
Sample records for higher plasma n-3

  1. Vegetable oils rich in alpha linolenic acid allow a higher accretion of n-3 LCPUFA in the plasma, liver and adipose tissue of the rat

    Directory of Open Access Journals (Sweden)

    Valenzuela, R.


    Full Text Available ALA is the precursor of EPA and DHA and its dietary availability is limited. Vegetable oils rich in ALA (48–64% are alternatives for increasing its consumption. The conversion of ALA into EPA and DHA and the ratio (EPA+DHA/ALA was evaluated in different tissues from male Wistar rats fed ALA –rich oils. Four groups (n=12/group were fed for 21 days with oils from: a corn (CO, 3% ALA; b soybean (SO, 6% ALA; c sacha inchi (SIO, 48% ALA and; d chia (ChO, 64% ALA. SO, SIO and ChO significantly increased ALA levels (pALA es precursor de EPA y DHA y sus fuentes dietarias son limitadas. Aceites ricos en ALA (48–64% son una alternativa para incrementar su consumo. En este trabajo se evaluó la conversión de ALA a EPA y DHA, y la relación (EPA+DHA/ALA en tejidos de ratas macho Wistar alimentadas con aceites con alto contenido en ALA. Cuatro grupos (n=12/grupo recibieron durante 21 días aceite de: a maíz (CO, 3% ALA; b soja (SO, 6% ALA; c sacha inchi (SIO, 48% ALA y; d chía (ChO, 64% ALA. SO, SIO y ChO incrementaron ALA (p<0,05 en los tejidos. Solo SIO y ChO incrementaron el EPA y DHA, disminuyendo la relación n-6/n-3 (p<0,05. Se propone SIO y ChO como fuentes de ALA para incrementar EPA y DHA en los tejidos.

  2. Effects of n-3 PUFAs on breast cancer cells through their incorporation in plasma membrane


    Corsetto, Paola A; Montorfano, Gigliola; Zava, Stefania; Jovenitti, Ilaria E; Cremona, Andrea; Berra, Bruno; Rizzo, Angela M


    Abstract Background PUFAs are important molecules for membrane order and function; they can modify inflammation-inducible cytokines production, eicosanoid production, plasma triacylglycerol synthesis and gene expression. Recent studies suggest that n-3 PUFAs can be cancer chemopreventive, chemosuppressive and auxiliary agents for cancer therapy. N-3 PUFAs could alter cancer growth influencing cell replication, cell cycle, and cell death. The question that remains to be answered is how n-3 PUF...

  3. Effects of varying levels of n-6:n-3 fatty acid ratio on plasma fatty acid ...

    African Journals Online (AJOL)

    This study investigated the effects of varying dietary levels of n-6:n-3 fatty acid ratio on plasma fatty acid composition and prostanoid synthesis in pregnant rats. Four groups consisting of seven rats per group of non pregnant rats were fed diets with either a very low n-6:n-3 ratio of 50% soybean oil (SBO): 50% cod liver oil ...

  4. Higher spin currents in the enhanced N=3 Kazama-Suzuki model

    Energy Technology Data Exchange (ETDEWEB)

    Ahn, Changhyun; Kim, Hyunsu [Department of Physics, Kyungpook National University,Taegu 41566 (Korea, Republic of)


    The N=3 Kazama-Suzuki model at the ‘critical’ level has been found by Creutzig, Hikida and Ronne. We construct the lowest higher spin currents of spins ((3/2),2,2,2,(5/2),(5/2),(5/2),3) in terms of various fermions. In order to obtain the operator product expansions (OPEs) between these higher spin currents, we describe three N=2 OPEs between the two N=2 higher spin currents denoted by ((3/2),2,2,(5/2)) and (2,(5/2),(5/2),3) (corresponding 36 OPEs in the component approach). Using the various Jacobi identities, the coefficient functions appearing on the right hand side of these N=2 OPEs are determined in terms of central charge completely. Then we describe them as one single N=3 OPE in the N=3 superspace. The right hand side of this N=3 OPE contains the SO(3)-singlet N=3 higher spin multiplet of spins (2,(5/2),(5/2),(5/2),3,3,3,(7/2)), the SO(3)-singlet N=3 higher spin multiplet of spins ((5/2),3,3,3,(7/2),(7/2),(7/2),4), and the SO(3)-triplet N=3 higher spin multiplets where each multiplet has the spins (3,(7/2),(7/2),(7/2),4,4,4,(9/2)), in addition to N=3 superconformal family of the identity operator. Finally, by factoring out the spin-(1/2) current of N=3 linear superconformal algebra generated by eight currents of spins ((1/2),1,1,1,(3/2),(3/2),(3/2),2), we obtain the extension of so-called SO(3) nonlinear Knizhnik Bershadsky algebra.

  5. Higher spin currents in the enhanced N=3 Kazama-Suzuki model (United States)

    Ahn, Changhyun; Kim, Hyunsu


    The N=3 Kazama-Suzuki model at the `critical' level has been found by Creutzig, Hikida and Ronne. We construct the lowest higher spin currents of spins (3/2,2,2,2,5/2,5/2,5/2,3) in terms of various fermions. In order to obtain the operator product expansions (OPEs) between these higher spin currents, we describe three N=2 OPEs between the two N=2 higher spin currents denoted by (3/2,2,2,5/2) and (2,5/2,5/2,3) (corresponding 36 OPEs in the component approach). Using the various Jacobi identities, the coefficient functions appearing on the right hand side of these N=2 OPEs are deter-mined in terms of central charge completely. Then we describe them as one single N=3 OPE in the N=3 superspace. The right hand side of this N=3 OPE contains the SO(3)-singlet N=3 higher spin multiplet of spins (2,5/2,5/2,5/2,3,3,3,7/2) , the SO(3)-singlet N=3 higher spin multiplet of spins (5/2,3,3,3,7/2,7/2,7/2,4) , and the SO(3)-triplet N=3 higher spin multiplets where each multiplet has the spins (3,7/2,7/2,7/2,4,4,4,9/2) , in addition to N=3 superconformal family of the identity operator. Finally, by factoring out the spin-1/2 current of N=3 linear superconformal algebra generated by eight currents of spins (1/2,1,1,1,3/2,3/2,3/2,2) , we obtain the extension of so-called SO (3) nonlinear Knizhnik Bershadsky algebra.

  6. Maternal high fat diet is associated with decreased plasma n-3 fatty acids and fetal hepatic apoptosis in nonhuman primates.

    Directory of Open Access Journals (Sweden)

    Wilmon F Grant


    Full Text Available To begin to understand the contributions of maternal obesity and over-nutrition to human development and the early origins of obesity, we utilized a non-human primate model to investigate the effects of maternal high-fat feeding and obesity on breast milk, maternal and fetal plasma fatty acid composition and fetal hepatic development. While the high-fat diet (HFD contained equivalent levels of n-3 fatty acids (FA's and higher levels of n-6 FA's than the control diet (CTR, we found significant decreases in docosahexaenoic acid (DHA and total n-3 FA's in HFD maternal and fetal plasma. Furthermore, the HFD fetal plasma n-6:n-3 ratio was elevated and was significantly correlated to the maternal plasma n-6:n-3 ratio and maternal hyperinsulinemia. Hepatic apoptosis was also increased in the HFD fetal liver. Switching HFD females to a CTR diet during a subsequent pregnancy normalized fetal DHA, n-3 FA's and fetal hepatic apoptosis to CTR levels. Breast milk from HFD dams contained lower levels of eicosopentanoic acid (EPA and DHA and lower levels of total protein than CTR breast milk. This study links chronic maternal consumption of a HFD with fetal hepatic apoptosis and suggests that a potentially pathological maternal fatty acid milieu is replicated in the developing fetal circulation in the nonhuman primate.

  7. Plasma phospholipid long-chain n-3 polyunsaturated fatty acids and body weight change

    DEFF Research Database (Denmark)

    Jakobsen, Marianne Uhre; Dethlefsen, Claus; Due, Karen Margrete


    We investigated the association between the proportion of long-chain n-3 polyunsaturated fatty acids (PUFA) in plasma phospholipids from blood samples drawn at enrollment and subsequent change in body weight. Sex, age, and BMI were considered as potential effect modifiers.......We investigated the association between the proportion of long-chain n-3 polyunsaturated fatty acids (PUFA) in plasma phospholipids from blood samples drawn at enrollment and subsequent change in body weight. Sex, age, and BMI were considered as potential effect modifiers....

  8. Effects of n-3 PUFAs on breast cancer cells through their incorporation in plasma membrane

    Directory of Open Access Journals (Sweden)

    Berra Bruno


    Full Text Available Abstract Background PUFAs are important molecules for membrane order and function; they can modify inflammation-inducible cytokines production, eicosanoid production, plasma triacylglycerol synthesis and gene expression. Recent studies suggest that n-3 PUFAs can be cancer chemopreventive, chemosuppressive and auxiliary agents for cancer therapy. N-3 PUFAs could alter cancer growth influencing cell replication, cell cycle, and cell death. The question that remains to be answered is how n-3 PUFAs can affect so many physiological processes. We hypothesize that n-3 PUFAs alter membrane stability, modifying cellular signalling in breast cancer cells. Methods Two lines of human breast cancer cells characterized by different expression of ER and EGFR receptors were treated with AA, EPA or DHA. We have used the MTT viability test and expression of apoptotic markers to evaluate the effect of PUFAs on cancer growth. Phospholipids were analysed by HPLC/GC, to assess n-3 incorporation into the cell membrane. Results We have observed that EPA and DHA induce cell apoptosis, a reduction of cell viability and the expression of Bcl2 and procaspase-8. Moreover, DHA slightly reduces the concentration of EGFR but EPA has no effect. Both EPA and DHA reduce the activation of EGFR. N-3 fatty acids are partially metabolized in both cell lines; AA is integrated without being further metabolized. We have analysed the fatty acid pattern in membrane phospholipids where they are incorporated with different degrees of specificity. N-3 PUFAs influence the n-6 content and vice versa. Conclusions Our results indicate that n-3 PUFA feeding might induce modifications of breast cancer membrane structure that increases the degree of fatty acid unsaturation. This paper underlines the importance of nutritional factors on health maintenance and on disease prevention.

  9. Effects of n-3 PUFAs on breast cancer cells through their incorporation in plasma membrane. (United States)

    Corsetto, Paola A; Montorfano, Gigliola; Zava, Stefania; Jovenitti, Ilaria E; Cremona, Andrea; Berra, Bruno; Rizzo, Angela M


    PUFAs are important molecules for membrane order and function; they can modify inflammation-inducible cytokines production, eicosanoid production, plasma triacylglycerol synthesis and gene expression. Recent studies suggest that n-3 PUFAs can be cancer chemopreventive, chemosuppressive and auxiliary agents for cancer therapy. N-3 PUFAs could alter cancer growth influencing cell replication, cell cycle, and cell death. The question that remains to be answered is how n-3 PUFAs can affect so many physiological processes. We hypothesize that n-3 PUFAs alter membrane stability, modifying cellular signalling in breast cancer cells. Two lines of human breast cancer cells characterized by different expression of ER and EGFR receptors were treated with AA, EPA or DHA. We have used the MTT viability test and expression of apoptotic markers to evaluate the effect of PUFAs on cancer growth. Phospholipids were analysed by HPLC/GC, to assess n-3 incorporation into the cell membrane. We have observed that EPA and DHA induce cell apoptosis, a reduction of cell viability and the expression of Bcl2 and procaspase-8. Moreover, DHA slightly reduces the concentration of EGFR but EPA has no effect. Both EPA and DHA reduce the activation of EGFR.N-3 fatty acids are partially metabolized in both cell lines; AA is integrated without being further metabolized. We have analysed the fatty acid pattern in membrane phospholipids where they are incorporated with different degrees of specificity. N-3 PUFAs influence the n-6 content and vice versa. Our results indicate that n-3 PUFA feeding might induce modifications of breast cancer membrane structure that increases the degree of fatty acid unsaturation. This paper underlines the importance of nutritional factors on health maintenance and on disease prevention.

  10. Incorporation of dietary n-3 fatty acids into selective phosphatidylcholine lipids in human plasma after salmon intake (United States)

    Elevated intake of n-3 long chain polyunsaturated fatty acids (n-3 LCPUFA) is associated with reduced risk for cardiovascular disease. Intake of n-3 LCPUFA is often quantified by analysis of plasma phospholipid fatty acids (PLFA); however, the typical analysis by gas chromatography does not allow fo...

  11. Long-chain n-3 polyunsaturated fatty acids in plasma in British meat-eating, vegetarian, and vegan men. (United States)

    Rosell, Magdalena S; Lloyd-Wright, Zouë; Appleby, Paul N; Sanders, Thomas A B; Allen, Naomi E; Key, Timothy J


    Plasma concentrations of long-chain n-3 polyunsaturated fatty acids are lower in vegetarians and in vegans than in omnivores. No data are available on whether these concentrations differ between long- and short-term vegetarians and vegans. We compared plasma fatty acid composition in meat-eaters, vegetarians, and vegans and examined whether the proportions of eicosapentaenoic acid (20:5n-3; EPA), docosapentaenoic acid (22:5n-3; DPA), and docosahexaenoic acid (22:6n-3; DHA) were related to the subjects' duration of adherence to their diets or to the proportions of plasma linoleic acid (18:2n-6; LA) and alpha-linolenic acid (18:3n-3; ALA). The present cross-sectional study included 196 meat-eating, 231 vegetarian, and 232 vegan men in the United Kingdom. Information on anthropometry, diet, and smoking habits was obtained through a questionnaire. Total fatty acid composition in plasma was measured. The proportions of plasma EPA and DHA were lower in the vegetarians and in the vegans than in the meat-eaters, whereas only small differences were seen for DPA. Plasma EPA, DPA, and DHA proportions were not significantly associated with the duration of time since the subjects became vegetarian or vegan, which ranged from 20 y. In the vegetarians and the vegans, plasma DHA was inversely correlated with plasma LA. The proportions of plasma long-chain n-3 fatty acids were not significantly affected by the duration of adherence to a vegetarian or vegan diet. This finding suggests that when animal foods are wholly excluded from the diet, the endogenous production of EPA and DHA results in low but stable plasma concentrations of these fatty acids.

  12. N = 3 chiral supergravity compatible with the reality condition and higher N chiral Lagrangian density


    Tsuda, Motomu


    We obtain N = 3 chiral supergravity (SUGRA) compatible with the reality condition by applying the prescription of constructing the chiral Lagrangian density from the usual SUGRA. The $N = 3$ chiral Lagrangian density in first-order form, which leads to the Ashtekar's canonical formulation, is determined so that it reproduces the second-order Lagrangian density of the usual SUGRA especially by adding appropriate four-fermion contact terms. We show that the four-fermion contact terms added in t...

  13. High concentrations of plasma n3 fatty acids are associated with decreased risk for late age-related macular degeneration. (United States)

    Merle, Bénédicte M J; Delyfer, Marie-Noëlle; Korobelnik, Jean-François; Rougier, Marie-Bénédicte; Malet, Florence; Féart, Catherine; Le Goff, Mélanie; Peuchant, Evelyne; Letenneur, Luc; Dartigues, Jean-François; Colin, Joseph; Barberger-Gateau, Pascale; Delcourt, Cécile


    High dietary intakes of n3 (ω3) polyunsaturated fatty acids (PUFA) and fish have been consistently associated with a decreased risk for age-related macular degeneration (AMD). We assessed the associations of late AMD with plasma n3 PUFA, a nutritional biomarker of n3 PUFA status. The Antioxydants Lipides Essentiels Nutrition et Maladies Occulaires (Alienor) Study is a prospective, population-based study on nutrition and age-related eye diseases performed in 963 residents of Bordeaux (France) aged ≥73 y. Participants had a first eye examination in 2006-2008 and were followed for 31 mo on average. Plasma fatty acids were measured by GC from fasting blood samples collected in 1999-2001. AMD was graded from non-mydriatic color retinal photographs at all examinations and spectral domain optical coherence tomography at follow-up. After adjustment for age, gender, smoking, education, physical activity, plasma HDL-cholesterol, plasma triglycerides, CFH Y402H, apoE4, and ARMS2 A69S polymorphisms, and follow-up time, high plasma total n3 PUFA was associated with a reduced risk for late AMD [OR = 0.62 for 1-SD increase (95% CI: 0.44-0.88); P = 0.008]. Associations were similar for plasma 18:3n3 [OR = 0.62 (95% CI: 0.43-0.88); P = 0.008] and n3 long-chain PUFA [OR = 0.65 (95% CI: 0.46-0.92); P = 0.01]. This study gives further support to the potential role of n3 PUFAs in the prevention of late AMD and highlights the necessity of randomized clinical trials to determine more accurately the value of n3 PUFAs as a means of reducing AMD incidence.

  14. Associations between intake of fish and n-3 long-chain polyunsaturated fatty acids and plasma metabolites related to the kynurenine pathway in patients with coronary artery disease. (United States)

    Karlsson, Therese; Strand, Elin; Dierkes, Jutta; Drevon, Christian A; Øyen, Jannike; Midttun, Øivind; Ueland, Per M; Gudbrandsen, Oddrun A; Pedersen, Eva Ringdal; Nygård, Ottar


    Enhanced tryptophan degradation via the kynurenine pathway has been related to several pathological conditions. However, little is known about the effect of diet on individual metabolites of this pathway. We investigated cross-sectional associations between reported intake of fish and omega-3 (n-3) long-chain PUFA (LC-PUFA) and plasma metabolites related to the kynurenine pathway. Participants were 2324 individuals with coronary artery disease from the Western Norway B Vitamin Intervention Trial. Fish and n-3 LC-PUFA intakes were assessed using a food frequency questionnaire. Plasma concentrations of tryptophan, kynurenine, kynurenic acid, anthranilic acid, 3-hydroxykynurenine, xanthurenic acid, 3-hydroxyanthranilic acid, neopterin, and kynurenine-to-tryptophan ratio (KTR) were analyzed. Associations were investigated using partial Spearman's rank correlations and multiple linear regressions. Median age at inclusion was 62 years (80 % males), and 84 % had stable angina pectoris. Intake of fatty fish and n-3 LC-PUFA was inversely associated with plasma 3-hydroxykynurenine. Consumption of total fish, lean fish, and n-3 LC-PUFA was inversely associated with plasma neopterin. Intake of total fish, fatty fish, and n-3 LC-PUFA was inversely associated with KTR. All these correlations were weak (ρ between -0.12 and -0.06, P fish intake was positively associated with plasma 3-hydroxyanthranilic acid (ρ = 0.22, P fish intake was inversely associated with KTR (ρ = -0.17, P Fish intake was not an important determinant of individual metabolites in the kynurenine pathway. However, some correlations were stronger in patients with diabetes. The inverse associations of fish or n-3 LC-PUFA with neopterin and KTR may suggest a slightly lower IFN-γ-mediated immune activation with a higher intake.

  15. Plasma very long-chain N-3 polyunsaturated fatty acids and age-related hearing loss in older adults

    NARCIS (Netherlands)

    Dullemeijer, C.; Verhoef, P.; Brouwer, I.A.; Kok, F.J.; Brummer, R.J.M.; Durga, J.


    Objectives: Age-related hearing loss is a common social and health problem in the older adult population. Up until now, very little scientific attention has been given to the potential role of fatty acids in age-related hearing loss. In this study we investigated whether plasma very long-chain n-3

  16. Marginal vitamin B-6 deficiency decreases plasma (n-3) and (n-6) PUFA concentrations in healthy men and women. (United States)

    Zhao, Mei; Lamers, Yvonne; Ralat, Maria A; Coats, Bonnie S; Chi, Yueh-Yun; Muller, Keith E; Bain, James R; Shankar, Meena N; Newgard, Christopher B; Stacpoole, Peter W; Gregory, Jesse F


    Previous animal studies showed that severe vitamin B-6 deficiency altered fatty acid profiles of tissue lipids, often with an increase of linoleic acid and a decrease of arachidonic acid. However, little is known about the extent to which vitamin B-6 deficiency affects human fatty acid profiles. The aim of this study was to determine the effects of marginal vitamin B-6 deficiency on fatty acid profiles in plasma, erythrocytes, and peripheral blood mononuclear cells (PBMC) of healthy adults fed a 28-d, low-vitamin B-6 diet. Healthy participants (n = 23) received a 2-d, controlled, vitamin B-6-adequate diet followed by a 28-d, vitamin B-6-restricted diet to induce a marginal deficiency. Plasma HDL and LDL cholesterol concentrations, FFA concentrations, and erythrocyte and PBMC membrane fatty acid compositions did not significantly change from baseline after the 28-d restriction. Plasma total arachidonic acid, EPA, and DHA concentrations decreased from (mean ± SD) 548 ± 96 to 490 ± 94 μmol/L, 37 ± 13 to 32 ± 13 μmol/L, and 121 ± 28 to 109 ± 28 μmol/L [positive false discovery rate (pFDR) adjusted P vitamin B-6 restriction decreases plasma (n-3) and (n-6) PUFA concentrations and tends to increase the plasma (n-6):(n-3) PUFA ratio. Such changes in blood lipids may be associated with the elevated risk of cardiovascular disease in vitamin B-6 insufficiency.

  17. Dose-dependent consumption of farmed Atlantic salmon (Salmo salar) increases plasma phospholipid n-3 fatty acids differentially. (United States)

    Raatz, Susan K; Rosenberger, Thad A; Johnson, LuAnn K; Wolters, William W; Burr, Gary S; Picklo, Matthew J


    Enhanced n-3 fatty acid intake benefits cardiovascular disease (CVD) risk reduction. Increasing consumption at a population level may be better addressed by diet than through supplementation. However, limited data are available on the effect of the dose response to fish intake on plasma levels of n-3 fatty acids. To compare the effects of different doses of farmed Atlantic salmon on plasma phospholipid fatty acid proportions and CVD risk biomarkers (eg, glucose, insulin, homeostasis model of assessment-insulin resistance, high-sensitivity C-reactive protein, and interleukin-6) in healthy subjects we performed a randomized three-period crossover-designed trial (4-week treatment, 4- to 8-week washout) to compare the effects of twice per week consumption of farmed Atlantic salmon at doses of 90, 180, and 270 g in 19 apparently healthy men and women (mean age 40 to 65 years) and a body mass index between 25 and 34.9. All study visits were conducted at the US Department of Agriculture Agricultural Research Service Grand Forks Human Nutrition Research Center. Eicosapentaenoic acid and total n-3 concentrations were increased (Pfarmed Atlantic salmon to the diet twice per week for 4 weeks at portions of 180 g and 270 g modifies phospholipid fatty acid proportions of n-3 and n-6 in a level associated with decreased risk for CVD. Copyright © 2013 Academy of Nutrition and Dietetics. Published by Elsevier Inc. All rights reserved.

  18. Genetic loci associated with plasma phospholipid N-3 fatty acids: A Meta-Analysis of Genome-Wide association studies from the charge consortium

    NARCIS (Netherlands)

    R.N. Lemaitre (Rozenn); T. Tanaka (Toshiko); W. Tang (Weihong); A. Manichaikul (Ani); M. Foy (Millennia); E.K. Kabagambe (Edmond); J.A. Nettleton (Jennifer ); I.B. King (Irena); L.-C. Weng; S. Bhattacharya (Sayanti); S. Bandinelli (Stefania); J.C. Bis (Joshua); S.S. Rich (Stephen); D.R. Jacobs (David); A. Cherubini (Antonio); B. McKnight (Barbara); S. Liang (Shuang); X. Gu (Xiangjun); K.M. Rice (Kenneth); C.C. Laurie (Cathy); T. Lumley (Thomas); B.L. Browning (Brian); B.M. Psaty (Bruce); Y.D.I. Chen (Yii-Der Ida); Y. Friedlander (Yechiel); L. Djousse (Luc); J.H.Y. Wu (Jason); D.S. Siscovick (David); A.G. Uitterlinden (André); L. Ferrucci (Luigi); M. Fornage (Myriam); M.Y. Tsai (Michael); D. Mozaffarian (Dariush); L.M. Steffen (Lyn); D.K. Arnett (Donna)


    textabstractLong-chain n-3 polyunsaturated fatty acids (PUFAs) can derive from diet or from α-linolenic acid (ALA) by elongation and desaturation. We investigated the association of common genetic variation with plasma phospholipid levels of the four major n-3 PUFAs by performing genome-wide

  19. Higher order structure in a complex plasma (United States)

    Donkó, Z.; Hartmann, P.; Magyar, P.; Kalman, G. J.; Golden, K. I.


    The direct experimental determination of the 3-point static structure function S(3)(k1, k2, k0) of a 2-dimensional dusty plasma liquid is presented. The measurements are complemented by molecular dynamics simulations of the system, using parameters (dust charge, plasma frequency, coupling and screening coefficients), which are derived from the experimentally obtained 2-point static structure function S(2), as well as the dynamic structure function and current-current fluctuation spectra. The experimental results of S(3) are in good agreement with those of the simulations, including the (low wavenumber) domain, where S(3) acquires negative values. The "Convolution Approximation" (giving S(3) in a factorized form of S(2) functions) clearly breaks down in this domain; however, it is found to be a useful aid for explaining the main features of the S(3)(k1, k2, k0) functions, for which (experimental and simulation) maps are presented at selected values of one of its arguments.

  20. Response of plasma fatty acid profiles to changes in dietary n-3 fatty acids and its correlation with erythrocyte fatty acid profiles in dogs. (United States)

    Stoeckel, K; Bachmann, L; Dobeleit, G; Fuhrmann, H


    An elevated level of long-chain n-3 fatty acids (FA) in tissue membranes has a positive influence on the progression and treatment of many diseases. Therefore, dietary supplementation of n-3 FA is recommended in some diseases. Even though n-3 FA are absorbed readily from the diet, their incorporation into tissues may be compromised in diseased animals. In a clinical setting, it is desirable to monitor the success of dietary intervention. Plasma FA as well as erythrocyte membrane (EM) FA can be used to monitor dietary FA intake. This study compares FA from EM and plasma with regard to their reaction time and reliability for monitoring dietary changes of tissue FA profiles in dogs. Thirty dogs were divided into three groups and fed for 12 weeks. The control group (CONT) was fed a commercial standard diet low in n-3 FA. One group received the standard diet and 85 mg/kg body weight of a docosahexaenoic acid (DHA) concentrate (ADD). The third group was fed a commercial dog food containing fish oil (FO), which is rich in eicosapentaenoic acid (EPA). EM and plasma FA profiles were analysed by GC separately. Data on EM FA were published recently. n-3 FA in plasma reached the new level after 2 weeks (8 weeks in EM). Dietary differences between DHA and EPA are obvious after 1 week already. The concomitant decrease in plasma n-6 FA differed between ADD and FO. In general, the correlation of n-6 FA between plasma and EM was low. We therefore conclude that analysis of plasma FA is sufficient for monitoring a diet-induced increase in tissue n-3 FA in dogs. However, EM FA should be analysed if the effect of dietary intervention on tissue n-6 FA is important. © 2012 Blackwell Verlag GmbH.

  1. Microencapsulated krill and tuna oil blend raises plasma long-chain n-3 polyunsaturated fatty acid levels compared to tuna oil with similar increases in ileal contractility in rats. (United States)

    Patten, Glen S; Sanguansri, Luz; Augustin, Mary Ann; Abeywardena, Mahinda Y; Bird, Anthony R; Patch, Craig S; Belobrajdic, Damien P


    Long-chain n-3 polyunsaturated fatty acids (LC n-3 PUFA) may be more bioavailable from krill oil compared to fish oil due to their phospholipid structure. We tested whether a microencapsulated krill and tuna oil blend (ME-TOKO) provided greater LC n-3 PUFA bioavailability, improved blood lipid profiles and increased intestinal contractility compared to microencapsulated tuna oil (ME-TO). Rats were divided into three groups to receive isocaloric diets containing ME-TO, ME-TOKO and microencapsulated olive oil (ME-OO) at 0.3 or 2 g/100 g for 4 weeks. Final body and organ weights, feed intake and waste output were similar. ME-TOKO rats had higher plasma total LC n-3 PUFA levels compared to ME-TO, but liver LC n-3 PUFA levels and plasma triglyceride and cholesterol levels were similar in non-fasted rats. Diets containing 2% ME-TO and ME-TOKO also showed similar increases in ileal contractility. In summary, ME-TO bioavailability of LC n-3 PUFA was similar to ME-TOKO.

  2. Higher order cumulants in colorless partonic plasma

    Energy Technology Data Exchange (ETDEWEB)

    Cherif, S. [Sciences and Technologies Department, University of Ghardaia, Ghardaia, Algiers (Algeria); Laboratoire de Physique et de Mathématiques Appliquées (LPMA), ENS-Kouba (Bachir El-Ibrahimi), Algiers (Algeria); Ahmed, M. A. A. [Department of Physics, College of Science, Taibah University Al-Madinah Al-Mounawwarah KSA (Saudi Arabia); Department of Physics, Taiz University in Turba, Taiz (Yemen); Laboratoire de Physique et de Mathématiques Appliquées (LPMA), ENS-Kouba (Bachir El-Ibrahimi), Algiers (Algeria); Ladrem, M., E-mail: [Department of Physics, College of Science, Taibah University Al-Madinah Al-Mounawwarah KSA (Saudi Arabia); Laboratoire de Physique et de Mathématiques Appliquées (LPMA), ENS-Kouba (Bachir El-Ibrahimi), Algiers (Algeria)


    Any physical system considered to study the QCD deconfinement phase transition certainly has a finite volume, so the finite size effects are inevitably present. This renders the location of the phase transition and the determination of its order as an extremely difficult task, even in the simplest known cases. In order to identify and locate the colorless QCD deconfinement transition point in finite volume T{sub 0}(V), a new approach based on the finite-size cumulant expansion of the order parameter and the ℒ{sub m,n}-Method is used. We have shown that both cumulants of higher order and their ratios, associated to the thermodynamical fluctuations of the order parameter, in QCD deconfinement phase transition behave in a particular enough way revealing pronounced oscillations in the transition region. The sign structure and the oscillatory behavior of these in the vicinity of the deconfinement phase transition point might be a sensitive probe and may allow one to elucidate their relation to the QCD phase transition point. In the context of our model, we have shown that the finite volume transition point is always associated to the appearance of a particular point in whole higher order cumulants under consideration.

  3. Effects of psyllium on plasma total and lipoprotein cholesterol and hepatic cholesterol in hamsters fed n-3 PUFA or n-6 PUFA with high cholesterol levels. (United States)

    Liu, Young-Chau; Liu, Shyun-Yeu; Lin, Mei-Huei


    This study was conducted to determine whether psyllium is known to alter cholesterol metabolism modulate the hypercholesterolemic effect of a high cholesterol, n-3 polyunsaturated fatty acids (PUFA) diet in hamsters. Concentrations of plasma, hepatic total cholesterol and lipoprotein cholesterol were measured in male hamsters fed an n-3 PUFA plus psyllium (8%, wt/wt) diet combined with variable levels of cholesterol (0, 0.05, 0.1%, wt/wt) or a cholesterol-enriched (0.2%, wt/wt) n-3 PUFA or n-6 PUFA diet that contained either 8% methyl cellulose or psyllium for 4 weeks. In the n-3 PUFA-fed hamsters, we have found that psyllium was able to reduce plasma total cholesterol and low density lipoprotein (LDL)-cholesterol significantly when 0.1% cholesterol was added to the diet. In contrast, the effects of psyllium were not seen in the n-3 PUFA-fed hamsters without dietary cholesterol or with 0.05% dietary cholesterol. However, no matter in the presence of psyllium or not, the increase of plasma total cholesterol, very-low-density lipoprotein (VLDL)-cholesterol, LDL-cholesterol and high-density lipoprotein (HDL)-cholesterol levels was depend on the content of dietary cholesterol. Although the cholesterol diet increased the liver total cholesterol level, 80 g psyllium/kg diet resulted in a significantly lower concentration of liver total cholesterol in the cholesterol-fed hamsters. In the second experiment, we have also found that psyllium feeding lowered significantly plasma total cholesterol and VLDL-cholesterol concentrations in hamsters fed n-3 PUFA but not in those fed n-6 PUFA. However, the levels of plasma total cholesterol, VLDL-cholesterol and LDL-cholesterol levels of the (n-6) PUFA-fed hamsters were significantly lower than those in the (n-3) PUFA-fed hamsters in the absence or presence of dietary psyllium. Our data also showed that hamsters fed both high-cholesterol n-3 PUFA and n-6 PUFA diets had a significant decrease in hepatic cholesterol with intake of

  4. Filtering of higher-order laser modes using plasma structures (United States)

    Djordjevic, Blagoje; Benedetti, Carlo; Schroeder, Carl; Esarey, Eric; Leemans, Wim


    Plasma structures based on leaky channels are proposed to filter higher-order laser mode content. The evolution and propagation of non-Gaussian laser pulses in leaky channels is studied, and it is shown that, for appropriate laser-plasma parameters, the higher-order laser mode content may be removed while the fundamental mode remains well-guided. The behavior of the multi-mode laser pulse is described analytically, including the derivation of the leakage coefficients, and compared to numerical calculations. Gaussian laser pulse propagation, without higher-order mode content, improves guiding in parabolic plasma channels, enabling extended interaction lengths for laser-plasma accelerator applications. This work was supported by the Director, Office of Science, Office of High Energy Physics, of the U.S. Department of Energy under Contract No. DE-AC02-05CH11231.

  5. Plasma n-3 fatty acids and the risk of cognitive decline in older adults: the Atherosclerosis Risk in Communities Study

    National Research Council Canada - National Science Library

    Beydoun, May A; Kaufman, Jay S; Satia, Jessie A; Rosamond, Wayne; Folsom, Aaron R


    Plasma fatty acids may affect the risk of cognitive decline in older adults. We prospectively studied the association between plasma fatty acids and cognitive decline in adults aged 50-65 y at baseline and conducted a subgroup analysis...

  6. n-3 PUFA Esterified to Glycerol or as Ethyl Esters Reduce Non-Fasting Plasma Triacylglycerol in Subjects with Hypertriglyceridemia

    DEFF Research Database (Denmark)

    Hedengran, Anne; Szecsi, Pal B; Dyerberg, Jørn


    To date, treatment of hypertriglyceridemia with long-chain n-3 polyunsaturated fatty acids (n-3 PUFA) has been investigated solely in fasting and postprandial subjects. However, non-fasting triacylglycerols are more strongly associated with risk of cardiovascular disease. The objective......-PUFA group (P omega-3 index (EPA + DHA content in erythrocyte membranes). The omega-3 index increased 63.2 % in the AG......-associated phospholipase A2 (LpPLA2) decreased in the EE-PUFA group (P = 0.001). No serious adverse events were observed. Supplementation with long-chain n-3 PUFA lowered non-fasting triacylglycerol levels, suggestive of a reduction in cardiovascular risk. Regardless of the different effects on heart rate, HDL, and LpPLA2...

  7. Atherogenic index of plasma is higher in rubella positive than ...

    African Journals Online (AJOL)

    Atherogenic index of plasma is higher in rubella positive than rubella negative pregnant women in Benin City. B.I. Adejumo, C.A. Chukwuekezie, M.A. Emokpae, C.O. Ewenighi, M.A. Muibi, U Dimkpa, U.C. Odionyema, T.J.P. Ezimokhai ...

  8. Association of n3 and n6 polyunsaturated fatty acids in red blood cell membrane and plasma with severity of normal tension glaucoma

    Directory of Open Access Journals (Sweden)

    Man Yu


    Full Text Available AIM:To determine whether red blood cell (RBC membrane and plasma lipids, particularly long-chain polyunsaturated fatty acids such as eicosapentaenoic acid (EPA, docosahexaenoic acid (DHA, arachidonic acid (AA are significantly correlated with severity of normal tension glaucoma (NTG.METHODS:This study included 35 patients with NTG and 12 healthy normal control subjects, matched for age and sex with the study group. The stage of glaucoma was determined according to the Hodapp-Parrish-Anderson classification. Lipids were extracted from RBC membranes and plasma, and fatty acid methyl esters prepared and analyzed by gas chromatography-mass spectrometry (GC-MS.RESULTS:When RBC lipids were analyzed, the levels of EPA, the levels of DHA and the ratio of n3 to n6 were positively associated with the Humphrey Perimetry mean deviation (MD score (r=0.617, P<0.001; r=0.727, P<0.001 and r=0.720, P<0.001, respectively, while the level of AA was negatively associated with the MD score (r=-0.427, P=0.001. When plasma lipids were analyzed, there was a significant positive relationship between the levels of EPA and the MD score (r=0.648, P<0.001, and the levels of AA were inversely correlated with the MD score (r=-0.638, P<0.001.CONCLUSION:The levels of n3 and n6 polyunsaturated fatty acids in RBC membrane and plasma lipids were associated with severity of NTG.

