WorldWideScience

Sample records for hiv phylogenetic relationships

  1. Assessment of phylogenetic sensitivity for reconstructing HIV-1 epidemiological relationships.

    Science.gov (United States)

    Beloukas, Apostolos; Magiorkinis, Emmanouil; Magiorkinis, Gkikas; Zavitsanou, Asimina; Karamitros, Timokratis; Hatzakis, Angelos; Paraskevis, Dimitrios

    2012-06-01

    Phylogenetic analysis has been extensively used as a tool for the reconstruction of epidemiological relations for research or for forensic purposes. It was our objective to assess the sensitivity of different phylogenetic methods and various phylogenetic programs to reconstruct epidemiological links among HIV-1 infected patients that is the probability to reveal a true transmission relationship. Multiple datasets (90) were prepared consisting of HIV-1 sequences in protease (PR) and partial reverse transcriptase (RT) sampled from patients with documented epidemiological relationship (target population), and from unrelated individuals (control population) belonging to the same HIV-1 subtype as the target population. Each dataset varied regarding the number, the geographic origin and the transmission risk groups of the sequences among the control population. Phylogenetic trees were inferred by neighbor-joining (NJ), maximum likelihood heuristics (hML) and Bayesian methods. All clusters of sequences belonging to the target population were correctly reconstructed by NJ and Bayesian methods receiving high bootstrap and posterior probability (PP) support, respectively. On the other hand, TreePuzzle failed to reconstruct or provide significant support for several clusters; high puzzling step support was associated with the inclusion of control sequences from the same geographic area as the target population. In contrary, all clusters were correctly reconstructed by hML as implemented in PhyML 3.0 receiving high bootstrap support. We report that under the conditions of our study, hML using PhyML, NJ and Bayesian methods were the most sensitive for the reconstruction of epidemiological links mostly from sexually infected individuals. Copyright © 2012 Elsevier B.V. All rights reserved.

  2. Contrasting HIV phylogenetic relationships and V3 loop protein similarities

    Energy Technology Data Exchange (ETDEWEB)

    Korber, B. (Los Alamos National Lab., NM (United States) Santa Fe Inst., NM (United States)); Myers, G. (Los Alamos National Lab., NM (United States))

    1992-01-01

    At least five distinct sequence subtypes of HIV-I can be identified from the major centers of the AMS pandemic. While it is too early to tell whether these subtypes are serologically or phenotypically similar or distinct in terms of properties such as pathogenicity and transmissibility, we can begin to investigate their potential for phenotypic divergence at the protein sequence level. Phylogenetic analysis of HIV DNA sequences is being widely used to examine lineages of different viral strains as they evolve and spread throughout the globe. We have identified five distinct HIV-1 subtypes (designated A-E), or clades, based on phylogenetic clustering patterns generated from genetic information from both the gag and envelope (env) genes from a spectrum of international isolates. Our initial observations concerning both HIV-1 and HIV-2 sequences indicate that conserved patterns in protein chemistry may indeed exist across distant lineages. Such patterns in V3 loop amino acid chemistry may be indicative of stable lineages or convergence within this highly variable, though functionally and immunologically critical, region. We think that there may be parallels between the apparently stable HIV-2 V3 lineage and the previously mentioned HIV-1 V3 loops which are very similar at the protein level despite being distant by cladistic analysis, and which do not possess the distinctive positively charged residues. Highly conserved V3 loop protein sequences are also encountered in SIVAGMs and CIVs (chimpanzee viral strains), which do not appear to be pathogenic in their wild-caught natural hosts.

  3. Contrasting HIV phylogenetic relationships and V3 loop protein similarities

    Energy Technology Data Exchange (ETDEWEB)

    Korber, B. [Los Alamos National Lab., NM (United States)]|[Santa Fe Inst., NM (United States); Myers, G. [Los Alamos National Lab., NM (United States)

    1992-12-31

    At least five distinct sequence subtypes of HIV-I can be identified from the major centers of the AMS pandemic. While it is too early to tell whether these subtypes are serologically or phenotypically similar or distinct in terms of properties such as pathogenicity and transmissibility, we can begin to investigate their potential for phenotypic divergence at the protein sequence level. Phylogenetic analysis of HIV DNA sequences is being widely used to examine lineages of different viral strains as they evolve and spread throughout the globe. We have identified five distinct HIV-1 subtypes (designated A-E), or clades, based on phylogenetic clustering patterns generated from genetic information from both the gag and envelope (env) genes from a spectrum of international isolates. Our initial observations concerning both HIV-1 and HIV-2 sequences indicate that conserved patterns in protein chemistry may indeed exist across distant lineages. Such patterns in V3 loop amino acid chemistry may be indicative of stable lineages or convergence within this highly variable, though functionally and immunologically critical, region. We think that there may be parallels between the apparently stable HIV-2 V3 lineage and the previously mentioned HIV-1 V3 loops which are very similar at the protein level despite being distant by cladistic analysis, and which do not possess the distinctive positively charged residues. Highly conserved V3 loop protein sequences are also encountered in SIVAGMs and CIVs (chimpanzee viral strains), which do not appear to be pathogenic in their wild-caught natural hosts.

  4. Phylogenetic Inference of HIV Transmission Clusters

    Directory of Open Access Journals (Sweden)

    Vlad Novitsky

    2017-10-01

    Full Text Available Better understanding the structure and dynamics of HIV transmission networks is essential for designing the most efficient interventions to prevent new HIV transmissions, and ultimately for gaining control of the HIV epidemic. The inference of phylogenetic relationships and the interpretation of results rely on the definition of the HIV transmission cluster. The definition of the HIV cluster is complex and dependent on multiple factors, including the design of sampling, accuracy of sequencing, precision of sequence alignment, evolutionary models, the phylogenetic method of inference, and specified thresholds for cluster support. While the majority of studies focus on clusters, non-clustered cases could also be highly informative. A new dimension in the analysis of the global and local HIV epidemics is the concept of phylogenetically distinct HIV sub-epidemics. The identification of active HIV sub-epidemics reveals spreading viral lineages and may help in the design of targeted interventions.HIVclustering can also be affected by sampling density. Obtaining a proper sampling density may increase statistical power and reduce sampling bias, so sampling density should be taken into account in study design and in interpretation of phylogenetic results. Finally, recent advances in long-range genotyping may enable more accurate inference of HIV transmission networks. If performed in real time, it could both inform public-health strategies and be clinically relevant (e.g., drug-resistance testing.

  5. The power and pitfalls of HIV phylogenetics in public health.

    Science.gov (United States)

    Brooks, James I; Sandstrom, Paul A

    2013-07-25

    Phylogenetics is the application of comparative studies of genetic sequences in order to infer evolutionary relationships among organisms. This tool can be used as a form of molecular epidemiology to enhance traditional population-level communicable disease surveillance. Phylogenetic study has resulted in new paradigms being created in the field of communicable diseases and this commentary aims to provide the reader with an explanation of how phylogenetics can be used in tracking infectious diseases. Special emphasis will be placed upon the application of phylogenetics as a tool to help elucidate HIV transmission patterns and the limitations to these methods when applied to forensic analysis. Understanding infectious disease epidemiology in order to prevent new transmissions is the sine qua non of public health. However, with increasing epidemiological resolution, there may be an associated potential loss of privacy to the individual. It is within this context that we aim to promote the discussion on how to use phylogenetics to achieve important public health goals, while at the same time protecting the rights of the individual.

  6. Nucleotide diversity and phylogenetic relationships among ...

    Indian Academy of Sciences (India)

    NIRAJ SINGH

    for phylogenetic analysis of Gladiolus and related taxa using combined datasets from chloroplast genome. The psbA–trnH ... phylogenetic relationships among cultivars could be useful for hybridization programmes for further improvement of the crop. [Singh N. ... breeding in nature, and exhibited diverse pollination mech-.

  7. Nucleotide diversity and phylogenetic relationships among ...

    Indian Academy of Sciences (India)

    Navya

    2 attached at the base of tree as the diverging Iridaceae relative's lineage. Present study revealed that psbA-trnH region are useful in addressing questions of phylogenetic relationships among the Gladiolus cultivars, as these intergenic spacers are more variable and have more phylogenetically informative sites than the ...

  8. Phylogenetic relationships among Maloideae species

    Science.gov (United States)

    The Maloideae is a highly diverse sub-family of the Rosaceae containing several agronomically important species (Malus sp. and Pyrus sp.) and their wild relatives. Previous phylogenetic work within the group has revealed extensive intergeneric hybridization and polyploidization. In order to develop...

  9. Nucleotide diversity and phylogenetic relationships among ...

    Indian Academy of Sciences (India)

    2017-03-03

    Mar 3, 2017 ... 2Department of Botany, D. S. B. Campus, Kumaun University, Nainital 263 001, India ... Rana T. S. 2017 Nucleotide diversity and phylogenetic relationships ... Anderson and Park 1989). ..... Edgewood Press, Edgewood, USA.

  10. Phenotypic diversity and phylogenetic relationship between the ...

    African Journals Online (AJOL)

    Phenotypic diversity and phylogenetic relationship between the Bakosi/Baweri and other pig breeds ( Sus scrofa Domesticus ) in the humid forest with monomodal rainfall agro-ecological zone of Cameroon.

  11. Phylogenetic relationship among Kenyan sorghum germplasms ...

    African Journals Online (AJOL)

    Mr Kiboi

    phylogenetic relationships based on 10 DNA fragments at AltSB loci with SbMATE, ORF9 and MITE primers. .... estimate the overall genetic diversity in Kenyan sorghum lines: Cheprot et al. 3529 ..... EARN project and Generation Challenge (GCP), ... genetics and molecular biology of plant aluminum resistance and toxicity.

  12. Molecular characterization and phylogenetic relationships among ...

    African Journals Online (AJOL)

    Molecular characterization and phylogenetic relationships among and within species of Phalaenopsis (Epidendroideae: Orchidaceae) based on RAPD analysis. ... Ph. parishii, Ph. labbi nepal, Ph. speciosa, Ph. lobbi yellow, Ph. venosa, Ph. hieroglyphica, and Ph. maculata; the third group consisted of Ph. minho princess, ...

  13. An Evaluation of Phylogenetic Methods for Reconstructing Transmitted HIV Variants using Longitudinal Clonal HIV Sequence Data

    Science.gov (United States)

    McCloskey, Rosemary M.; Liang, Richard H.; Harrigan, P. Richard; Brumme, Zabrina L.

    2014-01-01

    ABSTRACT A population of human immunodeficiency virus (HIV) within a host often descends from a single transmitted/founder virus. The high mutation rate of HIV, coupled with long delays between infection and diagnosis, make isolating and characterizing this strain a challenge. In theory, ancestral reconstruction could be used to recover this strain from sequences sampled in chronic infection; however, the accuracy of phylogenetic techniques in this context is unknown. To evaluate the accuracy of these methods, we applied ancestral reconstruction to a large panel of published longitudinal clonal and/or single-genome-amplification HIV sequence data sets with at least one intrapatient sequence set sampled within 6 months of infection or seroconversion (n = 19,486 sequences, median [interquartile range] = 49 [20 to 86] sequences/set). The consensus of the earliest sequences was used as the best possible estimate of the transmitted/founder. These sequences were compared to ancestral reconstructions from sequences sampled at later time points using both phylogenetic and phylogeny-naive methods. Overall, phylogenetic methods conferred a 16% improvement in reproducing the consensus of early sequences, compared to phylogeny-naive methods. This relative advantage increased with intrapatient sequence diversity (P reconstructing ancestral indel variation, especially within indel-rich regions of the HIV genome. Although further improvements are needed, our results indicate that phylogenetic methods for ancestral reconstruction significantly outperform phylogeny-naive alternatives, and we identify experimental conditions and study designs that can enhance accuracy of transmitted/founder virus reconstruction. IMPORTANCE When HIV is transmitted into a new host, most of the viruses fail to infect host cells. Consequently, an HIV infection tends to be descended from a single “founder” virus. A priority target for the vaccine research, these transmitted/founder viruses are

  14. Phylogenetic diversity and relationships among species of genus ...

    African Journals Online (AJOL)

    Fifty six Nicotiana species were used to construct phylogenetic trees and to asses the genetic relationships between them. Genetic distances estimated from RAPD analysis was used to construct phylogenetic trees using Phylogenetic Inference Package (PHYLIP). Since phylogenetic relationships estimated for closely ...

  15. Phylogenetics of the Danish HIV epidemic

    DEFF Research Database (Denmark)

    Audelin, Anne Margrethe; Cowan, Susan A; Obel, Niels

    2013-01-01

    BACKGROUND:: In Denmark 300 new individuals are diagnosed with HIV every year, despite decades of public health campaigns aimed to raise awareness of potential risk behaviour for HIV transmission. It is important to identify the driving forces of the epidemic, to enable more targeted campaigns...

  16. Atelinae phylogenetic relationships: the trichotomy revived?

    Science.gov (United States)

    Collins, A C

    2004-08-01

    This research examines phylogenetic relationships between members of the Atelinae subfamily (Alouatta, Ateles, Brachyteles, and Lagothrix), based on analysis of three genetic regions. Two loci, cytochrome c oxidase subunit II (COII) and the hypervariable I portion of the control region, are part of the mitochondrial genome. The other is a single-copy nuclear gene, Aldolase A Intron V. Analysis of these genetic regions provides support for tribe Alouattini containing the Alouatta species, while tribe Atelini contains the other three genera. However, these three genetic regions produce conflicting results for relationships among tribe Atelini members. Previous genetic studies supported grouping Brachyteles with Lagothrix, leaving Ateles in a separate subclade. The present data sets vary based on the genetic region analyzed and method of analysis suggesting all possible cladistic relationships. These results are more consistent with investigations of morphology and behavior among these primates. The primary cause of discrepancy between this study and previous genetic studies is postulated to reside in increased sampling in the present study of genetic variation among members of the Atelinae, specifically Ateles. The present study utilized samples of Ateles from all postulated species for this genetically variable primate, while previous studies used only one or two species of Ateles. This paper demonstrates that shifting relationships are produced when different species of Ateles are used to reconstruct phylogenies. This research concludes that a trichotomy should still be supported between members of tribe Atelini until further analyses, which include additional Atelinae haplotypes are conducted. Copyright 2003 Wiley-Liss, Inc.

  17. Ultrastructure, biology, and phylogenetic relationships of kinorhyncha.

    Science.gov (United States)

    Neuhaus, Birger; Higgins, Robert P

    2002-07-01

    The article summarizes current knowledge mainly about the (functional) morphology and ultrastructure, but also about the biology, development, and evolution of the Kinorhyncha. The Kinorhyncha are microscopic, bilaterally symmetrical, exclusively free-living, benthic, marine animals and ecologically part of the meiofauna. They occur throughout the world from the intertidal to the deep sea, generally in sediments but sometimes associated with plants or other animals. From adult stages 141 species are known, but 38 species have been described from juvenile stages. The trunk is arranged into 11 segments as evidenced by cuticular plates, sensory spots, setae or spines, nervous system, musculature, and subcuticular glands. The ultrastructure of several organ systems and the postembryonic development are known for very few species. Almost no data are available about the embryology and only a single gene has been sequenced for a single species. The phylogenetic relationships within Kinorhyncha are unresolved. Priapulida, Loricifera, and Kinorhyncha are grouped together as Scalidophora, but arguments are found for every possible sistergroup relationship within this taxon. The recently published Ecdysozoa hypothesis suggests a closer relationship of the Scalidophora, Nematoda, Nematomorpha, Tardigrada, Onychophora, and Arthropoda.

  18. Phylogenetic relationships of African sunbird-like warblers: Moho ...

    African Journals Online (AJOL)

    Phylogenetic relationships of African sunbird-like warblers: Moho ( Hypergerus atriceps ), Green Hylia ( Hylia prasina ) and Tit-hylia ( Pholidornis rushiae ) ... different points in avian evolution reduces the phylogenetic signal in molecular sequence data, making difficult the reconstruction of relationships among taxa resulting ...

  19. Phylogenetic relationships of the lancelets of the genus ...

    African Journals Online (AJOL)

    phylogenetic relationships of the Branchiostoma lancelets from South (Xiamen) and North (Qingdao and Rizhao) China, and phylogenetic trees constructed also included the existing data from Japanese waters. The genetic distances of the lancelets between South and North China averaged 0.19, 0.21, and 0.17 based on ...

  20. Mitochondrial DNA sequence-based phylogenetic relationship ...

    Indian Academy of Sciences (India)

    cophaga ranges from 0.037–0.106 and 0.049–0.207 for COI and ND5 genes, respectively (tables 2 and 3). Analysis of genetic distance on the basis of sequence difference for both the mitochondrial genes shows very little genetic difference. The discrepancy in the phylogenetic trees based on individ- ual genes may be due ...

  1. Analysis of HIV subtypes and the phylogenetic tree in HIV-positive samples from Saudi Arabia

    International Nuclear Information System (INIS)

    Al-Zahrani, Alhusain J.

    2008-01-01

    Objective was to assess the prevalence of HIV-1 genetic subtypes in Saudi Arabia in samples that are serologically positive for HIV-1 and compare the HIV-1 genetic subtypes prevalent in Saudi Arabia with the subtypes prevalent in other countries. Thirty-nine HIV-1 positive samples were analyzed for HIV-1 subtypes using molecular techniques. The study is retrospective study that was conducted in Dammam, Kingdom of Saudi Arabia and in Abbott laboratories (United States of America) from2004 to 2007. All samples were seropositive for HIV-1 group M. Of the 39 seropositive samples, only 12 were polymerase chain reaction positive. Subtype C is the most common virus strain as it occurred in 58% of these samples; subtype B occurred in 17%; subtypes A, D and G were found in 8% each. The phylogenetic tree was also identified for the isolates. Detection of HIV subtypes is important for epidemiological purposes and may help in tracing the source of HIV infections in the Kingdom of Saudi Arabia. (author)

  2. The combination of phylogenetic analysis with epidemiological and serological data to track HIV-1 transmission in a sexual transmission case.

    Directory of Open Access Journals (Sweden)

    Min Chen

    Full Text Available To investigate the linkage of HIV transmission from a man to a woman through unprotected sexual contact without disclosing his HIV-positive status.Combined with epidemiological information and serological tests, phylogenetic analysis was used to test the a priori hypothesis of HIV transmission from the man to the woman. Control subjects, infected with HIV through heterosexual intercourse, from the same location were also sampled. Phylogenetic analyses were performed using the consensus gag, pol and env sequences obtained from blood samples of the man, the woman and the local control subjects. The env quasispecies of the man, the woman, and two controls were also obtained using single genome amplification and sequencing (SGA/S to explore the paraphyletic relationship by phylogenetic analysis.Epidemiological information and serological tests indicated that the man was infected with HIV-1 earlier than the woman. Phylogenetic analyses of the consensus sequences showed a monophyletic cluster for the man and woman in all three genomic regions. Furthermore, gag sequences of the man and woman shared a unique recombination pattern from subtype B and C, which was different from those of CRF07_BC or CRF08_BC observed in the local samples. These indicated that the viral sequences from the two subjects display a high level of similarity. Further, viral quasispecies from the man exhibited a paraphyletic relationship with those from the woman in the Bayesian and maximum-likelihood (ML phylogenetic trees of the env region, which supported the transmission direction from the man to the woman.In the context of epidemiological and serological evidence, the results of phylogenetic analyses support the transmission from the man to the woman.

  3. HIV-1 phylogenetic analysis shows HIV-1 transits through the meninges to brain and peripheral tissues.

    Science.gov (United States)

    Lamers, Susanna L; Gray, Rebecca R; Salemi, Marco; Huysentruyt, Leanne C; McGrath, Michael S

    2011-01-01

    Brain infection by the human immunodeficiency virus type 1 (HIV-1) has been investigated in many reports with a variety of conclusions concerning the time of entry and degree of viral compartmentalization. To address these diverse findings, we sequenced HIV-1 gp120 clones from a wide range of brain, peripheral and meningeal tissues from five patients who died from several HIV-1 associated disease pathologies. High-resolution phylogenetic analysis confirmed previous studies that showed a significant degree of compartmentalization in brain and peripheral tissue subpopulations. Some intermixing between the HIV-1 subpopulations was evident, especially in patients that died from pathologies other than HIV-associated dementia. Interestingly, the major tissue harboring virus from both the brain and peripheral tissues was the meninges. These results show that (1) HIV-1 is clearly capable of migrating out of the brain, (2) the meninges are the most likely primary transport tissues, and (3) infected brain macrophages comprise an important HIV reservoir during highly active antiretroviral therapy. Copyright © 2010 Elsevier B.V. All rights reserved.

  4. Phylogenetic analysis of HIV-1 pol gene: first subgenomic evidence of CRF29-BF among Iranian HIV-1 patients

    Directory of Open Access Journals (Sweden)

    Kazem Baesi

    2014-09-01

    Full Text Available Objective: To identify the dominant subtype among the HIV-1 strains circulation in Iran. Methods: In this cross sectional study 100 HIV positive patients participated. HIV-1 RNA was extracted from plasma. RT nested-PCR was performed and the final products were sequenced and phylogenetically analyzed; reference sequences were downloaded from Los Alamos, aligned with Iranian pol sequences in the study and analyzed by neighbor-joining method. Results: The results of the phylogenetic analysis showed that HIV-1 subtype CRF-35AD was the dominant subtype among HIV-1 infected patients in Iran; this analysis also suggested a new circulating recombinant form that had not previously been identified in Iran: CRF-29BF. Conclusions: The impact of HIV diversity on pathogenesis, transmission and clinical management have been discussed in different studies; therefore, analyses of HIV genetic diversity is required to design effective antiretroviral strategies for different HIV subtypes.

  5. Phylogenetic relationships among members of the Pachydactylus ...

    African Journals Online (AJOL)

    The Pachydactylus capensis group is a phenetically-defined assemblage of five small-bodied geckos broadly distributed in eastern southern Africa. Several additional small-bodied Pachydactylus have been historically considered subspecies of P. capensis or members of this group. To assess evolutionary relationships ...

  6. Phylogenetic relationships within and among Brassica species from ...

    African Journals Online (AJOL)

    STORAGESEVER

    2008-05-02

    May 2, 2008 ... Inappropriate tree reconstruction methods would pose a problem only in the basal relationships rather than in terminal taxa; the paraphyly observed in this study applied mostly to terminal taxa. This study recovered sufficient phylogenetic characters to separate accessions of the same species, making.

  7. Phylogenetic reconstruction of transmission events from individuals with acute HIV infection: toward more-rigorous epidemiological definitions

    NARCIS (Netherlands)

    Brown, Alison E.; Gifford, Robert J.; Clewley, Jonathan P.; Kucherer, Claudia; Masquelier, Bernard; Porter, Kholoud; Balotta, Claudia; Back, Nicole K. T.; Jorgensen, Louise Bruun; de Mendoza, Carmen; Bhaskaran, Krishnan; Gill, O. Noel; Johnson, Anne M.; Pillay, Deenan; del Amo, Julia; Meyer, Laurence; Bucher, Heiner; Chene, Genevieve; Prins, Maria; Rosinska, Magda; Sabin, Caroline; Touloumi, Giota; Lodi, Sara; Walker, Sarah; Babiker, Abdel; Darbyshire, Janet; de Luca, Andrea; Fisher, Martin; Muga, Roberto; Kaldor, John; Kelleher, Tony; Ramacciotti, Tim; Gelgor, Linda; Cooper, David; Smith, Don; Gill, John; Nielsen, Claus; Pedersen, Court; Lutsar, Irja; Dabis, Francois; Thiebaut, Rodolphe; Costagliola, Dominique; Guiguet, Marguerite; Vanhems, Philippe; Boufassa, Faroudy; Hamouda, Osamah; Pantazis, Nikos; Hatzakis, Angelos; Geskus, Ronald; Coutinho, Roel

    2009-01-01

    Phylogenetic reconstructions of transmission events from individuals with acute human immunodeficiency virus (HIV) infection are conducted to illustrate this group's heightened infectivity. Varied definitions of acute infection and assumptions about observed phylogenetic clusters may produce

  8. Inference of Transmission Network Structure from HIV Phylogenetic Trees.

    Science.gov (United States)

    Giardina, Federica; Romero-Severson, Ethan Obie; Albert, Jan; Britton, Tom; Leitner, Thomas

    2017-01-01

    Phylogenetic inference is an attractive means to reconstruct transmission histories and epidemics. However, there is not a perfect correspondence between transmission history and virus phylogeny. Both node height and topological differences may occur, depending on the interaction between within-host evolutionary dynamics and between-host transmission patterns. To investigate these interactions, we added a within-host evolutionary model in epidemiological simulations and examined if the resulting phylogeny could recover different types of contact networks. To further improve realism, we also introduced patient-specific differences in infectivity across disease stages, and on the epidemic level we considered incomplete sampling and the age of the epidemic. Second, we implemented an inference method based on approximate Bayesian computation (ABC) to discriminate among three well-studied network models and jointly estimate both network parameters and key epidemiological quantities such as the infection rate. Our ABC framework used both topological and distance-based tree statistics for comparison between simulated and observed trees. Overall, our simulations showed that a virus time-scaled phylogeny (genealogy) may be substantially different from the between-host transmission tree. This has important implications for the interpretation of what a phylogeny reveals about the underlying epidemic contact network. In particular, we found that while the within-host evolutionary process obscures the transmission tree, the diversification process and infectivity dynamics also add discriminatory power to differentiate between different types of contact networks. We also found that the possibility to differentiate contact networks depends on how far an epidemic has progressed, where distance-based tree statistics have more power early in an epidemic. Finally, we applied our ABC inference on two different outbreaks from the Swedish HIV-1 epidemic.

  9. Limited overlap between phylogenetic HIV and hepatitis C virus clusters illustrates the dynamic sexual network structure of Dutch HIV-infected MSM.

    Science.gov (United States)

    Vanhommerig, Joost W; Bezemer, Daniela; Molenkamp, Richard; Van Sighem, Ard I; Smit, Colette; Arends, Joop E; Lauw, Fanny N; Brinkman, Kees; Rijnders, Bart J; Newsum, Astrid M; Bruisten, Sylvia M; Prins, Maria; Van Der Meer, Jan T; Van De Laar, Thijs J; Schinkel, Janke

    2017-09-24

    MSM are at increased risk for infection with HIV-1 and hepatitis C virus (HCV). Is HIV/HCV coinfection confined to specific HIV transmission networks? A HIV phylogenetic tree was constructed for 5038 HIV-1 subtype B polymerase (pol) sequences obtained from MSM in the AIDS therapy evaluation in the Netherlands cohort. We investigated the existence of HIV clusters with increased HCV prevalence, the HIV phylogenetic density (i.e. the number of potential HIV transmission partners) of HIV/HCV-coinfected MSM compared with HIV-infected MSM without HCV, and the overlap in HIV and HCV phylogenies using HCV nonstructural protein 5B sequences from 183 HIV-infected MSM with acute HCV infection. Five hundred and sixty-three of 5038 (11.2%) HIV-infected MSM tested HCV positive. Phylogenetic analysis revealed 93 large HIV clusters (≥10 MSM), 370 small HIV clusters (2-9 MSM), and 867 singletons with a median HCV prevalence of 11.5, 11.6, and 9.3%, respectively. We identified six large HIV clusters with elevated HCV prevalence (range 23.5-46.2%). Median HIV phylogenetic densities for MSM with HCV (3, interquartile range 1-7) and without HCV (3, interquartile range 1-8) were similar. HCV phylogeny showed 12 MSM-specific HCV clusters (clustersize: 2-39 HCV sequences); 12.7% of HCV infections were part of the same HIV and HCV cluster. We observed few HIV clusters with elevated HCV prevalence, no increase in the HIV phylogenetic density of HIV/HCV-coinfected MSM compared to HIV-infected MSM without HCV, and limited overlap between HIV and HCV phylogenies among HIV/HCV-coinfected MSM. Our data do not support the existence of MSM-specific sexual networks that fuel both the HIV and HCV epidemic.

  10. Phylogenetic relationships among species of Lutzomyia, subgenus Lutzomyia (Diptera: Psychodidae).

    Science.gov (United States)

    Pinto, Israel S; Filho, José D Andrade; Santos, Claudiney B; Falqueto, Aloísio; Leite, Yuri L R

    2010-01-01

    Lutzomyia França is the largest and most diverse sand fly genus in the New World and contains all the species involved in the transmission of American visceral leishmaniasis (AVL). Morphological characters were used to test the monophyly and to infer phylogenetic relationships among members of the Lutzomyia subgenus. Fifty-two morphological characters from male and female adult specimens belonging to 18 species of Lu. (Lutzomyia) were scored and analyzed. The resulting phylogeny confirms the monophyly of this subgenus and reveals four main internal clades. These four clades, however, do not support the classification of the subgenus in two series, longipalpis and cavernicola, because neither is necessarily monophyletic. Knowledge on phylogenetic relationships among these relevant vectors of AVL should be used as a tool for monitoring target taxa and a first step for establishing an early warning system for disease control.

  11. Phylogenetically informed logic relationships improve detection of biological network organization

    Science.gov (United States)

    2011-01-01

    Background A "phylogenetic profile" refers to the presence or absence of a gene across a set of organisms, and it has been proven valuable for understanding gene functional relationships and network organization. Despite this success, few studies have attempted to search beyond just pairwise relationships among genes. Here we search for logic relationships involving three genes, and explore its potential application in gene network analyses. Results Taking advantage of a phylogenetic matrix constructed from the large orthologs database Roundup, we invented a method to create balanced profiles for individual triplets of genes that guarantee equal weight on the different phylogenetic scenarios of coevolution between genes. When we applied this idea to LAPP, the method to search for logic triplets of genes, the balanced profiles resulted in significant performance improvement and the discovery of hundreds of thousands more putative triplets than unadjusted profiles. We found that logic triplets detected biological network organization and identified key proteins and their functions, ranging from neighbouring proteins in local pathways, to well separated proteins in the whole pathway, and to the interactions among different pathways at the system level. Finally, our case study suggested that the directionality in a logic relationship and the profile of a triplet could disclose the connectivity between the triplet and surrounding networks. Conclusion Balanced profiles are superior to the raw profiles employed by traditional methods of phylogenetic profiling in searching for high order gene sets. Gene triplets can provide valuable information in detection of biological network organization and identification of key genes at different levels of cellular interaction. PMID:22172058

  12. Phylogenetic relationships of Hemiptera inferred from mitochondrial and nuclear genes.

    Science.gov (United States)

    Song, Nan; Li, Hu; Cai, Wanzhi; Yan, Fengming; Wang, Jianyun; Song, Fan

    2016-11-01

    Here, we reconstructed the Hemiptera phylogeny based on the expanded mitochondrial protein-coding genes and the nuclear 18S rRNA gene, separately. The differential rates of change across lineages may associate with long-branch attraction (LBA) effect and result in conflicting estimates of phylogeny from different types of data. To reduce the potential effects of systematic biases on inferences of topology, various data coding schemes, site removal method, and different algorithms were utilized in phylogenetic reconstruction. We show that the outgroups Phthiraptera, Thysanoptera, and the ingroup Sternorrhyncha share similar base composition, and exhibit "long branches" relative to other hemipterans. Thus, the long-branch attraction between these groups is suspected to cause the failure of recovering Hemiptera under the homogeneous model. In contrast, a monophyletic Hemiptera is supported when heterogeneous model is utilized in the analysis. Although higher level phylogenetic relationships within Hemiptera remain to be answered, consensus between analyses is beginning to converge on a stable phylogeny.

  13. HIV forensics: pitfalls and acceptable standards in the use of phylogenetic analysis as evidence in criminal investigations of HIV transmission.

    Science.gov (United States)

    Bernard, E J; Azad, Y; Vandamme, A M; Weait, M; Geretti, A M

    2007-09-01

    Phylogenetic analysis - the study of the genetic relatedness between HIV strains - has recently been used in criminal prosecutions as evidence of responsibility for HIV transmission. In these trials, the expert opinion of virologists has been of critical importance. Phylogenetic analysis of HIV gene sequences is complex and its findings do not achieve the levels of certainty obtained with the forensic analysis of human DNA. Although two individuals may carry HIV strains that are closely related, these will not necessarily be unique to the two parties and could extend to other persons within the same transmission network. For forensic purposes, phylogenetic analysis should be conducted under strictly controlled conditions by laboratories with relevant expertise applying rigorous methods. It is vitally important to include the right controls, which should be epidemiologically and temporally relevant to the parties under investigation. Use of inappropriate controls can exaggerate any relatedness between the virus strains of the complainant and defendant as being strikingly unique. It will be often difficult to obtain the relevant controls. If convenient but less appropriate controls are used, interpretation of the findings should be tempered accordingly. Phylogenetic analysis cannot prove that HIV transmission occurred directly between two individuals. However, it can exonerate individuals by demonstrating that the defendant carries a virus strain unrelated to that of the complainant. Expert witnesses should acknowledge the limitations of the inferences that might be made and choose the correct language in both written and verbal testimony.

  14. Phylogenetic relationships, diversification and expansion of chili peppers (Capsicum, Solanaceae)

    Science.gov (United States)

    Carrizo García, Carolina; Barfuss, Michael H. J.; Sehr, Eva M.; Barboza, Gloria E.; Samuel, Rosabelle; Moscone, Eduardo A.; Ehrendorfer, Friedrich

    2016-01-01

    Background and Aims Capsicum (Solanaceae), native to the tropical and temperate Americas, comprises the well-known sweet and hot chili peppers and several wild species. So far, only partial taxonomic and phylogenetic analyses have been done for the genus. Here, the phylogenetic relationships between nearly all taxa of Capsicum were explored to test the monophyly of the genus and to obtain a better knowledge of species relationships, diversification and expansion. Methods Thirty-four of approximately 35 Capsicum species were sampled. Maximum parsimony and Bayesian inference analyses were performed using two plastid markers (matK and psbA-trnH) and one single-copy nuclear gene (waxy). The evolutionary changes of nine key features were reconstructed following the parsimony ancestral states method. Ancestral areas were reconstructed through a Bayesian Markov chain Monte Carlo analysis. Key Results Capsicum forms a monophyletic clade, with Lycianthes as a sister group, following both phylogenetic approaches. Eleven well-supported clades (four of them monotypic) can be recognized within Capsicum, although some interspecific relationships need further analysis. A few features are useful to characterize different clades (e.g. fruit anatomy, chromosome base number), whereas some others are highly homoplastic (e.g. seed colour). The origin of Capsicum is postulated in an area along the Andes of western to north-western South America. The expansion of the genus has followed a clockwise direction around the Amazon basin, towards central and south-eastern Brazil, then back to western South America, and finally northwards to Central America. Conclusions New insights are provided regarding interspecific relationships, character evolution, and geographical origin and expansion of Capsicum. A clearly distinct early-diverging clade can be distinguished, centred in western–north-western South America. Subsequent rapid speciation has led to the origin of the remaining clades. The

  15. Different relationships between temporal phylogenetic turnover and phylogenetic similarity and in two forests were detected by a new null model.

    Science.gov (United States)

    Huang, Jian-Xiong; Zhang, Jian; Shen, Yong; Lian, Ju-yu; Cao, Hong-lin; Ye, Wan-hui; Wu, Lin-fang; Bin, Yue

    2014-01-01

    Ecologists have been monitoring community dynamics with the purpose of understanding the rates and causes of community change. However, there is a lack of monitoring of community dynamics from the perspective of phylogeny. We attempted to understand temporal phylogenetic turnover in a 50 ha tropical forest (Barro Colorado Island, BCI) and a 20 ha subtropical forest (Dinghushan in southern China, DHS). To obtain temporal phylogenetic turnover under random conditions, two null models were used. The first shuffled names of species that are widely used in community phylogenetic analyses. The second simulated demographic processes with careful consideration on the variation in dispersal ability among species and the variations in mortality both among species and among size classes. With the two models, we tested the relationships between temporal phylogenetic turnover and phylogenetic similarity at different spatial scales in the two forests. Results were more consistent with previous findings using the second null model suggesting that the second null model is more appropriate for our purposes. With the second null model, a significantly positive relationship was detected between phylogenetic turnover and phylogenetic similarity in BCI at a 10 m×10 m scale, potentially indicating phylogenetic density dependence. This relationship in DHS was significantly negative at three of five spatial scales. This could indicate abiotic filtering processes for community assembly. Using variation partitioning, we found phylogenetic similarity contributed to variation in temporal phylogenetic turnover in the DHS plot but not in BCI plot. The mechanisms for community assembly in BCI and DHS vary from phylogenetic perspective. Only the second null model detected this difference indicating the importance of choosing a proper null model.

  16. Nosocomial HIV-transmission in an outpatient clinic detected by epidemiologicaland phylogenetic analyses

    DEFF Research Database (Denmark)

    Katzenstein, T.L.; Jørgensen, L.B.; H, Permin

    1999-01-01

    .9% respectively. In addition, GP harboured HIV RNA with a foscarnet resistance mutation further lendingsupport to virus from the foscarnet-treated FDL being the source of the infection. Interestingly, GP experienced increases inimmunoglobulin production after contracting the HIV-infection, and decreases after...... antiretroviral-induced viral suppression. Aclinical procedure which, under stressful conditions, could lead to breaches in infection control measures was identified. The source ofthe infection was most likely a contaminated multidose vial. CONCLUSION: Through epidemiological and phylogenetic analyses acase...

  17. Molecular and phylogenetic analysis of HIV-1 variants circulating in Italy

    Directory of Open Access Journals (Sweden)

    Sbreglia Costanza

    2008-10-01

    Full Text Available Abstract Objective The continuous identification of HIV-1 non-B subtypes and recombinant forms in Italy indicates the need of constant molecular epidemiology survey of genetic forms circulating and transmitted in the resident population. Methods The distribution of HIV-1 subtypes has been evaluated in 25 seropositive individuals residing in Italy, most of whom were infected through a sexual route during the 1995–2005 period. Each sample has been characterized by detailed molecular and phylogenetic analyses. Results 18 of the 25 samples were positive at HIV-1 PCR amplification. Three samples showed a nucleotide divergence compatible with a non-B subtype classification. The phylogenetic analysis, performed on both HIV-1 env and gag regions, confirms the molecular sub-typing prediction, given that 1 sample falls into the C subtype and 2 into the G subtype. The B subtype isolates show high levels of intra-subtype nucleotide divergence, compatible with a long-lasting epidemic and a progressive HIV-1 molecular diversification. Conclusion The Italian HIV-1 epidemic is still mostly attributable to the B subtype, regardless the transmission route, which shows an increasing nucleotide heterogeneity. Heterosexual transmission and the interracial blending, however, are slowly introducing novel HIV-1 subtypes. Therefore, a molecular monitoring is needed to follow the constant evolution of the HIV-1 epidemic.

  18. Forensic application of phylogenetic analyses - Exploration of suspected HIV-1 transmission case.

    Science.gov (United States)

    Siljic, Marina; Salemovic, Dubravka; Cirkovic, Valentina; Pesic-Pavlovic, Ivana; Ranin, Jovan; Todorovic, Marija; Nikolic, Slobodan; Jevtovic, Djordje; Stanojevic, Maja

    2017-03-01

    Transmission of human immunodeficiency virus (HIV) between individuals may have important legal implications and therefore may come to require forensic investigation based upon phylogenetic analysis. In criminal trials results of phylogenetic analyses have been used as evidence of responsibility for HIV transmission. In Serbia, as in many countries worldwide, exposure and deliberate transmission of HIV are criminalized. We present the results of applying state of the art phylogenetic analyses, based on pol and env genetic sequences, in exploration of suspected HIV transmission among three subjects: a man and two women, with presumed assumption of transmission direction from one woman to a man. Phylogenetic methods included relevant neighbor-joining (NJ), maximum likelihood (ML) and Bayesian methods of phylogenetic trees reconstruction and hypothesis testing, that has been shown to be the most sensitive for the reconstruction of epidemiological links mostly from sexually infected individuals. End-point limiting-dilution PCR (EPLD-PCR) assay, generating the minimum of 10 sequences per genetic region per subject, was performed to assess HIV quasispecies distribution and to explore the direction of HIV transmission between three subjects. Phylogenetic analysis revealed that the viral sequences from the three subjects were more genetically related to each other than to other strains circulating in the same area with the similar epidemiological profile, forming strongly supported transmission chain, which could be in favour of a priori hypothesis of one of the women infecting the man. However, in the EPLD based phylogenetic trees for both pol and env genetic region, viral sequences of one subject (man) were paraphyletic to those of two other subjects (women), implying the direction of transmission opposite to the a priori assumption. The dated tree in our analysis confirmed the clustering pattern of query sequences. Still, in the context of unsampled sequences and

  19. Phylogenetic relationships, diversification and expansion of chili peppers (Capsicum, Solanaceae).

    Science.gov (United States)

    Carrizo García, Carolina; Barfuss, Michael H J; Sehr, Eva M; Barboza, Gloria E; Samuel, Rosabelle; Moscone, Eduardo A; Ehrendorfer, Friedrich

    2016-07-01

    Capsicum (Solanaceae), native to the tropical and temperate Americas, comprises the well-known sweet and hot chili peppers and several wild species. So far, only partial taxonomic and phylogenetic analyses have been done for the genus. Here, the phylogenetic relationships between nearly all taxa of Capsicum were explored to test the monophyly of the genus and to obtain a better knowledge of species relationships, diversification and expansion. Thirty-four of approximately 35 Capsicum species were sampled. Maximum parsimony and Bayesian inference analyses were performed using two plastid markers (matK and psbA-trnH) and one single-copy nuclear gene (waxy). The evolutionary changes of nine key features were reconstructed following the parsimony ancestral states method. Ancestral areas were reconstructed through a Bayesian Markov chain Monte Carlo analysis. Capsicum forms a monophyletic clade, with Lycianthes as a sister group, following both phylogenetic approaches. Eleven well-supported clades (four of them monotypic) can be recognized within Capsicum, although some interspecific relationships need further analysis. A few features are useful to characterize different clades (e.g. fruit anatomy, chromosome base number), whereas some others are highly homoplastic (e.g. seed colour). The origin of Capsicum is postulated in an area along the Andes of western to north-western South America. The expansion of the genus has followed a clockwise direction around the Amazon basin, towards central and south-eastern Brazil, then back to western South America, and finally northwards to Central America. New insights are provided regarding interspecific relationships, character evolution, and geographical origin and expansion of Capsicum A clearly distinct early-diverging clade can be distinguished, centred in western-north-western South America. Subsequent rapid speciation has led to the origin of the remaining clades. The diversification of Capsicum has culminated in the origin

  20. An attempt to reconstruct phylogenetic relationships within Caribbean nummulitids: simulating relationships and tracing character evolution

    Science.gov (United States)

    Eder, Wolfgang; Ives Torres-Silva, Ana; Hohenegger, Johann

    2017-04-01

    Phylogenetic analysis and trees based on molecular data are broadly applied and used to infer genetical and biogeographic relationship in recent larger foraminifera. Molecular phylogenetic is intensively used within recent nummulitids, however for fossil representatives these trees are only of minor informational value. Hence, within paleontological studies a phylogenetic approach through morphometric analysis is of much higher value. To tackle phylogenetic relationships within the nummulitid family, a much higher number of morphological character must be measured than are commonly used in biometric studies, where mostly parameters describing embryonic size (e.g., proloculus diameter, deuteroloculus diameter) and/or the marginal spiral (e.g., spiral diagrams, spiral indices) are studied. For this purpose 11 growth-independent and/or growth-invariant characters have been used to describe the morphological variability of equatorial thin sections of seven Carribbean nummulitid taxa (Nummulites striatoreticulatus, N. macgillavry, Palaeonummulites willcoxi, P.floridensis, P. soldadensis, P.trinitatensis and P.ocalanus) and one outgroup taxon (Ranikothalia bermudezi). Using these characters, phylogenetic trees were calculated using a restricted maximum likelihood algorithm (REML), and results are cross-checked by ordination and cluster analysis. Square-change parsimony method has been run to reconstruct ancestral states, as well as to simulate the evolution of the chosen characters along the calculated phylogenetic tree and, independent - contrast analysis was used to estimate confidence intervals. Based on these simulations, phylogenetic tendencies of certain characters proposed for nummulitids (e.g., Cope's rule or nepionic acceleration) can be tested, whether these tendencies are valid for the whole family or only for certain clades. At least, within the Carribean nummulitids, phylogenetic trends along some growth-independent characters of the embryo (e.g., first

  1. Phylogenetic relationships and evolutionary patterns of the order Collodaria (Radiolaria.

    Directory of Open Access Journals (Sweden)

    Yoshiyuki Ishitani

    Full Text Available Collodaria are the only group of Radiolaria that has a colonial lifestyle. This group is potentially the most important plankton in the oligotrophic ocean because of its large biomass and the high primary productivity associated with the numerous symbionts inside a cell or colony. The evolution of Collodaria could thus be related to the changes in paleo-productivity that have affected organic carbon fixation in the oligotrophic ocean. However, the fossil record of Collodaria is insufficient to trace their abundance through geological time, because most collodarians do not have silicified shells. Recently, molecular phylogeny based on nuclear small sub-unit ribosomal DNA (SSU rDNA confirmed Collodaria to be one of five orders of Radiolaria, though the relationship among collodarians is still unresolved because of inadequate taxonomic sampling. Our phylogenetic analysis has revealed four novel collodarian sequences, on the basis of which collodarians can be divided into four clades that correspond to taxonomic grouping at the family level: Thalassicollidae, Collozoidae, Collosphaeridae, and Collophidae. Comparison of the results of our phylogenetic analyses with the morphological characteristics of each collodarian family suggests that the first ancestral collodarians had a solitary lifestyle and left no silica deposits. The timing of events estimated from molecular divergence calculations indicates that naked collodarian lineages first appeared around 45.6 million years (Ma ago, coincident with the diversification of diatoms in the pelagic oceans. Colonial collodarians appeared after the formation of the present ocean circulation system and the development of oligotrophic conditions in the equatorial Pacific (ca. 33.4 Ma ago. The divergence of colonial collodarians probably caused a shift in the efficiency of primary production during this period.

  2. Phylogenetic Relationships and Evolutionary Patterns of the Order Collodaria (Radiolaria)

    Science.gov (United States)

    Ishitani, Yoshiyuki; Ujiié, Yurika; de Vargas, Colomban; Not, Fabrice; Takahashi, Kozo

    2012-01-01

    Collodaria are the only group of Radiolaria that has a colonial lifestyle. This group is potentially the most important plankton in the oligotrophic ocean because of its large biomass and the high primary productivity associated with the numerous symbionts inside a cell or colony. The evolution of Collodaria could thus be related to the changes in paleo-productivity that have affected organic carbon fixation in the oligotrophic ocean. However, the fossil record of Collodaria is insufficient to trace their abundance through geological time, because most collodarians do not have silicified shells. Recently, molecular phylogeny based on nuclear small sub-unit ribosomal DNA (SSU rDNA) confirmed Collodaria to be one of five orders of Radiolaria, though the relationship among collodarians is still unresolved because of inadequate taxonomic sampling. Our phylogenetic analysis has revealed four novel collodarian sequences, on the basis of which collodarians can be divided into four clades that correspond to taxonomic grouping at the family level: Thalassicollidae, Collozoidae, Collosphaeridae, and Collophidae. Comparison of the results of our phylogenetic analyses with the morphological characteristics of each collodarian family suggests that the first ancestral collodarians had a solitary lifestyle and left no silica deposits. The timing of events estimated from molecular divergence calculations indicates that naked collodarian lineages first appeared around 45.6 million years (Ma) ago, coincident with the diversification of diatoms in the pelagic oceans. Colonial collodarians appeared after the formation of the present ocean circulation system and the development of oligotrophic conditions in the equatorial Pacific (ca. 33.4 Ma ago). The divergence of colonial collodarians probably caused a shift in the efficiency of primary production during this period. PMID:22567112

  3. Resolving ambiguity in the phylogenetic relationship of genotypes A, B, and C of hepatitis B virus

    Science.gov (United States)

    2013-01-01

    Background Hepatitis B virus (HBV) is an important infectious agent that causes widespread concern because billions of people are infected by at least 8 different HBV genotypes worldwide. However, reconstruction of the phylogenetic relationship between HBV genotypes is difficult. Specifically, the phylogenetic relationships among genotypes A, B, and C are not clear from previous studies because of the confounding effects of genotype recombination. In order to clarify the evolutionary relationships, a rigorous approach is required that can effectively explore genetic sequences with recombination. Result In the present study, phylogenetic relationship of the HBV genotypes was reconstructed using a consensus phylogeny of phylogenetic trees of HBV genome segments. Reliability of the reconstructed phylogeny was extensively evaluated in agreements of local phylogenies of genome segments. The reconstructed phylogenetic tree revealed that HBV genotypes B and C had a closer phylogenetic relationship than genotypes A and B or A and C. Evaluations showed the consensus method was capable to reconstruct reliable phylogenetic relationship in the presence of recombinants. Conclusion The consensus method implemented in this study provides an alternative approach for reconstructing reliable phylogenetic relationships for viruses with possible genetic recombination. Our approach revealed the phylogenetic relationships of genotypes A, B, and C of HBV. PMID:23758960

  4. Phylogenetic relationships within and among Brassica species from ...

    African Journals Online (AJOL)

    Consequently, two potentially susceptible B. napus accessions were identified. The high polymorphic information content (PIC) and number of phylogenetically informative bands established RAPD as a useful tool for phylogenetic reconstruction, quantification of genetic diversity for conservation, cultivar classification and ...

  5. Exploring the relationship between sequence similarity and accurate phylogenetic trees.

    Science.gov (United States)

    Cantarel, Brandi L; Morrison, Hilary G; Pearson, William

    2006-11-01

    We have characterized the relationship between accurate phylogenetic reconstruction and sequence similarity, testing whether high levels of sequence similarity can consistently produce accurate evolutionary trees. We generated protein families with known phylogenies using a modified version of the PAML/EVOLVER program that produces insertions and deletions as well as substitutions. Protein families were evolved over a range of 100-400 point accepted mutations; at these distances 63% of the families shared significant sequence similarity. Protein families were evolved using balanced and unbalanced trees, with ancient or recent radiations. In families sharing statistically significant similarity, about 60% of multiple sequence alignments were 95% identical to true alignments. To compare recovered topologies with true topologies, we used a score that reflects the fraction of clades that were correctly clustered. As expected, the accuracy of the phylogenies was greatest in the least divergent families. About 88% of phylogenies clustered over 80% of clades in families that shared significant sequence similarity, using Bayesian, parsimony, distance, and maximum likelihood methods. However, for protein families with short ancient branches (ancient radiation), only 30% of the most divergent (but statistically significant) families produced accurate phylogenies, and only about 70% of the second most highly conserved families, with median expectation values better than 10(-60), produced accurate trees. These values represent upper bounds on expected tree accuracy for sequences with a simple divergence history; proteins from 700 Giardia families, with a similar range of sequence similarities but considerably more gaps, produced much less accurate trees. For our simulated insertions and deletions, correct multiple sequence alignments did not perform much better than those produced by T-COFFEE, and including sequences with expressed sequence tag-like sequencing errors did not

  6. Phylogenetic versus functional signals in the evolution of form-function relationships in terrestrial vision.

    Science.gov (United States)

    Motani, Ryosuke; Schmitz, Lars

    2011-08-01

    Phylogeny is deeply pertinent to evolutionary studies. Traits that perform a body function are expected to be strongly influenced by physical "requirements" of the function. We investigated if such traits exhibit phylogenetic signals, and, if so, how phylogenetic noises bias quantification of form-function relationships. A form-function system that is strongly influenced by physics, namely the relationship between eye morphology and visual optics in amniotes, was used. We quantified the correlation between form (i.e., eye morphology) and function (i.e., ocular optics) while varying the level of phylogenetic bias removal through adjusting Pagel's λ. Ocular soft-tissue dimensions exhibited the highest correlation with ocular optics when 1% of phylogenetic bias expected from Brownian motion was removed (i.e., λ= 0.01); the value for hard-tissue data were 8%. A small degree of phylogenetic bias therefore exists in morphology despite of the stringent functional constraints. We also devised a phylogenetically informed discriminant analysis and recorded the effects of phylogenetic bias on this method using the same data. Use of proper λ values during phylogenetic bias removal improved misidentification rates in resulting classifications when prior probabilities were assumed to be equal. Even a small degree of phylogenetic bias affected the classification resulting from phylogenetically informed discriminant analysis. © 2011 The Author(s). Evolution© 2011 The Society for the Study of Evolution.

  7. Relationship between Knowledge and Attitude towards HIV ...

    African Journals Online (AJOL)

    The study assessed the relationship between knowledge and attitude towards HIV voluntary counselling among secondary school adolescents in Edo State. One hypothesis guided the study. This was a descriptive correlational study based on survey research design. The population of the study was one hundred and ...

  8. Phylogenetic relationships of Chaetomium isolates based on the ...

    African Journals Online (AJOL)

    Molecular characterization of 18 Chaetomium isolates collected from India based on the internal transcribed spacer (ITS) region of the rRNA gene sequences was done. Phylogenetic analysis of full length ITS region showed that Chaetomium globosum isolates, Cg1, Cg2, Cg6, Cg11 and Cg15, Chaetomium spp. isolates, ...

  9. Host specificity and phylogenetic relationships of chicken and turkey parvoviruses

    Science.gov (United States)

    Previous reports indicate that the newly discovered chicken parvoviruses (ChPV) and turkey parvoviruses (TuPV) are very similar to each other, yet they represent different species within a new genus of Parvoviridae. Currently, strain classification is based on the phylogenetic analysis of a 561 bas...

  10. Phylogenetic relationships of Chaetomium isolates based on the ...

    African Journals Online (AJOL)

    Biotech Unit

    2013-02-27

    Feb 27, 2013 ... Phylogenetic analysis of Chaetomium species. The evolutionary history was inferred using the maximum parsimony method. The bootstrap consensus tree inferred from. 1000 replicates is taken to represent the evolutionary history of the taxa analyzed (Felsenstein, 1985). The MP tree was obtained using.

  11. Delineation of Streptococcus dysgalactiae, its subspecies, and its clinical and phylogenetic relationship to Streptococcus pyogenes

    DEFF Research Database (Denmark)

    Jensen, Anders; Kilian, Mogens

    2011-01-01

    The close phylogenetic relationship of the important pathogen Streptococcus pneumoniae and several species of commensal streptococci, particularly Streptococcus mitis and Streptococcus pseudopneumoniae, and the recently demonstrated sharing of genes and phenotypic traits previously considered...

  12. Phylogenetic characteristics of HIV-1 among travelers entering China from Myanmar: A retrospective study.

    Science.gov (United States)

    Zhang, Li; Wang, Binhui; Liang, Yaobo; Feng, Yue; Dong, Shuwei; Wang, Yajuan; Li, Yaping; Zhang, A-Mei; Liu, Li; Qin, Weihong; Xia, Xueshan

    2017-08-01

    Due to the open policy of the Chinese government, a large number of Burmese individuals enter China at land ports in Yunnan province for travel or business. However, the situation of HIV-1 infection and its phylogenetic characteristics among these travelers remains unclear, which is a potential threat to public health. From January 2003 to December 2012, a total of 1,961 travelers were detected to be positive for HIV-1 infection at land ports between Myanmar and Yunnan province, China. From 1153 (58.8%) Burmese of them, we randomly collected 489 serum samples for HIV-1 subtype/recombinant analysis. Based on successfully obtained 223 gag-RT sequences, 187 of them were genotyped as 2 subtypes and 3 CRFs. CRF01_AE was showed to be the most prevalent genotype (54.3%), followed by subtypes C (13.5%) and B (10.8%). Notably, CRF07_BC (1.3%) and CRF08_BC (4.0%) were mainly distributed in travelers from Shan state and Kachin (91.7%, 11/12), but was not found in travelers from the capital city of Yangon (0/16). Additionally, there were 36 samples (16.1%) were preliminary determined as unique recombinant forms (URFs). The higher HIV-1 infection among entering travelers from Myanmar and its diverse and complex genotypes distribution suggest this bridge population may facilitate the transmission of HIV-1. It is necessary to have the strict monitoring on this population for prevention of HIV-1 cross-border transmission. © 2017 Wiley Periodicals, Inc.

  13. Phylogenetic relationships among populations of Pristurus rupestris Blanford,1874 (Sauria: Sphaerodactylidae) in southern Iran

    OpenAIRE

    YOUSOFI, SUGOL; POUYANI, ESKANDAR RASTEGAR; HOJATI, VIDA

    2015-01-01

    We examined intraspecific relationships of the subspecies Pristurus rupestris iranicus from the northern Persian Gulf area (Hormozgan, Bushehr, and Sistan and Baluchestan provinces). Phylogenetic relationships among these samples were estimated based on the mitochondrial cytochrome b gene. We used three methods of phylogenetic tree reconstruction (maximum likelihood, maximum parsimony, and Bayesian inference). The sampled populations were divided into 5 clades but exhibit little genetic diver...

  14. Molecular and phylogenetic analysis of HIV-1 variants circulating among injecting drug users in Mashhad-Iran

    Directory of Open Access Journals (Sweden)

    Buonaguro FM

    2006-09-01

    Full Text Available Abstract Genetic and phylogenetic information on the HIV-1 epidemic in Middle-East Countries, and in particular in Iran, are extremely limited. By March 2004, the Iranian Ministry of Health officially reported a cumulative number of 6'532 HIV positive individuals and 214 AIDS cases in the Iranian HIV-1 epidemic. The intra-venous drug users (IDUs represent the group at highest risk for HIV-1 infection in Iran, accounting for almost 63% of all HIV-infected population. In this regards, a molecular phylogenetic study has been performed on a sentinel cohort of HIV-1 seropositive IDUs enrolled at the end of 2005 at the University of Mashhad, the largest city North East of Tehran. The study has been performed on both gag and env subgenomic regions amplified by Polymerase Chain Reaction (PCR from peripheral blood mononuclear cells (PBMCs and characterized by direct DNA sequence analysis. The results reported here show that the HIV-1 subtype A is circulating in this IDUs sentinel cohort. Moreover, the single phylogenetic cluster as well as the intra-group low nucleotide divergence is indicative of a recent outbreak. Unexpectedly, the Iranian samples appear to be phylogenetically derived from African Sub-Saharan subtype A viruses, raising stirring speculations on HIV-1 introduction into the IDUs epidemic in Mashhad. This sentinel study could represent the starting point for a wider molecular survey of the HIV-1 epidemics in Iran to evaluate in detail the distribution of genetic subtypes and possible natural drug-resistant variants, which are extremely helpful information to design diagnostic and therapeutic strategies.

  15. Assessing the relationships between phylogenetic and functional singularities in sharks (Chondrichthyes).

    Science.gov (United States)

    Cachera, Marie; Le Loc'h, François

    2017-08-01

    The relationships between diversity and ecosystem functioning have become a major focus of science. A crucial issue is to estimate functional diversity, as it is intended to impact ecosystem dynamics and stability. However, depending on the ecosystem, it may be challenging or even impossible to directly measure ecological functions and thus functional diversity. Phylogenetic diversity was recently under consideration as a proxy for functional diversity. Phylogenetic diversity is indeed supposed to match functional diversity if functions are conservative traits along evolution. However, in case of adaptive radiation and/or evolutive convergence, a mismatch may appear between species phylogenetic and functional singularities. Using highly threatened taxa, sharks, this study aimed to explore the relationships between phylogenetic and functional diversities and singularities. Different statistical computations were used in order to test both methodological issue (phylogenetic reconstruction) and overall a theoretical questioning: the predictive power of phylogeny for function diversity. Despite these several methodological approaches, a mismatch between phylogeny and function was highlighted. This mismatch revealed that (i) functions are apparently nonconservative in shark species, and (ii) phylogenetic singularity is not a proxy for functional singularity. Functions appeared to be not conservative along the evolution of sharks, raising the conservational challenge to identify and protect both phylogenetic and functional singular species. Facing the current rate of species loss, it is indeed of major importance to target phylogenetically singular species to protect genetic diversity and also functionally singular species in order to maintain particular functions within ecosystem.

  16. Conformation of phylogenetic relationship of Penaeidae shrimp based on morphometric and molecular investigations.

    Science.gov (United States)

    Rajakumaran, P; Vaseeharan, B; Jayakumar, R; Chidambara, R

    2014-01-01

    Understanding of accurate phylogenetic relationship among Penaeidae shrimp is important for academic and fisheries industry. The Morphometric and Randomly amplified polymorphic DNA (RAPD) analysis was used to make the phylogenetic relationsip among 13 Penaeidae shrimp. For morphometric analysis forty variables and total lengths of shrimp were measured for each species, and removed the effect of size variation. The size normalized values obtained was subjected to UPGMA (Unweighted Pair-Group Method with Arithmetic Mean) cluster analysis. For RAPD analysis, the four primers showed reliable differentiation between species, and used correlation coefficient between the DNA banding patterns of 13 Penaeidae species to construct UPGMA dendrogram. Phylogenetic relationship from morphometric and molecular analysis for Penaeidae species found to be congruent. We concluded that as the results from morphometry investigations concur with molecular one, phylogenetic relationship obtained for the studied Penaeidae are considered to be reliable.

  17. NGS combined with phylogenetic analysis to detect HIV-1 dual infection in Romanian people who inject drugs.

    Science.gov (United States)

    Popescu, Bogdan; Banica, Leontina; Nicolae, Ionelia; Radu, Eugen; Niculescu, Iulia; Abagiu, Adrian; Otelea, Dan; Paraschiv, Simona

    2018-04-04

    Dual HIV infections are possible and likely in people who inject drugs (PWID). Thirty-eight newly diagnosed patients, 19 PWID and 19 heterosexually HIV infected were analysed. V2-V3 loop of HIV-1 env gene was sequenced on the NGS platform 454 GSJunior (Roche). HIV-1 dual/multiple infections were identified in five PWID. For three of these patients, the reconstructed variants belonged to pure F1 subtype and CRF14_BG strains according to phylogenetic analysis. New recombinant forms between these parental strains were identified in two PWID samples. NGS data can provide, with the help of phylogenetic analysis, important insights about the intra-host sub-population structure. Copyright © 2018. Published by Elsevier Masson SAS.

  18. Phylogenetic relationships among anuran trypanosomes as revealed by riboprinting.

    Science.gov (United States)

    Clark, C G; Martin, D S; Diamond, L S

    1995-01-01

    Twenty trypanosome isolates from Anura (frogs and toads) assigned to several species were characterized by riboprinting-restriction enzyme digestion of polymerase chain reaction amplified small subunit ribosomal RNA genes. Restriction site polymorphisms allowed distinction of all the recognized species and no intraspecific variation in riboprint patterns was detected. Phylogenetic reconstruction using parsimony and distance estimates based on restriction fragment comigration showed Trypanosoma chattoni to be only distantly related to the other species, while T. ranarum and T. fallisi appear to be sister taxa despite showing non-overlapping host specificities.

  19. The phylogenetic relationships among infraorders and superfamilies of Diptera based on morphological evidence

    DEFF Research Database (Denmark)

    Lambkin, Christine L.; Sinclair, Bradley J.; Pape, Thomas

    2013-01-01

    Members of the megadiverse insect order Diptera (flies) have successfully colonized all continents and nearly all habitats. There are more than 154 000 described fly species, representing 1012% of animal species. Elucidating the phylogenetic relationships of such a large component of global...... biodiversity is challenging, but significant advances have been made in the last few decades. Since Hennig first discussed the monophyly of major groupings, Diptera has attracted much study, but most researchers have used non-numerical qualitative methods to assess morphological data. More recently......, quantitative phylogenetic methods have been used on both morphological and molecular data. All previous quantitative morphological studies addressed narrower phylogenetic problems, often below the suborder or infraorder level. Here we present the first numerical analysis of phylogenetic relationships...

  20. Phylogenetic relationships of the South American Doradoidea (Ostariophysi: Siluriformes

    Directory of Open Access Journals (Sweden)

    José L. O. Birindelli

    Full Text Available A phylogenetic analysis based on 311 morphological characters is presented for most species of the Doradidae, all genera of the Auchenipteridae, and representatives of 16 other catfish families. The hypothesis that was derived from the six most parsimonious trees support the monophyly of the South American Doradoidea (Doradidae plus Auchenipteridae, as well as the monophyly of the clade Doradoidea plus the African Mochokidae. In addition, the clade with Sisoroidea plus Aspredinidae was considered sister to Doradoidea plus Mochokidae. Within the Auchenipteridae, the results support the monophyly of the Centromochlinae and Auchenipterinae. The latter is composed of Tocantinsia, and four monophyletic units, two small with Asterophysusand Liosomadoras, and Pseudotatiaand Pseudauchenipterus, respectively, and two large ones with the remaining genera. Within the Doradidae, parsimony analysis recovered Wertheimeriaas sister to Kalyptodoras, composing a clade sister to all remaining doradids, which include Franciscodorasand two monophyletic groups: Astrodoradinae (plus Acanthodorasand Agamyxis and Doradinae (new arrangement. Wertheimerinae, new subfamily, is described for Kalyptodoras and Wertheimeria. Doradinae is corroborated as monophyletic and composed of four groups, one including Centrochirand Platydoras, the other with the large-size species of doradids (except Oxydoras, another with Orinocodoras, Rhinodoras, and Rhynchodoras, and another with Oxydorasplus all the fimbriate-barbel doradids. Based on the results, the species of Opsodoras are included in Hemidoras; and Tenellus, new genus, is described to include Nemadoras trimaculatus, N. leporhinusand Nemadoras ternetzi. Due to conflicting hypotheses of the phylogenetic position of Acanthodoras, Agamyxis, and Franciscodoras, these are considered as incertae sedisin Doradidae. All suprageneric taxa of the Doradoidea are diagnosed based on synapomorphic morphological characteristics.

  1. Current Understanding of Ecdysozoa and its Internal Phylogenetic Relationships.

    Science.gov (United States)

    Giribet, Gonzalo; Edgecombe, Gregory D

    2017-09-01

    Twenty years after its proposal, the monophyly of molting protostomes-Ecdysozoa-is a well-corroborated hypothesis, but the interrelationships of its major subclades are more ambiguous than is commonly appreciated. Morphological and molecular support for arthropods, onychophorans and tardigrades as a clade (Panarthropoda) continues to be challenged by a grouping of tardigrades with Nematoida in some molecular analyses, although onychophorans are consistently recovered as the sister group of arthropods. The status of Cycloneuralia and Scalidophora, each proposed by morphologists in the 1990s and widely employed in textbooks, is in flux: Cycloneuralia is typically non-monophyletic in molecular analyses, and Scalidophora is either contradicted or incompletely tested because of limited genomic and transcriptomic data for Loricifera, Kinorhyncha, and Priapulida. However, novel genomic data across Ecdysozoa should soon be available to tackle these difficult phylogenetic questions. The Cambrian fossil record indicates crown-group members of various ecdysozoan phyla as well as stem-group taxa that assist with reconstructing the most recent common ancestor of panarthropods and cycloneuralians. © The Author 2017. Published by Oxford University Press on behalf of the Society for Integrative and Comparative Biology. All rights reserved. For permissions please email: journals.permissions@oup.com.

  2. Phylogenetic relationships of North American Gomphidae and their close relatives

    Science.gov (United States)

    Intrafamilial relationships among clubtail dragonflies (Gomphidae) have been the subject of many morphological studies, but have not yet been systematically evaluated using molecular data. Here we present the first molecular phylogeny of Gomphidae. We include six of the eight sub...

  3. HIV-1 subtype D infections among Caucasians from Northwestern Poland--phylogenetic and clinical analysis.

    Directory of Open Access Journals (Sweden)

    Miłosz Parczewski

    Full Text Available BACKGROUND: HIV-1 subtype D infections, which are associated with a faster rate of progression and lymphocyte CD4 decline, cognitive deficit and higher mortality, have rarely been found in native Europeans. In Northwestern Poland, however, infections with this subtype had been identified. This study aimed to analyze the sequence and clinical data for patients with subtype D using molecular phylogeography and identify transmission clusters and ancestry, as well as drug resistance, baseline HIV tropism and antiretroviral treatment efficacy. METHODS: Phylogenetic analyses of local HIV-1 subtype D sequences were performed, with time to the most recent common ancestor inferred using bayesian modeling. Sequence and drug resistance data were linked with the clinical and epidemiological information. RESULTS: Subtype D was found in 24 non-immigrant Caucasian, heterosexually infected patients (75% of females, median age at diagnosis of 49.5 years; IQR: 29-56 years. Partial pol sequences clustered monophyletically with the clades of Ugandan origin and no evidence of transmission from other European countries was found. Time to the most common recent ancestor was 1989.24 (95% HPD: 1968.83-1994.46. Baseline drug resistance to nucleoside reverse transcriptase inhibitors was observed in 54.5% of cases (mutations: M41L, K103N, T215S/D with evidence of clustering, no baseline integrase or protease resistance and infrequent non-R5 tropism (13.6%. Virologic failure was observed in 60% of cases and was associated with poor adherence (p<0.001 and subsequent development of drug resistance (p = 0.008, OR: 20 (95%CI: 1.7-290. CONCLUSIONS: Local subtype D represented an independently transmitted network with probably single index case, high frequency of primary drug resistance and evidence of transmission clusters.

  4. Phylogenetic relationships among vietnamese cocoa accessions using a non-coding region of the chloroplast dna

    International Nuclear Information System (INIS)

    Ha, L.T.V.; Dung, T.N.; Phuoc, P.H.D.

    2017-01-01

    Cocoa cultivation has increased in tropical areas around the world, including Vietnam, due to the high demand of cocoa beans for chocolate production. The genetic diversity of cocoa genotypes is recognized to be complex, however, their phylogenetic relationships need to be clarified. The present study aimed to classify the cocoa genotypes, that are imported and cultivated in Vietnam, based on a chloroplast DNA region. Sixty-three Vietnamese Cocoa accessions were collected from different regions in Southern Vietnam. Their phylogenetic relationships were identified using the universal primers c-B49317 and d-A49855 from the chloroplast DNA region. The sequences were situated in the trnL intron genes which are identify the closest terrestrial plant species of the chloroplast genome. DNA sequences were determined and subjected to an analysis of the phylogenetic relationship using the maximum evolution method. The genetic analysis showed clustering of 63 cocoa accessions in three groups: the domestically cultivated Trinitario group, the Indigenous cultivars, and the cultivations from Peru. The analyzed sequencing data also illustrated that the TD accessions and CT accessions were related genetically closed. Based on those results the genetic relation between PA and NA accessions was established as the hybrid origins of the TD and CT accessions. Some foreign accessions, including UIT, SCA and IMC accessions were confirmed of their genetic relationship. The present study is the first report of phylogenetic relationships of Vietnamese cocoa collections. The cocoa program in Vietnam has been in development for thirty years. (author)

  5. Phylogenetic studies of transmission dynamics in generalized HIV epidemics: An essential tool where the burden is greatest?

    Science.gov (United States)

    Dennis, Ann M.; Herbeck, Joshua T.; Brown, Andrew Leigh; Kellam, Paul; de Oliveira, Tulio; Pillay, Deenan; Fraser, Christophe; Cohen, Myron S.

    2014-01-01

    Efficient and effective HIV prevention measures for generalized epidemics in sub-Saharan Africa have not yet been validated at the population-level. Design and impact evaluation of such measures requires fine-scale understanding of local HIV transmission dynamics. The novel tools of HIV phylogenetics and molecular epidemiology may elucidate these transmission dynamics. Such methods have been incorporated into studies of concentrated HIV epidemics to identify proximate and determinant traits associated with ongoing transmission. However, applying similar phylogenetic analyses to generalized epidemics, including the design and evaluation of prevention trials, presents additional challenges. Here we review the scope of these methods and present examples of their use in concentrated epidemics in the context of prevention. Next, we describe the current uses for phylogenetics in generalized epidemics, and discuss their promise for elucidating transmission patterns and informing prevention trials. Finally, we review logistic and technical challenges inherent to large-scale molecular epidemiological studies of generalized epidemics, and suggest potential solutions. PMID:24977473

  6. A phylogenetic perspective on the individual species-area relationship in temperate and tropical tree communities.

    Science.gov (United States)

    Yang, Jie; Swenson, Nathan G; Cao, Min; Chuyong, George B; Ewango, Corneille E N; Howe, Robert; Kenfack, David; Thomas, Duncan; Wolf, Amy; Lin, Luxiang

    2013-01-01

    Ecologists have historically used species-area relationships (SARs) as a tool to understand the spatial distribution of species. Recent work has extended SARs to focus on individual-level distributions to generate individual species area relationships (ISARs). The ISAR approach quantifies whether individuals of a species tend have more or less species richness surrounding them than expected by chance. By identifying richness 'accumulators' and 'repellers', respectively, the ISAR approach has been used to infer the relative importance of abiotic and biotic interactions and neutrality. A clear limitation of the SAR and ISAR approaches is that all species are treated as evolutionarily independent and that a large amount of work has now shown that local tree neighborhoods exhibit non-random phylogenetic structure given the species richness. Here, we use nine tropical and temperate forest dynamics plots to ask: (i) do ISARs change predictably across latitude?; (ii) is the phylogenetic diversity in the neighborhood of species accumulators and repellers higher or lower than that expected given the observed species richness?; and (iii) do species accumulators, repellers distributed non-randomly on the community phylogenetic tree? The results indicate no clear trend in ISARs from the temperate zone to the tropics and that the phylogenetic diversity surrounding the individuals of species is generally only non-random on very local scales. Interestingly the distribution of species accumulators and repellers was non-random on the community phylogenies suggesting the presence of phylogenetic signal in the ISAR across latitude.

  7. Phylogenetic relationships in the "grossulariae" species group of the genus Aphis (Hemiptera: Sternorrhyncha: Aphididae): Molecular evidence

    DEFF Research Database (Denmark)

    Turcinaviciene, Jorga; Rakauskas, Rimantas; Pedersen, Bo Vest

    2006-01-01

    Phylogenetic relationships among Palaearctic Ribes and/or Onagraceae inhabiting Aphis species from five countries were examined using mitochondrial gene cytochrome oxidase I (CO-I) and nuclear gene elongation factor 1 a (EF-1a) sequences. There was no major conflict between the trees obtained fro...

  8. SICLE: a high-throughput tool for extracting evolutionary relationships from phylogenetic trees

    Directory of Open Access Journals (Sweden)

    Dan F. DeBlasio

    2016-08-01

    Full Text Available We present the phylogeny analysis software SICLE (Sister Clade Extractor, an easy-to-use, high-throughput tool to describe the nearest neighbors to a node of interest in a phylogenetic tree as well as the support value for the relationship. The application is a command line utility that can be embedded into a phylogenetic analysis pipeline or can be used as a subroutine within another C++ program. As a test case, we applied this new tool to the published phylome of Salinibacter ruber, a species of halophilic Bacteriodetes, identifying 13 unique sister relationships to S. ruber across the 4,589 gene phylogenies. S. ruber grouped with bacteria, most often other Bacteriodetes, in the majority of phylogenies, but 91 phylogenies showed a branch-supported sister association between S. ruber and Archaea, an evolutionarily intriguing relationship indicative of horizontal gene transfer. This test case demonstrates how SICLE makes it possible to summarize the phylogenetic information produced by automated phylogenetic pipelines to rapidly identify and quantify the possible evolutionary relationships that merit further investigation. SICLE is available for free for noncommercial use at http://eebweb.arizona.edu/sicle/.

  9. SICLE: a high-throughput tool for extracting evolutionary relationships from phylogenetic trees.

    Science.gov (United States)

    DeBlasio, Dan F; Wisecaver, Jennifer H

    2016-01-01

    We present the phylogeny analysis software SICLE (Sister Clade Extractor), an easy-to-use, high-throughput tool to describe the nearest neighbors to a node of interest in a phylogenetic tree as well as the support value for the relationship. The application is a command line utility that can be embedded into a phylogenetic analysis pipeline or can be used as a subroutine within another C++ program. As a test case, we applied this new tool to the published phylome of Salinibacter ruber, a species of halophilic Bacteriodetes, identifying 13 unique sister relationships to S. ruber across the 4,589 gene phylogenies. S. ruber grouped with bacteria, most often other Bacteriodetes, in the majority of phylogenies, but 91 phylogenies showed a branch-supported sister association between S. ruber and Archaea, an evolutionarily intriguing relationship indicative of horizontal gene transfer. This test case demonstrates how SICLE makes it possible to summarize the phylogenetic information produced by automated phylogenetic pipelines to rapidly identify and quantify the possible evolutionary relationships that merit further investigation. SICLE is available for free for noncommercial use at http://eebweb.arizona.edu/sicle/.

  10. Multigene analysis of lophophorate and chaetognath phylogenetic relationships.

    Science.gov (United States)

    Helmkampf, Martin; Bruchhaus, Iris; Hausdorf, Bernhard

    2008-01-01

    Maximum likelihood and Bayesian inference analyses of seven concatenated fragments of nuclear-encoded housekeeping genes indicate that Lophotrochozoa is monophyletic, i.e., the lophophorate groups Bryozoa, Brachiopoda and Phoronida are more closely related to molluscs and annelids than to Deuterostomia or Ecdysozoa. Lophophorates themselves, however, form a polyphyletic assemblage. The hypotheses that they are monophyletic and more closely allied to Deuterostomia than to Protostomia can be ruled out with both the approximately unbiased test and the expected likelihood weights test. The existence of Phoronozoa, a putative clade including Brachiopoda and Phoronida, has also been rejected. According to our analyses, phoronids instead share a more recent common ancestor with bryozoans than with brachiopods. Platyhelminthes is the sister group of Lophotrochozoa. Together these two constitute Spiralia. Although Chaetognatha appears as the sister group of Priapulida within Ecdysozoa in our analyses, alternative hypothesis concerning chaetognath relationships could not be rejected.

  11. [Comparative leaf anatomy and phylogenetic relationships of 11 species of Laeliinae with emphasis on Brassavola (Orchidaceae)].

