRS and eventually stopped for decay spectroscopy in a complex implantation detector developed at the institute E12. The Germanium array RISING was employed for the measurement of prompt and delayed gamma radiation. Production cross sections and half lives were determined along the proton dripline. The isotopes {sup 99}Sn, {sup 97}In and {sup 95}Cd were identified for the first time. additional nuclei studied in this thesis are {sup 103}Sn, {sup 96}Cd as well as the two tin isotopes {sup 101}Sn and {sup 102}Sn. (orig.)
Intercalation of organic molecules into SnS2 single crystals
International Nuclear Information System (INIS)
Toh, M.L.; Tan, K.J.; Wei, F.X.; Zhang, K.K.; Jiang, H.; Kloc, C.
2013-01-01
SnS 2 is a layered semiconductor with a van der Waals gap separating the covalently bonded layers. In this study, post-synthesis intercalation of donor organic amine molecules, such as ethylenediamine (en), into tin disulfide and secondary intercalation of p-phenylenediamine (PPD) and 1, 5-naphthalenediamine (NDA) into SnS 2e n have been verified with X-ray diffraction. PPD and NDA did not intercalate directly even during prolonged annealing but replaced en readily if en was already present in the van der Waals gap. The c-lattice dilation is proportional to the intercalant size. Unit cell lattices of intercalated products were determined from the positions of the X-ray diffraction peaks. Optical images taken during the intercalation showed that intercalation progressed from the periphery towards the interior of the crystal. TEM diffraction patterns in the [0 0 1] direction of SnS 2 after intercalation revealed defects and stacking mismatches among the SnS 2 layers caused by the intercalation. UV–Vis absorption studies showed a red shift in the band edge of the SnS 2 material after intercalation. The band edge was 2.2 eV for pristine SnS 2 ; after intercalation with en or PPD, the absorbance spectra band edges shifted to approximately 0.7 eV or 0.5 eV, respectively. - Graphical Abstract: SnS 2 single crystals were intercalated with organic amine molecules such as ethylenediamine, phenylenediamine and naphthalenediamine. Absorption studies showed red shift of band edge after intercalation, which was consistent with optical observations. X-ray diffraction indicated lattice dilation in the c-lattice of SnS 2 after intercalation. Highlights: ► Organic molecules intercalated inhomogenously between covalently bonded SnS 2 layers. ► Ethylenediamine (en) intercalate directly into SnS 2 . ► Phenylenediamine (PPD) and naphthalenediamine (NDA) can be intercalated into SnS 2 secondary. ► In a secondary intercalation the bonds between layers are weakened by direct
Energy Technology Data Exchange (ETDEWEB)
Baek, Yong-Ho [Department of Materials Science and Engineering, Korea University, Seoul 136-713 (Korea, Republic of); Division of Advanced Circuit Interconnect, Samsung Electro-Mechanics Co., Ltd., Suwon 443-743 (Korea, Republic of); Chung, Bo-Mook [Department of Materials Science and Engineering, Korea University, Seoul 136-713 (Korea, Republic of); Department of Research and Development, KPM TECH, Ansan 425-090 (Korea, Republic of); Choi, Young-Sik [Division of Advanced Circuit Interconnect, Samsung Electro-Mechanics Co., Ltd., Suwon 443-743 (Korea, Republic of); Choi, Jaeho [Department of Advanced Metal and Materials Engineering, Gangneung-Wonju National University, Gangneung 210-702 (Korea, Republic of); Huh, Joo-Youl, E-mail: jyhuh@korea.ac.kr [Department of Materials Science and Engineering, Korea University, Seoul 136-713 (Korea, Republic of)
2013-12-05
Highlights: •Ni{sub 3}Sn{sub 4} acts as a source of Ni atoms, leading to a strong cross-interaction with Pd. •(Cu,Ni){sub 6}Sn{sub 5} is an effective Ni diffusion barrier, inhibiting Pd resettlement. •Dissolution kinetics of (Pd,Ni)Sn{sub 4} was interpreted based on the Sn–Ni–Pd isotherm. •Cu addition to solder alleviates the (Pd,Ni)Sn{sub 4}-related risk of reliability deterioration. -- Abstract: We examined the effects of layers of intermetallic compound (IMC) Ni{sub 3}Sn{sub 4} and (Cu,Ni){sub 6}Sn{sub 5} formed at the solder/Ni interface, on the cross-interactions between Pd and Ni during solid-state aging and reflow soldering. Two types of diffusion couples, Pd/Sn/Ni and Pd/Sn–Cu/Ni, were aged at 150 °C to study the solid-state interactions. In contrast to the Pd/Sn/Ni couples in which a Ni{sub 3}Sn{sub 4} layer formed at the Ni interface, the Pd/Sn–Cu/Ni couple where a (Cu,Ni){sub 6}Sn{sub 5} layer formed at the Ni interface exhibited no significant interaction between Pd and Ni. The (Cu,Ni){sub 6}Sn{sub 5} layer acted as an effective barrier against Ni diffusion and thus inhibited the resettlement of (Pd,Ni)Sn{sub 4} onto the Ni interface. For the interaction during reflow, Sn–3.5Ag and Sn–3.0Ag–0.5Cu solder balls were isothermally reflowed on an electroless Ni(P)/electroless Pd/immersion Au (ENEPIG) surface finish at 250 °C, and the dissolution kinetics of the (Pd,Ni)Sn{sub 4} particles converted from the 0.2-μm-thick Pd-finish layer were examined. The spalled (Pd,Ni)Sn{sub 4} particles very quickly dissolved into the molten solder when the IMC layer formed on the Ni substrate was (Cu,Ni){sub 6}Sn{sub 5} rather than Ni{sub 3}Sn{sub 4}. The dependence of the dissolution kinetics of the spalled (Pd,Ni)Sn{sub 4} particles on the IMC layers was rationalized on the basis of a Sn–Ni–Pd isotherm at 250 °C. The present study suggests that the formation of a dense (Cu,Ni){sub 6}Sn{sub 5} layer at the solder/Ni interface can effectively
Nb3Sn for Radio Frequency Cavities
International Nuclear Information System (INIS)
Godeke, A.