  9. Association of Plasma Phospholipid n-3 and n-6 Polyunsaturated Fatty Acids with Type 2 Diabetes: The EPIC-InterAct Case-Cohort Study.

    Directory of Open Access Journals (Sweden)

    Nita G Forouhi


    Full Text Available Whether and how n-3 and n-6 polyunsaturated fatty acids (PUFAs are related to type 2 diabetes (T2D is debated. Objectively measured plasma PUFAs can help to clarify these associations.Plasma phospholipid PUFAs were measured by gas chromatography among 12,132 incident T2D cases and 15,919 subcohort participants in the European Prospective Investigation into Cancer and Nutrition (EPIC-InterAct study across eight European countries. Country-specific hazard ratios (HRs were estimated using Prentice-weighted Cox regression and pooled by random-effects meta-analysis. We also systematically reviewed published prospective studies on circulating PUFAs and T2D risk and pooled the quantitative evidence for comparison with results from EPIC-InterAct. In EPIC-InterAct, among long-chain n-3 PUFAs, α-linolenic acid (ALA was inversely associated with T2D (HR per standard deviation [SD] 0.93; 95% CI 0.88-0.98, but eicosapentaenoic acid (EPA and docosahexaenoic acid (DHA were not significantly associated. Among n-6 PUFAs, linoleic acid (LA (0.80; 95% CI 0.77-0.83 and eicosadienoic acid (EDA (0.89; 95% CI 0.85-0.94 were inversely related, and arachidonic acid (AA was not significantly associated, while significant positive associations were observed with γ-linolenic acid (GLA, dihomo-GLA, docosatetraenoic acid (DTA, and docosapentaenoic acid (n6-DPA, with HRs between 1.13 to 1.46 per SD. These findings from EPIC-InterAct were broadly similar to comparative findings from summary estimates from up to nine studies including between 71 to 2,499 T2D cases. Limitations included potential residual confounding and the inability to distinguish between dietary and metabolic influences on plasma phospholipid PUFAs.These large-scale findings suggest an important inverse association of circulating plant-origin n-3 PUFA (ALA but no convincing association of marine-derived n3 PUFAs (EPA and DHA with T2D. Moreover, they highlight that the most abundant n6-PUFA (LA is inversely

  10. Incremental replacement of saturated fats by n-3 fatty acids in high-fat, high-cholesterol diets reduces elevated plasma lipid levels and arterial lipoprotein lipase, macrophages and atherosclerosis in LDLR-/- mice. (United States)

    Chang, Chuchun L; Torrejon, Claudia; Jung, Un Ju; Graf, Kristin; Deckelbaum, Richard J


    Effects of progressive substitution of dietary n-3 fatty acids (FA) for saturated FA (SAT) on modulating risk factors for atherosclerosis have not been fully defined. Our previous reports demonstrate that SAT increased, but n-3 FA decreased, arterial lipoprotein lipase (LpL) levels and arterial LDL-cholesterol deposition early in atherogenesis. We now questioned whether incremental increases in dietary n-3 FA can counteract SAT-induced pro-atherogenic effects in atherosclerosis-prone LDL-receptor knockout (LDLR-/-) mice and have identified contributing mechanisms. Mice were fed chow or high-fat diets enriched in SAT, n-3, or a combination of both SAT and n-3 in ratios of 3:1 (S:n-3 3:1) or 1:1 (S:n-3 1:1). Each diet resulted in the expected changes in fatty acid composition in blood and aorta for each feeding group. SAT-fed mice became hyperlipidemic. By contrast, n-3 inclusion decreased plasma lipid levels, especially cholesterol. Arterial LpL and macrophage levels were increased over 2-fold in SAT-fed mice but these were decreased with incremental replacement with n-3 FA. n-3 FA partial inclusion markedly decreased expression of pro-inflammatory markers (CD68, IL-6, and VCAM-1) in aorta. SAT diets accelerated advanced atherosclerotic lesion development, whereas all n-3 FA-containing diets markedly slowed atherosclerotic progression. Mechanisms whereby dietary n-3 FA may improve adverse cardiovascular effects of high-SAT, high-fat diets include improving plasma lipid profiles, increasing amounts of n-3 FA in plasma and the arterial wall. Even low levels of replacement of SAT by n-3 FA effectively reduce arterial lipid deposition by decreasing aortic LpL, macrophages and pro-inflammatory markers. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  11. Incremental Replacement of Saturated Fats by n-3 Fatty Acids in High-Fat, High-Cholesterol Diets Reduces Elevated Plasma Lipid Levels and Arterial Lipoprotein Lipase, Macrophages and Atherosclerosis in LDLR−/− Mice (United States)

    Chang, Chuchun L.; Torrejon, Claudia; Jung, Un Ju; Graf, Kristin; Deckelbaum, Richard J.


    Objective Effects of progressive substitution of dietary n-3 fatty acids (FA) for saturated FA (SAT) on modulating risk factors for atherosclerosis have not been fully defined. Our previous reports demonstrate that SAT increased, but n-3 FA decreased, arterial lipoprotein lipase (LpL) levels and arterial LDL-cholesterol deposition early in atherogenesis. We now questioned whether incremental increases in dietary n-3 FA can counteract SAT-induced pro-atherogenic effects in atherosclerosis-prone LDL-receptor knockout (LDLR−/−) mice and have identified contributing mechanisms. Methods and results Mice were fed chow or high-fat diets enriched in SAT, n-3, or a combination of both SAT and n-3 in ratios of 3:1 (S:n-3 3:1) or 1:1 (S:n-3 1:1). Each diet resulted in the expected changes in fatty acid composition in blood and aorta for each feeding group. SAT-fed mice became hyperlipidemic. By contrast, n-3 inclusion decreased plasma lipid levels, especially cholesterol. Arterial LpL and macrophage levels were increased over 2-fold in SAT-fed mice but these were decreased with incremental replacement with n-3 FA. n-3 FA partial inclusion markedly decreased expression of pro-inflammatory markers (CD68, IL-6, and VCAM-1) in aorta. SAT diets accelerated advanced atherosclerotic lesion development, whereas all n-3 FA-containing diets markedly slowed atherosclerotic progression. Conclusion Mechanisms whereby dietary n-3 FA may improve adverse cardiovascular effects of high-SAT, high-fat diets include improving plasma lipid profiles, increasing amounts of n-3 FA in plasma and the arterial wall. Even low levels of replacement of SAT by n-3 FA effectively reduce arterial lipid deposition by decreasing aortic LpL, macrophages and pro-inflammatory markers. PMID:24747115

  12. Plasma conversion of methane into higher hydrocarbons at surfaces

    Energy Technology Data Exchange (ETDEWEB)

    Sackinger, W.M.; Kamath, V.A. [Univ. of Alaska, Fairbanks, AK (United States)


    Natural gas is widely abundant, is easily withdrawn from reservoirs, is commonly produced as an associated gas along with crude oil production, and is found in many geologic settings as a resource separate from oil. A much larger fraction of the natural gas may be produced from a gas reservoir, as compared with a crude oil reservoir. However, natural gas is normally transported by pipeline, and the energy throughput of such a pipeline is perhaps only 20% to 30% of the throughput of an oil pipeline of the same size and cost. Gas is difficult to transport in moderate quantities at low cost, as it must either have a special pipeline or must be liquified into LNG, shipped in cryogenic LNG tankers, and regasified chemical stability of methane has made it difficult to convert it directly into conventional hydrocarbon fuel mixtures, and has also impeded its use as a feedstock for petrochemical production. Experiments are described in which a methane plasma is created, and the resulting methyl and hydrogen ions have been accelerated within a microchannel array so that they interact with neutral methane molecules on the inside surfaces of the microchannels. No catalysts are used, and the device operates at room temperature. Impact energies of the ions are in the range of 15 ev to greater than 100 ev, and the energy delivered in the interaction at the surfaces has caused the production of larger hydrocarbon molecules, such as C{sub 2}H{sub 2}, C{sub 2}H{sub 4}, and C{sub 2}H{sub 6}, along with C{sub 3}, C{sub 4}, C{sub 5}, C{sub 6}, C{sub 7}, and C{sub 8} molecules. Conversion effectiveness is greater at higher pressure, due to the increased ionic activity. The costs of production of the plasma conversion devices are projected to be quite low, and the technology appears to be commercially and economically feasible.

  13. The Effect of Low-Dose Marine n-3 Fatty Acids on Plasma Levels of sCD36 in Overweight Subjects: A Randomized, Double-Blind, Placebo-Controlled Trial

    Directory of Open Access Journals (Sweden)

    Erik Berg Schmidt


    Full Text Available CD36 is a scavenger receptor involved in lipid uptake and inflammation. Recently, non-cell-bound CD36 (sCD36 was identified in plasma and suggested to be a marker of lipid accumulation in the vessel wall. Marine n-3 polyunsaturated fatty acids (PUFA may have cardioprotective effects. This study evaluated the effect of marine n-3 PUFA on sCD36 levels in overweight subjects. Fifty overweight subjects were randomized to 1.1 g of n-3 PUFA or 2 g of olive oil daily for six weeks. Neutrophils were isolated at baseline and after six weeks of treatment while an adipose tissue biopsy was obtained at baseline. The content of n-3 PUFA in adipose tissue and neutrophils was analyzed by gas chromatography, while plasma levels of sCD36 were determined using an enzyme-linked immunosorbent assay (ELISA. After six weeks of supplement plasma sCD36 did not differ between supplements (P = 0.18. There was no significant correlation between plasma sCD36 levels and n-3 PUFA in neutrophils at baseline (r = −0.02, P = 0.88, after six weeks supplement (r = −0.03, P = 0.85 or in adipose tissue (r = 0.14, P = 0.34. This study therefore does not provide evidence for a cardioprotective effect of n-3 PUFA acting through a CD36-dependent mechanism.

  14. Associations between dietary n-6 and n-3 fatty acids and arachidonic acid compositions in plasma and erythrocytes in young and elderly Japanese volunteers

    Directory of Open Access Journals (Sweden)

    Kawabata Terue


    Full Text Available Abstract Background We reported that the compositions of arachidonic acid (ARA in erythrocytes and plasma phospholipids (PL in the elderly were lower than those in the young, though the ARA intake was nearly identical. Objective We further analyzed data in four study groups with different ages and sexes, and determined that the blood ARA levels were affected by the kinds of dietary fatty acids ingested. Methods One hundred and four healthy young and elderly volunteers were recruited. Dietary records together with photographic records from 28 consecutive days were reviewed and the fatty acid composition in plasma lipid fractions and erythrocyte PL was analyzed. Results No correlations for ARA between dietary fatty acids and blood lipid fractions were observed. A significant negative correlation between eicosapentaenoic acid (EPA + docosahexaenoic acid (DHA intake and ARA composition in erythrocyte PL was observed. ARA composition in erythrocyte PL was significantly lower in elderly subjects than in young subjects, because EPA and DHA intake in elderly subjects was higher than in young subjects. However, after removing the effect of dietary EPA+DHA intake, the ARA composition in erythrocyte PL in elderly subjects was significantly lower than that in young subjects. Conclusions Changes in physical conditions with aging influenced the low ARA composition of erythrocyte in elderly subjects in addition to the effects of dietary EPA and DHA.

  15. Independent and interactive effects of plant sterols and fish oil n-3 long-chain polyunsaturated fatty acids on the plasma lipid profile of mildly hyperlipidaemic Indian adults

    National Research Council Canada - National Science Library

    Khandelwal, Shweta; Demonty, Isabelle; Jeemon, Panniyammakal; Lakshmy, Ramakrishnan; Mukherjee, Rajat; Gupta, Ruby; Snehi, Uma; Niveditha, Devasenapathy; Singh, Yogendra; van der Knaap, Henk C. M; Passi, Santosh J; Prabhakaran, Dorairaj; Reddy, K. Srinath


    The present study was designed to evaluate the independent and interactive effects of a once-a-day yoghurt drink providing 2 g plant sterols/d and capsules providing 2 g fish oil n-3 long-chain (LC...

  16. Fish oil and inflammatory status alter the n-3 to n-6 balance of the endocannabinoid and oxylipin metabolomes in mouse plasma and tissues

    NARCIS (Netherlands)

    Balvers, M.G.J.; Verhoeckx, K.C.M.; Bijlsma, S.; Rubingh, C.M.; Meijerink, J.; Wortelboer, H.M.; Witkamp, R.F.


    It is well established that dietary intake of n-3 fatty acids is associated with anti-inflammatory effects, and this has been linked to modulation of the oxylipin and endocannabinoid metabolomes. However, the amount of data on specific tissue effects is limited, and it is not known how inflammation

  17. Plasma homocysteine levels in Taiwanese vegetarians are higher than those of omnivores. (United States)

    Hung, Chien-Jung; Huang, Po-Chao; Lu, Shao-Chun; Li, Yi-Hwei; Huang, Hsien-Bin; Lin, Bi-Fong; Chang, Sue-Joan; Chou, Hsu-Fang


    Mild hyperhomocysteinemia is an independent risk factor for cardiovascular disease and may result from a deficiency of folate, vitamin B-6 or vitamin B-12. Because vitamin B-12 deficiency is often associated with vegetarianism, this study was designed to examine the effect of Taiwanese vegetarian diets on B-vitamin status and plasma homocysteine levels. Female Buddhist lacto-vegetarians (n = 45; 31-45 y) and matched omnivores (n = 45) recruited in Hualien, Taiwan, were investigated. Taiwanese vegetarians consumed normal amount of folate, but only 21% of Taiwan Recommended Daily Nutrient Allowances (RDNA) values of vitamin B-12. Compared with the omnivores, the vegetarians had significantly higher levels of plasma folate (14.79 +/- 7.70 vs. 11.98 +/- 8.29 nmol/L), but lower levels of vitamin B-12 (207.7 +/- 127.1 vs. 403.5 +/- 138.9 pmol/L). Fasting plasma homocysteine levels were significantly higher in vegetarians than in omnivores (mean: 11.20 +/- 4.27 vs. 8.64 +/- 2.06 micromol/L; median: 10.5 vs. 8.5 micromol/L). Fasting plasma homocysteine was inversely correlated with plasma folate and vitamin B-12 in the vegetarian group. Multiple regression analysis revealed that plasma folate, vitamin B-12 and creatinine were independent determinants of homocysteine variation and contributed to 38.6% of homocysteine variation in the vegetarians. Compared with the omnivores, vegetarians also had significantly lower serum levels of valine, isoleucine, leucine, lysine, alanine and arginine, but higher levels of glycine. In the vegetarian group, fasting plasma homocysteine correlated negatively with serum threonine, lysine, histidine, arginine and cystine, and these amino acids contributed to 38.7% of homocysteine variation. In conclusion, the Buddhist nuns who consumed a lacto-vegetarian diet had mildly elevated fasting plasma homocysteine levels presumably due to lower levels of plasma vitamin B-12.

  18. PHz-Wide Spectral Interference Through Coherent Plasma-Induced Fission of Higher-Order Solitons (United States)

    Köttig, F.; Tani, F.; Travers, J. C.; Russell, P. St. J.


    We identify a novel regime of soliton-plasma interactions in which high-intensity ultrashort pulses of intermediate soliton order undergo coherent plasma-induced fission. Experimental results obtained in gas-filled hollow-core photonic crystal fiber are supported by rigorous numerical simulations. In the anomalous dispersion regime, the cumulative blueshift of higher-order input solitons with ionizing intensities results in pulse splitting before the ultimate self-compression point, leading to the generation of robust pulse pairs with PHz bandwidths. The novel dynamics closes the gap between plasma-induced adiabatic soliton compression and modulational instability.

  19. Higher Plasma ApoE Levels are Associated with Low-Normal Thyroid Function : Studies in Diabetic and Nondiabetic Subjects

    NARCIS (Netherlands)

    Tienhoven-Wind, van Lynnda; Dallinga-Thie, G. M.; Dullaart, R. P. F.

    Low-normal thyroid function within the euthyroid range may confer higher plasma triglycerides, but relationships with plasma apoli-poprotein (apo) E, which plays an important role in the metabolism of triglyceride-rich apoB-containing lipoproteins, are unknown. We determined relationships of plasma

  20. Higher-order oligomerization targets plasma membrane proteins and HIV gag to exosomes.

    Directory of Open Access Journals (Sweden)

    Yi Fang


    Full Text Available Exosomes are secreted organelles that have the same topology as the cell and bud outward (outward is defined as away from the cytoplasm from endosome membranes or endosome-like domains of plasma membrane. Here we describe an exosomal protein-sorting pathway in Jurkat T cells that selects cargo proteins on the basis of both higher-order oligomerization (the oligomerization of oligomers and plasma membrane association, acts on proteins seemingly without regard to their function, sequence, topology, or mechanism of membrane association, and appears to operate independently of class E vacuolar protein-sorting (VPS function. We also show that higher-order oligomerization is sufficient to target plasma membrane proteins to HIV virus-like particles, that diverse Gag proteins possess exosomal-sorting information, and that higher-order oligomerization is a primary determinant of HIV Gag budding/exosomal sorting. In addition, we provide evidence that both the HIV late domain and class E VPS function promote HIV budding by unexpectedly complex, seemingly indirect mechanisms. These results support the hypothesis that HIV and other retroviruses are generated by a normal, nonviral pathway of exosome biogenesis.

  1. Diabetes is Associated with Higher Trimethylamine N-oxide Plasma Levels. (United States)

    Dambrova, M; Latkovskis, G; Kuka, J; Strele, I; Konrade, I; Grinberga, S; Hartmane, D; Pugovics, O; Erglis, A; Liepinsh, E


    Recent studies have revealed strong associations between systemic trimethylamine N-oxide (TMAO) levels, atherosclerosis and cardiovascular risk. In addition, plasma L-carnitine levels in patients with high TMAO concentrations predicted an increased risk for cardiovascular disease and incident major adverse cardiac events. The aim of the present study was to investigate the relation between TMAO and L-carnitine plasma levels and diabetes. Blood plasma samples were collected from 12 and 20 weeks old db/db mice and patients undergoing percutaneous coronary intervention. Diabetic compared to non-diabetic db/L mice presented 10-fold higher TMAO, but lower L-carnitine plasma concentrations at 12 weeks of age. After 8 weeks of observation, diabetic db/db mice had significantly increased body weight, insulin resistance and TMAO concentration in comparison to non-diabetic control. In 191 patients undergoing percutaneous coronary intervention the median (interquartile range) plasma concentration of TMAO was 1.8 (1.2-2.6) µmol/L. Analysis of the samples showed a bivariate association of TMAO level with age, total cholesterol and L-carnitine. The multivariate linear regression analysis revealed that, in addition to L-carnitine as the strongest predictor of log transformed TMAO (p<0.001), the parameters of age, diabetes status and body mass index (BMI) were independently associated with increased log transformed TMAO levels (p<0.01).Our data provide evidence that age, diabetes and BMI are associated with higher TMAO levels independently of L-carnitine. These data support the hypothesis of TMAO as a cardiovascular risk marker and warrant further investigation of TMAO for diabetes research applications. © Georg Thieme Verlag KG Stuttgart · New York.

  2. Higher order corrections to dust-acoustic shock waves in a strongly coupled cryogenic dusty plasma (United States)

    El-Borie, M. A.; Atteya, A.


    To investigate the contribution of higher-order nonlinearity and dissipation to nonlinear ultra-low-frequency dust-acoustic shock waves (DASWs), a reductive perturbation technique is employed in a strongly coupled cryogenic dusty plasma. The model consists of Boltzmann distributed electrons and ions, as well as equations for strongly coupled charged dust grains. A nonlinear Burger equation and a linear inhomogeneous Burger-type equation are derived. The present model admits both compressive and rarefactive dust-acoustic (DA) shocks. Including these higher-order corrections results in creating new shock wave structures called "humped DASWs." It is shown that the effects of kinematic viscosity, the number of electrons residing on the dust grain surface, Zd, and the dust number density via β have important roles in the basic features of the produced DA shocks and the associated electric fields. It has been shown that it is more important to be included. These findings are devoted to explaining the observed waves propagating in the laboratory plasma experiments at cryogenic temperature. This kind of plasma is used for etching nano-patterns without defects, used in nonideal systems, and physics of nucleation to deposit nanosize Si compounds.

  3. n-3 Polyunsaturated Fatty Acids and Metabolic Syndrome Risk: A Meta-Analysis

    Directory of Open Access Journals (Sweden)

    Xiao-fei Guo


    Full Text Available The associations between n-3 polyunsaturated fatty acids (PUFAs and metabolic syndrome (MetS risk have demonstrated inconsistent results. The present study aimed to investigate whether higher circulating n-3 PUFAs and dietary n-3 PUFAs intake have a protective effect on MetS risk. A systematic literature search in the PubMed, Scopus, and Chinese National Knowledge Infrastructure (CNKI databases was conducted up to March 2017. Odd ratios (ORs from case-control and cross-sectional studies were combined using a random-effects model for the highest versus lowest category. The differences of n-3 PUFAs between healthy subjects and patients with MetS were calculated as weighted mean difference (WMD by using a random-effects model. Seven case-control and 20 cross-sectional studies were included. A higher plasma/serum n-3 PUFAs was associated with a lower MetS risk (Pooled OR = 0.63, 95% CI: 0.49, 0.81. The plasma/serum n-3 PUFAs in controls was significantly higher than cases (WMD: 0.24; 95% CI: 0.04, 0.43, especially docosapentaenoic acid (DPA and docosahexaenoic acid (DHA. However, no significant association was found between dietary intake of n-3 PUFAs or fish and MetS risk. The present study provides substantial evidence of a higher circulating n-3 PUFAs associated with a lower MetS risk. The circulating n-3 PUFAs can be regarded as biomarkers indicating MetS risk, especially DPA and DHA.

  4. Higher level of plasma bioactive molecule sphingosine 1-phosphate in women is associated with estrogen. (United States)

    Guo, Shoudong; Yu, Yang; Zhang, Nan; Cui, Yingjie; Zhai, Lei; Li, Helou; Zhang, Ying; Li, Fuyu; Kan, Yujie; Qin, Shucun


    Both sphingosine 1-phosphate (S1P) and estrogen have been documented to play endothelial protective roles. However, it remains unclear whether estrogen could regulate the anabolism of the bioactive molecule S1P and the underlying mechanisms. In this study, 108 healthy participants were separated into three age groups, and their plasma S1P levels were analyzed by liquid chromatography tandem mass spectrometry. Results showed that the plasma S1P levels were significantly higher in women than those in men within the age of 16-55years old and higher in pre-menopausal than post-menopausal women. The experiment in C57 BL/6 mice confirmed the gender difference of plasma S1P level. In vitro study demonstrated that after the stimulation of 17β-estradiol (E2), S1P levels both in EA.hy926 cells and the culture media were increased about 9 and 3 times, respectively; the mRNA expression, the protein level and the activity of sphingosine kinase (SphK) 1, not SphK2, were markedly increased; the mRNA and protein expression of ATP-binding cassette transporter (ABC) C1, G2 and S1P transporter spinster homolog 2 (Spns2) were significantly elevated; furthermore, the mRNA and protein expressions of S1P receptors (S1PRs) 1-2 were increased in a time-dependent manner. This study suggests that E2 markedly improves S1P synthesis by activating SphK1 and induces S1P export via activating ABCC1, G2 and Spns2 from endothelium system, which may consequently lead to the gender difference of plasma S1P in adult human and mouse. The results of this study suggest that E2 may exert its vasculoprotective function by activation of the SphK1-S1P-S1PR signaling axis. Copyright © 2014 Elsevier B.V. All rights reserved.

  5. Analysis of higher harmonics on bidirectional heat pulse propagation experiment in helical and tokamak plasmas (United States)

    Kobayashi, T.; Ida, K.; Inagaki, S.; Tsuchiya, H.; Tamura, N.; Choe, G. H.; Yun, G. S.; Park, H. K.; Ko, W. H.; Evans, T. E.; Austin, M. E.; Shafer, M. W.; Ono, M.; López-bruna, D.; Ochando, M. A.; Estrada, T.; Hidalgo, C.; Moon, C.; Igami, H.; Yoshimura, Y.; Tsujimura, T. Ii.; Itoh, S.-I.; Itoh, K.


    In this contribution we analyze modulation electron cyclotron resonance heating (MECH) experiment and discuss higher harmonic frequency dependence of transport coefficients. We use the bidirectional heat pulse propagation method, in which both inward propagating heat pulse and outward propagating heat pulse are analyzed at a radial range, in order to distinguish frequency dependence of transport coefficients due to hysteresis from that due to other reasons, such as radially dependent transport coefficients, a finite damping term, or boundary effects. The method is applied to MECH experiments performed in various helical and tokamak devices, i.e. Large Helical Device (LHD), TJ-II, Korea Superconducting Tokamak Advanced Research (KSTAR), and Doublet III-D (DIII-D) with different plasma conditions. The frequency dependence of transport coefficients are clearly observed, showing a possibility of existence of transport hysteresis in flux-gradient relation.

  6. Butter blend containing fish oil improves the level of n-3 fatty acids in biological tissues of hamster

    DEFF Research Database (Denmark)

    Porsgaard, Trine; Overgaard, Jesper; Krogh, Anne Louise


    Syrian hamsters received hamster feed blended with one of the three butter products. After 6 weeks of feeding, the fatty acid compositions of plasma, erythrocytes, liver, brain, and visceral fat were determined. The intake of butter product with fish oil resulted in a higher level of n-3 PUFA in plasma......Many studies have shown beneficial effects of long chain n-3 polyunsaturated fatty acids (PUFA) on human health. Regardless of the positive effects of n-3 PUFA, the intake of these fatty acids remains low. An approach to increase the intake of n-3 PUFA in the population is to incorporate fish oil...... into food. In the present study, fish oil was incorporated into butter blends by enzymatic interesterification. The aim of the study was to investigate the effects of this butter product in comparison with a commercial butter blend and a product produced by interesterification but without fish oil. Golden...

  7. Cholesterol and triglyceride reduction in rats fed Matthiola incana seed oil rich in (n-3) fatty acids. (United States)

    Yaniv, Z; Schafferman, D; Shamir, I; Madar, Z


    Seeds of Matthiola incana contain oil rich (55-65%) in (n-3) linolenic acid. Selected lines were developed and evaluated for their agronomic and chemical parameters. Extracted oil was fed for 6 weeks to rats, which were compared with rats fed a diet containing coconut oil or sunflower oil. Cholesterol levels were significantly lowest in rats fed diets rich in M. incana oil (27% reduction), and triglycerides were significantly lower in rats receiving either M. incana or sunflower oil (36% reduction). The contents of arachidonic acid and other (n-6) fatty acids were significantly the lowest in the liver and plasma of rats that had received M. incana oil. The levels of (n-3) fatty acids were significantly greater in both the liver and plasma of rats fed M. incana oil. The ratio of (n-3)/(n-6) long-chain fatty acids in the plasma was 7 times higher in rats fed with M. incana oil than in those fed with sunflower oil and 6 times higher than in those fed coconut oil. The results demonstrate for the first time a beneficial effect of dietary M. incana oil in reducing cholesterol levels and increasing (n-3) fatty acid levels in the plasma. This new, terrestrial plant source of (n-3) fatty acids could replace marine oils and thereby contribute beneficially to the human diet.

  8. β-endorphins Plasma Level is Higher in Lean Polycystic Ovary Syndrome (PCOS) Women. (United States)

    Kiałka, M; Milewicz, T; Spałkowska, M; Krzyczkowska-Sendrakowska, M; Wasyl, B; Pełka, A; Krzysiek, J


    The evaluation the β-endorphin plasma levels in lean women with polycystic ovary syndrome as well as in women without this disorder. The associations between β-endorphins and other laboratory parameters were also investigated. 31 women lean, defined as women with normal range body mass index, 15 with polycystic ovary syndrome and 16 without this disorder were included to the study. In all the patients the level of β-endorphins was measured. Also the diagnostic laboratory profile including hormone assessment was made in all patients. There were significant differences in β-endorphin levels between the 2 groups. The β-endorphin level was higher in the polycystic ovary syndrome group compared to the healthy controls (15.5±4.37 pg/ml vs. 6.9±2.47 pg/ml, ppolycystic ovary syndrome group. Increase in β-endorphin level of 1 pg/ml was associated with an increase of cortisol at 8 am level of 1.134 µg/dl and decrease of sex hormone binding globuline of 0.948 nmol/l in polycystic ovary syndrome group. Our study showed that the levels of β-endorphins were significantly higher in lean patients with polycystic ovary syndrome than in lean controls. Moreover, β-endorphins levels were found to be correlated with other hormonal parameters. In this respect, β-endorphins may play a role in polycystic ovary syndrome pathophysiology. © Georg Thieme Verlag KG Stuttgart · New York.

  9. Natural gas conversion to higher hydrocarbons using plasma interactions with surfaces. Final report

    Energy Technology Data Exchange (ETDEWEB)

    Sackinger, W.M.; Kamath, V.A.; Morgan, B.L.; Airey, R.W.


    Experiments are reported in which a methane plasma is created, and the methyl ions and hydrogen ions are accelerated within a microchannel array so that they interact with neutral methane molecules on the inside surfaces of the microchannels. No catalysts are used, and the device operates at room temperature. Impact energies of the ions are in the range of 10 eV to greater than 100 eV, and the energy delivered in the interaction at the surfaces causes the production of larger hydrocarbon molecules, such as C{sub 2}H{sub 2}, C{sub 2}H{sub 4}, and C{sub 2}H{sub 6}, along with C{sub 3}, C{sub 4}, C{sub 5}m C{sub 6}, C{sub 7}m and C{sub 8} molecules. There is a decreasing percentage of larger molecules produced, in comparison with the C{sub 2} and C{sub 3} types. Conversion effectiveness is greater at higher pressure, due to the increased ionic activity. The yield of the higher hydrocarbons depends upon the external voltage used, and voltage can be used as a control parameter to adjust the output mixture proportions. A conversion energy of 2.59 kilowatt hours/killogram of output has been demonstrated, and a reduction of this by a factor of 10 is possible using known techniques. In batch experiments, the selectivity for C{sub 2} has varied from 47% to 88%, and selectivity for C{sub 6} has ranged from 0% to 12.8%. Other hydrocarbon selectivities also span a wide and useful range. The estimated costs for hydrocarbons produced with this technology are in the range of $200 per tonne, in production quantities, depending upon natural gas costs. Pilot production experiments are recommended to make these estimates more precise, and to address strategies for scaling the technology up to production levels. Applications are discussed.

  10. Higher intake of fish and fat is associated with lower plasma s-adenosylhomocysteine

    DEFF Research Database (Denmark)

    Lind, Mads Vendelbo; Lauritzen, Lotte; Pedersen, Oluf Borbye


    . In addition we assessed whole-blood fatty acid composition and plasma alkylresorcinols. Plasma s-adenosylmethionine (SAM), s-adenosylhomocysteine (SAH), homocysteine (Hcy) and vitamin B12 was included as one-carbon metabolism markers. We used principal component analysis (PCA) to explore dietary patterns...

  11. Associations between n-3 PUFA concentrations and cognitive function after recovery from late-life depression. (United States)

    Chiu, Chih-Chiang; Frangou, Sophia; Chang, Ching-Jui; Chiu, Wei-Che; Liu, Hsing-Cheng; Sun, I-Wen; Liu, Shen-Ing; Lu, Mong-Liang; Chen, Chun-Hsin; Huang, Shih-Yi; Dewey, Michael E; Stewart, Robert


    Lower concentrations of n-3 PUFAs have been reported to be associated with cognitive impairment and dementia, but also with depression-itself a potential risk factor for cognitive decline. The aims of this study were to investigate associations between n-3 PUFA concentrations in erythrocyte membrane or plasma and cognitive function in an at-risk sample of older people with previous major depression and to explore specificity with respect to cognitive domains. A cross-sectional sample of 132 eligible participants who had recovered from major depression (mean ± SD age: 67.8 ± 6.6 y) were enrolled from outpatient psychiatric services. A series of cognitive tests and a structured questionnaire were administered. Fasting blood samples were collected for n-3 PUFA measurements. Higher EPA and total n-3 PUFA concentrations and a lower ratio of arachidonic acid to EPA in erythrocyte membranes were associated with a higher cognitive composite score: independent of age and sex, but no longer significant after adjustment for education. No associations were found with plasma concentrations of any fatty acid. Considering individual cognitive tests, the strongest and most consistent correlations were found between immediate recall and concentrations of total n-3 PUFAs and α-linolenic acid (ALA) in erythrocytes, which were observed only in participants with recurrent depression. Total erythrocyte n-3 PUFA concentrations are positively associated with cognitive function, particularly immediate recall, in older people with previous depression. Lower concentrations of n-3 PUFAs or ALA in erythrocyte membranes may be good predictors for cognitive impairment in older people with previous recurrent depression.

  12. Higher Plasma Concentration of Food-Specific Antibodies in Persons with Autistic Disorder in Comparison to Their Siblings (United States)

    Trajkovski, Vladimir; Petlichkovski, Aleksandar; Efinska-Mladenovska, Olivija; Trajkov, Dejan; Arsov, Todor; Strezova, Ana; Ajdinski, Ljubomir; Spiroski, Mirko


    Specific IgA, IgG, and IgE antibodies to food antigens in 35 participants with autistic disorder and 21 of their siblings in the Republic of Macedonia were examined. Statistically significant higher plasma concentration of IgA antibodies against alpha-lactalbumin, beta-lactoglobulin, casein, and gliadin were found in the children with autistic…

  13. Butter blend containing fish oil improves the level of n-3 fatty acids in biological tissues of hamster. (United States)

    Porsgaard, Trine; Overgaard, Julie; Krogh, Anne Louise; Jensen, Mette Behrmann; Guo, Zheng; Mu, Huiling


    Many studies have shown beneficial effects of long chain n-3 polyunsaturated fatty acids (PUFA) on human health. Regardless of the positive effects of n-3 PUFA, the intake of these fatty acids remains low. An approach to increase the intake of n-3 PUFA in the population is to incorporate fish oil into food. In the present study, fish oil was incorporated into butter blends by enzymatic interesterification. The aim of the study was to investigate the effects of this butter product in comparison with a commercial butter blend and a product produced by interesterification but without fish oil. Golden Syrian hamsters received hamster feed blended with one of the three butter products. After 6 weeks of feeding, the fatty acid compositions of plasma, erythrocytes, liver, brain, and visceral fat were determined. The intake of butter product with fish oil resulted in a higher level of n-3 PUFA in plasma, erythrocytes, and liver. The incorporation of n-3 PUFA was significantly higher in phospholipids than in triacylglycerols. The results suggest that enriching butter blends with small amounts of fish oil can be used as an alternative method for improving the level of n-3 PUFA in biological tissues.

  14. Higher plasma quercetin levels following oral administration of an onion skin extract compared with pure quercetin dihydrate in humans. (United States)

    Burak, Constanze; Brüll, Verena; Langguth, Peter; Zimmermann, Benno F; Stoffel-Wagner, Birgit; Sausen, Udo; Stehle, Peter; Wolffram, Siegfried; Egert, Sarah


    To investigate the plasma kinetics of quercetin derived from hard capsules filled with onion skin extract powder or quercetin dihydrate in humans. In a randomized, single-blind, diet-controlled crossover study, 12 healthy subjects (six men and six women) aged 21-33 years were administered a single oral supra-nutritional dose of approximately 163 mg quercetin derived from onion skin extract powder (containing 95.3 % of total flavonoids as quercetin aglycone) or quercetin dihydrate (134 mg quercetin aglycone equivalent). Blood samples were collected before and during a 24-h period after quercetin administration. The concentrations of quercetin and its two monomethylated derivatives, isorhamnetin (3'-O-methyl quercetin), and tamarixetin (4'-O-methyl quercetin), were measured using HPLC with fluorescence detection after plasma enzymatic treatment. The systemic availability, determined by comparing the plasma concentration-time curves of quercetin, was 4.8 times higher, and the maximum plasma concentration (C max) was 5.4 times higher after ingestion of the onion skin extract than after ingestion of pure quercetin dihydrate. By contrast, t max did not differ significantly between the two formulations. The C max values for isorhamnetin and tamarixetin were 3.8 and 4.4 times higher, respectively, after administration of onion skin extract than after pure quercetin dihydrate. The plasma kinetics of quercetin were not significantly different in men and women. Quercetin aglycone derived from onion skin extract powder is significantly more bioavailable than that from quercetin dihydrate powder filled hard capsules.

  15. LIDAR TS for ITER core plasma. Part III: calibration and higher edge resolution (United States)

    Nielsen, P.; Gowers, C.; Salzmann, H.