    Science.gov (United States)

    Noguera-Savelli, Eliana; Jáuregui, Damelis

    2011-09-01

    Brassavola inhabits a wide altitude range and habitat types from Northern Mexico to Northern Argentina. Classification schemes in plants have normally used vegetative and floral characters, but when species are very similar, as in this genus, conflicts arise in species delimitation, and alternative methods should be applied. In this study we explored the taxonomic and phylogenetic value of the anatomical structure of leaves in Brassavola; as ingroup, seven species of Brassavola were considered, and as an outgroup Guarianthe skinneri, Laelia anceps, Rhyncholaelia digbyana and Rhyncholaelia glauca were evaluated. Leaf anatomical characters were studied in freehand cross sections of the middle portion with a light microscope. Ten vegetative anatomical characters were selected and coded for the phylogenetic analysis. Phylogenetic reconstruction was carried out under maximum parsimony using the program NONA through WinClada. Overall, Brassavola species reveal a wide variety of anatomical characters, many of them associated with xeromorphic plants: thick cuticle, hypodermis and cells of the mesophyll with spiral thickenings in the secondary wall. Moreover, mesophyll is either homogeneous or heterogeneous, often with extravascular bundles of fibers near the epidermis at both terete and flat leaves. All vascular bundles are collateral, arranged in more than one row in the mesophyll. The phylogenetic analysis did not resolve internal relationships of the genus; we obtained a polytomy, indicating that the anatomical characters by themselves have little phylogenetic value in Brassavola. We concluded that few anatomical characters are phylogenetically important; however, they would provide more support to elucidate the phylogenetic relantionships in the Orchidaceae and other plant groups if they are used in conjunction with morphological and/or molecular characters.

  12. Comparative analyses of plastid genomes from fourteen Cornales species: inferences for phylogenetic relationships and genome evolution.

    Science.gov (United States)

    Fu, Chao-Nan; Li, Hong-Tao; Milne, Richard; Zhang, Ting; Ma, Peng-Fei; Yang, Jing; Li, De-Zhu; Gao, Lian-Ming

    2017-12-08

    The Cornales is the basal lineage of the asterids, the largest angiosperm clade. Phylogenetic relationships within the order were previously not fully resolved. Fifteen plastid genomes representing 14 species, ten genera and seven families of Cornales were newly sequenced for comparative analyses of genome features, evolution, and phylogenomics based on different partitioning schemes and filtering strategies. All plastomes of the 14 Cornales species had the typical quadripartite structure with a genome size ranging from 156,567 bp to 158,715 bp, which included two inverted repeats (25,859-26,451 bp) separated by a large single-copy region (86,089-87,835 bp) and a small single-copy region (18,250-18,856 bp) region. These plastomes encoded the same set of 114 unique genes including 31 transfer RNA, 4 ribosomal RNA and 79 coding genes, with an identical gene order across all examined Cornales species. Two genes (rpl22 and ycf15) contained premature stop codons in seven and five species respectively. The phylogenetic relationships among all sampled species were fully resolved with maximum support. Different filtering strategies (none, light and strict) of sequence alignment did not have an effect on these relationships. The topology recovered from coding and noncoding data sets was the same as for the whole plastome, regardless of filtering strategy. Moreover, mutational hotspots and highly informative regions were identified. Phylogenetic relationships among families and intergeneric relationships within family of Cornales were well resolved. Different filtering strategies and partitioning schemes do not influence the relationships. Plastid genomes have great potential to resolve deep phylogenetic relationships of plants.

  13. Using phylogenetic analysis to trace HIV-1 migration among western European injecting drug users seroconverting from 1984 to 1997

    NARCIS (Netherlands)

    Op de Coul, E. L.; Prins, M. [= Maria; Cornelissen, M.; van der Schoot, A.; Boufassa, F.; Brettle, R. P.; Hernández-Aguado, L.; Schiffer, V.; McMenamin, J.; Rezza, G.; Robertson, R.; Zangerle, R.; Goudsmit, J.; Coutinho, R. A.; Lukashov, V. V.

    2001-01-01

    OBJECTIVE: To reconstruct the epidemiological relationships of the HIV epidemics among injecting drug users (IDU) in western Europe. METHODS: HIV env V3 sequences of and epidemiological data were obtained from 145 IDU who seroconverted in three sequential periods: 1984-1988, 1989-1992 and 1993-1997.

  14. The phylogenetic relationships of endemic Australasian trichostrongylin families (Nematoda: Strongylida) parasitic in marsupials and monotremes.

    Science.gov (United States)

    Chilton, Neil B; Huby-Chilton, Florence; Koehler, Anson V; Gasser, Robin B; Beveridge, Ian

    2015-10-01

    The phylogenetic relationships of the endemic (or largely endemic) Australasian trichostrongylin nematode families Herpetostrongylidae, Mackerrastrongylidae and Nicollinidae as well as endemic trichostrongylin nematodes currently placed in the families Trichostrongylidae and Molineidae were examined using the complete large subunit (28S) ribosomal RNA gene. The Herpetostrongylinae proved to be monophyletic. However, representatives of the Nicollinidae nested with the Herpetostrongylinae. The Mackerrastrongylidae was also a monophyletic group and included Peramelistrongylus, currently classified within the Trichostrongylidae. The Globocephaloidinae, currently considered to be a subfamily of the Herpetostrongylidae, was excluded from the family in the current analysis. Ollulanus and Libyostrongylus, included for the first time in a molecular phylogenetic analysis, were placed within the Trichostrongylidae. This study provided strong support for the Herpetostrongylidae (including within it the Nicollinidae, but excluding the Globocephaloidinae) and the Mackerrastrongylidae as monophyletic assemblages. Additional studies are required to resolve the relationships of the remaining endemic Australasian trichostrongylin genera.

  15. Possible sister groups and phylogenetic relationships among selected North Pacific and North Atlantic Rhodophyta

    Science.gov (United States)

    Lindstrom, Sandra C.

    1987-09-01

    Although the cool temperate (boreal) waters of the N. Pacific and N. Atlantic share many similar if not identical species, there have been few studies to test the identity of these species pairs. Whereas such tests are important from a taxonomic perspective, they tell us little if anything about biogeographic relationships. A more useful approach is one employing phylogenetic systematics (cladistics). The interpretation of phylogenetic diagrams (cladograms) in terms of biogeographic area relationships is explained. It is argued that cladistic analyses of taxa occurring in the cool temperate waters of the northern oceans can provide biogeographic tracks, which in turn can suggest the origins and migrations of species and possibly even floras. A number of cool temperate taxa that appear particularly amenable to this approach are discussed, including genera in the Palmariaceae, Corallinaceae, Dumontiaceae, Solieriaceae, Petrocelidaceae, Ceramiaceae and Rhodomelaceae.

  16. PHYLOGENETIC RELATIONSHIPS AMONG VIETNAMESE COCOA ACCESSIONS USING A NON-CODING REGION OF THE CHLOROPLAST DNA

    OpenAIRE

    Lam Thi, Viet Ha; D.T., Khang; Everaert, Helena; T.N, Dung; P.H.D, Phuoc; H.T., Toan; Dewettinck, Koen; Messens, Kathy

    2017-01-01

    Cocoa (Theobroma cacao L.) cultivation has increased in tropical areas around the world, including Vietnam, due to the high demand of cocoa beans for chocolate production. The genetic diversity of cocoa genotypes is recognized to be complex, however, their phylogenetic relationships need to be clarified. The present study aimed to classify the cocoa genotypes that are imported and cultivated in Vietnam based on a chloroplast DNA region. Sixty-three Vietnamese Cocoa accessions were collected f...

  17. Phylogenetic Relationships of Pseudorasbora, Pseudopungtungia, and Pungtungia (Teleostei; Cypriniformes; Gobioninae Inferred from Multiple Nuclear Gene Sequences

    Directory of Open Access Journals (Sweden)

    Keun-Yong Kim

    2013-01-01

    Full Text Available Gobionine species belonging to the genera Pseudorasbora, Pseudopungtungia, and Pungtungia (Teleostei; Cypriniformes; Cyprinidae have been heavily studied because of problems on taxonomy, threats of extinction, invasion, and human health. Nucleotide sequences of three nuclear genes, that is, recombination activating protein gene 1 (rag1, recombination activating gene 2 (rag2, and early growth response 1 gene (egr1, from Pseudorasbora, Pseudopungtungia, and Pungtungia species residing in China, Japan, and Korea, were analyzed to elucidate their intergeneric and interspecific phylogenetic relationships. In the phylogenetic tree inferred from their multiple gene sequences, Pseudorasbora, Pseudopungtungia and Pungtungia species ramified into three phylogenetically distinct clades; the “tenuicorpa” clade composed of Pseudopungtungia tenuicorpa, the “parva” clade composed of all Pseudorasbora species/subspecies, and the “herzi” clade composed of Pseudopungtungia nigra, and Pungtungia herzi. The genus Pseudorasbora was recovered as monophyletic, while the genus Pseudopungtungia was recovered as polyphyletic. Our phylogenetic result implies the unstable taxonomic status of the genus Pseudopungtungia.

  18. Phylogenetic groups among Klebsiella pneumoniae isolates from Brazil: relationship with antimicrobial resistance and origin.

    Science.gov (United States)

    de Melo, Maíra Espíndola Silva; Cabral, Adriane Borges; Maciel, Maria Amélia Vieira; da Silveira, Vera Magalhães; de Souza Lopes, Ana Catarina

    2011-05-01

    The objectives of this study were to determine the distribution of phylogenetic groups among Klebsiella pneumoniae isolates from Recife, Brazil and to assess the relationship between the groups and the isolation sites and resistance profile. Ninety four isolates of K. pneumoniae from hospital or community infections and from normal microbiota were analyzed by gyrA PCR-RFLP, antibiotic susceptibility, and adonitol fermentation. The results revealed the distinction of three phylogenetic groups, as it has also been reported in Europe, showing that these clusters are highly conserved within K. pneumoniae. Group KpI was dominantly represented by hospital and community isolates while groups KpII and KpIII displayed mainly normal microbiota isolates. The resistance to third generation cephalosporins, aztreonam, imipenem, amoxicillin/clavulanic acid, and streptomycin was only observed in KpI. The percentage of resistance was higher in KpI, followed by KpII and KpIII. The differences in the distribution of K. pneumoniae phylogenetic groups observed in this study suggest distinctive clinical and epidemiological characteristics among the three groups, which is important to understand the epidemiology of infections caused by this organism. This is the first study in Brazil on K. pneumoniae isolates from normal microbiota and community infections regarding the distribution of phylogenetic groups based on the gyrA gene.

  19. Evidence for a close phylogenetic relationship between Melissococcus pluton, the causative agent of European foulbrood disease, and the genus Enterococcus.

    Science.gov (United States)

    Cai, J; Collins, M D

    1994-04-01

    The 16S rRNA gene sequence of Melissococcus pluton, the causative agent of European foulbrood disease, was determined in order to investigate the phylogenetic relationships between this organism and other low-G + C-content gram-positive bacteria. A comparative sequence analysis revealed that M. pluton is a close phylogenetic relative of the genus Enterococcus.

  20. Phylogenetic relationships of typical antbirds (Thamnophilidae and test of incongruence based on Bayes factors

    Directory of Open Access Journals (Sweden)

    Nylander Johan AA

    2004-07-01

    Full Text Available Abstract Background The typical antbirds (Thamnophilidae form a monophyletic and diverse family of suboscine passerines that inhabit neotropical forests. However, the phylogenetic relationships within this assemblage are poorly understood. Herein, we present a hypothesis of the generic relationships of this group based on Bayesian inference analyses of two nuclear introns and the mitochondrial cytochrome b gene. The level of phylogenetic congruence between the individual genes has been investigated utilizing Bayes factors. We also explore how changes in the substitution models affected the observed incongruence between partitions of our data set. Results The phylogenetic analysis supports both novel relationships, as well as traditional groupings. Among the more interesting novel relationship suggested is that the Terenura antwrens, the wing-banded antbird (Myrmornis torquata, the spot-winged antshrike (Pygiptila stellaris and the russet antshrike (Thamnistes anabatinus are sisters to all other typical antbirds. The remaining genera fall into two major clades. The first includes antshrikes, antvireos and the Herpsilochmus antwrens, while the second clade consists of most antwren genera, the Myrmeciza antbirds, the "professional" ant-following antbirds, and allied species. Our results also support previously suggested polyphyly of Myrmotherula antwrens and Myrmeciza antbirds. The tests of phylogenetic incongruence, using Bayes factors, clearly suggests that allowing the gene partitions to have separate topology parameters clearly increased the model likelihood. However, changing a component of the nucleotide substitution model had much higher impact on the model likelihood. Conclusions The phylogenetic results are in broad agreement with traditional classification of the typical antbirds, but some relationships are unexpected based on external morphology. In these cases their true affinities may have been obscured by convergent evolution and

  1. The relationship of reported HIV risk and history of HIV testing among emergency department patients.

    Science.gov (United States)

    Merchant, Roland C; Freelove, Sarah M; Langan, Thomas J; Clark, Melissa A; Mayer, Kenneth H; Seage, George R; DeGruttola, Victor G

    2010-01-01

    Among a random sample of emergency department (ED) patients, we sought to determine the extent to which reported risk for human immunodeficiency virus (HIV) is related to ever having been tested for HIV. A random sample of patients (aged 18-64 years) from an adult, urban, northeastern United States, academic ED were surveyed about their history of ever having been tested for HIV and their reported HIV risk behaviors. A reported HIV risk score was calculated from the survey responses and divided into 4 levels, based on quartiles of the risk scores. Pearson's X(2) testing was used to compare HIV testing history and level of reported HIV risk. Logistic regression models were created to investigate the association between level of reported HIV risk and the outcome of ever having been tested for HIV. Of the 557 participants, 62.1% were female. A larger proportion of females than males (71.4% vs 60.6%; P history of injection-drug use, were associated with prior HIV testing for both genders. In the logistic regression analyses, there was no relationship between increasing level of reported HIV risk and a history of ever having been tested for HIV for males. For females, a history of ever having been tested was related to increasing level of reported risk, but not in a linear fashion. The relationship between reported HIV risk and history of testing among these ED patients was complex and differed by gender. Among these patients, having greater risk did not necessarily mean a higher likelihood of ever having been tested for HIV.

  2. An evolutionary model-based algorithm for accurate phylogenetic breakpoint mapping and subtype prediction in HIV-1.

    Directory of Open Access Journals (Sweden)

    Sergei L Kosakovsky Pond

    2009-11-01

    Full Text Available Genetically diverse pathogens (such as Human Immunodeficiency virus type 1, HIV-1 are frequently stratified into phylogenetically or immunologically defined subtypes for classification purposes. Computational identification of such subtypes is helpful in surveillance, epidemiological analysis and detection of novel variants, e.g., circulating recombinant forms in HIV-1. A number of conceptually and technically different techniques have been proposed for determining the subtype of a query sequence, but there is not a universally optimal approach. We present a model-based phylogenetic method for automatically subtyping an HIV-1 (or other viral or bacterial sequence, mapping the location of breakpoints and assigning parental sequences in recombinant strains as well as computing confidence levels for the inferred quantities. Our Subtype Classification Using Evolutionary ALgorithms (SCUEAL procedure is shown to perform very well in a variety of simulation scenarios, runs in parallel when multiple sequences are being screened, and matches or exceeds the performance of existing approaches on typical empirical cases. We applied SCUEAL to all available polymerase (pol sequences from two large databases, the Stanford Drug Resistance database and the UK HIV Drug Resistance Database. Comparing with subtypes which had previously been assigned revealed that a minor but substantial (approximately 5% fraction of pure subtype sequences may in fact be within- or inter-subtype recombinants. A free implementation of SCUEAL is provided as a module for the HyPhy package and the Datamonkey web server. Our method is especially useful when an accurate automatic classification of an unknown strain is desired, and is positioned to complement and extend faster but less accurate methods. Given the increasingly frequent use of HIV subtype information in studies focusing on the effect of subtype on treatment, clinical outcome, pathogenicity and vaccine design, the importance

  3. Application of multigene phylogenetics and site-stripping to resolve intraordinal relationships in the Rhodymeniales (Rhodophyta).

    Science.gov (United States)

    Filloramo, Gina V; Saunders, Gary W

    2016-06-01

    Previous molecular assessments of the red algal order Rhodymeniales have confirmed its monophyly and distinguished the six currently recognized families (viz. Champiaceae, Faucheaceae, Fryeellaceae, Hymenocladiaceae, Lomentariaceae, and Rhodymeniaceae); however, relationships among most of these families have remained unresolved possibly as a result of substitution saturation at deeper phylogenetic nodes. The objective of the current study was to improve rhodymenialean systematics by increasing taxonomic representation and using a more robust multigene dataset of mitochondrial (COB, COI/COI-5P), nuclear (LSU, EF2) and plastid markers (psbA, rbcL). Additionally, we aimed to prevent phylogenetic inference problems associated with substitution saturation (particularly at the interfamilial nodes) by removing fast-evolving sites and analyzing a series of progressively more conservative alignments. The Rhodymeniales was resolved as two major lineages: (i) the Fryeellaceae as sister to the Faucheaceae and Lomentariaceae; and (ii) the Rhodymeniaceae allied to the Champiaceae and Hymenocladiaceae. Support at the interfamilial nodes was highest when 20% of variable sites were removed. Inclusion of Binghamiopsis, Chamaebotrys, and Minium, which were absent in previous phylogenetic investigations, established their phylogenetic affinities while assessment of two genera consistently polyphyletic in phylogenetic analyses, Erythrymenia and Lomentaria, resulted in the proposition of the novel genera Perbella and Fushitsunagia. The taxonomic position of Drouetia was reinvestigated with re-examination of holotype material of D. coalescens to clarify tetrasporangial development in this genus. In addition, we added three novel Australian species to Drouetia as a result of ongoing DNA barcoding assessments-D. aggregata sp. nov., D. scutellata sp. nov., and D. viridescens sp. nov. © 2016 Phycological Society of America.

  4. HIV-1 transmission patterns in antiretroviral therapy-naive, HIV-infected North Americans based on phylogenetic analysis by population level and ultra-deep DNA sequencing.

    Directory of Open Access Journals (Sweden)

    Lisa L Ross

    Full Text Available Factors that contribute to the transmission of human immunodeficiency virus type 1 (HIV-1, especially drug-resistant HIV-1 variants remain a significant public health concern. In-depth phylogenetic analyses of viral sequences obtained in the screening phase from antiretroviral-naïve HIV-infected patients seeking enrollment in EPZ108859, a large open-label study in the USA, Canada and Puerto Rico (ClinicalTrials.gov NCT00440947 were examined for insights into the roles of drug resistance and epidemiological factors that could impact disease dissemination. Viral transmission clusters (VTCs were initially predicted from a phylogenetic analysis of population level HIV-1 pol sequences obtained from 690 antiretroviral-naïve subjects in 2007. Subsequently, the predicted VTCs were tested for robustness by ultra deep sequencing (UDS using pyrosequencing technology and further phylogenetic analyses. The demographic characteristics of clustered and non-clustered subjects were then compared. From 690 subjects, 69 were assigned to 1 of 30 VTCs, each containing 2 to 5 subjects. Race composition of VTCs were significantly more likely to be white (72% vs. 60%; p = 0.04. VTCs had fewer reverse transcriptase and major PI resistance mutations (9% vs. 24%; p = 0.002 than non-clustered sequences. Both men-who-have-sex-with-men (MSM (68% vs. 48%; p = 0.001 and Canadians (29% vs. 14%; p = 0.03 were significantly more frequent in VTCs than non-clustered sequences. Of the 515 subjects who initiated antiretroviral therapy, 33 experienced confirmed virologic failure through 144 weeks while only 3/33 were from VTCs. Fewer VTCs subjects (as compared to those with non-clustering virus had HIV-1 with resistance-associated mutations or experienced virologic failure during the course of the study. Our analysis shows specific geographical and drug resistance trends that correlate well with transmission clusters defined by HIV sequences of similarity

  5. A contribution to the understanding of phylogenetic relationships among species of the genus Octopus (Octopodidae: Cephalopoda

    Directory of Open Access Journals (Sweden)

    María Soledad Acosta-Jofré

    2011-11-01

    Full Text Available Many species of the genus Octopus are important resources for fisheries worldwide. Its approximately 200 species show a strong similarity in structural morphology and a wide diversity in skin coloration and patterning, behaviour and life strategies that have hampered the study of phylogenetic relationships. We used a Bayesian approach to estimate as yet unknown phylogenetic relationships among O. tehuelchus from the southwestern Atlantic, new specimens of O. mimus (Chile and Peru and other Octopus species, and used Bayes factors to test phylogenetic hypotheses. O. tehuelchus was more closely related to the genera Callistoctopus, Grimpella and Macroctopus than to Octopus, and therefore its generic placement may need a revision. O. vulgaris specimens from Costa Rica (Pacific Ocean and O. oculifer grouped with O. mimus. Bayes factors showed positive evidence in favor of this grouping and therefore these individuals could have been misidentified, being in fact O. mimus. O. vulgaris specimens from the Costa Rican Caribbean were more related to O. mimus than to other O. vulgaris and could represent a cryptic species. The remaining O. vulgaris clustered with O. tetricus. Bayes factors found strong evidence against the monophyly of O. vulgaris as currently defined, giving statistical support to the monophyly of an O. vulgaris s. str. + O. tetricus group proposed previously by other authors.

  6. Analysis of plasmid genes by phylogenetic profiling and visualization of homology relationships using Blast2Network

    Directory of Open Access Journals (Sweden)

    Bazzicalupo Marco

    2008-12-01

    Full Text Available Abstract Background Phylogenetic methods are well-established bioinformatic tools for sequence analysis, allowing to describe the non-independencies of sequences because of their common ancestor. However, the evolutionary profiles of bacterial genes are often complicated by hidden paralogy and extensive and/or (multiple horizontal gene transfer (HGT events which make bifurcating trees often inappropriate. In this context, plasmid sequences are paradigms of network-like relationships characterizing the evolution of prokaryotes. Actually, they can be transferred among different organisms allowing the dissemination of novel functions, thus playing a pivotal role in prokaryotic evolution. However, the study of their evolutionary dynamics is complicated by the absence of universally shared genes, a prerequisite for phylogenetic analyses. Results To overcome such limitations we developed a bioinformatic package, named Blast2Network (B2N, allowing the automatic phylogenetic profiling and the visualization of homology relationships in a large number of plasmid sequences. The software was applied to the study of 47 completely sequenced plasmids coming from Escherichia, Salmonella and Shigella spps. Conclusion The tools implemented by B2N allow to describe and visualize in a new way some of the evolutionary features of plasmid molecules of Enterobacteriaceae; in particular it helped to shed some light on the complex history of Escherichia, Salmonella and Shigella plasmids and to focus on possible roles of unannotated proteins. The proposed methodology is general enough to be used for comparative genomic analyses of bacteria.

  7. Phylogenetic relationships of Malaysia's long-tailed macaques, Macaca fascicularis, based on cytochrome b sequences.

    Science.gov (United States)

    Abdul-Latiff, Muhammad Abu Bakar; Ruslin, Farhani; Fui, Vun Vui; Abu, Mohd-Hashim; Rovie-Ryan, Jeffrine Japning; Abdul-Patah, Pazil; Lakim, Maklarin; Roos, Christian; Yaakop, Salmah; Md-Zain, Badrul Munir

    2014-01-01

    Phylogenetic relationships among Malaysia's long-tailed macaques have yet to be established, despite abundant genetic studies of the species worldwide. The aims of this study are to examine the phylogenetic relationships of Macaca fascicularis in Malaysia and to test its classification as a morphological subspecies. A total of 25 genetic samples of M. fascicularis yielding 383 bp of Cytochrome b (Cyt b) sequences were used in phylogenetic analysis along with one sample each of M. nemestrina and M. arctoides used as outgroups. Sequence character analysis reveals that Cyt b locus is a highly conserved region with only 23% parsimony informative character detected among ingroups. Further analysis indicates a clear separation between populations originating from different regions; the Malay Peninsula versus Borneo Insular, the East Coast versus West Coast of the Malay Peninsula, and the island versus mainland Malay Peninsula populations. Phylogenetic trees (NJ, MP and Bayesian) portray a consistent clustering paradigm as Borneo's population was distinguished from Peninsula's population (99% and 100% bootstrap value in NJ and MP respectively and 1.00 posterior probability in Bayesian trees). The East coast population was separated from other Peninsula populations (64% in NJ, 66% in MP and 0.53 posterior probability in Bayesian). West coast populations were divided into 2 clades: the North-South (47%/54% in NJ, 26/26% in MP and 1.00/0.80 posterior probability in Bayesian) and Island-Mainland (93% in NJ, 90% in MP and 1.00 posterior probability in Bayesian). The results confirm the previous morphological assignment of 2 subspecies, M. f. fascicularis and M. f. argentimembris, in the Malay Peninsula. These populations should be treated as separate genetic entities in order to conserve the genetic diversity of Malaysia's M. fascicularis. These findings are crucial in aiding the conservation management and translocation process of M. fascicularis populations in Malaysia.

  8. PHYLOGENETIC RELATIONSHIPS AMONGST 10 Durio SPECIES BASED ON PCR-RFLP ANALYSIS OF TWO CHLOROPLAST GENES

    Directory of Open Access Journals (Sweden)

    Panca J. Santoso

    2013-07-01

    Full Text Available Twenty seven species of Durio have been identified in Sabah and Sarawak, Malaysia, but their relationships have not been studied. This study was conducted to analyse phylogenetic relationships amongst 10 Durio species in Malaysia using PCR-RFLP on two chloroplast DNA genes, i.e. ndhC-trnV and rbcL. DNAs were extracted from young leaves of 11 accessions from 10 Durio species collected from the Tenom Agriculture Research Station, Sabah, and University Agriculture Park, Universiti Putra Malaysia. Two pairs of oligonucleotide primers, N1-N2 and rbcL1-rbcL2, were used to flank the target regions ndhC-trnV and rbcL. Eight restriction enzymes, HindIII, BsuRI, PstI, TaqI, MspI, SmaI, BshNI, and EcoR130I, were used to digest the amplicons. Based on the results of PCR-RFLP on ndhC-trnV gene, the 10 Durio species were grouped into five distinct clusters, and the accessions generally showed high variations. However, based on the results of PCR-RFLP on the rbcL gene, the species were grouped into three distinct clusters, and generally showed low variations. This means that ndhC-trnV gene is more reliable for phylogenetic analysis in lower taxonomic level of Durio species or for diversity analysis, while rbcL gene is reliable marker for phylogenetic analysis at higher taxonomic level. PCR-RFLP on the ndhC-trnV and rbcL genes could therefore be considered as useful markers to phylogenetic analysis amongst Durio species. These finding might be used for further molecular marker assisted in Durio breeding program.

  9. Bryozoans are returning home: recolonization of freshwater ecosystems inferred from phylogenetic relationships.

    Science.gov (United States)

    Koletić, Nikola; Novosel, Maja; Rajević, Nives; Franjević, Damjan

    2015-01-01

    Bryozoans are aquatic invertebrates that inhabit all types of aquatic ecosystems. They are small animals that form large colonies by asexual budding. Colonies can reach the size of several tens of centimeters, while individual units within a colony are the size of a few millimeters. Each individual within a colony works as a separate zooid and is genetically identical to each other individual within the same colony. Most freshwater species of bryozoans belong to the Phylactolaemata class, while several species that tolerate brackish water belong to the Gymnolaemata class. Tissue samples for this study were collected in the rivers of Adriatic and Danube basin and in the wetland areas in the continental part of Croatia (Europe). Freshwater and brackish taxons of bryozoans were genetically analyzed for the purpose of creating phylogenetic relationships between freshwater and brackish taxons of the Phylactolaemata and Gymnolaemata classes and determining the role of brackish species in colonizing freshwater and marine ecosystems. Phylogenetic relationships inferred on the genes for 18S rRNA, 28S rRNA, COI, and ITS2 region confirmed Phylactolaemata bryozoans as radix bryozoan group. Phylogenetic analysis proved Phylactolaemata bryozoan's close relations with taxons from Phoronida phylum as well as the separation of the Lophopodidae family from other families within the Plumatellida genus. Comparative analysis of existing knowledge about the phylogeny of bryozoans and the expansion of known evolutionary hypotheses is proposed with the model of settlement of marine and freshwater ecosystems by the bryozoans group during their evolutionary past. In this case study, brackish bryozoan taxons represent a link for this ecological phylogenetic hypothesis. Comparison of brackish bryozoan species Lophopus crystallinus and Conopeum seurati confirmed a dual colonization of freshwater ecosystems throughout evolution of this group of animals.

  10. HIV/AIDS, conflict and security in Africa: rethinking relationships.

    Science.gov (United States)

    Becker, Joseph U; Theodosis, Christian; Kulkarni, Rick

    2008-09-22

    The effect of conflict on HIV transmission and regional and global security has been the subject of much recent discussion and debate. Many long held assumptions regarding these relationships are being reconsidered. Conflict has long been assumed to contribute significantly to the spread of HIV infection. However, new research is casting doubt on this assumption. Studies from Africa suggest that conflict does not necessarily predispose to HIV transmission and indeed, there is evidence to suggest that recovery in the "post-conflict" state is potentially dangerous from the standpoint of HIV transmission. As well, refugee populations have been previously considered as highly infected vectors of HIV transmission. But in light of new investigation this belief is also being reconsidered. There has additionally been concern that high rates of HIV infection among many of the militaries of sub-Saharan Africa poses a threat to regional security. However, data is lacking on both dramatically elevated prevalence amongst soldiers and a possible negative effect on regional security. Nevertheless, HIV/AIDS remain a serious threat to population health and economic well being in this region. These issues are of vital importance for HIV programming and health sector development in conflict and "post-conflict" societies and will constitute formidable challenges to the international community. Further research is required to better inform the discussion of HIV, conflict, and security in sub-Saharan Africa.

  11. The complete mitochondrial genome of Sesarmops sinensis reveals gene rearrangements and phylogenetic relationships in Brachyura.

    Science.gov (United States)

    Tang, Bo-Ping; Xin, Zhao-Zhe; Liu, Yu; Zhang, Dai-Zhen; Wang, Zheng-Fei; Zhang, Hua-Bin; Chai, Xin-Yue; Zhou, Chun-Lin; Liu, Qiu-Ning

    2017-01-01

    Mitochondrial genome (mitogenome) is very important to understand molecular evolution and phylogenetics. Herein, in this study, the complete mitogenome of Sesarmops sinensis was reported. The mitogenome was 15,905 bp in size, and contained 13 protein-coding genes (PCGs), two ribosomal RNA (rRNA) genes, 22 transfer RNA (tRNA) genes, and a control region (CR). The AT skew and the GC skew are both negative in the mitogenomes of S. sinensis. The nucleotide composition of the S. sinensis mitogenome was also biased toward A + T nucleotides (75.7%). All tRNA genes displayed a typical mitochondrial tRNA cloverleaf structure, except for the trnS1 gene, which lacked a dihydroxyuridine arm. S. sinensis exhibits a novel rearrangement compared with the Pancrustacean ground pattern and other Brachyura species. Based on the 13 PCGs, the phylogenetic analysis showed that S. sinensis and Sesarma neglectum were clustered on one branch with high nodal support values, indicating that S. sinensis and S. neglectum have a sister group relationship. The group (S. sinensis + S. neglectum) was sister to (Parasesarmops tripectinis + Metopaulias depressus), suggesting that S. sinensis belongs to Grapsoidea, Sesarmidae. Phylogenetic trees based on amino acid sequences and nucleotide sequences of mitochondrial 13 PCGs using BI and ML respectively indicate that section Eubrachyura consists of four groups clearly. The resulting phylogeny supports the establishment of a separate subsection Potamoida. These four groups correspond to four subsections of Raninoida, Heterotremata, Potamoida, and Thoracotremata.

  12. Molecular and morphological analyses reveal phylogenetic relationships of stingrays focusing on the family Dasyatidae (Myliobatiformes.

    Directory of Open Access Journals (Sweden)

    Kean Chong Lim

    Full Text Available Elucidating the phylogenetic relationships of the current but problematic Dasyatidae (Order Myliobatiformes was the first priority of the current study. Here, we studied three molecular gene markers of 43 species (COI gene, 33 species (ND2 gene and 34 species (RAG1 gene of stingrays to draft out the phylogenetic tree of the order. Nine character states were identified and used to confirm the molecularly constructed phylogenetic trees. Eight or more clades (at different hierarchical level were identified for COI, ND2 and RAG1 genes in the Myliobatiformes including four clades containing members of the present Dasyatidae, thus rendering the latter non-monophyletic. The uncorrected p-distance between these four 'Dasytidae' clades when compared to the distance between formally known families confirmed that these four clades should be elevated to four separate families. We suggest a revision of the present classification, retaining the Dasyatidae (Dasyatis and Taeniurops species but adding three new families namely, Neotrygonidae (Neotrygon and Taeniura species, Himanturidae (Himantura species and Pastinachidae (Pastinachus species. Our result indicated the need to further review the classification of Dasyatis microps. By resolving the non-monophyletic problem, the suite of nine character states enables the natural classification of the Myliobatiformes into at least thirteen families based on morphology.

  13. The role of social relationship in HIV healing and its implications in HIV cure in China

    Science.gov (United States)

    Qiao, Shan; Nie, Jing-Bao; Tucker, Joseph; Rennie, Stuart; Li, Xiao-Ming

    2016-01-01

    HIV is both a biomedical disease and a social phenomenon that is constructed in particular cultural contexts. A successful and humane HIV cure requires not only the science of eradicating pathogens, but also the art of healing to restore harmony between mind and body. Healing in the context of HIV cure will be both personal and interpersonal, biological and social, and will involve rebuilding connections between HIV patients and their social environment. Social conceptions of healing have been highlighted in many regions with rich non-biomedical healing traditions, including China. Based on an adapted theoretical model on social relationships and health, we address the essential role of social relations for HIV healing in Chinese cultural context, and propose several recommendations for reforming practices and policies regarding HIV healing. In general, family is still a core social unit in HIV patients’ medical journey from diagnosis to treatment. A positive patient–physician relationship based on mutual respect and trust also has critical impact on patients’ physical and mental health. Physicians may become a key or the main source of social support in circumstances when families are not actively engaged in healing. Reconnecting HIV patients with their communities should be a necessary component of HIV cure, as this will help patients engage more fully in the HIV healing process. We call for a family-centered approach in HIV healing intervention to strengthen patient–family ties; a series of policies to build up and sustain positive patient–physician ties; and multi-level strategies to empower patients and rebuild their bonds to community and larger society. We also call for more empirical research on how non-biomedical healing approaches in various cultural settings could (directly or indirectly) inform HIV cure research. PMID:27042386

  14. Mitochondrial DNA genomes organization and phylogenetic relationships analysis of eight anemonefishes (pomacentridae: amphiprioninae.

    Directory of Open Access Journals (Sweden)

    Jianlong Li

    Full Text Available Anemonefishes (Pomacentridae Amphiprioninae are a group of 30 valid coral reef fish species with their phylogenetic relationships still under debate. The eight available mitogenomes of anemonefishes were used to reconstruct the molecular phylogenetic tree; six were obtained from this study (Amphiprion clarkii, A. frenatus, A. percula, A. perideraion, A. polymnus and Premnas biaculeatus and two from GenBank (A. bicinctus and A. ocellaris. The seven Amphiprion species represent all four subgenera and P. biaculeatus is the only species from Premnas. The eight mitogenomes of anemonefishes encoded 13 protein-coding genes, two rRNA genes, 22 tRNA genes and two main non-coding regions, with the gene arrangement and translation direction basically identical to other typical vertebrate mitogenomes. Among the 13 protein-coding genes, A. ocellaris (AP006017 and A. percula (KJ174497 had the same length in ND5 with 1,866 bp, which were three nucleotides less than the other six anemonefishes. Both structures of ND5, however, could translate to amino acid successfully. Only four mitogenomes had the tandem repeats in D-loop; the tandem repeats were located in downstream after Conserved Sequence Block rather than the upstream and repeated in a simply way. The phylogenetic utility was tested with Bayesian and Maximum Likelihood methods using all 13 protein-coding genes. The results strongly supported that the subfamily Amphiprioninae was monophyletic and P. biaculeatus should be assigned to the genus Amphiprion. Premnas biaculeatus with the percula complex were revealed to be the ancient anemonefish species. The tree forms of ND1, COIII, ND4, Cytb, Cytb+12S rRNA, Cytb+COI and Cytb+COI+12S rRNA were similar to that 13 protein-coding genes, therefore, we suggested that the suitable single mitochondrial gene for phylogenetic analysis of anemonefishes maybe Cytb. Additional mitogenomes of anemonefishes with a combination of nuclear markers will be useful to

  15. Complete mitochondrial genomes elucidate phylogenetic relationships of the deep-sea octocoral families Coralliidae and Paragorgiidae

    Science.gov (United States)

    Figueroa, Diego F.; Baco, Amy R.

    2014-01-01

    In the past decade, molecular phylogenetic analyses of octocorals have shown that the current morphological taxonomic classification of these organisms needs to be revised. The latest phylogenetic analyses show that most octocorals can be divided into three main clades. One of these clades contains the families Coralliidae and Paragorgiidae. These families share several taxonomically important characters and it has been suggested that they may not be monophyletic; with the possibility of the Coralliidae being a derived branch of the Paragorgiidae. Uncertainty exists not only in the relationship of these two families, but also in the classification of the two genera that make up the Coralliidae, Corallium and Paracorallium. Molecular analyses suggest that the genus Corallium is paraphyletic, and it can be divided into two main clades, with the Paracorallium as members of one of these clades. In this study we sequenced the whole mitochondrial genome of five species of Paragorgia and of five species of Corallium to use in a phylogenetic analysis to achieve two main objectives; the first to elucidate the phylogenetic relationship between the Paragorgiidae and Coralliidae and the second to determine whether the genera Corallium and Paracorallium are monophyletic. Our results show that other members of the Coralliidae share the two novel mitochondrial gene arrangements found in a previous study in Corallium konojoi and Paracorallium japonicum; and that the Corallium konojoi arrangement is also found in the Paragorgiidae. Our phylogenetic reconstruction based on all the protein coding genes and ribosomal RNAs of the mitochondrial genome suggest that the Coralliidae are not a derived branch of the Paragorgiidae, but rather a monophyletic sister branch to the Paragorgiidae. While our manuscript was in review a study was published using morphological data and several fragments from mitochondrial genes to redefine the taxonomy of the Coralliidae. Paracorallium was subsumed

  16. Phylogenetic Relationships of Five Asian Schilbid Genera Including Clupisoma (Siluriformes: Schilbeidae.

    Directory of Open Access Journals (Sweden)

    Jing Wang

    Full Text Available The phylogenetic relationships of Asian schilbid catfishes of the genera Clupisoma, Ailia, Horabagrus, Laides and Pseudeutropius are poorly understood, especially those of Clupisoma. Herein, we reconstruct the phylogeny of 38 species of catfishes belonging to 28 genera and 14 families using the concatenated mitochondrial genes COI, cytb, and 16S rRNA, as well as the nuclear genes RAG1 and RAG2. The resulting phylogenetic trees consistently place Clupisoma as the sister taxon of Laides, and the five representative Asian schilbid genera form two monophyletic groups with the relationships (Ailia (Laides, Clupisoma and (Horabagrus, Pseudeutropius. The so-called "Big Asia" lineage relates distantly to African schilbids. Independent analyses of the mitochondrial and nuclear DNA data yield differing trees for the two Asian schilbid groups. Analyses of the mitochondrial gene data support a sister-group relationship for (Ailia (Laides, Clupisoma and the Sisoroidea and a sister-taxon association of (Horabagrus, Pseudeutropius and the Bagridae. In contrast, analyses of the combined nuclear data indicate (Ailia (Laides, Clupisoma to be the sister group to (Horabagrus, Pseudeutropius. Our results indicate that the Horabagridae, recognized by some authors as consisting of Horabagrus, Pseudeutropius and Clupisoma does not include the latter genus. We formally erect a new family, Ailiidae fam. nov. for a monophyletic Asian group comprised of the genera Ailia, Laides and Clupisoma.

  17. [Telomere length and phylogenetic relationship of Baikal and Siberian planarians (Turbellaria, Tricladida)].

    Science.gov (United States)

    Koroleva, A G; Evtushenko, E V; Timoshkin, O A; Vershinin, A V; Kiril'chik, S V

    2013-01-01

    Dynamics of the telomeric DNA (tDNA) and the phylogeny of the Baikal and Siberian planarians have been studied based on the analysis of the 18S rDNA and beta-actin gene fragments. A relationship between tDNA and the planarians size has been demonstrated. Giant planarians with a minor exception have longer tDNA than little planarians. Phylogenetic affinity between the species that have the stretched tracks of tDNA, big size and similar habitats may indicate possible role of tDNA in the development of the indefinite regenerative capacity of planarians.

  18. Contribution of WUSCHEL-related homeobox (WOX genes to identify the phylogenetic relationships among Petunia species

    Directory of Open Access Journals (Sweden)

    Ana Lúcia Anversa Segatto

    Full Text Available Abstract Developmental genes are believed to contribute to major changes during plant evolution, from infrageneric to higher levels. Due to their putative high sequence conservation, developmental genes are rarely used as molecular markers, and few studies including these sequences at low taxonomic levels exist. WUSCHEL-related homeobox genes (WOX are transcription factors exclusively present in plants and are involved in developmental processes. In this study, we characterized the infrageneric genetic variation of Petunia WOX genes. We obtained phylogenetic relationships consistent with other phylogenies based on nuclear markers, but with higher statistical support, resolution in terminals, and compatibility with flower morphological changes.

  19. Phylogenetic analyses of Vitis (Vitaceae) based on complete chloroplast genome sequences: effects of taxon sampling and phylogenetic methods on resolving relationships among rosids.

    Science.gov (United States)

    Jansen, Robert K; Kaittanis, Charalambos; Saski, Christopher; Lee, Seung-Bum; Tomkins, Jeffrey; Alverson, Andrew J; Daniell, Henry

    2006-04-09

    The Vitaceae (grape) is an economically important family of angiosperms whose phylogenetic placement is currently unresolved. Recent phylogenetic analyses based on one to several genes have suggested several alternative placements of this family, including sister to Caryophyllales, asterids, Saxifragales, Dilleniaceae or to rest of rosids, though support for these different results has been weak. There has been a recent interest in using complete chloroplast genome sequences for resolving phylogenetic relationships among angiosperms. These studies have clarified relationships among several major lineages but they have also emphasized the importance of taxon sampling and the effects of different phylogenetic methods for obtaining accurate phylogenies. We sequenced the complete chloroplast genome of Vitis vinifera and used these data to assess relationships among 27 angiosperms, including nine taxa of rosids. The Vitis vinifera chloroplast genome is 160,928 bp in length, including a pair of inverted repeats of 26,358 bp that are separated by small and large single copy regions of 19,065 bp and 89,147 bp, respectively. The gene content and order of Vitis is identical to many other unrearranged angiosperm chloroplast genomes, including tobacco. Phylogenetic analyses using maximum parsimony and maximum likelihood were performed on DNA sequences of 61 protein-coding genes for two datasets with 28 or 29 taxa, including eight or nine taxa from four of the seven currently recognized major clades of rosids. Parsimony and likelihood phylogenies of both data sets provide strong support for the placement of Vitaceae as sister to the remaining rosids. However, the position of the Myrtales and support for the monophyly of the eurosid I clade differs between the two data sets and the two methods of analysis. In parsimony analyses, the inclusion of Gossypium is necessary to obtain trees that support the monophyly of the eurosid I clade. However, maximum likelihood analyses place

  20. Phylogenetic analyses of Vitis (Vitaceae based on complete chloroplast genome sequences: effects of taxon sampling and phylogenetic methods on resolving relationships among rosids

    Directory of Open Access Journals (Sweden)

    Alverson Andrew J

    2006-04-01

    Full Text Available Abstract Background The Vitaceae (grape is an economically important family of angiosperms whose phylogenetic placement is currently unresolved. Recent phylogenetic analyses based on one to several genes have suggested several alternative placements of this family, including sister to Caryophyllales, asterids, Saxifragales, Dilleniaceae or to rest of rosids, though support for these different results has been weak. There has been a recent interest in using complete chloroplast genome sequences for resolving phylogenetic relationships among angiosperms. These studies have clarified relationships among several major lineages but they have also emphasized the importance of taxon sampling and the effects of different phylogenetic methods for obtaining accurate phylogenies. We sequenced the complete chloroplast genome of Vitis vinifera and used these data to assess relationships among 27 angiosperms, including nine taxa of rosids. Results The Vitis vinifera chloroplast genome is 160,928 bp in length, including a pair of inverted repeats of 26,358 bp that are separated by small and large single copy regions of 19,065 bp and 89,147 bp, respectively. The gene content and order of Vitis is identical to many other unrearranged angiosperm chloroplast genomes, including tobacco. Phylogenetic analyses using maximum parsimony and maximum likelihood were performed on DNA sequences of 61 protein-coding genes for two datasets with 28 or 29 taxa, including eight or nine taxa from four of the seven currently recognized major clades of rosids. Parsimony and likelihood phylogenies of both data sets provide strong support for the placement of Vitaceae as sister to the remaining rosids. However, the position of the Myrtales and support for the monophyly of the eurosid I clade differs between the two data sets and the two methods of analysis. In parsimony analyses, the inclusion of Gossypium is necessary to obtain trees that support the monophyly of the eurosid I clade

  1. Short Communication Phylogenetic Characterization of HIV Type 1 CRF01_AE V3 Envelope Sequences in Pregnant Women in Northern Vietnam

    Science.gov (United States)

    Caridha, Rozina; Ha, Tran Thi Thanh; Gaseitsiwe, Simani; Hung, Pham Viet; Anh, Nguyen Mai; Bao, Nguyen Huy; Khang, Dinh Duy; Hien, Nguyen Tran; Cam, Phung Dac; Chiodi, Francesca

    2012-01-01

    Abstract Characterization of HIV-1 strains is important for surveillance of the HIV-1 epidemic. In Vietnam HIV-1-infected pregnant women often fail to receive the care they are entitled to. Here, we analyzed phylogenetically HIV-1 env sequences from 37 HIV-1-infected pregnant women from Ha Noi (n=22) and Hai Phong (n=15), where they delivered in 2005–2007. All carried CRF01_AE in the gp120 V3 region. In 21 women CRF01_AE was also found in the reverse transcriptase gene. We compared their env gp120 V3 sequences phylogenetically in a maximum likelihood tree to those of 198 other CRF01_AE sequences in Vietnam and 229 from neighboring countries, predominantly Thailand, from the HIV-1 database. Altogether 464 sequences were analyzed. All but one of the maternal sequences colocalized with sequences from northern Vietnam. The maternal sequences had evolved the least when compared to sequences collected in Ha Noi in 2002, as shown by analysis of synonymous and nonsynonymous changes, than to other Vietnamese sequences collected earlier and/or elsewhere. Since the HIV-1 epidemic in women in Vietnam may still be underestimated, characterization of HIV-1 in pregnant women is important to observe how HIV-1 has evolved and follow its molecular epidemiology. PMID:21936713

  2. Supermatrix and species tree methods resolve phylogenetic relationships within the big cats, Panthera (Carnivora: Felidae).

    Science.gov (United States)

    Davis, Brian W; Li, Gang; Murphy, William J

    2010-07-01

    The pantherine lineage of cats diverged from the remainder of modern Felidae less than 11 million years ago and consists of the five big cats of the genus Panthera, the lion, tiger, jaguar, leopard, and snow leopard, as well as the closely related clouded leopard. A significant problem exists with respect to the precise phylogeny of these highly threatened great cats. Despite multiple publications on the subject, no two molecular studies have reconstructed Panthera with the same topology. These evolutionary relationships remain unresolved partially due to the recent and rapid radiation of pantherines in the Pliocene, individual speciation events occurring within less than 1 million years, and probable introgression between lineages following their divergence. We provide an alternative, highly supported interpretation of the evolutionary history of the pantherine lineage using novel and published DNA sequence data from the autosomes, both sex chromosomes and the mitochondrial genome. New sequences were generated for 39 single-copy regions of the felid Y chromosome, as well as four mitochondrial and four autosomal gene segments, totaling 28.7 kb. Phylogenetic analysis of these new data, combined with all published data in GenBank, highlighted the prevalence of phylogenetic disparities stemming either from the amplification of a mitochondrial to nuclear translocation event (numt), or errors in species identification. Our 47.6 kb combined dataset was analyzed as a supermatrix and with respect to individual partitions using maximum likelihood and Bayesian phylogenetic inference, in conjunction with Bayesian Estimation of Species Trees (BEST) which accounts for heterogeneous gene histories. Our results yield a robust consensus topology supporting the monophyly of lion and leopard, with jaguar sister to these species, as well as a sister species relationship of tiger and snow leopard. These results highlight new avenues for the study of speciation genomics and

  3. AFLP analysis of genetic diversity and phylogenetic relationships of Brassica oleracea in Ireland.

    Science.gov (United States)

    El-Esawi, Mohamed A; Germaine, Kieran; Bourke, Paula; Malone, Renee

    2016-01-01

    Brassica oleracea L. is one of the most economically important vegetable crop species of the genus Brassica L. This species is threatened in Ireland, without any prior reported genetic studies. The use of this species is being very limited due to its imprecise phylogeny and uncompleted genetic characterisation. The main objective of this study was to assess the genetic diversity and phylogenetic relationships of a set of 25 Irish B. oleracea accessions using the powerful amplified fragment length polymorphism (AFLP) technique. A total of 471 fragments were scored across all the 11 AFLP primer sets used, out of which 423 (89.8%) were polymorphic and could differentiate the accessions analysed. The dendrogram showed that cauliflowers were more closely related to cabbages than kales were, and accessions of some cabbage types were distributed among different clusters within cabbage subgroups. Approximately 33.7% of the total genetic variation was found among accessions, and 66.3% of the variation resided within accessions. The total genetic diversity (HT) and the intra-accessional genetic diversity (HS) were 0.251 and 0.156, respectively. This high level of variation demonstrates that the Irish B. oleracea accessions studied should be managed and conserved for future utilisation and exploitation in food and agriculture. In conclusion, this study addressed important phylogenetic questions within this species, and provided a new insight into the inclusion of four accessions of cabbages and kales in future breeding programs for improving varieties. AFLP markers were efficient for assessing genetic diversity and phylogenetic relationships in Irish B. oleracea species. Copyright © 2016 Académie des sciences. Published by Elsevier SAS. All rights reserved.

  4. Phylogenetic relationships and evolution of growth form in Cactaceae (Caryophyllales, Eudicotyledoneae).

    Science.gov (United States)

    Hernández-Hernández, Tania; Hernández, Héctor M; De-Nova, J Arturo; Puente, Raul; Eguiarte, Luis E; Magallón, Susana

    2011-01-01

    Cactaceae is one of the most charismatic plant families because of the extreme succulence and outstanding diversity of growth forms of its members. Although cacti are conspicuous elements of arid ecosystems in the New World and are model systems for ecological and anatomical studies, the high morphological convergence and scarcity of phenotypic synapomorphies make the evolutionary relationships and trends among lineages difficult to understand. We performed phylogenetic analyses implementing parsimony ratchet and likelihood methods, using a concatenated matrix with 6148 bp of plastid and nuclear markers (trnK/matK, matK, trnL-trnF, rpl16, and ppc). We included 224 species representing approximately 85% of the family's genera. Likelihood methods were used to perform an ancestral character reconstruction within Cactoideae, the richest subfamily in terms of morphological diversity and species number, to evaluate possible growth form evolutionary trends. Our phylogenetic results support previous studies showing the paraphyly of subfamily Pereskioideae and the monophyly of subfamilies Opuntioideae and Cactoideae. After the early divergence of Blossfeldia, Cactoideae splits into two clades: Cacteae, including North American globose and barrel-shaped members, and core Cactoideae, including the largest diversity of growth forms distributed throughout the American continent. Para- or polyphyly is persistent in different parts of the phylogeny. Main Cactoideae clades were found to have different ancestral growth forms, and convergence toward globose, arborescent, or columnar forms occurred in different lineages. Our study enabled us to provide a detailed hypothesis of relationships among cacti lineages and represents the most complete general phylogenetic framework available to understand evolutionary trends within Cactaceae.

  5. Phylogenetic relationships, character evolution, and taxonomic implications within the slipper lobsters (Crustacea: Decapoda: Scyllaridae).

    Science.gov (United States)

    Yang, Chien-Hui; Bracken-Grissom, Heather; Kim, Dohyup; Crandall, Keith A; Chan, Tin-Yam

    2012-01-01

    The slipper lobsters belong to the family Scyllaridae which contains a total of 20 genera and 89 species distributed across four subfamilies (Arctidinae, Ibacinae, Scyllarinae, and Theninae). We have collected nucleotide sequence data from regions of five different genes (16S, 18S, COI, 28S, H3) to estimate phylogenetic relationships among 54 species from the Scyllaridae with a focus on the species rich subfamily Scyllarinae. We have included in our analyses at least one representative from all 20 genera in the Scyllaridae and 35 of the 52 species within the Scyllarinae. Our resulting phylogenetic estimate shows the subfamilies are monophyletic, except for Ibacinae, which has paraphyletic relationships among genera. Many of the genera within the Scyllarinae form non-monophyletic groups, while the genera from all other subfamilies form well supported clades. We discuss the implications of this history on the evolution of morphological characters and ecological transitions (nearshore vs. offshore) within the slipper lobsters. Finally, we identify, through ancestral state character reconstructions, key morphological features diagnostic of the major clades of diversity within the Scyllaridae and relate this character evolution to current taxonomy and classification. Copyright © 2011 Elsevier Inc. All rights reserved.

  6. Species boundaries and phylogenetic relationships in the critically endangered Asian box turtle genus Cuora.

    Science.gov (United States)

    Spinks, Phillip Q; Thomson, Robert C; Zhang, YaPing; Che, Jing; Wu, Yonghua; Shaffer, H Bradley

    2012-06-01

    Turtles are currently the most endangered major clade of vertebrates on earth, and Asian box turtles (Cuora) are in catastrophic decline. Effective management of this diverse turtle clade has been hampered by human-mediated, and perhaps natural hybridization, resulting in discordance between mitochondrial and nuclear markers and confusion regarding species boundaries and phylogenetic relationships among hypothesized species of Cuora. Here, we present analyses of mitochondrial and nuclear DNA data for all 12 currently hypothesized species to resolve both species boundaries and phylogenetic relationships. Our 15-gene, 40-individual nuclear data set was frequently in conflict with our mitochondrial data set; based on its general concordance with published morphological analyses and the strength of 15 independent estimates of evolutionary history, we interpret the nuclear data as representing the most reliable estimate of species boundaries and phylogeny of Cuora. Our results strongly reiterate the necessity of using multiple nuclear markers for phylogeny and species delimitation in these animals, including any form of DNA "barcoding", and point to Cuora as an important case study where reliance on mitochondrial DNA can lead to incorrect species identification. Copyright © 2012 Elsevier Inc. All rights reserved.

  7. Phylogenetic relationships in Peniocereus (Cactaceae) inferred from plastid DNA sequence data.

    Science.gov (United States)

    Arias, Salvador; Terrazas, Teresa; Arreola-Nava, Hilda J; Vázquez-Sánchez, Monserrat; Cameron, Kenneth M

    2005-10-01

    The phylogenetic relationships of Peniocereus (Cactaceae) species were studied using parsimony analyses of DNA sequence data. The plastid rpl16 and trnL-F regions were sequenced for 98 taxa including 17 species of Peniocereus, representatives from all genera of tribe Pachycereeae, four genera of tribe Hylocereeae, as well as from three additional outgroup genera of tribes Calymmantheae, Notocacteae, and Trichocereeae. Phylogenetic analyses support neither the monophyly of Peniocereus as currently circumscribed, nor the monophyly of tribe Pachycereeae since species of Peniocereus subgenus Pseudoacanthocereus are embedded within tribe Hylocereeae. Furthermore, these results show that the eight species of Peniocereus subgenus Peniocereus (Peniocereus sensu stricto) form a well-supported clade within subtribe Pachycereinae; P. serpentinus is also a member of this subtribe, but is sister to Bergerocactus. Moreover, Nyctocereus should be resurrected as a monotypic genus. Species of Peniocereus subgenus Pseudoacanthocereus are positioned among species of Acanthocereus within tribe Hylocereeae, indicating that they may be better classified within that genus. A number of morphological and anatomical characters, especially related to the presence or absence of dimorphic branches, are discussed to support these relationships.

  8. A Molecular Assessment of Phylogenetic Relationships and LineageDiversification Within the Family Salamandridae (Amphibia, Caudata)

    Energy Technology Data Exchange (ETDEWEB)

    Weisrock, David W.; Papenfuss, Theodore J.; Macey, J. Robert; Litvinchuk, Spartak N.; Polymeni, Rosa; Ugurtas, Ismail H.; Zhao, Ermi; Larson, Allan

    2005-08-08

    Phylogenetic relationships among species of the salamanderfamily Salamandridae are investigated using nearly 3000 nucleotide basesof newly reported mitochondrial DNA sequence data from the mtDNA genicregion spanning the genes tRNALeu-COI. This study uses nearlycomprehensive species-level sampling to provide the first completephylogeny for the Salamandridae. Deep phylogenetic relationships amongthe three most divergent lineages in the family Salamandrina terdigitata,a clade comprising the "True" salamanders, and a clade comprising allnewts except S. terdigitata are difficult to resolve. However, mostrelationships within the latter two lineages are resolved with robustlevels of branch support. The genera Euproctus and Triturus arestatistically shown to be nonmonophyletic, instead each contains adiverse set of lineages positioned within the large newt clade. The genusParamesotriton is also resolve as a nonmonophyletic group, with the newlydescribed species P. laoensis constituting a divergent lineage placed ina sister position to clade containing all Pachytriton species and allremaining Paramesotriton species. Sequence divergences between P.laoensis and other Paramesotriton species are as great as those comparingP. laoensis and species of the genera Cynops and Pachytriton. Analyses oflineage diversification across the Salamandridae indicate that, despiteits exceptional diversity, lineage accumulation appears to have beenconstant across time, indicating that it does not represent a truespecies radiation.

  9. Phylogenetic relationships between Sarcocystis species from reindeer and other Sarcocystidae deduced from ssu rRNA gene sequences

    DEFF Research Database (Denmark)

    Dahlgren, S.S.; Oliveira, Rodrigo Gouveia; Gjerde, B.

    2008-01-01

    any effect on previously inferred phylogenetic relationships within the Sarcocystidae. The complete small subunit (ssu) rRNA gene sequences of all six Sarcocystis species from reindeer were used in the phylogenetic analyses along with ssu rRNA gene sequences of 85 other members of the Coccidea. Trees...... the six species in phylogenetic analyses of the Sarcocystidae, and also to investigate the phylogenetic relationships between the species from reindeer and those from other hosts. The study also aimed at revealing whether the inclusion of six Sarcocystis species from the same intermediate host would have....... tarandivulpes, formed a sister group to other Sarcocystis species with a canine definitive host. The position of S. hardangeri on the tree suggested that it uses another type of definitive host than the other Sarcocystis species in this clade. Considering the geographical distribution and infection intensity...

  10. Phylogenetic relationships and divergence dates of softshell turtles (Testudines: Trionychidae) inferred from complete mitochondrial genomes.

    Science.gov (United States)

    Li, H; Liu, J; Xiong, L; Zhang, H; Zhou, H; Yin, H; Jing, W; Li, J; Shi, Q; Wang, Y; Liu, J; Nie, L

    2017-05-01

    The softshell turtles (Trionychidae) are one of the most widely distributed reptile groups in the world, and fossils have been found on all continents except Antarctica. The phylogenetic relationships among members of this group have been previously studied; however, disagreements regarding its taxonomy, its phylogeography and divergence times are still poorly understood as well. Here, we present a comprehensive mitogenomic study of softshell turtles. We sequenced the complete mitochondrial genomes of 10 softshell turtles, in addition to the GenBank sequence of Dogania subplana, Lissemys punctata, Trionyx triunguis, which cover all extant genera within Trionychidae except for Cyclanorbis and Cycloderma. These data were combined with other mitogenomes of turtles for phylogenetic analyses. Divergence time calibration and ancestral reconstruction were calculated using BEAST and RASP software, respectively. Our phylogenetic analyses indicate that Trionychidae is the sister taxon of Carettochelyidae, and support the monophyly of Trionychinae and Cyclanorbinae, which is consistent with morphological data and molecular analysis. Our phylogenetic analyses have established a sister taxon relationship between the Asian Rafetus and the Asian Palea + Pelodiscus + Dogania + Nilssonia + Amyda, whereas a previous study grouped the Asian Rafetus with the American Apalone. The results of divergence time estimates and area ancestral reconstruction show that extant Trionychidae originated in Asia at around 108 million years ago (MA), and radiations mainly occurred during two warm periods, namely Late Cretaceous-Early Eocene and Oligocene. By combining the estimated divergence time and the reconstructed ancestral area of softshell turtles, we determined that the dispersal of softshell turtles out of Asia may have taken three routes. Furthermore, the times of dispersal seem to be in agreement with the time of the India-Asia collision and opening of the Bering Strait, which

  11. Introgression evidence and phylogenetic relationships among three (ParaMisgurnus species as revealed by mitochondrial and nuclear DNA markers

    Directory of Open Access Journals (Sweden)

    Jakovlić I.

    2013-01-01

    Full Text Available The taxonomy of (ParaMisgurnus genera is still debated. We therefore used mitochondrial and nuclear DNA markers to analyze the phylogenetic relationships among Misgurnus anguillicaudatus, Paramisgurnus dabryanus and Misgurnus fossilis. Differing phylogenetic signals from mitochondrial and nuclear marker data suggest an introgression event in the history of M. anguillicaudatus and M. mohoity. No substantial genetic evidence was found that Paramisgurnus dabryanus should be classified as a separate genus.

  12. Genetic and phylogenetic evolution of HIV-1 in a low subtype heterogeneity epidemic: the Italian example

    Directory of Open Access Journals (Sweden)

    Tornesello Maria

    2007-05-01

    Full Text Available Abstract The Human Immunodeficiency Virus type 1 (HIV-1 is classified into genetic groups, subtypes and sub-subtypes which show a specific geographic distribution pattern. The HIV-1 epidemic in Italy, as in most of the Western Countries, has traditionally affected the Intra-venous drug user (IDU and Homosexual (Homo risk groups and has been sustained by the genetic B subtype. In the last years, however, the HIV-1 transmission rate among heterosexuals has dramatically increased, becoming the prevalent transmission route. In fact, while the traditional risk groups have high levels of knowledge and avoid high-risk practices, the heterosexuals do not sufficiently perceive the risk of HIV-1 infection. This misperception, linked to the growing number of immigrants from non-Western Countries, where non-B clades and circulating recombinant forms (CRFs are prevalent, is progressively introducing HIV-1 variants of non-B subtype in the Italian epidemic. This is in agreement with reports from other Western European Countries. In this context, the Italian HIV-1 epidemic is still characterized by low subtype heterogeneity and represents a paradigmatic example of the European situation. The continuous molecular evolution of the B subtype HIV-1 isolates, characteristic of a long-lasting epidemic, together with the introduction of new subtypes as well as recombinant forms may have significant implications for diagnostic, treatment, and vaccine development. The study and monitoring of the genetic evolution of the HIV-1 represent, therefore, an essential strategy for controlling the local as well as global HIV-1 epidemic and for developing efficient preventive and therapeutic strategies.

  13. Assessment of genetic diversity and phylogenetic relationships of Korean native chicken breeds using microsatellite markers

    Directory of Open Access Journals (Sweden)

    Joo Hee Seo

    2017-10-01

    Full Text Available Objective This study was conducted to investigate the basic information on genetic structure and characteristics of Korean Native chickens (NC and foreign breeds through the analysis of the pure chicken populations and commercial chicken lines of the Hanhyup Company which are popular in the NC market, using the 20 microsatellite markers. Methods In this study, the genetic diversity and phylogenetic relationships of 445 NC from five different breeds (NC, Leghorn [LH], Cornish [CS], Rhode Island Red [RIR], and Hanhyup [HH] commercial line were investigated by performing genotyping using 20 microsatellite markers. Results The highest genetic distance was observed between RIR and LH (18.9%, whereas the lowest genetic distance was observed between HH and NC (2.7%. In the principal coordinates analysis (PCoA illustrated by the first component, LH was clearly separated from the other groups. The correspondence analysis showed close relationship among individuals belonging to the NC, CS, and HH lines. From the STRUCTURE program, the presence of 5 clusters was detected and it was found that the proportion of membership in the different clusters was almost comparable among the breeds with the exception of one breed (HH, although it was highest in LH (0.987 and lowest in CS (0.578. For the cluster 1 it was high in HH (0.582 and in CS (0.368, while for the cluster 4 it was relatively higher in HH (0.392 than other breeds. Conclusion Our study showed useful genetic diversity and phylogenetic relationship data that can be utilized for NC breeding and development by the commercial chicken industry to meet consumer demands.

  14. A conceptual model exploring the relationship between HIV stigma and implementing HIV clinical trials in rural communities of North Carolina.

    Science.gov (United States)

    Sengupta, Sohini; Strauss, Ronald P; Miles, Margaret S; Roman-Isler, Malika; Banks, Bahby; Corbie-Smith, Giselle

    2010-01-01

    HIV/AIDS disproportionately affects minority groups in the United States, especially in the rural southeastern states. Poverty and lack of access to HIV care, including clinical trials, are prevalent in these areas and contribute to HIV stigma. This is the first study to develop a conceptual model exploring the relationship between HIV stigma and the implementation of HIV clinical trials in rural contexts to help improve participation in those trials. We conducted focus groups with HIV service providers and community leaders, and individual interviews with people living with HIV/AIDS in six counties in rural North Carolina. Themes related to stigma were elicited. We classified the themes into theoretical constructs and developed a conceptual model. HIV stigma themes were classified under the existing theoretical constructs of perceived, experienced, vicarious, and felt normative stigma. Two additional constructs emerged: causes of HIV stigma (e.g., low HIV knowledge and denial in the community) and consequences of HIV stigma (e.g., confidentiality concerns in clinical trials). The conceptual model illustrates that the causes of HIV stigma can give rise to perceived, experienced, and vicarious HIV stigma, and these types of stigma could lead to the consequences of HIV stigma that include felt normative stigma. Understanding HIV stigma in rural counties of North Carolina may not be generalizeable to other rural US southeastern states. The conceptual model emphasizes that HIV stigma--in its many forms--is a critical barrier to HIV clinical trial implementation in rural North Carolina.

  15. Reconstruction of family-level phylogenetic relationships within Demospongiae (Porifera using nuclear encoded housekeeping genes.

    Directory of Open Access Journals (Sweden)

    Malcolm S Hill

    Full Text Available Demosponges are challenging for phylogenetic systematics because of their plastic and relatively simple morphologies and many deep divergences between major clades. To improve understanding of the phylogenetic relationships within Demospongiae, we sequenced and analyzed seven nuclear housekeeping genes involved in a variety of cellular functions from a diverse group of sponges.We generated data from each of the four sponge classes (i.e., Calcarea, Demospongiae, Hexactinellida, and Homoscleromorpha, but focused on family-level relationships within demosponges. With data for 21 newly sampled families, our Maximum Likelihood and Bayesian-based approaches recovered previously phylogenetically defined taxa: Keratosa(p, Myxospongiae(p, Spongillida(p, Haploscleromorpha(p (the marine haplosclerids and Democlavia(p. We found conflicting results concerning the relationships of Keratosa(p and Myxospongiae(p to the remaining demosponges, but our results strongly supported a clade of Haploscleromorpha(p+Spongillida(p+Democlavia(p. In contrast to hypotheses based on mitochondrial genome and ribosomal data, nuclear housekeeping gene data suggested that freshwater sponges (Spongillida(p are sister to Haploscleromorpha(p rather than part of Democlavia(p. Within Keratosa(p, we found equivocal results as to the monophyly of Dictyoceratida. Within Myxospongiae(p, Chondrosida and Verongida were monophyletic. A well-supported clade within Democlavia(p, Tetractinellida(p, composed of all sampled members of Astrophorina and Spirophorina (including the only lithistid in our analysis, was consistently revealed as the sister group to all other members of Democlavia(p. Within Tetractinellida(p, we did not recover monophyletic Astrophorina or Spirophorina. Our results also reaffirmed the monophyly of order Poecilosclerida (excluding Desmacellidae and Raspailiidae, and polyphyly of Hadromerida and Halichondrida.These results, using an independent nuclear gene set, confirmed

  16. Reconstruction of family-level phylogenetic relationships within Demospongiae (Porifera) using nuclear encoded housekeeping genes.

    Science.gov (United States)

    Hill, Malcolm S; Hill, April L; Lopez, Jose; Peterson, Kevin J; Pomponi, Shirley; Diaz, Maria C; Thacker, Robert W; Adamska, Maja; Boury-Esnault, Nicole; Cárdenas, Paco; Chaves-Fonnegra, Andia; Danka, Elizabeth; De Laine, Bre-Onna; Formica, Dawn; Hajdu, Eduardo; Lobo-Hajdu, Gisele; Klontz, Sarah; Morrow, Christine C; Patel, Jignasa; Picton, Bernard; Pisani, Davide; Pohlmann, Deborah; Redmond, Niamh E; Reed, John; Richey, Stacy; Riesgo, Ana; Rubin, Ewelina; Russell, Zach; Rützler, Klaus; Sperling, Erik A; di Stefano, Michael; Tarver, James E; Collins, Allen G

    2013-01-01

    Demosponges are challenging for phylogenetic systematics because of their plastic and relatively simple morphologies and many deep divergences between major clades. To improve understanding of the phylogenetic relationships within Demospongiae, we sequenced and analyzed seven nuclear housekeeping genes involved in a variety of cellular functions from a diverse group of sponges. We generated data from each of the four sponge classes (i.e., Calcarea, Demospongiae, Hexactinellida, and Homoscleromorpha), but focused on family-level relationships within demosponges. With data for 21 newly sampled families, our Maximum Likelihood and Bayesian-based approaches recovered previously phylogenetically defined taxa: Keratosa(p), Myxospongiae(p), Spongillida(p), Haploscleromorpha(p) (the marine haplosclerids) and Democlavia(p). We found conflicting results concerning the relationships of Keratosa(p) and Myxospongiae(p) to the remaining demosponges, but our results strongly supported a clade of Haploscleromorpha(p)+Spongillida(p)+Democlavia(p). In contrast to hypotheses based on mitochondrial genome and ribosomal data, nuclear housekeeping gene data suggested that freshwater sponges (Spongillida(p)) are sister to Haploscleromorpha(p) rather than part of Democlavia(p). Within Keratosa(p), we found equivocal results as to the monophyly of Dictyoceratida. Within Myxospongiae(p), Chondrosida and Verongida were monophyletic. A well-supported clade within Democlavia(p), Tetractinellida(p), composed of all sampled members of Astrophorina and Spirophorina (including the only lithistid in our analysis), was consistently revealed as the sister group to all other members of Democlavia(p). Within Tetractinellida(p), we did not recover monophyletic Astrophorina or Spirophorina. Our results also reaffirmed the monophyly of order Poecilosclerida (excluding Desmacellidae and Raspailiidae), and polyphyly of Hadromerida and Halichondrida. These results, using an independent nuclear gene set

  17. [Irritable bowel syndrome: frequency and phylogenetic relationship of Blastocystis sp. from Mexican patients].

    Science.gov (United States)

    Ramírez-Miranda, M E; Jiménez-González, D E; Rodríguez-Campa, M E; González-Angulo, A; Hernández-Castellanos, R; Sara Arroyo-Escalante, A; Romero-Valdovinos, M; Martínez-Hernández, F; Flisser, A; Maravilla, P

    2011-01-01

    Recent studies reported increased presence of Blastocystis in patients with Irritable Bowel Syndrome (IBS) and an etiologic role has been proposed. The pathogenic role of Blastocystis is controversial, because it is frequently found not only in individuals with enteric symptoms but also in healthy and asymptomatic subjects. Furthermore, there are few studies of blastocistosis in Mexico. To assess the frequency of Blastocystis sp. in IBS patients using molecular techniques and to describe its phylogenetic relationship with sequences of other countries. IBS patients according to Rome III criteria were enrolled. In all patients evaluations included: colonoscopies, coproparasitoscopic studies, coproculture, fecal virus screening. PCR and sequencing for Blastocystis sp. were also performed. We recruited 11 men and 51 women with a mean age of 45.6 (SD ± 15.7) years. Eighty-six percent of the IBS patients presented a normal colonoscopy, 8% showed polyps and 6% diverticular disease. Blastocystis sp. was identified in 25% patients (all of them with normal colonoscopy), while two patients had Endolimax nana and Entamoeba histolytica/E. dispar, respectively. Phylogenetic analysis showed that major sequences of Mexican carriers clustered together with sequences of parasites from Japan and Denmark; furthermore, two sequences from IBS patients were grouped in a single cluster. Blastocystis sp. was identified in 25% of the IBS patients. Our data support the hypothesis of clonal lineages in distinct geographical areas in the world.

  18. Phylogenetic relationship of Hepatozoon blood parasites found in snakes from Africa, America and Asia.

    Science.gov (United States)

    Haklová, B; Majláthová, V; Majláth, I; Harris, D J; Petrilla, V; Litschka-Koen, T; Oros, M; Peťko, B

    2014-03-01

    The blood parasites from the genus Hepatozoon Miller, 1908 (Apicomplexa: Adeleida: Hepatozoidae) represent the most common intracellular protozoan parasites found in snakes. In the present study, we examined 209 individuals of snakes, from different zoogeographical regions (Africa, America, Asia and Europe), for the occurrence of blood parasites using both molecular and microscopic examination methods, and assess phylogenetic relationships of all Hepatozoon parasites from snakes for the first time. In total, 178 blood smears obtained from 209 individuals, representing 40 species, were examined, from which Hepatozoon unicellular parasites were found in 26 samples (14·6% prevalence). Out of 180 samples tested by molecular method polymerase chain reaction (PCR), the presence of parasites was observed in 21 individuals (prevalence 11·6%): 14 snakes from Africa belonging to six genera (Dendroaspis, Dispholidus, Mehelya, Naja, Philothamnus and Python), five snakes from Asia from the genus Morelia and two snakes from America, from two genera (Coluber and Corallus). The intensity of infection varied from one to 1433 infected cells per 10 000 erythrocytes. Results of phylogenetic analyses (Bayesian and Maximum Likelihood) revealed the existence of five haplotypes divided into four main lineages. The present data also indicate neither geographical pattern of studied Hepatozoon sp., nor congruency in the host association.

  19. Phylogenetic relationships of Palaearctic Formica species (Hymenoptera, Formicidae based on mitochondrial cytochrome B sequences.

    Directory of Open Access Journals (Sweden)

    Anna V Goropashnaya

    Full Text Available Ants of genus Formica demonstrate variation in social organization and represent model species for ecological, behavioral, evolutionary studies and testing theoretical implications of the kin selection theory. Subgeneric division of the Formica ants based on morphology has been questioned and remained unclear after an allozyme study on genetic differentiation between 13 species representing all subgenera was conducted. In the present study, the phylogenetic relationships within the genus were examined using mitochondrial DNA sequences of the cytochrome b and a part of the NADH dehydrogenase subunit 6. All 23 Formica species sampled in the Palaearctic clustered according to the subgeneric affiliation except F. uralensis that formed a separate phylogenetic group. Unlike Coptoformica and Formica s. str., the subgenus Serviformica did not form a tight cluster but more likely consisted of a few small clades. The genetic distances between the subgenera were around 10%, implying approximate divergence time of 5 Myr if we used the conventional insect divergence rate of 2% per Myr. Within-subgenus divergence estimates were 6.69% in Serviformica, 3.61% in Coptoformica, 1.18% in Formica s. str., which supported our previous results on relatively rapid speciation in the latter subgenus. The phylogeny inferred from DNA sequences provides a necessary framework against which the evolution of social traits can be compared. We discuss implications of inferred phylogeny for the evolution of social traits.

  20. Genetic diversity and phylogenetic relationship in different genotypes of cotton for future breeding

    Directory of Open Access Journals (Sweden)

    Jehan

    2017-11-01

    Full Text Available Background: To make the plants well adapted and more resistant to diseases and other environmental stresses there is always a need to improve the quality of plant’s genome i.e. to increase its genetic diversity. Methods: In the present study six variety and six lines of cotton were investigated for their genetic diversity and phylogenetic relationship. For this purpose 35 different RAPD primers obtained from the Gene Link Technologies, USA were used. Results: Among 35 RAPD primers, 13 primers produced reproducible PCR bands while the rest failed to show any amplification product. Our results indicated that the total count of the reproducible bands was 670 and polymorphic loci were counted to be 442 which constitute 66% of total loci. Phylogenetic analysis revealed two major groups each consists of 7 and 5 genotypes respectively. Genotypes Lp1 and Tp4 were placed at maximum genetic distance and in separate groups and could be utilized for future cotton breeding. Conclusions: RAPD analysis is a cheaper and time saving technique for the determination of genetic diversity of different cotton genotypes. Cotton genotype Lp1 and Tp4 could be the best candidates for future breeding programs as both genotypes are genetically distant from each other.

