WorldWideScience

Sample records for history relief position

  1. Canadian Pain Society Position Statement on Pain Relief

    Directory of Open Access Journals (Sweden)

    Judith H Watt-Watson

    1999-01-01

    Full Text Available The present report outlines key requirements that are central to helping patients manage pain effectively. Although current standards are available as guides for practice, the prevalence of pain suggests that many health professionals do not know and/or cannot relate to these standards. Therefore, a brief, pragmatic statement may be more useful initially for health professionals and patients learning about problematic pain outcomes. The principles in the brief statement produced by the Canadian Pain Society clarify and emphasize key underlying assumptions that have directed the development of many pain standards. The aim of the present paper is to increase awareness of ineffective pain practices and the importance of pain relief, and to stimulate further work in this area.

  2. A Context-Aware Model to Provide Positioning in Disaster Relief Scenarios

    Directory of Open Access Journals (Sweden)

    Daniel Moreno

    2015-09-01

    Full Text Available The effectiveness of the work performed during disaster relief efforts is highly dependent on the coordination of activities conducted by the first responders deployed in the affected area. Such coordination, in turn, depends on an appropriate management of geo-referenced information. Therefore, enabling first responders to count on positioning capabilities during these activities is vital to increase the effectiveness of the response process. The positioning methods used in this scenario must assume a lack of infrastructure-based communication and electrical energy, which usually characterizes affected areas. Although positioning systems such as the Global Positioning System (GPS have been shown to be useful, we cannot assume that all devices deployed in the area (or most of them will have positioning capabilities by themselves. Typically, many first responders carry devices that are not capable of performing positioning on their own, but that require such a service. In order to help increase the positioning capability of first responders in disaster-affected areas, this paper presents a context-aware positioning model that allows mobile devices to estimate their position based on information gathered from their surroundings. The performance of the proposed model was evaluated using simulations, and the obtained results show that mobile devices without positioning capabilities were able to use the model to estimate their position. Moreover, the accuracy of the positioning model has been shown to be suitable for conducting most first response activities.

  3. Work of Breathing in Fixed and Pressure Relief Continuous Positive Airway Pressure (C-Flex™): A post hoc Analysis.

    Science.gov (United States)

    Jerrentrup, Lukas; Canisius, Sebastian; Wilhelm, Susanne; Kesper, Karl; Ploch, Thomas; Vogelmeier, Claus; Greulich, Timm; Becker, Heinrich F

    2017-01-01

    Expiratory pressure relief continuous positive airway pressure (pressure relief CPAP; C-Flex™) causes increases in inspiratory duty cycle and shortening of expiratory time. It has been suggested that these changes are caused by an increase in work of breathing. We studied the effects of C-Flex on work of breathing and intrinsic positive end-expiratory pressure as compared to fixed CPAP. Work of breathing was analyzed in 24 patients with obstructive sleep apnea during treatment with fixed CPAP and C-Flex with 3 different pressure relief settings in a randomized order during rapid-eye-movement (REM) and non-REM sleep. Work of breathing was assessed on a breath-by-breath basis using a piezoelectric esophageal pressure catheter and a pneumotachograph for measuring airflow. We found there was no increase in inspiratory work of breathing observed using C-Flex compared to fixed CPAP. Instead, we found a linear decrease in inspiratory work of breathing with increasing pressure relief, with a mean difference of 1.22 J/min between CPAP and maximum pressure release (C-Flex 3; 90% of the value with nasal CPAP); however, the decrease was not statistically significant. The decrease in inspiratory work of breathing associated with C-Flex has a significant inverse correlation with BMI. The C-Flex technology does not change work of breathing but shows a tendency towards a reduction of inspiratory work of breathing in patients with a lower BMI using higher C-Flex. The effect is probably caused by diminishing airway resistance generated by the positive end-expiratory pressure. Our findings may lead to additional fields of application of the C-Flex technology, such as chronic obstructive pulmonary disease or muscular dystrophy. © 2016 S. Karger AG, Basel.

  4. Association of Positive History of Pulmonary Tuberculosis with Female Infertility

    Directory of Open Access Journals (Sweden)

    Babak Eshrati

    2007-01-01

    Full Text Available Background: The etiology of infertility has direct influence on the plan and outcome of its management.In this paper we showed the effect of history of tuberculosis (TB on female infertility among infertilecouples admitted to Royan infertility management center.Material and Methods: This case control study was performed on cases that were diagnosed withfemale infertility (308 women. Controls were women whose husbands were infertile due to some malefactor (314 women. Those who had both female and male infertility were excluded from the study. Theobserved variables were BMI>25 kg/m2, positive history of smoking, tuberculosis, sexually transmitteddisease and pelvic inflammatory diseases.Results: The age adjusted odds ratio of history of tuberculosis for female infertility was 6.21(95 CI:1.31-29.56.The attributable risk in exposed group was about 1%.Conclusion: According to our study, positive history of tuberculosis may be responsible for femaleinfertility.

  5. Pressure-Relief Features of Fixed and Autotitrating Continuous Positive Airway Pressure May Impair Their Efficacy: Evaluation with a Respiratory Bench Model

    Science.gov (United States)

    Zhu, Kaixian; Aouf, Sami; Roisman, Gabriel; Escourrou, Pierre

    2016-01-01

    Study Objectives: Pressure-relief features are aimed at improving the patient's comfort during continuous positive airway pressure (CPAP) treatment for obstructive sleep apnea. The objective of this study was to determine the effect of these therapy features on fixed CPAP and autotitrating CPAP (APAP) treatment efficacy. Methods: Seven pressure-relief features applied by three CPAP devices were included in our study (Remstar Auto: C-Flex 3, C-Flex+ 3, A-Flex 3, P-Flex; AirSense 10: EPR 3; Prisma 20A: SoftPAP 2 and 3). In fixed CPAP, the devices were subjected to a 10-min bench-simulated obstructive apnea sequence (initial apnea-hypopnea index, AHI = 60/h) with and without pressure-relief features. In APAP, the sequence was lengthened to 4.2 h (initial AHI = 58.6/h). The residual AHI and mean/median pressure were compared with and without pressure-relief features. Results: Compared to conventional CPAP, where pressure was adjusted to be just sufficient to control the simulated obstructive events, C-Flex+ 3, P-Flex, and EPR 3 failed to normalize the breathing flow and did not reduce the AHI. The mean pressures with the three features, respectively, were 1.8, 2.6, and 2.6 cmH2O lower than the conventional CPAP. Compared to conventional APAP, similar levels of control were observed with pressure-relief features, apart from P-Flex where the delivered mean pressure was lower and residual AHI greater. The device-reported mean/median pressures in APAP with A-Flex 3, P-Flex, EPR 3, and SoftPAP 3 were higher than that measured on the bench. Conclusions: Pressure-relief features may attenuate CPAP efficacy if not adjusted for at the time of their introduction. In clinical practice, efficacy can be ensured by increasing the therapeutic pressure delivered by fixed CPAP or by enabling the pressure-relief features prior to initial pressure titration. Device-reported pressures in APAP devices with pressure relief activated may overstate delivered pressures. Citation: Zhu K, Aouf S

  6. Study of main and cross-over effects on pressure relief among body mass index (BMI), body position and supporting material properties.

    Science.gov (United States)

    Hui, Chi-Leung; Feng, Qilong; Wong, M S; Ng, Sau-Fun; Lin, Yummy Y M

    2017-11-03

    Pressure ulcers influence people with limited mobility who must spend a long time lying or sitting because these positions create high interfacial pressure between the body and supporting materials. Supporting materials, such as mattresses and cushions, are designed to prevent pressure ulcers by increasing the contact area, reducing the interfacial pressure or reducing the contact time. Foam is the most common supporting material for relieving pressure because it is cheap and easy to change its shape to fit the contour of the body. Past studies showed that BMI, body position and supporting material properties have an impact on relieving pressure; however, there is no study of the main and cross-over effects among these parameters. This study aims to investigate the main and cross-over effects among BMI, body position and supporting material properties on pressure relieving performance using univariate ANOVA and correlation analysis. It was found that body position and foam density were the main effect and BMI and body position, and body position and foam density were the cross-over effects on pressure relief. It was also found that low density Polyurethane (PU) foam of less than 4 cm in thickness as well as the appropriate K2 and K3 moduli are best suited for pressure relief. The actual value of foam thickness and the appropriate K2 and K3 moduli are subject to BMI values and body position. The significance of the outcomes from this study is that it will aid in optimizing the design of supporting materials with varied BMI values and body positions to greatly reduce pressure ulcers for ailing patients. Copyright © 2017 IPEM. Published by Elsevier Ltd. All rights reserved.

  7. Time-history simulation of civil architecture earthquake disaster relief- based on the three-dimensional dynamic finite element method

    Directory of Open Access Journals (Sweden)

    Liu Bing

    2014-10-01

    Full Text Available Earthquake action is the main external factor which influences long-term safe operation of civil construction, especially of the high-rise building. Applying time-history method to simulate earthquake response process of civil construction foundation surrounding rock is an effective method for the anti-knock study of civil buildings. Therefore, this paper develops a civil building earthquake disaster three-dimensional dynamic finite element numerical simulation system. The system adopts the explicit central difference method. Strengthening characteristics of materials under high strain rate and damage characteristics of surrounding rock under the action of cyclic loading are considered. Then, dynamic constitutive model of rock mass suitable for civil building aseismic analysis is put forward. At the same time, through the earthquake disaster of time-history simulation of Shenzhen Children’s Palace, reliability and practicability of system program is verified in the analysis of practical engineering problems.

  8. A case history of using high-resolution LiDAR data to support archaeological prediction models in a low-relief area

    Science.gov (United States)

    Pacskó, Vivien; Székely, Balázs; Stibrányi, Máté; Koma, Zsófia

    2016-04-01

    Transdanubian Range characterized by NNW-SSE directed valleys. One of the largest valleys is a conspicuously straight valley section of the River Sárvíz between Székesfehérvár and Szekszárd. Archaeological surveys revealed various settlement remains since the Neolithic. LiDAR data acquisition has been carried out in the framework of an EUFAR project supported by the European Union. Although the weather conditions were not optimal during the flight, sophisticated processing (carried out with of OPALS software) removed most of the artifacts. The resulting 1 m resolution digital terrain model (DTM) has been used to out. This DTM and the known archaeological site locations were integrated in a GIS system for qualitative and quantitative analysis. The processing aimed at analyzing elevation patterns of archaeological sites: local microtopographic features have been outlined and local low-relief elevation data have been extracted and analysed along the Sárvíz valley. Sites have been grouped according to the age of the artifacts identified by the quick-look archaeological walkthrough surveys. The topographic context of these elevation patterns were compared to the relative relief positions of the sites. Some ages groups have confined elevation ranges that may indicate hydrological/climate dependency of the settlement site selection, whereas some long-lived sites can also be identified, typically further away from the local erosional base. Extremely low-relief areas are supposed to have had swampy or partly inundated environmental conditions in ancient times; these areas were unsuitable for human settlement for long time periods. Such areas can be typically attributed by low predictive probabilities, whereas small mounds, patches of topographic unevenness would get higher model probabilities. The final the models can be used for focused field surveys that can improve our archaeological knowledge of the area. The data used were acquired in the framework of the EUFAR ARMSRACE

  9. Explanations for attractiveness-related positive biases in an evolutionary perspective of life history theory.

    Science.gov (United States)

    Chen, Bin-Bin

    2017-01-01

    The mating-related evolutionary explanation that Maestripieri et al. offer does not apply to (1) infants' positive biases toward attractive individuals and (2) adults' positive biases toward attractive infants and children. They are best understood when integrated into an evolutionary life history framework. I argue that the life history of positive biases toward attractive individuals is driven by fundamental trade-offs made throughout development.

  10. Is a positive history of non-anaesthetic drug allergy a predictive factor for positive allergy tests to anaesthetics?

    Science.gov (United States)

    Hagau, Natalia; Gherman-Ionica, Nadia; Hagau, Denisa; Tranca, Sebastian; Sfichi, Manuela; Longrois, Dan

    2012-03-01

    International recommendations stipulate not performing screening skin tests to a drug in the absence of a clinical history consistent with that specific drug allergy. Nevertheless, two publications showed that a positive history of non-anaesthetic drug allergy was the only predictive factor for a positive skin test when screening for allergy to anaesthetic drugs was done. We selected from a surgical population 40 volunteers with a prior history of allergy to non-anaesthetic drugs in order to analyse the prevalence of positive allergy tests to anaesthetics. The selected adult patients were tested for 11 anaesthetic drugs using in vivo tests: skin prick (SPT) and intradermal (IDT) tests and in vitro tests: the basophil activation test (BAT) and detection of drug-specific immunoglobulin E (IgE). The prevalence for the positive SPT and IDT was 1.6% and 5.8% respectively. The result of flow cytometry agreed with the SPT in five out of seven positive SPT (71%). IgEs confirmed two positive SPT with corresponding positive BAT. Ten per cent of the patients had a positive prick test to neuromuscular blocking agents (NMBA). For midazolam none of the SPT was positive, but 11 patients had positive IDT nonconfirmed by BAT. The prevalence of positive in vivo and in vitro allergy tests to NMBAs is higher in our study population. This could be an argument for pre-operative SPT to NMBAs for the surgical population with reported non-anaesthetic drug allergies. A larger prospective study is needed to validate changes in clinical practice. © 2011 The Authors. British Journal of Clinical Pharmacology © 2011 The British Pharmacological Society.

  11. Emotional Stress-reactivity and Positive Affect among College Students: The Role of Depression History

    Science.gov (United States)

    O’Hara, Ross E.; Armeli, Stephen; Boynton, Marcella H.; Tennen, Howard

    2014-01-01

    Multiple theories posit that people with a history of depression are at higher risk for a depressive episode than people who have never experienced depression, which may be partly due to differences in stress-reactivity. Additionally, both the dynamic model of affect and the broaden-and-build theory suggest that stress and positive affect interact to predict negative affect, but this moderation has never been tested in the context of depression history. The current study used multilevel modeling to examine these issues among 1549 college students with or without a history of depression. Students completed a 30-day online diary study in which they reported daily their perceived stress, positive affect, and negative affect (including depression, anxiety, and hostility). On days characterized by higher than usual stress, students with a history of depression reported greater decreases in positive affect and greater increases in depressed affect than students with no history. Furthermore, the relations between daily stress and both depressed and anxious affect were moderated by daily positive affect among students with remitted depression. These results indicate that students with a history of depression show greater stress-reactivity even when in remission, which may place them at greater risk for recurrence. These individuals may also benefit more from positive affect on higher stress days despite being less likely to experience positive affect on such days. The current findings have various implications both clinically and for research on stress, mood, and depression. PMID:24274764

  12. Bill Gates køber sig til positive historier om udviklingsbistanden

    DEFF Research Database (Denmark)

    Fejerskov, Adam Moe

    2014-01-01

    Flere store og velansete medier får penge af Bill Gates' fond for at at bringe positive historier om udviklingsbistanden. Men det medfører en risiko for at journalistikken bliver ukritisk og overfladisk......Flere store og velansete medier får penge af Bill Gates' fond for at at bringe positive historier om udviklingsbistanden. Men det medfører en risiko for at journalistikken bliver ukritisk og overfladisk...

  13. Parental History of Diabetes, Positive Affect, and Diabetes Risk in Adults: Findings from MIDUS

    Science.gov (United States)

    Tsenkova, Vera; Karlamangla, Arun; Ryff, Carol

    2016-01-01

    Background Family history of diabetes is one of the major risk factors for diabetes but significant variability in this association remains unexplained, suggesting the presence of important effect modifiers. Purpose To our knowledge, no previous work has examined whether psychological factors moderate the degree to which family history of diabetes increases diabetes risk. Methods We investigated the relationships among parental history of diabetes, affective states (positive affect, negative affect, and depressed affect), and diabetes in 978 adults from the MIDUS 2 national sample. Results As expected, parental history of diabetes was associated with an almost threefold increase in diabetes risk. We found a significant interaction between positive affect and parental history of diabetes on diabetes (p=.009): higher positive affect was associated with a statistically significant lower relative risk for diabetes in participants who reported having a parental history of diabetes (RR=.66 per unit increase in positive affect; 95% CI: .47; .93), but it did not influence diabetes risk for participants who reported no parental history of diabetes (p=.34). This pattern persisted after adjusting for an extensive set of health and sociodemographic covariates and was independent of negative and depressed affect. Conclusions These results suggest that psychological well-being may protect individuals at increased risk from developing diabetes. Understanding such interactions between non-modifiable risk factors and modifiable psychological resources is important for delineating biopsychosocial pathways to diabetes and informing theory-based, patient-centered interventions to prevent the development of diabetes. PMID:27287937

  14. Emotional stress-reactivity and positive affect among college students: the role of depression history.

    Science.gov (United States)

    O'Hara, Ross E; Armeli, Stephen; Boynton, Marcella H; Tennen, Howard

    2014-02-01

    Multiple theories posit that people with a history of depression are at higher risk for a depressive episode than people who have never experienced depression, which may be partly due to differences in stress-reactivity. In addition, both the dynamic model of affect and the broaden-and-build theory suggest that stress and positive affect interact to predict negative affect, but this moderation has never been tested in the context of depression history. The current study used multilevel modeling to examine these issues among 1,549 college students with or without a history of depression. Students completed a 30-day online diary study in which they reported daily their perceived stress, positive affect, and negative affect (including depression, anxiety, and hostility). On days characterized by higher than usual stress, students with a history of depression reported greater decreases in positive affect and greater increases in depressed affect than students with no history. Furthermore, the relations between daily stress and both depressed and anxious affect were moderated by daily positive affect among students with remitted depression. These results indicate that students with a history of depression show greater stress-reactivity even when in remission, which may place them at greater risk for recurrence. These individuals may also benefit more from positive affect on higher stress days despite being less likely to experience positive affect on such days. The current findings have various implications both clinically and for research on stress, mood, and depression. (PsycINFO Database Record (c) 2014 APA, all rights reserved). PsycINFO Database Record (c) 2014 APA, all rights reserved.

  15. Penicillin sensitivity among children without a positive history for penicillin allergy.

    Science.gov (United States)

    Cetinkaya, Feyzullah; Cag, Yakup

    2004-06-01

    To establish the prevalence of positive penicillin skin tests among outpatients without any drug reaction history. Skin testing was performed in 147 children (aged 6-13 years) who had had received a penicillin preparation at least three times in the last 12 months without any allergic reaction. Before testing, detailed pediatric and allergy history were learned and then all children were tested with benzyl penicilloyl polylysin (PPL) and mixture of minor antigenic determinants. The test procedures were made epidermally and intradermally subsequently in every subject. The overall frequency of positive skin reactions to penicillin antigens was 10.2%. A mild systemic reaction was observed in one of the children during testing with PPL. We concluded that frequent use of penicillin and other beta-lactam antibiotics leads to sensitization of children in our study population despite these children seem to be asymptomatic during testing time. Copyright 2004 Blackwell Munksgaard

  16. Who Improved in a Trauma Intervention for HIV-Positive Women with Child Sexual Abuse Histories?

    OpenAIRE

    Chin, D; Myers, HF; M. Zhang; Loeb, T; Ullman, JB; Wyatt, GE; Carmona, J

    2013-01-01

    The Healing Our Women Program, an 11-week integrated trauma/HIV intervention designed for HIV-positive women with child sexual abuse histories, has been found to reduce psychological distress in treatment groups compared with wait-list controls (Chin, Wyatt, Carmona, Loeb, & Myers, 2004; Wyatt et al., 2011). This study examines the characteristics of participants who improved versus those who did not improve among participants who received the active intervention (N = 78) at post, 3-, and 6-m...

  17. Effect of parental family history of Alzheimer's disease on serial position profiles.

    Science.gov (United States)

    La Rue, Asenath; Hermann, Bruce; Jones, Jana E; Johnson, Sterling; Asthana, Sanjay; Sager, Mark A

    2008-07-01

    An exaggerated recency effect (ie, disproportionate recall of last-presented items) has been consistently observed in the word list learning of patients with Alzheimer's disease (AD). Our study sought to determine whether there were similar alterations in serial position learning among asymptomatic persons at risk for AD as a result of parental family history. Subjects included 623 asymptomatic middle-aged children of patients with AD (median, 53 years) and 157 control participants whose parents survived to at least age 70 without AD or other memory disorders. All participants were administered the Rey Auditory Verbal Learning Test, which requires learning and recall of 15 unrelated nouns. There was no significant difference in total words recalled between the AD children and control groups. However, compared with controls, AD children exhibited a significantly greater tendency to recall words from the end (recency) versus beginning (primacy) of the list. Serial position effects were unrelated to apolipoprotein allele epsilon 4 or depressive symptoms. Asymptomatic persons at risk for AD by virtue of family history do not show a difference in total words recalled compared with controls, but they exhibit a distinctly different serial position curve, suggesting greater reliance on immediate as opposed to episodic memory. This is the same serial position pattern observed in mild AD, seen here in reduced severity. Longitudinal follow-up is planned to determine whether changes in serial position patterns are a meaningful marker for preclinical detection of AD.

  18. Abdominal aortic aneurysms do not develop more aggressively among patients with a positive family history of the disease

    DEFF Research Database (Denmark)

    Mejnert Jørgensen, Trine; Wemmelund, Holger; Green, Anders

    Title: Abdominal aortic aneurysms no not develop more aggressively among patients with a positive family history of the disease Authors: Trine M. M. Joergensen, Holger Wemmelund, Anders Green, Jes Lindholt, Kim Houlind. Introduction: It is well known, that a family history of abdominal aortic...... among patients with a positive family history of the disease....... with information on family history of AAA, diameter of AAA throughout follow-up, surgery, ruptures, comorbidity, smoking, and use of medication. Methods: Patients with and without a family history of AAA were compared regarding mean age at diagnosis and surgery, diameter of AAA at diagnosis, risk of surgery...

  19. Strategies and outcomes of HIV status disclosure in HIV-positive young women with abuse histories.

    Science.gov (United States)

    Clum, Gretchen A; Czaplicki, Lauren; Andrinopoulos, Katherine; Muessig, Kathryn; Hamvas, L; Ellen, Jonathan M

    2013-03-01

    Young women with HIV and histories of physical and/or sexual abuse in childhood may be vulnerable to difficulties with disclosure to sexual partners. Abuse in childhood is highly prevalent in HIV-positive women, and has been associated with poorer communication, low assertiveness, low self worth, and increased risk for sexual and other risk behaviors that increase the risk of secondary transmission of HIV. HIV disclosure may be an important link between abuse and sexual risk behaviors. Qualitative interviews with 40 HIV-positive young women with childhood physical and/or sexual abuse were conducted; some women had also experienced adult victimization. Results suggest that HIV-positive women with abuse histories use a host of strategies to deal with disclosure of HIV status, including delaying disclosure, assessing hypothetical responses of partners, and determining appropriate stages in a relationship to disclose. Stigma was an important theme related to disclosure. We discuss how these disclosure processes impact sexual behavior and relationships and discuss intervention opportunities based on our findings.

  20. Deportation history among HIV-positive Latinos in two US-Mexico border communities.

    Science.gov (United States)

    Muñoz, Fátima A; Servin, Argentina E; Garfein, Richard S; Ojeda, Victoria D; Rangel, Gudelia; Zúñiga, María Luisa

    2015-02-01

    Health-related vulnerabilities associated with deportation are understudied. We conducted a cross-sectional study to identify factors associated with history of deportation from the US to Mexico among HIV-positive Latinos. From 2009 to 2010, we recruited a convenience sample from HIV clinics in San Diego, US and Tijuana, Mexico. Of 283 participants, 25% reported a prior deportation. Factors independently associated with increased odds of deportation history were being male [adjusted odds ratio (AOR) 2.77; 95% CI 1.18-6.48], having ≤high-school education (AOR 3.87; 95% CI 1.84-8.14), ever using cocaine (AOR 2.46; 95% CI 1.33-4.57), and reporting personalized HIV-stigma: "some have told me HIV is what I deserve for how I lived" (AOR 2.23; 95% CI 1.14-4.37). Lower self-reported antiretroviral medication adherence (AOR 0.35; 95% CI 0.12-0.96) and perceiving HIV-stigma: "most people believe a person who has HIV is dirty" (AOR 0.49; 95% CI 0.25-0.94) were associated with decreased odds of deportation history. Deportation is associated with specific socioeconomic indicators that are known to impact the health of individuals living with HIV.

  1. Positive and Negative Factors of Economic Development in Economic History of South Korea

    Directory of Open Access Journals (Sweden)

    Park Jong Min

    2017-01-01

    Full Text Available Purpose: the aim of the article is to analyze the Korean economic strategy from the beginning of its development until modern stage. Examination of how this strategy has changed depending on changes within domestic and international economic environment, assumptions, set goals, their effectiveness and significance of all the taken measures. It will demonstrate waypoints for the future economic development and will become a trigger towards recognition of the successful development of the Korean economy by other countries. Methods: the methodological bases of this article are the economic and statistical methods of analysis of the Korean economys, graphical methods displaying economic indicators. Results: economic history of South Korea over the past century shows the positive and negative factors of the development from an economically weak country into a developing country. The history of the Japanese occupation of Korea, lasting from 1910 to 1945, showed that for a country which has lost its national sovereignty, expropriated the state's economy has no effect after the restoration of independence, and that the economy cannot develop in conditions of chaos within the political, economic and social spheres. Even after the establishment of a military dictatorship, it is possible to note that despite limitations of citizens’ rights, the economy can still grow if the people want it. In addition to the development of internal political system, unstable factors in the process of promotion of social reforms and hastily adopted policy of "open doors" in order to enhance the international status are unreasonable political, economic and social changes. In turn, the inability to control currency exchange in Asian countries, which is a policy of economic development, has shown the existence of a risk of national bankruptcy. Moreover, the adoption of policies of excessive decrease of interest rates in order to revive the recession may be counterproductive

  2. Cenozoic tectono-thermal history of the Tordrillo Mountains, Alaska: Paleocene-Eocene ridge subduction, decreasing relief, and late Neogene faulting

    Science.gov (United States)

    Benowitz, Jeff A.; Haeussler, Peter J.; Layer, Paul W.; O'Sullivan, Paul B.; Wallace, Wes K.; Gillis, Robert J.

    2012-01-01

    Topographic development inboard of the continental margin is a predicted response to ridge subduction. New thermochronology results from the western Alaska Range document ridge subduction related orogenesis. K-feldspar thermochronology (KFAT) of bedrock samples from the Tordrillo Mountains in the western Alaska Range complement existing U-Pb, 40Ar/39Ar and AFT (apatite fission track) data to provide constraints on Paleocene pluton emplacement, and cooling as well as Late Eocene to Miocene vertical movements and exhumation along fault-bounded blocks. Based on the KFAT analysis we infer rapid exhumation-related cooling during the Eocene in the Tordrillo Mountains. Our KFAT cooling ages are coeval with deposition of clastic sediments in the Cook Inlet, Matanuska Valley and Tanana basins, which reflect high-energy depositional environments. The Tordrillo Mountains KFAT cooling ages are also the same as cooling ages in the Iliamna Lake region, the Kichatna Mountains of the western Alaska Range, and Mt. Logan in the Wrangell-St. Elias Mountains, thus rapid cooling at this time encompasses a broad region inboard of, and parallel to, the continental margin extending for several hundred kilometers. We infer these cooling events and deposition of clastic rocks are related to thermal effects that track the eastward passage of a slab window in Paleocene-Eocene time related to the subduction of the proposed Resurrection-Kula spreading ridge. In addition, we conclude that the reconstructed KFATmax negative age-elevation relationship is likely related to a long period of decreasing relief in the Tordrillo Mountains.

  3. Breast-conservation therapy in early-stage breast cancer patients with a positive family history.

    Science.gov (United States)

    Vlastos, Georges; Mirza, Nadeem Q; Meric, Funda; Hunt, Kelly K; Mirza, Attiqa N; Newman, Lisa A; Ames, Frederick C; Kuerer, Henry M; Ross, Merrick I; Feig, Barry; Babiera, Gildy; Buchholz, Thomas A; Hortobagyi, Gabriel N; Singletary, S Eva

    2002-11-01

    Our goal was to evaluate the role of breast-conservation therapy in early-stage breast cancer patients with a family history (FH) of breast cancer. Between 1970 and 1994, 1324 female patients with breast cancer were treated with breast-conservation therapy at our institution. From these, we identified 985 patients with stage 0-II breast cancer and who had available information on FH status. FH was considered positive in any patient who had a relative who had been previously diagnosed with breast cancer. Disease-specific survival was calculated from the date of initial diagnosis using the Kaplan-Meier method. The stage distribution for the 985 patients was as follows: 0 in 65 (7%), I in 500 (51%), and II in 420 (43%). The median age was 50 years (range, 21-88), with a median follow-up time of 8.8 years (range,.25-29). The median tumor size was 1.5 cm. FH was positive in 31%. There were no significant differences in locoregional recurrence, distant recurrence, disease-specific survival, or incidence of contralateral breast cancer in patients with a positive FH versus patients with a negative FH. Breast-conservation therapy is not contraindicated in early-stage breast cancer patients with a positive FH.

  4. Violence prevention among HIV-positive women with histories of violence: healing women in their communities.

    Science.gov (United States)

    Wyatt, Gail E; Hamilton, Alison B; Myers, Hector F; Ullman, Jodie B; Chin, Dorothy; Sumner, Lekeisha A; Loeb, Tamra B; Carmona, Jennifer V; Zhang, Muyu; Liu, Honghu

    2011-11-01

    Experiences of past and current gender-based violence are common among HIV-positive women in the United States, who are predominantly from ethnic minority groups. However, culturally congruent, feasible interventions for HIV-positive women who have experienced past and/or current violence are not widely available. The Office on Women's Health Gender Forum has made several recommendations for responding to the National HIV/AIDS Strategy Implementation Plan, including recommendations to incorporate gender-based violence prevention into a comprehensive, gender-responsive national strategy. This paper draws on an example of a community-based project for HIV-positive women, the Healing Our Women Project, to illustrate how violence prevention can be achieved within peer-led and community-based programming. Strong community partnerships, responsiveness to community needs and local cultural norms, a trained workforce, and culturally competent care are programmatic cornerstones of gender-responsive services. HIV-positive women with histories of gender-based violence and risk factors for current and future violence deserve the highest quality gender-responsive services to ensure that they can address their health needs within contexts of safety and respect. Published by Elsevier Inc.

  5. Historie

    DEFF Research Database (Denmark)

    Poulsen, Jens Aage

    Historie i serien handler om læreplaner og læremidler og deres brug i skolefaget historie. Bogen indeholder nyttige redskaber til at analysere og vurdere læremidler......Historie i serien handler om læreplaner og læremidler og deres brug i skolefaget historie. Bogen indeholder nyttige redskaber til at analysere og vurdere læremidler...

  6. Positive reproductive family history for spontaneous abortion: predictor for recurrent miscarriage in young couples.

    Science.gov (United States)

    Miskovic, Silvana; Culic, Vida; Konjevoda, Pasko; Pavelic, Jasminka

    2012-04-01

    The etiology of recurrent spontaneous abortions (RSA) in chromosomally normal parents is still unexplained. It is unclear whether or not some factors, such as spontaneous abortions (SA), which occur among extended family members can create a predisposition to RSA. Therefore, this study comprises two parts: (a) an epidemiological part, to evaluate the relationship between RSA in 567 couples and the frequency of SA among their first (I), second (II) and third (III) generation relatives, and (b) a genetic part, investigating whether parental and fetal chromosomal status may predispose to the occurrence of RSA. Couples (567) having one or more SA were analyzed in this retrospective case-control study. The family reproductive history data was collected from their medical charts. The total number of SA found in 567 couples was 1174, and the largest number occurred at 8-10 weeks of gestation. The majority of spouses had normal karyotypes (88.5% and 91%). Of the remainder, 65% of females and 76% of males expressed constitutional chromosomal variation, mostly pericentric inversion of chromosome 9. Cytogenetic analysis of aborted material showed some type of change in 40% of cases. The family reproductive history data indicated that SA among the couples' I, II and III generation relatives happened with a frequency two to three times higher than that of the general population (55.5, 47.6 and 32.6% for female relatives, and 45.8, 44.1 and 15.1% for male relatives). Positive reproductive family history for SA might be the causal factor for RSA and can also predetermine women that are of greater susceptibility to preterm pregnancy. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

  7. Impact of Tax Relief on Public Finance

    Directory of Open Access Journals (Sweden)

    Bikas Egidijus

    2016-12-01

    Full Text Available Tax reliefs are optional, but a very important element of the taxation system. This element is used for different purposes by a country’s government institutions. Tax reliefs are a form of tax expenditure that helps to reduce budget revenues. Tax reliefs influence individual and corporate financial behaviour and can have positive or negative effects on the economic and social factors. In the last few years, expansion of tax relief has attracted worldwide attention because of the fact that, after the global financial crisis, many countries are still suffering from fiscal deficits, and expansion of tax relief has not contributed to solving this problem. Tax reliefs are presupposed to be a fiscal policy tool of significance in various subsystems of public finances. The main aim of this article is to examine the impact of personal income tax reliefs on Lithuanian public finances. To achieve this aim, statistical information was systemized; Monte Carlo method was used to group data by horizontal rows and logical links analysed, which helped to evaluate the influence of tax reliefs on public finances. In the simulations, the Monte Carlo method helped to simulate random samples, which were then examined by adapting the conclusions of the theory of probability and mathematical statistics methods.

  8. Who Improved in a Trauma Intervention for HIV-Positive Women with Child Sexual Abuse Histories?

    Science.gov (United States)

    Chin, Dorothy; Myers, Hector F; Zhang, Muyu; Loeb, Tamra; Ullman, Jodie B; Wyatt, Gail E; Carmona, Jennifer

    2014-03-01

    The Healing Our Women Program, an 11-week integrated trauma/HIV intervention designed for HIV-positive women with child sexual abuse histories, has been found to reduce psychological distress in treatment groups compared to wait-list controls (Chin et al., 2004; Wyatt et al., 2011). This study examines the characteristics of participants who improved vs. those who did not improve among participants who received the active intervention (N=78) at post, three-, and six-month follow-up. Logistic regression analyses conducted post-intervention and at three- and six-month followups examined demographic characteristics, treatment attendance, AIDS diagnosis, and total trauma burden as possible predictors of improvement. Results indicated that at post-test, total trauma burden was significantly associated with improvement. At three-month follow-up, none of the variables discriminated the groups. At six-month follow-up, total trauma burden was again significantly related to improvement. The results suggest that the intervention is most appropriate for women with high trauma burdens. Future HIV interventions should go beyond the "one size fits all" approach" and consider the "fit" between intervention and participants.

  9. The clinical impact of a positive family history of psychosis or mental ...

    African Journals Online (AJOL)

    Background: A family history of psychosis is associated with negative clinical characteristics of psychosis. Aim: We aimed to determine the relationship between a family history (in first-degree relatives) of psychosis (FHP) or of any mental illness (FHM), and the clinical features (including cannabis use) of first episode early ...

  10. Silencing, positive selection and parallel evolution: busy history of primate cytochromes C.

    Directory of Open Access Journals (Sweden)

    Denis Pierron

    Full Text Available Cytochrome c (cyt c participates in two crucial cellular processes, energy production and apoptosis, and unsurprisingly is a highly conserved protein. However, previous studies have reported for the primate lineage (i loss of the paralogous testis isoform, (ii an acceleration and then a deceleration of the amino acid replacement rate of the cyt c somatic isoform, and (iii atypical biochemical behavior of human cyt c. To gain insight into the cause of these major evolutionary events, we have retraced the history of cyt c loci among primates. For testis cyt c, all primate sequences examined carry the same nonsense mutation, which suggests that silencing occurred before the primates diversified. For somatic cyt c, maximum parsimony, maximum likelihood, and Bayesian phylogenetic analyses yielded the same tree topology. The evolutionary analyses show that a fast accumulation of non-synonymous mutations (suggesting positive selection occurred specifically on the anthropoid lineage root and then continued in parallel on the early catarrhini and platyrrhini stems. Analysis of evolutionary changes using the 3D structure suggests they are focused on the respiratory chain rather than on apoptosis or other cyt c functions. In agreement with previous biochemical studies, our results suggest that silencing of the cyt c testis isoform could be linked with the decrease of primate reproduction rate. Finally, the evolution of cyt c in the two sister anthropoid groups leads us to propose that somatic cyt c evolution may be related both to COX evolution and to the convergent brain and body mass enlargement in these two anthropoid clades.

  11. "Less than a Vapor": Positioning Black lesbian women in history teacher education.

    Science.gov (United States)

    Woodson, Ashley N

    2017-10-02

    In this article, I discuss the possibilities and implications of centering Black lesbian identities and relationships in history teacher education through a case study with one straight Black woman preservice history teacher named Danitra. Danitra's understanding and navigation of historical research on Black lesbians are discussed in relation to core themes of lesbian historiography and emancipatory historiography. Though the literature on this group is limited, I argue that critical considerations of Black lesbians' interests and experiences help educators to conceive of and teach about history, citizenship, justice, and sexuality in more liberatory ways. I conclude by offering recommendations to history teachers and teacher educators who hope to draw on lesbian and emancipatory historiographies to challenge discourses of invisibility in history teacher education classrooms.

  12. HIV Positive Diagnosis During Pregnancy Increases Risk of IPV Postpartum Among Women with No History of IPV in Their Relationship.

    Science.gov (United States)

    Groves, Allison K; Reyes, H Luz McNaughton; Moodley, Dhayendre; Maman, Suzanne

    2017-07-24

    There has been limited study of whether and for whom physical intimate partner violence (IPV) is a consequence of an HIV-positive diagnosis. Per the diathesis stress model, the consequences of HIV infection may be worse for women with a history of IPV. We hypothesize that the positive association between HIV diagnosis in pregnancy and postpartum IPV will be exacerbated for women with a history of IPV. Data come from a prospective cohort study with 1015 participants who completed a baseline antenatal and 9-month postpartum visit. Using logistic regression analyses, we found a statistically significant interaction between HIV diagnosis, history of IPV and postpartum IPV (AOR: 0.40, 95% CI 0.17-0.96). The findings were in the opposite direction as expected: HIV-diagnosis was not associated with IPV for women with a history of IPV (AOR: 2.17, 95% CI 1.06, 4.42). However, HIV-positive women without a history of IPV faced more than two times the risk of incident postpartum IPV than HIV-negative women (AOR: 2.17, 95% CI 1.06, 4.42). Interventions to reduce incident and ongoing IPV during the perinatal period are needed.

  13. Validity of a self-reported history of a positive tuberculin skin test. A prospective study of drug users.

    Science.gov (United States)

    Kunins, Hillary V; Howard, Andrea A; Klein, Robert S; Arnsten, Julia H; Litwin, Alain H; Schoenbaum, Ellie E; Gourevitch, Marc N

    2004-10-01

    To define the prevalence of and factors associated with having a negative purified protein derivative (PPD) among persons who self-report a prior positive PPD and to define the safety of repeat testing in such persons. Observational cohort study. Methadone maintenance program with onsite primary care. Current or former drug users enrolled in methadone maintenance treatment. Structured interview, tuberculin skin testing regardless of self-reported PPD status, and anergy testing. Nearly one third (31%) of participants who self-reported a prior positive PPD had a negative measured PPD, despite receipt of a "booster" PPD. A single participant (0.5%) blistered in response to the PPD without lasting ill effect. Participants with PPD results discordant from their history were more likely to be HIV-seropositive and nonreactive to the anergy panel. The discordance rate among HIV-infected participants was 43%, and was largely attributable to immune dysfunction. Among HIV-seronegative participants, the discordance rate was 27%. Recent crack-cocaine use was independently associated with discordance in the absence of HIV infection. We confirmed that planting a PPD in patients who self-report a positive PPD history confers minimal risk. Substantial rates of discordance exist between self-reported history of a positive PPD and measured PPD status. Further research is needed to define the optimal management of PPD-negative patients who self-report a prior positive PPD and who have not received prior treatment for latent tuberculosis.

  14. Expanding the definition of a positive family history for early-onset coronary heart disease.

    Science.gov (United States)

    Scheuner, Maren T; Whitworth, William C; McGruder, Henraya; Yoon, Paula W; Khoury, Muin J

    2006-08-01

    Assessing familial risk for early-onset coronary heart disease (CHD) is typically limited to first-degree relatives with early-onset CHD. To evaluate the impact of additional family history, we examined the associations between various family history definitions and early-onset CHD. By using the national HealthStyles 2003 survey data, we assessed associations between self-reported family history and personal history of early-onset CHD (diagnosed at or before age 60 years), adjusting for demographics, hypercholesterolemia, hypertension, and obesity. Of 4,035 respondents, 60% were female and 72% were white, with a mean age of 48.8 years; 4.4% had early-onset CHD. In addition to having at least one first-degree relative with early-onset CHD, other significant associations included having at least one first-degree relative with late-onset CHD, at least one second-degree relative with early-onset CHD, and two or more affected second-degree relatives regardless of age of onset of CHD. Early-onset stroke in at least one first-degree relative and, in women, having at least one first-degree relative with diabetes were also significantly associated with early-onset CHD. Family history beyond early-onset CHD in first-degree relatives is significantly associated with prevalent CHD diagnosed at or before age 60 years.

  15. Paper relief architecture

    NARCIS (Netherlands)

    Latka, J.F.

    2014-01-01

    The article presents two contemporary projects of paper structures relief architecture designed and built by Shigeru Ban Architects and Voluntary Architect Network. Author of the article took part in design and construction process of one of the projects. The project of Yaan Nursery School, which

  16. Itching for Allergy Relief?

    Science.gov (United States)

    ... function, you don't find relief from OTC drugs, or you experience allergy symptoms over a long period. You may need ... available OTC and in generic form. The prescription drugs Astelin ... sprays approved to treat allergy symptoms. They can be used several times a ...

  17. No differences in ventral striatum responsivity between adolescents with a positive family history of alcoholism and controls.

    Science.gov (United States)

    Müller, Kathrin U; Gan, Gabriela; Banaschewski, Tobias; Barker, Gareth J; Bokde, Arun L W; Büchel, Christian; Conrod, Patricia; Fauth-Bühler, Mira; Flor, Herta; Gallinat, Jürgen; Garavan, Hugh; Gowland, Penny; Heinz, Andreas; Ittermann, Bernd; Lawrence, Claire; Loth, Eva; Mann, Karl; Martinot, Jean-Luc; Nees, Frauke; Paus, Tomáš; Pausova, Zdenka; Rietschel, Marcella; Ströhle, Andreas; Struve, Maren; Schumann, Gunter; Smolka, Michael N

    2015-05-01

    Individuals with alcohol-dependent parents show an elevated risk of developing alcohol-related problems themselves. Modulations of the mesolimbic reward circuit have been postulated as a pre-existing marker of alcoholism. We tested whether a positive family history of alcoholism is correlated with ventral striatum functionality during a reward task. All participants performed a modified version of the monetary incentive delay task while their brain responses were measured with functional magnetic resonance imaging. We compared 206 healthy adolescents (aged 13-15) who had any first- or second-degree relative with alcoholism to 206 matched controls with no biological relative with alcoholism. Reward anticipation as well as feedback of win recruited the ventral striatum in all participants, but adolescents with a positive family history of alcoholism did not differ from their matched peers. Also we did not find any correlation between family history density and reward anticipation or feedback of win. This finding of no differences did not change when we analyzed a subsample of 77 adolescents with at least one parent with alcohol use disorder and their matched controls. Because this result is in line with another study reporting no differences between children with alcohol-dependent parents and controls at young age, but contrasts with studies of older individuals, one might conclude that at younger age the effect of family history has not yet exerted its influence on the still developing mesolimbic reward circuit. © 2014 Society for the Study of Addiction.

  18. Hot water epilepsy: a video case of European boy with positive family history and subsequent non-reflex epilepsy.

    Science.gov (United States)

    Vignoli, Aglaia; Savini, Miriam Nella; La Briola, Francesca; Chiesa, Valentina; Zambrelli, Elena; Peron, Angela; Canevini, Maria Paola

    2014-03-01

    A 9-year-old Caucasian boy affected by hot water epilepsy, with positive family history, experienced complex partial seizures during contact with hot water. A video-EEG recording was taken while hot water was poured onto his chest. Hot water epilepsy is rarely described in European countries, where bathing epilepsy in younger children is more common and often confused with this type of epilepsy.

  19. 24 CFR 7.44 - Interim relief.

    Science.gov (United States)

    2010-04-01

    ... will result in the dismissal of the Department's appeal. (e) The Department may, by notice to the... conditional restoration of the employee to duty status in the position specified in the decision, pending the outcome of the Department appeal. The employee may decline the offer of interim relief. (b) Service under...

  20. Tetanus infection in an HIV-positive patient with a history of prior ...

    African Journals Online (AJOL)

    An HIV-positive woman (previously vaccinated against tetanus) presented with tetanus infection after uvulectomy and manual vacuum aspiration (MVA).The course of her disease and treatment exposed critical issues in the proper prophylaxis and management of tetanus, particularly in a limited-resource setting with a high ...

  1. The beneficial effects of a positive attention bias amongst children with a history of psychosocial deprivation.

    Science.gov (United States)

    Troller-Renfree, Sonya; McLaughlin, Katie A; Sheridan, Margaret A; Nelson, Charles A; Zeanah, Charles H; Fox, Nathan A

    2017-01-01

    Children raised in institutions experience psychosocial deprivation that has detrimental influences on attention and mental health. The current study examined patterns of attention biases in children from institutions who were randomized at approximately 21.6 months to receive either a high-quality foster care intervention or care-as-usual. At age 12, children performed a dot-probe task and indices of attention bias were calculated. Additionally, children completed a social stress paradigm and cortisol reactivity was computed. Children randomized into foster care (N=40) exhibited an attention bias toward positive stimuli but not threat, whereas children who received care-as-usual (N=40) and a never-institutionalized comparison group (N=47) showed no bias. Stability of foster care placement was related to positive bias, while instability of foster care placement was related to threat bias. The magnitude of the positive bias was associated with fewer internalizing problems and better coping mechanisms. Within the foster care group, positive attention bias was related to less blunted cortisol reactivity. Copyright © 2016 Elsevier B.V. All rights reserved.

  2. Controlled administration of penicillin to patients with a positive history but negative skin and specific serum IgE tests.

    Science.gov (United States)

    Torres, M J; Mayorga, C; Leyva, L; Guzman, A E; Cornejo-García, J A; Juarez, C; Blanca, M

    2002-02-01

    Although subjects with a positive history of immediate allergy to penicillin and negative skin test are traditionally considered to tolerate penicillin, current evidence indicates that they may develop an immediate reaction despite negative skin and serum specific IgE tests. It is thought that these patients require additional tests to confirm the diagnosis. To assess in a large group of patients with a history of immediate allergy to penicillins but with both skin test and CAP-FEIA-negative to classical and side chain penicillin determinants, the role of controlled administration of betalactams as a diagnostic test. A group of 330 patients with a history of immediate allergic reactions to penicillins was studied by two evaluators from the same allergy unit using the following protocol: skin tests with major and minor determinants of benzylpenicillin (benzylpenicilloyl-poly l-lysine and minor determinant mixture), amoxicillin and ampicillin, and determination of specific IgE antibodies to penicillins, by CAP-FEIA, in serum. If both tests proved negative, a controlled administration of the drug was then carried out. A total of 89 (27%) patients were skin test and CAP-FEIA-negative and therefore required controlled administration of the drug. Of these, 49 developed an immediate response and were therefore considered allergic, and the remainder had good tolerance after administration of both benzylpenicillin and amoxicillin. The clinical characteristics of this group were similar to the other allergic patients who were skin test or CAP-FEIA-positive, except that they were younger (P reactions appeared within 1 h, a positive correlation was found between the dose inducing the response and the time elapsed from drug administration, for both benzylpenicillin and amoxicillin (P reactions and younger subjects. This suggests that new diagnostic tests are required so as to limit the use of controlled administration.

  3. A clarified position for Solanum lycopersicum var. cerasiforme in the evolutionary history of tomatoes (solanaceae).

    Science.gov (United States)

    Ranc, Nicolas; Muños, Stéphane; Santoni, Sylvain; Causse, Mathilde

    2008-12-20

    The natural phenotypic variability present in the germplasm of cultivated plants can be linked to molecular polymorphisms using association genetics. However it is necessary to consider the genetic structure of the germplasm used to avoid false association. The knowledge of genetic structure of plant populations can help in inferring plant evolutionary history. In this context, we genotyped 360 wild, feral and cultivated accessions with 20 simple sequence repeat markers and investigated the extent and structure of the genetic variation. The study focused on the red fruited tomato clade involved in the domestication of tomato and confirmed the admixture status of cherry tomatoes (Solanum lycopersicum var. cerasiforme). We used a nested sample strategy to set-up core collection maximizing the genetic diversity with a minimum of individuals. Molecular diversity was considerably lower in S. lycopersicum i.e. the domesticated form. Model-based analysis showed that the 144 S. lycopersicum var. cerasiforme accessions were structured into two groups: one close to the domesticated group and one resulting from the admixture of the S. lycopersicum and S. pimpinellifolium genomes. SSR genotyping also indicates that domesticated and wild tomatoes have evolved as a species complex with intensive level of hybridization. We compiled genotypic and phenotypic data to identify sub-samples of 8, 24, 32 and 64 cherry tomato accessions that captured most of the genetic and morphological diversity present in the entire S. lycopersicum var. cerasiforme collection. The extent and structure of allelic variation is discussed in relation to historical events like domestication and modern selection. The potential use of the admixed group of S. lycopersicum var. cerasiforme for association genetics studies is also discussed. Nested core collections sampled to represent tomato diversity will be useful in diversity studies. Molecular and phenotypic variability of these core collections is defined

  4. A clarified position for solanum lycopersicum var. cerasiforme in the evolutionary history of tomatoes (solanaceae

    Directory of Open Access Journals (Sweden)

    Causse Mathilde

    2008-12-01

    Full Text Available Abstract Background The natural phenotypic variability present in the germplasm of cultivated plants can be linked to molecular polymorphisms using association genetics. However it is necessary to consider the genetic structure of the germplasm used to avoid false association. The knowledge of genetic structure of plant populations can help in inferring plant evolutionary history. In this context, we genotyped 360 wild, feral and cultivated accessions with 20 simple sequence repeat markers and investigated the extent and structure of the genetic variation. The study focused on the red fruited tomato clade involved in the domestication of tomato and confirmed the admixture status of cherry tomatoes (Solanum lycopersicum var. cerasiforme. We used a nested sample strategy to set-up core collection maximizing the genetic diversity with a minimum of individuals. Results Molecular diversity was considerably lower in S. lycopersicum i.e. the domesticated form. Model-based analysis showed that the 144 S. lycopersicum var. cerasiforme accessions were structured into two groups: one close to the domesticated group and one resulting from the admixture of the S. lycopersicum and S. pimpinellifolium genomes. SSR genotyping also indicates that domesticated and wild tomatoes have evolved as a species complex with intensive level of hybridization. We compiled genotypic and phenotypic data to identify sub-samples of 8, 24, 32 and 64 cherry tomato accessions that captured most of the genetic and morphological diversity present in the entire S. lycopersicum var. cerasiforme collection. Conclusion The extent and structure of allelic variation is discussed in relation to historical events like domestication and modern selection. The potential use of the admixed group of S. lycopersicum var. cerasiforme for association genetics studies is also discussed. Nested core collections sampled to represent tomato diversity will be useful in diversity studies. Molecular and

  5. Frequency of a positive family history of colorectal cancer in general practice: a cross-sectional study.

    Science.gov (United States)

    Plath, Jasper; Siebenhofer, Andrea; Koné, Insa; Hechtner, Marlene; Schulz-Rothe, Sylvia; Beyer, Martin; Gerlach, Ferdinand M; Guethlin, Corina

    2017-02-01

    Evidence on the frequency of a positive family history of colorectal cancer (CRC) among individuals aged history of CRC among patients aged 40 to 54 years in a general practice setting. We conducted a cross-sectional study in 21 general practices in Germany. Patients aged 40 to 54 years were identified by means of the practice software and interviewed by health care assistants using a standardized four-item questionnaire. Outcome was occurrence of a positive family history of CRC, defined as at least one first-degree relative (FDR: parents, siblings, or children) with CRC. Further measurements were FDRs with CRC / colorectal polyps (adenomas) diagnosed before the age of 50 and occurrence of three or more relatives with colorectal, stomach, cervical, ovarian, urethel or renal pelvic cancer. Out of 6723 participants, 7.2% (95% confidence interval [CI] 6.6% to 7.8%) reported at least one FDR with CRC and 1.2% (95% CI 0.9% to 1.5%) reported FDRs with CRC diagnosed before the age of 50. A further 2.6% (95% CI 2.3% to 3.0%) reported colorectal polyps in FDRs diagnosed before the age of 50 and 2.1% (95% CI 1.8% to 2.5%) reported three or more relatives with entities mentioned above. One in 14 patients reported at least one FDR with CRC. General practice should be considered when defining requirements of risk-adapted CRC screening. © The Author 2016. Published by Oxford University Press. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  6. Risk reduction for HIV-positive African American and Latino men with histories of childhood sexual abuse.

    Science.gov (United States)

    Williams, John K; Wyatt, Gail E; Rivkin, Inna; Ramamurthi, Hema Codathi; Li, Xiaomin; Liu, Honghu

    2008-10-01

    While the HIV epidemic has disproportionately affected African American and Latino men who have sex with men (MSM), few HIV prevention interventions have focused on African American and Latino men who have sex with both men and women (MSMW). Even fewer interventions target HIV-positive African American and Latino MSM and MSMW with histories of childhood sexual abuse (CSA), a population that may be vulnerable to high-risk sexual behaviors, having multiple sexual partners, and depression. The Men's Health Project, a small randomized clinical trial, compared the effects of two 6-session interventions, the Sexual Health Intervention for Men (S-HIM), guided by social learning theory and aimed at decreasing high-risk sexual behaviors, number of sexual partners, and depressive symptoms, and a standard health promotion control (SHP). A community sample of 137 HIV-positive gay and non-gay identifying African American and Latino MSM and MSMW with histories of CSA was recruited. Results were based on an "intent to treat" analyses of baseline to post, 3 and 6 month follow-ups. The sample as a whole reported reductions in sexual risk behaviors and number of sexual partners from baseline to post-test, and from the 3 to 6 month follow-ups, although the decrease in sexual risk behavior from baseline to post-test was significant only for S-HIM participants. No significant differences between conditions were reported for depressive symptoms, but the total sample reported a significant decrease at 6 months. These findings highlight the importance of addressing sexual decision-making and psychological adjustment for ethnic men, while being sensitive to CSA histories and sexual minority status, and suggest the need to develop additional strategies to heighten HIV risk reduction over time.