    Calibration, after initial installation, of the proposed two wavelength LIDAR Thomson Scattering System requires no access to the front end and does not require a foreign gas fill for Raman scattering. As already described, the variation of solid angle of collection with scattering position is a simple geometrical variation over the unvignetted region. The additional loss over the vignetted region can easily be estimated and in the case of a small beam dump located between the Be tiles, it is within the specified accuracy of the density. The only additional calibration is the absolute spectral transmission of the front-end optics. Over time we expect the transmission of the two front-end mirrors to suffer a deterioration mainly due to depositions. The reduction in transmission is likely to be worse towards the blue end of the scattering spectrum. It is therefore necessary to have a method to monitor such changes and to determine its spectral variation. Standard methods use two lasers at different wavelength with a small time separation. Using the two-wavelength approach, a method has been developed to determine the relative spectral variation of the transmission loss, using simply the measured signals in plasmas with peak temperatures of 4–6 keV . Comparing the calculated line integral of the fitted density over the full chord to the corresponding interferometer data we also have an absolute calibration. At the outer plasma boundary, the standard resolution of the LIDAR Thomson Scattering System is not sufficient to determine the edge gradient in an H-mode plasma. However, because of the step like nature of the signal here, it is possible to carry out a deconvolution of the scattered signals, thereby achieving an effective resolution of ~ 1–2 cm in the outer 10–20 cm.

  16. Mothers of autistic children: lower plasma levels of oxytocin and Arg-vasopressin and a higher level of testosterone.

    Directory of Open Access Journals (Sweden)

    Xin-Jie Xu

    Full Text Available BACKGROUND: Autism is a pervasive neurodevelopmental disorder,thought to be caused by a combination of genetic heritability and environmental risk factors. Some autistic-like traits have been reported in mothers of autistic children. We hypothesized that dysregulation of oxytocin (OXT, Arg-vasopressin (AVP and sex hormones, found in autistic children, may also exist in their mothers. METHODS: We determined plasma levels of OXT (40 in autism vs. 26 in control group, AVP (40 vs. 17 and sex hormones (61 vs. 47 in mothers of autistic and normal children by enzyme immunoassay and radioimmunoassay, respectively and investigated their relationships with the children's autistic behavior scores (Childhood Autism Rating Scale (CARS and Autism Behavior Checklist (ABC. RESULTS: Significantly lower plasma concentrations of OXT (p<0.001 and AVP (p<0.001, as well as a higher level of plasma testosterone (p<0.05, were found in mothers of autistic children vs. those of control. The children's autistic behavior scores were negatively associated with maternal plasma levels of OXT and AVP. CONCLUSIONS: These results suggest that dysregulation of OXT, AVP and/or testosterone systems exist in mothers of autistic children, which may impact children's susceptibility to autism.

  17. N-(3,4-Dimethylphenylbenzamide

    Directory of Open Access Journals (Sweden)

    B. Thimme Gowda


    Full Text Available The conformation of the NH bond in the structure of the title compound (N34DMPBA, C15H15NO, is anti to the meta-methyl substituent in the aniline ring, similar to that observed with respect to the meta-chloro substituent in N-(3,4-dichlorophenylbenzamide (N34DCPBA, but in contrast to the syn conformation observed with respect to the meta-methyl substituent in N-(3,4-dimethylphenylacetamide. The bond parameters in N34DMPBA are similar to those in N34DCPBA and other benzanilides. The molecules in N34DMPBA are packed into a column-like structure in the direction of the a axis through N—H...O hydrogen bonds.

  18. N-(3-Chlorophenyl-2-methylbenzamide

    Directory of Open Access Journals (Sweden)

    Hartmut Fuess


    Full Text Available The conformation of the N—H bond in the structure of the title compound, C14H12ClNO, is anti to the meta-chloro substituent in the aniline ring, while the C=O bond is syn to the ortho-methyl substituent in the benzoyl ring. The conformations of the N—H and C=O bonds are anti to each other, similar to those observed in 2-methyl-N-(3-methylphenylbenzamide (N3MP2MBA. The –NHC(=O– group makes a dihedral angle of 55.8 (7° with the benzoyl ring, while the angle between the benzoyl and aniline rings is 37.5 (1°; the respective values for N3MP2MBA are 55.2 (7 and 36.2 (1°. N—H...O hydrogen bonds link the molecules into infinite chains running along the c axis.

  19. Pressure pain threshold and β-endorphins plasma level are higher in lean polycystic ovary syndrome women. (United States)

    Kiałka, Marta; Milewicz, Tomasz; Mrozińska, Sandra; Rogatko, Iwona; Sztefko, Krystyna; Majewska, Renata


    Despite some evidence that indicates that the evolution of polycystic ovary syndrome (PCOS) is related to the activity of the endogenous opioid system, and that concentration of plasma β-endorphin levels can increase pain threshold, there are no studies which evaluate pressure pain threshold in the PCOS women population. In 48 lean women with PCOS and 38 lean women without this disorder plasma β-endorphins and PPT were measured. The β-endorphins level was higher in the PCOS group compared to the controls (15.28±2.49 pg/mL vs. 6.33±1.71 pg/mL, Pendorphin levels positively correlated with PPTs in PCOS group. Increase in β-endorphin level of 1 pg/mL was associated with increase of PPT value on deltoid muscle of 0.23 kg/cm² (R=0.632, P=0.011) and of 0.18 kg/cm² on trapezius muscle (R=0.588, P=0.037). There were no correlations between testosterone level and PPT in PCOS group. β-endorphin serum level as well as PPT are higher in lean PCOS group than in controls. We found correlations between β-endorphin levels and PPT in the PCOS group. It may suggest the role of endogenous opioids in the pathogenesis of PCOS and also that the increases in circulating plasma β-endorphins concentration can increases PPT in this group.

  20. Higher Plasma Methylglyoxal Levels are Associated with Incident Cardiovascular Disease in Individuals with Type 1 Diabetes

    DEFF Research Database (Denmark)

    Hanssen, Nordin M J; Scheijen, Jean L J M; Jorsal, Anders


    analyzed with Cox regression, with adjustment for sex, age, HbA1c, DN, diabetes duration, smoking, systolic blood pressure, anti-hypertensive medication and BMI. During follow-up, 73 individuals suffered at least one CVD event (36 fatal and 53 non-fatal events). Higher MGO levels were associated with total...

  1. Impact of maternal dietary n-3 and n-6 fatty acids on milk medium-chain fatty acids and the implications for neonatal liver metabolism. (United States)

    Novak, Elizabeth M; Innis, Sheila M


    Levels of n-6, n-3, and medium-chain fatty acids (MCFA) in milk are highly variable. Higher carbohydrate intakes are associated with increased mammary gland MCFA synthesis, but the role of unsaturated fatty acids for milk MCFA secretion is unclear. This study addressed whether n-6 and n-3 fatty acids, which are known to inhibit hepatic fatty acid synthesis, influence MCFA in rat and human milk and the implications of varying MCFA, n-6, and n-3 fatty acids in rat milk for metabolic regulation in the neonatal liver. Rats were fed a low-fat diet or one of six higher-fat diets, varying in 16:0, 18:1n-9, 18:2n-6, 18:3n-3, and long-chain (LC) n-3 fatty acids. Higher maternal dietary 18:2n-6 or 18:3n-3 did not influence milk MCFA, but lower maternal plasma triglycerides, due to either a low-fat or a high-fat high-LC n-3 diet led to higher milk MCFA. MCFA levels were inversely associated with 18:1n-9, 18:2n-6, and 18:3n-3 in human milk, likely reflecting the association between dietary total fat and unsaturated fatty acids. High LC n-3 fatty acid in rat milk was associated with lower hepatic Pklr, Acly, Fasn, and Scd1 and higher Hmgcs2 in the milk-fed rat neonate, with no effect of milk 18:1n-9, 18:2n-6, or MCFA. These studies show that the dietary fatty acid composition does not impact MCFA secretion in milk, but the fatty acid composition of milk, particularly the LC n-3 fatty acid, is relevant to hepatic metabolic regulation in the milk-fed neonate.

  2. Interaction between Marine-Derived n-3 Long Chain Polyunsaturated Fatty Acids and Uric Acid on Glucose Metabolism and Risk of Type 2 Diabetes Mellitus: A Case-Control Study. (United States)

    Li, Kelei; Wu, Kejian; Zhao, Yimin; Huang, Tao; Lou, Dajun; Yu, Xiaomei; Li, Duo


    The present case-control study explored the interaction between marine-derived n-3 long chain polyunsaturated fatty acids (n-3 LC PUFAs) and uric acid (UA) on glucose metabolism and risk of type 2 diabetes mellitus (T2DM). Two hundred and eleven healthy subjects in control group and 268 T2DM subjects in case group were included. Plasma phospholipid (PL) fatty acids and biochemical parameters were detected by standard methods. Plasma PL C22:6n-3 was significantly lower in case group than in control group, and was negatively correlated with fasting glucose (r = -0.177, p < 0.001). Higher plasma PL C22:6n-3 was associated with lower risk of T2DM, and the OR was 0.32 (95% confidence interval (CI), 0.12 to 0.80; p = 0.016) for per unit increase of C22:6n-3. UA was significantly lower in case group than in control group. UA was positively correlated with fasting glucose in healthy subjects, but this correlation became negative in T2DM subjects. A significant interaction was observed between C22:6n-3 and UA on fasting glucose (p for interaction = 0.005): the lowering effect of C22:6n-3 was only significant in subjects with a lower level of UA. In conclusion, C22:6n-3 interacts with UA to modulate glucose metabolism.

  3. Editorial - V.13, N.3

    Directory of Open Access Journals (Sweden)

    Editores REB


    Full Text Available  Editorial 2015 - 3Estamos constantemente trabalhando para melhorias e crescimento da REB, nesse sentido, optamos pelo retorno de um número exclusivo para os trabalhos dos eventos relacionados ao ensino de Bioquímica (Brasil e outros países e dois números para demais seções. Além disso, ampliamos nesse semestre nossa divulgação online.Fomos inclusos no JornalTocs (Collection of Scholarly Journal Tables of Contents, SHERPA/RoMEO e divulgados nas Bibliotecas EZB (Electronic Journals Library - Universität Regensburg, Universiteits Bibliotheek Gent, ILSE - IPN Library Search Ensine, University of Maryland Francis King Carey School of Law e LIS Cuba - Biblioteca Virtual de Saúde (BVS.O Vol. 13, N. 3 da REB é constituído por sete artigos distribuídos em 4 seções.Na seção Pesquisa em Ensino, dois artigos relatam, respectivamente, como diferentes estratégias aumentaram a aquisição de conhecimento por parte da comunidade acadêmica e fora dela, em duas ciências básicas, a Imunologia e a Genética.Na seção Inovações Educacionais, um artigo descreve como é possível com uma metodologia simples, desenvolver o princípio da metodologia analítica da Espectrometria de Massa. O outro artigo apresenta um lúdico aplicativo para dispositivos móveis para facilitar o aprendizado de Bioquímica básica.Na seção REB na Escola, mostra uma criativa e simples técnica para a fácil apropriação dos conceitos de fibras alimentares e dos mecanismos de ação do tubo digestório humano.Na seção Imagem Pública e Divulgação Científica da Bioquímica, são reportadas duas experiências com motivações semelhantes. Uma narrando a formação de uma Liga de Bioquímica Clínica e a outra contando a difusão da ciência em escolas públicas, através interação lúdica com Sistema Nervoso Humano.  Atenciosamente  Bayardo B. TorresUSPEduardo GalembeckUnicampGabriel G. HorninkUnifal-MGVera Maria T. TrindadeUFRGS 

  4. The Role of Higher-Order Modes on the Electromagnetic Whistler-Cyclotron Wave Fluctuations of Thermal and Non-Thermal Plasmas (United States)

    Vinas, Adolfo F.; Moya, Pablo S.; Navarro, Roberto; Araneda, Jamie A.


    Two fundamental challenging problems of laboratory and astrophysical plasmas are the understanding of the relaxation of a collisionless plasmas with nearly isotropic velocity distribution functions and the resultant state of nearly equipartition energy density with electromagnetic plasma turbulence. Here, we present the results of a study which shows the role that higher-order-modes play in limiting the electromagnetic whistler-like fluctuations in a thermal and non-thermal plasma. Our main results show that for a thermal plasma the magnetic fluctuations are confined by regions that are bounded by the least-damped higher order modes. We further show that the zone where the whistler-cyclotron normal modes merges the electromagnetic fluctuations shifts to longer wavelengths as the beta(sub e) increases. This merging zone has been interpreted as the beginning of the region where the whistler-cyclotron waves losses their identity and become heavily damped while merging with the fluctuations. Our results further indicate that in the case of nonthermal plasmas, the higher-order modes do not confine the fluctuations due to the effective higher-temperature effects and the excess of suprathermal plasma particles. The analysis presented here considers the second-order theory of fluctuations and the dispersion relation of weakly transverse fluctuations, with wave vectors parallel to the uniform background magnetic field, in a finite temperature isotropic bi-Maxwellian and Tsallis-kappa-like magnetized electron-proton plasma. Our results indicate that the spontaneously emitted electromagnetic fluctuations are in fact enhanced over these quasi modes suggesting that such modes play an important role in the emission and absorption of electromagnetic fluctuations in thermal or quasi-thermal plasmas.

  5. Higher plasma motilin levels in obese patients decrease after Roux-en-Y gastric bypass surgery and regulate hunger. (United States)

    Deloose, E; Janssen, P; Lannoo, M; Van der Schueren, B; Depoortere, I; Tack, J


    Motilin-induced phase III contractions of the migrating motor complex (MMC) signal hunger in healthy volunteers. The current aim was to study the role of motilin as a hunger-inducing factor in obese patients and to evaluate the effect of Roux-en-Y gastric bypass (RYGB) surgery on plasma motilin levels and hunger scores. Motilin and ghrelin plasma levels were determined during a complete MMC cycle in controls and obese patients selected for RYGB before, 6 months and 1 year after surgery. 20 min after the end of the second phase III, obese patients received an intravenous infusion of 40 mg erythromycin. Hunger was scored every 5 min. Hedonic hunger was assessed in obese patients with the Power of Food Scale questionnaire. Obesity caused a switch in the origin of phase III from antrum to duodenum. Obese patients had significantly higher motilin levels compared with controls during the MMC but tended to lack the motilin peak prior to phase III necessary to trigger hunger. Hunger scores during phase III were significantly lower in obese patients, but could be restored to control levels through the administration of a low dose of the motilin agonist, erythromycin. After RYGB surgery motilin, but not ghrelin, levels decreased in parallel with hedonic hunger scores. Motilin may be an important regulator involved in the pathogenesis of obesity. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to

  6. N-3 PUFAs protect against aortic inflammation and oxidative stress in angiotensin II-infused apolipoprotein E-/- mice.

    Directory of Open Access Journals (Sweden)

    Kathryn M Wales

    Full Text Available Abdominal aortic aneurysm is associated with infiltration of inflammatory cells into the aortic wall. The inflammatory response is also evident in animal models, such as apolipoprotein E-deficient (ApoE-/- mice that have been infused with angiotensin II, prior to development of aortic aneurysm. Since omega-3 polyunsaturated fatty acids (n-3 PUFAs and their metabolites have anti-inflammatory and pro-resolving activity, we hypothesised that dietary supplementation with n-3 PUFAs would protect against inflammatory processes in this mouse model. Twenty C57 and 20 ApoE-/- 3-4 week old male mice were supplemented with a low (0.14%, n = 10/group or high (0.70%, n = 10/group n-3 PUFA diet for 8 weeks before 2-day infusion with 0.9% saline or angiotensin II (1000 ng/kg/min. Four ApoE-/- mice on the low n-3 PUFA diet and none of the ApoE-/- mice on the high n-3 PUFA diet showed morphological evidence of abdominal aortic dissection. The plasma concentration of the n-3 PUFA metabolite, resolvin D1 was higher in angiotensin II-infused ApoE-/- mice fed the high, compared to the low n-3 PUFA diet. The number of neutrophils and macrophages infiltrating the abdominal aorta was elevated in ApoE-/- mice on the low n-3 PUFA diet, and this was significantly attenuated in mice that were fed the high n-3 PUFA diet. Most neutrophils and macrophages were associated with dissected aortas. Immunoreactivity of the catalytic subunit of nicotinamide-adenine dinucleotide phosphate (NADPH oxidase, Nox2, and superoxide were elevated in ApoE-/- mice that were fed the low n-3 PUFA diet, and this was also significantly attenuated in mice that were fed the high n-3 PUFA diet. Together, the findings indicate that supplementation of ApoE-/- mice with a diet high in n-3 PUFA content protected the mice against pro-inflammatory and oxidative stress responses following short-term infusion with angiotensin II.

  7. A comparison of heart rate variability, n-3 PUFA status and lipid mediator profile in age- and BMI-matched middle-aged vegans and omnivores. (United States)

    Pinto, Ana M; Sanders, Thomas A B; Kendall, Alexandra C; Nicolaou, Anna; Gray, Robert; Al-Khatib, Haya; Hall, Wendy L


    Low heart rate variability (HRV) predicts sudden cardiac death. Long-chain (LC) n-3 PUFA (C20-C22) status is positively associated with HRV. This cross-sectional study investigated whether vegans aged 40-70 years (n 23), whose diets are naturally free from EPA (20 : 5n-3) and DHA (22 : 6n-3), have lower HRV compared with omnivores (n 24). Proportions of LC n-3 PUFA in erythrocyte membranes, plasma fatty acids and concentrations of plasma LC n-3 PUFA-derived lipid mediators were significantly lower in vegans. Day-time interbeat intervals (IBI), adjusted for physical activity, age, BMI and sex, were significantly shorter in vegans compared with omnivores (mean difference -67 ms; 95 % CI -130, -3·4, P50 % and high-frequency power) were similarly lower in vegans, with no differences during sleep. In conclusion, vegans have higher 24 h SDNN, but lower day-time HRV and shorter day-time IBI relative to comparable omnivores. Vegans may have reduced availability of precursor markers for pro-resolving lipid mediators; it remains to be determined whether there is a direct link with impaired cardiac function in populations with low-n-3 status.

  8. Effects of dietary n-3 and n-6 fatty acids on clinical outcome in a porcine model on postoperative infection

    DEFF Research Database (Denmark)

    Langerhuus, Sine Nygaard; Tønnesen, Else Kirstine; Jensen, Karin Hjelholt


    , daily body-weight gain was determined in both periods. The preoperative changes in plasma and erythrocyte n-3 and n-6 LC-PUFA concentrations reflected the fatty acid compositions of the dietary treatments given, and plasma PGE2 metabolite concentration decreased in the fish oil treatment (P ... oil (rich in n-3 LC-PUFA), sunflower oil (rich in n-6 LC-PUFA) or animal fat. After 3 weeks of dietary treatment, the pigs had an aortic vascular prosthetic graft inserted, and it was inoculated with Staphylococcus aureus (106 colony-forming units). Changes in selected plasma and erythrocyte n-3 and n......·001). In the post-operative period, feed intake (P = 0·004) and body-weight gain (P = 0·038) were higher in the fish oil treatment compared with the sunflower oil treatment. The dietary treatments did not affect the number of days pigs were showing fever, weakness in the hindquarters or impaired general appearance...

  9. Plasma TNF-α levels are higher in early pregnancy in patients with secondary compared with primary recurrent miscarriage

    DEFF Research Database (Denmark)

    Piosik, Zofia Maria; Goegebeur, Yuri; Klitkou, Louise


    Specific pro-inflammatory cytokine profiles in plasma may characterize women with recurrent miscarriage (RM) but the dynamics of the cytokine profiles with progressing pregnancy is largely unknown.......Specific pro-inflammatory cytokine profiles in plasma may characterize women with recurrent miscarriage (RM) but the dynamics of the cytokine profiles with progressing pregnancy is largely unknown....

  10. The 4G/4G Genotype of PAI-1 Polymorphism Is Associated with Higher Plasma PAI-1 Concentrations and Mortality in Patients with Severe Sepsis (United States)

    Lorente, Leonardo; Martín, María M.; Borreguero-León, Juan M.; Barrios, Ysamar; Solé-Violán, Jordi; Ferreres, José; Labarta, Lorenzo; Díaz, César; Jiménez, Alejandro


    Objective Two studies have reported that patients with the 4G/4G genotype of the plasminogen activator inhibitor-1 (PAI-1) genetic polymorphism had higher plasma PAI-1 concentrations and higher risk of death than those with the 4G/5G or 5G/5G genotypes; one study involved 175 children with meningococcal disease, and the other included 88 adult patients with septic shock. Thus, the objective of this study was to determine whether there is an association between carriage of the 4G/4G genotype, plasma PAI-1 concentrations and mortality in a large series of adult septic patients. Methods An observational, prospective, multicenter study was carried out in six Spanish Intensive Care Units including severe septic patients. We determined the PAI-1 4G/5G polymorphism and plasma PAI-1 concentrations in all patients. The end-points of the study were 30-day and 6-month mortality. Results We included a total of 260 patients, 82 (31.5%) with 4G/4G, 126 (48.5%) with 4G/5G and 52 (20.0%) with 5G/5G genotype. Multivariate logistic regression analysis showed that the 4G/4G genotype was associated with higher mortality at 30 days (Odds Ratio = 1.95; 95% CI = 1.063–3.561; p = 0.03) and at 6 months (Odds Ratio = 2.19; 95% CI = 1.221–3.934; p = 0.01), and that higher plasma PAI-1 concentrations were associated with higher mortality at 30 days (Odds Ratio = 1.01; 95% CI = 1.002–1.022; p = 0.02) at 6 months (Odds Ratio = 1.01; 95% CI = 1.003–1.023; p = 0.01). Multivariate linear regression analysis showed that increased plasma PAI-1 concentrations were associated with the PAI-1 4G/4G genotype (regression coefficient = 4.82; 95% CI = 3.227 to 6.406; p<0.001). Conclusions The major findings of our study, to our knowledge the largest series reporting data about 4G/5G polymorphism of the PAI-1 gene, plasma PAI-1 concentrations and mortality in septic patients, were that septic patients with the 4G/4G genotype had higher plasma PAI-1 concentrations and higher risk of death than those

  11. Egg n-3 fatty acid composition modulates biomarkers of choline metabolism in free-living lacto-ovo-vegetarian women of reproductive age. (United States)

    West, Allyson A; Shih, Yun; Wang, Wei; Oda, Keiji; Jaceldo-Siegl, Karen; Sabaté, Joan; Haddad, Ella; Rajaram, Sujatha; Caudill, Marie A; Burns-Whitmore, Bonny


    The lacto-ovo-vegetarian (LOV) dietary regimen allows eggs, which are a rich source of choline. Consumption of eggs by LOV women may be especially important during pregnancy and lactation when demand for choline is high. The aim of this single blind, randomized, crossover-feeding study was to determine how near-daily egg consumption influenced biomarkers of choline metabolism in healthy LOV women of reproductive age (n=15). Because long-chain n-3 fatty acids could influence choline metabolism, the effect of n-3-enriched vs nonenriched eggs on choline metabolites was also investigated. Three 8-week dietary treatments consisting of six n-3-enriched eggs per week, six nonenriched eggs per week, and an egg-free control phase were separated by 4-week washout periods. Choline metabolites were quantified in fasted plasma collected before and after each treatment and differences in posttreatment choline metabolite concentrations were determined with linear mixed models. The n-3-enriched and nonenriched egg treatments produced different choline metabolite profiles compared with the egg-free control; however, response to the eggs did not differ (P>0.1). Consumption of the n-3-enriched egg treatment yielded higher plasma free choline (P=0.02) and betaine (P<0.01) (vs egg-free control) concentrations, whereas consumption of the nonenriched egg treatment yielded borderline higher (P=0.06) plasma phosphatidylcholine (vs egg-free control) levels. Neither egg treatment increased levels of plasma trimethylamine oxide, a gut-flora-dependent oxidative choline metabolite implicated as a possible risk factor for cardiovascular disease. Overall these data suggest that egg fatty-acid composition modulates the metabolic use of choline. Copyright © 2014 Academy of Nutrition and Dietetics. Published by Elsevier Inc. All rights reserved.

  12. Long-acting combination anti-HIV drug suspension enhances and sustains higher drug levels in lymph node cells than in blood cells and plasma. (United States)

    Kraft, John C; McConnachie, Lisa A; Koehn, Josefin; Kinman, Loren; Collins, Carol; Shen, Danny D; Collier, Ann C; Ho, Rodney J Y


    The aim of the present study was to determine whether a combination of anti-HIV drugs - tenofovir (TFV), lopinavir (LPV) and ritonavir (RTV) - in a lipid-stabilized nanosuspension (called TLC-ART101) could enhance and sustain intracellular drug levels and exposures in lymph node and blood cells above those in plasma. Four macaques were given a single dose of TLC-ART101 subcutaneously. Drug concentrations in plasma and mononuclear cells of the blood (PBMCs) and lymph nodes (LNMCs) were analysed using a validated combination LC-MS/MS assay. For the two active drugs (TFV, LPV), plasma and PBMC intracellular drug levels persisted for over 2 weeks; PBMC drug exposures were three- to four-fold higher than those in plasma. Apparent terminal half-lives (t1/2) of TFV and LPV were 65.3 and 476.9 h in plasma, and 169.1 and 151.2 h in PBMCs. At 24 and 192 h, TFV and LPV drug levels in LNMCs were up to 79-fold higher than those in PBMCs. Analysis of PBMC intracellular TFV and its active metabolite TFV-diphosphate (TFV-DP) indicated that intracellular exposures of total TFV and TFV-DP were markedly higher and persisted longer than in humans and macaques dosed with oral TFV prodrugs, tenofovir disoproxil fumarate (TDF) or tenofovir alafenamide (TAF). A simple, scalable three-drug combination, lipid-stabilized nanosuspension exhibited persistent drug levels in cells of lymph nodes and the blood (HIV host cells) and in plasma. With appropriate dose adjustment, TLC-ART101 may be a useful HIV treatment with a potential to impact residual virus in lymph nodes.

  13. Effect of n-3 and n-6 fatty acid supplementation on fetal, gestation ...

    African Journals Online (AJOL)

    The aim of this study was to evaluate the effect of different ratio of n-6:n-3 on gestation and parturition as well as to determine the hormone concentration on plasma of the pregnant rats. At the end of the trial period, blood plasma was collected and analysed for progesterone, estradiol and prostaglandin F2α hormone ...

  14. Anti-steatotic effects of an n-3 LCPUFA and extra virgin olive oil mixture in the liver of mice subjected to high-fat diet. (United States)

    Valenzuela, Rodrigo; Espinosa, Alejandra; Llanos, Paola; Hernandez-Rodas, Maria Catalina; Barrera, Cynthia; Vergara, Daniela; Romero, Nalda; Pérez, Francisco; Ruz, Manuel; Videla, Luis A


    Non-alcoholic fatty liver disease (NAFLD) is characterized by liver steatosis, oxidative stress, and drastic depletion of n-3 long-chain polyunsaturated fatty acids (n-3 LCPUFA), namely, eicosapentaenoic acid (C20:5 n-3, EPA) and docosahexaenoic acid (C22:6 n-3, DHA), which trigger lipolysis stimulation and lipogenesis inhibition. Extra virgin olive oil (EVOO) has important antioxidant effects. This study evaluated the anti-steatotic effects of n-3 LCPUFA plus EVOO in the liver of male C57BL/6J mice subjected to a control diet (CD) (10% fat, 20% protein, 70% carbohydrate) or high fat diet (HFD) (60% fat, 20% protein, 20% carbohydrate), without and with supplementation with n-3 LCPUFA (100 mg per kg per day) plus EVOO (100 mg per kg per day) for 12 weeks. HFD induced (i) liver steatosis (increased total fat, triacylglycerols, and free fatty acid total contents), (ii) higher fasting serum glucose and insulin levels and HOMA index, total cholesterol, triacylglycerols and TNF-α and IL-6, (iii) liver and plasma oxidative stress enhancement, (iv) depletion of the n-3 LCPUFA hepatic content, and (v) increment in lipogenic enzyme activity and reduction in lipolytic enzyme activity. These changes were either reduced (p EVOO. In conclusion, n-3 LCPUFA plus EVOO intervention exerts anti-steatotic effects underlying antioxidant and anti-inflammatory responses, improved insulin sensitivity, and recovery of the lipolytic/lipogenic status of the liver altered by HFD, and supports the potential therapeutic use of n-3 LCPUFA plus EVOO supplementation in the treatment of human liver steatosis induced by nutritional factors or other etiologies.

  15. Endogenous synthesis of n-3 polyunsaturated fatty acids in Fat-1 mice is associated with increased mammary gland and liver syndecan-1.

    Directory of Open Access Journals (Sweden)

    Haiguo Sun

    Full Text Available Long chain n-3 PUFA have been shown to have chemopreventive properties against breast cancer through various mechanisms. One pathway, studied in human breast cancer cell lines, involves upregulation of the proteoglycan, syndecan-1 (SDC-1 by n-3 PUFA-enriched LDL. Using Fat-1 mice that are able to convert n-6 to n-3 PUFA, we tested whether SDC-1 level in vivo is elevated in mammary glands due to endogenously synthesized rather than LDL-derived n-3 PUFA. Female Fat-1 and wild type (wt mice were fed an n-6 PUFA- enriched diet for 7 weeks. Fatty acid analysis of plasma lipoproteins showed that total n-6 PUFA reflected dietary intake similarly in both genotypes (VLDL, 36.2±2.2 and 40.9±3.9; LDL, 49.0±3.3 and 48.1±2.0; HDL, 54.6±1.2 and 58.2±1.3, mean ± SEM percent of total fatty acids for Fat-1 and wt animals respectively. Lipoprotein percent n-3 PUFA was also similar between groups. However, phospholipids and triglycerides extracted from mammary and liver tissues demonstrated significantly higher n-3 PUFA and a corresponding decrease in the ratio n-6/n-3 PUFA in Fat-1 compared to wt mice. This was accompanied by higher SDC-1 in mammary glands and livers of Fat-1 mice, thus demonstrating that endogenously synthesized n-3 PUFA may upregulate SDC-1 in the presence of high dietary n-6 PUFA.

  16. Regional Hippocampal Atrophy and Higher Levels of Plasma Amyloid-Beta Are Associated With Subjective Memory Complaints in Nondemented Elderly Subjects

    DEFF Research Database (Denmark)

    Cantero, Jose L; Iglesias, Juan E.; Van Leemput, Koen


    Background: Evidence suggests a link between the presence of subjective memory complaints (SMC) and lower volume of the hippocampus, one of the first regions to show neuropathological lesions in Alzheimer's disease. However, it remains unknown whether this pattern of hippocampal atrophy is region......Background: Evidence suggests a link between the presence of subjective memory complaints (SMC) and lower volume of the hippocampus, one of the first regions to show neuropathological lesions in Alzheimer's disease. However, it remains unknown whether this pattern of hippocampal atrophy...... volume differences in hippocampal subregions were further correlated with plasma Aβ levels and with objective memory performance. Results: Individuals with SMC exhibited significantly higher Aβ1-42 concentrations and lower volumes of CA1, CA4, dentate gyrus, and molecular layer compared with SMC......(-) participants. Regression analyses further showed significant associations between lower volume of the dentate gyrus and both poorer memory performance and higher plasma Aβ1-42 levels in SMC(+) participants. Conclusions: The presence of SMC, lower volumes of specific hippocampal regions, and higher plasma Aβ1...

  17. Higher plasma CXCL12 levels predict incident myocardial infarction and death in chronic kidney disease: findings from the Chronic Renal Insufficiency Cohort study. (United States)

    Mehta, Nehal N; Matthews, Gregory J; Krishnamoorthy, Parasuram; Shah, Rhia; McLaughlin, Catherine; Patel, Parth; Budoff, Matthew; Chen, Jing; Wolman, Melanie; Go, Alan; He, Jiang; Kanetsky, Peter A; Master, Stephen R; Rader, Daniel J; Raj, Dominic; Gadegbeku, Crystal A; Shah, Rachana; Schreiber, Marty; Fischer, Michael J; Townsend, Raymond R; Kusek, John; Feldman, Harold I; Foulkes, Andrea S; Reilly, Muredach P


    Genome-wide association studies revealed an association between a locus at 10q11, downstream from CXCL12, and myocardial infarction (MI). However, the relationship among plasma CXCL12, cardiovascular disease (CVD) risk factors, incident MI, and death is unknown. We analysed study-entry plasma CXCL12 levels in 3687 participants of the Chronic Renal Insufficiency Cohort (CRIC) Study, a prospective study of cardiovascular and kidney outcomes in chronic kidney disease (CKD) patients. Mean follow-up was 6 years for incident MI or death. Plasma CXCL12 levels were positively associated with several cardiovascular risk factors (age, hypertension, diabetes, hypercholesterolaemia), lower estimated glomerular filtration rate (eGFR), and higher inflammatory cytokine levels (P < 0.05). In fully adjusted models, higher study-entry CXCL12 was associated with increased odds of prevalent CVD (OR 1.23; 95% confidence interval 1.14, 1.33, P < 0.001) for one standard deviation (SD) increase in CXCL12. Similarly, one SD higher CXCL12 increased the hazard of incident MI (1.26; 1.09,1.45, P < 0.001), death (1.20; 1.09,1.33, P < 0.001), and combined MI/death (1.23; 1.13-1.34, P < 0.001) adjusting for demographic factors, known CVD risk factors, and inflammatory markers and remained significant for MI (1.19; 1.03,1.39, P = 0.01) and the combined MI/death (1.13; 1.03,1.24, P = 0.01) after further controlling for eGFR and urinary albumin:creatinine ratio. In CKD, higher plasma CXCL12 was associated with CVD risk factors and prevalent CVD as well as the hazard of incident MI and death. Further studies are required to establish if plasma CXCL12 reflect causal actions at the vessel wall and is a tool for genomic and therapeutic trials. Published by Oxford University Press on behalf of the European Society of Cardiology 2013. This work is written by (a) US Government employee(s) and is in the public domain in the US.

  18. Higher levels of ethyl paraben and butyl paraben in rat amniotic fluid than in maternal plasma after subcutaneous administration

    DEFF Research Database (Denmark)

    Frederiksen, Hanne; Taxvig, Camilla; Hass, Ulla


    Parabens are a group of antimicrobial preservatives widely used in cosmetics, pharmaceuticals, and in foods. Previous in vitro and in vivo studies have shown weak estrogenic effects of some parabens. Thus, especially, exposure of fetus and infants via the mother is a matter of concern. In order...... to obtain more knowledge about the distribution of ethyl paraben and butyl paraben in pregnant rats and pups after perinatal exposure, the presented study was designed. The data show response and distribution of ethyl paraben and butyl paraben in maternal rat plasma, pools of amniotic fluids, placenta......, whole-body fetuses, and in fetal liver after dosing of dams with 100, 200, and 400 mg/kg body weight (bw)/day from gestational day 7 to 21. After cesarean section of dams, the fluids and tissues were collected, deconjugated, and purified by solid-phase extraction, and ethyl paraben and butyl paraben...

  19. Enhanced increase of omega-3 index in healthy individuals with response to 4-week n-3 fatty acid supplementation from krill oil versus fish oil. (United States)

    Ramprasath, Vanu R; Eyal, Inbal; Zchut, Sigalit; Jones, Peter J H


    Due to structural differences, bioavailability of krill oil, a phospholipid based oil, could be higher than fish oil, a triglyceride-based oil, conferring properties that render it more effective than fish oil in increasing omega-3 index and thereby, reducing cardiovascular disease (CVD) risk. The objective was to assess the effects of krill oil compared with fish oil or a placebo control on plasma and red blood cell (RBC) fatty acid profile in healthy volunteers. Twenty four healthy volunteers were recruited for a double blinded, randomized, placebo-controlled, crossover trial. The study consisted of three treatment phases including krill or fish oil each providing 600 mg of n-3 polyunsaturated fatty acids (PUFA) or placebo control, corn oil in capsule form. Each treatment lasted 4 wk and was separated by 8 wk washout phases. Krill oil consumption increased plasma (p = 0.0043) and RBC (p = 0.0011) n-3 PUFA concentrations, including EPA and DHA, and reduced n-6:n-3 PUFA ratios (plasma: p = 0.0043, RBC: p = 0.0143) compared with fish oil consumption. Sum of EPA and DHA concentrations in RBC, the omega-3 index, was increased following krill oil supplementation compared with fish oil (p = 0.0143) and control (p krill (TC: p = 0.0067, LDL: p = 0.0143) and fish oil supplementation (TC: p = 0.0028, LDL: p = 0.0143) compared with control. Consumption of krill oil was well tolerated with no adverse events. Results indicate that krill oil could be more effective than fish oil in increasing n-3 PUFA, reducing n-6:n-3 PUFA ratio, and improving the omega-3 index., NCT01323036.