  1. The phylogenetic relationships of basal archosauromorphs, with an emphasis on the systematics of proterosuchian archosauriforms

    Science.gov (United States)

    2016-01-01

    The early evolution of archosauromorphs during the Permo-Triassic constitutes an excellent empirical case study to shed light on evolutionary radiations in deep time and the timing and processes of recovery of terrestrial faunas after a mass extinction. However, macroevolutionary studies of early archosauromorphs are currently limited by poor knowledge of their phylogenetic relationships. In particular, one of the main early archosauromorph groups that need an exhaustive phylogenetic study is “Proterosuchia,” which as historically conceived includes members of both Proterosuchidae and Erythrosuchidae. A new data matrix composed of 96 separate taxa (several of them not included in a quantitative phylogenetic analysis before) and 600 osteological characters was assembled and analysed to generate a comprehensive higher-level phylogenetic hypothesis of basal archosauromorphs and shed light on the species-level interrelationships of taxa historically identified as proterosuchian archosauriforms. The results of the analysis using maximum parsimony include a polyphyletic “Prolacertiformes” and “Protorosauria,” in which the Permian Aenigmastropheus and Protorosaurus are the most basal archosauromorphs. The enigmatic choristoderans are either found as the sister-taxa of all other lepidosauromorphs or archosauromorphs, but consistently placed within Sauria. Prolacertids, rhynchosaurs, allokotosaurians and tanystropheids are the major successive sister clades of Archosauriformes. The Early Triassic Tasmaniosaurus is recovered as the sister-taxon of Archosauriformes. Proterosuchidae is unambiguosly restricted to five species that occur immediately after and before the Permo-Triassic boundary, thus implying that they are a short-lived “disaster” clade. Erythrosuchidae is composed of eight nominal species that occur during the Early and Middle Triassic. “Proterosuchia” is polyphyletic, in which erythrosuchids are more closely related to Euparkeria and more

  2. Phylogenetic relationship among East Asian species of the Stegana genus group (Diptera, Drosophilidae).

    Science.gov (United States)

    Li, Tong; Gao, Jian-jun; Lu, Jin-ming; Ji, Xing-lai; Chen, Hong-wei

    2013-01-01

    The phylogenetic relationship among 27 East Asian species of the Stegana genus group was reconstructed using DNA sequences of mitochondrial (COI and ND2) and nuclear (28S) genes. The results lent support to the current generic/subgeneric taxonomic classification in the genus group with the exceptions of the paraphyly of the genus Parastegana and the subgenus Oxyphortica in the genus Stegana. The ancestral areas and divergence times in the genus group were reconstructed/estimated, and accordingly, the biogeographical history of this important clade was discussed. It was proposed that, the evolution of the plant family Fagaceae, especially Quercus, may have played a certain role in facilitating the diversification of the Stegana genus group. Copyright © 2012 Elsevier Inc. All rights reserved.

  3. Molecular cytogenetic (FISH and genome analysis of diploid wheatgrasses and their phylogenetic relationship.

    Directory of Open Access Journals (Sweden)

    Gabriella Linc

    Full Text Available This paper reports detailed FISH-based karyotypes for three diploid wheatgrass species Agropyron cristatum (L. Beauv., Thinopyrum bessarabicum (Savul.&Rayss A. Löve, Pseudoroegneria spicata (Pursh A. Löve, the supposed ancestors of hexaploid Thinopyrum intermedium (Host Barkworth & D.R.Dewey, compiled using DNA repeats and comparative genome analysis based on COS markers. Fluorescence in situ hybridization (FISH with repetitive DNA probes proved suitable for the identification of individual chromosomes in the diploid JJ, StSt and PP genomes. Of the seven microsatellite markers tested only the (GAAn trinucleotide sequence was appropriate for use as a single chromosome marker for the P. spicata AS chromosome. Based on COS marker analysis, the phylogenetic relationship between diploid wheatgrasses and the hexaploid bread wheat genomes was established. These findings confirmed that the J and E genomes are in neighbouring clusters.

  4. Poly-γ-glutamic Acid Synthesis, Gene Regulation, Phylogenetic Relationships, and Role in Fermentation

    Science.gov (United States)

    Hsueh, Yi-Huang; Huang, Kai-Yao; Kunene, Sikhumbuzo Charles; Lee, Tzong-Yi

    2017-01-01

    Poly-γ-glutamic acid (γ-PGA) is a biodegradable biopolymer produced by several bacteria, including Bacillus subtilis and other Bacillus species; it has good biocompatibility, is non-toxic, and has various potential biological applications in the food, pharmaceutical, cosmetic, and other industries. In this review, we have described the mechanisms of γ-PGA synthesis and gene regulation, its role in fermentation, and the phylogenetic relationships among various pgsBCAE, a biosynthesis gene cluster of γ-PGA, and pgdS, a degradation gene of γ-PGA. We also discuss potential applications of γ-PGA and highlight the established genetic recombinant bacterial strains that produce high levels of γ-PGA, which can be useful for large-scale γ-PGA production. PMID:29215550

  5. Poly-γ-glutamic Acid Synthesis, Gene Regulation, Phylogenetic Relationships, and Role in Fermentation.

    Science.gov (United States)

    Hsueh, Yi-Huang; Huang, Kai-Yao; Kunene, Sikhumbuzo Charles; Lee, Tzong-Yi

    2017-12-07

    Poly-γ-glutamic acid (γ-PGA) is a biodegradable biopolymer produced by several bacteria, including Bacillus subtilis and other Bacillus species; it has good biocompatibility, is non-toxic, and has various potential biological applications in the food, pharmaceutical, cosmetic, and other industries. In this review, we have described the mechanisms of γ-PGA synthesis and gene regulation, its role in fermentation, and the phylogenetic relationships among various pgsBCAE , a biosynthesis gene cluster of γ-PGA, and pgdS , a degradation gene of γ-PGA. We also discuss potential applications of γ-PGA and highlight the established genetic recombinant bacterial strains that produce high levels of γ-PGA, which can be useful for large-scale γ-PGA production.

  6. Poly-γ-glutamic Acid Synthesis, Gene Regulation, Phylogenetic Relationships, and Role in Fermentation

    Directory of Open Access Journals (Sweden)

    Yi-Huang Hsueh

    2017-12-01

    Full Text Available Poly-γ-glutamic acid (γ-PGA is a biodegradable biopolymer produced by several bacteria, including Bacillus subtilis and other Bacillus species; it has good biocompatibility, is non-toxic, and has various potential biological applications in the food, pharmaceutical, cosmetic, and other industries. In this review, we have described the mechanisms of γ-PGA synthesis and gene regulation, its role in fermentation, and the phylogenetic relationships among various pgsBCAE, a biosynthesis gene cluster of γ-PGA, and pgdS, a degradation gene of γ-PGA. We also discuss potential applications of γ-PGA and highlight the established genetic recombinant bacterial strains that produce high levels of γ-PGA, which can be useful for large-scale γ-PGA production.

  7. Unraveling the phylogenetic relationships of the Eccoptochilinae, an enigmatic array of ordovician cheirurid trilobites.

    Directory of Open Access Journals (Sweden)

    I Wesley Gapp

    Full Text Available The Cheiruridae are a diverse group of trilobites and several subfamilies within the clade have been the focus of recent phylogenetic studies. This paper focuses on the relationships of one of those subfamilies, the Ordovician Eccoptochilinae. We analyze sixteen species from six genera within the traditionally defined group, using the pilekiid Anacheirurus frederici as an outgroup. To assess the monophyly of the Eccoptochilinae seven sphaerexochine species, Kawina arnoldi, Sphaerexochus arenosus, S. atacius, S. latifrons, S. mirus, S. parvus, and S. scabridus were included in the analysis as well. The results of this analysis show that the genus Eccoptochile represents a paraphyletic grade and species traditionally assigned to Parasphaerexochus and Skelipyx plot within Pseudosphaerexochus. Also, representative species of Sphaerexochinae plot within the traditionally defined Eccoptochilinae, suggesting Eccoptochilinae itself is paraphyletic. To resolve this, we propose all species of Pseudosphaerexochus be placed within Sphaerexochinae and Eccoptochilinae be restricted to a monotypic Eccoptochile clavigera.

  8. Diversity of Kale (Brassica oleracea var. sabellica): Glucosinolate Content and Phylogenetic Relationships.

    Science.gov (United States)

    Hahn, Christoph; Müller, Anja; Kuhnert, Nikolai; Albach, Dirk

    2016-04-27

    Recently, kale has become popular due to nutritive components beneficial for human health. It is an important source of phytochemicals such as glucosinolates that trigger associated cancer-preventive activity. However, nutritional value varies among glucosinolates and among cultivars. Here, we start a systematic determination of the content of five glucosinolates in 25 kale varieties and 11 non-kale Brassica oleracea cultivars by HPLC-DAD-ESI-MS(n) and compare the profiles with results from the analysis of SNPs derived from a KASP genotyping assay. Our results demonstrate that the glucosinolate levels differ markedly among varieties of different origin. Comparison of the phytochemical data with phylogenetic relationships revealed that the common name kale refers to at least three different groups. German, American, and Italian kales differ morphologically and phytochemically. Landraces do not show outstanding glucosinolate levels. Our results demonstrate the diversity of kale and the importance of preserving a broad genepool for future breeding purposes.

  9. Genetic variation and phylogenetic relationships of the ectomycorrhizal Floccularia luteovirens on the Qinghai-Tibet Plateau.

    Science.gov (United States)

    Xing, Rui; Gao, Qing-Bo; Zhang, Fa-Qi; Fu, Peng-Cheng; Wang, Jiu-Li; Yan, Hui-Ying; Chen, Shi-Long

    2017-08-01

    Floccularia luteovirens, as an ectomycorrhizal fungus, is widely distributed in the Qinghai-Tibet Plateau. As an edible fungus, it is famous for its unique flavor. Former studies mainly focus on the chemical composition and genetic structure of this species. However, the phylogenetic relationship between genotypes remains unknown. In this study, the genetic variation and phylogenetic relationship between the genotypes of F. luteovirens in Qinghai-Tibet Plateau was estimated through the analysis on two protein-coding genes (rpb1 and ef-1α) from 398 individuals collected from 24 wild populations. The sample covered the entire range of this species during all the growth seasons from 2011 to 2015. 13 genotypes were detected and moderate genetic diversity was revealed. Based on the results of network analysis, the maximum likelihood (ML), maximum parsimony (MP), and Bayesian inference (BI) analyses, the genotypes H-1, H-4, H-6, H-8, H-10, and H-11 were grouped into one clade. Additionally, a relatively higher genotype diversity (average h value is 0.722) and unique genotypes in the northeast edge of Qinghai- Tibet plateau have been found, combined with the results of mismatch analysis and neutrality tests indicated that Southeast Qinghai-Tibet plateau was a refuge for F. luteovirens during the historical geological or climatic events (uplifting of the Qinghai-Tibet Plateau or Last Glacial Maximum). Furthermore, the present distribution of the species on the Qinghai-Tibet plateau has resulted from the recent population expansion. Our findings provide a foundation for the future study of the evolutionary history and the speciation of this species.

  10. The SOD gene family in tomato: identification, phylogenetic relationships and expression patterns

    Directory of Open Access Journals (Sweden)

    kun feng

    2016-08-01

    Full Text Available Superoxide dismutases (SODs are critical antioxidant enzymes that protect organisms from reactive oxygen species (ROS caused by adverse conditions, and have been widely found in the cytoplasm, chloroplasts, and mitochondria of eukaryotic and prokaryotic cells. Tomato (Solanum lycopersicum L. is an important economic crop and is cultivated worldwide. However, abiotic and biotic stresses severely hinder growth and development of the plant, which affects the production and quality of the crop. To reveal the potential roles of SOD genes under various stresses, we performed a systematic analysis of the tomato SOD gene family and analyzed the expression patterns of SlSOD genes in response to abiotic stresses at the whole-genome level. The characteristics of the SlSOD gene family were determined by analyzing gene structure, conserved motifs, chromosomal distribution, phylogenetic relationships, and expression patterns. We determined that there are at least nine SOD genes in tomato, including four Cu/ZnSODs, three FeSODs, and one MnSOD, and they are unevenly distributed on 12 chromosomes. Phylogenetic analyses of SOD genes from tomato and other plant species were separated into two groups with a high bootstrap value, indicating that these SOD genes were present before the monocot-dicot split. Additionally, many cis-elements that respond to different stresses were found in the promoters of nine SlSOD genes. Gene expression analysis based on RNA-seq data showed that most genes were expressed in all tested tissues, with the exception of SlSOD6 and SlSOD8, which were only expressed in young fruits. Microarray data analysis showed that most members of the SlSOD gene family were altered under salt- and drought-stress conditions. This genome-wide analysis of SlSOD genes helps to clarify the function of SlSOD genes under different stress conditions and provides information to aid in further understanding the evolutionary relationships of SOD genes in plants.

  11. Re-visiting phylogenetic and taxonomic relationships in the genus Saga (Insecta: Orthoptera.

    Directory of Open Access Journals (Sweden)

    Balázs Kolics

    Full Text Available Twelve of the 13 bushcricket species of the Saga genus are bisexuals and diploids, except the parthenogenetic and tetraploid bush cricket, Saga pedo. Despite a continuous research effort stretching through the 1900s, the taxonomic relationships of the Saga species are still disputed. In this study, our primary aim was to reveal natural relationships of the European Saga species and three of their Asian relatives, with special attention to the problematic taxonomy of two subspecies: S. campbelli campbelli and S. c. gracilis. Following a phylogenetic analysis of eight species, a comprehensive study was carried out on the above three taxa by using acoustic and morphometric approaches in parallel. Our phylogenetic data showed that European Saga species evolved from a monophyletic lineage. The geographical transitional species S. cappadocica was positioned between European and Asian lineages supporting the idea that the European Saga lineage originated phylogeographically from the Asian clade. The above results showed better agreement with the morphological data than with earlier ones based either on karyology or acoustic information only. After reviewing our data, we concluded that Saga pedo has most likely evolved from S. c. gracilis and not from S. rammei or S. ephippigera, as proposed by earlier studies. S. c. gracilis shares the same ITS2 haplotype with S. pedo, indicating that the latter could have evolved from populations of the former, probably through whole genome duplication. Based on acoustic and morphometric differences, we propose to elevate the two subspecies, S. campbelli campbelli and S. c. gracilis, to species level status, as Saga gracilis Kis 1962, and Saga campbelli Uvarov 1921. The present work sets the stage for future genetic and experimental investigations of Saginae and highlights the need for additional comprehensive analysis involving more Asian Saga species.

  12. Re-visiting phylogenetic and taxonomic relationships in the genus Saga (Insecta: Orthoptera).

    Science.gov (United States)

    Kolics, Balázs; Ács, Zoltán; Chobanov, Dragan Petrov; Orci, Kirill Márk; Qiang, Lo Shun; Kovács, Balázs; Kondorosy, Előd; Decsi, Kincső; Taller, János; Specziár, András; Orbán, László; Müller, Tamás

    2012-01-01

    Twelve of the 13 bushcricket species of the Saga genus are bisexuals and diploids, except the parthenogenetic and tetraploid bush cricket, Saga pedo. Despite a continuous research effort stretching through the 1900s, the taxonomic relationships of the Saga species are still disputed. In this study, our primary aim was to reveal natural relationships of the European Saga species and three of their Asian relatives, with special attention to the problematic taxonomy of two subspecies: S. campbelli campbelli and S. c. gracilis. Following a phylogenetic analysis of eight species, a comprehensive study was carried out on the above three taxa by using acoustic and morphometric approaches in parallel. Our phylogenetic data showed that European Saga species evolved from a monophyletic lineage. The geographical transitional species S. cappadocica was positioned between European and Asian lineages supporting the idea that the European Saga lineage originated phylogeographically from the Asian clade. The above results showed better agreement with the morphological data than with earlier ones based either on karyology or acoustic information only. After reviewing our data, we concluded that Saga pedo has most likely evolved from S. c. gracilis and not from S. rammei or S. ephippigera, as proposed by earlier studies. S. c. gracilis shares the same ITS2 haplotype with S. pedo, indicating that the latter could have evolved from populations of the former, probably through whole genome duplication. Based on acoustic and morphometric differences, we propose to elevate the two subspecies, S. campbelli campbelli and S. c. gracilis, to species level status, as Saga gracilis Kis 1962, and Saga campbelli Uvarov 1921. The present work sets the stage for future genetic and experimental investigations of Saginae and highlights the need for additional comprehensive analysis involving more Asian Saga species.

  13. Biometrical studies upon hominoid teeth: the coefficient of variation, sexual dimorphism and questions of phylogenetic relationship.

    Science.gov (United States)

    Blumenberg, B

    1985-01-01

    Sexual dimorphism as a function of variation in hominoid tooth metrics has been investigated for four groups of taxa: Recent great apes (two subfamilies), Dryopiths (one subfamily), Ramapiths (one subfamily) and hominids (one family). Gorilla, and to a lesser extent Pan, appear characterized by very high levels of sexual dimorphism and meet several criteria for statistical outliers. Recent great apes are the only group exhibiting consistently high levels of sexual dimorphism. Ramapiths are the only group characterized by low levels of sexual dimorphism and their relative canine length is most similar to Dryopiths. Both Dryopiths and hominids contain taxa with low and intermediate levels of sexual dimorphism. The Gingerich and Shoeninger hypothesis relating coefficients of variation to occlusal complexity is supported. Non-parametric statistics suggest that homogeneity of coefficient of variation profiles over most of the tooth row is characteristic of only the Dryopiths and a composite data set composed of the Dryopith plus Ramapith tooth measurements. Oxnard's model for the multifactorial basis of multiple sexual dimorphisms is also supported. The Dryopith and hominid patterns of sexual dimorphism are similar, an observation that suggests phylogenetic relationship. At the taxonomic level of subfamily or family, sexual dimorphism is a character of cladistic usefulness and possible phylogenetic valence. Assuming that breeding system and sexual dimorphism are functional correlates as many workers suggest, then Ramapithecus sp. China, Sivapithecus indicus and possibly Australopithecus boisei are good candidates for having possessed monogamous breeding/social structures. All Dryopith taxa, S. sivalensis, Sivapithecus sp. China, A. afarensis, Homo habilis and H. erectus emerge as the best candidates for having possessed a polygynous breeding/social structure. No biometrical affinities of Ramapiths with hominids can be demonstrated and some phylogenetic relationship with

  14. Exploring Phylogenetic Relationships within Myriapoda and the Effects of Matrix Composition and Occupancy on Phylogenomic Reconstruction.

    Science.gov (United States)

    Fernández, Rosa; Edgecombe, Gregory D; Giribet, Gonzalo

    2016-09-01

    Myriapods, including the diverse and familiar centipedes and millipedes, are one of the dominant terrestrial arthropod groups. Although molecular evidence has shown that Myriapoda is monophyletic, its internal phylogeny remains contentious and understudied, especially when compared to those of Chelicerata and Hexapoda. Until now, efforts have focused on taxon sampling (e.g., by including a handful of genes from many species) or on maximizing matrix size (e.g., by including hundreds or thousands of genes in just a few species), but a phylogeny maximizing sampling at both levels remains elusive. In this study, we analyzed 40 Illumina transcriptomes representing 3 of the 4 myriapod classes (Diplopoda, Chilopoda, and Symphyla); 25 transcriptomes were newly sequenced to maximize representation at the ordinal level in Diplopoda and at the family level in Chilopoda. Ten supermatrices were constructed to explore the effect of several potential phylogenetic biases (e.g., rate of evolution, heterotachy) at 3 levels of gene occupancy per taxon (50%, 75%, and 90%). Analyses based on maximum likelihood and Bayesian mixture models retrieved monophyly of each myriapod class, and resulted in 2 alternative phylogenetic positions for Symphyla, as sister group to Diplopoda + Chilopoda, or closer to Diplopoda, the latter hypothesis having been traditionally supported by morphology. Within centipedes, all orders were well supported, but 2 deep nodes remained in conflict in the different analyses despite dense taxon sampling at the family level. Relationships among centipede orders in all analyses conducted with the most complete matrix (90% occupancy) are at odds not only with the sparser but more gene-rich supermatrices (75% and 50% supermatrices) and with the matrices optimizing phylogenetic informativeness or most conserved genes, but also with previous hypotheses based on morphology, development, or other molecular data sets. Our results indicate that a high percentage of ribosomal

  15. Improving the precision of the structure-function relationship by considering phylogenetic context.

    Directory of Open Access Journals (Sweden)

    2005-06-01

    Full Text Available Understanding the relationship between protein structure and function is one of the foremost challenges in post-genomic biology. Higher conservation of structure could, in principle, allow researchers to extend current limitations of annotation. However, despite significant research in the area, a precise and quantitative relationship between biochemical function and protein structure has been elusive. Attempts to draw an unambiguous link have often been complicated by pleiotropy, variable transcriptional control, and adaptations to genomic context, all of which adversely affect simple definitions of function. In this paper, I report that integrating genomic information can be used to clarify the link between protein structure and function. First, I present a novel measure of functional proximity between protein structures (F-score. Then, using F-score and other entirely automatic methods measuring structure and phylogenetic similarity, I present a three-dimensional landscape describing their inter-relationship. The result is a "well-shaped" landscape that demonstrates the added value of considering genomic context in inferring function from structural homology. A generalization of methodology presented in this paper can be used to improve the precision of annotation of genes in current and newly sequenced genomes.

  16. Evaluating the relationship between evolutionary divergence and phylogenetic accuracy in AFLP data sets.

    Science.gov (United States)

    García-Pereira, María Jesús; Caballero, Armando; Quesada, Humberto

    2010-05-01

    Using in silico amplified fragment length polymorphism (AFLP) fingerprints, we explore the relationship between sequence similarity and phylogeny accuracy to test when, in terms of genetic divergence, the quality of AFLP data becomes too low to be informative for a reliable phylogenetic reconstruction. We generated DNA sequences with known phylogenies using balanced and unbalanced trees with recent, uniform and ancient radiations, and average branch lengths (from the most internal node to the tip) ranging from 0.02 to 0.4 substitutions per site. The resulting sequences were used to emulate the AFLP procedure. Trees were estimated by maximum parsimony (MP), neighbor-joining (NJ), and minimum evolution (ME) methods from both DNA sequences and virtual AFLP fingerprints. The estimated trees were compared with the reference trees using a score that measures overall differences in both topology and relative branch length. As expected, the accuracy of AFLP-based phylogenies decreased dramatically in the more divergent data sets. Above a divergence of approximately 0.05, AFLP-based phylogenies were largely inaccurate irrespective of the distinct topology, radiation model, or phylogenetic method used. This value represents an upper bound of expected tree accuracy for data sets with a simple divergence history; AFLP data sets with a similar divergence but with unbalanced topologies and short ancestral branches produced much less accurate trees. The lack of homology of AFLP bands quickly increases with divergence and reaches its maximum value (100%) at a divergence of only 0.4. Low guanine-cytosine (GC) contents increase the number of nonhomologous bands in AFLP data sets and lead to less reliable trees. However, the effect of the lack of band homology on tree accuracy is surprisingly small relative to the negative impact due to the low information content of AFLP characters. Tree-building methods based on genetic distance displayed similar trends and outperformed parsimony

  17. Phylogenetic Relationships of Citrus and Its Relatives Based on matK Gene Sequences

    Science.gov (United States)

    Penjor, Tshering; Uehara, Miki; Ide, Manami; Matsumoto, Natsumi; Matsumoto, Ryoji

    2013-01-01

    The genus Citrus includes mandarin, orange, lemon, grapefruit and lime, which have high economic and nutritional value. The family Rutaceae can be divided into 7 subfamilies, including Aurantioideae. The genus Citrus belongs to the subfamily Aurantioideae. In this study, we sequenced the chloroplast matK genes of 135 accessions from 22 genera of Aurantioideae and analyzed them phylogenetically. Our study includes many accessions that have not been examined in other studies. The subfamily Aurantioideae has been classified into 2 tribes, Clauseneae and Citreae, and our current molecular analysis clearly discriminate Citreae from Clauseneae by using only 1 chloroplast DNA sequence. Our study confirms previous observations on the molecular phylogeny of Aurantioideae in many aspects. However, we have provided novel information on these genetic relationships. For example, inconsistent with the previous observation, and consistent with our preliminary study using the chloroplast rbcL genes, our analysis showed that Feroniella oblata is not nested in Citrus species and is closely related with Feronia limonia. Furthermore, we have shown that Murraya paniculata is similar to Merrillia caloxylon and is dissimilar to Murraya koenigii. We found that “true citrus fruit trees” could be divided into 2 subclusters. One subcluster included Citrus, Fortunella, and Poncirus, while the other cluster included Microcitrus and Eremocitrus. Compared to previous studies, our current study is the most extensive phylogenetic study of Citrus species since it includes 93 accessions. The results indicate that Citrus species can be classified into 3 clusters: a citron cluster, a pummelo cluster, and a mandarin cluster. Although most mandarin accessions belonged to the mandarin cluster, we found some exceptions. We also obtained the information on the genetic background of various species of acid citrus grown in Japan. Because the genus Citrus contains many important accessions, we have

  18. Phylogenetic relationships of citrus and its relatives based on matK gene sequences.

    Directory of Open Access Journals (Sweden)

    Tshering Penjor

    Full Text Available The genus Citrus includes mandarin, orange, lemon, grapefruit and lime, which have high economic and nutritional value. The family Rutaceae can be divided into 7 subfamilies, including Aurantioideae. The genus Citrus belongs to the subfamily Aurantioideae. In this study, we sequenced the chloroplast matK genes of 135 accessions from 22 genera of Aurantioideae and analyzed them phylogenetically. Our study includes many accessions that have not been examined in other studies. The subfamily Aurantioideae has been classified into 2 tribes, Clauseneae and Citreae, and our current molecular analysis clearly discriminate Citreae from Clauseneae by using only 1 chloroplast DNA sequence. Our study confirms previous observations on the molecular phylogeny of Aurantioideae in many aspects. However, we have provided novel information on these genetic relationships. For example, inconsistent with the previous observation, and consistent with our preliminary study using the chloroplast rbcL genes, our analysis showed that Feroniella oblata is not nested in Citrus species and is closely related with Feronia limonia. Furthermore, we have shown that Murraya paniculata is similar to Merrillia caloxylon and is dissimilar to Murraya koenigii. We found that "true citrus fruit trees" could be divided into 2 subclusters. One subcluster included Citrus, Fortunella, and Poncirus, while the other cluster included Microcitrus and Eremocitrus. Compared to previous studies, our current study is the most extensive phylogenetic study of Citrus species since it includes 93 accessions. The results indicate that Citrus species can be classified into 3 clusters: a citron cluster, a pummelo cluster, and a mandarin cluster. Although most mandarin accessions belonged to the mandarin cluster, we found some exceptions. We also obtained the information on the genetic background of various species of acid citrus grown in Japan. Because the genus Citrus contains many important accessions

  19. Phylogenetic relationships of citrus and its relatives based on matK gene sequences.

    Science.gov (United States)

    Penjor, Tshering; Yamamoto, Masashi; Uehara, Miki; Ide, Manami; Matsumoto, Natsumi; Matsumoto, Ryoji; Nagano, Yukio

    2013-01-01

    The genus Citrus includes mandarin, orange, lemon, grapefruit and lime, which have high economic and nutritional value. The family Rutaceae can be divided into 7 subfamilies, including Aurantioideae. The genus Citrus belongs to the subfamily Aurantioideae. In this study, we sequenced the chloroplast matK genes of 135 accessions from 22 genera of Aurantioideae and analyzed them phylogenetically. Our study includes many accessions that have not been examined in other studies. The subfamily Aurantioideae has been classified into 2 tribes, Clauseneae and Citreae, and our current molecular analysis clearly discriminate Citreae from Clauseneae by using only 1 chloroplast DNA sequence. Our study confirms previous observations on the molecular phylogeny of Aurantioideae in many aspects. However, we have provided novel information on these genetic relationships. For example, inconsistent with the previous observation, and consistent with our preliminary study using the chloroplast rbcL genes, our analysis showed that Feroniella oblata is not nested in Citrus species and is closely related with Feronia limonia. Furthermore, we have shown that Murraya paniculata is similar to Merrillia caloxylon and is dissimilar to Murraya koenigii. We found that "true citrus fruit trees" could be divided into 2 subclusters. One subcluster included Citrus, Fortunella, and Poncirus, while the other cluster included Microcitrus and Eremocitrus. Compared to previous studies, our current study is the most extensive phylogenetic study of Citrus species since it includes 93 accessions. The results indicate that Citrus species can be classified into 3 clusters: a citron cluster, a pummelo cluster, and a mandarin cluster. Although most mandarin accessions belonged to the mandarin cluster, we found some exceptions. We also obtained the information on the genetic background of various species of acid citrus grown in Japan. Because the genus Citrus contains many important accessions, we have

  20. 16S ribosomal RNA sequence analysis for determination of phylogenetic relationship among methylotrophs.

    Science.gov (United States)

    Tsuji, K; Tsien, H C; Hanson, R S; DePalma, S R; Scholtz, R; LaRoche, S

    1990-01-01

    16S ribosomal RNAs (rRNA) of 12 methylotrophic bacteria have been almost completely sequenced to establish their phylogenetic relationships. Methylotrophs that are physiologically related are phylogenetically diverse and are scattered among the purple eubacteria (class Proteobacteria). Group I methylotrophs can be classified in the beta- and the gamma-subdivisions and group II methylotrophs in the alpha-subdivision of the purple eubacteria, respectively. Pink-pigmented facultative and non-pigmented obligate group II methylotrophs form two distinctly separate branches within the alpha-subdivision. The secondary structures of the 16S rRNA sequences of 'Methylocystis parvus' strain OBBP, 'Methylosinus trichosporium' strain OB3b, 'Methylosporovibrio methanica' strain 81Z and Hyphomicrobium sp. strain DM2 are similar, and these non-pigmented obligate group II methylotrophs form one tight cluster in the alpha-subdivision. The pink-pigmented facultative methylotrophs, Methylobacterium extorquens strain AM1, Methylobacterium sp. strain DM4 and Methylobacterium organophilum strain XX form another cluster within the alpha-subdivision. Although similar in phenotypic characteristics, Methylobacterium organophilum strain XX and Methylobacterium extorquens strain AM1 are clearly distinguishable by their 16S rRNA sequences. The group I methylotrophs, Methylophilus methylotrophus strain AS1 and methylotrophic species DM11, which do not utilize methane, are similar in 16S rRNA sequence to bacteria in the beta-subdivision. The methane-utilizing, obligate group I methanotrophs, Methylococcus capsulatus strain BATH and Methylomonas methanica, are placed in the gamma-subdivision. The results demonstrate that it is possible to distinguish and classify the methylotrophic bacteria using 16S rRNA sequence analysis.

  1. Phylogenetic relationships in Asarum: Effect of data partitioning and a revised classification.

    Science.gov (United States)

    Sinn, Brandon T; Kelly, Lawrence M; Freudenstein, John V

    2015-05-01

    Generic boundaries and infrageneric relationships among the charismatic temperate magnoliid Asarum sensu lato (Aristolochiaceae) have long been uncertain. Previous molecular phylogenetic analyses used either plastid or nuclear loci alone and varied greatly in their taxonomic implications for the genus. We analyzed additional molecular markers from the nuclear and plastid genomes, reevaluated the possibility of a derived loss of autonomous self-pollination, and investigated the topological effects of matrix-partitioning-scheme choice. We sequenced seven plastid regions and the nuclear ITS1-ITS2 region of 58 individuals representing all previously recognized Asarum s.l. segregate genera and the monotypic genus Saruma. Matrices were partitioned using common a priori partitioning schemes and PartitionFinder. Topologies that were recovered using a priori partitioning of matrices differed from those recovered using a PartitionFinder-selected scheme, and by analysis method. We recovered six monophyletic groups that we circumscribed into three subgenera and six sections. Putative fungal mimic characters served as synapomorphies only for subgenus Heterotropa. Subgenus Geotaenium, a new subgenus, was recovered as sister to the remainder of Asarum by ML analyses of highly partitioned datasets. Section Longistylis, also newly named, is sister to section Hexastylis. Our analyses do not unambiguously support a single origin for all fungal-mimicry characters. Topologies recovered through the analysis of PartitionFinder-optimized matrices can differ drastically from those inferred from a priori partitioned matrices, and by analytical method. We recommend that investigators evaluate the topological effects of matrix partitioning using multiple methods of phylogenetic reconstruction. © 2015 Botanical Society of America, Inc.

  2. HIV-1 transmission networks in high risk fishing communities on the shores of Lake Victoria in Uganda: A phylogenetic and epidemiological approach.

    Directory of Open Access Journals (Sweden)

    Sylvia Kiwuwa-Muyingo

    Full Text Available Fishing communities around Lake Victoria in sub-Saharan Africa have been characterised as a population at high risk of HIV-infection.Using data from a cohort of HIV-positive individuals aged 13-49 years, enrolled from 5 fishing communities on Lake Victoria between 2009-2011, we sought to identify factors contributing to the epidemic and to understand the underlying structure of HIV transmission networks. Clinical and socio-demographic data were combined with HIV-1 phylogenetic analyses. HIV-1 gag-p24 and env-gp-41 sub-genomic fragments were amplified and sequenced from 283 HIV-1-infected participants. Phylogenetic clusters with ≥2 highly related sequences were defined as transmission clusters. Logistic regression models were used to determine factors associated with clustering.Altogether, 24% (n = 67/283 of HIV positive individuals with sequences fell within 34 phylogenetically distinct clusters in at least one gene region (either gag or env. Of these, 83% occurred either within households or within community; 8/34 (24% occurred within household partnerships, and 20/34 (59% within community. 7/12 couples (58% within households clustered together. Individuals in clusters with potential recent transmission (11/34 were more likely to be younger 71% (15/21 versus 46% (21/46 in un-clustered individuals and had recently become resident in the community 67% (14/21 vs 48% (22/46. Four of 11 (36% potential transmission clusters included incident-incident transmissions. Independently, clustering was less likely in HIV subtype D (adjusted Odds Ratio, aOR = 0.51 [95% CI 0.26-1.00] than A and more likely in those living with an HIV-infected individual in the household (aOR = 6.30 [95% CI 3.40-11.68].A large proportion of HIV sexual transmissions occur within house-holds and within communities even in this key mobile population. The findings suggest localized HIV transmissions and hence a potential benefit for the test and treat approach even at a community

  3. The complete genome structure and phylogenetic relationship of infectious hematopoietic necrosis virus

    Science.gov (United States)

    Morzunov , Sergey P.; Winton, James R.; Nichol, Stuart T.

    1995-01-01

    Infectious hematopoietic necrosis virus (IHNV), a member of the family Rhabdoviridae, causes a severe disease with high mortality in salmonid fish. The nucleotide sequence (11, 131 bases) of the entire genome was determined for the pathogenic WRAC strain of IHNV from southern Idaho. This allowed detailed analysis of all 6 genes, the deduced amino acid sequences of their encoded proteins, and important control motifs including leader, trailer and gene junction regions. Sequence analysis revealed that the 6 virus genes are located along the genome in the 3′ to 5′ order: nucleocapsid (N), polymerase-associated phosphoprotein (P or M1), matrix protein (M or M2), surface glycoprotein (G), a unique non-virion protein (NV) and virus polymerase (L). The IHNV genome RNA was found to have highly complementary termini (15 of 16 nucleotides). The gene junction regions display the highly conserved sequence UCURUC(U)7RCCGUG(N)4CACR (in the vRNA sense), which includes the typical rhabdovirus transcription termination/polyadenylation signal and a novel putative transcription initiation signal. Phylogenetic analysis of M, G and L protein sequences allowed insights into the evolutionary and taxonomic relationship of rhabdoviruses of fish relative to those of insects or mammals, and a broader sense of the relationship of non-segmented negative-strand RNA viruses. Based on these data, a new genus, piscivirus, is proposed which will initially contain IHNV, viral hemorrhagic septicemia virus and Hirame rhabdovirus.

  4. Intraspecific relationship within the genus convolvulus l. inferred by rbcl gene using different phylogenetic approaches

    International Nuclear Information System (INIS)

    Kausar, S.; Qamarunnisa, S.

    2016-01-01

    A molecular systematics analysis was conducted using sequence data of chloroplast rbcL gene for the genus Convolvulus L., by distance and character based phylogenetic methods. Fifteen representative members from genus Convolvulus L., were included as in group whereas two members from a sister family Solanaceae were taken as out group to root the tree. Intraspecific relationships within Convolvulus were inferred by distance matrix, maximum parsimony and bayesian analysis. Transition/transversion ratio was also calculated and it was revealed that in the investigated Convolvulus species, transitional changes were more prevalent in rbcL gene. The nature of rbcL gene in the present study was observed to be conserved, as it does not show major variations between examined species. Distance matrix represented the minimal genetic variations between some species (C. glomeratus and C. pyrrhotrichus), thus exhibiting them as close relatives. The result of parsimonious and bayesian analysis revealed almost similar clades however maximum parsimony based tree was unable to establish relationship between some Convolvulus species. The bayesian inference method was found to be the method of choice for establishing intraspecific associations between Convolvulus species using rbcL data as it clearly defined the connections supported by posterior probability values. (author)

  5. Mitochondrial DNA sequence-based phylogenetic relationship of Trichiurus lepturus (Perciformes: Trichiuridae) from the Persian Gulf

    Science.gov (United States)

    Tamadoni Jahromi, S.; Mohd Noor, S. A.; Pirian, K.; Dehghani, R.; Nazemi, M.; Khazaali, A.

    2016-01-01

    In this study, mitochondrial DNA analysis using 16S ribosomal DNA (rDNA) was performed to investigate the phylogeny relationship of Trichiurus lepturus in the Persian Gulf compared to the other investigated area. The amplification of 16S rDNA resulted in a product of 600 bp in all samples. The results showed that the isolated strain belongs to T. lepturus showing 42 divergence sites among the same reported partial sequences of 16S rRNA gene from the other area (West Atlantic and Indo-Pacific area). Phylogeny results showed that all 18 haplotypes of the species clustered into five clades with reasonably high bootstrap support of values (>64%). Overall, the tree topology for both phylogenetic and phenetic trees for 16S rDNA was similar. Both trees exposed two major clusters, one wholly containing the haplotypes of the T. lepturus species belonging to Indo-Pacific area with two major sister groups including Persian Gulf specimen and the other cleared the Western Atlantic and Japan individuals clustered in another distinct clade supporting the differentiation between the two areas. Phylogenic relationship observed between the Persian Gulf and the other Indo-Pacific Individuals suggested homogeneity between two mentioned areas. PMID:27822250

  6. Phylogenetic relationships of the Orang Asli and Iban of Malaysia based on maternal markers.

    Science.gov (United States)

    Ang, K C; Leow, J W H; Yeap, W K; Hood, S; Mahani, M C; Md-Zain, B M

    2011-04-12

    Malaysia remains as a crossroad of different cultures and peoples, and it has long been recognized that studying its population history can provide crucial insight into the prehistory of Southeast Asia as a whole. The earliest inhabitants were the Orang Asli in Peninsular Malaysia and the indigenous groups in Sabah and Sarawak. Although they were the earliest migrants in this region, these tribes are divided geographically by the South China Sea. We analyzed DNA sequences of 18 Orang Asli using mitochondrial DNA extracted from blood samples, each representing one sub-tribe, and from five Sarawakian Iban. Mitochondrial DNA was extracted from hair samples in order to examine relationships with the main ethnic groups in Malaysia. The D-loop region and cytochrome b genes were used as the candidate loci. Phylogenetic relationships were investigated using maximum parsimony and neighbor joining algorithms, and each tree was subjected to bootstrap analysis with 1000 replicates. Analyses of the HVS I region showed that the Iban are not a distinct group from the Orang Asli; they form a sub-clade within the Orang Asli. Based on the cytochrome b gene, the Iban clustered with the Orang Asli in the same clade. We found evidence for considerable gene flow between Orang Asli and Iban. We concluded that the Orang Asli, Iban and the main ethnic groups of Malaysia are probably derived from a common ancestor. This is in agreement with a single-route migration theory, but it does not dismiss a two-route migration theory.

  7. Epidemiological study of phylogenetic transmission clusters in a local HIV-1 epidemic reveals distinct differences between subtype B and non-B infections.

    Science.gov (United States)

    Chalmet, Kristen; Staelens, Delfien; Blot, Stijn; Dinakis, Sylvie; Pelgrom, Jolanda; Plum, Jean; Vogelaers, Dirk; Vandekerckhove, Linos; Verhofstede, Chris

    2010-09-07

    The number of HIV-1 infected individuals in the Western world continues to rise. More in-depth understanding of regional HIV-1 epidemics is necessary for the optimal design and adequate use of future prevention strategies. The use of a combination of phylogenetic analysis of HIV sequences, with data on patients' demographics, infection route, clinical information and laboratory results, will allow a better characterization of individuals responsible for local transmission. Baseline HIV-1 pol sequences, obtained through routine drug-resistance testing, from 506 patients, newly diagnosed between 2001 and 2009, were used to construct phylogenetic trees and identify transmission-clusters. Patients' demographics, laboratory and clinical data, were retrieved anonymously. Statistical analysis was performed to identify subtype-specific and transmission-cluster-specific characteristics. Multivariate analysis showed significant differences between the 59.7% of individuals with subtype B infection and the 40.3% non-B infected individuals, with regard to route of transmission, origin, infection with Chlamydia (p = 0.01) and infection with Hepatitis C virus (p = 0.017). More and larger transmission-clusters were identified among the subtype B infections (p HIV (p = 0.017). Combination of phylogenetics with demographic information, laboratory and clinical data, revealed that HIV-1 subtype B infected Caucasian men-who-have-sex-with-men with high prevalence of sexually transmitted diseases, account for the majority of local HIV-transmissions. This finding elucidates observed epidemiological trends through molecular analysis, and justifies sustained focus in prevention on this high risk group.

  8. Relationships among North American and Japanese Laetiporus isolates inferred from molecular phylogenetics and single-spore incompatibility reactions

    Science.gov (United States)

    Mark T. Banik; Daniel L. Lindner; Yuko Ota; Tsutomu Hattori

    2010-01-01

    Relationships were investigated among North American and Japanese isolates of Laetiporus using phylogenetic analysis of ITS sequences and single-spore isolate incompatibility. Single-spore isolate pairings revealed no significant compatibility between North American and Japanese isolates. ITS analysis revealed 12 clades within the core ...

  9. PHYLOGENETIC RELATIONSHIP OF THE RED TIDE DINOFLAGELLATE GYMNODINIUM BREVE TO OTHER MEMBERS OF THE GENERA GYMNODINIUM AND GYRODINIUM

    Science.gov (United States)

    Phylogenetic relationships between the red-tide dinoflagellate Gymnodinium breve and other members of the genera Gymnodinium and Gyrodinium have not been studied at the molecular level. G. breve is most noted for its production of brevetoxin, which has been linked to extensive f...

  10. The importance of species phylogenetic relationships and species traits for the intensity of plant-soil feedback

    Czech Academy of Sciences Publication Activity Database

    Münzbergová, Zuzana; Šurinová, Mária

    2015-01-01

    Roč. 6, č. 11 (2015), s. 1-16 ISSN 2150-8925 R&D Projects: GA ČR(CZ) GA15-11635S Institutional support: RVO:67985939 Keywords : phylogenetic relationships * species traits * plant-soil feedback Subject RIV: EF - Botanics Impact factor: 2.287, year: 2015

  11. Phylogenetic relationships of cone snails endemic to Cabo Verde based on mitochondrial genomes.

    Science.gov (United States)

    Abalde, Samuel; Tenorio, Manuel J; Afonso, Carlos M L; Uribe, Juan E; Echeverry, Ana M; Zardoya, Rafael

    2017-11-25

    Due to their great species and ecological diversity as well as their capacity to produce hundreds of different toxins, cone snails are of interest to evolutionary biologists, pharmacologists and amateur naturalists alike. Taxonomic identification of cone snails still relies mostly on the shape, color, and banding patterns of the shell. However, these phenotypic traits are prone to homoplasy. Therefore, the consistent use of genetic data for species delimitation and phylogenetic inference in this apparently hyperdiverse group is largely wanting. Here, we reconstruct the phylogeny of the cones endemic to Cabo Verde archipelago, a well-known radiation of the group, using mitochondrial (mt) genomes. The reconstructed phylogeny grouped the analyzed species into two main clades, one including Kalloconus from West Africa sister to Trovaoconus from Cabo Verde and the other with a paraphyletic Lautoconus due to the sister group relationship of Africonus from Cabo Verde and Lautoconus ventricosus from Mediterranean Sea and neighboring Atlantic Ocean to the exclusion of Lautoconus endemic to Senegal (plus Lautoconus guanche from Mauritania, Morocco, and Canary Islands). Within Trovaoconus, up to three main lineages could be distinguished. The clade of Africonus included four main lineages (named I to IV), each further subdivided into two monophyletic groups. The reconstructed phylogeny allowed inferring the evolution of the radula in the studied lineages as well as biogeographic patterns. The number of cone species endemic to Cabo Verde was revised under the light of sequence divergence data and the inferred phylogenetic relationships. The sequence divergence between continental members of the genus Kalloconus and island endemics ascribed to the genus Trovaoconus is low, prompting for synonymization of the latter. The genus Lautoconus is paraphyletic. Lautoconus ventricosus is the closest living sister group of genus Africonus. Diversification of Africonus was in allopatry

  12. Phylogenetic relationships and evolutionary history of the reef fish family Labridae.

    Science.gov (United States)

    Westneat, Mark W; Alfaro, Michael E

    2005-08-01

    The family Labridae (including scarines and odacines) contains 82 genera and about 600 species of fishes that inhabit coastal and continental shelf waters in tropical and temperate oceans throughout the world. The Labridae (the wrasses) is the fifth largest fish family and second largest marine fish family, and is one of the most morphologically and ecologically diversified families of fishes in size, shape, and color. Labrid phylogeny is a long-standing problem in ichthyology that is part of the larger question of relationships within the suborder Labroidei. A phylogenetic analysis of labrids was conducted to investigate relationships among the six classical tribes of wrasses, the affinities of the wrasses to the parrotfishes (scarines), and the broad phylogenetic structure among labrid genera. Four gene fragments were sequenced from 98 fish species, including 84 labrid fishes and 14 outgroup taxa. Taxa were chosen from all major labrid clades and most major global ocean regions where labrid fishes exist, as well as cichlid, pomacentrid, and embiotocid outgroups. From the mitochondrial genome we sequenced portions of 12S rRNA (1000 bp) and 16S rRNA (585 bp), which were aligned by using a secondary structure model. From the nuclear genome, we sequenced part of the protein-coding genes RAG2 (846 bp) and Tmo4C4 (541 bp). Maximum likelihood, maximum parsimony, and Bayesian analyses on the resulting 2972 bp of DNA sequence produced similar topologies that confirm the monophyly of a family Labridae that includes the parrotfishes and butterfishes and strong support for many previously identified taxonomic subgroups. The tribe Hypsigenyini (hogfishes, tuskfishes) is the sister group to the remaining labrids and includes odacines and the chisel-tooth wrasse Pseudodax moluccanus, a species previously considered close to scarines. Cheilines and scarines are sister-groups, closely related to the temperate Labrini, and pseudocheilines and cheilines are split in all phylogenies

  13. Morphometric relationship, phylogenetic correlation, and character evolution in the species-rich genus Aphis (Hemiptera: Aphididae.

    Directory of Open Access Journals (Sweden)

    Hyojoong Kim

    2010-07-01

    Full Text Available The species-rich genus Aphis consists of more than 500 species, many of them host-specific on a wide range of plants, yet very similar in general appearance due to convergence toward particular morphological types. Most species have been historically clustered into four main phenotypic groups (gossypii, craccivora, fabae, and spiraecola groups. To confirm the morphological hypotheses between these groups and to examine the characteristics that determine them, multivariate morphometric analyses were performed using 28 characters measured/counted from 40 species. To infer whether the morphological relationships are correlated with the genetic relationships, we compared the morphometric dataset with a phylogeny reconstructed from the combined dataset of three mtDNA and one nuclear DNA regions.Based on a comparison of morphological and molecular datasets, we confirmed morphological reduction or regression in the gossypii group unlike in related groups. Most morphological characteristics of the gossypii group were less variable than for the other groups. Due to these, the gossypii group could be morphologically well separated from the craccivora, fabae, and spiraecola groups. In addition, the correlation of the rates of evolution between morphological and DNA datasets was highly significant in their diversification.The morphological separation between the gossypii group and the other species-groups are congruent with their phylogenetic relationships. Analysis of trait evolution revealed that the morphological traits found to be significant based on the morphometric analyses were confidently correlated with the phylogeny. The dominant patterns of trait evolution resulting in increased rates of short branches and temporally later evolution are likely suitable for the modality of Aphis speciation because they have adapted species-specifically, rapidly, and more recently on many different host plants.

  14. Nuclear and cpDNA sequences combined provide strong inference of higher phylogenetic relationships in the phlox family (Polemoniaceae).

    Science.gov (United States)

    Johnson, Leigh A; Chan, Lauren M; Weese, Terri L; Busby, Lisa D; McMurry, Samuel

    2008-09-01

    Members of the phlox family (Polemoniaceae) serve as useful models for studying various evolutionary and biological processes. Despite its biological importance, no family-wide phylogenetic estimate based on multiple DNA regions with complete generic sampling is available. Here, we analyze one nuclear and five chloroplast DNA sequence regions (nuclear ITS, chloroplast matK, trnL intron plus trnL-trnF intergeneric spacer, and the trnS-trnG, trnD-trnT, and psbM-trnD intergenic spacers) using parsimony and Bayesian methods, as well as assessments of congruence and long branch attraction, to explore phylogenetic relationships among 84 ingroup species representing all currently recognized Polemoniaceae genera. Relationships inferred from the ITS and concatenated chloroplast regions are similar overall. A combined analysis provides strong support for the monophyly of Polemoniaceae and subfamilies Acanthogilioideae, Cobaeoideae, and Polemonioideae. Relationships among subfamilies, and thus for the precise root of Polemoniaceae, remain poorly supported. Within the largest subfamily, Polemonioideae, four clades corresponding to tribes Polemonieae, Phlocideae, Gilieae, and Loeselieae receive strong support. The monogeneric Polemonieae appears sister to Phlocideae. Relationships within Polemonieae, Phlocideae, and Gilieae are mostly consistent between analyses and data permutations. Many relationships within Loeselieae remain uncertain. Overall, inferred phylogenetic relationships support a higher-level classification for Polemoniaceae proposed in 2000.

  15. Phylogenetic relationships of the Fox (Forkhead) gene family in the Bilateria

    Science.gov (United States)

    Mazet, Francoise; Yu, Jr Kai; Liberles, David A.; Holland, Linda Z.; Shimeld, Sebastian M.

    2003-01-01

    The Forkhead or Fox gene family encodes putative transcription factors. There are at least four Fox genes in yeast, 16 in Drosophila melanogaster (Dm) and 42 in humans. Recently, vertebrate Fox genes have been classified into 17 groups named FoxA to FoxQ. Here, we extend this analysis to invertebrates, using available sequences from D. melanogaster, Anopheles gambiae (Ag), Caenorhabditis elegans (Ce), the sea squirt Ciona intestinalis (Ci) and amphioxus Branchiostoma floridae (Bf), from which we also cloned several Fox genes. Phylogenetic analyses lend support to the previous overall subclassification of vertebrate genes, but suggest that four subclasses (FoxJ, L, N and Q) could be further subdivided to reflect their relationships to invertebrate genes. We were unable to identify orthologs of Fox subclasses E, H, I, J, M and Q1 in D. melanogaster, A. gambiae or C. elegans, suggesting either considerable loss in ecdysozoans or the evolution of these subclasses in the deuterostome lineage. Our analyses suggest that the common ancestor of protostomes and deuterostomes had a minimum complement of 14 Fox genes.

  16. New insights into the phylogenetic relationships, character evolution, and phytogeographic patterns of Calceolaria (Calceolariaceae).

    Science.gov (United States)

    Cosacov, Andrea; Sérsic, Alicia N; Sosa, Victoria; De-Nova, J Arturo; Nylinder, Stephan; Cocucci, Andrea A

    2009-12-01

    Biogeographical patterns and diversification processes in Andean and Patagonian flora are not yet well understood. Calceolaria is a highly diversified genus of these areas, representing one of the most specialized plant-pollinator systems because flowers produce nonvolatile oils, a very unusual floral reward. Phylogenetic analyses with molecular (ITS and matK) and morphological characters from 103 Calceolaria species were conducted to examine relationships, to understand biogeographic patterns, and to detect evolutionary patterns of floral and ecological characters. Total evidence analysis retrieved three major clades, which strongly correspond to the three previously recognized subgenera, although only subgenus Rosula was retrieved as a monophyletic group. A single historical event explains the expansion from the southern to central Andes, while different parallel evolutionary lines show a northward expansion from the central to northern Andes across the Huancabamba Deflection, an important geographical barrier in northern Peru. Polyploidy, acquisition of elaiophores, and a nototribic pollination mechanism are key aspects of the evolutionary history of Calceolaria. Pollination interactions were more frequently established with Centris than with Chalepogenus oil-collecting bee species. The repeated loss of the oil gland and shifts to pollen as the only reward suggest an evolutionary tendency from highly to moderately specialized pollination systems.

  17. Phylogenetic relationships of the Cochliopinae (Rissooidea: Hydrobiidae): an enigmatic group of aquatic gastropods.

    Science.gov (United States)

    Liu, H P; Hershler, R; Thompson, F G

    2001-10-01

    Phylogenetic analysis based on a partial sequence of the mitochondrial cytochrome c oxidase subunit I gene was performed for 26 representatives of the aquatic gastropod subfamily Cochliopinae, 6 additional members of the family Hydrobiidae, and outgroup species of the families Rissoidae and Pomatiopsidae. Maximum-parsimony analysis yielded a single shortest tree which resolved two monophyletic groups: (1) a clade containing all cochliopine taxa with the exception of Antroselates and (2) a clade composed of Antroselates and the hydrobiid genus Amnicola. The clade containing both of these monophyletic groups was depicted as more closely related to members of the family Pomatiopsidae than to other hydrobiid snails which were basally positioned in our topology. New anatomical evidence supports recognition of the cochliopine and Antroselates-Amnicola clades, and structure within the monophyletic group of cochliopines is largely congruent with genitalic characters. However, the close relationship between the Pomatiopsidae and these clades is in conflict with commonly accepted classifications and suggests that a widely accepted scenario for genitalic evolution in these snails is in need of further study. Copyright 2001 Academic Press.

  18. Phylogenetic relationships among East African haplochromine fish as revealed by short interspersed elements (SINEs).

    Science.gov (United States)

    Terai, Yohey; Takezaki, Naoko; Mayer, Werner E; Tichy, Herbert; Takahata, Naoyuki; Klein, Jan; Okada, Norihiro

    2004-01-01

    Genomic DNA libraries were prepared from two endemic species of Lake Victoria haplochromine (cichlid) fish and used to isolate and characterize a set of short interspersed elements (SINEs). The distribution and sequences of the SINEs were used to infer phylogenetic relationships among East African haplochromines. The SINE-based classification divides the fish into four groups, which, in order of their divergence from a stem lineage, are the endemic Lake Tanganyika flock (group 1); fish of the nonendemic, monotypic, widely distributed genus Astatoreochromis (group 2); the endemic Lake Malawi flock (group 3); and group 4, which contains fish from widely dispersed East African localities including Lakes Victoria, Edward, George, Albert, and Rukwa, as well as many rivers. The group 4 haplochromines are characterized by a subset of polymorphic SINEs, each of which is present in some individuals and absent in others of the same population at a given locality, the same morphologically defined species, and the same mtDNA-defined haplogroup. SINE-defined group 4 contains six of the seven previously described mtDNA haplogroups. One of the polymorphic SINEs appears to be fixed in the endemic Lake Victoria flock; four others display the presence-or-absence polymorphism within the species of this flock. These findings have implications for the origin of Lake Victoria cichlids and for their founding population sizes.

  19. Phylogenetic relationships and evolutionary history of the greater horseshoe bat, Rhinolophus ferrumequinum, in Northeast Asia.

    Science.gov (United States)

    Liu, Tong; Sun, Keping; Park, Yung Chul; Feng, Jiang

    2016-01-01

    The greater horseshoe bat, Rhinolophus ferrumequinum , is an important model organism for studies on chiropteran phylogeographic patterns. Previous studies revealed the population history of R. ferrumequinum from Europe and most Asian regions, yet there continue to be arguments about their evolutionary process in Northeast Asia. In this study, we obtained mitochondrial DNA cyt b and D-loop data of R. ferrumequinum from Northeast China, South Korea and Japan to clarify their phylogenetic relationships and evolutionary process. Our results indicate a highly supported monophyletic group of Northeast Asian greater horseshoe bats, in which Japanese populations formed a single clade and clustered into the mixed branches of Northeast Chinese and South Korean populations. We infer that R. ferrumequinum in Northeast Asia originated in Northeast China and South Korea during a cold glacial period, while some ancestors likely arrived in Japan by flying or land bridge and subsequently adapted to the local environment. Consequently, during the warm Eemian interglaciation, the Korea Strait, between Japan and South Korea, became a geographical barrier to Japanese and inland populations, while the Changbai Mountains, between China and North Korea, did not play a significant role as a barrier between Northeast China and South Korea populations.

  20. Interpersonal relationships and HIV/AIDS stigma in China

    Directory of Open Access Journals (Sweden)

    Li Liu

    2011-06-01

    Full Text Available This study explores the implications of interpersonal relationships to HIV/AIDS stigma in Chinese society. The data were collected by 67 open-ended individual interviews. The study shows that HIV/AIDS stigma goes beyond fears about the risk of infection. Two interrelated themes, the social categorisation and bao, constitute the underlying principles in the structure of discourse. On the one hand, people with HIV/AIDS are typically represented as a deviant outgroup. They are believed to be retributed by the Heaven. However, the differentiation between ingroup and outgroup is not just simply based on HIV/AIDS infection. Instead, the boundary between the two is penetrable and is mediated by blood ties. One the other hand, the double-entendre of bao is called to play with respect to ingroup and outgroup. When a close kinship is taken into account, the belief of divine retribution fades out, and the belief of worldly reciprocation foregrounds. People with HIV/AIDS in this case straddle the very fine line between outgroup and ingroup. They are considered to be outgroup in the sense that HIV/AIDS as a virus/disease (a third party found in their body is contagious, and the physical boundary between “them” and “us” is therefore needed. Yet they are considered to be the part of ingroup, because either they are innocent, or they make use of the profit for righteousness. In both cases, they deserve to be reciprocally cared for by their family. The reciprocity hereby acts as an invisible binding force between the infected and the uninfected within a close kinship.

  1. Phylogenetic relationships in Demodex mites (Acari: Demodicidae) based on mitochondrial 16S rDNA partial sequences.

    Science.gov (United States)

    Zhao, Ya-E; Wu, Li-Ping

    2012-09-01

    To confirm phylogenetic relationships in Demodex mites based on mitochondrial 16S rDNA partial sequences, mtDNA 16S partial sequences of ten isolates of three Demodex species from China were amplified, recombined, and sequenced and then analyzed with two Demodex folliculorum isolates from Spain. Lastly, genetic distance was computed, and phylogenetic tree was reconstructed. MEGA 4.0 analysis showed high sequence identity among 16S rDNA partial sequences of three Demodex species, which were 95.85 % in D. folliculorum, 98.53 % in Demodex canis, and 99.71 % in Demodex brevis. The divergence, genetic distance, and transition/transversions of the three Demodex species reached interspecies level, whereas there was no significant difference of the divergence (1.1 %), genetic distance (0.011), and transition/transversions (3/1) of the two geographic D. folliculorum isolates (Spain and China). Phylogenetic trees reveal that the three Demodex species formed three separate branches of one clade, where D. folliculorum and D. canis gathered first, and then gathered with D. brevis. The two Spain and five China D. folliculorum isolates did not form sister clades. In conclusion, 16S mtDNA are suitable for phylogenetic relationship analysis in low taxa (genus or species), but not for intraspecies determination of Demodex. The differentiation among the three Demodex species has reached interspecies level.

  2. Phylogenetic relationships of Malaysia's pig-tailed macaque Macaca nemestrina based on D-loop region sequences

    Science.gov (United States)

    Abdul-Latiff M. A., B.; Ampeng, A.; Yaakop, S.; Md-Zain B., M.

    2014-09-01

    Phylogenetic relationships among Malaysian pig-tailed macaques have never been established even though the data are crucial in aiding conservation plan for the species. The aims of this study is to establish the phylogenetic relationships of Macaca nemestrina in Malaysia. A total of 21 genetic samples of M. nemestrina yielding 458 bp of D-loop sequences were used in phylogenetic analyses, in addition to one sample of M. fascicularis which was used as an outgroup. Sequence character analysis revealed that D-loop locus contains 23% parsimony informative character detected among the ingroups. Further analysis indicated a clear separation between populations originating from different regions; the Malay Peninsula populations are separated from Borneo Insular population; and Perak population formed a distinctive clade within Peninsular Malaysia populations. Phylogenetic trees (NJ, MP and Bayesian) portray a consistent clustering paradigm as Borneo population was distinguished from Peninsula population (100% bootstrap value in the NJ, MP, 1.00 posterior probability in Bayesian trees). Perak's population was separated from other Peninsula populations (100% in NJ, 99% in MP and 1.00 in Bayesian). D-loop region of mtDNA is proven to be a suitable locus in studying the separation of M. nemestrina at population level. These findings are crucial in aiding the conservation management and translocation process of M. fascicularis populations in Malaysia.

  3. The complete chloroplast genome sequence of Ampelopsis: gene organization, comparative analysis and phylogenetic relationships to other angiosperms

    Directory of Open Access Journals (Sweden)

    Gurusamy eRaman

    2016-03-01

    Full Text Available Ampelopsis brevipedunculata is an economically important plant that belongs to the Vitaceae family of angiosperms. The phylogenetic placement of Vitaceae is still unresolved. Recent phylogenetic studies suggested that it should be placed in various alternative families including Caryophyllaceae, asteraceae, Saxifragaceae, Dilleniaceae, or with the rest of the rosid families. However, these analyses provided weak supportive results because they were based on only one of several genes. Accordingly, complete chloroplast genome sequences are required to resolve the phylogenetic relationships among angiosperms. Recent phylogenetic analyses based on the complete chloroplast genome sequence suggested strong support for the position of Vitaceae as the earliest diverging lineage of rosids and placed it as a sister to the remaining rosids. These studies also revealed relationships among several major lineages of angiosperms; however, they highlighted the significance of taxon sampling for obtaining accurate phylogenies. In the present study, we sequenced the complete chloroplast genome of A. brevipedunculata and used these data to assess the relationships among 32 angiosperms, including 18 taxa of rosids. The Ampelopsis chloroplast genome is 161,090 bp in length, and includes a pair of inverted repeats of 26,394 bp that are separated by small and large single copy regions of 19,036 bp and 89,266 bp, respectively. The gene content and order of Ampelopsis is identical to many other unrearranged angiosperm chloroplast genomes, including Vitis and tobacco. A phylogenetic tree constructed based on 70 protein-coding genes of 33 angiosperms showed that both Saxifragales and Vitaceae diverged from the rosid clade and formed two clades with 100% bootstrap value. The position of the Vitaceae is sister to Saxifragales, and both are the basal and earliest diverging lineages. Moreover, Saxifragales forms a sister clade to Vitaceae of rosids. Overall, the results of

  4. Determinants of HIV Phylogenetic Clustering in Chicago Among Young Black Men Who Have Sex With Men From the uConnect Cohort.

    Science.gov (United States)

    Morgan, Ethan; Nyaku, Amesika N; DʼAquila, Richard T; Schneider, John A

    2017-07-01

    Phylogenetic analysis determines similarities among HIV genetic sequences from persons infected with HIV, identifying clusters of transmission. We determined characteristics associated with both membership in an HIV transmission cluster and the number of clustered sequences among a cohort of young black men who have sex with men (YBMSM) in Chicago. Pairwise genetic distances of HIV-1 pol sequences were collected during 2013-2016. Potential transmission ties were identified among HIV-infected persons whose sequences were ≤1.5% genetically distant. Putative transmission pairs were defined as ≥1 tie to another sequence. We then determined demographic and risk attributes associated with both membership in an HIV transmission cluster and the number of ties to the sequences from other persons in the cluster. Of 86 available sequences, 31 (36.0%) were tied to ≥1 other sequence. Through multivariable analyses, we determined that those who reported symptoms of depression and those who had a higher number of confidants in their network had significantly decreased odds of membership in transmission clusters. We found that those who had unstable housing and who reported heavy marijuana use had significantly more ties to other individuals within transmission clusters, whereas those identifying as bisexual, those participating in group sex, and those with higher numbers of sexual partners had significantly fewer ties. This study demonstrates the potential for combining phylogenetic and individual and network attributes to target HIV control efforts to persons with potentially higher transmission risk, as well as suggesting some unappreciated specific predictors of transmission risk among YBMSM in Chicago for future study.

  5. Phylogenetic relationships of Erysimum (Brassicaceae from the Baetic Mountains (SE Iberian Peninsula

    Directory of Open Access Journals (Sweden)

    Abdelaziz, Mohamed

    2014-06-01

    Full Text Available The Baetic mountains, located in the southern Iberian Peninsula, is a major hotspot of biodiversity in the Mediterranean Basin, constituting one of the most important glacial refugia for vascular plants in Europe. Despite their relatively limited extension, the Baetic Mountains contain almost 50% of the total endemic Erysimum species in the Iberian Peninsula. The broadly distributed Erysimum genus has diversified profusely in the Mediterranean region, with more than a hundred species described in the area, out of a total of c. 200 species included in the genus. We used two plastid DNA regions (ndhF and trnT-L and one nuclear DNA region (ITS1-5.8S rDNA-ITS2, with 3,556 bp total length, to carry out phylogenetic analysis by Bayesian inference, maximum likelihood and maximum parsimony, in order to explore the evolutionary relationships between the Erysimum species inhabiting these ranges. Analyses of concatenated sequences from the two genomes identified two main clades with no overlap in species composition so that samples from the same species fell within the same major clade. The phylogenetic relationships depicted by those two clades do not give support to the E. nevadense group, previously proposed on taxonomic grounds. In addition, our results indicated recurrent changes in flower colour in the Baetic Erysimum species although, alternatively, reticulate evolution, which is suggested by incongruent position of taxa in the different trees, may have also affected this trait.Las cordilleras Béticas, localizadas en el sudeste de la Península Ibérica, representan una importante zona para la biodiversidad de la cuenca mediterránea, constituyendo uno de los refugios glaciares más destacados de plantas vasculares en Europa. A pesar de su extensión relativamente limitada, las cordilleras Béticas albergan casi el 50% del total de las especies endémicas de Erysimum de la Península Ibérica. Erysimum es un género ampliamente distribuido, que se

  6. Agent-based and phylogenetic analyses reveal how HIV-1 moves between risk groups: injecting drug users sustain the heterosexual epidemic in Latvia

    Science.gov (United States)

    Graw, Frederik; Leitner, Thomas; Ribeiro, Ruy M.

    2012-01-01

    Injecting drug users (IDU) are a driving force for the spread of HIV-1 in Latvia and other Baltic States, accounting for a majority of cases. However, in recent years, heterosexual cases have increased disproportionately. It is unclear how the changes in incidence patterns in Latvia can be explained, and how important IDU are for the heterosexual sub-epidemic. We introduce a novel epidemic model and use phylogenetic analyses in parallel to examine the spread of HIV-1 in Latvia between 1987 and 2010. Using a hybrid framework with a mean-field description for the susceptible population and an agent-based model for the infecteds, we track infected individuals and follow transmission histories dynamically formed during the simulation. The agent-based simulations and the phylogenetic analysis show that more than half of the heterosexual transmissions in Latvia were caused by IDU, which sustain the heterosexual epidemic. Indeed, we find that heterosexual clusters are characterized by short transmission chains with up to 63% of the chains dying out after the first introduction. In the simulations, the distribution of transmission chain sizes follows a power law distribution, which is confirmed by the phylogenetic data. Our models indicate that frequent introductions reduced the extinction probability of an autonomously spreading heterosexual HIV-1 epidemic, which now has the potential to dominate the spread of the overall epidemic in the future. Furthermore, our model shows that social heterogeneity of the susceptible population can explain the shift in HIV-1 incidence in Latvia over the course of the epidemic. Thus, the decrease in IDU incidence may be due to local heterogeneities in transmission, rather than the implementation of control measures. Increases in susceptibles, through social or geographic movement of IDU, could lead to a boost in HIV-1 infections in this risk group. Targeting individuals that bridge social groups would help prevent further spread of the

  7. Genetic diversity and phylogenetic relationship of Indonesian Local goats using microsatellite DNA markers

    Directory of Open Access Journals (Sweden)

    M Syamsul Arifin Zein

    2012-03-01

    Full Text Available Genetic diversity is important information in the process of conservation and sustainable utilization of animal genetic resources. Thirteen microsatellite markers were used to estimate the degree of genetic diversity on five Indonesian local goats. Results showed the highest average allele diversity present in the locus MAF70 (5.6 ± 2.9, and the lowest was in the locus MAF035 (1.6 ± 0.6, the average number of alleles per locus was 6 ± 2.3. The lowest average alleles diversity present was in the Gembrong goat (2.2 ± 1.1 and the highest was in the Jawarandu goat (4.9 ± 2.2. There is a unique alleles at loci MCM527 and present in all Indonesian local goat with the highest allele frequency on Peranakan Etawa (37.2% and lowest in Gembrong goat (7.9%. H0 ranged from 0.372 ± 0.173 (Gembrong to 0.540 ± 0.204 (Peranakan Etawa, and HE ranging from 0.249 ± 0.196 (Gembrong to 0.540 ± 0.212 (Peranakan Etawa.The genetic differentiation for inbreeding among population (FIS, within population (FIT, and average genetic differention (FST were 0,0208 (2,08%, 0,1532 (15,32%, and 0,1352 (13,52%, respectively. Locus ILSTS029, BMS1494, MAF035 and INRA0132 had a low PIC value (PIC 0.5. Phylogenetic relationship was consistent with the history of its development based on Kacang goat except was for Gembrong Goat. This research information can be used for conservation strategies and breeding programs on each population of Indonesian local goat.

  8. A phylogenetic analysis of normal modes evolution in enzymes and its relationship to enzyme function.

    Science.gov (United States)

    Lai, Jason; Jin, Jing; Kubelka, Jan; Liberles, David A

    2012-09-21

    Since the dynamic nature of protein structures is essential for enzymatic function, it is expected that functional evolution can be inferred from the changes in protein dynamics. However, dynamics can also diverge neutrally with sequence substitution between enzymes without changes of function. In this study, a phylogenetic approach is implemented to explore the relationship between enzyme dynamics and function through evolutionary history. Protein dynamics are described by normal mode analysis based on a simplified harmonic potential force field applied to the reduced C(α) representation of the protein structure while enzymatic function is described by Enzyme Commission numbers. Similarity of the binding pocket dynamics at each branch of the protein family's phylogeny was analyzed in two ways: (1) explicitly by quantifying the normal mode overlap calculated for the reconstructed ancestral proteins at each end and (2) implicitly using a diffusion model to obtain the reconstructed lineage-specific changes in the normal modes. Both explicit and implicit ancestral reconstruction identified generally faster rates of change in dynamics compared with the expected change from neutral evolution at the branches of potential functional divergences for the α-amylase, D-isomer-specific 2-hydroxyacid dehydrogenase, and copper-containing amine oxidase protein families. Normal mode analysis added additional information over just comparing the RMSD of static structures. However, the branch-specific changes were not statistically significant compared to background function-independent neutral rates of change of dynamic properties and blind application of the analysis would not enable prediction of changes in enzyme specificity. Copyright © 2012 Elsevier Ltd. All rights reserved.

  9. Phylogenetic Relationships of the Fern Cyrtomium falcatum (Dryopteridaceae from Dokdo Island Based on Chloroplast Genome Sequencing

    Directory of Open Access Journals (Sweden)

    Gurusamy Raman

    2016-12-01

    Full Text Available Cyrtomium falcatum is a popular ornamental fern cultivated worldwide. Native to the Korean Peninsula, Japan, and Dokdo Island in the Sea of Japan, it is the only fern present on Dokdo Island. We isolated and characterized the chloroplast (cp genome of C. falcatum, and compared it with those of closely related species. The genes trnV-GAC and trnV-GAU were found to be present within the cp genome of C. falcatum, whereas trnP-GGG and rpl21 were lacking. Moreover, cp genomes of Cyrtomium devexiscapulae and Adiantum capillus-veneris lack trnP-GGG and rpl21, suggesting these are not conserved among angiosperm cp genomes. The deletion of trnR-UCG, trnR-CCG, and trnSeC in the cp genomes of C. falcatum and other eupolypod ferns indicates these genes are restricted to tree ferns, non-core leptosporangiates, and basal ferns. The C. falcatum cp genome also encoded ndhF and rps7, with GUG start codons that were only conserved in polypod ferns, and it shares two significant inversions with other ferns, including a minor inversion of the trnD-GUC region and an approximate 3 kb inversion of the trnG-trnT region. Phylogenetic analyses showed that Equisetum was found to be a sister clade to Psilotales-Ophioglossales with a 100% bootstrap (BS value. The sister relationship between Pteridaceae and eupolypods was also strongly supported by a 100% BS, but Bayesian molecular clock analyses suggested that C. falcatum diversified in the mid-Paleogene period (45.15 ± 4.93 million years ago and might have moved from Eurasia to Dokdo Island.

  10. Phylogenetic relationships and morphological evolution in Lentinus, Polyporellus and Neofavolus, emphasizing southeastern Asian taxa.

    Science.gov (United States)

    Seelan, Jaya Seelan Sathiya; Justo, Alfredo; Nagy, Laszlo G; Grand, Edward A; Redhead, Scott A; Hibbett, David

    2015-01-01

    The genus Lentinus (Polyporaceae, Basidiomycota) is widely documented from tropical and temperate forests and is taxonomically controversial. Here we studied the relationships between Lentinus subg. Lentinus sensu Pegler (i.e. sections Lentinus, Tigrini, Dicholamellatae, Rigidi, Lentodiellum and Pleuroti and polypores that share similar morphological characters). We generated sequences of internal transcribed spacers (ITS) and partial 28S regions of nuc rDNA and genes encoding the largest subunit of RNA polymerase II (RPB1), focusing on Lentinus subg. Lentinus sensu Pegler and the Neofavolus group, combined these data with sequences from GenBank (including RPB2 gene sequences) and performed phylogenetic analyses with maximum likelihood and Bayesian methods. We also evaluated the transition in hymenophore morphology between Lentinus, Neofavolus and related polypores with ancestral state reconstruction. Single-gene phylogenies and phylogenies combining ITS and 28S with RPB1 and RPB2 genes all support existence of a Lentinus/Polyporellus clade and a separate Neofavolus clade. Polyporellus (represented by P. arcularius, P. ciliatus, P. brumalis) forms a clade with species representing Lentinus subg. Lentinus sensu Pegler (1983), excluding L. suavissimus. Lentinus tigrinus appears as the sister group of Polyporellus in the four-gene phylogeny, but this placement was weakly supported. All three multigene analyses and the single-gene analysis using ITS strongly supported Polyporus tricholoma as the sister group of the Lentinus/Polyporellus clade; only the 28S rRNA phylogeny failed to support this placement. Under parsimony the ancestral hymenophoral configuration for the Lentinus/Polyporellus clade is estimated to be circular pores, with independent transitions to angular pores and lamellae. The ancestral state for the Neofavolus clade is estimated to be angular pores, with a single transition to lamellae in L. suavissimus. We propose that Lentinus suavissimus (section

  11. Phylogenetic relationships of rollers (Coraciidae) based on complete mitochondrial genomes and fifteen nuclear genes.

    Science.gov (United States)

    Johansson, Ulf S; Irestedt, Martin; Qu, Yanhua; Ericson, Per G P

    2018-04-06

    The rollers (Coraciidae) constitute a relative small avian family with ca. 12 species distributed in Africa, western and southern Eurasia, and eastern Australia. In this study we examine the phylogenetic relationships of all species currently recognized in the family, including two taxa whose taxonomic status is currently contested. By using shotgun sequencing on degraded DNA from museum study skins we have been able to recover complete mitochondrial genomes as well as 15 nuclear genes for in total 16 taxa. The gene sequences were analyzed both concatenated in a maximum likelihood framework as well in a species tree approach using MP-EST. The different analytical approaches yield similar, highly supported trees and support the current division of the rollers into two genera, Coracias and Eurystomus. The only conflict relates to the placement of the Blue-bellied Roller (C. cyanogaster), where the mitochondrial, and the concatenated nuclear and mitochondrial data set, place this taxon as sister to the other Coracias species, whereas nuclear data and the species tree analysis place it as the sister taxon of C. naevia and C. spatulatus. All analyses place the Eurasian roller (C. garrulus) with the two African species, Abyssinian Roller (C. abyssinica) and Liliac-breasted Roller (C. caudatus), and place this clade as the sister group to the Asian Coracias rollers. In addition, our results support a sister group relationship between the morphologically rather dissimilar Purple Roller (C. naevia) and Racquet-tailed Roller (C. spatulatus) and also support the division of Eurystomus in an African and an Asian clade. However, within the Asian clade the Azure Roller (E. azureus) from Halmahera appears to be nested within the Dollarbird (E. orientalis), indicating that that this taxon is a morphological divergent, but a rather recent offshoot, of the widespread Dollarbird. Similarly, the Purple-winged Roller (C. temminickii) from Sulawesi group together with C. benghalensis

  12. Comparative analysis of DNA polymorphisms and phylogenetic relationships among Syzygium cumini Skeels based on phenotypic characters and RAPD technique.

    Science.gov (United States)

    Singh, Jitendra P; Singh, Ak; Bajpai, Anju; Ahmad, Iffat Zareen

    2014-01-01

    The Indian black berry (Syzygium cumini Skeels) has a great nutraceutical and medicinal properties. As in other fruit crops, the fruit characteristics are important attributes for differentiation were also determined for different accessions of S. cumini. The fruit weight, length, breadth, length: breadth ratio, pulp weight, pulp content, seed weight and pulp: seed ratio significantly varied in different accessions. Molecular characterization was carried out using PCR based RAPD technique. Out of 80 RAPD primers, only 18 primers produced stable polymorphisms that were used to examine the phylogenetic relationship. A sum of 207 loci were generated out of which 201 loci found polymorphic. The average genetic dissimilarity was 97 per cent among jamun accessions. The phylogenetic relationship was also determined by principal coordinates analysis (PCoA) that explained 46.95 per cent cumulative variance. The two-dimensional PCoA analysis showed grouping of the different accessions that were plotted into four sub-plots, representing clustering of accessions. The UPGMA (r = 0.967) and NJ (r = 0.987) dendrogram constructed based on the dissimilarity matrix revealed a good degree of fit with the cophenetic correlation value. The dendrogram grouped the accessions into three main clusters according to their eco-geographical regions which given useful insight into their phylogenetic relationships.