2006-01-01
In this article, the suitability of Nb3Sn to improve the performance of superconducting Radio-Frequency (RF) cavities is discussed. The use of Nb3Sn in RF cavities is recognized as an enabling technology to retain a very high cavity quality factor (Q0) at 4.2 K and to significantly improve the cavity accelerating efficiency per unit length (Eacc). This potential arises through the fundamental properties of Nb3Sn. The properties that are extensively characterized in the literature are, however, mainly related to improvements in current carrying capacity (Jc) in the vortex state. Much less is available for the Meissner state, which is of key importance to cavities. Relevant data, available for the Meissner state is summarized, and it is shown how this already validates the use of Nb3Sn. In addition, missing knowledge is highlighted and suggestions are given for further Meissner state specific research
Cu2ZnSn(S,Se)4 from CuxSnSy nanoparticle precursors on ZnO nanorod arrays
International Nuclear Information System (INIS)
Kavalakkatt, Jaison; Lin, Xianzhong; Kornhuber, Kai; Kusch, Patryk; Ennaoui, Ahmed; Reich, Stephanie; Lux-Steiner, Martha Ch.
2013-01-01
Solar cells with Cu 2 ZnSnS 4 absorber thin films have a potential for high energy conversion efficiencies with earth-abundant and non-toxic elements. In this work the formation of CZTSSe from Cu x SnS y nanoparticles (NPs) deposited on ZnO nanorod (NR) arrays as precursors for zinc is investigated. The NPs are prepared using a chemical route and are dispersed in toluene. The ZnO NRs are grown on fluorine doped SnO 2 coated glass substrates by electro deposition method. A series of samples are annealed at different temperatures between 300 °C and 550 °C in selenium containing argon atmosphere. To investigate the products of the reaction between the precursors the series is analyzed by means of X-ray diffraction (XRD) and Raman spectroscopy. The morphology is recorded by scanning electron microscopy (SEM) images of broken cross sections. The XRD measurements and the SEM images show the disappearing of ZnO NRs with increasing annealing temperature. Simultaneously the XRD and Raman measurements show the formation of CZTSSe. The formation of secondary phases and the optimum conditions for the preparation of CZTSSe is discussed. - Highlights: ► Cu x SnS y nanoparticles are deposited on ZnO nanorod arrays. ► Samples are annealed at different temperatures (300–550 °C) in Se/Ar-atmosphere. ► Raman spectroscopy, X-ray diffraction and electron microscopy are performed. ► ZnO disappears with increasing annealing temperature. ► With increasing temperature Cu x SnS y and ZnO form Cu 2 ZnSn(S,Se) 4
25 CFR 26.8 - Where do I go to apply for Job Placement and Training assistance?
2010-04-01
... 25 Indians 1 2010-04-01 2010-04-01 false Where do I go to apply for Job Placement and Training... PLACEMENT AND TRAINING PROGRAM General Applicability § 26.8 Where do I go to apply for Job Placement and Training assistance? You may apply for Job Placement and Training assistance at the servicing office...
Electrochemical studies of CNT/Si–SnSb nanoparticles for lithium ion batteries
Energy Technology Data Exchange (ETDEWEB)
Nithyadharseni, P. [Department of Physics, Bannari Amman Institute of Technology, Sathyamangalam 638402 (India); Department of Physics, Advanced Batteries Lab, National University of Singapore, 117542 (Singapore); Reddy, M.V., E-mail: phymvvr@nus.edu.sg [Department of Physics, Advanced Batteries Lab, National University of Singapore, 117542 (Singapore); Nalini, B., E-mail: lalin99@rediffmail.com [Department of Physics, Avinashilingam University for Women, Coimbatore 641043 (India); Ravindran, T.R. [Centre for Research in Nanotechnology, Karunya University, Coimbatore 641114 (India); Pillai, B.C.; Kalpana, M. [Indira Gandhi Centre for Atomic Research (IGCAR), Kalpakkam 603102 (India); Chowdari, B.V.R. [Department of Physics, Advanced Batteries Lab, National University of Singapore, 117542 (Singapore)
2015-10-15
Highlights: • Si added SnSb and CNT exhibits very low particle size of below 30 nm • A strong PL quenching due to the addition of Si to SnSb. • Electrochemical studies show CNT added SnSb shows good capacity retention. - Abstract: Nano-structured SnSb, SnSb–CNT, Si–SnSb and Si–SnSb–CNT alloys were synthesized from metal chlorides of Sn, Sb and Si via reductive co-precipitation technique using NaBH{sub 4} as reducing agent. The as prepared compounds were characterized by various techniques such as X-ray diffraction (XRD), scanning electron microscope (SEM), Raman, Fourier transform infra-red (FTIR) and photoluminescence (PL) spectroscopy. The electrochemical performances of the compounds were characterized by galvanostatic cycling (GC) and cyclic voltammetry (CV). The Si–SnSb–CNT compound shows a high reversible capacity of 1200 mAh g{sup −1}. However, the rapid capacity fading was observed during cycling. In contrast, SnSb–CNT compound showed a high reversible capacity of 568 mAh g{sup −1} at 30th cycles with good cycling stability. The improved reversible capacity and cyclic performance of the SnSb–CNT compound could be attributed to the nanosacle dimension of SnSb particles and the structural advantage of CNTs.
Photoluminescence and electroluminescence from Ge/strained GeSn/Ge quantum wells
Energy Technology Data Exchange (ETDEWEB)
Lin, Chung-Yi; Chang, Chih-Chiang [Department of Electrical Engineering, Graduate Institute of Photonics and Optoelectronics, National Taiwan University, Taipei 10617, Taiwan (China); Huang, Chih-Hsiung; Huang, Shih-Hsien [Department of Electrical Engineering, Graduate Institute of Electronics Engineering, National Taiwan University, Taipei 10617, Taiwan (China); Liu, C. W., E-mail: chee@cc.ee.ntu.edu.tw [Department of Electrical Engineering, Graduate Institute of Photonics and Optoelectronics, National Taiwan University, Taipei 10617, Taiwan (China); Department of Electrical Engineering, Graduate Institute of Electronics Engineering, National Taiwan University, Taipei 10617, Taiwan (China); National Nano Device Labs, Hsinchu 30077, Taiwan (China); Huang, Yi-Chiau; Chung, Hua; Chang, Chorng-Ping [Applied Materials Inc., Sunnyvale, California 94085 (United States)
2016-08-29
Ge/strained GeSn/Ge quantum wells are grown on a 300 mm Si substrate by chemical vapor deposition. The direct bandgap emission from strained GeSn is observed in the photoluminescence spectra and is enhanced by Al{sub 2}O{sub 3}/SiO{sub 2} passivation due to the field effect. The electroluminescence of the direct bandgap emission of strained GeSn is also observed from the Ni/Al{sub 2}O{sub 3}/GeSn metal-insulator-semiconductor tunneling diodes. Electroluminescence is a good indicator of GeSn material quality, since defects in GeSn layers degrade the electroluminescence intensity significantly. At the accumulation bias, the holes in the Ni gate electrode tunnel to the strained n-type GeSn layer through the ultrathin Al{sub 2}O{sub 3} and recombine radiatively with electrons. The emission wavelength of photoluminescence and electroluminescence can be tuned by the Sn content.