  20. N-(3-Methylphenyl-N′-(4-nitrobenzoylthiourea

    Directory of Open Access Journals (Sweden)

    Liang Xian


    Full Text Available Two molecules of the title compound, C15H13N3O3S, are linked by an intermolecular N—H...S hydrogen bond. There is also an intramolecular N—H...O hydrogen bond, forming a six-membered ring. The steric restriction of the m-methyl and p-nitro groups, as well as the intramolecular hydrogen bond, are the main factors influencing the molecular conformation.

  1. Plasma mRNA concentrations of placenta-specific 1 (PLAC1) and pregnancy associated plasma protein A (PAPP-A) are higher in early-onset than late-onset pre-eclampsia. (United States)

    Kodama, Miho; Miyoshi, Hiroshi; Fujito, Naoya; Samura, Osamu; Kudo, Yoshiki


    Some mRNA concentrations are observed to increase in the maternal circulation in association with pre-eclampsia, including placenta-specific 1 (PLAC1) and pregnancy associated plasma protein A (PAPP-A), which were previously proposed as predictive markers for pre-eclampsia. Here, we investigated their concentrations in early-onset and late-onset pre-eclampsia maternal plasma to determine whether different mechanisms are involved in these two forms of the disorder. Peripheral blood and placental samples were collected from patients with pre-eclampsia. RNA was extracted and levels of PLAC1 and PAPP-A mRNAs were determined using real-time quantitative PCR. PLAC1 and PAPP-A mRNA levels were significantly increased in plasma from pregnant women with pre-eclampsia compared with those from healthy pregnant women. The median concentration of PLAC1 was 5.5 times higher (PPAPP-A was 5.1 times higher (P<0.01) in early-onset than in late-onset pre-eclampsia. The expression of these mRNAs in the placenta showed no significant difference in early-onset pre-eclampsia, late-onset pre-eclampsia and healthy pregnant women. These findings suggest that the concentration of mRNAs in maternal plasma reflect leakage from damaged villus cells rather than expression levels in the placenta. Injury to chorionic villus cells might be more severe in early-onset pre-eclampsia than in late-onset pre-eclampsia. © 2011 The Authors. Journal of Obstetrics and Gynaecology Research © 2011 Japan Society of Obstetrics and Gynecology.

  2. Basic and Meal Stimulated Plasma GIP Levels are Higher in Lean PCOS Women with FAI over 5. (United States)

    Milewicz, T; Migacz, K; Kiałka, M; Rogatko, I; Kowalczuk, A; Spalkowska, M; Mrozińska, S; Czajkowska, Z; Sztefko, K


    Glucose dependent insulinotropic peptide (GIP) belongs to the incretins which are responsible for 70% of the insulin release after oral glucose intake. Its impaired secretion was noted in several conditions involving insulin resistance, including polycystic ovary syndrome (PCOS), known as the state with increased testosterone level. This paper considers a possible relationship between the free androgen index (FAI) and basal as well as meal stimulated level of GIP in lean women affected by PCOS. To our knowledge, no previous study has evaluated the matter so far. cross-sectional study 50 age-matched lean women (BMI=20.76±1.83) were enrolled to the study and divided into 2 groups. Patients with phenotype with FAIFAI>5 formed group 2. All subjects underwent standard meal test. Serum GIP concentration was determined both at fasting and at 60 min of the test. Calculations were carried out using Statistica 10. Mann-Whitney test indicated a statistically significant difference in medians values of GIP plasma levels between groups on fasting (36.4 pg/ml vs. 59.6 pg/ml; p=0.0007) and at 60 min after meal test (50.1 pg/ml vs. 72.5 pg/ml; p=0.006). Spearman test indicated significant positive correlation between FAI and GIP levels at 0' and 60' in total study population (0':R=0.37;p=0.008; 60':R=0.28; p=0.049). Excess androgen activity might be a factor contributing to alter secretion of incretins in lean PCOS women. However it could not be ruled out that it is also possible that increased GIP levels might induce hyperandrogenemia in PCOS. An increased GIP levels may induce hyperinsulinemia and play an additive to insulin resistance role in progression to diabetes mellitus type 2 (DMT2). © Georg Thieme Verlag KG Stuttgart · New York.

  3. Fish, fish-derived n-3 fatty acids, and risk of incident atrial fibrillation in the Atherosclerosis Risk in Communities (ARIC) study. (United States)

    Gronroos, Noelle N; Chamberlain, Alanna M; Folsom, Aaron R; Soliman, Elsayed Z; Agarwal, Sunil K; Nettleton, Jennifer A; Alonso, Alvaro


    Results of observational and experimental studies investigating the association between intake of long-chain n-3 polyunsaturated fatty acids (PUFAs) and risk of atrial fibrillation (AF) have been inconsistent. We studied the association of fish and the fish-derived n-3 PUFAs eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA) with the risk of incident AF in individuals aged 45-64 from the Atherosclerosis Risk in Communities (ARIC) cohort (n = 14,222, 27% African Americans). Intake of fish and of DHA and EPA were measured via food frequency questionnaire. Plasma levels of DHA and EPA were measured in phospholipids in a subset of participants (n = 3,757). Incident AF was identified through the end of 2008 using ECGs, hospital discharge codes and death certificates. Cox proportional hazards regression was used to estimate hazard ratios of AF by quartiles of n-3 PUFAs or by fish intake. During the average follow-up of 17.6 years, 1,604 AF events were identified. In multivariable analyses, total fish intake and dietary DHA and EPA were not associated with AF risk. Higher intake of oily fish and canned tuna was associated with a nonsignificant lower risk of AF (p for trend = 0.09). Phospholipid levels of DHA+EPA were not related to incident AF. However, DHA and EPA showed differential associations with AF risk when analyzed separately, with lower risk of AF in those with higher levels of DHA but no association between EPA levels and AF risk. In this racially diverse sample, dietary intake of fish and fish-derived n-3 fatty acids, as well as plasma biomarkers of fish intake, were not associated with AF risk.

  4. Fish, fish-derived n-3 fatty acids, and risk of incident atrial fibrillation in the Atherosclerosis Risk in Communities (ARIC study.

    Directory of Open Access Journals (Sweden)

    Noelle N Gronroos

    Full Text Available Results of observational and experimental studies investigating the association between intake of long-chain n-3 polyunsaturated fatty acids (PUFAs and risk of atrial fibrillation (AF have been inconsistent.We studied the association of fish and the fish-derived n-3 PUFAs eicosapentaenoic acid (EPA and docosahexaenoic acid (DHA with the risk of incident AF in individuals aged 45-64 from the Atherosclerosis Risk in Communities (ARIC cohort (n = 14,222, 27% African Americans. Intake of fish and of DHA and EPA were measured via food frequency questionnaire. Plasma levels of DHA and EPA were measured in phospholipids in a subset of participants (n = 3,757. Incident AF was identified through the end of 2008 using ECGs, hospital discharge codes and death certificates. Cox proportional hazards regression was used to estimate hazard ratios of AF by quartiles of n-3 PUFAs or by fish intake.During the average follow-up of 17.6 years, 1,604 AF events were identified. In multivariable analyses, total fish intake and dietary DHA and EPA were not associated with AF risk. Higher intake of oily fish and canned tuna was associated with a nonsignificant lower risk of AF (p for trend = 0.09. Phospholipid levels of DHA+EPA were not related to incident AF. However, DHA and EPA showed differential associations with AF risk when analyzed separately, with lower risk of AF in those with higher levels of DHA but no association between EPA levels and AF risk.In this racially diverse sample, dietary intake of fish and fish-derived n-3 fatty acids, as well as plasma biomarkers of fish intake, were not associated with AF risk.

  5. Higher plasma levels of MR-pro-atrial natriuretic peptide are linked to less anxiety: results from the observational DIAST-CHF study. (United States)

    Meyer, Thomas; Herrrmann-Lingen, Christoph; Chavanon, Mira-Lynn; Nolte, Kathleen; Pasedach, Caroline Anna; Binder, Lutz; Pieske, Burkert; Hasenfuss, Gerd; Wachter, Rolf; Edelmann, Frank


    Growing evidence suggests that natriuretic peptides play a role in the neurobiology of anxiety. In the present study, we investigated whether in patients with cardiovascular risk factors higher plasma levels of natriuretic peptides are linked to reduced anxiety. A total of 1,360 patients from the observational DIAST-CHF study (mean age 65.9 ± 8.2 years, 48.7 % males, mean left ventricular ejection fraction 60.0 ± 8.2 %) with risk factors for diastolic heart failure were included. Study participants underwent physical examination, echocardiography, and assessment of anxiety using the Hospital Anxiety and Depression Scale (HADS). In addition, plasma concentrations of natriuretic peptides were measured. Among the total study population, there were n = 117 patients (8.6 %) with HADS anxiety scores above the cut-off (≥11) suggestive of clinically relevant anxiety. In bivariate analyses, we found a significant inverse association between elevated HADS anxiety and log-transformed mid-regional pro-atrial natriuretic peptide (MR-proANP) (p anxiety, while NT-proBNP (exp(β) = 0.67, 95 % CI 0.41-1.07, p = 0.094) failed to reach the significance level in independently predicting anxiety. In our study population of outpatients with cardiovascular risk factors, plasma concentrations of MR-proANP were negatively and independently related to clinically relevant anxiety. Further investigations are required to search for possible anxiolytic effects of this circulating natriuretic peptide in medical outpatients with cardiovascular risk factors for diastolic dysfunction.

  6. Treatment with high-dose n-3 PUFAs has no effect on platelet function, coagulation, metabolic status or inflammation in patients with atherosclerosis and type 2 diabetes. (United States)

    Poreba, Malgorzata; Mostowik, Magdalena; Siniarski, Aleksander; Golebiowska-Wiatrak, Renata; Malinowski, Krzysztof Piotr; Haberka, Maciej; Konduracka, Ewa; Nessler, Jadwiga; Undas, Anetta; Gajos, Grzegorz


    Despite numerous studies on cardioprotective effects of omega-3 polyunsaturated fatty acids (n-3 PUFAs), there is limited evidence for n-3 PUFA-mediated effects, especially at its higher dose, on cardiovascular risk in patients with type 2 diabetes (DM2) and established atherosclerosis. To investigate the effect of daily treatment with a higher dose (2 g) of n-3 PUFAs on platelet function, coagulation parameters, fibrin clot properties, markers of systemic inflammation and metabolic status, in patients with atherosclerotic vascular disease and DM2 who receive optimal medical therapy. We conducted a prospective, double-blind, placebo-controlled, randomized, double-center study, in which thrombin generation (plasma thrombogenic potential from automated thrombogram), fibrin clot properties (plasma fibrin clot permeability; lysis time), platelet aggregation (light transmission aggregometry with adenosine diphosphate and arachidonic acid used as agonists), HbA1c, insulin level, lipid profiles, leptin and adiponectin levels, as well as markers of systemic inflammation (i.e., hsCRP, IL-6, TNF-α, ICAM-1, VCAM-1, and myeloperoxidase) were determined at baseline and at 3 months after treatment with 2 g/day of n-3 PUFAs (n = 36) or placebo (n = 38). Moreover, we assessed serum fatty acids of the phospholipid fraction by gas chromatography both at baseline and at the end of the study. Majority of patients were treated with optimal medical therapy and achieved recommended treatment targets. Despite higher serum levels of eicosapentaenoic acid (EPA) (by 204%; p acid (DHA) (by 62%; p coagulation, metabolic, and inflammatory status when measured with the specified tests. The study was registered in; identifier: NCT02178501. Registration date: April 12, 2014.

  7. N-(3-Methylphenylquinoxalin-2-amine monohydrate

    Directory of Open Access Journals (Sweden)

    Azila Idris


    Full Text Available The quinoxaline system in the title hydrate, C15H13N3·H2O, is roughly planar, the r.m.s. deviation for the 18 non-H atoms being 0.188 Å; this conformation features a short intramolecular C—H...N(pyrazine interaction. In the crystal, the amine H atom forms an N—H...O hydrogen bond to the water molecule, which in turn forms two O—H...N hydrogen bonds to the pyrazine N atoms of different organic molecules. These interactions lead to supramolecular arrays in the bc plane that are two molecules thick; additional π–π interactions stabilize the layers [ring centroid–centroid distance = 3.5923 (7 Å]. The layers stack along the a-axis direction via C—H...π contacts.

  8. Increased plasma levels of the high mobility group box 1 protein (HMGB1) are associated with a higher score of gastrointestinal dysfunction in individuals with autism. (United States)

    Babinská, K; Bucová, M; Ďurmanová, V; Lakatošová, S; Jánošíková, D; Bakoš, J; Hlavatá, A; Ostatníková, D


    Autism is a disorder of neural development characterized by impairments in communication, social interaction, restricted interests and repetitive behavior. The etiology of autism is poorly understood, the evidence indicates that inflammation may play a key role. In autism a high prevalence of gastrointestinal disturbances is reported, that are linked to a low-grade chronic inflammation of the intestinal mucosa. High mobility group box 1 protein (HMGB1) is an intranuclear protein that can be passively released from necrotic cells or actively secreted under inflammatory conditions as alarmin or late proinflammatory cytokine. The objective of this study was to measure plasma levels of HMGB1 in individuals with autism and to analyze their association with gastrointestinal symptoms. The study involved 31 subjects with low-functioning autistic disorder aged 2-22 years and 16 healthy controls. Plasma HMGB1 levels were significantly higher in individuals with autism than in controls (13.8+/-11.7 ng/ml vs. 7.90+/-4.0 ng/ml, pautism and its possible association with GI symptoms.

  9. Higher plasma levels of advanced glycation end products are associated with incident cardiovascular disease and all-cause mortality in type 1 diabetes

    DEFF Research Database (Denmark)

    Nin, Johanna W; Jorsal, Anders; Ferreira, Isabel


    or endothelial dysfunction, low-grade inflammation, or arterial stiffness. CONCLUSIONS: Higher levels of AGEs are associated with incident fatal and nonfatal CVD as well as all-cause mortality in individuals with type 1 diabetes, independently of other risk factors and of several potential AGEs-related......OBJECTIVE: To investigate the associations of plasma levels of advanced glycation end products (AGEs) with incident cardiovascular disease (CVD) and all-cause mortality in type 1 diabetes and the extent to which any such associations could be explained by endothelial and renal dysfunction, low-grade...... inflammation, and arterial stiffness. RESEARCH DESIGN AND METHODS: We prospectively followed 169 individuals with diabetic nephropathy and 170 individuals with persistent normoalbuminuria who were free of CVD at study entry and in whom levels of N(ε)-(carboxymethyl)lysine, N...

  10. Dietary omega-3 polyunsaturated fatty acids alter the fatty acid composition of hepatic and plasma bioactive lipids in C57BL/6 mice: a lipidomic approach.

    Directory of Open Access Journals (Sweden)

    Kayode A Balogun

    Full Text Available BACKGROUND: Omega (n-3 polyunsaturated fatty acids (PUFA are converted to bioactive lipid components that are important mediators in metabolic and physiological pathways; however, which bioactive compounds are metabolically active, and their mechanisms of action are still not clear. We investigated using lipidomic techniques, the effects of diets high in n-3 PUFA on the fatty acid composition of various bioactive lipids in plasma and liver. METHODOLOGY AND PRINCIPAL FINDINGS: Female C57BL/6 mice were fed semi-purified diets (20% w/w fat containing varying amounts of n-3 PUFA before mating, during gestation and lactation, and until weaning. Male offspring were continued on their mothers' diets for 16 weeks. Hepatic and plasma lipids were extracted in the presence of non-naturally occurring internal standards, and tandem electrospray ionization mass spectrometry methods were used to measure the fatty acyl compositions. There was no significant difference in total concentrations of phospholipids in both groups. However, there was a significantly higher concentration of eicosapentaenoic acid containing phosphatidylcholine (PC, lysophosphatidylcholine (LPC, and cholesteryl esters (CE (p < 0.01 in the high n-3 PUFA group compared to the low n-3 PUFA group in both liver and plasma. Plasma and liver from the high n-3 PUFA group also had a higher concentration of free n-3 PUFA (p < 0.05. There were no significant differences in plasma concentrations of different fatty acyl species of phosphatidylethanolamine, triglycerides, sphingomyelin and ceramides. CONCLUSIONS/SIGNIFICANCE: Our findings reveal for the first time that a diet high in n-3 PUFA caused enrichment of n-3 PUFA in PC, LPC, CE and free fatty acids in the plasma and liver of C57BL/6 mice. PC, LPC, and unesterified free n-3 PUFA are important bioactive lipids, thus altering their fatty acyl composition will have important metabolic and physiological roles.

  11. Lipid profiles of sperm and seminal plasma from boars having normal or low sperm motility. (United States)

    Am-in, N; Kirkwood, R N; Techakumphu, M; Tantasuparuk, W


    Sperm plasma membrane lipids have an important role to play in determining membrane fluidity and sperm motility. The objective of the present study was to determine whether there are differences in the lipid and fatty acid (FA) composition of boar sperm and seminal plasma in the ejaculates of boars having different sperm motilities. Semen was collected from two groups of boars having normal (> 60%; n = 53) or low (sperm and the semen was evaluated for motility, morphology and vitality. The semen was then centrifuged to separate the sperm from the seminal plasma and both were kept at -20 °C until analyzed for lipid content and FA profile by gas chromatography. Total antioxidant status (TAS) of seminal plasma was determined using a commercial kit. There were differences (P ≤ 0.05) in sperm total lipids, cholesterol, saturated fatty acids (SFA), phospholipids, n-3 polyunsaturated fatty acids (PUFA), docosahexaenoic acid (DHA) and the ratio of n-6:n-3 PUFA between boars with normal and low motility sperm. Total lipids, cholesterol, phospholipids, PUFA, DHA and n-3 PUFA were positively correlated with sperm motility, viability, normal morphology and normal plasma membrane. In contrast, SFA and the ratio of n-6: n-3 PUFA were negatively correlated (P ≤ 0.05) with sperm motility, viability, normal morphology and normal plasma membranes. The TAS of seminal plasma from boars having normal motility sperm was higher (P ≤ 0.05) than that of boars having low motility sperm and TAS was positively correlated (P = 0.0001) with sperm motility, viability, normal morphology and normal plasma membranes. In summary, differences in sperm motility were related to n-3 PUFA content in the sperm plasma membrane and extracellular antioxidants in seminal plasma which protect sperm plasma membranes from lipid peroxidation during periods of oxidative stress. Copyright © 2011 Elsevier Inc. All rights reserved.

  12. n-3 PUFA status in school children is associated with beneficial lipid profile, reduced physical activity and increased blood pressure in boys

    DEFF Research Database (Denmark)

    Damsgaard, Camilla T.; Stark, Ken D.; Hjorth, Mads F.


    the relationship between fasting whole-blood EPA or DHA (w/w% of the total fatty acids, FA%) and markers of the MetS (anthropometry, blood pressure, plasma lipids and glucose homeostasis) cross-sectionally in seventy-three 8–11-year-old Danish children from the OPUS School Meal Pilot Study (OPUS is an acronym......Dietary n-3 long-chain PUFA (LC-PUFA) improve dyslipidaemia and hypertension and may affect insulin resistance and adiposity. Increasing numbers of children show signs of the metabolic syndrome (MetS), but few studies have investigated the association with n-3 LC-PUFA status. We examined...... of the project ‘Optimal well-being, development and health for Danish children through a healthy New Nordic Diet’ and is supported by a grant from the Nordea Foundation). Also, we explored the potential mediating effects of physical activity and energy intake. Girls had higher body fat percentage (BF...

  13. Effects of supplementation with n-3 polyunsaturated fatty acids on cognitive performance and cardiometabolic risk markers in healthy 51 to 72 years old subjects: a randomized controlled cross-over study

    Directory of Open Access Journals (Sweden)

    Nilsson Anne


    Full Text Available Abstract Background Higher plasma n-3 polyunsaturated fatty acids (PUFA have been associated with a lower risk of age related cognitive decline, and to beneficially affect cardiometabolic risk factors. A relation exists between metabolic disorders such as diabetes type 2 and cognitive decline. Results regarding the potential effects of n-3 PUFA on risk factors in healthy subjects are divergent, and studies regarding the possible relation between cardiometabolic parameters and cognitive performance are scarce. The objective was to evaluate the effects of five weeks intake of long chain n-3 PUFA on cognitive performance in healthy individuals, and to exploit the possible relation between outcomes in cognitive tests to cardiometabolic risk parameters. Methods Fish oil n-3 PUFA (3g daily were consumed during 5weeks separated by a 5 week washout period in a cross-over placebo controlled study, including 40 healthy middle aged to elderly subjects. Cognitive performance was determined by tests measuring working memory (WM and selective attention. Results Supplementation with n-3 PUFA resulted in better performance in the WM-test compared with placebo (p p p p = 0.05, and s-TNF-α (p = 0.05, were inversely related to the performance in cognitive tests. Conclusions Intake of n-3 PUFA improved cognitive performance in healthy subjects after five weeks compared with placebo. In addition, inverse relations were obtained between cardiometabolic risk factors and cognitive performance, indicating a potential of dietary prevention strategies to delay onset of metabolic disorders and associated cognitive decline.

  14. Effects of supplementation with n-3 polyunsaturated fatty acids on cognitive performance and cardiometabolic risk markers in healthy 51 to 72 years old subjects: a randomized controlled cross-over study. (United States)

    Nilsson, Anne; Radeborg, Karl; Salo, Ilkka; Björck, Inger


    Higher plasma n-3 polyunsaturated fatty acids (PUFA) have been associated with a lower risk of age related cognitive decline, and to beneficially affect cardiometabolic risk factors. A relation exists between metabolic disorders such as diabetes type 2 and cognitive decline. Results regarding the potential effects of n-3 PUFA on risk factors in healthy subjects are divergent, and studies regarding the possible relation between cardiometabolic parameters and cognitive performance are scarce. The objective was to evaluate the effects of five weeks intake of long chain n-3 PUFA on cognitive performance in healthy individuals, and to exploit the possible relation between outcomes in cognitive tests to cardiometabolic risk parameters. Fish oil n-3 PUFA (3g daily) were consumed during 5 weeks separated by a 5 week washout period in a cross-over placebo controlled study, including 40 healthy middle aged to elderly subjects. Cognitive performance was determined by tests measuring working memory (WM) and selective attention. Supplementation with n-3 PUFA resulted in better performance in the WM-test compared with placebo (p performance in cognitive tests. Intake of n-3 PUFA improved cognitive performance in healthy subjects after five weeks compared with placebo. In addition, inverse relations were obtained between cardiometabolic risk factors and cognitive performance, indicating a potential of dietary prevention strategies to delay onset of metabolic disorders and associated cognitive decline.

  15. Blood fatty acid changes in healthy young Americans in response to a 10-week diet that increased n-3 and reduced n-6 fatty acid consumption: a randomised controlled trial. (United States)

    Young, Andrew J; Marriott, Bernadette P; Champagne, Catherine M; Hawes, Michael R; Montain, Scott J; Johannsen, Neil M; Berry, Kevin; Hibbeln, Joseph R


    Military personnel generally under-consume n-3 fatty acids and overconsume n-6 fatty acids. In a placebo-controlled, double-blinded study, we investigated whether a diet suitable for implementation in military dining facilities and civilian cafeterias could benefit n-3/n-6 fatty acid status of consumers. Three volunteer groups were provided different diets for 10 weeks. Control (CON) participants consumed meals from the US Military's Standard Garrison Dining Facility Menu. Experimental, moderate (EXP-Mod) and experimental-high (EXP-High) participants consumed the same meals, but high n-6 fatty acid and low n-3 fatty acid containing chicken, egg, oils and food ingredients were replaced with products having less n-6 fatty acids and more n-3 fatty acids. The EXP-High participants also consumed smoothies containing 1000 mg n-3 fatty acids per serving, whereas other participants received placebo smoothies. Plasma and erythrocyte EPA and DHA in CON group remained unchanged throughout, whereas EPA, DHA and Omega-3 Index increased in EXP-Mod and EXP-High groups, and were higher than in CON group after 5 weeks. After 10 weeks, Omega-3 Index in EXP-High group had increased further. No participants exhibited changes in fasting plasma TAG, total cholesterol, LDL, HDL, mood or emotional reactivity. Replacing high linoleic acid (LA) containing foods in dining facility menus with similar high oleic acid/low LA and high n-3 fatty acid foods can improve n-6/n-3 blood fatty acid status after 5 weeks. The diets were well accepted and suitable for implementation in group feeding settings like military dining facilities and civilian cafeterias.

  16. Omega-3 fatty acids status in human subjects estimated using a food frequency questionnaire and plasma phospholipids levels

    Directory of Open Access Journals (Sweden)

    Garneau Véronique


    Full Text Available Abstract Background Intakes of omega-3 (n-3 fatty acids (FA are associated with several health benefits. The aim of this study was to verify whether intakes of n-3 FA estimated from a food frequency questionnaire (FFQ correlate with n-3 FA levels measured in plasma phospholipids (PL. Methods The study sample consisted of 200 French-Canadians men and women aged between 18 to 55 years. Dietary data were collected using a validated FFQ. Fasting blood samples were collected and the plasma PL FA profile was measured by gas chromatography. Results Low intakes of n-3 long-chain FA together with low percentages of n-3 long-chain FA in plasma PL were found in French-Canadian population. Daily intakes of eicosapentaenoic acid (EPA, docosapentaenoic acid (DPA and docosahexaenoic acid (DHA were similar between men and women. Yet, alpha-linolenic acid (ALA and total n-3 FA intakes were significantly higher in men compared to women (ALA: 2.28 g and 1.69 g, p n-3 FA: 2.57 g and 1.99 g, p n-3 FA (men: r = 0.47, p  Conclusion Estimated n-3 long-chain FA intake among this young and well-educated French-Canadian population is lower than the recommendations. Further, FFQ data is comparable to plasma PL results to estimate DHA and total n-3 FA status in healthy individuals as well as to evaluate the EPA and DPA status in women. Overall, this FFQ could be used as a simple, low-cost tool in future studies to rank n-3 FA status of individuals.

  17. Fish intake, erythrocyte n-3 fatty acid status and metabolic health in Danish adolescent girls and boys

    DEFF Research Database (Denmark)

    Lauritzen, Lotte; Harsløf, Laurine B. S.; Hellgren, Lars


    the effects of n-3 LCPUFA in adolescence. The present study examines associations between fish intake (assessed by a 7 d pre-coded food diary), erythrocyte (RBC) DHA status (analysed by GC) and metabolic syndrome measures (anthropometry, blood pressure and plasma lipids, insulin and glucose) in 109 17-year......-old children from the Copenhagen Birth Cohort Study. Of the children, 8% were overweight or obese and few showed signs of the metabolic syndrome, but all the metabolic syndrome variables were correlated. Median fish intake was 10·7 (interquartile range 3·6–21·2) g/d. Boys tended to have a higher fish intake (P...... fasting insulin (P¼0·018), but no adverse association was observed with the mean metabolic syndrome z-score. Overall, the present study showed the expected association between fish intake and RBC-DHA, which in contrast to our expectations tended to be associated with a poorer metabolic profile. Whether...

  18. n-3 polyunsaturated fatty acid supplementation during cancer chemotherapy


    Morland, Sarah Louise; Martins, Karen J.B.; Mazurak, Vera C


    Evidence from several clinical trials suggests that n-3 polyunsaturated fatty acid (n-3 PUFA) supplementation during cancer chemotherapy improves patient outcomes related to chemotherapy tolerability, regardless of the type of chemotherapy used. While the effects of n-3 PUFA supplementation during chemotherapy have been the subject of several reviews, the mechanisms by which n-3 PUFA improve patient responses through improved chemotherapy tolerability are unclear. There are several barriers c...

  19. Beneficial Effect of Higher Dietary Fiber Intake on Plasma HDL-C and TC/HDL-C Ratio among Chinese Rural-to-Urban Migrant Workers. (United States)

    Zhou, Quan; Wu, Jiang; Tang, Jie; Wang, Jia-Ji; Lu, Chu-Hong; Wang, Pei-Xi


    Research has shown that high-dose supplemental dietary fiber intake has beneficial effects on cardiovascular risk factors. To clarify such a relationship, we examined the association between daily dietary fiber intake and plasma lipids using a cross-sectional design including 1034 (M 502, F 532) rural-to-urban workers in China. We found a dose-response relationship between increased dietary fiber intakes and increase of HDL cholesterol in male workers. There was also a dose-response relationship between increased dietary fiber intake and decreased total cholesterol to HDL cholesterol (TC/HDL-C) ratio in both male and female workers, after adjusting for potential confounders (p for trend, all p dietary fiber intake increased from less than 18 g/day to over 30 g/day, the average HDL cholesterol level increased by 10.1%, and the TC/HDL-C ratio decreased by 14.4% for males (p = 0.020) and by 11.1% for females (p = 0.048). In conclusion, higher daily dietary fiber consumption is associated with beneficial effect on cholesterol for rural-to-urban workers in China, suggesting its potential beneficial effect on decreasing the risk of cardiovascular diseases.

  20. N-3 long-chain polyunsaturated fatty acid supplementation significantly reduces liver oxidative stress in high fat induced steatosis.

    Directory of Open Access Journals (Sweden)

    Rodrigo Valenzuela

    Full Text Available Omega-3 (n-3 long-chain polyunsaturated fatty acids (n-3 LCPUFA are associated with several physiological functions, suggesting that their administration may prevent non transmissible chronic diseases. Therefore, we investigate whether dietary n-3 LCPUFA supplementation triggers an antioxidant response preventing liver steatosis in mice fed a high fat diet (HFD in relation to n-3 LCPUFA levels. Male C57BL/6J mice received (a control diet (10% fat, 20% protein, 70% carbohydrate, (b control diet plus n-3 LCPUFA (108 mg/kg/day eicosapentaenoic acid plus 92 mg/kg/day docosahexaenoic acid, (c HFD (60% fat, 20% protein, 20% carbohydrate, or (d HFD plus n-3 LCPUFA for 12 weeks. Parameters of liver steatosis, glutathione status, protein carbonylation, and fatty acid analysis were determined, concomitantly with insulin resistance and serum tumor necrosis factor-α (TNF-α, interleukin (IL-1β, and IL-6 levels. HFD significantly increased total fat and triacylglyceride contents with macrovesicular steatosis, concomitantly with higher fasting serum glucose and insulin levels, HOMA, and serum TNF-α, IL-1β, and IL-6. Reduced and total liver glutathione contents were diminished by HFD, with higher GSSG/GSH ratio and protein carbonylation, n-3 LCPUFA depletion and elevated n-6/n-3 ratio over control values. These changes were either reduced or normalized to control values in animals subjected to HFD and n-3 LCPUFA, with significant increased hepatic total n-3 LCPUFA content and reduced n-6/n-3 ratio being observed after n-3 LCPUFA supplementation alone. So, repletion of liver n-3 LCPUFA levels by n-3 LCPUFA dietary supplementation in HFD obese mice reduces hepatic lipid content, with concomitant antioxidant and anti-inflammatory responses favouring insulin sensitivity.

  1. Association between plasma omega-3 fatty acids and cardiovascular disease risk factors. (United States)

    Garneau, Véronique; Rudkowska, Iwona; Paradis, Ann-Marie; Godin, Gaston; Julien, Pierre; Pérusse, Louis; Vohl, Marie-Claude


    The consumption of omega-3 (n-3) fatty acids (FA), namely eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA), have been linked to reduced cardiovascular disease (CVD) risk. The objective of this study was to examine the relation between n-3 FA in plasma phospholipid (PL) levels and CVD risk factors. n-3 FA levels in plasma PL were determined using gas chromatography in 100 obese (body mass index (BMI), ≥30 kg·m(-2)) and 100 nonobese selected individuals from the Quebec City metropolitan area. The CVD risk factors analysed were BMI, blood pressure, plasma lipids levels, and fasting plasma glucose. Significantly higher levels of alpha-linolenic acid (ALA) and docosapentaenoic acid (DPA) were observed in obese subjects, whereas significantly higher levels of DHA were observed in nonobese subjects. For CVD risk factors, ALA levels were positively correlated with plasma triglyceride concentrations and negatively associated with diastolic blood pressure. None of the CVD risk factors studied was linked to EPA levels. In addition, DPA was negatively related to high-density lipoprotein cholesterol (HDL-C) and positively correlated with the total cholesterol/HDL-C ratio. DHA levels were negatively correlated with BMI, waist circumference, and plasma triglyceride levels, whereas a positive association was observed with HDL-C levels. Total n-3 FA percentages were negatively correlated with BMI. In conclusion, higher DHA percentages in plasma PL are associated with a more favourable CVD risk profile, whereas higher DPA percentages in plasma PL are associated with a more deteriorated CVD risk profile.

  2. Modulation of enzymatic activities by n-3 polyunsaturated fatty acids to support cardiovascular health. (United States)

    Siddiqui, Rafat A; Harvey, Kevin A; Zaloga, Gary P


    Epidemiological evidence from Greenland Eskimos and Japanese fishing villages suggests that eating fish oil and marine animals can prevent coronary heart disease. Dietary studies from various laboratories have similarly indicated that regular fish oil intake affects several humoral and cellular factors involved in atherogenesis and may prevent atherosclerosis, arrhythmia, thrombosis, cardiac hypertrophy and sudden cardiac death. The beneficial effects of fish oil are attributed to their n-3 polyunsaturated fatty acid (PUFA; also known as omega-3 fatty acids) content, particularly eicosapentaenoic acid (EPA; 20:5, n-3) and docosahexaenoic acid (DHA; 22:6, n-3). Dietary supplementation of DHA and EPA influences the fatty acid composition of plasma phospholipids that, in turn, may affect cardiac cell functions in vivo. Recent studies have demonstrated that long-chain omega-3 fatty acids may exert beneficial effects by affecting a wide variety of cellular signaling mechanisms. Pathways involved in calcium homeostasis in the heart may be of particular importance. L-type calcium channels, the Na+-Ca2+ exchanger and mobilization of calcium from intracellular stores are the most obvious key signaling pathways affecting the cardiovascular system; however, recent studies now suggest that other signaling pathways involving activation of phospholipases, synthesis of eicosanoids, regulation of receptor-associated enzymes and protein kinases also play very important roles in mediating n-3 PUFA effects on cardiovascular health. This review is therefore focused on the molecular targets and signaling pathways that are regulated by n-3 PUFAs in relation to their cardioprotective effects.

  3. Higgs boson gluon-fusion production in N3LO QCD

    CERN Document Server

    Anastasiou, Charalampos; Dulat, Falko; Herzog, Franz; Mistlberger, Bernhard


    We present the cross-section for the production of a Higgs boson at hadron-colliders at next-to- next-to-next-to-leading order (N3LO) in perturbative QCD. The calculation is based on a method to perform a series expansion of the partonic cross-section around the threshold limit to an arbitrary order. We perform this expansion to sufficiently high order to obtain the value of the hadronic cross at N3LO in the large top-mass limit. For renormalisation and factorisation scales equal to half the Higgs mass, the N3LO corrections are of the order of +2.2%. The total scale variation at N3LO is 3%, reducing the uncertainty due to missing higher order QCD corrections by a factor of three.

  4. Review of Propulsion Technologies for N+3 Subsonic Vehicle Concepts (United States)

    Ashcraft, Scott W.; Padron, Andres S.; Pascioni, Kyle A.; Stout, Gary W., Jr.; Huff, Dennis L.


    NASA has set aggressive fuel burn, noise, and emission reduction goals for a new generation (N+3) of aircraft targeting concepts that could be viable in the 2035 timeframe. Several N+3 concepts have been formulated, where the term "N+3" indicate aircraft three generations later than current state-of-the-art aircraft, "N". Dramatic improvements need to be made in the airframe, propulsion systems, mission design, and the air transportation system in order to meet these N+3 goals. The propulsion system is a key element to achieving these goals due to its major role with reducing emissions, fuel burn, and noise. This report provides an in-depth description and assessment of propulsion systems and technologies considered in the N+3 subsonic vehicle concepts. Recommendations for technologies that merit further research and development are presented based upon their impact on the N+3 goals and likelihood of being operational by 2035.