  7. [Positive family history of colorectal cancer--use of a questionnaire].

    Science.gov (United States)

    Katalinic, A; Raspe, H; Waldmann, A

    2009-11-01

    The overall aim of the present work was to estimate the potential of early detection of colorectal cancer in persons with familial or hereditary risk. In this paper we present projections on how many persons in the age groups 30 - 49 and 30 - 54 years, respectively, would be classified as being at familial or hereditary risk when a questionnaire distributed by the "Netzwerk gegen Darmkrebs e. V." (network against colon cancer) is used for identification. Based on the results of a systematic literature search on the validity of questionnaires, the estimated prevalence of familial and hereditary disposition for colorectal cancer as well as actual German tumour incidence data projections were calculated. Given a 10 % prevalence of persons with a familial risk in the German general population and a maximum knowledge of all tumour cases in kindred, a total of 5.7 % of all Germans in the age group 30 - 49 years would be classified as familial risk persons (7.2 % in the age group 30 - 54 years). Taking familial and hereditary risks into account 6.7 % (8.2 %) will have a positive questionnaire result. If the questionnaire is used on a population-based level and the participation rate is 35 %, approximately 542 000 persons in the age group 30 - 49 years (816 000 in the age group 30 - 54 years) will be classified as having a familial or hereditary risk for colorectal cancer.

  8. Music for pain relief.

    Science.gov (United States)

    Cepeda, M S; Carr, D B; Lau, J; Alvarez, H

    2006-04-19

    The efficacy of music for the treatment of pain has not been established. To evaluate the effect of music on acute, chronic or cancer pain intensity, pain relief, and analgesic requirements. We searched The Cochrane Library, MEDLINE, EMBASE, PsycINFO, LILACS and the references in retrieved manuscripts. There was no language restriction. We included randomized controlled trials that evaluated the effect of music on any type of pain in children or adults. We excluded trials that reported results of concurrent non-pharmacological therapies. Data was extracted by two independent review authors. We calculated the mean difference in pain intensity levels, percentage of patients with at least 50% pain relief, and opioid requirements. We converted opioid consumption to morphine equivalents. To explore heterogeneity, studies that evaluated adults, children, acute, chronic, malignant, labor, procedural, or experimental pain were evaluated separately, as well as those studies in which patients chose the type of music. Fifty-one studies involving 1867 subjects exposed to music and 1796 controls met inclusion criteria. In the 31 studies evaluating mean pain intensity there was a considerable variation in the effect of music, indicating statistical heterogeneity ( I(2) = 85.3%). After grouping the studies according to the pain model, this heterogeneity remained, with the exception of the studies that evaluated acute postoperative pain. In this last group, patients exposed to music had pain intensity that was 0.5 units lower on a zero to ten scale than unexposed subjects (95% CI: -0.9 to -0.2). Studies that permitted patients to select the music did not reveal a benefit from music; the decline in pain intensity was 0.2 units, 95% CI (-0.7 to 0.2). Four studies reported the proportion of subjects with at least 50% pain relief; subjects exposed to music had a 70% higher likelihood of having pain relief than unexposed subjects (95% CI: 1.21 to 2.37). NNT = 5 (95% CI: 4 to 13). Three

  9. Sexual risk behaviors by relationship type and trauma history among HIV-positive men who have sex with men.

    Science.gov (United States)

    Kamen, Charles; Etter, Darryl; Flores, Sergio; Sharp, Susan; Lee, Susanne; Gore-Felton, Cheryl

    2013-02-01

    The association of trauma exposure and coping style to sexual risk behavior has yet to be fully examined in the context of primary and casual sexual partnerships. The current study assessed a high risk sexual behavior-unprotected anal intercourse (UAI)-in a high risk population of HIV-positive men who have sex with men (MSM) with a history of trauma. Using audio computer-assisted self-interview technology, 132 HIV-positive MSM completed measures of trauma exposure, trauma symptoms, coping strategies, and sexual risk behavior. Hierarchical logistic regression analyses indicated that completing more years of education and having experienced sexual abuse were positively associated with UAI with casual partners. Additionally, use of active coping was negatively associated with UAI with casual partners and the final model significantly predicted variance in UAI with casual partners. However, no variables were significantly associated with UAI with primary partners, suggesting that sexual risk behavior with primary partners may be associated with factors not commonly assessed in risk prediction or prevention research. We discuss the results in the context of developing new or modifying existing interventions to address rates of sexual risk in the relationships of HIV-positive MSM.

  10. A Case Report of Incontinentia Pigmenti in a Newborn with Positive Family History Extending Over Three Generations

    Directory of Open Access Journals (Sweden)

    Seyedeh Fatemeh Khatami

    2017-06-01

    Full Text Available Background: Incontinentia pigmenti (IP, also known as Bloch-Sulzberger syndrome, is a rare X-linked dominant genodermatosis that presents at the time of birth or soon after birth with cutaneous manifestation. This disorder may also affect the ectodermal tissues, such as the central nervous system, skeletal system, eyes, hair, nails, and teeth. The dermatological findings occur in four successive phases.Case report: Herein, we presented the case of a two day-old female newborn with inflammatory vesiculopustular lesions on the right forearm and lower limbs, who was in a good general condition. The patient had a history of similar disease in three other members of her family, who had dental abnormalities as the most common non-cutaneous manifestation. This case report highlighted the importance of a detailed diagnostic workup for the newborns with pustular skin disease.Conclusion: IP is a rare, x-linked dominant genodermatosis with multiple organs involvement. Dermatological abnormalities are the most prominent manifestation. The diagnosis is based on the clinical findings, the presence of positive family history of skin vesiculopustular lesions support the diagnosis. The skin lesions do not require specific treatment and prognosis depend to other organs involvement.

  11. Southern Alaska Coastal Relief Model

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — NOAA's National Geophysical Data Center (NGDC) is building coastal-relief models (CRM) for select U.S. coastal regions. Bathymetric, topographic, and shoreline data...

  12. Differences in joint-position sense and vibratory threshold in runners with and without a history of overuse injury.

    Science.gov (United States)

    Switlick, Tiffany; Kernozek, Thomas W; Meardon, Stacey

    2015-02-01

    A relationship between altered postural control and injury has been reported in sports. Sensorimotor function serves a fundamental role in postural control and is not often studied in runners. Persons who sustain running injury may have altered sensorimotor function contributing to risk of injury or reinjury. To determine if differences in knee and ankle proprioception or plantar sensation exist between injured and noninjured runners. Retrospective case-control study. University campus. Twenty runners with a history of lower-extremity overuse injury and 20 noninjured runners were examined. Injured runners were subcategorized into 2 groups based on site of injury: foot/ankle and knee/hip. Active absolute joint-repositioning error of the ankle at 20° inversion and 10° eversion and the knee at 15° and 40° flexion was assessed using an isokinetic dynamometer. Vibratory threshold at the calcaneus, arch, and great toe was determined for each subject using a handheld electric sensory threshold instrument. Runners in the injured-foot/ankle group had increased absolute error during ankle-eversion repositioning (6.55° ± 3.58°) compared with those in the noninjured (4.04° ± 1.78°, P = .01) and the hip/knee (3.63° ± 2.2°, P = .01) groups. Runners in the injured group, as a whole, had greater sensitivity in the arch of the plantar surface (2.94 ± 0.52 V) than noninjured runners (2.38 ± 0.53 V, P = .02). Differences in ankle-eversion proprioception between runners with a history of ankle and foot injuries and noninjured runners were observed. Runners with a history of injury also displayed an increased vibratory threshold in the arch region compared with noninjured runners. Poor ankle-joint-position sense and increased plantar sensitivity suggest altered sensorimotor function after injury. These factors may influence underlying postural control and contribute to altered loading responses commonly observed in injured runners.

  13. Ethanol-induced autonomic responses and risk taking increase in young adults with a positive family history of alcohol problems.

    Science.gov (United States)

    Caneto, Florencia; Pautassi, Ricardo Marcos; Pilatti, Angelina

    2018-01-01

    The mechanisms that underlie the greater prevalence of alcohol use disorders in individuals with a positive family history (FH+) of alcohol abuse are still under investigation. These subjects may exhibit differential sensitivity to alcohol's effects on psychomotor stimulation and impulsivity. Alcohol-induced psychomotor stimulation, measured as the heart rate (HR) response, is a proxy for the positive rewarding effects of the drug. We analyzed alcohol-induced effects on time perception (Time Production Task), risk taking (Balloon Analogue Risk Task [BART]), and HR in FH+ and FH- participants. In the FH+ and FH- groups, women and men received 0.6 and 0.7g/kg alcohol, respectively. The alcohol dose yielded a breath alcohol concentration of 0.08% throughout the experiment. The control groups received placebo, and the subjective perception of alcohol intoxication was assessed. Alcohol intoxication significantly increased HR and the adjusted average number of pumps on the BART (a measure of risk taking) in FH+ men and women but not in FH- participants. Behavioral impulsivity was unaffected by alcohol or a FH of alcohol abuse. FH- but not FH+ participants who received alcohol reported significantly greater subjective perception of alcohol's effects than their placebo counterparts. These results indicate that FH+ individuals presented heightened sensitivity to alcohol-induced HR stimulation and alcohol-induced risk taking compared with their FH- counterparts. FH+ subjects, however, were insensitive to the subjective effects of alcohol. This idiosyncratic response pattern may be a likely pathway by which a FH of alcohol problems promotes alcohol drinking. Copyright © 2017 Elsevier Ltd. All rights reserved.

  14. Seepage remediation by positive cut-off walls : a compendium and analysis of North American case histories

    Energy Technology Data Exchange (ETDEWEB)

    Bruce, D.A. [Geosystems LP, Venetia, PA (United States); Ressi di Cervia, A. [Treviicos Corp., North Dighton, MA (United States); Amos-Venti, J. [Merrimack College, North Andover, MA (United States)

    2006-07-01

    Reservoir leakage at major dams in North America is typically remediated through the use of positive cut-offs. Many dam owners and designers use cut-offs as an inexpensive means of addressing leakage. However, the use of cut-offs can lead to depressions and sinkholes, disturb trends from dam and foundation piezometers, and cause the presence of sediment or embankment materials in springs. This paper presented a summary of published literature relating to major North American seepage remediation. Twenty-two case histories were presented in tabulated and summarized form in which cut-offs were constructed from concrete and plastic concrete walls; cement-bentonite walls; and cut-offs using deep mixing methods (DMM). Key observations and relevant details were provided for each case study. The aim of the paper was to provide perspectives to potential users of the various techniques in relation to depth capability; geotechnical suitability; constructability; quality control and verification; and cost. It was concluded that further data input is needed to provide a better understanding of cut-off techniques. 39 refs., 2 tabs., 8 figs.

  15. Within, Between, Above, and Beyond: (Pre)positions for a History of the Internationalisation of Educational Practices and Knowledge

    Science.gov (United States)

    Caruso, Marcelo

    2014-01-01

    Not only in education, but also in other social practices, the history of "internationalisation" is correlative to the history of "nationalisation". In this broad sense, this article outlines four main constellations of the links between education and nationalisation/internationalisation dynamics. After a brief description of…

  16. Kantian Right and Poverty Relief

    Directory of Open Access Journals (Sweden)

    Andrea Faggion

    2014-12-01

    Full Text Available http://dx.doi.org/10.5007/1677-2954.2014v13n2p283I have two goals in this paper. First, I want to determine whether Kant’s justification for state programs for poverty relief in The Doctrine of Right is based on 1 Kantian duties of virtue,  2 Kantian duties of right, or instead merely on 3 instrumental arguments regarding the preservation of a State as such.  I claim that the last alternative is the correct one. Second, I will argue, against Kant himself, that even his merely instrumental arguments for public programs for poverty relief are ruled out by his doctrine of right. My conclusion is that, perhaps surprisingly, the only genuinely Kantian way to provide poverty relief is privately, just as Libertarians have argued.

  17. Relief as a reward: hedonic and neural responses to safety from pain.

    Directory of Open Access Journals (Sweden)

    Siri Leknes

    2011-04-01

    Full Text Available Relief fits the definition of a reward. Unlike other reward types the pleasantness of relief depends on the violation of a negative expectation, yet this has not been investigated using neuroimaging approaches. We hypothesized that the degree of negative expectation depends on state (dread and trait (pessimism sensitivity. Of the brain regions that are involved in mediating pleasure, the nucleus accumbens also signals unexpected reward and positive prediction error. We hypothesized that accumbens activity reflects the level of negative expectation and subsequent pleasant relief. Using fMRI and two purpose-made tasks, we compared hedonic and BOLD responses to relief with responses during an appetitive reward task in 18 healthy volunteers. We expected some similarities in task responses, reflecting common neural substrates implicated across reward types. However, we also hypothesized that relief responses would differ from appetitive rewards in the nucleus accumbens, since only relief pleasantness depends on negative expectations. The results confirmed these hypotheses. Relief and appetitive reward task activity converged in the ventromedial prefrontal cortex, which also correlated with appetitive reward pleasantness ratings. In contrast, dread and pessimism scores correlated with relief but not with appetitive reward hedonics. Moreover, only relief pleasantness covaried with accumbens activation. Importantly, the accumbens signal appeared to specifically reflect individual differences in anticipation of the adverse event (dread, pessimism but was uncorrelated to appetitive reward hedonics. In conclusion, relief differs from appetitive rewards due to its reliance on negative expectations, the violation of which is reflected in relief-related accumbens activation.

  18. Selective deficits in semantic verbal fluency in patients with a first affective episode with psychotic symptoms and a positive history of mania.

    LENUS (Irish Health Repository)

    Kravariti, Eugenia

    2009-05-01

    Neurocognitive dysfunction is likely to represent a trait characteristic of bipolar disorder, but the extent to which it comprises \\'core\\' deficits as opposed to those secondary to longstanding illness or intellectual decline is unclear. We investigated neuropsychological performance in an epidemiologically derived sample of patients with a first affective episode with psychotic symptoms and a positive history of mania, compared to community controls.

  19. Diagnostic exome sequencing for patients with a family history of consanguinity: over 38% of positive results are not autosomal recessive pattern.

    Science.gov (United States)

    Powis, Zöe; Farwell, Kelly D; Alamillo, Christina L; Tang, Sha

    2016-02-01

    Diagnostic exome sequencing (DES) is an effective tool for diagnosis in intractable cases where the underlying cause is thought be genetic. It is commonly assumed that patients with a family history of consanguinity will have increased detection rates for rare autosomal recessive Mendelian disorders through DES. Herein, we analyzed the diagnostic yield and relevant inheritance patterns within the DES cases with a reported consanguineous family history. Of the first 500 unselected cases referred for DES, 40 (8.0%) had a known consanguineous family history. Among the 40 cases, 13 (32.5%) received a definitive molecular diagnosis through DES and such positive rate is similar to that of families with no reported consanguinity (139/460, 30.2%, P=0.63). Although homozygous alterations likely related to consanguinity have been identified in eight positive cases, the other five (38.4%) causative mutations were unrelated to autosomal recessive inheritance. Our retrospective analysis demonstrated that individuals with known consanguinity were not more likely to have a positive DES result and a significant portion of the positive findings were not within an autosomal recessive gene. These results highlight that all applicable inheritance patterns should be considered for patients with a known family history of consanguinity.

  20. Is the current ASAS expert definition of a positive family history useful in identifying axial spondyloarthritis? Results from the SPACE and DESIR cohorts

    NARCIS (Netherlands)

    Ez-Zaitouni, Zineb; Hilkens, Andrea; Gossec, Laure; Berg, Inger Jorid; Landewe, Robert; Ramonda, Roberta; Dougados, Maxime; van der Heijde, Desiree; van Gaalen, Floris

    2017-01-01

    Background: The Assessment of SpondyloArthritis international Society (ASAS) definition of a positive family history (PFH) of spondyloarthritis (SpA) includes the following diseases in first-or second-degree relatives: ankylosing spondylitis (AS), acute anterior uveitis (AAU), reactive arthritis

  1. Fraktalnist deformational relief polycrystalline aluminum

    Directory of Open Access Journals (Sweden)

    М.В. Карускевич

    2006-02-01

    Full Text Available  The possibility of the fractal geometry method application for the analisys of surface deformation structures under cyclic loading is presented.It is shown, that deformation relief of the alclad aluminium alloyes meets the criteria of the fractality. For the fractal demention estimation the method of  “box-counting”can be applied.

  2. Pictorial relief for equiluminant images

    NARCIS (Netherlands)

    Van Doorn, A.J.; De Ridder, H.; Koenderink, J.J.

    2005-01-01

    Pictorial relief depends strongly on “cues” in the image. For isoluminant renderings some cues are missing, namely all information that is related to luminance contrast (e.g., shading, atmospheric perspective). It has been suggested that spatial discrimination and especially pictorial space suffer

  3. Self-reported history of Pap-smear in HIV-positive women in Northern Italy: a cross-sectional study

    Directory of Open Access Journals (Sweden)

    Ghinelli Florio

    2010-06-01

    Full Text Available Abstract Background The incidence of invasive cervical cancer in HIV-positive women is higher than in the general population. There is evidence that HIV-positive women do not participate sufficiently in cervical cancer screening in Italy, where cervical cancer is more than 10-fold higher in women with AIDS than in the general population. The aim of the present study was to evaluate the history of Pap-smear in HIV-positive women in Italy in recent years. We also examined the sociodemographic, clinical, and organizational factors associated with adherence to cervical cancer screening. Methods A cross-sectional study was conducted between July 2006 and June 2007 in Emilia-Romagna region (Northern Italy. All HIV-positive women who received a follow-up visit in one of the 10 regional infectivology units were invited to participate. History of Pap-smear, including abnormal smears and subsequent treatment, was investigated through a self-administered anonymous questionnaire. The association between lack of Pap-smear in the year preceding the interview and selected characteristics was assessed by means of odds ratios (OR and 95% confidence intervals adjusted for study centre and age. Results A total of 1,002 HIV-positive women were interviewed. Nine percent reported no history of Pap-smear, and 39% had no Pap-smear in the year prior to the date of questionnaire (last year. The lack of Pap-smear in the last year was significantly associated with age Three hundred five (34% women reported a previous abnormal Pap-smear, and of the 178 (58% referred for treatment, 97% complied. Conclusions In recent years the self-reported history of Pap-smear in HIV-positive women, in some public clinics in Italy, is higher than previously reported, but further efforts are required to make sure cervical cancer screening is accessible to all HIV-positive women.

  4. History Kern National Wildlife Refuge

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — Details the location, physiography, relief, and drainage, vegetation, settlement and population, transportation and markets, climate, soils, acquisition history, and...

  5. Self-reported history of Pap-smear in HIV-positive women in Northern Italy: a cross-sectional study.

    Science.gov (United States)

    Dal Maso, Luigino; Franceschi, Silvia; Lise, Mauro; De' Bianchi, Priscilla Sassoli; Polesel, Jerry; Ghinelli, Florio; Falcini, Fabio; Finarelli, Alba C

    2010-06-21

    The incidence of invasive cervical cancer in HIV-positive women is higher than in the general population. There is evidence that HIV-positive women do not participate sufficiently in cervical cancer screening in Italy, where cervical cancer is more than 10-fold higher in women with AIDS than in the general population. The aim of the present study was to evaluate the history of Pap-smear in HIV-positive women in Italy in recent years. We also examined the sociodemographic, clinical, and organizational factors associated with adherence to cervical cancer screening. A cross-sectional study was conducted between July 2006 and June 2007 in Emilia-Romagna region (Northern Italy). All HIV-positive women who received a follow-up visit in one of the 10 regional infectivology units were invited to participate. History of Pap-smear, including abnormal smears and subsequent treatment, was investigated through a self-administered anonymous questionnaire. The association between lack of Pap-smear in the year preceding the interview and selected characteristics was assessed by means of odds ratios (OR) and 95% confidence intervals adjusted for study centre and age. A total of 1,002 HIV-positive women were interviewed. Nine percent reported no history of Pap-smear, and 39% had no Pap-smear in the year prior to the date of questionnaire (last year). The lack of Pap-smear in the last year was significantly associated with age or =45 years), lower education level (OR = 1.3), first HIV-positive test in the last 2 years (OR = 1.4), and CD4 count Pap-smear in the last year were found in women born in Central-Eastern Europe (OR = 1.8) and Africa (OR = 1.3). No difference in history of Pap-smear emerged by mode of HIV-acquisition or AIDS status.Three hundred five (34%) women reported a previous abnormal Pap-smear, and of the 178 (58%) referred for treatment, 97% complied. In recent years the self-reported history of Pap-smear in HIV-positive women, in some public clinics in Italy, is

  6. Possible link between history of hypersensitivity to a specific non-steroidal anti-inflammatory drug (NSAID) and positive results following challenge test to alternative NSAIDS.

    Science.gov (United States)

    Trombetta, Domenico; Imbesi, Selene; Vita, Giuseppe; Isola, Stefania; Minciullo, Paola Lucia; Saija, Antonella; Gangemi, Sebastiano

    2009-01-01

    In subjects with hypersensitivity reactions to non-steroidal anti-inflammatory drugs (NSAIDs), the choice of suitable alternative drugs with the lowest risk of reaction is imperative for therapeutic management. A safe method to exclude drug hypersensitivity is to perform a challenge test for an alternative drug. The present study was conducted to: obtain more information about the safety of NSAIDs; assess the risk of reaction following the administration of a selective or nonselective cyclooxygenase 2 (COX-2) inhibitor in patients with a history of adverse reactions to NSAIDs; investigate if age and/or gender play a role in the susceptibility to develop adverse reactions to NSAIDs. This retrospective study includes 524 patients with a history of hypersensitivity to NSAIDs admitted to undergo challenge test to an alternative anti-inflammatory drug. Statistical significance was achieved when odds ratio (OR) and risk ratio (RR) values were >1. 8.39% of patients with hypersensitivity reactions to NSAIDs showed a positive challenge test for the alternative drug. Challenge tests for nonselective COX-2 inhibitors were positive in 16.2% of patients with previous reaction to a same drug class and in 12.9% of patients with a history of reaction to selective COX-2 inhibitors. No positive challenge test to a non-selective COX-2 inhibitor was found in patients with a history of hypersensitivity to nimesulide (CAS 51803-78-2). Challenge tests for selective COX-2 inhibitors were positive in 4.6% of patients with a previous reaction to nonselective COX-2 inhibitors and in 7.2% of patients with a history of reaction to selective COX-2 inhibitors. The RR of a positive challenge test to a non-selective COX-2 inhibitor was significant in patients who had a history of reaction to an analogous compound (P 0.21, OR 1.31, RR 1.26). In this study, selective COX-2 inhibitors represented the class of NSAIDs less frequently reported as responsible of adverse reaction. These data underline

  7. Patients with premature cardiovascular disease and a positive family history for cardiovascular disease are prone to recurrent events

    NARCIS (Netherlands)

    Mulders, Ties A.; Meyer, Zainna; van der Donk, Christel; Kroon, Abraham A.; Ferreira, Isabel; Stehouwer, Coen D. A.; Pinto-Sietsma, Sara-Joan

    2011-01-01

    Background: Premature cardiovascular disease (CVD) is treated in the same way as CVD of advanced age. However, in patients with premature CVD and a family history of CVD, different -possibly genetic-mechanisms may underlie this disease, which current medical treatment is not targeted to. This

  8. 47 CFR 69.727 - Regulatory relief.

    Science.gov (United States)

    2010-10-01

    ... Pricing Flexibility § 69.727 Regulatory relief. (a) Phase I relief. Upon satisfaction of the Phase I... customer. (b) Phase II relief. Upon satisfaction of the Phase II triggers specified in §§ 69.709(c) or 69... similarly situated customers; and (ii) The price cap LEC excludes all contract tariff offerings from price...

  9. Service Learning Through Disaster Relief

    Directory of Open Access Journals (Sweden)

    Donna J. Duerst

    2010-06-01

    Full Text Available The Rock County 4-H Disaster Relief Committee raised $1,550 to aid tsunami victims in Sri Lanka and then turned its attention to Hurricane Katrina relief efforts. Thirty-one 4-H youth participated in a service learning trip to the South with the objectives of helping hurricane victims, learning about new cultures and achieving personal growth during three days of service projects in Louisiana and Mississippi. Their written reflections and other evaluative measures revealed they learned about southern culture, gained a greater appreciation for their lives, gained self confidence and developed a desire to help others more often. The trip was a valuable developmental experience for the youth, and information from the trip could be utilized to create similar experiences based on service learning. This article provides an overview of the trip and describes the evaluation methods used to measure learning and assess personal growth.

  10. Individuals family history positive for alcoholism show functional magnetic resonance imaging differences in reward sensitivity that are related to impulsivity factors.

    Science.gov (United States)

    Andrews, Melissa M; Meda, Shashwath A; Thomas, Andre D; Potenza, Marc N; Krystal, John H; Worhunsky, Patrick; Stevens, Michael C; O'Malley, Stephanie; Book, Gregory A; Reynolds, Brady; Pearlson, Godfrey D

    2011-04-01

    Substance-abusing individuals tend to display abnormal reward processing and a vulnerability to being impulsive. Detoxified alcoholics show differences in regional brain activation during a monetary incentive delay task. However, there is limited information on whether this uncharacteristic behavior represents a biological predisposition toward alcohol abuse, a consequence of chronic alcohol use, or both. We investigated proposed neural correlates of substance disorder risk by examining reward system activity during a monetary incentive delay task with separate reward prospect, reward anticipation, and reward outcome phases in 30 individuals with and 19 without family histories of alcoholism. All subjects were healthy, lacked DSM-IV past or current alcohol or substance abuse histories, and were free of illegal substances as verified by a urine toxicology screening at the time of scanning. Additionally, we explored specific correlations between task-related nucleus accumbens (NAcc) activation and distinct factor analysis-derived domains of behavioral impulsivity. During reward anticipation, functional magnetic resonance imaging data confirmed blunted NAcc activation in family history positive subjects. In addition, we found atypical activation in additional reward-associated brain regions during additional task phases. We further found a significant negative correlation between NAcc activation during reward anticipation and an impulsivity construct. Overall, results demonstrate that sensitivity of the reward circuit, including NAcc, is functionally different in alcoholism family history positive individuals in multiple regards. Copyright © 2011 Society of Biological Psychiatry. Published by Elsevier Inc. All rights reserved.

  11. Positive family history of colorectal cancer in a general practice setting [FRIDA.Frankfurt]: study protocol of a of a cross-sectional study.

    Science.gov (United States)

    Siebenhofer, Andrea; Plath, Jasper; Taubenroth, Maja; Singer, Susanne; Hechtner, Marlene; Dahlhaus, Anne; Rauck, Sandra; Schulz-Rothe, Sylvia; Koné, Insa; Gerlach, Ferdinand M

    2015-08-28

    Although the risk of developing colorectal cancer (CRC) is 2-4 times higher in case of a positive family history, risk-adapted screening programs for family members related to CRC- patients do not exist in the German health care system. CRC screening recommendations for persons under 55 years of age that have a family predisposition have been published in several guidelines. The primary aim of this study is to determine the frequency of positive family history of CRC (1st degree relatives with CRC) among 40-54 year old persons in a general practitioner (GP) setting in Germany. Secondary aims are to detect the frequency of occurrence of colorectal neoplasms (CRC and advanced adenomas) in 1st degree relatives of CRC patients and to identify the variables (e.g. demographic, genetic, epigenetic and proteomic characteristics) that are associated with it. This study also explores whether evidence-based information contributes to informed decisions and how screening participation correlates with anxiety and (anticipated) regret. Prior to the beginning of the study, the GP team (GP and one health care assistant) in around 50 practices will be trained, and about 8,750 persons that are registered with them will be asked to complete the "Network against colorectal cancer" questionnaire. The 10% who are expected to have a positive family history will then be invited to give their informed consent to participate in the study. All individuals with positive family history will be provided with evidence-based information and prevention strategies. We plan to examine each participant's family history of CRC in detail and to collect information on further variables (e.g. demographics) associated with increased risk. Additional stool and blood samples will be collected from study-participants who decide to undergo a colonoscopy (n ~ 350) and then analyzed at the German Cancer Research Center (DKFZ) Heidelberg to see whether further relevant variables are associated with an

  12. History of Intimate Partner Violence is Associated with Sex Work but not STI among HIV- positive Female Drinkers in Russia

    Science.gov (United States)

    Urada, Lianne A.; Raj, Anita; Cheng, Debbie M.; Quinn, Emily; Bridden, Carly; Blokhina, Elena A.; Krupitsky, Evgeny; Samet, Jeffrey H.

    2013-01-01

    This paper assesses the associations between intimate partner violence (IPV) and STIs and sexual risks among HIV-positive female drinkers in St. Petersburg, Russia. Survey and STI data were analyzed from 285 women in HERMITAGE, a secondary prevention study with HIV-positive heavy drinkers. Logistic and Poisson regression analyses assessed associations of IPV with STI and risky sex. Most women (78%) experienced IPV and 19% were STI-positive; 15% sold sex. IPV was not significantly associated with STI, but was with selling sex (AOR=3.56, 95% CI=1.02–12.43). In conclusion, IPV is common and associated with sex trade involvement among Russian HIV-positive female drinkers. PMID:23970660

  13. Exercise Based- Pain Relief Program

    DEFF Research Database (Denmark)

    Zadeh, Mahdi Hossein

    Exercise-based pain management programs are suggested for relieving from musculoskeletal pain; however the pain experienced after unaccustomed, especially eccentric exercise (ECC) alters people´s ability to participate in therapeutic exercises. Subsequent muscle pain after ECC has been shown...... in the current study was to use exercise induced- muscle damage followed by ECC as an acute pain model and observe its effects on the sensitivity of the nociceptive system and blood supply in healthy subjects. Then, the effect of a repeated bout of the same exercise as a healthy pain relief strategy...

  14. Positive Affectivity is Dampened in Youths with Histories of Major Depression and Their Never-Depressed Adolescent Siblings.

    Science.gov (United States)

    Kovacs, Maria; Bylsma, Lauren M; Yaroslavsky, Ilya; Rottenberg, Jonathan; George, Charles J; Kiss, Enikő; Halas, Kitti; Benák, István; Baji, Ildiko; Vetro, Ágnes; Kapornai, Krisztina

    2016-07-01

    While hedonic capacity is diminished during clinical depression, it is unclear whether that deficit constitutes a risk factor and/or persists after depression episodes remit. To examine these issues, adolescents with current/past major depression (probands; n=218), never depressed biological siblings of probands (n=207), and emotionally-well controls (n=183) were exposed to several positively valenced probes. Across baseline and hedonic probe conditions, controls consistently reported higher levels of positive affect than high-risk siblings, and siblings reported higher levels of positive affect than probands (remitted and depressed probands' reports were similar). Extent of positive affect across the protocol predicted adolescents' self-reports of social support network and parental reports of offspring's use of various adaptive mood repair responses in daily life. Attenuated hedonic responding among youths remitted from depression offers partial support for anhedonia as a trait, while its presence among never depressed high-risk siblings argues for anhedonia as a potential diathesis for clinical depression.

  15. Corporate communication positioned with communication studies: Corporate Communications, an International Journal: The Journal and its history, scope and future developments

    NARCIS (Netherlands)

    Elving, W.J.L.

    2012-01-01

    Studies of communication by and inside organizations are conducted within various fields, including the field of corporate communication. In this manuscript, the author presents the journal and positions the various fields of study that are represented within it. The theoretical foundations of

  16. Positive and negative life events and reasons for living modulate suicidal ideation in a sample of patients with history of suicide attempts.

    Science.gov (United States)

    Laglaoui Bakhiyi, Camélia; Jaussent, Isabelle; Beziat, Séverine; Cohen, Renaud; Genty, Catherine; Kahn, Jean-Pierre; Leboyer, Marion; Le Vaou, Pascal; Guillaume, Sébastien; Courtet, Philippe

    2017-05-01

    The influence of life events on suicidal behavior remains inconclusive, while reasons for living (RFL) may be protective. To analyze the association between positive and negative life events and suicidal ideation (SI) and the interaction between life events and RFL on SI. Patients with history of suicide attempts (n = 338) underwent a comprehensive clinical evaluation, including SI (Beck's Suicidal Ideation scale), RFL (Reasons for Living Inventory, RFLI) and life events (family, school, student or professional, social, health and religion-related and other life events) during the last twelve months. The only negative life events associated with SI were health-related events (OR = 2.01 95%CI[1.04;3.92]). Family-related positive life events and RFL were negatively associated with SI (OR = 0.73 95%CI[0.58;0.91] and OR = 0.98 95%CI[0.97;0.98], respectively). No significant interaction between the number of positive life events and RFLI total score with current SI (p = 0.57) was detected. Family-related positive life events and RFL did not have any additive effect on SI. Positive life events did not moderate the association between health-related negative life events and SI. This was a retrospective study, the presence of axis II disorders was not investigated and results cannot be generalized due to the sample choice (only suicide attempters). Patients with history of suicide attempts could be less sensitive to negative life events, except for those related to health. Clinicians should pay more attention to somatic problems in patients at risk of suicide. Family support, positive psychology and therapies that strengthen RFL should be developed to prevent suicide. Copyright © 2017 Elsevier Ltd. All rights reserved.

  17. Characteristics of local field potentials correlate with pain relief by deep brain stimulation.

    Science.gov (United States)

    Huang, Yongzhi; Luo, Huichun; Green, Alexander L; Aziz, Tipu Z; Wang, Shouyan

    2016-07-01

    To investigate the link between neuronal activity recorded from the sensory thalamus and periventricular gray/periaqueductal gray (PVAG) and pain relief by deep brain stimulation (DBS). Local field potentials (LFPs) were recorded from the sensory thalamus and PVAG post-operatively from ten patients with neuropathic pain. The LFPs were quantified using spectral and time-frequency analysis, the relationship between the LFPs and pain relief was quantified with nonlinear correlation analysis. The theta oscillations of both sensory thalamus and PVAG correlated inversely with pain relief. The high beta oscillations in the sensory thalamus and the alpha oscillations in the PVAG correlated positively with pain relief. Moreover, the ratio of high-power duration to low-power duration of theta band activity in the sensory thalamus and PVAG correlated inversely with pain relief. The duration ratio at the high beta band in the sensory thalamus correlated positively with pain relief. Our results reveal distinct neuronal oscillations at the theta, alpha, and beta frequencies correlating with pain relief by DBS. The study provides quantitative measures for predicting the outcomes of neuropathic pain relief by DBS as well as potential biomarkers for developing adaptive stimulation strategies. Copyright © 2016 International Federation of Clinical Neurophysiology. Published by Elsevier Ireland Ltd. All rights reserved.

  18. On positive psychological outcomes: what helps groups with a history of conflict to forgive and reconcile with each other?

    Science.gov (United States)

    Noor, Masi; Brown, Rupert; Gonzalez, Roberto; Manzi, Jorge; Lewis, Christopher Alan

    2008-06-01

    Three studies examined the roles of traditional and novel social psychological variables involved in intergroup forgiveness. Study 1 (N = 480) revealed that among the pro-Pinochet and the anti-Pinochet groups in Chile, forgiveness was predicted by ingroup identity (negatively), common ingroup identity (positively), empathy and trust (positively), and competitive victimhood (the subjective sense of having suffered more than the outgroup, negatively). Political ideology (Right vs. Left) moderated the relationship between empathy and forgiveness, trust and forgiveness, and between the latter and competitive victimhood. Study 2 (N = 309), set in the Northern Irish conflict between Protestants and Catholics, provided a replication and extension of Study 1. Finally, Study 3 (N = 155/108) examined the longitudinal relationship between forgiveness and reconciliation in Northern Ireland, revealing that forgiveness predicted reconciliation intentions. The reverse direction of this relationship was also marginally significant. Results are discussed in terms of their theoretical and practical implications.

  19. Trigeminal neuralgia relief with intrathecal ziconotide.

    Science.gov (United States)

    Michiels, Whitney B; McGlthlen, Gail L; Platt, Benjamin J; Grigsby, Eric J

    2011-05-01

    We report a case of a 59-year-old female with severe TN who experienced satisfactory symptom relief from a single-shot trial of intrathecal ziconotide. Performed a 1 μg single-shot trial of Prialt. Report of satisfaction, no side effects, and complete face and back relief briefly but most notably relief from the TN. Ziconotide should be considered for treatment of TN, although further investigation is recommended.

  20. A sigh of relief or a sigh of expected relief: Sigh rate in response to dyspnea relief.

    Science.gov (United States)

    Vlemincx, Elke; Meulders, Michel; Luminet, Olivier

    2017-08-09

    Research has suggested that sighs may serve a regulatory function during stress and emotions by facilitating relief. Evidence supports the hypotheses that sighs both express and induce relief from stress. To explore the potential role of sighs in the regulation of symptoms, the present study aimed to investigate the relationship between sighs and relief of symptoms, and relief of dyspnea, specifically. Healthy volunteers participated in two studies (N = 44, N = 47) in which dyspnea was induced by mild (10 cmH2 O/l/s) or high (20 cmH2 0/l/s) inspiratory resistances. Dyspnea relief was induced by the offset of the inspiratory resistances (transitions from high and mild inspiratory resistance to no resistance). Control comparisons included dyspnea increases (transitions from no or mild inspiratory resistance to high inspiratory resistance) and dyspnea continuations (continuations of either no resistance or a high resistance). In Experiment 1, dyspnea levels were cued. In Experiment 2, no cues were provided. Sigh rate during dyspnea relief was significantly higher compared to control conditions, and sigh rate increased as self-reported dyspnea decreased. Additionally, sigh rate was higher during cued dyspnea relief compared to noncued dyspnea relief. These results suggest that sighs are important markers of dyspnea relief. Moreover, sighs may importantly express dyspnea relief, as they are related to experiential dyspnea decreases and occur more frequently during expected dyspnea relief. These findings suggest that sighs may not only be important in the regulation of stress and emotions, but also may be functional in the regulation of dyspnea. © 2017 Society for Psychophysiological Research.

  1. False Positive Findings on I-131 WBS and SPECT/CT in Patients with History of Thyroid Cancer: Case Series

    Directory of Open Access Journals (Sweden)

    Zeina C. Hannoush

    2017-01-01

    Full Text Available Introduction. Although whole body scan (WBS with I-131 is a highly sensitive tool for detecting normal thyroid tissue and metastasis of differentiated thyroid cancer (DTC, it is not specific. Additional information, provided by single photon emission computed tomography combined with X-ray computed tomography (SPECT/CT and by the serum thyroglobulin level, is extremely useful for the interpretation of findings. Case Presentation. We report four cases of false positive WBS in patients with DTC: ovarian uptake corresponding to an endometrioma, scrotal uptake due to a spermatocele, rib-cage uptake due to an old fracture, and hepatic and renal uptake secondary to a granuloma and simple cyst, respectively. Conclusions. Trapping, organification, and storage of iodine are more prominent in thyroid tissue but not specific. Physiologic sodium-iodine symporter expression in other tissues explains some, but not all, of the WBS false positive cases. Other proposed etiologies are accumulation of radioiodine in inflamed organs, metabolism of radiodinated thyroid hormone, presence of radioiodine in body fluids, and contamination. In our cases nonthyroidal pathologies were suspected since the imaging findings were not corroborated by an elevated thyroglobulin level, which is considered a reliable tumor marker for most well-differentiated thyroid cancers. Clinicians should be aware of the potential pitfalls of WBS in DTC to avoid incorrect management.

  2. Pain relief can be painful

    Directory of Open Access Journals (Sweden)

    Ashish Bindra

    2015-01-01

    Full Text Available Mandibular nerve block is periodically used procedure used to treat neuralgic pain in the distribution of trigeminal nerve. It is a commonly performed block in outpatient settings at our institute. We present a case of an elderly edentulous patient with trigeminal neuralgia who suffered recurrent temporomandibular joint (TMJ dislocation following mandibular nerve block. The patient presented with complaints of severe pain, inability to close mouth, and eat food since 2 days. Anterior closed reduction of TMJ resulted in reduction of joint and immediate pain relief. However, the maneuver failed due to recurrent dislocation of the joint. A Barton dressing was applied to prevent another dislocation. This was followed by autologous blood injection into the joint. This case focuses on the preponderance of clinical evaluation and accentuates the need for additional forethought to be taken during pain procedures, particularly in the geriatric population.

  3. [Assessment of recent weight history before instituting continuous positive airways pressure in a cohort of patients with severe obstructive sleep apnoea/hypopnea syndrome].

    Science.gov (United States)

    Laaban, J-P; Mounier, L; Roque d'Orbcastel, O; Melloni, B; Cornette, A; Muir, J-F

    2014-01-01

    The aim of this study is to evaluate the recent weight history in patients with the obstructive sleep apnoea/hypopnoea syndrome (OSAHS) needing treatment with continuous positive airways pressure (CPAP). Over a period of 18 months, a self-administered questionnaire concerning recent weight history was given to patients during the installation of CPAP. The study population consisted of 1337 patients. An increase in weight of at least 5% over the 5 years preceding the institution of CPAP was found in 44% of patients. This increase was moderate (5-10%), important (10-20%) and very important (>20%) in respectively 12.3%, 16.1% and 15.6% of patients. The patients with important or very important weight gain differed from those whose weight remained steady in a higher percentage of women, young people, and patients with a higher prevalence of obesity, persistent smoking, a history of venous thromboembolism and treatment with anti-depressants. A recent increase in weight is frequently seen in severe OSAHS and is associated with some clinical characteristics. Published by Elsevier Masson SAS.

  4. Effect of seed position in spikelet on life history of Eremopyrum distans (Poaceae) from the cold desert of north-west China.

    Science.gov (United States)

    Wang, Ai Bo; Tan, Dun Yan; Baskin, Carol C; Baskin, Jerry M

    2010-07-01

    Most studies on seed position-dependent effects have focused on germination characteristics. Our aim was to determine the effects of seed position in the spikelet on differences in timing of germination and on the ecological life history of the grass Eremopyrum distans in its cold desert habitat. For seeds in three spikelet positions, morphology, mass and dormancy/germination characteristics were determined in the laboratory, and seeds planted in field plots with and without watering were followed to reproduction to investigate seedling emergence and survival, plant size and seed production. After maturation, of the seeds within the spikelet, basal ones (group 1) are the largest and have the highest proportion with physiological dormancy, while distal ones (group 3) are the smallest and have the highest proportion of non-dormant seeds. A higher percentage of seeds after-ripened in groups 2 and 3 than in group 1. Seeds sown in the field in early summer and watered at short, regular intervals germinated primarily in autumn, while those under natural soil moisture conditions germinated only in spring. Both cohorts completed their life cycle in early summer. Seeds in group 1 had lower percentages of seedling emergence and higher percentages of seedling survival than those in groups 2 and 3. Also, plants from group 1 seeds were larger and produced more seeds per plant than those from groups 2 and 3. Seed position-dependent mass was associated with quantitative differences in several life history traits of E. distans. The environmentally enforced (low soil moisture) delay of germination from autumn to spring results in a reduction in fitness via reduction in number of seeds produced per plant.

  5. Positive selection on sperm ion channels in a brooding brittle star: consequence of life-history traits evolution.

    Science.gov (United States)

    Weber, A A-T; Abi-Rached, L; Galtier, N; Bernard, A; Montoya-Burgos, J I; Chenuil, A

    2017-07-01

    Closely related species are key models to investigate mechanisms leading to reproductive isolation and early stages of diversification, also at the genomic level. The brittle star cryptic species complex Ophioderma longicauda encompasses the sympatric broadcast-spawning species C3 and the internal brooding species C5. Here, we used de novo transcriptome sequencing and assembly in two closely related species displaying contrasting reproductive modes to compare their genetic diversity and to investigate the role of natural selection in reproductive isolation. We reconstructed 20 146 and 22 123 genes for C3 and C5, respectively, and characterized a set of 12 229 orthologs. Genetic diversity was 1.5-2 times higher in C3 compared to C5, confirming that species with low parental investment display higher levels of genetic diversity. Forty-eight genes were the targets of positive diversifying selection during the evolution of the two species. Notably, two genes (NHE and TetraKCNG) are sperm-specific ion channels involved in sperm motility. Ancestral sequence reconstructions show that natural selection targeted the two genes in the brooding species. This may result from an adaptation to the novel environmental conditions surrounding sperm in the brooding species, either directly affecting sperm or via an increase in male/female conflict. This phenomenon could have promoted prezygotic reproductive isolation between C3 and C5. Finally, the sperm receptors to egg chemoattractants differed between C3 and C5 in the ligand-binding region. We propose that mechanisms of species-specific gamete recognition in brittle stars occur during sperm chemotaxis (sperm attraction towards the eggs), contrary to other marine invertebrates where prezygotic barriers to interspecific hybridization typically occur before sperm-egg fusion. © 2017 John Wiley & Sons Ltd.

  6. Reductions in alcohol and cocaine use following a group coping intervention for HIV-positive adults with childhood sexual abuse histories.

    Science.gov (United States)

    Meade, Christina S; Drabkin, Anya S; Hansen, Nathan B; Wilson, Patrick A; Kochman, Arlene; Sikkema, Kathleen J

    2010-11-01

    Few interventions exist to reduce alcohol and non-injection drug use among people living with HIV/AIDS. This study tested the effects of a coping group intervention for HIV-positive adults with childhood sexual abuse histories on alcohol, cocaine and marijuana use. Participants were assigned randomly to the experimental coping group or a time-matched comparison support group. Both interventions were delivered in a group format over 15 weekly 90-minute sessions. A diverse sample of 247 HIV-positive men and women with childhood sexual abuse were recruited from AIDS service organizations and community health centers in New York City. Substance use was assessed pre- and post-intervention and every 4 months during a 12-month follow-up period. Using an intent-to-treat analysis, longitudinal changes in substance use by condition were assessed using generalized estimating equations. At baseline, 42% of participants drank alcohol, 26% used cocaine and 26% used marijuana. Relative to participants in the support group, those in the coping group had greater reductions in quantity of alcohol use (Wald χ²(₄)=10.77, P = 0.029) and any cocaine use (Wald χ²(₄) = 9.81, P = 0.044) overtime. Many HIV patients, particularly those with childhood sexual abuse histories, continue to abuse substances. This group intervention that addressed coping with HIV and sexual trauma was effective in reducing alcohol and cocaine use, with effects sustained at 12-month follow-up. Integrating mental health treatment into HIV prevention may improve outcomes. © 2010 The Authors, Addiction © 2010 Society for the Study of Addiction.

  7. Positive deviance control-case life history: a method to develop grounded hypotheses about successful long-term avoidance of infection

    Directory of Open Access Journals (Sweden)

    Sandoval Milagros

    2008-03-01

    Full Text Available Abstract Background Prevalence rates for long-term injection drug users in some localities surpass 60% for HIV and 80% for HCV. We describe methods for developing grounded hypotheses about how some injectors avoid infection with either virus. Methods Subjects: 25 drug injectors who have injected drugs 8 – 15 years in New York City. 17 remain without antibody to either HIV or HCV; 3 are double-positives; and 5 are positive for HCV but not HIV. "Staying Safe" methodology compares serostatus groups using detailed biographical timelines and narratives; and information about how subjects maintain access to physical resources and social support; their strategies and tactics to remain safe; how they handle problems of addiction and demands by drug dealers and other drug users; and how their behaviors and strategies do or do not become socially-embedded practices. Grounded theory and life-history analysis techniques compare and contrast doubly-uninfected with those infected with both viruses or only with HCV. Results Themes and initial hypotheses emerging from analyses included two master hypotheses that, if confirmed, should help shape preventive interventions: 1 Staying uninfected is not simply a question of social structure or social position. It involves agency by drug injectors, including sustained hard work and adaptation to changing circumstances. 2 Multiple intentionalities contribute to remaining uninfected. These conscious goals include balancing one's need for drugs and one's income; developing ways to avoid drug withdrawal sickness; avoiding situations where other drug users importune you to share drugs; and avoiding HIV (and perhaps HCV infection. Thus, focusing on a single goal in prevention might be sub-optimal. Other hypotheses specify mechanisms of enacting these intentionalities. One example is finding ways to avoid extreme social ostracism. Conclusion We have identified strategies and tactics that some doubly-uninfected IDUs have

  8. ANALYSIS OF MUTATIONS OF TUBERCULOUS MYCOBACTERIA DEFINING DRUG RESISTANCE IN HIV POSITIVE AND HIV NEGATIVE TUBERCULOSIS PATIENTS WITHOUT PRIOR HISTORY OF TREATMENT IN SVERDLOVSK REGION

    Directory of Open Access Journals (Sweden)

    G. V. Panov

    2017-01-01

    Full Text Available Goal of the study: to identify profile of mutations of tuberculous mycobacteria responsible for resistance to anti-tuberculosis drugs in HIV positive and HIV negative tuberculosis patients without prior history of treatment.Materials and methods. 165 strains of tuberculous mycobacteria from HIV positive patients and 166 strains of tuberculous mycobacteria from HIV negative patients were studied in Sverdlovsk Region (TB Dispensary, Yekaterinburg. Mutations in genes were identified using microchips of TB-BIOCHIP® and TB-BIOCHIP®-2 in compliance with the manufacturer's guidelines (OOO Biochip-IMB, Moscow.Results. It was observed that 85/165 (51.52% strains isolated from HIV positive tuberculosis patients and 58/166 (34.94% strains isolated from tuberculosis patients not associated with HIV possessed MDR genotype (p < 0.01. The majority of MDR strains had mutations in the 531th codon of rpoB (Ser→Leu and 315th codon of katG (Ser→Thr (64/85, 75.29% and 38/58, 65.52% respective the groups, resulting in the high level of resistance to rifampicin and isoniazid. Each group also had approximately equal ratio (11/165, 6.67% and 12/166, 7.23% respective the groups of strains with genomic mutations defining the resistance to isoniazid, rifampicin and fluoruquinolones. No confident difference was found in mutation patterns of genome of tuberculous mycobacteria isolated from HIV positive and HIV negative tuberculosis patients. 

  9. Supply Chain Management in Humanitarian Relief Logistics

    National Research Council Canada - National Science Library

    Rodman, William

    2004-01-01

    Hundreds of millions of people are affected by disasters each year. This thesis explores the use of supply chain management techniques to overcome the barriers encountered by logistics managers during humanitarian relief operations...

  10. U.S. Coastal Relief Model - Hawaii

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — NGDC's U.S. Coastal Relief Model (CRM) provides the first comprehensive view of the U.S. coastal zone integrating offshore bathymetry with land topography into a...

  11. U.S. Coastal Relief Model

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — NGDC's U.S. Coastal Relief Model (CRM) provides the first comprehensive view of the U.S. coastal zone integrating offshore bathymetry with land topography into a...

  12. Lake Bathymetric DEM Shaded Relief Image

    Data.gov (United States)

    Minnesota Department of Natural Resources — Geo-referenced, shaded relief image of lake bathymetry classified at 5-foot depth intervals. This dataset has a cell resolution of 5 meters (occasionally 10m) as...

  13. Shaded Relief of Minnesota Elevation - Color

    Data.gov (United States)

    Minnesota Department of Natural Resources — This file is a product of a shaded relief process on the 30 meter resolution Digital Elevation Model data (dem30im3). This image was created using a custom AML...

  14. Shaded Relief of Minnesota Elevation - Black & White

    Data.gov (United States)

    Minnesota Department of Natural Resources — This file is a product of a shaded relief process on the 30 meter resolution Digital Elevation Model data (dem30im3). This image was created using a custom AML...

  15. Is the current ASAS expert definition of a positive family history useful in identifying axial spondyloarthritis? Results from the SPACE and DESIR cohorts.

    Science.gov (United States)

    Ez-Zaitouni, Zineb; Hilkens, Andrea; Gossec, Laure; Berg, Inger Jorid; Landewé, Robert; Ramonda, Roberta; Dougados, Maxime; van der Heijde, Désirée; van Gaalen, Floris

    2017-05-31

    The Assessment of SpondyloArthritis international Society (ASAS) definition of a positive family history (PFH) of spondyloarthritis (SpA) includes the following diseases in first- or second-degree relatives: ankylosing spondylitis (AS), acute anterior uveitis (AAU), reactive arthritis (ReA), inflammatory bowel disease (IBD), and psoriasis. However, it is not known if a PFH for each of these diseases contributes to making a diagnosis of axSpA, sacroiliitis on imaging, or fulfilling the ASAS criteria in patients presenting with chronic back pain (CBP). Therefore, the aim of this study was to assess which SpA diseases in family members are associated with human leukocyte antigen B27 (HLA-B27) and axial spondyloarthritis (axSpA) in CBP patients. CBP patients suspected of axSpA from the SPACE (n = 438) and the DESIR (n = 647) cohort were asked about the presence of SpA diseases in first- or second-degree relatives (AS, AAU, ReA, IBD, and psoriasis). The associations between a PFH and HLA-B27, sacroiliitis on imaging (magnetic resonance imaging (MRI) or radiographs), axSpA diagnosis, and ASAS classification in CBP patients were assessed. In the SPACE and the DESIR cohort, a PFH of AS (odds ratio (OR) 5.9 (95% confidence interval (CI) 3.5-9.9), and OR 3.3 (95% CI 2.1-5.2)) and a PFH of AAU (OR 9.8 (95% CI 3.3-28.9) and OR 21.6 (95% CI 2.9-160.1)) were significantly associated with presence of HLA-B27. Furthermore, in both cohorts a PFH of AS and a PFH of AAU were positively associated with fulfilment of the ASAS criteria, but not with sacroiliitis on imaging. In SPACE but not in DESIR a PFH of AAU was positively associated with axSpA diagnosis. In both cohorts a PFH of ReA, IBD, or psoriasis was not positively associated with HLA-B27 positivity, sacroiliitis on imaging, axSpA diagnosis, or meeting the ASAS criteria for axSpA. In our cohorts, a PFH of AS or AAU is useful for case-finding of axSpA as this is correlated with HLA-B27 carriership. However, as a PFH of

  16. Fertility and Symptom Relief following Robot-Assisted Laparoscopic Myomectomy

    Directory of Open Access Journals (Sweden)

    Michael C. Pitter

    2015-01-01

    Full Text Available Objective. To examine success of robot-assisted laparoscopic myomectomy (RALM measured by sustained symptom relief and fertility. Methods. This is a retrospective survey of 426 women who underwent RALM for fibroids, symptom relief, or infertility at three practice sites across the US. We examined rates of symptom recurrence and pregnancy and factors associated with these outcomes. Results. Overall, 70% of women reported being symptom-free, with 62.9% free of symptoms after three years. At >3 years, 66.7% of women who underwent surgery to treat infertility and 80% who were also symptom-free reported achieving pregnancy. Factors independently associated with symptom recurrence included greater time after surgery, preoperative dyspareunia, multiple fibroid surgeries, smoking after surgery, and preexisting diabetes. Factors positively correlated with achieving pregnancy included desiring pregnancy, prior pregnancy, greater time since surgery, and Caucasian race. Factors negatively correlated with pregnancy were advanced age and symptom recurrence. Conclusions. This paper, the first to examine symptom recurrence after RALM, demonstrates both short- and long-term effectiveness in providing symptom relief. Furthermore, RALM may have the potential to improve the chance of conception, even in a population at high risk of subfertility, with greater benefits among those who remain symptom-free. These findings require prospective validation.