  13. Phylogenetic investigation of a statewide HIV-1 epidemic reveals ongoing and active transmission networks among men who have sex with men

    Science.gov (United States)

    Chan, Philip A.; Hogan, Joseph W.; Huang, Austin; DeLong, Allison; Salemi, Marco; Mayer, Kenneth H.; Kantor, Rami

    2015-01-01

    Background Molecular epidemiologic evaluation of HIV-1 transmission networks can elucidate behavioral components of transmission that can be targets for intervention. Methods We combined phylogenetic and statistical approaches using pol sequences from patients diagnosed 2004-2011 at a large HIV center in Rhode Island, following 75% of the state’s HIV population. Phylogenetic trees were constructed using maximum likelihood and putative transmission clusters were evaluated using latent class analyses (LCA) to determine association of cluster size with underlying demographic/behavioral characteristics. A logistic growth model was used to assess intra-cluster dynamics over time and predict “active” clusters that were more likely to harbor undiagnosed infections. Results Of 1,166 HIV-1 subtype B sequences, 31% were distributed among 114 statistically-supported, monophyletic clusters (range: 2-15 sequences/cluster). Sequences from men who have sex with men (MSM) formed 52% of clusters. LCA demonstrated that sequences from recently diagnosed (2008-2011) MSM with primary HIV infection (PHI) and other sexually transmitted infections (STIs) were more likely to form larger clusters (Odds Ratio 1.62-11.25, ppornographic stores. Four large clusters with 38 sequences (100% male, 89% MSM) had a high-probability of harboring undiagnosed infections and included younger MSM with PHI and STIs. Conclusions In this first large-scale molecular epidemiologic investigation of HIV-1 transmission in New England, sexual networks among recently diagnosed MSM with PHI and concomitant STIs contributed to ongoing transmission. Characterization of transmission dynamics revealed actively growing clusters which may be targets for intervention. PMID:26258569

  14. The relationships between HIV stigma, emotional status, and emotional regulation among HIV-affected children in rural China.

    Science.gov (United States)

    Wei, Wei; Li, Xiaoming; Harrison, Sayward; Zhao, Junfeng; Zhao, Guoxiang

    2016-03-01

    Children affected by HIV/AIDS have unique psychosocial needs that often go unaddressed in traditional treatment approaches. They are more likely than unaffected peers to encounter stigma, including overt discriminatory behaviors, as well as stereotyped attitudes. In addition, HIV-affected children are at risk for experiencing negative affect, including sadness and depression. Previous studies have identified a link between HIV stigma and the subsequent emotional status of children affected by HIV/AIDS. However, limited data are available regarding protective psychological factors that can mitigate the effects of HIV stigma and thus promote resiliency for this vulnerable population. Utilizing data from 790 children aged 6-17 years affected by parental HIV in rural central China this study aims to examine the association between HIV stigma, including both enacted and perceived stigma, and emotional status among HIV-affected children, as well as to evaluate the mediating effects of emotional regulation on the relationship between HIV stigma and emotional status. In addition, the moderating role of age is tested. Multiple regression was conducted to test the mediation model. We found that the experience of HIV stigma had a direct positive effect on negative emotions among children affected by HIV. Emotional regulation offers a level of protection, as it mediated the impact of HIV stigma on negative emotions. Moreover, age was found to moderate the relationship between perceived stigma and negative emotions. A significant interaction between perceived stigma and age suggested that negative emotions increase with age among those who perceived a higher level of stigmatization. Results suggest that children affected by HIV may benefit from interventions designed to enhance their capacity to regulate emotions and that health professionals should be aware of the link between stigma and negative emotion in childhood and adolescence and use the knowledge to inform their

  15. Sexual violence and associated factors among women in HIV discordant and concordant relationships in Uganda.

    Science.gov (United States)

    Shuaib, Faisal M B; Ehiri, John E; Jolly, Pauline; Zhang, Qionghui; Emusu, Donath; Ngu, Julius; Foushee, Herman; Katongole, Drake; Kirby, Russell; Wabwire-Mangen, Fred

    2012-01-01

    HIV serodiscordance is a sexual partnership in which one partner is infected with HIV while the other is not. Managing emotional and sexual intimacy in HIV serodiscordant unions can be difficult due to concerns about HIV transmission and the challenge of initiating and maintaining safe sex. In situations where couples are jointly aware of their HIV status, women in serodiscordant unions may face increased risk of partner violence. We conducted an investigation to assess risk factors for HIV serodiscordance and determine if HIV serodiscordance is associated with incident sexual violence among a cohort of women attending HIV post-test club services at three AIDS Information Centers (AICs) in Uganda. Using a prospective study of 250 women, we elicited information about sexual violence using structured face-to-face interviews. Sexual violence and risk factors were assessed and compared among HIV positive women in HIV discordant unions, HIV negative women in discordant unions, and HIV negative women in negative concordant unions. Multivariable logistic regression was used to assess the association between participants' serostatus and sexual violence. HIV negative women in serodiscordant relationships (36.1±11.1 years, range: 19-65 years) were significantly older than either HIV positive women in serodiscordant relationships (32.2±9.0 years, range: 18-56 years), or HIV negative women in concordant relationships (32.3±11.0 years, range: 18-62), (p=0.033). Early age at sexual debut was associated with a 2.4-fold increased risk of experiencing sexual violence (OR 2.4, 95% CI 1.27-4.65). Based on unadjusted analysis, HIV positive women in discordant relationship were at highest risk for sexual violence compared to HIV negative women in discordant unions, and HIV negative women in negative concordant unions. HIV negative women in discordant relationships and those in concordant negative relationships showed no increased risk for sexual violence. However, couples' HIV

  16. Phylogenetic relationships and acaricidal effects of Beauveria bassiana obtained from cattle farm soils against Rhipicephalus microplus.

    Science.gov (United States)

    Fernández-Salas, Agustin; Alonso Díaz, Miguel Angel; Alonso Morales, Rogelio Alejandro; Lezama-Gutierrez, Roberto; Cervantes-Chávez, José Antonio

    2018-03-16

    The objectives of the present study were to isolate Beauveria bassiana strains from cattle farms soils, to analyze the phylogenetic relationships among the isolated fungi strains, and to determine the acaricidal effect of B. bassiana isolates on Rhipicephalus microplus engorged ticks, resistant or susceptible to chemical acaricides. Six strains of Beauveria bassiana were obtained and isolated from cattle farms soils by Galleria bait method in Mexican tropics and the acaricidal effect was assessed against 2 populations of R. microplus ("Media Joya" resistant strain or "CLAR" susceptible strain to chemical acaricides) using the adult immersion test. The BbV03 strain produced an 86.7% and a 60% of mortality on resistant and susceptible ticks on day 20, respectively; whereas the mortality scored with the BbV04 strain was 66.7% and 53.5% on resistant and susceptible ticks at the same day, respectively. The BbV03 and BbV04 strains reduced egg-laying on both R. microplus populations. There were not statistical differences in the acaricidal effect of B. bassiana strains, between the R. microplus susceptible or resistant populations (P > 0.05). The BbV03 strain was the most virulent against R. microplus with a LC50 of 2 x 107 and a LC99 of 7 x 108 conidia/ml. We found that the 6 B. bassiana isolated were clustered into the same clade with other previously reported B. bassiana strains (from GenBank); however, they were separated into 3 different sub-clades. This study shows that some B. bassiana strains might be a promising coadjuvant alternative for biological tick control, including those that are resistant to chemical acaricides. Beauveria bassiana is present in the pastures of tropic cattle farms and there are genetic variations between members of the bassiana specie that are living in this ecosystem. This last showed that B. bassiana might play an important roll in the natural control of R. microplus at paddocks of cattle farms.

  17. Phylogenetic relationships of true butterflies (Lepidoptera: Papilionoidea) inferred from COI, 16S rRNA and EF-1α sequences.

    Science.gov (United States)

    Kim, Man Il; Wan, Xinlong; Kim, Min Jee; Jeong, Heon Cheon; Ahn, Neung-Ho; Kim, Ki-Gyoung; Han, Yeon Soo; Kim, Iksoo

    2010-11-01

    The molecular phylogenetic relationships among true butterfly families (superfamily Papilionoidea) have been a matter of substantial controversy; this debate has led to several competing hypotheses. Two of the most compelling of those hypotheses involve the relationships of (Nymphalidae + Lycaenidae) + (Pieridae + Papilionidae) and (((Nymphalidae + Lycaenidae) + Pieridae) + Papilionidae). In this study, approximately 3,500 nucleotide sequences from cytochrome oxidase subunit I (COI), 16S ribosomal RNA (16S rRNA), and elongation factor-1 alpha (EF-1α) were sequenced from 83 species belonging to four true butterfly families, along with those of three outgroup species belonging to three lepidopteran superfamilies. These sequences were subjected to phylogenetic reconstruction via Bayesian Inference (BI), Maximum Likelihood (ML), and Maximum Parsimony (MP) algorithms. The monophyletic Pieridae and monophyletic Papilionidae evidenced good recovery in all analyses, but in some analyses, the monophylies of the Lycaenidae and Nymphalidae were hampered by the inclusion of single species of the lycaenid subfamily Miletinae and the nymphalid subfamily Danainae. Excluding those singletons, all phylogenetic analyses among the four true butterfly families clearly identified the Nymphalidae as the sister to the Lycaenidae and identified this group as a sister to the Pieridae, with the Papilionidae identified as the most basal linage to the true butterfly, thus supporting the hypothesis: (Papilionidae + (Pieridae + (Nymphalidae + Lycaenidae))).

  18. Taking into account the quality of the relationship in HIV disclosure

    OpenAIRE

    Smith, Charlotte; Cook, Rachel; Rohleder, Poul

    2016-01-01

    Despite growing interest in HIV disclosure, most theoretical frameworks and empirical studies focus on individual and social factors affecting the process, leaving the contribution of interpersonal factors relatively unexplored. HIV transmission and disclosure often occur within a couple however, and this is where disclosure has the most scope as a HIV transmission intervention. With this in mind, this study explores whether perceived relationship quality influences HIV disclosure outcomes. N...

  19. Differences in knowledge, attitudes and behaviors of Israeli HIV-uninfected gay men in HIV-discordant vs. concordant steady relationships.

    Science.gov (United States)

    Tairy, Daniel; Levy, Itzchak; Turner, Dan; Livnat, Yuval; Mor, Zohar

    2018-06-01

    HIV-discordant gay male couples may play an important role in HIV-transmissions. This cross-sectional study compared the knowledge, attitudes and sexual behaviors of HIV-uninfected gay men, between those in HIV-discordant and those in HIV-concordant steady relationships. Anonymous questionnaires were distributed electronically in designated gay-related internet sites and in AIDS-clinics in 2015. The dependent variable was defined as a steady relationship of an HIV-uninfected man with an HIV-infected partner. Risky sexual behavior was defined as unprotected anal intercourse (UAI) with a sex partner whose HIV-status was either positive or unknown. Of 2,319 responders, 460 (20%) were HIV-uninfected gay men in steady relationships, of whom 72 were in HIV-discordant relationships and 388 were in HIV-concordant relationships. Those in HIV-discordant relationships presented better established knowledge regarding HIV-transmission, more lenient attitudes regarding UAI, and reported being involved in riskier sexual behavior, both within and outside their steady relationship compared to men in HIV-concordant relationships. UAI was performed by 48% of the HIV-discordant couples and was associated with the use of sero-positioning strategy and with achieving undetectable viral-load. These findings reflect the complexity of constant use of condoms during long-term sero-discordant relationships. Targeted interventions for HIV-prevention in HIV-discordant couples should be employed for balancing the partners' desire for intimacy and sexual pleasure in the relationship, while reducing the risk for acquiring HIV. ART: Antiretroviral therapy; PEP: Post exposure prophylaxis; PrEP: Pre exposure prophylaxis; STI: Sexually transmitted infections; UAI: Unprotected anal intercourse.

  20. Analysis of Fatty Acid and Growth Profiles in Ten Shewanella spp. to Associate Phylogenetic Relationships

    Science.gov (United States)

    2015-10-25

    microorganisms from the same genus using physiological responses. To understand these changes, a shift in fatty acid length distributions and growth of...phylogenetically dissimilar microorganisms from the same genus using physiological responses. To understand these changes, a shift in fatty acid length...region contaminated with metals: relation with ecological characteristics and soil respiration. J. Biorem. Biodegrad . 6, 1000274/1000271-1000274

  1. Complete mitochondrial genome of threatened mahseer Tor tor (Hamilton 1822) and its phylogenetic relationship within Cyprinidae family.

    Science.gov (United States)

    Pavan-Kumar, A; Raman, Sudhanshu; Koringa, Prakash G; Patel, Namrata; Shah, Tejas; Singh, Rajeev K; Krishna, Gopal; Joshi, C G; Gireesh-Babu, P; Chaudhari, Aparna

    2016-12-01

    The mahseers (Tor, Neolissochilus and Naziritor) are an important group of fishes endemic to Asia with the conservation status of most species evaluated as threatened. Conservation plans to revive these declining wild populations are hindered by unstable taxonomy. Molecular phylogeny studies with mitochondrial genome have been successfully used to reconstruct the phylogenetic tree and to resolve taxonomic ambiguity. In the present study, complete mitochondrial genome of Tor tor has been sequenced using ion torrent next-generation sequencing platform with coverage of more than 1000 x. Comparative mitogenome analysis shows higher divergence value at ND1 gene than COI gene. Further, occurrence of a distinct genetic lineage of T. tor is revealed. The phylogenetic relationship among mahseer group has been defined as Neolissochilus hexagonolepis ((T. sinensis (T. putitora, T. tor), (T. khudree, T. tambroides)).

  2. Phylogenetic relationships of Malayan gaur with other species of the genus Bos based on cytochrome b gene DNA sequences.

    Science.gov (United States)

    Rosli, M K A; Zakaria, S S; Syed-Shabthar, S M F; Zainal, Z Z; Shukor, M N; Mahani, M C; Abas-Mazni, O; Md-Zain, B M

    2011-03-22

    The Malayan gaur (Bos gaurus hubbacki) is one of the three subspecies of gaurs that can be found in Malaysia. We examined the phylogenetic relationships of this subspecies with other species of the genus Bos (B. javanicus, B. indicus, B. taurus, and B. grunniens). The sequence of a key gene, cytochrome b, was compared among 20 Bos species and the bongo antelope, used as an outgroup. Phylogenetic reconstruction was employed using neighbor joining and maximum parsimony in PAUP and Bayesian inference in MrBayes 3.1. All tree topologies indicated that the Malayan gaur is in its own monophyletic clade, distinct from other species of the genus Bos. We also found significant branching differences in the tree topologies between wild and domestic cattle.

  3. Phylogenetic relationships of Malaysia’s long-tailed macaques, Macaca fascicularis, based on cytochrome b sequences

    Science.gov (United States)

    Abdul-Latiff, Muhammad Abu Bakar; Ruslin, Farhani; Fui, Vun Vui; Abu, Mohd-Hashim; Rovie-Ryan, Jeffrine Japning; Abdul-Patah, Pazil; Lakim, Maklarin; Roos, Christian; Yaakop, Salmah; Md-Zain, Badrul Munir

    2014-01-01

    Abstract Phylogenetic relationships among Malaysia’s long-tailed macaques have yet to be established, despite abundant genetic studies of the species worldwide. The aims of this study are to examine the phylogenetic relationships of Macaca fascicularis in Malaysia and to test its classification as a morphological subspecies. A total of 25 genetic samples of M. fascicularis yielding 383 bp of Cytochrome b (Cyt b) sequences were used in phylogenetic analysis along with one sample each of M. nemestrina and M. arctoides used as outgroups. Sequence character analysis reveals that Cyt b locus is a highly conserved region with only 23% parsimony informative character detected among ingroups. Further analysis indicates a clear separation between populations originating from different regions; the Malay Peninsula versus Borneo Insular, the East Coast versus West Coast of the Malay Peninsula, and the island versus mainland Malay Peninsula populations. Phylogenetic trees (NJ, MP and Bayesian) portray a consistent clustering paradigm as Borneo’s population was distinguished from Peninsula’s population (99% and 100% bootstrap value in NJ and MP respectively and 1.00 posterior probability in Bayesian trees). The East coast population was separated from other Peninsula populations (64% in NJ, 66% in MP and 0.53 posterior probability in Bayesian). West coast populations were divided into 2 clades: the North-South (47%/54% in NJ, 26/26% in MP and 1.00/0.80 posterior probability in Bayesian) and Island-Mainland (93% in NJ, 90% in MP and 1.00 posterior probability in Bayesian). The results confirm the previous morphological assignment of 2 subspecies, M. f. fascicularis and M. f. argentimembris, in the Malay Peninsula. These populations should be treated as separate genetic entities in order to conserve the genetic diversity of Malaysia’s M. fascicularis. These findings are crucial in aiding the conservation management and translocation process of M. fascicularis populations

  4. Using phylogenetic and ionomic relationships to predict the uptake of radionuclides by any plant species

    Energy Technology Data Exchange (ETDEWEB)

    Willey, Neil J.; Siasou, Eleni [Centre for Research In Biosciences, University of the West of England, Coldharbour Lane, Frenchay, Bristol BS16 1QY (United Kingdom)

    2014-07-01

    It is not practical to empirically derive soil-to-plant TFs for all soil-plant combinations that are important in radiological assessments, so predictions for a range of species on different soils types are frequently impossible because TFs are unknown. This severely hampers predictions of both doses to biota and of the contamination of a variety of food chains with radioisotopes. Compilations of TFs in themselves provide no fundamental understanding of the plant factors that control the soil-to-plant transfer of radionuclides and thus no method of prediction. We have developed methods for the meta-analyses of radionuclide transfer data that can be used to make predictions of the transfer of radionuclides into any plants species for which TFs do not exist based on an understand of the plant factors that control radionuclide uptake. There is no reason a priori to think that variation in TF should be constrained by species. The species is, essentially, a reproductive unit and variation in many plant traits, some of which might control radionuclide uptake, occurs at taxonomic levels above the species. In the last 15 years genomic information has transformed the understanding of the evolutionary relationships of the living world so that new 'trees of life' (phylogenies) are now available. Using a Residual Maximum Likelihood modeling procedure to compile a significant proportion of all existing TF data onto a single scale, we here present a synthesis of the influence of phylogeny on variation in soil-to-plant TFs for radioisotopes of Cs, Sr, Co, I, Tc, and S. We show that a significant proportion of variation in TF is associated with major branches of the phylogeny of angiosperms (flowering plants) so that knowledge of a species' position on the phylogeny can be used to make predictions of transfer relative to other species. These phylogenetically-based predictions of relative transfer to any species can be used to make absolute predictions to any species

  5. Phylogenetic relationships of the intercellular fish pathogen Ichthyophonus hoferi and fungi, choanoflagellates and the rosette agent

    DEFF Research Database (Denmark)

    Spanggaard, Bettina; Skouboe, P.; Rossen, L.

    1996-01-01

    Ichthyophonus hoferi Plehn and Mulsow, 1911 is thought to be one of the few pathogenic fungal infections of marine fish. The result of an attack is severe epizootics in herring stocks with drastic reduction in the population as a consequence. The exact phylogenetic position of the genus Ichthyoph......Ichthyophonus hoferi Plehn and Mulsow, 1911 is thought to be one of the few pathogenic fungal infections of marine fish. The result of an attack is severe epizootics in herring stocks with drastic reduction in the population as a consequence. The exact phylogenetic position of the genus...... Ichthyophonus is not known. In the present study, a combination of molecular data, ultrastructure and biochemical characters were utilized to investigate the phylogeny of I. hoferi. The genomic DNA encoding the small subunit ribosomal RNA (18S rRNA) was amplified and sequenced. Comparisons with other eukaryotic...

  6. Phylogenetic relationships among Neoechinorhynchus species (Acanthocephala: Neoechinorhynchidae) from North-East Asia based on molecular data.

    Science.gov (United States)

    Malyarchuk, Boris; Derenko, Miroslava; Mikhailova, Ekaterina; Denisova, Galina

    2014-02-01

    Phylogenetic and statistical analyses of DNA sequences of two genes, cytochrome oxidase subunit 1 (cox 1) of the mitochondrial DNA and 18S subunit of the nuclear ribosomal RNA (18S rRNA), was used to characterize Neoechinorhynchus species from fishes collected in different localities of North-East Asia. It has been found that four species can be clearly recognized using molecular markers-Neoechinorhynchus tumidus, Neoechinorhynchus beringianus, Neoechinorhynchus simansularis and Neoechinorhynchus salmonis. 18S sequences ascribed to Neoechinorhynchus crassus specimens from North-East Asia were identical to those of N. tumidus, but differed substantially from North American N. crassus. We renamed North-East Asian N. crassus specimens to N. sp., although the possibility that they represent a subspecies of N. tumidus cannot be excluded, taking into account a relatively small distance between cox 1 sequences of North-East Asian specimens of N. crassus and N. tumidus. Maximum likelihood, maximum parsimony and Bayesian inference analyses were performed for phylogeny reconstruction. All the phylogenetic trees showed that North-East Asian species of Neoechinorhynchus analyzed in this study represent independent clades, with the only exception of N. tumidus and N. sp. for 18S data. Phylogenetic analysis has shown that the majority of species sampled (N. tumidus+N. sp., N. simansularis and N. beringianus) are probably very closely related, while N. salmonis occupies separate position in the trees, possibly indicating a North American origin of this species. © 2013.

  7. Endosymbiosis In Statu Nascendi: Close Phylogenetic RelationshipBetween Obligately Endosymbiotic and Obligately Free-LivingPolynucleobacter Strains (Betaproteobacteria)

    Energy Technology Data Exchange (ETDEWEB)

    Vannini, Claudia; Pockl, Matthias; Petroni, Giulio; Wu, Qinglong; Lang, Elke; Stackebrandt, Erko; Schrallhammer, Martina; Richardson, PaulM.; Hahn, Martin W.

    2006-07-21

    Bacterial strains affiliated to the phylogenetically shallowsubcluster C (PnecC) of the 28 Polynucleobacter cluster, which ischaracterized by a minimal 16S rRNA gene sequence similarity of approx.98.5 percent, have been reported to occur as obligate endosymbionts of 30ciliates (Euplotes spp.), as well as to occur as free-living cells in thepelagic zone of freshwater habitats. We investigated if these two groupsof closely related bacteria represent 32 strains fundamentally differingin lifestyle, or if they simply represent different stages of afacultative endosymbiotic lifestyle. The phylogenetic analysis of 16SrRNA gene and 16S34 23S ITS sequences of five endosymbiont strains fromtwo different Euplotes species and 40 pure culture strains demonstratedhost-species-specific clustering of the endosymbiont 36 sequences withinthe PnecC subcluster. The sequences of the endosymbionts showedcharacteristics indicating an obligate endosymbiotic lifestyle.Cultivation experiments 38 revealed fundamental differences inphysiological adaptations, and determination of the genome sizesindicated a slight size reduction in endosymbiotic strains. We concludethat the 40 two groups of PnecC bacteria represent obligately free-livingand obligately endosymbiotic strains, respectively, and do not representdifferent stages of the same complex lifecycle. 42 These closely relatedstrains occupy completely separated ecological niches. To our bestknowledge, this is the closest phylogenetic relationship between obligateendosymbionts and 44 obligately free-living bacteria everrevealed.

  8. Couple-level Motivations to Test for HIV for Gay Men in Relationships

    Science.gov (United States)

    Beougher, Sean C.; Bircher, Anja E.; Chakravarty, Deepalika; Darbes, Lynae A.; Gómez Mandic, Carmen; Neilands, Torsten B.; Garcia, Carla C.; Hoff, Colleen C.

    2015-01-01

    Previous studies of HIV testing among gay men describe the motivations, facilitators and barriers, behaviors, and demographic characteristics of individuals who test. What little research focuses on HIV testing among gay men in relationships shows that they do not test regularly or, in some cases, at all – their motivations to test have not been investigated. With so little data on HIV testing for this population, and the continued privileging of individually-focused approaches, gay men in relationships fall into a blind spot of research and prevention efforts. This study examined motivations to test for HIV using qualitative data from both partners in 20 gay male couples. Analysis revealed that the partners’ motivations were either event-related (e.g., participants testing the beginning of their relationship or HIV-negative participants in an HIV-discordant relationship testing after risky episode with their discordant primary partner) or partner-related (e.g., participants testing in response to a request or suggestion to test from their primary partner or participants testing out of concern for their primary partner’s health and wellbeing). These data provide insight into relationship-oriented motivations to test for HIV for gay men in relationships and, in doing so, demonstrates their commitment to their primary partner and relationship. These motivations can be leveraged to increase HIV testing among gay men in relationships, a population that tests less often than single gay men, yet, until recently, has been underserved by prevention efforts. PMID:25550145

  9. Continuous osteological characters in the reconstruction of phylogenetic relationships of the six Euro-Mediterranean mullet species (Mugilidae).

    Science.gov (United States)

    Antović, Ivanka

    2013-09-01

    Sixty-three continuous osteological characters (18 skull continuous characters and the total length of neurocranium, 45 continuous characters of 15 elements of the viscerodermal skeleton) were analyzed and included in the reconstruction of phylogenetic relationships of the six Euro-Mediterranean mullet species from the South Adriatic Sea: Mugil cephalus Linnaeus, 1758; Liza saliens Risso, 1810; Liza aurata Risso, 1810; Liza ramada Risso, 1826; Chelon labrosus Risso, 1826 and Oedalechilus labeo Cuvier, 1829. The study reveals that Sphyraenidae was separated clearly from Mugilidae, C. labrosus and three Liza species form a common cluster (L. ramada and L. saliens being the closest), while O. labeo and M. cephalus cluster together.

  10. Phylogenetic relationships of leopard frogs (Rana pipiens complex) from an isolated coastal mountain range in southern Sonora, Mexico.

    Science.gov (United States)

    Pfeiler, E; Markow, T A

    2008-10-01

    Mitochondrial DNA sequence data from the control region and 12S rRNA in leopard frogs from the Sierra El Aguaje of southern Sonora, Mexico, together with GenBank sequences, were used to infer taxonomic identity and provide phylogenetic hypotheses for relationships with other members of the Rana pipiens complex. We show that frogs from the Sierra El Aguaje belong to the Rana berlandieri subgroup, or Scurrilirana clade, of the R. pipiens group, and are most closely related to Rana magnaocularis from Nayarit, Mexico. We also provide further evidence that Rana magnaocularis and R. yavapaiensis are close relatives.

  11. Relationship of race-, sexual orientation-, and HIV-related discrimination with adherence to HIV treatment: a pilot study.

    Science.gov (United States)

    Boarts, Jessica M; Bogart, Laura M; Tabak, Melanie A; Armelie, Aaron P; Delahanty, Douglas L

    2008-10-01

    Adherence to highly active antiretroviral therapy (HAART) must be close to perfect in order to maintain suppression of HIV viral load, and to prevent the development of drug resistant strains of HIV. People living with HIV (PLWH) often report low levels of adherence. One variable that has been linked to poor adherence is perceived discrimination; however, research has generally not considered the possible unique effects of different types of discrimination on adherence. The present pilot study aimed to examine the association of three types of discrimination (due to HIV+ status, race, or sexual orientation) with adherence among 57 PLWH. Logistic regression analyses were conducted to demonstrate the relationships between each type of discrimination and self-reported adherence. Racial discrimination significantly predicted lower adherence levels, whereas sexual orientation- and HIV-related discrimination did not. Results underscore the importance of addressing discrimination issues, specifically racial, when designing interventions to improve adherence to HAART.

  12. Phylogenetic analysis consistent with a clinical history of sexual transmission of HIV-1 from a single donor reveals transmission of highly distinct variants

    Directory of Open Access Journals (Sweden)

    McClure Myra

    2011-07-01

    Full Text Available Abstract Background To combat the pandemic of human immunodeficiency virus 1 (HIV-1, a successful vaccine will need to cope with the variability of transmissible viruses. Human hosts infected with HIV-1 potentially harbour many viral variants but very little is known about viruses that are likely to be transmitted, or even if there are viral characteristics that predict enhanced transmission in vivo. We show for the first time that genetic divergence consistent with a single transmission event in vivo can represent several years of pre-transmission evolution. Results We describe a highly unusual case consistent with a single donor transmitting highly related but distinct HIV-1 variants to two individuals on the same evening. We confirm that the clustering of viral genetic sequences, present within each recipient, is consistent with the history of a single donor across the viral env, gag and pol genes by maximum likelihood and Bayesian Markov Chain Monte Carlo based phylogenetic analyses. Based on an uncorrelated, lognormal relaxed clock of env gene evolution calibrated with other datasets, the time since the most recent common ancestor is estimated as 2.86 years prior to transmission (95% confidence interval 1.28 to 4.54 years. Conclusion Our results show that an effective design for a preventative vaccine will need to anticipate extensive HIV-1 diversity within an individual donor as well as diversity at the population level.

  13. Co-circulating serotypes in a dengue fever outbreak: Differential hematological profiles and phylogenetic relationships among viruses.

    Science.gov (United States)

    Carmo, Andreia Moreira Dos Santos; Suzuki, Rodrigo Buzinaro; Cabral, Aline Diniz; Costa, Renata Torres da; Massari, Gabriela Pena; Riquena, Michele Marcondes; Fracasso, Helio Augusto Alves; Eterovic, Andre; Marcili, Arlei; Sperança, Márcia Aparecida

    2017-05-01

    Dengue virus, represented by four distinct, genetically diverse serotypes, is the etiologic agent of asymptomatic to severe hemorrhagic diseases. The spatiotemporal dynamics of dengue serotypes and its association to specific diseases vary among the different regions worldwide. By 2007, and in São Paulo State, Brazil, dengue-case concentration in urban centers had changed to increased incidence in small- and medium-sized towns, the case of Marília. The aim of this article was to distinguish dengue serotypes circulating during the 2007 Marília outbreak and define their association to demographic and hematological patient profiles, as well as the phylogenetic relationships among the different viruses. PCR amplicons corresponding to the junction of capsid and dengue pre-membrane encoding genes, obtained from dengue serologically positive patients, were sequenced. Hematological and demographic data of patients with different Dengue serotypes were evaluated by univariate and bivariate statistics. Dengue PCR sequences were used in phylogenetic relationships analyzed for maximum parsimony. Molecular typing confirmed co-circulation of the dengue serotypes 1 (DENV1) and 3 (DENV3), which presented divergent correlation patterns with regard to hematological descriptors. The increase in atypical lymphocytes, a likely indication of virus load, could be significantly associated to a decrease in leukocyte counts in the DENV3 group and platelet in the DENV1. Phylogenetic reconstitution revealed the introduction of DENV1 from northern Brazil and local divergence of DENV3 by either microevolution or viral introduction from other geographical regions or both. Dengue dynamics showed regional molecular-epidemiologic specificity, which has important implications for introduction of vaccines, disease management, and transmission control. Copyright © 2017 Elsevier B.V. All rights reserved.

  14. The challenges to intimacy and sexual relationships for gay men in HIV serodiscordant relationships: a pilot study.

    Science.gov (United States)

    Palmer, R; Bor, R

    2001-10-01

    Human Immunodeficiency Virus (HIV) infection and disease progression create imbalance in long-term, HIV-serodiscordant, gay male relationships, particularly in sexual relations and issues of physical and emotional intimacy. Stage of disease progression and worldview of the couple both affect the relationship and its survival. To redress imbalance, partners employ a range of coping strategies and techniques. This article explores these issues in the context of HIV serodiscordant gay couples and how they preserve their relationships in the face of these unique challenges. For workers who provide psychotherapeutic and community support for people with HIV and for their partners, the results of this study may be helpful in recognizing stress factors for couples, and tailoring support services to the needs of both partners. Overall, this study provides a basis for further work examining the dynamics of serodiscordant relationships.

  15. Molecular characterization of Hepatozoon sp. from Brazilian dogs and its phylogenetic relationship with other Hepatozoon spp.

    Science.gov (United States)

    Forlano, M D; Teixeira, K R S; Scofield, A; Elisei, C; Yotoko, K S C; Fernandes, K R; Linhares, G F C; Ewing, S A; Massard, C L

    2007-04-10

    To characterize phylogenetically the species which causes canine hepatozoonosis at two rural areas of Rio de Janeiro State, Brazil, we used universal or Hepatozoon spp. primer sets for the 18S SSU rRNA coding region. DNA extracts were obtained from blood samples of thirteen dogs naturally infected, from four experimentally infected, and from five puppies infected by vertical transmission from a dam, that was experimentally infected. DNA of sporozoites of Hepatozoon americanum was used as positive control. The amplification of DNA extracts from blood of dogs infected with sporozoites of Hepatozoon spp. was observed in the presence of primers to 18S SSU rRNA gene of Hepatozoon spp., whereas DNA of H. americanum sporozoites was amplified in the presence of either universal or Hepatozoon spp.-specific primer sets; the amplified products were approximately 600bp in size. Cloned PCR products obtained from DNA extracts of blood from two dogs experimentally infected with Hepatozoon sp. were sequenced. The consensus sequence, derived from six sequence data sets, were blasted against sequences of 18S SSU rRNA of Hepatozoon spp. available at GenBank and aligned to homologous sequences to perform the phylogenetic analysis. This analysis clearly showed that our sequence clustered, independently of H. americanum sequences, within a group comprising other Hepatozoon canis sequences. Our results confirmed the hypothesis that the agent causing hepatozoonosis in the areas studied in Brazil is H. canis, supporting previous reports that were based on morphological and morphometric analyses.

  16. Molecular Identification and Phylogenetic Relationships of Pleurotus spp. Diversity in Malaysia by ITS Marker

    International Nuclear Information System (INIS)

    Zaiton Abdul Kadir; Azhar Mohamad; Nie, H.J.

    2016-01-01

    Pleurotus species is an edible mushroom in Malaysia which is commonly known as Oyster mushroom and grow by small holder farmers. This species is important for nutraceutical, pharmaceutical and cosmoceutical industries. However, there is some mis identification due to phenotypic variation in which the species shared some similarities due to environmental factors, and thus create troublesome. Thus, eleven isolates of Pleurotus sample which comprise of 4 different species were collected from different locations in Malaysia were used for strain and species identification including mutant line Pleurotus. Pleurotus pulmonarius coded as ATCC 62887 was used as a reference. Total genomic DNA was extracted, quantified and amplified by using rDNA-ITS (Ribosomal DNA Internal Transcribed Spacers) ITS8-F: 5"'AGTCGTAACAAGGTTTCCGTAGGTG3"' and ITS6-R: 5"'TTCCCGCTTCACTCGC-AGT3"'primers. The PCR products were directly sequenced for BLAST evaluation. Phylogenetic (UPGMA) was constructed by using CLC Sequence Viewer 6.8.1. It clearly shown distinct clades of the Pleurotus species and strains. Pleurotus pulmonarius were found to be grouped in one group while Pleurotus florida and Pleurotus columbinus were in the other different clade. For Pleurotus geesteranus, which has the most nucleotide similarity and morphology with Pleurotus pulmonarius, was grouped in its own clade and was single isolated. Thus, ITS marker found to be reliable, rapid, robust and reproducible approach in screening of Pleurotus species and its variants for taxonomical purposes and phylogenetic analysis. (author)

  17. Genetic variation and phylogenetic relationship analysis of Jatropha curcas L. inferred from nrDNA ITS sequences.

    Science.gov (United States)

    Guo, Guo-Ye; Chen, Fang; Shi, Xiao-Dong; Tian, Yin-Shuai; Yu, Mao-Qun; Han, Xue-Qin; Yuan, Li-Chun; Zhang, Ying

    2016-01-01

    Genetic variation and phylogenetic relationships among 102 Jatropha curcas accessions from Asia, Africa, and the Americas were assessed using the internal transcribed spacer region of nuclear ribosomal DNA (nrDNA ITS). The average G+C content (65.04%) was considerably higher than the A+T (34.96%) content. The estimated genetic diversity revealed moderate genetic variation. The pairwise genetic divergences (GD) between haplotypes were evaluated and ranged from 0.000 to 0.017, suggesting a higher level of genetic differentiation in Mexican accessions than those of other regions. Phylogenetic relationships and intraspecific divergence were inferred by Bayesian inference (BI), maximum parsimony (MP), and median joining (MJ) network analysis and were generally resolved. The J. curcas accessions were consistently divided into three lineages, groups A, B, and C, which demonstrated distant geographical isolation and genetic divergence between American accessions and those from other regions. The MJ network analysis confirmed that Central America was the possible center of origin. The putative migration route suggested that J. curcas was distributed from Mexico or Brazil, via Cape Verde and then split into two routes. One route was dispersed to Spain, then migrated to China, eventually spreading to southeastern Asia, while the other route was dispersed to Africa, via Madagascar and migrated to China, later spreading to southeastern Asia. Copyright © 2016 Académie des sciences. Published by Elsevier SAS. All rights reserved.

  18. [Sequence of the ITS region of nuclear ribosomal DNA(nrDNA) in Xinjiang wild Dianthus and its phylogenetic relationship].

    Science.gov (United States)

    Zhang, Lu; Cai, You-Ming; Zhuge, Qiang; Zou, Hui-Yu; Huang, Min-Ren

    2002-06-01

    Xinjiang is a center of distribution and differentiation of genus Dianthus in China, and has a great deal of species resources. The sequences of ITS region (including ITS-1, 5.8S rDNA and ITS-2) of nuclear ribosomal DNA from 8 species of genus Dianthus wildly distributed in Xinjiang were determined by direct sequencing of PCR products. The result showed that the size of the ITS of Dianthus is from 617 to 621 bp, and the length variation is only 4 bp. There are very high homogeneous (97.6%-99.8%) sequences between species, and about 80% homogeneous sequences between genus Dianthus and outgroup. The sequences of ITS in genus Dianthus are relatively conservative. In general, there are more conversion than transition in the variation sites among genus Dianthus. The conversion rates are relatively high, and the ratios of conversion/transition are 1.0-3.0. On the basis of phylogenetic analysis of nucleotide sequences the species of Dianthus in China would be divided into three sections. There is a distant relationship between sect. Barbulatum Williams and sect. Dianthus and between sect. Barbulatum Williams and sect. Fimbriatum Williams, and there is a close relationship between sect. Dianthus and sect. Fimbriatum Williams. From the phylogenetic tree of ITS it was found that the origin of sect. Dianthusis is earlier than that of sect. Fimbriatum Williams and sect. Barbulatum Williams.

  19. Differential relationships between social adversity and depressive symptoms by HIV status and racial/ethnic identity.

    Science.gov (United States)

    Williamson, Timothy J; Mahmood, Zanjbeel; Kuhn, Taylor P; Thames, April D

    2017-02-01

    Historically marginalized groups are likely to be exposed to social adversity, which predicts important mental health outcomes (e.g., depression). Despite the well-established relationship between adversity and poor health, few studies have examined how adversity differentially predicts mental health among people living with multiple, co-occurring marginalized identities or statuses. The current study fills this gap by examining whether relationships between social adversity and depressive symptoms differed between those living with or without a stigmatized disease (i.e., HIV) and/or marginalized racial/ethnic identity (i.e., African American). A community sample of men and women (N = 149) completed questionnaires assessing demographics and depressive symptoms. Additionally, a composite index of social adversity was derived from measures of perceived discrimination, socioeconomic status, financial restriction to receiving medical care, and perceived neighborhood characteristics. Multiple regression was used to test whether relationships between adversity and depressive symptoms differed as a function of HIV status and racial/ethnic identity. A significant 3-way interaction between social adversity, HIV status, and racial/ethnic identity indicated that there was a direct relationship between adversity and depressive symptoms for HIV-positive (HIV+) African Americans but not for HIV-negative (HIV-) African Americans, HIV+ Caucasians, or HIV- Caucasians. Further, HIV+ African Americans evidenced a significantly greater relationship between adversity and depressive symptoms compared with HIV- African Americans, but not compared with other groups. The findings suggest that HIV+ African Americans may be at risk for higher depressive symptoms amid adversity, highlighting the importance of evaluating intersectional identities/statuses in the context of mental health. (PsycINFO Database Record (c) 2017 APA, all rights reserved).

  20. Dispersion of the HIV-1 Epidemic in Men Who Have Sex with Men in the Netherlands: A Combined Mathematical Model and Phylogenetic Analysis.

    Directory of Open Access Journals (Sweden)

    Daniela Bezemer

    2015-11-01

    Full Text Available The HIV-1 subtype B epidemic amongst men who have sex with men (MSM is resurgent in many countries despite the widespread use of effective combination antiretroviral therapy (cART. In this combined mathematical and phylogenetic study of observational data, we aimed to find out the extent to which the resurgent epidemic is the result of newly introduced strains or of growth of already circulating strains.As of November 2011, the ATHENA observational HIV cohort of all patients in care in the Netherlands since 1996 included HIV-1 subtype B polymerase sequences from 5,852 patients. Patients who were diagnosed between 1981 and 1995 were included in the cohort if they were still alive in 1996. The ten most similar sequences to each ATHENA sequence were selected from the Los Alamos HIV Sequence Database, and a phylogenetic tree was created of a total of 8,320 sequences. Large transmission clusters that included ≥10 ATHENA sequences were selected, with a local support value ≥ 0.9 and median pairwise patristic distance below the fifth percentile of distances in the whole tree. Time-varying reproduction numbers of the large MSM-majority clusters were estimated through mathematical modeling. We identified 106 large transmission clusters, including 3,061 (52% ATHENA and 652 Los Alamos sequences. Half of the HIV sequences from MSM registered in the cohort in the Netherlands (2,128 of 4,288 were included in 91 large MSM-majority clusters. Strikingly, at least 54 (59% of these 91 MSM-majority clusters were already circulating before 1996, when cART was introduced, and have persisted to the present. Overall, 1,226 (35% of the 3,460 diagnoses among MSM since 1996 were found in these 54 long-standing clusters. The reproduction numbers of all large MSM-majority clusters were around the epidemic threshold value of one over the whole study period. A tendency towards higher numbers was visible in recent years, especially in the more recently introduced clusters

  1. Genome-wide analysis of SINA family in plants and their phylogenetic relationships.

    Science.gov (United States)

    Wang, Meng; Jin, Ying; Fu, Junjie; Zhu, Yun; Zheng, Jun; Hu, Jian; Wang, Guoying

    2008-06-01

    SINA genes in plants are part of a multigene family with 5 members in Arabidopsis thaliana, 10 members in Populus trichocarpa, 6 members in Oryza sativa, at least 6 members in Zea mays and at least 1 member in Physcomitrella patens. Six members in maize were confirmed by RT-PCR. All SINAs have one RING domain and one SINA domain. These two domains are highly conserved in plants. According to the motif organization and phylogenetic tree, SINA family members were divided into 2 groups. In addition, through semi-quantitative RT-PCR analysis of maize members and Digital Northern analysis of Arabidopsis and rice members, we found that the tissue expression patterns are more diverse in monocot than in Arabidopsis.

  2. Phylogenetic relationships and host range of Rhizobium spp. that nodulate Phaseolus vulgaris L.

    Science.gov (United States)

    Hernandez-Lucas, I; Segovia, L; Martinez-Romero, E; Pueppke, S G

    1995-07-01

    We determined the nucleotide sequences of 16S rRNA gene segments from five Rhizobium strains that have been isolated from tropical legume species. All share the capacity to nodulate Phaseolus vulgaris L., the common bean. Phylogenetic analysis confirmed that these strains are of two different chromosomal lineages. We defined the host ranges of two strains of Rhizobium etli and three strains of R. tropici, comparing them with those of the two most divergently related new strains. Twenty-two of the 43 tested legume species were nodulated by three or more of these strains. All seven strains have broad host ranges that include woody species such as Albizia lebbeck, Gliricidia maculata, and Leucaena leucocephala.

  3. Phylogenetic relationships of German heavy draught horse breeds inferred from mitochondrial DNA D-loop variation.

    Science.gov (United States)

    Aberle, K S; Hamann, H; Drögemüller, C; Distl, O

    2007-04-01

    We analysed a 610-bp mitochondrial (mt)DNA D-loop fragment in a sample of German draught horse breeds and compared the polymorphic sites with sequences from Arabian, Hanoverian, Exmoor, Icelandic, Sorraia and Przewalski's Horses as well as with Suffolk, Shire and Belgian horses. In a total of 65 horses, 70 polymorphic sites representing 47 haplotypes were observed. The average percentage of polymorphic sites was 11.5% for the mtDNA fragment analysed. In the nine different draught horse breeds including South German, Mecklenburg, Saxon Thuringa coldblood, Rhenisch German, Schleswig Draught Horse, Black Forest Horse, Shire, Suffolk and Belgian, 61 polymorphic sites and 24 haplotypes were found. The phylogenetic analysis failed to show monophyletic groups for the draught horses. The analysis indicated that the draught horse populations investigated consist of diverse genetic groups with respect to their maternal lineage.

  4. The Semen Microbiome and Its Relationship with Local Immunology and Viral Load in HIV Infection

    Science.gov (United States)

    Liu, Cindy M.; Osborne, Brendan J. W.; Hungate, Bruce A.; Shahabi, Kamnoosh; Huibner, Sanja; Lester, Richard; Dwan, Michael G.; Kovacs, Colin; Contente-Cuomo, Tania L.; Benko, Erika; Aziz, Maliha

    2014-01-01

    Semen is a major vector for HIV transmission, but the semen HIV RNA viral load (VL) only correlates moderately with the blood VL. Viral shedding can be enhanced by genital infections and associated inflammation, but it can also occur in the absence of classical pathogens. Thus, we hypothesized that a dysregulated semen microbiome correlates with local HIV shedding. We analyzed semen samples from 49 men who have sex with men (MSM), including 22 HIV-uninfected and 27 HIV-infected men, at baseline and after starting antiretroviral therapy (ART) using 16S rRNA gene-based pyrosequencing and quantitative PCR. We studied the relationship of semen bacteria with HIV infection, semen cytokine levels, and semen VL by linear regression, non-metric multidimensional scaling, and goodness-of-fit test. Streptococcus, Corynebacterium, and Staphylococcus were common semen bacteria, irrespective of HIV status. While Ureaplasma was the more abundant Mollicutes in HIV-uninfected men, Mycoplasma dominated after HIV infection. HIV infection was associated with decreased semen microbiome diversity and richness, which were restored after six months of ART. In HIV-infected men, semen bacterial load correlated with seven pro-inflammatory semen cytokines, including IL-6 (p = 0.024), TNF-α (p = 0.009), and IL-1b (p = 0.002). IL-1b in particular was associated with semen VL (r2 = 0.18, p = 0.02). Semen bacterial load was also directly linked to the semen HIV VL (r2 = 0.15, p = 0.02). HIV infection reshapes the relationship between semen bacteria and pro-inflammatory cytokines, and both are linked to semen VL, which supports a role of the semen microbiome in HIV sexual transmission. PMID:25058515

  5. The semen microbiome and its relationship with local immunology and viral load in HIV infection.

    Directory of Open Access Journals (Sweden)

    Cindy M Liu

    2014-07-01

    Full Text Available Semen is a major vector for HIV transmission, but the semen HIV RNA viral load (VL only correlates moderately with the blood VL. Viral shedding can be enhanced by genital infections and associated inflammation, but it can also occur in the absence of classical pathogens. Thus, we hypothesized that a dysregulated semen microbiome correlates with local HIV shedding. We analyzed semen samples from 49 men who have sex with men (MSM, including 22 HIV-uninfected and 27 HIV-infected men, at baseline and after starting antiretroviral therapy (ART using 16S rRNA gene-based pyrosequencing and quantitative PCR. We studied the relationship of semen bacteria with HIV infection, semen cytokine levels, and semen VL by linear regression, non-metric multidimensional scaling, and goodness-of-fit test. Streptococcus, Corynebacterium, and Staphylococcus were common semen bacteria, irrespective of HIV status. While Ureaplasma was the more abundant Mollicutes in HIV-uninfected men, Mycoplasma dominated after HIV infection. HIV infection was associated with decreased semen microbiome diversity and richness, which were restored after six months of ART. In HIV-infected men, semen bacterial load correlated with seven pro-inflammatory semen cytokines, including IL-6 (p = 0.024, TNF-α (p = 0.009, and IL-1b (p = 0.002. IL-1b in particular was associated with semen VL (r(2  = 0.18, p = 0.02. Semen bacterial load was also directly linked to the semen HIV VL (r(2 = 0.15, p = 0.02. HIV infection reshapes the relationship between semen bacteria and pro-inflammatory cytokines, and both are linked to semen VL, which supports a role of the semen microbiome in HIV sexual transmission.

  6. Phylogenetic relationships among amphisbaenian reptiles based on complete mitochondrial genomic sequences.

    Science.gov (United States)

    Macey, J Robert; Papenfuss, Theodore J; Kuehl, Jennifer V; Fourcade, H Mathew; Boore, Jeffrey L

    2004-10-01

    Complete mitochondrial genomic sequences are reported from 12 members in the four families of the reptile group Amphisbaenia. Analysis of 11,946 aligned nucleotide positions (5797 informative) produces a robust phylogenetic hypothesis. The family Rhineuridae is basal and Bipedidae is the sister taxon to the Amphisbaenidae plus Trogonophidae. Amphisbaenian reptiles are surprisingly old, predating the breakup of Pangaea 200 million years before present, because successive basal taxa (Rhineuridae and Bipedidae) are situated in tectonic regions of Laurasia and nested taxa (Amphisbaenidae and Trogonophidae) are found in Gondwanan regions. Thorough sampling within the Bipedidae shows that it is not tectonic movement of Baja California away from the Mexican mainland that is primary in isolating Bipes species, but rather that primary vicariance occurred between northern and southern groups. Amphisbaenian families show parallel reduction in number of limbs and Bipes species exhibit parallel reduction in number of digits. A measure is developed for comparing the phylogenetic information content of various genes. A synapomorphic trait defining the Bipedidae is a shift from the typical vertebrate mitochondrial gene arrangement to the derived state of trnE and nad6. In addition, a tandem duplication of trnT and trnP is observed in Bipes biporus with a pattern of pseudogene formation that varies among populations. The first case of convergent rearrangement of the mitochondrial genome among animals demonstrated by complete genomic sequences is reported. Relative to most vertebrates, the Rhineuridae has the block nad6, trnE switched in order with the block cob, trnT, trnP, as they are in birds.

  7. Phylogenetic relationships among amphisbaenian reptiles based on complete mitochondrial genomic sequences

    Energy Technology Data Exchange (ETDEWEB)

    Macey, J. Robert; Papenfuss, Theodore J.; Kuehl, Jennifer V.; Fourcade, H. Matthew; Boore, Jeffrey L.

    2004-05-19

    Complete mitochondrial genomic sequences are reported from 12 members in the four families of the reptile group Amphisbaenia. Analysis of 11,946 aligned nucleotide positions (5,797 informative) produces a robust phylogenetic hypothesis. The family Rhineuridae is basal and Bipedidae is the sister taxon to the Amphisbaenidae plus Trogonophidae. Amphisbaenian reptiles are surprisingly old, predating the breakup of Pangaea 200 million years before present, because successive basal taxa (Rhineuridae and Bipedidae) are situated in tectonic regions of Laurasia and nested taxa (Amphisbaenidae and Trogonophidae) are found in Gondwanan regions. Thorough sampling within the Bipedidae shows that it is not tectonic movement of Baja California away from the Mexican mainland that is primary in isolating Bipes species, but rather that primary vicariance occurred between northern and southern groups. Amphisbaenian families show parallel reduction in number of limbs and Bipes species exhibit parallel reduction in number of digits. A measure is developed for comparing the phylogenetic information content of various genes. A synapomorphic trait defining the Bipedidae is a shift from the typical vertebrate mitochondrial gene arrangement to the derived state of trnE and nad6. In addition, a tandem duplication of trnT and trnP is observed in B. biporus with a pattern of pseudogene formation that varies among populations. The first case of convergent rearrangement of the mitochondrial genome among animals demonstrated by complete genomic sequences is reported. Relative to most vertebrates, the Rhineuridae has the block nad6, trnE switched in order with cob, trnT, trnP, as they are in birds.

  8. Perceptions and Definitions of Power Within the Context of HIV-Negative Male Couples’ Relationships

    OpenAIRE

    Mitchell, Jason W.; Sophus, Amber I.

    2016-01-01

    Examining dynamics within relationships is critical for development of effective HIV prevention interventions for male couples. The dynamic of power has received little attention in research with male couples, though power has been reported to affect HIV risk among heterosexual couples. To help address this knowledge gap, the present cross-sectional analysis used mixed methods with dyadic data from 142 HIV-negative male couples to (1) assess partnered men’s perception of who has the most powe...

  9. Relationship of HIV Reservoir Characteristics with Immune Status and Viral Rebound Kinetics in an HIV Therapeutic Vaccine Study

    Science.gov (United States)

    Li, Jonathan Z.; Heisey, Andrea; Ahmed, Hayat; Wang, Hongying; Zheng, Lu; Carrington, Mary; Wrin, Terri; Schooley, Robert T.; Lederman, Michael M.; Kuritzkes, Daniel R.

    2014-01-01

    Objectives To evaluate the impact of therapeutic HIV vaccination on the HIV reservoir, and assess the relationship of the viral reservoir with HIV-specific immune status and viral rebound kinetics. Design Retrospective analysis of ACTG A5197, a randomized, placebo-controlled trial of a therapeutic rAd5 HIV-1 gag vaccine. Methods Participants received vaccine/placebo at weeks 0, 4, and 26 prior to a 16-week analytic treatment interruption (ATI) at week 38. Cell-associated HIV-1 RNA and DNA (CA-RNA and CA-DNA) and HIV-1 residual viremia (RV) were quantified at weeks 0, 8, and 38. HIV-specific CD4+/CD8+ activity were assessed by an intracellular cytokine staining assay. Results At study entry, CA-RNA and CA-DNA levels were correlated inversely with the numbers of HIV-specific CD4+ interferon-γ-producing cells (CA-RNA: r = −0.23, P=0.03 and CA-DNA: r = −0.28, P<0.01, N=93). Therapeutic HIV vaccination induced HIV-specific CD4+ activity, but did not significantly affect levels of CA-RNA or CA-DNA. Vaccine recipients with undetectable RV at week 8 had higher frequencies of HIV-specific CD4+ and CD8+ interferon-γ-producing cells (undetectable versus detectable RV: 277 versus 161 CD4+ cells/106 lymphocytes, P=0.03 and 1326 versus 669 CD8+ cells/106 lymphocytes, P=0.04). Pre-ATI CA-RNA and CA-DNA were associated with post-ATI plasma HIV set point (CA-RNA: r = 0.51, P<0.01 and CA-DNA: r = 0.47, P<0.01). Conclusions Vaccine-induced T-cell responses were associated with a modest transient effect on RV, but more potent immune responses and/or combination treatment with latency-reversing agents are needed to reduce the HIV reservoir. HIV reservoir measures may act as biomarkers of post-ATI viral rebound kinetics. PMID:25254301

  10. New insights on the phylogenetic relationships among the traditional Philodendron subgenera and the other groups of the Homalomena clade (Araceae).

    Science.gov (United States)

    Vasconcelos, Santelmo; Soares, Maria de Lourdes; Sakuragui, Cássia M; Croat, Thomas B; Oliveira, Guilherme; Benko-Iseppon, Ana M

    2018-05-19

    Philodendron (Araceae) is one of the largest Neotropical plant genera, with approximately 500 species and at least 1000 species predicted. There is a considerable ecological diversity in the group, although most species occur in the humid forests of tropical America. Despite being relatively well-studied in taxonomic analyses, the relationships among the traditional morphological groups of the genus are not well-established, mainly regarding the three traditional subgenera, referred here as Philodendron sensu lato (s.l.), P. subg. Pteromischum, P. subg. Philodendron and P. subg. Meconostigma, which was recently recognized as a separate genus, Thaumatophyllum. Therefore, the present work evaluates the phylogenetic position and the monophyly of Philodendron s.l. and its three main subdivisions, and the sister groups within the Homalomena clade, which also includes the Neotropical genus Adelonema, the two Asian genera Homalomena and Furtadoa, and the two African genera Cercestis and Culcasia, by means of molecular phylogenetic approaches including chloroplast DNA (atpF-atpH, rpl32-trnL, trnQ-5'-rps16 and trnV-ndhC) and nuclear (ITS2) markers. The monophyly of Philodendron s.l. and its three lineages is confirmed and our analyses corroborate previous morphologic data indicating Thaumatophyllum as sister to the clade formed by P. subg. Pteromischum and P. subg. Philodendron. Copyright © 2018 Elsevier Inc. All rights reserved.

  11. Phylogenetic relationships among zooxanthellae (Symbiodinium) associated to excavating sponges (Cliona spp.) reveal an unexpected lineage in the Caribbean.

    Science.gov (United States)

    Granados, C; Camargo, C; Zea, S; Sánchez, J A

    2008-11-01

    Phylogenetic relationships of symbiotic dinoflagellate lineages, distributed in all tropical and subtropical seas, suggest strategies for long distance dispersal but at the same time strong host specialization. Zooxanthellae (Symbiodinium: Dinophyta), which are associated to diverse shallow-water cnidarians, also engage in symbioses with some sponge species of the genus Cliona. In the Caribbean, zooxanthellae-bearing Cliona has recently become abundant due to global warming, overfishing, and algae abundance. Using molecular techniques, the symbionts from five excavating species (Clionacaribbaea, C. tenuis, C. varians, C. aprica and C. laticavicola) from the southern and southwestern Caribbean were surveyed. Several DNA sequence regions were used in order to confirm zooxanthellae identity; 18S rDNA, domain V of chloroplast large subunit (cp23S), internal transcribed spacer 2 (ITS2), and ITS2 secondary structure. Sequence analyses corroborated the presence of three zooxanthellae clades: A, B, and G. Presence of clades A and B in common boring sponges of the Caribbean fit with the general pattern of the province. The discovery of clade G for the first time in any organism of the Atlantic Ocean leads us to consider this unusual finding as a phylogenetic relict through common ancestors of sponge clades or an invasion of the sponge from the Indo-Pacific.

  12. The amino acid sequences of two alpha chains of hemoglobins from Komodo dragon Varanus komodoensis and phylogenetic relationships of amniotes.

    Science.gov (United States)

    Fushitani, K; Higashiyama, K; Moriyama, E N; Imai, K; Hosokawa, K

    1996-09-01

    To elucidate phylogenetic relationships among amniotes and the evolution of alpha globins, hemoglobins were analyzed from the Komodo dragon (Komodo monitor lizard) Varanus komodoensis, the world's largest extant lizard, inhabiting Komodo Islands, Indonesia. Four unique globin chains (alpha A, alpha D, beta B, and beta C) were isolated in an equal molar ratio by high performance liquid chromatography from the hemolysate. The amino acid sequences of two alpha chains were determined. The alpha D chain has a glutamine at E7 as does an alpha chain of a snake, Liophis miliaris, but the alpha A chain has a histidine at E7 like the majority of hemoglobins. Phylogenetic analyses of 19 globins including two alpha chains of Komodo dragon and ones from representative amniotes showed the following results: (1) The a chains of squamates (snakes and lizards), which have a glutamine at E7, are clustered with the embryonic alpha globin family, which typically includes the alpha D chain from birds; (2) birds form a sister group with other reptiles but not with mammals; (3) the genes for embryonic and adult types of alpha globins were possibly produced by duplication of the ancestral alpha gene before ancestral amniotes diverged, indicating that each of the present amniotes might carry descendants of the two types of alpha globin genes; (4) squamates first split off from the ancestor of other reptiles and birds.

  13. Phylogenetic relationship and Fourier-transform infrared spectroscopy-derived lipid determinants of lifespan parameters in the Saccharomyces cerevisiae yeast.

    Science.gov (United States)

    Molon, Mateusz; Zebrowski, Jacek

    2017-06-01

    Yeast ageing has been gaining much attention in gerontology research, yet the process itself is still not entirely clear. One of the constraints related to the use of the Saccharomyces cerevisiae yeast in studies is the ambiguity of the results concerning ageing determinants for different genetic backgrounds. In this paper, we compare reproductive potentials and lifespans of seven widely used haploid laboratory strains differing in daughter cells production capabilities and highlight the importance of choosing an appropriate genotype for the studies on ageing. Moreover, we show here links between post-reproductive lifespan and lipid metabolism, as well as between reproductive potential, reproductive lifespan and phylogenetic relationship. Using FTIR spectroscopy that generated a biochemical fingerprint of cells, coupled with chemometrics, we found that the band of carbonyl (C = O) stretching vibration discriminates the strains according to post-reproductive lifespan. The results indicated that prolonged post-reproductive lifespan was associated with relatively lower amount of fatty acids esterified to phospholipids compared to a free acid pool, thus implying phospholipid metabolism for the post-reproductive lifespan of yeast. In addition, phylogenetic analysis showed a correlation between nucleotide similarity and the reproductive potential or reproductive lifespan, but not to the longevity expressed in time units. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  14. Phylogenetic incongruence in E. coli O104: understanding the evolutionary relationships of emerging pathogens in the face of homologous recombination.

    Directory of Open Access Journals (Sweden)

    Weilong Hao

    Full Text Available Escherichia coli O104:H4 was identified as an emerging pathogen during the spring and summer of 2011 and was responsible for a widespread outbreak that resulted in the deaths of 50 people and sickened over 4075. Traditional phenotypic and genotypic assays, such as serotyping, pulsed field gel electrophoresis (PFGE, and multilocus sequence typing (MLST, permit identification and classification of bacterial pathogens, but cannot accurately resolve relationships among genotypically similar but pathotypically different isolates. To understand the evolutionary origins of E. coli O104:H4, we sequenced two strains isolated in Ontario, Canada. One was epidemiologically linked to the 2011 outbreak, and the second, unrelated isolate, was obtained in 2010. MLST analysis indicated that both isolates are of the same sequence type (ST678, but whole-genome sequencing revealed differences in chromosomal and plasmid content. Through comprehensive phylogenetic analysis of five O104:H4 ST678 genomes, we identified 167 genes in three gene clusters that have undergone homologous recombination with distantly related E. coli strains. These recombination events have resulted in unexpectedly high sequence diversity within the same sequence type. Failure to recognize or adjust for homologous recombination can result in phylogenetic incongruence. Understanding the extent of homologous recombination among different strains of the same sequence type may explain the pathotypic differences between the ON2010 and ON2011 strains and help shed new light on the emergence of this new pathogen.

  15. Phylogenetic Diversity in Core Region of Hepatitis C Virus Genotype 1a as a Factor Associated with Fibrosis Severity in HIV-1-Coinfected Patients

    Directory of Open Access Journals (Sweden)

    Micaela Parra

    2017-01-01

    Full Text Available High hepatitis C virus (HCV genetic diversity impacts infectivity/pathogenicity, influencing chronic liver disease progression associated with fibrosis degrees and hepatocellular carcinoma. HCV core protein is crucial in cell-growth regulation and host-gene expression. Liver fibrosis is accelerated by unknown mechanisms in human immunodeficiency virus-1- (HIV-1- coinfected individuals. We aimed to study whether well-defined HCV-1a core polymorphisms and genetic heterogeneity are related to fibrosis in a highly homogeneous group of interferon-treated HIV-HCV-coinfected patients. Genetic heterogeneity was weighed by Faith’s phylogenetic diversity (PD, which has been little studied in HCV. Eighteen HCV/HIV-coinfected patients presenting different liver fibrosis stages before anti-HCV treatment-initiation were recruited. Sampling at baseline and during and after treatment was performed up to 72 weeks. At inter/intrahost level, HCV-1a populations were studied using molecular cloning and Sanger sequencing. Over 400 complete HCV-1a core sequences encompassing 573 positions of C were obtained. Amino acid substitutions found previously at positions 70 and 91 of HCV-1b core region were not observed. However, HCV genetic heterogeneity was higher in mild than in severe fibrosis cases. These results suggest a potential utility of PD as a virus-related factor associated with chronic hepatitis C progression. These observations should be reassessed in larger cohorts to corroborate our findings and assess other potential covariates.

  16. Phylogenetic relationships of seven previously unclassified viruses within the family Rhabdoviridae using partial nucleoprotein gene sequences.

    Science.gov (United States)

    Kuzmin, I V; Hughes, G J; Rupprecht, C E

    2006-08-01

    Partial nucleoprotein (N) gene sequences of the rhabdoviruses Obodhiang (OBOV), Kotonkon (KOTV), Rochambeau (RBUV), Kern canyon (KCV), Mount Elgon bat (MEBV), Kolongo (KOLV) and Sandjimba (SJAV) were generated and their phylogenetic positions within the family Rhabdoviridae were determined. Both OBOV and KOTV were placed within the genus Ephemerovirus. RBUV was joined to the same cluster, but more distantly. MEBV and KCV were grouped into a monophyletic cluster (putative genus) with Oita virus (OITAV). These three viruses, originating from different regions of the world, were all isolated from insectivorous bats and may be specific for these mammals. African avian viruses KOLV and SJAV were joined to each other and formed another clade at the genus level. Further, they were grouped with the recently characterized rhabdovirus Tupaia virus (TRV). Although the genetic distance was great, the grouping was supported by consistent bootstrap values. This observation suggests that viruses of this group may be distributed widely in the Old World. Non-synonymous/synonymous substitution ratio estimations (dN/dS) using a partial N gene fragment (241 codons) for the three rhabdovirus genera revealed contrasting patterns of evolution, where dN/dS values follow the pattern Ephemerovirus > Vesiculovirus > Lyssavirus. The magnitude of this ratio corresponds well with the number of negatively selected codons. The accumulation of dS appears evenly distributed along the gene fragment for all three genera. These estimations demonstrated clearly that lyssaviruses are subjected to the strongest constraints against amino acid substitutions, probably related to their particular niche and unique pathobiology.

  17. Genetic characterization, molecular epidemiology, and phylogenetic relationships of insect-specific viruses in the taxon Negevirus.

    Science.gov (United States)

    Nunes, Marcio R T; Contreras-Gutierrez, María Angélica; Guzman, Hilda; Martins, Livia C; Barbirato, Mayla Feitoza; Savit, Chelsea; Balta, Victoria; Uribe, Sandra; Vivero, Rafael; Suaza, Juan David; Oliveira, Hamilton; Nunes Neto, Joaquin P; Carvalho, Valeria L; da Silva, Sandro Patroca; Cardoso, Jedson F; de Oliveira, Rodrigo Santo; da Silva Lemos, Poliana; Wood, Thomas G; Widen, Steven G; Vasconcelos, Pedro F C; Fish, Durland; Vasilakis, Nikos; Tesh, Robert B

    2017-04-01

    The recently described taxon Negevirus is comprised of a diverse group of insect-specific viruses isolated from mosquitoes and phlebotomine sandflies. In this study, a comprehensive genetic characterization, molecular, epidemiological and evolutionary analyses were conducted on nearly full-length sequences of 91 new negevirus isolates obtained in Brazil, Colombia, Peru, Panama, USA and Nepal. We demonstrated that these arthropod restricted viruses are clustered in two major phylogenetic groups with origins related to three plant virus genera (Cilevirus, Higrevirus and Blunevirus). Molecular analyses demonstrated that specific host correlations are not present with most negeviruses; instead, high genetic variability, wide host-range, and cross-species transmission were noted. The data presented here also revealed the existence of five novel insect-specific viruses falling into two arthropod-restrictive virus taxa, previously proposed as distinct genera, designated Nelorpivirus and Sandewavirus. Our results provide a better understanding of the molecular epidemiology, evolution, taxonomy and stability of this group of insect-restricted viruses. Copyright © 2017 Elsevier Inc. All rights reserved.

  18. Tracking the Origin and Deciphering the Phylogenetic Relationship of Porcine Epidemic Diarrhea Virus in Ecuador

    Directory of Open Access Journals (Sweden)

    Maritza Barrera

    2017-01-01

    Full Text Available In 2010, new Chinese strains of porcine epidemic diarrhea virus (PEDV, clinically more severe than the classical strains, emerged. These strains were spread to United States in 2013 through an intercontinental transmission from China with further spreading across the world, evidencing the emergent nature of these strains. In the present study, an analysis of PEDV field sequences from Ecuador was conducted by comparing all the PEDV S gene sequences available in the GenBank database. Phylogenetic comparisons and Bayesian phylogeographic inference based on complete S gene sequences were also conducted to track the origin and putative route of PEDV. The sequence from the PED-outbreak in Ecuador was grouped into the clade II of PEDV genogroup 2a together with other sequences of isolates from Mexico, Canada, and United States. The phylogeographic study revealed the emergence of the Chinese PEDV strains, followed by spreading to US in 2013, from US to Korea, and later the introduction of PEDV to Canada, Mexico, and Ecuador directly from the US. The sources of imports of live swine in Ecuador in 2014 were mainly from Chile and US. Thus, this movement of pigs is suggested as the main way for introducing PEDV to Ecuador.

  19. Phylogenetic Relationship of Phosphate Solubilizing Bacteria according to 16S rRNA Genes

    Directory of Open Access Journals (Sweden)

    Mohammad Bagher Javadi Nobandegani

    2015-01-01

    Full Text Available Phosphate solubilizing bacteria (PSB can convert insoluble form of phosphorous to an available form. Applications of PSB as inoculants increase the phosphorus uptake by plant in the field. In this study, isolation and precise identification of PSB were carried out in Malaysian (Serdang oil palm field (University Putra Malaysia. Identification and phylogenetic analysis of 8 better isolates were carried out by 16S rRNA gene sequencing in which as a result five isolates belong to the Beta subdivision of Proteobacteria, one isolate was related to the Gama subdivision of Proteobacteria, and two isolates were related to the Firmicutes. Bacterial isolates of 6upmr, 2upmr, 19upmnr, 10upmr, and 24upmr were identified as Alcaligenes faecalis. Also, bacterial isolates of 20upmnr and 17upmnr were identified as Bacillus cereus and Vagococcus carniphilus, respectively, and bacterial isolates of 31upmr were identified as Serratia plymuthica. Molecular identification and characterization of oil palm strains as the specific phosphate solubilizer can reduce the time and cost of producing effective inoculate (biofertilizer in an oil palm field.

  20. Phylogenetic relationships of three new microsporidian isolates from the silkworm, Bombyx mori.

    Science.gov (United States)

    Nageswara Rao, S; Muthulakshmi, M; Kanginakudru, S; Nagaraju, J

    2004-07-01

    The pathogenicity, mode of transmission, tissue specificity of infection and the small subunit rRNA (SSU-rRNA) gene sequences of the three new microsporidian isolates from the silkworm Bombyx mori were studied. Out of the three, NIK-2r revealed life cycle features and SSU-rRNA gene sequence similar to Nosema bombycis, suggesting that it is N. bombycis. The other two, NIK-4m and NIK-3h, differed from each other as well as from N. bombycis. NIK-4m was highly pathogenic and did not show any vertical transmission, in accordance with the apparent lack of gonadal infection, whereas NIK-3h was less pathogenic and vertical transmission was not detected but could not be excluded. Phylogenetic analysis based on SSU-rRNA gene sequence placed NIK-3h and NIK-4m in a distinct clade that included almost all the Vairimorpha species and Nosema species that infect lepidopteran and non-lepidopteran hosts, while NIK-2r was included in a clade containing almost all the Nosema isolates that infect only lepidopteran hosts. Thus, we have presented molecular evidence that one of the three isolates is in fact the type species N. bombycis, while the other two isolates are Vairimorpha spp. There was distinct separation of microsporidian isolates infecting only lepidopteran hosts and those infecting lepidopteran and non-lepidopteran hosts, reflecting possible co-evolution of hosts and microsporidian isolates.

  1. Coptobrycon bilineatus (Ellis, 1911 (Characiformes: Characidae: redescription and comments on its phylogenetic relationships

    Directory of Open Access Journals (Sweden)

    Francisco Langeani

    Full Text Available Coptobrycon bilineatus (Ellis, 1911 is redescribed on the basis of specimens from the District of Paranapiacaba, Municipality of Santo André, upper rio Tietê, and additional ones recently collected in a small coastal river system of Serra do Mar, very near the headwaters of the rio Tietê. The genus was compared to other Characidae lacking a supraorbital, and it seems to be more phylogenetically related to Grundulus based on the possession of various putative apomorphic character states related to: the absence of a rhinosphenoid and fourth, fifth (sometimes and sixth infraorbitals; nasal pores separated; nares with up to six nasal lamellae; cephalic laterosensory system poorly developed on supraorbital and infraorbital series; and a globose scapula. Furthermore, Coptobrycon and Grundulus are characterized by the absence of the adipose fin, of the supraorbital laterosensory series on the parietal, and of the humeral spot, and by the reduction of lateral musculature in front of the first pleural rib and between the first and second pleural ribs. Biogeographic comments are also provided.

  2. Complete mitochondrial genome of Porzana fusca and Porzana pusilla and phylogenetic relationship of 16 Rallidae species.

    Science.gov (United States)

    Chen, Peng; Han, Yuqing; Zhu, Chaoying; Gao, Bin; Ruan, Luzhang

    2017-12-01

    The complete mitochondrial genome sequences of Porzana fusca and Porzana pusilla were determined. The two avian species share a high degree of homology in terms of mitochondrial genome organization and gene arrangement. Their corresponding mitochondrial genomes are 16,935 and 16,978 bp and consist of 37 genes and a control region. Their PCGs were both 11,365 bp long and have similar structure. Their tRNA gene sequences could be folded into canonical cloverleaf secondary structure, except for tRNA Ser (AGY) , which lost its "DHU" arm. Based on the concatenated nucleotide sequences of the complete mitochondrial DNA genes of 16 Rallidae species, reconstruction of phylogenetic trees and analysis of the molecular clock of P. fusca and P. pusilla indicated that these species from a sister group, which in turn are sister group to Rallina eurizonoides. The genus Gallirallus is a sister group to genus Lewinia, and these groups in turn are sister groups to genus Porphyrio. Moreover, molecular clock analyses suggested that the basal divergence of Rallidae could be traced back to 40.47 (41.46‒39.45) million years ago (Mya), and the divergence of Porzana occurred approximately 5.80 (15.16‒0.79) Mya.

  3. Phylogenetic Characterization of Encephalitozoon Romaleae (Microsporidia) from a Grasshopper Host: Relationship to Encephalitozoon spp. Infecting Humans

    Science.gov (United States)

    Encephalitozoon species are the most common microsporidian pathogens of humans and domesticated animals. We recently discovered a new microsporidium, Encephalitozoon romaleae, infecting the eastern lubber grasshopper Romalea microptera. To understand its evolutionary relationships, we compared par...

  4. Veronica: Chemical characters for the support of phylogenetic relationships based on nuclear ribosomal and plastid DNA sequence data

    DEFF Research Database (Denmark)

    Albach, Dirk C.; Jensen, Søren Rosendal; Özgökce, Fevzi

    2005-01-01

    Molecular phylogenetic analyses have revealed many relationships in Veronica (Plantaginaceae) never anticipated before. However, phytochemical characters show good congruence with DNA-based analyses. We have analysed a combined data set of 49 species and subspecies derived from the nuclear...... are monophyletic sister groups with the annual species consecutive sisters to them. All species of Veronica that contain cornoside are found in this subgenus, although some species seem to have secondarily lost the ability to produce this compound. Subgenera Pocilla and Pentasepalae are well supported sister...... species in the genus analysed to date to contain melittoside and globularifolin. Subgenus Pentasepalae appears to be a clade of diverse lineages from southwestern Asia and a single European clade. Species shown to have 6-hydroxyflavones do not form a monophyletic group. Subgenus Pseudolysimachium seems...

  5. Phylogenetic relationships of hexaploid large-sized barbs (genus Labeobarbus, Cyprinidae) based on mtDNA data.

    Science.gov (United States)

    Tsigenopoulos, Costas S; Kasapidis, Panagiotis; Berrebi, Patrick

    2010-08-01

    The phylogenetic relationships among species of the Labeobarbus genus (Teleostei, Cyprinidae) which comprises large body-sized hexaploid taxa were inferred using complete cytochrome b mitochondrial gene sequences. Molecular data suggest two main evolutionary groups which roughly correspond to a Northern (Middle East and Northwest Africa) and a sub-Saharan lineage. The splitting of the African hexaploids from their Asian ancestors and their subsequent diversification on the African continent occurred in the Late Miocene, a period in which other cyprinins also invaded Africa and radiated in the Mediterranean region. Finally, systematic implications of these results to the taxonomic validity of genera or subgenera such as Varicorhinus, Kosswigobarbus, Carasobarbus and Capoeta are further discussed. Copyright 2010 Elsevier Inc. All rights reserved.

  6. Phylogenetic relationships and generic delimitation in Inuleae subtribe Inulinae (Asteraceae) based on ITS and cpDNA sequence data

    DEFF Research Database (Denmark)

    Englund, Marcus; Pornpongrungrueng, Pimwadee; Gustafsson, Mats

    2009-01-01

    Phylogenetic relationships in Inuleae subtribe Inulinae (Asteraceae) were investigated. DNA sequence data from three chloroplast regions (ndhF, trnL-F and psbA-trnH) and the nuclear ribosomal internal transcribed spacer (ITS) region were analysed separately and in combination using parsimony...... and Bayesian inference. A total of 163 ingroup taxa were included, of which 60 were sampled for all four markers. Conflicts between chloroplast and nuclear data were assessed using partitioned Bremer support (PBS). Rather than averaging PBS over several trees from constrained searches, individual trees were...... considered by evaluating PBS ranges. Criteria to be used in the detection of a significant conflict between data partitions are proposed. Three nodes in the total data tree were found to encompass significant conflict that could result from ancient hybridization. Neither of the large, heterogeneous...