  5. Involvement of gut microbial fermentation in the metabolic alterations occurring in n-3 polyunsaturated fatty acids-depleted mice

    Directory of Open Access Journals (Sweden)

    Carpentier Yvon A


    Full Text Available Abstract Backround Western diet is characterized by an insufficient n-3 polyunsaturated fatty acid (PUFA consumption which is known to promote the pathogenesis of several diseases. We have previously observed that mice fed with a diet poor in n-3 PUFA for two generations exhibit hepatic steatosis together with a decrease in body weight. The gut microbiota contributes to the regulation of host energy metabolism, due to symbiotic relationship with fermentable nutrients provided in the diet. In this study, we have tested the hypothesis that perturbations of the gut microbiota contribute to the metabolic alterations occurring in mice fed a diet poor in n-3 PUFA for two generations (n-3/- mice. Methods C57Bl/6J mice fed with a control or an n-3 PUFA depleted diet for two generations were supplemented with prebiotic (inulin-type Fructooligosaccharides, FOS, 0.20 g/day/mice during 24 days. Results n-3/-mice exhibited a marked drop in caecum weight, a decrease in lactobacilli and an increase in bifidobacteria in the caecal content as compared to control mice (n-3/+ mice. Dietary supplementation with FOS for 24 days was sufficient to increase caecal weight and bifidobacteria count in both n-3/+ and n-3/-mice. Moreover, FOS increased lactobacilli content in n-3/-mice, whereas it decreased their level in n-3/+ mice. Interestingly, FOS treatment promoted body weight gain in n-3/-mice by increasing energy efficiency. In addition, FOS treatment decreased fasting glycemia and lowered the higher expression of key factors involved in the fatty acid catabolism observed in the liver of n-3/-mice, without lessening steatosis. Conclusions the changes in the gut microbiota composition induced by FOS are different depending on the type of diet. We show that FOS may promote lactobacilli and counteract the catabolic status induced by n-3 PUFA depletion in mice, thereby contributing to restore efficient fat storage.

  6. Higher plasma high-mobility group box 1 levels are associated with incident cardiovascular disease and all-cause mortality in type 1 diabetes

    DEFF Research Database (Denmark)

    Nin, J W M; Ferreira, I; Schalkwijk, C G


    This study aimed to investigate the associations of plasma levels of the pro-inflammatory cytokine high-mobility group box 1 (HMGB1) with incident cardiovascular disease (CVD) and all-cause mortality in patients with type 1 diabetes.......This study aimed to investigate the associations of plasma levels of the pro-inflammatory cytokine high-mobility group box 1 (HMGB1) with incident cardiovascular disease (CVD) and all-cause mortality in patients with type 1 diabetes....

  7. N-3 polyunsaturated fatty acids, body fat and inflammation

    DEFF Research Database (Denmark)

    Lund, Anne-Sofie Quist; Hasselbalch, Ann Louise; Gamborg, Michael


    BACKGROUND: Based on animal studies, n-3 polyunsaturated fatty acids (PUFAs) have been suggested to lower the risk of obesity and inflammation. We aimed to investigate if, among humans, intake of n-3 PUFAs was associated with i) total body fat, ii) body fat distribution and iii) obesity-related i......BACKGROUND: Based on animal studies, n-3 polyunsaturated fatty acids (PUFAs) have been suggested to lower the risk of obesity and inflammation. We aimed to investigate if, among humans, intake of n-3 PUFAs was associated with i) total body fat, ii) body fat distribution and iii) obesity...

  8. Higher Decorin Levels in Bone Marrow Plasma Are Associated with Superior Treatment Response to Novel Agent-Based Induction in Patients with Newly Diagnosed Myeloma - A Retrospective Study.

    Directory of Open Access Journals (Sweden)

    Shang-Yi Huang

    Full Text Available The growth of myeloma cells depends on bone marrow (BM stroma consisting of stromal cells, secreted cytokines and the extracellular matrix (ECM. Decorin, a small leucine-rich proteoglycan in the ECM, is a signaling ligand and native anti-tumor agent. However, the role of decorin in patients with myeloma is not clear. We evaluated the correlation between the decorin levels measured by enzyme-linked immunosorbent assay in BM plasma from 121 patients with newly diagnosed myeloma based on their clinical features and treatment response. The median decorin levels in the patients and the normal control group were 12.31 ng/mL [standard deviation (SD, 7.50 ng/mL; range, 2.45 to 44.46 ng/mL] and 10.31 ng/mL (SD, 2.42 ng/mL; range, 4.85-15.14 ng/mL, respectively (P < 0.001. Using 15.15 ng/mL as a cut-off, 46 patients (38% exhibited higher decorin levels (H-DCN, whereas the other patients exhibited normal to lower decorin levels (NL-DCN. Except for the median age, which was significantly younger in the H-DCN than in the NL-DCN group (60.6 ± 14.0 vs. 65.8 ± 12.2 years, respectively; P = 0.034, there were no differences between the two groups. However, in 79 patients who had received novel agent-based induction, the overall response rate was significantly better in the H-DCN than in the NL-DCN (97 vs. 63%, respectively; P < 0.001, as was the depth of responses (P = 0.008, which were not observed in those who had received chemotherapeutic agents alone. Progression-free survival (PFS was significantly longer in H-DCN than NL-DCN (not reached vs. 19.5 mo, respectively; P = 0.0003. Multivariate analyses indicated that H-DCN, as a significantly independent factor, was associated with better treatment response (odds ratio, 20.014; 95% CI, 2.187-183.150; P = 0.008 and longer PFS (hazard ratio, 0.135; 95% CI, 0.051-0.361; P < 0.001. These findings disclose the potential role of decorin in myeloma and provide a basis for further study on possible synergistic anti

  9. Changes in cholesterol homeostasis modify the response of F1B hamsters to dietary very long chain n-3 and n-6 polyunsaturated fatty acids

    Directory of Open Access Journals (Sweden)

    Rader Daniel J


    Full Text Available Abstract Background The plasma lipoprotein response of F1B Golden-Syrian hamsters fed diets high in very long chain (VLC n-3 polyunsaturated fatty acids (PUFA is paradoxical to that observed in humans. This anomaly is attributed, in part, to low lipoprotein lipase activity and is dependent on cholesterol status. To further elucidate the mechanism(s for these responses, hamsters were fed diets containing supplemental fish oil (VLC n-3 PUFA or safflower oil (n-6 PUFA (both 10% [w/w] and either cholesterol-supplemented (0.1% cholesterol [w/w] or cholesterol-depleted (0.01% cholesterol [w/w] and 10 days prior to killing fed 0.15% lovastatin+2% cholestyramine [w/w]. Results Cholesterol-supplemented hamsters fed fish oil, relative to safflower oil, had higher non-high density lipoprotein (HDL cholesterol and triglyceride concentrations (P Conclusion These data suggest disturbing cholesterol homeostasis in F1B hamsters alters their response to dietary fatty acids, which is reflected in altered plasma lipoprotein patterns and regulation of genes associated with their metabolism.

  10. Higher plasma soluble Receptor for Advanced Glycation End Products (sRAGE) levels are associated with incident cardiovascular disease and all-cause mortality in type 1 diabetes

    DEFF Research Database (Denmark)

    Nin, Johanna W M; Jorsal, Anders; Ferreira, Isabel


    To investigate the associations of plasma levels of soluble receptor for advanced glycation end products (sRAGE) with incident cardiovascular disease (CVD) and all-cause mortality in type 1 diabetes and the extent to which any such associations could be explained by endothelial and renal dysfunct......To investigate the associations of plasma levels of soluble receptor for advanced glycation end products (sRAGE) with incident cardiovascular disease (CVD) and all-cause mortality in type 1 diabetes and the extent to which any such associations could be explained by endothelial and renal...

  11. Higher high density lipoprotein cholesterol associated with moderate alcohol consumption is not related to altered plasma lecithin : cholesterol acyltransferase and lipid transfer protein activity levels

    NARCIS (Netherlands)

    Riemens, SC; vanTol, A; Hoogenberg, K; vanGent, T; Scheek, LM; Sluiter, WJ; Dullaart, RPF


    Lecithin:cholesterol acyltransferase (LCAT), cholesteryl ester transfer protein (CETP) and phospholipid transfer protein (PLTP) are important factors involved in HDL metabolism. Altered plasma activity levels of these factors could play a role in the increase in high density lipoprotein (HDL)

  12. Randomized placebo-controlled intervention with n-3 LC-PUFA-supplemented yoghurt: effects on circulating eicosanoids and cardiovascular risk factors. (United States)

    Dawczynski, Christine; Massey, Karen A; Ness, Christina; Kiehntopf, Michael; Stepanow, Stefanie; Platzer, Matthias; Grün, Michael; Nicolaou, Anna; Jahreis, Gerhard


    The study examined the value of n-3 LC-PUFA-enriched yogurt as means of improving cardiovascular health. Fifty three mildly hypertriacylglycerolemic subjects (TAG ≥ 1.7 mmol/L) participated in a randomized, placebo-controlled, double-blind, parallel designed study. The subjects consumed 1) control yoghurt; 2) yoghurt enriched with 0.8 g n-3 LC-PUFA/d; or 3) yoghurt enriched with 3 g n-3 LC-PUFA/d for a period of 10 wks. Blood samples were taken at the beginning and the end of the study period. Following daily intake of 3 g n-3 LC-PUFA for 10 weeks, n-3 LC-PUFA levels increased significantly in plasma and red blood cells (RBC) with concomitant increase in the EPA-derived mediators (PGE₃, 12-, 15-, 18-HEPE) in plasma whilst cardiovascular risk factors such as HDL, TAG, AA/EPA ratio, and n-3 index were improved (P LC-PUFA in RBC and plasma lipids due to intake of n-3 LC-PUFA enriched yoghurt resulted in a reduction of cardiovascular risk factors and inflammatory mediators showing that daily consumption of n-3 PUFA enriched yoghurt can be an effective way of supplementing the daily diet and improving cardiovascular health. Crown Copyright © 2013. Published by Elsevier Ltd. All rights reserved.

  13. The role of n-3 LCPUFA in pregnancy

    Directory of Open Access Journals (Sweden)

    Makrides Maria


    Full Text Available The metabolic demand for n-3 long chain polyunsaturated fatty acids (n-3 LCPUFA, particularly docosahexaenoic acid (22: 6 n-3, DHA is increased during pregnancy because of the extra needs of the fetus, expanded maternal cell mass and placenta. However, in Western countries maternal dietary n-3 LCPUFA intake in pregnancy is low and it is not clear whether adaptive metabolic mechanisms, such as increased DHA synthesis from precursor fatty acids, are capable of meeting the increased need in pregnancy. Consequently randomized controlled trials have been important to determine whether additional dietary n-3 LCPUFA in pregnancy modifies pregnancy, maternal and infant health outcomes. Supplementation with at least 1g n-3 LCPUFA per day results in a modest increase in the duration of gestation that may be most evident at the extremes of gestation. Additionally, n-3 LPUFA supplementation of well nourished pregnant women has little benefit in preventing maternal postnatal depression and is unlikely to result in major benefits to the developmental outcomes of young children. Further work in needed to identify the specific ‘‘at risk’’ groups who are most likely to benefit from supplementation.

  14. Palm olein and olive oil cause a higher increase in postprandial lipemia compared with lard but had no effect on plasma glucose, insulin and adipocytokines. (United States)

    Teng, Kim-Tiu; Nagapan, Gowri; Cheng, Hwee Ming; Nesaretnam, Kalanithi


    Postprandial lipemia impairs insulin sensitivity and triggers the pro-inflammatory state which may lead to the progression of cardiovascular diseases. A randomized, crossover single-blind study (n = 10 healthy men) was designed to compare the effects of a high-fat load (50 g fat), rich in palmitic acid from both plant (palm olein) or animal source (lard) versus an oleic acid-rich fat (virgin olive oil) on lipemia, plasma glucose, insulin and adipocytokines. Serum triacylglycerol (TAG) concentrations were significantly lower after the lard meal than after the olive oil and palm olein meals (meal effect P = 0.003; time effect P lipemia compared with palm olein. A high fat load but not the type of fats influences concentrations of plasma IL-1β over time but had no effect on other pro-inflammatory markers tested in the postprandial state.

  15. Schnittke: Symphony N3. Stockholm Philharmonic Orchestra / David J. Fanning

    Index Scriptorium Estoniae

    Fanning, David J.


    Uuest heliplaadist "Schnittke: Symphony N3. Stockholm Philharmonic Orchestra, Eri Klas. BIS/ Conifer CD 477 Schnittke: Concerto Grosso N4, Symphony N5. Gothenburg Symphony Orchestra, Neeme Järvi" BIS/ Conifer CD 427

  16. Effect of Different Dietary n-6 to n-3 Fatty Acid Ratios on the Performance and Fatty Acid Composition in Muscles of Broiler Chickens

    Directory of Open Access Journals (Sweden)

    G. P. Mandal


    Full Text Available The objective of this study was to investigate the different dietary ratios of n-6 to n-3 (n-6/n-3 fatty acid (FA on performance and n-6/n-3 FA in muscles of broiler chickens. A total of 300 one-day-old Cobb chicks were randomly assigned to 3 treatments of 10 replicates in each (10 birds/replicate. Birds were fed on a corn-soybean meal-based diet containing 1% oil during starter (day 1 to 21 and 2% oil during finisher (day 22 to 39 phases, respectively. Treatments of high, medium and low dietary n-6/n-3 FA were formulated by replacing rice bran oil with linseed oil to achieve n-6/n-3 FA close to >20:1, 10:1 and 5:1, respectively. Average daily gain, average daily feed intake, and feed conversion ratio were similar (p>0.05 among the treatments. Serum glucose, cholesterol and triglycerides concentrations were not affected (p>0.05 by dietary treatments. In breast, concentration of C18:3n-3 was significantly greater (p = 0.001 for medium and low vs high n-6/n-3 FA, while concentrations of C20:5n-3, C22:6n-3, total n-3 FA, and n-6/n-3 FA were significantly higher for low vs medium, and medium vs high dietary n-6/n-3 FA. In contrast, concentrations of C18:2 and mono-unsaturated FA (MUFA were lower for low vs high dietary n-6/n-3 FA. In thigh muscles, concentrations of C20:5n-3 were higher (p<0.05 for medium and low vs high dietary n-6/n-3 FA, and concentrations of C18:3n-3, C22:6, and n-3 FA were greater (p<0.05 for medium vs high, low vs medium dietary n-6/n-3 FA. However, concentrations of C18:1, MUFA, n-6/n-3 were lower (p<0.05 for low and medium vs high dietary n-6/n-3 FA. In conclusion, lowering the dietary n-6/n-3 FA did not affect the performance of chickens, but enhanced beneficial long-chain n-3 FA and decreased n-6/n-3 FA in chicken breast and thigh, which could be advantageous for obtaining healthy chicken products.

  17. N-3 polyunsaturated fatty acids do not affect the cytokine response to strenuous exercise

    DEFF Research Database (Denmark)

    Toft, A.D.; Thorn, Mette; Ostrowski, Kenneth


    -supplemented and the control group, showing incorporation of n-3 PUFA and less arachidonic acid in BMNC in the supplemented group. The plasma levels of tumor necrosis factor-alpha, interleukin-6, and transforming growth factor-beta(1) peaked immediately after the run, the increase being 3-, 92-, and 1.1-fold, respectively......, compared with resting samples. The level of interleukin-1 receptor antagonist peaked 1.5 h after exercise, with the increase being 87-fold. However, the cytokine levels did not differ among the two groups. Furthermore, supplementation with fish oil did not influence exercise-induced increases in leucocytes...

  18. Effect of Dietary n-3 Polyunsaturated Fatty Acids on Oxidant/Antioxidant Status in Macrosomic Offspring of Diabetic Rats

    Directory of Open Access Journals (Sweden)

    B. Guermouche


    Full Text Available The aim of this work was to determine the effect of dietary n-3 PUFA on oxidant/antioxidant status, in vitro very low and low density lipoprotein (VLDL-LDL, and VLDL-LDL-fatty acid composition in macrosomic pups of diabetic mothers. We hypothesized that n-3 PUFA would improve oxidative stress in macrosomia. Diabetes was induced in female Wistar rats fed with the ISIO diet (control or with the EPAX diet (enriched in n-3 PUFAs, by streptozotocin. The macrosomic pups were killed at birth (day 0 and at adulthood (day 90. Lipid parameters and VLDL-LDL-fatty acid composition were investigated. The oxidant/antioxidant status was determined by measuring plasma oxygen radical absorbance capacity (ORAC, hydroperoxides, carbonyl proteins, and VLDL-LDL oxidation. Macrosomic rats of ISIO fed diabetic mothers showed an increase in plasma and VLDL-LDL-triglycerides and VLDL-LDL-cholesterol levels and altered VLDL-LDL-fatty acid composition. Plasma ORAC was low with high hydroperoxide and carbonyl protein levels. The in vitro oxidizability of VLDL-LDL was enhanced in these macrosomic rats. The EPAX diet corrected lipid parameters and improved oxidant/antioxidant status but increased VLDL-LDL susceptibility to oxidation. Macrosomia is associated with lipid abnormalities and oxidative stress. n-3 PUFA exerts favorable effects on lipid metabolism and on the oxidant/antioxidant status of macrosomic rats. However, there are no evident effects on VLDL-LDL oxidation.

  19. Adrenal Chromaffin Cells Exposed to 5-ns Pulses Require Higher Electric Fields to Porate Intracellular Membranes than the Plasma Membrane: An Experimental and Modeling Study. (United States)

    Zaklit, Josette; Craviso, Gale L; Leblanc, Normand; Yang, Lisha; Vernier, P Thomas; Chatterjee, Indira


    Nanosecond-duration electric pulses (NEPs) can permeabilize the endoplasmic reticulum (ER), causing release of Ca 2+ into the cytoplasm. This study used experimentation coupled with numerical modeling to understand the lack of Ca 2+ mobilization from Ca 2+ -storing organelles in catecholamine-secreting adrenal chromaffin cells exposed to 5-ns pulses. Fluorescence imaging determined a threshold electric (E) field of 8 MV/m for mobilizing intracellular Ca 2+ whereas whole-cell recordings of membrane conductance determined a threshold E-field of 3 MV/m for causing plasma membrane permeabilization. In contrast, a 2D numerical model of a chromaffin cell, which was constructed with internal structures representing a nucleus, mitochondrion, ER, and secretory granule, predicted that exposing the cell to the same 5-ns pulse electroporated the plasma and ER membranes at the same E-field amplitude, 3-4 MV/m. Agreement of the numerical simulations with the experimental results was obtained only when the ER interior conductivity was 30-fold lower than that of the cytoplasm and the ER membrane permittivity was twice that of the plasma membrane. A more realistic intracellular geometry for chromaffin cells in which structures representing multiple secretory granules and an ER showed slight differences in the thresholds necessary to porate the membranes of the secretory granules. We conclude that more sophisticated cell models together with knowledge of accurate dielectric properties are needed to understand the effects of NEPs on intracellular membranes in chromaffin cells, information that will be important for elucidating how NEPs porate organelle membranes in other cell types having a similarly complex cytoplasmic ultrastructure.

  20. Does continuous endurance exercise in water elicit a higher release of ANP and BNP and a higher plasma concentration of FFAs in pre-obese and obese men than high intensity intermittent endurance exercise? - study protocol for a randomized controlled trial. (United States)

    Karner-Rezek, Klaus; Knechtle, Beat; Fenzl, Matthias; Gredig, Joeri; Rosemann, Thomas


    Atrial natriuretic peptides (ANP) and Brain natriuretic peptides (BNP) stimulate fat cell plasma membrane receptors. They are potent lipolytic agents on isolated fat cells from subcutaneous adipose tissue. The physiological effects of continuous endurance exercise on ANP release and plasma free fatty acids (FFA) concentrations have been well described. The enhancement of fat metabolism using high intensity intermittent exercise protocols has been assessed in more recent investigations. The combined effects of endurance exercise and water immersion on ANP and FFA plasma concentration and the magnitude of excess post-exercise oxygen consumption (EPOC) might be further enhanced by choosing the most effective exercise protocol. Exercise modalities may play a significant role in the future prevention and treatment of obesity. The two testing trials will be performed according to a randomized and cross-over design. Twenty healthy sedentary pre-obese and obese class-1 men will be scrutinized with regard to their metabolic responses to continuous exercise in water and to high intensity endurance exercise in water. Both trials will be matched for energy expenditure. After preliminary testing, the tests will be conducted as repeated measurements. The two different exercise protocols will be compared. The aims of the study are to investigate (1) whether continuous endurance exercise or high intensity intermittent endurance exercise in water elicits both a higher release of ANP and BNP and a higher plasma concentration of glycerol and (2) to determine whether continuous endurance exercise in water or a high intensity intermittent endurance exercise in water would lead to a more pronounced short term (two hours) EPOC effect. If our hypothesis would be confirmed, the most effective exercise protocol based on the combined effects of high intensity endurance exercise and water immersion on ANP and BNP release and glycerol plasma concentrations can be identified. Moreover, the

  1. An N+3 Technology Level Reference Propulsion System (United States)

    Jones, Scott M.; Haller, William J.; Tong, Michael To-Hing


    An N+3 technology level engine, suitable as a propulsion system for an advanced single-aisle transport, was developed as a reference cycle for use in technology assessment and decision-making efforts. This reference engine serves three main purposes: it provides thermodynamic quantities at each major engine station, it provides overall propulsion system performance data for vehicle designers to use in their analyses, and it can be used for comparison against other proposed N+3 technology-level propulsion systems on an equal basis. This reference cycle is meant to represent the expected capability of gas turbine engines in the N+3 timeframe given reasonable extrapolations of technology improvements and the ability to take full advantage of those improvements.

  2. M2-Branes in N = 3 Harmonic Superspace

    Directory of Open Access Journals (Sweden)

    E. Ivanov


    Full Text Available We give a brief account of the recently proposed N = 3 superfield formulation of the N = 6, 3D superconformal theory of Aharony et al (ABJM describing a low-energy limit of the system of multiple M2-branes on the AdS4×S7/Zk background. This formulation is given in harmonic N = 3 superspace and reveals a number of surprising new features. In particular, the sextic scalar potential of ABJM arises at the on-shell component level as the result of eliminating appropriate auxiliary fields, while there is no explicit superpotential at the off-shell superfield level.

  3. n-3 PUFAs in cancer, surgery, and critical care: a systematic review on clinical effects, incorporation, and washout of oral or enteral compared with parenteral supplementation. (United States)

    van der Meij, Barbara S; van Bokhorst-de van der Schueren, Marian A E; Langius, Jacqueline A E; Brouwer, Ingeborg A; van Leeuwen, Paul A M


    n-3 (omega-3) Fatty acids (FAs) may have beneficial effects in patients with cancer or in patients who undergo surgery or critical care. Our aim was to systematically review the effects of oral or enteral and parenteral n-3 FA supplementation on clinical outcomes and to describe the incorporation of n-3 FAs into phospholipids of plasma, blood cells, and mucosal tissue and the subsequent washout in these patients. We investigated the supplementation of n-3 FAs in these patients by using a systematic literature review. In cancer, the oral or enteral supplementation of n-3 FAs contributed to the maintenance of body weight and quality of life but not to survival. We did not find any studies on parenteral supplementation of n-3 FAs in cancer. In surgical oncology, we did not find any studies on enteral supplementation of n-3 FAs. However, postoperative parenteral supplementation in surgical oncology may reduce the length of a hospital stay. For general surgery, we did not find any studies on enteral supplementation of n-3 FAs, and evidence on parenteral supplementation was insufficient. In critical care, enteral supplementation of n-3 FAs had beneficial effects on clinical outcomes; evidence on parenteral supplementation in critical care was inconsistent. The incorporation of n-3 FAs in plasma and blood cells was slower with enteral supplementation (4-7 d) than with parenteral supplementation (1-3 d). The washout was 5-7 d. This review shows the beneficial effects of n-3 FA supplementation in cancer, surgical oncology, and critical care patients. Supplementation in these specific patient populations could be considered with the route of administration taken into account.

  4. Early behavior and development are influenced by the n-6 and n-3 status in prematures*

    Directory of Open Access Journals (Sweden)

    Strandvik Birgitta


    Full Text Available In a cohort of premature infants, consecutively included in the study at birth and followed to 18 months of age, the neonatal status of essential fatty acids and longchain polyunsaturated fatty acids (LCPUFA were investigated and correlated to the development at 40 and 44 weeks gestational age and at 3, 6, 10 and 18 months corrected age. The diet reported by the mothers contained low EFA, 98% had an intake < 1 energy% of n-3 fatty acids. Fatty acid analyses were performed in early breast milk and in mothers’ and infants’ plasma phospholipids early after birth and at gestational age 40 and 44 weeks. The development of the infants were assessed with Brazelton Neonatal Behavioral Assessment Scale (BNBAS at 40 and 44 weeks and with Bayley’s Scales of Infant Development (Second Edition (BSID-II at 3, 6, 10 and 18 months corrected age. At 40 weeks and 3 months videotapes were made of the infants’ spontaneous motor behavior to assess the quality of their general movements. Adjustments for confounding background factors were made in multiple logistic regression analyses and mothers’ education had the highest impact of the background variables. At all ages tested the n-6 fatty acid concentrations, expressed as total concentrations, LA, AA or as ratios to n-3 fatty acids in breast milk and early plasma phospholipids were negatively associated with development. Positive associations with LCPUFA, especially DHA, were mainly found after 10 months of age. Both mental and motor developments had similar pattern of associations, fatty acid concentrations and background factors explaining 20-50% (R2 of the developmental scores. This was only an observational study, and it cannot be excluded that the highly negative influence of n- 6 fatty acids was an effect of the low intake of n-3 fatty acids, which in the context of the changes generally seen in Western diet imply urgent need for larger studies.

  5. Effects of the n-6/n-3 polyunsaturated fatty acids ratio on postprandial metabolism in hypertriacylglycerolemia patients (United States)


    Background Atherosclerosis is a postprandial phenomenon. The balanced n-6/n-3 PUFA ratio contributing to the prevention of atherosclerosis has been well shown, but the effect of the ratio on postprandial metabolism has not been fully investigated. The aim of this study was to investigate the effects of the n-6/n-3 PUFAs ratio on postprandial metabolism in hypertriacylglycerolemia patients, comparing them to healthy controls. Methods Test meals with 0.97 (high n-3) and 8.80 (low n-3) n-6/n-3 PUFAs ratio were administered in a randomized crossover design to 8 healthy and 8 hypertriacylglycerolemia subjects. Blood samples were collected for 8 hours after meals to measure triglyceride (TG), total cholesterol (TC), HDL, ApoA, ApoB, glucose, insulin, inflammatory makers including tumor necrosis factor alpha (TNF-α) and interleukin-6 (IL-6), endothelial function including nitric oxide (NO) and endothelin-1 (ET-1). Results According to repeated–measures ANOVA, the postprandial response of lipid, glucose, insulin, inflammation and endothelial function were not significantly different between meals. The postprandial TG and NO response were significantly different between healthy control (HC) and hypertriglyceridemia group (HTG) after both meals (P HTG group than HC group, the difference was significant after low n-3 meal but not after high n-3 meal. The concentration of glucose, insulin, IL-6, TNFα and ET-1 at each time point was higher and NO was lower in HTG group, but the maximal change and iAUC had no significant difference except for iAUC of insulin, IL-6 and diAUC of NO after low n-3 meal. Conclusions The ratio of n-6 and n-3 maybe do not acutely influence the postprandial metabolism, inflammatory response and endothelial function, but the low n-3 meal can strengthen the difference between HTG and HC group. PMID:24325472

  6. Threshold resummation at N3LL accuracy and soft-virtual cross sections at N3LO

    Directory of Open Access Journals (Sweden)

    Stefano Catani


    Full Text Available We consider QCD radiative corrections to the production of colorless high-mass systems in hadron collisions. We show that the recent computation of the soft-virtual corrections to Higgs boson production at N3LO [1] together with the universality structure of soft-gluon emission can be exploited to extract the general expression of the hard-virtual coefficient that contributes to threshold resummation at N3LL accuracy. The hard-virtual coefficient is directly related to the process-dependent virtual amplitude through a universal (process-independent factorization formula that we explicitly evaluate up to three-loop order. As an application, we present the explicit expression of the soft-virtual N3LO corrections for the production of an arbitrary colorless system. In the case of the Drell–Yan process, we confirm the recent result of Ref. [2].

  7. Echium oil: A valuable source of n-3 and n-6 fatty acids

    Directory of Open Access Journals (Sweden)

    MIR Miquel


    Full Text Available Echium oil is a vegetable oil of non-GMO plant origin extracted from the seeds of Echium plantagineum containing significant amounts of omega-3 fatty acid Stearidonic Acid (SDA and omega-6 acid γ-linolenic acid (GLA. Typical fatty acid composition of Echium oil is: Oleic acid (18:1 n-9 16%, Linoleic acid (LA, 18:2 n-6 19%, γ-linolenic acid (GLA, 18:3 n-610%, α-linolenic acid (ALA, 18:3 n-3 30% and Stearidonic acid (SDA, 18:4 n-3 13%. This natural ratio of fatty acids, trough their metabolism, deliver enhanced plasma concentrations of eicosapentaenoic (EPA, 20:5 n-3, docosapentaenoic (DPA, 22:5 n-3 and dihomo-γ-linolenic (DGLA, 20:3 n-6 acids without increasing the concentrations of arachidonic acid (AA, 20:4 n-6. GLA is commonly associated with the anti-inflammatory effects of oils such as evening primrose oil and borage oil. Supplementation with GLA can markedly increase serum AA with subsequent pro-inflammatory effects. The presence of stearidonic acid in echium oil prevents the accumulation of serum AA and AA-derived eicosanoids without preventing the accumulation of DGLA which is the real n-6 precursor of anti-inflammatory eicosanoids. SDA is an intermediate in the biosynthetic conversion of ALA to EPA. As SDA is the product of the rate-limiting ∆6-desaturase step and due the efficiency of the elongase and ∆5-desaturase steps, SDA is readily converted to EPA. SDA has the physiologic benefits of EPA, for instance, lowering the serum triglycerides in hypertriglyceridemic subjects. Therefore echium oil is a true alternative for vegetarians or those who do not eat fish, to benefit from the anti-inflammatory effects of omega-3 and omega-6 long chain polyunsaturated fatty acids.

  8. Attitude estimation of the Delfi-n3Xt satellite

    NARCIS (Netherlands)

    Choukroun, D.; Maas, A.; Kuiper, J.M.


    This paper presents current developments of the attitude determination algorithm for Del¦-n3Xt, TU Delft next nanosatellite. Several novel quaternion filters using Sun vector and Earth magnetic field measurements and rate gyro outputs are presented. The quaternion measurement matrix associated with

  9. [N-3 polyunsaturated fatty acid in cardiovascular disease]. (United States)

    Cybulska, Idalia


    The role of polyunsaturated n-3 fatty acids in prevention of many diseases, especially cardiovascular diseases, is becoming more and more important. In the article most important, selected by the author, studies on their legitimacy of application in prevention of coronary heart disease, sudden death and general cardio-protection are presented.

  10. Antiatherogenic effects of n-3 fatty acids - evidence and mechanisms

    Directory of Open Access Journals (Sweden)

    Antonella Zampolli


    Full Text Available N-3 (omega-3 (polyunsaturated fatty acids are thought to display a variety of beneficial effects for human health. Clues to the occurrence of cardiovascular protective effects have been, however, the spur for the first biomedical interest in these compounds, and are the best documented. Historically, the epidemiologic association between dietary consumption of n-3 fatty acids and cardiovascular protection was first suggested by Bang and Dyerberg, who identified the high consumption of fish, and therefore, of fish oil-derived n-3 fatty acids, as the likely explanation for the strikingly low rate of coronary heart disease events reported in the Inuit population. Since their initial reports, research has proceeded in parallel to provide further evidence for their cardioprotection and to understand underlying mechanisms. Decreased atherogenesis is currently thought to be a part of the cardiovascular protection by n-3 fatty acids. This article summarizes the evidence for such a claim and the mechanisms putatively involved. (Heart International 2006; 3-4: 141-54

  11. Radiation from an electron beam in magnetized plasma: excitation of a whistler mode wave packet by interacting, higher-frequency, electrostatic-wave eigenmodes (United States)

    Brenning, N.; Axnäs, I.; Koepke, M.; Raadu, M. A.; Tennfors, E.


    Infrequent, bursty, electromagnetic, whistler-mode wave packets, excited spontaneously in the laboratory by an electron beam from a hot cathode, appear transiently, each with a time duration τ around ∼1 μs. The wave packets have a center frequency f W that is broadly distributed in the range 7 MHz electrostatic (es) plasma oscillations at values of f hf, 200 MHz < f hf < 500 MHz, that are hypothesized to match eigenmode frequencies of an axially localized hf es field in a well-defined region attached to the cathode. Features of these es-eigenmodes that are studied include: the mode competition at times of transitions from one dominating es-eigenmode to another, the amplitude and spectral distribution of simultaneously occurring es-eigenmodes that do not lead to a transition, and the correlation of these features with the excitation of whistler mode waves. It is concluded that transient coupling of es-eigenmode pairs at f hf such that | {{{f}}}1,{{h}{{f}}}-{{{f}}}2,{{h}{{f}}}| = {f}{{W}}< {f}{{g}{{e}}} can explain both the transient lifetime and the frequency spectra of the whistler-mode wave packets (f W) as observed in lab. The generalization of the results to bursty whistler-mode excitation in space from electron beams, created on the high potential side of double layers, is discussed.

  12. The effects of n-3 long-chain polyunsaturated fatty acids on bone formation and growth factors in adolescent boys

    DEFF Research Database (Denmark)

    Damsgaard, C. T.; Mølgaard, C.; Gyldenløve, S. N.


    with docosahexaenoic acid (DHA) status and (ii) affected by fish oil supplementation, in adolescent boys. METHODS: Seventy-eight healthy, slightly overweight 13- to 15-y-old boys were randomly assigned to breads with DHA-rich fish oil (1.1 g/d n-3 LCPUFA) or control for 16 wk. Whole-body bone mineral content (BMC......), bone area (BA), bone mineral density (BMD), plasma osteocalcin, and growth factors were measured at wk 0 and wk 16, as well as diet, physical activity, and n-3 LCPUFA status in erythrocytes. RESULTS: Fish oil strongly increased DHA status (P = 0.0001). No associations were found between DHA status...... and BMC, BA, BMD, or the markers of bone formation and growth at baseline. Furthermore, the fish oil intervention did not affect any of the outcomes as compared with control. However, dose-response analyses revealed a positive association between changes in DHA status and plasma insulin-like growth factor...

  13. Very long-chain n-3 fatty acids and human health: fact, fiction and the future. (United States)

    Calder, P C


    EPA and DHA appear to be the most important n-3 fatty acids, but roles for n-3 docosapentaenoic acid are now also emerging. Intakes of EPA and DHA are usually low, typically below those recommended. Increased intakes result in higher concentrations of EPA and DHA in blood lipids, cells and tissues. Increased content of EPA and DHA modifies the structure of cell membranes and the function of membrane proteins. EPA and DHA modulate the production of lipid mediators and through effects on cell signalling can alter the patterns of gene expression. Through these mechanisms, EPA and DHA alter cell and tissue responsiveness in a way that often results in more optimal conditions for growth, development and maintenance of health. DHA has vital roles in brain and eye development and function. EPA and DHA have a wide range of physiological roles, which are linked to certain health or clinical benefits, particularly related to CVD, cancer, inflammation and neurocognitive function. The benefits of EPA and DHA are evident throughout the life course. Future research will include better identification of the determinants of variation of responses to increased intake of EPA and DHA; more in-depth dose-response studies of the effects of EPA and DHA; clearer identification of the specific roles of EPA, docosapentaenoic acid and DHA; testing strategies to enhance delivery of n-3 fatty acids to the bloodstream; and exploration of sustainable alternatives to fish-derived very long-chain n-3 fatty acids.

  14. DHA-rich n-3 fatty acid supplementation decreases DNA methylation in blood leukocytes: the OmegAD study. (United States)

    Karimi, Mohsen; Vedin, Inger; Freund Levi, Yvonne; Basun, Hans; Faxén Irving, Gerd; Eriksdotter, Maria; Wahlund, Lars-Olof; Schultzberg, Marianne; Hjorth, Erik; Cederholm, Tommy; Palmblad, Jan


    Background: Dietary fish oils, rich in long-chain n-3 (ω-3) fatty acids (FAs) [e.g., docosahexaenoic acid (DHA, 22:6n-3) and eicosapentaenoic acid (EPA, 20:5n-3)], modulate inflammatory reactions through various mechanisms, including gene expression, which is measured as messenger RNA concentration. However, the effects of long-term treatment of humans with DHA and EPA on various epigenetic factors-such as DNA methylation, which controls messenger RNA generation-are poorly described.Objective: We wanted to determine the effects of 6 mo of dietary supplementation with an n-3 FA preparation rich in DHA on global DNA methylation of peripheral blood leukocytes (PBLs) and the relation to plasma EPA and DHA concentrations in Alzheimer disease (AD) patients.Design: In the present study, DNA methylation in four 5'-cytosine-phosphate-guanine-3' (CpG) sites of long interspersed nuclear element-1 repetitive sequences was assessed in a group of 63 patients (30 given the n-3 FA preparation and 33 given placebo) as an estimation of the global DNA methylation in blood cells. Patients originated from the randomized, double-blind, placebo-controlled OmegAD study, in which 174 AD patients received either 1.7 g DHA and 0.6 g EPA (the n-3 FA group) or placebo daily for 6 mo.Results: At 6 mo, the n-3 FA group displayed marked increases in DHA and EPA plasma concentrations (2.6- and 3.5-fold), as well as decreased methylation in 2 out of 4 CpG sites (P DHA concentration, and were not related to apolipoprotein E-4 allele frequency.Conclusion: Supplementation with n-3 FA for 6 mo was associated with global DNA hypomethylation in PBLs. Our data may be of importance in measuring various effects of marine oils, including gene expression, in patients with AD and in other patients taking n-3 FA supplements. This trial was registered at as NCT00211159. © 2017 American Society for Nutrition.