Structural, optical and thermal characterization of PVC/SnO2 nanocomposites
Taha, T. A.; Ismail, Z.; Elhawary, M. M.
2018-04-01
The structural, optical, and thermal properties of PVC/SnO2 nanocomposites were investigated. XRD patterns were used to explore the structures of these prepared samples. Optical UV-Vis measurements were analyzed to calculate the spectroscopic optical constants of the prepared PVC/SnO2 nanocomposites. Both direct and indirect optical band gaps decreased with increasing SnO2 content. The refractive index, high frequency dielectric constant, plasma frequency, and optical conductivity values increased with SnO2. The single oscillator energy increased from 5.64 to 10.97 eV and the dispersion energy increased from 6.35 to 19.80 eV with the addition of SnO2. The other optical parameters such as optical moments, single oscillator strength, volume energy loss, and surface energy loss were calculated for different SnO2 concentrations. Raman spectra of the PVC/SnO2 nanocomposite films revealed the characteristic vibrational modes of PVC and surface phonon modes of SnO2. The thermal stability of PVC/SnO2 nanocomposite films was studied using DTA and thermogravimetric analysis. The glass transition ( T g) values abruptly changed from 46 °C for PVC to an average value of 59 °C for the polymer films doped with 2.0, 4.0, and 6.0 wt% SnO2. The weight loss decreased as the SnO2 concentration increased in the temperature range of 350-500 °C, corresponding to enhanced thermal stability.
Co-depositing Sn controls the growth of Al films as surfactant
International Nuclear Information System (INIS)
Barna, P. B.; Kovacs, A.; Misjak, F.; Eisenmenger-Sittner, C.; Bangert, H.; Tomastik, C.
2002-01-01
The present study investigates the influence of co-deposited Sn on the atomic processes involved in the structure evolution of vapour-deposited Al films. The films were prepared in HV by thermal evaporation from W sources at 1600 C substrate temperature either on Si wafers covered by a thermally grown oxide or on air cleaved mica. By applying the half-shadow technique, pure and Sn-doped Al films could be deposited simultaneously. The samples were investigated by AFM, scanning AES, X-TEM as well as by X-ray diffraction methods. The grain growth of Al is promoted by Sn in all stages of the film formation. Scanning AES measurements prove the existence of a wetting Sn layer both on the surface of Al islands and on the surface of the continuos Al layer. Excess Sn forms islands on the growth surface. The surface of pure Al layers exhibits grain boundary grooves and bunches of growth steps around terraces, while that of the Sn doped layers is more rounded. The substrate-film interface was covered by a thin Sn layer. AES measurements also prove the presence of Sn on the growth surface of Al films even after termination of Sn addition. Results of these experiments indicate that during co-deposition of Al and Sn the impinging Al atoms penetrate the wetting layer and are incorporated into the already existing Al crystals. A model has been developed for describing the growth of Al crystals in the presence Sn. (Authors)
Void formation and its impact on Cu−Sn intermetallic compound formation
Energy Technology Data Exchange (ETDEWEB)
Ross, Glenn, E-mail: Glenn.Ross@aalto.fi; Vuorinen, Vesa; Paulasto-Kröckel, Mervi
2016-08-25
Void formation in the Cu−Sn system has been identified as a major reliability issue with small volume electronic interconnects. Voids form during the interdiffusion of electrochemically deposited Cu and Sn, with varying magnitude and density. Electroplating parameters include the electrolytic chemistry composition and the electroplating current density, all of which appear to effect the voiding characteristics of the Cu−Sn system. In addition, interfacial voiding affects the growth kinetics of the Cu{sub 3}Sn and Cu{sub 6}Sn{sub 5} intermetallic compounds of the Cu−Sn system. The aim here is to present voiding data as a function of electroplating chemistry and current density over a duration (up to 72 h) of isothermal annealing at 423 K (150 °C). Voiding data includes the average interfacial void size and average void density. Voids sizes grew proportionally as a function of thermal annealing time, whereas the void density grew initially very quickly but tended to saturate at a fixed density. A morphological evolution analysis called the physicochemical approach is utilised to understand the processes that occur when a voided Cu/Cu{sub 3}Sn interface causes changes to the IMC phase growth. The method is used to simulate the intermetallic thickness growths' response to interfacial voiding. The Cu/Cu{sub 3}Sn interface acts as a Cu diffusion barrier disrupting the diffusion of Cu. This resulted in a reduction in the Cu{sub 3}Sn thickness and an accelerated growth rate of Cu{sub 6}Sn{sub 5}. - Highlights: • Average void size is proportional linearly to thermal annealing time. • Average void density grows initially very rapidly followed by saturation. • Voids located close to the Cu/Cu{sub 3}Sn interface affect IMC growth rates. • Voids act as a diffusion barrier inhibiting Cu diffusion towards Sn. • Voids located at the interface cause Cu{sub 3}Sn to be consumed by Cu{sub 6}Sn{sub 5}.
Zr-rich corner of the Zr-Sn-O diagram
International Nuclear Information System (INIS)
Roberti, L.A.; Arias, D.E.