  17. Modeling attitude towards drug treament: the role of internal motivation, external pressure, and dramatic relief.

    Science.gov (United States)

    Conner, Bradley T; Longshore, Douglas; Anglin, M Douglas

    2009-04-01

    Motivation for change has historically been viewed as the crucial element affecting responsiveness to drug treatment. Various external pressures, such as legal coercion, may engender motivation in an individual previously resistant to change. Dramatic relief may be the change process that is most salient as individuals internalize such external pressures. Results of structural equation modeling on data from 465 drug users (58.9% male; 21.3% Black, 34.2% Hispanic/Latino, and 35.1% White) entering drug treatment indicated that internal motivation and external pressure significantly and positively predicted dramatic relief and that dramatic relief significantly predicted attitudes towards drug treatment: chi (2) = 142.20, df = 100, p motivation are high, dramatic relief is also likely to be high. When dramatic relief is high, attitudes towards drug treatment are likely to be positive. The findings indicate that interventions to get individuals into drug treatment should include processes that promote Dramatic Relief. Implications for addictions health services are discussed.

  18. 46 CFR 154.802 - Alternate pressure relief settings.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Alternate pressure relief settings. 154.802 Section 154... Equipment Cargo Vent Systems § 154.802 Alternate pressure relief settings. Cargo tanks with more than one relief valve setting must have one of the following arrangements: (a) Relief valves that: (1) Are set and...

  19. The Impact of Shame on Health-Related Quality of Life Among HIV-Positive Adults with a History of Childhood Sexual Abuse

    Science.gov (United States)

    Persons, Elizabeth; Kershaw, Trace; Sikkema, Kathleen J.

    2010-01-01

    Abstract Childhood sexual abuse is prevalent among people living with HIV, and the experience of shame is a common consequence of childhood sexual abuse and HIV infection. This study examined the role of shame in health-related quality of life among HIV-positive adults who have experienced childhood sexual abuse. Data from 247 HIV-infected adults with a history of childhood sexual abuse were analyzed. Hierarchical linear regression was conducted to assess the impact of shame regarding both sexual abuse and HIV infection, while controlling for demographic, clinical, and psychosocial factors. In bivariate analyses, shame regarding sexual abuse and HIV infection were each negatively associated with health-related quality of life and its components (physical well-being, function and global well-being, emotional and social well-being, and cognitive functioning). After controlling for demographic, clinical, and psychosocial factors, HIV-related, but not sexual abuse-related, shame remained a significant predictor of reduced health-related quality of life, explaining up to 10% of the variance in multivariable models for overall health-related quality of life, emotional, function and global, and social well-being and cognitive functioning over and above that of other variables entered into the model. Additionally, HIV symptoms, perceived stress, and perceived availability of social support were associated with health-related quality of life in multivariable models. Shame is an important and modifiable predictor of health-related quality of life in HIV-positive populations, and medical and mental health providers serving HIV-infected populations should be aware of the importance of shame and its impact on the well-being of their patients. PMID:20718687

  20. A 23-Nucleotide Deletion in STK11 Gene Causes Peutz-Jeghers Syndrome and Malignancy in a Chinese Patient Without a Positive Family History.

    Science.gov (United States)

    Zhao, Zi-Ye; Jiang, Yu-Liang; Li, Bai-Rong; Yang, Fu; Li, Jing; Jin, Xiao-Wei; Ning, Shou-Bin; Sun, Shu-Han

    2017-11-01

    Peutz-Jeghers syndrome (PJS) is an autosomal-dominant genetic disease caused by mutations in the tumor suppressor gene, STK11, which is characterized by gastrointestinal hamartomas, melanin spots on the lips and the extremities, and an increased risk of developing both gastrointestinal and extraintestinal malignancies. We treated a PJS patient without a positive family history, who possessed typical clinical manifestations including polyp canceration. In order to explore the genotype of this patient, blood samples were collected from all the available family members. The whole coding region and the flanking regions of the STK11 gene were amplified by polymerase chain reaction and analyzed by Sanger sequencing. Molecular analysis of the STK11 gene here revealed a 23-nucleotide deletion (c.426-448delCGTGCCGGAGAAGCGTTTCCCAG) in exon 3, resulting in a change of 13 codons and a truncating protein (p.S142SfsX13). This mutation was not found in normal individuals in this family including her parents or in 100 control individuals. Protein structure prediction indicated a dramatic loss of the kinase domain and complete loss of the C-terminal regulatory domain. The results presented here enlarge the spectrum of STK11 mutation both disease-causing and malignancy-causing.

  1. Glovebox pressure relief and check valve

    Energy Technology Data Exchange (ETDEWEB)

    Blaedel, K.L.

    1986-03-17

    This device is a combined pressure relief valve and check valve providing overpressure protection and preventing back flow into an inert atmosphere enclosure. The pressure relief is embodied by a submerged vent line in a mercury reservior, the releif pressure being a function of the submerged depth. The pressure relief can be vented into an exhaust system and the relieving pressure is only slightly influenced by the varying pressure in the exhaust system. The check valve is embodied by a ball which floats on the mercury column and contacts a seat whenever vacuum exists within the glovebox enclosure. Alternatively, the check valve is embodied by a vertical column of mercury, the maximum back pressure being a function of the height of the column of mercury.

  2. Whole-genome sequence analyses of Western Central African Pygmy hunter-gatherers reveal a complex demographic history and identify candidate genes under positive natural selection.

    Science.gov (United States)

    Hsieh, PingHsun; Veeramah, Krishna R; Lachance, Joseph; Tishkoff, Sarah A; Wall, Jeffrey D; Hammer, Michael F; Gutenkunst, Ryan N

    2016-03-01

    African Pygmies practicing a mobile hunter-gatherer lifestyle are phenotypically and genetically diverged from other anatomically modern humans, and they likely experienced strong selective pressures due to their unique lifestyle in the Central African rainforest. To identify genomic targets of adaptation, we sequenced the genomes of four Biaka Pygmies from the Central African Republic and jointly analyzed these data with the genome sequences of three Baka Pygmies from Cameroon and nine Yoruba famers. To account for the complex demographic history of these populations that includes both isolation and gene flow, we fit models using the joint allele frequency spectrum and validated them using independent approaches. Our two best-fit models both suggest ancient divergence between the ancestors of the farmers and Pygmies, 90,000 or 150,000 yr ago. We also find that bidirectional asymmetric gene flow is statistically better supported than a single pulse of unidirectional gene flow from farmers to Pygmies, as previously suggested. We then applied complementary statistics to scan the genome for evidence of selective sweeps and polygenic selection. We found that conventional statistical outlier approaches were biased toward identifying candidates in regions of high mutation or low recombination rate. To avoid this bias, we assigned P-values for candidates using whole-genome simulations incorporating demography and variation in both recombination and mutation rates. We found that genes and gene sets involved in muscle development, bone synthesis, immunity, reproduction, cell signaling and development, and energy metabolism are likely to be targets of positive natural selection in Western African Pygmies or their recent ancestors. © 2016 Hsieh et al.; Published by Cold Spring Harbor Laboratory Press.

  3. A node architecture for disaster relief networking

    NARCIS (Netherlands)

    Hoeksema, F.W.; Heskamp, M.; Schiphorst, Roelof; Slump, Cornelis H.

    2005-01-01

    In this paper we present node architecture for a personal node in a cognitive ad-hoc disaster relief network. This architecture is motivated from the network system requirements, especially single-hop distance and jamming-resilience requirements. It is shown that the power consumption of current-day

  4. 7 CFR 760.106 - Equitable relief.

    Science.gov (United States)

    2010-01-01

    ... accordance with the FCIA (7 U.S.C. 1501-1524) or (ii) Application closing date for NAP. (b) Equitable relief will not be granted to participants in instances of: (1) A scheme or device that had the effect or intent of defeating the purposes of a program of insurance, NAP, or any other program administered under...

  5. Relief for surviving relatives following a suicide.

    NARCIS (Netherlands)

    Oud, MJT; de Groot, MH

    2006-01-01

    Relief for surviving relatives following a suicide. - After the suicide of a 43-year-old woman with known depression, a 41-year-old paraplegic man who recently developed diarrhoea and a 41-year-old woman with probable depression with symptoms of psychosis, the general practitioners of the surviving

  6. Climatic vs. tectonic control on glacial relief

    Science.gov (United States)

    Prasicek, Günther; Herman, Frederic; Robl, Jörg

    2017-04-01

    The limiting effect of a climatically-induced glacial buzz-saw on the height of mountain ranges has been extensively discussed in the geosciences. The buzz-saw concept assumes that solely climate controls the amount of topography present above the equilibrium line altitude (ELA), while the rock uplift rate plays no relevant role. This view is supported by analyses of hypsometric patterns in orogens worldwide. Furthermore, numerical landscape evolution models show that glacial erosion modifies the hypsometry and reduces the overall relief of mountain landscapes. However, such models often do not incorporate tectonic uplift and can only simulate glacial erosion over a limited amount of time, typically one or several glacial cycles. Constraints on glacial end-member landscapes from analytical, time-independent models are widely lacking. Here we present a steady-state solution for a glacier equilibrium profile in an active orogen modified from the mathematical conception presented by Headley et al. (2012). Our approach combines a glacial erosion law with the shallow ice approximation, specifically the formulations of ice sliding and deformation velocities and ice flux, to calculate ice surface and bed topography from prescribed specific mass balance and rock uplift rate. This solution allows the application of both linear and non-linear erosion laws and can be iteratively fitted to a predefined gradient of specific mass balance with elevation. We tested the influence of climate (fixed rock uplift rate, different ELAs) and tectonic forcing (fixed ELA, different rock uplift rates) on steady-state relief. Our results show that, similar to fluvial orogens, both climate and rock uplift rate exert a strong influence on glacial relief and that the relation among rock uplift rate and relief is governed by the glacial erosion law. This finding can provide an explanation for the presence of high relief in high latitudes. Headley, R.M., Roe, G., Hallet, B., 2012. Glacier

  7. Bathymetric Shaded Relief of North America - Direct Download

    Data.gov (United States)

    U.S. Geological Survey, Department of the Interior — The Bathymetric Shaded Relief of North America map layer shows depth ranges using colors, with relief enhanced by shading. The image was derived from the National...

  8. Mechanical Designs for Relief Valves for Cryogenic Apparatuses and Installations

    CERN Multimedia

    CERN. Geneva

    2016-01-01

    There are also pressure relief valves with warm seat available on which the set pressure is based on an adjustment of forces by permanent magnets. Pressure vessel rules allows also the choice for an active triggered pressure relief valve (Cont...

  9. 100-Meter Resolution Grayscale Shaded Relief of Hawaii - Direct Download

    Data.gov (United States)

    U.S. Geological Survey, Department of the Interior — The Grayscale Shaded Relief of Hawaii map layer is a 100-meter resolution grayscale shaded relief image of Hawaii, in an Albers Equal-Area Conic projection. Shaded...

  10. 100-Meter Resolution Grayscale Shaded Relief of Alaska - Direct Download

    Data.gov (United States)

    U.S. Geological Survey, Department of the Interior — The Grayscale Shaded Relief of Alaska map layer is a 100-meter resolution grayscale shaded relief image of Alaska, in an Albers Equal-Area Conic projection. Shaded...

  11. Topographic and Bathymetric Shaded Relief of North America - Direct Download

    Data.gov (United States)

    U.S. Geological Survey, Department of the Interior — The Topographic and Bathymetric Shaded Relief of North America map layer shows depth and elevation ranges using colors, with relief enhanced by shading. The image...

  12. 100-Meter Resolution Color Shaded Relief of Hawaii - Direct Download

    Data.gov (United States)

    U.S. Geological Survey, Department of the Interior — The Color Shaded Relief of Hawaii map layer is a 100-meter resolution color-sliced elevation image of Hawaii, with relief shading added to accentuate terrain...

  13. 100-Meter Resolution Color Shaded Relief of Alaska - Direct Download

    Data.gov (United States)

    U.S. Geological Survey, Department of the Interior — The Color Shaded Relief of Alaska map layer is a 100-meter resolution color-sliced elevation image of Alaska, with relief shading added to accentuate terrain...

  14. Libraries and information provision for African relief

    Directory of Open Access Journals (Sweden)

    Elsemieke Wishart

    2012-08-01

    Full Text Available This research article explores the concept that libraries as communication centres in sub-Saharan Africa can play a vital role in bringing poverty relief by providing greater access to information through modern technology. It discusses the patrons who can benefit from community information centres and explores their particular needs. I have researched how modern tools like the Internet, computers, e-readers and cell phones can bring valuable information to impoverished citizens. My research was conducted through reading research papers using article databases, books and Internet websites. The future for libraries in sub-Saharan Africa is bright, as new technology opens up vast opportunities to share information in a way that is accessible, affordable and adaptable to the needs of the African people. I recommend that librarians and relief organisations in Southern Africa seriously consider using modern technology to provide information that will empower its citizens.

  15. Cordaid's post-disaster shelter strategy in Haiti : Linking relief and development

    NARCIS (Netherlands)

    Janse, H.C.; Van der Flier, C.L.

    2014-01-01

    Haiti was struck by a heavy earthquake in 2010 and international aid poured into the country. News reports in 2011 were not very positive about the results of post-disaster reconstruction: “The relief efforts are only putting Haiti on lifesupport instead of evolving into the next stage of

  16. Relief Evolution in Tectonically Active Mountain Ranges

    Science.gov (United States)

    Whipple, Kelin X.

    2004-01-01

    The overall aims of this 3-yr project, as originally proposed were to: (1) investigate quantitatively the roles of fluvial and glacial erosion in the evolution of relief in mountainous regions, and (2) test rigorously the quality and accuracy of SRTM topographic data in areas of rugged relief - both the most challenging and of greatest interest to geomorphic, neotectonic, and hazards applications. Natural laboratories in both the western US and the Southern Alps of New Zealand were identified as most promising. The project has been both successful and productive, despite the fact that no SRTM data for our primary field sites in New Zealand were released on the time frame of the work effort. Given the delayed release of SRTM data, we pursued the scientific questions of the roles of fluvial and, especially, glacial erosion in the evolution of relief in mountainous regions using available digital elevation models (DEMs) for the Southern Alps of New Zealand (available at both 25m and 50m pixel sizes), and USGS 10m and 30m DEMs within the Western US. As emphasized in the original proposal, we chose the emphasis on the role of glacial modification of topographic relief because there has been little quantitative investigation of glacial erosion processes at landscape scale. This is particularly surprising considering the dramatic sculpting of most mid- and high-latitude mountain ranges, the prodigious quantities of glacially-derived sediment in terrestrial and marine basins, and the current cross-disciplinary interest in the role of denudational processes in orogenesis and the evolution of topography in general. Moreover, the evolution of glaciated landscapes is not only a fundamental problem in geomorphology in its own right, but also is at the heart of the debate over Late Cenozoic linkages between climate and tectonics.

  17. Quantifying landscape differences across the Tibetan plateau: Implications for topographic relief evolution

    Science.gov (United States)

    Liu-Zeng, J.; Tapponnier, P.; Gaudemer, Y.; Ding, L.

    2008-12-01

    We quantify the bulk topographic characteristics of the Tibet-Qinghai plateau with specific focus on three representative regions: northern, central, and southeastern Tibet. Quantitative landscape information is extracted from Shuttle Radar Topography Mission digital elevation models. We find that the morphology of the Tibetan plateau is nonuniform with systematic regional differences. The northern and central parts of the plateau are characterized by what we suggest to call "positive topography," i.e., a topography in which elevation is positively correlated with relief and mean slope. A major change from the internally drained central part of Tibet to the externally drained part of eastern Tibet is accompanied by a transition from low to high relief and from positive to "negative topography," i.e., a topography where there is an inverse or negative correlation between elevation and relief and between elevation and mean slope. Relief in eastern Tibet is largest along rivers as they cross an ancient, eroded plateau margin at high angle to the major strike-slip faults, the Yalong-Yulong thrust belt, implying strong structural control of regional topography. We propose that the evolution of river systems and drainage efficiency, the ability of rivers to transport sediments out of the orogen, coupled with tectonic uplift, is the simplest mechanism to explain systematic regional differences in Tibetan landscapes. Basin filling due to inefficient drainage played a major role in smoothing out the tectonically generated structural relief. This mode of smoothing started concurrently with tectonic construction of the relief, as most clearly illustrated today in the Qilian Shan-Qaidam region of the northeastern plateau. In the interior of Tibet, further "passive" filling, due to internal drainage only, continued to smooth the local relief millions of years after the cessation of major phases of surface uplift due to crustal shortening. Thus, diachronous beveling at high

  18. Topography, relief, climate and glaciers: a global prespective

    Science.gov (United States)

    Champagnac, Jean-Daniel; Valla, Pierre; Herman, fred

    2014-05-01

    agent in temperate area, with important amplitude between glacial and interglacial climate. This is consistent with the view of a very variable glacier erodibility that can erode and protect the landscape, as well as with studies documenting a bimodal location of the preferred glacial erosion, at relatively high elevation (around the long-term ELA), and at much lower elevation (close to the glacial maximum lower reaches), thanks to efficient water lubrication of the glacier bases that greatly enhance the sliding velocity. These findings show that the relation between the mountain topography and the long term snowline is not as straightforward as previously proposed. Beside the role of tectonic forcing highlighted by several authors, the importance of the glacial erosion appears to be crucial at mid latitude, but more complex at both high and low latitude. Moreover, the relief at mid latitude appears to be higher, hence suggesting a positive correlation between relief and topographic control of glacier on the landscape.

  19. Relief-oriented use of marijuana by teens

    Directory of Open Access Journals (Sweden)

    Johnson Joy L

    2009-04-01

    Full Text Available Abstract Background There are indications that marijuana is increasingly used to alleviate symptoms and for the treatment of a variety of medical conditions both physical and psychological. The purpose of this study was to describe the health concerns and problems that prompt some adolescents to use marijuana for therapeutic reasons, and their beliefs about the risks and benefits of the therapeutic use of marijuana. Methods As part of a larger ethnographic study of 63 adolescents who were regular marijuana users, we analyzed interviews conducted with 20 youth who self-identified as using marijuana to relieve or manage health problems. Results Thematic analysis revealed that these teens differentiated themselves from recreational users and positioned their use of marijuana for relief by emphasizing their inability to find other ways to deal with their health problems, the sophisticated ways in which they titrated their intake, and the benefits that they experienced. These teens used marijuana to gain relief from difficult feelings (including depression, anxiety and stress, sleep difficulties, problems with concentration and physical pain. Most were not overly concerned about the risks associated with using marijuana, maintaining that their use of marijuana was not 'in excess' and that their use fit into the realm of 'normal.' Conclusion Marijuana is perceived by some teens to be the only available alternative for teens experiencing difficult health problems when medical treatments have failed or when they lack access to appropriate health care.

  20. Digital shaded-relief map of Venezuela

    Science.gov (United States)

    Garrity, Christopher P.; Hackley, Paul C.; Urbani, Franco

    2004-01-01

    The Digital Shaded-Relief Map of Venezuela is a composite of more than 20 tiles of 90 meter (3 arc second) pixel resolution elevation data, captured during the Shuttle Radar Topography Mission (SRTM) in February 2000. The SRTM, a joint project between the National Geospatial-Intelligence Agency (NGA) and the National Aeronautics and Space Administration (NASA), provides the most accurate and comprehensive international digital elevation dataset ever assembled. The 10-day flight mission aboard the U.S. Space Shuttle Endeavour obtained elevation data for about 80% of the world's landmass at 3-5 meter pixel resolution through the use of synthetic aperture radar (SAR) technology. SAR is desirable because it acquires data along continuous swaths, maintaining data consistency across large areas, independent of cloud cover. Swaths were captured at an altitude of 230 km, and are approximately 225 km wide with varying lengths. Rendering of the shaded-relief image required editing of the raw elevation data to remove numerous holes and anomalously high and low values inherent in the dataset. Customized ArcInfo Arc Macro Language (AML) scripts were written to interpolate areas of null values and generalize irregular elevation spikes and wells. Coastlines and major water bodies used as a clipping mask were extracted from 1:500,000-scale geologic maps of Venezuela (Bellizzia and others, 1976). The shaded-relief image was rendered with an illumination azimuth of 315? and an altitude of 65?. A vertical exaggeration of 2X was applied to the image to enhance land-surface features. Image post-processing techniques were accomplished using conventional desktop imaging software.

  1. Music as a form of stress relief

    OpenAIRE

    Čadež, Nežka

    2014-01-01

    The aim of this paper is to find out, whether the modern music has a relaxing effect on today’s youngsters. The theoretical part will present the period of adolescence and especially all the challenges they face during this time. These challenges can represent a high amount of stress in a youngster’s life, and one of the ways of stress relief is music. In addition to having a relaxing effect, music also enables them to shape their identity and to integrate into groups of people that share the...

  2. Pain relief that matters to patients

    DEFF Research Database (Denmark)

    Olsen, Mette Frahm; Bjerre, Eik; Damkjær Hansen, Maria

    2017-01-01

    relief. Subgroup analyses showed that the definition of improved patients (one or several categories improvement or meaningful change) and the design of studies (single or multiple measurements) also influenced MCID values. CONCLUSIONS: The MCID in acute pain varied greatly between studies...... and was influenced by baseline pain, definitions of improved patients and study design. MCID is context-specific and potentially misguiding if determined, applied or interpreted inappropriately. Explicit and conscientious reflections on the choice of a reference value are required when using MCID to classify...

  3. Organisation for the relief of concentration camps.

    Science.gov (United States)

    Engel, H O

    2003-12-01

    To review the essential principles involved in rescue missions for natural and man-made disasters. A description of the relief of a concentration camp in 1945 as an example of the logistics required in any major disaster or rescue. The arrival of trained Army rescue teams on the first day and dealing systematically with priorities in salvage, treatment and nursing saved many lives, even of desperately ill patients. A centralised administration and organisation of supplies is the first priority. Suitable intravenous and very light nutrients, and the prevention and combating of infections are more urgent than the provision of shelter and clothing.

  4. History of intimate partner violence is associated with sex work but not sexually transmitted infection among HIV-positive female drinkers in Russia.

    Science.gov (United States)

    Urada, L A; Raj, A; Cheng, D M; Quinn, E; Bridden, C; Blokhina, E A; Krupitsky, E; Samet, J H

    2013-04-01

    This paper assesses the associations between intimate partner violence (IPV) and sexually transmitted infections (STIs) and sexual risks among HIV-positive female drinkers in St Petersburg, Russia. Survey and STI data were analysed from 285 women in HERMITAGE, a secondary prevention study of HIV-positive heavy drinkers. Logistic and Poisson regression analyses assessed associations of IPV with STI and risky sex. Most women (78%) experienced IPV and 19% were STI positive; 15% sold sex. IPV was not significantly associated with STI, but was with selling sex (adjusted odds ratio = 3.56, 95% confidence interval = 1.02-12.43). In conclusion, IPV is common and associated with sex trade involvement among Russian HIV-positive female drinkers.

  5. The effects of implementation of guideline-directed medical therapy on relief of angina in patients with stable coronary artery disease in Serbia

    Directory of Open Access Journals (Sweden)

    Ilić Ivan

    2016-01-01

    Full Text Available Introduction. Adherence to proposed lifestyle changes and prescribed medication in patients with stable coronary artery disease (SCAD is poor. Objective. We sought to investigate the influence of adjusting guideline proposed medications on relief of angina in a large group of patients with SCAD in Serbia. Methods. The study included a total of 3,490 patients from 15 cardiology clinics with symptoms of stable angina and at least one of the following criteria: abnormal electrocardiogram (ECG, history of myocardial infarction (MI, positive stress test, significant coronary artery disease on coronary angiogram or previous revascularization. All the patients underwent comprehensive evaluation at initial visit and after two months. The relief of angina was study end-point defined as any reduction in Canadian Cardiology Society (CCS class, number of angina attacks per week and/or number of tablets of short-acting nitrates per week. Results. Most patients were included based on abnormal ECG (48.4%. At Visit 1, the average number of prescribed classes of medications to a single patient increased from 4.16 ± 1.29 to 4.63 ± 1.57 (p < 0.001. At the follow-up, the patients had significantly lower blood pressure (141 ± 19 / 85 ± 11 vs. 130 ± 12 / 80 ± 8 mmHg; p < 0.001 and most of them reported CCS class I (63.3%. The average weekly number of angina attacks was reduced from 2.82 ± 2.50 at Visit 1 to 1.72 0 ± 1.66 at Visit 2, as well as average weekly use of short-acting nitrates to treat these attacks (2.69 ± 2.53 to 1.74 ± 1.47 tablets; p < 0.001 for all. Conclusion. Adjustment of prescribed medications to guideline recommendations in a large Serbian patient population with prevalent risk factors led to significant relief of angina.

  6. Spouses' Perspective of their Participation and Role in Childbirth Pain Relief

    Science.gov (United States)

    Emelonye, AU; Pitkäaho, T; Aregbesola, A; Vehviläinen-Julkunen, K

    2016-01-01

    Background: Childbirth is a period characterized by severe pain, and most women desire to ameliorate their pain among other things by having their spouses present and involved in the birthing process. In developing countries like Nigeria, spousal involvement is still an emerging concept in childbirth. Aim: To investigate and provide an insight into spousal perceptions toward their participation and role in labor pain relief during childbirth in Nigeria. Subjects and Methods: A cross-sectional descriptive study of 142 spouses was conducted in the maternity units of four hospitals in Abuja, Nigeria, from June to December 2014. Data were collected through a pretested interview-administered 24 item questionnaire, the Abuja Instrument for Parturient Spouse. The data were analyzed statistically using Chi-square test for association between the variables and content analysis for open-ended questions. Results: Most (94.4%, 134/142) of the spouses had a positive perception toward labor pain relief. They believed that their presence and activities contributed to labor pain relief and are willing to be present at subsequent births. Conclusion: Findings in this study have revealed a positive trend in spousal perception and involvement during childbirth and pain relief, as contrast to the prevailing assumption that childbirth is an exclusive woman affair. Spousal presence during childbirth can be beneficial not only to the woman but also to the spouse and family. PMID:28540105

  7. Iraq's Debt Relief: Procedure and Potential Implications for International Debt Relief

    National Research Council Canada - National Science Library

    Weiss, Martin A

    2009-01-01

    .... Reducing this debt to a sustainable level has been a priority of the U.S. government. Since 2003, debt relief negotiations have taken place in a variety of fora and led to the cancellation of a significant amount of Iraq's external debt...

  8. Relief formation in polished amalgam surfaces.

    Science.gov (United States)

    Leitão, J

    1984-12-01

    The relief produced in the surface of dental amalgam as a result of polishing was studied by scanning electron microscopy in traditional low-copper amalgams, high-copper dispersant-type amalgams, and high-copper single-composition amalgams. Specimens were polished metallographically in two planes at right angles to each other. Micrographs were taken of the edge between the planes; the profile of one of the polished planes could be traced and the microstructural phases recognized. The traced lines were analyzed by a computer that calculated the mean levels of the phases and the mean deviation (roughness) of all the phases along the scanned distance. Recesses were seen in the surface of the gamma-2 phase. The gamma-1 phase attained the highest level, protruding above the phases of the alloy particles. The results indicate that well-polished amalgam surfaces have a structural relief that contributes to the roughness and limits the degree of smoothness that can be obtained in an amalgam surface.

  9. Global Emergency Observation, Warning and Relief Network

    Energy Technology Data Exchange (ETDEWEB)

    Bukley, A.P.; Mulqueen, J.A. [NASA Marshall Space Flight Center, Huntsville, AL (United States)

    1995-12-31

    The decade of the 1990`s has been proclaimed by the United Nations to be the International Decade for Natural Disaster Reduction (IDNDR). There exists a documented need for improved communications and information distribution to provide adequate warning in the face of impending disasters and facilitate the response after a disaster has occurred. The Global Emergency Observation Warning and Relief Network (GEOWARN) is proposed as a system that can potentially fill the existing gaps in the disaster management capabilities by providing a mechanism for the timely processing of information both before and after an event has occurred. A system design is proposed that would utilize existing remote sensing resources augmented by additional satellites and airborne sensor platforms linked together via a computer network. This network would be configured around five control centers called Multi-National Centers which would host an extensive Geographical Information System to perform the task of providing global disaster warning and relief support. To support the potential development of GEOWARN, the NASA Marshall Space Flight Center performed a study to assess concept feasibility. This study has resulted in several recommended modifications to the ISU system concept. It was concluded that a system design which optimizes the use of existing resources can result in significant improvements in disaster warning and management capabilities for most of the world. This paper presents the results of the feasibility study, including a general overview of the GEOWARN concept and the elements comprising the system.

  10. The glacial relief in the Leaota Mountains

    Directory of Open Access Journals (Sweden)

    George MURĂTOREANU

    2008-05-01

    Full Text Available The presence of glacial relief in the Romanian medium height massifs is still controversial. The medium height mountains, such as theLeaota Mountains (in the Bucegi group, with maximum altitudes of almost 2000 m andmedium altitudes of approximately 1250 m, can display traces of glacial relief dating from theUpper Pleistocene. The aim of this article is to provide evidence about the presence of theglacial morphology in the northern part of the Leaota Peak, the main orographic node in themassif with the same name. Thus, on the basis of field observations, of topographical mapanalysis and by using the geographic information systems which made possible a detailedmorphometric analysis, I was able to gather evidence proving the existence of a glacial cirquein the Leaota Mountains. The arguments put forward in this article show that the glacial reliefis represented in the Leaota Mountains through a small-size suspended glacial cirque, whichdisplays all the morphologic elements proving the existence of glaciation in this massif.

  11. The Activation of Reward Versus Relief Gambling Outcome Expectancies in Regular Gamblers: Relations to Gambling Motives.

    Science.gov (United States)

    Yi, Sunghwan; Stewart, Melissa; Collins, Pamela; Stewart, Sherry H

    2015-12-01

    Gambling outcome expectancies refer to the anticipated outcomes that gamblers expect will occur from gambling (i.e., learned memory associations between gambling cues, behavior, and outcomes). Unlike previous approaches to gambling outcome expectancies that have predominantly focused on the valence of outcome expectancies (positive vs. negative), the present study investigated two specific types of positive gambling outcome expectancies: reward and relief gambling outcome expectancies. Specifically, the primary purpose of the current research was to examine whether gambling prime exposure activates different types of positive gambling outcome expectancies in enhancement- versus coping-motivated gamblers. Fifty adult, community-recruited regular gamblers performed a reaction time (RT) task and completed a self-report expectancy scale, both designed to assess reward and relief gambling outcome expectancies. They also completed the Gambling Motives Questionnaire (Stewart and Zack in Addiction 103:1110-1117 2008) to assess their levels of coping and enhancement motives for gambling. As hypothesized, reward gambling outcome expectancies were more strongly activated by gambling prime exposure than relief outcome expectancies on the RT task for gamblers with high enhancement motives. On the self-report expectancy measure, high enhancement-motivated gamblers endorsed stronger reward gambling outcome expectancies than low enhancement-motivated gamblers, and high coping-motivated gamblers endorsed stronger relief gambling outcome expectancies than low coping-motivated gamblers. Results suggest that automatic activation of reward gambling outcome expectancies is particularly strong for high enhancement-motivated gamblers. Possible reasons for the failure to observe an association between coping gambling motives and automatic relief gambling outcome expectancies are discussed.

  12. Symptoms of Anxiety and Depression Are Correlates of Angina Pectoris by Recent History and an Ischemia-Positive Treadmill Test in Patients with Documented Coronary Artery Disease in the Pimi Study

    Directory of Open Access Journals (Sweden)

    Mark W. Ketterer

    2011-01-01

    Full Text Available Objective. We tested the association of specific psychological characteristics in patients having stable coronary disease with the reporting of anginal symptoms during daily activities, and positive exercise testing. Methods. One hundred and ninety-six patients with documented CAD enrolled in the Psychophysiological Investigations of Myocardial Ischemia (PIMI Study completed an anginal history questionnaire and a battery of psychometric tests. They also underwent standardized exercise treadmill tests. Results. Patients with a recent history of angina were more likely to be female, and had higher Beck Depression (P=.002, State Anxiety (P=.001, Trait Anxiety (P=.03, Harm Avoidance (P=.04 and Muscle Tension (P=.004 scores than patients who had no recent history of angina. Along with several treadmill variables indicating more severe disease state and reduced exercise tolerance, patients who developed angina on a positive treadmill test also displayed higher scores on the Beck Depression Inventory (P=.003 and State Anxiety (P=.004 scales. Conclusions. Several psychological characteristics, and most notably anxiety and depression, are strong correlates of recent angina and angina in the presence of ischemia provoked by treadmill testing.

  13. Study of safety relief valve operation under ATWS conditions. [PWR

    Energy Technology Data Exchange (ETDEWEB)

    Hutmacher, E.S.; Nesmith, B.J.; Brukiewa, J.B.

    1979-06-25

    A literature survey and analysis project has been performed to determine if recent (since mid-1975) data has been reported which could influence the current approach to predicting PWR relief valve capacity under ATWS conditions. This study was conducted by the Energy Technology Engineering Center for NRC. Results indicate that the current relief valve capacity model tends to predict less capacity than actually obtains; however, no experimental verification at PWR ATWS conditions was found. Other project objectives were to establish the availability of methods for evaluating reaction forces and back pressure effects on relief valve capacity, and to determine if facilities exist which are capable of testing PWR relief valves at ATWS conditions.

  14. Sandy PMO Disaster Relief Appropriations Act of 2013 Financial Data

    Data.gov (United States)

    Department of Homeland Security — Sandy PMO: Disaster Relief Appropriations Act of 2013 (Sandy Supplemental Bill) Financial Data. This is the Sandy Supplemental Quarterly Financial Datasets that are...

  15. Sharing Information among Various Organizations in Relief Efforts

    National Research Council Canada - National Science Library

    Costur, Gurkan

    2005-01-01

    .... An analysis is presented of the December 2004 Indian Ocean tsunami relief effort; specifically, how different organizations such as the military, United Nations, and non-governmental organizations...

  16. The importance of a positive family history of alcoholism, parental rejection and emotional warmth, behavioral problems and peer substance use for alcohol problems in teenagers: a path analysis.

    Science.gov (United States)

    Barnow, Sven; Schuckit, Marc A; Lucht, Michael; John, Ulrich; Freyberger, Harald J

    2002-05-01

    The purpose of this study was to test a hypothetical model of alcohol problems in German adolescents. Among 180 offspring, family history of alcoholism, parenting styles, behavioral and emotional problems, peer-group characteristics, feelings of self-esteem, behavioral problems and psychiatric comorbidity of the parents were examined. Data were generated from the Study of Health in Pomerania (SHIP), in which families were randomly selected if 12-18 year old biological offspring were members of the household; a smaller group of subjects was selected from local outpatient treatment centers. Members of 133 families, including 180 (50.6% male) offspring who were appropriate for the current analyses, received personal semistructured diagnostic interviews and several self-rating questionnaires. Analyses compared offspring with alcohol problems (AP; n = 40) and with no alcohol problems (NAP; n = 140), and used structural equation modeling to test a hypothetical model. The comparisons revealed that the AP group had significantly more behavioral problems (e.g., aggression/delinquency), more perceived parental rejection and less emotional warmth, a higher amount of alcohol consumption, were more likely to associate with substance-using peers and more often received a diagnosis of conduct disorder or antisocial personality disorder. Whereas the family history of alcoholism did not differ significantly between groups, parents of offspring with an alcohol use disorder had significantly more additional diagnoses on DSM-IV Axis I. The evaluation of the model supported the importance of aggression/delinquency and association with substance-using peers for alcohol problems in people. An additional diagnosis in the parents was directly and indirectly (through aggression/delinquency) related to alcohol problems of the adolescents. The data indicate that alcohol problems in the offspring are associated with several domains of influence in their environment. Prospective studies

  17. The importance of context: when relative relief renders pain pleasant.

    Science.gov (United States)

    Leknes, Siri; Berna, Chantal; Lee, Michael C; Snyder, Gregory D; Biele, Guido; Tracey, Irene

    2013-03-01

    Context can influence the experience of any event. For instance, the thought that "it could be worse" can improve feelings towards a present misfortune. In this study we measured hedonic feelings, skin conductance, and brain activation patterns in 16 healthy volunteers who experienced moderate pain in two different contexts. In the "relative relief context," moderate pain represented the best outcome, since the alternative outcome was intense pain. However, in the control context, moderate pain represented the worst outcome and elicited negative hedonic feelings. The context manipulation resulted in a "hedonic flip," such that moderate pain elicited positive hedonics in the relative relief context. Somewhat surprisingly, moderate pain was even rated as pleasant in this context, despite being reported as painful in the control context. This "hedonic flip" was corroborated by physiological and functional neuroimaging data. When moderate pain was perceived as pleasant, skin conductance and activity in insula and dorsal anterior cingulate were significantly attenuated relative to the control moderate stimulus. "Pleasant pain" also increased activity in reward and valuation circuitry, including the medial orbitofrontal and ventromedial prefrontal cortices. Furthermore, the change in outcome hedonics correlated with activity in the periacqueductal grey (PAG) of the descending pain modulatory system (DPMS). The context manipulation also significantly increased functional connectivity between reward circuitry and the PAG, consistent with a functional change of the DPMS due to the altered motivational state. The findings of this study point to a role for brainstem and reward circuitry in a context-induced "hedonic flip" of pain. Copyright © 2012 International Association for the Study of Pain. All rights reserved.

  18. Technology and information sharing in disaster relief

    DEFF Research Database (Denmark)

    Bjerge, Benedikte Alkjærsig; Clark, Nathan Edward; Fisker, Peter Kielberg

    2016-01-01

    database of user interaction including more than 20,000 users and 11,000 comments spread across approximately 300 disaster events. Controlling for types and severities of the events, location-specific vulnerabilities, and the overall trends, we find that the introduction of new features have led......This paper seeks to examine the extent to which technological advances can enhance inter-organizational information sharing in disaster relief. Our case is the Virtual OSOCC (On-Site Operations Coordination Centre) which is a part of the Global Disaster Alert and Coordination System (GDACS) under...... the United Nations Office for Coordination of Humanitarian Affairs (UN OCHA). The online platform, which has been developing for more than a decade, provides a unique insight into coordination behaviour among disaster management agencies and individual actors. We build our study on the analysis of a complete...

  19. VA administrators breahe a sigh of relief

    Directory of Open Access Journals (Sweden)

    Robbins RA

    2014-06-01

    Full Text Available No abstract available. Article truncated at 150 words. On May 30, Eric Shinseki, the Secretary for Veterans Affairs (VA, resigned under pressure amidst a growing scandal regarding falsification of patient wait times at nearly 40 VA medical centers. Before leaving office Shinseki fired Sharon Helman, the former hospital director at the Phoenix VA, where the story first broke, along with her deputy and another unnamed administrator. In addition, Susan Bowers, director of VA Veterans Integrated Service Network (VISN 18 and Helman’s boss, resigned. Robert Petzel, undersecretary for the Veterans Health Administration (VHA, head of the VA hospitals and clinics, had resigned earlier. You could hear the sigh of relief from the VA administrators. With their bosses resigning left and right, the VA leadership in shambles and the reputation of the VA soiled for many years to come, why are the VA administrators relieved? The simple answer is that nothing has really changed. There for a moment it looked ...

  20. Cannibal's relief: the origins of sex

    Science.gov (United States)

    Sagan, D.; Margulis, L.

    1987-01-01

    Microorganisms in the gut of a cockroach resemble those that lived on earth 2000 million years ago. One of their activities, eating each other, may hold the key to the history of sexual reproduction in today's animals and plants.

  1. Diffuse thyroid uptake incidentally found on 1'8{sup F}-Flurodeoxygluse position emission tomography in subjects without cancer history

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Ji Young; Choi, Joon Young; Choi, Yoon Ho; Hyun, Seung Hyup; Moon, Seung Hwan; Jang, Su Jin; Cheo, Yeam Seung; Lee, Kyung Han; Kim, Byung Tae [Samsung Medical Center, Sungkyunkwan University School of Medicine, Seoul (Korea, Republic of)

    2013-06-15

    We investigated the clinical significance of incidental diffuse thyroid uptake (DTU) on 1{sup 8F}-FDG PET in subjects without a history of cancer. This study included 2062 studies from adults who underwent 1{sup 8F}-FDG PET as a cancer screening program. Subjects were divided into the following two groups: with (group I) or without (group II) DTU. The presence of DTU and the thyroid visual grading score were compared with thyroid function tests, serum anti-microsomal antibody (AMA) levels, and the presence of diffuse parenchymal change (DPC) on ultrasonography (USG). DTU was found in 6.6% of the scans (137/2062). Serum thyroid stimulating hormone (TSH) and AMA levels were significantly higher in group I than in group II. Increased AMA level (55.1%) and DPC (48.7%) were more frequently found in group I (p < 0.001). The proportion of subjects with any abnormal results in serum free thyroxine, triiodothyronine, TSH, or AMA levels or DPC on USG was significantly higher in group I than in group II (71.5% vs. 10.6%, p < 0.001), and was significantly and gradually increased according to the visual grading score group (0 vs. 1-2 vs. 3-4 = 10.6% vs. 58.5% vs. 90.9%, p < 0.001). TSH and is AMA levels were significantly increased according to the visual grading score. The presence or degree of incidental DTU on 1{sup 8F}-FDG PET is closely correlated with increased serum AMA and TSH levels, and the presence of DPC on USG. Therefore, the most plausible pathological cause of DTU may be cell damage by an autoimmune mechanism.

  2. civil-military relations in disaster rescue and relief activities

    African Journals Online (AJOL)

    Abel

    When the NDCC later shifted to a cluster approach to disaster management, the AFP was assigned .... own relief items and supplies flown in from Tacloban Airport, and distributed them in St Bernard (Pagasartonga ... Tacloban Airport, where most relief goods and supplies from Manila and overseas were flown in using the ...

  3. 30 CFR 203.53 - What relief will MMS grant?

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false What relief will MMS grant? 203.53 Section 203...-Life Leases § 203.53 What relief will MMS grant? (a) If we approve your application and you meet certain conditions, we will reduce the pre-application effective royalty rate by one-half on production up...

  4. The economic impact of the Troubled Assets Relief Programme ...

    African Journals Online (AJOL)

    The economic impact of the Troubled Assets Relief Programme (TARP) in the USA: an assessment of the level to which an optimal allocation of funds occurred. ... within this model: whether the Troubled Assets Relief Programme (TARP)1 bailout will give rise to greater economic effi ciencies and productivity, which would ...

  5. Donation to disaster relief campaigns: underlying social cognitive factors exposed

    NARCIS (Netherlands)

    Oosterhof, Liesbeth; Heuvelman, A.; Peters, O.

    2009-01-01

    number of very serious natural disasters have put an enormous pressure on relief organizations in the last few years. The present study exposes underlying social cognitive factors for donation to relief campaigns. A causal model was constructed, based on social cognitive theory, research on

  6. Emergency Relief for Teachers of Children Who Challenge

    Science.gov (United States)

    Crow, René; Cooper, Mark; Dallas, Jamie

    2015-01-01

    Teachers of students with chronic challenging behaviors need relief, and they need it quickly. While they may appreciate the sympathy of others, what they really need is some genuine help. Challenging children can make a teacher's day difficult. In this article, the authors share some strategies that can provide "emergency relief" to…

  7. 47 CFR 52.19 - Area code relief.

    Science.gov (United States)

    2010-10-01

    ... 47 Telecommunication 3 2010-10-01 2010-10-01 false Area code relief. 52.19 Section 52.19... Administration § 52.19 Area code relief. (a) State commissions may resolve matters involving the introduction of new area codes within their states. Such matters may include, but are not limited to: Directing...

  8. Knowledge of and attitude towards pain relief during labour of ...

    African Journals Online (AJOL)

    Most of the women gained knowledge regarding pain relief from past experiences or from friends and relatives. Even though the few women who received information about what to expect during labour found the information useful, most expressed little confidence in labour pain relief. South African Family Practice Vol.

  9. Trends in intraoperative pain relief in anesthesized Nigerian ...

    African Journals Online (AJOL)

    shobha

    Background: New drugs and new modalities for intraoperative pain relief is the current trend in pain management. Aim: The study aims at examining the current trend in intraoperative pain relief in patients of pediatric age at the. University of Benin Teaching Hospital (UBTH) and its implications for a developing economy ...

  10. Mengenal Relief, Mudra dan Stupa Candi Borobudur untuk Anak-Anak Usia 9-12 Tahun melalui Edugame

    Directory of Open Access Journals (Sweden)

    Ima Kusumawati Hidayat

    2014-01-01

    Full Text Available Candi Borobudur sebagai salah satu aset budaya Indonesia dan menjadi salah satu keajaiban dunia, pertama diperkenalkan kepada anak-anak dalam mata pelajaran Ilmu Pengetahuan Sosial (IPS di Sekolah Dasar (SD sebagai bangunan peninggalan kerajaan Buddha di Indonesia. Pengetahuan yang diberikan sebatas pada tahun pembangunan, raja yang memimpin dan membangun, serta nama tingkatan pada candi. Pemberian pelajaran di sekolah tidak hanya dari buku, namun dapat dilakukan dengan pendekatan multimedia. Berdasarkan hasil penelitian yang dilakukan kepada anak-anak usia 9-12 tahun, guru pelajaran IPS dan pemandu wisata Candi Borobudur yang memberi materi kepada anak-anak ketika berkunjung. Candi Borobudur tidak dapat dipisahkan dari relief-reliefnya yang indah, arca Buddha yang memiliki berbagai sikap tangan (mudra dan stupa Candi Borobudur menjadi materi yang perlu diberikan kepada anak-anak karena belum didapatkan di sekolah. Memberikan pendekatan yang berbeda dalam mempelajari suatu pengetahuan baru dapat memudahkan anak-anak untuk menyerap teori baru namun dengan cara yang lebih menyenangkan. Memadukan game dengan ilmu pengetahuan menjadi edugame merupakan salah satu cara untuk menyiasati anak-anak agar tetap belajar sambil bermain. Kata kunci: anak-anak; Candi Borobudur; edugame.Borobudur Temple is one of the world heritage from Indonesia that being introduced to Indonesian student in history lesson at elementary school. But the national curriculum doesn’t give all children needs because they should learn lot of lessons from history. Different knowledge of Borobudur Temple can be given to children by video game, because as a student, children want to spend their leisure time at home with something they like most. The knowledges that will be given to children are based on the research from children, 9-12 years old, their teachers, and tourist guide who gave the children some knowledge when they come to Borobudur temple. The main of Borobudur temple are

  11. Using augmented-reality and mobile three-dimensional graphics techniques in relief work on radiological disaster sites

    Directory of Open Access Journals (Sweden)

    Tsai Ming-Kuan

    2013-01-01

    Full Text Available Many countries tightly manage and monitor various radiological sources and facilities, yet some serious radiological disasters still occurred in recent decades. In order to reach effective relief work on radiological disaster sites, numerous information techniques have become popular, i. e. global positioning system, geographical information system, computer simulation, and three-dimensional graphics. However, this study recognizes insufficient information service in global positioning system and geographical information system and inconvenient information operation in computer simulation and three-dimensional graphics. Therefore, this study adopts augmented-reality and mobile three-dimensional graphics techniques to construct a mobile relief work system. This system helps relief workers to comprehend the spatial relationship among their localities, the targeted constructions, and the anticipated shelters. Based on the testing results regarding escaping victims, through the mobile relief work system in contrast to a Google maps-based system, relief workers more easily arrive at the targeted constructions, and more rapidly seek the anticipated shelters. In sum, this study is useful for similar applications in disaster management.

  12. Flood, disaster, and turmoil: social issues in cleft and craniofacial care and crisis relief.

    Science.gov (United States)

    Strauss, Ronald P; van Aalst, John A; Fox, Lynn; Stein, Margot; Moses, Michael; Cassell, Cynthia H

    2011-11-01

    To examine social issues in the conduct of cleft and craniofacial care through relief programs in disrupted crisis contexts. Social, health policy, and ethical analyses. At best, craniofacial team care is multidisciplinary, coordinated, and sustained, requiring a long-term relationship between team members, patients, and families. Disasters and societal turmoil interrupt such relationships, causing craniofacial care to become a secondary concern. Providing craniofacial team care in a crisis setting requires rebuilding disrupted coordination and communication. Crisis relief care involves a complex set of expectations and responsibilities and raises issues such as (1) quality assurance, infection control, appropriate standards of care, and follow-up care/continuity; (2) equity of access to services and clinical ethics in the context of war and/or deprivation; (3) training of visitors in the local nation or site; (4) disciplinary composition of teams, interprofessional communication/rivalry, and credentials of clinicians; (5) ownership of the site and local visitor relations; (6) fundraising and marketing strategies; and (7) ethical issues in the doctor-patient relationship. Specific ethical standards for international cleft and craniofacial care delivery also apply to domestic and global crisis relief contexts. Guidance on issues related to professional experience, informed consent, and continuity of care will help care providers address social and ethical issues raised in crisis relief programs. This paper proposes that the Position Paper of the American Cleft Palate-Craniofacial Association (ACPA) on International Treatment Programs should be used as a template to develop and disseminate a set of standards that apply to crisis relief.

  13. Testosterone-receptor positive hepatocellular carcinoma in a 29-year old bodybuilder with a history of anabolic androgenic steroid abuse: a case report.

    Science.gov (United States)

    Solbach, Philipp; Potthoff, Andrej; Raatschen, Hans-Jürgen; Soudah, Bisharah; Lehmann, Ulrich; Schneider, Andrea; Gebel, Michael J; Manns, Michael P; Vogel, Arndt

    2015-05-20

    Continuous use of anabolic androgenic steroid in high-doses is associated with substantial health risks, including hepatocellular adenoma. Malignant transformation from hepatocellular adenoma to hepatocellular carcinoma after anabolic androgenic steroid abuse has been rarely reported. The morphological distinction of adenoma from well-differentiated hepatocellular carcinoma is challenging and requires elaborated imaging techniques and histology. We report about a 29-year old male professional bodybuilder who presented with mid-epigastric pain at the emergency unit. Ultrasound showed a severe hepatomegaly with multiple lesions. Contrast-enhanced ultrasound revealed a heterogeneous pattern with signs of hepatocellular carcinoma. CT scan of the abdomen confirmed multiple hypervascular lesions and central areas of necrosis without contrast enhancement. Subsequent diagnostics included fine needle aspiration (FNA) of suspicious lesions and mini-laparoscopy to establish the diagnosis of a β-catenin and testosterone-receptor positive hepatocellular carcinoma embedded in multiple adenomas. The patient was subsequently treated by liver transplantation and remains tumor-free 27 month after surgery. Hepatocellular carcinoma occurring in association with anabolic androgenic steroid abuse should sensitize physicians and especially professional bodybuilders for the harmful use of high doses of steroids.

  14. Ibuprofen and paracetamol for pain relief during medical abortion: a double-blind randomized controlled study.

    Science.gov (United States)

    Livshits, Anna; Machtinger, Ronit; David, Liat Ben; Spira, Maya; Moshe-Zahav, Aliza; Seidman, Daniel S

    2009-05-01

    To determine the efficacy of a nonsteroidal anti-inflammatory drug vs. paracetamol in pain relief during medical abortion and to evaluate whether nonsteroidal anti-inflammatory drugs interfere with the action of misoprostol. A prospective double-blind controlled study. University-affiliated tertiary hospital. One hundred twenty women who underwent first-trimester termination of pregnancy. Patients received 600 mg mifepristone orally, followed by 400 microg of oral misoprostol 2 days later. They were randomized to receive ibuprofen or paracetamol when pain relief was necessary. Patients completed a questionnaire about side effects and pain score and returned for an ultrasound follow-up examination 10-14 days after medical abortion. Success rates, as defined by no surgical intervention, and pain scores were assessed. Ibuprofen was found to be statistically significantly more effective for pain relief after medical abortion compared with paracetamol. There was no difference in the failure rate of medical abortion, and the frequency of surgical intervention was slightly higher in the group that received paracetamol (16.3% vs. 8.5%). Ibuprofen was found to be more effective than paracetamol for pain reduction during medical abortion. A history of surgical or medical abortion was predictive for high pain scores. Despite its anti-prostaglandin effects, ibuprofen use did not interfere with the action of misoprostol.

  15. Navigating the profits and pitfalls of governmental partnerships: the ICRC and intergovernmental relief, 1918-23.

    Science.gov (United States)

    Lowe, Kimberly A

    2015-10-01

    The International Committee of the Red Cross (ICRC) is today a staunch proponent of the need for humanitarian organisations to remain independent of state interests, yet it deliberately solicited intergovernmental intervention in international relief after the First World War of 1914-18. This paper examines why an organisation committed to upholding the independence and impartiality of humanitarian action might still choose to partner with governmental bodies. It also highlights the historical beginnings of a linkage between international aid and geopolitics. To secure governmental funding for refugee relief during the 1920s, the ICRC argued that the humanitarian crises of the post-war years were a threat to the political and social stability of Europe. While this has become axiomatic, the interwar history of the ICRC demonstrates that the perceived connection between relief and geopolitical stability is historically constructed, and that it must continue to be asserted persuasively to be effective. © 2015 The Author(s). Disasters © Overseas Development Institute, 2015.

  16. Pulmonary case of the month: stress relief

    Directory of Open Access Journals (Sweden)

    Viggiano RW

    2014-05-01

    Full Text Available No abstract available. Article truncated at 150 words. History of Present Illness A 62 year old man was referred for an abnormal CT scan of the chest. He was found to have an abnormality in the lung as an incidental finding on a CT scan of the abdomen done 6 months earlier for abdominal pain. A CT-guided needle biopsy was performed but revealed only scant tissue and no diagnosis was made. The patient was asymptomatic without dyspnea, wheezing or cough. He had no fevers, chills, history of pneumonia or sinus disease. He denied any symptoms of gastroesophageal reflux disease (GERD, regurgitation, dysphagia or aspiration. PMH, FH, SH The patient had a small melanoma excised from his arm several months earlier. Family history was noncontributory. He smoked a pack per day for 7 years but quit over 30 years earlier. He does not drink. Medications Vitamins Mineral oil laxative Physical Examination Physical examination was unremarkable. Radiography A CT scan ...