  15. Circadian profiling reveals higher histamine plasma levels and lower diamine oxidase serum activities in 24% of patients with suspected histamine intolerance compared to food allergy and controls. (United States)

    Pinzer, T C; Tietz, E; Waldmann, E; Schink, M; Neurath, M F; Zopf, Y


    Histamine intolerance is thought to trigger manifold clinical symptoms after ingesting histamine-rich food due to reduced activity of diamine oxidase (DAO). No study has hitherto systematically assessed daily fluctuations of histamine levels and DAO activities in symptomatic patients. The aim of the study was to investigate the presence of histamine intolerance, to therefore establish day profiles of histamine levels and DAO activities, and to compare the results between patients with suspected histamine intolerance, food allergy and healthy controls. We determined day profiles of histamine plasma levels and DAO serum activities in 33 patients with suspected histamine intolerance, in 21 patients with proven food allergy and in 10 healthy control patients. Clinical symptoms, food intolerances and further clinical and laboratory chemical parameters were evaluated. Twenty-four percent (8 of 33) suspected histamine-intolerant patients showed elevated histamine levels during the day. That might be caused by constantly and significantly reduced DAO activities in these patients compared to food-allergic and control patients. The remaining 25 patients presented normal histamine levels and DAO activities, but an increased prevalence of multiple food intolerances compared to the other subgroup of suspected histamine-intolerants. There was no correlation between subjective complaints and serological histamine parameters in patients with suspected histamine intolerance. We determined by daily profiling that decreased DAO activities correlated with elevated histamine levels in a subgroup of suspected histamine-intolerants. This finding discriminates these patients from food intolerant individuals with similar clinical symptoms and strongly suggests the presence of histamine intolerance. © 2017 EAACI and John Wiley and Sons A/S. Published by John Wiley and Sons Ltd.

  16. Effect of intakes of n-3 long chain polyunsaturated fatty acids during pregnancy and early childhood оn development, morbidity and immunity of in infants in fist year of life: cross-sectional study

    Directory of Open Access Journals (Sweden)

    Marushko RV


    Full Text Available Background: at present, there are considered the efficient mechanisms existed by which diets high in n-3 LC PUFAs during pregnancy and early childhood may modulate the development of innative immune disorders and promote the adequate formation of immune system both on general and local levels. Early availability of n-3 LC PUFA could contribute to the normal growth and development, decrease risk factors of diseases or pathological disorders in infants. Goals: to assess the relationship between n-3 LC PUFAs intakes during pregnancy and postnatally and development, morbidity and immunity of infants in first year of life. A retrospective study was conducted using interview method of 300 women, whose children reached the age of one year. Elaborated questionnaires were filled in by pediatricians throughout their daily working hours while attending the patients. Was conducted assessment of frequency of common diseases and disorders like respiratory diseases, functional intestinal disorders and atopic diseases. Were investigated immunity of infants assessing the content of IgA, IgG and IgM by immunological methods and detected DHA, EPA (n-3 LC PUFAs and AA (n-6 LC PUFAs by gas chromatographic analysis in blood serum of children. The outcomes of the study were analysed and processed using statistical methods. Retrospective clinical findings indicate on higher incidence of acute respiratory tract and atopic diseases as well as functional disorders of the gastrointestinal tract in infants whose mothers did not use seafood in their diets during the pregnancy and in the lactating period. The research of immunity of children showed no difference in concentration of IgG and IgM in blood serum (p >> 0,05 but significant difference for IgA concentrations in plasma. In infants of n-3 LC PUFAs group IgA concentration was higher compared to opposite group. The fatty acid composition of the blood serum showed changes in the content of the main representatives of n-3

  17. Influence des acides gras polyinsaturés n-3 et des antioxydants alimentaires sur les acides gras de la viande et la lipoperoxydation chez le bovin en finition

    Directory of Open Access Journals (Sweden)

    Bauchart Dominique


    Full Text Available The aim of this study was to analyze, on beef lipids and FA and on beef colour, the impact of extruded linseed (rich in n-3 PUFA given alone or with rapeseed (rich in n-3 and n-6 PUFA and in 18:1 n-9 in association or not with antioxidants given to Normand (fat breed cull cows during the finishing period. Dietary linseeds significantly increased proportions of 18:3 n-3 (+56 and +36 % respectively, total trans 18:1 (+66 and +105 %; and of 9cis, 11trans 18:2 (CLA (+50 and +41 % in LT muscle of which 18:3 n-3 and CLA are known to be beneficial for the human health. Addition of antioxidants (vitamin E plus plant extracts rich in polyphenols, PERP reinforced the stimulating effect of lipid supplements on proportions of the three considered FA (18:3 n-3, total trans 18:1, 9cis, 11trans 18:2 in total lipids of both muscles. Dietary n-3 PUFA reduced the resistance capacity of plasma against lipoperoxidation (–11 % favouring peroxidized products formations such as conjugated dienes (×1.75 and malonedialdehyde (MDA, ×2. Intensity of beef lipoperoxidation (estimated by MDA level tended to be higher in meats packaged under modified atmosphere rich in oxygen (70 % in the linseed group (2.96 μg/g of tissue compared to that of the control group (2.19 μg/g of tissue, P = 0.1. Dietary vitamin E provided with PERP effectively protected beef against lipoperoxidation, even in beef packagings with O2. Beef under air packaging from cows given the linseed supplement had a higher redness value than that from control cows. In the case of animals given lipid supplemented diets and submitted to an emotional stress, beef packaged under air or modified atmosphere rich in O2 had a lower redness than that of the same animals given lipids associated to antioxidant supplements. We concluded that the dietary strategy combining addition of n-3 PUFA and of the antioxidant mixture in diets would avoid major risks of lipoperoxidation and alteration of colour in beef products

  18. Effects of varying levels of n-6:n-3 fatty acid ratio on plasma fatty acid ...

    African Journals Online (AJOL)



    Dec 20, 2010 ... ²Department of Pathology and Microbiology Veterinar, Faculty of Veterinary Medicine, Universiti Putra Malaysia, 43400. UPM Serdang, Selangor, Malaysia. Accepted 5 November, 2010 ...... synthesis and cholesterol metabolism in aging rats. Lipids. 7(9): 576-. 589. Elmes M, Tew P, Cheng Z, Kirkup SE, ...

  19. Overview of the n3He Experiment and Target Chamber (United States)

    McCrea, Mark; n3He Collaboration


    The n3He Experiment aims to measure the parity-violating asymmetry in the direction of proton emission relative to the initial neutron polarization direction in the reaction n-> +3 He -> T + p + 765 keV to a high precision. The size of the asymmetry is estimated to be in the range - 9 . 5 - 2 . 5 ×10-8 , and our goal statistical accuracy is 2 ×10-8 . The experiment ran at the Spallation Neutron Source with data taking completing at the end of 2015. The experiment used a Helium-3 ionization chamber as the combined target and detector. Data analysis is underway and is currently in an advanced stage

  20. Editorial L&E, v.9, n.3, 2015


    Conpadre, Rede


    Editorial L&E, v.9, n.3, 2015 É com imensa satisfação que apresentamos mais um número da revista Labor & Engenho, este, o terceiro do seu nono ano: L&E, v.9, n.3, 2015. Cumprindo fielmente sua missão de difundir a engenharia e a ciência aplicadas ao desenvolvimento local sustentável, valorizando o trabalho (labor) e a inovação (engenho) resultantes da pesquisa acadêmica ou da experiência profissional, este número destaca a importância da gestão de pessoas e da participação da comunidade nos p...

  1. Plasma Based Devices

    National Research Council Canada - National Science Library

    Gundersen, M


    .... Energy-efficient plasma-based technologies, supported through this grant, are now under commercial investigation for pollution abatement, and have potential for reduced emissions, higher efficiencies...

  2. Large N (=3) neutrinos and random matrix theory (United States)

    Bai, Yang; Torroba, Gonzalo


    The large N limit has been successfully applied to QCD, leading to qualitatively correct results even for N = 3. In this work, we propose to treat the number N = 3 of Standard Model generations as a large number. Specifically, we apply this idea to the neutrino anarchy scenario and study neutrino physics using Random Matrix Theory, finding new results in both areas. For neutrino physics, we obtain predictions for the masses and mixing angles as a function of the generation number N. The Seesaw mechanism produces a hierarchy of order 1 /N 3 between the lightest and heaviest neutrino, and a θ 13 mixing angle of order 1 /N, in parametric agreement with experimental data when N goes to 3. For Random Matrix Theory, this motivates the introduction of a new type of ensemble of random matrices, the "Seesaw ensemble." Basic properties of such matrices are studied, including the eigenvalue density and the interpretation as a Coulomb gas system. Besides its mathematical interest, the Seesaw ensemble may be useful in random systems where two hierarchical scales exist.

  3. Cord blood n-3 LC-PUFA is associated with adiponectin concentrations at 10 years of age. (United States)

    Standl, M; Demmelmair, H; Koletzko, B; Heinrich, J


    An elevated ratio of n-6 to n-3 long-chain (LC-) polyunsaturated fatty acids (PUFA) may be a potential risk factor for obesity development. N-3 LC-PUFA are thought to alter adiponectin concentrations, and thus may have a beneficial effect on weight development. We analysed the association between n-3 LC-PUFA concentrations in cord blood and adiponectin concentrations at 10 years. Fatty acid composition was measured in cord blood and at 10 years of age by gas chromatography, and adiponectin concentrations were measured only at 10 years of age in 237 children from the Munich LISAplus birth cohort study. Linear regression models assessed associations between n-3 LC-PUFA, n-6 LC-PUFA and the n-6/n-3 ratio in cord blood with adiponectin concentrations at 10 years of age. LC-PUFA were presented as percentages and categorized into tertiles. Regression models were adjusted for LC-PUFA percentages at 10 years of age and other potential confounding factors. Cord blood n-3 LC-PUFA tertiles were significantly associated with adiponectin concentrations in an inverse J-shaped relationship [2nd tertile versus 1st tertile: Beta=1.84 (SE=0.65), and 3rd tertile versus 1st tertile: 1.02 (0.68), p-valueLC-PUFA tertiles were not associated with adiponectin concentrations. Our results suggest that a higher n-3 LC-PUFA concentrations and a lower n-6/n-3 ratio in cord blood are associated with higher adiponectin concentrations at 10 years of age. Copyright © 2015 The Authors. Published by Elsevier Ltd.. All rights reserved.

  4. Soft Expansion of Double-Real-Virtual Corrections to Higgs Production at N$^3$LO

    CERN Document Server

    Anastasiou, Charalampos; Dulat, Falko; Furlan, Elisabetta; Herzog, Franz; Mistlberger, Bernhard


    We present methods to compute higher orders in the threshold expansion for the one-loop production of a Higgs boson in association with two partons at hadron colliders. This process contributes to the N$^3$LO Higgs production cross section beyond the soft-virtual approximation. We use reverse unitarity to expand the phase-space integrals in the small kinematic parameters and to reduce the coefficients of the expansion to a small set of master integrals. We describe two methods for the calculation of the master integrals. The first was introduced for the calculation of the soft triple-real radiation relevant to N$^3$LO Higgs production. The second uses a particular factorization of the three body phase-space measure and the knowledge of the scaling properties of the integral itself. Our result is presented as a Laurent expansion in the dimensional regulator, although some of the master integrals are computed to all orders in this parameter.

  5. The Expected Cardiovascular Benefit of Plasma Cholesterol Lowering with or Without LDL-C Targets in Healthy Individuals at Higher Cardiovascular Risk

    Directory of Open Access Journals (Sweden)

    Fernando Henpin Yue Cesena

    Full Text Available Abstract Background: There is controversy whether management of blood cholesterol should be based or not on LDL-cholesterol (LDL-c target concentrations. Objectives: To compare the estimated impact of different lipid-lowering strategies, based or not on LDL-c targets, on the risk of major cardiovascular events in a population with higher cardiovascular risk. Methods: We included consecutive individuals undergoing a routine health screening in a single center who had a 10-year risk for atherosclerotic cardiovascular disease (ASCVD ≥ 7.5% (pooled cohort equations, ACC/AHA, 2013. For each individual, we simulated two strategies based on LDL-c target (≤ 100 mg/dL [Starget-100] or ≤ 70 mg/dL [Starget-70] and two strategies based on percent LDL-c reduction (30% [S30%] or 50% [S50%]. Results: In 1,897 subjects (57 ± 7 years, 96% men, 10-year ASCVD risk 13.7 ± 7.1%, LDL-c would be lowered from 141 ± 33 mg/dL to 99 ± 23 mg/dL in S30%, 71 ± 16 mg/dL in S50%, 98 ± 9 mg/dL in Starget-100, and 70 ± 2 mg/dL in Starget-70. Ten-year ASCVD risk would be reduced to 8.8 ± 4.8% in S50% and 8.9 ± 5.2 in Starget-70. The number of major cardiovascular events prevented in 10 years per 1,000 individuals would be 32 in S30%, 31 in Starget-100, 49 in S50%, and 48 in Starget-70. Compared with Starget-70, S50% would prevent more events in the lower LDL-c tertile and fewer events in the higher LDL-c tertile. Conclusions: The more aggressive lipid-lowering approaches simulated in this study, based on LDL-c target or percent reduction, may potentially prevent approximately 50% more hard cardiovascular events in the population compared with the less intensive treatments. Baseline LDL-c determines which strategy (based or not on LDL-c target is more appropriate at the individual level.

  6. Plasma physics an introduction

    CERN Document Server

    Fitzpatrick, Richard


    Plasma Physics: An Introduction is based on a series of university course lectures by a leading name in the field, and thoroughly covers the physics of the fourth state of matter. This book looks at non-relativistic, fully ionized, nondegenerate, quasi-neutral, and weakly coupled plasma. Intended for the student market, the text provides a concise and cohesive introduction to plasma physics theory, and offers a solid foundation for students wishing to take higher level courses in plasma physics.

  7. In male rats with concurrent iron and (n-3) fatty acid deficiency, provision of either iron or (n-3) fatty acids alone alters monoamine metabolism and exacerbates the cognitive deficits associated with combined deficiency. (United States)

    Baumgartner, Jeannine; Smuts, Cornelius M; Malan, Linda; Arnold, Myrtha; Yee, Benjamin K; Bianco, Laura E; Boekschoten, Mark V; Müller, Michael; Langhans, Wolfgang; Hurrell, Richard F; Zimmermann, Michael B


    Concurrent deficiencies of iron (Fe) (ID) and (n-3) fatty acids [(n-3)FAD)] in rats can alter brain monoamine pathways and impair learning and memory. We examined whether repletion with Fe and DHA/EPA, alone and in combination, corrects the deficits in brain monoamine activity (by measuring monoamines and related gene expression) and spatial working and reference memory [by Morris water maze (MWM) testing] associated with deficiency. Using a 2 × 2 design, male rats with concurrent ID and (n-3)FAD [ID+(n-3)FAD] were fed an Fe+DHA/EPA, Fe+(n-3)FAD, ID+DHA/EPA, or ID+(n-3)FAD diet for 5 wk [postnatal d 56-91]. Biochemical measures and MWM performance after repletion were compared to age-matched control rats. The provision of Fe in combination with DHA/EPA synergistically increased Fe concentrations in the olfactory bulb (OB) (Fe x DHA/EPA interaction). Similarly, provision of DHA/EPA in combination with Fe resulted in higher brain DHA concentrations than provision of DHA alone in the frontal cortex (FC) and OB (P FAD affects the DA and 5-HT pathways differently than combined repletion and exacerbates the cognitive deficits associated with combined deficiency.

  8. Dietary long-chain n-3 PUFA, gut microbiota and fat mass in early postnatal piglet development—exploring a potential interplay

    DEFF Research Database (Denmark)

    Andersen, A.D.; Mølbak, Lars; Thymann, T.


    Dietary n-3PUFA and gut bacteria, particularly Bacteroidetes, have been suggested to be related to adiposity. We investigated if n-3PUFA affected fat storage and cecal bacteria in piglets. Twenty-four 4-day-old piglets were allocated to formula rich in n-3PUFA (∼3E%) from fish oil (FO) or n-6PUFA...... from sunflower oil (SO) for 14 days. We assessed body weight, fat accumulation by dual-energy X-ray absorptiometry and microbial molecular fingerprints. Dietary PUFA-composition was reflected in higher erythrocyte n-3PUFA in the FO- than the SO-group (P...

  9. Effects of n-3 polyunsaturated fatty acids on malignant ventricular arrhythmias in patients with chronic heart failure and implantable cardioverter-defibrillators: A substudy of the Gruppo Italiano per lo Studio della Sopravvivenza nell'Insufficienza Cardiaca (GISSI-HF) trial. (United States)

    Finzi, Andrea A; Latini, Roberto; Barlera, Simona; Rossi, Maria G; Ruggeri, Albarosa; Mezzani, Alessandro; Favero, Chiara; Franzosi, Maria G; Serra, Domenico; Lucci, Donata; Bianchini, Francesca; Bernasconi, Roberto; Maggioni, Aldo P; Nicolosi, Gianluigi; Porcu, Maurizio; Tognoni, Gianni; Tavazzi, Luigi; Marchioli, Roberto


    The antiarrhythmic effects of n-3 polyunsaturated fatty acids (n-3PUFA) in ischemic heart disease have been demonstrated; however, studies in patients surviving malignant ventricular arrhythmias of different etiologies treated with an implantable cardioverter-defibrillator (ICD) have given conflicting results. The purpose of this study was to assess the antiarrhythmic effect of n-3PUFA versus placebo in 566 patients with heart failure enrolled in the GISSI-HF trial who received an ICD for secondary or primary prevention of ventricular fibrillation (VF) or tachycardia (VT). Clinical data and arrhythmic event recordings extracted from the device memory were obtained. We tested the treatment effect by a multivariate Cox model adjusting for all clinical parameters associated with the primary end point defined as time to first appropriate ICD discharge for VT/VF. In the 566 patients with at least one recorded follow-up visit, 1363 VT and 316 VF episodes were terminated by ICD pacing or shock over a median follow-up of 928 days. The incidence of the primary end point event was 27.3% in the n-3PUFA group and 34.0% in the placebo group (adjusted hazard rate = 0.80, 95% CI 0.59-1.09, P = .152). Patients who received 1, 2 to 3, or >3 ICD discharges were 8.9%, 7.1%, and 11.1% in the n-3PUFA group, compared with slightly higher rates of 11.1%, 10.7%, and 12.1% in the placebo group (overall P = .30). Patients with the highest 3-month increase in plasma n-3PUFA had a somewhat lower incidence of arrhythmic events. The results of this study, though not statistically significant, support prior evidences of an antiarrhythmic effect of n-3PUFA in patients with ICD, although they leave open the issue of whether this effect leads to a survival benefit. Copyright © 2011 Mosby, Inc. All rights reserved.

  10. The Expected Cardiovascular Benefit of Plasma Cholesterol Lowering with or Without LDL-C Targets in Healthy Individuals at Higher Cardiovascular Risk. (United States)

    Cesena, Fernando Henpin Yue; Laurinavicius, Antonio Gabriele; Valente, Viviane A; Conceição, Raquel D; Santos, Raul D; Bittencourt, Marcio S


    There is controversy whether management of blood cholesterol should be based or not on LDL-cholesterol (LDL-c) target concentrations. To compare the estimated impact of different lipid-lowering strategies, based or not on LDL-c targets, on the risk of major cardiovascular events in a population with higher cardiovascular risk. We included consecutive individuals undergoing a routine health screening in a single center who had a 10-year risk for atherosclerotic cardiovascular disease (ASCVD) ≥ 7.5% (pooled cohort equations, ACC/AHA, 2013). For each individual, we simulated two strategies based on LDL-c target (≤ 100 mg/dL [Starget-100] or ≤ 70 mg/dL [Starget-70]) and two strategies based on percent LDL-c reduction (30% [S30%] or 50% [S50%]). In 1,897 subjects (57 ± 7 years, 96% men, 10-year ASCVD risk 13.7 ± 7.1%), LDL-c would be lowered from 141 ± 33 mg/dL to 99 ± 23 mg/dL in S30%, 71 ± 16 mg/dL in S50%, 98 ± 9 mg/dL in Starget-100, and 70 ± 2 mg/dL in Starget-70. Ten-year ASCVD risk would be reduced to 8.8 ± 4.8% in S50% and 8.9 ± 5.2 in Starget-70. The number of major cardiovascular events prevented in 10 years per 1,000 individuals would be 32 in S30%, 31 in Starget-100, 49 in S50%, and 48 in Starget-70. Compared with Starget-70, S50% would prevent more events in the lower LDL-c tertile and fewer events in the higher LDL-c tertile. The more aggressive lipid-lowering approaches simulated in this study, based on LDL-c target or percent reduction, may potentially prevent approximately 50% more hard cardiovascular events in the population compared with the less intensive treatments. Baseline LDL-c determines which strategy (based or not on LDL-c target) is more appropriate at the individual level. Há controvérsias sobre se o controle do colesterol plasmático deve ou não se basear em metas de concentração de colesterol LDL (LDL-c). Comparar o impacto estimado de diferentes estratégias hipolipemiantes, baseadas ou não em metas de LDL-c, sobre o


    Directory of Open Access Journals (Sweden)

    Miljenko Ernoić


    Full Text Available The objective of the research was to find out which combinations of oils give a desirable effect on n-3 PUFA content modification and total values increase in pigs’ meat without negative effects on fattening characteristics and carcass and meat quality of. The standard daily fattening pigs’ diet was supplemented with combinations of fish, linseed and rapeseed oils. The control group (A received 3% of animal (pork fat in their diet while 4 experimental groups received the following oil combinations: fish oil 0.5% + rapeseed oil 2.5% (B; fish oil 0.5% + linseed oil 2.5% (C; fish oil 1.0% + rapeseed oil 2.0% (D, and fish oil 1.0% + linseed oil 2.0% (E. The experiment was carried out in the last 4 weeks of fattening. A random sample of 50 pigs (Duroc x Swedish Landrace x Pietrain was divided into 5 groups with 10 pigs each of the equal ratio of both sexes. The results showed that the treatment and the sex statistically did not significantly influence daily gains whereas the interaction of the treatment and the sex did have a significant influence (p0.05 between the content of DHA in MLD in treatments A, B, and C. Increasing the content of fish oil in meals from 0.5% to 1% (treatments D and E produced a statistically significant increase of the DHA content compared to other groups (A, B, and C. The supplement of rapeseed oil (2% and fish oil (1% in pigs’ meals (treatment D influenced significantly higher disposal of n-3 PUFA in MLD compared to pigs fed with the supplement of 3% animal fat (treatment A. The ratio n-6/n-3 PUFA u MLD was statistically highly influenced (p<0.001 by the feeding treatment. The n-6/n-3 PUFA ratio ranged from 4.65:1 (barrows in treatment C to 20.14:1 (barrows in treatment A. The best n-6/n-3 PUFA ratio was observed in fattening pigs of both sexes from treatment C (5.00:1. Fattening pigs fed the combination of linseed oil and fish oil (treatments C and E had a better n-6/n-3 PUFA ratio in MLD (p<0.05, 5.00:1 and 6

  12. Fifteen weeks of dietary n-3 polyunsaturated fatty acid deprivation increases turnover of n-6 docosapentaenoic acid in rat-brain phospholipids (United States)

    Igarashi, Miki; Kim, Hyung-Wook; Gao, Fei; Chang, Lisa; Ma, Kaizong; Rapoport, Stanley I.


    Docosapentaenoic acid (DPAn-6, 22:5n-6) is an n-6 polyunsaturated fatty acid (PUFA) whose brain concentration can be increased in rodents by dietary n-3 PUFA deficiency, which may contribute to their behavioral dysfunction. We used our in vivo intravenous infusion method to see if brain DPAn-6 turnover and metabolism also were altered with deprivation. We studied male rats that had been fed for 15 weeks post-weaning an n-3 PUFA adequate diet containing 4.6% alpha-linolenic acid (α-LNA, 18:3n-3) or a deficient diet (0.2% α-LNA), each lacking docosahexaenoic acid (22:6n-3) and arachidonic acid (AA, 20:4n-6). [1-14C]DPAn-6 was infused intravenously for 5 min in unanesthetized rats, after which the brain underwent high-energy microwaving, and then was analyzed. The n-3 PUFA deficient compared with adequate diet increased DPAn-6 and decreased DHA concentrations in plasma and brain, while minimally changing brain AA concentration. Incorporation rates of unesterified DPAn-6 from plasma into individual brain phospholipids were increased 5.2–7.7 fold, while turnover rates were increased 2.1–4.7 fold. The observations suggest that increased metabolism and brain concentrations of DPAn-6 and its metabolites, together with a reduced brain DHA concentration, contribute to behavioral and functional abnormalities reported with dietary n-3 PUFA deprivation in rodents. PMID:22142872

  13. Changes in cholesterol homeostasis modify the response of F1B hamsters to dietary very long chain n-3 and n-6 polyunsaturated fatty acids (United States)

    The plasma lipoprotein response of F1B Golden-Syrian hamsters fed diets high in very long chain (VLC) n-3 PUFA is paradoxical to that observed in humans. This anomaly is attributed, in part, to low lipoprotein lipase activity and dependent on cholesterol status. To further elucidate the mechanism(...

  14. Intake of Fish and Omega-3 (n-3) Fatty Acids: Effect on Humans During Actual and Simulated Weightlessness (United States)

    Smith, S. M.; Pierson, D. L.; Mehta, S. K.; Zwart, S. R.


    Space flight has many negative effects on human physiology, including bone and muscle loss. Bone and muscle are two systems that are positively affected by dietary intake of fish and n-3 fatty acids. The mechanism is likely to be related to inhibition by n-3 fatty acids of inflammatory cytokines (such as TNF) and thus inhibition of downstream NF-kB activation. We have documented this effect in a 3-dimensional cell culture model, where NF-kB activation in osteoclasts was inhibited by eicosapentaenoic acid, an n-3 fatty acid. We have also indentified that NF-kB activation in peripheral blood mononuclear cells of Space Shuttle crews. We found that after Shuttle flights of 2 wk, expression of the protein p65 (evidence of NF-kB activation) was increased at landing (P less than 0.001). When evaluating the effects of n-3 fatty acid intake on bone breakdown after 60 d of bed rest (a weightlessness analog). We found that after 60 d of bed rest, greater intake of n-3 fatty acids was associated with less N-telopeptide excretion (Pearson r = -0.62, P less than 0.05). We also evaluated the relationship of fish intake and bone loss in astronauts after 4 to 6 mo missions on the International Space Station. Higher consumption of fish during flight was associated with higher bone mineral density (Pearson r = 0.46, P less than 0.05). Together, these findings provide evidence of the cellular mechanism by which n-3 fatty acids can inhibit bone loss, and preliminary human evidence of the potential for n-3 fatty acids to counteract bone loss associated with space flight. This study was supported by the NASA Human Research Program.

  15. Ratio of Dietary n-6/n-3 Polyunsaturated Fatty Acids Independently Related to Muscle Mass Decline in Hemodialysis Patients.

    Directory of Open Access Journals (Sweden)

    Te-Chih Wong

    Full Text Available n-3 polyunsaturated fatty acids (PUFAs might be useful nutritional strategy for treating patients with sarcopenia. We evaluated the effect of the intake of dietary n-3 PUFAs on the skeletal muscle mass (SMM, appendicular skeletal muscle mass (ASM, and its determinants in patients receiving standard hemodialysis (HD treatment for the management of end stage renal disease.In this cross-sectional study, data of 111 HD patients were analyzed. Anthropometric and bioelectrical impedance measurements used to estimate the muscle mass were performed the day of dialysis immediately after the dialysis session. Routine laboratory and 3-day dietary data were also collected. The cutoff value of adequate intake (AI for both n-3 PUFAs and alpha-linolenic acid (ALA was 1.6 g/day and 1.1 g/day for men and women, respectively.The mean age, mean dietary n-3 PUFAs intake, ALA intake, ratio of n-6/n-3 PUFAs intake, SMM, and ASM of patients were 61.4 ± 10.4 years, 2.0 ± 1.3 g/day, 1.5 ± 1.0 g/day, 9.5 ± 6.7 g/day, 23.9 ± 5.5 kg, and 17.5 ± 4.5 kg, respectively. A higher SMM and ASM significantly observed in patients who achieved an AI of n-3 PUFAs. Similar trends appeared to be observed among those patients who achieved the AI of ALA, but the difference was not significantly, except for ASM (P = 0.047. No relevant differences in demographics, laboratory and nutritional parameters were observed, regardless of whether the patients achieved an AI of n-3 PUFAs. Multivariate analysis showed that the BMI and equilibrated Kt/V were independent determinants of the muscle mass. Moreover, the ratio of n-6/n-3 PUFAs was an independent risk determinant of reduced ASM in HD patients.Patients with an AI of n-3 PUFAs had better total-body SMM and ASM. A higher dietary ratio of n-6/n-3 PUFAs seemed to be associated with a reduced muscle mass in HD patients.

  16. Hepatic n-3 polyunsaturated fatty acid depletion promotes steatosis and insulin resistance in mice: genomic analysis of cellular targets.

    Directory of Open Access Journals (Sweden)

    Barbara D Pachikian

    Full Text Available Patients with non-alcoholic fatty liver disease are characterised by a decreased n-3/n-6 polyunsaturated fatty acid (PUFA ratio in hepatic phospholipids. The metabolic consequences of n-3 PUFA depletion in the liver are poorly understood. We have reproduced a drastic drop in n-3 PUFA among hepatic phospholipids by feeding C57Bl/6J mice for 3 months with an n-3 PUFA depleted diet (DEF versus a control diet (CT, which only differed in the PUFA content. DEF mice exhibited hepatic insulin resistance (assessed by euglycemic-hyperinsulinemic clamp and steatosis that was associated with a decrease in fatty acid oxidation and occurred despite a higher capacity for triglyceride secretion. Microarray and qPCR analysis of the liver tissue revealed higher expression of all the enzymes involved in lipogenesis in DEF mice compared to CT mice, as well as increased expression and activation of sterol regulatory element binding protein-1c (SREBP-1c. Our data suggest that the activation of the liver X receptor pathway is involved in the overexpression of SREBP-1c, and this phenomenon cannot be attributed to insulin or to endoplasmic reticulum stress responses. In conclusion, n-3 PUFA depletion in liver phospholipids leads to activation of SREBP-1c and lipogenesis, which contributes to hepatic steatosis.

  17. C-reactive protein, dietary n-3 fatty acids, and the extent of coronary artery disease

    DEFF Research Database (Denmark)

    Madsen, Trine; Skou, Helle Aarup; Hansen, Vibeke Ellegaard


    The acute-phase reactant C-reactive protein (CRP) has emerged as an independent risk factor for coronary artery disease. Experimental and clinical studies provide evidence of anti-inflammatory effects of n-3 polyunsaturated fatty acids (PUFA) derived from fish. We have studied the effect of marine...... vessels. Subjects with CRP levels in the lower quartile had a significantly higher content of docosahexaenoic acid (DHA) in granulocytes than subjects with CRP levels in the upper quartile (p=0.02), and in a multivariate linear regression analysis, DHA was independently correlated to CRP (R-2=0.179; p=0...

  18. Influence of Omega-3 (N3 Index on Performance and Wellbeing in Young Adults after Heavy Eccentric Exercise

    Directory of Open Access Journals (Sweden)

    Peter Lembke


    Full Text Available A clinical study was undertaken to evaluate the associations between the tissue levels of omega-3 (N3, also known as the Omega-3 Index (N3 Index, on various clinical and quality of life outcomes in healthy young adults after heavy eccentric exercise.. To ensure an adequate number of participants with an elevated N3 index would be available for comparison to those with a lower N3 Index, a subgroup of the study participants received N3 dietary supplementation (2.7 g·d-1 for 30 days prior to the performance of the heavy eccentric exercise. The remaining participants received a placebo supplement for the same 30-day period. After 30 days of supplementation, participants performed an eccentric exercise routine and were then measured at baseline (time 0, 24-, 48-, 72-, and 96 hours respectively on the following outcomes; C-reactive protein (CRP and creatine kinase. Blood lactate levels were analyzed immediately after the exercise. Functional measurements of delayed onset of muscle soreness (DOMS, extension and torque were also analyzed. Quality of life (QOL was measured by the quantitative questionnaire, the Profile of Mood States Questionnaire (POMS. Safety monitoring and analysis of adverse events was continuous throughout the study. Differences as demonstrated by a reduction in pain following eccentric exercise was experienced at both 72 and 96 hour time points in subjects with a higher N3 Index however there were no differences in extension or strength between the two groups. There was a significant difference in blood lactate levels (p = 0.0309 and improved emotional stability, reflected by the POMS questionnaire, in subjects with a higher N3 Index level. There was a statistically significant difference in CRP levels in subjects with a higher N3 Index level at 24 hours and a trend toward significance over 96 hours. There were no significant differences in creatine kinase levels and no reported adverse events. Subjects with a higher Omega-3 (N3

  19. An investigation into driver fatigue on the N3 between Villiers and Warden

    CSIR Research Space (South Africa)

    Venter, Karien


    Full Text Available The N3 Toll Concession (Pty) Ltd (N3TC) manages the 420 km of the N3 Route between Heidelberg (Gauteng) and Cedara (KwaZulu-Natal) on behalf of SANRAL. The N3 Route is described as one of the busiest roads in South Africa linking the port of Durban...

  20. The Decrease of n-3 Fatty Acid Energy Percentage in an Equicaloric Diet Fed to B6C3Fe Mice for Three Generations Elicits Obesity

    Directory of Open Access Journals (Sweden)

    Ingeborg Hanbauer


    Full Text Available Feeding mice, over 3 generations, an equicaloric diet in which α-linolenic acid, the dietary precursor of n-3 polyunsaturated fatty acids, was substituted by linoleic acid, the dietary precursor of n-6 polyunsaturated fatty acids, significantly increased body weight throughout life when compared with standard diet-fed mice. Adipogenesis observed in the low n-3 fatty acid mice was accompanied by a 6-fold upregulation of stearyl-coenzyme A desaturase 1 (Scd1, whose activity is correlated to plasma triglyceride levels. In total liver lipid and phospholipid extracts, the sum of n-3 fatty acids and the individual longer carbon chain acids, eicosapentaenoic acid (20:5n3, docosapentaenoic acid (22:5n3, and docosahexaenoic acid (22:6n3 were significantly decreased whereas arachidonic acid (20:4n6 was significantly increased. In addition, low n-3 fatty acid-fed mice had liver steatosis, heart, and kidney hypertrophy. Hence, reducing dietary α-linolenic acid, from 1.02 energy% to 0.16 energy% combined with raising linoleic acid intake resulted in obesity and had detrimental consequences on organ function.

  1. 2-[N-(3-Amino-4-nitrophenylcarboximidoyl]phenol

    Directory of Open Access Journals (Sweden)

    Gholam Hossein Shahverdizadeh


    Full Text Available The title compound, C13H11N3O3, is essentially planar (r.m.s. for the 19 non-H atoms = 0.031 Å, a conformation stabilized in part by intramolecular O—H...N and N—H...O hydrogen bonds. The configuration about the imine bond [1.2919 (12 Å] is E. The presence of N—H...O(nitro hydrogen bonds leads to the formation of supramolecular tapes in the crystal structure. These are connected into layers by π–π interactions [centroid–centroid distance = 3.6046 (6 Å] occurring between the hydroxy- and amino-substituted benzene rings.

  2. Multiple blocking sets in PG(n,q), n>=3

    DEFF Research Database (Denmark)

    Barat, Janos


    This article discusses minimal s-fold blocking sets B in PG (n, q), q = ph, p prime, q > 661, n > 3, of size |B| > sq + cp q2/3 - (s - 1) (s - 2)/2 (s > min (cp q1/6, q1/4/2)). It is shown that these s-fold blocking sets contain the disjoint union of a collection of s lines and/or Baer subplanes....... To obtain these results, we extend results of Blokhuis–Storme–Szönyi on s-fold blocking sets in PG(2, q) to s-fold blocking sets having points to which a multiplicity is given. Then the results in PG(n, q), n ≥ 3, are obtained using projection arguments. The results of this article also improve results...