1993-01-01
The understanding of the effect of light elements (in particular oxygen, nitrogen and hydrogen) on the behaviour of alloys for nuclear use is necessary because of its technological importance. The Zr-Sn-O system is perhaps the most representative of all possible ternary systems which can be used to simulate a simplified Zircaloy-type alloy in which the effect of O can be studied. However, in the specialized literature experimental data on phase equilibria and thermophysical properties of this system are not easily found. In the present work, the equilibrium compositions of the α and β phases of the Zr-Sn-O system at temperatures between 1150 and 1323 K are calculated, using the scarce available information. First results of the calculations show satisfactory coincidences with experimental data. Future work will be oriented towards the proposal of isothermal cross-sections calculated by a modelling of phases with wider Sn and O composition ranges, and involving equilibria with the phases Zr 4 Sn, Zr 5 Sn 3 , ZrO 2 , ZrSnO 4 . (Author)
Evaluation of sup(99m)Tc-Sn-colloid on liver scintigram
Energy Technology Data Exchange (ETDEWEB)
Matsuyuki, Y; Kanao, K; Honda, M; Ishihara, S [Sumitomo Hospital, Osaka (Japan)
1975-04-01
sup(99m)Tc-Sn-colloid injectable solution and Sn-colloid preparation set were used for nuclear medical examination of the liver and their efficiency was discussed. Both sup(99m)Tc-Sn-colloid injectable solution and Sn-colloid preparation set showed the same kinetics in vivo, and the sup(99m)Tc-Sn-colloid rapidly disappeared from the serum and concentrated to the liver and spleen. Comparing /sup 198/Au-colloid, sup(99m)Tc-Sn-colloid could be increased the administration dose, and provided easy examination within short time period, easy observation from multiple directions, and improvement of resolution by scinticamera. Imaging of the spleen with sup(99m)Tc-Sn-colloid was slightly superior to that with sup(99m)Tc-sulfur-colloid. sup(99m)Tc-Sn-colloid injectable solution which required no procedure of labeling was evaluated as the most safe and easy technique. Side effects were not recognized. As the results, already made preparation, such as sup(99m)Tc-Sn-colloid injectable solution, which provided easy preparation with less absorbed dose of the tissue and high resolution would be frequently required.
Evaluation of sup(99m)Tc-Sn-colloid on liver scintigram
International Nuclear Information System (INIS)
Matsuyuki, Yoshihiko; Kanao, Keisuke; Honda, Minoru; Ishihara, Shizumori
1975-01-01
sup(99m)Tc-Sn-colloid injectable solution and Sn-colloid preparation set were used for nuclear medical examination of the liver and their efficiency was discussed. Both sup(99m)Tc-Sn-colloid injectable solution and Sn-colloid preparation set showed the same kinetics in vivo, and the sup(99m)Tc-Sn-colloid rapidly disappeared from the serum and concentrated to the liver and spleen. Comparing 198 Au-colloid, sup(99m)Tc-Sn-colloid could be increased the administration dose, and provided easy examination within short time period, easy observation from multiple directions, and improvement of resolution by scinticamera. Imaging of the spleen with sup(99m)Tc-Sn-colloid was slightly superior to that with sup(99m)Tc-sulfur-colloid. sup(99m)Tc-Sn-colloid injectable solution which required no procedure of labeling was evaluated as the most safe and easy technique. Side effects were not recognized. As the results, already made preparation, such as sup(99m)Tc-Sn-colloid injectable solution, which provided easy preparation with less absorbed dose of the tissue and high resolution would be frequently required. (Mukohata, S.)
Boualleg, Malika
2010-01-01
The facile and selective synthesis of small crystalline Pt3Sn alloy nanoparticles was performed at room temperature under H2, using a colloidal approach without the use of extra-stabilizing ligands. The Pt 3Sn alloy was found to be obtained spontaneously as the unique phase regardless of the number of tin equivalents introduced. © 2010 The Royal Society of Chemistry.
Energy Technology Data Exchange (ETDEWEB)
Romaka, L., E-mail: romakal@franko.lviv.ua [Inorganic Chemistry Department, Ivan Franko Lviv National University, Kyryla and Mefodiya str. 6, 79005 Lviv (Ukraine); Stadnyk, Yu. [Inorganic Chemistry Department, Ivan Franko Lviv National University, Kyryla and Mefodiya str. 6, 79005 Lviv (Ukraine); Romaka, V.V. [Department of Materials Engineering and Applied Physics, Lviv Polytechnic National University, Ustyyanovycha Str. 5, 79013 Lviv (Ukraine); Demchenko, P.; Stadnyshyn, M.; Konyk, M. [Inorganic Chemistry Department, Ivan Franko Lviv National University, Kyryla and Mefodiya str. 6, 79005 Lviv (Ukraine)
2011-09-08
Highlights: > {l_brace}Gd, Er{r_brace}-V-Sn ternary systems at 870 K are characterized by formation of stannides with general compositions RV{sub 6}Sn{sub 6}. > Isostructural RV{sub 6}Sn{sub 6} compounds were also found with Y, Dy, Ho, Tm, and Lu. > The crystal structure of RV{sub 6}Sn{sub 6} compounds was determined by powder diffraction method. > Structural analysis showed that RV{sub 6}Sn{sub 6} compounds (R = Gd, Dy-Tm, Lu) are disordered; YV{sub 6}Sn{sub 6} is characterized by structure ordering. - Abstract: The phase equilibria in the Gd-V-Sn and Er-V-Sn ternary systems were studied at 870 K by means of X-ray and metallographic analyses in the whole concentration range. Both Gd-V-Sn and Er-V-Sn systems are characterized by formation of one ternary compound at investigated temperature, with stoichiometry RV{sub 6}Sn{sub 6} (SmMn{sub 6}Sn{sub 6}-type, space group P6/mmm, a = 0.55322(3) nm, c = 0.91949(7) nm for Gd, a = 0.55191(2) nm, c = 0.91869(8) nm for Er). Solubility of the third component in the binary compounds was not observed. Compounds with the SmMn{sub 6}Sn{sub 6}-type were also found with Dy, Ho, Tm, and Lu, while YV{sub 6}Sn{sub 6} compound crystallizes in HfFe{sub 6}Ge{sub 6} structure type. All investigated compounds are the first ternary stannides with rare earth elements and vanadium.
Au–Sn bonding material for the assembly of power integrated circuit module
Energy Technology Data Exchange (ETDEWEB)
Zhu, Z.X.; Li, C.C. [Department of Materials Science & Engineering, National Taiwan University, Taipei, Taiwan (China); Liao, L.L.; Liu, C.K. [Electronic and Optoelectronics Research Laboratories, Industrial Technology Research Institute, Hsinchu, Taiwan (China); Kao, C.R., E-mail: crkao@ntu.edu.tw [Department of Materials Science & Engineering, National Taiwan University, Taipei, Taiwan (China)
2016-06-25
Insulated gate bipolar transistor (IGBT) chips are the key components in high-temperature power electronic modules, which have to efficiently convert electricity between direct and alternating current. In this study, the eutectic Au–Sn (20 wt.% Sn) is successfully used to assemble IGBT chips and direct-bond-copper substrates by using solid liquid interdiffusion (SLID) bonding. During subsequent isothermal aging at 150, 200, and 240 °C, the microstructure evolution and growth kinetics of intermetallic compounds are investigated. Excellent thermal stability and mechanical strength are observed. It is concluded that the eutectic Au–Sn solder is ideal to assemble high-temperature IGBT by using the SLID process. - Highlights: • Au–20Sn serves as a promising bonding material for IGBT operating at T < 519 °C. • The Au–20Sn reacted with Ni to form (Ni,Au){sub 3}Sn{sub 2}/(Au{sub 5}Sn + AuSn)/(Ni,Au){sub 3}Sn{sub 2}. • Once the AuSn was nearly exhausted, the whole joint could withstand higher temperatures. • A cost-effective way for long-term operations at high temperature.