  17. Pain relief by touch: a quantitative approach.

    Science.gov (United States)

    Mancini, Flavia; Nash, Thomas; Iannetti, Gian Domenico; Haggard, Patrick

    2014-03-01

    Pain relief by touch has been studied for decades in pain neuroscience. Human perceptual studies revealed analgesic effects of segmental tactile stimulation, as compared to extrasegmental touch. However, the spatial organisation of touch-pain interactions within a single human dermatome has not been investigated yet. In 2 experiments we tested whether, how, and where within a dermatome touch modulates the perception of laser-evoked pain. We measured pain perception using intensity ratings, qualitative descriptors, and signal detection measures of sensitivity and response bias. Touch concurrent with laser pulses produced a significant analgesia, and reduced the sensitivity in detecting the energy of laser stimulation, implying a functional loss of information within the ascending Aδ pathway. Touch also produced a bias to judge laser stimuli as less painful. This bias decreased linearly when the distance between the laser and tactile stimuli increased. Thus, our study provides evidence for a spatial organisation of intrasegmental touch-pain interactions. Copyright © 2013 International Association for the Study of Pain. Published by Elsevier B.V. All rights reserved.

  18. Technology and Information Sharing in Disaster Relief.

    Directory of Open Access Journals (Sweden)

    Benedikte Bjerge

    Full Text Available This paper seeks to examine the extent to which technological advances can enhance inter-organizational information sharing in disaster relief. Our case is the Virtual OSOCC (On-Site Operations Coordination Centre which is a part of the Global Disaster Alert and Coordination System (GDACS under the United Nations Office for Coordination of Humanitarian Affairs (UN OCHA. The online platform, which has been developing for more than a decade, provides a unique insight into coordination behaviour among disaster management agencies and individual actors. We build our study on the analysis of a complete database of user interaction including more than 20,000 users and 11,000 comments spread across approximately 300 disaster events. Controlling for types and severities of the events, location-specific vulnerabilities, and the overall trends, we find that the introduction of new features have led to increases in user activity. We supplement the data-driven approach with evidence from semi-structured interviews with administrators and key users, as well as a survey among all users specifically designed to capture and assess the elements highlighted by both interviews and data analysis.

  19. Asian tsunami relief: Department of Defense public health response: policy and strategic coordination considerations.

    Science.gov (United States)

    Tarantino, Dave

    2006-10-01

    The Asian tsunami of December 26, 2004, was one of the most devastating natural disasters in modern history. In particular, this disaster created massive, unique, public health threats, necessitating equally massive public health response efforts. The U.S. government (USG), including the Department of Defense (DoD), played a pivotal role in the response. This article examines some of the central policy issues and strategic coordination and planning measures involved in the public health response. The nearly unanimous consensus of international public health experts has been that the potential public health crisis in the aftermath of the Asian tsunami was averted largely because of the coordinated efforts of host nation officials and professionals, international and nongovernmental health organizations, and bilateral donors, especially the USG, including the DoD. The DoD played a central role in public health efforts through coordination and communication assistance, logistical and materiel support, disease surveillance activities, health needs assessments, and the contributions of the USS Mercy hospital ship. The core lessons involve the importance of an early, dedicated, public health response as a component of the overall disaster relief effort, as well as seamless coordination of health sector stakeholders in the USG and with those of the international community and affected host nations, which allows each organization to play to its strengths and to avoid duplication. The Asian tsunami relief effort highlighted the value of civil-military cooperation in disaster relief, particularly in the area of public health. The prominent role of the DoD in tsunami relief efforts, including public health efforts, also yielded beneficial secondary effects by bolstering security cooperation and winning "hearts and minds" in the region.

  20. Carbon accumulation by biological soil crusts in relation to relief and sampling depth

    Science.gov (United States)

    Jetter, Stefan; Drahorad, Sylvie; Felix-Henningsen, Peter

    2010-05-01

    In arid and semiarid ecosystems the soil surface is covered by biological soil crusts (BSC). These BSC are microbial communities of cyanobacteria, lichens and mosses. Due to the photosynthetic activity of these microorganisms, BSC are main carbon contributors to arid ecosystems. The cover is related to ecosystem functions like surface stabilization, water redistribution and nutrient fixation. These functions rely on the microbial community composition of the BSC. Cyanobacteria and cyanolichens excrete exopolysaccharides, which build microaggregates with soil particles. This stabilizes and seals the soil surface. Therefore cyanobacteria and cyanolichen dominated crusts introduce runoff, which affects the distribution of carbon. The total amount of soil organic carbon was determined in relation to the relief position and BSC thickness showing a strong correlation between relief, sampling depth and carbon amounts. At the Arid Ecosystem Research Center (AERC) station of the Nizzana sand dunes (NW Negev, Israel) the dunes and the interdune corridor are covered by BSC up to 80% of the total area. The BSC are composed of a thin topcrust section and a mineral subcrust section. The overall thickness changes in relation to the relief position. Along a dune transect topcrust and subcrust samples were taken and analyzed on their C_org, C_carb, and C_total concentration. The total amount of carbon (g m^-2) was calculated from the carbon concentrations, the BSC bulk density and the sampling depth. Comparing the topcrust and subcrust values of the sampling points the topcrust sections showed 3-4 times higher concentrations of organic carbon than the subcrust sections. The light intensity decreases with soil depth, resulting in a higher biological activity and carbon fixation in the topcrust sections. The subcrust showed relative higher amounts of C_carb contributing to the soil surface stability. Depending on the relief position the total amount of accumulated carbon was 4 times

  1. Spinal fusion surgery: From relief to insecurity.

    Science.gov (United States)

    Damsgaard, Janne B; Jørgensen, Lene B; Norlyk, Annelise; Birkelund, Regner

    2017-02-01

    During their decision-making process patients perceive surgery as a voluntary yet necessary choice. Surgery initiates hope for a life with less pain but also creates a feeling of existential insecurity in terms of fear, isolation and uncertainty. The aim of this study was to explore how patients experience their situation from the point of making the decision to undergo spinal fusion surgery to living their everyday life after surgery. A phenomenological-hermeneutic study design was applied based on the French philosopher Paul Ricoeur's theory of interpretation. Data were collected through observations and semi-structured interviews. The recommendation and decision to undergo spinal fusion surgery felt like a turning point for the patients and brought hope of regaining their normal lives, of being a more resourceful parent, partner, friend and colleague with no or less pain. Thus, deciding to undergo surgery created a brief feeling of relief. However, life with back pain had changed the patients' understanding of themselves. Consequently, some patients postoperatively experienced insecurity and a weakened self-image with difficulties creating meaning in their lives. Being recommended and undergoing spinal fusion surgery initiates hope for a life with less pain and altered life conditions. At the same time, paradoxically, this creates a feeling of existential insecurity in terms of facing the surgery and the future to come. It is, therefore, important to recognise and include the patients' everyday life experiences concerning how they give (or may not give) meaning to their illness, i.e. their understanding of how it is affecting them. These aspects are essential for the patients' definition and re-definition of themselves and thus crucial to draw upon in the relationship and communication between patient and healthcare professional. Copyright © 2016 Elsevier Ltd. All rights reserved.

  2. Grayscale North America Shaded Relief ? 1-Kilometer Resolution - Direct Download

    Data.gov (United States)

    U.S. Geological Survey, Department of the Interior — The grayscale North America shaded relief data were derived from the GTOPO30 elevation data. GTOPO30 is a global digital elevation model (DEM) with a horizontal grid...

  3. Grayscale Hawaii Shaded Relief ? 200-Meter Resolution - Direct Download

    Data.gov (United States)

    U.S. Geological Survey, Department of the Interior — The grayscale Hawaii shaded relief data were derived from National Elevation Dataset (NED) data, and show the terrain of Hawaii at a resolution of 200 meters. The...

  4. U.S. Coastal Relief Model - Western Gulf of Mexico

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — NGDC's U.S. Coastal Relief Model (CRM) provides the first comprehensive view of the U.S. coastal zone integrating offshore bathymetry with land topography into a...

  5. U.S. Coastal Relief Model - Southern California Version 2

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — NGDC's U.S. Coastal Relief Model (CRM) provides a comprehensive view of the U.S. coastal zone integrating offshore bathymetry with land topography into a seamless...

  6. U.S. Coastal Relief Model - Central Gulf of Mexico

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — NGDC's U.S. Coastal Relief Model (CRM) provides the first comprehensive view of the U.S. coastal zone integrating offshore bathymetry with land topography into a...

  7. U.S. Coastal Relief Model - Northwest Pacific

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — NGDC's U.S. Coastal Relief Model (CRM) provides the first comprehensive view of the U.S. coastal zone integrating offshore bathymetry with land topography into a...

  8. U.S. Coastal Relief Model - Puerto Rico

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — NGDC's U.S. Coastal Relief Model (CRM) provides the first comprehensive view of the U.S. coastal zone integrating offshore bathymetry with land topography into a...

  9. U.S. Coastal Relief Model - Southern California

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — NGDC's U.S. Coastal Relief Model (CRM) provides the first comprehensive view of the U.S. coastal zone integrating offshore bathymetry with land topography into a...

  10. U.S. Coastal Relief Model - Northeast Atlantic

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — NGDC's U.S. Coastal Relief Model (CRM) provides the first comprehensive view of the U.S. coastal zone integrating offshore bathymetry with land topography into a...

  11. U.S. Coastal Relief Model - Central Pacific

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — NGDC's U.S. Coastal Relief Model (CRM) provides the first comprehensive view of the U.S. coastal zone integrating offshore bathymetry with land topography into a...

  12. 49 CFR 179.300-15 - Pressure relief devices.

    Science.gov (United States)

    2010-10-01

    ... percent of the tank test pressure. When relief devices of the fusible plug type are used, the required... exceeding that specified in § 179.301. (d) Fusible plugs shall function at a temperature not exceeding 175...

  13. U.S. Coastal Relief Model - Southeast Atlantic

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — NGDC's U.S. Coastal Relief Model (CRM) provides the first comprehensive view of the U.S. coastal zone integrating offshore bathymetry with land topography into a...

  14. Satellite View of Hawaii, with Shaded Relief - Direct Download

    Data.gov (United States)

    U.S. Geological Survey, Department of the Interior — The Satellite View of Hawaii, with Shaded Relief map layer is a 200- meter-resolution simulated-natural-color image of Hawaii. Vegetation is generally green, with...

  15. Color Alaska Shaded Relief ? 200-Meter Resolution - Direct Download

    Data.gov (United States)

    U.S. Geological Survey, Department of the Interior — The color Alaska shaded relief data were derived from National Elevation Dataset (NED) data, and show the terrain of Alaska at a resolution of 200 meters. The NED is...

  16. Color Hawaii Shaded Relief ? 200-Meter Resolution - Direct Download

    Data.gov (United States)

    U.S. Geological Survey, Department of the Interior — The color Hawaii shaded relief data were derived from National Elevation Dataset (NED) data, and show the terrain of Hawaii at a resolution of 200 meters. The NED is...

  17. Satellite View of Alaska, with Shaded Relief - Direct Download

    Data.gov (United States)

    U.S. Geological Survey, Department of the Interior — The Satellite View of Alaska, with Shaded Relief map layer is a 200- meter-resolution simulated-natural-color image of Alaska. Vegetation is generally green, with...

  18. Medications for Pain Relief during Labor and Delivery

    Science.gov (United States)

    ... that carry feeling to the vagina , vulva , and perineum . Local anesthetics provide relief from pain in these ... spine. Episiotomy: A surgical incision made into the perineum (the region between the vagina and the anus) ...

  19. Models for disaster relief shelter location and supply routing.

    Science.gov (United States)

    2013-01-01

    This project focuses on the development of a natural disaster response planning model that determines where to locate points of distribution for relief supplies after a disaster occurs. Advance planning (selecting locations for points of distribution...

  20. Pain relief and clinical outcome: from opioids to balanced analgesia

    DEFF Research Database (Denmark)

    Kehlet, H

    1996-01-01

    If it is generally accepted that adequate postoperative pain relief will improve outcome from surgery, several controlled trials demonstrated this only for lower body surgical procedures with epidural and spinal anesthetics. Important effects on outcome were not shown when postoperative opioids...... were administered with patient controlled (PCA) or epidural techniques. However, the most optimal pain relief seems to be best achieved with balanced analgesia techniques using combinations of epidural opioids and local anesthetics and systemic non-steroidal antiinflammatory drugs. Future efforts...

  1. Method for residual stress relief and retained austenite destabilization

    Science.gov (United States)

    Ludtka, Gerard M.

    2004-08-10

    A method using of a magnetic field to affect residual stress relief or phase transformations in a metallic material is disclosed. In a first aspect of the method, residual stress relief of a material is achieved at ambient temperatures by placing the material in a magnetic field. In a second aspect of the method, retained austenite stabilization is reversed in a ferrous alloy by applying a magnetic field to the alloy at ambient temperatures.

  2. Sinai Peninsula, Shaded Relief and Colored Height

    Science.gov (United States)

    2004-01-01

    The Sinai Peninsula, located between Africa and Asia, is a result of those two continents pulling apart from each other. Earth's crust is cracking, stretching, and lowering along the two northern branches of the Red Sea, namely the Gulf of Suez, seen here on the west (left), and the Gulf of Aqaba, seen to the east (right). This color-coded shaded relief image shows the triangular nature of the peninsula, with the coast of the Mediterranean Sea forming the northern side of the triangle. The Suez Canal can be seen as the narrow vertical blue line in the upper left connecting the Red Sea to the Mediterranean. The peninsula is divided into three distinct parts; the northern region consisting chiefly of sandstone, plains and hills, the central area dominated by the Tih Plateau, and the mountainous southern region where towering peaks abound. Much of the Sinai is deeply dissected by river valleys, or wadis, that eroded during an earlier geologic period and break the surface of the plateau into a series of detached massifs with a few scattered oases. Two visualization methods were combined to produce the image: shading and color coding of topographic height. The shade image was derived by computing topographic slope in the northwest-southeast direction, so that northwest slopes appear bright and southeast slopes appear dark. Color coding is directly related to topographic height, with green at the lower elevations, rising through yellow and tan, to white at the highest elevations. Elevation data used in this image were acquired by the Shuttle Radar Topography Mission aboard the Space Shuttle Endeavour, launched on Feb. 11, 2000. SRTM used the same radar instrument that comprised the Spaceborne Imaging Radar-C/X-Band Synthetic Aperture Radar (SIR-C/X-SAR) that flew twice on the Space Shuttle Endeavour in 1994. SRTM was designed to collect 3-D measurements of the Earth's surface. To collect the 3-D data, engineers added a 60-meter (approximately 200-foot) mast, installed

  3. Olduvai Gorge, Shaded Relief and Colored Height

    Science.gov (United States)

    2004-01-01

    Three striking and important areas of Tanzania in eastern Africa are shown in this color-coded shaded relief image from the Shuttle Radar Topography Mission. The largest circular feature in the center right is the caldera, or central crater, of the extinct volcano Ngorongoro. It is surrounded by a number of smaller volcanoes, all associated with the Great Rift Valley, a geologic fault system that extends for about 4,830 kilometers (2,995 miles) from Syria to central Mozambique. Ngorongoro's caldera is 22.5 kilometers (14 miles) across at its widest point and is 610 meters (2,000 feet) deep. Its floor is very level, holding a lake fed by streams running down the caldera wall. It is part of the Ngorongoro Conservation Area and is home to over 75,000 animals. The lakes south of the crater are Lake Eyasi and Lake Manyara, also part of the conservation area. The relatively smooth region in the upper left of the image is the Serengeti National Park, the largest in Tanzania. The park encompasses the main part of the Serengeti ecosystem, supporting the greatest remaining concentration of plains game in Africa including more than 3,000,000 large mammals. The animals roam the park freely and in the spectacular migrations, huge herds of wild animals move to other areas of the park in search of greener grazing grounds (requiring over 4,000 tons of grass each day) and water. The faint, nearly horizontal line near the center of the image is Olduvai Gorge, made famous by the discovery of remains of the earliest humans to exist. Between 1.9 and 1.2 million years ago a salt lake occupied this area, followed by the appearance of fresh water streams and small ponds. Exposed deposits show rich fossil fauna, many hominid remains and items belonging to one of the oldest stone tool technologies, called Olduwan. The time span of the objects recovered dates from 2,100,000 to 15,000 years ago. Two visualization methods were combined to produce the image: shading and color coding of

  4. 29 CFR 1614.505 - Interim relief.

    Science.gov (United States)

    2010-07-01

    ... provide notification will result in the dismissal of the agency's appeal. (5) The agency may, by notice to... extent of the temporary or conditional restoration of the employee to duty status in the position specified in the decision, pending the outcome of the agency appeal. The employee may decline the offer of...

  5. 12 CFR 268.505 - Interim relief.

    Science.gov (United States)

    2010-01-01

    ... provide notification will result in the dismissal of the Board's appeal. (5) The Board may, by notice to... to the extent of the temporary or conditional restoration of the employee to duty status in the position specified in the decision, pending the outcome of the Board appeal. The employee may decline the...

  6. Topography of the Betics: crustal thickening, dynamic topography and relief inheritance

    Science.gov (United States)

    Janowski, Marianne; Loget, Nicolas; Bellahsen, Nicolas; Husson, Laurent; Le Pourhiet, Laetitia; Meyer, Bertrand

    2017-04-01

    The main mechanism that explains high orogenic topographies is the isostatic adjustment due to crustal thickening. However in the Betic Cordillera (South Spain), the present-day elevation and crustal thickness are not correlated. That is at odds with the general premise of isostasy and requires reappraising the question of the driving mechanisms leading to the current topography. The Betics are located at the western edge of the alpine Mediterranean belt. Its Cenozoic orogenic building was disrupted by a major crustal thinning event induced by a slab rollback in the internal zones (Alboran domain) during Neogene. Topography was largely levelled and flooded by the sea during Neogene extension, and then has been folded since the Late Tortonian inversion. The present-day topography shows flat summits still preserved from fluvial regression in the internal zones (central and eastern Betics). These low-relief surfaces may be inherited from the Neogene planation toward sea-level as rocks cooling histories inferred from low-temperature thermochronology seem to point it out. Post-Tortonian shortening estimated thanks to a crustal-scale N-S cross-section in the eastern Betics (at the Sierra Nevada longitude) does not exceed few kilometers which is much lower than the shortening required by isostatic equilibrium, and is thus insufficient to explain the post-Tortonian topography building. We tested the hypothesis that mantle dynamics could in fact be an important mechanism that explains the topography of the Betics. We first computed the residual topography (i.e. the non-isostatic component of the elevation) using the most recent published Moho mapping of the area. In the western Betics, our results show important negative residual topography (down to -3 km) possibly associated with the west-Alboran slab suction. In the eastern Betics however, positive residual topography is important (up to +3 km) and can be explained by the dynamic mantle support of the topography, possibly

  7. Understanding History

    OpenAIRE

    Gorman, Jonathan

    2017-01-01

    Has any question about the historical past ever been finally answered? Of course there is much disagreement among professional historians about what happened in the past and how to explain it. But this incisive study goes one step further and brings into question the very ability of historians to gather and communicate genuine knowledge about the past. Understanding History applies this general question from the philosophy of history to economic history of American slaveholders. Do we unders...

  8. Financial History

    OpenAIRE

    Cassis, Y.; Cottrell, P. L

    2017-01-01

    The considerable renewal of interest in all aspects of financial history over recent years provided one motivation for this new venture. Yet, the foundations for our specialism, which draws from both History and the Social Sciences, especially economics, have been laid by many. Some would point to continuity in our interest from the publication in the 1930s of jubilee banking history volumes, such as those written for British institutions by Gregory, and by Crick and Wadsworth. Further schola...

  9. Conceptual History, Cultural History, Social History

    Directory of Open Access Journals (Sweden)

    Viktor Zhivov (†

    2014-10-01

    Full Text Available V. M. Zhivov’s introduction to Studies in Historical Semantics of the Russian Language in the Early Modern Period (2009, translated here for the first time, offers a critical survey of the historiography on Begriffsgeschichte, the German school of conceptual history associated with the work of Reinhart Koselleck, as well as of its application to the study of Russian culture.  By situating Begriffsgeschichte in the context of late-nineteenth and early twentieth-century European philosophy, particularly hermeneutics and phenomenology, the author points out the important, and as yet unacknowledged, role that Russian linguists have played in the development of a native school of conceptual history.  In the process of outlining this alternative history of the discipline, Zhivov provides some specific examples of the way in which the study of “historical semantics” can be used to analyze the development of Russian modernity.

  10. Experiences from tsunami relief activity: implications for medical training

    Directory of Open Access Journals (Sweden)

    Sudharsanam Manni Balasubramaniam

    2012-09-01

    Full Text Available A tsunami struck the coast of Tamilnadu and Pondicherry on 26 December 2004. Jawaharlal Institute of Postgraduate Medical Education & Research, (JIPMER in Pondicherry played a vital role in providing medical relief. The experiences from the relief activities revealed areas of deficiency in medical education in regards to disaster preparedness. A qualitative study using focus group discussion was employed to find the lacunae in skills in managing medical relief measures. Many skills were identified; the most important of which was addressing the psychological impact of the tsunami on the victims. Limited coordination and leadership skills were also identified. It is recommended that activity-based learning can be included in the curriculum to improve these skills.

  11. Unmanned Aerial Vehicle Systems for Disaster Relief: Tornado Alley

    Science.gov (United States)

    DeBusk, Wesley M.

    2009-01-01

    Unmanned aerial vehicle systems are currently in limited use for public service missions worldwide. Development of civil unmanned technology in the United States currently lags behind military unmanned technology development in part because of unresolved regulatory and technological issues. Civil unmanned aerial vehicle systems have potential to augment disaster relief and emergency response efforts. Optimal design of aerial systems for such applications will lead to unmanned vehicles which provide maximum potentiality for relief and emergency response while accounting for public safety concerns and regulatory requirements. A case study is presented that demonstrates application of a civil unmanned system to a disaster relief mission with the intent on saving lives. The concept utilizes unmanned aircraft to obtain advanced warning and damage assessments for tornados and severe thunderstorms. Overview of a tornado watch mission architecture as well as commentary on risk, cost, need for, and design tradeoffs for unmanned aerial systems are provided.

  12. Bridging the sanitation gap between disaster relief and development.

    Science.gov (United States)

    Lai, Ka-Man; Ramirez, Claudia; Liu, Weilong; Kirilova, Darina; Vick, David; Mari, Joe; Smith, Rachel; Lam, Ho-Yin; Ostovari, Afshin; Shibakawa, Akifumi; Liu, Yang; Samant, Sidharth; Osaro, Lucky

    2015-10-01

    By interpreting disasters as opportunities to initiate the fulfilment of development needs, realise the vulnerability of the affected community and environment, and extend the legacy of relief funds and effort, this paper builds upon the concept linking relief, rehabilitation and development (LRRD) in the sanitation sector. It aims to use a composite of case studies to devise a framework for a semi-hypothetical scenario to identify critical components and generic processes for a LRRD action plan. The scenario is based on a latrine wetland sanitation system in a Muslim community. Several sub-frameworks are developed: (i) latrine design; (ii) assessment of human waste treatment; (iii) connective sanitation promotion strategy; and (iv) ecological systems and environmental services for sanitation and development. This scenario illustrates the complex issues involved in LRRD in sanitation work and provides technical notes and references for a legacy plan for disaster relief and development. © 2015 The Author(s). Disasters © Overseas Development Institute, 2015.

  13. Experiences in disaster-related mental health relief work: An exploratory model for the interprofessional training of psychological relief workers.

    Science.gov (United States)

    Ren, ZhengJia; Wang, HongTao; Zhang, Wei

    2017-01-01

    The purpose of this study was to begin to generate an exploratory model of the disaster-related mental health education process associated with the training experiences of psychological relief workers active during the Sichuan earthquake in China. The data consisted of semi-structured interviews with 20 psychological relief workers from four different professions (social workers, psychiatric nurses, psychiatrists, and counsellors) regarding their experiences in training and ideas for improvement. The model explains the need to use a people-centred community interprofessional education approach, which focuses on role-modelling of the trainer, caring for relief workers, paying attention to the needs of the trainee, and building systematic interprofessional education strategies. The proposed model identifies areas for the comprehensive training of relief workers and aims to address the importance of people-centred mental health service provisions, ensure intentional and strategic training of relief workers using interprofessional concepts and strategies, and use culturally attuned and community-informed strategies in mental health training practices.

  14. Subducted oceanic relief locks the shallow megathrust in central Ecuador

    Science.gov (United States)

    Collot, Jean-Yves; Sanclemente, Eddy; Nocquet, Jean-Mathieu; Leprêtre, Angélique; Ribodetti, Alessandra; Jarrin, Paul; Chlieh, Mohamed; Graindorge, David; Charvis, Philippe

    2017-05-01

    Whether subducted oceanic reliefs such as seamounts promote seismic rupture or aseismic slip remains controversial. Here we use swath bathymetry, prestack depth-migrated multichannel seismic reflection lines, and wide-angle seismic data collected across the central Ecuador subduction segment to reveal a broad 55 km × 50 km, 1.5-2.0 km high, low height-to-width ratio, multipeaked, sediment-bare, shallow subducted oceanic relief. Owing to La Plata Island and the coastline being located, respectively, 35 km and 50-60 km from the trench, GPS measurements allow us to demonstrate that the subducted oceanic relief spatially correlates to a shallow, 80 km × 55 km locked interplate asperity within a dominantly creeping subduction segment. The oceanic relief geometrical anomaly together with its highly jagged topography, the absence of a subduction channel, and a stiff erosive oceanic margin are found to be long-term geological characteristics associated with the shallow locking of the megathrust. Although the size and level of locking observed at the subducted relief scale could produce an Mw >7+ event, no large earthquakes are known to have happened for several centuries. On the contrary, frequent slow slip events have been recorded since 2010 within the locked patch, and regular seismic swarms have occurred in this area during the last 40 years. These transient processes, together with the rough subducted oceanic topography, suggest that interplate friction might actually be heterogeneous within the locked patch. Additionally, we find that the subducted relief undergoes internal shearing and produces a permanent flexural bulge of the margin, which uplifted La Plata Island.

  15. Public History

    Directory of Open Access Journals (Sweden)

    Marta Gouveia de Oliveira Rovai

    2017-04-01

    Full Text Available Este artigo tem como proposta apresentar o conceito e as práticas de História Pública como um novo posicionamento da ciência histórica em diálogo com profissionais da comunicação, no sentido de produzir e divulgar as experiências humanas. Para isso, discute-se a origem do conceito de História Pública e as diferentes formas de educação histórica que a utilização das novas tecnologias podem proporcionar (dentre elas a internet. Nesse sentido, convida-se o leitor para a reflexão sobre as possibilidades de publicização e de democratização do conhecimento histórico e da cultura, ampliando-se a oportunidade de produção, de divulgação e de acesso do público a diferentes formas experiências no tempo. O artigo também intenciona chamar atenção dos profissionais que lidam com a História e com a Comunicação para os perigos de produções exclusivamente submetidas ao mercado que transformam a popularização da História no reforço de estigmas culturais.   PALAVRAS-CHAVE: História Pública; Educação histórica e Comunicação; democratização e estigmatização.     ABSTRACT This article aims to present the concept and practices of Public History as a new positioning of historical science in dialogue with communication professionals, in the sense of producing and disseminating human experiences. For this, the origin of the concept of Public History and the different forms of historical education that the use of the new technologies can provide (among them the Internet is discussed. In this sense, the reader is invited to reflect on the possibilities of publicizing and democratizing historical knowledge and culture, expanding the opportunity for production, dissemination and public access to different forms of experience in time. The article also intends to draw attention from professionals dealing with History and Communication to the dangers of exclusively commercialized productions that transform the popularization

  16. Intellectual History

    DEFF Research Database (Denmark)

    In the 5 Questions book series, this volume presents a range of leading scholars in Intellectual History and the History of Ideas through their answers to a brief questionnaire. Respondents include Michael Friedman, Jacques le Goff, Hans Ulrich Gumbrecht, Jonathan Israel, Phiip Pettit, John Pocock...

  17. Romerrigets historie

    DEFF Research Database (Denmark)

    Christiansen, Erik

    Romerrigets historie fra Roms legendariske grundlæggelse i 753 f.v.t. til Heraklios' tronbestigelse i 610 e.v.t.......Romerrigets historie fra Roms legendariske grundlæggelse i 753 f.v.t. til Heraklios' tronbestigelse i 610 e.v.t....

  18. Epidural morphine for postoperative pain relief in children

    DEFF Research Database (Denmark)

    Henneberg, S W; Hole, P; Haas, Inge Madsen De

    1993-01-01

    for postoperative pain relief after major abdominal surgery. The age distribution was from newborn to 13 years, with a median age of 12 months. It was estimated that 94% of the patients had good analgesia for the first 24 postoperative hours and no other opioids were given. The side effects were few, but one case...... the investigation. We observed a change in the sleeping pattern with an increased number of sleep-induced myoclonia during the administration of epidural morphine. In conclusion, the use of epidural morphine in children for postoperative pain relief is very efficient. The minimal effective dose has not been...

  19. Epidural morphine for postoperative pain relief in children

    DEFF Research Database (Denmark)

    Henneberg, S W; Hole, P; Haas, Inge Madsen De

    1993-01-01

    Epidural morphine for postoperative pain relief is in general use, and has proved to be very efficient in adults. The epidural technique and the use of epidural morphine are much less frequent in children. For 2 years we have prospectively followed 76 children who had epidural morphine...... the investigation. We observed a change in the sleeping pattern with an increased number of sleep-induced myoclonia during the administration of epidural morphine. In conclusion, the use of epidural morphine in children for postoperative pain relief is very efficient. The minimal effective dose has not been...

  20. Statistical modeling implicates neuroanatomical circuit mediating stress relief by 'comfort' food.

    Science.gov (United States)

    Ulrich-Lai, Yvonne M; Christiansen, Anne M; Wang, Xia; Song, Seongho; Herman, James P

    2016-07-01

    A history of eating highly palatable foods reduces physiological and emotional responses to stress. For instance, we have previously shown that limited sucrose intake (4 ml of 30 % sucrose twice daily for 14 days) reduces hypothalamic-pituitary-adrenocortical (HPA) axis responses to stress. However, the neural mechanisms underlying stress relief by such 'comfort' foods are unclear, and could reveal an endogenous brain pathway for stress mitigation. As such, the present work assessed the expression of several proteins related to neuronal activation and/or plasticity in multiple stress- and reward-regulatory brain regions of rats after limited sucrose (vs. water control) intake. These data were then subjected to a series of statistical analyses, including Bayesian modeling, to identify the most likely neurocircuit mediating stress relief by sucrose. The analyses suggest that sucrose reduces HPA activation by dampening an excitatory basolateral amygdala-medial amygdala circuit, while also potentiating an inhibitory bed nucleus of the stria terminalis principle subdivision-mediated circuit, resulting in reduced HPA activation after stress. Collectively, the results support the hypothesis that sucrose limits stress responses via plastic changes to the structure and function of stress-regulatory neural circuits. The work also illustrates that advanced statistical methods are useful approaches to identify potentially novel and important underlying relationships in biological datasets.

  1. Sculpture, Dance and Heritage: animating dance sequences from temple reliefs using movement modelling software

    Directory of Open Access Journals (Sweden)

    Alessandra Lopez y Royo Iyer

    2001-06-01

    Full Text Available This article discusses research carried out in 1999 at the School of Performing Arts of the University of Surrey, Dance Studies Department. For this research project, computer animation modelling techniques were used to recreate a series of dance movement sequences depicted in the reliefs around the balustrade of the main temple at the Prambanan temple complex in Central Java, built in the 9th century CE. The reconstruction and re-creation of the dance movements from the reliefs are inseparable from the context of the temple complex. The issues of heritage, its interpretation and conservation are also discussed, particularly since the construction of dance as heritage is widespread in Southeast Asia and is linked with tourist consumption of archaeological sites. The article makes a case for the use of computer technology in research areas previously regarded as distinct and disconnected, such as archaeology, art history and dance, and in this specific case study, computer technology has provided a bridge between these disciplines.

  2. History of aviation safety; the satisfying sighs of relief due to developments in Aviation safety

    NARCIS (Netherlands)

    Stoop, J.A.A.M.

    2014-01-01

    ”Aviation safety is an Integral part of my career. Being part of TU Delft’s impressive record of research on Aviation safety, my career has been with a sense of purpose and a responsibility to equip students to deal with the status quo challenges on Aviation safety, developments, Investigations and

  3. Comparison of custom sounds for achieving tinnitus relief.

    Science.gov (United States)

    Henry, James A; Rheinsburg, Betsy; Zaugg, Tara

    2004-09-01

    Tinnitus masking has been a widely used method for treating clinically significant tinnitus. The method, referred to herein as "sound-based relief," typically uses wearable ear-level devices ("maskers") to effect palliative tinnitus relief. Although often effective, this approach is limited to the use of broadband noise with the maskers. We hypothesized that the effectiveness of treatment can be improved by expanding the auditory-stimulus options available to patients. A pilot study was conducted to determine for each of 21 subjects the most effective of custom sounds that are designed to promote tinnitus relief. While sitting in a sound booth, subjects listened to white noise and to custom sounds that are available commercially for providing tinnitus relief. Three sound formats ("E-Water," "E-Nature," and "E-Air") were provided by the Dynamic Tinnitus Mitigation (DTM-6a) system (Petroff Audio Technologies, Inc.). Additionally, seven sounds were provided by the Moses/Lang CD7 system (Oregon Hearing Research Center). Considering group data, all of the sounds provided a significant reduction in tinnitus annoyance relative to the annoyance of tinnitus alone. Two of the commercial sounds (DTM E-Nature and E-Water) were judged significantly more effective than the other sounds.

  4. 2-minute Gridded Global Relief Data (ETOPO2) v2

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Two-minute gridded global relief for both ocean and land areas are available in the ETOPO2v2 (2006) database. ETOPO2v2 replaced ETOPO2 (2001). The historic 2-minute...

  5. Poverty Relief or Poverty Eradication? | Kritzinger | Acta Theologica

    African Journals Online (AJOL)

    The author challenges the reader to make two mindshifts: from a focus on poverty relief to an emphasis on poverty eradication; and from viewing the poor as the objects of poverty alleviation to accepting them as the subjects of poverty eradication. The case is argued and a practical approach towards poverty eradication is ...

  6. Japanese women's experiences of pharmacological pain relief in New Zealand.

    Science.gov (United States)

    Doering, Keiko; Patterson, Jean; Griffiths, Christine R

    2014-06-01

    In Japan, most women manage labour pain without pharmacological interventions. However, New Zealand statistics show a high percentage of epidural use amongst Asian women. Entonox (a gas mixture of nitrous oxide and oxygen) and pethidine are also available to women in New Zealand. This article investigates how Japanese women in New Zealand respond to the use of pharmacological pain relief in labour. The study was guided by two research questions: (1) How do Japanese women experience and manage labour pain in New Zealand? (2) How do they feel about the use of pharmacological pain relief? Thirteen Japanese women who had given birth in New Zealand were interviewed individually or in a focus group. The conversations were analysed using thematic analysis. Although in Japan very few women use pain relief, nine women received epidural and/or Entonox out of 11 women who experienced labour pain. The contrast between their Japanese cultural expectations and their birth experiences caused some of the women subsequent personal conflict. Japanese women's cultural perspectives and passive attitudes were demonstrated to influence the decision-making process concerning pain relief. It was concluded that understanding Japanese cultural worldviews and approaches to the role of pain in labour would help maternity providers in their provision of appropriate care for Japanese women. Copyright © 2013 Australian College of Midwives. Published by Elsevier Ltd. All rights reserved.

  7. Eksplorasi Pose dalam Pemotretan Model Melalui Kajian Visual Relief Karmawibhangga

    Directory of Open Access Journals (Sweden)

    Noor Latif CM

    2015-10-01

    Full Text Available Karmawibhangga Relief panel located at the foot of Borobudur is a relic of the visual artifacts that contains fragments of past life with a very high historical value. 160 Karmawibhangga panels tell the reality of people's lives at the time wrapped with a moral message plight. The relief provides a lot of visual references to be excavated and reconstructed again for the benefit of the creative industries today. This research digged one small part of the masterpieces of the past through photography. Understanding visual artists who create these reliefs will be beauty in the show gestures in building a very interesting story to be re-examined. Visual communication through gestures in relief Karmawibhangga enables new assumptions about body language dialect differences to current conditions. Through model genre photography, it is very useful in connection with the development of local nuanced scientific photography. Efforts to develop the traditions and culture through new media are expected to be creative commodity with a very strong product differentiation. 

  8. Cyclist's iliac syndrome: temporary relief by balloon angioplasty

    OpenAIRE

    Wijesinghe, L.; Coughlin, P; Robertson, I; Kessel, D; Kent, P.; Kester, R

    2001-01-01

    External iliac stenosis due to endofibrosis is a rare condition that predominantly affects top level cyclists. Short term symptomatic relief is reported in an Olympian after percutaneous transluminal angioplasty, which was performed to allow the patient to return to training without delay.

  9. Knowledge of and attitude towards pain relief during labour of ...

    African Journals Online (AJOL)

    Objective: This study determined women's knowledge of and attitudes to pain relief during labour. Methods: This descriptive study included 151 women, 18 years or older, attending the antenatal clinic of Cecilia Makiwane Hospital. Women were interviewed using a questionnaire that determined their knowledge of and ...

  10. Topical cryotherapy-use for relief of pain and spasticity.

    Science.gov (United States)

    Mead, S; Knott, M

    1966-09-01

    Cold applications are sometimes of pronounced symptomatic benefit in some rheumatic disorders such as acute myalgia; in the temporary relief of spasticity; in helping to release tight structures in poliomyelitis and allied diseases; and in temporary recovery of energy in multiple sclerosis.

  11. Topical Cryotherapy—Use for Relief of Pain and Spasticity

    Science.gov (United States)

    Mead, Sedgwick; Knott, Margaret

    1966-01-01

    Cold applications are sometimes of pronounced symptomatic benefit in some rheumatic disorders such as acute myalgia; in the temporary relief of spasticity; in helping to release tight structures in poliomyelitis and allied diseases; and in temporary recovery of energy in multiple sclerosis. PMID:18730022

  12. Physico-Chemistry Of Geophagic Soils Ingested To Relief Nausea ...

    African Journals Online (AJOL)

    The aim of this study was to physico-chemically characterise selected geophagic soils from Cameroon and South Africa, ingested for the relief of NVP and to appraise their ability to meet the needs of geophagic individuals. Materials and Methods: Thirteen geophagic soil samples (6 from Cameroon and 7 from South Africa) ...

  13. Careful: Acetaminophen in Pain Relief Medicines Can Cause Liver Damage

    Science.gov (United States)

    ... the-Counter Pain Relievers and Fever Reducers Careful: Acetaminophen in pain relief medicines can cause liver damage ... More sharing options Linkedin Pin it Email Print Acetaminophen (a∙SEET∙a∙MIN∙o∙fen) is an ...

  14. Civil-military relations in disaster rescue and relief activities ...

    African Journals Online (AJOL)

    This article examines engagements between civilian actors, the Philippine security forces and the US military during disaster response operations. The Philippine disaster framework recognises the military's role in disaster relief and has existing mechanisms for accepting international assistance and procedures for ...

  15. 14 CFR 125.165 - Extinguishing agent container pressure relief.

    Science.gov (United States)

    2010-01-01

    ... 14 Aeronautics and Space 3 2010-01-01 2010-01-01 false Extinguishing agent container pressure relief. 125.165 Section 125.165 Aeronautics and Space FEDERAL AVIATION ADMINISTRATION, DEPARTMENT OF TRANSPORTATION (CONTINUED) AIR CARRIERS AND OPERATORS FOR COMPENSATION OR HIRE: CERTIFICATION AND OPERATIONS...

  16. 14 CFR 121.267 - Extinguishing agent container pressure relief.

    Science.gov (United States)

    2010-01-01

    ... 14 Aeronautics and Space 3 2010-01-01 2010-01-01 false Extinguishing agent container pressure relief. 121.267 Section 121.267 Aeronautics and Space FEDERAL AVIATION ADMINISTRATION, DEPARTMENT OF TRANSPORTATION (CONTINUED) AIR CARRIERS AND OPERATORS FOR COMPENSATION OR HIRE: CERTIFICATION AND OPERATIONS...

  17. Optically induced surface relief phenomena in azobenzene polymers

    DEFF Research Database (Denmark)

    Holme, NCR; Nikolova, Ludmila; Hvilsted, Søren

    1999-01-01

    Azobenzene polymers and oligomers show intriguing surface relief features when irradiated with polarized laser light. We show through atomic force microscopic investigation of side-chain azobenzene polymers after irradiation through an amplitude mask that large peaks or trenches result depending...

  18. Diffraction from relief gratings on a biomimetic elastomer cast

    Energy Technology Data Exchange (ETDEWEB)

    Guerrero, Raphael A., E-mail: rguerrero@admu.edu.ph [Department of Physics, Ateneo de Manila University, Loyola Heights, Quezon City (Philippines); Aranas, Erika B. [Department of Physics, Ateneo de Manila University, Loyola Heights, Quezon City (Philippines)

    2010-10-12

    Biomimetic optical elements combine the optimized designs of nature with the versatility of materials engineering. We employ a beetle carapace as the template for fabricating relief gratings on an elastomer substrate. Biological surface features are successfully replicated by a direct casting procedure. Far-field diffraction effects are discussed in terms of the Fraunhofer approximation in Fourier space.

  19. Civil-military relations in disaster rescue and relief activities ...

    African Journals Online (AJOL)

    The Philippine disaster framework recognises the military's role in disaster relief and has existing mechanisms for accepting international assistance and procedures for military-to-military ... The US military's activities were confined to search and rescue and to providing critical logistics, which the Philippines actors lacked.

  20. Dysmenorrhoea: Pain relief strategies among a cohort of ...

    African Journals Online (AJOL)

    McRoy

    Dysmenorrhoea: Pain relief strategies among a cohort of undergraduates in Nigeria. Emmanuel A1*, Achema G2, Gimba SM1, Mafuyai MJ1, Afoi BB3, Ifere I.O1. 1Department of Nursing, University of Jos, Plateau, Nigeria, 2School of Nursing and Public. Health, Howard College, University of Kwazulu-Natal, Durban, South ...

  1. Trends in intraoperative pain relief in anesthesized Nigerian ...

    African Journals Online (AJOL)

    shobha

    IV NSAID, e.g., ketorolac. IV ketamine. IV PCA (PICA). 568. 4. 16. –. 550 (96.8). 2 (50). 14 (87.5). –. Regional blocks: Caudal block. Epidural/ spinal blocks. 41. 5. 41 (100). 5 (100). Local infiltration of local anesthetic. 6. 6 (100). Unspecified. 41. –. Total. *689. 612. Multimodal pain relief methods were used in some patients.

  2. Unique post-doctoral positions in Master of Arts in Teaching Earth Science program at the American Museum of Natural History: Involving early-career research scientists in Earth science education

    Science.gov (United States)

    Flores, K. E.; Nadeau, P. A.; Zirakparvar, N. A.; Grcevich, J.; Ustunisik, G. K.

    2012-12-01

    Post-doctoral positions in Earth science fields traditionally emphasize research within a university setting or research institute. Such positions may include a teaching component, but one which is often restricted to introductory undergraduate Earth science courses or upper-level courses within their own field of specialization. With such a specific focus, there may not be much inclination on the part of a post-doctoral fellow to involve themselves in broader education programs, such as public outreach or secondary schools. The American Museum of Natural History is now conducting a non-traditional post-doctoral position as part of its new Master of Arts in Teaching Earth Science (MAT). This pilot program involves forging a one-of-a-kind partnership between a world-class research museum and high-needs schools in New York City with the goal of addressing a critical shortage of qualified Earth Science teachers in New York State, particularly in high-needs schools with diverse populations. The program, which is part of the state's Race to the Top initiative, is approved by the NYS Board of Regents and will prepare a total of 50 candidates in two cohorts to earn a Board of Regents-awarded Masters of Arts in Teaching (MAT) degree with a specialization in Earth Science for grades 7-12. The post-doctoral fellows of the MAT program have unique 3-year positions, with more traditional research-based work comprising 65% of the tenure and non-traditional educational roles 35%. The MAT fellows are divided into two types: those with a teaching role, who are involved in the co-design and co-teaching of graduate-level Earth science courses; and those in a research/mentoring role, who design and teach a summer-long science research practicum while also providing informal support to MAT teaching candidates throughout the school year. Over the first year of the MAT program's implementation, fellows have been exposed to a range of activities outside the realm of a traditional post

  3. [Academic heritage of Jiu huang ben cao (Materia Medica for Relief of Famines) in Japan].

    Science.gov (United States)

    He, Huiling; Xiao, Yongzhi

    2014-11-01

    Jiu huang ben cao (Materia Medica for Relief of Famines) was the first monograph on famines herbal in the history of China, which creates a new research field of edible plants. Around the middle and late 17th century, Jiu huang ben cao was spread to Japan and aroused great attention of famous Japanese herbalists. Thus, all versions of different edition systems were circulated in Japan. Later, some famous Japanese scholar ssuccessively quoted texts of Jiu huang ben cao from the Nong zheng quan shu (Whole book on Agricultural Administration) spread in Japan, and block-printed it as an independent work. As a result, Jiu huang ben cao virtually circulated widely in Japan.

  4. History of Bioterrorism: Botulism

    Medline Plus

    Full Text Available ... Resources for Emergency Health Professionals Clinician Outreach and Communication Activity (COCA) Crisis & Emergency Risk Communication (CERC) Disaster Relief Volunteers Emergency Planners and Responders ...

  5. History of Bioterrorism: Botulism

    Medline Plus

    Full Text Available ... Clinician Outreach and Communication Activity (COCA) Crisis & Emergency Risk Communication (CERC) Disaster Relief Volunteers Emergency Planners and Responders Emergency Responder ...

  6. History of Bioterrorism: Botulism

    Medline Plus

    Full Text Available ... Resources for Emergency Health Professionals Clinician Outreach and Communication Activity (COCA) Crisis & Emergency Risk Communication (CERC) Disaster Relief Volunteers Emergency ...

  7. Delayed relief of hemifacial spasm after microvascular decompression.

    Science.gov (United States)

    Xia, Lei; Zhong, Jun; Zhu, Jin; Dou, Ning-Ning; Liu, Ming-Xing; Li, Shi-Ting

    2015-03-01

    Microvascular decompression (MVD) has been accepted worldwide as a reasonable treatment for hemifacial spasm (HFS); however, resolution of the HFS is often gradual. To conclude the delayed relief rate of the MVD for the treatment of HFS, we conducted a systematic review. Using the keywords delayed relief, hemifacial spasm, or microvascular decompression, articles published in English-language journals and indexed in PubMed between June 1, 1994 and June 1, 2014 on the treatment of HFS with emphasis on delayed relief were considered for this study. Twelve articles with 2727 patients with HFS were finally enrolled in this review. Among all the patients, the ratio of male versus female was 1:2.7, and left versus right was 1:1.6. The average age at surgery was 52.5 years (49.1-55.9 y), with HFS symptom duration of 68.4 months (38.4-98.4 mo) before the surgery. The average follow-up duration was 49 months (6.4-121.6 mo). After examining all the patients, we obtained a mean postoperative success rate of 85.1% (76.5%-93.5%), but the success rate after the MVD immediately is only 71.8% (59.5%-84%). The mean rate of delayed relief was 25.4% (18.8%-37.1%). Approximately 13.1% (5.9%-19.7%) of the patients with symptom recurrence resorted to repeated MVD during the follow-up period. Accordingly, MVD is the most effective treatment for patients with HFS, but some of the patients may experienced delayed relief, which could be avoided if a thorough decompression of the facial nerve root had been obtained.

  8. Australia, Shaded Relief and Colored Height

    Science.gov (United States)

    2004-01-01

    Australia is the world's smallest, flattest, and (after Antarctica) driest continent, but at 7.7 million square kilometers (3.0 million square miles) it is also the sixth largest country. Its low average elevation (300 meters, or less than 1000 feet) is caused by its position near the center of a tectonic plate, where there are no volcanic or other geologic forces of the type that raise the topography of other continents. In fact Australia is the only continent without any current volcanic activity at all - the last eruption took place 1400 years ago at Mt. Gambier. The Australian continent is also one of the oldest land masses, with some of its erosion-exposed bedrock age dated at more than 3 billion years. More than one-fifth of the land area is desert, with more than two-thirds being classified as arid or semi-arid and unsuitable for settlement. The coldest regions are in the highlands and tablelands of Tasmania and the Australian Alps at the southeastern corner of the continent, location of Australia's highest point, Mt. Kosciusko (2228 meters, or 7310 feet.) Prominent features of Australia include the Lake Eyre basin, the darker green region visible in the center-right. At 16 meters (52 feet) below sea level this depression is one of the largest inland drainage systems in the world, covering more than 1.3 million square kilometers (500,000 square miles). The mountain range near the east coast is called the Great Dividing Range, forming a watershed between east and west flowing rivers. Erosion has created deep valleys, gorges and waterfalls in this range where rivers tumble over escarpments on their way to the sea. The crescent shaped uniform green region in the south, just left of center, is the Nullarbor Plain, a low-lying limestone plateau which is so flat that the Trans-Australian Railway runs through it in a straight line for more than 483 kilometers (300 miles). Two visualization methods were combined to produce this image: shading and color coding of

  9. Glacial erosion of high-elevation low-relief summits on passive continental margins constrained by cosmogenic nuclides

    DEFF Research Database (Denmark)

    Andersen, Jane Lund; Egholm, David Lundbek; Knudsen, Mads Faurschou

    , indicating that warm-based ice eroded the summits during the last glacial period. From the isotope concentrations we model denudation histories using a recently developed Monte Carlo Markov Chain inversion model (Knudsen et al, 2015). The model relies on the benthic d18O curve (Lisiecki and Raymo, 2005...... important implications for the understanding of high-elevation low-relief summits in general, as these have often been interpreted as relict landforms inherited from pre-Quaternary times and thus indicating long periods of surface stability. Our results point instead to substantial modification...

  10. Supply Positioning in Support of Humanitarian Assistance and Disaster Relief Operations

    Science.gov (United States)

    2011-06-01

    include medical, surgical, dental, and veterinary care, as well as well-drilling, surface transportation, and sanitation facility and public...General dentistry 35 VI. CONCLUSIONS AND RECOMMENDATIONS A. SUMMARY AND CONCLUSIONS The U.S. military is a major player in HA/DR operations due to the

  11. 100-Meter Resolution Grayscale Shaded Relief of the Conterminous United States - Direct Download

    Data.gov (United States)

    U.S. Geological Survey, Department of the Interior — The Grayscale Shaded Relief of the Conterminous United States map layer is a 100-meter resolution grayscale shaded relief image of the United States, in an Albers...

  12. 19 CFR 133.51 - Relief from forfeiture or liquidated damages.

    Science.gov (United States)

    2010-04-01

    ... claim for liquidated damages for failure to redeliver released merchandise incurred under the provisions... counterfeit trademark, relief from a forfeiture may be granted pursuant to a petition for relief upon the...

  13. Integration of real-time mapping technology in disaster relief distribution.

    Science.gov (United States)

    2013-02-01

    Vehicle routing for disaster relief distribution involves many challenges that distinguish this problem from those in commercial settings, given the time sensitive and resource constrained nature of relief activities. While operations research approa...

  14. 100-Meter Resolution Satellite View with Shaded Relief of Hawaii - Direct Download

    Data.gov (United States)

    U.S. Geological Survey, Department of the Interior — The Satellite View with Shaded Relief of Hawaii map layer is a 100-meter resolution simulated natural-color image of Hawaii, with relief shading added to accentuate...

  15. 100-Meter Resolution Color Shaded Relief of the Conterminous United States - Direct Download

    Data.gov (United States)

    U.S. Geological Survey, Department of the Interior — The Color Shaded Relief of the Conterminous United States map layer is a 100-meter resolution color-sliced elevation image of the United States, with relief shading...

  16. USGS Small-scale Dataset - Bathymetric Shaded Relief of North America 200509 GeoTIFF

    Data.gov (United States)

    U.S. Geological Survey, Department of the Interior — The Bathymetric Shaded Relief of North America map layer shows depth ranges using colors, with relief enhanced by shading. The image was derived from the National...

  17. 78 FR 33467 - Second Allocation of Public Transportation Emergency Relief Funds in Response to Hurricane Sandy...

    Science.gov (United States)

    2013-06-04

    ... From the Federal Register Online via the Government Publishing Office DEPARTMENT OF TRANSPORTATION Federal Transit Administration Second Allocation of Public Transportation Emergency Relief Funds in... the Public Transportation Emergency Relief Program to the four FTA recipients most severely affected...