  3. Cortometraje de animación 3D


    Alemañ Baeza, Tomás


    Usando técnicas y equipos de cine de animación 3D se realizará un cortometraje de temática libre. Se desarrollará UN CORTO DE ANIMACION en formato de animación digital en un tamaño no inferior a 640 x 480 píxeles, con un mínimo de 24 fotogramas por segundo. Tendrá una duración máxima de 10 minutos. El tema a desarrollar es libre, la temática no contendrá escenas agresivas, discriminatorias u ofensivas. Se utilizará Blender u otro programa de animación. Además se tendrá que usar un traje de ca...

  4. Cognitive aging, childhood intelligence, and the use of food supplements: possible involvement of n-3 fatty acids. (United States)

    Whalley, Lawrence J; Fox, Helen C; Wahle, Klaus W; Starr, John M; Deary, Ian J


    Food supplement use is widely promoted, but little is known about the cognitive effects of food supplements. We examined the effects of food supplement use on cognitive aging. This was an observational study of subjects born in 1936 whose mental ability was tested in 1947 and who were followed up in 2000-2001, at which time cognition, diet, food supplement use, and risk factors for vascular disease were assessed. In a nested case-control study, fish-oil users were matched with nonusers, and cognitive function was related to erythrocyte n-3 fatty acid composition. Childhood intelligence quotient (IQ) did not differ significantly by category of food supplement use (ie, none, fish oil, vitamins, and other). At the age of 64 y, cognitive function was higher in food supplement users than in nonusers before adjustment for childhood IQ. After adjustment for childhood IQ, digit symbol (mental speed) test scores were higher in food supplement users. Fish-oil supplement users consumed more vitamin C and vegetable and cereal fiber than did non-supplement-users. In a nested case-control study, erythrocyte membrane n-3 content was higher in fish-oil supplement users than in nonusers, but cognitive function did not differ significantly between groups. Total erythrocyte n-3 fatty acids and the ratio of docosahexaenoic acid to arachidonic acid was associated with better cognitive function in late life before and after adjustment for childhood IQ. Food supplement use and erythrocyte n-3 content are associated with better cognitive aging. If associations with n-3 content are causal, optimization of n-3 and n-6 fatty acid intakes could improve retention of cognitive function in old age.

  5. Longer habitual afternoon napping is associated with a higher risk for impaired fasting plasma glucose and diabetes mellitus in older adults: results from the Dongfeng-Tongji cohort of retired workers. (United States)

    Fang, Weimin; Li, Zhongliang; Wu, Li; Cao, Zhongqiang; Liang, Yuan; Yang, Handong; Wang, Youjie; Wu, Tangchun


    Afternoon napping is a common habit in China. We used data obtained from the Dongfeng-Tongji cohort to examine if duration of habitual afternoon napping was associated with risks for impaired fasting plasma glucose (IFG) and diabetes mellitus (DM) in a Chinese elderly population. A total of 27,009 participants underwent a physical examination, laboratory tests, and face-to-face interview. They were categorized into four groups according to nap duration (no napping, or =90 min). Logistic regression models were used to examine the odds ratios (ORs) of napping duration with IFG and DM. Of the participants, 18,515 (68.6%) reported regularly taking afternoon naps. Those with longer nap duration had considerably higher prevalence of IFG and DM. Napping duration was associated in a dose-dependent manner with IFG and DM (Pnap duration (>60 min; all Pnap duration (>30 min) was associated with increased risk for DM; however, this finding was not significant in the group with a nap duration of 60-90 min. Longer habitual afternoon napping was associated with a moderate increase for DM risk, independent of several covariates. This finding suggests that longer nap duration may represent a novel risk factor for DM and higher blood glucose levels. Copyright © 2013. Published by Elsevier B.V.

  6. Outcomes of Positron Emission Tomography-Staged Clinical N3 Breast Cancer Treated With Neoadjuvant Chemotherapy, Surgery, and Radiotherapy

    Energy Technology Data Exchange (ETDEWEB)

    Park, Hae Jin [Department of Radiation Oncology, Seoul National University College of Medicine, Seoul (Korea, Republic of); Shin, Kyung Hwan, E-mail: [Center for Breast Cancer, Research Institute and Hospital, National Cancer Center, Goyang (Korea, Republic of); Proton Therapy Center, Research Institute and Hospital, National Cancer Center, Goyang (Korea, Republic of); Cho, Kwan Ho [Proton Therapy Center, Research Institute and Hospital, National Cancer Center, Goyang (Korea, Republic of); Park, In Hae; Lee, Keun Seok; Ro, Jungsil; Jung, So-Youn; Lee, Seeyoun; Kim, Seok Won; Kang, Han-Sung [Center for Breast Cancer, Research Institute and Hospital, National Cancer Center, Goyang (Korea, Republic of); Chie, Eui Kyu; Ha, Sung Whan [Department of Radiation Oncology, Seoul National University College of Medicine, Seoul (Korea, Republic of)


    Purpose: To evaluate the treatment outcome and efficacy of regional lymph node irradiation after neoadjuvant chemotherapy (NCT) and surgery in positron emission tomography (PET)-positive clinical N3 (cN3) breast cancer patients. Methods and Materials: A total of 55 patients with ipsilateral infraclavicular (ICL), internal mammary (IMN), or supraclavicular (SCL) lymph node involvement in the absence of distant metastases, as revealed by an initial PET scan, were retrospectively analyzed. The clinical nodal stage at diagnosis (2002 AJCC) was cN3a in 14 patients (26%), cN3b in 12 patients (22%), and cN3c in 29 patients (53%). All patients were treated with NCT, followed by mastectomy or breast-conserving surgery and subsequent radiotherapy (RT) with curative intent. Results: At the median follow-up of 38 months (range, 9-80 months), 20 patients (36%) had developed treatment failures, including distant metastases either alone or combined with locoregional recurrences that included one ipsilateral breast recurrence (IBR), six regional failures (RF), and one case of combined IBR and RF. Only 3 patients (5.5%) exhibited treatment failure at the initial PET-positive clinical N3 lymph node. The 5-year locoregional relapse-free survival, disease-free survival (DFS), and overall survival rates were 80%, 60%, and 79%, respectively. RT delivered to PET-positive IMN regions in cN3b patients and at higher doses ({>=}55 Gy) to SCL regions in cN3c patients was not associated with improved 5-year IMN/SCL relapse-free survival or DFS. Conclusion: NCT followed by surgery and RT, including the regional lymph nodes, resulted in excellent locoregional control for patients with PET-positive cN3 breast cancer. The primary treatment failure in this group was due to distant metastasis rather than RF. Neither higher-dose RT directed at PET-positive SCL nodes nor coverage of PET-positive IMN nodes was associated with additional gains in locoregional control or DFS.

  7. Use of algae or algal oil rich in n-3 fatty acids as a feed supplement for dairy cattle. (United States)

    Stamey, J A; Shepherd, D M; de Veth, M J; Corl, B A


    Fish oil is used as a ration additive to provide n-3 fatty acids to dairy cows. Fish do not synthesize n-3 fatty acids; they must consume microscopic algae or other algae-consuming fish. New technology allows for the production of algal biomass for use as a ration supplement for dairy cattle. Lipid encapsulation of the algal biomass protects n-3 fatty acids from biohydrogenation in the rumen and allows them to be available for absorption and utilization in the small intestine. Our objective was to examine the use of algal products as a source for n-3 fatty acids in milk. Four mid-lactation Holsteins were assigned to a 4×4 Latin square design. Their rations were supplemented with 1× or 0.5× rumen-protected (RP) algal biomass supplement, 1× RP algal oil supplement, or no supplement for 7 d. Supplements were lipid encapsulated (Balchem Corp., New Hampton, NY). The 1× supplements provided 29 g/d of docosahexaenoic acid (DHA), and 0.5× provided half of this amount. Treatments were analyzed by orthogonal contrasts. Supplementing dairy rations with rumen-protected algal products did not affect feed intake, milk yield, or milk component yield. Short- and medium-chain fatty acid yields in milk were not influenced by supplements. Both 0.5× and 1× RP algae supplements increased daily milk fat yield of DHA (0.5 and 0.6±0.10 g/d, respectively) compared with 1× RP oil (0.3±0.10 g/d), but all supplements resulted in milk fat yields greater than that of the control (0.1±0.10g/d). Yield of trans-18:1 fatty acids in milk fat was also increased by supplementation. Trans-11 18:1 yield (13, 20, 27, and 15±3.0 g/d for control, 0.5× RP algae, 1× RP algae, and 1× RP oil, respectively) was greater for supplements than for control. Concentration of DHA in the plasma lipid fraction on d 7 showed that the DHA concentration was greatest in plasma phospholipid. Rumen-protected algal biomass provided better DHA yield than algal oil. Feeding lipid-encapsulated algae supplements

  8. Higher education


    Wolter, Andrä


    During the last five years higher education research in Germany seems to be in a significant upturn. This is a side effect partly of the obvious boom of empirical educational research in general and partly of the reform movement that has affected the German higher education system since middle of the 1990s. The demand for data in the field of higher education will increase considerably in future. The available data infrastructure for higher education research in Germany consists of two comple...

  9. Camelina meal increases egg n-3 fatty acid content without altering quality or production in laying hens. (United States)

    Kakani, Radhika; Fowler, Justin; Haq, Akram-Ul; Murphy, Eric J; Rosenberger, Thad A; Berhow, Mark; Bailey, Christopher A


    Camelina sativa is an oilseed plant rich in n-3 and n-6 fatty acids and extruding the seeds results in high protein meal (*40%) containing high levels of n-3 fatty acids. In this study, we examined the effects of feeding extruded defatted camelina meal to commercial laying hens, measuring egg production, quality, and fatty acid composition. Lohmann White Leghorn hens (29 weeks old) were randomly allocated to three dietary treatment groups (n = 25 per group) and data was collected over a 12 week production period. All the treatment groups were fed a corn soy based experimental diet containing 0% (control), 5, or 10% extruded camelina meal. We found no significant differences in percent hen-day egg production and feed consumed per dozen eggs. Egg shell strength was significantly higher in both camelina groups compared to the controls. Egg total n-3 fatty acid content increased 1.9- and 2.7-fold in 5 and 10% camelina groups respectively relative to the control. A similar increase in DHA content also occurred. Further camelina meal did not alter glucosinolate levels and no detectable glucosinolates or metabolic product isothiocyanates were found in the eggs from either the 5 or 10% camelina groups. These results indicate that camelina meal is a viable dietary source of n-3 fatty acids for poultry and its dietary inclusion results in eggs enriched with n-3 fatty acids.

  10. Metabolic responses to high-fat diets rich in n-3 or n-6 long-chain polyunsaturated fatty acids in mice selected for either high body weight or leanness explain different health outcomes

    Directory of Open Access Journals (Sweden)

    Nuernberg Karin


    Full Text Available Abstract Background Increasing evidence suggests that diets high in polyunsaturated fatty acids (PUFA confer health benefits by improving insulin sensitivity and lipid metabolism in liver, muscle and adipose tissue. Methods The present study investigates metabolic responses in two different lines of mice either selected for high body weight (DU6 leading to rapid obesity development, or selected for high treadmill performance (DUhTP leading to a lean phenotype. At 29 days of age the mice were fed standard chow (7.2% fat, 25.7% protein, or a high-fat diet rich in n-3 PUFA (n-3 HFD, 27.7% fat, 19% protein or a high-fat diet rich in n-6 PUFA (n-6 HFD, 27.7% fat, 18.6% protein for 8 weeks. The aim of the study was to determine the effect of these PUFA-rich high-fat diets on the fatty acid profile and on the protein expression of key components of insulin signalling pathways. Results Plasma concentrations of leptin and insulin were higher in DU6 in comparison with DUhTP mice. The high-fat diets stimulated a strong increase in leptin levels and body fat only in DU6 mice. Muscle and liver fatty acid composition were clearly changed by dietary lipid composition. In both lines of mice n-3 HFD feeding significantly reduced the hepatic insulin receptor β protein concentration which may explain decreased insulin action in liver. In contrast, protein kinase C ζ expression increased strongly in abdominal fat of n-3 HFD fed DUhTP mice, indicating enhanced insulin sensitivity in adipose tissue. Conclusions A diet high in n-3 PUFA may facilitate a shift from fuel deposition in liver to fuel storage as fat in adipose tissue in mice. Tissue specific changes in insulin sensitivity may describe, at least in part, the health improving properties of dietary n-3 PUFA. However, important genotype-diet interactions may explain why such diets have little effect in some population groups.

  11. Fatty-acid composition of maternal and umbilical cord plasma and early childhood atopic eczema in a Spanish cohort. (United States)

    Montes, R; Chisaguano, A M; Castellote, A I; Morales, E; Sunyer, J; López-Sabater, M C


    Fatty-acid status during in-utero development might influence the risk of atopic diseases in early childhood. The aim of this work was to identify the relationship between maternal plasma and cord blood fatty acid (FA) composition and the risk of atopic eczema in the offspring at 14 months of age. Two hundred and eleven non-atopic mothers and their children were studied. Mothers were recruited in their first trimester of gestation and children were monitored until 14 months of age. Samples of maternal plasma and cord blood plasma were analyzed to determine the FA profile of total lipids. Presence of atopic eczema in the infants was documented through questionnaires at 6 and 14 months of age. Higher concentrations of total long-chain polyunsaturated FA (LC-PUFA) were found in maternal plasma of non-atopic children in relation to atopic group. Moreover, this maternal plasma LC-PUFA content was negatively correlated with the atopic eczema (odds ratios (OR)=0.83, P=0.04) in infants. Regarding cord blood samples, docosahexaenoic acid (DHA C22:6n3) and the sum of total n-3 and of LC-PUFA n-3 showed a negative correlation with the prevalence of the disease (OR=0.50, 0.49 and 0.49, respectively). Our results show that the fatty-acid status of the fetus during pregnancy has an important role in the development of atopic eczema in early childhood. The prevalence of this atopic disorder is related to lower cord blood plasma levels of FA belonging to n-3 series, especially DHA.

  12. Membrane raft organization is more sensitive to disruption by (n-3) PUFA than nonraft organization in EL4 and B cells. (United States)

    Rockett, Benjamin Drew; Franklin, Andrew; Harris, Mitchel; Teague, Heather; Rockett, Alexis; Shaikh, Saame Raza


    Model membrane and cellular detergent extraction studies show (n-3) PUFA predominately incorporate into nonrafts; thus, we hypothesized (n-3) PUFA could disrupt nonraft organization. The first objective of this study was to determine whether (n-3) PUFA disrupted nonrafts of EL4 cells, an extension of our previous work in which we discovered an (n-3) PUFA diminished raft clustering. EPA or DHA treatment of EL4 cells increased plasma membrane accumulation of the nonraft probe 1,1'-dilinoleyl-3,3,3',3'-tetramethylindocarbocyanine perchlorate by ~50-70% relative to a BSA control. Förster resonance energy transfer imaging showed EPA and DHA also disrupted EL4 nanometer scale nonraft organization by increasing the distance between nonraft molecules by ~25% compared with BSA. However, changes in nonrafts were due to an increase in cell size; under conditions where EPA or DHA did not increase cell size, nonraft organization was unaffected. We next translated findings on EL4 cells by testing if (n-3) PUFA administered to mice disrupted nonrafts and rafts. Imaging of B cells isolated from mice fed low- or high-fat (HF) (n-3) PUFA diets showed no change in nonraft organization compared with a control diet (CD). However, confocal microscopy revealed the HF (n-3) PUFA diet disrupted lipid raft clustering and size by ~40% relative to CD. Taken together, our data from 2 different model systems suggest (n-3) PUFA have limited effects on nonrafts. The ex vivo data, which confirm previous studies with EL4 cells, provide evidence that (n-3) PUFA consumed through the diet disrupt B cell lipid raft clustering.

  13. Membrane Raft Organization Is More Sensitive to Disruption by (n-3) PUFA Than Nonraft Organization in EL4 and B Cells123 (United States)

    Rockett, Benjamin Drew; Franklin, Andrew; Harris, Mitchel; Teague, Heather; Rockett, Alexis; Shaikh, Saame Raza


    Model membrane and cellular detergent extraction studies show (n-3) PUFA predominately incorporate into nonrafts; thus, we hypothesized (n-3) PUFA could disrupt nonraft organization. The first objective of this study was to determine whether (n-3) PUFA disrupted nonrafts of EL4 cells, an extension of our previous work in which we discovered an (n-3) PUFA diminished raft clustering. EPA or DHA treatment of EL4 cells increased plasma membrane accumulation of the nonraft probe 1,1′-dilinoleyl-3,3,3′,3′-tetramethylindocarbocyanine perchlorate by ~50–70% relative to a BSA control. Förster resonance energy transfer imaging showed EPA and DHA also disrupted EL4 nanometer scale nonraft organization by increasing the distance between nonraft molecules by ~25% compared with BSA. However, changes in nonrafts were due to an increase in cell size; under conditions where EPA or DHA did not increase cell size, nonraft organization was unaffected. We next translated findings on EL4 cells by testing if (n-3) PUFA administered to mice disrupted nonrafts and rafts. Imaging of B cells isolated from mice fed low- or high-fat (HF) (n-3) PUFA diets showed no change in nonraft organization compared with a control diet (CD). However, confocal microscopy revealed the HF (n-3) PUFA diet disrupted lipid raft clustering and size by ~40% relative to CD. Taken together, our data from 2 different model systems suggest (n-3) PUFA have limited effects on nonrafts. The ex vivo data, which confirm previous studies with EL4 cells, provide evidence that (n-3) PUFA consumed through the diet disrupt B cell lipid raft clustering. PMID:21525263

  14. Anti-Inflammatory Activity of N-(3-Florophenylethylcaffeamide in Mice

    Directory of Open Access Journals (Sweden)

    Yueh-Hsiung Kuo


    Full Text Available In this study, we evaluated the anti-inflammatory activity of one synthetic product, N-(3-Florophenylethylcaffeamide (abbrev. FECA, by using animal model of λ-carrageenan-induced paw edema in mice. The anti-inflammatory mechanism of FECA was determined by measuring the levels of cyclooxygenase-2 (COX-2, nitric oxide (NO, tumor necrosis factor (TNF-α, interleukin-1β (IL-1β, and malondialdehyde (MDA in the edema paw tissue, and the activities of superoxide dismutase (SOD, glutathione peroxidase (GPx, and glutathione reductase (GRd in the liver. The results showed that FECA reduced the paw edema at three, four and five hours after λ-carrageenan administration. The levels of COX-2, NO, TNF-α, and MDA in the λ-carrageenan-induced edema paws were reduced and the activities of SOD, GPx, and GRd in liver tissues were raised by FECA. These results suggested that FECA possessed anti-inflammatory activities and the anti-inflammatory mechanisms might be related to the decrease of the levels of COX-2, NO, and TNF-α in inflamed tissues and the increase in the MDA level by increasing the activities of SOD, GPx, and GRd.

  15. Effect of three sources of long-chain fatty acids on the plasma fatty acid profile, plasma prostaglandin E2 concentrations, and pruritus symptoms in hemodialysis patients. (United States)

    Peck, L W; Monsen, E R; Ahmad, S


    Patients with chronic renal failure exhibit plasma fatty acid patterns indicative of essential fatty acid deficiency. The plasma fatty acid profile of 25 hemodialysis patients with a history of pruritus symptoms indicated lower 20:3n-9 (eicosatrienoic acid), 20:4n-6 (arachidonic acid), and 20:5n-3 (eicosapentaenoic acid) concentrations; a higher 18:1n-9 (oleic acid) concentration; and above-normal ranges of prostaglandin E2 (PGE2) compared with 22 subjects chosen from a normal population. No significant difference in 22:6n-3 (docosahexaenoic acid) was shown between the hemodialysis patients and the normal subjects. The dietary intake of 20:5n-3 was higher and that of 18:1n-9 lower in the patients compared with the normal population group. In this 8-wk double-blind study the hemodialysis patients were randomly assigned to receive daily supplements of 6 g ethyl ester of either fish oil, olive oil, or safflower oil. At the end of 8 wk of treatment the fish oil group (FO group) had a greater decrease in 18:1n-9 (P P > 0.05) compared with the other two groups. The increases in 20:5n-3 and 22:6n-3 in the FO group indicate compliance with fish oil supplementation. Results indicate that hemodialysis patients have abnormal fatty acid profiles and increased PGE2 values. Fish oil intervention changes the fatty acid profile and may improve the symptoms of pruritus.

  16. Ta2N3 nanocrystals grown in Al2O3 thin layers

    Directory of Open Access Journals (Sweden)

    Krešimir Salamon


    Full Text Available Tantalum nitride nanoparticles (NPs and cubic bixbyite-type Ta2N3 nanocrystals (NCs were grown in (Ta–N+Al2O3/Al2O3 periodic multilayers (MLs after thermal treatment. The MLs were prepared by magnetron deposition at room temperature and characterized using grazing incidence small-angle X-ray scattering (GISAXS, X-ray reflectivity (XRR, grazing incidence X-ray diffraction (GIXRD, secondary ion mass spectrometry (SIMS and X-ray photoelectron spectroscopy (XPS. We found amorphous tantalum nitride NPs at 600–800 °C, with a high degree of ordering along the surface normal and short-range ordering within the layers containing tantalum (metallic layers. At an even higher annealing temperature of 900 °C the NPs crystallize in the rare and relatively unexplored Ta2N3 phase. However, the environment, morphology and spatial ordering of the NCs depend on the thickness of the metallic layers. For 12 nm thick metallic layers, the Ta2N3 NCs have an average diameter of 6 nm and they are confined and short-range ordered within the metallic layers. When the metallic layers are thinner, the NCs grow over 20 nm in diameter, show no spatial ordering, while the periodic structure of the ML was completely destroyed. The results presented here demonstrate a self-assembly process of tantalum nitride NPs, the morphological properties of which depend on the preparation conditions. This can be used as a generic procedure to realize highly tunable and designable optical properties of thin films containing transition-metal nitride nanocrystals.

  17. Intake of Fish and Omega-3 (N-3) Fatty Acid: Effect on Humans during Actual and Simulated Weightlessness (United States)

    Smith, Scott M.; Mehta, Satish K.; Pierson, Duane L.; Zwart, Sara R.


    Space flight has many negative effects on human physiology, including bone and muscle loss. These are some of the systems on which intakes of fish and n-3 fatty acids have positive effects. These effects are likely to occur through inhibition of inflammatory cytokines (such as TNFalpha) and thus inhibition of downstream NF-KB activation. We documented this effect in a 3D cell culture model, where NF-KB activation in osteoclasts was inhibited by eicosapentaenoic acid, an n-3 fatty acid. We have extended these studies and report here (a) NF-KB expression in peripheral blood mononuclear cells of Space Shuttle crews on 2-wk missions, (b) the effects of n-3 fatty acid intake after 60 d of bed rest (a weightlessness analog), and (c) the effects of fish intake in astronauts after 4 to 6 mo on the International Space Station. After Shuttle flights of 2 wk, NFKB p65 expression at landing was increased (P less than 0.001). After 60 d of bed rest, higher intake of n-3 fatty acids was associated with less N-telopeptide excretion (Pearson r = -0.62, P less than 0.05). Higher consumption of fish during flight was associated with higher bone mineral density (Pearson r = -0.46, P less than 0.05). Together with our earlier findings, these data provide mechanistic cellular and preliminary human evidence of the potential for n-3 fatty acids to counteract bone loss associated with spaceflight. This study was supported by the NASA Human Research Program.

  18. The effects of dietary supplementation with n-3 polyunsaturated fatty acids in patients with rheumatoid arthritis

    DEFF Research Database (Denmark)

    Nielsen, G L; Faarvang, K L; Thomsen, B S


    STUDY OBJECTIVE: To determine the effect of dietary supplementation with n-3 polyunsaturated fatty acids (n-3 PUFA) on disease variables in patients with rheumatoid arthritis. DESIGN: Multicenter, randomized, placebo controlled, double blind. SETTING: Three Danish hospital Departments of Rheumato...

  19. Long-chain n-3 PUFAs from fish oil enhance resting state brain glucose utilization and reduce anxiety in an adult nonhuman primate, the grey mouse lemur. (United States)

    Pifferi, Fabien; Dorieux, Olène; Castellano, Christian-Alexandre; Croteau, Etienne; Masson, Marie; Guillermier, Martine; Van Camp, Nadja; Guesnet, Philippe; Alessandri, Jean-Marc; Cunnane, Stephen; Dhenain, Marc; Aujard, Fabienne


    Decreased brain content of DHA, the most abundant long-chain n-3 polyunsaturated fatty acid (n-3 LCPUFA) in the brain, is accompanied by severe neurosensorial impairments linked to impaired neurotransmission and impaired brain glucose utilization. In the present study, we hypothesized that increasing n-3 LCPUFA intake at an early age may help to prevent or correct the glucose hypometabolism observed during aging and age-related cognitive decline. The effects of 12 months' supplementation with n-3 LCPUFA on brain glucose utilization assessed by positron emission tomography was tested in young adult mouse lemurs (Microcebus murinus). Cognitive function was tested in parallel in the same animals. Lemurs supplemented with n-3 LCPUFA had higher brain glucose uptake and cerebral metabolic rate of glucose compared with controls in all brain regions. The n-3 LCPUFA-supplemented animals also had higher exploratory activity in an open-field task and lower evidence of anxiety in the Barnes maze. Our results demonstrate for the first time in a nonhuman primate that n-3 LCPUFA supplementation increases brain glucose uptake and metabolism and concomitantly reduces anxiety. Copyright © 2015 by the American Society for Biochemistry and Molecular Biology, Inc.

  20. Enriched eggs as a source of n-3 polyunsaturated fatty acids for humans

    Directory of Open Access Journals (Sweden)

    Gordana Kralik


    Full Text Available The aim of the research was to enrich eggs with n-3 polyunsaturated fatty acids by using plant oils and fish oil as dietary supplements in laying hens’ feed. The focus was put on the effect of the daily consumption of 100 g of egg yolk, i.e. 100 g of egg mass, on the human health. The 1st group of laying hens was fed a diet containing soybean and fish oil, and the 2nd group was given feed containing a combination of linseed, rapeseed, soybean, and fish oils. Eggs laid by the 2nd group contained 4.73% α-linolenic acid, 0.20% eicosapentaenoic acid and 2.37% docosahexaenoic acid (% of total fatty acids in yolk lipids, P < 0.001, which marks an increase of × 4.04 for α-linolenic acid, × 3.33 for eicosapentaenoic acid, and × 1.75 for docosahexaenoic acid compared to eggs laid by the 1st group. Total n-3 polyunsaturated fatty acids in eggs of the 2nd group were × 2.8 higher than in the 1st first group. Calculated per 100 g of eggs of the 2nd group, the intake for the human body corresponds to 435 mg α-linolenic acid, 18.43 mg eicosapentaenoic acid, and 218.2 mg docosahexaenoic acid.

  1. Whole Rye Consumption Improves Blood and Liver n-3 Fatty Acid Profile and Gut Microbiota Composition in Rats.

    Directory of Open Access Journals (Sweden)

    Fayçal Ounnas

    Full Text Available Whole rye (WR consumption seems to be associated with beneficial health effects. Although rye fiber and polyphenols are thought to be bioactive, the mechanisms behind the health effects of WR have yet to be fully identified. This study in rats was designed to investigate whether WR can influence the metabolism of n-3 and n-6 long-chain fatty acids (LCFA and gut microbiota composition.For 12 weeks, rats were fed a diet containing either 50% WR or 50% refined rye (RR. The WR diet provided more fiber (+21% and polyphenols (+29% than the RR diet. Fat intake was the same in both diets and particularly involved similar amounts of essential (18-carbon n-3 and n-6 LCFAs.The WR diet significantly increased the 24-hour urinary excretion of polyphenol metabolites-including enterolactone-compared with the RR diet. The WR rats had significantly more n-3 LCFA-in particular, eicosapentanoic (EPA and docosahexanoic (DHA acids-in their plasma and liver. Compared with the RR diet, the WR diet brought significant changes in gut microbiota composition, with increased diversity in the feces (Shannon and Simpson indices, decreased Firmicutes/Bacteroidetes ratio and decreased proportions of uncultured Clostridiales cluster IA and Clostridium cluster IV in the feces. In contrast, no difference was found between groups with regards to cecum microbiota. The WR rats had lower concentrations of total short-chain fatty acids (SCFA in cecum and feces (p<0.05. Finally, acetate was lower (p<0.001 in the cecum of WR rats while butyrate was lower (p<0.05 in the feces of WR rats.This study shows for the first time that WR consumption results in major biological modifications-increased plasma and liver n-3 EPA and DHA levels and improved gut microbiota profile, notably with increased diversity-known to provide health benefits. Unexpectedly, WR decreased SCFA levels in both cecum and feces. More studies are needed to understand the interactions between whole rye (fiber and

  2. Data of evolutionary structure change: 1N3CA-2NOZA [Confc[Archive

    Lifescience Database Archive (English)


  3. Data of evolutionary structure change: 1N3AA-2NOZA [Confc[Archive

    Lifescience Database Archive (English)


  4. Incorporation of n-3 polyunsaturated fatty acids of marine or vegetable origin into rat enterocyte phospholipids

    DEFF Research Database (Denmark)

    Poulsen, Christian; Christensen, Michael Søberg; Høy, Carl-Erik


    were: Palm oil diet (PD), 0.6 wt% n-3 PUFA; fish oil diet (FD), 32 wt% n-3 PUFA (C20-C22); and linseed oil diet (LD), 32 wt% n-3 PUFA (C18:3n-3). Forty weanling male Wistar rats were fed PD for 34 days and then divided into three groups. Two groups of sixteen rats each were then fed FD or LD...

  5. Effect of gene transfer of Chlorella vulgaris n-3 fatty acid desaturase ...

    African Journals Online (AJOL)

    Chlorella vulgaris had the gene of n-3 fatty acid desaturase (CvFad3) which can synthesize the precursor of n-3 polyunsaturated fatty acids (PUFAs) or to convert n-6 to n-3 PUFAs. The objective of this study was to examine whether the CvFad3 gene from C. vulgaris can be functionally expressed in mammalian cells and ...

  6. Metabolic effects of n-3 PUFA as phospholipids are superior to triglycerides in mice fed a high-fat diet: possible role of endocannabinoids.

    Directory of Open Access Journals (Sweden)

    Martin Rossmeisl

    Full Text Available BACKGROUND: n-3 polyunsaturated fatty acids, namely docosahexaenoic acid (DHA and eicosapentaenoic acid (EPA, reduce the risk of cardiovascular disease and can ameliorate many of obesity-associated disorders. We hypothesised that the latter effect will be more pronounced when DHA/EPA is supplemented as phospholipids rather than as triglycerides. METHODOLOGY/PRINCIPAL FINDINGS: In a 'prevention study', C57BL/6J mice were fed for 9 weeks on either a corn oil-based high-fat obesogenic diet (cHF; lipids ∼35% wt/wt, or cHF-based diets in which corn oil was partially replaced by DHA/EPA, admixed either as phospholipids or triglycerides from marine fish. The reversal of obesity was studied in mice subjected to the preceding cHF-feeding for 4 months. DHA/EPA administered as phospholipids prevented glucose intolerance and tended to reduce obesity better than triglycerides. Lipemia and hepatosteatosis were suppressed more in response to dietary phospholipids, in correlation with better bioavailability of DHA and EPA, and a higher DHA accumulation in the liver, white adipose tissue (WAT, and muscle phospholipids. In dietary obese mice, both DHA/EPA concentrates prevented a further weight gain, reduced plasma lipid levels to a similar extent, and tended to improve glucose tolerance. Importantly, only the phospholipid form reduced plasma insulin and adipocyte hypertrophy, while being more effective in reducing hepatic steatosis and low-grade inflammation of WAT. These beneficial effects were correlated with changes of endocannabinoid metabolome in WAT, where phospholipids reduced 2-arachidonoylglycerol, and were more effective in increasing anti-inflammatory lipids such as N-docosahexaenoylethanolamine. CONCLUSIONS/SIGNIFICANCE: Compared with triglycerides, dietary DHA/EPA administered as phospholipids are superior in preserving a healthy metabolic profile under obesogenic conditions, possibly reflecting better bioavalability and improved modulation of the

  7. Plasma harmonics

    CERN Document Server

    Ganeev, Rashid A


    Preface; Why plasma harmonics? A very brief introduction Early stage of plasma harmonic studies - hopes and frustrations New developments in plasma harmonics studies: first successes Improvements of plasma harmonics; Theoretical basics of plasma harmonics; Basics of HHG Harmonic generation in fullerenes using few-cycle pulsesVarious approaches for description of observed peculiarities of resonant enhancement of a single harmonic in laser plasmaTwo-colour pump resonance-induced enhancement of odd and even harmonics from a tin plasmaCalculations of single harmonic generation from Mn plasma;Low-o

  8. Increased Zn/Glutathione Levels and Higher Superoxide Dismutase-1 Activity as Biomarkers of Oxidative Stress in Women with Long-Term Dental Amalgam Fillings: Correlation between Mercury/Aluminium Levels (in Hair and Antioxidant Systems in Plasma.

    Directory of Open Access Journals (Sweden)

    María Eugenia Cabaña-Muñoz

    Full Text Available The induction of oxidative stress by Hg can affect antioxidant enzymes. However, epidemiological studies have failed to establish clear association between dental fillings presence and health problems.To determine whether heavy metals (in hair, antioxidant enzymes (SOD-1 and glutathione levels could be affected by the chronic presence of heavy metals in women who had dental amalgam fillings.55 hair samples (42 females with amalgam fillings and 13 female control subjects were obtained. All subjects (mean age 44 years who had dental amalgam filling for more than 10 years (average 15 years. Certain metals were quantified by ICP-MS (Mass Spectrophotometry in hair (μg/g: Al, Hg, Ba, Ag, Sb, As, Be, Bi, Cd, Pb, Pt, Tl, Th, U, Ni, Sn, Ti and SOD-1 and Glutathione (reduced form levels in plasma. Data were compared with controls without amalgams, and analyzed to identify any significant relation between metals and the total number of amalgam fillings, comparing those with four or less (n = 27 with those with more than four (n = 15. As no significant differences were detected, the two groups were pooled (Amlgam; n = 42.Hg, Ag, Al and Ba were higher in the amalgam group but without significant differences for most of the heavy metals analyzed. Increased SOD-1 activity and glutathione levels (reduced form were observed in the amalgam group. Aluminum (Al correlated with glutathione levels while Hg levels correlated with SOD-1. The observed Al/glutathione and Hg/SOD-1 correlation could be adaptive responses against the chronic presence of mercury.Hg, Ag, Al and Ba levels increased in women who had dental amalgam fillings for long periods. Al correlated with glutathione, and Hg with SOD-1. SOD-1 may be a possible biomarker for assessing chronic Hg toxicity.

  9. Increased Zn/Glutathione Levels and Higher Superoxide Dismutase-1 Activity as Biomarkers of Oxidative Stress in Women with Long-Term Dental Amalgam Fillings: Correlation between Mercury/Aluminium Levels (in Hair) and Antioxidant Systems in Plasma (United States)

    Cabaña-Muñoz, María Eugenia; Parmigiani-Izquierdo, José María; Bravo-González, Luis Alberto; Kyung, Hee-Moon; Merino, José Joaquín


    Background The induction of oxidative stress by Hg can affect antioxidant enzymes. However, epidemiological studies have failed to establish clear association between dental fillings presence and health problems. Objectives To determine whether heavy metals (in hair), antioxidant enzymes (SOD-1) and glutathione levels could be affected by the chronic presence of heavy metals in women who had dental amalgam fillings. Materials and Methods 55 hair samples (42 females with amalgam fillings and 13 female control subjects) were obtained. All subjects (mean age 44 years) who had dental amalgam filling for more than 10 years (average 15 years). Certain metals were quantified by ICP-MS (Mass Spectrophotometry) in hair (μg/g: Al, Hg, Ba, Ag, Sb, As, Be, Bi, Cd, Pb, Pt, Tl, Th, U, Ni, Sn, Ti) and SOD-1 and Glutathione (reduced form) levels in plasma. Data were compared with controls without amalgams, and analyzed to identify any significant relation between metals and the total number of amalgam fillings, comparing those with four or less (n = 27) with those with more than four (n = 15). As no significant differences were detected, the two groups were pooled (Amlgam; n = 42). Findings Hg, Ag, Al and Ba were higher in the amalgam group but without significant differences for most of the heavy metals analyzed. Increased SOD-1 activity and glutathione levels (reduced form) were observed in the amalgam group. Aluminum (Al) correlated with glutathione levels while Hg levels correlated with SOD-1. The observed Al/glutathione and Hg/SOD-1 correlation could be adaptive responses against the chronic presence of mercury. Conclusions Hg, Ag, Al and Ba levels increased in women who had dental amalgam fillings for long periods. Al correlated with glutathione, and Hg with SOD-1. SOD-1 may be a possible biomarker for assessing chronic Hg toxicity. PMID:26076368

  10. Low n-6/n-3 PUFA Ratio Improves Lipid Metabolism, Inflammation, Oxidative Stress and Endothelial Function in Rats Using Plant Oils as n-3 Fatty Acid Source. (United States)

    Yang, Li Gang; Song, Zhi Xiu; Yin, Hong; Wang, Yan Yan; Shu, Guo Fang; Lu, Hui Xia; Wang, Shao Kang; Sun, Gui Ju


    Lipid metabolism, inflammation, oxidative stress and endothelial function play important roles in the pathogenesis of cardiovascular disease (CVD), which may be affected by an imbalance in the n-6/n-3 polyunsaturated fatty acid (PUFA) ratio. This study aimed to investigate the effects of the n-6/n-3 PUFA ratio on these cardiovascular risk factors in rats fed a high-fat diet using plant oils as the main n-3 PUFA source. The 1:1 and 5:1 ratio groups had significantly decreased serum levels of total cholesterol, low-density lipoprotein cholesterol, and proinflammatory cytokines compared with the 20:1 group (p stress compared with the other groups (p stress effects, and improving endothelial function. A high n-6/n-3 PUFA ratio (20:1) had adverse effects. Our results indicated that low n-6/n-3 PUFA ratios exerted beneficial cardiovascular effects, suggesting that plant oils could be used as a source of n-3 fatty acids to prevent CVD. They also suggested that we should be aware of possible adverse effects from excessive n-3 PUFA.