Defect interactions in Sn1−xGex random alloys
Chroneos, Alexander; Bracht, H.; Grimes, R. W.; Jiang, C.; Schwingenschlö gl, Udo
2009-01-01
Sn1−xGex alloys are candidates for buffer layers to match the lattices of III-V or II-VI compounds with Si or Ge for microelectronic or optoelectronic applications. In the present work electronic structure calculations are used to study relative energies of clusters formed between Sn atoms and lattice vacancies in Ge that relate to alloys of low Sn content. We also establish that the special quasirandom structure approach correctly describes the random alloy nature of Sn1−xGex with higher Sn content. In particular, the calculated deviations of the lattice parameters from Vegard’s Law are consistent with experimental results.
Defect interactions in Sn1−xGex random alloys
Chroneos, Alexander
2009-06-23
Sn1−xGex alloys are candidates for buffer layers to match the lattices of III-V or II-VI compounds with Si or Ge for microelectronic or optoelectronic applications. In the present work electronic structure calculations are used to study relative energies of clusters formed between Sn atoms and lattice vacancies in Ge that relate to alloys of low Sn content. We also establish that the special quasirandom structure approach correctly describes the random alloy nature of Sn1−xGex with higher Sn content. In particular, the calculated deviations of the lattice parameters from Vegard’s Law are consistent with experimental results.
Morphology and chemical composition of Cu/Sn/Cu and Cu(5 at-%Ni)/Sn/Cu(5 at-%Ni) interconnections
Wierzbicka-Miernik, A.; Wojewoda-Budka, J.; Litynska-Dobrzynska, L.; Kodentsov, A.; Zieba, P.
2012-01-01
In the present paper, scanning and transmission electron microscopies as well as energy dispersive X-ray spectroscopy investigations were performed to describe the morphology and chemical composition of the intermetallic phases growing in Cu/Sn/Cu and Cu(Ni)/Sn/Cu(Ni) interconnections during the
Irradiated Graphene Loaded with SnO₂ Quantum Dots for Energy Storage.
Huang, Ruting; Wang, Lijun; Zhang, Qian; Chen, Zhiwen; Li, Zhen; Pan, Dengyu; Zhao, Bing; Wu, Minghong; Wu, C M Lawrence; Shek, Chan-Hung
2015-11-24
Tin dioxide (SnO2) and graphene are unique strategic functional materials with widespread technological applications, particularly in the areas of solar batteries, optoelectronic devices, and solid-state gas sensors owing to advances in optical and electronic properties. Versatile strategies for microstructural evolution and related performance of SnO2 and graphene composites are of fundamental importance in the development of electrode materials. Here we report that a novel composite, SnO2 quantum dots (QDs) supported by graphene nanosheets (GNSs), has been prepared successfully by a simple hydrothermal method and electron-beam irradiation (EBI) strategies. Microstructure analysis indicates that the EBI technique can induce the exfoliation of GNSs and increase their interlayer spacing, resulting in the increase of GNS amorphization, disorder, and defects and the removal of partial oxygen-containing functional groups on the surface of GNSs. The investigation of SnO2 nanoparticles supported by GNSs (SnO2/GNSs) reveals that the GNSs are loaded with SnO2 QDs, which are dispersed uniformly on both sides of GNSs. Interestingly, the electrochemical performance of SnO2/GNSs indicates that SnO2 QDs supported by a 210 kGy irradiated GNS shows excellent cycle response, high specific capacity, and high reversible capacity. This novel SnO2/GNS composite has potential practical applications in SnO2 electrode materials during Li(+) insertion/extraction.
Tunable SnO2 Nanoribbon by Electric Fields and Hydrogen Passivation
Directory of Open Access Journals (Sweden)
Xin-Lian Chen
2017-01-01
Full Text Available Under external transverse electronic fields and hydrogen passivation, the electronic structure and band gap of tin dioxide nanoribbons (SnO2NRs with both zigzag and armchair shaped edges are studied by using the first-principles projector augmented wave (PAW potential with the density function theory (DFT framework. The results showed that the electronic structures of zigzag and armchair edge SnO2NRs exhibit an indirect semiconducting nature and the band gaps demonstrate a remarkable reduction with the increase of external transverse electronic field intensity, which demonstrate a giant Stark effect. The value of the critical electric field for bare Z-SnO2NRs is smaller than A-SnO2NRs. In addition, the different hydrogen passivation nanoribbons (Z-SnO2NRs-2H and A-SnO2NRs-OH show different band gaps and a slightly weaker Stark effect. The band gap of A-SnO2NRs-OH obviously is enhanced while the Z-SnO2NRs-2H reduce. Interestingly, the Z-SnO2NRs-OH presented the convert of metal-semiconductor-metal under external transverse electronic fields. In the end, the electronic transport properties of the different edges SnO2NRs are studied. These findings provide useful ways in nanomaterial design and band engineering for spintronics.
An HDAC3-PROX1 corepressor module acts on HNF4α to control hepatic triglycerides.
Armour, Sean M; Remsberg, Jarrett R; Damle, Manashree; Sidoli, Simone; Ho, Wesley Y; Li, Zhenghui; Garcia, Benjamin A; Lazar, Mitchell A
2017-09-15
The histone deacetylase HDAC3 is a critical mediator of hepatic lipid metabolism, and liver-specific deletion of HDAC3 leads to fatty liver. To elucidate the underlying mechanism, here we report a method of cross-linking followed by mass spectrometry to define a high-confidence HDAC3 interactome in vivo that includes the canonical NCoR-HDAC3 complex as well as Prospero-related homeobox 1 protein (PROX1). HDAC3 and PROX1 co-localize extensively on the mouse liver genome, and are co-recruited by hepatocyte nuclear factor 4α (HNF4α). The HDAC3-PROX1 module controls the expression of a gene program regulating lipid homeostasis, and hepatic-specific ablation of either component increases triglyceride content in liver. These findings underscore the importance of specific combinations of transcription factors and coregulators in the fine tuning of organismal metabolism.HDAC3 is a critical mediator of hepatic lipid metabolism and its loss leads to fatty liver. Here, the authors characterize the liver HDAC3 interactome in vivo, provide evidence that HDAC3 interacts with PROX1, and show that HDAC3 and PROX1 control expression of genes regulating lipid homeostasis.