  7. Chloroplast genes as genetic markers for inferring patterns of change, maternal ancestry and phylogenetic relationships among Eleusine species.

    Science.gov (United States)

    Agrawal, Renuka; Agrawal, Nitin; Tandon, Rajesh; Raina, Soom Nath

    2014-01-01

    Assessment of phylogenetic relationships is an important component of any successful crop improvement programme, as wild relatives of the crop species often carry agronomically beneficial traits. Since its domestication in East Africa, Eleusine coracana (2n = 4x = 36), a species belonging to the genus Eleusine (x = 8, 9, 10), has held a prominent place in the semi-arid regions of India, Nepal and Africa. The patterns of variation between the cultivated and wild species reported so far and the interpretations based upon them have been considered primarily in terms of nuclear events. We analysed, for the first time, the phylogenetic relationship between finger millet (E. coracana) and its wild relatives by species-specific chloroplast deoxyribonucleic acid (cpDNA) polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) and chloroplast simple sequence repeat (cpSSR) markers/sequences. Restriction fragment length polymorphism of the seven amplified chloroplast genes/intergenic spacers (trnK, psbD, psaA, trnH-trnK, trnL-trnF, 16S and trnS-psbC), nucleotide sequencing of the chloroplast trnK gene and chloroplast microsatellite polymorphism were analysed in all nine known species of Eleusine. The RFLP of all seven amplified chloroplast genes/intergenic spacers and trnK gene sequences in the diploid (2n = 16, 18, 20) and allotetraploid (2n = 36, 38) species resulted in well-resolved phylogenetic trees with high bootstrap values. Eleusine coracana, E. africana, E. tristachya, E. indica and E. kigeziensis did not show even a single change in restriction site. Eleusine intermedia and E. floccifolia were also shown to have identical cpDNA fragment patterns. The cpDNA diversity in Eleusine multiflora was found to be more extensive than that of the other eight species. The trnK gene sequence data complemented the results obtained by PCR-RFLP. The maternal lineage of all three allotetraploid species (AABB, AADD) was the same, with E. indica being the

  8. The evolution of giant flightless birds and novel phylogenetic relationships for extinct fowl (Aves, Galloanseres)

    Science.gov (United States)

    Worthy, Trevor H.; Degrange, Federico J.; Handley, Warren D.; Lee, Michael S. Y.

    2017-10-01

    The extinct dromornithids, gastornithids and phorusrhacids are among the most spectacular birds to have ever lived, with some giants exceeding 500 kg. The affinities and evolution of these and other related extinct birds remain contentious, with previous phylogenetic analyses being affected by widespread convergence and limited taxon sampling. We address these problems using both parsimony and tip-dated Bayesian approaches on an expansive taxon set that includes all key extinct flightless and flighted (e.g. Vegavis and lithornithids) forms, an extensive array of extant fowl (Galloanseres), representative Neoaves and palaeognaths. The Paleogene volant Lithornithidae are recovered as stem palaeognaths in the Bayesian analyses. The Galloanseres comprise four clades inferred to have diverged in the Late Cretaceous on Gondwana. In addition to Anseriformes and Galliformes, we recognize a robust new clade (Gastornithiformes) for the giant flightless Dromornithidae (Australia) and Gastornithidae (Eurasia, North America). This clade exhibits parallels to ratite palaeognaths in that flight presumably was lost and giant size attained multiple times. A fourth clade is represented by the Cretaceous Vegavis (Antarctica), which was strongly excluded from Anseriformes; thus, a crucial molecular calibration point needs to be reconsidered. The presbyornithids Wilaru (Australia) and Presbyornis (Northern Hemisphere) are robustly found to be the sister group to Anatoidea (Anseranatidae + Anatidae), a relatively more basal position than hitherto recognized. South America's largest bird, Brontornis, is not a galloansere, but a member of Neoaves related to Cariamiformes; therefore, giant Galloanseres remain unknown from this continent. Trait analyses showed that while gigantism and flightlessness evolved repeatedly in groups, diet is constrained by phylogeny: all giant Galloanseres and palaeognaths are herbivores or mainly herbivorous, and giant neoavians are zoophagous or omnivorous.

  9. The relationship between female genital mutilation and HIV transmission in sub-Saharan Africa.

    Science.gov (United States)

    Olaniran, Abimbola A

    2013-12-01

    Female genital mutilation (FGM) is an age-old practice that has since been linked with many health problems. This review aims to highlight some of the controversies trailing the relationship between FGM and HIV transmission in sub-Saharan Africa. A literature search was conducted on the subject matter. This was done using articles published in English while limiting the geographical coverage to sub-Saharan Africa. Three themes were noted. These themes include: Direct causal link between FGM and HIV transmission; indirect causal link between FGM and HIV transmission and a negative or no association between FGM and HIV transmission. While many of the arguments are within scientific reasoning, the researches supporting the views seem to lack the necessary objectivity. This study underscored the need for a more objective lens in viewing and conducting research on the relationship between FGM and HIV transmission in sub-Saharan Africa.

  10. A comparative ZOO-FISH analysis in bats elucidates the phylogenetic relationships between Megachiroptera and five microchiropteran families.

    Science.gov (United States)

    Volleth, M; Heller, K G; Pfeiffer, R A; Hameister, H

    2002-01-01

    Fluorescence in-situ hybridization with human whole chromosome painting probes (WCPs) was applied to compare the karyotypes of members of five bat families. Twenty-five evolutionarily conserved units (ECUs) were identified by ZOO-FISH analysis. In 10 of these 25 ECUs, thorough GTG-band comparison revealed an identical banding pattern in all families studied. Differences in the remaining ECUs were used as characters to judge the phylogenetic relationships within Chiroptera. Close relationships were found between Rhinolophidae and Hipposideridae. Also closely related are the representatives of the yangochiropteran families Phyllostomidae (genus studied: Glossophaga, Volleth et al. 1999), Molossidae and Vespertilionidae. All microchiropteran species studied here share four common features not found in the megachiropteran species Eonycteris spelaea. Two of these are considered as derived characters with a high probability of parallel evolution. On the other hand, Eonycteris shares one common, probably derived feature with the rhinolophoid families Rhinolophidae and Hipposideridae and an additional one only with Hipposideridae. At the moment, the relationships between Yangochiroptera, Rhinolophoidea and Megachiroptera must be left in an unsolved trichotomy. Comparison of neighboring segment combinations found in Chiroptera with those found in other mammalian taxa revealed six synapomorphic features for Chiroptera. Therefore, for karyological reasons, monophyly of Chiroptera is strongly supported.

  11. Karyotypic evolution and phylogenetic relationships in the order Chiroptera as revealed by G-banding comparison and chromosome painting.

    Science.gov (United States)

    Ao, Lei; Mao, Xiuguang; Nie, Wenhui; Gu, Xiaoming; Feng, Qing; Wang, Jinhuan; Su, Weiting; Wang, Yingxiang; Volleth, Marianne; Yang, Fengtang

    2007-01-01

    Bats are a unique but enigmatic group of mammals and have a world-wide distribution. The phylogenetic relationships of extant bats are far from being resolved. Here, we investigated the karyotypic relationships of representative species from four families of the order Chiroptera by comparative chromosome painting and banding. A complete set of painting probes derived from flow-sorted chromosomes of Myotis myotis (family Vespertilionidae) were hybridized onto metaphases of Cynopterus sphinx (2n = 34, family Pteropodidae), Rhinolophus sinicus (2n=36, family Rhinolophidae) and Aselliscus stoliczkanus (2n=30, family Hipposideridae) and delimited 27, 30 and 25 conserved chromosomal segments in the three genomes, respectively. The results substantiate that Robertsonian translocation is the main mode of chromosome evolution in the order Chiroptera, with extensive conservation of whole chromosomal arms. The use of M. myotis (2n=44) probes has enabled the integration of C. sphinx, R. sinicus and A. stoliczkanus chromosomes into the previously established comparative maps between human and Eonycteris spelaea (2n=36), Rhinolophus mehelyi (2n=58), Hipposideros larvatus (2n=32), and M. myotis. Our results provide the first cytogenetic signature rearrangement that supports the grouping of Pteropodidae and Rhinolophoidea in a common clade (i.e. Pteropodiformes or Yinpterochiroptera) and thus improve our understanding on the karyotypic relationships and genome phylogeny of these bat species.

  12. Romantic Relationships: An Important Context for HIV/STI and Pregnancy Prevention Programmes with Young People

    Science.gov (United States)

    Coyle, Karin K.; Anderson, Pamela M.; Franks, Heather M.; Glassman, Jill; Walker, James D.; Charles, Vignetta Eugenia

    2014-01-01

    Romantic relationships are central in the lives of young people. This paper uses data on romantic relationships from urban youth in the USA to illustrate how using a relationships perspective in HIV/STI and pregnancy prevention programmes broadens the skills and content covered, and contextualises the learning to enhance relevance and use.…

  13. Phylogenetic relationships within the cyst-forming nematodes (Nematoda, Heteroderidae) based on analysis of sequences from the ITS regions of ribosomal DNA.

    Science.gov (United States)

    Subbotin, S A; Vierstraete, A; De Ley, P; Rowe, J; Waeyenberge, L; Moens, M; Vanfleteren, J R

    2001-10-01

    The ITS1, ITS2, and 5.8S gene sequences of nuclear ribosomal DNA from 40 taxa of the family Heteroderidae (including the genera Afenestrata, Cactodera, Heterodera, Globodera, Punctodera, Meloidodera, Cryphodera, and Thecavermiculatus) were sequenced and analyzed. The ITS regions displayed high levels of sequence divergence within Heteroderinae and compared to outgroup taxa. Unlike recent findings in root knot nematodes, ITS sequence polymorphism does not appear to complicate phylogenetic analysis of cyst nematodes. Phylogenetic analyses with maximum-parsimony, minimum-evolution, and maximum-likelihood methods were performed with a range of computer alignments, including elision and culled alignments. All multiple alignments and phylogenetic methods yielded similar basic structure for phylogenetic relationships of Heteroderidae. The cyst-forming nematodes are represented by six main clades corresponding to morphological characters and host specialization, with certain clades assuming different positions depending on alignment procedure and/or method of phylogenetic inference. Hypotheses of monophyly of Punctoderinae and Heteroderinae are, respectively, strongly and moderately supported by the ITS data across most alignments. Close relationships were revealed between the Avenae and the Sacchari groups and between the Humuli group and the species H. salixophila within Heteroderinae. The Goettingiana group occupies a basal position within this subfamily. The validity of the genera Afenestrata and Bidera was tested and is discussed based on molecular data. We conclude that ITS sequence data are appropriate for studies of relationships within the different species groups and less so for recovery of more ancient speciations within Heteroderidae. Copyright 2001 Academic Press.

  14. Age-disparate relationships and HIV incidence in adolescent girls and young women: evidence from Zimbabwe.

    Science.gov (United States)

    Schaefer, Robin; Gregson, Simon; Eaton, Jeffrey W; Mugurungi, Owen; Rhead, Rebecca; Takaruza, Albert; Maswera, Rufurwokuda; Nyamukapa, Constance

    2017-06-19

    Age-disparate sexual relationships with older men may drive high rates of HIV acquisition in young women in sub-Saharan Africa, but evidence is limited. We investigate the association between age-disparate relationships and HIV incidence in Manicaland, Zimbabwe. A general-population open-cohort study (six surveys) (1998-2013). A total of 3746 young women aged 15-24 years participated in consecutive surveys and were HIV-negative at the beginning of intersurvey periods. Last sexual partner age difference and age-disparate relationships [intergenerational (≥10 years age difference) and intragenerational (5-9 years) versus age-homogeneous (0-4 years)] were tested for associations with HIV incidence in Cox regressions. A proximate determinants framework was used to explore factors possibly explaining variations in the contribution of age-disparate relationships to HIV incidence between populations and over time. About 126 HIV infections occurred over 8777 person-years (1.43 per 100 person-years; 95% confidence interval = 1.17-1.68). Sixty-five percent of women reported partner age differences of at least 5 years. Increasing partner age differences were associated with higher HIV incidence [adjusted hazard ratio (aHR) = 1.05 (1.01-1.09)]. Intergenerational relationships tended to increase HIV incidence [aHR = 1.78 (0.96-3.29)] but not intragenerational relationships [aHR = 0.91 (0.47-1.76)]. Secondary education was associated with reductions in intergenerational relationships [adjusted odds ratio (aOR) = 0.49 (0.36-0.68)]. Intergenerational relationships were associated with partners having concurrent relationships [aOR = 2.59 (1.81-3.70)], which tended to increase HIV incidence [aHR = 1.74 (0.96-3.17)]. Associations between age disparity and HIV incidence did not change over time. Sexual relationships with older men expose young women to increased risk of HIV acquisition in Manicaland, which did not change over time, even with introduction

  15. Is there a causal relationship between alcohol and HIV? Implications ...

    African Journals Online (AJOL)

    There is now conclusive evidence of a causal linkage between heavy drinking patterns and/or alcohol use disorders and the worsening of the disease course for HIV. However, while alcohol usage is consistently associated with the prevalence and incidence of HIV, further research is needed to substantiate causality in ...

  16. Relationships matter: contraceptive choices among HIV-positive ...

    African Journals Online (AJOL)

    Efforts to eliminate mother-to-child transmission of HIV in Tanzania are guided by a four-prong strategy advocated by the World Health Organization (WHO). Prong 2, prevention of unintended pregnancies among women living with HIV, has, however, received the least attention and contraceptive use to prevent unintended ...

  17. Rejection Sensitivity, Perceived Power, and HIV Risk in the Relationships of Low-Income Urban Women.

    Science.gov (United States)

    Berenson, Kathy R; Paprocki, Christine; Thomas Fishman, Marget; Bhushan, Devika; El-Bassel, Nabila; Downey, Geraldine

    2015-01-01

    The psychological processes associated with HIV infection in long-term relationships differ from those operative in casual sexual encounters, and relatively little research has considered the aspects of personality applicable in the ongoing heterosexual relationships in which women are at greatest risk. Sensitivity to rejection has been linked with efforts to prevent rejection at a cost to the self and, therefore, may be relevant to the health risks that many women incur in relationships. We examined the association of rejection sensitivity with women's sexual risk behavior in a sample of women at heightened risk for HIV exposure. Women in long-term heterosexual relationships (N = 159) were recruited for study participation in the hospital emergency room serving a low-income neighborhood in New York City, in 2001-2003. Rejection sensitivity and known HIV risk factors were assessed using verbally administered questionnaires. Rejection sensitivity was associated with lower perceived relationship power and, in turn, more frequent unprotected sex with a partner perceived to be at risk for HIV. These results held when controlling for other HIV risk factors including partner violence, economic dependence, and substance use. Understanding the association of rejection concerns with lower perceived personal power in relationships may be important for HIV prevention.

  18. Orders out of chaos--molecular phylogenetics reveals the complexity of shark and stingray tapeworm relationships.

    Science.gov (United States)

    Caira, Janine N; Jensen, Kirsten; Waeschenbach, Andrea; Olson, Peter D; Littlewood, D Timothy J

    2014-01-01

    elasmobranch cestodes. Across analyses, the sister group to the clade of "terrestrial" cestode orders was found to be an elasmobranch-hosted genus, as was the sister to the freshwater fish- and tetrapod-hosted Proteocephalidea. Whilst further data are required to resolve outstanding nomenclatural and phylogenetic issues, the present analyses contribute significantly to an understanding of the evolutionary radiation of the entire Cestoda. Clearly, elasmobranch tapeworms comprise the backbone of cestode phylogeny. Copyright © 2013 Australian Society for Parasitology Inc. Published by Elsevier Ltd. All rights reserved.

  19. Phylogenetic relationships in Epidendroideae (Orchidaceae), one of the great flowering plant radiations: progressive specialization and diversification.

    Science.gov (United States)

    Freudenstein, John V; Chase, Mark W

    2015-03-01

    The largest subfamily of orchids, Epidendroideae, represents one of the most significant diversifications among flowering plants in terms of pollination strategy, vegetative adaptation and number of species. Although many groups in the subfamily have been resolved, significant relationships in the tree remain unclear, limiting conclusions about diversification and creating uncertainty in the classification. This study brings together DNA sequences from nuclear, plastid and mitochrondrial genomes in order to clarify relationships, to test associations of key characters with diversification and to improve the classification. Sequences from seven loci were concatenated in a supermatrix analysis for 312 genera representing most of epidendroid diversity. Maximum-likelihood and parsimony analyses were performed on this matrix and on subsets of the data to generate trees and to investigate the effect of missing values. Statistical character-associated diversification analyses were performed. Likelihood and parsimony analyses yielded highly resolved trees that are in strong agreement and show significant support for many key clades. Many previously proposed relationships among tribes and subtribes are supported, and some new relationships are revealed. Analyses of subsets of the data suggest that the relatively high number of missing data for the full analysis is not problematic. Diversification analyses show that epiphytism is most strongly associated with diversification among epidendroids, followed by expansion into the New World and anther characters that are involved with pollinator specificity, namely early anther inflexion, cellular pollinium stalks and the superposed pollinium arrangement. All tested characters show significant association with speciation in Epidendroideae, suggesting that no single character accounts for the success of this group. Rather, it appears that a succession of key features appeared that have contributed to diversification, sometimes in

  20. Phylogenetic relationships of geckos of the genus Nactus and their relatives (Squamata: Gekkonidae

    Directory of Open Access Journals (Sweden)

    Todd R. Jackman

    2008-05-01

    Full Text Available We employed nuclear and mitochondrial DNA sequence data to investigate relationships within the gekkonid genus Nactus and between Nactus and other gekkonid genera. Nuclear (RAG-1, PDC and mitochondrial (ND2 data provide strong support for conflicting patterns of relationship among bisexual New Guinean species of Nactus and the unisexual oceanic form N. pelagicus. This may be explained by an ancient mitochondrial introgression event between N. sphaerodactylodes and N. vankampeni, a recent selective sweep of mitochondrial DNA throughout N. vankampeni, and gene conflict stemming from the hybrid event that gave rise to N. pelagicus. Strong support from all data partitions is obtained for the sister group relationship of Nactus to a clade consisting of the Australian Heteronotia and the Southeast Asian Dixonius. Putative synapomorphies of the Nactus/Heteronotia/Dixonius clade include the reduction of the second phalanx of digit IV of the manus and the presence of regular rows of keeled (sometimes multicarinate dorsal tubercles on the dorsum. Nactus and Heteronotia both include parthenogenetic species formed via hybridogenesis. This is rare among geckos, and vertebrates in general, and at some level may also be synapomorphic. Dixonius is not known to have any all-female species, but “D. siamensis” consists of multiple chromosome “races” that mirror morphologically cryptic, but karyotypically distinct, species in the other two genera. The strong support for the Nactus/Heteronotia/Dixonius clade demonstrates that the leaf-toed digital morphology of Dixonius has evolved multiple times within the Gekkonidae and suggests that superficial digital morphology may be misleading with respect to gekkonid suprageneric relationships.

  1. Phylogenetic relationships in three species of canine Demodex mite based on partial sequences of mitochondrial 16S rDNA.

    Science.gov (United States)

    Sastre, Natalia; Ravera, Ivan; Villanueva, Sergio; Altet, Laura; Bardagí, Mar; Sánchez, Armand; Francino, Olga; Ferrer, Lluís

    2012-12-01

    The historical classification of Demodex mites has been based on their hosts and morphological features. Genome sequencing has proved to be a very effective taxonomic tool in phylogenetic studies and has been applied in the classification of Demodex. Mitochondrial 16S rDNA has been demonstrated to be an especially useful marker to establish phylogenetic relationships. To amplify and sequence a segment of the mitochondrial 16S rDNA from Demodex canis and Demodex injai, as well as from the short-bodied mite called, unofficially, D. cornei and to determine their genetic proximity. Demodex mites were examined microscopically and classified as Demodex folliculorum (one sample), D. canis (four samples), D. injai (two samples) or the short-bodied species D. cornei (three samples). DNA was extracted, and a 338 bp fragment of the 16S rDNA was amplified and sequenced. The sequences of the four D. canis mites were identical and shared 99.6 and 97.3% identity with two D. canis sequences available at GenBank. The sequences of the D. cornei isolates were identical and showed 97.8, 98.2 and 99.6% identity with the D. canis isolates. The sequences of the two D. injai isolates were also identical and showed 76.6% identity with the D. canis sequence. Demodex canis and D. injai are two different species, with a genetic distance of 23.3%. It would seem that the short-bodied Demodex mite D. cornei is a morphological variant of D. canis. © 2012 The Authors. Veterinary Dermatology © 2012 ESVD and ACVD.

  2. The Influence of Trauma History and Relationship Power on Latinas' Sexual Risk for HIV/STIs

    Science.gov (United States)

    Randolph, Mary E.; Gamble, Heather L.; Buscemi, Joanna

    2014-01-01

    A community sample of Latinas completed surveys that included measures of sexual abuse and intimate partner violence history, relationship power, negotiating power regarding condom use, perceived HIV/STI risk of sexual partner, and sexual behavior. Over half of the women reported a history of intimate partner violence in the past year and/or sexual abuse in their lifetime. Intimate partner violence was correlated with lower overall sexual relationship power scores, while sexual abuse was correlated with lower condom use negotiating power. More extensive intimate partner violence had the strongest association with higher HIV/STI risk, controlling for relationship status, sexual abuse, and relationship power. PMID:25067990

  3. Molecular Phylogenetics of Transmitted Drug Resistance in Newly Diagnosed HIV Type 1 Individuals in Denmark, a Nation-Wide Study

    DEFF Research Database (Denmark)

    Audelin, Anne Margrethe; Gerstoft, Jan; Obel, Niels

    2011-01-01

    Abstract Highly active antiretroviral treatment is compromised by viral resistance mutations. Transmitted drug resistance (TDR) is therefore monitored closely, but follow-up studies of these patients are limited. Virus from 1405 individuals diagnosed with HIV-1 in Denmark between 2001 and 2009...... without resistance mutations. We observed no difference in progression of the infection between individuals infected with TDR and individuals infected with wild-type HIV-1. The prevalence of TDR is low in Denmark and transmission of dual-drug-resistant HIV-1 is infrequent. The TDR isolates were shown...... resulting in a prevalence of 6.1%, with no changes over time. The main resistance mutations were nucleoside reverse transcriptase inhibitor (NRTI) mutation 215 revertants, as well as nonnucleoside reverse transcriptase inhibitor (NNRTI) mutation 103N/S and protease inhibitor (PI) mutations 90M and 85V...

  4. Molecular phylogenetics of transmitted drug resistance in newly diagnosed HIV Type 1 individuals in Denmark: a nation-wide study

    DEFF Research Database (Denmark)

    Audelin, Anne Margrethe; Gerstoft, Jan; Obel, Niels

    2011-01-01

    Abstract Highly active antiretroviral treatment is compromised by viral resistance mutations. Transmitted drug resistance (TDR) is therefore monitored closely, but follow-up studies of these patients are limited. Virus from 1405 individuals diagnosed with HIV-1 in Denmark between 2001 and 2009...... without resistance mutations. We observed no difference in progression of the infection between individuals infected with TDR and individuals infected with wild-type HIV-1. The prevalence of TDR is low in Denmark and transmission of dual-drug-resistant HIV-1 is infrequent. The TDR isolates were shown...... resulting in a prevalence of 6.1%, with no changes over time. The main resistance mutations were nucleoside reverse transcriptase inhibitor (NRTI) mutation 215 revertants, as well as nonnucleoside reverse transcriptase inhibitor (NNRTI) mutation 103N/S and protease inhibitor (PI) mutations 90M and 85V...

  5. Relationship between socioeconomic status and HIV infection in a rural tertiary health center

    Directory of Open Access Journals (Sweden)

    Ogunmola OJ

    2014-04-01

    Full Text Available Olarinde Jeffrey Ogunmola,1 Yusuf Olatunji Oladosu,2 Michael Adeyemi Olamoyegun31Cardiac Care Centre, Department of Internal Medicine, Federal Medical Centre, Ido-Ekiti, Ekiti State, Nigeria, 2Department of Internal Medicine, Federal Medical Centre, Ido-Ekiti, Ekiti State, Nigeria, 3Endocrinology, Diabetes and Metabolism Unit, Department of Internal Medicine, Ladoke-Akintola University of Technology Teaching Hospital, Ogbomoso, Oyo State, NigeriaBackground: There is a scarcity of data in rural health centers in Nigeria regarding the relationship between socioeconomic status (SES and HIV infection. We investigated this relationship using indicators of SES.Methods: An analytical case-control study was conducted in the HIV clinic of a rural tertiary health center. Data collection included demographic variables, educational attainment, employment status, monthly income, marital status, and religion. HIV was diagnosed by conventional methods. Data were analyzed with the SPSS version 16 software.Results: A total of 115 (48.5% HIV-negative subjects with a mean age of 35.49±7.63 years (range: 15–54 years, and 122 (51.5% HIV-positive subjects with a mean age of 36.35±8.31 years (range: 15–53 years were involved in the study. Participants consisted of 47 (40.9% men and 68 (59.1% women who were HIV negative. Those who were HIV positive consisted of 35 (28.7% men and 87 (71.3% women. Attainment of secondary school levels of education, and all categories of monthly income showed statistically significant relationships with HIV infection (P=0.018 and P<0.05, respectively after analysis using a logistic regression model. Employment status did not show any significant relationship with HIV infection.Conclusion: Our findings suggested that some indicators of SES are differently related to HIV infection. Prevalent HIV infections are now concentrated among those with low incomes. Urgent measures to improve HIV prevention among low income earners are

  6. Taking into Account the Quality of the Relationship in HIV Disclosure.

    Science.gov (United States)

    Smith, Charlotte; Cook, Rachel; Rohleder, Poul

    2017-01-01

    Despite growing interest in HIV disclosure, most theoretical frameworks and empirical studies focus on individual and social factors affecting the process, leaving the contribution of interpersonal factors relatively unexplored. HIV transmission and disclosure often occur within a couple however, and this is where disclosure has the most scope as a HIV transmission intervention. With this in mind, this study explores whether perceived relationship quality influences HIV disclosure outcomes. Ninety-five UK individuals with HIV participated in a cross-sectional survey. Retrospective data were collected on their perceived relationship quality prior to disclosing their HIV positive status, and on disclosure outcomes. Perceived relationship quality was found to significantly affect disclosure outcomes. Positive qualities in the relationship were associated with positive outcomes, whereas negative qualities were associated with negative outcomes. Results further confirmed that this association was not merely correlational, but demonstrated predictive power. Relationship quality might act as either a risk or a resilience factor in the disclosure process, and thus warrants greater attention in future research.

  7. Phylogenetic Relationships of Cucullanidae (Nematoda), with Observations on Seuratoidea and the Monophyly of Cucullanus, Dichelyne and Truttaedacnitis.

    Science.gov (United States)

    Choudhury, Anindo; Nadler, Steven A

    2016-02-01

    The phylogenetic relationships of Cucullanidae were explored using near-complete sequences of the 18S rDNA (rRNA gene). Sequences (1,750-1,760 bp) were obtained from 7 species of Cucullanidae belonging to 3 genera, Cucullanus (2 spp.), Dichelyne (2 spp.), Truttaedacnitis (3 spp.), and 1 species of Quimperiidae ( Paraseuratum sp.). These sequences were aligned with those of 128 other nematode species available in GenBank, including 3 other cucullanids (Dichelyne mexicanus, Cucullanus robustus, and Cucullanus baylisi) and 2 non-cucullanid seuratoids (Paraquimperia africana, and Linstowinema sp.). Bayesian (BPP) and maximum likelihood (ML) analyses of 2 different datasets strongly supported a monophyletic Cucullanidae. Bayesian analysis placed this family as the sister group to a clade containing species of Diplogasterida, Strongylida, Rhabditida, and Tylenchida with very strong support. Neither BPP nor ML analyses recovered a close relationship of Cucullanidae to Ascaridida. None of the 3 non-cucullanid seuratoid species were sister to Cucullanidae, nor did they form a monophyletic group of their own, which questions the monophyly of Seuratoidea and the relationships among species within this superfamily. The 3 genera of cucullanids were also not monophyletic, although morphologically similar species such as the 2 species of Cucullanus from Neotropical catfishes and 2 species of Dichelyne from Nearctic ictalurid catfishes were sister taxa with strong support. The results were ambiguous with respect to the relationship of 2 Truttaedacnitis spp. in Nearctic freshwater fishes but do not support Truttaedacnitis heterodonti, a parasite of heterodontid sharks, as belonging to this genus. The study shows that all aspects of the conventional classification of Seuratoidea and its taxa should be scrutinized by even more extensive sampling across hosts and habitats.

  8. Studying the evolutionary relationships and phylogenetic trees of 21 groups of tRNA sequences based on complex networks.

    Science.gov (United States)

    Wei, Fangping; Chen, Bowen

    2012-03-01

    To find out the evolutionary relationships among different tRNA sequences of 21 amino acids, 22 networks are constructed. One is constructed from whole tRNAs, and the other 21 networks are constructed from the tRNAs which carry the same amino acids. A new method is proposed such that the alignment scores of any two amino acids groups are determined by the average degree and the average clustering coefficient of their networks. The anticodon feature of isolated tRNA and the phylogenetic trees of 21 group networks are discussed. We find that some isolated tRNA sequences in 21 networks still connect with other tRNAs outside their group, which reflects the fact that those tRNAs might evolve by intercrossing among these 21 groups. We also find that most anticodons among the same cluster are only one base different in the same sites when S ≥ 70, and they stay in the same rank in the ladder of evolutionary relationships. Those observations seem to agree on that some tRNAs might mutate from the same ancestor sequences based on point mutation mechanisms.

  9. Vertebrate hosts and phylogenetic relationships of amphibian trypanosomes from a potential invertebrate vector, Culex territans Walker (Diptera: Culicidae).

    Science.gov (United States)

    Bartlett-Healy, Kristen; Crans, Wayne; Gaugler, Randy

    2009-04-01

    The blood meals of field-collected female Culex territans (Diptera: Culicidae) were concurrently assayed for the presence of trypanosomes and for vertebrate host identification. We amplified vertebrate DNA in 42 of 119 females and made positive identification to the host species level in 29 of those samples. Of the 119 field-collected Cx. territans females, 24 were infected with trypanosomes. Phylogenetic analysis placed the trypanosomes in the amphibian portion of the aquatic clade of the Trypanosomatidae. These trypanosomes were isolated from Cx. territans females that had fed on the frog species Rana clamitans, R. catesbeiana, R. virgatipes, and Rana spp. Results support a potential new lineage of dipteran-transmitted amphibian trypanosomes may occur within the aquatic clade. The frequency in which female Cx. territans acquire trypanosomes, through diverse feeding habits, indicates a new relationship between amphibian trypanosomes and mosquitoes that has not been examined previously. Combining Trypanosoma species, invertebrate, and vertebrate hosts to existing phylogenies can elucidate trypanosome and host relationships.

  10. Higher level phylogenetic relationships within the bamboos (Poaceae: Bambusoideae) based on five plastid markers.

    Science.gov (United States)

    Kelchner, Scot A

    2013-05-01

    Bamboos are large perennial grasses of temperate and tropical forests worldwide. Two general growth forms exist: the economically and ecologically important woody bamboos (tribes Arundinarieae and Bambuseae), and the understory herbaceous bamboos (tribe Olyreae). Evolutionary relationships among the 1400+described species have been difficult to resolve with confidence. Comparative analysis of bamboo plastid (chloroplast) DNA has revealed three to five major lineages that show distinct biogeographic distributions. Taxon sampling across tribes and subtribes has been incomplete and most published data sets include a relatively small number of nucleotide characters. Branching order among lineages is often poorly supported, and in more than one study herbaceous bamboos form a clade within the woody bamboos. In this paper, the Bamboo Phylogeny Group presents the most complete phylogeny estimation to date of bamboo tribes and subtribes using 6.7 kb of coding and noncoding sequence data and 37 microstructural characters from the chloroplast genome. Quality of data is assessed, as is the possibility of long branch attraction, the degree of character conflict at key nodes in the tree, and the legitimacy of three alternative hypotheses of relationship. Four major plastid lineages are recognized: temperate woody, paleotropical woody, neotropical woody, and herbaceous bamboos. Woody bamboos are resolved as paraphyletic with respect to Olyreae but SH tests cannot reject monophyly of woody species (Arundinarieae+Bambuseae). Published by Elsevier Inc.

  11. [Phylogenetic relationships among the genera of Taxodiaceae and Cupressaceae from 28S rDNA sequences].

    Science.gov (United States)

    Li, Chun-Xiang; Yang, Qun

    2003-03-01

    DNA sequences from 28S rDNA were used to assess relationships between and within traditional Taxodiaceae and Cupressaceae s.s. The MP tree and NJ tree generally are similar to one another. The results show that Taxodiaceae and Cupressaceae s.s. form a monophyletic conifer lineage excluding Sciadopitys. In the Taxodiaceae-Cupressaceae s.s. monophyletic group, the Taxodiaceae is paraphyletic. Taxodium, Glyptostrobus and Cryptomeria forming a clade(Taxodioideae), in which Glyptostrobus and Taxodium are closely related and sister to Cryptomeria; Sequoia, Sequoiadendron and Metasequoia are closely related to each other, forming another clade (Sequoioideae), in which Sequoia and Sequoiadendron are closely related and sister to Metasequoia; the seven genera of Cupressaceae s.s. are found to be closely related to form a monophyletic lineage (Cupressoideae). These results are basically similar to analyses from chloroplast gene data. But the relationships among Taiwania, Sequoioideae, Taxodioideae, and Cupressoideae remain unclear because of the slow evolution rate of 28S rDNA, which might best be answered by sequencing more rapidly evolving nuclear genes.

  12. Tryptophan Metabolism and Its Relationship with Depression and Cognitive Impairment among HIV-infected Individuals

    Directory of Open Access Journals (Sweden)

    Michael R. Keegan

    2016-01-01

    Full Text Available Objective Cognitive impairment (CI and major depressive disorder (MDD remain prevalent in treated HIV-1 disease; however, the pathogenesis remains elusive. A possible contributing mechanism is immune-mediated degradation of tryptophan (TRP via the kynurenine (KYN pathway, resulting in decreased production of serotonin and accumulation of TRP degradation products. We explored the association of these biochemical pathways and their relationship with CI and MDD in HIV-positive (HIV+ individuals. Methods In a cross-sectional analysis, concentrations of neopterin (NEO, tumor necrosis factor-alpha, TRP, KYN, KYN/TRP ratio, phenylalanine (PHE, tyrosine (TYR, PHE/TYR ratio, and nitrite were assessed in the cerebrospinal fluid (CSF and plasma of HIV+( n = 91 and HIV-negative (HIV- individuals ( n = 66. CI and MDD were assessed via a comprehensive neuropsychological test battery. A Global Deficit Score ≥0.5 was defined as CI. Nonparametric statistical analyses included Kruskal–Wallis and Mann–Whitney U tests, and multivariate logistic regression. Results Following Bonferroni correction, NEO concentrations were found to be greater in CSF and TRP concentration was found to be lower in the plasma of HIV+ versus HIV– individuals, including a subgroup of aviremic (defined as HIV-1 RNA <50 cps/mL HIV+ participants receiving antiretroviral therapy ( n = 44. There was a nonsignificant trend toward higher KYN/TRP ratios in plasma in the HIV+ group ( P = 0.027; Bonferroni corrected α = 0.0027. In a logistic regression model, lower KYN/TRP ratios in plasma were associated with CI and MDD in the overall HIV+ group ( P = 0.038 and P = 0.063, respectively and the aviremic subgroup ( P = 0.066 and P = 0.027, respectively, though this observation was not statistically significant following Bonferroni correction (Bonferroni corrected α = 0.0031. Conclusions We observed a trend toward lower KYN/TRP ratios in aviremic HIV+ patients with CI and MDD.

  13. Phylogenetic relationships among the species of the genus testudo (Testudines : Testudinidae) inferred from mitochondrial 12S rRNA gene sequences

    NARCIS (Netherlands)

    van der Kuyl, Antoinette C.; Ph Ballasina, Donato L.; Dekker, John T.; Maas, Jolanda; Willemsen, Ronald E.; Goudsmit, Jaap

    2002-01-01

    To test phylogenetic relationships within the genus Testudo (Testudines: Testudinidae), we have sequenced a fragment of the mitochondrial (mt) 12S rRNA gene of 98 tortoise specimens belonging to the genera Testudo, Indotestudo, and Geochelone. Maximum likelihood and neighbor-joining methods identify

  14. Phylogenetic relationships of the Gomphales based on nuc-25S-rDNA, mit-12S-rDNA, and mit-atp6-DNA combined sequences

    Science.gov (United States)

    Admir J. Giachini; Kentaro Hosaka; Eduardo Nouhra; Joseph Spatafora; James M. Trappe

    2010-01-01

    Phylogenetic relationships among Geastrales, Gomphales, Hysterangiales, and Phallales were estimated via combined sequences: nuclear large subunit ribosomal DNA (nuc-25S-rDNA), mitochondrial small subunit ribosomal DNA (mit-12S-rDNA), and mitochondrial atp6 DNA (mit-atp6-DNA). Eighty-one taxa comprising 19 genera and 58 species...

  15. Phylogenetic relationships of the cultivated neotropical palm Bactris gasipaes (arecaceae) with its wild relatives inferred from chloroplast and nuclear DNA polymorphisms

    NARCIS (Netherlands)

    Couvreur, T.L.P.; Hahn, K.; Granville, de J.J.; Pham, J.L.; Ludena, B.; Pintaud, J.C.

    2007-01-01

    Peach palm (Bactris gasipaes Kunth.) is the only Neotropical palm domesticated since pre-Columbian times. It plays an important role not only at the local level due to its very nutritious fruits, but also in the international market for its gourmet palm heart. Phylogenetic relationships of the peach

  16. ORIGINAL ARTICLES Male circumcision and its relationship to HIV ...

    African Journals Online (AJOL)

    2008-10-09

    Oct 9, 2008 ... The notion that male circumcision could be protective against HIV infection ..... to finally gain acceptance of their masculinity by other Xhosa men.14 ... Prevalence, Behavioural Risks and Mass Media Household Survey 2002.

  17. HIV infection and hepatitis C virus genotype 1a are associated with phylogenetic clustering among people with recently acquired hepatitis C virus infection.

    Science.gov (United States)

    Bartlett, Sofia R; Jacka, Brendan; Bull, Rowena A; Luciani, Fabio; Matthews, Gail V; Lamoury, Francois M J; Hellard, Margaret E; Hajarizadeh, Behzad; Teutsch, Suzy; White, Bethany; Maher, Lisa; Dore, Gregory J; Lloyd, Andrew R; Grebely, Jason; Applegate, Tanya L

    2016-01-01

    The aim of this study was to identify factors associated with phylogenetic clustering among people with recently acquired hepatitis C virus (HCV) infection. Participants with available sample at time of HCV detection were selected from three studies; the Australian Trial in Acute Hepatitis C, the Hepatitis C Incidence and Transmission Study - Prison and Community. HCV RNA was extracted and Core to E2 region of HCV sequenced. Clusters were identified from maximum likelihood trees with 1000 bootstrap replicates using 90% bootstrap and 5% genetic distance threshold. Among 225 participants with available Core-E2 sequence (ATAHC, n=113; HITS-p, n=90; and HITS-c, n=22), HCV genotype prevalence was: G1a: 38% (n=86), G1b: 5% (n=12), G2a: 1% (n=2), G2b: 5% (n=11), G3a: 48% (n=109), G6a: 1% (n=2) and G6l 1% (n=3). Of participants included in phylogenetic trees, 22% of participants were in a pair/cluster (G1a-35%, 30/85, mean maximum genetic distance=0.031; G3a-11%, 12/106, mean maximum genetic distance=0.021; other genotypes-21%, 6/28, mean maximum genetic distance=0.023). Among HCV/HIV co-infected participants, 50% (18/36) were in a pair/cluster, compared to 16% (30/183) with HCV mono-infection (P=infection [vs. HCV mono-infection; adjusted odds ratio (AOR) 4.24; 95%CI 1.91, 9.39], and HCV G1a infection (vs. other HCV genotypes; AOR 3.33, 95%CI 0.14, 0.61).HCV treatment and prevention strategies, including enhanced antiviral therapy, should be optimised. The impact of targeting of HCV treatment as prevention to populations with higher phylogenetic clustering, such as those with HIV co-infection, could be explored through mathematical modelling. Copyright © 2015 Elsevier B.V. All rights reserved.

  18. Diversification of Scrophularia (Scrophulariaceae) in the Western Mediterranean and Macaronesia--phylogenetic relationships, reticulate evolution and biogeographic patterns.

    Science.gov (United States)

    Scheunert, Agnes; Heubl, Günther

    2014-01-01

    The flora of the Mediterranean region and Macaronesia is characterized by high levels of species diversity and endemism. We examined phylogenetic relationships of Scrophularia within one of its secondary centers of diversity located in the Iberian Peninsula and adjacent Macaronesia. In total, 65 ingroup accessions from 45 species, representing an almost complete sampling of the region, were analyzed using sequences from the internal transcribed spacer region (ITS) and the plastid trnQ-rps16 intergenic spacer. Phylogenetic relationships were inferred using Bayesian inference, maximum likelihood and statistical parsimony networking. Incongruence between datasets was assessed with statistical tests and displayed by split networks. Biogeographic inferences incorporating information from both markers (despite low resolution in some parts of the trees) and all incongruent taxa were accomplished with a novel combination of methods, using trees generated with the taxon duplication approach as input for Bayesian binary MCMC (BBM) analysis as implemented in RASP. Nuclear and chloroplast markers support a clade which comprises the majority of Iberian and Macaronesian species and consists of three subclades. Analyses of the substantial incongruence observed among markers indicate reticulate evolution and suggest that Scrophularia species diversity in this region is largely attributable to hybridization; a combination of both polyploidy and dysploidy in the karyotypic evolution of Western Mediterranean Scrophularia taxa is proposed. Our results provide support for an ancient hybridization event between two widespread lineages, which resulted in an allopolyploid ancestor of the Iberian - Macaronesian group with 2n=58 chromosomes. The ancestor then diverged into the three main lineages present in the Iberian Peninsula, Northern Africa and Macaronesia today. Subsequent interspecific hybridizations at different ploidy levels additionally generated new species. Presumably

  19. Monophyly of Archaeplastida supergroup and relationships among its lineages in the light of phylogenetic and phylogenomic studies. Are we close to a consensus?

    Directory of Open Access Journals (Sweden)

    Paweł Mackiewicz

    2014-12-01

    Full Text Available One of the key evolutionary events on the scale of the biosphere was an endosymbiosis between a heterotrophic eukaryote and a cyanobacterium, resulting in a primary plastid. Such an organelle is characteristic of three eukaryotic lineages, glaucophytes, red algae and green plants. The three groups are usually united under the common name Archaeplastida or Plantae in modern taxonomic classifications, which indicates they are considered monophyletic. The methods generally used to verify this monophyly are phylogenetic analyses. In this article we review up-to-date results of such analyses and discussed their inconsistencies. Although phylogenies of plastid genes suggest a single primary endosymbiosis, which is assumed to mean a common origin of the Archaeplastida, different phylogenetic trees based on nuclear markers show monophyly, paraphyly, polyphyly or unresolved topologies of Archaeplastida hosts. The difficulties in reconstructing host cell relationships could result from stochastic and systematic biases in data sets, including different substitution rates and patterns, gene paralogy and horizontal/endosymbiotic gene transfer into eukaryotic lineages, which attract Archaeplastida in phylogenetic trees. Based on results to date, it is neither possible to confirm nor refute alternative evolutionary scenarios to a single primary endosymbiosis. Nevertheless, if trees supporting monophyly are considered, relationships inferred among Archaeplastida lineages can be discussed. Phylogenetic analyses based on nuclear genes clearly show the earlier divergence of glaucophytes from red algae and green plants. Plastid genes suggest a more complicated history, but at least some studies are congruent with this concept. Additional research involving more representatives of glaucophytes and many understudied lineages of Eukaryota can improve inferring phylogenetic relationships related to the Archaeplastida. In addition, alternative approaches not directly

  20. Impact of HIV/AIDS on Social Relationships in Rural China.

    Science.gov (United States)

    Zhang, Yurong; Zhang, Xiulan; Hanko Aleong, Tamara; Fuller-Thomson, Esme

    2011-01-01

    Social support promotes greater medical compliance, better immune system functioning and slows the progress of HIV/AIDS. One in every 50 People Living With HIV/AIDS (PLWHA) is Chinese, yet little is known about the impact of HIV/AIDS on social relationships in China. This study compares the characteristics of those who report that HIV/AIDS had a substantial impact versus a modest impact on their social relationships. We obtained data from a survey of 866 PLWHA in rural China, which was conducted in 2006-2007 in the three Chinese provinces with the highest prevalence of HIV/AIDS. Chi-square test and multiple logistic regression were performed. The analysis shows that PLWHA who had full-blown AIDS (OR= 1.53; 95% CI=1.09-2.13) and those who were poor (OR=2.19; 95% CI=1.52-3.16) reported greater impact on their social relationships. The results lay a solid foundation for designing effective policy initiatives and intervention programs aimed at alleviating the impact of HIV/AIDS on social relationships and improving the quality of life of PLWHA.

  1. Phylogenetic Relationships between Four Salix L. Species Based on DArT Markers

    Directory of Open Access Journals (Sweden)

    Jerzy A. Przyborowski

    2013-12-01

    Full Text Available The objectives of this study were to evaluate the usefulness of DArT markers in genotypic identification of willow species and describe genetic relationships between four willow species: Salix viminalis, S. purpurea, S. alba and S. triandra. The experimental plant material comprised 53 willow genotypes of these four species, which are popularly grown in Poland. DArT markers seem to identify Salix species with a high degree of accuracy. As a result, the examined species were divided into four distinct groups which corresponded to the four analyzed species. In our study, we observed that S. triandra was very different genetically from the other species, including S. alba which is generally classified into the same subgenus of Salix. The above corroborates the findings of other authors who relied on molecular methods to reveal that the classification of S. triandra to the subgenus Salix was erroneous. The Principal Coordinate Analysis (PCoA and the neighbor-joining dendrogram also confirmed the clear division of the studied willow genotypes into four clusters corresponding to individual species. This confirmed the usefulness of DArT markers in taxonomic analyses and identification of willow species.

  2. Phylogenetic relationships of Vepris (Rutaceae inferred from chloroplast, nuclear, and morphological data.

    Directory of Open Access Journals (Sweden)

    Cynthia M Morton

    Full Text Available The tribe Toddalieae Hook. F. (Rutaceae has been controversial since its inception by Bentham and Hooker. The nine taxa examined, Acronychia J.R. & G.Foster, Diphasia Pierre, Diphasiopsis Mendonca, Fagaropsis Mildbr.ex. Siebenl., Oricia Pierre, Teclea Delile, Toddaliopsis Engl., Toddalia Juss. and Vepris Comm. ex. A. Juss, have been recognized under the tribe Toddalieae or Tribes Acronychia, Phellodendron and Toddalia. More recently Araliopsis Engl., Diphasia, Diphasiopsis, Oricia, Teclea, and Toddaliopsis have been incorporated into the genus Vepris, while Toddalia and Fagaropsis have continued to be recognized as closely related. For this study, sequence data of one non-coding chloroplast region (trnL-F and one nuclear region (ITS and various morphological characters, based on Mziray's taxonomic studies were examined to try to elucidate these relationships. This study found that the taxa Diphasia, Diphasiopsis, Oricia, Teclea, Toddaliopsis, Vepris, Toddalia eugeniifolia Engl. and Toddalia glomerata F. Hoffm. form a monophyletic group. Due to the amount of intrageneric and intraspecific variation, species delimitations were difficult to determine; however, these genera should be united into Vepris. The analyses also confirmed that Toddalia asiatica (L. Lam., Zanthoxylon sp. and Fagaropsis angolensis (Engl. H.M. Gardner are the closest relatives to this group.

  3. Phylogenetic relationships among Lactuca (Asteraceae) species and related genera based on ITS-1 DNA sequences.

    Science.gov (United States)

    Koopman, W J; Guetta, E; van de Wiel, C C; Vosman, B; van den Berg, R G

    1998-11-01

    Internal transcribed spacer (ITS-1) sequences from 97 accessions representing 23 species of Lactuca and related genera were determined and used to evaluate species relationships of Lactuca sensu lato (s.l.). The ITS-1 phylogenies, calculated using PAUP and PHYLIP, correspond better to the classification of Feráková than to other classifications evaluated, although the inclusion of sect. Lactuca subsect. Cyanicae is not supported. Therefore, exclusion of subsect. Cyanicae from Lactuca sensu Feráková is proposed. The amended genus contains the entire gene pool (sensu Harlan and De Wet) of cultivated lettuce (Lactuca sativa). The position of the species in the amended classification corresponds to their position in the lettuce gene pool. In the ITS-1 phylogenies, a clade with L. sativa, L. serriola, L. dregeana, L. altaica, and L. aculeata represents the primary gene pool. L. virosa and L. saligna, branching off closest to this clade, encompass the secondary gene pool. L. virosa is possibly of hybrid origin. The primary and secondary gene pool species are classified in sect. Lactuca subsect. Lactuca. The species L. quercina, L. viminea, L. sibirica, and L. tatarica, branching off next, represent the tertiary gene pool. They are classified in Lactuca sect. Lactucopsis, sect. Phaenixopus, and sect. Mulgedium, respectively. L. perennis and L. tenerrima, classified in sect. Lactuca subsect. Cyanicae, form clades with species from related genera and are not part of the lettuce gene pool.

  4. Phylogenetic relationships and genetic diversity of the Polypedates leucomystax complex in Thailand

    Directory of Open Access Journals (Sweden)

    Kittisak Buddhachat

    2018-01-01

    Full Text Available Taxonomic uncertainty of the Asian tree frog Polypedates leucomystax complex presents the challenging task of inferring its biogeographical history. Here, we describe its dispersion and the genetic relationships among different populations in Thailand, where we connect the population of the P. leucomystax complex of the Sunda Islands to the Indochina (mainland population based on analyses of 266 sequences of the mitochondrial cytochrome c oxidase subunit I (COI gene. Our maternal genealogy implies that there are four well-supported lineages in Thailand, consisting of Northern A (clade A: Polypedates sp., Nan (clade B: P. cf. impresus, Southern (clade C: P. cf. leucomystax and Northern D (clade D: P. cf. megacephalus, with Bayesian posterior probability >0.9. Phylogeny and haplotype networks indicate that clades A, B and D are sympatric. In contrast, clade C (P. cf. leucomystax and clade D (P. cf. megacephalus are genetically divergent due to the geographical barrier of the Isthmus of Kra, resulting in an allopatric distribution. Climatic conditions, in particular differences in rainfall on each side of the Isthmus of Kra, may play an important role in limiting the immigration of both clades. For the within-populations of either clades C or D, there was no significant correlation between geographic and genetic distance by the isolation-by-distance test, indicating intraspecific-dispersal of each clade. Population expansion occurred in clade C, whereas clade D showed a constant population. Taken together, the P. leucomystax complex in South East Asia may have diversified under climatic pressure, leading to allopatric and/or sympatric speciation.

  5. Phylogenetic relationships in the Festuca-Lolium complex (Loliinae; Poaceae: New insights from chloroplast sequences

    Directory of Open Access Journals (Sweden)

    Yajuan Cheng

    2016-07-01

    Full Text Available The species within the Lolium/Festuca grass complex have dispersed and colonized large areas of temperate global grasslands both naturally and by human intervention. The species within this grass complex represent some of the most important grass species both for amenity and agricultural use worldwide. There has been renewed interest by grass breeders in producing hybrid combinations between these species and several countries now market Festulolium varieties as a combination of genes from both genera. The two genera have been differentiated by their inflorescence structure, but controversy has surrounded the taxonomic classification of the Lolium-Festuca complex species for several decades. In order to better understand the complexities within the Lolium/Festuca complex and their genetic background, the phylogeny of important examplers from the Lolium-Festuca complex were reconstructed. In total 40 taxa representing the Festuca and Lolium species with Vulpia myuros and Brachypodium distachyon as outgroups were sampled, using two noncoding intergenic spacers (trnQ-rps16, trnH-psbA and one coding gene (rbcL. Maximum parsimony (MP, Bayesian inference (BI analyses based on each partition and combined plastid DNA dataset, and median-jointing network analysis were employed. The outcomes strongly suggested that the subgen. Schedonorus has a close relationship to Lolium, and it is also proposed to move the sect. Leucopoa from subgen. Leucopoa to Subgen. Schedonorus and to separate sect. Breviaristatae from the subgen. Leucopoa. We found that F. californica could be a lineage of hybrid origin because of its intermediate placement between the broad-leaved and fine-leaved clade.

  6. Analysis of mitochondrial DNA: taxonomic and phylogenetic relationships in two fish taxa (Pisces: Mugilidae and Cyprinidae).

    Science.gov (United States)

    Semina, A V; Polyakova, N E; Brykov, Vl A

    2007-12-01

    To solve some systematic questions as well as to study genetic variability and evolutionary relationships in two groups of fish belonging to the Mugilid (Mugilidae) and Cyprinid (Cyprinidae) families, we have used restriction fragment length polymorphism analysis of mitochondrial DNA (mtDNA) fragments amplified in polymerase chain reaction. The analysis of three mtDNA fragments of 7220 bp total length of six Mugilid species has shown that Mediterranean Liza aurata, L. ramada, L. saliens, and Chelon labrosus form a common cluster, L. aurata and C. labrosus being the closest relatives, whereas L. haematocheilus (syn. C. haematocheilus) of the Sea of Japan forms a sister group to the Mediterranean cluster. It was found that Chelon and Liza genera are paraphyletic, and therefore their division into two genera is unnatural and they should be synonymized. According to priority, Liza species should be ascribed to Chelon genus. Mugil cephalus is the most distant compared to the rest of the species studied. The level of genetic divergence between allopatric samples of M. cephalus from the Sea of Japan and the Mediterranean Sea has proved to be very high--4.5% of nucleotide substitutions. The analysis of four mtDNA fragments of 9340 bp total length of six Cyprinid species has shown that L. waleckii is the most genetically distant. Pseudaspius leptocephalus is a sister group to Tribolodon species. All Tribolodon species form a common cluster with T. sachalinensis as a root. The remaining species form two branches, one of which includes T. nakamurai and T. brandtii, another one combines T. hakonensis and a new form of Tribolodon revealed that is close to T. hakonensis by its mtDNA (2.4% of nucleotide substitutions). This new form might be an independent species.

  7. Phylogenetic relationships among Perissodactyla: secretoglobin 1A1 gene duplication and triplication in the Equidae family.

    Science.gov (United States)

    Côté, Olivier; Viel, Laurent; Bienzle, Dorothee

    2013-12-01

    Secretoglobin family 1A member 1 (SCGB 1A1) is a small anti-inflammatory and immunomodulatory protein that is abundantly secreted in airway surface fluids. We recently reported the existence of three distinct SCGB1A1 genes in the domestic horse genome as opposed to the single gene copy consensus present in other mammals. The origin of SCGB1A1 gene triplication and the evolutionary relationship of the three genes amongst Equidae family members are unknown. For this study, SCGB1A1 genomic data were collected from various Equus individuals including E. caballus, E. przewalskii, E. asinus, E. grevyi, and E. quagga. Three SCGB1A1 genes in E. przewalskii, two SCGB1A1 genes in E. asinus, and a single SCGB1A1 gene in E. grevyi and E. quagga were identified. Sequence analysis revealed that the non-synonymous nucleotide substitutions between the different equid genes coded for 17 amino acid changes. Most of these changes localized to the SCGB 1A1 central cavity that binds hydrophobic ligands, suggesting that this area of SCGB 1A1 evolved to accommodate diverse molecular interactions. Three-dimensional modeling of the proteins revealed that the size of the SCGB 1A1 central cavity is larger than that of SCGB 1A1A. Altogether, these findings suggest that evolution of the SCGB1A1 gene may parallel the separation of caballine and non-caballine species amongst Equidae, and may indicate an expansion of function for SCGB1A1 gene products. Copyright © 2013 Elsevier Inc. All rights reserved.

  8. Comprehensive transcriptome analysis provides new insights into nutritional strategies and phylogenetic relationships of chrysophytes

    Directory of Open Access Journals (Sweden)

    Daniela Beisser

    2017-01-01

    Full Text Available Background Chrysophytes are protist model species in ecology and ecophysiology and important grazers of bacteria-sized microorganisms and primary producers. However, they have not yet been investigated in detail at the molecular level, and no genomic and only little transcriptomic information is available. Chrysophytes exhibit different trophic modes: while phototrophic chrysophytes perform only photosynthesis, mixotrophs can gain carbon from bacterial food as well as from photosynthesis, and heterotrophs solely feed on bacteria-sized microorganisms. Recent phylogenies and megasystematics demonstrate an immense complexity of eukaryotic diversity with numerous transitions between phototrophic and heterotrophic organisms. The question we aim to answer is how the diverse nutritional strategies, accompanied or brought about by a reduction of the plasmid and size reduction in heterotrophic strains, affect physiology and molecular processes. Results We sequenced the mRNA of 18 chrysophyte strains on the Illumina HiSeq platform and analysed the transcriptomes to determine relations between the trophic mode (mixotrophic vs. heterotrophic and gene expression. We observed an enrichment of genes for photosynthesis, porphyrin and chlorophyll metabolism for phototrophic and mixotrophic strains that can perform photosynthesis. Genes involved in nutrient absorption, environmental information processing and various transporters (e.g., monosaccharide, peptide, lipid transporters were present or highly expressed only in heterotrophic strains that have to sense, digest and absorb bacterial food. We furthermore present a transcriptome-based alignment-free phylogeny construction approach using transcripts assembled from short reads to determine the evolutionary relationships between the strains and the possible influence of nutritional strategies on the reconstructed phylogeny. We discuss the resulting phylogenies in comparison to those from established approaches

  9. Liaisons dangereuses: HIV risk behavior and prevention in steady gay relationships

    NARCIS (Netherlands)

    Davidovich, E.

    2006-01-01

    This dissertation studied sexual risk-taking behavior among gay men in steady relationships. The main targets of this study were to establish: (a) whether steady relationships form a risk environment for HIV-infection; (b) some of the determinants of risky and protective behavior between steady

  10. Relationship between HIV stigma and self-isolation among people living with HIV in Tennessee.

    Directory of Open Access Journals (Sweden)

    Carolyn M Audet

    Full Text Available HIV stigma is a contributing factor to poor patient outcomes. Although HIV stigma has been documented, its impact on patient well-being in the southern US is not well understood.Thirty-two adults participated in cognitive interviews after completing the Berger HIV or the Van Rie stigma scale. Participant responses were probed to ensure the scales accurately measured stigma and to assess the impact stigma had on behavior.Three main themes emerged regarding HIV stigma: (1 negative attitudes, fear of contagion, and misperceptions about transmission; (2 acts of discrimination by families, friends, health care providers, and within the workplace; and (3 participants' use of self-isolation as a coping mechanism. Overwhelming reluctance to disclose a person's HIV status made identifying enacted stigma with a quantitative scale difficult.Fear of discrimination resulted in participants isolating themselves from friends or experiences to avoid disclosure. Participant unwillingness to disclose their HIV status to friends and family could lead to an underestimation of enacted HIV stigma in quantitative scales.

  11. Differences in Gay Male Couples' Use of Drugs and Alcohol With Sex by Relationship HIV Status.

    Science.gov (United States)

    Mitchell, Jason W

    2016-07-01

    Prior studies with men who have sex with men have documented a strong association between substance use with sex and risk for acquisition of HIV. However, few studies have been conducted about gay male couples' use of substances with sex, despite the fact that between one third and two thirds of men who have sex with men acquire HIV from their relationship partners. The present study sought to (1) describe whether one or both partners in the male couple uses substances with sex-by substance type-within and/or outside of their relationship, and (2) assess whether differences exist in those who use substances with sex within and outside the relationship by the couples' HIV status. Dyadic data for this analysis were collected in the United States from a nation-wide cross-sectional Internet study about male couples' relationships and behaviors. Couple-level descriptive and comparative analyses were employed with 361 male couples. Except for alcohol, most couples did not use substances with sex. Of those who did, rates of who used it with sex and substance type within the relationship varied; most couples only had one partner who used substances with sex outside the relationship. Significantly higher proportions of concordantly HIV-negative and HIV-positive couples had both partners who used substances (all types) with sex within their relationship over discordant couples. Most couples had one partner who used outside the relationship; only marijuana and erectile dysfunction medication use with sex significantly differed by couples' HIV status. Findings indicate the need to conduct additional research for prevention development. © The Author(s) 2014.

  12. Karyotype evolution and phylogenetic relationships of hamsters (Cricetidae, Muroidea, Rodentia) inferred from chromosomal painting and banding comparison.

    Science.gov (United States)

    Romanenko, Svetlana A; Volobouev, Vitaly T; Perelman, Polina L; Lebedev, Vladimir S; Serdukova, Natalya A; Trifonov, Vladimir A; Biltueva, Larisa S; Nie, Wenhui; O'Brien, Patricia C M; Bulatova, Nina Sh; Ferguson-Smith, Malcolm A; Yang, Fengtang; Graphodatsky, Alexander S

    2007-01-01

    The evolutionary success of rodents of the superfamily Muroidea makes this taxon the most interesting for evolution studies, including study at the chromosomal level. Chromosome-specific painting probes from the Chinese hamster and the Syrian (golden) hamster were used to delimit homologous chromosomal segments among 15 hamster species from eight genera: Allocricetulus, Calomyscus, Cricetulus, Cricetus, Mesocricetus, Peromyscus, Phodopus and Tscherskia (Cricetidae, Muroidea, Rodentia). Based on results of chromosome painting and G-banding, comparative maps between 20 rodent species have been established. The integrated maps demonstrate a high level of karyotype conservation among species in the Cricetus group (Cricetus, Cricetulus, Allocricetulus) with Tscherskia as its sister group. Species within the genera Mesocricetus and Phodopus also show a high degree of chromosomal conservation. Our results substantiate many of the conclusions suggested by other data and strengthen the topology of the Muroidea phylogenetic tree through the inclusion of genome-wide chromosome rearrangements. The derivation of the muroids karyotypes from the putative ancestral state involved centric fusions, fissions, addition of heterochromatic arms and a great number of inversions. Our results provide further insights into the karyotype relationships of all species investigated.

  13. Mitochondrial haplotype distribution and phylogenetic relationship of an endangered species Reeve's turtle (Mauremys reevesii in East Asia

    Directory of Open Access Journals (Sweden)

    Hong-Shik Oh

    2017-03-01

    Full Text Available This study was examined to reveal haplotype distribution and phylogenetic relationship using mitochondrial DNA CYTB gene sequences of Reeve’s turtle (Mauremys reevesii of East Asia. CYTB sequences of Reeve’s turtles were divided into 6 haplotypes (Hap01–Hap06. Chinese turtles were found in Hap01, Hap02, Hap04, and Hap05, and Hap01 was the highest frequency of 85.0%. Korean Turtles were found in Hap01, Hap03, Hap04, and Hap05, and Hap03 was the highest frequency of 52.1%. Although there was no haplotype which includes only the CYTB sequence exclusive for Reeve’s turtles of Korea, since no CYTB sequence of China was found in Hap03, it would be possible that Hap03 turtles of Korea are separated from those of China. The haplotypes of Reeve’s turtles of East Asia were monophyletic, which indicated that they had been evolved from a single maternal lineage, but went through local evolution after geographical migration and isolation in East Asia.

  14. Phylogenetic analysis of molecular and morphological data highlights uncertainty in the relationships of fossil and living species of Elopomorpha (Actinopterygii: Teleostei).

    Science.gov (United States)

    Dornburg, Alex; Friedman, Matt; Near, Thomas J

    2015-08-01

    Elopomorpha is one of the three main clades of living teleost fishes and includes a range of disparate lineages including eels, tarpons, bonefishes, and halosaurs. Elopomorphs were among the first groups of fishes investigated using Hennigian phylogenetic methods and continue to be the object of intense phylogenetic scrutiny due to their economic significance, diversity, and crucial evolutionary status as the sister group of all other teleosts. While portions of the phylogenetic backbone for Elopomorpha are consistent between studies, the relationships among Albula, Pterothrissus, Notacanthiformes, and Anguilliformes remain contentious and difficult to evaluate. This lack of phylogenetic resolution is problematic as fossil lineages are often described and placed taxonomically based on an assumed sister group relationship between Albula and Pterothrissus. In addition, phylogenetic studies using morphological data that sample elopomorph fossil lineages often do not include notacanthiform or anguilliform lineages, potentially introducing a bias toward interpreting fossils as members of the common stem of Pterothrissus and Albula. Here we provide a phylogenetic analysis of DNA sequences sampled from multiple nuclear genes that include representative taxa from Albula, Pterothrissus, Notacanthiformes and Anguilliformes. We integrate our molecular dataset with a morphological character matrix that spans both living and fossil elopomorph lineages. Our results reveal substantial uncertainty in the placement of Pterothrissus as well as all sampled fossil lineages, questioning the stability of the taxonomy of fossil Elopomorpha. However, despite topological uncertainty, our integration of fossil lineages into a Bayesian time calibrated framework provides divergence time estimates for the clade that are consistent with previously published age estimates based on the elopomorph fossil record and molecular estimates resulting from traditional node-dating methods. Copyright

  15. Recurrent hybridization and recent origin obscure phylogenetic relationships within the ‘white-headed’ gull (Larus sp.) complex

    Science.gov (United States)

    Sonsthagen, Sarah A.; Wilson, Robert E.; Chesser, Terry; Pons, Jean-Marc; Crochet, Pierre-Andre; Driscoll, Amy; Dove, Carla

    2016-01-01

    Species complexes that have undergone recent radiations are often characterized by extensive allele sharing due to recent ancestry and (or) introgressive hybridization. This can result in discordant evolutionary histories of genes and heterogeneous genomes, making delineating species limits difficult. Here we examine the phylogenetic relationships among a complex group of birds, the white-headed gulls (Aves: Laridae), which offer a unique window into the speciation process due to their recent evolutionary history and propensity to hybridize. Relationships were examined among 17 species (61 populations) using a multilocus approach, including mitochondrial and nuclear intron DNA sequences and microsatellite genotype information. Analyses of microsatellite and intron data resulted in some species-based groupings, although most species were not represented by a single cluster. Considerable allele and haplotype sharing among white-headed gull species was observed; no locus contained a species-specific clade. Despite this, our multilocus approach provided better resolution among some species than previous studies. Interestingly, most clades appear to correspond to geographic locality: our BEAST analysis recovered strong support for a northern European/Icelandic clade, a southern European/Russian clade, and a western North American/canus clade, with weak evidence for a high latitude clade spanning North America and northwestern Europe. This geographical structuring is concordant with behavioral observations of pervasive hybridization in areas of secondary contact. The extent of allele and haplotype sharing indicates that ecological and sexual selection are likely not strong enough to complete reproductive isolation within several species in the white-headed gull complex. This suggests that just a few genes are driving the speciation process.

  16. Honey bee dopamine and octopamine receptors linked to intracellular calcium signaling have a close phylogenetic and pharmacological relationship.

    Directory of Open Access Journals (Sweden)

    Kyle T Beggs

    Full Text Available BACKGROUND: Three dopamine receptor genes have been identified that are highly conserved among arthropod species. One of these genes, referred to in honey bees as Amdop2, shows a close phylogenetic relationship to the a-adrenergic-like octopamine receptor family. In this study we examined in parallel the functional and pharmacological properties of AmDOP2 and the honey bee octopamine receptor, AmOA1. For comparison, pharmacological properties of the honey bee dopamine receptors AmDOP1 and AmDOP3, and the tyramine receptor AmTYR1, were also examined. METHODOLOGY/PRINCIPAL FINDINGS: Using HEK293 cells heterologously expressing honey bee biogenic amine receptors, we found that activation of AmDOP2 receptors, like AmOA1 receptors, initiates a rapid increase in intracellular calcium levels. We found no evidence of calcium signaling via AmDOP1, AmDOP3 or AmTYR1 receptors. AmDOP2- and AmOA1-mediated increases in intracellular calcium were inhibited by 10 µM edelfosine indicating a requirement for phospholipase C-β activity in this signaling pathway. Edelfosine treatment had no effect on AmDOP2- or AmOA1-mediated increases in intracellular cAMP. The synthetic compounds mianserin and epinastine, like cis-(Z-flupentixol and spiperone, were found to have significant antagonist activity on AmDOP2 receptors. All 4 compounds were effective antagonists also on AmOA1 receptors. Analysis of putative ligand binding sites offers a possible explanation for why epinastine acts as an antagonist at AmDOP2 receptors, but fails to block responses mediated via AmDOP1. CONCLUSIONS/SIGNIFICANCE: Our results indicate that AmDOP2, like AmOA1, is coupled not only to cAMP, but also to calcium-signalling and moreover, that the two signalling pathways are independent upstream of phospholipase C-β activity. The striking similarity between the pharmacological properties of these 2 receptors suggests an underlying conservation of structural properties related to receptor

  17. The Role of Relationship Dynamics and Gender Inequalities As Barriers to HIV-Serostatus Disclosure: Qualitative Study among Women and Men Living with HIV in Durban, South Africa

    Directory of Open Access Journals (Sweden)

    Divya S. Bhatia

    2017-07-01

    Full Text Available BackgroundThis qualitative study investigated gender power inequalities as they contribute to relationship dynamics and HIV-serostatus disclosure among men and women living with HIV in Durban, South Africa. HIV serodiscordance among men and women within stable partnerships contributes to high HIV incidence in southern Africa, yet disclosure rates remain low. Given the emphasis on prevention for HIV-serodiscordant couples, this research supports the urgent need to explore how best to support couples to recognize that they are part of this priority population and to access appropriate prevention and treatment.MethodsThirty-five in-depth individual interviews were conducted with 15 HIV-positive men and 20 HIV-positive women (not couples receiving care at public-sector clinics near Durban. A structured coding scheme was developed to investigate men’s and women’s attitudes toward HIV-serostatus disclosure and behaviors of sharing (or not sharing HIV serostatus with a partner. Narratives were analyzed for barriers and facilitators of disclosure through the lens of sociocultural gender inequality, focusing on reasons for non-disclosure.ResultsAmong 35 participants: median age was 33 years (men and 30 years (women; average years since HIV diagnosis was 1 (men and 1.5 (women. Four themes related to gender inequality and HIV-serostatus disclosure emerged: (1 Men and women fear disclosing to partners due to concerns about stigma and relationship dissolution, (2 suspicions and mistrust between partners underlies decisions for non-disclosure, (3 unequal, gendered power in relationships causes differential likelihood and safety of disclosure among men and women, and (4 incomplete or implicit disclosure are strategies to navigate disclosure challenges. Findings illustrate HIV-serostatus disclosure as a complex process evolving over time, rather than a one-time event.ConclusionPartner communication about HIV serostatus is infrequent and complicated

  18. Modelling the relationship between antiretroviral treatment and HIV ...

    African Journals Online (AJOL)

    This paper shows how two publicly available epidemiological modelling packages, namely the Spectrum AIDS Impact Model and the ASSA2003 AIDS and Demographic Model, predict very different impacts from rolling out highly active antiretroviral treatment (HAART) on new HIV infections. Using South Africa as a case ...

  19. Estimating phylogenetic relationships despite discordant gene trees across loci: the species tree of a diverse species group of feather mites (Acari: Proctophyllodidae).

    Science.gov (United States)

    Knowles, Lacey L; Klimov, Pavel B

    2011-11-01

    With the increased availability of multilocus sequence data, the lack of concordance of gene trees estimated for independent loci has focused attention on both the biological processes producing the discord and the methodologies used to estimate phylogenetic relationships. What has emerged is a suite of new analytical tools for phylogenetic inference--species tree approaches. In contrast to traditional phylogenetic methods that are stymied by the idiosyncrasies of gene trees, approaches for estimating species trees explicitly take into account the cause of discord among loci and, in the process, provides a direct estimate of phylogenetic history (i.e. the history of species divergence, not divergence of specific loci). We illustrate the utility of species tree estimates with an analysis of a diverse group of feather mites, the pinnatus species group (genus Proctophyllodes). Discord among four sequenced nuclear loci is consistent with theoretical expectations, given the short time separating speciation events (as evident by short internodes relative to terminal branch lengths in the trees). Nevertheless, many of the relationships are well resolved in a Bayesian estimate of the species tree; the analysis also highlights ambiguous aspects of the phylogeny that require additional loci. The broad utility of species tree approaches is discussed, and specifically, their application to groups with high speciation rates--a history of diversification with particular prevalence in host/parasite systems where species interactions can drive rapid diversification.

  20. Assessing physician/patient relationships in the presence of HIV/AIDS: an exploratory study.

    Science.gov (United States)

    Taylor, S A; Madrigal, C

    1998-01-01

    The following study investigates the nature of the relationship between physicians and HIV/AIDS patients within the context of the rapidly evolving services/relationship marketing literatures. The emerging evidence suggests that service providers generally play a critical role in the development of positive consumer attitudes and behaviors, and that relationship marketing practices can contribute to the delivery of health services. However, to date, there appears little evidence supporting the efficacy of employing relationship marketing practices in relation to a target market of HIV/AIDS patients. This exploratory study contributes to the body of knowledge by more closely investigating the nature of the patient-physician relationship relative to HIV/AIDS patients' attitudes, marketing-related behaviors, and overall quality-of-life/life satisfaction judgments. The results of this study first suggest that HIV/AIDS patients use the expectancy disconfirmation model when evaluating the performance of their physician. A reliance on expectancy disconfirmation suggests the likely prevalent role of service quality perceptions and satisfaction judgments in evaluating their relationship with their physician. Second, the results appear to support the conclusion that the patient's evaluation of their physician relationship and subsequent behaviors (e.g., word-of-mouth) are directly related to the patient's general perception of received health services. Thus, the patient/physician relationship may play a particularly powerful role in determining patient (marketing related) outcomes relative to other health service settings. Third, a direct influence is supported between negative affective reactions by patients and subsequent outcome behaviors. This finding lends support for the potential efficacy of service recovery efforts when rendering treatment to HIV/AIDS patients. Finally, evidence is presented demonstrating the effect of positive perceptions of the patient

  1. Phylogenetic trees

    OpenAIRE

    Baños, Hector; Bushek, Nathaniel; Davidson, Ruth; Gross, Elizabeth; Harris, Pamela E.; Krone, Robert; Long, Colby; Stewart, Allen; Walker, Robert

    2016-01-01

    We introduce the package PhylogeneticTrees for Macaulay2 which allows users to compute phylogenetic invariants for group-based tree models. We provide some background information on phylogenetic algebraic geometry and show how the package PhylogeneticTrees can be used to calculate a generating set for a phylogenetic ideal as well as a lower bound for its dimension. Finally, we show how methods within the package can be used to compute a generating set for the join of any two ideals.

  2. Phylogenetic diversity and biodiversity indices on phylogenetic networks.

    Science.gov (United States)

    Wicke, Kristina; Fischer, Mareike

    2018-04-01

    In biodiversity conservation it is often necessary to prioritize the species to conserve. Existing approaches to prioritization, e.g. the Fair Proportion Index and the Shapley Value, are based on phylogenetic trees and rank species according to their contribution to overall phylogenetic diversity. However, in many cases evolution is not treelike and thus, phylogenetic networks have been developed as a generalization of phylogenetic trees, allowing for the representation of non-treelike evolutionary events, such as hybridization. Here, we extend the concepts of phylogenetic diversity and phylogenetic diversity indices from phylogenetic trees to phylogenetic networks. On the one hand, we consider the treelike content of a phylogenetic network, e.g. the (multi)set of phylogenetic trees displayed by a network and the so-called lowest stable ancestor tree associated with it. On the other hand, we derive the phylogenetic diversity of subsets of taxa and biodiversity indices directly from the internal structure of the network. We consider both approaches that are independent of so-called inheritance probabilities as well as approaches that explicitly incorporate these probabilities. Furthermore, we introduce our software package NetDiversity, which is implemented in Perl and allows for the calculation of all generalized measures of phylogenetic diversity and generalized phylogenetic diversity indices established in this note that are independent of inheritance probabilities. We apply our methods to a phylogenetic network representing the evolutionary relationships among swordtails and platyfishes (Xiphophorus: Poeciliidae), a group of species characterized by widespread hybridization. Copyright © 2018 Elsevier Inc. All rights reserved.

  3. Arthropod phylogenetics in light of three novel millipede (myriapoda: diplopoda) mitochondrial genomes with comments on the appropriateness of mitochondrial genome sequence data for inferring deep level relationships.

    Science.gov (United States)

    Brewer, Michael S; Swafford, Lynn; Spruill, Chad L; Bond, Jason E

    2013-01-01

    Arthropods are the most diverse group of eukaryotic organisms, but their phylogenetic relationships are poorly understood. Herein, we describe three mitochondrial genomes representing orders of millipedes for which complete genomes had not been characterized. Newly sequenced genomes are combined with existing data to characterize the protein coding regions of myriapods and to attempt to reconstruct the evolutionary relationships within the Myriapoda and Arthropoda. The newly sequenced genomes are similar to previously characterized millipede sequences in terms of synteny and length. Unique translocations occurred within the newly sequenced taxa, including one half of the Appalachioria falcifera genome, which is inverted with respect to other millipede genomes. Across myriapods, amino acid conservation levels are highly dependent on the gene region. Additionally, individual loci varied in the level of amino acid conservation. Overall, most gene regions showed low levels of conservation at many sites. Attempts to reconstruct the evolutionary relationships suffered from questionable relationships and low support values. Analyses of phylogenetic informativeness show the lack of signal deep in the trees (i.e., genes evolve too quickly). As a result, the myriapod tree resembles previously published results but lacks convincing support, and, within the arthropod tree, well established groups were recovered as polyphyletic. The novel genome sequences described herein provide useful genomic information concerning millipede groups that had not been investigated. Taken together with existing sequences, the variety of compositions and evolution of myriapod mitochondrial genomes are shown to be more complex than previously thought. Unfortunately, the use of mitochondrial protein-coding regions in deep arthropod phylogenetics appears problematic, a result consistent with previously published studies. Lack of phylogenetic signal renders the resulting tree topologies as suspect

  4. Arthropod phylogenetics in light of three novel millipede (myriapoda: diplopoda mitochondrial genomes with comments on the appropriateness of mitochondrial genome sequence data for inferring deep level relationships.