  18. Parenteral opioids for maternal pain relief in labour.

    Science.gov (United States)

    Ullman, Roz; Smith, Lesley A; Burns, Ethel; Mori, Rintaro; Dowswell, Therese

    2010-09-08

    Parenteral opioids are used for pain relief in labour in many countries throughout the world. To assess the acceptability, effectiveness and safety of different types, doses and modes of administration of parenteral opioids given to women in labour. We searched the Cochrane Pregnancy and Childbirth Group's Trials Register (January 2010) and reference lists of retrieved studies. We included randomised controlled trials examining the use of intramuscular or intravenous opioids (including patient controlled analgesia) for women in labour. We looked at studies comparing an opioid with placebo or another opioid. At least two review authors independently assessed study eligibility, collected data and assessed risk of bias. We included 54 studies involving more than 7000 women that compared an opioid with placebo or another opioid administered intramuscularly or intravenously. The 54 studies reported on 27 different comparisons, and for many outcomes only one study contributed data. Overall the evidence was of poor quality regarding the analgesic effect of opioids, satisfaction with analgesia, adverse effects and harm to women and babies. There were few statistically significant results. Many of the studies had small sample sizes, and low statistical power. Overall, findings indicated that parenteral opioids provided some pain relief and moderate satisfaction with analgesia in labour, although up to two-thirds of women who received opioids reported moderate or severe pain and/or poor or moderate pain relief one or two hours after administration. Opioid drugs were associated with maternal nausea, vomiting and drowsiness, although different opioid drugs were associated with different adverse effects. There was no clear evidence of adverse effects of opioids on the newborn. We did not have sufficient evidence to assess which opioid drug provided the best pain relief with the least adverse effects. Parenteral opioids provide some relief from pain in labour but are associated

  19. Estimation of Erosion Dissection of North-Eastern Caucasus Relief for Recreational Land Use

    Directory of Open Access Journals (Sweden)

    Zagir V. Ataev

    2012-02-01

    Full Text Available The digital model of the relief (DMR of North-East Caucasus relief was used for an estimation of an erosive partition of territory. The card of usages of erosive forms and density of an erosive partition of a relief was made on basis of GIS-technology. The analysis of these parameters has allowed to estimate the potential of a relief of studied territory for such kinds of touristic and recreational activity, as foot and a cycle tourism

  20. History's Purpose in Antebellum Textbooks

    Science.gov (United States)

    McInnis, Edward Cromwell

    2012-01-01

    Many scholars have argued that history education during the antebellum period in the United States supported conservative values and sought to produce close-minded citizens. History textbooks of that era, they frequently posit, cast Americans as God's chosen people and present the past in a style that reaffirms established social conventions. Ruth…

  1. Matematikkens historie

    DEFF Research Database (Denmark)

    Hansen, Vagn Lundsgaard

    2009-01-01

    Matematikkens historie i syv kapitler: 1. Matematik i støbeskeen; 2. Matematikkens græske arv; 3. Den gyldne tidsalder for hinduer og arabere; 4. Matematik i Kina; 5. Renæssancens matematik; 6. Regning med infinitesimaler ser dagens lys; 7. Matematik i det tyvende århundrede.......Matematikkens historie i syv kapitler: 1. Matematik i støbeskeen; 2. Matematikkens græske arv; 3. Den gyldne tidsalder for hinduer og arabere; 4. Matematik i Kina; 5. Renæssancens matematik; 6. Regning med infinitesimaler ser dagens lys; 7. Matematik i det tyvende århundrede....

  2. 77 FR 59408 - Finding of Equivalence; Alternate Pressure Relief Valve Settings on Certain Vessels Carrying...

    Science.gov (United States)

    2012-09-27

    ...] Finding of Equivalence; Alternate Pressure Relief Valve Settings on Certain Vessels Carrying Liquefied... announces the availability of CG-ENG Policy Letter 04-12, ``Alternative Pressure Relief Valve Settings on.... The higher stress factors lead to lower maximum allowable relief valve settings (MARVS) than are...

  3. Humanitarian relief supply chain: a multi-objective model and solution

    Indian Academy of Sciences (India)

    ADITYA JHA

    Abstract. This paper models a humanitarian relief chain that includes a relief goods supply chain and an evacuation chain in case of a natural disaster. Optimum network flow is studied for both the chains by con- sidering three conflicting objectives, namely demand satisfaction in relief chain, demand satisfaction in evac-.

  4. 12 CFR 303.248 - Truth in Lending Act-Relief from reimbursement.

    Science.gov (United States)

    2010-01-01

    ... 12 Banks and Banking 4 2010-01-01 2010-01-01 false Truth in Lending Act-Relief from reimbursement... PRACTICE FILING PROCEDURES Other Filings § 303.248 Truth in Lending Act—Relief from reimbursement. (a) Scope. This section applies to requests for relief from reimbursement pursuant to the Truth in Lending...

  5. 46 CFR 153.371 - Minimum relief valve setting for refrigerated cargo tanks.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Minimum relief valve setting for refrigerated cargo... Design and Equipment Cargo Venting Systems § 153.371 Minimum relief valve setting for refrigerated cargo tanks. The relief valve setting for a containment system that carries a refrigerated cargo must at least...

  6. 78 FR 19357 - Allocation of Public Transportation Emergency Relief Funds in Response to Hurricane Sandy

    Science.gov (United States)

    2013-03-29

    ... Federal Transit Administration Allocation of Public Transportation Emergency Relief Funds in Response to...,000 under the Public Transportation Emergency Relief Program (Emergency Relief Program, Catalogue of... disaster that affects public transportation systems. The Appropriations Act provides $10.9 billion for FTA...

  7. Reward and motivation in pain and pain relief.

    Science.gov (United States)

    Navratilova, Edita; Porreca, Frank

    2014-10-01

    Pain is fundamentally unpleasant, a feature that protects the organism by promoting motivation and learning. Relief of aversive states, including pain, is rewarding. The aversiveness of pain, as well as the reward from relief of pain, is encoded by brain reward/motivational mesocorticolimbic circuitry. In this Review, we describe current knowledge of the impact of acute and chronic pain on reward/motivation circuits gained from preclinical models and from human neuroimaging. We highlight emerging clinical evidence suggesting that anatomical and functional changes in these circuits contribute to the transition from acute to chronic pain. We propose that assessing activity in these conserved circuits can offer new outcome measures for preclinical evaluation of analgesic efficacy to improve translation and speed drug discovery. We further suggest that targeting reward/motivation circuits may provide a path for normalizing the consequences of chronic pain to the brain, surpassing symptomatic management to promote recovery from chronic pain.

  8. Knowledge and power: a critique of an international relief operation.

    Science.gov (United States)

    Hendrie, B

    1997-03-01

    Exploring an alternative way to approach famine relief interventions, this paper draws on the work of French philosopher Michel Foucault and David Keen's recent work on south-west Sudan. It suggests that different discourses on 'famine' can lead to the dominance of certain kinds of institutional practices, and the prioritisation of special kinds of knowledge, at the expense of other modes of understanding and action. Using the case of the relief operation to Tigrayan refugees in eastern Sudan in 1984/5, the paper examines the specific ways in which 'power' was elaborated in the midst of the operation, and the manner in which institutional practices-designed to save as many lives as possible-influenced the reaction of international agencies to the spontaneous repatriation of the Tigrayans back to Ethiopia.

  9. Study of pressing machine pressure relief characteristics based on AMESim

    Science.gov (United States)

    Wang, Chuanli; Zhang, Hui; Yu, Caofeng; Wu, Xiaolei

    2016-01-01

    When a working cylinder of the pressing machine working cylinder was stuck and underwent retracted conversion, pressure shock was high in working cylinder cavity and flow pulsation was distinct in the pipeline due to the high working pressure and frequent retracted transformation of the working cylinder, which not only shortened the service life of the pressing machine, but also exerted serious impacts on the machining precision and quality, especially after the pressing machine applied loads and high-pressure oil in work rod end cavity of working cylinder needed to be relieved in a short time. In order to research and analyze the better pressure relief characteristics of the two types of pressure relief circuits of the pressing machine, the paper established models, carried out simulation and analysis and then made contrastive analysis of the working cylinder rod velocity, rod acceleration and port pressure pulsation according to the simulation results.

  10. Epidural morphine for postoperative pain relief in children

    DEFF Research Database (Denmark)

    Henneberg, S W; Hole, P; Haas, Inge Madsen De

    1993-01-01

    the investigation. We observed a change in the sleeping pattern with an increased number of sleep-induced myoclonia during the administration of epidural morphine. In conclusion, the use of epidural morphine in children for postoperative pain relief is very efficient. The minimal effective dose has not been...... for postoperative pain relief after major abdominal surgery. The age distribution was from newborn to 13 years, with a median age of 12 months. It was estimated that 94% of the patients had good analgesia for the first 24 postoperative hours and no other opioids were given. The side effects were few, but one case...... established as yet, but 50 micrograms/kg every 8 h, supplemented with small doses of bupivacaine, provides excellent analgesia in the immediate postoperative period after major abdominal surgery. The side effects are few, but the risk of respiratory depression is always present and observation...

  11. The Pressure Relief System Design for Industrial Reactors

    Directory of Open Access Journals (Sweden)

    Iztok Hace

    2013-01-01

    Full Text Available A quick and simple approach for reactor—emergency relief system design—for runaway chemical reactions is presented. A cookbook for system sizing with all main characteristic dimensions and parameters is shown on one realistic example from process industry. System design was done based on existing theories, standards, and correlations obtained from the literature, which were implemented for presented case. A simple and effective method for emergency relief system is shown, which may serve as an example for similar systems design. Obtained results may contribute to better understanding of blow down system frequently used in industrial plants, for increasing safety, decreasing explosion damage, and alleviating the ecological problems together with environmental pollution in case of industrial accidents.

  12. Cultural history as polyphonic history

    Directory of Open Access Journals (Sweden)

    Burke, Peter

    2010-06-01

    Full Text Available This texts offers a reflection on the origins and actual development of the field of cultural history through a comparison with the term that has served as title for this seminar: “polyphonic history”. The author provides an overview of the themes that have structured the seminar (the history of representations, the history of the body and the cultural history of science with the aim of making explicit and clarifying this plurality of voices in the field of history as well as its pervasiveness in other research areas.

    En este texto se ofrece una reflexión sobre el origen y actual desarrollo del campo de la historia cultural a través de una comparación con el término que ha dado título a este seminario: “historia polifónica”. El autor propone un recorrido por las áreas temáticas que han conformado la estructura del seminario (la historia de las representaciones, la historia del cuerpo y la historia cultural de la ciencia con el objeto de explicitar y explicar esta pluralidad de voces en el campo de la historia, así como su repercusión en otras áreas del conocimiento.

  13. Trends in intraoperative pain relief in anesthesized Nigerian ...

    African Journals Online (AJOL)

    Keywords: Intraoperative period, pain relief, trends. Arrière-plan: De nouveaux médicaments et nouvelles modalités pour soulager la douleur peropératoire est la tendance actuelle dans la gestion de la douleur. L'étude vise à examiner la tendance actuelle dans le soulagement de la douleur peropératoire chez les patients ...

  14. Challenges and Opportunities for Humanitarian Relief in Afghanistan

    Science.gov (United States)

    2002-06-15

    vaccine [5, 18]. An estimated 10% of children are acutely malnourished and 50% are chronically malnourished [5, 18]. THE CURRENT HUMANITARIAN... malnourished children and partic- ularly those with vitamin A deficiency. Malaria. Malaria is endemic in the country below 1500 m of elevation...typically refugees and IDPs, women, children, the elderly , single women as heads of households, and unaccom- Humanitarian Relief in Afghanistan • CID

  15. Mechanisms of pain relief by vibration and movement.

    OpenAIRE

    Kakigi, R; Shibasaki, H

    1992-01-01

    Mechanisms of pain relief induced by vibration and movement were investigated. A CO2 laser beam, which is useful for pure nociceptive stimulation, was used for recording pain-related somatosensory evoked potentials (pain SEPs) and for measuring pain threshold and reaction time (RT). Concurrently applied vibratory stimuli to and active movements of the fingers significantly reduced and prolonged pain SEPs, increased pain threshold, and prolonged RT, indicating that an increase in the inhibitor...

  16. Foreign Humanitarian Assistance/Disaster Relief Operations Planning

    Science.gov (United States)

    2006-05-15

    water pillow tanks (PWPTs) 6. Reverse osmosis water purification units (ROWPUs), pumps (for removal of contaminated well water) 7. Other needed...elimination of on-scene health hazards along with SAR and emergent surgical services may be the highest priority. This type of support is generally...for relief workers? 5. What role did the embarked Navy fleet surgical team (FST) perform? Who tasked them? Personnel 1. Was there a specialized

  17. Parents' knowledge, attitudes, use of pain relief methods and satisfaction related to their children's postoperative pain management: a descriptive correlational study.

    Science.gov (United States)

    Chng, Hui Yi; He, Hong-Gu; Chan, Sally Wai-Chi; Liam, Joanne Li Wee; Zhu, Lixia; Cheng, Karis Kin Fong

    2015-06-01

    To examine parents' knowledge about and attitudes towards pain management, use of pain relief strategies and satisfaction with their children's postoperative pain management, as well as the relationships among these variables. Children's postoperative pain is inadequately managed worldwide. Despite increasing emphasis on parental involvement in children's postoperative pain management, few studies have examined parents' management of their child's postoperative pain in Singapore. A descriptive correlational study. A convenience sample of 60 parents having 6- to 14-year-old children undergoing inpatient elective surgery in a public hospital in Singapore was recruited. Data were collected one day after each child's surgery using the Pain Management Knowledge and Attitudes questionnaire and the Parents' Use of Pain Relief Strategies questionnaire. Descriptive statistics, Mann-Whitney U tests, Kruskal-Wallis tests and Spearman's rank correlation coefficient were used for data analyses. Parents displayed moderate levels of knowledge, attitudes and use of pain relief methods in relation to their children's postoperative pain and pain management. They were generally satisfied with the management of their child's postoperative pain. There was significant difference in Parents' Use of Pain Relief Strategies scores between parents with and without previous experience of caring for their hospitalised child. Statistically significant positive correlations were found between parents' knowledge and attitude, knowledge and satisfaction, attitude and satisfaction, knowledge and pain relief strategies, as well as attitude and pain relief strategies. This study indicates the need to provide parents with more information regarding their children's postoperative pain management. Future studies are needed to develop educational interventions for parents to improve their knowledge and attitudes, which will eventually improve their use of pain relief strategies for their children. Health

  18. Potted history

    NARCIS (Netherlands)

    Groot, N.; Van Dijk, T.

    2010-01-01

    The Jordan Valley was once populated by a people, now almost forgotten by historians, with whom the pharaoh of Egypt sought favour. That is the conclusion reached by Niels Groot, the first researcher to take a PhD at the Delft-Leiden Centre for Archaeology, Art History and Science.

  19. LCA History

    DEFF Research Database (Denmark)

    Bjørn, Anders; Owsianiak, Mikołaj; Molin, Christine

    2017-01-01

    The idea of LCA was conceived in the 1960s when environmental degradation and in particular the limited access to resources started becoming a concern. This chapter gives a brief summary of the history of LCA since then with a focus on the fields of methodological development, application...

  20. Epidural morphine for postoperative pain relief in children

    DEFF Research Database (Denmark)

    Henneberg, S W; Hole, P; Haas, Inge Madsen De

    1993-01-01

    Epidural morphine for postoperative pain relief is in general use, and has proved to be very efficient in adults. The epidural technique and the use of epidural morphine are much less frequent in children. For 2 years we have prospectively followed 76 children who had epidural morphine for postop......Epidural morphine for postoperative pain relief is in general use, and has proved to be very efficient in adults. The epidural technique and the use of epidural morphine are much less frequent in children. For 2 years we have prospectively followed 76 children who had epidural morphine...... for postoperative pain relief after major abdominal surgery. The age distribution was from newborn to 13 years, with a median age of 12 months. It was estimated that 94% of the patients had good analgesia for the first 24 postoperative hours and no other opioids were given. The side effects were few, but one case...... of respiratory depression was seen and 20% of the children had pruritus. There were four dural punctures and three catheters slipped out accidentally, but otherwise the treatment was continued as long as it was considered necessary (1-11 days). The use of postoperative ventilatory support decreased during...

  1. Neural correlates of mindfulness meditation-related anxiety relief

    Science.gov (United States)

    Martucci, Katherine T.; Kraft, Robert A.; McHaffie, John G.; Coghill, Robert C.

    2014-01-01

    Anxiety is the cognitive state related to the inability to control emotional responses to perceived threats. Anxiety is inversely related to brain activity associated with the cognitive regulation of emotions. Mindfulness meditation has been found to regulate anxiety. However, the brain mechanisms involved in meditation-related anxiety relief are largely unknown. We employed pulsed arterial spin labeling MRI to compare the effects of distraction in the form of attending to the breath (ATB; before meditation training) to mindfulness meditation (after meditation training) on state anxiety across the same subjects. Fifteen healthy subjects, with no prior meditation experience, participated in 4 d of mindfulness meditation training. ATB did not reduce state anxiety, but state anxiety was significantly reduced in every session that subjects meditated. Meditation-related anxiety relief was associated with activation of the anterior cingulate cortex, ventromedial prefrontal cortex and anterior insula. Meditation-related activation in these regions exhibited a strong relationship to anxiety relief when compared to ATB. During meditation, those who exhibited greater default-related activity (i.e. posterior cingulate cortex) reported greater anxiety, possibly reflecting an inability to control self-referential thoughts. These findings provide evidence that mindfulness meditation attenuates anxiety through mechanisms involved in the regulation of self-referential thought processes. PMID:23615765

  2. [Postoperative pain relief by patient controlled analgesia using intravenous pentazocine].

    Science.gov (United States)

    Sugai, N; Yajima, C; Chinzei, M; Nagase, M; Nishitateno, K

    1995-02-01

    Patient controlled analgesia (PCA) by intravenous pentazocine was performed to determine its efficacy and the dose required for the pain relief after gynecological or obstetric operations. After obtaining informed consent, studies were performed on 28 female patients (ASA I, II: Mean age 38.1 years: Mean weight, 53.8 kg) who had received gynecological or obstetric operations with lower abdominal incision. Anesthesia given was nitrous oxide and isoflurane combined with epidural anesthesia with 1% mepivacaine used only during the operation. Six patients had cesarian section under spinal anesthesia. No patients received opioid during anesthesia. PCA was performed with a Graseby PCA pump. Lockout time was 8 minutes and the bolus dose was 3 mg. In all the patients, satisfactory pain relief was obtained and no other analgesic was necessary. Mean initial dose was 169.4 micrograms.kg-1 and the mean doses used for following each 6 hours until 24 hours were 409.7, 368.6, 279.3 and 211.1 micrograms.kg-1 respectively. Evaluation of PCA by the patients after the procedure showed excellent (13 patients) good (12) and passable (3) analgesia. No significant complication was observed except temporary nausea in two patients. Satisfactory postoperative pain relief could be obtained by relatively small doses of pentazocine and adverse reactions related especially to sigma receptor could be avoided.

  3. Preoccupation in an early-romantic relationship predicts experimental pain relief.

    Science.gov (United States)

    Nilakantan, Aneesha; Younger, Jarred; Aron, Arthur; Mackey, Sean

    2014-06-01

    Individuals involved in the early stages of a passionate romantic relationship can be consumed by the experience and report emotional dependence and constant focus on their romantic partner. A few studies have shown that viewing pictures of a romantic partner can significantly reduce experimental pain. The strength of the effect, however, varies substantially between individuals. To study why some individuals experience significant pain reduction when looking at a picture of their partner, we examined partner preoccupation. We hypothesized that a greater degree of preoccupation in the early stages of a romantic relationship would be associated with greater analgesia during a pain induction task. Participants were shown pictures of their romantic partner or an equally attractive and familiar acquaintance while exposed to low, moderate, or high levels of thermal pain. Participants were also asked to rate how much time they spent thinking about their romantic partner during an average day. Degree of preoccupation was defined as the percentage of time participants spent thinking about their partner on an average day. In two separate experiments, viewing pictures of a romantic partner produced an analgesic effect. The degree of pain relief was positively correlated with partner preoccupation. The results suggest that preoccupation with a romantic partner during early stage romantic love is a predictor of pain relief when viewing pictures of the beloved. Wiley Periodicals, Inc.

  4. Business History as Cultural History

    DEFF Research Database (Denmark)

    Lunde Jørgensen, Ida

    The paper engages with the larger question of how cultural heritage becomes taken for granted and offers a complimentary view to the anthropological ʻCopenhagen School’ of business history, one that draws attention to the way corporate wealth directly and indirectly influences the culture available...

  5. Evaluation of an International Disaster Relief Team After Participation in an ASEAN Regional Forum Disaster Relief Exercise.

    Science.gov (United States)

    Lee, Jeong Il; Lee, Kang Hyun; Kim, Oh Hyun; Cha, Yong Sung; Hwang, Sung Oh; Kim, Hyun; Cha, Kyung Chul

    2016-10-01

    Devastating disasters around the world directly contribute to significant increases in human mortality and economic costs. The objective of this study was to examine the current state of the Korea Disaster Relief Team that participated in an international training module. The whole training period was videotaped in order to observe and evaluate the respondents. The survey was carried out after completion of the 3-day training, and the scores were reported by use of a 5-point Likert scale. A total of 43 respondents were interviewed for the survey, and the results showed that the overall preparedness score for international disasters was 3.4±1.6 (mean±SD). The awareness of the Incident Command System for international disasters was shown to be low (3.5±1.1). Higher scores were given to personnel who took on leadership roles in the team and who answered "I knew my duty" (4.4±0.6) in the survey, as well as to the training participants who answered "I clearly knew my duty" (4.5±0.5). The preparedness level of the Korea Disaster Relief Team was shown to be insufficient, whereas understanding of the roles of leaders and training participants in the rescue team was found to be high. It is assumed that the preparedness level for disaster relief must be improved through continued training. (Disaster Med Public Health Preparedness. 2016;1-5).

  6. Pressure-relief and methane production performance of pressure relief gas extraction technology in the longwall mining

    Science.gov (United States)

    Zhang, Cun; Tu, Shihao; Chen, Min; Zhang, Lei

    2017-02-01

    Pressure relief gas extraction technology (PRGET) has been successfully implemented at many locations as a coal mine methane exploitation and outburst prevention technology. Comprehensive PRGET including gob gas venthole (GGV), crossing seam drilling hole (CSDH), large diameter horizontal long drilling hole (LDHLDH) and buried pipe for extraction (BPE) have been used to extract abundant pressure-relief methane (PRM) during protective coal seam mining; these techniques mitigated dangers associated with coal and gas outbursts in 13-1 coal seam mining in the Huainan coalfield. These extraction technologies can ensure safe protective seam mining and effectively extract coal and gas. This article analyses PRGET production performance and verifies it with the field measurement. The results showed that PRGET drilling to extract PRM from the protected coal seam significantly reduced methane emissions from a longwall ventilation system and produced highly efficient extraction. Material balance analyses indicated a significant decrease in gas content and pressure in the protected coal seam, from 8.78 m3 t-1 and 4.2 MPa to 2.34 m3 t-1 and 0.285 MPa, respectively. The field measurement results of the residual gas content in protected coal seam (13-1 coal seam) indicated the reliability of the material balance analyses and the pressure relief range of PRGET in the protected coal seam is obtained.

  7. Positioning consumption

    DEFF Research Database (Denmark)

    Halkier, Bente; Keller, Margit

    2014-01-01

    positionings emerges based on empirical examples of research in parent–children consumption. Positionings are flexible discursive fixations of the relationship between the performances of the practitioner, other practitioners, media discourse and consumption activities. The basic positioning types...

  8. Sommerferiens historie

    DEFF Research Database (Denmark)

    Lützen, Karin

    2011-01-01

    Summer holiday is a pleasure which did not become available to many people until the 20th Century. The article describes the early mountain rambles of the bourgeoisie and their holidays in seaside boarding houses. Outdoor pursuits and stays in boarding houses at bathing resorts also became...... pattern. Finally, the history of the special holiday camps is told, which were established by American Jews because they were excluded from many hotels....

  9. Business History

    DEFF Research Database (Denmark)

    Hansen, Per H.

    2012-01-01

    This article argues that a cultural and narrative perspective can enrich the business history field, encourage new and different questions and answers, and provide new ways of thinking about methods and empirical material. It discusses what culture is and how it relates to narratives. Taking...... a cultural and narrative approach may affect questions, sources, and methodologies, as well as the status of our results. Finally, a narrative approach may contribute to our historical understanding of entrepreneurship and globalization....

  10. Analytical history

    OpenAIRE

    Bertrand M. Roehner

    2017-01-01

    The purpose of this note is to explain what is "analytical history", a modular and testable analysis of historical events introduced in a book published in 2002 (Roehner and Syme 2002). Broadly speaking, it is a comparative methodology for the analysis of historical events. Comparison is the keystone and hallmark of science. For instance, the extrasolar planets are crucial for understanding our own solar system. Until their discovery, astronomers could observe only one instance. Single instan...

  11. Development of dependence following treatment with opioid analgesics for pain relief: a systematic review.

    Science.gov (United States)

    Minozzi, Silvia; Amato, Laura; Davoli, Marina

    2013-04-01

    To assess the incidence or prevalence of opioid dependence syndrome in adults (with and without previous history of substance abuse) following treatment with opioid analgesics for pain relief. Medline, Embase, CINHAL and the Cochrane Library were searched up to January 2011. Systematic reviews and primary studies were included if they reported data about incidence or prevalence of opioid dependence syndrome (as defined by DSM-IV or ICD-10) in patients receiving strong opioids (or opioid-type analgesics) for treatment of acute or chronic pain due to any physical condition. The data were abstracted, and the methodological quality was assessed using validated checklists. Data were extracted from 17 studies involving a total of 88 235 participants. The studies included three systematic reviews, one randomized controlled trial, eight cross-sectional studies and four uncontrolled case series. Most studies included adult patients with chronic non-malignant pain; two also included patients with cancer pain; only one included patients with a previous history of dependence. Incidence ranged from 0 to 24% (median 0.5%); prevalence ranged from 0 to 31% (median 4.5%). The available evidence suggests that opioid analgesics for chronic pain conditions are not associated with a major risk for developing dependence. © 2012 The Authors, Addiction © 2012 Society for the Study of Addiction.

  12. Glaucoma history and risk factors

    Directory of Open Access Journals (Sweden)

    Charles W. McMonnies

    2017-04-01

    Full Text Available Apart from the risk of developing glaucoma there is also the risk that it is not detected and irreversible loss of vision ensues. Some studies of methods of glaucoma diagnosis have examined the results of instrument-based examinations with great if not complete reliance on objective findings in arriving at a diagnosis. The very valuable advances in glaucoma detection instrument technologies, and apparent increasing dependence on them, may have led to reduced consideration of information available from a patient history in those studies. Dependence on objective evidence of glaucomatous pathology may reduce the possibility of detecting glaucoma suspects or patients at risk for becoming glaucoma suspects. A valid positive family history of glaucoma is very valuable information. However, negative family histories can often be unreliable due to large numbers of glaucoma cases being undiagnosed. No evidence of family history is appropriate rather than no family history. In addition the unreliability of a negative family history is increased when patients with glaucoma fail to inform their family members. A finding of no family history can only be stated as no known family history. In examining the potential diagnostic contribution from a patient history, this review considers, age, frailty, race, type and degree of refractive error, systemic hyper- and hypotension, vasospasm, migraine, pigmentary dispersion syndrome, pseudoexfoliation syndrome, obstructive sleep apnea syndrome, diabetes, medication interactions and side effects, the degree of exposure to intraocular and intracranial pressure elevations and fluctuations, smoking, and symptoms in addition to genetics and family history of the disease.

  13. Ildens historier

    DEFF Research Database (Denmark)

    Lassen, Henrik Roesgaard

    In December 2012 a manuscript entitled "Tællelyset" ['The Tallow Candle'] was discovered in an archive. The story was subsequently presented to the world as Hans Christian Andersen's first fairy tale and rather bombastically celebrated as such. In this book it is demonstrated that the text cannot...... have been written by Andersen. In several chapters the curiously forgotten history of fire-lighting technology is outlined, and it is demonstrated that "Tællelyset" is written by a person with a modern perspective on how to light a candle - among other things. The central argument in the book springs...

  14. On the applicability of analysis of internal and external factors: A case study of Imam Khomeini Relief Foundation in Ardabil

    Directory of Open Access Journals (Sweden)

    Houshang Sharifi Namin

    2015-03-01

    Full Text Available Recognition and prioritization of environmental factors affecting the performance of organizations is one of the most important steps in developing long-term plans and organizational strategies. The present study investigates the current status of head office of Ardabil Imam Khomeini Relief Foundation through analyzing internal and external environmental factors. To this end, a sequential mixed method design was used for collecting, analyzing, and interpreting research question. Sixty-eight employees participated in the study. This study was carried out through a survey method using research-made questionnaire and interview as the main instruments. The results demonstrated that Ardabil Imam Khomeini Relief Foundation had some strengths and weaknesses regarding internal and external environmental factors and this organization appeared to have relatively good position considering organization’s internal factors which were supposed to affect it. The findings of the study showed that Ardabil Imam Khomeini Relief Foundation can overcome and neutralize some of its organizational threats and weaknesses using the current organizational opportunities and strengths and applying strategic planning.

  15. When Certainty and Legality Collide: The Efficacy of Interdictory Relief for the Cessation of Building Works pending Review Proceedings

    Directory of Open Access Journals (Sweden)

    R Summers

    2010-12-01

    Full Text Available Effective legal redress against unlawful building works or construction activities can be an elusive target. Given the desirability of legal certainty attached to administrative decisions in terms of which building plans are approved, should the practical implications of this principle trump the equally important principle of legality? This article examines the – at times – competing imperatives of certainty and legality in the context of several recent decisions of the Western Cape High Court that related to applications for interdictory relief for the cessation of allegedly unlawful building works. The practical difficulties for an applicant in these circumstances are particularly acute when the relief is sought pending the final determination of an application for judicial review of the impugned administrative decision to grant building plan approval. The article highlights the approach of the Western Cape High Court in three cases to invoking considerations of legality in circumstances where building works had reached an advanced stage and the respondent had effectively achieved what has been described as an "impregnable position". The principal difficulty for an applicant lies in the fact that where interdictory relief is sought against building works that have reached an advanced stage, this potentially renders an eventual successful review application brutum fulmen.

  16. Energy Regeneration Hydraulic System via a Relief Valve with Energy Regeneration Unit

    Directory of Open Access Journals (Sweden)

    Tianliang Lin

    2017-06-01

    Full Text Available Relief valves are widely used in industrial machinery. Due to the outlet of the relief valve being connected to the tank, the pressure drop of the relief valve is frequently equal to the inlet pressure. Accordingly, the energy loss of the relief valve is very high in some cases and this will worsen with an increase in the rated pressure of the hydraulic system. In order to overcome the disadvantage of overflow energy loss in a relief valve, a hydraulic energy regeneration unit (HERU is connected to the outlet of the relief valve to decrease the pressure drop between the inlet and outlet of the relief valve. The overflow loss, which is characterized by the pressure drop, can be reduced accordingly. The approach is to convert the overflow energy loss in hydraulic form and allow for release when needed. The configuration and working principle of the relief valve with HERU is introduced in this present study. The mathematical model is established to obtain the factors influencing the stability of the relief valve. The working pressure of the hydraulic accumulator (HA is explored. Furthermore, the control process of the operating state of the HA is scheduled to decide whether to regenerate the energy via the HERU. The software AMESim is utilized to analyze the performance and characteristics of the relief valve with HERU. Following this, the test rig is built and used to verify the effectiveness of the proposed relief valve with HERU. The experimental results show that the relief valve with the HERU connected to its outlet can still achieve better pressure-regulating characteristics. The energy regeneration efficiency saved by the HA is up to 83.6%, with a higher pre-charge pressure of the HA. This indicates that the proposed structure of the relief valve with HERU can achieve a better performance and higher regeneration efficiency.

  17. History of Bioterrorism: Botulism

    Medline Plus

    Full Text Available ... Hygiene Clean Hands Save Lives Resources for Emergency Health Professionals Clinician Outreach and Communication Activity (COCA) Crisis & ... Relief Volunteers Emergency Planners and Responders Emergency Responder Health Monitoring & Surveillance (ERHMS) MedCon Epi-X Public Health ...

  18. History of Bioterrorism: Botulism

    Medline Plus

    Full Text Available ... Clinician Outreach and Communication Activity (COCA) Crisis & Emergency Risk Communication (CERC) Disaster Relief Volunteers Emergency Planners and ... Resources Response Worker Health and Safety Reaching At-Risk Populations Health Alert Network (HAN) Laboratory Information Social ...

  19. Adults with an epilepsy history fare significantly worse on positive mental and physical health than adults with other common chronic conditions-Estimates from the 2010 National Health Interview Survey and Patient Reported Outcome Measurement System (PROMIS) Global Health Scale.

    Science.gov (United States)

    Kobau, Rosemarie; Cui, Wanjun; Zack, Matthew M

    2017-07-01

    Healthy People 2020, a national health promotion initiative, calls for increasing the proportion of U.S. adults who self-report good or better health. The Patient-Reported Outcomes Measurement Information System (PROMIS) Global Health Scale (GHS) was identified as a reliable and valid set of items of self-reported physical and mental health to monitor these two domains across the decade. The purpose of this study was to examine the percentage of adults with an epilepsy history who met the Healthy People 2020 target for self-reported good or better health and to compare these percentages to adults with history of other common chronic conditions. Using the 2010 National Health Interview Survey, we compared and estimated the age-standardized prevalence of reporting good or better physical and mental health among adults with five selected chronic conditions including epilepsy, diabetes, heart disease, cancer, and hypertension. We examined response patterns for physical and mental health scale among adults with these five conditions. The percentages of adults with epilepsy who reported good or better physical health (52%) or mental health (54%) were significantly below the Healthy People 2020 target estimate of 80% for both outcomes. Significantly smaller percentages of adults with an epilepsy history reported good or better physical health than adults with heart disease, cancer, or hypertension. Significantly smaller percentages of adults with an epilepsy history reported good or better mental health than adults with all other four conditions. Health and social service providers can implement and enhance existing evidence-based clinical interventions and public health programs and strategies shown to improve outcomes in epilepsy. These estimates can be used to assess improvements in the Healthy People 2020 Health-Related Quality of Life and Well-Being Objective throughout the decade. Published by Elsevier Inc.

  20. Functional relationships between denudation and hillslope form and relief

    Science.gov (United States)

    Roering, Joshua J.; Perron, J. Taylor; Kirchner, James W.

    2007-12-01

    Functional relationships between landscape morphology and denudation rate allow for the estimation of sediment fluxes using readily available topographic information. Empirical studies of topography-erosion linkages typically employ data with diverse temporal and broad spatial scales, such that heterogeneity in properties and processes may cloud fundamental process-scale feedbacks between tectonics, climate, and landscape development. Here, we use a previously proposed nonlinear model for sediment transport on hillslopes to formulate 1-D dimensionless functions for hillslope morphology as well as a generalized expression relating steady-state hillslope relief to erosion rate, hillslope transport parameters, and hillslope length. For study sites in the Oregon Coast Range and Gabilan Mesa, CA, model predictions of local relief and average hillslope gradient compare well with values derived from high-resolution topographic data acquired via airborne laser altimetry. Our formulation yields a nondimensional number describing the extent to which the nonlinearity in our gradient-flux model affects slope morphology and landscape response to tectonic and climatic forcing. These results should be useful for inferring rates of hillslope denudation and sediment flux from topography, or for coarse-scale landscape evolution simulations, in that first-order hillslope properties can be calculated without explicit modeling of individual hillslopes.

  1. Portable exothermal energy source for disaster relief operations

    Science.gov (United States)

    Zimbeck, Walter R.

    1994-03-01

    This manuscript describes an example of transfer technology from a U.S. Government Laboratory to commercial products that meet national needs in the public safety and health care sectors. Funded by the U.S. Army, the first project is the development of a portable, non-powered food warming device for serving meals to soldiers in the field. The second project is being funded by the National Institutes of Health for development of a heat therapy device for relief from rheumatoid arthritis discomfort in the hands and other affected joints. Both of these heating devices are portable, reusable heat pack products that can be regenerated in a microwave oven or in boiling water. The knowledge developed during these two projects will be applied to many other related products. Applications in support of natural and manmade disaster relief include food warming heat packs for food service to victims and rescue workers in sustained black-out conditions, and heat pack warming blankets for emergency medical situations in which patients are in traumatic shock and the onset of hypothermia is imminent.

  2. Anthropogenic transformation of the relief of the Aegean Islands

    Directory of Open Access Journals (Sweden)

    Tsermegas Irena

    2015-06-01

    Full Text Available The purpose of this article is to present the role of human impact in the forming and transformation of the relief of the Aegean Islands. The most significant changes (with a displacement of more than 10 bln m3 of rock material are related to the creation of road infrastructure and the construction of agricultural terraces. In order to create stone buildings, 20 mln m3 of rock material was used; for the purposes of air transport a surface area of nearly 2.5 km2 was levelled; many kilometres of artificial shorelines were created and at least 4.5 mln m3 of material was displaced for the purposes of the construction of artificial reservoirs of a total capacity of more than 25 mln m3. A huge amount of material was removed as a result of mining activities. The indirect impact of economic activities on the relief of the discussed area includes mainly slope, fluvial and coastal processes.

  3. Putting Qumran, Jesus and his movement into relief

    Directory of Open Access Journals (Sweden)

    Eben Scheffler

    2016-11-01

    Full Text Available After referring briefly to the fantasies regarding the origins of Christianity as elicited by the discovery of the Dead Sea Scrolls in 1947 (Dupont-Sommer, Allegro, Thiering, the purpose of the contribution is to put the Jesus movement into relief in the context of first-century Judaism. The identity of the Qumranites is argued to be Essene scribes. The identity, ideology and practices of the latter are compared with those of Jesus of Nazareth and the movement he elicited using the following rubrics: (1 Jesus, the teacher of righteousness and the powers that be; (2 asceticism versus itinerary charismaticism; (3 caring versus lack of caring for the sick, poor and marginalised; (4 elitist priests and scribes versus lower-class peasants; (5 the interpretation of the law; (6 religious and daily practices (baptism, ritual meal, sacrifice, prayer, community of possessions, scribal activity; (7 religious views or ideology (kingdom of God, the new covenant, light and darkness, politics. The result is a picture of Jesus (with his focus on human suffering in sharp relief versus Qumran and facets of the early church.

  4. Cognitive orientation as predictor of pain relief following acupuncture.

    Science.gov (United States)

    Kreitler, S; Kreitler, H; Carasso, R

    1987-03-01

    The study investigated the role of beliefs concerning pain relief after treatment. Following the cognitive orientation theory, we hypothesized that beliefs concerning goals, norms, oneself, and general beliefs would predict the extent of improvement following acupuncture. Subjects were 30 Israeli chronic-pain patients (22 women, 8 men; mean age 41.6 years). They were administered a questionnaire assessing the 4 belief types, and control measures assessing personality traits, demographic variables, and pain characteristics. All underwent 4-6 acupuncture sessions. Improvement was determined by patient and physician ratings, and an index based on medication, subjective evaluations, and duration of resting. There were two follow-ups. Three improvement groups were defined: none (n = 8), slight (n = 12), and high (n = 10). These groups did not differ on any of the variables tested except the 4 belief types. A discriminant analysis with belief types as predictors enabled correct classification of the patients in 83% of the cases. A stepwise regression analysis showed that beliefs accounted for 85% of the variance. Discussion focuses on the nature of pain relief and the role of beliefs in disease.

  5. Humanitarian assistance and disaster relief: changing the face of defense.

    Science.gov (United States)

    Laraby, Patrick R; Bourdeaux, Margaret; Casscells, S Ward; Smith, David J; Lawry, Lynn

    2009-01-01

    The US Department of Defense (DOD) is evolving to meet new security challenges in the twenty-first century. Today's challenges result from growing political, environmental, and economic instability in important areas of the globe that threaten national and global security. Immediate outreach to foreign nations in times of violent instability or natural disaster fosters security and stability both for the affected country and for the United States. Foreign humanitarian assistance (FHA) is a rapidly evolving military mission that addresses conflict prevention, conflict, postconflict, and natural disasters. With DOD's extensive global medical resources, it is often uniquely qualified to execute a critical role in relief and/or public health efforts. When and how the American military will act in FHA and disaster relief is a still evolving doctrine with three issues deserving particular attention: aligning operations with host government leadership, preserving humanitarian space, and tailoring the US military's unique resources to the specific political and medical situation at hand. The DOD's response to a large-scale earthquake in Peru suggests useful approaches to these three issues, provides a template for future FHA mission, and points to strategic decisions and operational capabilities that need further development to establish the FHA mission firmly within DOD's repertoire of security engagement activities.

  6. Corruption in cyclone preparedness and relief efforts in coastal Bangladesh

    DEFF Research Database (Denmark)

    Mahmud, Tanvir; Prowse, Martin

    2012-01-01

    This article seeks to draw possible lessons for adaptation programmes in Bangladesh by examining whether cyclone preparedness and relief interventions are subject to corrupt practices. Based on a random sample survey of 278 households, three focus-group discussions and seven key-informant intervi......This article seeks to draw possible lessons for adaptation programmes in Bangladesh by examining whether cyclone preparedness and relief interventions are subject to corrupt practices. Based on a random sample survey of 278 households, three focus-group discussions and seven key......-informant interviews, the article investigates the nature and extent of corruption in pre- and post-disaster interventions in Khulna before and after Cyclone Aila in May 2009. Ninety nine percent of households reported losses from corrupt practices. Post-disaster interventions (such as food aid and public works...... schemes) suffered from greater levels, and worse types, of corruption than pre-disaster interventions (such as cyclone warning systems and disaster-preparedness training). Using an asset index created using principal component analysis, the article assesses how corruption affected wealth quartiles. Ultra...

  7. Position Information

    Data.gov (United States)

    Social Security Administration — The Position Information Data Asset provides the ability to search for active SSA position descriptions using various search criteria. An individual may search by PD...

  8. Environmental history

    DEFF Research Database (Denmark)

    Pawson, Eric; Christensen, Andreas Aagaard

    2017-01-01

    risks”. These are exposed by environmental history’s focus on long-run analysis and its narrative form that identifies the stories that we tell ourselves about nature. How a better understanding of past environmental transformations helps to analyse society and agency, and what this can mean......Environmental history is an interdisciplinary pursuit that has developed as a form of conscience to counter an increasingly powerful, forward-looking liberal theory of the environment. It deals with the relations between environmental ideas and materialities, from the work of the geographers George...... Perkins Marsh, Carl Sauer, and Clarence Glacken, to more recent global-scale assessments of the impact of the “great acceleration” since 1950. Today’s “runaway world” paradoxically embraces risk management in an attempt to determine its own future whilst generating a whole new category of “manufactured...

  9. Positive Psychology

    Science.gov (United States)

    Peterson, Christopher

    2009-01-01

    Positive psychology is a deliberate correction to the focus of psychology on problems. Positive psychology does not deny the difficulties that people may experience but does suggest that sole attention to disorder leads to an incomplete view of the human condition. Positive psychologists concern themselves with four major topics: (1) positive…

  10. Study on the Temporal and Spatial Effect of the Relief Pressure of Upper Protective Layer Mining

    Directory of Open Access Journals (Sweden)

    Li Chengcheng

    2017-01-01

    Full Text Available In order to study the law of pressure relief of upper protective layer mining. Through theoretical analysis and numerical simulation method, studied the distance on the protection layer mining floor stress field evolution and distribution, found a protective layer on the longwall mining goaf bottom coal seam inclination direction is concave, and strike plane was “O” shape of relief ball shell, the pressure relief angle in the cut or end mining line near the corner of the middle bottom is minimum, the scope of protection of coal seam pressure relief effect than on both sides of the pressure relief effect, namely the scope of protection of inclined coal seam central drainage radius than the two larger; in the trend of protected layer pressure relief protection layer mining face lag distance based on this theory, research to guide the protected layer of gas drilling drainage is very important.

  11. 38 CFR 1.893 - Establishing and converting part-time positions.

    Science.gov (United States)

    2010-07-01

    ... converting part-time positions. 1.893 Section 1.893 Pensions, Bonuses, and Veterans' Relief DEPARTMENT OF VETERANS AFFAIRS GENERAL PROVISIONS Part-Time Career Employment Program § 1.893 Establishing and converting part-time positions. Position management and other internal reviews may indicate that positions may be...

  12. Ubiquitous positioning

    CERN Document Server

    Mannings, Robin

    2008-01-01

    This groundbreaking resource offers a practical, in-depth understanding of Ubiquitous Positioning - positioning systems that identify the location and position of people, vehicles and objects in time and space in the digitized networked economy. The future and growth of ubiquitous positioning will be fueled by the convergence of many other areas of technology, from mobile telematics, Internet technology, and location systems, to sensing systems, geographic information systems, and the semantic web. This first-of-its-kind volume explores ubiquitous positioning from a convergence perspective, of

  13. Intra-articular hip injection: does pain relief correlate with radiographic severity of osteoarthritis?

    Energy Technology Data Exchange (ETDEWEB)

    Deshmukh, Ajit J.; Rodriguez, Jose A. [North Shore LIJ Lenox Hill Hospital, Department of Orthopaedic Surgery, New York, NY (United States); Panagopoulos, Georgia [North Shore LIJ Lenox Hill Hospital, Department of Research, New York, NY (United States); Alizadeh, Ahmadreza; Klein, Devon A. [North Shore LIJ Lenox Hill Hospital, Department of Radiology, New York, NY (United States)

    2011-11-15

    Intra-articular injection is being used widely for both diagnostic and therapeutic purposes in the hip. However, its efficacy is not always predictable in patients with hip osteoarthritis (OA). The purpose of this study was to determine whether the degree of radiographic severity of OA was predictive of the response to intra-articular injection of local anesthetic with corticosteroid and to determine the relationship between immediate pain relief resulting from the anesthetic and delayed pain relief resulting from corticosteroid administration. This retrospective study included 217 patients (220 injections) with diagnosis of hip OA who underwent a fluoroscopically guided therapeutic hip injection of local anesthetic and corticosteroid. Hip radiographs were scored using the Kellgren-Lawrence scale. Immediate and delayed pain relief was documented using a visual analog scale. Logistic regression analysis was performed to investigate whether age, gender or radiographic severity of OA were independent predictors of pain relief. Degree of agreement between immediate and delayed response was assessed with the kappa coefficient. Immediate pain relief was reported in 68.2% of hips and delayed relief in 71.4% of hips. A high level of agreement was observed between immediate and delayed pain relief (kappa = 0.80, p < 0.001). 94% of patients reporting immediate relief also reported relief 2 weeks later. Univariate and multivariate analysis revealed that neither gender nor age was related to immediate or delayed pain relief. Only severity of OA (based on radiographic analysis) was observed to be predictive of pain relief. Pain relief following intra-articular hip injection correlated with radiographic severity of OA. This intervention may be of therapeutic and prognostic value in patients awaiting hip arthroplasty. (orig.)

  14. Lessons from DoD Disaster Relief Efforts in the Asia-Pacific Region

    Science.gov (United States)

    2013-01-01

    Orientation & Review,” USARPAC briefing, undated; “USARPAC OSInt Support to Cyclone nargis Relief Efforts in Burma 2008,” USARPAC briefing, undated; phone...all organizations relied, to a large extent, on the staff and national partners they already had 71 “USARPAC OSINT Support to Cyclone Nargis Relief...undated. As of September 8, 2012: http://www.kadena.af.mil/shared/media/document/AFD-120426-002.pdf “USARPAC OSINT Support to Cyclone Nargis Relief

  15. Quantitative studies of the morphology of the south Poland using Relief Index (RI

    Directory of Open Access Journals (Sweden)

    Szypuła Bartłomiej

    2017-10-01

    Full Text Available The aim of this study was to introduce a new morphometric index named Relief Index (RI. RI is the ratio of the total length of the contour lines and the surface area at which they occur. This easily calculated index provides an objective quantitative measure of relief variability as an important feature in geomorphological studies. To achieve this goal, a highly detailed morphometric analysis was carried out using a high-resolution (1m×1m DEM. Twenty one sample areas in southern Poland were examined. These analyses showed RI, as a good tool for rapidly evaluating topography heterogeneity in division into relief classes. I distinguished 4 classes of the Relief Index that classify earth surface considering the variability of the relief. Results of the calculations demonstrated that there is a significant correlation between RI and the local relief and slopes, but there is no correlation between RI and planar curvatures and TWI. The relief of the sample areas were analysed using geomorphometric parameters (slopes, local relief, planar curvatures. Moreover the influence of the DEM resolution on Relief Index values was examined.

  16. Motion and Pain Relief Remain 23 Years After Manipulation Under Anesthesia for Frozen Shoulder

    National Research Council Canada - National Science Library

    Vastamäki, Heidi; Vastamäki, Martti

    2013-01-01

    Manipulation under anesthesia (MUA) as treatment for idiopathic frozen shoulder increases motion, provides pain relief, and restores function, but it is unclear whether the improvements persist long...

  17. How Absent Negativity Relates to Affect and Motivation: An Integrative Relief Model

    Directory of Open Access Journals (Sweden)

    Roland eDeutsch

    2015-03-01

    Full Text Available The present paper concerns the motivational underpinnings and behavioral correlates of the prevention or stopping of negative stimulation – a situation referred to as relief. Relief is of great theoretical and applied interest. Theoretically, it is tied to theories linking affect, emotion and motivational systems (Carver & Scheier, 1990; Gray & McNaughton, 2000; Higgins, 1997; Lang, Bradley, & Cuthbert, 1990. Importantly, these theories make different predictions regarding the association between relief and motivational systems. Moreover, relief is a prototypical antecedent of counterfactual emotions, which involve specific cognitive processes compared to factual or mere anticipatory emotions. Practically, relief may be an important motivator of addictive and phobic behaviors (Mowrer, 1951; Ostafin & Brooks, 2011, self destructive behaviors (Favazza, 1998; Franklin, Lee, Hanna, & Prinstein, 2013, and social influence (Dolinski & Nawrat, 1998. In the present paper, we will first provide a review of conflicting conceptualizations of relief. We will then present an integrative relief model (IRMO that aims at resolving existing theoretical conflicts. We then review evidence relevant to distinctive predictions regarding the moderating role of various procedural features of relief situations. We conclude that our integrated model results in a better understanding of existing evidence on the affective and motivational underpinnings of relief, but that further evidence is needed to come to a more comprehensive evaluation of the viability of IRMO.

  18. How absent negativity relates to affect and motivation: an integrative relief model

    Science.gov (United States)

    Deutsch, Roland; Smith, Kevin J. M.; Kordts-Freudinger, Robert; Reichardt, Regina

    2015-01-01

    The present paper concerns the motivational underpinnings and behavioral correlates of the prevention or stopping of negative stimulation – a situation referred to as relief. Relief is of great theoretical and applied interest. Theoretically, it is tied to theories linking affect, emotion, and motivational systems. Importantly, these theories make different predictions regarding the association between relief and motivational systems. Moreover, relief is a prototypical antecedent of counterfactual emotions, which involve specific cognitive processes compared to factual or mere anticipatory emotions. Practically, relief may be an important motivator of addictive and phobic behaviors, self destructive behaviors, and social influence. In the present paper, we will first provide a review of conflicting conceptualizations of relief. We will then present an integrative relief model (IRMO) that aims at resolving existing theoretical conflicts. We then review evidence relevant to distinctive predictions regarding the moderating role of various procedural features of relief situations. We conclude that our integrated model results in a better understanding of existing evidence on the affective and motivational underpinnings of relief, but that further evidence is needed to come to a more comprehensive evaluation of the viability of IRMO. PMID:25806008

  19. Relief and snow avalanches in the Tatra Mts.

    Science.gov (United States)

    Rączkowska, Zofia; Długosz, Michał; Rojan, Elżbieta

    2015-04-01

    Snow avalanches are among the main factors influencing the high-mountain environment of the Tatra Mts. and their denudation system in the three uppermost geoecological belts. Dirty avalanches are assumed to be an important morphogenetic factor but also relief affects spatial differentiation of snow avalanche activity. The research aims to recognize the geomorphological conditions for avalanches and assessment of the morphogenetic role of avalanches in the whole Tatra Mts. For recognition of geomorphological conditions of snow avalanches activity was made map of avalanches paths, based on maps of snow avalanches occurred in the recent past, air- photos and digital terrain model. Starting zone and transition zone were specified within each path. For each type of designated zones the morphometric analysis was made, taking in account slope aspect and inclination. The map presents more than 3700 avalanche paths. The number of avalanche paths is more than double in the High Tatras than in the Western Tatras. Morphometric features and altitudinal range of avalanche paths also differ in individual parts of the Tatras what correspond with the relief differences. Length of avalanche paths reach up to 3138 m and in average is the biggest avalanche in the Bielanske Tatra. The paths are located about 200 m higher in the High Tatras than in other parts of the massif. There is no clear relationship between exposure of the slopes and the distribution of the avalanche path, while relationship with slope inclination is distinct. Over 70% of the avalanche paths occur on slopes 26-55o. Similar patterns were found in the distribution of avalanche accumulation zones. Detailed studies of morphogenetic role of avalanches are conducted in four chosen avalanche paths located both in the Western and the High Tatras. Measuring points of erosion, transport and accumulation installed there in the autumn 2012 are checked two times a year. It was found that effects of snow avalanches on the

  20. IMPACT OF INTERFERENTIAL CURRENT ON PAIN RELIEF AMONG PATIENTS WITH ORCHIALGIA

    Directory of Open Access Journals (Sweden)

    Hany M.I. Elgohary

    2016-08-01

    Full Text Available Background: Scrotal discomfort can contribute to unusual impact on body scheme and result in behavioral alterations, as well as changes in sexual function such as delay of sexual ability that may affect both man and his companion. There are many physiotherapy modalities to reduce the intratesticular pain such as pelvic floor muscle training, hydrotherapy, ultrasound and electrotherapy. Interferential current therapy is a noninvasive therapy used to reduce acute and chronic, post-operative and post-trauma acute pain. It provides a safe and effective alternative to pharmacological approaches to pain control. The purpose of the current study was to investigate the efficacy of interferential current in alleviating testicular pain. Methods: Randomized clinical study conducted on 50 participants. They divided into two equal groups: Group A received interferential current with two electrodes placed over the upper medial aspects of thighs and the other two electrodes were positioned over the suprapubic area. While group B received placebo interferential current. The treatment protocol was applied 3 times/ week for six successive weeks, in a total of 18 sessions. Patients were evaluated before and after the six weeks of the treatment by visual analogue scale and pain intensity while pain relief scale was measured after the treatment. Results: Group A showed a significant pain improvement in both inter and intra group comparison in all measured parameters (visual analogue scale and pain intensity while pain relief scale (p <0.05. Conclusion: The findings show that interferential current is an effective modality and can be recommended for the treatment of testicular pain.

  1. Ras history

    Science.gov (United States)

    2010-01-01

    Although the roots of Ras sprouted from the rich history of retrovirus research, it was the discovery of mutationally activated RAS genes in human cancer in 1982 that stimulated an intensive research effort to understand Ras protein structure, biochemistry and biology. While the ultimate goal has been developing anti-Ras drugs for cancer treatment, discoveries from Ras have laid the foundation for three broad areas of science. First, they focused studies on the origins of cancer to the molecular level, with the subsequent discovery of genes mutated in cancer that now number in the thousands. Second, elucidation of the biochemical mechanisms by which Ras facilitates signal transduction established many of our fundamental concepts of how a normal cell orchestrates responses to extracellular cues. Third, Ras proteins are also founding members of a large superfamily of small GTPases that regulate all key cellular processes and established the versatile role of small GTP-binding proteins in biology. We highlight some of the key findings of the last 28 years. PMID:21686117

  2. Numerical study of emergency cryogenics gas relief into confined spaces

    CERN Multimedia

    CERN. Geneva

    2016-01-01

    The presented work focuses on the risk analysis and the consequences of the unexpected leak to the tunnel of cryogenics gases. Formation of the gas mixture and its propagation along tunnels is an important issue for the safe operation of cryogenic machines, including superconducting accelerators or free electron lasers. As the cryogenics gas the helium and argon will be considered. A minimal numerical model will be presented and discussed. Series of numerical results related to emergency helium relief to the CERN tunnel and related to unexpected leak of the argon to an underground tunnel, will be shown. The numerical results will show temperature distribution, oxygen deficiency and gas cloud propagation in function of intensity of the leak and intensity of the ventilation.