Production and application of Sn-117m
International Nuclear Information System (INIS)
Vucina, J.; Nikolic, N.; Orlic, M.
2005-01-01
For targeted therapy in nuclear medicine, besides the usually used, like 32 P, 89 Sr, 131 I, 186,188 Re, new radioisotopes are intensively investigated. Particular interest is devoted to 117m Sn. It decays by isomeric transition with the emission of low energy conversion electrons and short range. Their potent lethality, due to high LET, particularly when the emitter is located inside the cell, on or near nucleus, is well known. The accompanying gamma rays (Eγ = 159 keV) are also suitable for detection. At present, the specific activity which can be achieved in nuclear reactors is is sufficient for the production of agents for bone palliation. The best results so far were achieved with 117m Sn(IV)-DTPA. It is expected that the use of this radioisotope will increase when a method of its production in the no-carrier form will be developed. In the paper the production of 117m Sn and 117m Sn radiopharmaceuticals is briefly reviewed. (author) [sr
Phase diagram of the ternary Zr-Ti-Sn system
International Nuclear Information System (INIS)
Arias, D.; Gonzalez Camus, M.
1987-01-01
It is well known that Ti stabilizes the high temperature cubic phase of Zr and that Sn stabilizes the low temperature hexagonal phase of Zr. The effect of Sn on the Zr-Ti diagram has been studied in the present paper. Using high purity metals, nine different alloys have been prepared, with 4-32 at % Ti, 0.7-2.2 at % Sn and Zr till 100%. Resistivity and optical and SEM metallography techniques have been employed. Effect of some impurities have been analyzed. The results are discussed and different isothermic sections of the ternary Zr-Ti-Sn diagram are presented. (Author) [es
Drzymała, Elżbieta; Gruzeł, Grzegorz; Pajor-Świerzy, Anna; Depciuch, Joanna; Socha, Robert; Kowal, Andrzej; Warszyński, Piotr; Parlinska-Wojtan, Magdalena
2018-05-01
In this study Pt, Re, and SnO2 nanoparticles (NPs) were combined in a controlled manner into binary and ternary combinations for a possible application for ethanol oxidation. For this purpose, zeta potentials as a function of the pH of the individual NPs solutions were measured. In order to successfully combine the NPs into Pt/SnO2 and Re/SnO2 NPs, the solutions were mixed together at a pH guaranteeing opposite zeta potentials of the metal and oxide NPs. The individually synthesized NPs and their binary/ternary combinations were characterized by Fourier transform infrared spectroscopy (FTIR) and scanning transmission electron microscopy (STEM) combined with energy dispersive X-ray spectroscopy (EDS) analysis. FTIR and XPS spectroscopy showed that the individually synthesized Pt and Re NPs are metallic and the Sn component was oxidized to SnO2. STEM showed that all NPs are well crystallized and the sizes of the Pt, Re, and SnO2 NPs were 2.2, 1.0, and 3.4 nm, respectively. Moreover, EDS analysis confirmed the successful formation of binary Pt/SnO2 and Re/SnO2 NP, as well as ternary Pt/Re/SnO2 NP combinations. This study shows that by controlling the zeta potential of individual metal and oxide NPs, it is possible to assemble them into binary and ternary combinations. [Figure not available: see fulltext.
Energy Technology Data Exchange (ETDEWEB)
De Moure F, F. [universidad Autonoma de Queretaro, Facultad de Quimica Materiales, Queretaro 76010, Queretaro (Mexico); Guillen C, A.; Nieto Z, K. E.; Quinones G, J. G.; Hernandez H, A.; Melendez L, M.; Olvera, M. de la L., E-mail: fcomoure@hotmail.com [IPN, Centro de Investigacion y de Estudios Avanzados, Departamento de Fisica, Apdo. Postal 14-740, 07360 Mexico D. F. (Mexico)
2013-08-01
SnO{sub 2}:F thin films were prepared by RF magnetron sputtering onto glass substrates using SnF{sub 2} as fluorine source. The films were deposited under a mixed argon/hydrogen atmosphere at a substrate temperature of 500 C. The X-ray diffraction shows that polycrystalline films were grown with a phases mixture of SnO{sub 2} and Sn O. The optical transmittance is between 80 and 90%. The physical properties of the films suggest that SnO{sub 2} thin films grown with small SnF{sub 2} content in the target can be considered as candidates for transparent electrodes. (Author)
Directory of Open Access Journals (Sweden)
Ana Cláudia Bernardes Silva
2003-06-01
Full Text Available In this work highly dispersed Ru-Sn bimetallic catalysts have been prepared from organobimetallic Cp(PPh32Ru-SnX3 (X = Cl or Br complexes. These single source precursors can be easily impregnated in high surface area supports, such as activated carbon and sol-gel SiO2, and upon controlled thermal treatment the ligands are released as volatile products resulting in the formation of the bimetallic system Ru-Sn. Catalytic reactions, such as hydrodechlorination of CCl4 and chlorobenzene and TPR (Temperature Programmed Reduction experiments carried out with these RuSn catalysts suggested a strong interaction between Ruthenium and Tin. Mössbauer measurements showed that these materials when exposed to air are immediately oxidized to form Sn (IV. It was shown that upon controlled reduction conditions with H2 it is possible to reduce selectively Sn to different oxidation states and different phases. The Sn oxidation state showed significant effect on the catalytic hydrogenation of 1,5-cyclooctadiene. The use of these single source precursors with a controlled decomposition/reduction procedure allows the preparation of unique catalysts with an intimate interaction between the components ruthenium and tin and the possibility of varying the Sn oxidation state around the Ru metal.
Studies of Nuclei Close to 132Sn Using Single-Neutron Transfer Reactions
International Nuclear Information System (INIS)
Jones, K.L.; Pain, S.D.; Kozub, R.L.; Adekola, Aderemi S.; Bardayan, Daniel W.; Blackmon, Jeff C.; Catford, Wilton N.; Chae, K.Y.; Chipps, K.; Cizewski, J.A.; Erikson, Luke; Gaddis, A.L.; Greife, U.; Grzywacz, R.K.; Harlin, Christopher W.; Hatarik, Robert; Howard, Joshua A.; James, J.; Kapler, R.; Krolas, W.; Liang, J. Felix; Ma, Zhanwen; Matei, Catalin; Moazen, Brian; Nesaraja, Caroline D.; O'Malley, Patrick; Patterson, N.P.; Paulauskas, Stanley; Shapira, Dan; Shriner, J.F. Jr.; Sikora, M.; Sissom, D.J.; Smith, Michael Scott; Swan, T.P.; Thomas, J.S.; Wilson, Gemma L.