    Directory of Open Access Journals (Sweden)

    Michael S Brewer

    Full Text Available BACKGROUND: Arthropods are the most diverse group of eukaryotic organisms, but their phylogenetic relationships are poorly understood. Herein, we describe three mitochondrial genomes representing orders of millipedes for which complete genomes had not been characterized. Newly sequenced genomes are combined with existing data to characterize the protein coding regions of myriapods and to attempt to reconstruct the evolutionary relationships within the Myriapoda and Arthropoda. RESULTS: The newly sequenced genomes are similar to previously characterized millipede sequences in terms of synteny and length. Unique translocations occurred within the newly sequenced taxa, including one half of the Appalachioria falcifera genome, which is inverted with respect to other millipede genomes. Across myriapods, amino acid conservation levels are highly dependent on the gene region. Additionally, individual loci varied in the level of amino acid conservation. Overall, most gene regions showed low levels of conservation at many sites. Attempts to reconstruct the evolutionary relationships suffered from questionable relationships and low support values. Analyses of phylogenetic informativeness show the lack of signal deep in the trees (i.e., genes evolve too quickly. As a result, the myriapod tree resembles previously published results but lacks convincing support, and, within the arthropod tree, well established groups were recovered as polyphyletic. CONCLUSIONS: The novel genome sequences described herein provide useful genomic information concerning millipede groups that had not been investigated. Taken together with existing sequences, the variety of compositions and evolution of myriapod mitochondrial genomes are shown to be more complex than previously thought. Unfortunately, the use of mitochondrial protein-coding regions in deep arthropod phylogenetics appears problematic, a result consistent with previously published studies. Lack of phylogenetic

  5. Phylogenetic relationships and biogeography of the groundwater-dwelling amphipod genus Pseudoniphargus (Crustacea), with emphasis on the Iberian species

    NARCIS (Netherlands)

    Notenboom, Jos

    1988-01-01

    Numerical phylogenetic methods are applied in order to arrive at synapomorphic similarities between species of the stygobiont amphipod genus Pseudoniphargus. Character polarity is assessed by comparison with the relevant outgroups Parapseudoniphargus and Allomelita, within a cluster of presumedly

  6. Human papillomavirus genotypes and phylogenetic analysis of HPV-16 variants in HIV-1 infected subjects in Italy.

    Science.gov (United States)

    Tanzi, Elisabetta; Amendola, Antonella; Bianchi, Silvia; Fasolo, M Michela; Beretta, Rosangela; Pariani, Elena; Zappa, Alessandra; Frati, Elena; Orlando, Giovanna

    2009-05-29

    A cross-sectional study was carried out to improve the state of evidence regarding the spectrum of HPV types and HPV-16 LCR variants circulating among men and women infected with HIV-1 in Italy. This study, conducted in 518 HIV-positive subjects (346 males and 172 females), showed a high prevalence of HPV anal infections (88.7%) in men and of cervical infections (65.1%) in women. A wide spectrum of HPV genotypes has been observed, as both single and multiple infections. Low-risk HPV types 6, 11 and 61 were frequently detected. HPV-16 was the prevalent high-risk type. Fourteen different HPV-16 LCR variants were found. Ten belonged to the European lineage (78.7% were detected in Italian subjects and 21.3% in foreign-born, all homo/bisexual men), two to the Asiatic lineage and two to the African-2 lineage. This study underlines the great genotypic heterogeneity characterizing anal and cervical HPV infections and the marked polymorphism of the predominant HPV-16 in this high-risk population in Italy.

  7. Relationship between xerostomia and salivary flow rates in HIV-infected individuals.

    Science.gov (United States)

    Nittayananta, Wipawee; Chanowanna, Nilnara; Pruphetkaew, Nannapat; Nauntofte, Birgitte

    2013-08-01

    The aim of the present study was to determine the relationship between self-reported xerostomia and salivary flow rates among HIV-infected individuals. A cross-sectional study was performed on 173 individuals (81 HIV-infected individuals, mean age: 32 years, and 92 non-HIV controls, mean age: 30 years). Subjective complaints of dry mouth, based on a self-report of xerostomia questions, and dry mouth, based on a visual analogue scale (VAS), were recorded along with measurements of salivary flow rate of both unstimulated and wax-stimulated whole saliva. The relationship between subjective responses to the xerostomia questions, the VAS of dry mouth, and objective measurements of salivary flow rates were analyzed. Responses to the questions--Do you carry water or a saliva substitute? and Have you had taste disturbance?--were significantly different between HIV-infected and non-HIV individuals (P flow rate. A significant correlation between the VAS of dry mouth and salivary flow rates was observed (P = 0.023). Responses to self-reported xerostomia questions reflects low unstimulated salivary flow rates. Thus, questions concerning dry mouth might be useful tools to identify HIV-infected individuals with hyposalivation, especially at a resting stage. © 2013 Wiley Publishing Asia Pty Ltd.

  8. The dynamic relationship between social support and HIV-related stigma in rural Uganda.

    Science.gov (United States)

    Takada, Sae; Weiser, Sheri D; Kumbakumba, Elias; Muzoora, Conrad; Martin, Jeffrey N; Hunt, Peter W; Haberer, Jessica E; Kawuma, Annet; Bangsberg, David R; Tsai, Alexander C

    2014-08-01

    Cross-sectional studies show that human immunodeficiency virus (HIV) stigma is negatively correlated with social support. The purpose of this study is to examine the bidirectional relationship between social support and HIV stigma. We collected quarterly data from a cohort of 422 people living with HIV in Uganda, followed for a median of 2.1 years. We used multilevel regression to model the contemporaneous and 3-month-lagged associations between social support and both enacted and internalized stigma. Lagged enacted stigma was negatively correlated with emotional and instrumental social support, and lagged instrumental social support was negatively correlated with enacted stigma. Internalized stigma and emotional social support had reciprocal lagged associations. Interventions to reduce enacted stigma may strengthen social support for people living with HIV. Improved social support may in turn have a protective influence against future enacted and internalized stigma.

  9. The Dynamic Relationship Between Social Support and HIV-Related Stigma in Rural Uganda

    Science.gov (United States)

    Weiser, Sheri D.; Kumbakumba, Elias; Muzoora, Conrad; Martin, Jeffrey N.; Hunt, Peter W.; Haberer, Jessica E.; Kawuma, Annet; Bangsberg, David R.; Tsai, Alexander C.

    2014-01-01

    Background Cross-sectional studies show that human immunodeficiency virus (HIV) stigma is negatively correlated with social support. Purpose The purpose of this study is to examine the bidirectional relationship between social support and HIV stigma. Methods We collected quarterly data from a cohort of 422 people living with HIV in Uganda, followed for a median of 2.1 years. We used multilevel regression to model the contemporaneous and 3-month-lagged associations between social support and both enacted and internalized stigma. Results Lagged enacted stigma was negatively correlated with emotional and instrumental social support, and lagged instrumental social support was negatively correlated with enacted stigma. Internalized stigma and emotional social support had reciprocal lagged associations. Conclusions Interventions to reduce enacted stigma may strengthen social support for people living with HIV. Improved social support may in turn have a protective influence against future enacted and internalized stigma. PMID:24500077

  10. Psychological well-being among individuals aging with HIV: the value of social relationships.

    Science.gov (United States)

    Mavandadi, Shahrzad; Zanjani, Faika; Ten Have, Thomas R; Oslin, David W

    2009-05-01

    Utilizing a heterogenous sample of adults diagnosed with HIV infection, the current study sought to explore associations among age, various dimensions of social support, and psychological and functional well-being. Cross-sectional data capturing subjective and instrumental support, social interaction, behavioral health service utilization, and psychological well-being (ie, positive affect and depressive symptomatology), and physical functioning, were collected from 109 men and women living with HIV. To explore age group differences, participants were stratified by age (social interaction. However, older adults reported higher subjective support, which in turn was associated with lower depressive symptomatology, greater positive affect, and nonutilization of behavioral health services. More attention should be paid to the social environment of individuals diagnosed with HIV as the quality of social relationships may be particularly important for successful psychological adaptation to HIV.

  11. Phylogenetic relationships within Echinococcus and Taenia tapeworms (Cestoda: Taeniidae): an inference from nuclear protein-coding genes.

    Science.gov (United States)

    Knapp, Jenny; Nakao, Minoru; Yanagida, Tetsuya; Okamoto, Munehiro; Saarma, Urmas; Lavikainen, Antti; Ito, Akira

    2011-12-01

    The family Taeniidae of tapeworms is composed of two genera, Echinococcus and Taenia, which obligately parasitize mammals including humans. Inferring phylogeny via molecular markers is the only way to trace back their evolutionary histories. However, molecular dating approaches are lacking so far. Here we established new markers from nuclear protein-coding genes for RNA polymerase II second largest subunit (rpb2), phosphoenolpyruvate carboxykinase (pepck) and DNA polymerase delta (pold). Bayesian inference and maximum likelihood analyses of the concatenated gene sequences allowed us to reconstruct phylogenetic trees for taeniid parasites. The tree topologies clearly demonstrated that Taenia is paraphyletic and that the clade of Echinococcus oligarthrus and Echinococcusvogeli is sister to all other members of Echinococcus. Both species are endemic in Central and South America, and their definitive hosts originated from carnivores that immigrated from North America after the formation of the Panamanian land bridge about 3 million years ago (Ma). A time-calibrated phylogeny was estimated by a Bayesian relaxed-clock method based on the assumption that the most recent common ancestor of E. oligarthrus and E. vogeli existed during the late Pliocene (3.0 Ma). The results suggest that a clade of Taenia including human-pathogenic species diversified primarily in the late Miocene (11.2 Ma), whereas Echinococcus started to diversify later, in the end of the Miocene (5.8 Ma). Close genetic relationships among the members of Echinococcus imply that the genus is a young group in which speciation and global radiation occurred rapidly. Copyright © 2011 Elsevier Inc. All rights reserved.

  12. Genetic Diversity and Phylogenetic Relationships of Cytochrome C Oxidase Subunit I in Cimex hemipterus (Hemiptera: Cimicidae) Populations in Malaysia.

    Science.gov (United States)

    Seri Masran, Siti Nor Ain; Ab Majid, Abdul Hafiz

    2017-07-01

    The tropical bed bug is scientifically recognized as a significant public health problem. While there is an increased awareness about their resurgence by medical and life science committees, efficient bed bug management still remains unresolved. The solution may soon arise, as information about bed bugs' infestation dynamics and systematics are becoming more distinguishable. Recent developments in studies about bed bugs are based on molecular intervention by determining their genetic variation and phylogeography. The aim of this study is to assess the phylogenetic relationships and genetic diversity among the populations of tropical bed bugs inhabiting Malaysia. A molecular genotyping study was conducted with 22 tropical bed bug populations composed of three individuals per population. The mitochondrial (COI) gene was used as a marker. The data obtained were analyzed using the T-Coffee, ClustalX, MEGA 6.0, and PAUP software. The results showed one main monophyletic clade that consisted of two groups: Ch01 and Ch02. Ch02 consists of samples from the Bandar Hilir population, differing from the other populations studied by one singleton base. However, as there were no changes in the amino acid, this singleton genetic variation was considered to have no effect on genetic differentiation. Ch01 shows similarity with some sequence of Cimex hemipterus (F.) from Thailand, suggesting an international diversity connection. The disparity index apparently suggests that all isolates are homogeneous populations and are supported by the low value of the mean pairwise distance between isolates. This study will increase the knowledge about phylogeographic diversity of tropical bed bug in Malaysia. © The Authors 2017. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  13. Coalescent-Based Analyses of Genomic Sequence Data Provide a Robust Resolution of Phylogenetic Relationships among Major Groups of Gibbons

    Science.gov (United States)

    Shi, Cheng-Min; Yang, Ziheng

    2018-01-01

    Abstract The phylogenetic relationships among extant gibbon species remain unresolved despite numerous efforts using morphological, behavorial, and genetic data and the sequencing of whole genomes. A major challenge in reconstructing the gibbon phylogeny is the radiative speciation process, which resulted in extremely short internal branches in the species phylogeny and extensive incomplete lineage sorting with extensive gene-tree heterogeneity across the genome. Here, we analyze two genomic-scale data sets, with ∼10,000 putative noncoding and exonic loci, respectively, to estimate the species tree for the major groups of gibbons. We used the Bayesian full-likelihood method bpp under the multispecies coalescent model, which naturally accommodates incomplete lineage sorting and uncertainties in the gene trees. For comparison, we included three heuristic coalescent-based methods (mp-est, SVDQuartets, and astral) as well as concatenation. From both data sets, we infer the phylogeny for the four extant gibbon genera to be (Hylobates, (Nomascus, (Hoolock, Symphalangus))). We used simulation guided by the real data to evaluate the accuracy of the methods used. Astral, while not as efficient as bpp, performed well in estimation of the species tree even in presence of excessive incomplete lineage sorting. Concatenation, mp-est and SVDQuartets were unreliable when the species tree contains very short internal branches. Likelihood ratio test of gene flow suggests a small amount of migration from Hylobates moloch to H. pileatus, while cross-genera migration is absent or rare. Our results highlight the utility of coalescent-based methods in addressing challenging species tree problems characterized by short internal branches and rampant gene tree-species tree discordance. PMID:29087487

  14. Phylogenetic relationship of the Brazilian isolates of the rat lungworm Angiostrongylus cantonensis (Nematoda: Metastrongylidae employing mitochondrial COI gene sequence data

    Directory of Open Access Journals (Sweden)

    Monte Tainá CC

    2012-11-01

    Full Text Available Abstract Background The rat lungworm Angiostrongylus cantonensis can cause eosinophilic meningoencephalitis in humans. This nematode’s main definitive hosts are rodents and its intermediate hosts are snails. This parasite was first described in China and currently is dispersed across several Pacific islands, Asia, Australia, Africa, some Caribbean islands and most recently in the Americas. Here, we report the genetic variability among A. cantonensis isolates from different geographical locations in Brazil using mitochondrial cytochrome c oxidase subunit I (COI gene sequences. Methods The isolates of A. cantonensis were obtained from distinct geographical locations of Brazil. Genomic DNAs were extracted, amplified by polymerase reaction, purified and sequenced. A partial sequence of COI gene was determined to assess their phylogenetic relationship. Results The sequences of A. cantonensis were monophyletic. We identified a distinct clade that included all isolates of A. cantonensis from Brazil and Asia based on eight distinct haplotypes (ac1, ac2, ac3, ac4, ac5, ac6, ac7 and ac8 from a previous study. Interestingly, the Brazilian haplotype ac5 is clustered with isolates from Japan, and the Brazilian haplotype ac8 from Rio de Janeiro, São Paulo, Pará and Pernambuco states formed a distinct clade. There is a divergent Brazilian haplotype, which we named ac9, closely related to Chinese haplotype ac6 and Japanese haplotype ac7. Conclusion The genetic variation observed among Brazilian isolates supports the hypothesis that the appearance of A. cantonensis in Brazil is likely a result of multiple introductions of parasite-carrying rats, transported on ships due to active commerce with Africa and Asia during the European colonization period. The rapid spread of the intermediate host, Achatina fulica, also seems to have contributed to the dispersion of this parasite and the infection of the definitive host in different Brazilian regions.

  15. Phylogenetic relationship of the Brazilian isolates of the rat lungworm Angiostrongylus cantonensis (Nematoda: Metastrongylidae) employing mitochondrial COI gene sequence data

    Science.gov (United States)

    2012-01-01

    Background The rat lungworm Angiostrongylus cantonensis can cause eosinophilic meningoencephalitis in humans. This nematode’s main definitive hosts are rodents and its intermediate hosts are snails. This parasite was first described in China and currently is dispersed across several Pacific islands, Asia, Australia, Africa, some Caribbean islands and most recently in the Americas. Here, we report the genetic variability among A. cantonensis isolates from different geographical locations in Brazil using mitochondrial cytochrome c oxidase subunit I (COI) gene sequences. Methods The isolates of A. cantonensis were obtained from distinct geographical locations of Brazil. Genomic DNAs were extracted, amplified by polymerase reaction, purified and sequenced. A partial sequence of COI gene was determined to assess their phylogenetic relationship. Results The sequences of A. cantonensis were monophyletic. We identified a distinct clade that included all isolates of A. cantonensis from Brazil and Asia based on eight distinct haplotypes (ac1, ac2, ac3, ac4, ac5, ac6, ac7 and ac8) from a previous study. Interestingly, the Brazilian haplotype ac5 is clustered with isolates from Japan, and the Brazilian haplotype ac8 from Rio de Janeiro, São Paulo, Pará and Pernambuco states formed a distinct clade. There is a divergent Brazilian haplotype, which we named ac9, closely related to Chinese haplotype ac6 and Japanese haplotype ac7. Conclusion The genetic variation observed among Brazilian isolates supports the hypothesis that the appearance of A. cantonensis in Brazil is likely a result of multiple introductions of parasite-carrying rats, transported on ships due to active commerce with Africa and Asia during the European colonization period. The rapid spread of the intermediate host, Achatina fulica, also seems to have contributed to the dispersion of this parasite and the infection of the definitive host in different Brazilian regions. PMID:23130987

  16. Phylogenetic relationship of the Brazilian isolates of the rat lungworm Angiostrongylus cantonensis (Nematoda: Metastrongylidae) employing mitochondrial COI gene sequence data.

    Science.gov (United States)

    Monte, Tainá C C; Simões, Raquel O; Oliveira, Ana Paula M; Novaes, Clodoaldo F; Thiengo, Silvana C; Silva, Alexandre J; Estrela, Pedro C; Maldonado, Arnaldo

    2012-11-06

    The rat lungworm Angiostrongylus cantonensis can cause eosinophilic meningoencephalitis in humans. This nematode's main definitive hosts are rodents and its intermediate hosts are snails. This parasite was first described in China and currently is dispersed across several Pacific islands, Asia, Australia, Africa, some Caribbean islands and most recently in the Americas. Here, we report the genetic variability among A. cantonensis isolates from different geographical locations in Brazil using mitochondrial cytochrome c oxidase subunit I (COI) gene sequences. The isolates of A. cantonensis were obtained from distinct geographical locations of Brazil. Genomic DNAs were extracted, amplified by polymerase reaction, purified and sequenced. A partial sequence of COI gene was determined to assess their phylogenetic relationship. The sequences of A. cantonensis were monophyletic. We identified a distinct clade that included all isolates of A. cantonensis from Brazil and Asia based on eight distinct haplotypes (ac1, ac2, ac3, ac4, ac5, ac6, ac7 and ac8) from a previous study. Interestingly, the Brazilian haplotype ac5 is clustered with isolates from Japan, and the Brazilian haplotype ac8 from Rio de Janeiro, São Paulo, Pará and Pernambuco states formed a distinct clade. There is a divergent Brazilian haplotype, which we named ac9, closely related to Chinese haplotype ac6 and Japanese haplotype ac7. The genetic variation observed among Brazilian isolates supports the hypothesis that the appearance of A. cantonensis in Brazil is likely a result of multiple introductions of parasite-carrying rats, transported on ships due to active commerce with Africa and Asia during the European colonization period. The rapid spread of the intermediate host, Achatina fulica, also seems to have contributed to the dispersion of this parasite and the infection of the definitive host in different Brazilian regions.

  17. Reconstruction of phylogenetic relationships in a highly reticulate group with deep coalescence and recent speciation (Hieracium, Asteraceae).

    Science.gov (United States)

    Krak, K; Caklová, P; Chrtek, J; Fehrer, J

    2013-02-01

    Phylogeny reconstruction based on multiple unlinked markers is often hampered by incongruent gene trees, especially in closely related species complexes with high degrees of hybridization and polyploidy. To investigate the particular strengths and limitations of chloroplast DNA (cpDNA), low-copy nuclear and multicopy nuclear markers for elucidating the evolutionary history of such groups, we focus on Hieracium s.str., a predominantly apomictic genus combining the above-mentioned features. Sequences of the trnV-ndhC and trnT-trnL intergenic spacers were combined for phylogenetic analyses of cpDNA. Part of the highly variable gene for squalene synthase (sqs) was applied as a low-copy nuclear marker. Both gene trees were compared with previous results based on the multicopy external transcribed spacer (ETS) of the nuclear ribosomal DNA. The power of the different markers to detect hybridization varied, but they largely agreed on particular hybrid and allopolyploid origins. The same crown groups of species were recognizable in each dataset, but basal relationships were strongly incongruent among cpDNA, sqs and ETS trees. The ETS tree was considered as the best approximation of the species tree. Both cpDNA and sqs trees showed basal polytomies as well as merging or splitting of species groups of non-hybrid taxa. These patterns can be best explained by a rapid diversification of the genus with ancestral polymorphism and incomplete lineage sorting. A hypothetical scenario of Hieracium speciation based on all available (including non-molecular) evidence is depicted. Incorporation of seemingly contradictory information helped to better understand species origins and evolutionary patterns in this notoriously difficult agamic complex.

  18. Maternal phylogenetic relationships and genetic variation among Arabian horse populations using whole mitochondrial DNA D-loop sequencing.

    Science.gov (United States)

    Khanshour, Anas M; Cothran, Ernest Gus

    2013-09-13

    Maternal inheritance is an essential point in Arabian horse population genetics and strains classification. The mitochondrial DNA (mtDNA) sequencing is a highly informative tool to investigate maternal lineages. We sequenced the whole mtDNA D-loop of 251 Arabian horses to study the genetic diversity and phylogenetic relationships of Arabian populations and to examine the traditional strain classification system that depends on maternal family lines using native Arabian horses from the Middle East. The variability in the upstream region of the D-loop revealed additional differences among the haplotypes that had identical sequences in the hypervariable region 1 (HVR1). While the American-Arabians showed relatively low diversity, the Syrian population was the most variable and contained a very rare and old haplogroup. The Middle Eastern horses had major genetic contributions to the Western horses and there was no clear pattern of differentiation among all tested populations. Our results also showed that several individuals from different strains shared a single haplotype, and individuals from a single strain were represented in clearly separated haplogroups. The whole mtDNA D-loop sequence was more powerful for analysis of the maternal genetic diversity in the Arabian horses than using just the HVR1. Native populations from the Middle East, such as Syrians, could be suggested as a hot spot of genetic diversity and may help in understanding the evolution history of the Arabian horse breed. Most importantly, there was no evidence that the Arabian horse breed has clear subdivisions depending on the traditional maternal based strain classification system.

  19. Assessment of phylogenetic relationship of rare plant species collected from Saudi Arabia using internal transcribed spacer sequences of nuclear ribosomal DNA.

    Science.gov (United States)

    Al-Qurainy, F; Khan, S; Nadeem, M; Tarroum, M; Alaklabi, A

    2013-03-11

    The rare and endangered plants of any country are important genetic resources that often require urgent conservation measures. Assessment of phylogenetic relationships and evaluation of genetic diversity is very important prior to implementation of conservation strategies for saving rare and endangered plant species. We used internal transcribed spacer sequences of nuclear ribosomal DNA for the evaluation of sequence identity from the available taxa in the GenBank database by using the Basic Local Alignment Search Tool (BLAST). Two rare plant species viz, Heliotropium strigosum claded with H. pilosum (98% branch support) and Pancratium tortuosum claded with P. tenuifolium (61% branch support) clearly. However, some species, viz Scadoxus multiflorus, Commiphora myrrha and Senecio hadiensis showed close relationships with more than one species. We conclude that nuclear ribosomal internal transcribed spacer sequences are useful markers for phylogenetic study of these rare plant species in Saudi Arabia.

  20. Sexual relationship power and depression among HIV-infected women in Rural Uganda.

    Directory of Open Access Journals (Sweden)

    Abigail M Hatcher

    Full Text Available Depression is associated with increased HIV transmission risk, increased morbidity, and higher risk of HIV-related death among HIV-infected women. Low sexual relationship power also contributes to HIV risk, but there is limited understanding of how it relates to mental health among HIV-infected women.Participants were 270 HIV-infected women from the Uganda AIDS Rural Treatment Outcomes study, a prospective cohort of individuals initiating antiretroviral therapy (ART in Mbarara, Uganda. Our primary predictor was baseline sexual relationship power as measured by the Sexual Relationship Power Scale (SRPS. The primary outcome was depression severity, measured with the Hopkins Symptom Checklist (HSCL, and a secondary outcome was a functional scale for mental health status (MHS. Adjusted models controlled for socio-demographic factors, CD4 count, alcohol and tobacco use, baseline WHO stage 4 disease, social support, and duration of ART.The mean HSCL score was 1.34 and 23.7% of participants had HSCL scores consistent with probable depression (HSCL>1.75. Compared to participants with low SRPS scores, individuals with both moderate (coefficient b = -0.21; 95%CI, -0.36 to -0.07 and high power (b = -0.21; 95%CI, -0.36 to -0.06 reported decreased depressive symptomology. High SRPS scores halved the likelihood of women meeting criteria for probable depression (adjusted odds ratio = 0.44; 95%CI, 0.20 to 0.93. In lagged models, low SRPS predicted subsequent depression severity, but depression did not predict subsequent changes in SPRS. Results were similar for MHS, with lagged models showing SRPS predicts subsequent mental health, but not visa versa. Both Decision-Making Dominance and Relationship Control subscales of SRPS were associated with depression symptom severity.HIV-infected women with high sexual relationship power had lower depression and higher mental health status than women with low power. Interventions to improve equity in decision

  1. Relationships matter: contraceptive choices among HIV-positive women in Tanzania.

    Science.gov (United States)

    Nyanja, Tabitha Alexandria Njeri; Tulinius, Charlotte

    2017-07-01

    Efforts to eliminate mother-to-child transmission of HIV in Tanzania are guided by a four-prong strategy advocated by the World Health Organization (WHO). Prong 2, prevention of unintended pregnancies among women living with HIV, has, however, received the least attention and contraceptive use to prevent unintended pregnancies remains low. This study explored the perceived barriers to the use of modern methods of contraception, and factors influencing contraceptive choice among HIV-positive women in urban Dar-es-Salaam, Tanzania. A qualitative multi-site study was conducted, utilising in-depth interviews and focus group discussions with 37 sexually active HIV-positive women aged between 20 and 44 years, attending three health facilities within Dar-es-Salaam. The theoretical framework was a patient centred model. Four barriers were identified: the influence of the women's spousal relationships; personal beliefs and the relationship of these in understanding her disease; the influence of the social demands on the woman and her relationships; and the importance of a woman's relationship with her healthcare provider/healthcare system. Being the bearers of bad news (HIV-positive status) the pregnant women experienced conflicts, violence, abandonment and rejection. The loss in negotiating power for the women was in relation to their intimate partners, but also in the patient-healthcare provider relationship. The role of the male partner as a barrier to contraceptive use cannot be understated. Therefore, the results suggest that healthcare providers should ensure patient-focused education and provide support that encompasses the importance of their relationships. Additional research is required to elucidate the functional association between contraceptive choices and personal and social relationships.

  2. Modeling the Relationship between Trauma and Psychological Distress among HIV-Positive and HIV-Negative Women.

    Science.gov (United States)

    Brumsey, Ayesha Delany; Joseph, Nataria T; Myers, Hector F; Ullman, Jodie B; Wyatt, Gail E

    2013-01-01

    This study investigated the association between cumulative exposure to multiple traumatic events and psychological distress, as mediated by problematic substance use and impaired psychosocial resources. A sample of HIV-positive and HIV-negative women were assessed for a history of childhood and adult sexual abuse and non-sexual trauma as predictors of psychological distress (i.e., depression, non-specific anxiety, and posttraumatic stress), as mediated by problematic alcohol and drug use and psychosocial resources (i.e., social support, self-esteem and optimism). Structural equation modeling confirmed that cumulative trauma exposure is positively associated with greater psychological distress, and that this association is partially mediated through impaired psychosocial resources. However, although cumulative trauma was associated with greater problematic substance use, substance use did not mediate the relationship between trauma and psychological distress.

  3. Sexual risk behaviors and acceptability of HIV pre-exposure prophylaxis among HIV-negative gay and bisexual men in serodiscordant relationships: a mixed methods study.

    Science.gov (United States)

    Brooks, Ronald A; Landovitz, Raphael J; Kaplan, Rachel L; Lieber, Eli; Lee, Sung-Jae; Barkley, Thomas W

    2012-02-01

    The objective of this mixed methods study was to examine current sexual risk behaviors, acceptability and potential adoption of pre-exposure prophylaxis (PrEP) for HIV prevention, and sexual behavior intentions with PrEP adoption among HIV-negative gay and bisexual men (GBM) in HIV serodiscordant relationships. A multiracial/ethnic sample of 25 HIV-negative GBM in serodiscordant relationships completed a qualitative interview and a brief interviewer-administered survey. A modified grounded theory approach was used to identify key themes relating to acceptability and future adoption of PrEP. Participants reported engaging in sexual risk behaviors that place them at risk for HIV infection. Participants also reported a high level of acceptability for PrEP and willingness to adopt PrEP for HIV prevention. Qualitative themes explaining future PrEP adoption included: (1) the opportunity to engage in sex using a noncondom HIV prevention method, (2) protection from HIV infection, and (3) less anxiety when engaging in sex with an HIV-positive partner. Associated with the future adoption of PrEP, a majority (64%) of participants indicated the likelihood for an increase in sexual risk behaviors and a majority (60%) of participants also indicated the likelihood for a decrease or abandonment of condom use, both of which are in contrast to the findings from the large iPrEx study. These findings suggest that the use of PrEP by HIV-negative GBM in serodiscordant relationships carries with it the potential for risk compensation. The findings suggest that PrEP only be offered as part of a comprehensive HIV prevention strategy that includes ongoing risk reduction counseling in the delivery of PrEP to help moderate risk compensation.

  4. Relationship Power, Sexual Decision Making, and HIV Risk Among Midlife and Older Women.

    Science.gov (United States)

    Altschuler, Joanne; Rhee, Siyon

    2015-01-01

    The number of midlife and older women with HIV/AIDS is high and increasing, especially among women of color. This article addresses these demographic realities by reporting on findings about self-esteem, relationship power, and HIV risk from a pilot study of midlife and older women. A purposive sample (N = 110) of ethnically, economically, and educationally diverse women 40 years and older from the Greater Los Angeles Area was surveyed to determine their levels of self-esteem, general relationship power, sexual decision-making power, safer sex behaviors, and HIV knowledge. Women with higher levels of self-esteem exercised greater power in their relationships with their partner. Women with higher levels of general relationship power and self-esteem tend to exercise greater power in sexual decision making, such as having sex and choosing sexual acts. Income and sexual decision-making power were statistically significant in predicting the use of condoms. Implications and recommendations for future HIV/AIDS research and intervention targeting midlife and older women are presented.

  5. Social and Behavioural Correlates of HIV Testing Among Australian Gay and Bisexual Men in Regular Relationships

    NARCIS (Netherlands)

    Lee, Evelyn; Murphy, Dean; Mao, Limin; de Wit, John; Prestage, Garrett; Zablotska, Iryna; Holt, Martin

    In this study we sought to identify the social and behavioural characteristics of Australian gay and bisexual men who had and had not tested for HIV during their current relationship. The results were based on 2012 and 2013 data collected from ongoing cross-sectional and community-based surveys held

  6. The Relationship of Social Support and Neighborhood Perceptions among Individuals with HIV.

    Science.gov (United States)

    Shacham, Enbal; López, Julia D; Önen, Nur F; Overton, Edgar T

    Social support has been noted to improve health outcomes for individuals with HIV. Understanding how neighborhoods contribute to feelings of social support is beneficial to create environments where populations with HIV can be supported. This study assessed the relationship between neighborhood perceptions and social support with HIV management. A total of 201 individuals were recruited; individuals with HIV, 18 years or older, who were eligible to participate in the 2-hour interview. Psychiatric diagnostic interviews were conducted alongside assessments of social support and neighborhood perceptions; biomedical markers were abstracted from medical records. Correlations and linear regression analyses were performed to assess relationships between social support and neighborhood perceptions with HIV management biomarkers. The majority of the sample was male (68.8%) and African American (72.3%), with a mean age of 43.1 years. Overall, 78% were receiving combination antiretroviral therapy (cART) prescriptions, with 69% being virally suppressed. Fear of neighborhood activities was independently associated with receiving current cART. Reports of social support and neighborhood perceptions were highly correlated. Findings suggest that supportive home environments likely would improve perceptions of social support.

  7. Relationship between HIV stage and psychomotor speed neurocognitive score at a Kenyan sub-county hospital

    Directory of Open Access Journals (Sweden)

    Rachael N. Kinuthia

    2016-08-01

    Full Text Available Background: Human immunodeficiency virus (HIV and acquired immunodeficiency syndrome (AIDS is associated with cognitive impairment which affects psychomotor speed. Psychomotor slowing is a predictor of dementia and death in people living with HIV and AIDS. The purpose of this study was to assess the relationship between HIV disease stage and psychomotor speed neurocognitive score which will add to the body of knowledge required to manage patients with HIV and AIDS. Objective: To determine the relationship between psychomotor speed neurocognitive score and the HIV disease stage in adults at initiation of care. Setting: This study was conducted at Kangundo Sub-county hospital comprehensive care centre. Methods: This was a cross-sectional study. All HIV seropositive patients aged 18 to 50 years recently initiated into care were studied. A pretested questionnaire was used to collect data. The World Health Organization (WHO stage was used during data collection to classify study participants into asymptomatic and symptomatic groups. The grooved pegboard test was used to obtain psychomotor speed neurocognitive scores. Descriptive statistics were used to summarise data. Mann–Whitney U test, Spearman’s rho and multiple linear regression were employed in the analysis; p-value of 0.05 was considered significant. Results: The WHO stage did not have a significant effect on the psychomotor speed neurocognitive score (p ≥ 0.05. The CD4 count had a significant effect on psychomotor speed neurocognitive score (p = 0.001. Conclusions: There was a significant correlation between CD4 counts and psychomotor speed neurocognitive score. Efforts should be made to ensure that the CD4 counts of people living with HIV and AIDS do not continue to fall after initiation into care in order to preserve psychomotor function.

  8. Personal Risk Perception, HIV Knowledge and Risk Avoidance Behavior, and Their Relationships to Actual HIV Serostatus in an Urban African Obstetric Population

    Science.gov (United States)

    Stringer, Elizabeth M.; Sinkala, Moses; Kumwenda, Rosemary; Chapman, Victoria; Mwale, Alexandrina; Vermund, Sten H.; Goldenberg, Robert L.; Stringer, Jeffrey S.A.

    2009-01-01

    One quarter of pregnant women in Zambia are infected with HIV. Understanding how knowledge of HIV relates to personal risk perception and avoidance of risky behaviors is critical to devising effective HIV prevention strategies. In conjunction with a large clinical trial in Lusaka, Zambia, we surveyed postpartum women who had been tested for HIV but did not know their status before undergoing the questionnaire. Of 858 women for whom complete data were available, 248 (29%) were HIV infected. Women 22 years of age or older (adjusted odds ratio [AOR], 1.7; 95% confidence interval [CI], 1.1–2.5), women reporting ≥2 sexual partners in their lifetime (AOR, 1.8; 95% CI, 1.3–2.5), and women reporting a history of a sexually transmitted infection (AOR, 2.7; 95% CI, 1.7–4.3) were more likely to be HIV infected. Having had ≥2 lifetime sexual partners was a marker for perception of high personnel risk for HIV infection (AOR, 1.5; 95% CI, 1.1–2.1). However, there was no relationship between perceived risk of HIV infection and actual HIV status. In fact, 127 (52%) of 245 women who stated that they were at no or low risk for HIV infection were HIV infected. Living in an area of high HIV seroprevalence like Zambia seems to be the greatest risk factor for infection in unselected pregnant women. Before significant inroads can be made in decreasing the incidence of HIV infection among pregnant women, population-based strategies that involve men must be implemented. PMID:14707794

  9. Differential relationships between social adversity and depressive symptoms by HIV-status and racial/ethnic identity

    Science.gov (United States)

    Williamson, Timothy J.; Mahmood, Zanjbeel; Kuhn, Taylor P.; Thames, April D.

    2016-01-01

    Objective Historically marginalized groups are likely to be exposed to social adversity, which predicts important mental health outcomes (e.g., depression). Despite the well-established relationship between adversity and poor health, few studies have examined how adversity differentially predicts mental health among people living with multiple, co-occurring marginalized identities or statuses. The current study fills this gap by examining whether relationships between social adversity and depressive symptoms differed between those living with or without a stigmatized disease (i.e., HIV) and/or marginalized racial/ethnic identity (i.e., African American). Method A community sample of men and women (n = 149) completed questionnaires assessing demographics and depressive symptoms. Additionally, a composite index of social adversity was derived from measures of perceived discrimination, socioeconomic status, financial restriction to receiving medical care, and perceived neighborhood characteristics. Multiple regression was used to test whether relationships between adversity and depressive symptoms differed as a function of HIV-status and racial/ethnic identity. Results A significant three-way interaction between social adversity, HIV-status, and racial/ethnic identity indicated that there was a direct relationship between adversity and depressive symptoms for HIV-positive (HIV+) African Americans but not for HIV-negative (HIV-) African Americans, HIV+ Caucasians, or HIV- Caucasians. Further, HIV+ African Americans evidenced a significantly greater relationship between adversity and depressive symptoms, as compared to HIV- African Americans but not as compared to other groups. Conclusions The findings suggest that HIV+ African Americans may be at risk for higher depressive symptoms amidst adversity, highlighting the importance of evaluating intersectional identities/statuses in the context of mental health. PMID:27929330

  10. Phylogenetic relationships of the glycoprotein gene of bovine ephemeral fever virus isolated from mainland China, Taiwan, Japan, Turkey, Israel and Australia

    Directory of Open Access Journals (Sweden)

    Zheng Fuying

    2012-11-01

    Full Text Available Abstract Background The glycoprotein (G gene sequences of bovine ephemeral fever virus (BEFV strains derived from mainland China have not been compared with those of the isolates from other countries or areas. Therefore, the G genes of four BEFV isolates obtained from mainland China were amplified and sequenced. A phylogenetic tree was constructed in order to compare and analyze the genetic relationships of the BEFV isolates derived from mainland China and different countries and areas. Results The complete BEFV G gene was successfully amplified and sequenced from four isolates that originated from mainland China. A total of fifty-one BEFV strains were analyzed based on the G gene sequence and were found to be highly conserved. A phylogenetic tree showed that the isolates were grouped into three distinct lineages depending on their source of origin. The antigenic sites of G1, G2 and G3 are conserved among the isolates, except for several substitutions in a few strains. Conclusions The phylogenetic relationships of the BEFV isolates that originated from mainland China, Taiwan, Japan, Turkey, Israel and Australia were closely related to their source of origin, while the antigenic sites G1, G2 and G3 are conserved among the BEFV isolates used in this work.

  11. Phylogenetic relationships of the freshwater alga Boldia erythrosiphon (Compsopogonales, Rhodophyta) based on 18S rRNA gene sequences

    NARCIS (Netherlands)

    Holton, R.W; Boele-Bos, S.A.; Stam, W.T.

    The nuclear small-subunit ribosomal DNA sequence from the freshwater red alga Boldia erythrosiphon Herndon emend Howard et Parker was determined. Phylogenetic analysis confirms the positioning of this species within the bangiophycidean order of the Compsopogonales. The results strongly suggest that

  12. The impact of parenting on gay male couples' relationships, sexuality, and HIV risk

    Science.gov (United States)

    Huebner, David M.; Mandic, Carmen Gómez; Mackaronis, Julia E.; Beougher, Sean C.; Hoff, Colleen C.

    2014-01-01

    Parenthood changes couples' relationships across multiple domains, generally decreasing relationship quality, sexual satisfaction, and sexual frequency. Emerging research suggests that gay couples who are parenting might experience similar challenges. However, such changes might have even more profound implications for gay couples' health, and in particular their HIV risk, given the somewhat different ways in which they negotiate and tolerate sexual behaviors with outside partners. We aimed to examine these issues in a qualitative analysis of interviews from 48 gay male couples who were actively parenting children. Findings suggest that parenthood increases men's commitment to their primary relationship while simultaneously decreasing time and energy for relationship maintenance, and generally decreasing sexual satisfaction. These challenges alone did not generally result in greater infidelity or HIV risk, as most men reported successfully coping with such changes through a combination of acceptance and revaluing what is important in their relationships. Additionally, couples reported negotiating agreements regarding sex with outside partners that closely resemble those documented in studies of gay couples who are not parents. Men reported that parenthood typically decreased their opportunities to engage in sex with outside partners, but also posed barriers to talking about these behaviors with their partners and healthcare providers. HIV-related sexual risk behavior was relatively rare, but nevertheless present in some men. Providers should assess sexual function as a regular part of their work with gay couples who parent, and facilitate opportunities for men to discuss their sexual agreements both with their primary partners and with relevant healthcare providers. PMID:25674355

  13. Biogeographic links between southern Atlantic Forest and western South America: Rediscovery, re-description, and phylogenetic relationships of two rare montane anole lizards from Brazil.

    Science.gov (United States)

    Prates, Ivan; Melo-Sampaio, Paulo Roberto; Drummond, Leandro de Oliveira; Teixeira, Mauro; Rodrigues, Miguel Trefaut; Carnaval, Ana Carolina

    2017-08-01

    Data on species ranges and phylogenetic relationships are key in historical biogeographical inference. In South America, our understanding of the evolutionary processes that underlie biodiversity patterns varies greatly across regions. Little is known, for instance, about the drivers of high endemism in the southern montane region of the Atlantic Rainforest. In this region, former biogeographic connections with other South American ecosystems have been invoked to explain the phylogenetic affinities of a number of endemic taxa. This may also be the case of the montane anole lizards Anolis nasofrontalis and A. pseudotigrinus, known from few specimens collected more than 40years ago. We combine new genetic data with published sequences of species in the Dactyloa clade of Anolis to investigate the phylogenetic relationships of A. nasofrontalis and A. pseudotigrinus, as well as estimate divergence times from their closest relatives. Based on newly sampled and previously overlooked specimens, we provide a taxonomic re-description of those two taxa. Our phylogenetic analysis recovered six main clades within Dactyloa, five of which were previously referred to as species series (aequatorialis, heterodermus, latifrons, punctatus, roquet). A sixth clade clustered A. nasofrontalis and A. pseudotigrinus with A. dissimilis from western Amazonia, A. calimae from the Andes, A. neblininus from the Guiana Shield, and two undescribed Andean taxa. We therefore define a sixth species series within Dactyloa: the neblininus series. Close phylogenetic relationships between highly disjunct, narrowly-distributed anoles suggest that patches of suitable habitat connected the southern Atlantic Forest to western South America during the Miocene, in agreement with the age of former connections between the central Andes and the Brazilian Shield as a result of Andean orogeny. The data also support the view of recurrent evolution (or loss) of a twig anole-like phenotype in mainland anoles, in

  14. Manifestations of tuberculosis in HIV/AIDS patients and its relationship with CD4 count

    Directory of Open Access Journals (Sweden)

    Ajay Jaryal

    2011-01-01

    Full Text Available Background: HIV/AIDS pandemic is responsible for the resurgence of TB worldwide, resulting in increased morbidity and mortality. HIV and Mycobacterium tuberculosis have a synergistic interaction; each propagates progression of the other. Coinfection with HIV infection leads to difficulties in both the diagnosis and treatment of tuberculosis, increase risk of death, treatment failure and relapse. Objective: The aim of the present study is to study the clinical, radiological profile of pulmonary and extrapulmonary tuberculosis (EPTB in HIV-seropositive patients and their relationship to CD4 counts. Materials and Methods: It was a prospective study conducted over a period of 1 year in the department of medicine, Indira Gandhi Medical College, Shimla. We examined 87 HIV-infected patients with associated tuberculosis recruited from the department of medicine and antiretroviral center and were subjected to thorough clinical examination, X-ray chest, tuberculin testing and sputum examination for AFB and necessary relevant investigations for EPTB. Results: Most common affected age group was 31-40 years. EPTB is the commonest form of TB in our study detected in 65 patients. Commonest EPTB was CNS tuberculosis. Disseminated tuberculosis was only found in patient with CD4 count less than 200/cmm. Majority of lymph node TB was diagnosed by fine needle aspiration cytology (FNAC examination. All patients with AFB-positive lymph node had CD4 count below 200/cum. Conclusions: The results of this study provide information regarding the various forms of TB and their presentation in HIV-infected persons. Early diagnosis of tuberculosis and prompt institution of antitubercular treatment (ATT reduces mortality and morbidity significantly. In resource-poor areas, the diagnosis can be established with cytological/biochemical analysis of fluid, histopathological examination and ZN staining of tissue coupled with radiological features and response to ATT. Therefore

  15. Sharing the trousers: gender roles and relationships in an HIV-prevention trial in Zimbabwe.

    Science.gov (United States)

    Montgomery, Elizabeth T; Chidanyika, Agnes; Chipato, Tsungai; van der Straten, Ariane

    2012-01-01

    Male and female gender roles and inequalities are important in contributing to the disproportionate burden of HIV experienced by women in sub-Saharan Africa. Within the context of an HIV prevention trial, we aimed to describe and understand male partner influence on women's use of HIV-prevention methods. Our presumption was not that regressive gender norms prevailed - rather, that a wide range of gendered attitudes and dynamics would be expressed among couples. Data from 16 focus groups with Zimbabwean female trial participants and their male partners and 4 in-depth couples interviews were collected, and form the basis of the analysis. Findings offer descriptions of how couples have adapted techniques for negotiating modern household economies and sexual decision-making in a manner that both preserves traditional gender roles, while accommodating women's entrance into new domains such as the workforce or an HIV-prevention trial. Women's agency to introduce novel female-initiated-method use into her intimate relationships is described. Men and women's accounts of method introduction and use suggest different perceptions about the locus of sexual decision making. The study provides unique insight into a gendered context that is dynamic yet sensitive to change, which in turn can provide useful information to more appropriately guide HIV-prevention activities in this setting.

  16. The relationship between skin manifestations and CD4 counts among hiv positive patients

    International Nuclear Information System (INIS)

    Rad, F.; Ghaderi, E.; Moradi, G.; Mafakheri, L.

    2008-01-01

    Skin manifestations are common clinical features among HIV positive patients. The aim of this study was to document skin manifestations and their relationships with CD4 cell counts among HIV positive patients in Sanandaj. This was a descriptive study. The patients were examined for skin disorders by a dermatologist and CD4 counts were obtained from the patient's medical records. Independent samples T test were used for data analysis. In this study 66 (94.3%) patients had at least one skin problem. Fungal infections were the most common cause. The eight most common types of mucocutaneous problems were gingivitis, pallor, itching, photosensitivity, seborrheic dermatitis, candidiasis, folliculitis and tinea versicolor. The most common manifestation was gingivitis. Mean CD4 cell counts were lower in individuals with viral and bacterial skin diseases (P <0.05). The results of this study indicated that skin problems were common among HIV positive patients. Patients with advanced stages of skin disorders had relatively lower CD4 counts. Therefore examination of skin is recommended for all HIV positive patients for early detection of skin disorders, as early diagnosis and management of dermatologic problems will improve the quality of life in HIV positive patients. (author)

  17. Avoidant Coping Mediates the Relationship Between Self-Efficacy for HIV Disclosure and Depression Symptoms Among Men Who Have Sex with Men Newly Diagnosed with HIV.

    Science.gov (United States)

    Cherenack, Emily M; Sikkema, Kathleen J; Watt, Melissa H; Hansen, Nathan B; Wilson, Patrick A

    2018-01-25

    HIV diagnosis presents a critical opportunity to reduce secondary transmission, improve engagement in care, and enhance overall well-being. To develop relevant interventions, research is needed on the psychosocial experiences of newly diagnosed individuals. This study examined avoidant coping, self-efficacy for HIV disclosure decisions, and depression among 92 newly diagnosed men who have sex with men who reported recent sexual risk behavior. It was hypothesized that avoidant coping would mediate the relationship between self-efficacy and depression. Cross-sectional surveys were collected from participants 3 months after HIV diagnosis. To test for mediation, multiple linear regressions were conducted while controlling for HIV disclosure to sexual partners. Self-efficacy for HIV disclosure decisions showed a negative linear relationship to depression symptoms, and 99% of this relationship was mediated by avoidant coping. The index of mediation of self-efficacy on depression indicated a small-to-medium effect. Higher self-efficacy was related to less avoidant coping, and less avoidant coping was related to decreased depression symptoms, all else held constant. These findings highlight the role of avoidant coping in explaining the relationship between self-efficacy for HIV disclosure decisions and depression.

  18. Exploring Gender Differences in the Relationship between HIV/STD Testing and Condom Use among Undergraduate College Students

    Science.gov (United States)

    Bontempi, Jean Breny; Mugno, Raymond; Bulmer, Sandra M.; Danvers, Karina; Vancour, Michele L.

    2009-01-01

    Background: Rates of HIV/AIDS, and other sexually transmitted diseases (STDs), are increasing among university students. Purpose: The purpose of this study was to examine gender differences in the relationship between condom use and (1) HIV/STD testing behaviors, (2) STD treatment behaviors and, (3) alcohol use behaviors. Methods: A survey was…

  19. Relationships between neighbourhood characteristics and current STI status among HIV-infected and HIV-uninfected women living in the Southern USA: a cross-sectional multilevel analysis.

    Science.gov (United States)

    Haley, Danielle F; Kramer, Michael R; Adimora, Adaora A; Haardörfer, Regine; Wingood, Gina M; Ludema, Christina; Rubtsova, Anna; Hickson, DeMarc A; Ross, Zev; Golub, Elizabeth; Bolivar, Hector; Cooper, Hannah Lf

    2017-12-01

    Neighbourhood characteristics (eg, high poverty rates) are associated with STIs among HIV-uninfected women in the USA. However, no multilevel analyses investigating the associations between neighbourhood exposures and STIs have explored these relationships among women living with HIV infection. The objectives of this study were to: (1) examine relationships between neighbourhood characteristics and current STI status and (2) investigate whether the magnitudes and directions of these relationships varied by HIV status in a predominantly HIV-infected cohort of women living in the Southern USA. This cross-sectional multilevel analysis tests relationships between census tract characteristics and current STI status using data from 737 women enrolled at the Women's Interagency HIV Study's southern sites (530 HIV-infected and 207 HIV-uninfected women). Administrative data (eg, US Census) described the census tract-level social disorder (eg, violent crime rate) and social disadvantage (eg, alcohol outlet density) where women lived. Participant-level data were gathered via survey. Testing positive for a current STI was defined as a laboratory-confirmed diagnosis of chlamydia, gonorrhoea, trichomoniasis or syphilis. Hierarchical generalised linear models were used to determine relationships between tract-level characteristics and current STI status, and to test whether these relationships varied by HIV status. Eleven per cent of participants tested positive for at least one current STI. Greater tract-level social disorder (OR=1.34, 95% CI 0.99 to 1.87) and social disadvantage (OR=1.34, 95% CI 0.96 to 1.86) were associated with having a current STI. There was no evidence of additive or multiplicative interaction between tract-level characteristics and HIV status. Findings suggest that neighbourhood characteristics may be associated with current STIs among women living in the South, and that relationships do not vary by HIV status. Future research should establish the

  20. Re-Evaluation of Phylogenetic Relationships among Species of the Mangrove Genus Avicennia from Indo-West Pacific Based on Multilocus Analyses.

    Science.gov (United States)

    Li, Xinnian; Duke, Norman C; Yang, Yuchen; Huang, Lishi; Zhu, Yuxiang; Zhang, Zhang; Zhou, Renchao; Zhong, Cairong; Huang, Yelin; Shi, Suhua

    2016-01-01

    Avicennia L. (Avicenniaceae), one of the most diverse mangrove genera, is distributed widely in tropical and subtropical intertidal zones worldwide. Five species of Avicennia in the Indo-West Pacific region have been previously described. However, their phylogenetic relationships were determined based on morphological and allozyme data. To enhance our understanding of evolutionary patterns in the clade, we carried out a molecular phylogenetic study using wide sampling and multiple loci. Our results support two monophyletic clades across all species worldwide in Avicennia: an Atlantic-East Pacific (AEP) lineage and an Indo-West Pacific (IWP) lineage. This split is in line with biogeographic distribution of the clade. Focusing on the IWP branch, we reconstructed a detailed phylogenetic tree based on sequences from 25 nuclear genes. The results identified three distinct subclades, (1) A. rumphiana and A. alba, (2) A. officinalis and A. integra, and (3) the A. marina complex, with high bootstrap support. The results strongly corresponded to two morphological traits in floral structure: stigma position in relation to the anthers and style length. Using Bayesian dating methods we estimated diversification of the IWP lineage was dated to late Miocene (c. 6.0 million years ago) and may have been driven largely by the fluctuating sea levels since that time.

  1. Re-Evaluation of Phylogenetic Relationships among Species of the Mangrove Genus Avicennia from Indo-West Pacific Based on Multilocus Analyses.

    Directory of Open Access Journals (Sweden)

    Xinnian Li

    Full Text Available Avicennia L. (Avicenniaceae, one of the most diverse mangrove genera, is distributed widely in tropical and subtropical intertidal zones worldwide. Five species of Avicennia in the Indo-West Pacific region have been previously described. However, their phylogenetic relationships were determined based on morphological and allozyme data. To enhance our understanding of evolutionary patterns in the clade, we carried out a molecular phylogenetic study using wide sampling and multiple loci. Our results support two monophyletic clades across all species worldwide in Avicennia: an Atlantic-East Pacific (AEP lineage and an Indo-West Pacific (IWP lineage. This split is in line with biogeographic distribution of the clade. Focusing on the IWP branch, we reconstructed a detailed phylogenetic tree based on sequences from 25 nuclear genes. The results identified three distinct subclades, (1 A. rumphiana and A. alba, (2 A. officinalis and A. integra, and (3 the A. marina complex, with high bootstrap support. The results strongly corresponded to two morphological traits in floral structure: stigma position in relation to the anthers and style length. Using Bayesian dating methods we estimated diversification of the IWP lineage was dated to late Miocene (c. 6.0 million years ago and may have been driven largely by the fluctuating sea levels since that time.

  2. Revealing pancrustacean relationships: Phylogenetic analysis of ribosomal protein genes places Collembola (springtails in a monophyletic Hexapoda and reinforces the discrepancy between mitochondrial and nuclear DNA markers

    Directory of Open Access Journals (Sweden)

    Mariën J

    2008-03-01

    Full Text Available Abstract Background In recent years, several new hypotheses on phylogenetic relations among arthropods have been proposed on the basis of DNA sequences. One of the challenged hypotheses is the monophyly of hexapods. This discussion originated from analyses based on mitochondrial DNA datasets that, due to an unusual positioning of Collembola, suggested that the hexapod body plan evolved at least twice. Here, we re-evaluate the position of Collembola using ribosomal protein gene sequences. Results In total 48 ribosomal proteins were obtained for the collembolan Folsomia candida. These 48 sequences were aligned with sequence data on 35 other ecdysozoans. Each ribosomal protein gene was available for 25% to 86% of the taxa. However, the total sequence information was unequally distributed over the taxa and ranged between 4% and 100%. A concatenated dataset was constructed (5034 inferred amino acids in length, of which ~66% of the positions were filled. Phylogenetic tree reconstructions, using Maximum Likelihood, Maximum Parsimony, and Bayesian methods, resulted in a topology that supports monophyly of Hexapoda. Conclusion Although ribosomal proteins in general may not evolve independently, they once more appear highly valuable for phylogenetic reconstruction. Our analyses clearly suggest that Hexapoda is monophyletic. This underpins the inconsistency between nuclear and mitochondrial datasets when analyzing pancrustacean relationships. Caution is needed when applying mitochondrial markers in deep phylogeny.

  3. Revealing pancrustacean relationships: phylogenetic analysis of ribosomal protein genes places Collembola (springtails) in a monophyletic Hexapoda and reinforces the discrepancy between mitochondrial and nuclear DNA markers.

    Science.gov (United States)

    Timmermans, M J T N; Roelofs, D; Mariën, J; van Straalen, N M

    2008-03-12

    In recent years, several new hypotheses on phylogenetic relations among arthropods have been proposed on the basis of DNA sequences. One of the challenged hypotheses is the monophyly of hexapods. This discussion originated from analyses based on mitochondrial DNA datasets that, due to an unusual positioning of Collembola, suggested that the hexapod body plan evolved at least twice. Here, we re-evaluate the position of Collembola using ribosomal protein gene sequences. In total 48 ribosomal proteins were obtained for the collembolan Folsomia candida. These 48 sequences were aligned with sequence data on 35 other ecdysozoans. Each ribosomal protein gene was available for 25% to 86% of the taxa. However, the total sequence information was unequally distributed over the taxa and ranged between 4% and 100%. A concatenated dataset was constructed (5034 inferred amino acids in length), of which ~66% of the positions were filled. Phylogenetic tree reconstructions, using Maximum Likelihood, Maximum Parsimony, and Bayesian methods, resulted in a topology that supports monophyly of Hexapoda. Although ribosomal proteins in general may not evolve independently, they once more appear highly valuable for phylogenetic reconstruction. Our analyses clearly suggest that Hexapoda is monophyletic. This underpins the inconsistency between nuclear and mitochondrial datasets when analyzing pancrustacean relationships. Caution is needed when applying mitochondrial markers in deep phylogeny.

  4. "HIV is irrelevant to our company": everyday practices and the logic of relationships in HIV/AIDS management by Japanese multinational corporations in northern Thailand.

    Science.gov (United States)

    Michinobu, Ryoko

    2009-03-01

    Multinational corporations (MNCs) are important participants in workplace initiatives on HIV/AIDS as they collaborate with international organizations to globally promote various policies and guidelines. To date, MNCs have enacted the majority of such initiatives in North America, Europe and South Africa, but we have little information on how MNCs elsewhere, especially in Japan, have responded to the issue of HIV/AIDS in the workplace. This study examines the actual on the ground situation of HIV/AIDS management in Japanese MNCs, specifically investigating everyday corporate practices in the context of internal interactions and relationships and the resulting practices and outlook concerning HIV/AIDS. It is based on a secondary analysis of ethnographic case studies conducted in 10 Japanese-affiliated companies in northern Thailand. Japanese managers, Thai managers and ordinary Thai workers all considered HIV/AIDS to be "irrelevant" to their company and/or themselves. HIV/AIDS measures in the companies were limited to provision of information. This perception and management of HIV/AIDS developed from their everyday interactions governed by the logic of relationships in the companies. In these interactions, they categorized others based on their ascriptive status, primarily based on class, ethnicity and nationality. They sought scapegoat groups that were lower than them in the class- and ethnicity/nationality-based hierarchical system, and cast the risk of HIV infection upon the scapegoat groups, thus reducing their own sense of risk. The paper shows that the relational logic, not ideals or principles, influences their views of and actions concerning HIV/AIDS management in the companies. This is why Japanese companies are unable to deal with HIV/AIDS in terms of international policies and guidelines that are based on the logic of human rights and the logic of business principles. The results suggest a need for international policymakers to pay more attention to

  5. Homophobia and communal coping for HIV risk management among gay men in relationships.

    Science.gov (United States)

    Stachowski, Courtney; Stephenson, Rob

    2015-02-01

    Men who have sex with men (MSM) remain disproportionately affected by the HIV epidemic in the US and estimates suggest that one to two-thirds of new infections occur among main partners. Previous research has focused on individual MSM and their risk for HIV, yet couples' ability to manage risk has been largely understudied. In particular, the role that homophobia plays in shaping the ability of gay male couples to cope with HIV risk is currently understudied. A sample of 447 gay/bisexual men with main partners was taken from a 2011 survey of gay and bisexual men in Atlanta. Linear regression models were fitted for three couples' coping outcome scales (outcome efficacy, couple efficacy, communal coping) and included indicators of homophobia (internalized homophobia and homophobic discrimination). Findings indicate that reporting of increased levels of internalized homophobia were consistently associated with decreased outcome measures of couples' coping ability regarding risk management. The results highlight the role that homophobia plays in gay male couples' relationships and HIV risk, extending the existing literature in the field of same-sex relationships as influenced by homophobia.

  6. Does Maternal HIV Disclosure Self-Efficacy Enhance Parent-Child Relationships and Child Adjustment?

    Science.gov (United States)

    Armistead, Lisa; Goodrum, Nada; Schulte, Marya; Marelich, William; LeCroix, Rebecca; Murphy, Debra A

    2018-02-09

    Nondisclosure of maternal HIV status to young children can negatively impact child functioning; however, many mothers do not disclose due to lack of self-efficacy for the disclosure process. This study examines demographic variations in disclosure self-efficacy, regardless of intention to disclose, and assesses the relationship between self-efficacy and child adjustment via the parent-child relationship among a sample of HIV+ mothers and their healthy children (N = 181 pairs). Mothers completed demographic and self-efficacy measures; children completed measures assessing the parent-child relationship and child adjustment (i.e., worry, self-concept, depression). Across demographics, few mothers reported confidence in disclosure. Results from covariance structural modeling showed mothers endorsing higher self-efficacy had children who reported better relationship quality, and, in turn, reported fewer adjustment difficulties; higher levels of disclosure self-efficacy also directly predicted fewer adjustment problems. Findings offer support for interventions aimed at providing mothers with skills to enhance confidence for disclosing their HIV status.

  7. How HIV diagnosis and disclosure affect sexual behavior and relationships in Ugandan fishing communities.

    Science.gov (United States)

    McArthur, Moriah; Birdthistle, Isolde; Seeley, Janet; Mpendo, Juliet; Asiki, Gershim

    2013-08-01

    In this article we examine how members of fishing communities on the shores of Lake Victoria in Uganda respond to HIV diagnosis in terms of disclosure to sexual partners. We then explore the subsequent changes in sexual behavior and relationships. To access this information, we collected life history data from 78 HIV-positive individuals in five fishing communities. We found that the strength of the sexual relationships shaped how and why individuals disclosed to partners, and that these relationships tended to be stronger when partners shared familial responsibility. Those who perceived their current sexual partnership to be weak sought to conceal their status by maintaining prediagnosis patterns of sexual behavior. The majority of the study's participants rarely changed their sexual behavior following HIV diagnosis, regardless of their relationship's strength. These findings elucidate barriers to disclosure and behavior change, and suggest that a life-course approach might enhance individual-level counseling so that counselors can provide tailored support to individuals regarding disclosure decisions and outcomes.

  8. Perceptions and Definitions of Power Within the Context of HIV-Negative Male Couples’ Relationships

    Science.gov (United States)

    Mitchell, Jason W.; Sophus, Amber I.

    2016-01-01

    Examining dynamics within relationships is critical for development of effective HIV prevention interventions for male couples. The dynamic of power has received little attention in research with male couples, though power has been reported to affect HIV risk among heterosexual couples. To help address this knowledge gap, the present cross-sectional analysis used mixed methods with dyadic data from 142 HIV-negative male couples to (1) assess partnered men’s perception of who has the most power in their relationship and why, (2) examine whether partners concur about who has the most power and their reasoning for this selection, and (3) assess whether male couples’ concurrence about who has the most power is associated with their engagement of condomless anal sex within and/or outside the relationship, type of relationship, and aspects of their sexual agreement. Individual- and couple-level responses about who has the most power were quantitatively assessed, whereas for why, their responses were coded qualitatively. Fifty-six percent of couples concurred about who has the most power in their relationship and of these, many said it was equal. Regarding why, themes of responses ranged from “compromise” and “shared responsibility” for those who concurred about who has the most power versus “dominant/compliant personality” and “money” among the couples who disagreed about who has the most power in their relationship. Concordance about who has the most power was only associated with condomless anal sex within the relationship. Further research is warranted to examine how power may affect other dynamics of male couples’ relationships and risk-related behaviors. PMID:26186952

  9. Perceptions and Definitions of Power Within the Context of HIV-Negative Male Couples' Relationships.

    Science.gov (United States)

    Mitchell, Jason W; Sophus, Amber I

    2017-07-01

    Examining dynamics within relationships is critical for development of effective HIV prevention interventions for male couples. The dynamic of power has received little attention in research with male couples, though power has been reported to affect HIV risk among heterosexual couples. To help address this knowledge gap, the present cross-sectional analysis used mixed methods with dyadic data from 142 HIV-negative male couples to (1) assess partnered men's perception of who has the most power in their relationship and why, (2) examine whether partners concur about who has the most power and their reasoning for this selection, and (3) assess whether male couples' concurrence about who has the most power is associated with their engagement of condomless anal sex within and/or outside the relationship, type of relationship, and aspects of their sexual agreement. Individual- and couple-level responses about who has the most power were quantitatively assessed, whereas for why, their responses were coded qualitatively. Fifty-six percent of couples concurred about who has the most power in their relationship and of these, many said it was equal. Regarding why, themes of responses ranged from "compromise" and "shared responsibility" for those who concurred about who has the most power versus "dominant/compliant personality" and "money" among the couples who disagreed about who has the most power in their relationship. Concordance about who has the most power was only associated with condomless anal sex within the relationship. Further research is warranted to examine how power may affect other dynamics of male couples' relationships and risk-related behaviors.

  10. Differential evolution of a CXCR4-using HIV-1 strain in CCR5wt/wt and CCR5∆32/∆32 hosts revealed by longitudinal deep sequencing and phylogenetic reconstruction.

    Science.gov (United States)

    Le, Anh Q; Taylor, Jeremy; Dong, Winnie; McCloskey, Rosemary; Woods, Conan; Danroth, Ryan; Hayashi, Kanna; Milloy, M-J; Poon, Art F Y; Brumme, Zabrina L

    2015-12-03

    Rare individuals homozygous for a naturally-occurring 32 base pair deletion in the CCR5 gene (CCR5∆32/∆32) are resistant to infection by CCR5-using ("R5") HIV-1 strains but remain susceptible to less common CXCR4-using ("X4") strains. The evolutionary dynamics of X4 infections however, remain incompletely understood. We identified two individuals, one CCR5wt/wt and one CCR5∆32/∆32, within the Vancouver Injection Drug Users Study who were infected with a genetically similar X4 HIV-1 strain. While early-stage plasma viral loads were comparable in the two individuals (~4.5-5 log10 HIV-1 RNA copies/ml), CD4 counts in the CCR5wt/wt individual reached a nadir of 250 cells/mm(3) in the CCR5∆32/∆32 individual. Ancestral phylogenetic reconstructions using longitudinal envelope-V3 deep sequences suggested that both individuals were infected by a single transmitted/founder (T/F) X4 virus that differed at only one V3 site (codon 24). While substantial within-host HIV-1 V3 diversification was observed in plasma and PBMC in both individuals, the CCR5wt/wt individual's HIV-1 population gradually reverted from 100% X4 to ~60% R5 over ~4 years whereas the CCR5∆32/∆32 individual's remained consistently X4. Our observations illuminate early dynamics of X4 HIV-1 infections and underscore the influence of CCR5 genotype on HIV-1 V3 evolution.

  11. Phylogenetic Relationships among Species of Phellinus sensu stricto, Cause of White Trunk Rot of Hardwoods, from Northern North America

    Directory of Open Access Journals (Sweden)

    Nicholas J. Brazee

    2015-11-01

    Full Text Available Species in Phellinus s.s. are some of the most important wood-decaying fungal pathogens in northern temperate forests, yet data on species incidence in North America remains limited. Therefore, phylogenetic analyses were performed using four loci (ITS, nLSU, tef1 and rpb2 with isolates representing 13 species. Results of phylogenetic analyses using maximum likelihood and Bayesian inference revealed that eight species of Phellinus s.s. occur in North America, and include: P. alni, P. arctostaphyli, P. betulinus, P. lundellii, P. nigricans, P. tremulae and two undescribed species, P. NA1 and P. NA2. Meanwhile, P. tuberculosus, P. igniarius s.s., P. populicola, P. laevigatus s.s. and P. orienticus were not detected and appear restricted to Europe and/or Asia. The tef1 dataset outperformed all other loci used and was able to discriminate among all 13 of the currently known Phellinus s.s. species with significant statistical support. The internal transcribed spacer (ITS region performed well but a high level of intraspecific variation could lead to inflated taxa recognition. Phellinus alni exhibited the broadest host range, as demonstrated previously, and appears to be the most common species in northern hardwood (Acer-Betula-Fagus, northern floodplain (Fraxinus-Populus-Ulmus and coastal alder (Alnus forests of North America.

  12. A Universal Phylogenetic Tree.

    Science.gov (United States)

    Offner, Susan

    2001-01-01

    Presents a universal phylogenetic tree suitable for use in high school and college-level biology classrooms. Illustrates the antiquity of life and that all life is related, even if it dates back 3.5 billion years. Reflects important evolutionary relationships and provides an exciting way to learn about the history of life. (SAH)

  13. The relationship between ART adherence and smoking status among HIV+ individuals.

    Science.gov (United States)

    Moreno, Jose L; Catley, Delwyn; Lee, Hyoung S; Goggin, Kathy

    2015-04-01

    Smoking is highly prevalent among HIV+ individuals and studies indicate that it may be associated with poor ART adherence, though the relationship is poorly understood. In addition little is known about interest in quitting among HIV+ smokers who are having adherence difficulties. We examined smoking and ART adherence among 203 HIV+ individuals enrolled in a randomized trial of interventions to increase ART adherence. Prior analyses indicated there were no overall treatment group effects. Smoking status and motivation to quit was assessed at baseline and ART adherence was assessed at week 12, 24, 36, and 48. Longitudinal generalized estimating equation analysis that controlled for treatment group revealed that smoking status was not significantly related to adherence over time. Motivation to quit was high with 58 % intending to quit in the next 6 months and 25 % intending to quit in the next 30 days. Findings suggest that smoking is not associated with adherence among those with adherence difficulties. However it does not diminish importance of addressing both behaviors especially given HIV+ smokers substantial interest in changing smoking behavior.

  14. Genetic Characterization of a Novel HIV-1 Circulating Recombinant Form (CRF74_01B) Identified among Intravenous Drug Users in Malaysia: Recombination History and Phylogenetic Linkage with Previously Defined Recombinant Lineages.

    Science.gov (United States)

    Cheong, Hui Ting; Chow, Wei Zhen; Takebe, Yutaka; Chook, Jack Bee; Chan, Kok Gan; Al-Darraji, Haider Abdulrazzaq Abed; Koh, Clayton; Kamarulzaman, Adeeba; Tee, Kok Keng

    2015-01-01

    In many parts of Southeast Asia, the HIV-1 epidemic has been driven by the sharing of needles and equipment among intravenous drug users (IDUs). Over the last few decades, many studies have proven time and again that the diversity of HIV-1 epidemics can often be linked to the route of infection transmission. That said, the diversity and complexity of HIV-1 molecular epidemics in the region have been increasing at an alarming rate, due in part to the high tendency of the viral RNA to recombine. This scenario was exemplified by the discovery of numerous circulating recombinant forms (CRFs), especially in Thailand and Malaysia. In this study, we characterized a novel CRF designated CRF74_01B, which was identified in six epidemiologically unlinked IDUs in Kuala Lumpur, Malaysia. The near-full length genomes were composed of CRF01_AE and subtype B', with eight breakpoints dispersed in the gag-pol and nef regions. Remarkably, this CRF shared four and two recombination hotspots with the previously described CRF33_01B and the less prevalent CRF53_01B, respectively. Genealogy-based Bayesian phylogenetic analysis of CRF74_01B genomic regions showed that it is closely related to both CRF33_01B and CRF53_01B. This observation suggests that CRF74_01B was probably a direct descendent from specific lineages of CRF33_01B, CRF53_01B and subtype B' that could have emerged in the mid-1990s. Additionally, it illustrated the active recombination processes between prevalent HIV-1 subtypes and recombinants in Malaysia. In summary, we report a novel HIV-1 genotype designated CRF74_01B among IDUs in Kuala Lumpur, Malaysia. The characterization of the novel CRF74_01B is of considerable significance towards the understanding of the genetic diversity and population dynamics of HIV-1 circulating in the region.

  15. Genetic Characterization of a Novel HIV-1 Circulating Recombinant Form (CRF74_01B Identified among Intravenous Drug Users in Malaysia: Recombination History and Phylogenetic Linkage with Previously Defined Recombinant Lineages.

    Directory of Open Access Journals (Sweden)

    Hui Ting Cheong

    Full Text Available In many parts of Southeast Asia, the HIV-1 epidemic has been driven by the sharing of needles and equipment among intravenous drug users (IDUs. Over the last few decades, many studies have proven time and again that the diversity of HIV-1 epidemics can often be linked to the route of infection transmission. That said, the diversity and complexity of HIV-1 molecular epidemics in the region have been increasing at an alarming rate, due in part to the high tendency of the viral RNA to recombine. This scenario was exemplified by the discovery of numerous circulating recombinant forms (CRFs, especially in Thailand and Malaysia. In this study, we characterized a novel CRF designated CRF74_01B, which was identified in six epidemiologically unlinked IDUs in Kuala Lumpur, Malaysia. The near-full length genomes were composed of CRF01_AE and subtype B', with eight breakpoints dispersed in the gag-pol and nef regions. Remarkably, this CRF shared four and two recombination hotspots with the previously described CRF33_01B and the less prevalent CRF53_01B, respectively. Genealogy-based Bayesian phylogenetic analysis of CRF74_01B genomic regions showed that it is closely related to both CRF33_01B and CRF53_01B. This observation suggests that CRF74_01B was probably a direct descendent from specific lineages of CRF33_01B, CRF53_01B and subtype B' that could have emerged in the mid-1990s. Additionally, it illustrated the active recombination processes between prevalent HIV-1 subtypes and recombinants in Malaysia. In summary, we report a novel HIV-1 genotype designated CRF74_01B among IDUs in Kuala Lumpur, Malaysia. The characterization of the novel CRF74_01B is of considerable significance towards the understanding of the genetic diversity and population dynamics of HIV-1 circulating in the region.

  16. Incompletely resolved phylogenetic trees inflate estimates of phylogenetic conservatism.

    Science.gov (United States)

    Davies, T Jonathan; Kraft, Nathan J B; Salamin, Nicolas; Wolkovich, Elizabeth M

    2012-02-01

    The tendency for more closely related species to share similar traits and ecological strategies can be explained by their longer shared evolutionary histories and represents phylogenetic conservatism. How strongly species traits co-vary with phylogeny can significantly impact how we analyze cross-species data and can influence our interpretation of assembly rules in the rapidly expanding field of community phylogenetics. Phylogenetic conservatism is typically quantified by analyzing the distribution of species values on the phylogenetic tree that connects them. Many phylogenetic approaches, however, assume a completely sampled phylogeny: while we have good estimates of deeper phylogenetic relationships for many species-rich groups, such as birds and flowering plants, we often lack information on more recent interspecific relationships (i.e., within a genus). A common solution has been to represent these relationships as polytomies on trees using taxonomy as a guide. Here we show that such trees can dramatically inflate estimates of phylogenetic conservatism quantified using S. P. Blomberg et al.'s K statistic. Using simulations, we show that even randomly generated traits can appear to be phylogenetically conserved on poorly resolved trees. We provide a simple rarefaction-based solution that can reliably retrieve unbiased estimates of K, and we illustrate our method using data on first flowering times from Thoreau's woods (Concord, Massachusetts, USA).

  17. Pachyseris inattesa sp. n. (Cnidaria, Anthozoa, Scleractinia): A new reef coral species from the red sea and its phylogenetic relationships

    KAUST Repository

    Terraneo, Tullia I.; Berumen, Michael L.; Arrigoni, Roberto; Waheed, Zarinah; Bouwmeester, Jessica; Caragnano, Annalisa; Stefani, Fabrizio; Benzoni, Francesca

    2014-01-01

    A new scleractinian coral species, Pachyseris inattesa sp. n., is described from the Red Sea. Despite a superficial resemblance with some species in the agariciid genus Leptoseris with which it has been previously confused, P. inattesa sp. n. has micro-morphological characters typical of the genus Pachyseris. This genus, once part of the Agariciidae, is comprised of five extant species and is widely distributed throughout the tropical Indo-Pacific. It is currently incertae sedis as a result of recent molecular analysis and appears to be closely related to the Euphylliidae. A molecular phylogenetic reconstruction including P. inattesa sp. n., the genus type species P. rugosa, and P. speciosa, all present in the Red Sea, was performed using the mitochondrial intergenic spacer between COI and 16S-rRNA. The results confirm that P. inattesa sp. n. is a monophyletic lineage closely related to the other Pachyseris species examined. © Tullia I. Terraneo et al.

  18. A new subtype of hepatitis C virus genotype 1: complete genome and phylogenetic relationships of an Equatorial Guinea isolate.

    Science.gov (United States)

    Bracho, Maria Alma; Carrillo-Cruz, Francy Yolima; Ortega, Enrique; Moya, Andrés; González-Candelas, Fernando

    2006-06-01

    Hepatitis C virus (HCV) is the leading cause of chronic liver disease and is associated with hepatocellular carcinoma. However, there have been few studies on the distribution and genetic diversity of HCV isolates in non-developed countries. Here, the complete genome sequence of an HCV genotype 1 isolate from Equatorial Guinea is reported, the first complete HCV-1 genome of African origin. Phylogenetic analysis revealed that this sequence always grouped with sequences of genotype 1, but did not group clearly with any subtype described so far. An analysis of partial NS5B gene sequences with additional sequences of African origin also failed to find close similarities between the new sequence and any previously known isolate. Genetic divergence of the coding region of this new sequence with respect to the recognized subtypes of HCV-1 ranged from 20 to 22%. It is proposed that this isolate is a representative of a new, distinct variant of HCV subtype 1.