  3. A Disaster Relief Inventory Model Based on Transshipment

    Directory of Open Access Journals (Sweden)

    Pedro Reyes

    2013-11-01

    Full Text Available This research study is an effort to shed light on how transshipment may help improve the management of inventory in a disaster relief system. System dynamics simulation was used to compare inventory control and costs in a humanitarian supply chain without transshipment vs. one with transshipment. A framework for this approach is given along with the results of simulations on a system consisting of two warehouses where transshipment is allowed compared to the alternative where transshipment is not allowed. The preliminary results of this study indicate that transshipment can reduce costs and improve service to disaster victims based on inventory levels maintained in the warehouses. In some cases, transshipment may be more expensive, but this assumes the cost of replenishing inventory as a result of emergency purchase costs.

  4. Does a view of nature promote relief from acute pain?

    Science.gov (United States)

    Kline, Grace A

    2009-09-01

    Inadequate control of acute pain is a well-recognized and serious problem. Distraction is one of the methods used in adjunct with medications to relieve pain. Nature-related sensory stimuli are frequently used for both distraction and relaxation. The human response model that focuses on individual adaptation to health conditions is used in this article to guide an analysis of relevant studies. Four studies in clinical settings evaluated the effect of nature (as a visual stimulus) to determine whether it promoted relief of acute pain. All these studies also used audio stimuli (nature sounds or music). Distracting visual and auditory stimuli used together provided stronger evidence of pain reduction than when either type of stimulus was used alone.

  5. Cultural differences in music chosen for pain relief.

    Science.gov (United States)

    Good, M; Picot, B L; Salem, S G; Chin, C C; Picot, S F; Lane, D

    2000-09-01

    Nurses use music therapeutically but often assume that all patients will equally appreciate the same type of music. Cultural differences in music preferences are compared across five pain studies. Music preferences for pain relief are described as the most frequently chosen type of music for each culture. Findings indicate that in four studies, musical choices were related to cultural background (p = .002 to .049). Although the majority in each group chose among the other types of music, Caucasians most frequently chose orchestra music, African Americans chose jazz, and Taiwanese chose harp music. For culturally congruent care, nurses should become aware of cultural differences in music preference and provide culturally specific selections among other music expected to have a therapeutic effect.

  6. Gain-Based Relief for Invasion of Privacy

    Directory of Open Access Journals (Sweden)

    Sirko Harder

    2013-11-01

    Full Text Available In many common law jurisdictions, some or all instances of invasion of privacy constitute a privacy-specific wrong either at common law (including equity or under statute. A remedy invariably available for such a wrong is compensation for loss. However, the plaintiff may instead seek to claim the profit the defendant has made from the invasion. This article examines when a plaintiff is, and should be, entitled to claim that profit, provided that invasion of privacy is actionable as such. After a brief overview of the relevant law in major common law jurisdictions, the article investigates how invasion of privacy fits into a general concept of what is called ‘restitution for wrongs’. It will be argued that the right to privacy is a right against the whole world and as such forms a proper basis of awarding gain-based relief for the unauthorised use of that right.

  7. Acupucture as pain relief during delivery - a randomized controlled trial

    DEFF Research Database (Denmark)

    Borup, Lissa; Wurlitzer, Winnie; Hedegaard, Morten

    2009-01-01

    with the intention-to-treat principle. Results: Use of pharmacological and invasive methods was significantly lower in the acupuncture group (acupuncture vs traditional, p acupuncture vs TENS, p = 0.031). Pain scores were comparable. Acupuncture did not influence the duration of labor or the use of oxytocin......Background: Many women need some kind of analgesic treatment to relieve pain during childbirth. The objective of our study was to compare the effect of acupuncture with transcutaneous electric nerve stimulation (TENS) and traditional analgesics for pain relief and relaxation during delivery...... with respect to pain intensity, birth experience, and obstetric outcome. Methods: A randomized controlled trial was conducted with 607 healthy women in labor at term who received acupuncture, TENS, or traditional analgesics. Primary outcomes were the need for pharmacological and invasive methods, level of pain...

  8. Acupuncture as pain relief during delivery: a randomized controlled trial

    DEFF Research Database (Denmark)

    Borup, Lissa; Wurlitzer, Winnie; Hedegaard, Morten

    2009-01-01

    with the intention-to-treat principle. RESULTS: Use of pharmacological and invasive methods was significantly lower in the acupuncture group (acupuncture vs traditional, p acupuncture vs TENS, p = 0.031). Pain scores were comparable. Acupuncture did not influence the duration of labor or the use of oxytocin......BACKGROUND: Many women need some kind of analgesic treatment to relieve pain during childbirth. The objective of our study was to compare the effect of acupuncture with transcutaneous electric nerve stimulation (TENS) and traditional analgesics for pain relief and relaxation during delivery...... with respect to pain intensity, birth experience, and obstetric outcome. METHODS: A randomized controlled trial was conducted with 607 healthy women in labor at term who received acupuncture, TENS, or traditional analgesics. Primary outcomes were the need for pharmacological and invasive methods, level of pain...

  9. Rectangular Relief Diffraction Gratings for Coherent Lidar Beam Deflection

    Science.gov (United States)

    Cole, H. J.; Dixit, S. N.; Shore, B. W.; Chambers, D. M.; Britten, J. A.; Kavaya, M. J.

    1999-01-01

    LIDAR systems require a light transmitting system for sending a laser light pulse into space and a receiving system for collecting the retro-scattered light, separating it from the outgoing beam and analyzing the received signal for calculating wind velocities. Currently, a shuttle manifested coherent LIDAR experiment called SPARCLE (SPAce Readiness Coherent Lidar Experiment) includes a silicon wedge (or prism) in its design in order to deflect the outgoing beam 30 degrees relative to the incident direction. The intent of this paper is to present two optical design approaches that may enable the replacement of the optical wedge component (in future, larger aperture, post-SPARCLE missions) with a surface relief transmission diffraction grating. Such a grating could be etched into a lightweight, flat, fused quartz substrate. The potential advantages of a diffractive beam deflector include reduced weight, reduced power requirements for the driving scanning motor, reduced optical sensitivity to thermal gradients, and increased dynamic stability.

  10. Western Tibet relief evolution, insight from sedimentary record and thermochronology

    Science.gov (United States)

    Mahéo, Gweltaz; Gourbet, Loraine; Hervé Leloup, Philippe; Sorrel, Philippe; Shuster, David L.; Paquette, Jean-Louis; Quillévéré, Frédéric

    2014-05-01

    The Tibetan plateau is defined as a low relief high elevation zone, resulting from India-Asia convergence. However, its morphology is relatively heterogeneous. Especially the western Tibetan plateau is characterized by a strong relief, numerous peaks higher than 6000 m.a.s.l. and large (up to 10 km), deep (1-2 km) valleys. We investigate the origin of this particular morphology, coupling geomorphologic studies with sedimentary records and (U-Th)/He thermochronometry. The western Tibet Tertiary sedimentation is mostly characterized by conglomerates, red sandstone and siltstones related with alluvial fan deposits. Zircon U-Pb dating of interbedded trachyte flows implies that deposition started before 25 Ma and was still ongoing at 20 Ma. These continental, detrital deposits are filling wide open valleys during probable arid climatic conditions. Such valleys are thus interpreted as inherited basins, paleovalleys, formed before detrital sedimentation i.e. at ~25 Ma. Moreover, rare marine sediments were observed below the detrital deposits. Foraminifera suggest an Oligocene age, which implies that the paleovalleys already existed during the Oligocene, and that the emersion of the Western Tibetan Plateau occurred between the Oligocene and 25 Ma. This emersion thus occurred much later than the India-Asia collision (~50-45Ma) but is compatible with the onset of the main thickening phase of the Indian plate. The orientation of the inherited valley axis appears to be that of active strike slip faults that induced eastward extrusion of Western Tibet. This suggests that such extrusion was already active at the time of sedimentation (both marine and continental). Thus extrusion was also active during the plateau emersion at Oligocene time. The morphology of the valleys, and their sedimentary infilling, suggest that a significant relief, similar to present-day one (about 1000-2000m between valleys floor and surrounding peaks) already existed at the time of sedimentation. This

  11. Human milk for neonatal pain relief during ophthalmoscopy

    Directory of Open Access Journals (Sweden)

    Laiane Medeiros Ribeiro

    2013-10-01

    Full Text Available Ophthalmoscopy performed for the early diagnosis of retinopathy of prematurity (ROP is painful for preterm infants, thus necessitating interventions for minimizing pain. The present study aimed to establish the effectiveness of human milk, compared with sucrose, for pain relief in premature infants subjected to ophthalmoscopy for the early diagnosis of ROP. This investigation was a pilot, quasi-experimental study conducted with 14 premature infants admitted to the neonatal intensive care unit (NICU of a university hospital. Comparison between the groups did not yield a statistically significant difference relative to the crying time, salivary cortisol, or heart rate (HR. Human milk appears to be as effective as sucrose in relieving acute pain associated with ophthalmoscopy. The study’s limitations included its small sample size and lack of randomization. Experimental investigations with greater sample power should be performed to reinforce the evidence found in the present study.

  12. Pemanfaatan Frekuensi Untuk Public Protection and Disaster Relief (PPDR

    Directory of Open Access Journals (Sweden)

    Diah Yuniarti

    2014-03-01

    Full Text Available Penanganan kejadian yang terkait dengan Public Protection and Disaster Relief (PPDR di Indonesia yang merupakan negara yang rawan terhadap bencana dan permasalahan sosial membutuhkan komunikasi yang intensif. Penelitian ini mengkaji mengenai kondisi pemanfaatan frekuensi PPDR di Indonesia dan strategi pengembangan ke depannya dengan menggunakan analisis SWOT. Hasil penelitian menunjukkan bahwa sistem komunikasi pada instansi PPDR di Indonesia tidak mendukung interoperabilitas dalam penanganan kejadian PPDR yang terkoordinasi. Selain itu, pita frekuensi yang digunakan merupakan pita sempit yang tidak mendukung aplikasi video dan data kecepatan tinggi yang dibutuhkan dalam penanganan kejadian PPDR yang lebih efektif. Oleh karena itu, dalam perencanaan alokasi frekuensi ke depannya, pemerintah perlu mengintegrasikan pita lebar ke dalam perencanaan sistem Government Radio Network (GRN.

  13. Antiquity of the relief of the Paratetis mountain system

    Energy Technology Data Exchange (ETDEWEB)

    Blagovolin, N.S.; Pshenin, G.N.

    1981-01-01

    The northern flank of the extended Alpian folded belt (Tetis) which is known under the common name of Paratetis underwent several large tectonic epochs. The article indicates the constant development within the Crimean-Caucasus and Central Asian sectors of the Paratetis of a mountain relief which begins from the epigeosynclinal orgenic structures and is maintained by numerous subsequent phases of tectonic activation. The method in completeness of a known concept regarding the latest tectonic deformations of the socalled preorgenic surface of planation is stressed as the basis of the mountain relief of the Crimea, Caucasus and large part of the Central Asian mountains. A survey is made of the data regarding the distribution of stable carbon isotopes in an insoluble (debituminized) organic matter (IOM). A study is made of the carbon isotope composition in IOM from deposits of the Riphean, Vendian, Paleozoic and Mesozoic of the Siberian platform in the West Siberian plate. The isotope composition of carbon varies from -23 to 35/sup 0//oo. The dependence of the isotope composition of SOM on its original genetic type is complicated to a certain measure by the influence of diagnetic transformations of aquagenic organic matter and the effect of apocatagenesis and metagenesis. It is noted, that contrary to the viewpoint dominant in the literature, the main law governing the distribution of carbon isotopes and SOM of sedimentary rocks of the Phanerozoic at the stages of the proto-and mesocatagenesis is enrichment of the aquagenic SOM with the C /sup 12/ isotope as compared to the terrigenous.

  14. Relief of BPO or improvement in quality of life?

    Science.gov (United States)

    Teillac, P

    1998-01-01

    Benign prostatic hyperplasia (BPH) can cause benign prostatic enlargement with subsequent benign prostatic obstruction (BPO) and lower urinary tract symptoms (LUTS). A reduction in the size of the prostate has long been considered one of the most important treatment goals. However, there is a poor correlation between prostate size and both LUTS and BPO, and between BPO and symptoms. Today, the urologist's primary objectives are to minimize symptoms, relieve BPO and decrease the morbidity associated with BPO. From the patient's point of view, rapid relief of LUTS and immediate improvement in associated quality of life (QOL) are the most important factors. Although there is a good correlation between relief of symptoms (as measured by the International Prostate Symptom Score [I-PSS], for example) and associated improvement in bothersomeness and QOL, particularly that associated with filling ('irritative') symptoms, it is still important to quantify LUTS-related bothersomeness and QOL. Various questionnaires have been developed to measure bothersomeness (e.g. Symptom Problem Index [SPI], Danish PSS [DAN-PSS], International Continence Society BPH Study Group [ICSmale] questionnaire) and QOL (e.g. I-PSS-QOL, BPH Impact Index [BII] and QOL9 BPH-specific questionnaire). In addition, the impact of treatment on sexual function should also be taken into account when judging the overall well being or QOL of the patient. A grading system to evaluate the global improvement in patients following treatment has been established. Patients are either graded as showing 'slight', 'moderate' or 'marked' improvement, with the reduction in I-PSS or BII scores required for each classification dependent on baseline symptom severity. Medical treatment strategies designed to alleviate the symptoms of BPH and consequently improve the patient's QOL are now becoming increasingly important.

  15. Evaluation of HIV and Highly Active Antiretroviral Therapy on the Natural History of Human Papillomavirus Infection and Cervical Cytopathologic Findings in HIV-Positive and High-Risk HIV-Negative Women

    NARCIS (Netherlands)

    Blitz, Sandra; Baxter, Joanna; Raboud, Janet; Walmsley, Sharon; Rachlis, Anita; Smaill, Fiona; Ferenczy, Alex; Coutlée, François; Hankins, Catherine; Money, Deborah

    2013-01-01

    Background. The Canadian Women's HIV Study (CWHS) enrolled human immunodeficiency virus (HIV)-positive and high-risk HIV-negative women in a longitudinal cohort. This analysis considered the effects of HIV and highly active antiretroviral therapy (HAART) on HPV persistence and cervical squamous

  16. Researcher Positioning

    DEFF Research Database (Denmark)

    Khawaja, Iram; Mørck, Line Lerche

    2009-01-01

    This article focuses on the complex and multilayered process of researcher positioning,specifically in relation to the politically sensitive study of marginalised and "othered"groups such as Muslims living in Denmark. We discuss the impact of different ethnic,religious, and racial backgrounds...... involvement by the researcher, which challenges traditional perspectives onresearch and researcher positioning. A key point in this regard is the importance ofconstant awareness of and reflection on the multiple ways in which one's positioningas a researcher influences the research process. Studying the other...... calls for closereflections on one's own position, theoretically, personally, and politically, taking intoaccount one's complicity in either overcoming or reproducing processes of otheringand marginalisation....

  17. ENVIRONMENTAL TECHNOLOGY VERIFICATION REPORT THE PROTECTOSEAL COMPANY PIN-TECH BUBBLE TIGHT < 500 PPM RELIEF VENT

    Science.gov (United States)

    The Environmental Technology Verification report discusses the technology and performance of a pressure relief valve for protection of storage tanks that operate at pressures of 15 psig or less. Four Pin-Tech Bubble Tight <500 ppm Relief Vent valves manufactured by the Protectose...

  18. 21 CFR 882.5840 - Implanted intracerebral/subcortical stimulator for pain relief.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Implanted intracerebral/subcortical stimulator for... Devices § 882.5840 Implanted intracerebral/subcortical stimulator for pain relief. (a) Identification. An implanted intracerebral/subcortical stimulator for pain relief is a device that applies electrical current...

  19. 21 CFR 882.5880 - Implanted spinal cord stimulator for pain relief.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Implanted spinal cord stimulator for pain relief... Implanted spinal cord stimulator for pain relief. (a) Identification. An implanted spinal cord stimulator... severe intractable pain. The stimulator consists of an implanted receiver with electrodes that are placed...

  20. Memory decay and susceptibility to amnesia dissociate punishment- from relief-learning

    Science.gov (United States)

    Diegelmann, Sören; Preuschoff, Stephan; Appel, Mirjam; Niewalda, Thomas; Gerber, Bertram; Yarali, Ayse

    2013-01-01

    Painful events shape future behaviour in two ways: stimuli associated with pain onset subsequently support learned avoidance (i.e. punishment-learning) because they signal future, upcoming pain. Stimuli associated with pain offset in turn signal relief and later on support learned approach (i.e. relief-learning). The relative strengths of such punishment- and relief-learning can be crucial for the adaptive organization of behaviour in the aftermath of painful events. Using Drosophila, we compare punishment- and relief-memories in terms of their temporal decay and sensitivity to retrograde amnesia. During the first 75 min following training, relief-memory is stable, whereas punishment-memory decays to half of the initial score. By 24 h after training, however, relief-memory is lost, whereas a third of punishment-memory scores still remain. In accordance with such rapid temporal decay from 75 min on, retrograde amnesia erases relief-memory but leaves a half of punishment-memory scores intact. These findings suggest differential mechanistic bases for punishment- and relief-memory, thus offering possibilities for separately interfering with either of them. PMID:23658002

  1. Paracetamol for pain relief after surgical removal of lower wisdom teeth

    NARCIS (Netherlands)

    Weil, K.; Hooper, L.; Afzal, Z.; Esposito, M.; Worthington, H.V.; van Wijk, A.J.; Coulthard, P.

    2008-01-01

    Background: Paracetamol has been commonly used for the relief of postoperative pain following oral surgery. In this review we investigated the optimal dose of paracetamol and the optimal time for drug administration to provide pain relief, taking into account the side effects of different doses of

  2. Visual structure analysis of compound reliefs of milli hats used by ...

    African Journals Online (AJOL)

    The Milli hat is one of the most elaborately hand-woven crafts created by Kurdish women in Makriyan region. They use diverse ways of symmetry to bring graceful and exquisite reliefs into being and present them to their men. The present study aims to collect, identify and visually analyze the compound recurring reliefs on ...

  3. A neurogenetic dissociation between punishment-, reward- and relief-learning in Drosophila

    Directory of Open Access Journals (Sweden)

    ayse Yarali

    2010-12-01

    Full Text Available What is particularly worth remembering about a traumatic experience is what brought it about, and what made it cease. For example, fruit flies avoid an odour which during training had preceded electric shock punishment; on the other hand, if the odour had followed shock during training, it is later on approached as a signal for the relieving end of shock. We provide a neurogenetic analysis of such relief learning. Blocking, using UAS-shibirets1, the output from a particular set of dopaminergic neurons defined by the TH-Gal4 driver partially impaired punishment learning, but left relief learning intact. Thus, with respect to these particular neurons, relief learning differs from punishment learning. Targeting another set of dopaminergic/ serotonergic neurons defined by the DDC-Gal4 driver on the other hand affected neither punishment nor relief learning. As for the octopaminergic system, the tbhM18 mutation, compromising octopamine biosynthesis, partially impaired sugar-reward learning, but not relief learning. Thus, with respect to this particular mutation, relief learning and reward learning are dissociated. Finally, blocking output from the set of octopaminergic/ tyraminergic neurons defined by the TDC2-Gal4 driver affected neither reward, nor relief learning. We conclude that regarding the used genetic tools, relief learning is neurogenetically dissociated from both punishment and reward learning.

  4. Pentazocine pain relief in adult patients with acute abdominal ain: A ...

    African Journals Online (AJOL)

    Background: Reported studies in the African population, on early pain relief in patients with acute abdominal pain are few. The objective of the study was to evaluate the effect of pentazocine (PZ) on pain relief, diagnostic accuracy and treatment decisions in patients with acute abdominal pain. Methods: This was a ...

  5. Attitude of Nigerian Mothers to Labour Pain and its Relief | Akpan ...

    African Journals Online (AJOL)

    The attitude of 110 mothers to labour pains and its relief were assessed 24 hours after normal vaginal deliveries in the post-natal ward of the University of Calabar Teaching Hospital. The study was carried out with the view of formally introducing pain relief in labour (epidural analgesia in the University of Calabar Teaching ...

  6. 7 CFR 718.307 - Special relief approval authority for State Executive Directors.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 7 2010-01-01 2010-01-01 false Special relief approval authority for State Executive... SERVICE AGENCY, DEPARTMENT OF AGRICULTURE FARM MARKETING QUOTAS, ACREAGE ALLOTMENTS, AND PRODUCTION... relief approval authority for State Executive Directors. (a) General nature of the special authority...

  7. The Unintended Consequences of Property Tax Relief: New York's STAR Program

    Science.gov (United States)

    Eom, Tae Ho; Duncombe, William; Nguyen-Hoang, Phuong; Yinger, John

    2014-01-01

    New York's School Tax Relief Program, STAR, provides state-funded property tax relief for homeowners. Like a matching grant, STAR changes the price of education, thereby altering the incentives of voters and school officials and leading to unintended consequences. Using data for New York State school districts before and after STAR was…

  8. 30 CFR 18.28 - Devices for pressure relief, ventilation, or drainage.

    Science.gov (United States)

    2010-07-01

    ... for installation on explosion-proof enclosures to relieve pressure, ventilate, or drain will be... metal will prevent discharge of flame in explosion tests. (b) Devices for pressure relief, ventilation.... (c) Devices for pressure relief, ventilation, or drainage will be acceptable for application only on...

  9. 46 CFR 153.370 - Minimum relief valve setting for ambient temperature cargo tanks.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Minimum relief valve setting for ambient temperature...) CERTAIN BULK DANGEROUS CARGOES SHIPS CARRYING BULK LIQUID, LIQUEFIED GAS, OR COMPRESSED GAS HAZARDOUS... temperature cargo tanks. The relief valve setting for a containment system that carries a cargo at ambient...

  10. "There Is a Lot that I Want to Do": Reflections on the Relief Efforts in Haiti

    Science.gov (United States)

    Desgrottes, Maryse

    2011-01-01

    In October 2010, Harvard Educational Review editor Raygine DiAquoi interviewed Maryse Desgrottes, the mother of a close friend and a visible presence in the relief efforts in Petit Goave, Haiti. Desgrottes, a former physician's assistant turned educator and school superintendent, shares the story of her involvement in Haiti's relief efforts since…

  11. Researcher positioning

    DEFF Research Database (Denmark)

    Mørck, Line Lerche; Khawaja, Iram

    2009-01-01

    abstract  This article focuses on the complex and multi-layered process of researcher positioning, specifically in relation to the politically sensitive study of marginalised and ‘othered' groups such as Muslims living in Denmark. We discuss the impact of different ethnic, religious and racial...... political and personal involvement by the researcher, which challenges traditional perspectives on research and researcher positioning. A key point in this regard is the importance of constant awareness of and reflection on the multiple ways in which one's positioning as a researcher influences the research...... process. Studying the other calls for close reflections on one's own position, theoretically, personally, and politically, taking into account one's complicity in either overcoming or reproducing processes of othering and marginalisation. [i] We use the term (ethnic) minoritised, not as a distinction...

  12. Glaucoma history and risk factors.

    Science.gov (United States)

    McMonnies, Charles W

    Apart from the risk of developing glaucoma there is also the risk that it is not detected and irreversible loss of vision ensues. Some studies of methods of glaucoma diagnosis have examined the results of instrument-based examinations with great if not complete reliance on objective findings in arriving at a diagnosis. The very valuable advances in glaucoma detection instrument technologies, and apparent increasing dependence on them, may have led to reduced consideration of information available from a patient history in those studies. Dependence on objective evidence of glaucomatous pathology may reduce the possibility of detecting glaucoma suspects or patients at risk for becoming glaucoma suspects. A valid positive family history of glaucoma is very valuable information. However, negative family histories can often be unreliable due to large numbers of glaucoma cases being undiagnosed. No evidence of family history is appropriate rather than no family history. In addition the unreliability of a negative family history is increased when patients with glaucoma fail to inform their family members. A finding of no family history can only be stated as no known family history. In examining the potential diagnostic contribution from a patient history, this review considers, age, frailty, race, type and degree of refractive error, systemic hyper- and hypotension, vasospasm, migraine, pigmentary dispersion syndrome, pseudoexfoliation syndrome, obstructive sleep apnea syndrome, diabetes, medication interactions and side effects, the degree of exposure to intraocular and intracranial pressure elevations and fluctuations, smoking, and symptoms in addition to genetics and family history of the disease. Copyright © 2016 Spanish General Council of Optometry. Published by Elsevier España, S.L.U. All rights reserved.

  13. Landsat - SRTM Shaded Relief Comparison, Los Angeles and Vicinity

    Science.gov (United States)

    2002-01-01

    Digital elevation models (DEMs), such as those produced by the Shuttle Radar Topography Mission (SRTM), allow user-controlled visualization of the Earth's landforms that is not possible using satellite imagery alone. This three-view comparison shows Los Angeles, Calif., and vicinity, with a Landsat image (only) on the left, a shaded relief rendering of the SRTM DEM on the right, and a merge of the two data sets in the middle. Note that topographic expression in the Landsat image alone is very subtle due to the fairly high sun angle (63 degrees above the horizon) during the satellite overflight in late morning of a mid-Spring day (May 4, 2001). In contrast, computer generated topographic shading of the DEM provides a pure and bold image of topographic expression with a user specified illumination direction. The middle image shows how combining the Landsat and DEM shaded relief can result in a topographically enhanced satellite image in which the information content of both data sets is merged into a single view.Landsat has been providing visible and infrared views of the Earth since 1972. SRTM elevation data matches the 30-meter (98-foot) resolution of most Landsat images and helps in analyzing the large and growing Landsat image archive, managed by the U.S. Geological Survey (USGS).Elevation data used in this image was acquired by the Shuttle Radar Topography Mission (SRTM) aboard the Space Shuttle Endeavour, launched on Feb. 11, 2000. SRTM used the same radar instrument that comprised the Spaceborne Imaging Radar-C/X-Band Synthetic Aperture Radar (SIR-C/X-SAR) that flew twice on the Space Shuttle Endeavour in 1994. SRTM was designed to collect 3-D measurements of the Earth's surface. To collect the 3-D data, engineers added a 60-meter (approximately 200-foot) mast, installed additional C-band and X-band antennas, and improved tracking and navigation devices. The mission is a cooperative project between NASA, the National Imagery and Mapping Agency (NIMA) of the U

  14. The rise and fall of a genus: Complete mtDNA genomes shed light on the phylogenetic position of yellow-tailed woolly monkeys, Lagothrix flavicauda, and on the evolutionary history of the family Atelidae (Primates: Platyrrhini).

    Science.gov (United States)

    Di Fiore, Anthony; Chaves, Paulo B; Cornejo, Fanny M; Schmitt, Christopher A; Shanee, Sam; Cortés-Ortiz, Liliana; Fagundes, Valéria; Roos, Christian; Pacheco, Víctor

    2015-01-01

    Using complete mitochondrial genome sequences, we provide the first molecular analysis of the phylogenetic position of the yellow-tailed woolly monkey, Lagothrix flavicauda (a.k.a. Oreonax flavicauda), a critically endangered neotropical primate endemic to northern Perú. The taxonomic status and phylogenetic position of yellow-tailed woolly monkeys have been debated for many years, but in this study both Bayesian and maximum likelihood phylogenetic reconstructions unequivocally support a monophyletic woolly monkey clade that includes L. flavicauda as the basal taxon within the radiation. Bayesian dating analyses using several alternative calibrations suggest that the divergence of yellow-tailed woolly monkeys from other Lagothrix occurred in the Pleistocene, ∼2.1Ma, roughly 6.5 my after the divergence of woolly monkeys from their sister genus, Brachyteles. Additionally, comparative analysis of the cytochrome oxidase subunit 2 (COX2) gene shows that genetic distances between yellow-tailed woolly monkeys and other Lagothrix from across the genus' geographic distribution fall well within the range of between-species divergences seen in a large number of other platyrrhine primate genera at the same locus and outside the range of between-genus divergences. Our results thus confirm a position within Lagothrix for the yellow-tailed woolly monkey and strongly suggest that the name Oreonax be formally considered a synonym for this genus. This revision in taxonomic status does not change the dire conservation threats facing the yellow-tailed woolly monkey in Perú, where the remaining wild population is estimated at only ∼10,000 individuals living in a highly fragmented landscape. Copyright © 2014 Elsevier Inc. All rights reserved.

  15. Positional games

    CERN Document Server

    Hefetz, Dan; Stojaković, Miloš; Szabó, Tibor

    2014-01-01

    This text serves as a thorough introduction to the rapidly developing field of positional games. This area constitutes an important branch of combinatorics, whose aim it is to systematically develop an extensive mathematical basis for a variety of two-player perfect information games. These range from such popular games as Tic-Tac-Toe and Hex to purely abstract games played on graphs and hypergraphs. The subject of positional games is strongly related to several other branches of combinatorics such as Ramsey theory, extremal graph and set theory, and the probabilistic method. These notes cover a variety of topics in positional games, including both classical results and recent important developments. They are presented in an accessible way and are accompanied by exercises of varying difficulty, helping the reader to better understand the theory. The text will benefit both researchers and graduate students in combinatorics and adjacent fields.

  16. Position indicator

    Science.gov (United States)

    Tanner, David E.

    1981-01-01

    A nuclear reactor system is described in which a position indicator is provided for detecting and indicating the position of a movable element inside a pressure vessel. The movable element may be a valve element or similar device which moves about an axis. Light from a light source is transmitted from a source outside the pressure vessel to a first region inside the pressure vessel in alignment with the axis of the movable element. The light is redirected by a reflector prism to a second region displaced radially from the first region. The reflector prism moves in response to movement of the movable element about its axis such that the second region moves arcuately with respect to the first region. Sensors are arrayed in an arc corresponding to the arc of movement of the second region and signals are transmitted from the sensors to the exterior of the reactor vessel to provide indication of the position of the movable element.

  17. USGS Small-scale Dataset - Topographic and Bathymetric Shaded Relief of North America 200509 GeoTIFF

    Data.gov (United States)

    U.S. Geological Survey, Department of the Interior — The Topographic and Bathymetric Shaded Relief of North America map layer shows depth and elevation ranges using colors, with relief enhanced by shading. The image...

  18. USGS Small-scale Dataset - 100-Meter Resolution Grayscale Shaded Relief of Hawaii 201304 GeoTIFF

    Data.gov (United States)

    U.S. Geological Survey, Department of the Interior — The Grayscale Shaded Relief of Hawaii map layer is a 100-meter resolution grayscale shaded relief image of Hawaii, in an Albers Equal-Area Conic projection. Shaded...

  19. USGS Small-scale Dataset - 100-Meter Resolution Grayscale Shaded Relief of the Conterminous United States 201304 GeoTIFF

    Data.gov (United States)

    U.S. Geological Survey, Department of the Interior — The Grayscale Shaded Relief of the Conterminous United States map layer is a 100-meter resolution grayscale shaded relief image of the United States, in an Albers...

  20. USGS Small-scale Dataset - 100-Meter Resolution Grayscale Shaded Relief of Alaska 201304 GeoTIFF

    Data.gov (United States)

    U.S. Geological Survey, Department of the Interior — The Grayscale Shaded Relief of Alaska map layer is a 100-meter resolution grayscale shaded relief image of Alaska, in an Albers Equal-Area Conic projection. Shaded...

  1. USGS Small-scale Dataset - 100-Meter Resolution Color Shaded Relief of the Conterminous United States 201304 GeoTIFF

    Data.gov (United States)

    U.S. Geological Survey, Department of the Interior — The Color Shaded Relief of the Conterminous United States map layer is a 100-meter resolution color-sliced elevation image of the United States, with relief shading...

  2. Inadequate pain relief and consequences in oncological elderly patients.

    Science.gov (United States)

    Caltagirone, Carlo; Spoletini, Ilaria; Gianni, Walter; Spalletta, Gianfranco

    2010-09-01

    Elderly patients with cancer are particularly burdened with pain, which has an impact on physical, psychological and cognitive symptoms, and consequently, on the overall quality of life. Here, the existing literature on pain and its consequences in elderly patients with cancer is reviewed, in order to understand the impact of cancer pain and its related symptoms, and the importance of its correct assessment and management, in the geriatric population. From the literature, it emerges that cancer pain has a complex and multidimensional phenomenology in this population, and it is often underestimated and consequently untreated. Furthermore, elderly cancer patients are at higher risk of suffering from pain. Aetiology of cancer pain in elderly patients is still an emergent issue, and immunological findings on the link between pain, cancer and aging may help enlighten the pathophysiological mechanisms underlying pain in elderly cancer patients. Particularly, immune dysfunction may represent a common pathogenic ground of pain and its more common related symptoms (i.e. depression and cognitive decline) in elderly cancer patients. Appropriate pain relief represents a challenge in oncological research, in order to improve patients' and caregivers' quality of life. Copyright 2009 Elsevier Ltd. All rights reserved.

  3. Viatical settlement tax reform: Republicans support relief, Democrats divided.

    Science.gov (United States)

    James, J S; Roehr, B

    1995-03-03

    Congress is considering the tax exempt status on money received from a life insurance policy before death of a person with a short life expectancy due to illness. Tax exempt status is being considered for both accelerated benefits and viatical settlement. Accelerated benefits allows for pre-payment in advance of death. A viatical settlement is the purchase of an insurance policy by third parties with the condition of their becoming the irrevocable beneficiary of the policy being purchased. While House Republicans on the House Ways and Means Committee are generally supportive of not taxing viatical settlements, Democrats are divided. Letters to Congress are needed, especially to House Ways and Means Democrats from voters in their districts and states to encourage their support of the reform bill (HR 8, the Senior Citizens' Equity Act) which includes tax relief for both accelerated benefits and viatical settlements. More information can be obtained by calling Gary Rose, National Association of People with AIDS, (202) 898-0414, or Tom McCormack, Affording Care, (202) 479-2543.

  4. PDMS-based waveguides with surface relief Bragg grating

    Science.gov (United States)

    Goraus, Matej; Pudis, Dusan; Jandura, Daniel; Berezina, Sofia

    2016-12-01

    In this paper we present fabrication process of waveguides with surface relief Bragg grating (SR-BG) embossed in poly dimethyl diphenyl siloxane (PDMDPS). Generally, the Bragg grating causes spectral selectivity of propagated light in optical fibers and optical waveguides. We prepared the original concept of fabrication of novel optical waveguides with SR-BG using the laser interference lithography in combination with embossing process of liquid polymer. We used laser interference lithography in Mach-Zehnder configuration to create a grating with period of 21 μm in thin photoresist layer. In this manner, we created an array of D-shaped waveguides of 10 μm wide and app. 2.5 μm high. SR-BG was created in the next step, where the one dimensional surface Bragg grating with period 1.64 μm was prepared by interference lithography. This period was designed to reflect narrow spectral band close the telecommunication wavelength of 1.55 μm. Quality of the prepared waveguides and SR-BG was confirmed from atomic force microscope analysis. Transmission and coupling properties of the prepared SR-BG waveguides were finally measured by spectral measurements in infrared spectral region.

  5. Surface relief gratings in azobenzene supramolecular systems based on polyimides

    Science.gov (United States)

    Schab-Balcerzak, Ewa; Sobolewska, Anna; Stumpe, Joachim; Hamryszak, Lukasz; Bujak, Piotr

    2012-12-01

    The paper describes formation of new supramolecular azopolymers based on hydrogen bonds as perspective materials for laser induced surface relief gratings (SRGs) and for polarization gratings. Supramolecular films were built on the basis of hydrogen bonds between the functional groups of polymer and azobenzene derivatives, that is 4-[4-(3-hydroxypropyloxy)phenylazo]-pyridine and 4-[4-(6-hydroxyhexyloxy)phenylazo]pyridine. Polymers with imide rings, i.e., poly(esterimide)s and poly(etherimide)s, with phenolic hydroxyl or carboxylic groups were applied as matrixes for polymer-dye supramolecular systems. They revealed glass transition temperatures (Tg) in the range of 170-260 °C, whereas supramolecular systems exhibited lower Tg (88-187 °C). The polymers were easily soluble in aprotic polar solvents and exhibited remarkable good film forming properties. Moreover, new chromophore 4-[4-(3-hydroxypropyloxy)phenylazo]pyridine was synthesized and characterized. The light induced SRGs formation and simultaneous formation of the polarization gratings were explored in prepared polymer-chromophore assembles films using a holographic grating recording technique. First time to the best of our knowledge SRGs were formed in hydrogen-bonded supramolecular systems based on polyimides. The highest SRG amplitude and thus the highest diffraction efficiency were obtained in poly(esterimide)s with the hydroxyl functional group. Additionally, the thermal stability of the photoinduced surface gratings and polarization gratings were tested revealing in the case of the SRGs partial stability and almost complete erasure of the polarization gratings.

  6. Effects of tolvaptan on dyspnoea relief from the EVEREST trials

    Science.gov (United States)

    Pang, Peter S.; Konstam, Marvin A.; Krasa, Holly B.; Swedberg, Karl; Zannad, Faiez; Blair, John E.A.; Zimmer, Christopher; Teerlink, John R.; Maggioni, Aldo P.; Burnett, John C.; Grinfeld, Liliana; Ouyang, John; Udelson, James E.; Gheorghiade, Mihai

    2009-01-01

    Aims To describe the effects of tolvaptan therapy on dyspnoea relief based on timing of delivery, influence of concomitant therapies, and baseline patient and clinical characteristics. Also, the influence of clinical trial design on dyspnoea measurement, from the Efficacy of Vasopressin Antagonism in Heart Failure Outcome Study with Tolvaptan (EVEREST) trials. Methods and results Post hoc analysis was performed based on the endpoint of patient-assessed dyspnoea. Changes from baseline at inpatient Day 1 were compared between treatment groups by the van Elteren test. Pre-determined subgroup analyses were also performed. Tolvaptan's effects are greatest within 12 h after first dose with an additional, but modest dyspnoea improvement benefit irrespective of time after admission. Overall, patients continue to report dyspnoea improvement up to 60 h after admission. The window of enrolment, up to 48 h after admission, combined with measurement on ‘Day 1’ led to a wide range over when dyspnoea was assessed. Conclusion Post hoc analysis suggests that tolvaptan modestly improves dyspnoea compared with standard therapy alone, regardless if given early or relatively late after hospitalization, and also across major pre-specified subgroups, despite ongoing background therapy aimed at relieving signs and symptoms. Significant variability around when dyspnoea was assessed, in addition to the persistence of dyspnoea despite ongoing background therapy, may influence how future clinical trials assess dyspnoea in acute heart failure syndromes. PMID:19561338

  7. A test of stress theory: relief workers in refugee camps.

    Science.gov (United States)

    Soliman, Hussein H; Gillespie, David F

    2011-10-01

    The purpose of this paper is to apply a stress model drawn from the literature to the relief and social service workers who have been active in refugee camps for a prolonged period of time. Working in difficult environments, social service workers deliver essential services to refugee populations around the world. A model of four work-stress determinants--tasks, management, appreciation and collaboration--was tested on 274 social workers in five regions of the Middle East (Jordan, Lebanon and Syria, as well as the occupied Palestinian territories of the Gaza Strip and the West Bank). Statistical fit indices were adequate but two relationships were statistically insignificant. The collaboration variable was dropped to create a modified model with tasks indirectly and management and appreciation directly affecting work-related stress. The five direct relationships and two indirect relationships of this modified model are consistent with stress theory, and all relationships--direct and indirect--are statistically significant. © 2011 The Author(s). Disasters © Overseas Development Institute, 2011.

  8. Music therapy in relief of pain in oncology patients

    Directory of Open Access Journals (Sweden)

    Mariana Franco

    2009-03-01

    Full Text Available Objective: To evaluate the perception of oncology patients with chronic pain as to the effects of music in alleviating pain, to identify if there are changes in the vital signs of these patients before and after the musicotherapy session, and to identify whether the intensity of pain is diminished after the music session as per an analogic scale of pain. Methods: This level II, descriptive-exploratory and cross-sectional study used a quantitative and qualitative approach. The sample consisted of ten oncology patients with chronic pain. Rresults: There was a reduction in vital signs and in intensity of pain in ten patients of the sample; after the music sessions, the patients reported a sensation of relief of pain, relaxation, and a belief in the power of music as a supplementary therapy. Cconclusions: Music showed an influence in reducing vital signs and pain intensity, and the patients perceived a reduction of pain and anxiety, and began to believe in music as a form of therapy.

  9. (153)Sm-EDTMP for pain relief of bone metastases from prostate and breast cancer and other malignancies.

    Science.gov (United States)

    Correa-González, Luis; Arteaga de Murphy, Consuelo; Pichardo-Romero, Pablo; Pedraza-López, Martha; Moreno-García, Claudia; Correa-Hernández, Luis

    2014-05-01

    Approximately 85% of patients with cancer suffer severe metastatic bone pain for which radionuclide therapy has been employed for pain palliation. We undertook this study to evaluate the pain relief effect of (153)Sm-EDTMP in Mexican patients with severe and painful bone metastases from mainly prostate, breast, and renal cancer and other malignancies. Patients (277) with intense sustained pain caused by bone metastases were referred to the Nuclear Medicine Department of the Oncology Hospital of the Mexican Social Security Institute. The patients had to have acceptable physical conditions, a previous positive (99m)Tc-MDP scan and blood values within normal range. (153)Sm-EDTMP was prepared at the Instituto Nacional de Investigaciones Nucleares (ININ) and 37 MBq/kg of body weight was injected intravenously. Pain palliation was evaluated with a visual analogue scale (VAS) and a verbal rating scale (VRS) before treatment and 3 and 12 weeks after treatment was started. The age interval of the patients was 24-92 years with a mean age of 64 ± 12 years. Mean values for hemoglobin, leukocyte and platelet counts did not statistically differ at zero time, 3 and 12 weeks after treatment. Pain intensity and relief assessment were statistically different: 9.1 ± 0.61 units initially; 4.2 ± 1.3 units 3 weeks later (54%) and after 12 weeks the pain diminished to 2.4 ± 1.4 units (74%) in the pain relief score scales. (153)Sm-EDTMP was readily available, safe and well tolerated. We conclude that (153)Sm-EDTMP was an adequate palliative agent and was the best option for our Mexican patients to relieve their severe metastatic bone pain. Copyright © 2014 IMSS. Published by Elsevier Inc. All rights reserved.

  10. Popular history magazines and history education

    Directory of Open Access Journals (Sweden)

    Robert Thorp

    2016-05-01

    Full Text Available This paper argues that popular history magazines may be a welcome complement to other forms of historical media in history teaching. By outlining a theoretical framework that captures uses of history, the paper analyses popular history magazine articles from five European countries all dealing with the outbreak of World War I. The study finds that while the studied articles provide a rather heterogeneous view of the causes of the Great War, they can be used to discuss and analyse the importance of perspective in history, thus offering an opportunity to further a more disciplinary historical understanding.

  11. The natural history of violence.

    Science.gov (United States)

    Russell, C; Russell, W M

    1979-01-01

    In the past, human violence was associated with food shortage, but recently it has increased even in relatively well-fed societies. The reason appears from studies of monkeys under relaxed, spacious conditions and under crowding stress. Uncrowded monkeys have unaggressive leaders, rarely quarrel, and protect females and young. Crowded monkeys (even well-fed) have brutal bosses, often quarrel, and wound and kill each other, including females and young. Crowding has similar behaviour effects on other mammals, with physiological disturbances including greater susceptibility to infections. All this appears to be a regular response to overpopulation, reducing the population before it has depleted its natural resources. Human beings, like monkeys and other mammals, need ample space, and become more violent when crowded. Human history is marked by population cycles: population outgrows resources, the resulting violence, stress and disease mortality cuts down the population, leading to a relief period of social and cultural progress, till renewed population growth produces the next crisis. The modern population crisis is world-wide, and explains the increase of violence even in well-fed societies. The solution to the problem of violence is to substitute voluntary birth control for involuntary death control, and bring about relaxed conditions for a reduced world population. PMID:114662

  12. History of Bioterrorism: Botulism

    Medline Plus

    Full Text Available ... Outreach and Communication Activity (COCA) Crisis & Emergency Risk Communication (CERC) Disaster Relief Volunteers Emergency Planners and Responders Emergency Responder Health Monitoring & Surveillance (ERHMS) MedCon Epi-X Public Health Assessment and Surveillance Tools Cities Readiness Initiative ( ...

  13. Involvement of anticancer drugs in the relief system for adverse drug reactions in Japan.

    Science.gov (United States)

    Maeda, Hideki; Kurokawa, Tatsuo

    2013-12-01

    The compensation scheme for adverse drug reactions in Japan was implemented more than three decades ago as relief system by regulatory agencies. Because of the high frequency of adverse drug reactions, anticancer drugs have been excluded from coverage by the relief system since its implementation. Requests have recently been made by some patient advocates for the expansion of relief coverage to include anticancer drugs. In response to these requests, the Ministry of Health, Labor and Welfare of Japan established a committee to discuss relief from anticancer drug-induced health damages in June 2011. We conducted comprehensive research into the compensation scheme for adverse drug reactions in the world. We also investigated the situation of compensation and the committee for discussing inclusion of anticancer drugs into the relief system in Japan. Many countries including the United States and UK do not have relief or compensation schemes for no-fault compensation. We investigated whether a no-fault compensation system exists in Nordic countries (Sweden, Denmark, Norway and Finland), France, Germany, New Zealand and Taiwan in the world, although they offer different services from Japan. We also reviewed current situation and the fundamental difficulties associated with including anticancer drugs in the systems in Japan. The present study investigated the current situation and the fundamental difficulties associated with including anticancer drugs in the systems in Japan and pointed out part of the reason why the committee could not conclude involvement of anticancer drugs in the relief system.

  14. An emergency dispatch model considering the urgency of the requirement for reliefs in different disaster areas

    Directory of Open Access Journals (Sweden)

    Liu Sheng

    2015-11-01

    Full Text Available Abstract: Purpose: Frequent sudden-onset disasters which have threatened the survival of human and the development of society force the public to pay an increasing attention to emergency management. A challenging task in the process of emergency management is emergency dispatch of reliefs. An emergency dispatch model considering the urgency of the requirement for reliefs in different disaster areas is proposed in this paper to dispatch reliefs reasonably and reduce the effect of sudden-onset disasters. Design/methodology/approach: Firstly, quantitative assessment on the urgency of the requirement for reliefs in different disaster areas is done by an evaluation method based on Fuzzy Comprehensive Evaluation and improved Evidence Reasoning which is proposed in this paper. And then based the quantitative results, an emergency dispatch model aiming to minimize the response time, the distribution cost and the unsatisfied rate of the requirement for reliefs is proposed, which reflects the requests of disaster areas under emergency, including the urgency of requirement, the economy of distribution and the equity of allocation. Finally, the Genetic Algorithm is improved based on the adaptive crossover and mutation probability function to solve the emergency dispatch model. Findings and Originality/value: A case that the Y hydraulic power enterprise carries on emergency dispatch of reliefs under continuous sudden-onset heavy rain is given to illustrate the availability of the emergency dispatch model proposed in this paper. The results show that the emergency dispatch model meets the distribution priority requirement of disaster area with the higher urgency, so thatreliefs are supplied more timely. Research limitations/implications: The emergency dispatch model faced to large scale sudden-onset disasters is complex. The quantity of reliefs that disaster area requires and the running time of vehicles are viewed as available information, and the problem

  15. Non-destructive Assessment of Relief Marking Parameters of Heat Shrinkable Installation Parts for Aviation Technology

    Directory of Open Access Journals (Sweden)

    Kondratov Aleksandr P.

    2017-01-01

    Full Text Available The article explains a new method of relief marking of heat-shrinkable tubing and sleeves made of polymer materials with “shape memory effect.” Method of instrument evaluation of relief marking stereometry of installation parts for aviation equipment, made of polyvinyl chloride, polyethyleneterephthalate and polystyrene was developed and the results were explained. Parameters of pin-point relief marking and compliance of point forms to the Braille font standard were determined with the use of the non-destructive method based on the color of interference pattern with precision of 0.02 mm.

  16. [Reminiscence of the "Relief Houses" that operated in rural Chile between 1931 and 1945].

    Science.gov (United States)

    Laval, Enrique

    2016-06-01

    In June 1929, the medical charity inspectors (Isauro Torres and Enrique Laval M.) submitted to the Direction of the Institution a plan for the normalization of all hospitals, which was approved by the Central Board at its meeting on 19 July of that year. The plan was to phase in the hospital action from the First-aid Posts or "Relief Houses" to the large referral hospitals. The "Relief House" would become the initial phase of hospital organization, located in rural areas. Finally, we emphasize that the Relief Houses were establishments for preventive and curative medicine in rural areas.

  17. Digital relief 3D model of the Khibiny massive (Kola peninsula)

    Science.gov (United States)

    Chesalova, Elena; Asavin, Alex

    2015-04-01

    at the bottom and at the edge of the valley. Changing these parameters for different climatic seasons allows us to estimate the duration of the existence of gas in homogeneities in the aerial under soil and up soil layers. Complex ring structure site and manifestations of recent tectonic movements allow it to allocate more closed areas with different plant-land cover and different geomorphological features. In particular stand out - bogs, forest area on the slopes and riparian forest zone, the zone of mountain tundra and rocky plateau. Designated areas should be considered together with the full history of the evolution relief Khibin, processes of decrease glaciers and their occurrence. One of the results of the work performed is the allocation within the array of closed circuses, paleo-ice landforms drumlin and moraine ridges. These landforms represent the latest stage of the glacial history of glaciation on the Kola Peninsula and the Arctic coast. Estimated areal characteristics of different forms. In some cases it was possible to separate a sequence of glacial relief forms, which suggests staging a retreat of glaciers in the area. The project highlighted areas open mining apatite ores in Khibiny massif. Career located in the inner part of the massif form a closed area drain mine water pollution and wind. While the new career located on the border of the array and the forest zone characterized by a single watershed and accordingly included in the ecological life support cycle of residential villages and towns of Kirovsk and Apatity. This fact forces us to view mining activity as a powerful source of contamination. Designed GIS project thus can be used to solve a number of problems geomorphological orientation. In addition a number of application issues - the environment, paleoclimatology, geotectonic can be successfully addressed on the basis of the digital 3D model.

  18. Cognitive Structuring and Its Cognitive-Motivational Determinants as an Explanatory Framework of the Fear-Then-Relief Social Influence Strategy.

    Science.gov (United States)

    Dolinski, Dariusz; Dolinska, Barbara; Bar-Tal, Yoram

    2017-01-01

    According to the fear-then-relief technique of social influence, people who experience anxiety whose source is abruptly withdrawn usually respond positively to various requests and commands addressed to them. This effect is usually explained by the fact that fear invokes a specific program of action, and that when the source of this emotion is suddenly and unexpectedly removed, the program is no longer operative, but the person has not yet invoked a new program. This specific state of disorientation makes compliance more likely. In this paper, an alternative explanation of the fear-then-relief effect is offered. It is assumed that the rapid change of emotions is associated with feelings of uncertainty and confusion. The positive response to the request is a form of coping with uncertainty. In line with this reasoning, while individuals with a high need for closure (NFC) should comply with a request after a fear-then-relief situation, low NFC individuals who are less threatened by uncertainty should not. This assumption was confirmed in the experiment.

  19. Pain-relief learning in flies, rats, and man: basic research and applied perspectives

    Science.gov (United States)

    Gerber, Bertram; Yarali, Ayse; Diegelmann, Sören; Wotjak, Carsten T.; Pauli, Paul; Fendt, Markus

    2014-01-01

    Memories relating to a painful, negative event are adaptive and can be stored for a lifetime to support preemptive avoidance, escape, or attack behavior. However, under unfavorable circumstances such memories can become overwhelmingly powerful. They may trigger excessively negative psychological states and uncontrollable avoidance of locations, objects, or social interactions. It is therefore obvious that any process to counteract such effects will be of value. In this context, we stress from a basic-research perspective that painful, negative events are “Janus-faced” in the sense that there are actually two aspects about them that are worth remembering: What made them happen and what made them cease. We review published findings from fruit flies, rats, and man showing that both aspects, respectively related to the onset and the offset of the negative event, induce distinct and oppositely valenced memories: Stimuli experienced before an electric shock acquire negative valence as they signal upcoming punishment, whereas stimuli experienced after an electric shock acquire positive valence because of their association with the relieving cessation of pain. We discuss how memories for such punishment- and relief-learning are organized, how this organization fits into the threat-imminence model of defensive behavior, and what perspectives these considerations offer for applied psychology in the context of trauma, panic, and nonsuicidal self-injury. PMID:24643725

  20. Personal Narratives in Life History Research

    Science.gov (United States)

    Germeten, Sidsel

    2013-01-01

    In this article I discuss how to create personal narratives in life history research methodology. People tell stories of their lives, and the researchers make these stories into life histories. Based on theoretical perspectives on "discourse" inspired by Michel Foucault, narratives are seen as ways of positioning oneself as a…

  1. Imaginative ethics--bringing ethical praxis into sharper relief.

    Science.gov (United States)

    Hansson, Mats G

    2002-01-01

    The empirical basis for this article is three years of experience with ethical rounds at Uppsala University Hospital. Three standard approaches of ethical reasoning are examined as potential explanations of what actually occurs during the ethical rounds. For reasons given, these are not found to be satisfying explanations. An approach called "imaginative ethics", is suggested as a more satisfactory account of this kind of ethical reasoning. The participants in the ethical rounds seem to draw on a kind of moral competence based on personal life experience and professional competence and experience. By listening to other perspectives and other experiences related to one particular patient story, the participants imagine alternative horizons of moral experience and explore a multitude of values related to clinical practice that might be at stake. In his systematic treatment of aesthetics in the Critique of Judgement, Kant made use of an operation of thought that, if applied to ethics, will enable us to be more sensitive to the particulars of each moral situation. Based on this reading of Kant, an account of imaginative ethics is developed in order to bring the ethical praxis of doctors and nurses into sharper relief. The Hebraic and the Hellenic traditions of imagination are used in order to illuminate some of the experiences of ethical rounds. In conclusion, it is argued that imaginative ethics and principle-based ethics should be seen as complementary in order to endow a moral discourse with ethical authority. Kantian ethics will do the job if it is remembered that Kant suggested only a modest, negative role of principle-based deliberation.