2009-01-01
Neutron transfer reactions were performed in inverse kinematics using radioactive ion beams of 132Sn, 130Sn, and 134Te and deuterated polyethylene targets. Preliminary results are presented. The Q-value spectra for 133Sn, 131Sn and 135Te reveal a number of previously unobserved peaks. The angular distributions are compatible with the expected lf7/2 nature of the ground state of 133Sn, and 2p3/2 for the 3.4 MeV state in 131Sn.
Alternating field losses in Nb3Sn multifilamentary superconductor
International Nuclear Information System (INIS)
Murphy, J.H.; Deis, D.W.; Shaw, B.J.; Walker, M.S.
1975-01-01
Transverse alternating field losses at 4.2K have been measured from 0.5 Hz to 10 kHz in a Nb 3 Sn multifilamentary superconductor in bias fields to 5 Tesla. The 0.020 inch diameter sample was prepared by heat treating a Cu, Nb-1 wt percent Zr, CuSn composite at 700 0 C for 20 hours to form Nb 3 Sn on the inside surface of the annular filaments. Metallurgical studies have been made to determine the Sn distribution and to estimate the thickness of the Nb 3 Sn layer. The I/sub c/-H curve and resistive and inductive transition curves are presented. The losses are analyzed with respect to the present loss theories using the conductor characteristics measured and excellent agreement between experiment and theory is achieved. 1 table, 6 figures
Energy Technology Data Exchange (ETDEWEB)
Lopes, E.S.N.; Contieri, R.J.; Caram, R., E-mail: ederlopes@fem.unicamp.b [Universidade Estadual de Campinas (DEMA/FEM/UNICAMP), SP (Brazil). Fac. de Engenharia Mecanica. Dept. de Engenharia de Materiais; Moraes, P.E.L. [FATEC Artur Azevedo, Mogi Mirim, SP (Brazil); Costa, A.M.S. [Universidade de Sao Paulo (DEMAR/EEL/USP), Lorena, SP (Brazil). Escola de Engenharia. Dept. de Engenharia de Materiais
2010-07-01
The arc voltaic centrifugal casting is an interesting alternative in terms of economic and technological development in the production of components based on materials with high reactivity and high melting point, such as titanium alloys. In this work, Ti-30Nb (wt. %) with additions of Sn (2, 4, 6, 8 and 10 wt. %) were formed by casting process. Characterization of the samples included optical microscopy, scanning electron microscopy, X-ray diffraction, Vickers hardness and elastic modulus measures by acoustic techniques. It was observed that the microstructure of the samples investigated is composed by dendritic structures, with clear segregation of alloying elements. The Vickers hardness and the elastic modulus decreased with the addition of Sn. The results show that the mechanical behavior of Ti-Nb alloys can be controlled within certain limits, by adding Sn. (author)
Energy Technology Data Exchange (ETDEWEB)
Tusi, M.M.; Ayoub, J.M.S.; Costa, T.C.; Spinace, E.V.; Neto, A.O., E-mail: aolivei@ipen.b, E-mail: espinace@ipen.b [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), Sao Paulo, SP (Brazil)
2010-07-01
PtSn/C (Pt:Sn atomic ratio of 50:50) and PtSnSb/C (Pt:Sn:Sb atomic ratio of 50:45:05, 50:40:10 and 50:10:40) electrocatalysts were prepared (20 wt% metal loading) by an alcohol-reduction process using ethylene glycol as reducing agent, H{sub 2}PtCl{sub 6}.6H{sub 2}O, SnCl{sub 2}.H{sub 2}O and Sb(OOCCH{sub 3}){sub 3} and carbon Vulcan XC72 as support. The obtained materials were characterized by X-ray diffraction (XRD), transmission electron microscopy (TEM) and chronoamperometry. The PtSnSb/C (50:45:05) prepared by an alcohol-reduction process showed the best performance for ethanol electro-oxidation compared to the others catalysts. (author)
Zillner, E.; Paul, A.; Jutimoosik, J.; Chandarak, S.; Monnor, T.; Rujirawat, S.; Yimnirun, R.; Lin, X. Z.; Ennaoui, A.; Dittrich, Th.; Lux-Steiner, M.
2013-06-01
Lattice positions of Sn in kesterite Cu2ZnSnS4 and Cu2SnS3 nanoparticles and thin films were investigated by XANES (x-ray absorption near edge structure) analysis at the S K-edge. XANES spectra were analyzed by comparison with simulations taking into account anti-site defects and vacancies. Annealing of Cu2ZnSnS4 nanoparticle thin films led to a decrease of Sn at its native and defect sites. The results show that XANES analysis at the S K-edge is a sensitive tool for the investigation of defect sites, being critical in kesterite thin film solar cells.
Diffusion and chemical activity of Zr-Sn and Zr-Ti systems
International Nuclear Information System (INIS)
Zee, R.H.; Watters, J.F.; Davidson, R.D.