  19. Pachyseris inattesa sp. n. (Cnidaria, Anthozoa, Scleractinia): A new reef coral species from the red sea and its phylogenetic relationships

    KAUST Repository

    Terraneo, Tullia I.

    2014-08-13

    A new scleractinian coral species, Pachyseris inattesa sp. n., is described from the Red Sea. Despite a superficial resemblance with some species in the agariciid genus Leptoseris with which it has been previously confused, P. inattesa sp. n. has micro-morphological characters typical of the genus Pachyseris. This genus, once part of the Agariciidae, is comprised of five extant species and is widely distributed throughout the tropical Indo-Pacific. It is currently incertae sedis as a result of recent molecular analysis and appears to be closely related to the Euphylliidae. A molecular phylogenetic reconstruction including P. inattesa sp. n., the genus type species P. rugosa, and P. speciosa, all present in the Red Sea, was performed using the mitochondrial intergenic spacer between COI and 16S-rRNA. The results confirm that P. inattesa sp. n. is a monophyletic lineage closely related to the other Pachyseris species examined. © Tullia I. Terraneo et al.

  20. A Closer Look at Bacteroides: Phylogenetic Relationship and Genomic Implications of a Life in the Human Gut

    DEFF Research Database (Denmark)

    Karlsson, Fredrik H.; Ussery, David; Nielsen, Jens

    2011-01-01

    The human gut is extremely densely inhabited by bacteria mainly from two phyla, Bacteroidetes and Firmicutes, and there is a great interest in analyzing whole-genome sequences for these species because of their relation to human health and disease. Here, we do whole-genome comparison of 105...... of extracytoplasmic function σ factors (ECF σ factors) and two component systems for extracellular signal transduction compared to other Bacteroidetes/Chlorobi species. A whole-genome phylogenetic analysis shows a very little difference between the Parabacteroides and Bacteroides genera. Further analysis shows...... of members of the Bacteroidetes/Chlorobi phylum by whole genome comparison. Gut living Bacteroides have an enriched set of glycan, vitamin, and cofactor enzymes important for diet digestion....

  1. Phylogenetic relationships and timing of diversification in gonorynchiform fishes inferred using nuclear gene DNA sequences (Teleostei: Ostariophysi).

    Science.gov (United States)

    Near, Thomas J; Dornburg, Alex; Friedman, Matt

    2014-11-01

    The Gonorynchiformes are the sister lineage of the species-rich Otophysi and provide important insights into the diversification of ostariophysan fishes. Phylogenies of gonorynchiforms inferred using morphological characters and mtDNA gene sequences provide differing resolutions with regard to the sister lineage of all other gonorynchiforms (Chanos vs. Gonorynchus) and support for monophyly of the two miniaturized lineages Cromeria and Grasseichthys. In this study the phylogeny and divergence times of gonorynchiforms are investigated with DNA sequences sampled from nine nuclear genes and a published morphological character matrix. Bayesian phylogenetic analyses reveal substantial congruence among individual gene trees with inferences from eight genes placing Gonorynchus as the sister lineage to all other gonorynchiforms. Seven gene trees resolve Cromeria and Grasseichthys as a clade, supporting previous inferences using morphological characters. Phylogenies resulting from either concatenating the nuclear genes, performing a multispecies coalescent species tree analysis, or combining the morphological and nuclear gene DNA sequences resolve Gonorynchus as the living sister lineage of all other gonorynchiforms, strongly support the monophyly of Cromeria and Grasseichthys, and resolve a clade containing Parakneria, Cromeria, and Grasseichthys. The morphological dataset, which includes 13 gonorynchiform fossil taxa that range in age from Early Cretaceous to Eocene, was analyzed in combination with DNA sequences from the nine nuclear genes and a relaxed molecular clock to estimate times of evolutionary divergence. This "tip dating" strategy accommodates uncertainty in the phylogenetic resolution of fossil taxa that provide calibration information in the relaxed molecular clock analysis. The estimated age of the most recent common ancestor (MRCA) of living gonorynchiforms is slightly older than estimates from previous node dating efforts, but the molecular tip dating

  2. Mitochondrial genomes of Meloidogyne chitwoodi and M. incognita (Nematoda: Tylenchina): comparative analysis, gene order and phylogenetic relationships with other nematodes.

    Science.gov (United States)

    Humphreys-Pereira, Danny A; Elling, Axel A

    2014-01-01

    Root-knot nematodes (Meloidogyne spp.) are among the most important plant pathogens. In this study, the mitochondrial (mt) genomes of the root-knot nematodes, M. chitwoodi and M. incognita were sequenced. PCR analyses suggest that both mt genomes are circular, with an estimated size of 19.7 and 18.6-19.1kb, respectively. The mt genomes each contain a large non-coding region with tandem repeats and the control region. The mt gene arrangement of M. chitwoodi and M. incognita is unlike that of other nematodes. Sequence alignments of the two Meloidogyne mt genomes showed three translocations; two in transfer RNAs and one in cox2. Compared with other nematode mt genomes, the gene arrangement of M. chitwoodi and M. incognita was most similar to Pratylenchus vulnus. Phylogenetic analyses (Maximum Likelihood and Bayesian inference) were conducted using 78 complete mt genomes of diverse nematode species. Analyses based on nucleotides and amino acids of the 12 protein-coding mt genes showed strong support for the monophyly of class Chromadorea, but only amino acid-based analyses supported the monophyly of class Enoplea. The suborder Spirurina was not monophyletic in any of the phylogenetic analyses, contradicting the Clade III model, which groups Ascaridomorpha, Spiruromorpha and Oxyuridomorpha based on the small subunit ribosomal RNA gene. Importantly, comparisons of mt gene arrangement and tree-based methods placed Meloidogyne as sister taxa of Pratylenchus, a migratory plant endoparasitic nematode, and not with the sedentary endoparasitic Heterodera. Thus, comparative analyses of mt genomes suggest that sedentary endoparasitism in Meloidogyne and Heterodera is based on convergent evolution. Copyright © 2014 Elsevier B.V. All rights reserved.

  3. No relationship between late HIV diagnosis and social deprivation in newly diagnosed patients in France.

    Science.gov (United States)

    Cuzin, L; Yazdanpanah, Y; Huleux, T; Cotte, L; Pugliese, P; Allavena, C; Reynes, J; Poizot-Martin, I; Bani-Sadr, F; Delpierre, C

    2018-03-01

    The aim of the study was to determine whether there is a relationship between social deprivation and time of HIV diagnosis in France. Prospectively collected data from a multicentre database were used in the study. Patients with a first HIV diagnosis between 1 January 2014 and 31 December 2015 were selected from the database. Deprivation was measured using the European Deprivation Index (EDI), which is an ecological index constructed from the address of residence and based on the smallest geographical census unit, in which individuals are classified so as to be comparable with national quintiles. Time of diagnosis was classified as being at an early, intermediate, late, or advanced stage of disease. Age, gender, distance from home to HIV centre, most probable route of infection, and hepatitis B or C coinfection were considered in the analysis. Because of a strong interaction between gender and most probable route of infection, we constructed a 'population' variable: men who have sex with men (MSM), heterosexual men and women. Of 1421 newly diagnosed patients, 44% were diagnosed either late or at an advanced stage of disease, and 46.3% were in the highest deprivation quintile. Using multivariate logistic regression, 'population' [odds ratio (OR) 0.62 (95% confidence interval (CI) 0.48-0.78) for MSM compared with women] and age [OR 1.39 (95% CI 1.07-1.80), 1.72 (1.32-2.23) and 1.86 (1.40-2.47) for the second, third and fourth quartiles, respectively, compared with the first quartile] were found to be related to late diagnosis. EDI level was not related to late HIV diagnosis. 'Population' seems to be more relevant than EDI to define evidence-based interventions to limit late diagnosis. © 2017 British HIV Association.

  4. Phylogenetic relationships of Sarcocystis neurona of horses and opossums to other cyst-forming coccidia deduced from SSU rRNA gene sequences.

    Science.gov (United States)

    Elsheikha, Hany M; Lacher, David W; Mansfield, Linda S

    2005-11-01

    Phylogenetic analyses based on sequences of the nuclear-encoded small subunit rRNA (ssurRNA) gene were performed to examine the origin, phylogeny, and biogeographic relationships of Sarcocystis neurona isolates from opossums and horses from the State of Michigan, USA, in relation to other cyst-forming coccidia. A total of 31 taxa representing all recognized subfamilies and genera of Sarcocystidae were included in the analyses with clonal isolates of two opossum and two horse S. neurona. Phylogenies obtained by the four tree-building methods were consistent with the classical taxonomy based on morphological criteria. The "isosporid" coccidia Neospora, Toxoplasma, Besnoitia, Isospora lacking stieda bodies, and Hyaloklossia formed a sister group to the Sarcocystis spp. Sarcocystis species were divided into three main lineages; S. neurona isolates were located in the second lineage and clustered with S. mucosa, S. dispersa, S. lacertae, S. rodentifelis, S. muris, and Frenkelia spp. Alignment of S. neurona SSU rRNA gene sequences of Michigan opossum isolates (MIOP5, MIOP20) and a S. neurona Michigan horse isolate (MIH8) showed 100% identity. These Michigan isolates differed in 2/1085 bp (0.2%) from a Kentucky S. neurona horse isolate (SN5). Additionally, S. neurona isolates from horses and opossums were identical based on the ultrastructural features and PCR-RFLP analyses thus forming a phylogenetically indistinct group in these regions. These findings revealed the concordance between the morphological and molecular data and confirmed that S. neurona from opossums and horses originated from the same phylogenetic origin.

  5. Unveiling the Identity of Wenwan Walnuts and Phylogenetic Relationships of Asian Juglans Species Using Restriction Site-Associated DNA-Sequencing

    Directory of Open Access Journals (Sweden)

    Xian-Yun Mu

    2017-10-01

    Full Text Available Juglans species have considerable ecological and economic value worldwide. In China, Wenwan walnuts have been collected by aristocrats and noblemen for more than 2000 years. As a diversity center of Asian Juglans, five species are widely distributed in China. The most famous of these is Mahetao (J. hopeiensis, which is an uncharacterized species that is mostly cultivated. Wild J. hopeiensis individuals are very rare and are endemic to Hebei Province. Because of the minimal variations in previously used molecular markers and the heterogeneity between chloroplast and nuclear genomes, determining the phylogenetic relationships among the Juglans species has been challenging, and has hindered subsequent evolutionary inferences. In this study, we collected enough materials for both cultivated and wild Mahetao to construct well-resolved phylogenetic trees for Asian Juglans species. We used a high-throughput genome-wide restriction site-associated DNA sequencing method. Consequently, the identity of J. hopeiensis has been clearly resolved. Our results indicate that J. hopeiensis is a hybrid of J. regia and J. mandshurica. However, J. hopeiensis, J. regia and J. sigillata should be considered as a single species from section Juglans. Additionally, J. ailantifolia, J. cathayensis, and J. mandshurica likely represent one species from section Cardiocaryon according to morphological and molecular studies. These results are supported by population structure analysis and morphological comparison. We propose that J. hopeiensis trees growing in the wild should be conserved because of the economic value of their nuts. These trees may be of particular importance to impoverished communities. Furthermore, they may serve as a valuable genetic resource relevant for enhancing the production of edible walnuts. The 2b-RAD method is a viable option for future phylogenetic studies of Juglans species as well as other plant species.

  6. Relationship between inflammatory and coagulation biomarkers and cardiac autonomic function in HIV-infected individuals

    DEFF Research Database (Denmark)

    Young, Lari C; Roediger, Mollie P; Grandits, Greg

    2014-01-01

    Therapy study. We examined the association between IL-6, high-sensitivity C-reactive protein (hsCRP) and D-dimer with heart rate variability measures (SDNN and rMSSD), both cross-sectionally and longitudinally. RESULTS: Cross-sectional analysis revealed significant inverse associations between IL-6, hs......CRP and d-dimer with SDNN and rMSSD (p Cross-sectionally, higher levels of inflammatory and coagulation biomarkers were......AIM: To examine the relationship between inflammatory and coagulation biomarkers and cardiac autonomic function (CAF) as measured by heart rate variability in persons with HIV. MATERIALS & METHODS: This analysis included 4073 HIV-infected persons from the Strategies for Management of Antiretroviral...

  7. Couple Relationship Functioning as a Source or Mitigator of HIV Risk: Associations Between Relationship Quality and Sexual Risk Behavior in Peri-urban Uganda.

    Science.gov (United States)

    Ruark, Allison; Kajubi, Phoebe; Ruteikara, Sam; Green, Edward C; Hearst, Norman

    2018-04-01

    Despite evidence that a greater focus on couples could strengthen HIV prevention efforts, little health-related research has explored relationship functioning and relationship quality among couples in Africa. Using data from 162 couples (324 individuals) resident in a peri-urban Ugandan community, we assessed actor and partner effects of sexual risk behaviors on relationship quality, using psychometric measures of dyadic adjustment, sexual satisfaction, commitment, intimacy, and communication. For women and men, poor relationship quality was associated with having concurrent sexual partners and suspecting that one's partner had concurrent sexual partners (actor effects). Women's poor relationship quality was also associated with men's sexual risk behaviors (partner effects), although the inverse partner effect was not observed. These findings suggest that relationship quality is linked to HIV risk, particularly through the pathway of concurrent sexual partnerships, and that positive relationship attributes such as sexual satisfaction, intimacy, and constructive communication can help couples to avoid risk.

  8. The relationship between negative responses to HIV status disclosure and psychosocial outcomes among people living with HIV.

    Science.gov (United States)

    Cama, Elena; Brener, Loren; Slavin, Sean; de Wit, John

    2017-07-01

    This report examines rates of HIV status disclosure and negative responses to disclosure among people living with HIV in Australia. Among 697 people living with HIV, most (>90%) had disclosed their status to friends, sexual partners and health providers. Almost a third had not disclosed to family, and half had not told any work colleagues. Negative responses to disclosure (e.g. blame, rejection) by all groups were associated with increased HIV-related stigma, psychological distress and diminished social support and health satisfaction. These results shed light on rates of disclosure among people living with HIV in Australia and the adverse health impacts of negative responses to disclosure.

  9. Hepatozoon canis in German red foxes (Vulpes vulpes) and their ticks: molecular characterization and the phylogenetic relationship to other Hepatozoon spp.

    Science.gov (United States)

    Najm, Nour-Addeen; Meyer-Kayser, Elisabeth; Hoffmann, Lothar; Pfister, Kurt; Silaghi, Cornelia

    2014-07-01

    In this study, the prevalence of Hepatozoon spp. in red foxes (Vulpes vulpes) and their ticks from Germany, as well as molecular characterizations and phylogenetic relationship to other Hepatozoon spp. were investigated. DNA extracts of 261 spleen samples and 1,953 ticks were examined for the presence of Hepatozoon spp. by a conventional polymerase chain reaction (PCR) targeting the 18S rRNA gene. The ticks included four tick species: Ixodes ricinus, Ixodes canisuga, Ixodes hexagonus and Dermacentor reticulatus. A total of 118/261 foxes (45.2%) and 148/1,953 ticks (7.5%) were Hepatozoon PCR-positive. Amplicons from 36 positive foxes and 41 positive ticks were sequenced. All sequences obtained from foxes and 39/41 from ticks had a 99% similarity to Hepatozoon canis, whereas two ticks' sequences had a 99% identity to Hepatozoon sp. The obtained Hepatozoon sequences in this study were phylogenetically related to other Hepatozoon sequences detected in other countries, which may represent strain variants. The high prevalence of H. canis DNA in red foxes in this study supports the suggested role of those animals in distribution of this parasite. Furthermore, detection of DNA of H. canis in foxes and all examined tick species collected from those foxes allows speculating about previously undescribed potential vectors for H. canis and suggests a potential role of the red fox in its natural endemic cycles.

  10. Diversity of 16S-23S rDNA internal transcribed spacer (ITS reveals phylogenetic relationships in Burkholderia pseudomallei and its near-neighbors.

    Directory of Open Access Journals (Sweden)

    Andrew P Liguori

    Full Text Available Length polymorphisms within the 16S-23S ribosomal DNA internal transcribed spacer (ITS have been described as stable genetic markers for studying bacterial phylogenetics. In this study, we used these genetic markers to investigate phylogenetic relationships in Burkholderia pseudomallei and its near-relative species. B. pseudomallei is known as one of the most genetically recombined bacterial species. In silico analysis of multiple B. pseudomallei genomes revealed approximately four homologous rRNA operons and ITS length polymorphisms therein. We characterized ITS distribution using PCR and analyzed via a high-throughput capillary electrophoresis in 1,191 B. pseudomallei strains. Three major ITS types were identified, two of which were commonly found in most B. pseudomallei strains from the endemic areas, whereas the third one was significantly correlated with worldwide sporadic strains. Interestingly, mixtures of the two common ITS types were observed within the same strains, and at a greater incidence in Thailand than Australia suggesting that genetic recombination causes the ITS variation within species, with greater recombination frequency in Thailand. In addition, the B. mallei ITS type was common to B. pseudomallei, providing further support that B. mallei is a clone of B. pseudomallei. Other B. pseudomallei near-neighbors possessed unique and monomorphic ITS types. Our data shed light on evolutionary patterns of B. pseudomallei and its near relative species.

  11. Phylogenetic relationships in the genus Leonardoxa (Leguminosae: Caesalpinioideae) inferred from chloroplast trnL intron and trnL-trnF intergenic spacer sequences.

    Science.gov (United States)

    Brouat, Carine; Gielly, Ludovic; McKey, Doyle

    2001-01-01

    The African genus LEONARDOXA: (Leguminosae: Caesalpinioideae) comprises two Congolean species and a group of four mostly allopatric subspecies principally located in Cameroon and clustered together in the L. africana complex. LEONARDOXA: provides a good opportunity to investigate the evolutionary history of ant-plant mutualisms, as it exhibits various grades of ant-plant interactions from diffuse to obligate and symbiotic associations. We present in this paper the first molecular phylogenetic study of this genus. We sequenced both the chloroplast DNA trnL intron (677 aligned base pairs [bp]) and trnL-trnF intergene spacer (598 aligned bp). Inferred phylogenetic relationships suggested first that the genus is paraphyletic. The L. africana complex is clearly separated from the two Congolean species, and the integrity of the genus is thus in question. In the L. africana complex, our data showed a lack of congruence between clades suggested by morphological and chloroplast characters. This, and the low level of molecular divergence found between subspecies, suggests gene flow and introgressive events in the L. africana complex.

  12. Phylogenetic relationships of Scomberomorus commerson using sequence analysis of the mtDNA D-loop region in the Persian Gulf, Oman Sea and Arabian Sea

    Directory of Open Access Journals (Sweden)

    Ana Mansourkiaei

    2016-04-01

    Full Text Available Abstract Narrow-barred Spanish mackerel, Scomberomorus commerson, is an epipelagic and migratory species of family Scombridae which have a significant role in terms of ecology and fishery. 100 samples were collected from the Persian Gulf, Oman Sea and Arabian Sea. Part of their dorsal fins was snipped and transferred to micro-tubes containing ethanol; then, DNAs were extracted and HRM-Real Time PCR was performed to designate representative specimens for sequencing. Phylogenetic relationships of S. commerson from Persian Gulf, Oman Sea and Arabian Sea were investigated using sequence data of mitochondrial DNA D-loop region. None clustered Neighbor Joining tree indicated the proximity amid S. commerson in four sites. As numbers demonstrated in sequence analyses of mitochondrial DNA D-Loop region a sublimely high degree of genetic similarity among S. commerson from the Persian Gulf and Oman Sea were perceived, thereafter, having one stock structure of S. commerson in four regions were proved, and this approximation can be merely justified by their migration process along the coasts of Oman Sea and Persian Gulf. Therefore, the assessment of distribution patterns of 20 haplotypes in the constructed phylogenetic tree using mtDNA D-Loop sequences ascertained that no significant clustering according to the sampling sites was concluded.

  13. Negotiating sexual safety in the era of biomedical HIV prevention: relationship dynamics among male couples using pre-exposure prophylaxis.

    Science.gov (United States)

    Malone, Jowanna; Syvertsen, Jennifer L; Johnson, Blake E; Mimiaga, Matthew J; Mayer, Kenneth H; Bazzi, Angela R

    2018-06-01

    Up to two-thirds of new cases of HIV transmission between gay, bisexual and other men who have sex with men in the USA are attributed to primary relationships. Understanding the relationship dynamics and sexual agreements of male-male couples can provide insight into HIV transmission patterns and prevention needs in this population. The daily use of antiretroviral pre-exposure prophylaxis (PrEP) is highly effective in preventing HIV, but its negotiation and use within social and intimate relationship contexts remain understudied. We conducted semi-structured qualitative interviews with 20 male couples (n = 40 men) in which at least one partner was either using or in the process of initiating PrEP. Congruent with a theoretical focus on social theories of relationships and negotiated risk, couples were interviewed about relationship dynamics, trust, communication and sexual health practices, including their perception and use of PrEP. Overall, we found that couples showed heightened trust and communication when establishing open, sexual agreements and demonstrated high awareness of sexual risks and health practices in the context of PrEP use. This study demonstrates how understanding relationship dynamics can better inform HIV prevention and sexual health promotion efforts for male couples at risk of HIV.

  14. 'Testing Together Challenges the Relationship': Consequences of HIV Testing as a Couple in a High HIV Prevalence Setting in Rural South Africa.

    Directory of Open Access Journals (Sweden)

    Hanani Tabana

    Full Text Available We conducted qualitative individual and combined interviews with couples to explore their experiences since the time of taking an HIV test and receiving the test result together, as part of a home-based HIV counselling and testing intervention.This study was conducted in October 2011 in rural KwaZulu-Natal, South Africa, about 2 years after couples tested and received results together. Fourteen couples were purposively sampled: discordant, concordant negative and concordant positive couples.Learning about each other's status together challenged relationships of the couples in different ways depending on HIV status and gender. The mutual information confirmed suspected infidelity that had not been discussed before. Negative women in discordant partnerships remained with their positive partner due to social pressure and struggled to maintain their HIV negative status. Most of the couple relationships were characterized by silence and mistrust. Knowledge of sero-status also led to loss of sexual intimacy in some couples especially the discordant. For most men in concordant negative couples, knowledge of status was an awakening of the importance of fidelity and an opportunity for behaviour change, while for concordant positive and discordant couples, it was seen as proof of infidelity. Although positive HIV status was perceived as confirmation of infidelity, couples continued their relationship and offered some support for each other, living and managing life together. Sexual life in these couples was characterized by conflict and sometimes violence. In the concordant negative couples, trust was enhanced and behaviour change was promised.Findings suggest that testing together as couples challenged relationships in both negative and positive ways. Further, knowledge of HIV status indicated potential to influence behaviour change especially among concordant negatives. In the discordant and concordant positive couples, traditional gender roles exposed

  15. "Don't tell him you have HIV unless he's 'the one'": romantic relationships among adolescents and young adults with perinatal HIV infection.

    Science.gov (United States)

    Fair, Cynthia; Albright, Jamie

    2012-12-01

    Individuals with perinatally-acquired HIV (PHIV) are surviving into young adulthood. Previous literature has explored the sexual behavior of those with PHIV. However, their perspectives on navigating romantic relationships are not well understood. Semi-structured interviews were conducted with 35 young adults living with PHIV recruited from two pediatric infectious disease clinics in the southeast United States. The majority of participants were African American (n=27, 77.2%), female (n=23, 65.7%), and the mean age was 20.7 (range 15-30) years. Questions focused on experiences with dating and romantic relationships as well as relationship advice for others living with HIV. Transcribed interviews were coded for emergent themes. Qualitative analyses revealed that the majority of participants have dated and struggled with their HIV status in their intimate relationships. The majority of those who disclosed their HIV status to past partners had experienced some form of rejection. However, several participants reported receiving support upon disclosure. Some individuals had never disclosed to a romantic partner, but carefully managed intimacy by delaying dating, terminating relationships, and "taking it slow." Advice fell into two broad categories: "be safe" which referred to the physical protection of self and partners, as well as emotional protection from possible rejection. The second advice category was basic encouragement which stressed the importance for young adults living with HIV to have hope that they would find a supportive partner and to be patient. The focus of education must include not only transmission risk factors, but also developing and maintaining healthy relationships in the context of a highly stigmatized illness.

  16. Phylogenetic relationships of Semaphore geckos (Squamata: Sphaerodactylidae: Pristurus) with an assessment of the taxonomy of Pristurus rupestris.

    Science.gov (United States)

    Badiane, Arnaud; Garcia-Porta, Joan; Červenka, Jan; Kratochvíl, Lukáš; Sindaco, Roberto; Robinson, Michael D; Morales, Hernan; Mazuch, Tomáš; Price, Thomas; Amat, Fèlix; Shobrak, Mohammed Y; Wilms, Thomas; Simó-Riudalbas, Marc; Ahmadzadeh, Faraham; Papenfuss, Theodore J; Cluchier, Alexandre; Viglione, Julien; Carranza, Salvador

    2014-07-09

    A molecular phylogeny of the sphaerodactylid geckos of the genus Pristurus is inferred based on an alignment of 1845 base pairs (bp) of concatenated mitochondrial (12S) and nuclear (acm4, cmos, rag1 and rag2) genes for 80 individuals, representing 18 of the 23-26 species, and the three subspecies of P. rupestris. The results indicate that P. rupestris is polyphyletic and includes two highly divergent clades: the eastern clade, found in coastal Iran and throughout the Hajar Mountain range in northern Oman and eastern UAE; and the western clade, distributed from central coastal Oman, through Yemen, Saudi Arabia and north to southern Jordan. Inferred haplotype networks for the four nuclear genes show that the eastern and western clades of "P. rupestris" are highly differentiated and do not share any alleles. Moreover, although the two clades are differentiated by a morphological multivariate analysis, no one character or set of characters was found to be diagnostic. Based on the molecular analysis of specimens from the type locality of P. rupestris rupestris, the name P. rupestris is applied to the eastern clade. The name that should apply to the western clade cannot be clarified until morphological and genetic data for "P. rupestris" is available from the vicinity of Bosaso, Somalia, and therefore we refer to it as Pristurus sp. 1. The phylogenetic tree of Pristurus supports the hypothesis that P. celerrimus is sister to all the other species in the analyses and that the Socotra Archipelago was independently colonized a minimum of two times.

  17. The Efficacy of Consensus Tree Methods for Summarizing Phylogenetic Relationships from a Posterior Sample of Trees Estimated from Morphological Data.

    Science.gov (United States)

    O'Reilly, Joseph E; Donoghue, Philip C J

    2018-03-01

    Consensus trees are required to summarize trees obtained through MCMC sampling of a posterior distribution, providing an overview of the distribution of estimated parameters such as topology, branch lengths, and divergence times. Numerous consensus tree construction methods are available, each presenting a different interpretation of the tree sample. The rise of morphological clock and sampled-ancestor methods of divergence time estimation, in which times and topology are coestimated, has increased the popularity of the maximum clade credibility (MCC) consensus tree method. The MCC method assumes that the sampled, fully resolved topology with the highest clade credibility is an adequate summary of the most probable clades, with parameter estimates from compatible sampled trees used to obtain the marginal distributions of parameters such as clade ages and branch lengths. Using both simulated and empirical data, we demonstrate that MCC trees, and trees constructed using the similar maximum a posteriori (MAP) method, often include poorly supported and incorrect clades when summarizing diffuse posterior samples of trees. We demonstrate that the paucity of information in morphological data sets contributes to the inability of MCC and MAP trees to accurately summarise of the posterior distribution. Conversely, majority-rule consensus (MRC) trees represent a lower proportion of incorrect nodes when summarizing the same posterior samples of trees. Thus, we advocate the use of MRC trees, in place of MCC or MAP trees, in attempts to summarize the results of Bayesian phylogenetic analyses of morphological data.

  18. Morphological re-description and phylogenetic relationship of five myxosporean species of the family Myxobolidae infecting Nile tilapia.

    Science.gov (United States)

    Abdel-Gaber, Rewaida; Abdel-Ghaffar, Fathy; Maher, Sherein; El-Mallah, Al-Mahy; Al Quraishy, Saleh; Mehlhorn, Heinz

    2017-05-11

    Freshwater fish have a major economic and nutritional importance worldwide. Myxosporeans are highly dangerous parasites that infect different fish species, causing severe damage to a large number of economically important species, especially in aquaculture. We conducted a survey of myxosporean parasites infecting Nile tilapia Oreochromis niloticus (Perciformes: Cichlidae) collected from different localities along the River Nile passing through Giza province, Egypt. Out of 100 fish specimens collected, 45 were found to be naturally infected with these parasites in the region of the trunk kidney. Light microscopic examination revealed the presence of 5 distinct myxosporean species belonging to 2 different genera, viz. Myxobolus and Triangula, belonging to the family Myxobolidae; all 5 species have been previously described. Morphological characteristics, host specificity and geographical distribution, tissue tropism, and molecular analysis of the partial sequence of small subunit ribosomal DNA gene revealed that the recovered myxosporean species described herein were genetically distinct from other myxozoan species but had 95% sequence similarity to M. cerebralis. Also, phylogenetic analysis placed the present myxosporean species in the freshwater Myxobolus clade, which is a sister group of freshwater Myxobolus/Henneguya species.

  19. Analysis of Comparative Sequence and Genomic Data to Verify Phylogenetic Relationship and Explore a New Subfamily of Bacterial Lipases.

    Directory of Open Access Journals (Sweden)

    Malihe Masomian

    Full Text Available Thermostable and organic solvent-tolerant enzymes have significant potential in a wide range of synthetic reactions in industry due to their inherent stability at high temperatures and their ability to endure harsh organic solvents. In this study, a novel gene encoding a true lipase was isolated by construction of a genomic DNA library of thermophilic Aneurinibacillus thermoaerophilus strain HZ into Escherichia coli plasmid vector. Sequence analysis revealed that HZ lipase had 62% identity to putative lipase from Bacillus pseudomycoides. The closely characterized lipases to the HZ lipase gene are from thermostable Bacillus and Geobacillus lipases belonging to the subfamily I.5 with ≤ 57% identity. The amino acid sequence analysis of HZ lipase determined a conserved pentapeptide containing the active serine, GHSMG and a Ca(2+-binding motif, GCYGSD in the enzyme. Protein structure modeling showed that HZ lipase consisted of an α/β hydrolase fold and a lid domain. Protein sequence alignment, conserved regions analysis, clustal distance matrix and amino acid composition illustrated differences between HZ lipase and other thermostable lipases. Phylogenetic analysis revealed that this lipase represented a new subfamily of family I of bacterial true lipases, classified as family I.9. The HZ lipase was expressed under promoter Plac using IPTG and was characterized. The recombinant enzyme showed optimal activity at 65 °C and retained ≥ 97% activity after incubation at 50 °C for 1h. The HZ lipase was stable in various polar and non-polar organic solvents.

  20. Phylogenetic relationships within anuran clade Terrarana, with emphasis on the placement of Brazilian Atlantic rainforest frogs genus Ischnocnema (Anura: Brachycephalidae).

    Science.gov (United States)

    Canedo, Clarissa; Haddad, Célio F B

    2012-11-01

    We present a phylogenetic hypothesis of the anuran clade Terrarana based on partial sequences of nuclear (Tyr and RAG1) and mitochondrial (12S, tRNA-Val, and 16S) genes, testing the monophyly of Ischnocnema and its species series. We performed maximum parsimony, maximum likelihood, and Bayesian inference analyses on 364 terminals: 11 outgroup terminals and 353 ingroup Terrarana terminals, including 139 Ischnocnema terminals (accounting for 29 of the 35 named Ischnocnema species) and 214 other Terrarana terminals within the families Brachycephalidae, Ceuthomantidae, Craugastoridae, and Eleutherodactylidae. Different optimality criteria produced similar results and mostly recovered the currently accepted families and genera. According to these topologies, Ischnocnema is not a monophyletic group. We propose new combinations for three species, relocating them to Pristimantis, and render Eleutherodactylus bilineatus Bokermann, 1975 incertae sedis status within Holoadeninae. The rearrangements in Ischnocnema place it outside the northernmost Brazilian Atlantic rainforest, where the fauna of Terrarana comprises typical Amazonian genera. Copyright © 2012 Elsevier Inc. All rights reserved.

  1. Motivators, concerns, and barriers to adoption of pre-exposure prophylaxis for HIV prevention among gay and bisexual men in HIV serodiscordant male relationships

    Science.gov (United States)

    Brooks, Ronald A.; Kaplan, Rachel L.; Lieber, Eli; Landovitz, Raphael J.; Lee, Sung-Jae; Leibowitz, Arleen A.

    2011-01-01

    The purpose of this study was to identify factors that may facilitate or impede future adoption of pre-exposure prophylaxis (PrEP) for HIV prevention among gay and bisexual men in HIV-serodiscordant relationships. This qualitative study utilized semi-structured interviews conducted with a multi-racial/ethnic sample of 25 gay and bisexual HIV serodiscordant male couples (n=50 individuals) recruited from community settings in Los Angeles, California. A modified grounded theory approach was employed to identify major themes relating to future adoption of PrEP for HIV prevention. Motivators for adoption included protection against HIV infection, less concern and fear regarding HIV transmission, the opportunity to engage in unprotected sex, and endorsements of PrEP’s effectiveness. Concerns and barriers to adoption included the cost of PrEP, short- and long-term side effects, adverse effects of intermittent use or discontinuing PrEP, and accessibility of PrEP. The findings suggest the need for a carefully planned implementation program along with educational and counseling interventions in the dissemination of an effective PrEP agent. PMID:21476147

  2. Studies on Morphological and Phylogenetic Relationship of Salak Pondoh Varieties (Salacca zalacca (Gaert. Voss. at Sleman Highlands

    Directory of Open Access Journals (Sweden)

    NUR HIDAYAH

    2000-07-01

    Full Text Available The objectives of the study were to know the morphological variation of salak-plants (Salacca zalacca (Gaert. Voss. and their relationship. The study was conducted in May to April 2000, at Turi and Pakem of Sleman district, Yogyakarta. Samples were randomly taken, 5 plants of each variety were studied their morphological characters such as stem, leaf, flower and fruit. The data collected were then analyzed descriptive comparatively and their relationships were then determined. The result of the study indicate that there were at least 8 varieties of salak at Sleman district, green-, black-, yellow-, manggala-, red-yellow-, golden-, red-, and red-black pondoh. Morphological differences among varieties were markedly different. The closest relationship was found between variety of red-black- and black pondoh, while the farthest relationship among the varieties was manggala pondoh.

  3. Mediation and Moderation: Testing Relationships between Symptom Status, Functional Health, and Quality of Life in HIV Patients

    Science.gov (United States)

    Ryu, Ehri; West, Stephen G.; Sousa, Karen H.

    2009-01-01

    We extended Wilson and Cleary's (1995) health-related quality of life model to examine the relationships among symptom status (Symptoms), functional health (Disability), and quality of life (QOL). Using a community sample (N = 956) of male HIV positive patients, we tested a mediation model in which the relationship between Symptoms and QOL is…

  4. Phylogenetic relationship of the genus Gilbertella and related genera within the order Mucorales based on 5.8 S ribosomal DNA sequences.

    Science.gov (United States)

    Papp, T; Acs, Klára; Nyilasi, Ildikó; Nagy, Erzsébet; Vágvölgyi, Cs

    2003-01-01

    The complete ITS (internal transcribed spacer) region coding the ITS1, the ITS2 and the 5.8S rDNA was amplified by polymerase chain reaction from two strains of Gilbertella persicaria, six strains in the Mucoraceae (Mucor piriformis, M. rouxii, M. circinelloides, Rhizomucor miehei, R. pusillus and R. tauricus) and four strains representing three species of the Choanephoraceae (Blakeslea trispora, Choanephora infundibulifera and Poitrasia circinans). Sequences of the amplified DNA fragments were determined and analysed. G. persicaria belongs to the monogeneric family (Gilbertellaceae), however, originally it was described as Choanephora persicaria. The goal of this study was to reveal the phylogenetic relationship among fungi belonging to Gilbertellaceae, Choanephoraceae and Mucoraceae. Our results support that the "intermediate" position of this family is between Choanephoraceae and Mucoraceae.

  5. Probing the phylogenetic relationships of a few newly recorded intertidal zoanthids of Gujarat coast (India) with mtDNA COI sequences.

    Science.gov (United States)

    Joseph, Sneha; Poriya, Paresh; Kundu, Rahul

    2016-11-01

    The present study reports the phylogenetic relationship of six zoanthid species belonging to three genera, Isaurus, Palythoa, and Zoanthus identified using systematic computational analysis of mtDNA gene sequences. All six species are first recorded from the coasts of Kathiawar Peninsula, India. Genus: Isaurus is represented by Isaurus tuberculatus, genus Zoanthus is represented by Zoanthus kuroshio and Zoanthus sansibaricus, while genus Palythoa is represented by Palythoa tuberculosa, P. sp. JVK-2006 and Palythoa heliodiscus. Results of the present study revealed that among the various species observed along the coastline, a minimum of 99% sequence divergence and a maximum of 96% sequence divergence were seen. An interspecific divergence of 1-4% and negligible intraspecific divergence was observed. These results not only highlighted the efficiency of the COI gene region in species identification but also demonstrated the genetic variability of zoanthids along the Saurashtra coastline of the west coast of India.

  6. Long-term recall of social relationships related to addiction and HIV risk behaviors.

    Science.gov (United States)

    Stout, R L; Janssen, T; Braciszewski, J M; Vose-O'Neal, A

    2017-08-01

    Social relationships have been demonstrated as a key predictor of relapse among addicted persons and are likely to be important determinants of HIV risk behaviors also. However, the degree to which this population can reliably and consistently identify important people (IPs) in retrospect has been understudied. Using the modified Important People and Activities questionnaire, we investigated to what degree IPs were dropped, added, or retained, and whether data about individual IPs were reported accurately on 6- and 12-month follow up periods using a sample of 50 drug or alcohol abusing participants. We found that IPs were largely retained, and that those retained versus dropped/added differed by their reaction to participant alcohol/drug use, as well as frequency of contact. We further found that there were differences in reliability of data describing specific IPs. While both 6- and 12-month follow up periods led to reliabilities ranging from excellent to fair, we found poorer reliability on responses to recall of "frequency of contact" and "reactions to drinking", as well as "reactions to drug use". Future investigations of reliability of social relationships recalled retrospectively should attempt to examine possible systematic biases in addition to the reliability of specific IP data. More sophisticated studies are needed on factors associated with systematic variation in reporting of aspects of social relationships that are associated with addictions or HIV risk outcomes. Copyright © 2017 Elsevier B.V. All rights reserved.

  7. Relationship between hunger, adherence to antiretroviral therapy and plasma HIV RNA suppression among HIV-positive illicit drug users in a Canadian setting.

    Science.gov (United States)

    Anema, Aranka; Kerr, Thomas; Milloy, M-J; Feng, Cindy; Montaner, Julio S G; Wood, Evan

    2014-04-01

    Food insecurity may be a barrier to achieving optimal HIV treatment-related outcomes among illicit drug users. This study therefore, aimed to assess the impact of severe food insecurity, or hunger, on plasma HIV RNA suppression among illicit drug users receiving antiretroviral therapy (ART). A cross-sectional Multivariate logistic regression model was used to assess the potential relationship between hunger and plasma HIV RNA suppression. A sample of n = 406 adults was derived from a community-recruited open prospective cohort of HIV-positive illicit drug users, in Vancouver, British Columbia (BC), Canada. A total of 235 (63.7%) reported "being hungry and unable to afford enough food," and 241 (59.4%) had plasma HIV RNA hunger was associated with lower odds of plasma HIV RNA suppression (Odds Ratio = 0.59, 95% confidence interval [CI]: 0.39-0.90, p = 0.015). In multivariate analyses, this association was no longer significant after controlling for socio-demographic, behavioral, and clinical characteristics, including 95% adherence (Adjusted Odds Ratio [AOR] = 0.65, 95% CI: 0.37-1.10, p = 0.105). Multivariate models stratified by 95% adherence found that the direction and magnitude of this association was not significantly altered by the adherence level. Hunger was common among illicit drug users in this setting. Although, there was an association between hunger and lower likelihood of plasma HIV RNA suppression, this did not persist in adjusted analyses. Further research is warranted to understand the social-structural, policy, and physical factors shaping the HIV outcomes of illicit drug users.

  8. Relationships among Childhood Trauma, Posttraumatic Stress Disorder and Dissociation in Men Living with HIV/AIDS

    Science.gov (United States)

    Kamen, Charles; Bergstrom, Jessica; Koopman, Cheryl; Lee, Susanne; Gore-Felton, Cheryl

    2012-01-01

    This study examined the relationships among dissociation, childhood trauma and sexual abuse, and posttraumatic stress disorder (PTSD) symptoms in HIV-positive men. Data was collected from 167 men enrolled in a randomized clinical trial (Project RISE) that examined a group therapy intervention to decrease HIV-related risk behavior and trauma-related stress symptoms. Participants completed the Trauma History Questionnaire, the Impact of Event Scale - Revised, and the Stanford Acute Stress Reaction Questionnaire. Overall, 35.3% of the participants reported having experienced childhood sexual abuse (CSA). A total of 55.7% of the sample met diagnostic criteria for PTSD. The intensity of dissociative symptoms that participants endorsed was positively associated with experience of childhood sexual abuse (r = .20, p Dissociative symptoms were also positively associated with specific PTSD symptoms, notably hyperarousal (r = .69, p dissociation than childhood sexual abuse. These results suggest that childhood sexual abuse may be involved in the development of dissociative symptoms in the context of adulthood stress reactions. Furthermore, the pattern of the association between dissociation and PTSD is consistent with the possibility of a dissociative PTSD subtype among HIV-positive men. PMID:22211444

  9. The emergence of lobsters: phylogenetic relationships, morphological evolution and divergence time comparisons of an ancient group (decapoda: achelata, astacidea, glypheidea, polychelida).

    Science.gov (United States)

    Bracken-Grissom, Heather D; Ahyong, Shane T; Wilkinson, Richard D; Feldmann, Rodney M; Schweitzer, Carrie E; Breinholt, Jesse W; Bendall, Matthew; Palero, Ferran; Chan, Tin-Yam; Felder, Darryl L; Robles, Rafael; Chu, Ka-Hou; Tsang, Ling-Ming; Kim, Dohyup; Martin, Joel W; Crandall, Keith A

    2014-07-01

    Lobsters are a ubiquitous and economically important group of decapod crustaceans that include the infraorders Polychelida, Glypheidea, Astacidea and Achelata. They include familiar forms such as the spiny, slipper, clawed lobsters and crayfish and unfamiliar forms such as the deep-sea and "living fossil" species. The high degree of morphological diversity among these infraorders has led to a dynamic classification and conflicting hypotheses of evolutionary relationships. In this study, we estimated phylogenetic relationships among the major groups of all lobster families and 94% of the genera using six genes (mitochondrial and nuclear) and 195 morphological characters across 173 species of lobsters for the most comprehensive sampling to date. Lobsters were recovered as a non-monophyletic assemblage in the combined (molecular + morphology) analysis. All families were monophyletic, with the exception of Cambaridae, and 7 of 79 genera were recovered as poly- or paraphyletic. A rich fossil history coupled with dense taxon coverage allowed us to estimate and compare divergence times and origins of major lineages using two drastically different approaches. Age priors were constructed and/or included based on fossil age information or fossil discovery, age, and extant species count data. Results from the two approaches were largely congruent across deep to shallow taxonomic divergences across major lineages. The origin of the first lobster-like decapod (Polychelida) was estimated in the Devonian (∼409-372 Ma) with all infraorders present in the Carboniferous (∼353-318 Ma). Fossil calibration subsampling studies examined the influence of sampling density (number of fossils) and placement (deep, middle, and shallow) on divergence time estimates. Results from our study suggest including at least 1 fossil per 10 operational taxonomic units (OTUs) in divergence dating analyses. [Dating; decapods; divergence; lobsters; molecular; morphology; phylogenetics.]. © The

  10. The social determinants of HIV serostatus in sub-Saharan Africa: an inverse relationship between poverty and HIV?

    Science.gov (United States)

    Fox, Ashley M

    2010-01-01

    Contrary to theories that poverty acts as an underlying driver of human immunodeficiency virus (HIV) infection in sub-Saharan Africa (SSA), an increasing body of evidence at the national and individual levels indicates that wealthier countries, and wealthier individuals within countries, are at heightened risk for HIV. This article reviews the literature on what has increasingly become known as the positive-wealth gradient in HIV infection in SSA, or the counterintuitive finding that the poor do not have higher rates of HIV. This article also discusses the programmatic and theoretical implications of the positive HIV-wealth gradient for traditional behavioral interventions and the social determinants of health literature, and concludes by proposing that economic and social policies be leveraged as structural interventions to prevent HIV in SSA.

  11. Phylogenetic relationships and pathogenicity variation of two Newcastle disease viruses isolated from domestic ducks in Southern China.

    Science.gov (United States)

    Kang, Yinfeng; Li, Yanling; Yuan, Runyu; Li, Xianwei; Sun, Minhua; Wang, Zhaoxiong; Feng, Minsha; Jiao, Peirong; Ren, Tao

    2014-08-12

    Newcastle disease (ND) is an OIE listed disease caused by virulent avian paramyxovirus type 1 (APMV-1) strains, which is enzootic and causes large economic losses in the poultry sector. Genotype VII and genotype IX NDV viruses were the predominant circulating genotype in China, which may possibly be responsible for disease outbreaks in chicken flocks in recent years. While ducks and geese usually have exhibited inapparent infections. In the present study, we investigate the complete genome sequence, the clinicopathological characterization and transmission of two virulent Newcastle disease viruses, SS-10 and NH-10, isolated from domestic ducks in Southern China in 2010. F, and the complete gene sequences based on phylogenetic analysis demonstrated that SS-10 (genotype VII) and NH-10 (genotype IX) belongs to class II. The deduced amino acid sequence was (112)R-R-Q-K/R-R-F(117) at the fusion protein cleavage site. Animal experiment results showed that the SS-10 virus isolated from ducks was highly pathogenic for chickens and geese, but low pathogenic for ducks. It could be detected from spleen, lung, kidney, trachea, small intestine, bursa of fabricius, thymus, pancreas and cecal tonsils, oropharyngeal and cloacal swabs, and could transmit to the naive contact birds. Moreover, it could transmit to chickens, ducks and geese by naive contact. However, the NH-10 virus isolated from ducks could infect some chickens, ducks and geese, but only caused chickens to die. Additionally, it could transmit to the naive contact chickens, ducks, and geese. The two NDV isolates exhibited different biological properties with respect to pathogenicity and transmission in chickens, ducks and geese. Therefore, no species-preference exists for chicken, duck or goose viruses and more attention should be paid to the trans-species transmission of VII NDVs between ducks, geese and chickens for the control and eradication of ND.

  12. Bacterial Communities in Women with Bacterial Vaginosis: High Resolution Phylogenetic Analyses Reveal Relationships of Microbiota to Clinical Criteria

    Science.gov (United States)

    Srinivasan, Sujatha; Hoffman, Noah G.; Morgan, Martin T.; Matsen, Frederick A.; Fiedler, Tina L.; Hall, Robert W.; Ross, Frederick J.; McCoy, Connor O.; Bumgarner, Roger; Marrazzo, Jeanne M.; Fredricks, David N.

    2012-01-01

    Background Bacterial vaginosis (BV) is a common condition that is associated with numerous adverse health outcomes and is characterized by poorly understood changes in the vaginal microbiota. We sought to describe the composition and diversity of the vaginal bacterial biota in women with BV using deep sequencing of the 16S rRNA gene coupled with species-level taxonomic identification. We investigated the associations between the presence of individual bacterial species and clinical diagnostic characteristics of BV. Methodology/Principal Findings Broad-range 16S rRNA gene PCR and pyrosequencing were performed on vaginal swabs from 220 women with and without BV. BV was assessed by Amsel’s clinical criteria and confirmed by Gram stain. Taxonomic classification was performed using phylogenetic placement tools that assigned 99% of query sequence reads to the species level. Women with BV had heterogeneous vaginal bacterial communities that were usually not dominated by a single taxon. In the absence of BV, vaginal bacterial communities were dominated by either Lactobacillus crispatus or Lactobacillus iners. Leptotrichia amnionii and Eggerthella sp. were the only two BV-associated bacteria (BVABs) significantly associated with each of the four Amsel’s criteria. Co-occurrence analysis revealed the presence of several sub-groups of BVABs suggesting metabolic co-dependencies. Greater abundance of several BVABs was observed in Black women without BV. Conclusions/Significance The human vaginal bacterial biota is heterogeneous and marked by greater species richness and diversity in women with BV; no species is universally present. Different bacterial species have different associations with the four clinical criteria, which may account for discrepancies often observed between Amsel and Nugent (Gram stain) diagnostic criteria. Several BVABs exhibited race-dependent prevalence when analyzed in separate groups by BV status which may contribute to increased incidence of BV in

  13. Genes versus environment: geography and phylogenetic relationships shape the chemical profiles of stingless bees on a global scale

    Science.gov (United States)

    Leonhardt, Sara D.; Rasmussen, Claus; Schmitt, Thomas

    2013-01-01

    Chemical compounds are highly important in the ecology of animals. In social insects, compounds on the body surface represent a particularly interesting trait, because they comprise different compound classes that are involved in different functions, such as communication, recognition and protection, all of which can be differentially affected by evolutionary processes. Here, we investigate the widely unknown and possibly antagonistic influence of phylogenetic and environmental factors on the composition of the cuticular chemistry of tropical stingless bees. We chose stingless bees because some species are unique in expressing not only self-produced compounds, but also compounds that are taken up from the environment. By relating the cuticular chemistry of 40 bee species from all over the world to their molecular phylogeny and geographical occurrence, we found that distribution patterns of different groups of compounds were differentially affected by genetic relatedness and biogeography. The ability to acquire environmental compounds was, for example, highly correlated with the bees' phylogeny and predominated in evolutionarily derived species. Owing to the presence of environmentally derived compounds, those species further expressed a higher chemical and thus functional diversity. In Old World species, chemical similarity of both environmentally derived and self-produced compounds was particularly high among sympatric species, even when they were less related to each other than to allopatric species, revealing a strong environmental effect even on largely genetically determined compounds. Thus, our findings do not only reveal an unexpectedly strong influence of the environment on the cuticular chemistry of stingless bees, but also demonstrate that even within one morphological trait (an insect's cuticular profile), different components (compound classes) can be differentially affected by different drivers (relatedness and biogeography), depending on the

  14. Genotyping of Capreolus pygargus fossil DNA from Denisova cave reveals phylogenetic relationships between ancient and modern populations.

    Directory of Open Access Journals (Sweden)

    Nadezhda V Vorobieva

    Full Text Available BACKGROUND: The extant roe deer (Capreolus Gray, 1821 includes two species: the European roe deer (C. capreolus and the Siberian roe deer (C. pygargus that are distinguished by morphological and karyotypical differences. The Siberian roe deer occupies a vast area of Asia and is considerably less studied than the European roe deer. Modern systematics of the Siberian roe deer remain controversial with 4 morphological subspecies. Roe deer fossilized bones are quite abundant in Denisova cave (Altai Mountains, South Siberia, where dozens of both extant and extinct mammalian species from modern Holocene to Middle Pleistocene have been retrieved. METHODOLOGY/PRINCIPAL FINDINGS: We analyzed a 629 bp fragment of the mitochondrial control region from ancient bones of 10 Holocene and four Pleistocene Siberian roe deer from Denisova cave as well as 37 modern specimen belonging to populations from Altai, Tian Shan (Kyrgyzstan, Yakutia, Novosibirsk region and the Russian Far East. Genealogical reconstructions indicated that most Holocene haplotypes were probably ancestral for modern roe deer populations of Western Siberia and Tian Shan. One of the Pleistocene haplotypes was possibly ancestral for modern Yakutian populations, and two extinct Pleistocene haplotypes were close to modern roe deer from Tian Shan and Yakutia. Most modern geographical populations (except for West Siberian Plains are heterogeneous and there is some tentative evidence for structure. However, we did not find any distinct phylogenetic signal characterizing particular subspecies in either modern or ancient samples. CONCLUSION/SIGNIFICANCE: Analysis of mitochondrial DNA from both ancient and modern samples of Siberian roe deer shed new light on understanding the evolutionary history of roe deer. Our data indicate that during the last 50,000 years multiple replacements of populations of the Siberian roe deer took place in the Altai Mountains correlating with climatic changes. The Siberian

  15. Social support among HIV-positive and HIV-negative adolescents in Umlazi, South Africa: changes in family and partner relationships during pregnancy and the postpartum period.

    Science.gov (United States)

    Hill, Lauren M; Maman, Suzanne; Groves, Allison K; Moodley, Dhayendre

    2015-05-17

    Pregnancy is common among adolescents in South Africa, yet the social experiences of adolescents during the pregnancy and postpartum period remain understudied in this context. We aimed to explore how adolescent women's discovery and disclosure of both their pregnancy and HIV status affected their relationships with family members and sexual partners, with a particular focus on whether and how support changed throughout this time period. We conducted in-depth semi-structured interviews with 15 HIV-positive and HIV-negative adolescent women who were either pregnant or had delivered in the last 18 months from one urban clinic in Umlazi, South Africa. Interviews were audiotaped, transcribed, translated, and coded for analysis. Young women described stress and instability in their relationships with family and partners during pregnancy and the postpartum period, though prior to and during HIV-status disclosure women generally experienced less stress than in disclosing their pregnancy to family members and partners. After a destabilizing period immediately following pregnancy disclosure, families became and remained the primary source of material and emotional support for the young women. Women discussed heightened closeness with their partners during pregnancy, but few women had close relationships with their partners postpartum. Support experiences did not differ by HIV status. Programs should be aware of the relative importance of pregnancy-related concerns over HIV-related concerns in this population of young women. Engaging family members is critical in ensuring social support for this population of young pregnant women, and in encouraging timely initiation of antenatal care.

  16. [Adherence as a result of a "particular relationship". HIV-infected patients about their physician-patient relationship].

    Science.gov (United States)

    Engelbach, Ute; Dannecker, Martin; Kaufhold, Johannes; Lenz, Cynthia; Grabhorn, Ralph

    2008-06-01

    This qualitative study examines the relationship between doctors and HIV-infected patients with regard to problems of adherence. Objective hermeneutics was used to analyze the scene of a doctor-patient conversation produced through psychodrama. Specific traits shared by the patients in question were a confused regulation of closeness and distance as well as a non-maintenance of the traditional asymmetry within the doctor-patient relation. The patients faced the doctors on a level of diffuse social relations and showed the tendency to involve the doctor into their community. The conclusion for a model explaining patients' adherence may be: it exist an individual level of the need for being accepted by the doctor as somebody particular. If this level is reached, i. e. individual claims are met and personal desires are satisfied, the patient will follow the physician's advice. Authors discuss whether the model is compatible with the conflict of self-esteem.

  17. HIV Infection Disrupts the Sympatric Host–Pathogen Relationship in Human Tuberculosis

    Science.gov (United States)

    Fenner, Lukas; Egger, Matthias; Bodmer, Thomas; Furrer, Hansjakob; Ballif, Marie; Battegay, Manuel; Helbling, Peter; Fehr, Jan; Gsponer, Thomas; Rieder, Hans L.; Zwahlen, Marcel; Hoffmann, Matthias; Bernasconi, Enos; Cavassini, Matthias; Calmy, Alexandra; Dolina, Marisa; Frei, Reno; Janssens, Jean-Paul; Borrell, Sonia; Stucki, David; Schrenzel, Jacques; Böttger, Erik C.; Gagneux, Sebastien

    2013-01-01

    The phylogeographic population structure of Mycobacterium tuberculosis suggests local adaptation to sympatric human populations. We hypothesized that HIV infection, which induces immunodeficiency, will alter the sympatric relationship between M. tuberculosis and its human host. To test this hypothesis, we performed a nine-year nation-wide molecular-epidemiological study of HIV–infected and HIV–negative patients with tuberculosis (TB) between 2000 and 2008 in Switzerland. We analyzed 518 TB patients of whom 112 (21.6%) were HIV–infected and 233 (45.0%) were born in Europe. We found that among European-born TB patients, recent transmission was more likely to occur in sympatric compared to allopatric host–pathogen combinations (adjusted odds ratio [OR] 7.5, 95% confidence interval [95% CI] 1.21–infinity, p = 0.03). HIV infection was significantly associated with TB caused by an allopatric (as opposed to sympatric) M. tuberculosis lineage (OR 7.0, 95% CI 2.5–19.1, p<0.0001). This association remained when adjusting for frequent travelling, contact with foreigners, age, sex, and country of birth (adjusted OR 5.6, 95% CI 1.5–20.8, p = 0.01). Moreover, it became stronger with greater immunosuppression as defined by CD4 T-cell depletion and was not the result of increased social mixing in HIV–infected patients. Our observation was replicated in a second independent panel of 440 M. tuberculosis strains collected during a population-based study in the Canton of Bern between 1991 and 2011. In summary, these findings support a model for TB in which the stable relationship between the human host and its locally adapted M. tuberculosis is disrupted by HIV infection. PMID:23505379

  18. Integrating HIV Prevention and Relationship Education for Young Same-Sex Male Couples: A Pilot Trial of the 2GETHER Intervention.

    Science.gov (United States)

    Newcomb, Michael E; Macapagal, Kathryn R; Feinstein, Brian A; Bettin, Emily; Swann, Gregory; Whitton, Sarah W

    2017-08-01

    Young men who have sex with men are at high risk for HIV, and most new HIV infections occur in serious relationships. This pilot study assessed the feasibility, acceptability and preliminary efficacy of the 2GETHER couples-based HIV prevention and relationship education intervention for young same-sex male couples. We enrolled 57 young male couples (N = 114) into a four-session hybrid group and individual intervention. We assessed acceptability via post-session surveys and exit interviews, and we examined preliminary efficacy at a two week posttest. The vast majority of participants (93%) reported exclusively positive impressions of 2GETHER, and all components received high mean ratings. We observed decreases in HIV risk behavior, increases in information, motivation and behavioral skills related to HIV prevention, and improvement in relationship investment between pretest and posttest. Integrating relationship education and sexual health programming may be an effective way to reduce HIV transmissions in young male couples.

  19. ANALYSIS OF HIV SUBTYPES AND CLINICAL STAGING OF HIV DISEASE/AIDS IN EAST JAVA

    Directory of Open Access Journals (Sweden)

    Yulia Ismail

    2012-04-01

    Full Text Available Human Immunodeficiency Virus type 1 (HIV-1 known to cause Acquired Immune Deficiency Syndrome (AIDS disease are divided into several subtypes (A, B, C, D, F, G, H, J, K and Circulating Recombinant Form (CRF. Different characteristics of subtype of the virus and its interaction with the host can affect the severity of the disease. This study was to analyze HIV-1 subtypes circulating in HIV/AIDS patients from the East Java region descriptively and to analyze its relationship with clinical stadiums of HIV/AIDS. Information from this research was expected to complement the data of mocular epidemiology of HIV in Indonesia. This study utilited blood plasma from patients who had been tested to be HIV positive who sected treatment to or were reffered to the Intermediate Care Unit of Infectious Disease (UPIPI Dr. Soetomo Hospital Surabaya from various area representing the East Java regions. Plasma was separated from blood samples by centrifugation for use in the the molecular biology examination including RNA extraction, nested PCR using specific primer for HIV gp120 env gene region, DNA purifying, DNA sequencing, and homology and phylogenetic analysis. Based on the nucleotide sequence of the HIV gp120 env gene, it was found that the most dominant subtypes in East Java were in one group of Circulating Recombinant Form (CRF that is CRF01_AE, CRF33_01B and CRF34_01B which was also found in Southeast Asia. In the phylogenetic tree, most of HIV samples (30 samples are in the same branch with CRF01_AE, CRF33_01B and CRF34_01B, except for one sample (HIV40 which is in the same branch with subtype B. HIV subtypes are associated with clinical stadiums (disease severity since samples from different stages of HIV disease have the same subtype.

  20. Molecular characterization and phylogenetic relationship of wild type 1 poliovirus strains circulating across Pakistan and Afghanistan bordering areas during 2010-2012.

    Directory of Open Access Journals (Sweden)

    Shahzad Shaukat

    Full Text Available Pakistan and Afghanistan share a long uncontrolled border with extensive population movement on both sides. Wild poliovirus transmission has never been interrupted in this block due to war against terrorism, poor public health infrastructure, misconceptions about polio vaccines and inadequate immunization activities. All these issues complicate the eradication operations and reinforce the complexity of wiping out poliomyelitis from this region. This study illustrates the origins and routes of cross-border wild poliovirus type 1 (WPV1 transmission during 2010-2012 between Pakistan and Afghanistan. Sequence analyses were conducted based on complete VP1 capsid protein sequences for WPV1 study strains to determine the origin of poliovirus genetic lineages and their evolutionary relationships. Phylogenetic tree was constructed from VP1 gene sequences applying Maximum Likelihood method using Kimura 2- parameter model in MEGA program v 5.0. A total of 72 (14.3% out of 502 wild-type 1 polioviruses were found circulating in border areas of both countries during 2010-2012. Molecular phylogenetic analysis classified these strains in to two sub-genotypes with four clusters and 18 lineages. Genetic data confirmed that the most of WPV1 lineages (12; 66.6% were transmitted from Pakistan to Afghanistan. However, the genetic diversity was significantly reduced during 2012 as most of the lineages were completely eliminated. In conclusion, Pakistan-Afghanistan block has emerged as a single poliovirus reservoir sharing the multiple poliovirus lineages due to uncontrolled movement of people across the borders between two countries. If it is neglected, it can jeopardize the extensive global efforts done so-far to eradicate the poliovirus infection. Our data will be helpful to devise the preventive strategies for effective control of wild poliovirus transmission in this region.

  1. Molecular characterization and phylogenetic relationships among microsporidian isolates infecting silkworm, Bombyx mori using small subunit rRNA (SSU-rRNA) gene sequence analysis.

    Science.gov (United States)

    Nath, B Surendra; Gupta, S K; Bajpai, A K

    2012-12-01

    The life cycle, spore morphology, pathogenicity, tissue specificity, mode of transmission and small subunit rRNA (SSU-rRNA) gene sequence analysis of the five new microsporidian isolates viz., NIWB-11bp, NIWB-12n, NIWB-13md, NIWB-14b and NIWB-15mb identified from the silkworm, Bombyx mori have been studied along with type species, NIK-1s_mys. The life cycle of the microsporidians identified exhibited the sequential developmental cycles that are similar to the general developmental cycle of the genus, Nosema. The spores showed considerable variations in their shape, length and width. The pathogenicity observed was dose-dependent and differed from each of the microsporidian isolates; the NIWB-15mb was found to be more virulent than other isolates. All of the microsporidians were found to infect most of the tissues examined and showed gonadal infection and transovarial transmission in the infected silkworms. SSU-rRNA sequence based phylogenetic tree placed NIWB-14b, NIWB-12n and NIWB-11bp in a separate branch along with other Nosema species and Nosema bombycis; while NIWB-15mb and NIWB-13md together formed another cluster along with other Nosema species. NIK-1s_mys revealed a signature sequence similar to standard type species, N. bombycis, indicating that NIK-1s_mys is similar to N. bombycis. Based on phylogenetic relationships, branch length information based on genetic distance and nucleotide differences, we conclude that the microsporidian isolates identified are distinctly different from the other known species and belonging to the genus, Nosema. This SSU-rRNA gene sequence analysis method is found to be more useful approach in detecting different and closely related microsporidians of this economically important domestic insect.

  2. First time molecular detection and phylogenetic relationships of torque teno sus virus 1 and 2 in domestic pigs in Uganda: further evidence for a global distribution

    Directory of Open Access Journals (Sweden)

    Brink Matilda

    2012-02-01

    Full Text Available Abstract Background Torque teno sus virus 1 (TTSuV1 and 2 (TTSuV2 are small, single-stranded circular DNA viruses belonging to the Anelloviridae family. Available studies clearly show that both viruses are widely distributed in the pig populations in America, Europe and Asia, although the impact of the infection is still unclear. Currently, the situation in domestic pig populations on the African continent is not known. Therefore, the aim of this study was to investigate the possible presence of the two viruses in domestic pigs in Uganda, and describe the phylogenetic relationships to those in the rest of the world. Results Ninety-five serum samples from six districts in Uganda were used, and PCR using TTSuV1 and 2 specific primers for the UTR region was run for viral nucleic acid detection. The positive samples were sequenced, and phylogenetic analyses performed in order to compare the Ugandan sequences with sequences from other parts of the world. The prevalence of TTSuV1 and 2 in the selected domestic pigs were estimated at 16.8% and 48.4% respectively, with co-infection found in 13.7%. The sequence identity was 90-100% between the Ugandan TTSuV1; and 63-100% between the Ugandan TTSuV2 sequences. Conclusion This is the first report on the presence of TTSuV1 and 2 in domestic pigs in Uganda. These results highlight the importance of screening for emerging viruses given the globalisation of human activities.

  3. Visualizing phylogenetic tree landscapes.

    Science.gov (United States)

    Wilgenbusch, James C; Huang, Wen; Gallivan, Kyle A

    2017-02-02

    Genomic-scale sequence alignments are increasingly used to infer phylogenies in order to better understand the processes and patterns of evolution. Different partitions within these new alignments (e.g., genes, codon positions, and structural features) often favor hundreds if not thousands of competing phylogenies. Summarizing and comparing phylogenies obtained from multi-source data sets using current consensus tree methods discards valuable information and can disguise potential methodological problems. Discovery of efficient and accurate dimensionality reduction methods used to display at once in 2- or 3- dimensions the relationship among these competing phylogenies will help practitioners diagnose the limits of current evolutionary models and potential problems with phylogenetic reconstruction methods when analyzing large multi-source data sets. We introduce several dimensionality reduction methods to visualize in 2- and 3-dimensions the relationship among competing phylogenies obtained from gene partitions found in three mid- to large-size mitochondrial genome alignments. We test the performance of these dimensionality reduction methods by applying several goodness-of-fit measures. The intrinsic dimensionality of each data set is also estimated to determine whether projections in 2- and 3-dimensions can be expected to reveal meaningful relationships among trees from different data partitions. Several new approaches to aid in the comparison of different phylogenetic landscapes are presented. Curvilinear Components Analysis (CCA) and a stochastic gradient decent (SGD) optimization method give the best representation of the original tree-to-tree distance matrix for each of the three- mitochondrial genome alignments and greatly outperformed the method currently used to visualize tree landscapes. The CCA + SGD method converged at least as fast as previously applied methods for visualizing tree landscapes. We demonstrate for all three mtDNA alignments that 3D

  4. Phylogenetic relationships among Brazilian howler monkeys, genus Alouatta (Platyrrhini, Atelidae, based on g1-globin pseudogene sequences

    Directory of Open Access Journals (Sweden)

    Carla Maria Meireles

    1999-09-01

    Full Text Available The genus Alouatta (howler monkeys is the most widely distributed of New World primates, and has been arranged in three species groups: the Central American Alouatta palliata group and the South American Alouatta seniculus and Alouatta caraya groups. While the latter is monotypic, the A. seniculus group encompasses at least three species (A. seniculus, A. belzebul and A. fusca. In the present study, approximately 600 base pairs of the g1-globin pseudogene were sequenced in the four Brazilian species (A. seniculus, A. belzebul, A. fusca and A. caraya. Maximum parsimony and maximum likelihood methods yielded phylogenetic trees with the same arrangement: {A. caraya [A. seniculus (A. fusca, A. belzebul]}. The most parsimonious tree had bootstrap values greater than 82% for all groupings, and strength of grouping values of at least 2, supporting the sister clade of A. fusca and A. belzebul. The study also confirmed the presence of a 150-base pair Alu insertion element and a 1.8-kb deletion in the g1-globin pseudogene in A. fusca, features found previously in the remaining three species. The cladistic classification based on molecular data agrees with those of morphological studies, with the monospecific A. caraya group being clearly differentiated from the A. seniculus group.Os guaribas, do gênero Alouatta, que são os primatas do Novo Mundo com maior distribuição geográfica, têm sido colocados em três grupos de espécies: o grupo Alouatta palliata da América central, e os grupos sulamericanos Alouatta seniculus e Alouatta caraya. Este último é monotípico, mas o grupo A. seniculus inclui pelo menos três espécies (A. seniculus, A. belzebul e A. fusca. Neste estudo, foram seqüenciados aproximadamente 600 pares de base do pseudogene globina g1 nas quatro espécies brasileiras (A. seniculus, A. belzebul, A. fusca e A. caraya. Os métodos de máxima parcimônia e máxima verossimilhança produziram árvores filogenéticas com o mesmo arranjo

  5. Gender role and relationship norms among young adults in South Africa: measuring the context of masculinity and HIV risk.

    Science.gov (United States)

    Harrison, Abigail; O'Sullivan, Lucia F; Hoffman, Susie; Dolezal, Curtis; Morrell, Robert

    2006-07-01

    In the global literature on HIV/AIDS, much attention has been paid to the role of gender inequalities in facilitating the transmission of HIV. For women, gender inequality may be manifested in sexual coercion, reduced negotiating power and partnering with older men, all practices that heighten risk for HIV. Less attention, however, has been paid to how men's relationship behaviors may place them at risk for HIV. Using six culturally specific psychometric scales developed in South Africa, this study examined men's and women's gender role and relationship norms, attitudes and beliefs in the context of ongoing partnerships. These measures were then examined in relation to four sexual risk behaviors: frequency of condom use (with primary or secondary partners) and number of partners (last 3 months and lifetime). Participants were 101 male and 199 female young adults aged, 18-24, recruited from a secondary school in northern KwaZulu/Natal province. Associations between gender and relationship scale scores and sexual risk outcomes yielded both expected and contradictory findings. For men, more frequent condom use was associated with higher levels of partner attachment (hyper-romanticism) but also with stronger approval of relationship violence and dominant behavior. In contrast, for women, more frequent condom use was correlated with a lower endorsement of relationship violence. Men with lower relationship power scores had fewer sexual partners in the preceding 3 months, while women with more egalitarian sexual scripts reported more sexual partners, as did those with higher hyper-romanticism scores. In logistic regression analysis, more egalitarian relationship norms among men were predictive of less consistent condom use, as were higher relationship power scores for women. These findings are discussed in relation to previous research on gender, heterosexual interactions and masculinity in this area, as well as the implications for HIV prevention programs.

  6. From GRID to gridlock: the relationship between scientific biomedical breakthroughs and HIV/AIDS policy in the US Congress.

    Science.gov (United States)

    Platt, Matthew B; Platt, Manu O

    2013-11-27

    From the travel ban on people living with HIV (PLHIV) to resistance to needle exchange programmes, there are many examples where policy responses to HIV/AIDS in the United States seem divorced from behavioural, public health and sociological evidence. At its root, however, the unknowns about HIV/AIDS lie at biomedical science, and scientific researchers have made tremendous progress over the past 30 years of the epidemic by using antiretroviral therapy to increase the life expectancy of PLHIV almost to the same level as non-infected individuals; but a relationship between biomedical science discoveries and congressional responses to HIV/AIDS has not been studied. Using quantitative approaches, we directly examine the hypothesis that progress in HIV/AIDS biomedical science discoveries would have a correlative relationship with congressional response to HIV/AIDS from 1981 to 2010. This study used original data on every bill introduced, hearing held and law passed by the US Congress relating to HIV/AIDS over 30 years (1981-2010). We combined congressional data with the most cited and impactful biomedical research scientific publications over the same time period as a metric of biomedical science breakthroughs. Correlations between congressional policy and biomedical research were then analyzed at the aggregate and individual levels. Biomedical research advancements helped shape both the level and content of bill sponsorship on HIV/AIDS, but they had no effect on other stages of the legislative process. Examination of the content of bills and biomedical research indicated that science helped transform HIV/AIDS bill sponsorship from a niche concern of liberal Democrats to a bipartisan coalition when Republicans became the majority party. The trade-off for that expansion has been an emphasis on the global epidemic to the detriment of domestic policies and programmes. Breakthroughs in biomedical science did associate with the number and types of HIV/AIDS bills introduced

  7. Revisiting the Housing-Health Relationship for HIV-Positive Persons: Qualitative Evidence From the Lower Manya Krobo District, Ghana.

    Science.gov (United States)

    Teye-Kau, Mabel; Tenkorang, Eric Y; Adjei, Paul B

    2018-03-01

    The relationship between housing and HIV infection is complex. On one hand, poor housing arrangements may affect the health of persons living with HIV/AIDS (PLWHAs). On the other hand, PLWHAs may be more likely to live in substandard homes because of their health. We used qualitative in-depth individual interviews of 38 PLWHAs attending voluntary counseling services at two government hospitals in the Lower Manya Krobo District (LMKD) in the Eastern region of Ghana to examine their housing and health outcomes. Results show that the majority of PLWHAs lived in homes that lacked basic amenities, were overcrowded, had structural deficiencies, and were noisy and dirty. They suffered from poor housing conditions mainly because of their HIV serostatus, as this affected their ability to finance adequate homes, while HIV-related stigmatization led to eviction from either family homes or rented facilities.

  8. Phylogenetic relationships among domesticated and wild species of Cucurbita (Cucurbitaceae) inferred from a mitochondrial gene: Implications for crop plant evolution and areas of origin.

    Science.gov (United States)

    Sanjur, Oris I; Piperno, Dolores R; Andres, Thomas C; Wessel-Beaver, Linda

    2002-01-08

    We have investigated the phylogenetic relationships among six wild and six domesticated taxa of Cucurbita using as a marker an intron region from the mitochondrial nad1 gene. Our study represents one of the first successful uses of a mtDNA gene in resolving inter- and intraspecific taxonomic relationships in Angiosperms and yields several important insights into the origins of domesticated Cucurbita. First, our data suggest at least six independent domestication events from distinct wild ancestors. Second, Cucurbita argyrosperma likely was domesticated from a wild Mexican gourd, Cucurbita sororia, probably in the same region of southwest Mexico that gave rise to maize. Third, the wild ancestor of Cucurbita moschata is still unknown, but mtDNA data combined with other sources of information suggest that it will probably be found in lowland northern South America. Fourth, Cucurbita andreana is supported as the wild progenitor of Cucurbita maxima, but humid lowland regions of Bolivia in addition to warmer temperate zones in South America from where C. andreana was originally described should possibly be considered as an area of origin for C. maxima. Fifth, our data support other molecular results that indicate two separate domestications in the Cucurbita pepo complex. The potential zone of domestication for one of the domesticated subspecies, C. pepo subsp. ovifera, includes eastern North America and should be extended to northeastern Mexico. The wild ancestor of the other domesticated subspecies, C. pepo subsp. pepo, is undiscovered but is closely related to C. pepo subsp. fraterna and possibly will be found in southern Mexico.

  9. Phylogenetic relationships and cryptic species diversity in the Brazilian egg-brooding tree frog, genus Fritziana Mello-Leitão 1937 (Anura: Hemiphractidae).

    Science.gov (United States)

    Walker, Marina; Lyra, Mariana L; Haddad, Célio F B

    2018-06-01

    The genus Fritziana (Anura: Hemiphractidae) comprises six described species (F. goeldii, F. ohausi, F. fissilis, F. ulei, F. tonimi, and F. izecksohni) that are endemic to the Brazilian Atlantic Forest. Although the genus has been the subject of studies dealing with its taxonomy, phylogeny, and systematics, there is considerable evidence for cryptic diversity hidden among the species. The present study aims to understand the genetic diversity and phylogenetic relationships among the species of Fritziana, as well as the relationships among populations within species. We analyzed 107 individuals throughout the distribution of the genus using three mitochondrial gene fragments (12S, 16S, and COI) and two nuclear genes (RAG1 and SLC8A3). Our data indicated that the species diversity in the genus Fritziana is underestimated by the existence of at least three candidate species hidden amongst the group of species with a closed dorsal pouch (i.e. F. fissilis and F. ulei). We also found four species presenting geographical population structures and high genetic diversity, and thus require further investigations. In addition, we found that two candidate species show a new arrangement for the tRNA-Phe gene, unique in Anura so far. Based on our results, we suggest that the conservation status of the species, as well as the species diversity in the genus Fritziana, needs to be reviewed. Copyright © 2018 Elsevier Inc. All rights reserved.

  10. The phylogenetic relationships among germplasm resources of wild ramie (boehmeria nivea l. gaud) in china based on trnl-f and its sequences

    International Nuclear Information System (INIS)

    Runqing, Y.; Baloch, S.U.; Lijun, L.; Dingxiang, P.

    2015-01-01

    Ramie (Boehmeria nivea L. Gaud) is an important fiber crop in China, which also possesses many wild species in genus Boehmeria Jacq. However, the taxonomic position of these species has not been settled. To determine the evolutionary relationships among the members of the genus Boehmeria, the combination of ITS and trnL-F sequences were used for molecular phylogenetic analyses of 31 ramie accessions (28 species and three varieties) including multiple materials collected in high-altitude regions that have not been previously reported (B. clidemioides var. diffusa, B. bicuspis and B. longispica). The ITS and trnL-F trees produced showed that Boehmeria was classified into four separate clusters. The Sect. Duretia, which has a high evolutionary level, clustered with Sects Zoilingeriana and Phyllostachys. The grouping pattern of clustering differed from traditional taxonomy and indicated possible interspecific hybridization among Boehmeria. We found that B. malabarica Wedd. var. leioclada of Sect. Boehmeria clustered into a clade with Sect. Tilocnide, providing solid support for the expansion of wild ramie core germplasm resources. The molecular results did not support the intraspecific geographic migration of Boehmeria. This study, therefore, established relationships among wild species which will help in ramie crop improvement programs. The results will be important for the collection and conservation of germplasm resources of Chinese wild ramie. (author)

  11. The phylogenetic relationships of insectivores with special reference to the lesser hedgehog tenrec as inferred from the complete sequence of their mitochondrial genome.