  2. Surveys right after the atomic bombing and a relief squad

    Energy Technology Data Exchange (ETDEWEB)

    Mine, Mariko [Nagasaki Univ. (Japan). School of Medicine

    1998-12-01

    An outline of four survey reports right after the atomic bombing in Nagasaki and Hiroshima is introduced. The report of Manhattan District Atomic Bomb Investigating Groups: The subjects of this survey were 900 inpatients in Nagasaki (for 16 days from September 20) and Hiroshima (for 5 days from October 3). Two hundreds and forty-nine patients (16%) died. In cases died without injury, the severe symptoms were alopecia, purpura, hemorrhage, oral cavity and pharynx lesion, vomiting, diarrhea and fever. The residual radioactivity measured at six weeks later was 6-25 roentgen in Hiroshima and 30-110 roentgen in Nagasaki (Nishiyama riverhead area). These values were lower than the predicted value from the clinical consequence. The report of Joint Commission for the Investigation of the Atomic Bomb: Following the above survey, about 6500 subjects were investigated both in Nagasaki and Hiroshima. Incidence of alopecia was investigated by shielded situation at a spot of 2.1 to 2.5 km from a blast center. It was 7.2% of outdoors (shielded: 7.3%, non-shielded: 17.4%) and 2.9% of indoors. The report of the Special Committee for Atomic Bomb Casualty Investigation and Research of the Scientific Research Council of Japan: General part of the report consists of medical part and physical part, and reports from each university were classified and listed in the supplement. Survey of Nagasaki Medical College (not in public): About 8000 subjects were investigated from October to December. Data were gathered up about lethality, time of death, injury and radiation sickness, etc. There was also autograph of a relief squad of the Nagasaki Medical College. (K.H.)

  3. Pharmacological interventions for pain relief during orthodontic treatment.

    Science.gov (United States)

    Monk, Aoife B; Harrison, Jayne E; Worthington, Helen V; Teague, Annabel

    2017-11-28

    Pain is a common side effect of orthodontic treatment. It increases in proportion to the amount of force applied to the teeth, and the type of orthodontic appliance used can affect the intensity of the pain. Pain during orthodontic treatment has been shown to be the most common reason for people wanting to discontinue treatment, and has been ranked as the worst aspect of treatment. Although pharmacological methods of pain relief have been investigated, there remains some uncertainty among orthodontists about which painkillers are most suitable and whether pre-emptive analgesia is beneficial. We conducted this Cochrane Review to assess and summarize the international evidence relating to the effectiveness of analgesics for preventing this unwanted side effect associated with orthodontic treatment. The objectives of this review are to determine:- the effectiveness of drug interventions for pain relief during orthodontic treatment; and- whether there is a difference in the analgesic effect provided by different types, forms and doses of analgesia taken during orthodontic treatment. Cochrane Oral Health's Information Specialist searched the following databases: the Cochrane Oral Health Trials Register (to 19 June 2017), the Cochrane Central Register of Controlled Trials (CENTRAL;the Cochrane Library 2016, Issue 7), MEDLINE Ovid (1946 to 19 June 2017), Embase Ovid (1980 to 19 June 2017) and CINAHL EBSCO (Cumulative Index to Nursing and Allied Health Literature; 1937 to 19 June 2017). The US National Institutes of Health Ongoing Trials Register (ClinicalTrials.gov) and the World Health Organization International Clinical Trials Registry Platform were searched on the 19 June 2017 for ongoing studies. We placed no restrictions on language or date of publication when searching the electronic databases. We included randomized controlled trials (RCTs) relating to pain control during orthodontic treatment. Pain could be measured on a visual analogue scale (VAS), numerical

  4. O método da falsa posição na história e na educação matemática The false position method in history and in mathematics education

    Directory of Open Access Journals (Sweden)

    Cleide Farias de Medeiros

    2004-12-01

    Full Text Available Este texto coloca em uma perspectiva histórica o tratamento algébrico precoce que, costumeiramente, é dedicado ao ensino elementar da Aritmética. Defendendo que um tal tratamento algébrico precoce carrega vários pontos negativos para a formação do educando, o texto discute o "método da falsa posição" como uma alternativa viável para um tal ensino introdutório. Apontando as raízes históricas de tal método, o texto procura evidenciar as origens, aplicações e várias formas de visualizar este procedimento iterativo, desde a manipulação de materiais concretos, passando por aplicações geométricas, até atingir o Cálculo Numérico, como um dos procedimentos iterativos na resolução de equações lineares. Uma das conclusões é que, embora não seja o referido método, em sua forma mais simples, nenhum substitutivo para a resolução algébrica simbólica e moderna de equações e de sistemas de equações, ele se constitui certamente em um precioso trampolim para iniciarmos o salto em direção a um estudo mais formalizado. Particularmente, o método da falsa posição revela-se uma utilíssima ferramenta pedagógica na Educação Matemática, principalmente quando vinculado às suas origens históricas, suas abordagens concretas iniciais e suas associações com a Geometria e a Geometria Analítica.This text is a historical perspective on the early algebraic approach that is usually applied to the elementary teaching of Arithmetic. By arguing that such an initial algebraic treatment contains several drawbacks for elementary education, the ‘false position method' is discussed and is presented as a viable alternative for such introductory teaching. By pointing out the historical roots of the method, the text tries to make clear several ways of visualising this iterative procedure. This is done by incorporating the use of manipulatives and geometrical applications as well as the use of numerical calculus as an iterative

  5. The Effect of Non-Pharmacological Methods of Labor Pain Relief on Mothers’ Perceived Stress: ARandomized Controlled Trial

    Directory of Open Access Journals (Sweden)

    Mojghan Mirghafourvand

    2014-12-01

    Full Text Available Background & objectives: Childbirth is the most stressful event for the women both mentally and physically affecting their physiological and psychological indicators during labour. The aim of this study was to assess the effect of non-pharmacological methods of labor pain relief in mothers’ perceived stress conducted in Alavi hospital of Ardabil, 2013.  Methods: In this double blind randomized controlled trial, 320 mothers were allocated into two groups by stratified block randomization . The intervention group (n=158 received continuous support throughout the labour process, positioning and movement, music, aromatherapy, showering andconsumption of a light diet or water.The control group received only a routine care. The perceived stress scale (PSS was employed to collect data in three stages at the beginning of the active phase, before the intervention, six hours after birth and then eight weeks postpartum. The two groupswere compared using General Linear Model with controlling the baseline scores. Results: There were 14 participants loss to follow-up. The mean of perceived stress score in the intervention group was significantly lower than the control group at 6 hours [adjusted mean difference: -1.0 (95% confidence interval: -0.01 to -1.9]. However, there was no difference between two groups in terms of perceived stress score at 8 weeks postpartum (p=0.692.  Conclusion: Non-pharmacological methods of labor pain relief are an effective intervention for reducing perceived stress level in mothers during labor and therefore use of this intervention is recommended.

  6. [Pierre Janet observes history].

    Science.gov (United States)

    Fischer-Homberger, Esther

    2014-01-01

    Janet, philosopher and physician, Freud's junior by three years, not only described traumatic dissociation and pathogenic subconscious ideas; he outlined a comprehensive system of psychology. Still, he considered his concepts to be mere linguistic tools, designed to grasp mental phenomena as precisely as possible. His prime interest was in observations - his own and those of others, whether his contemporaries at home and abroad or predecessors of all kinds. Janet never regarded himself as a historian, but his works as well as his way of thinking are most interesting from a historiographical point of view. His three-volume Médications psychologiques of 1919 contains a wealth of material about the history of psychotherapy. Furthermore, he dealt with his sources in a critical and historically reflexive manner. The later Janet considered any explanation and theory to be "inventions", more or less useful and basically open to change. By working with the notion of "narration", he described scientific statements as narratives, different from lies, fairy-tales or novels only in their claim to be verifiable. Every narration, however, is placed in a social context: narrators always wish to evoke a particular image of the real in their audience. Thus Janet established the link between scientific edifices and individual motivation, an unsettling link in terms of the history of science and certainly alien, if not positively abhorrent to Freud.

  7. Conceptual history and History of Education

    Directory of Open Access Journals (Sweden)

    Conrad VILANOU I TORRANO

    2013-11-01

    Full Text Available After noting the importance of linguistic turn in the field of historiography, the two leading currents in the field of conceptual history are identi- fied, the Cambridge school and Reinhart Koselleck’s Begriffsgeschichte. The paper focuses on the analysis of the latter trend in conceptual history, linked to the phi- losophical (Heidegger, Gadamer, political (Schmitt and historical (Dilthey tradi- tion within the German academic community. The paper then reviews the origin and nature of the History of Pedagogy, which arose as part of the classic History of Ideas and later gave rise, after the Second World War, to a Social History of Education. Finally, a conceptual History of Education is proposed that, in addi- tion to addressing the various conceptual strata included in the different terms, also takes into account the intellectual and cultural aspects through a return to discourses and pedadogic narratives.

  8. Microforms and Sport History.

    Science.gov (United States)

    Levine, Peter

    1986-01-01

    Explores the importance of sport history as it reflects the social and cultural history of the United States. Discussion covers the various sport history materials that are available in microform, including the Spalding Collection, twentieth-century microfilm sources, and sports and social history (Sports Periodicals microfilm series). (EJS)

  9. Kiropraktikkens historie i Danmark

    DEFF Research Database (Denmark)

    Jørgensen, Per

    Bogen er den første samlede, forskningsbaserede fremstilling om kiropraktikkens danske historie. Den har udblik til kiropraktikkens historie i USA.......Bogen er den første samlede, forskningsbaserede fremstilling om kiropraktikkens danske historie. Den har udblik til kiropraktikkens historie i USA....

  10. Reinventing Entrepreneurial History

    DEFF Research Database (Denmark)

    Wadhwani, R. Daniel; Lubinski, Christina

    2017-01-01

    Research on entrepreneurship remains fragmented in business history. A lack of conceptual clarity inhibits comparisons between studies and dialogue among scholars. To address these issues, we propose to reinvent entrepreneurial history as a research field. We define “new entrepreneurial history...... and reconfiguring resources, and legitimizing novelty. The article elaborates on the historiography, premises, and potential contributions of new entrepreneurial history....

  11. USGS Small-scale Dataset - Satellite View of Alaska, with Shaded Relief 200605 GeoTIFF

    Data.gov (United States)

    U.S. Geological Survey, Department of the Interior — The Satellite View of Alaska, with Shaded Relief map layer is a 200- meter-resolution simulated-natural-color image of Alaska. Vegetation is generally green, with...

  12. RESEARCH ON NUMERICAL SIMULATION APLICABLE TO THE PRESSURE RELIEF VALVE ON THE BORE GAS EVACUATION DEVICE

    National Research Council Canada - National Science Library

    Gheorghe Negru

    2016-01-01

      The paper presents the research approach on the numerical simulation applicable to pressure relief valve on the bore gas evacuation device embedded on the high pressure barrels with special destinations...

  13. USGS Shaded Relief Large-scale Base Map Service from The National Map

    Data.gov (United States)

    U.S. Geological Survey, Department of the Interior — The USGS Shaded Relief Large service from The National Map (TNM) was created from the National Elevation Dataset (NED), a seamless dataset of best available raster...

  14. U.S. Coastal Relief Model - Florida and East Gulf of Mexico

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — NGDC's U.S. Coastal Relief Model (CRM) provides the first comprehensive view of the U.S. coastal zone integrating offshore bathymetry with land topography into a...

  15. Color Conterminous United States Shaded Relief ? 200-Meter Resolution - Direct Download

    Data.gov (United States)

    U.S. Geological Survey, Department of the Interior — The color conterminous United States shaded relief data were derived from National Elevation Dataset (NED) data, and show the terrain of the conterminous United...

  16. USGS Small-scale Dataset - Color Hawaii Shaded Relief - 200-Meter Resolution 200512 GeoTIFF

    Data.gov (United States)

    U.S. Geological Survey, Department of the Interior — The color Hawaii shaded relief data were derived from National Elevation Dataset (NED) data, and show the terrain of Hawaii at a resolution of 200 meters. The NED is...

  17. Multiple 60-Minute Massages per Week Offer Relief for Chronic Neck Pain

    Science.gov (United States)

    ... Minute Massages per Week Offer Relief for Chronic Neck Pain Share: © Bob Stockfield Courtesy: National Center for Complementary ... fewer or shorter sessions for people with chronic neck pain, suggesting that several hour-long massages per week ...

  18. Satellite View of the Conterminous United States, with Shaded Relief - Direct Download

    Data.gov (United States)

    U.S. Geological Survey, Department of the Interior — The Satellite View of the Conterminous United States, with Shaded Relief map layer is a 200-meter-resolution simulated-natural-color image of the United States....

  19. Color North America Shaded Relief – 1-Kilometer Resolution - Direct Download

    Data.gov (United States)

    U.S. Geological Survey, Department of the Interior — The North America Shaded Relief data were derived from the GTOPO30 elevation data. GTOPO30 is a global digital elevation model (DEM) with a horizontal grid spacing...

  20. FY2005 Supplemental Appropriations for Iraq and Afghanistan, Tsunami Relief, and Other Activities

    National Research Council Canada - National Science Library

    Belasco, Amy; Nowels, Larry

    2005-01-01

    ... (subsequently amended to total $82.04 billion) to provide funds for ongoing military operations in Iraq and Afghanistan, the global war on terror, reconstruction in Afghanistan, Tsunami relief and rehabilitation, and other activities...

  1. Present day relief-shaping systems acting on the southern slope of ...

    Indian Academy of Sciences (India)

    term evolution that brought about significant alterations of the landscape, and especially of the relief, which has acquired different features depending on the intensity of the relationship between the exogenous and endogenous agents. At present ...

  2. Grayscale Conterminous United States Shaded Relief ? 200-Meter Resolution - Direct Download

    Data.gov (United States)

    U.S. Geological Survey, Department of the Interior — The grayscale conterminous United States shaded relief data were derived from National Elevation Dataset (NED) data, and show the terrain of the conterminous United...

  3. Optimizing hurricane disaster relief goods distribution: model development and application with respect to planning strategies.

    Science.gov (United States)

    Horner, Mark W; Downs, Joni A

    2010-07-01

    Over the last few years, hurricane emergencies have been among the most pervasive major disruptions in the United States, particularly in the south-east region of the country. A key aspect of managing hurricane disasters involves logistical planning to facilitate the distribution and transportation of relief goods to populations in need. This study shows how a variant of the capacitated warehouse location model can be used to manage the flow of goods shipments to people in need. In this application, the model is used with protocols set forth in Florida's Comprehensive Emergency Plan and tested in a smaller city in north Florida. Scenarios explore the effects of alternate goods distribution strategies on the provision of disaster relief. Results show that measures describing people's accessibility to relief goods are affected by the distribution infrastructure used to provide relief, as well as assumptions made regarding the population(s) assumed to be in need of aid.

  4. Modelling the Influence of Ground Surface Relief on Electric Sounding Curves Using the Integral Equations Method

    Directory of Open Access Journals (Sweden)

    Balgaisha Mukanova

    2017-01-01

    Full Text Available The problem of electrical sounding of a medium with ground surface relief is modelled using the integral equations method. This numerical method is based on the triangulation of the computational domain, which is adapted to the shape of the relief and the measuring line. The numerical algorithm is tested by comparing the results with the known solution for horizontally layered media with two layers. Calculations are also performed to verify the fulfilment of the “reciprocity principle” for the 4-electrode installations in our numerical model. Simulations are then performed for a two-layered medium with a surface relief. The quantitative influences of the relief, the resistivity ratios of the contacting media, and the depth of the second layer on the apparent resistivity curves are established.

  5. Color Alaska Shaded Relief ? 200-Meter Resolution, Albers projection - Direct Download

    Data.gov (United States)

    U.S. Geological Survey, Department of the Interior — The color Alaska shaded relief data were derived from National Elevation Dataset (NED) data, and show the terrain of Alaska at a resolution of 200 meters. The NED is...

  6. USGS Small-scale Dataset - Color Alaska Shaded Relief - 200-Meter Resolution 200512 GeoTIFF

    Data.gov (United States)

    U.S. Geological Survey, Department of the Interior — The color Alaska shaded relief data were derived from National Elevation Dataset (NED) data, and show the terrain of Alaska at a resolution of 200 meters. The NED is...

  7. Color Conterminous United States Shaded Relief ? 200-Meter Resolution, Albers projection - Direct Download

    Data.gov (United States)

    U.S. Geological Survey, Department of the Interior — The color conterminous United States shaded relief data were derived from National Elevation Dataset (NED) data, and show the terrain of the conterminous United...

  8. USGS Small-scale Dataset - Satellite View of Hawaii, with Shaded Relief 200603 GeoTIFF

    Data.gov (United States)

    U.S. Geological Survey, Department of the Interior — The Satellite View of Hawaii, with Shaded Relief map layer is a 200- meter-resolution simulated-natural-color image of Hawaii. Vegetation is generally green, with...

  9. Color Hawaii Shaded Relief ? 200-Meter Resolution, Albers projection - Direct Download

    Data.gov (United States)

    U.S. Geological Survey, Department of the Interior — The color Hawaii shaded relief data were derived from National Elevation Dataset (NED) data, and show the terrain of Hawaii at a resolution of 200 meters. The NED is...

  10. Administrative Relief for Grantees impacted by Hurricanes Harvey, Irma, and Maria

    Science.gov (United States)

    On October 26, 2017, the Office of Management and Budget issued the attached memorandum, Administrative Relief for Grantees impacted by Hurricanes, to provide Federal agencies with flexibility to assist their grant applicants and recipients.

  11. Determining Tooth Occlusal Surface Relief Indicator by Means of Automated 3d Shape Analysis

    Science.gov (United States)

    Gaboutchian, A. V.; Knyaz, V. A.

    2017-05-01

    Determining occlusal surface relief indicator plays an important role in odontometric tooth shape analysis. An analysis of the parameters of surface relief indicators provides valuable information about closure of dental arches (occlusion) and changes in structure of teeth in lifetime. Such data is relevant for dentistry or anthropology applications. Descriptive techniques commonly used for surface relief evaluation have limited precision which, as a result, does not provide for reliability of conclusions about structure and functioning of teeth. Parametric techniques developed for such applications need special facilities and are time-consuming which limits their spread and ease to access. Nevertheless the use of 3D models, obtained by photogrammetric techniques, allows attaining required measurements accuracy and has a potential for process automation. We introduce new approaches for determining tooth occlusal surface relief indicator and provide data on efficiency in use of different indicators in natural attrition evaluation.

  12. Pectus excavatum in relief from Ancient Egypt (dating back to circa 2400 BC).

    Science.gov (United States)

    Bialas, Adam J; Kaczmarski, Jacek; Kozak, Jozef; Kempinska-Miroslawska, Bogumila

    2015-04-01

    Pectus excavatum is one of the most common congenital deformities of the chest wall. The aim of the study was to analyse 621 artefacts (reliefs, sculptures, paintings) from Ancient Egypt in terms of anatomical defects of the chest. The team which analysed artefacts consisted of historians of medicine and thoracic surgeons. The researchers found a relief, depicting a man with an abnormal shape of the chest. The relief was from Niankhkhnum and Khnumhotep mastaba and dates back to circa 2400 BC. The authors think it is possible that the relief may represent a pectus excavatum deformity and believe the image will open up debate on the occurrence of this deformity in ancient times. © The Author 2015. Published by Oxford University Press on behalf of the European Association for Cardio-Thoracic Surgery. All rights reserved.

  13. Congestion relief by travel time minimization in near real time : Detroit area I-75 corridor study.

    Science.gov (United States)

    2008-12-01

    "This document summarizes the activities concerning the project: Congestion Relief by : Travel Time Minimization in Near Real Time -- Detroit Area I-75 Corridor Study since : the inception of the project (Nov. 22, 2006 through September 30, 2008). : ...

  14. The comparison between suppository diclofenac and pethidine in post-cesarean section pain relief: a randomized controlled clinical trial

    Directory of Open Access Journals (Sweden)

    Ziba Zahiri Soroori

    2006-12-01

    Full Text Available BACKGROUND: Narcotic drugs are usually used for postoperative pain control which could cause several complications such as respiratory depression and apnea. Therefore, replacement of these drugs with safer analgesics is recommended. The aim of this study was to compare the analgesic effects of suppository diclofenac and pethidine in post-cesarean section (C/S patients. METHODS: In this clinical trial, pregnant women who were admitted to Alzahrah Hospital, Isfahan, Iran, between August and February 2004 and met the inclusion criteria were recruited. After obtaining informed consent, the patients were randomly assigned (block randomization to two groups. In group A, 100 mg rectal suppository diclofenac was used after operation at four time points: at the end of operation and 8, 16 and 24 hours after the operation. Group B received pethidine 1 mg/kg intramuscularly at similar time points. The pain scores were assessed at 2, 10, 18 and 26 hours after C/S using the Visual Analogue Scale (VAS. Age, gestational age, parity, history of previous abortion, C/S and abdominal surgery, level of education, pain score, side effects and satisfaction level were assessed. Analysis was carried out with ANCOVA model and χ2 Mantel Haenszel tests by SPSS.10 software. P<0.05 was considered significant. RESULTS: Two hundred forty patients met inclusion criteria. Age, parity, history of previous abortion, history of previous C/S and abdominal surgery, level of education and satisfaction level were similar in the two groups (P>0.05. There was no significant difference between side effects in the two groups except for dizziness in 11 cases in group B. There were significant statistical difference between pain intensity in 10, 18 and 26 hours after C/S in group A and group B (2.05 ± 2.07, 1.4 ± 1.6 and 0.5 ± 1.1 vs. 2.6 ± 2.2, 2.3 ± 2.2 and 1.3 ± 1.9 respectively. CONCLUSIONS: The results of the present study showed that the use of suppository diclofenac is an

  15. RELIEF JENIS-JENIS FAUNA DAN SETTING LINGKUNGANNYA PADA PAHATAN DINDING CANDI BOROBUDUR (Fauna and Environmental Setting Reliefs on Sculptured Wall of the Borobudur Temple

    Directory of Open Access Journals (Sweden)

    Bambang Agus Suripto

    2001-04-01

    Full Text Available ABSTRAK Dalam perkembangan kebudayaannya, manusia selalu akrab dengan fauna yang hidup di sekitar lingkungannya. Pada dinding gua yang pernah dihuni oleh manusia, bangunan candi, piramid, sphinx dsb. dijumpai gambaran tentang fauna. Pada dinding Candi Borobudur banyak dijumpai relief berbagai kelompok fauna tetapi belum diketahui apakah fauna itu semuanya berasal dari India atau terdapat pula kelompok yang ada atau pernah ada di Pulau Jawa. Tujuan penelitian ini adalah untuk mengetahui relief jenis-jenis fauna yang dipahat pada dinding candi Borobudur, dan mengetahui asal-usul jenis yang tergarnbar pada relief itu dari Pulau Jawa atau dari India. Informasi itu diharapkan dapat diungkapkan ada tidaknya gambaran setting lingkungan Pulau Jawa tercermin pada pahatan di dinding Candi itu. Relief fauna pada pahatan dinding langkan, dinding utama bagian atas-bawah di tingkatan Rupadhatu dipotret dan nama kelompok fauna diindentifikasi dengan buku-buku kunci identifikasi bergambar, kemudian penyebaran alami masing-masing kelompok fauna diketahui melalui kajian pustaka. Data yang diperoleh dianalisis secara deskriptif untuk mengungkap ada atau tidaknya gambaran setting lingkungan Pulau Jawa yang tercermin pada pahatan di dinding Candi Borsbudur. Pada dinding Candi Borobudur terdapat relief paling sedikit 25 jenis anggota Osteichthyes, Reptilia, Aves dan Mammalia yang dipahat secara natural, dan terdapat paling sedikit 5 jenis hewan yang dipahat secara setilir. Semua jenis fauna itu terdapat di Asia Selatan, dan beberapa di anlaranya secara alami tidak pernah hidup di Pulau Jawa, misalnya singa Pantera leo. Setting lingkungan India Abad VII tervisualisasi dengan baik pada relief pahatan dinding Candi Borobudur, tetapi setting lingkungan Pulau Jawa sampai sebelum masa penjajahan Belanda tidak tergambar dengan baik.   ABSTRACT In the cource of culture development, human was always close to fauna in their surrounding areas. Pictures of fauna are found in

  16. Private-Public Disaster Relief: What Is the Military’s Role?

    Science.gov (United States)

    2014-03-01

    local and federal companies in the 70 Russell Sobel , “The Use of Knowledge in Natural-Disaster...76 Sobel , “The Use of Knowledge in Natural-Disaster Relief Management, 18. 77 Ibid. 78 Chan Lowe...Domestic Disasters.” Homeland Security Affairs 7 (2011). Sobel , Russell. “The Use of Knowledge in Natural-Disaster Relief Management.” Last accessed

  17. The Impacts of Humanitarian Assistance/Disaster Relief Operations on the Mental Health of Marines

    Science.gov (United States)

    2015-12-01

    Diagnosed = 11,200 Self Inflicted InjuriesPTSD Substance Abuse 36 clinical depression. Having 3 or more children , being divorced , and being married were...for their unwavering support throughout this process, as well as my entire career. I have been fortunate enough to be blessed with two strong parents ... prepared and equipped for the trials of disaster relief. Further, the researchers suggest that because military relief workers are armed, the

  18. The Effects of Die Relief Agent on the Retention of Full Coverage Castings,

    Science.gov (United States)

    1981-02-19

    number) eTh efct of the use of a proprietary die relief agent on the retention of cas- tings cemented with zinc phosphate , a zinc polycarboxylate or a...higher when zinc phosphate ce- • ment- was the luting medium. The use of die relief agent resulted in a 32% re- duction in the forces required to...dislodge zinc phosphate -cemented castings. L"> Data for the other luting media did not differ statistically. Correlation of these data with shear strengt

  19. Clinical Inquiries: How do hyaluronic acid and corticosteroid injections compare for knee OA relief?

    Science.gov (United States)

    Lyon, Corey; Spencer, Emily; Spittler, Jack; Desanto, Kristen

    2018-01-01

    Inconsistent evidence shows a small amount of pain relief early (one week to 3 months) with corticosteroid (CS) injections and an equally small improvement in pain relief and function later (3 to 12 months) with hyaluronic acid (HA) injections (strength of recommendation [SOR]: B, meta-analysis of a randomized controlled trial and inconsistent RCTs). Guidelines state that CS injections can be considered for symptomatic knee osteoarthritis, but that insufficient evidence exists to recommend HA injections (SOR: B, evidence-based guidelines).

  20. Safety life cycle analysis applied to the engineering of pressure relief valves in process plants

    OpenAIRE

    Basco Montia, Josep

    2016-01-01

    Chemical plants and other industrial installations process and store hazardous materials, which represent a certain risk to people, equipment and the environment. Overpressure is one of the most common upsets in process plants and relief devices (pressure relief valves, rupture discs, overpressure-vacuum valves) are required on process equipment to prevent internal pressures from rising to levels, which could cause catastrophic equipment failure. They are the ultimate line of protection again...

  1. Sistem Identifikasi Relief pada Situs Bersejarah Menggunakan Perangkat Mobile Android (Studi Kasus Candi Borobudur

    Directory of Open Access Journals (Sweden)

    Rajif Agung Yunmar

    2014-07-01

                Identification testing of relief images is done by different variations, ie angle, distance, rotation, intensity of the light and wholeness of image input to see the effect on the relief image recognition results. The proposed identification method gives recognition results of 93.30% and the average computation time for 59.55 seconds.

  2. The practice of history: the Smithsons, Colin St John Wilson, and the writing of architectural history

    Directory of Open Access Journals (Sweden)

    Matthew Wells

    2016-06-01

    Full Text Available The purpose of this paper is to explore the type, form, and methodology of history written by practicing architects following the arrival of kunstgeschichte in Britain. Through an analysis of historical writings by Alison and Peter Smithson, and Colin St John Wilson a series of topics are explored including the relationship between history and practice, the use of different narrative structures, and the qualities that a practicing architect can bring to the study of the past. The paper concludes by emphasising that whilst all history is contemporary history, the association between history and its architect-author was not simplistic but a complex interrelationship of position and intention.

  3. A brief history of videogames

    Directory of Open Access Journals (Sweden)

    Simone Belli

    2008-11-01

    Full Text Available The following text contains a brief journey through a short and yet intense adventure, the history of videogames. Since its beginnings in the 1950's decade to the present time, videogames have progressively changed from a hobby for ingeneering studens to the most powerfull leisure industry. In order to gain a better understanding of this phenomenon it is necessary to look over the path of its transformation from a retrospecive point of view. Such a look has necessarily to focus on those devices and games that had made a landmark in the history of videogames, taking them to their current position. Besides, it is crucial to address their implications in contemporary visual culture, along with current prejudices against them. This is a short account about a great history.

  4. Proactive pressure relief system management of life cycle and ageing in nuclear power plants

    Energy Technology Data Exchange (ETDEWEB)

    Kolenc, J. [Farris Engineering, Edmonton, Alberta (Canada); Ferrar, S. [Farris Engineering, Brantford, Ontario (Canada)

    2011-07-01

    The last major power nuclear station built in North America was built when the Altair Company introduced the first microcomputer sparking the PC frenzy. It is safe to assume that there have been a great many changes since 1977 on both accounts. As the world's aging nuclear plants continue to be challenged with maintenance and replacement issues (obsolescence), as well making improvements within their facilities, proper pressure relief system management looms as a growing concern. This problem grows more acute as new engineering best practices are promulgated across industries and regulatory standards become more rigorous with much stricter enforcements. Unlike most pieces of operating equipment in a nuclear facility, pressure relief devices demand an extra level of consideration; as they form the 'last line of defense'. Combine the on-going obsolescence issue, with today's ever increasing demands for overall plant and public safety; pressure relief safety management will require increasing 'proactive' efforts to ensure safe facilities. This paper has been written to address some global pressure relief system management issues with respect the worlds aging nuclear facilities. This paper reflects findings we have discovered while conducting engineering pressure relief system audits on various nuclear power stations. It should be noted that these finding are not atypical of similar findings in pressure relief systems in the hydrocarbon processing world. (author)

  5. Assessment of plantar pressure in hindfoot relief shoes of different designs.

    Science.gov (United States)

    Hahn, Thomas; Carl, Hans-Dieter; Jendrissek, Andreas; Brem, Matthias; Swoboda, Bernd; Rummel, Philipp; Pauser, Johannes

    2014-01-01

    Although there are several different concepts of hindfoot relief footwear, there are no studies on the extent of pressure reduction to be achieved by this footwear. Therefore, we sought to evaluate the reduction in plantar pressure to be achieved with two different hindfoot relief shoes. Ten healthy volunteers performed three trials at a self-selected speed. Peak pressure values in mass-produced shoes (normal gait) were considered as 100% and were compared with measurements in two differently designed hindfoot relief shoes. Foot portions were defined as heel (0%-15% of total insole length), hindfoot (16%-30%), midfoot (31%-60%), and forefoot (61%-100%). Heel and hindfoot peak pressures were significantly reduced in both shoes compared with normal gait (P shoes. Midfoot peak pressure was not significantly reduced in tested shoes compared with baseline (P > .05) but differed significantly between the two shoes. Forefoot peak pressure was significantly reduced with one of the tested shoes (to a median 73% baseline; P = .004) but not with the other (median, 88% baseline). Hindfoot relief shoes leave a considerable amount of peak pressure, predominantly under the hindfoot. The extent of peak pressure reduction for the heel and the hindfoot varies between different hindfoot relief shoes. Depending on the affected foot area, the kind of hindfoot relief shoe should be carefully chosen.

  6. The roles, barriers and experiences of rehabilitation therapists in disaster relief: post-earthquake Haiti 2010.

    Science.gov (United States)

    Klappa, Susan; Audette, Jennifer; Do, Sandy

    2014-01-01

    This article describes the roles and experiences of rehabilitation therapists involved in disaster relief work (DRW) in Haiti after the 2010 earthquake. The results of a pilot study and phenomenological study are presented. A phenomenological study of rehabilitation providers' experiences in post-disaster relief care is presented along with preliminary pilot study results. The phenomenological study explored the experiences of therapists from a lived experience perspective through the roles they played in DRW. Participants provided disaster relief through direct patient care, adaptive equipment sourcing and allocation, education and training, community outreach and logistic or administrative duties. Barriers and challenges included: (1) emotions: ups and downs; (2) challenges: working at the edge of practice; (3) education: key to success and sustainability; (4) lessons learned: social responsibility is why we go; and (5) difficulty coming home: no one understands. Therapists play a key role in disaster relief situations. Data presented should encourage organizations to include therapists from early planning to implementation of relief services. Further studies are needed to evaluate the impact of rehabilitation interventions in disaster settings. Understanding the roles and experiences of therapists in disaster relief setting is important Certain barriers to providing care in post-disaster settings exist Those participating in disaster response should be well prepared and aware of that they might be asked to do.

  7. Diclofenac suppository versus intramuscular pethidine in post herniorrhaphy pain relief

    Directory of Open Access Journals (Sweden)

    Noroozinia H

    2011-06-01

    Full Text Available "n Normal 0 false false false EN-US X-NONE AR-SA MicrosoftInternetExplorer4 /* Style Definitions */ table.MsoNormalTable {mso-style-name:"Table Normal"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-priority:99; mso-style-qformat:yes; mso-style-parent:""; mso-padding-alt:0in 5.4pt 0in 5.4pt; mso-para-margin:0in; mso-para-margin-bottom:.0001pt; mso-pagination:widow-orphan; font-size:11.0pt; font-family:"Calibri","sans-serif"; mso-ascii-font-family:Calibri; mso-ascii-theme-font:minor-latin; mso-fareast-font-family:"Times New Roman"; mso-fareast-theme-font:minor-fareast; mso-hansi-font-family:Calibri; mso-hansi-theme-font:minor-latin; mso-bidi-font-family:Arial; mso-bidi-theme-font:minor-bidi;} Background: Non-steroidal anti-inflammatory drugs (NSADs and opioids are frequently administered to relieve postoperative pain. Uncontrolled postoperative pain may produce a range of detrimental acute and chronic health consequences and increase mortality and morbidity. Practically, the analgesic efficacy of opioids is typically limited by the development of tolerance to them or by opioid-related side-effects such as nausea, vomiting, sedation or respiratory depression. This study aims to assess the effects of suppository diclofenac on post-herniorrhaphy pain management."n"nMethods: In this prospective double-blind clinical trial, 60 patients who were candidate for the surgical repair of inguinal hernia were divided into two groups. Patients in group A received 100 mg of suppository diclofenac and patients in group B 50 mg of pethidine after the induction of anesthesia and before surgical incision. Postoperative pain assessment was done by an unbiased observer on the arrival of patients in the recovery room, using a 10-cm visual analogue scale (VAS( at 2-hour intervals for 6 hours."n"nResults: Pain relief was similar in the two groups (P=0.3. Patients in group B required more analgesia two hours post-operatively (P=0

  8. Bathymetry, Multibeam, and Coastal Relief: Data on Demand

    Science.gov (United States)

    Sharman, G. F.; Virden, W. T.; Divins, D. L.; Fox, C. G.; Habermann, T.

    2004-12-01

    The National Oceanic and Atmospheric Administration's (NOAA) National Geophysical Data Center (NGDC), Boulder, Colorado is distributing increasing quantities of data via the Internet. With evolving technology and broader bandwidth, it is possible to deliver large volumes (up to 2 GB) of data directly over the Internet and to provide server-side-generated products and services with more user options. In 2004, NGDC (www.ngdc.noaa.gov) initiated a web-based multibeam bathymetric data system,leveraging off geospatial and relational database technologies being utilized at the Center. The system has an ESRI ArcIMS interface, which handles the geospatial character of the data, and provides a standardized GIS interface and tool suite. All of this rests on a foundation Oracle database containing an inventory and metadata. It also uses software developed at NOAA's Pacific Marine Environmental Laboratory, which scripts the National Science Foundation-supported software packages: MBSystem (for managing multibeam data) and Generic Mapping Tools (GMT) (for mapping and display). In whole, the MultiBeam Bathymetric Data Base (MBBDB) (Virden, et al., "Multibeam Bathymetric Data at NOAA/NGDC," OTO '04) enables the web user to browse, discover, review, select, map, and download multibeam data directly, without human intervention by NGDC. A similar development, the NGDC Coastal Relief Model (CRM), http://www.ngdc.noaa.gov/mgg/coastal/coastal.html, is available for download at a variety of sampling intervals. This data set is built on multibeam and conventional offshore hydrography, resampled into a 3 arc-second lat-lon grid, which is matched to a 3 arc-second version of the USGS National Elevation Database (NED). The resulting fusion gives a continuous elevation surface model from the seafloor, across the coastline and onto the land. These data provide the foundation for a multitude of environmental studies and models, such as Tsunami or storm surge propagation, run up, and inundation

  9. History Circles: The Doing of Teaching History

    Science.gov (United States)

    Brown, Sarah Drake

    2009-01-01

    Lesson planning is a critical task in the education of pre-service teachers, but the author has often questioned the extent to which traditional lesson plan formats truly contribute to the teaching and learning of history. Since current research in history education calls for an emphasis on building "historical thinking" skills and content…

  10. Africa in SRTM 3-D, Anaglyph of Shaded Relief

    Science.gov (United States)

    2004-01-01

    This stereoscopic shaded relief image shows Africa's topography as measured by the Shuttle Radar Topography Mission (SRTM) in February 2000. Also shown are Madagascar, the Arabian Peninsula, and other adjacent regions. Previously, much of the topography here was not mapped in detail. Digital elevation data, such as provided by SRTM, are in high demand by scientists studying earthquakes, volcanism, and erosion patterns and for use in mapping and modeling hazards to human habitation. But the shape of Earth's surface affects nearly every natural process and human endeavor that occurs there, so elevation data are used in a wide range of applications. The image shown here is greatly reduced from the original data resolution, but still provides a good overview of the continent's landforms. It is best viewed while panning at full resolution while using image display software. The northern part of the continent consists of a system of basins and plateaus, with several volcanic uplands whose uplift has been matched by subsidence in the large surrounding basins. Many of these basins have been infilled with sand and gravel, creating the vast Saharan lands. The Atlas Mountains in the northwest were created by convergence of the African and Eurasian tectonic plates. The geography of the central latitudes of Africa is dominated by the Great Rift Valley, extending from Lake Nyasa to the Red Sea, and splitting into two arms to enclose an interior plateau and the nearly circular Lake Victoria, visible in the right center of the image. To the west lies the Congo Basin, a vast, shallow depression that rises to form an almost circular rim of highlands. Most of the southern part of the continent rests on a concave plateau comprising the Kalahari Basin and a mountainous fringe, skirted by a coastal plain that widens out in Mozambique in the southeast. Specific noteworthy features one may wish to explore in this scene include (1) the Richat Structure in Mauritania, a 'bull's eye

  11. The value of surgical history.

    Science.gov (United States)

    Rutkow, I M

    1991-08-01

    It remains a rhetorical question whether or not an understanding of surgical history is important to the maturation and continued education of a surgeon. Conversely, it is hardly necessary to dwell on the heuristic value that an appreciation of history provides in developing adjunctive humanistic, literary, and philosophic tastes. Unfortunately, modern medical historians usually hold nonmedical degrees and basically restrict themselves to research concerning medical or public health aspects of social history. Clinical surgical history is increasingly avoided because the professional medical historian has no clinical background. However, practicing surgeons, who can serve as amateur medical historians, have knowledge and experience that place them in a unique position to assess historic facts and direct surgical historic inquiry. It is my belief that if medicine were taught with a greater emphasis on the historic approach, our country's physicians would be better prepared to cope with the health care problems of the future. By increasing the number of surgeons, who as an avocation, research and write about surgical history, our ability to provide better surgical care in our nation's coming years will be enhanced.

  12. Challenges of correlating pH change with relief of clinical symptoms in gastro esophageal reflux disease: a phase III, randomized study of Zegerid versus Losec.

    Science.gov (United States)

    Walker, Dave; Ng Kwet Shing, Richard; Jones, Deborah; Gruss, Hans-Jurgen; Reguła, Jarosław

    2015-01-01

    Zegerid (on demand immediate-release omeprazole and sodium bicarbonate combination therapy) has demonstrated earlier absorption and more rapid pH change compared with Losec (standard enteric coated omeprazole), suggesting more rapid clinical relief of heartburn. This Phase III, multicenter, double-blind, double-dummy, randomized study assessed the clinical superiority of Zegerid versus Losec for rapid relief of heartburn associated with gastro-esophageal reflux disease (GERD). Patients with a history of frequent (2 3 days/week) uncomplicated GERD, were randomized to receive Zegerid (20 mg) or Losec (20 mg) with corresponding placebo. Study medication was self-administered on the first episode of heartburn, and could be taken for up to 3 days within a 14 day study period. Heartburn severity was self assessed up to 180 minutes post dose (9 point Likert scale). Primary endpoint was median time to sustained response (≥3 point reduction in heartburn severity for ≥45 minutes). Of patients randomized to Zegerid (N=122) or Losec (N=117), 228/239 had recorded ≥1 evaluable heartburn episodes and were included in the modified intent-to-treat population. No significant between-group differences were observed for median time to sustained response (60.0 vs. 52.2 minutes, Zegerid [N=117] and Losec [N=111], respectively), sustained partial response (both, 37.5 minutes) and sustained total relief (both, 105 minutes). Significantly more patients treated with Zegerid reached sustained total relief within 0-30 minutes post dose in all analysis sets (p<0.05). Both treatments were well tolerated and did not raise any safety concerns. Superiority of Zegerid over Losec for rapid heartburn relief was not demonstrated; both treatments were equally effective however the rapid onset of action of Losec was unexpected. Factors, including aspects of study design may have contributed to this. This study supports previously reported difficulty in correlating intra-gastric pH change with

  13. Challenges of correlating pH change with relief of clinical symptoms in gastro esophageal reflux disease: a phase III, randomized study of Zegerid versus Losec.

    Directory of Open Access Journals (Sweden)

    Dave Walker

    Full Text Available Zegerid (on demand immediate-release omeprazole and sodium bicarbonate combination therapy has demonstrated earlier absorption and more rapid pH change compared with Losec (standard enteric coated omeprazole, suggesting more rapid clinical relief of heartburn. This Phase III, multicenter, double-blind, double-dummy, randomized study assessed the clinical superiority of Zegerid versus Losec for rapid relief of heartburn associated with gastro-esophageal reflux disease (GERD.Patients with a history of frequent (2 3 days/week uncomplicated GERD, were randomized to receive Zegerid (20 mg or Losec (20 mg with corresponding placebo. Study medication was self-administered on the first episode of heartburn, and could be taken for up to 3 days within a 14 day study period. Heartburn severity was self assessed up to 180 minutes post dose (9 point Likert scale. Primary endpoint was median time to sustained response (≥3 point reduction in heartburn severity for ≥45 minutes.Of patients randomized to Zegerid (N=122 or Losec (N=117, 228/239 had recorded ≥1 evaluable heartburn episodes and were included in the modified intent-to-treat population. No significant between-group differences were observed for median time to sustained response (60.0 vs. 52.2 minutes, Zegerid [N=117] and Losec [N=111], respectively, sustained partial response (both, 37.5 minutes and sustained total relief (both, 105 minutes. Significantly more patients treated with Zegerid reached sustained total relief within 0-30 minutes post dose in all analysis sets (p<0.05. Both treatments were well tolerated and did not raise any safety concerns.Superiority of Zegerid over Losec for rapid heartburn relief was not demonstrated; both treatments were equally effective however the rapid onset of action of Losec was unexpected. Factors, including aspects of study design may have contributed to this. This study supports previously reported difficulty in correlating intra-gastric pH change with

  14. History of allergy in antiquity.

    Science.gov (United States)

    Ring, Johannes

    2014-01-01

    Allergic diseases are not new. They have been described in the early medical literature in various cultures like Egypt, China, indigenous America and in the Greco-Roman tradition. The terms 'idiosyncrasy', 'asthma' and 'eczema' are still in use today. The most famous allergic individual of antiquity with the whole triad of atopic diseases and a positive family history of atopy probably was Emperor Octavianus Augustus. © 2014 S. Karger AG, Basel.

  15. Bas-relief map using texture analysis with application to live enhancement of ultrasound images.

    Science.gov (United States)

    Du, Huarui; Ma, Rui; Wang, Xiaoying; Zhang, Jue; Fang, Jing

    2015-05-01

    For ultrasound imaging, speckle is one of the most important factors in the degradation of contrast resolution because it masks meaningful texture and has the potential to interfere with diagnosis. It is expected that researchers would explore appropriate ways to reduce the speckle noise, to find the edges of structures and enhance weak borders between different organs in ultrasound imaging. Inspired by the principle of differential interference contrast microscopy, a "bas-relief map" is proposed that depicts the texture structure of ultrasound images. Based on a bas-relief map, an adaptive bas-relief filter was developed for ultrafast despeckling. Subsequently, an edge map was introduced to enhance the edges of images in real time. The holistic bas-relief map approach has been used experimentally with synthetic phantoms and digital ultrasound B-scan images of liver, kidney and gallbladder. Based on the visual inspection and the performance metrics of the despeckled images, it was found that the bas-relief map approach is capable of effectively reducing the speckle while significantly enhancing contrast and tissue boundaries for ultrasonic images, and its speckle reduction ability is comparable to that of Kuan, Lee and Frost filters. Meanwhile, the proposed technique could preserve more intra-region details compared with the popular speckle reducing anisotropic diffusion technique and more effectively enhance edges. In addition, the adaptive bas-relief filter was much less time consuming than the Kuan, Lee and Frost filter and speckle reducing anisotropic diffusion techniques. The bas-relief map strategy is effective for speckle reduction and live enhancement of ultrasound images, and can provide a valuable tool for clinical diagnosis. Copyright © 2015 World Federation for Ultrasound in Medicine & Biology. Published by Elsevier Inc. All rights reserved.

  16. Early history of the Riemann Hypothesis in positive characteristic

    NARCIS (Netherlands)

    Oort, F.; Schappacher, Norbert

    2016-01-01

    The classical Riemann Hypothesis RH is among the most prominent unsolved problems in modern mathematics. The development of Number Theory in the 19th century spawned an arithmetic theory of polynomials over finite fields in which an analogue of the Riemann Hypothesis suggested itself. We describe

  17. History of Bioterrorism: Botulism

    Science.gov (United States)

    ... is Doing Blog: Public Health Matters Video: "The History of Bioterrorism" Recommend on Facebook Tweet Share Compartir ... as bioterrorist weapons. Watch the Complete Program "The History of Bioterroism" (26 min 38 sec) Watch Specific ...

  18. History of Bioterrorism: Botulism

    Medline Plus

    Full Text Available ... is Doing Blog: Public Health Matters Video: "The History of Bioterrorism" Recommend on Facebook Tweet Share Compartir ... as bioterrorist weapons. Watch the Complete Program "The History of Bioterroism" (26 min 38 sec) Watch Specific ...

  19. "Hillary - en god historie"

    DEFF Research Database (Denmark)

    Bjerre, Thomas Ærvold

    2007-01-01

    Anmeldelse af Carl Bernsteins Hillary Rodham Clinton og Michael Ehrenreichs Hillary - En amerikansk historie Udgivelsesdato: 15. november......Anmeldelse af Carl Bernsteins Hillary Rodham Clinton og Michael Ehrenreichs Hillary - En amerikansk historie Udgivelsesdato: 15. november...

  20. History of Bioterrorism: Botulism

    Medline Plus

    Full Text Available ... Information Social Media Zombie Apocalypse What’s New Video: "The History of Bioterrorism" Recommend on Facebook Tweet Share ... or can be used as bioterrorist weapons. Watch the Complete Program "The History of Bioterroism" (26 min ...

  1. Mere historie og kulturarv?

    DEFF Research Database (Denmark)

    Olesen, Marie Bonde; Brunbech, Peter

    2016-01-01

    Præsentation af HistorieLab og om folkeskolereformen og kulturinstitutionernes muligheder og udfordringer i samarbejdet med skolerne......Præsentation af HistorieLab og om folkeskolereformen og kulturinstitutionernes muligheder og udfordringer i samarbejdet med skolerne...

  2. History of Bioterrorism: Botulism

    Medline Plus

    Full Text Available ... Social Media Zombie Apocalypse What’s New Video: "The History of Bioterrorism" Recommend on Facebook Tweet Share Compartir ... as bioterrorist weapons. Watch the Complete Program "The History of Bioterroism" (26 min 38 sec) Watch Specific ...

  3. History and Epic Poetry.

    Science.gov (United States)

    Turk, Thomas N.

    1994-01-01

    Describes the use of epic poetry in a combined English/history humanities class. Concludes that epic poetry, the combination of history and verse, helps students understand the continuity and meaning of the Western tradition. (CFR)

  4. History of Bioterrorism: Botulism

    Medline Plus

    Full Text Available ... CDC is Doing Blog: Public Health Matters Video: "The History of Bioterrorism" Recommend on Facebook Tweet Share ... or can be used as bioterrorist weapons. Watch the Complete Program "The History of Bioterroism" (26 min ...

  5. Canadian petroleum history bibliography

    Energy Technology Data Exchange (ETDEWEB)

    Cass, D.

    2003-09-27

    The Petroleum History Bibliography includes a list of more than 2,000 publications that record the history of the Canadian petroleum industry. The list includes books, theses, films, audio tapes, published articles, company histories, biographies, autobiographies, fiction, poetry, humour, and an author index. It was created over a period of several years to help with projects at the Petroleum History Society. It is an ongoing piece of work, and as such, invites comments and additions.

  6. Diet History Questionnaire: Database Revision History

    Science.gov (United States)

    The following details all additions and revisions made to the DHQ nutrient and food database. This revision history is provided as a reference for investigators who may have performed analyses with a previous release of the database.

  7. Towards a European History

    NARCIS (Netherlands)

    H. van Dijk (Henk)

    2000-01-01

    textabstractAlthough historical writing is a profession with a long tradition, history as an academic discipline is strongly related to the development of the nation state in the nineteenth century. Notwithstanding specialisations like e.g. cultural history and social and economic history put less

  8. Mellem historie- og krigsvidenskab

    DEFF Research Database (Denmark)

    Hansen Schøning, Anna Sofie

    2016-01-01

    The article investigates how military history was taught as part of the Danish higher officer education from 1830 to 1920 and how the subject was affected by developments in academic history and the science of war. It argues that military history, as it was taught in the formal officer education...

  9. Correct Diagnosis Provides Relief for Those with Dry Mouth

    Science.gov (United States)

    ... Job? Start by Visiting the Dentist Pacifiers Have Negative and Positive Effects Are You Biting Off More Than You Can Chew? Learn what those dental words mean. Check out how your teeth and mouth change in every stage of life. More RSS ...

  10. Designing and Pre-Positioning Humanitarian Assistance Pack-Up Kits (HA PUKs) to Support Pacific Fleet Emergency Relief Operations

    Science.gov (United States)

    2006-12-01

    will flutter to the ground [Smith, 2004]. These meals are nutritious , can be eaten by virtually anyone regardless of culture or religion, and are cost...cm), • 3 kg of laundry soap, • 100 g Bar of body soap, • 250 ml Baby shampoo, • 250 ml Baby lotion, • 250 g Baby powder, • 12 washable diapers...2342 3 0.002 0.01 $ 0.2 1 per infant kit Baby soap - Johnson’s baby bar (3 oz bar ) unavail 44 0.000 0.00 $ 0.2 1 per infant kit Baby

  11. S-equol: a potential nonhormonal agent for menopause-related symptom relief.

    Science.gov (United States)

    Utian, Wulf H; Jones, Michelle; Setchell, Kenneth D R

    2015-03-01

    Many women suffering from vasomotor symptoms (VMS) are now seeking nonpharmaceutical treatments for symptom relief. Recently, S-equol, an intestinal bacterial metabolite of the soybean isoflavone daidzein has received attention for its ability to alleviate VMS and provide other important health benefits to menopausal women. S-equol is found in very few foods and only in traces. About 50% of Asians and 25% of non-Asians host the intestinal bacteria that convert daidzein into S-equol. Clinical trials that evaluated the efficacy of an S-equol-containing product found that VMS were alleviated but these trials were limited in scope and primarily involved Japanese women for whom hot flashes are a minor complaint. The only trial in the United States evaluating hot flashes found symptoms were significantly reduced by S-equol, but the study lacked a placebo group, although it did include a positive control. The daily dose of S-equol used in most trials was 10 mg, and because the half-life of S-equol is 7-10 hours, to maximize efficacy, it was taken twice daily. Subanalysis of epidemiologic studies suggests that equol producers are more likely to benefit from soyfood consumption than nonproducers with respect to both cardiovascular disease and osteoporosis, although the data are inconsistent. The limited safety data for S-equol do not suggest cause for concern, especially with regard to its effects on breast and endometrial tissue. Further studies are needed before definitive conclusions of its effectiveness for VMS can be made, but the preliminary evidence warrants clinicians discussing the potential of S-equol for the alleviation of VMS with patients.

  12. Post-traumatic stress disorder status in a rescue group after the Wenchuan earthquake relief.

    Science.gov (United States)

    Huang, Junhua; Liu, Qunying; Li, Jinliang; Li, Xuejiang; You, Jin; Zhang, Liang; Tian, Changfu; Luan, Rongsheng

    2013-07-15

    Previous studies have suggested that the incidence of post-traumatic stress disorder in earthquake rescue workers is relatively high. Risk factors for this disorder include demographic characteristics, earthquake-related high-risk factors, risk factors in the rescue process, personality, social support and coping style. This study examined the current status of a unit of 1 040 rescue workers who participated in earthquake relief for the Wenchuan earthquake that occurred on May 12(th), 2008. Post-traumatic stress disorder was diagnosed primarily using the Clinician-Administered Post-traumatic Stress Disorder Scale during structured interviews. Univariate and multivariate statistical analyses were used to examine major risk factors that contributed to the incidence of post-traumatic stress disorder. Results revealed that the incidence of this disorder in the rescue group was 5.96%. The impact factors in univariate analysis included death of family members, contact with corpses or witnessing of the deceased or seriously injured, near-death experience, severe injury or mental trauma in the rescue process and working at the epicenter of the earthquake. Correlation analysis suggested that post-traumatic stress disorder was positively correlated with psychotic and neurotic personalities, negative coping and low social support. Impact factors in multivariate logistic regression analysis included near-death experience, severe injury or mental trauma, working in the epicenter of the rescue, neurotic personality, negative coping and low social support, among which low social support had the largest odds ratio of 20.42. Findings showed that the occurrence of post-traumatic stress disorder was the result of the interaction of multiple factors.