1986-01-01
A modified evaporation method was used to determine the diffusion coefficients and the emission rates of Sn and Ti in Zr-Sn and Zr-Ti, respectively, at temperatures between 1605 and 1970 K. Results show that both Sn and Ti diffuse in their respective alloys via a vacancy mechanism. Comparison with data in the literature reveals that the activation energy for diffusion of Sn in Zr-Sn, with Sn content between 3 and 5 at.X is relatively constant from 1200 to 1970 K. From the measured emission rates, values of 103 and 98 kcal/mol were obtained for the enthalpies of sublimation for Sn and Ti in their alloys. With a comparison of the solute vapor pressures with those of the pure elements, partial molar free energies, entropies, and enthalpies for the two systems were determined in the temperature range investigated. The Zr-Sn system shows a very large negative heat of formation (-33 kcal/mol) whereas the Zr-Ti system behaves quite ideally, in agreement with phase-diagram predictions
Mesoscale elucidation of laser-assisted chemical deposition of Sn nanostructured electrodes
Energy Technology Data Exchange (ETDEWEB)
Liu, Zhixiao; Mukherjee, Partha P., E-mail: pmukherjee@tamu.edu [Department of Mechanical Engineering, Texas A and M University, College Station, Texas 77843 (United States); Deng, Biwei; Cheng, Gary J. [School of Industrial Engineering, Purdue University, West Lafayette, Indiana 47906 (United States); Deng, Huiqiu [Department of Applied Physics, School of Physics and Electronics, Hunan University, Changsha 410082 (China)
2015-06-07
Nanostructured tin (Sn) is a promising high-capacity electrode for improved performance in lithium-ion batteries for electric vehicles. In this work, Sn nanoisland growth for nanostructured electrodes assisted by the pulse laser irradiation has been investigated based on a mesoscale modeling formalism. The influence of pertinent processing conditions, such as pulse duration, heating/cooling rates, and atom flux, on the Sn nanostructure formation is specifically considered. The interaction between the adsorbed atom and the substrate, represented by the adatom diffusion barrier, is carefully studied. It is found that the diffusion barrier predominantly affects the distribution of Sn atoms. For both α-Sn and β-Sn, the averaged coordination number is larger than 3 when the diffusion barrier equals to 0.15 eV. The averaged coordination number decreases as the diffusion barrier increases. The substrate temperature, which is determined by heating/cooling rates and pulse duration, can also affect the formation of Sn nanoislands. For α-Sn, when applied low heating/cooling rates, nanoislands cannot form if the diffusion barrier is larger than 0.35 eV.
Energy Technology Data Exchange (ETDEWEB)
Maurya, V. K.; Shruti,; Patnaik, S., E-mail: spatnaik@mail.jnu.ac.in [School of Physical Sciences, Jawaharlal Nehru University New Delhi (India); Jha, Rajveer; Awana, V. P. S. [National Physical Laboratory, New Delhi 110012 (India)
2016-05-23
We are reporting decrease in superconducting transition temperature accompanied by increased metallicity in indium doped SnTe superconductor. SnTe is a topological crystalline insulator and superconductivity is achieved by indium substitution in place of tin. With application of hydrostatic pressure we find negative dT{sub c}/dP of ~ -0.6K/GPa upto 2.5 GPa. The overall phenomenon is ascribed to unconventional superconductivity. Decrease in resistivity is also seen in single crystal SnTe with application of pressure but no evidence of superconductivity is observed.
SN 2009bb: A PECULIAR BROAD-LINED TYPE Ic SUPERNOVA ,
International Nuclear Information System (INIS)
Pignata, Giuliano; Stritzinger, Maximilian; Phillips, M. M.; Morrell, Nidia; Boldt, Luis; Campillay, Abdo; Contreras, Carlos; Gonzalez, Sergio; Krzeminski, Wojtek; Roth, Miguel; Salgado, Francisco; Soderberg, Alicia; Mazzali, Paolo; Anderson, J. P.; Folatelli, Gaston; Foerster, Francisco; Hamuy, Mario; Maza, Jose; Levesque, Emily M.; Rest, Armin
2011-01-01
Ultraviolet, optical, and near-infrared photometry and optical spectroscopy of the broad-lined Type Ic supernova (SN) 2009bb are presented, following the flux evolution from -10 to +285 days past B-band maximum. Thanks to the very early discovery, it is possible to place tight constraints on the SN explosion epoch. The expansion velocities measured from near maximum spectra are found to be only slightly smaller than those measured from spectra of the prototype broad-lined SN 1998bw associated with GRB 980425. Fitting an analytical model to the pseudobolometric light curve of SN 2009bb suggests that 4.1 ± 1.9 M sun of material was ejected with 0.22 ± 0.06 M sun of it being 56 Ni. The resulting kinetic energy is 1.8 ± 0.7 x 10 52 erg. This, together with an absolute peak magnitude of M B = -18.36 ± 0.44, places SN 2009bb on the energetic and luminous end of the broad-lined Type Ic (SN Ic) sequence. Detection of helium in the early time optical spectra accompanied with strong radio emission and high metallicity of its environment makes SN 2009bb a peculiar object. Similar to the case for gamma-ray bursts (GRBs), we find that the bulk explosion parameters of SN 2009bb cannot account for the copious energy coupled to relativistic ejecta, and conclude that another energy reservoir (a central engine) is required to power the radio emission. Nevertheless, the analysis of the SN 2009bb nebular spectrum suggests that the failed GRB detection is not imputable to a large angle between the line-of-sight and the GRB beamed radiation. Therefore, if a GRB was produced during the SN 2009bb explosion, it was below the threshold of the current generation of γ-ray instruments.
Energy Technology Data Exchange (ETDEWEB)
Glowacki, B A; Fray, D J; Yan, X-Y; Chen, G
2003-05-01
The article is focused on low temperature superconducting Nb{sub 3}Sn material manufactured by novel electrodeoxidizing method developed in Cambridge whereby the range of alloys and intermetallics are produced cheaply making potential superconducting wires more cost effective. The process of direct electrochemical reduction of Nb{sub 2}O{sub 5}-SnO{sub 2} mixtures and in situ formation of the Nb{sub 3}Sn is discussed in details.
Synthesis and photoluminescence of Ca-(Sn,Ti)-Si-O compounds
International Nuclear Information System (INIS)
Abe, Shunsuke; Yamane, Hisanori; Yoshida, Hisashi
2010-01-01
The phase relation of the compounds prepared in the CaO-SnO 2 -SiO 2 system at 1673 K and in the CaO-TiO 2 -SiO 2 system at 1573 K was investigated in order to explore new Ti 4+ -activated stannate phosphors. Solid solutions of Ca(Sn 1-x Ti x )SiO 5 and Ca 3 (Sn 1-y Ti y )Si 2 O 9 were synthesized at x = 0-1.0 and y = 0-0.10, respectively, and their crystal structures were analyzed by powder X-ray diffraction. Photoluminescence of these solid solutions was observed in a broad range of a visible light wavelength region under ultraviolet (UV) light excitation. The peaks of the emission band of Ca(Sn 0.97 Ti 0.03 )SiO 5 and Ca 3 (Sn 0.925 Ti 0.075 )Si 2 O 9 were at 510 nm under excitation of 252 nm and at 534 nm under excitation of 258 nm, respectively. The absorption edges estimated by the diffuse reflectance spectra were at 300 nm (4.1 eV) for CaSnSiO 5 and at 270 nm (4.6 eV) for Ca 3 SnSi 2 O 9 , suggesting that the excitation levels in Ca(Sn 1-x Ti x )SiO 5 were above the band gap of the host, although the levels in Ca 3 (Sn 1-y Ti y )Si 2 O 9 were within the band gap and near the conduction band edge.