    Science.gov (United States)

    Nikaido, Masato; Cao, Ying; Okada, Norihiro; Hasegawa, Masami

    2003-02-01

    The complete mitochondrial genome of a lesser hedgehog tenrec Echinops telfairi was determined in this study. It is an endemic African insectivore that is found specifically in Madagascar. The tenrec's back is covered with hedgehog-like spines. Unlike other spiny mammals, such as spiny mice, spiny rats, spiny dormice and porcupines, lesser hedgehog tenrecs look amazingly like true hedgehogs (Erinaceidae). However, they are distinguished morphologically from hedgehogs by the absence of a jugal bone. We determined the complete sequence of the mitochondrial genome of a lesser hedgehog tenrec and analyzed the results phylogenetically to determine the relationships between the tenrec and other insectivores (moles, shrews and hedgehogs), as well as the relationships between the tenrec and endemic African mammals, classified as Afrotheria, that have recently been shown by molecular analysis to be close relatives of the tenrec. Our data confirmed the afrotherian status of the tenrec, and no direct relation was recovered between the tenrec and the hedgehog. Comparing our data with those of others, we found that within-species variations in the mitochondrial DNA of lesser hedgehog tenrecs appear to be the largest recognized to date among mammals, apart from orangutans, which might be interesting from the view point of evolutionary history of tenrecs on Madagascar.

  12. Type and severity of intimate partner violence and its relationship with PTSD in HIV-infected women.

    Science.gov (United States)

    Hansrod, Fatima; Spies, Georgina; Seedat, Soraya

    2015-01-01

    HIV has an impact on the presence and severity of both intimate partner violence (IPV) and posttraumatic stress disorder (PTSD) in infected women. However, the relationship of type and severity of IPV with PTSD in this population has not been adequately explored. We focus on the association between the type and severity of IPV and HIV status and PTSD in a sample of South African women. One hundred and sixty-nine women (114 HIV-positive and 55 HIV-negative controls), matched for geographical area, education, and socio-economic status, were recruited from HIV clinics. Clinical and demographic data were collected, including data on childhood trauma, other traumatic life events, IPV, posttraumatic stress symptoms, problematic alcohol use, and depressive symptoms. HIV-positive women had significantly more depressive symptoms, alcohol abuse, and childhood trauma exposure as well as significantly higher rates of PTSD (25.4%) when compared with uninfected women (10.9%). No significant group differences in the rate, pattern, and severity of physical, sexual, psychological, injury, and negotiation IPV were found. In logistic regression analysis, the rate and severity category of IPV did not significantly predict PTSD in HIV-positive women when childhood trauma and life events were controlled for. Our results indicate the need for screening for alcohol abuse, PTSD and depressive symptoms at HIV wellness, and ARV clinics. The high rates of PTSD in HIV-positive women indicate the need for specialized programs to manage PTSD and minimize negative sequelae in this population. These results also highlight the need for improved screening and prevention of childhood trauma and IPV both in infected and uninfected women.

  13. Relationship between HIV risk perception and condom use: Evidence from a population-based survey in Mozambique.

    Science.gov (United States)

    Prata, Ndola; Morris, Leo; Mazive, Elizio; Vahidnia, Farnaz; Stehr, Mark

    2006-12-01

    The relationship between individuals' perception of their risk for acquiring HIV and their use of condoms is poorly understood. Understanding this relationship is crucial to the development of effective strategies to fight HIV and AIDS. Data from the Mozambique 2001 Adolescent and Young Adult Reproductive Health and Behavior Risk Survey are used to compare 15-24-year-olds' assessments of their HIV risk with assessments based on current and past sexual behavior. In bivariate and probit regression analyses, the relationship between correct risk assessment and the likelihood of condom use at last intercourse is examined. Twenty-seven percent of women and 80% of men who considered themselves to have no risk or a small risk of contracting HIV were actually at moderate or high risk. For both men and women, the prevalence of condom use at last sex was more than twice as high among those who assessed their risk correctly (30% and 16%, respectively) as among those who did not (14% and 6%). Multivariate analysis showed that correct assessment was positively associated with condom use; the association was driven by use among never-married individuals. Never-married males who assessed their risk correctly were 18% more likely than other males to report condom use; never-married females, 17% more likely than other females. Educational messages should aim at enabling individuals to correctly assess their own HIV risk and encouraging behavior change based on self-assessment of risk.

  14. Phylogenetic relationships of Iranian infectious hematopoietic necrosis virus of rainbow trout (Oncorhynchus mykiss) based on the glycoprotein gene

    Science.gov (United States)

    Adel, Milad; Amiri, Alireza Babaalian; Dada, Maryam; Kurath, Gael; Laktarashi, Bahram; Ghajari, Amrolah; Breyta, Rachel

    2016-01-01

    Infectious hematopoietic necrosis virus (IHNV), a member of family Rhabdoviridae and genus Novirhabdoviridae, causes a highly lethal disease of salmon and trout. In Iran IHNV was first detected in 2001 on farms rearing rainbow trout (Oncorhynchus mykiss). To evaluate the genetic relationships of IHNV from northern and western Iran, the sequences of a 651-nt region of the glycoprotein gene were determined for two Iranian isolates. These sequences were analyzed to evaluate their genetic relatedness to worldwide isolates representing the five known genogroups of IHNV. Iranian isolates were most closely related to European isolates within the genogroup E rather than those of North American genogroups U, M and L, or the Asian genogroup J. It appears that Iranian IHNV was most likely introduced to Iran from a source in Europe by the movement of contaminated fish eggs.

  15. Detection, Prevalence and Phylogenetic Relationships of Demodex spp and further Skin Prostigmata Mites (Acari, Arachnida) in Wild and Domestic Mammals.

    Science.gov (United States)

    Sastre, Natalia; Francino, Olga; Curti, Joseph N; Armenta, Tiffany C; Fraser, Devaughn L; Kelly, Rochelle M; Hunt, Erin; Silbermayr, Katja; Zewe, Christine; Sánchez, Armand; Ferrer, Lluís

    2016-01-01

    This study was conceived to detect skin mites in social mammals through real-time qPCR, and to estimate taxonomic Demodex and further Prostigmata mite relationships in different host species by comparing sequences from two genes: mitochondrial 16S rRNA and nuclear 18S rRNA. We determined the mite prevalence in the hair follicles of marmots (13%) and bats (17%). The high prevalence found in marmots and bats by sampling only one site on the body may indicate that mites are common inhabitants of their skin. Since we found three different mites (Neuchelacheles sp, Myobia sp and Penthaleus sp) in three bat species (Miotis yumanensis, Miotis californicus and Corynorhinus townsendii) and two different mites (both inferred to be members of the Prostigmata order) in one marmot species (Marmota flaviventris), we tentatively concluded that these skin mites 1) cannot be assigned to the same genus based only on a common host, and 2) seem to evolve according to the specific habitat and/or specific hair and sebaceous gland of the mammalian host. Moreover, two M. yumanensis bats harbored identical Neuchelacheles mites, indicating the possibility of interspecific cross-infection within a colony. However, some skin mites species are less restricted by host species than previously thought. Specifically, Demodex canis seems to be more transmissible across species than other skin mites. D. canis have been found mostly in dogs but also in cats and captive bats. In addition, we report the first case of D. canis infestation in a domestic ferret (Mustela putorius). All these mammalian hosts are related to human activities, and D. canis evolution may be a consequence of this relationship. The monophyletic Demodex clade showing closely related dog and human Demodex sequences also supports this likely hypothesis.

  16. Detection, Prevalence and Phylogenetic Relationships of Demodex spp and further Skin Prostigmata Mites (Acari, Arachnida in Wild and Domestic Mammals.

    Directory of Open Access Journals (Sweden)

    Natalia Sastre

    Full Text Available This study was conceived to detect skin mites in social mammals through real-time qPCR, and to estimate taxonomic Demodex and further Prostigmata mite relationships in different host species by comparing sequences from two genes: mitochondrial 16S rRNA and nuclear 18S rRNA. We determined the mite prevalence in the hair follicles of marmots (13% and bats (17%. The high prevalence found in marmots and bats by sampling only one site on the body may indicate that mites are common inhabitants of their skin. Since we found three different mites (Neuchelacheles sp, Myobia sp and Penthaleus sp in three bat species (Miotis yumanensis, Miotis californicus and Corynorhinus townsendii and two different mites (both inferred to be members of the Prostigmata order in one marmot species (Marmota flaviventris, we tentatively concluded that these skin mites 1 cannot be assigned to the same genus based only on a common host, and 2 seem to evolve according to the specific habitat and/or specific hair and sebaceous gland of the mammalian host. Moreover, two M. yumanensis bats harbored identical Neuchelacheles mites, indicating the possibility of interspecific cross-infection within a colony. However, some skin mites species are less restricted by host species than previously thought. Specifically, Demodex canis seems to be more transmissible across species than other skin mites. D. canis have been found mostly in dogs but also in cats and captive bats. In addition, we report the first case of D. canis infestation in a domestic ferret (Mustela putorius. All these mammalian hosts are related to human activities, and D. canis evolution may be a consequence of this relationship. The monophyletic Demodex clade showing closely related dog and human Demodex sequences also supports this likely hypothesis.

  17. Modeling the Relationship Between Trauma and Psychological Distress Among HIV-Positive and HIV-Negative Women

    OpenAIRE

    Delany-Brumsey, A; Joseph, NT; Myers, HF; Ullman, JB; Wyatt, GE

    2013-01-01

    This study investigated the association between cumulative exposure to multiple traumatic events and psychological distress, as mediated by problematic substance use and impaired psychosocial resources. A sample of HIV-positive and HIV-negative women were assessed for a history of childhood and adult sexual abuse and non-sexual trauma as predictors of psychological distress (i.e., depression, non-specific anxiety, and posttraumatic stress), as mediated by problematic alcohol and drug use and ...

  18. Depression and Social Context: Primary Supporter Relationship Factors Associated with Depressive Symptoms among a Disadvantaged Population with HIV/AIDS

    Science.gov (United States)

    Knowlton, Amy R.; Curry, Aaron; Hua, Wei; Wissow, Lawrence

    2009-01-01

    Social support is associated with better health outcomes among chronically ill individuals, yet support receipt can be stressful. The study examined supporter relationship factors, among n = 156 main-supporter-HIV+support-recipient dyads, associated with recipient's depression (CES-D greater than or equal to 16). Results indicated that support…

  19. Relationship of Stigma and Depression Among Newly HIV-Diagnosed Chinese Men Who Have Sex with Men.

    Science.gov (United States)

    Tao, Jun; Wang, Lijuan; Kipp, Aaron M; Qian, Han-Zhu; Yin, Lu; Ruan, Yuhua; Shao, Yiming; Lu, Hongyan; Vermund, Sten H

    2017-01-01

    Little is known about the relationship between HIV stigma and depression among newly diagnosed HIV-infected men who have sex with men (MSM). We measured HIV-related stigma and current depression using standard scales among 367 Chinese MSM who had been diagnosed very recently with HIV infection, analyzing key associations with multivariable ordinal logistic regression. Current depression prevalence was 36 %. Median scores for felt, vicarious, and internalized stigma were 17, 2, and 5, respectively, each on a 0-30 scale. A one-point increase in the total stigma score was associated with a 4 % increase in the odds of current depression [adjusted odds ratio (aOR) = 1.04, 95 % confidence interval (CI) 1.03-1.05]. Internalized stigma had the strongest association with depression (aOR = 1.09, 95 % CI 1.07-1.12). Effective interventions to address coping with HIV-related stigma immediately following HIV-diagnosis might help reduce depression, improve long-term mental health, and improve engagement in their care.

  20. The relationship between HIV and AIDS and water scarcity in Nyamakate resettlements land, north-central Zimbabwe.

    Science.gov (United States)

    Mbereko, Alexio; Scott, Dianne; John Chimbari, Moses

    2016-12-01

    HIV and AIDS and water variability have been studied separately, yet, they impact on rural households simultaneously in an interactive manner. The study provide narratives on various realities from a study in the Nyamakate community that illustrates the dialectical relationship between HIV and AIDS and water scarcity. A qualitative research methodology was employed, and the following data collection tools were used: semi-structured interviews, focus group discussions (FGDs) and participant observations. The study showed that in the Nyamakate area, HIV- and AIDS-affected households utilise more water if there is a bedridden patient. Such households utilise an average of 145 litres per day and reported a water shortage of 103 litres per day. Although community rules and customs stipulate that water should be accessible to everyone, exclusion of HIV- and AIDS-affected households is underlined by cultural issues, scorn at poor levels of hygiene, infectious opportunistic infections and labour shortage, which limited access to water points by households directly affected by HIV and AIDS. In cases where women were overwhelmed with caregiving roles, men fetch water. We conclude that HIV and AIDS and water scarcity are dialectically related and hence should be considered in an interactive manner in order to understand the challenges faced by affected households.

  1. Phylogenetic relationships among extinct and extant turtles: the position of Pleurodira and the effects of the fossils on rooting crown-group turtles

    NARCIS (Netherlands)

    Sterli, J.

    2010-01-01

    The origin and evolution of the crown-group of turtles (Cryptodira + Pleurodira) is one of the most interesting topics in turtle evolution, second perhaps only to the phylogenetic position of turtles among amniotes. The present contribution focuses on the former problem, exploring the phylogenetic

  2. Patient-provider relationship predicts mental and physical health indicators for HIV-positive men who have sex with men.

    Science.gov (United States)

    Bankoff, Sarah M; McCullough, Mary B; Pantalone, David W

    2013-06-01

    We used secondary data analysis to examine associations among aspects of patient-provider relationships and mental and physical health indicators. Positive patient perceptions of patient-provider relationships were associated with fewer mental health symptoms in this outpatient sample of HIV-positive men who have sex with men (N = 171). Regression analyses revealed the role of anxiety and depression in explaining associations between two aspects of patient-provider relationships (i.e. quality of information offered and provider interactional style) and health-related quality of life. The findings demonstrated the importance of patient-provider relationships to improving physical health and functioning and maintaining engagement in care, among HIV-positive men who have sex with men.

  3. Phylogenetic analysis of HIV-1 reverse transcriptase sequences from 382 patients recruited in JJ Hospital of Mumbai, India, between 2002 and 2008.

    Science.gov (United States)

    Deshpande, Alaka; Jauvin, Valerie; Pinson, Patricia; Jeannot, Anne Cecile; Fleury, Herve J

    2009-06-01

    Analysis of reverse transcriptase (RT) sequences of 382 HIV-1 isolates from untreated and treated patients recruited in JJ Hospital (Mumbai, India) between 2002 and 2008 shows that subtype C is largely predominant (98%) and that non-C sequences cluster with A1, B, CRF01_AE, and CRF06_cpx.

  4. Impact of CCR5delta32 Host Genetic Background and Disease Progression on HIV-1 Intrahost Evolutionary Processes: Efficient Hypothesis Testing through Hierarchical Phylogenetic Models

    NARCIS (Netherlands)

    Edo-Matas, Diana; Lemey, Philippe; Tom, Jennifer A.; Serna-Bolea, Cèlia; van den Blink, Agnes E.; van 't Wout, Angélique B.; Schuitemaker, Hanneke; Suchard, Marc A.

    2011-01-01

    The interplay between C-C chemokine receptor type 5 (CCR5) host genetic background, disease progression, and intrahost HIV-1 evolutionary dynamics remains unclear because differences in viral evolution between hosts limit the ability to draw conclusions across hosts stratified into clinically

  5. 'Love and trust, you can be blinded': HIV risk within relationships among Latina women in Miami, Florida.

    Science.gov (United States)

    Ibañez, Gladys E; Whitt, Elaine; Avent, Tenesha; Martin, Steve S; Varga, Leah M; Cano, Miguel A; O'Connell, Daniel J

    2017-10-01

    Latina women are disproportionately affected by HIV in the US, and account for 30% of all HIV infections in Miami-Dade County, Florida. The main risk for Latina women is heterosexual contact. Little is known about the relational and cultural factors that may impact women's HIV risk perception. This study aims to describe Latina women's perception of their HIV risk within a relational, cultural, and linguistic context. Eight focus groups of Latina women (n = 28), four English speaking groups and four Spanish speaking groups, were conducted between December 2013 and May 2014. Women were recruited from a diversion program for criminal justice clients and by word of mouth. Eligibility criteria included the following: self-identify as Hispanic/Latino, 18-49 years of age, and self-identify as heterosexual. A two-level open coding analytic approach was conducted to identify themes across groups. Most participants were foreign-born (61%) and represented the following countries: Cuba (47%), Honduras (17.5%), Mexico (12%), as well as Nicaragua, Puerto Rico, Colombia, and Venezuela (15%). Participant ages ranged between 18 and 49, with a mean age of 32 years. Relationship factors were important in perceiving HIV risk including male infidelity, women's trust in their male partners, relationship type, and getting caught up in the heat of the moment. For women in the English speaking groups, drug use and trading sex for drugs were also reasons cited for putting them at risk for HIV. English speaking women also reported that women should take more responsibility regarding condom use. Findings emphasize the importance of taking relational and cultural context into account when developing HIV prevention programs for Latina women. Interventions targeting English speaking Latina women should focus on women being more proactive in their sexual health; interventions focused on Spanish speaking women might target their prevention messages to either men or couples.

  6. The relationship between HIV and fertility in the era of antiretroviral therapy in sub-Saharan Africa: evidence from 49 Demographic and Health Surveys.

    Science.gov (United States)

    Marston, M; Zaba, B; Eaton, J W

    2017-12-01

    To describe regional differences in the relative fertility of HIV-positive vs. HIV-negative women and changes as antiretroviral treatment (ART) is scaled up, to improve estimates of predicted need for and coverage of prevention of mother-to-child transmission services at national and subnational levels. We analysed 49 nationally representative household surveys in sub-Saharan Africa between 2003 and 2016 to estimate fertility rate ratios of HIV-positive and HIV-negative women by age using exponential regression and test for regional and urban/rural differences. We estimated the association between national ART coverage and the relationship between HIV and fertility. Significant regional differences exist in HIV and fertility relationships, with less HIV-associated subfertility in Southern Africa. Age patterns of relative fertility are similar. HIV impact on fertility is weaker in urban than rural areas. For women below age 30, regional and urban/rural differences are largely explained by differences in age at sexual debut. Higher levels of national ART coverage were associated with slight attenuation of the relationship between HIV and fertility. Regional differences in HIV-associated subfertility and urban-rural differences in age patterns of relative fertility should be accounted for when predicting need for and coverage of PMTCT services at national and subnational level. Although HIV impacts on fertility are somewhat reduced at higher levels of national ART coverage, differences in fertility between HIV positive and negative remain, and fertility of women on ART should not be assumed to be the same as HIV-negative women. There were few data in recent years, when ART has reached high levels, and this relationship should continue to be assessed as further evidence becomes available. © 2017 The Authors. Tropical Medicine & International Health Published by John Wiley & Sons Ltd.

  7. First amplification of Eimeria hessei DNA from the lesser horseshoe bat (Rhinolophus hipposideros) and its phylogenetic relationships with Eimeria species from other bats and rodents.

    Science.gov (United States)

    Afonso, Eve; Baurand, Pierre-Emmanuel; Tournant, Pierline; Capelli, Nicolas

    2014-04-01

    Although coccidian parasites of the genus Eimeria are among the best-documented parasites in bats, few Eimeria species found in bats have been characterised using molecular tools, and none of the characterised species are found in European countries. Phylogenetic relationships of Eimeria species that parasitise bats and rodents can be related to the morphology of oocysts, independently from host range, suggesting that these species are derived from common ancestors. In the present study, we isolated a partial sequence of the Eimeria hessei 18S rRNA gene from the lesser horseshoe bat (Rhinolophus hipposideros), a European bat species. Droppings from lesser horseshoe bats were collected from 11 maternity roosts located in France that were positive for the presence of the parasite. Through morphological characterisation, the oocysts detected in the lesser horseshoe bat droppings were confirmed to be E. hessei. The unique E. hessei sequence obtained through molecular analysis belonged to a clade that includes both rodent and bat Eimeria species. However, the E. hessei oocysts isolated from the bat droppings did not show morphological similarities to rodent Eimeria species. Copyright © 2014 Elsevier Inc. All rights reserved.

  8. Genetic divergence and phylogenetic relationships in grey mullets (Teleostei: Mugilidae) based on PCR-RFLP analysis of mtDNA segments.

    Science.gov (United States)

    Papasotiropoulos, V; Klossa-Kilia, E; Kilias, G; Alahiotis, S

    2002-04-01

    The genetic differentiation and phylogenetic relationships among five species of the Mugilidae family (Mugil cephalus, Chelon labrosus, Liza aurata, Liza ramada, and Liza saliens) were investigated at the mtDNA level, on samples taken from Messolongi lagoon-Greece. RFLP analysis of three PCR-amplified mtDNA gene segments (12s rRNA, 16s rRNA, and CO I) was used. Ten, eight, and nine restriction enzymes were found to have at least one recognition site at 12s rRNA, 16s rRNA, and CO I genes, respectively. Several fragment patterns were revealed to be species-specific, and thus they could be useful in species taxonomy as diagnostic markers, as well as for further evolutionary studies. Seven different haplotypes were detected. The greatest amount of genetic differentiation was observed at the interspecific level, while little variation was revealed at the intraspecific level. The highest values of nucleotide sequence divergence were observed between M. cephalus and all the other species, while the lowest was found between C. labrosus and L. saliens. Dendrograms obtained by the three different methods (UPGMA, Neighbor-Joining, and Dollo parsimony), were found to exhibit in all cases the same topology. According to this, the most distinct species is M. cephalus, while the other species are clustered in two separate groups, thefirst one containing L. aurata and L. ramada, the other L. saliens and C. labrosus. This last clustering makes the monophyletic origin of the genus Liza questionable.

  9. An appraisal of the phylogenetic relationships of Hypoptopomatini cascudinhos with description of two new genera and three new species (Siluriformes: Loricariidae

    Directory of Open Access Journals (Sweden)

    Maria Laura S. Delapieve

    2017-12-01

    Full Text Available ABSTRACT The discovery of three new taxa of Hypoptotopomatini with ambiguous generic assignment prompted a reanalysis of the phylogenetic relationships of the tribe. The analysis focused on a data matrix of 56 terminals and 107 morphological characters comprising the three new taxa, most species of Hypoptopoma and Otocinclus, and all other species of the tribe. The 162 maximally parsimonious trees of 382 steps, consistency index of 0.41, and retention index of 0.83 were then summarized in a strict consensus tree. The results confirm the monophyly of the Hypoptopomatini, recover four genera as monophyletic (Acestridium, Hypoptopoma, Niobichthys, and Otocinclus, revealed Hypoptopoma and Oxyropsis to be non-monophyletic; and revealed two new genera within Hypoptopomatini. Additionally, Otocinclus was found to be sister to a group with all remaining genera of the tribe; Acestridium and Niobichthys were found to be sister to each other and that clade sister to a group formed by ((Leptotocinclus + Hypoptopoma [part] + (Nannoxyropsis (Oxyropsis + Hypoptopoma [part]. Based on this framework, changes to the classification and the taxonomy of the Hypoptopomatini are suggested and the new taxa are described.

  10. Molecular differentiation and phylogenetic relationships of three Angiostrongylus species and Angiostrongylus cantonensis geographical isolates based on a 66-kDa protein gene of A. cantonensis (Nematoda: Angiostrongylidae).

    Science.gov (United States)

    Eamsobhana, Praphathip; Lim, Phaik Eem; Zhang, Hongman; Gan, Xiaoxian; Yong, Hoi Sen

    2010-12-01

    The phylogenetic relationships and molecular differentiation of three species of angiostrongylid nematodes (Angiostrongylus cantonensis, Angiostrongylus costaricensis and Angiostrongylus malaysiensis) were studied using the AC primers for a 66-kDa protein gene of A. cantonensis. The AC primers successfully amplified the genomic DNA of these angiostrongylid nematodes. No amplification was detected for the DNA of Ascaris lumbricoides, Ascaris suum, Anisakis simplex, Gnathostoma spinigerum, Toxocara canis, and Trichinella spiralis. The maximum-parsimony (MP) consensus tree and the maximum-likelihood (ML) tree both showed that the Angiostrongylus taxa could be divided into two major clades - Clade 1 (A. costaricensis) and Clade 2 (A. cantonensis and A. malaysiensis) with a full support bootstrap value. A. costaricensis is the most distant taxon. A. cantonensis is a sister group to A. malaysiensis; these two taxa (species) are clearly separated. There is no clear distinction between the A. cantonensis samples from four different geographical localities (Thailand, China, Japan and Hawaii); only some of the samples are grouped ranging from no support or low support to moderate support of bootstrap values. The published nucleotide sequences of A. cantonensis adult-specific native 66kDa protein mRNA, clone L5-400 from Taiwan (U17585) appear to be very distant from the A. cantonensis samples from Thailand, China, Japan and Hawaii, with the uncorrected p-distance values ranging from 26.87% to 29.92%.

  11. Testing the phylogenetic affinities of Southeast Asia's rarest geckos: Flap-legged geckos (Luperosaurus), Flying geckos (Ptychozoon) and their relationship to the pan-Asian genus Gekko.

    Science.gov (United States)

    Brown, Rafe M; Siler, Cameron D; Das, Indraneil; Min, Yong

    2012-06-01

    Some of Southeast Asia's most poorly known vertebrates include forest lizards that are rarely seen by field biologists. Arguably the most enigmatic of forest lizards from the Indo Australian archipelago are the Flap-legged geckos and the Flying geckos of the genera Luperosaurus and Ptychozoon. As new species have accumulated, several have been noted for their bizarre combination of morphological characteristics, seemingly intermediate between these genera and the pan-Asian gecko genus Gekko. We used the first multilocus phylogeny for these taxa to estimate their relationships, with particular attention to the phylogenetic placement of the morphologically intermediate taxa Ptychozoon rhacophorus, Luperosaurus iskandari, and L. gulat. Surprisingly, our results demonstrate that Luperosaurus is more closely related to Lepidodactylus and Pseudogekko than it is to Gekko but that some species currently classified as Luperosaurus are nested within Gekko. The Flying Gecko genus Ptychozoon is also nested within Gekko, suggesting that higher-level taxonomic revision of the generic boundaries within Southeast Asian gekkonines will be a priority for the immediate future. Copyright © 2012 Elsevier Inc. All rights reserved.

  12. Phylogenetic relationships among domesticated and wild species of Cucurbita (Cucurbitaceae) inferred from a mitochondrial gene: Implications for crop plant evolution and areas of origin

    Science.gov (United States)

    Sanjur, Oris I.; Piperno, Dolores R.; Andres, Thomas C.; Wessel-Beaver, Linda

    2002-01-01

    We have investigated the phylogenetic relationships among six wild and six domesticated taxa of Cucurbita using as a marker an intron region from the mitochondrial nad1 gene. Our study represents one of the first successful uses of a mtDNA gene in resolving inter- and intraspecific taxonomic relationships in Angiosperms and yields several important insights into the origins of domesticated Cucurbita. First, our data suggest at least six independent domestication events from distinct wild ancestors. Second, Cucurbita argyrosperma likely was domesticated from a wild Mexican gourd, Cucurbita sororia, probably in the same region of southwest Mexico that gave rise to maize. Third, the wild ancestor of Cucurbita moschata is still unknown, but mtDNA data combined with other sources of information suggest that it will probably be found in lowland northern South America. Fourth, Cucurbita andreana is supported as the wild progenitor of Cucurbita maxima, but humid lowland regions of Bolivia in addition to warmer temperate zones in South America from where C. andreana was originally described should possibly be considered as an area of origin for C. maxima. Fifth, our data support other molecular results that indicate two separate domestications in the Cucurbita pepo complex. The potential zone of domestication for one of the domesticated subspecies, C. pepo subsp. ovifera, includes eastern North America and should be extended to northeastern Mexico. The wild ancestor of the other domesticated subspecies, C. pepo subsp. pepo, is undiscovered but is closely related to C. pepo subsp. fraterna and possibly will be found in southern Mexico. PMID:11782554

  13. Phylogenetic analysis, genetic diversity and relationships between the recently segregated species of Corynandra and Cleoserrata from the genus Cleome using DNA barcoding and molecular markers.

    Science.gov (United States)

    Tamboli, Asif Shabodin; Patil, Swapnil Mahadeo; Gholave, Avinash Ramchandra; Kadam, Suhas Kishor; Kotibhaskar, Shreya Vijaykumar; Yadav, Shrirang Ramchandra; Govindwar, Sanjay Prabhu

    2016-01-01

    Cleome is the largest genus in the family Cleomaceae and it is known for its various medicinal properties. Recently, some species from the Cleome genus (Cleome viscosa, Cleome chelidonii, Cleome felina and Cleome speciosa) are split into genera Corynandra (Corynandra viscosa, Corynandra chelidonii, Corynandra felina), and Cleoserrata (Cleoserrata speciosa). The objective of this study was to obtain DNA barcodes for these species for their accurate identification and determining phylogenetic relationships. Out of 10 screened barcoding regions, rbcL, matK and ITS1 regions showed higher PCR efficiency and sequencing success. This study added matK, rbcL and ITS1 barcodes for the identification of Corynandra chelidonii, Corynandra felina, Cleome simplicifolia and Cleome aspera species in existing barcode data. Corynandra chelidonii and Corynandra felina species belong to the Corynandra genus, but they are not grouped with the Corynandra viscosa species, however clustered with the Cleome species. Molecular marker analysis showed 100% polymorphism among the studied plant samples. Diversity indices for molecular markers were ranged from He=0.1115-0.1714 and I=0.2268-0.2700, which indicates a significant amount of genetic diversity among studied species. Discrimination of the Cleome and Corynandra species from Cleoserrata speciosa was obtained by two RAPD primers (OPA-4 and RAPD-17) and two ISSR primers (ISSR-1 and ISSR-2). RAPD and ISSR markers are useful for the genetic characterization of these studied species. The present investigation will be helpful to understand the relationships of Cleome lineages with Corynandra and Cleoserrata species. Copyright © 2016 Académie des sciences. Published by Elsevier SAS. All rights reserved.

  14. Serological and virological survey of hepatitis E virus (HEV) in animal reservoirs from Uruguay reveals elevated prevalences and a very close phylogenetic relationship between swine and human strains.

    Science.gov (United States)

    Mirazo, Santiago; Gardinali, Noemí R; Cecilia, D'Albora; Verger, Lorenzo; Ottonelli, Florencia; Ramos, Natalia; Castro, Gustavo; Pinto, Marcelo A; Ré, Viviana; Pisano, Belén; Lozano, Alejandra; de Oliveira, Jaqueline Mendes; Arbiza, Juan

    2018-01-01

    Hepatitis E virus (HEV) infection is an issue of public health concern in high-income and non-endemic countries. Increasing evidence supports the hypothesis of a zoonotic route as the main mode of infection in this epidemiological setting, since the transmission of genotypes HEV-3 and HEV-4 from reservoirs to humans has been demonstrated. In America, studies have confirmed the circulation of HEV in pig herds but the zoonotic role of wild boars has never been evaluated. Uruguay has a high burden of HEV- associated acute hepatitis, and a close phylogenetic relationship was observed among human HEV-3 strains and European isolates detected in swine. However in this context, swine herds have never been surveyed. Herein is reported a survey of HEV in swine herds, pigs at slaughter-house and free-living wild boar populations. Two-hundred and twenty sera and 150 liver tissue samples from domestic pigs, and 140 sera from wild boars were tested for HEV by ELISA and PCR-based approaches. All tested swine farms resulted seropositive with an overall rate of 46.8%. In turn, 22.1% of the wild boars had anti-HEV antibodies. HEV RNA was detected in 16.6% and 9.3% of liver samples from slaughter-age pigs and adult wild boars sera, respectively. Three strains from domestic pig were also amplified by nested-PCR approaches. By contrast, none of the positive samples obtained from wild boars could be confirmed by nested-PCR. Phylogenetic analysis revealed a very high nucleotide identity among swine strains and sequences obtained from humans in Uruguay. Results showed that HEV is widely distributed among swine herds in Uruguay. Additionally, this study evidences for the first time in the American continent that wild boar populations are a reservoir for HEV, though its zoonotic role remains to be elucidated. Altogether, data presented here suggest a high zoonotic risk of HEV transmission from swine to humans. Copyright © 2017 Elsevier B.V. All rights reserved.

  15. Breast Cancer and HIV in Sub-Saharan Africa: A Complex Relationship

    OpenAIRE

    Surbhi Grover; Yehoda M. Martei; Priya Puri; Pooja Prabhakar; Miriam Mutebi; Onyinye D. Balogun; Aryeh J. Price; Alexandra H. Freeman; Mohan Narasimhamurthy; Danielle Rodin; Sarah Rayne; Nicola M. Zetola

    2017-01-01

    Introduction: The number and lifespan of individuals living with HIV have increased significantly with the scale-up of antiretroviral therapy. Furthermore, the incidence of breast cancer in women with HIV is growing, especially in sub-Saharan Africa (SSA). However, the association between HIV infection and breast cancer is not well understood. Methods: A literature search was performed to identify articles published in journals pertaining to breast cancer and HIV, with an emphasis on SSA. Sel...

  16. Power and the association with relationship quality in South African couples: Implications for HIV/AIDS interventions.

    Science.gov (United States)

    Conroy, Amy A; McGrath, Nuala; van Rooyen, Heidi; Hosegood, Victoria; Johnson, Mallory O; Fritz, Katherine; Marr, Alexander; Ngubane, Thulani; Darbes, Lynae A

    2016-03-01

    Power imbalances within sexual relationships have significant implications for HIV prevention in sub-Saharan Africa. Little is known about how power influences the quality of a relationship, which could be an important pathway leading to healthy behavior around HIV/AIDS. This paper uses data from 448 heterosexual couples (896 individuals) in rural KwaZulu-Natal, South Africa who completed baseline surveys from 2012 to 2014 as part of a couples-based HIV intervention trial. Using an actor-partner interdependence perspective, we assessed: (1) how both partners' perceptions of power influences their own (i.e., actor effect) and their partner's reports of relationship quality (i.e., partner effect); and (2) whether these associations differed by gender. We examined three constructs related to power (female power, male equitable gender norms, and shared power) and four domains of relationship quality (intimacy, trust, mutually constructive communication, and conflict). For actor effects, shared power was strongly and consistently associated with higher relationship quality across all four domains. The effect of shared power on trust, mutually constructive communication, and conflict were stronger for men than women. The findings for female power and male equitable gender norms were more mixed. Female power was positively associated with women's reports of trust and mutually constructive communication, but negatively associated with intimacy. Male equitable gender norms were positively associated with men's reports of mutually constructive communication. For partner effects, male equitable gender norms were positively associated with women's reports of intimacy and negatively associated with women's reports of conflict. Research and health interventions aiming to improving HIV-related behaviors should consider sources of shared power within couples and potential leverage points for empowerment at the couple level. Efforts solely focused on empowering women should also

  17. Power and the Association with Relationship Quality in South African Couples: Implications for HIV/AIDS Interventions

    Science.gov (United States)

    Conroy, Amy A.; McGrath, Nuala; van Rooyen, Heidi; Hosegood, Victoria; Johnson, Mallory O.; Fritz, Katherine; Marr, Alexander; Ngubane, Thulani; Darbes, Lynae A.

    2016-01-01

    Introduction Power imbalances within sexual relationships have significant implications for HIV prevention in sub-Saharan Africa. Little is known about how power influences the quality of a relationship, which could be an important pathway leading to healthy behavior around HIV/AIDS. Methods This paper uses data from 448 heterosexual couples (896 individuals) in rural KwaZulu-Natal, South Africa who completed baseline surveys from 2012–2014 as part of a couples-based HIV intervention trial. Using an actor-partner interdependence perspective, we assessed: (1) how both partners’ perceptions of power influences their own (i.e., actor effect) and their partner’s reports of relationship quality (i.e., partner effect); and (2) whether these associations differed by gender. We examined three constructs related to power (female power, male equitable gender norms, and shared power) and four domains of relationship quality (intimacy, trust, mutually constructive communication, and conflict). Results For actor effects, shared power was strongly and consistently associated with higher relationship quality across all four domains. The effect of shared power on trust, mutually constructive communication, and conflict were stronger for men than women. The findings for female power and male equitable gender norms were more mixed. Female power was positively associated with women’s reports of trust and mutually constructive communication, but negatively associated with intimacy. Male equitable gender norms were positively associated with men’s reports of mutually constructive communication. For partner effects, male equitable gender norms were positively associated with women’s reports of intimacy and negatively associated with women’s reports of conflict. Conclusions Research and health interventions aiming to improving HIV-related behaviors should consider sources of shared power within couples and potential leverage points for empowerment at the couple level

  18. A narrative analysis positioning HIV relative to personal (sexual) relationship challenges in an agony aunt column in the Western Cape, South Africa - Aunty Mona's "love advice".

    Science.gov (United States)

    Viljoen, Lario; Thorne, Marguerite; Thomas, Angelique; Bond, Virginia; Hoddinott, Graeme

    2016-01-01

    HIV prevalence and incidence in South Africa remain high, making HIV a part of everyday life. Community narratives on HIV treatment and prevention are important and influence official and unofficial health messaging and community perceptions and understandings of HIV. We explore how contributors and the columnist of an agony aunt column position HIV relative to choices made about love, partnership, and sex over three years. We analysed all columns of an agony aunt series (Antie Mona) published between December 2012 and November 2015. The column is published in a South African, Afrikaans-language newspaper "Son", prioritising sensationalist news items. Trends were identified through narrative analysis. Data were managed in ATLAS.ti and inductive, iterative coding conducted. It was found that letters to the agony aunt rarely refer to HIV directly (less than 7%). Euphemisms such as diseases of the flesh and the great flu were more commonly used instead of HIV or AIDS. Letters addressed HIV in three ways: direct references to experiences living with HIV; direct questions about HIV prevention; and scenarios where HIV could (from a public health perspective) have been the main concern, but everyday issues took precedence. The majority of letters fell into this latter category where the writers focused on the immediate concerns of good sexual relations, problems related to love and romantic relationships, good moral behaviour of others, and issues of oppressive life conditions rather than on HIV directly. The findings illustrate that informal, public contributions to health information, such as agony aunts, are important narratives that inform popular perspectives on HIV and health. A better appreciation of this context would allow health implementers to ensure that these role players receive updated health messaging to avoid the risk of HIV-related stigma where HIV is used as a moral rod to punish perceived moral transgressions.

  19. Phylogenetic relationships of Acheilognathidae (Cypriniformes: Cyprinoidea) as revealed from evidence of both nuclear and mitochondrial gene sequence variation: evidence for necessary taxonomic revision in the family and the identification of cryptic species.

    Science.gov (United States)

    Chang, Chia-Hao; Li, Fan; Shao, Kwang-Tsao; Lin, Yeong-Shin; Morosawa, Takahiro; Kim, Sungmin; Koo, Hyeyoung; Kim, Won; Lee, Jae-Seong; He, Shunping; Smith, Carl; Reichard, Martin; Miya, Masaki; Sado, Tetsuya; Uehara, Kazuhiko; Lavoué, Sébastien; Chen, Wei-Jen; Mayden, Richard L

    2014-12-01

    Bitterlings are relatively small cypriniform species and extremely interesting evolutionarily due to their unusual reproductive behaviors and their coevolutionary relationships with freshwater mussels. As a group, they have attracted a great deal of attention in biological studies. Understanding the origin and evolution of their mating system demands a well-corroborated hypothesis of their evolutionary relationships. In this study, we provide the most comprehensive phylogenetic reconstruction of species relationships of the group based on partitioned maximum likelihood and Bayesian methods using DNA sequence variation of nuclear and mitochondrial genes on 41 species, several subspecies and three undescribed species. Our findings support the monophyly of the Acheilognathidae. Two of the three currently recognized genera are not monophyletic and the family can be subdivided into six clades. These clades are further regarded as genera based on both their phylogenetic relationships and a reappraisal of morphological characters. We present a revised classification for the Acheilognathidae with five genera/lineages: Rhodeus, Acheilognathus (new constitution), Tanakia (new constitution), Paratanakia gen. nov., and Pseudorhodeus gen. nov. and an unnamed clade containing five species currently referred to as "Acheilognathus". Gene trees of several bitterling species indicate that the taxa are not monophyletic. This result highlights a potentially dramatic underestimation of species diversity in this family. Using our new phylogenetic framework, we discuss the evolution of the Acheilognathidae relative to classification, taxonomy and biogeography. Copyright © 2014 Elsevier Inc. All rights reserved.

  20. Phylogenetic relationships in Solanaceae and related species based on cpDNA sequence from plastid trnE-trnT region

    Directory of Open Access Journals (Sweden)

    Danila Montewka Melotto-Passarin

    2008-01-01

    Full Text Available Intergenic spacers of chloroplast DNA (cpDNA are very useful in phylogenetic and population genetic studiesof plant species, to study their potential integration in phylogenetic analysis. The non-coding trnE-trnT intergenic spacer ofcpDNA was analyzed to assess the nucleotide sequence polymorphism of 16 Solanaceae species and to estimate its ability tocontribute to the resolution of phylogenetic studies of this group. Multiple alignments of DNA sequences of trnE-trnT intergenicspacer made the identification of nucleotide variability in this region possible and the phylogeny was estimated by maximumparsimony and rooted with Convolvulaceae Ipomoea batatas, the most closely related family. Besides, this intergenic spacerwas tested for the phylogenetic ability to differentiate taxonomic levels. For this purpose, species from four other families wereanalyzed and compared with Solanaceae species. Results confirmed polymorphism in the trnE-trnT region at different taxonomiclevels.

  1. The relationship between social support and anxiety among caregivers of children in HIV-endemic South Africa.

    Science.gov (United States)

    Casale, Marisa; Wild, Lauren; Cluver, Lucie; Kuo, Caroline

    2014-01-01

    Caring for children can be a source of joy and fulfilment, but also a source of stress, especially for caregivers living with illness and/or coping with difficult socio-economic conditions. Risks for poor caregiver mental health are especially salient in many parts of southern Africa affected by a generalised HIV-epidemic, high rates of physical illness, difficult livelihood conditions and an increasing number of orphaned and vulnerable children in need of care. Given limited availability and low uptake of formal mental health services in South Africa, the potential protective role of informal community or "social" resources for caregiver populations requires greater attention. To our knowledge, this is the first study to quantitatively assess the relationship between social support and symptomatic anxiety among caregivers of children living in HIV-endemic southern African communities. The data are from household survey interviews with 2477 adult primary caregivers of children aged 10-17 years living in two (urban and rural) resource-deprived HIV-endemic South African communities. Hierarchical logistic regression analysis with interaction terms was conducted to assess whether HIV and other illness were significant stressors for caregiver anxiety, whether social support had main or stress-buffering protective effects on anxiety and whether gender moderated the association between social support and anxiety. Our findings showed significant main effects of social support on caregiver anxiety, but no evidence of stress-buffering effects of support or of gender moderating the support-anxiety relationship. This suggests that social support is a general mental health resource for both male and female caregivers of children in these HIV-endemic communities, regardless of whether they are facing specific stressors related to HIV or other illness. Our results highlight the importance of paying greater attention to the social environment when designing and implementing

  2. Examining relationships of intimate partner violence and food insecurity with HIV-related risk factors among young pregnant Liberian women.

    Science.gov (United States)

    Willie, Tiara C; Kershaw, Trace S; Callands, Tamora A

    2018-04-22

    Gender inequities place women at an increased risk for HIV acquisition, and this association may particularly disenfranchize young pregnant women. Intimate partner violence (IPV) and food insecurity may contribute to gender differences in power, thereby influencing HIV disparities between women and men. Factors influencing gender disparities in HIV are unique and country-specific within sub-Saharan Africa, yet these factors are understudied among women in Liberia. This paper sought to examine the unique contributions and intersections of intimate partner violence (IPV) and food insecurity with HIV-related risk factors among young pregnant women in Liberia. Between March 2016 and August 2016, cross-sectional data collected from 195 women aged 18-30, residing in Monrovia, Liberia who were receiving prenatal services were used to examine the independent and interaction effects of IPV and food insecurity on HIV-related risk factors (i.e., sexual partner concurrency, economically-motivated relationships). IPV (31.3%) and food insecurity (47.7%) were prevalent. Young women who experience IPV are more likely to report food insecurity (p insecurity were more likely to start a new relationship for economic support (ps insecurity were more likely to report engaging in transactional sex (ps insecurity (ps > 0.05). IPV and food insecurity each uniquely heighten young Liberian women's vulnerability to HIV. Intervention and policy efforts are need to promote and empower women's sexual health through integrated sexual and reproductive health services, and reduce IPV and food insecurity among pregnant Liberian women.

  3. The influence of molecular markers and methods on inferring the phylogenetic relationships between the representatives of the Arini (parrots, Psittaciformes), determined on the basis of their complete mitochondrial genomes.

    Science.gov (United States)

    Urantowka, Adam Dawid; Kroczak, Aleksandra; Mackiewicz, Paweł

    2017-07-14

    Conures are a morphologically diverse group of Neotropical parrots classified as members of the tribe Arini, which has recently been subjected to a taxonomic revision. The previously broadly defined Aratinga genus of this tribe has been split into the 'true' Aratinga and three additional genera, Eupsittula, Psittacara and Thectocercus. Popular markers used in the reconstruction of the parrots' phylogenies derive from mitochondrial DNA. However, current phylogenetic analyses seem to indicate conflicting relationships between Aratinga and other conures, and also among other Arini members. Therefore, it is not clear if the mtDNA phylogenies can reliably define the species tree. The inconsistencies may result from the variable evolution rate of the markers used or their weak phylogenetic signal. To resolve these controversies and to assess to what extent the phylogenetic relationships in the tribe Arini can be inferred from mitochondrial genomes, we compared representative Arini mitogenomes as well as examined the usefulness of the individual mitochondrial markers and the efficiency of various phylogenetic methods. Single molecular markers produced inconsistent tree topologies, while different methods offered various topologies even for the same marker. A significant disagreement in these tree topologies occurred for cytb, nd2 and nd6 genes, which are commonly used in parrot phylogenies. The strongest phylogenetic signal was found in the control region and RNA genes. However, these markers cannot be used alone in inferring Arini phylogenies because they do not provide fully resolved trees. The most reliable phylogeny of the parrots under study is obtained only on the concatenated set of all mitochondrial markers. The analyses established significantly resolved relationships within the former Aratinga representatives and the main genera of the tribe Arini. Such mtDNA phylogeny can be in agreement with the species tree, owing to its match with synapomorphic features in

  4. Phylogenetic relationships and generic delimitation of Eurasian Aster (Asteraceae: Astereae) inferred from ITS, ETS and trnL-F sequence data

    Science.gov (United States)

    Li, Wei-Ping; Yang, Fu-Sheng; Jivkova, Todorka; Yin, Gen-Shen

    2012-01-01

    Background and Aims The classification and phylogeny of Eurasian (EA) Aster (Asterinae, Astereae, Asteraceae) remain poorly resolved. Some taxonomists adopt a broad definition of EA Aster, whereas others favour a narrow generic concept. The present study aims to delimit EA Aster sensu stricto (s.s.), elucidate the phylogenetic relationships of EA Aster s.s. and segregate genera. Methods The internal and external transcribed spacers of nuclear ribosomal DNA and the plastid DNA trnL-F region were used to reconstruct the phylogeny of EA Aster through maximum parsimony and Bayesian analyses. Key Results The analyses strongly support an Aster clade including the genera Sheareria, Rhynchospermum, Kalimeris (excluding Kalimeris longipetiolata), Heteropappus, Miyamayomena, Turczaninowia, Rhinactinidia, eastern Asian Doellingeria, Asterothamnus and Arctogeron. Many well-recognized species of Chinese Aster s.s. lie outside of the Aster clade. Conclusions The results reveal that EA Aster s.s. is both paraphyletic and polyphyletic. Sheareria, Rhynchospermum, Kalimeris (excluding K. longipetiolata), Heteropappus, Miyamayomena, Turczaninowia, Rhinactinidia, eastern Asian Doellingeria, Asterothamnus and Arctogeron should be included in Aster, whereas many species of Chinese Aster s.s. should be excluded. The recircumscribed Aster should be divided into two subgenera and nine sections. Kalimeris longipetiolata, Aster batangensis, A. ser. Albescentes, A. series Hersileoides, a two-species group composed of A. senecioides and A. fuscescens, and a six-species group including A. asteroides, should be elevated to generic level. With the Aster clade, they belong to the Australasian lineages. The generic status of Callistephus should be maintained. Whether Galatella (including Crinitina) and Tripolium should remain as genera or be merged into a single genus remains to be determined. In addition, the taxonomic status of A. auriculatus and the A. pycnophyllus–A. panduratus clade remains

  5. Co-existence of Paragonimus harinasutai and Paragonimus bangkokensis metacercariae in fresh water crab hosts in central Viet Nam with special emphasis on their close phylogenetic relationship.

    Science.gov (United States)

    Doanh, Pham Ngoc; Hien, Hoang Van; Nonaka, Nariaki; Horii, Yoichiro; Nawa, Yukifumi

    2012-09-01

    During our epidemiological surveys for Paragonimus species in central Viet Nam, we found four morphologically different Paragonimus metacercariae in mountainous crabs. They were identified as metacercariae of Paragonimus westermani, P. bangkokensis, P. proliferus, and P. harinasutai in the order of their prevalence in crab hosts. This is the first discovery of P. harinasutai in Viet Nam, co-inhabiting with P. bangkokensis and other species. Metacercariae of P. harinasutai were given orally to a cat to obtain adult worms. Then, ITS2 and CO1 sequences of metacercariae and adults of P. harinasutai, and metacercariae of P. bangkokensis collected from the same place were determined for analyses of phylogenetic relationships to other P. harinasutai and P. bangkokensis populations as well as related species. The results of molecular analyses showed that P. harinasutai from Quang Binh province of central Viet Nam was almost completely identical with those from Vientiane, Lao PDR; P. bangkokensis from Quang Binh, Viet Nam was also almost completely identical with those from Lao PDR and from Quang Ninh province, Viet Nam. Except for one P. harinasutai isolate from China, all populations of P. harinasutai and P. bangkokensis from Thailand, Lao and Viet Nam make a single clade in both ITS2 and CO1 trees. In ITS2 sequences, AT deletion and ATC insertion were observed in some isolates of both species, indicating recent gene flow between P. harinasutai and P. bangkokensis. Moreover, because of their extremely high genetic similarities and their co-inhabitation in the same crab hosts found in Thailand, Lao PDR and Viet Nam, they should be considered as the sister species at the early stage of divergence. In addition, P. microrchis previously described from Yunnan, China should be placed as the synonym of P. harinasutai, because of their morphological and molecular similarities. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

  6. Amended diagnosis and redescription of Pristimantis marmoratus (Boulenger, 1900 (Amphibia: Craugastoridae, with a description of its advertisement call and notes on its breeding ecology and phylogenetic relationships

    Directory of Open Access Journals (Sweden)

    Philippe J.R. Kok

    2018-01-01

    Full Text Available The frog Pristimantis marmoratus was originally described as Hylodes marmoratus by George A. Boulenger in 1900 based on a single specimen reported to have been collected at the foot of Mount Roraima in Guyana in 1898. We herein discuss the exact location of the type locality of P. marmoratus and provide a redescription of the species based on new material from Kaieteur National Park and from the slopes of Maringma-tepui in Guyana. We also describe the previously unknown vocalization and breeding ecology of the species, and conducted an exploratory molecular analysis of the phylogenetic relationships within the genus Pristimantis represented by the members of the “unistrigatus species group” in the Guiana Shield. Pristimantis marmoratus is a small-sized species mainly distinguished from its known Guiana Shield congeners by the combination of F I < II, SVL ≤ 20.4 in males, presence of vocal slits in males, granular/pustulate dorsal skin with well-developed scapular ridges, basal webbing between fingers, fringes on fingers and toes, crossed iris, diffuse yellow or pale green wash on groin, and absence of flashy colour on axillary/pre-axillary region. The advertisement call consists of a single note repeated at a rate of ca 11 calls/min with a dominant frequency ranging from 2756 to 3101 Hz. Pristimantis marmoratus is primarily arboreal, exclusively active at dusk, and probably restricted to the pristine rainforests of the Pantepui uplands and highlands, east of the Gran Sabana between ca 600 and 1800 m above sea level. Preliminary molecular analyses recovered Pristimantis marmoratus as sister to an unnamed species from the Eastern Guiana Shield. On grounds of the newly established distributional extent we suggest maintaining the IUCN conservation status as Least Concern.

  7. Archigregarines of the English Channel revisited: New molecular data on Selenidium species including early described and new species and the uncertainties of phylogenetic relationships.

    Directory of Open Access Journals (Sweden)

    Sonja Rueckert

    Full Text Available Gregarines represent an important transition step from free-living predatory (colpodellids s.l. and/or photosynthetic (Chromera and Vitrella apicomplexan lineages to the most important pathogens, obligate intracellular parasites of humans and domestic animals such as coccidians and haemosporidians (Plasmodium, Toxoplasma, Eimeria, Babesia, etc.. While dozens of genomes of other apicomplexan groups are available, gregarines are barely entering the molecular age. Among the gregarines, archigregarines possess a unique mixture of ancestral (myzocytosis and derived (lack of apicoplast, presence of subpellicular microtubules features.In this study we revisited five of the early-described species of the genus Selenidium including the type species Selenidium pendula, with special focus on surface ultrastructure and molecular data. We were also able to describe three new species within this genus. All species were characterized at morphological (light and scanning electron microscopy data and molecular (SSU rDNA sequence data levels. Gregarine specimens were isolated from polychaete hosts collected from the English Channel near the Station Biologique de Roscoff, France: Selenidium pendula from Scolelepis squamata, S. hollandei and S. sabellariae from Sabellaria alveolata, S. sabellae from Sabella pavonina, Selenidium fallax from Cirriformia tentaculata, S. spiralis sp. n. and S. antevariabilis sp. n. from Amphitritides gracilis, and S. opheliae sp. n. from Ophelia roscoffensis. Molecular phylogenetic analyses of these data showed archigregarines clustering into five separate clades and support previous doubts about their monophyly.Our phylogenies using the extended gregarine sampling show that the archigregarines are indeed not monophyletic with one strongly supported clade of Selenidium sequences around the type species S. pendula. We suggest the revision of the whole archigregarine taxonomy with only the species within this clade remaining in the genus

  8. Relationship between Teachers' Motivation Teaching HIV/AIDS Education and Students' Knowledge and Attitude towards Sexual Behaviour in Secondary Schools in Coast Region, Kenya

    Science.gov (United States)

    Thuo, Daniel Njane; Nyaga, Veronica K.; Bururia, David N.; Barchok, Hilary K.

    2016-01-01

    Education plays an important role in curbing the spread of HIV and AIDS among the youth. However, there is little known how teachers' motivation in teaching HIV/AIDS education affects students' knowledge and attitudes towards sexual behaviour. The purpose of the study was to determine the relationship between teachers' level of motivation in…

  9. The relationship between pornography use and sexual behaviors among at-risk HIV negative men who have sex with men

    Science.gov (United States)

    Eaton, Lisa A.; Cain, Demetria N.; Pope, Howard; Garcia, Jonathan; Cherry, Chauncey

    2013-01-01

    Objectives Although pornography is widely available and frequently used among many adults in the US, little is known about the relationship between pornography and risk factors for HIV transmission among men who have sex with men. Methods Baseline assessments from a behavioral intervention trial for at-risk men who have sex with men were conducted in Atlanta, GA in 2009. Univariate and multivariate generalized linear models were used to assess the relationships between known risk factors for HIV infection, time spent viewing pornography, and sex behaviors. Results One hundred forty nine men reporting HIV-negative status and two or more unprotected anal sex partners in the past six months were enrolled in an intervention trial and completed survey assessments. Time spent viewing pornography was significantly associated with having more male sexual partners (B=.45, SE=.04, ppornography. Conclusions This exploratory study is novel in that it sheds light on the associations between viewing pornography and sexual risk taking for HIV infection. Future studies in this area should focus on understanding how the content of pornography, in particular the viewing of unprotected and protected sex acts, may affect sexual risk taking behavior. PMID:22498161

  10. A nuclear phylogenetic analysis: SNPs, indels and SSRs deliver new insights into the relationships in the 'true citrus fruit trees' group (Citrinae, Rutaceae) and the origin of cultivated species.

    Science.gov (United States)

    Garcia-Lor, Andres; Curk, Franck; Snoussi-Trifa, Hager; Morillon, Raphael; Ancillo, Gema; Luro, François; Navarro, Luis; Ollitrault, Patrick

    2013-01-01

    Despite differences in morphology, the genera representing 'true citrus fruit trees' are sexually compatible, and their phylogenetic relationships remain unclear. Most of the important commercial 'species' of Citrus are believed to be of interspecific origin. By studying polymorphisms of 27 nuclear genes, the average molecular differentiation between species was estimated and some phylogenetic relationships between 'true citrus fruit trees' were clarified. Sanger sequencing of PCR-amplified fragments from 18 genes involved in metabolite biosynthesis pathways and nine putative genes for salt tolerance was performed for 45 genotypes of Citrus and relatives of Citrus to mine single nucleotide polymorphisms (SNPs) and indel polymorphisms. Fifty nuclear simple sequence repeats (SSRs) were also analysed. A total of 16 238 kb of DNA was sequenced for each genotype, and 1097 single nucleotide polymorphisms (SNPs) and 50 indels were identified. These polymorphisms were more valuable than SSRs for inter-taxon differentiation. Nuclear phylogenetic analysis revealed that Citrus reticulata and Fortunella form a cluster that is differentiated from the clade that includes three other basic taxa of cultivated citrus (C. maxima, C. medica and C. micrantha). These results confirm the taxonomic subdivision between the subgenera Metacitrus and Archicitrus. A few genes displayed positive selection patterns within or between species, but most of them displayed neutral patterns. The phylogenetic inheritance patterns of the analysed genes were inferred for commercial Citrus spp. Numerous molecular polymorphisms (SNPs and indels), which are potentially useful for the analysis of interspecific genetic structures, have been identified. The nuclear phylogenetic network for Citrus and its sexually compatible relatives was consistent with the geographical origins of these genera. The positive selection observed for a few genes will help further works to analyse the molecular basis of the

  11. A nuclear phylogenetic analysis: SNPs, indels and SSRs deliver new insights into the relationships in the ‘true citrus fruit trees’ group (Citrinae, Rutaceae) and the origin of cultivated species

    Science.gov (United States)

    Garcia-Lor, Andres; Curk, Franck; Snoussi-Trifa, Hager; Morillon, Raphael; Ancillo, Gema; Luro, François; Navarro, Luis; Ollitrault, Patrick

    2013-01-01

    Background and Aims Despite differences in morphology, the genera representing ‘true citrus fruit trees’ are sexually compatible, and their phylogenetic relationships remain unclear. Most of the important commercial ‘species’ of Citrus are believed to be of interspecific origin. By studying polymorphisms of 27 nuclear genes, the average molecular differentiation between species was estimated and some phylogenetic relationships between ‘true citrus fruit trees’ were clarified. Methods Sanger sequencing of PCR-amplified fragments from 18 genes involved in metabolite biosynthesis pathways and nine putative genes for salt tolerance was performed for 45 genotypes of Citrus and relatives of Citrus to mine single nucleotide polymorphisms (SNPs) and indel polymorphisms. Fifty nuclear simple sequence repeats (SSRs) were also analysed. Key Results A total of 16 238 kb of DNA was sequenced for each genotype, and 1097 single nucleotide polymorphisms (SNPs) and 50 indels were identified. These polymorphisms were more valuable than SSRs for inter-taxon differentiation. Nuclear phylogenetic analysis revealed that Citrus reticulata and Fortunella form a cluster that is differentiated from the clade that includes three other basic taxa of cultivated citrus (C. maxima, C. medica and C. micrantha). These results confirm the taxonomic subdivision between the subgenera Metacitrus and Archicitrus. A few genes displayed positive selection patterns within or between species, but most of them displayed neutral patterns. The phylogenetic inheritance patterns of the analysed genes were inferred for commercial Citrus spp. Conclusions Numerous molecular polymorphisms (SNPs and indels), which are potentially useful for the analysis of interspecific genetic structures, have been identified. The nuclear phylogenetic network for Citrus and its sexually compatible relatives was consistent with the geographical origins of these genera. The positive selection observed for a few genes will

  12. Phylogenetic trees in bioinformatics

    Energy Technology Data Exchange (ETDEWEB)

    Burr, Tom L [Los Alamos National Laboratory

    2008-01-01

    Genetic data is often used to infer evolutionary relationships among a collection of viruses, bacteria, animal or plant species, or other operational taxonomic units (OTU). A phylogenetic tree depicts such relationships and provides a visual representation of the estimated branching order of the OTUs. Tree estimation is unique for several reasons, including: the types of data used to represent each OTU; the use ofprobabilistic nucleotide substitution models; the inference goals involving both tree topology and branch length, and the huge number of possible trees for a given sample of a very modest number of OTUs, which implies that fmding the best tree(s) to describe the genetic data for each OTU is computationally demanding. Bioinformatics is too large a field to review here. We focus on that aspect of bioinformatics that includes study of similarities in genetic data from multiple OTUs. Although research questions are diverse, a common underlying challenge is to estimate the evolutionary history of the OTUs. Therefore, this paper reviews the role of phylogenetic tree estimation in bioinformatics, available methods and software, and identifies areas for additional research and development.

  13. Is there a relationship between geographic distance and uptake of HIV testing services? A representative population-based study of Chinese adults in Guangzhou, China.

    Directory of Open Access Journals (Sweden)

    Wen Chen

    Full Text Available Achieving high coverage of HIV testing services is critical in many health systems, especially where HIV testing services remain centralized and inconvenient for many. As a result, planning the optimal spatial distribution of HIV testing sites is increasingly important. We aimed to assess the relationship between geographic distance and uptake of HIV testing services among the general population in Guangzhou, China. Utilizing spatial epidemiological methods and stratified household random sampling, we studied 666 adults aged 18-59. Computer-assisted interviews assessed self-reported HIV testing history. Spatial scan statistic assessed the clustering of participants who have ever been tested for HIV, and two-level logistic regression models assessed the association between uptake of HIV testing and the mean driving distance from the participant's residence to all HIV testing sites in the research sites. The percentage of participants who have ever been tested for HIV was 25.2% (168/666, 95%CI: 21.9%, 28.5%, and the majority (82.7% of participants tested for HIV in Centres for Disease Control and Prevention, public hospitals or STIs clinics. None reported using self-testing. Spatial clustering analyses found a hotspot included 48 participants who have ever been tested for HIV and 25.8 expected cases (Rate Ratio = 1.86, P = 0.002. Adjusted two-level logistic regression found an inverse relationship between geographic distance (kilometers and ever being tested for HIV (aOR = 0.90, 95%CI: 0.84, 0.96. Married or cohabiting participants (aOR = 2.14, 95%CI: 1.09, 4.20 and those with greater social support (aOR = 1.04, 95%CI: 1.01, 1.07 were more likely to be tested for HIV. Our findings underscore the importance of considering the geographical distribution of HIV testing sites to increase testing. In addition, expanding HIV testing coverage by introducing non-facility based HIV testing services and self-testing might be useful to achieve the goal that

  14. Family-of-Origin Factors and Partner Violence in the Intimate Relationships of Gay Men Who Are HIV Positive

    OpenAIRE

    CRAFT, SHONDA M.; SEROVICH, JULIANNE M.

    2005-01-01

    This exploratory study examined the prevalence of intimate partner violence in a sample of gay men who are HIV positive. The concept of intergenerational transmission of violence, from family systems theory, provided the basis of this examination. It was hypothesized that men who had witnessed or experienced violence in their families of origin would be more likely to perpetrate or experience violence in their intimate relationships. Perpetration and receipt of abuse were assessed to provide ...

  15. Assessing the relationship between child sexual abuse and marginal living conditions on HIV/AIDS-related risk behavior among women prisoners.

    Science.gov (United States)

    Mullings, J L; Marquart, J W; Brewer, V E

    2000-05-01

    There were two aims in this research. First, to examine the relationships between childhood sexual abuse and HIV drug and sexual risk taking behaviors among female prisoners, and second, to examine the relationship between a marginal adult living context and HIV drug and sexual risk taking behavior among female prisoners. The data were collected through face-to-face interviews with a random sample of 500 women at admission to prison in 1994. Differences between women who were sexually abused while growing up (n = 130) were compared to women who reported no sexual abuse (n = 370) along various demographic, and HIV drug and sexual risk taking dimensions. A history of sexual abuse while growing up was associated with increased sexual risk taking behaviors in adulthood. A marginal adult living situation also emerged as an important factor increasing the risk for HIV infection. Examining the co-occurrence of both childhood sexual abuse and adult marginal living context revealed a strong relationship between these two factors and HIV risk taking activities. The findings indicate that childhood sexual abuse may be a predictor for HIV sexual risk taking behaviors among incarcerated women. The marginal and chaotic adult living style of these women was also associated the extent of their HIV drug and sexual risk taking behaviors. Our research suggests that the co-occurrence of sexual victimization and marginality is a stronger predictor of HIV risk than each variable alone.

  16. Importance of Women's Relative Socioeconomic Status within Sexual Relationships in Communication about Safer Sex and HIV/STI Prevention.

    Science.gov (United States)

    Muchomba, Felix M; Chan, Christine; El-Bassel, Nabila

    2015-06-01

    The socioeconomic status (SES) of women is increasingly considered an important factor for HIV/STI risk. The HIV/STI literature has largely focused on women's absolute levels of SES, and therefore, the importance of their SES relative to their male sexual partners remains understudied. This paper examines the association between women's relative SES and frequency of safer sex communication among heterosexual couples. A convenience sample of 342 couples (N = 684) recruited in New York City was asked about frequency of discussions with their partner about the need to use male condoms, about HIV prevention, and about STI prevention in the previous 90 days. Differences between partners in education, income, employment, housing, and incarceration history were combined using principal component analysis to form an index of women's relative SES. Negative binomial regression models assessed associations between woman's relative SES and communication frequency controlling for age, sex, race, ethnicity, education, and relationship type using a generalized estimating equation framework. On average, participants had 2.5, 4.2, and 4.8 discussions regarding the need to use male condoms, about HIV prevention, and about STI prevention, respectively. A one standard deviation increase in a woman's relative SES score was associated with increased frequency of discussions about male condom use (adjusted rate ratio [aRR], 1.15; 95% confidence interval [CI], 1.03-1.29), about HIV prevention (aRR, 1.25; CI, 1.14-1.37), and about STI prevention (aRR, 1.29; CI, 1.18-1.41). Women's relative SES may be an important factor for sexual communication, and further research on its role in HIV/STI risk may uncover avenues for intervention.

  17. The relationship between HIV and prevalence of disabilities in sub-Saharan Africa: systematic review (FA).

    Science.gov (United States)

    Banks, Lena Morgon; Zuurmond, Maria; Ferrand, Rashida; Kuper, Hannah

    2015-04-01

    comparator found a significant difference between PLHIV and controls; for cognitive development and global delay, a significant detrimental effect of HIV was found in five of six and one of two studies, respectively. In the nine cohort studies comparing vertically infected and uninfected children, eight showed a significant gap in development over time in children with HIV. Finally, fifteen of thirty-one (48%) studies found a statistically significant dose-response relationship between indicators of disease progression (CD4 or WHO stage) and disability. HIV is widespread in sub-Saharan Africa and the evidence suggests that it is linked to disabilities, affecting a range of body structures and functions. More research is needed to better understand the implications of HIV-related disability for individuals, their families as well as those working in the fields of disability and HIV so that appropriate interventions can be developed. © 2014 John Wiley & Sons Ltd.

  18. The relationship between health worker stigma and uptake of HIV counseling and testing and utilization of non-HIV health services: the experience of male and female sex workers in Kenya.

    Science.gov (United States)

    Nyblade, Laura; Reddy, Aditi; Mbote, David; Kraemer, John; Stockton, Melissa; Kemunto, Caroline; Krotki, Karol; Morla, Javier; Njuguna, Stella; Dutta, Arin; Barker, Catherine

    2017-11-01

    The barrier HIV-stigma presents to the HIV treatment cascade is increasingly documented; however less is known about female and male sex worker engagement in and the influence of sex-work stigma on the HIV care continuum. While stigma occurs in all spheres of life, stigma within health services may be particularly detrimental to health seeking behaviors. Therefore, we present levels of sex-work stigma from healthcare workers (HCW) among male and female sex workers in Kenya, and explore the relationship between sex-work stigma and HIV counseling and testing. We also examine the relationship between sex-work stigma and utilization of non-HIV health services. A snowball sample of 497 female sex workers (FSW) and 232 male sex workers (MSW) across four sites was recruited through a modified respondent-driven sampling process. About 50% of both male and female sex workers reported anticipating verbal stigma from HCW while 72% of FSW and 54% of MSW reported experiencing at least one of seven measured forms of stigma from HCW. In general, stigma led to higher odds of reporting delay or avoidance of counseling and testing, as well as non-HIV specific services. Statistical significance of relationships varied across type of health service, type of stigma and gender. For example, anticipated stigma was not a significant predictor of delay or avoidance of health services for MSW; however, FSW who anticipated HCW stigma had significantly higher odds of avoiding (OR = 2.11) non-HIV services, compared to FSW who did not. This paper adds to the growing evidence of stigma as a roadblock in the HIV treatment cascade, as well as its undermining of the human right to health. While more attention is being paid to addressing HIV-stigma, it is equally important to address the key population stigma that often intersects with HIV-stigma.

  19. Family-of-Origin Factors and Partner Violence in the Intimate Relationships of Gay Men Who Are HIV Positive

    Science.gov (United States)

    SEROVICH, JULIANNE M.

    2005-01-01

    This exploratory study examined the prevalence of intimate partner violence in a sample of gay men who are HIV positive. The concept of intergenerational transmission of violence, from family systems theory, provided the basis of this examination. It was hypothesized that men who had witnessed or experienced violence in their families of origin would be more likely to perpetrate or experience violence in their intimate relationships. Perpetration and receipt of abuse were assessed to provide a more comprehensive examination of these relationships. The results of this study indicated that psychological abuse was the most commonly reported form of violence in these relationships. The results also provided partial support for the hypothesized relationship between family-of-origin violence and subsequent violence in an intimate relationship. Implications for future research and intervention are discussed. PMID:15914700

  20. Relationship between expressed HIV/AIDS-related stigma and HIV-beliefs/knowledge and behaviour in families of HIV infected children in Kenya.

    Science.gov (United States)

    Hamra, Mary; Ross, Michael W; Orrs, Mark; D'Agostino, Angelo

    2006-04-01

    To quantify expressed stigma in clients of the Kangemi program for HIV+ children, and to characterize the association between stigma and other population characteristics. By means of a household survey we created a stigma index and indices for other social and knowledge domains that influence HIV-related healthcare. We used chi2, anova, and correlation to identify associations between domains. The mean (+/-SD) expressed stigma on a six points scale (6 = least stigma) was 3.65 +/- 1.64. Composite scores on knowledge about AIDS were skewed toward more knowledge; and analysis of individual knowledge items indicates that most respondents reject erroneous traditional beliefs and myths about the causes and transmission routes of AIDS. Respondents who were younger, had never married, and had less education expressed greater stigma. Differences in stigma were associated with poor knowledge about AIDS and negative attitudes toward testing, but not with gender or tribal affiliation. Condom use at last intercourse, unrelated to stigma, was only 40% (n = 218). While this population has good knowledge about AIDS and appraises risks realistically, it fails to reduce these risks. Associations between stigma and other domains can inform interventions that improve HIV care and mitigate spread of HIV.

  1. Undergraduate Students’ Difficulties in Reading and Constructing Phylogenetic Tree

    Science.gov (United States)

    Sa'adah, S.; Tapilouw, F. S.; Hidayat, T.

    2017-02-01

    Representation is a very important communication tool to communicate scientific concepts. Biologists produce phylogenetic representation to express their understanding of evolutionary relationships. The phylogenetic tree is visual representation depict a hypothesis about the evolutionary relationship and widely used in the biological sciences. Phylogenetic tree currently growing for many disciplines in biology. Consequently, learning about phylogenetic tree become an important part of biological education and an interesting area for biology education research. However, research showed many students often struggle with interpreting the information that phylogenetic trees depict. The purpose of this study was to investigate undergraduate students’ difficulties in reading and constructing a phylogenetic tree. The method of this study is a descriptive method. In this study, we used questionnaires, interviews, multiple choice and open-ended questions, reflective journals and observations. The findings showed students experiencing difficulties, especially in constructing a phylogenetic tree. The students’ responds indicated that main reasons for difficulties in constructing a phylogenetic tree are difficult to placing taxa in a phylogenetic tree based on the data provided so that the phylogenetic tree constructed does not describe the actual evolutionary relationship (incorrect relatedness). Students also have difficulties in determining the sister group, character synapomorphy, autapomorphy from data provided (character table) and comparing among phylogenetic tree. According to them building the phylogenetic tree is more difficult than reading the phylogenetic tree. Finding this studies provide information to undergraduate instructor and students to overcome learning difficulties of reading and constructing phylogenetic tree.

  2. Unraveling the relationship between microbial translocation and systemic immune activation in HIV infection

    Science.gov (United States)

    Shan, Liang; Siliciano, Robert F.

    2014-01-01

    Chronic immune activation is a key factor in HIV-1 disease progression. The translocation of microbial products from the intestinal lumen into the systemic circulation occurs during HIV-1 infection and is associated closely with immune activation; however, it has not been determined conclusively whether microbial translocation drives immune activation or occurs as a consequence of HIV-1 infection. In an important study in this issue of the JCI, Kristoff and colleagues describe the role of microbial translocation in producing immune activation in an animal model of HIV-1 infection, SIV infection of pigtailed macaques. Blocking translocation of intestinal bacterial LPS into the circulation dramatically reduced T cell activation and proliferation, production of proinflammatory cytokines, and plasma SIV RNA levels. This study directly demonstrates that microbial translocation promotes the systemic immune activation associated with HIV-1/SIV infection. PMID:24837427

  3. The complete chloroplast genome sequence of Mahonia bealei (Berberidaceae) reveals a significant expansion of the inverted repeat and phylogenetic relationship with other angiosperms.

    Science.gov (United States)

    Ma, Ji; Yang, Bingxian; Zhu, Wei; Sun, Lianli; Tian, Jingkui; Wang, Xumin

    2013-10-10

    Mahonia bealei (Berberidaceae) is a frequently-used traditional Chinese medicinal plant with efficient anti-inflammatory ability. This plant is one of the sources of berberine, a new cholesterol-lowering drug with anti-diabetic activity. We have sequenced the complete nucleotide sequence of the chloroplast (cp) genome of M. bealei. The complete cp genome of M. bealei is 164,792 bp in length, and has a typical structure with large (LSC 73,052 bp) and small (SSC 18,591 bp) single-copy regions separated by a pair of inverted repeats (IRs 36,501 bp) of large size. The Mahonia cp genome contains 111 unique genes and 39 genes are duplicated in the IR regions. The gene order and content of M. bealei are almost unarranged which is consistent with the hypothesis that large IRs stabilize cp genome and reduce gene loss-and-gain probabilities during evolutionary process. A large IR expansion of over 12 kb has occurred in M. bealei, 15 genes (rps19, rpl22, rps3, rpl16, rpl14, rps8, infA, rpl36, rps11, petD, petB, psbH, psbN, psbT and psbB) have expanded to have an additional copy in the IRs. The IR expansion rearrangement occurred via a double-strand DNA break and subsequence repair, which is different from the ordinary gene conversion mechanism. Repeat analysis identified 39 direct/inverted repeats 30 bp or longer with a sequence identity ≥ 90%. Analysis also revealed 75 simple sequence repeat (SSR) loci and almost all are composed of A or T, contributing to a distinct bias in base composition. Comparison of protein-coding sequences with ESTs reveals 9 putative RNA edits and 5 of them resulted in non-synonymous modifications in rpoC1, rps2, rps19 and ycf1. Phylogenetic analysis using maximum parsimony (MP) and maximum likelihood (ML) was performed on a dataset composed of 65 protein-coding genes from 25 taxa, which yields an identical tree topology as previous plastid-based trees, and provides strong support for the sister relationship between Ranunculaceae and Berberidaceae

  4. Molecular Phylogenetics: Concepts for a Newcomer.

    Science.gov (United States)

    Ajawatanawong, Pravech

    Molecular phylogenetics is the study of evolutionary relationships among organisms using molecular sequence data. The aim of this review is to introduce the important terminology and general concepts of tree reconstruction to biologists who lack a strong background in the field of molecular evolution. Some modern phylogenetic programs are easy to use because of their user-friendly interfaces, but understanding the phylogenetic algorithms and substitution models, which are based on advanced statistics, is still important for the analysis and interpretation without a guide. Briefly, there are five general steps in carrying out a phylogenetic analysis: (1) sequence data preparation, (2) sequence alignment, (3) choosing a phylogenetic reconstruction method, (4) identification of the best tree, and (5) evaluating the tree. Concepts in this review enable biologists to grasp the basic ideas behind phylogenetic analysis and also help provide a sound basis for discussions with expert phylogeneticists.

  5. Phylogenetic inertia and Darwin's higher law.

    Science.gov (United States)

    Shanahan, Timothy

    2011-03-01

    The concept of 'phylogenetic inertia' is routinely deployed in evolutionary biology as an alternative to natural selection for explaining the persistence of characteristics that appear sub-optimal from an adaptationist perspective. However, in many of these contexts the precise meaning of 'phylogenetic inertia' and its relationship to selection are far from clear. After tracing the history of the concept of 'inertia' in evolutionary biology, I argue that treating phylogenetic inertia and natural selection as alternative explanations is mistaken because phylogenetic inertia is, from a Darwinian point of view, simply an expected effect of selection. Although Darwin did not discuss 'phylogenetic inertia,' he did assert the explanatory priority of selection over descent. An analysis of 'phylogenetic inertia' provides a perspective from which to assess Darwin's view. Copyright © 2010 Elsevier Ltd. All rights reserved.