  13. Oral pregabalin for postoperative pain relief after third molar extraction: a randomized controlled clinical trial.

    Science.gov (United States)

    Olmedo-Gaya, Maria Victoria; Manzano-Moreno, Francisco J; Galvez-Mateos, Rafael; González-Rodriguez, Maria Paloma; Talero-Sevilla, Cristina; Vallecillo-Capilla, Manuel

    2016-09-01

    The aim of this randomized controlled clinical trial was to evaluate the efficacy and safety of pregabalin administered pre- and postoperatively in patients with pain and swelling due to the surgical removal of impacted lower third molars. The final study sample comprised 60 volunteers (23 males and 37 females). Group 1 (n = 30) received 75 mg oral pregabalin 1 h before surgery and 1 h after surgery. Group 2 (n = 30) served as a control group and received no pregabalin. Both groups were administered with 650 mg paracetamol every 8 h for 2 days. Postoperative pain intensity and swelling were measured using a visual analog scale (VAS); pain relief experienced was reported using a four-point verbal rating scale (VRS); the rescue medication requirement, adverse effects, and global impression of the medication were also recorded. No significant difference in pain intensity (VAS) was observed between the groups. However, fewer rescue medication tablets were needed by pregabalin-treated patients than by controls (p = 0.021). The frequency and intensity of adverse effects were significantly higher in pregabalin-treated patients (p medication received was more positive in the pregabalin group (p = 0.042). The administration of pregabalin reduces the requirement for rescue medication after third molar surgery and results in a more constant pain level, with fewer peaks of pain intensity. These findings suggest that pregabalin may be useful to control acute postoperative pain. Adverse effects are known to be reduced at the low pregabalin dose used in our study.

  14. Threshold responses in regional runoff from a heterogeneous low relief terrain - Western Canada's Boreal Plains

    Science.gov (United States)

    Devito, Kevin; Anderson, Axel; Kettridge, Nick; Mendoza, Carl; Petrone, Rich; Silins, Uldis; Smith, Kevin; Waddington, Mike

    2014-05-01

    Runoff from larger catchments (>1000km) in the continental Boreal Plains (BP) eco-region of Western Canada, although low, can range over 3 orders of magnitude (4 mm to 350 mm/yr) among years and be difficult to predict. This region of western Canada is experiencing unprecedentedly rapid and large-scale industrial development. There is a need to assess and understand the dominant controls on the temporal and spatial threshold responses of regional runoff generation to be able to predict and mitigate the potential impacts of land use and effectiveness of reclamation practices on surface water quantity and quality. The Boreal Plain climate has regional moisture deficit (P 200 mm) states occurring every 2-3 decades. The differing CMD states altered the hydrologic connectivity among different portions of HRA's and HUs within catchments. During dry states base flow conditions ranged by over an order of magnitude (2 to 80 mm/yr), and increased with percent area of coarse textured HRAs. In fine textured landforms significant runoff was observed only in catchments with >30% wetland area. During mesic conditions catchment runoff coefficients were positively correlated with percent wetland area, suggesting that wetland networks were the primary source areas of surface water to regional runoff. During the infrequent wet states, runoff coefficients were similar among all catchments indicating that storage in forest HUs was exceeded and both forestlands and wetlands contribute to catchment runoff. Integrating the CMD with the configuration of wetland and forestland HUs and the type of glacial landforms HRAs rather than topographic drainage networks appears to better represent water cycling and sink source dynamics controlling runoff in low relief glacial landscapes such as the Boreal Plain.

  15. The dynamic implications of debt relief for low-income countries

    Directory of Open Access Journals (Sweden)

    Alma Lucía Romero-Barrutieta

    2015-06-01

    Full Text Available Debt relief provides low-income countries with an incentive to accumulate debt, boost consumption, and reduce investment over time. We quantify this incentive effect employing a dynamic stochastic general equilibrium model, calibrated to 1982–2006 Ugandan data, and find that long-run debt and consumption-to-GDP ratios are about twice as high with debt relief than without it, while the investment-to-GDP ratio is sixty percent lower. Our simulations show that debt-relief episodes are likely to have only a temporary impact on debt levels but may have a lasting effect over the size of the economy, lowering GDP growth up to twenty percent over time. These results fill a gap in the debt relief literature since, to the best of our knowledge, the quantification of incentive effects is rather scarce. The paper further contributes to the literature by constructing a tractable structural model that is able to replicate the data well and captures key features of low-income countries facing the possibility of debt relief.

  16. Sigh rate during emotional transitions: More evidence for a sigh of relief.

    Science.gov (United States)

    Vlemincx, Elke; Meulders, Michel; Abelson, James L

    2017-04-01

    Evidence suggests that sighs regulate stress and emotions, e.g. by facilitating relief. This study aimed to investigate sigh rates during relief. In addition, links between sighs, anxiety sensitivity and HPA-axis activity were explored. Healthy volunteers (N=29) were presented cues predicting the valence of subsequent stimuli. By sequencing cues that predicted pleasant or unpleasant stimuli with or without certainty, transitions to certain pleasantness (relief) or to certain unpleasantness (control) were created and compared to no transitions. Salivary cortisol, anxiety sensitivity and respiration were measured. Sigh frequency was significantly higher during relief than during control transitions and no transition states, and higher during control transitions than during no transition states. Sigh frequency increased with steeper cortisol declines for high anxiety sensitive persons. Results confirm a relationship between sighs and relief. In addition, results suggest that sigh frequency is importantly related to HPA-axis activity, particularly in high anxiety sensitive persons. Copyright © 2017 Elsevier B.V. All rights reserved.

  17. 'Birthgasm': A Literary Review of Orgasm as an Alternative Mode of Pain Relief in Childbirth.

    Science.gov (United States)

    Mayberry, Lorel; Daniel, Jacqueline

    2016-12-01

    Childbirth is a fundamental component of a woman's sexual cycle. The sexuality of childbirth is not well recognized in Western society despite research showing that some women experience orgasm(s) during labor and childbirth. Current thinking supports the view that labor and childbirth are perceived to be physically painful events, and more women are relying on medical interventions for pain relief in labor. This review explores the potential of orgasm as a mode of pain relief in childbirth and outlines the physiological explanations for its occurrence. Potential barriers to sexual expression during childbirth and labor, including the influence of deeply held cultural beliefs about sexuality, the importance of privacy and intimacy in facilitating orgasmic birth experiences, and the value of including prospective fathers in the birthing experience, are discussed. The role of midwives and their perceptions of the use of complementary and alternative therapies for pain relief in labor are examined. While there are indications of widespread use of complementary and alternative therapies such as hydrotherapy, herbal remedies, and breathing techniques for pain relief in childbirth, orgasm was not among those mentioned. Lack of recognition of the sexuality of childbirth, despite findings that orgasm can attenuate the effects of labor pain, suggests the need for greater awareness among expectant parents, educators, and health professionals of the potential of orgasm as a means of pain relief in childbirth. © The Author(s) 2015.

  18. Ubiquitous Creation of Bas-Relief Surfaces with Depth-of-Field Effects Using Smartphones

    Directory of Open Access Journals (Sweden)

    Bong-Soo Sohn

    2017-03-01

    Full Text Available This paper describes a new method to automatically generate digital bas-reliefs with depth-of-field effects from general scenes. Most previous methods for bas-relief generation take input in the form of 3D models. However, obtaining 3D models of real scenes or objects is often difficult, inaccurate, and time-consuming. From this motivation, we developed a method that takes as input a set of photographs that can be quickly and ubiquitously captured by ordinary smartphone cameras. A depth map is computed from the input photographs. The value range of the depth map is compressed and used as a base map representing the overall shape of the bas-relief. However, the resulting base map contains little information on details of the scene. Thus, we construct a detail map using pixel values of the input image to express the details. The base and detail maps are blended to generate a new depth map that reflects both overall depth and scene detail information. This map is selectively blurred to simulate the depth-of-field effects. The final depth map is converted to a bas-relief surface mesh. Experimental results show that our method generates a realistic bas-relief surface of general scenes with no expensive manual processing.

  19. Ubiquitous Creation of Bas-Relief Surfaces with Depth-of-Field Effects Using Smartphones.

    Science.gov (United States)

    Sohn, Bong-Soo

    2017-03-11

    This paper describes a new method to automatically generate digital bas-reliefs with depth-of-field effects from general scenes. Most previous methods for bas-relief generation take input in the form of 3D models. However, obtaining 3D models of real scenes or objects is often difficult, inaccurate, and time-consuming. From this motivation, we developed a method that takes as input a set of photographs that can be quickly and ubiquitously captured by ordinary smartphone cameras. A depth map is computed from the input photographs. The value range of the depth map is compressed and used as a base map representing the overall shape of the bas-relief. However, the resulting base map contains little information on details of the scene. Thus, we construct a detail map using pixel values of the input image to express the details. The base and detail maps are blended to generate a new depth map that reflects both overall depth and scene detail information. This map is selectively blurred to simulate the depth-of-field effects. The final depth map is converted to a bas-relief surface mesh. Experimental results show that our method generates a realistic bas-relief surface of general scenes with no expensive manual processing.

  20. The relief formed by the descent phenomenon in the north-east part of Kosova.

    Science.gov (United States)

    Bulliqi, Shpejtim; Isufi, Florim; Ramadani, Ibrahim; Gashi, Gani

    2012-04-01

    In the diverse relief of north-east part of Kosova a relatively wide range occupies the relief modelled by the descent phenomenon, which is conditioned by morph-structural and climatic factors quite suitable for their development. The morphogenesis activity of descent phenomenon is conditioned by the types of rocks, tectonic process of this region and climatic conditions. These factors condition horizontal and vertical relief fragmentation, slope, especially in Gollaku mountains and in SE part of Kopaonik mountain. Along the tectonic descents, the steepness is detaching and the detaching lines consisting of magmatic rocks show overthrows, demolitions and stony torrents, but the Teri gene composition formations are modelled by sliding and muddy torrents, depending upon the presence of clayey and alevrolite belts on these Teri gene ones. The impact of factors and conditions on the relief of this part, the phenomena like demolitions, overthrows, sliding, muddy torrents, stony torrents, etc, operate here, which play an important morphological role in the modelling of relief.

  1. Strain relief InGaN/GaN MQW micro-pillars for high brightness LEDs

    KAUST Repository

    Shen, Chao

    2013-01-01

    Micro-structured group-III-nitrides are considered as promising strain relief structures for high efficiency solid state lighting. In this work, the strain field in InGaN/GaN multi-quantum wells (MQWs) micro-pillars is investigated using micro-Raman spectroscopy and the design of micro-pillars were studied experimentally. We distinguished the strained and strain-relieved signatures of the GaN layer from the E2 phonon peak split from the Raman scattering signatures at 572 cm-1 and 568 cm-1, respectively. The extent of strain relief is examined considering the height and size of micro-pillars fabricated using focused ion beam (FIB) micro-machining technique. A significant strain relief can be achieved when one micro-machined through the entire epi-layers, 3 μm in our study. The dependence of strain relief on micro-pillar diameter (D) suggested that micro-pillar with D < 3 μm showed high degree of strain relief. Our results shed new insights into designing strain-relieved InGaN/GaN microstructures for high brightness light emitting diode arrays. © 2013 IEEE.

  2. Conflict, Memory, and Positioning

    DEFF Research Database (Denmark)

    Brescó, Ignacio

    2016-01-01

    The aim of this paper was to bring the dialogical and multivoiced dimension of conflict to the fore in the study of how people remember a particular event in the past. Drawing from different case studies, it contains analyses of how subjects identifying with different political actors in the Basq...... with a discussion on the role of history teaching in promoting a more critical, reflexive, and pluralistic way of dealing with memory, and hence with conflict....... conflict adopted their respective positions, and interpretation of the conflict, and how, in light of same, they reconstruct the failed peace process that took place in 2006 between the terrorist group ETA (Euzkadi ta Azcatasuna, or Basque Country and Freedom in English) and the Spanish government. Results...

  3. Reflections on the history of occupational stress in hospice/palliative care.

    Science.gov (United States)

    Vachon, M L

    1999-01-01

    The concept of hospice and palliative care emerged a quarter of a century ago out of recognition of the unmet needs of dying persons and the social issues of the 1960s and 1970s. The issues of the day included the sexual revolution; a questioning of social values; an increased awareness of death resulting from the murder of the Kennedy brothers and Martin Luther King and daily television exposure to deaths in the Vietnam War, feminism, consumerism, reclaiming a more humanized role in the birth process, and hence in the process of death. The history of the hospice movement and the stress experienced by staff is traced from the early developmental days through to the present. Initially there was sometimes a struggle to integrate the concepts of relief of physical symptoms with meeting the psychosocial and emotional needs of patients and families, caregivers were expected to sacrifice much of their personal life for work, emotional intensity was high and supports were developed to ease some of the stress experienced by caregivers. From the early days team stress and burnout have been issues of concern. In the 1980s issues involved establishing funding sources, dealing with the new crisis of AIDS, and dealing with the gap between the ideal and the real. In the 1990s the economic climate has escalated some of the tensions that have always existed as hospice attempts to position itself within mainstream care with diminishing fiscal resources. These are issues that confront us as we move into the next century.

  4. KSC History Project

    Science.gov (United States)

    Moore, Patrick K.

    2003-01-01

    The 2003 NASA/ASEE KSC History Project focused on a series of six history initiatives designed to acquire, preserve, and interpret the history of Kennedy Space Center. These six projects included the completion of Voices From the Cape, historical work co-authored with NASA historian Roger Launius, the completion of a series of oral histories with key KSC personnel, expansion of monograph on Public Affairs into two comprehensive pieces on KSC press operations and KSC visitor operations, the expansion of KSC Historical Concept Maps (Cmap) for history knowledge preservation, the expansion of the KSC oral history program through the administration of an oral history workshop for KSC-based practitioners, and the continued collaborative relationships between Kennedy Space Center, the University of West Florida, the University of Central Florida and other institutions including the University of Louisiana at Lafayette.

  5. Portraying User Interface History

    DEFF Research Database (Denmark)

    Jørgensen, Anker Helms

    2008-01-01

    The user interface is coming of age. Papers adressing UI history have appeared in fair amounts in the last 25 years. Most of them address particular aspects such as an in­novative interface paradigm or the contribution of a visionary or a research lab. Contrasting this, papers addres­sing UI...... history at large have been sparse. However, a small spate of publications appeared recently, so a reasonable number of papers are available. Hence this work-in-progress paints a portrait of the current history of user interfaces at large. The paper first describes a theoretical framework recruited from...... in that they largely address prevailing UI techno­logies, and thirdly history from above in that they focus on the great deeds of the visionaries. The paper then compares this state-of-art in UI history to the much more mature fields history of computing and history of technology. Based hereon, some speculations...

  6. Three concepts of history

    Directory of Open Access Journals (Sweden)

    Antonio Campillo

    2016-05-01

    Full Text Available The aim of this article is twofold. On the one hand, I will outline the diverse usages that the concept of history has taken on throughout Western history. These different usages may be grouped together in three semantic fields (history as a way of knowing, as a way of being and as a way of doing, which correspond to three ways of understanding the Philosophy of History: as Epistemology of History, as Ontology of historicity and as ethical-political Critique of the present. On the other hand, I will show that these three concepts of history (and, accordingly, the three ways of understanding the Philosophy of History refer mutually to each other and, thus, are inseparable from each other.

  7. Intelligence, Surveillance, and Reconnaissance Support to Humanitarian Relief Operations within the United States: Where Everyone is in Charge

    National Research Council Canada - National Science Library

    Sovada, Jennifer P

    2008-01-01

    ... the leadership of the military, federal government, and state governments since Hurricane Katrina. These organizations have deemed ISR support essential to conducting timely, effective, and responsive relief operations...

  8. Ear Acupuncture versus  local anaestethic for pain relief during perineal repair - a randomised controlled trial

    DEFF Research Database (Denmark)

    Kindberg, Sara

    2007-01-01

    ACUPUNCTURE OR LOCAL ANAESTETICS FOR PAIN RELIEF DURING PERINEAL REPAIR AFTER VAGINAL DELIVERY: A RANDOMISED CONTROLLED TRIAL.   By:  Sara Kindberg. Midwife and PhD student, Sønderborg Hospital, Denmark. Objective: To evaluate acupuncture as a new method of pain relief for postpartum perineal...... as photos of the acupuncture points. Perspectives:  Basic midwifery services such as providing sufficient pain relief during perineal repair still need improvement. Clinical practice should be improved continuously and thus produce reliable evidence on different pain relief methods. Website:        http...

  9. Acid-suppressive therapy with esomeprazole for relief of unexplained chest pain in primary care: a randomized, double-blind, placebo-controlled trial.

    Science.gov (United States)

    Flook, Nigel W; Moayyedi, Paul; Dent, John; Talley, Nicholas J; Persson, Tore; Karlson, Björn W; Ruth, Magnus

    2013-01-01

    High-quality data regarding the efficacy of acid-suppressive treatment for unexplained chest pain are lacking. The aim of this study was to evaluate the efficacy of esomeprazole in primary-care treatment of patients with unexplained chest pain stratified for frequency of reflux/regurgitation symptoms. Patients with a ≥ 2-week history of unexplained chest pain (unrelated to gastroesophageal reflux) who had at least moderate pain on ≥ 2 of the last 7 days were stratified by heartburn/regurgitation frequency (≤ 1 day/week (stratum 1) vs. ≥ 2 days/week (stratum 2)) and randomized to 4 weeks of double-blind treatment with twice-daily esomeprazole 40 mg or placebo. Chest pain relief during the last 7 days of treatment (≤ 1 day with minimal symptoms assessed daily using a 7-point scale) was analyzed by stratum in keeping with the predetermined analysis plan. Overall, 599 patients (esomeprazole: 297, placebo: 302) were randomized. In stratum 1, more esomeprazole than placebo recipients achieved chest pain relief (38.7% vs. 25.5%; P=0.018); no between-treatment difference was observed in stratum 2 (27.2% vs. 24.2%; P=0.54). However, esomeprazole was superior to placebo in a post-hoc analysis of the whole study population (combined strata; 33.1% vs. 24.9%; P=0.035). A 4-week course of high-dose esomeprazole provided statistically significant relief of unexplained chest pain in primary-care patients who experienced infrequent or no heartburn/regurgitation, but there was no such significant reduction in patients with more frequent reflux symptoms.

  10. History of magnetorheological finishing

    Science.gov (United States)

    Harris, Daniel C.

    2011-06-01

    Magnetorheological finishing (MRF) is a deterministic method for producing complex optics with figure accuracy businessman Lowell Mintz was invited to Minsk in 1990 to explore possibilities for technology transfer. Mintz was told of the potential for MRF, but did not understand whether it had value. Mintz was referred to Harvey Pollicove at the Center for Optics Manufacturing of the University of Rochester. As a result of their conversation, they sent Prof. Steve Jacobs to visit Minsk and evaluate MRF. From Jacobs' positive findings, and with support from Lowell Mintz, Kordonski and his colleagues were invited in 1993 to work at the Center for Optics Manufacturing with Jacobs and Don Golini to refine MRF technology. A "preprototype" finishing machine was operating by 1994. Prof. Greg Forbes and doctoral student Paul Dumas developed algorithms for deterministic control of MRF. In 1996, Golini recognized the commercial potential of MRF, secured investment capital from Lowell Mintz, and founded QED Technologies. The first commercial MRF machine was unveiled in 1998. It was followed by more advanced models and by groundbreaking subaperture stitching interferometers for metrology. In 2006, QED was acquired by and became a division of Cabot Microelectronics. This paper recounts the history of the development of MRF and the founding of QED Technologies.

  11. A Study on the Pressure Relief Scope and the Stress Variation of Hydraulic Flushing Borehole

    Directory of Open Access Journals (Sweden)

    C. F.Wei

    2014-01-01

    Full Text Available To study the variation of the pressure relief scope and the stress around hydraulic flushing borehole, the theory of coalrock damage was utilized to distinguish the interaction area of water-jet and coal-rock into the coal-rock crushing area, the water-jet pressure stagnation area, the transition area and the original stress recovery area of coal-rock. Based on the actual occurrence conditions of the coal seam, the pressure variation and relief scope around the hydraulic flushing borehole were analyzed and simulated by RFPA2D-Flow software. The results showed that a relief area with the radius of 5.0 ~ 6.0 m around the borehole formed due to the hydraulic flushing with the pressure relief of 0.038 ~ 6.545 MPa, and the maximum principal stress is 15.85 MPa with a distance of 6.8 m from the inspected hole where stress concentration appeared. After hydraulic flushing test, the diameter (441.8 ~ 1171.6 mm of the hole which can be an expression of coal crushing area size, was calculated based on the examination of the coal amount through the trial process, and it can be drawn that the pressure relief area must be larger than that of the coal-rock crushing area. Meanwhile, the measured pressures relief range(5.96 ~ 6.62 m is basically consistent with the numerical simulation result (5.0 ~ 6.0 m which verified the accuracy of the simulation analysis, according to the distance from the inspection drilling to the hydraulic flushing borehole and the decreased degree of the gas content in the inspection hole by the way of Gas Content.

  12. Numerical studies on surrounding rock deformation controlled by pressure relief groove in deep roadway

    Science.gov (United States)

    Liu, Chaoke; Ren, Jianxi; Zhang, Kun; Chen, Shaojie

    2017-05-01

    After entering deep mining, the roadway is in a high stress state, the deformation of surrounding rock becomes larger, and the roadway floor is particularly significant under unsupported state, which brings great difficulty to the safe production and support of the coal mine. Pressure relief method can change the stress field of surrounding rocks so that the surrounding rock can be in stress-reducing area. The present paper studied the deformation law of the roadway and the changes in the stress state and plastic zone of the surrounding rocks around the roadway before and after the excavation of pressure relief groove on the bottom floor of the high-stress roadway by using FLAC under the engineering background of one mine in Binchang, analyzed the influence of different groove depths and widths on the floor heave, convergence on both sides and roof subsidence. The simulation results show that: after the roadway floor was grooved in the high stress roadway, a larger stress-relaxed area will be formed near the roadway floor, the stress will be transferred to the deep roadway floor, and the pressure relief groove plays a better control effect on the deformation of the high-stress roadway. With the increase of the width and depth of the pressure relief groove, the convergence of the top and bottom of the roadway will be decreased accordingly, but the effect is not significant, while its influence on the convergence on both sides is relatively significant. After applying the simulation results to the engineering practice, the practice shows that: the combined support of anchor rod, anchor rope plus pressure relief groove can control the deformation of the roadway well and the conclusion obtained can provide some reference values for the study and design of the grooving pressure relief control technology.

  13. Creating a family health history

    Science.gov (United States)

    Family health history; Create a family health history; Family medical history ... include your: Genes Diet and exercise habits Environment Family members tend to share certain behaviors, genetic traits, ...

  14. The effect of standard care, ibuprofen, and music on pain relief and patient satisfaction in adults with musculoskeletal trauma.

    Science.gov (United States)

    Tanabe, P; Thomas, R; Paice, J; Spiller, M; Marcantonio, R

    2001-04-01

    The purposes of this study were to determine the most effective nursing intervention to decrease pain for patients with minor musculoskeletal trauma and moderate pain at triage and to examine patient satisfaction. Patients were assigned to 1 of 3 intervention groups: (1) standard care (ice, elevation, and immobilization); (2) standard care and ibuprofen; or (3) standard care and music distraction. Patients were monitored for pain ratings for 60 minutes. Patients who sustained minor musculoskeletal trauma within the past 24 hours and presented with pain ratings of 4 or greater were included. Two patient satisfaction questions were asked upon discharge from the emergency department. Seventy-seven patients met the inclusion criteria. No differences in pain ratings between groups were demonstrated. A statistically significant reduction in pain for all patients occurred at 30 minutes (F = 16.18, P pain ratings of 4 or greater (on a scale of 1 to 10) at 60 minutes. The reduction in pain was not found to be clinically significant.Eighty-four percent of patients stated that they were more satisfied with their overall care in the emergency department because of the immediate attention to pain relief they received at triage. No differences in satisfaction existed between treatment groups, although patients who reported higher pain ratings expressed statistically significant lower satisfaction with pain management scores (F = 9.375, P =.003). None of the therapies-standard care (ice, elevation, immobilization), standard care with ibuprofen, or standard care with music distraction-provided clinically significant pain relief to patients who had minor musculoskeletal trauma (ie, sprains and fractures) and moderate pain at triage. Interestingly, satisfaction scores were sometimes positive, even when pain was not relieved.

  15. Pain relief produces negative reinforcement through activation of mesolimbic reward-valuation circuitry.

    Science.gov (United States)

    Navratilova, Edita; Xie, Jennifer Y; Okun, Alec; Qu, Chaoling; Eyde, Nathan; Ci, Shuang; Ossipov, Michael H; King, Tamara; Fields, Howard L; Porreca, Frank

    2012-12-11

    Relief of pain is rewarding. Using a model of experimental postsurgical pain we show that blockade of afferent input from the injury with local anesthetic elicits conditioned place preference, activates ventral tegmental dopaminergic cells, and increases dopamine release in the nucleus accumbens. Importantly, place preference is associated with increased activity in midbrain dopaminergic neurons and blocked by dopamine antagonists injected into the nucleus accumbens. The data directly support the hypothesis that relief of pain produces negative reinforcement through activation of the mesolimbic reward-valuation circuitry.

  16. Spatially Uniform ReliefF (SURF for computationally-efficient filtering of gene-gene interactions

    Directory of Open Access Journals (Sweden)

    Greene Casey S

    2009-09-01

    Full Text Available Abstract Background Genome-wide association studies are becoming the de facto standard in the genetic analysis of common human diseases. Given the complexity and robustness of biological networks such diseases are unlikely to be the result of single points of failure but instead likely arise from the joint failure of two or more interacting components. The hope in genome-wide screens is that these points of failure can be linked to single nucleotide polymorphisms (SNPs which confer disease susceptibility. Detecting interacting variants that lead to disease in the absence of single-gene effects is difficult however, and methods to exhaustively analyze sets of these variants for interactions are combinatorial in nature thus making them computationally infeasible. Efficient algorithms which can detect interacting SNPs are needed. ReliefF is one such promising algorithm, although it has low success rate for noisy datasets when the interaction effect is small. ReliefF has been paired with an iterative approach, Tuned ReliefF (TuRF, which improves the estimation of weights in noisy data but does not fundamentally change the underlying ReliefF algorithm. To improve the sensitivity of studies using these methods to detect small effects we introduce Spatially Uniform ReliefF (SURF. Results SURF's ability to detect interactions in this domain is significantly greater than that of ReliefF. Similarly SURF, in combination with the TuRF strategy significantly outperforms TuRF alone for SNP selection under an epistasis model. It is important to note that this success rate increase does not require an increase in algorithmic complexity and allows for increased success rate, even with the removal of a nuisance parameter from the algorithm. Conclusion Researchers performing genetic association studies and aiming to discover gene-gene interactions associated with increased disease susceptibility should use SURF in place of ReliefF. For instance, SURF should be

  17. Increased joint loads during walking--a consequence of pain relief in knee osteoarthritis

    DEFF Research Database (Denmark)

    Henriksen, Marius; Simonsen, Erik B; Alkjaer, T

    2006-01-01

    Joint pain is a primary symptom in knee osteoarthritis (OA), but the effect of pain and pain relief on the knee joint mechanics of walking is not clear. In this study, the effects of local knee joint analgesia on knee joint loads during walking were studied in a group of knee osteoarthritis...... patients. A group of healthy subjects was included as a reference group. The joint loads were calculated from standard gait analysis data obtained with standardised walking speed (4 km/h). The gait analyses were performed before and after pain relief by intra-articular injections of 10 mL lidocaine (1...

  18. Simulation of durability the evaluation of relief-dot Braille images

    Directory of Open Access Journals (Sweden)

    Svitlana Havenko

    2016-07-01

    Full Text Available The paper presents a model of factors that influence on the quality of relief-dot Braille inscriptions in their intensive use by blind people. It was constructed matrix of depending and distancing by using a directed graph. It allowed establish a hierarchy between studied criteria’s of impact the on durability of relief prints. It was developed a basic structure of digital system of assessment the conformity of Braille symbols to applicable international standards and definition of operational stability.

  19. Centralized cooperative spectrum sensing for ad-hoc disaster relief network clusters

    DEFF Research Database (Denmark)

    Pratas, Nuno; Marchetti, Nicola; Prasad, Neeli R.

    2010-01-01

    Disaster relief networks have to be highly adaptable and resilient. Cognitive radio enhanced ad-hoc architecture have been put forward as a candidate to enable such networks. Spectrum sensing is the cornerstone of the cognitive radio paradigm, and it has been the target of intensive research....... The main common conclusion was that the achievable spectrum sensing accuracy can be greatly enhanced through the use of cooperative sensing schemes. When considering applying Cognitive Radio to ad-hoc disaster relief networks, spectrum sensing cooperative schemes are paramount. A centralized cluster...

  20. Women and children first? The administration of Titanic relief in Southampton, 1912–59.

    Science.gov (United States)

    Gregson, Sarah

    2012-01-01

    One of the principal narratives woven around the 1912 sinking of the Titanic is that the tragedy united people around the world in a shared sense of horror and grief. This study examines the administration of the relief fund collected for victims and questions the established image of social unity and collective suffering. The records of the Southampton Titanic Relief Fund reveal welfare processes imbued with class and gender prejudices that consigned many of the relatives of victims to poverty-stricken lives, despite the massive fund collected in their names.

  1. The teaching of history through histories

    Directory of Open Access Journals (Sweden)

    María Gabriela Calvas-Ojeda

    2017-12-01

    Full Text Available The comic strips have been introduced into the world of history as a didactic resource for their learning; However, there are still shortcomings in their use by teachers, motivated on many occasions due to lack of knowledge and insufficient methodological preparation; The purpose of this work is to socialize knowledge related to these didactic resources to contribute to the didactic-methodological enrichment of the teacher, in order to change this attitude. The methodological strategy responds to the quantitative-qualitative paradigm; in the collection of the information a participant observation guide was used to the history classes and interview to a sample of 9 teachers of Third Degree of the schools of the city of Machala randomly selected. We recorded the observations of the knowledge acquired by the 98 students who received the classes mediated by comic strips, which allowed us to conclude that comics for the teaching and learning of History constitute a powerful didactic resource.

  2. Quantitative analysis of the relief in watersheds of the “El Ávila” massif northern hillside (Vargas State, Venezuela and its hydrogeomorphological meaning

    Directory of Open Access Journals (Sweden)

    Williams José Méndez Mata

    2016-11-01

    Full Text Available The morphological features of the relief and its quantitative morphometric quantification are essential elements in interpreting its influence on the hydrogeomorphological dynamics of watersheds in mountainous environments. This is particularly important when studying small spatial units (micro watersheds and torrential regimes, as this influences the sudden and aggressive hydrological responses of these systems and the likelihood of activation of mass removal processes. In the study region (Vargas State, Venezuela the most important debris flow recorded in Venezuela’s history occurred on December 14, 15 and 16, 1999, as a consequence of extremely heavy rainfall in those dates associated with a very particular weather. For the above reasons, this research conducted a quantitative analysis of the relief features in watersheds of “El Ávila” massive northern hillside and their impact on the local hydrogeomorphological dynamics, aimed at identifying the main attributes influencing these dynamics. The study area is located in the northern-central region of Venezuela, in the central part of Vargas state, delimited by 10º32’25”-10º37’35”N and 66º40’08”- 66º59’12”W, and comprises thirteen micro watersheds of mountainous environment. The methodology consisted of (a the geomorphological characterization of the area, from the review and interpretation of digitized base maps at scales 1:5 000 and 1:25 000, the digital elevation model (DEM, aerial photographs at scale 1:5 000, orthophotomaps at scale 1:25 000, satellite images, Google Earth and Google Maps images, and geomorphological maps (landforms and geomorphological processes at scale 1:25 000; (b measurements and calculations of basic morphometric parameters of watershed relief on digital mapping using the ArcGIS 9.2 and their Spatial Analysis and ArcHydro modules, and the mathematical equations that define the other parameters using MS Excel; (c descriptive statistical

  3. Photogrammetric Recording and Reconstruction of Town Scale Models - the Case of the Plan-Relief of Strasbourg

    Science.gov (United States)

    Macher, H.; Grussenmeyer, P.; Landes, T.; Halin, G.; Chevrier, C.; Huyghe, O.

    2017-08-01

    The French collection of Plan-Reliefs, scale models of fortified towns, constitutes a precious testimony of the history of France. The aim of the URBANIA project is the valorisation and the diffusion of this Heritage through the creation of virtual models. The town scale model of Strasbourg at 1/600 currently exhibited in the Historical Museum of Strasbourg was selected as a case study. In this paper, the photogrammetric recording of this scale model is first presented. The acquisition protocol as well as the data post-processing are detailed. Then, the modelling of the city and more specially building blocks is investigated. Based on point clouds of the scale model, the extraction of roof elements is considered. It deals first with the segmentation of the point cloud into building blocks. Then, for each block, points belonging to roofs are identified and the extraction of chimney point clouds as well as roof ridges and roof planes is performed. Finally, the 3D parametric modelling of the building blocks is studied by considering roof polygons and polylines describing chimneys as input. In a future works section, the semantically enrichment and the potential usage scenarios of the scale model are envisaged.

  4. Landslide susceptibility assessment in the Peloritani Mts. (Sicily, Italy and clues for tectonic control of relief processes

    Directory of Open Access Journals (Sweden)

    G. De Guidi

    2013-04-01

    Full Text Available Many destructive shallow landslides hit villages in the Peloritani Mountains area (Sicily, Italy on 1 October 2009 after heavy rainfall. The collection of several types of spatial data, together with a landslide inventory, allows the assessment of the landslide susceptibility by applying a statistical technique. The susceptibility model was validated by performing an analysis in a test area using independent landslide information, the results being able to correctly predict more than 70% of the landslides. Furthermore, the susceptibility analysis allowed the identification of which combinations of classes, within the different factors, have greater relevance in slope instability, and afterwards associating the most unstable combinations (with a short–medium term incidence with the endogenic processes acting in the area (huge regional uplift, fault activity. Geological and tectonic history are believed to be key to interpreting morphological processes and landscape evolution. Recent tectonic activity was found to be a very important controlling factor in landscape evolution. A geomorphological model of cyclical relief evolution is proposed in which endogenic processes are directly linked to superficial processes. The results are relevant both to risk reduction and the understanding of active geological dynamics.

  5. Marine Environmental History

    DEFF Research Database (Denmark)

    Poulsen, Bo

    2012-01-01

    This essay provides an overview of recent trends in the historiography of marine environmental history, a sub-field of environmental history which has grown tremendously in scope and size over the last c. 15 years. The object of marine environmental history is the changing relationship between...... human society and natural marine resources. Within this broad topic, several trends and objectives are discernable. The essay argue that the so-called material marine environmental history has its main focus on trying to reconstruct the presence, development and environmental impact of past fisheries...... and whaling operations. This ambition often entails a reconstruction also of how marine life has changed over time. The time frame rages from Paleolithicum to the present era. The field of marine environmental history also includes a more culturally oriented environmental history, which mainly has come...

  6. Efficacy of a novel food supplement in the relief of the signs and symptoms of seasonal allergic rhinitis and in the reduction of the consumption of anti-allergic drugs.

    Science.gov (United States)

    Ariano, Renato

    2015-04-27

    Seasonal Allergic rhinitis (SAR) is characterized by runny nose, congestion, sneezing and sinus pressure. A clinical study was performed to demonstrate the efficacy of Lertal®, an innovative food supplement containing Quercetin, Perilla frutescens and Vitamin D3 formu-lated in a double layer "fast-slow" release tablet form, in the relief of symptoms of seasonal allergic rhinitis and in the reduction of consumption of anti-allergic drugs. 23 subjects enrolled in the open clinical study had at least one year history of allergic rhinitis and positive skin prick test or RAST to Parietaria officinalis pollen. At baseline, the subjects had symptoms of nasal and/or ocular seasonal allergic rhinitis. The activity of the food supplement was evaluated using the Total Symptoms Score at first (baseline) and second (final) visit, after one month of supplementation. The consumption of anti-allergic drugs was also evaluated. All subjects enrolled completed the study. The comparison of the scores obtained in the two visits (baseline and final) showed a highly significant reduction of the overall symptoms: approximately 70% for symptom scores and 73% in use of anti-allergic drugs. Sneezing, rhinorrhea, nasal obstruction, ocular itching, lacrimation and congestion of the conjunctiva, all showed a highly significant reduction. No noteworthy side effect was recorded and all patients finished the study with good compliance. The results showed a clear efficacy of the food supplement Lertal® in reducing nasal and/or eye symptoms. This activity was objectively confirmed by the reduction in the consumption of anti-allergic drugs used to relieve symptoms. (www.actabiomedica.it).

  7. Family Health History and Diabetes

    Science.gov (United States)

    ... Diabetes Diabetes Risk Test Family Health History Quiz Family Health History Quiz Family health history is an ... health problems. Four Questions You Should Ask Your Family About Diabetes & Family Health History Knowing your family ...

  8. Ranking Economic History Journals

    DEFF Research Database (Denmark)

    Di Vaio, Gianfranco; Weisdorf, Jacob Louis

    This study ranks - for the first time - 12 international academic journals that have economic history as their main topic. The ranking is based on data collected for the year 2007. Journals are ranked using standard citation analysis where we adjust for age, size and self-citation of journals. We...... also compare the leading economic history journals with the leading journals in economics in order to measure the influence on economics of economic history, and vice versa. With a few exceptions, our results confirm the general idea about what economic history journals are the most influential...

  9. Ranking economic history journals

    DEFF Research Database (Denmark)

    Di Vaio, Gianfranco; Weisdorf, Jacob Louis

    2010-01-01

    This study ranks-for the first time-12 international academic journals that have economic history as their main topic. The ranking is based on data collected for the year 2007. Journals are ranked using standard citation analysis where we adjust for age, size and self-citation of journals. We also...... compare the leading economic history journals with the leading journals in economics in order to measure the influence on economics of economic history, and vice versa. With a few exceptions, our results confirm the general idea about what economic history journals are the most influential for economic...

  10. History: Hindrance to Unity

    Science.gov (United States)

    Rosenbaum, Robert J.

    1973-01-01

    Differing histories, racial compositions, economic interests, and present circumstances cut across the Mexican American people obliquely and work against a sense of ethnic identity or cultural nationalism. (Author)

  11. Public and popular history

    CERN Document Server

    De Groot, Jerome

    2013-01-01

    This interdisciplinary collection considers public and popular history within a global framework, seeking to understand considerations of local, domestic histories and the ways they interact with broader discourses. Grounded in particular local and national situations, the book addresses the issues associated with popular history in a globalised cultural world, such as: how the study of popular history might work in the future; new ways in which the terms 'popular' and 'public' might inform one another and nuance scholarship; transnational, intercultural models of 'pastness'; cultural translat

  12. Cooperative Station History Forms

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Various forms, photographs and correspondence documenting the history of Cooperative station instrumentation, location changes, inspections, and...

  13. Teaching Sport as History, History through Sport

    Science.gov (United States)

    Wheeler, Robert F.

    1978-01-01

    Describes an undergraduate history course based on two themes: sport as a reflection of society and sport as a socializing agent affecting society. The course focuses on sports and industrialization, traditional and modern sports, political and economic aspects of sport, and inequality and discrimination in sports. (Author/JK)

  14. Philippine Academy of Rehabilitation Medicine emergency basic relief and medical aid mission project (November 2013-February 2014): the role of physiatrists in Super Typhoon Haiyan.

    Science.gov (United States)

    Ganchoon, Filipinas; Bugho, Rommel; Calina, Liezel; Dy, Rochelle; Gosney, James

    2017-06-09

    Physiatrists have provided humanitarian assistance in recent large-scale global natural disasters. Super Typhoon Haiyan, the deadliest and most costly typhoon in modern Philippine history, made landfall on 8 November 2013 resulting in significant humanitarian needs. Philippine Academy of Rehabilitation Medicine physiatrists conducted a project of 23 emergency basic relief and medical aid missions in response to Super Typhoon Haiyan from November 2013 to February 2014. The final mission was a medical aid mission to the inland rural community of Burauen, Leyte. Summary data were collected, collated, and tabulated; project and mission evaluation was performed. During the humanitarian assistance project, 31,254 basic relief kits containing a variety of food and non-food items were distributed and medical services including consultation, treatment, and medicines were provided to 7255 patients. Of the 344 conditions evaluated in the medical aid mission to Burauen, Leyte 85 (59%) were physical and rehabilitation medicine conditions comprised of musculoskeletal (62 [73%]), neurological (17 [20%]), and dermatological (6 [7%]) diagnoses. Post-mission and project analysis resulted in recommendations and programmatic changes to strengthen response in future disasters. Physiatrists functioned as medical providers, mission team leaders, community advocates, and in other roles. This physiatrist-led humanitarian assistance project met critical basic relief and medical aid needs of persons impacted by Super Typhoon Haiyan, demonstrating significant roles performed by physiatrists in response to a large-scale natural disaster. Resulting disaster programing changes and recommendations may inform a more effective response by PARM mission teams in the Philippines as well as by other South-Eastern Asia teams comprising rehabilitation professionals to large-scale, regional natural disasters. Implications for rehabilitation Large-scale natural disasters including tropical cyclones can

  15. The pioneer income tax relief as an investment incentive in Nigeria ...

    African Journals Online (AJOL)

    Taxation is one of the major fiscal policy instruments used by government in regulating the economy, boosting investments and regulating inflation. Many developing nations formulate tax policies aimed at stimulating rapid economic growth. One of such policies in Nigeria is the Pioneer Income Tax Relief with the main goal ...

  16. 40 CFR 80.1335 - Can a refiner seek relief from the requirements of this subpart?

    Science.gov (United States)

    2010-07-01

    ... (CONTINUED) AIR PROGRAMS (CONTINUED) REGULATION OF FUELS AND FUEL ADDITIVES Gasoline Benzene Hardship... obtain credits, including the prices of credits available, but deemed uneconomical by the refiner. (2..., including unacceptable environmental impact. (d) EPA may impose any other reasonable conditions on relief...

  17. An Approach to Assessment of Relief Formats for Hardcopy Topographic Maps

    Science.gov (United States)

    1979-04-01

    determine what types of relief information must be ex-dtracted from maps by representative users, we studied and analyzed Army Field Manual FM 21-16, "Map...extensive review materiall (a) study of one map format might facilitate (or hinder) use of another map format. TRAINING NECESSARY [OR TEST USE This test

  18. An audit of aspects of informed consent and pain relief in general ...

    African Journals Online (AJOL)

    There is the need to adequately inform patients about their disease, treatment options, surgery and post-operative complications. Adequate pain relief after surgery leads to less morbidity. Two important aspects of surgical practice are being addressed in this paper, the need for informed consent and post operative pain ...

  19. The psychological and physiological stress relief effect of the green roof

    Energy Technology Data Exchange (ETDEWEB)

    Lee, H.; Koshimizu, H. [Meiji Univ., Tokyo (Japan). Dept. of Agriculture

    2007-07-01

    The visual sense influences human psychology and physiology. As such, green gardens in urban environments are touted as being healing gardens that lead to stress relief and improved work efficiency. This paper focused on the visual aspects of such rehabilitation sites. Psychological and physiological experiments were conducted on human response to green roofs in order to quantify the stress relief effect of the green roof scenery. In addition, different green roof designs were tested to determine whether they change the stress relief effect. A 360 degrees panorama photograph of green roofs was shown to 3 male and 3 female students in Meiji University. The experiment was followed by a questionnaire survey based on the semantic differential (SD) method as a psychological evaluation. The SD method is a representative psychological measurement to quantify an image of people for a scene. The changes in heart rate were studied along with blood pressure, and stress degree as a physiological evaluation. The relation between the results of the SD method-based psychological evaluation and the physiological experiment was determined using multiple regression analysis. It was concluded that the stress relief effect can be improved by changing linear scenery to a more curvy one. 15 refs., 4 tabs., 20 figs.

  20. Ibuprofen and/or paracetamol (acetaminophen) for pain relief after surgical removal of lower wisdom teeth

    NARCIS (Netherlands)

    Bailey, E.; Worthington, H.V.; van Wijk, A.; Yates, J.M.; Coulthard, P.; Afzal, Z.

    2013-01-01

    Background Both paracetamol and ibuprofen are commonly used analgesics for the relief of pain following the surgical removal of lower wisdom teeth (third molars). In 2010, a novel analgesic (marketed as Nuromol) containing both paracetamol and ibuprofen in the same tablet was launched in the United

  1. Housing environment influences the need for pain relief during post-operative recovery in mice

    NARCIS (Netherlands)

    Pham, T.M.; Hagman, B.; Codita, A.; Loo, P.L.P. van; Strömmer, L.; Baumans, V.

    2010-01-01

    The impact of invasive experimental procedures on perceived stress and pain may be dependent on both physical and social environmental conditions. The aim of this study was to evaluate the effects of a physically and a socially enriched environment on the need for pain relief following painful

  2. 77 FR 58150 - Granting of Relief; Federal Firearms Privileges (2011R-13T)

    Science.gov (United States)

    2012-09-19

    ... Corporation (NGC), has been granted relief from the disabilities imposed by Federal laws by the Director of... provisions of the Gun Control Act of 1968 (GCA), 18 U.S.C. Chapter 44. He has delegated that responsibility... from the disabilities imposed by Federal laws with respect to the acquisition, transfer, receipt...

  3. 21 CFR 882.5870 - Implanted peripheral nerve stimulator for pain relief.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Implanted peripheral nerve stimulator for pain....5870 Implanted peripheral nerve stimulator for pain relief. (a) Identification. An implanted peripheral... the stimulating pulses across the patient's skin to the implanted receiver. (b) Classification. Class...

  4. Survey of plants popularly used for pain relief in Rio Grande do Sul, southern Brazil

    Directory of Open Access Journals (Sweden)

    Eveline D. Stolz

    Full Text Available Ethnobotanical data can be an important tool in the search for new drugs. The Brazilian Health Surveillance Agency accepts the registration of herbal medicines based on ethnopharmacological and ethnobotanical studies. With the purpose of increasing the knowledge of potentially useful plants for the treatment of painful conditions, we analyzed the ethnobotanical studies carried out in Rio Grande do Sul state (RS-Southern Brazil; we had access to nineteen studies.To our knowledge, this is the first compilation of ethnobotanical studies that focus on pain relief carried out in RS. The species native to RS cited in at least nine (about 50% of these studies were selected. The search retrieved 28 native species cited as used to alleviate painful conditions, which are distributed in eighteen botanical families, being Asteraceae the most mentioned. The species more frequently cited for pain relief were Achyrocline satureioides, Baccharis articulata, Baccharis crispa, Lepidium didymum, Eugenia uniflora and Maytenus ilicifolia. The only species not reported in any pre-clinical study associated with pain relief was B. articulata. Among the six species cited, no studies on clinical efficacy were found. In conclusion, the folk use of native plants with therapeutic purposes is widespread in RS State (Brazil, being pain relief an important property.

  5. Vulnerability of Internally Displaced Children in Disaster Relief Camps of Pakistan: Issues, Challenges, and Way Forward

    Science.gov (United States)

    Hirani, Shela Akbar Ali

    2014-01-01

    Pakistan is a developing country with the second highest infant and child mortality rates in South Asia. During the past years this region has undergone several humanitarian emergencies that have negatively affected all the aspects of health and development of young children. During these emergencies relief camps are set up by governmental and…

  6. Dead letter or living document? Ten years Code of Conduct for Disaster Relief

    NARCIS (Netherlands)

    Hilhorst, D.J.M.

    2005-01-01

    This paper examines the present value of the Code of Conduct for the International Red Cross and Red Crescent Movement and Non-Governmental Organizations (NGOs) in Disaster Relief, in view of discussions on neutrality and the Western bias of the humanitarian aid system, and assesses how it can

  7. A Novel Uni-Acupoint Electroacupuncture Stimulation Method for Pain Relief

    Directory of Open Access Journals (Sweden)

    Chuansen Niu

    2011-01-01

    Full Text Available Electroacupuncture stimulation (EAS has been demonstrated effective for pain relief and treating other various diseases. However, the conventional way of EAS, the bi-acupoint method, is not suitable for basis study of acupoint specificity. Moreover, its operations are inconvenient and difficult to be persevered, especially for long-term, continuous and even imperative treatments. These disadvantages motivate designs of new EAS methods. We present a novel uni-acupoint electrical stimulation method, which is applied at a single acupoint and quite meets the needs of basis study and simpler clinical application. Its pain relief effect has been evaluated by animal tests of Wistar rats. During the experiments, rats were given 30 min 2/100 Hz uni- and bi-acupoint EAS and their nociceptive thresholds before and after EAS were attained by hot-plate test. The analgesic effect was defined as the change of nociceptive threshold and used to evaluate the effectiveness of uni-acupoint EAS for pain relief. The hot-plate test results indicated that analgesic effect of uni-acupoint group was significantly higher than that of the control group and there was no significant difference of analgesic effects between uni- and bi-acupoint EAS. The results suggested that uni-acupoint method was an effective EAS method and had comparable pain relief effect with bi-acupoint method.

  8. Psychotherapeutic Effects of Transcendental Meditation with Controls for Expectation of Relief and Daily Sitting

    Science.gov (United States)

    Smith, Jonathan C.

    1976-01-01

    Two experiments were conducted to isolate the trait-anxiety-reducing effects of transcendental meditation (TM) from expectation of relief and the concomitant ritual of sitting twice daily. The results strongly support the conclusion that the crucial therapeutic component of TM is not the TM exercise. (Author)

  9. Comparison of two analgesics used for pain relief after placement of orthodontic separators

    Directory of Open Access Journals (Sweden)

    Nasser Alqahtani

    2017-12-01

    Conclusion: The patients prescribed ibuprofen did not report any problem with tooth movement along with significant reduction in pain as compared to paracetamol. Pain relief medication after placement of separators should be taken only if patient feels intolerable pain but not as routine practice.

  10. Size and structure of disaster relief when state capacity is limited: China's 1823 flood

    NARCIS (Netherlands)

    Uebele, Martin; Ni, Yuping

    2015-01-01

    This paper presents new archival evidence about amount and structure of central government disaster relief during China’s devastating flood of 1823. While the flood affected 20 percent of China’s counties, spending per capita was sizable and distributed between provinces depending on the intensity

  11. Predicting homeless people’s perceived health after entering the social relief system in The Netherlands

    NARCIS (Netherlands)

    Van Der Laan, J.; Van Straaten, B.; Boersma, S.N.; Rodenburg, G.; van de Mheen, D.; Wolf, J.R.L.M.

    2018-01-01

    We explored whether changes in the perceived health of homeless people after entering the social relief system (SRS) in The Netherlands were predicted by housing, income, hours of work, social support, unmet care needs, arrests, physical and mental health, substance use, and experiences of autonomy,

  12. 76 FR 77533 - Mandatory Electronic Filing for Cable Special Relief Petitions and Cable Show Cause Petitions...

    Science.gov (United States)

    2011-12-13

    ...: This document announces the implementation of electronic filing of Cable Special Relief (CSR) Petitions... filing of CSR and CSC petitions will be permitted through January 3, 2012, when electronic filing will... Tillery of the Media Bureau at (202) 418-1056. SUPPLEMENTARY INFORMATION: This is a summary of the CSR and...

  13. Servicemembers Civil Relief Act: Information on Mortgage Protections and Related Education Efforts

    Science.gov (United States)

    2014-01-01

    agencies and nonprofit organizations to help provide financial education to servicemembers, but limited information on the effectiveness of these...Relief Act DOD has entered into partnerships with many federal agencies and nonprofit organizations to help provide financial education to...servicemembers of their SCRA rights. DOD also has entered into partnerships with many other federal agencies and nonprofit organizations to help provide

  14. Present day relief-shaping systems acting on the southern slope of ...

    Indian Academy of Sciences (India)

    The present topography of the Făgăraş Mountains is a snapshot of the long-term evolution that brought about significant alterations of the landscape, and especially of the relief, which has acquired different features depending on the intensity of the relationship between the exogenous and endogenous agents. At present ...

  15. Effect of tegaserod on quality of life and symptom relief in women ...

    African Journals Online (AJOL)

    Background: Tegaserod is a promotility agent with proven efficacy and safety in patients with irritable bowel syndrome with constipation (IBS-C). AIM: Assess tegaserod's effect on quality of life (QOL) and symptom relief in South African patients. Methods: Women >18 years old meeting Rome II criteria for IBS-C were enrolled ...

  16. Effects of an eight-week training programme on pain relief and ...

    African Journals Online (AJOL)

    Effects of an eight-week training programme on pain relief and physical condition of overweight and obese women with early stage primary knee osteoarthritis. ... with the requirements of the Osteoarthritis Research Society International Committee in terms of pain, physical function, strength and cardiorespiratory endurance.

  17. Knowledge, attitude and use of pain relief in labour among women ...

    African Journals Online (AJOL)

    Objective: To find out the knowledge, attitude and practice of pain relief methods during labour among mothers attending antenatal clinics at Shalom Community Hospital, Athi River, Kenya. Design: Cross Sectional study. Setting: Shalom Community Hospital, Athi River, Kenya Subjects: Two hundred and seven participants ...

  18. 78 FR 46952 - Relief-Mart, Inc.; Analysis of Proposed Consent Order To Aid Public Comment

    Science.gov (United States)

    2013-08-02

    ... comment at https://ftcpublic.commentworks.com/ftc/reliefmartincconsent online or on paper, by following... ``Relief Mart, File No. 122 3128'' on your comment and file your comment online at https://ftcpublic... calling (202) 326-2222. You can file a comment online or on paper. For the Commission to consider your...

  19. 76 FR 4149 - Notice of Establishment of Emergency Relief Docket for Calendar Year 2011

    Science.gov (United States)

    2011-01-24

    ... more information prior to making a decision. FTA shall then post a decision to the Emergency Relief...) and docket number FTA-2011-0001. Grantees and subgrantees making submissions to the docket by mail or... administrative requirements will be conditionally granted for a period of three (3) business days from the date...

  20. Introducing a patient-controlled analgesia-based acute pain relief ...

    African Journals Online (AJOL)

    The 10 months after the introduction of the first acute pain relief service (APRS) in southern Africa is described. Seven hundred patients were treated with morphine by means of patient-controlled analgesia (PCA), administered to patients after major surgery or extensive burns via the intravenous (IV) or subcutaneous (SC) ...