  11. Higher Education. (United States)

    Hendrickson, Robert M.

    This chapter reviews litigation in higher education for 1986. The first section discusses the relationship between postsecondary institutions and various governmental agencies, in which litigation covers questions on the authority of boards, access to information through sunshine laws, questions of tax exempt status, and issues of accreditation.…

  12. Effects of dietary n-6:n-3 fatty acid ratio and vitamin E on semen quality, fatty acid composition and antioxidant status in boars. (United States)

    Liu, Q; Zhou, Y F; Duan, R J; Wei, H K; Jiang, S W; Peng, J


    The aim of the present study was to evaluate the effects of dietary n-6:n-3 fatty acid (FA) ratio and vitamin E on the semen quality, FA composition and antioxidant status of boars. Forty-eight Landrace boars were randomly distributed in a 3×2 factorial design with three n-6:n-3 FA ratios (14.4, 6.6 and 2.2) by the inclusion of three oil sources (soybean, fish/soybean, fish) and two vitamin E levels (200 and 400mg/kg). During the 8 weeks of treatment, semen parameters were evaluated. Serum, sperm and seminal plasma samples were taken at 0 and 8 weeks to monitor the FA composition and antioxidant status. Results showed that the 6.6 and 2.2 dietary ratios very effectively increased docosahexaenoic acid (DHA) and n-3 polyunsaturated fatty acid (PUFA) and decreased docosapentaenoic acid (DPA) and n-6:n-3 ratio in spermatozoa. The 6.6 dietary ratio contributed to a greater progressive sperm motility (P400mg/kg supplementation of vitamin E increased the progressive sperm motility, SOD of sperm, TAC and SOD of seminal plasma and serum, and decreased sperm malondialdehyde (MDA) (P400mg/kg vitamin E supplementation improve progressive sperm motility by modifying the sperm FA composition and antioxidant status. Copyright © 2015 Elsevier B.V. All rights reserved.

  13. The effect of feeding modified soyabean oil enriched with C18 : 4 n-3 to broilers on the deposition of n-3 fatty acids in chicken meat


    Rymer, C.; Hartnell, G. F.; Givens, D. I.


    Supplementing broiler diets with conventional vegetable oils has little effect on the long-chain n-3 PUFA (LC n-3 PUFA) content of the meat. The present study investigated the effect on fatty acid composition and sensory characteristics of chicken meat when broilers were fed oil extracted from soyabeans (SDASOY) that had been genetically engineered to produce C18 : 4n-3 (stearidonic acid (SDA), 240 mg/g oil). Three diets were fed to 120 birds (eight replicate pens of five birds) from 15 d to ...

  14. Short term effects of dietary medium-chain fatty acids and n-3 long-chain polyunsaturated fatty acids on the fat metabolism of healthy volunteers

    Directory of Open Access Journals (Sweden)

    Hauenschild A


    Full Text Available Abstract Background The amount and quality of dietary fatty acids can modulate the fat metabolism. Objective This dietary intervention is based on the different metabolic pathways of long-chain saturated fatty acids (LCFA, which are mostly stored in adipocytic triacylglycerols, medium-chain fatty acids (MCFA which are preferentially available for hepatic mitochondrial β-oxidation and n-3 long-chain polyunsaturated fatty acids (n-3 LCPUFA suggested to modulate fat oxidation and storage by stimulating the peroxisomal β-oxidation. Combined dietary MCFA and n-3 LCPUFA without LCFA may synergistically stimulate fatty acid oxidation resulting in blood lipid clearance and LCFA release from adipocytes. Design In a short term, parallel, randomized, double-blind trial effects on the fatty acid metabolism of 10 healthy volunteers (Body Mass Index 25–30 of a formula containing 72% MCFA and 22% n-3 LCPUFA without LCFA (intake: 1.500 kcal/day; fat: 55.5% of energy were measured in comparison to an isoenergetic formula with equal fat amount and LCFA dominated lipid profile. Results The plasma triacylglycerol (p Conclusion Combined dietary 72% MCFA and 22% n-3 LCPUFA without LCFA stimulate the fatty acid oxidation and release from adipocytes without affecting any safety parameters measured.

  15. Pork as a Source of Omega-3 (n-3) Fatty Acids. (United States)

    Dugan, Michael E R; Vahmani, Payam; Turner, Tyler D; Mapiye, Cletos; Juárez, Manuel; Prieto, Nuria; Beaulieu, Angela D; Zijlstra, Ruurd T; Patience, John F; Aalhus, Jennifer L


    Pork is the most widely eaten meat in the world, but typical feeding practices give it a high omega-6 (n-6) to omega-3 (n-3) fatty acid ratio and make it a poor source of n-3 fatty acids. Feeding pigs n-3 fatty acids can increase their contents in pork, and in countries where label claims are permitted, claims can be met with limited feeding of n-3 fatty acid enrich feedstuffs, provided contributions of both fat and muscle are included in pork servings. Pork enriched with n-3 fatty acids is, however, not widely available. Producing and marketing n-3 fatty acid enriched pork requires regulatory approval, development costs, quality control costs, may increase production costs, and enriched pork has to be tracked to retail and sold for a premium. Mandatory labelling of the n-6/n-3 ratio and the n-3 fatty acid content of pork may help drive production of n-3 fatty acid enriched pork, and open the door to population-based disease prevention polices (i.e., food tax to provide incentives to improve production practices). A shift from the status-quo, however, will require stronger signals along the value chain indicating production of n-3 fatty acid enriched pork is an industry priority.

  16. Pork as a Source of Omega-3 (n-3) Fatty Acids (United States)

    Dugan, Michael E.R.; Vahmani, Payam; Turner, Tyler D.; Mapiye, Cletos; Juárez, Manuel; Prieto, Nuria; Beaulieu, Angela D.; Zijlstra, Ruurd T.; Patience, John F.; Aalhus, Jennifer L.


    Pork is the most widely eaten meat in the world, but typical feeding practices give it a high omega-6 (n-6) to omega-3 (n-3) fatty acid ratio and make it a poor source of n-3 fatty acids. Feeding pigs n-3 fatty acids can increase their contents in pork, and in countries where label claims are permitted, claims can be met with limited feeding of n-3 fatty acid enrich feedstuffs, provided contributions of both fat and muscle are included in pork servings. Pork enriched with n-3 fatty acids is, however, not widely available. Producing and marketing n-3 fatty acid enriched pork requires regulatory approval, development costs, quality control costs, may increase production costs, and enriched pork has to be tracked to retail and sold for a premium. Mandatory labelling of the n-6/n-3 ratio and the n-3 fatty acid content of pork may help drive production of n-3 fatty acid enriched pork, and open the door to population-based disease prevention polices (i.e., food tax to provide incentives to improve production practices). A shift from the status-quo, however, will require stronger signals along the value chain indicating production of n-3 fatty acid enriched pork is an industry priority. PMID:26694475

  17. Pork as a Source of Omega-3 (n-3 Fatty Acids

    Directory of Open Access Journals (Sweden)

    Michael E.R. Dugan


    Full Text Available Pork is the most widely eaten meat in the world, but typical feeding practices give it a high omega-6 (n-6 to omega-3 (n-3 fatty acid ratio and make it a poor source of n-3 fatty acids. Feeding pigs n-3 fatty acids can increase their contents in pork, and in countries where label claims are permitted, claims can be met with limited feeding of n-3 fatty acid enrich feedstuffs, provided contributions of both fat and muscle are included in pork servings. Pork enriched with n-3 fatty acids is, however, not widely available. Producing and marketing n-3 fatty acid enriched pork requires regulatory approval, development costs, quality control costs, may increase production costs, and enriched pork has to be tracked to retail and sold for a premium. Mandatory labelling of the n-6/n-3 ratio and the n-3 fatty acid content of pork may help drive production of n-3 fatty acid enriched pork, and open the door to population-based disease prevention polices (i.e., food tax to provide incentives to improve production practices. A shift from the status-quo, however, will require stronger signals along the value chain indicating production of n-3 fatty acid enriched pork is an industry priority.

  18. Dietary n-6:n-3 ratio and Vitamin E improve motility characteristics in association with membrane properties of boar spermatozoa. (United States)

    Liu, Qing; Zhou, Yuan-Fei; Duan, Run-Jia; Wei, Hong-Kui; Peng, Jian; Jiang, Si-Wen


    This study was aimed to evaluate the effects of dietary n-6:n-3 ratio and Vitamin E on the membrane properties and motility characteristics of spermatozoa in boars. Forty Duroc boars were randomly distributed in a 2 × 2 factorial design with two n-6:n-3 ratios (14.4 and 6.6) and two Vitamin E levels (200 and 400 mg kg-1 ). During 16 weeks of treatment, fresh semen was collected at weeks 0, 8, 12, and 16 for measurements of motility characteristics, contents of fatty acids, membrane properties (membrane fluidity and membrane integrity), and lipid peroxidation of the spermatozoa. The semen was diluted in Beltsville Thawing Solution (BTS) extender and stored at 17°C, and the sperm motility was assessed at 12, 36, 72, and 120 h of storage. The 6.6 n-6:n-3 dietary ratio increased the contents of n-3 polyunsaturated fatty acids (PUFAs) and docosahexaenoic acid (DHA) and improved the membrane integrity and membrane fluidity of the spermatozoa, resulting in notably increased total motility, sperm progressive motility, and velocity parameters of fresh semen. Feeding diet with Vitamin E (400 mg kg-1 ) prevented sperm lipid peroxidation, and resulted in higher total motility and sperm progressive motility in fresh and liquid stored semen. In conclusion, the adjustment of n-6:n-3 ratio (6.6) and supply of Vitamin E (400 mg kg-1 ) successfully improved sperm motility characteristics and thus may be beneficial to the fertility of boars, which might be due to the modification of the physical and functional properties of spermatozoa membrane in response to dietary supplementation.

  19. Dietary n-6:n-3 ratio and Vitamin E improve motility characteristics in association with membrane properties of boar spermatozoa

    Directory of Open Access Journals (Sweden)

    Qing Liu


    Full Text Available This study was aimed to evaluate the effects of dietary n-6:n-3 ratio and Vitamin E on the membrane properties and motility characteristics of spermatozoa in boars. Forty Duroc boars were randomly distributed in a 2 × 2 factorial design with two n-6:n-3 ratios (14.4 and 6.6 and two Vitamin E levels (200 and 400 mg kg−1 . During 16 weeks of treatment, fresh semen was collected at weeks 0, 8, 12, and 16 for measurements of motility characteristics, contents of fatty acids, membrane properties (membrane fluidity and membrane integrity, and lipid peroxidation of the spermatozoa. The semen was diluted in Beltsville Thawing Solution (BTS extender and stored at 17°C, and the sperm motility was assessed at 12, 36, 72, and 120 h of storage. The 6.6 n-6:n-3 dietary ratio increased the contents of n-3 polyunsaturated fatty acids (PUFAs and docosahexaenoic acid (DHA and improved the membrane integrity and membrane fluidity of the spermatozoa, resulting in notably increased total motility, sperm progressive motility, and velocity parameters of fresh semen. Feeding diet with Vitamin E (400 mg kg−1 prevented sperm lipid peroxidation, and resulted in higher total motility and sperm progressive motility in fresh and liquid stored semen. In conclusion, the adjustment of n-6:n-3 ratio (6.6 and supply of Vitamin E (400 mg kg−1 successfully improved sperm motility characteristics and thus may be beneficial to the fertility of boars, which might be due to the modification of the physical and functional properties of spermatozoa membrane in response to dietary supplementation.

  20. Effects of prenatal n-3 fatty acid supplementation on offspring resolvins at birth and 12 years of age: a double-blind, randomised controlled clinical trial. (United States)

    See, Valene H L; Mas, Emilie; Prescott, Susan L; Beilin, Lawrence J; Burrows, Sally; Barden, Anne E; Huang, Rae-Chi; Mori, Trevor A


    Resolution of inflammation is an active process involving specialised pro-resolving mediators (SPM) generated from the n-3 fatty acids EPA and DHA. n-3 Fatty acid supplementation during pregnancy may provide an intervention strategy to modify these novel SPM. This study aimed to assess the effect of n-3 fatty acid supplementation in pregnancy on offspring SPM at birth and 12 years of age (12 years). In all, ninety-eight atopic pregnant women were randomised to 3·7 g daily n-3 fatty acids or a control (olive oil), from 20 weeks gestation until delivery. Blood was collected from the offspring at birth and at 12 years. Plasma SPM consisting of 18-hydroxyeicosapentaenoic acid (18-HEPE), E-series resolvins, 17-hydroxydocosahexaenoic acid (17-HDHA), D-series resolvins, 14-hydroxydocosahexaenoic acid (14-HDHA), 10 S,17S-dihydroxydocosahexaenoic acid, maresins and protectin 1, were measured by liquid chromatography-tandem MS. We identified the resolvins RvE1, RvE2, RvE3, RvD1, 17R-RvD1 and RvD2 for the first time in human cord blood. n-3 Fatty acids increased cord blood 18-HEPE (Pbirth was significantly increased in the n-3 fatty acid group relative to the controls (P=0·001), but other SPM were not different between the groups. n-3 Fatty acid supplementation during pregnancy was associated with an increase in SPM precursors in the offspring at birth but the effects were not sustained at 12 years. The presence of these SPM, particularly at birth, may have functions relevant in the newborn that remain to be established, which may be useful for future investigations.

  1. The effect of feeding modified soyabean oil enriched with C18 : 4 n-3 to broilers on the deposition of n-3 fatty acids in chicken meat. (United States)

    Rymer, C; Hartnell, G F; Givens, D I


    Supplementing broiler diets with conventional vegetable oils has little effect on the long-chain n-3 PUFA (LC n-3 PUFA) content of the meat. The present study investigated the effect on fatty acid composition and sensory characteristics of chicken meat when broilers were fed oil extracted from soyabeans (SDASOY) that had been genetically engineered to produce C18 : 4n-3 (stearidonic acid (SDA), 240 mg/g oil). Three diets were fed to 120 birds (eight replicate pens of five birds) from 15 d to slaughter (41-50 d). Diets were identical apart from the oil added to them (45 and 50 g/kg as fed in the grower and finisher phases, respectively), which was either SDASOY, near-isogenic soya (CON) or fish oil (FISH). The LC n-3 PUFA content of the meat increased in the order CON, SDASOY and FISH. In breast meat with skin, the SDA concentration was 522, 13 and 37 (sem 14·4) mg/100 g meat for SDASOY, CON and FISH, respectively. Equivalent values for C20 : 5n-3 (EPA) were 53, 13 and 140 (sem 8·4); for C22 : 5n-3 (docosapentaenoic acid (DPA)) 65, 15 and 101 (sem 3·5); for C22 : 6n-3 (DHA) 19, 9 and 181 (sem 4·4). Leg meat (with skin) values for SDA were 861, 23 and 68 (sem 30·1); for EPA 87, 9 and 258 (sem 7·5); for DPA 95, 20 and 165 (sem 5·0); for DHA 29, 10 and 278 (sem 8·4). Aroma, taste and aftertaste of freshly cooked breast meat were not affected. Fishy aromas, tastes and aftertastes were associated with LC n-3 PUFA content of the meat, being most noticeable in the FISH leg meat (both freshly cooked and reheated) and in the reheated SDASOY leg meat.

  2. Elevated N3-methylpurine-DNA glycosylase DNA repair activity is associated with lung cancer

    Energy Technology Data Exchange (ETDEWEB)

    Crosbie, Philip A.J. [Cancer Research UK Carcinogenesis Group, Paterson Institute for Cancer Research, University of Manchester, Manchester (United Kingdom); North West Lung Centre, University Hospital of South Manchester, Manchester (United Kingdom); Centre for Occupational and Environmental Health, Faculty of Medical and Human Sciences, University of Manchester, Manchester (United Kingdom); Watson, Amanda J. [Cancer Research UK Carcinogenesis Group, Paterson Institute for Cancer Research, University of Manchester, Manchester (United Kingdom); Agius, Raymond [Centre for Occupational and Environmental Health, Faculty of Medical and Human Sciences, University of Manchester, Manchester (United Kingdom); Barber, Philip V. [North West Lung Centre, University Hospital of South Manchester, Manchester (United Kingdom); Margison, Geoffrey P. [Cancer Research UK Carcinogenesis Group, Paterson Institute for Cancer Research, University of Manchester, Manchester (United Kingdom); Povey, Andrew C., E-mail: [Centre for Occupational and Environmental Health, Faculty of Medical and Human Sciences, University of Manchester, Manchester (United Kingdom)


    Tobacco smoke contains a range of chemical agents that can alkylate DNA. DNA repair proteins such as N3-methylpurine-DNA glycosylase (MPG) provide protection against cell killing and mutagenicity by removing lesions such as N7-methylguanine and N3-methyladenine. However, high levels of MPG activity in transfected mammalian cells in vitro have also been associated with increased genotoxicity. The aim of this study was to examine to what extent inter-individual differences in MPG activity modify susceptibility to lung cancer. Incident cases of lung cancer (n = 51) and cancer free controls (n = 88) were recruited from a hospital bronchoscopy unit. Repair activity was determined in a nuclear extract of peripheral blood mononuclear cells, using a [{sup 32}P]-based oligonucleotide cleavage assay (MPG substrate 5 Prime -CCGCT{epsilon}AGCGGGTACCGAGCTCGAAT; {epsilon}A = ethenoadenine). MPG activity was not related to sex or smoking status but was significantly higher in cases compared to controls (4.21 {+-} 1.67 fmol/{mu}g DNA/h vs 3.47 {+-} 1.35 fmol/{mu}g DNA/h, p = 0.005). After adjustment for age, sex, presence of chronic respiratory disease and smoking duration, patients in the highest tertile of MPG activity had a three fold increased probability of lung cancer (OR 3.00, 95% CI 1.16-7.75) when compared to those patients in the lowest tertile. These results suggest that elevated MPG activity is associated with lung cancer, possibly by creating an imbalance in the base excision repair pathway.

  3. Transgenic mice: fat-1 mice convert n-6 to n-3 fatty acids. (United States)

    Kang, Jing X; Wang, Jingdong; Wu, Lin; Kang, Zhao B


    Mammals cannot naturally produce omega-3 (n-3) fatty acids--beneficial nutrients found mainly in fish oil--from the more abundant omega-6 (n-6) fatty acids and so they must rely on a dietary supply. Here we show that mice engineered to carry a fat-1 gene from the roundworm Caenorhabditis elegans can add a double bond into an unsaturated fatty-acid hydrocarbon chain and convert n-6 to n-3 fatty acids. This results in an abundance of n-3 and a reduction in n-6 fatty acids in the organs and tissues of these mice, in the absence of dietary n-3. As well as presenting an opportunity to investigate the roles played by n-3 fatty acids in the body, our discovery indicates that this technology might be adapted to enrich n-3 fatty acids in animal products such as meat, milk and eggs.

  4. Protective role of n6/n3 PUFA supplementation with varying DHA/EPA ratios against atherosclerosis in mice. (United States)

    Liu, Liang; Hu, Qinling; Wu, Huihui; Xue, Yihong; Cai, Liang; Fang, Min; Liu, Zhiguo; Yao, Ping; Wu, Yongning; Gong, Zhiyong


    The effects of n3 polyunsaturated fatty acids (PUFA) on cardiovascular disease are controversial. We currently explored the effects of various ratios of docosahexaenoic acid (DHA) and eicosapentaenoic acid (EPA) on high-fat-induced atherosclerosis. In model apoE(-/-) mice, high-fat diets (HFD) were partially replaced with fish and algal oils (DHA/EPA 2:1, 1:1 and 1:2) and/or plant oils enriched in linoleic and alpha-linolenic acids with an n6/n3 ratio of 4:1. PUFA supplementation significantly reduced the atherosclerotic plaque area, serum lipid profile, inflammatory response, aortic ROS production, proinflammatory factors and scavenger receptor expression as compared to those in the HFD group. However, plant oils did not have a significant effect on the following: serum HDL-C level; aortic ABCA1, ABCG1 and LAL mRNA expression; and CD36 and LOX-1 protein expression. Compared to the plant-oil-treated group, the DHA/EPA 1:1 group had a smaller atherosclerotic plaque area, higher serum HDL-C levels and lesser CD36 and MSR-1 mRNA expression; the DHA/EPA 2:1 group had lower serum TC, LDL-C and TNF-α levels and lower aortic ROS levels. Our study suggested that n3 PUFA from animals had more potent atheroprotective effects than that from plants. Supplementation involving higher DHA/EPA ratios and an n6/n3 ratio of 4:1 was beneficial for reducing serum "bad cholesterol" and a 1:1 DHA/EPA ratio with an n6/n3 ratio of 4:1 was beneficial for improving serum "good cholesterol" and inhibiting ox-LDL uptake. Our results suggest that achieving an n6/n3 ratio of 4:1 in the diet is also important in addition to having an optimal DHA/EPA ratio. Copyright © 2016 Elsevier Inc. All rights reserved.

  5. Effect of gene transfer of Chlorella vulgaris n-3 fatty acid desaturase ...

    African Journals Online (AJOL)



    Apr 5, 2012 ... Chlorella vulgaris had the gene of n-3 fatty acid desaturase (CvFad3) which can synthesize the precursor of ... vector pEGFP-C3-n-3 and expressed the n-3 Fad gene in mouse breast cancer cells (4T1 cells). Transfection of ..... altering dietary omega-6/omega-3 fatty acid ratios on prostate cancer membrane ...

  6. Early postoperative tumor marker responses provide a robust prognostic indicator for N3 stage gastric cancer. (United States)

    Zhang, Qingrui; Qu, Hui; Sun, Guorui; Li, Zhiqiang; Ma, Shuzhen; Shi, Zhenxing; Zhao, Ensheng; Zhang, Hao; He, Qingsi


    The clinical significance of tumor markers after radical gastrectomy has not been well characterized. The purpose of this study is to evaluate the prognostic value of early postoperative tumor marker normalization in N3 stage gastric cancer (GC) patients. A total of 259 N3 stage GC patients with preoperatively elevated carcinoembryonic antigen (CEA, >5 ng/mL) or carbohydrate antigen 19-9 (CA19-9, >37 U/mL) levels underwent radical gastrectomy were analyzed retrospectively. Early postoperative tumor marker response was considered as a normalization of CEA or CA19-9 levels 4 weeks after surgery. The disease-free survival (DFS) and overall survival (OS) were analyzed. N3 stage GC patients were divided into N3a (n = 157) and N3b (n = 102) groups according to the 8th TNM stage system. Early tumor marker response was identified in 96 of 157 N3a patients (61.15%) and 57 of 102 N3b patients (55.88%). In N3 stage GC patients with a tumor marker response, significant increase was observed in both DFS (25.2 months vs 12.5 months, P early tumor marker response was an independent factor for DFS and OS in N3 stage GC, as well as for depth of invasion and metastatic lymph node rate (P Early postoperative CEA or CA19-9 normalization serves as a strong prognostic indicator in N3 stage GC. Both N3a and N3b patients with increased early postoperative tumor marker levels showed poor outcomes.

  7. Effect of dietary n?3 PUFA supplementation on the muscle transcriptome in older adults


    Yoshino, Jun; Smith, Gordon I.; Kelly, Shannon C.; Julliand, Sophie; Reeds, Dominic N.; Mittendorfer, Bettina


    Abstract Dietary fish oil?derived n?3 PUFA supplementation can increase muscle mass, reduce oxygen demand during physical activity, and improve physical function (muscle strength and power, and endurance) in people. The results from several studies conducted in animals suggest that the anabolic and performance?enhancing effects of n?3 PUFA are at least in part transcriptionally regulated. The effect of n?3 PUFA therapy on the muscle transcriptome in people is unknown. In this study, we used m...

  8. 5 prime -Azido-(3,6- sup 3 H sub 2 )-1-naphthylphthalamic acid, a photoactivatable probe for naphthylphthalamic acid receptor proteins from higher plants: Identification of a 23-kDa protein from maize coleoptile plasma membranes

    Energy Technology Data Exchange (ETDEWEB)

    Zettl, R.; Feldwisch, J.; Schell, J.; Palme, K. (Max-Planck-Inst. fuer Zuechtungsforschung, Koeln (West Germany)); Boland, W. (Univ. Karlsruhe (West Germany))


    1-Naphthylphthalamic acid (NPA) is a specific inhibitor of polar auxin transport that blocks carrier mediated auxin efflux from plant cells. To allow identification of the NPA receptor thought to be part of the auxin efflux carrier, the authors have synthesized a tritiated, photolabile NPA analogue, 5{prime}-azido-(3,6-{sup 3}H{sub 2})NPA (({sup 3}H{sub 2})N{sub 3}NPA). This analogue was used to identify NPA-binding proteins in fractions highly enriched for plasma membrane vesicles isolated from maize coleoptiles (Zea mays L.). Competition studies showed that binding of ({sup 3}H{sub 2})N{sub 3}NPA to maize plasma membrane vesicles was blocked by nonradioactive NPA but not by benzoic acid. After incubation of plasma membrane vesicles with ({sup 3}H{sub 2})N{sub 3}NPA and exposure to UV light, they observed specific photoaffinity labeling of a protein with an apparent molecular mass of 23 kDa. Pretreatment of the plasma membrane vesicles with indole-3-acetic acid or with the auxin-transport inhibitors NPA and 2,3,5-triiodobenzoic acid strongly reduced specific labeling of this protein. This 23-kDa protein was also labeled by addition of 5-azido-(7-{sup 3}H)indole-3-acetic acid to plasma membranes prior to exposure to UV light. The 23-kDa protein was solubilized from plasma membranes by 1% Triton X-100. The possibility that this 23-kDa polypeptide is part of the auxin efflux carrier system is discussed.

  9. Does continuous endurance exercise in water elicit a higher release of ANP and BNP and a higher plasma concentration of FFAs in pre-obese and obese men than high intensity intermittent endurance exercise? ? Study protocol for a randomized controlled trial


    Karner-Rezek, K; Knechtle, B.; Fenzl, M; Gredig, J; Rosemann, T


    Background Atrial natriuretic peptides (ANP) and Brain natriuretic peptides (BNP) stimulate fat cell plasma membrane receptors. They are potent lipolytic agents on isolated fat cells from subcutaneous adipose tissue. The physiological effects of continuous endurance exercise on ANP release and plasma free fatty acids (FFA) concentrations have been well described. The enhancement of fat metabolism using high intensity intermittent exercise protocols has been assessed in more recent investigati...

  10. Higher plasma soluble Receptor for Advanced Glycation End Products (sRAGE) levels are associated with incident cardiovascular disease and all-cause mortality in type 1 diabetes: a 12-year follow-up study

    DEFF Research Database (Denmark)

    Nin, Johanna W M; Jorsal, Anders; Merces Ferreira, Isabel Maria


    To investigate the associations of plasma levels of soluble receptor for advanced glycation end products (sRAGE) with incident cardiovascular disease (CVD) and all-cause mortality in type 1 diabetes and the extent to which any such associations could be explained by endothelial and renal dysfunct......To investigate the associations of plasma levels of soluble receptor for advanced glycation end products (sRAGE) with incident cardiovascular disease (CVD) and all-cause mortality in type 1 diabetes and the extent to which any such associations could be explained by endothelial and renal...

  11. Plasma astrophysics

    CERN Document Server

    Kaplan, S A; ter Haar, D


    Plasma Astrophysics is a translation from the Russian language; the topics discussed are based on lectures given by V.N. Tsytovich at several universities. The book describes the physics of the various phenomena and their mathematical formulation connected with plasma astrophysics. This book also explains the theory of the interaction of fast particles plasma, their radiation activities, as well as the plasma behavior when exposed to a very strong magnetic field. The text describes the nature of collective plasma processes and of plasma turbulence. One author explains the method of elementary

  12. Plasma waves

    CERN Document Server

    Swanson, DG


    Plasma Waves discusses the basic development and equations for the many aspects of plasma waves. The book is organized into two major parts, examining both linear and nonlinear plasma waves in the eight chapters it encompasses. After briefly discussing the properties and applications of plasma wave, the book goes on examining the wave types in a cold, magnetized plasma and the general forms of the dispersion relation that characterize the waves and label the various types of solutions. Chapters 3 and 4 analyze the acoustic phenomena through the fluid model of plasma and the kinetic effects. Th

  13. Erythrocyte levels compared with reported dietary intake of marine n-3 fatty acids in pregnant women

    DEFF Research Database (Denmark)

    Olsen, S.F.; Hansen, Harald S.; Sandstrom, B.


    It is web established that marine n-3 fatty acids measured in erythrocyte phospholipids of non-pregnant subjects reflect the subjects' intake of these fatty acids. In 135 pregnant women in the 30th week of gestation we compared intake of marine n-3 fatty acids and energy, estimated by a combined...... acids in pregnant women may be employed as a qualitative method to rank subjects according to intake of marine n-3 fatty acids; (2) with respect to the power to explain FA-ratio variability, three simple marine food frequency questions were comparable with intake of marine n-3 fatty acids assessed...

  14. Erythrocyte levels compared with reported dietary intake of marine n-3 fatty acids in pregnant women

    DEFF Research Database (Denmark)

    Olsen, S.F.; Hansen, H.S.; Sandstrom, B.


    It is well established that marine n-3 fatty acids measured in erythrocyte phospholipids of non-pregnant subjects reflect the subjects' intake of these fatty acids. In 135 pregnant women in the 30th week of gestation we compared intake of marine n-3 fatty acids and energy, estimated by a combined...... acids in pregnant women may be employed as a qualitative method to rank subjects according to intake of marine n-3 fatty acids; (2) with respect to the power to explain FA-ratio variability, three simple marine food frequency questions were comparable with intake of marine n-3 fatty acids assessed...

  15. Dietary intake and status of n-3 polyunsaturated fatty acids in a population of fish-eating and non-fish-eating meat-eaters, vegetarians, and vegans and the product-precursor ratio [corrected] of α-linolenic acid to long-chain n-3 polyunsaturated fatty acids: results from the EPIC-Norfolk cohort. (United States)

    Welch, Ailsa A; Shakya-Shrestha, Subodha; Lentjes, Marleen A H; Wareham, Nicholas J; Khaw, Kay-Tee


    Intakes of n-3 (omega-3) polyunsaturated fatty acids (PUFAs) are important for health. Because fish is the major source of eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA), non-fish-eaters may have suboptimal n-3 PUFA status, although the importance of the conversion of plant-derived α-linolenic acid (ALA) to EPA and DHA is debated. The objective was to determine intakes, food sources, and status of n-3 PUFAs according to dietary habit (fish-eaters and non-fish-eating meat-eaters, vegetarians, or vegans) and estimated conversion between dietary ALA and circulating long-chain n-3 PUFAs. This study included 14,422 men and women aged 39-78 y from the EPIC (European Prospective Investigation into Cancer and Nutrition)-Norfolk cohort with 7-d diary data and a substudy in 4902 individuals with plasma phospholipid fatty acid measures. Intakes and status of n-3 PUFAs were measured, and the product-precursor ratio [corrected] of ALA to circulating n-3 PUFAs was calculated. Most of the dietary intake of EPA and DHA was supplied by fish; however, meat was the major source in meat-eaters, and spreading fats, soups, and sauces were the major sources in vegetarians. Total n-3 PUFA intakes in non-fish-eaters were 57-80% of those in fish-eaters, but status differences were considerably smaller [corrected]. The estimated product-precursor ratio [corrected] was greater in women than in men and greater in non-fish-eaters than in fish-eaters. Substantial differences in intakes and in sources of n-3 PUFAs existed between the dietary-habit groups, but the differences in status were smaller than expected, possibly because the product-precursor ratio [corrected] was greater in non-fish-eaters than in fish-eaters, potentially indicating increased estimated conversion of ALA. If intervention studies were to confirm these findings, it could have implications for fish requirements.


    Fuschino, Jenny R; Guschina, Irina A; Dobson, Gary; Yan, Norman D; Harwood, John L; Arts, Michael T


    The biosynthesis of nutritionally important polyunsaturated fatty acids (PUFAs) in phytoplankton is influenced by environmental temperature. We investigated the potential of climate warming to alter lipid dynamics of Scenedesmus obliquus (Turpin) Kütz. by comparing lipid and fatty acid (FA) profiles as well as FA metabolism (using [1-(14) C] acetate) at 20°C and 28°C. We documented an overall decline (53%-37%) in the proportion of n-3 PUFA (in particular, of α-linolenic acid [ALA; 18:3n-3]), and a concomitant increase in saturated fatty acids (SAFAs) in total lipids (TLs) at 28°C, consistent with enhanced incorporation of radioactivity from [1-(14) C] acetate into total 16:0, 18:1, and decreased incorporation into 18:2 and 18:3 FA (from 36% to 22% of the total) at 28°C. Glycerophospholipids were also affected by warming; ALA and stearidonic acids (SDAs; 18:4n-3) both decreased (by 13% and 15%, respectively) in phosphatidylcholine (PC) and (by 24% and 20%, respectively) in phosphatidylethanolamine (PE). The characteristic FA in phosphatidylglycerol (PG; 16:1n-13t) increased (by 22%) at 28°C. The activities of desaturases, which add double bonds to FA moieties, comprised the major suite of reactions affected by the temperature increase in TL and polar lipid (PL) classes. Climate modelers predict an increase in the number of extreme heat days in summer at temperate latitudes, with parallel projected increases in water temperatures of shallow water bodies. Our results suggest that the overall decrease in the essential n-3 FA ALA in S. obliquus at higher water temperatures may lower food quality for higher tropic levels, adding another climate-warming stress. Her Majesty the Queen in Right of Canada [2011].

  17. Complete assessment of whole-body n-3 and n-6 PUFA synthesis-secretion kinetics and DHA turnover in a rodent model. (United States)

    Metherel, Adam H; Lacombe, R J Scott; Chouinard-Watkins, Rapha Eumll; Hopperton, Kathryn E; Bazinet, Richard P


    Previous assessments of the PUFA biosynthesis pathway have focused on DHA and arachidonic acid synthesis. Here, we determined whole-body synthesis-secretion kinetics for all downstream products of PUFA metabolism, including direct measurements of DHA and n-6 docosapentaenoic acid (DPAn-6, 22:5n-6) turnover, and compared n-6 and n-3 homologue kinetics. We infused labeled α-linolenic acid (ALA, 18:3n-3), linoleic acid (LNA, 18:2n-6), DHA and DPAn-6 as 2H5-ALA, 13C18-LNA, 13C22-DHA or 13C22-DPAn-6. Eight 11-week-old Long Evans rats fed a 10% fat diet were infused with the labeled PUFAs over 3 h, and plasma enrichment of labeled products was measured every 30 min. The DHA synthesis-secretion rate (94 +/- 34 nmol/day) did not differ from other PUFA products (range, 21.8 +/- 4.3 to 408 +/- 116 nmol/day). Synthesis-secretion rates of n-6 and n-3 PUFA homologues were similar, except 22:4n-6 and DPAn-6 had lower synthesis rates. However, daily turnover from newly synthesized DHA (0.067% +/- 0.023%) was 56-fold to 556-fold slower than all other PUFA turnover and was 130-fold slower than that determined directly from the total plasma unesterified DHA pool. In conclusion, n-6 and n-3 PUFA synthesis-secretion kinetics suggest that differences in turnover, not in synthesis-secretion rates, primarily determine PUFA plasma levels. Copyright © 2017, The American Society for Biochemistry and Molecular Biology.

  18. Influence of maternal dietary n-3 fatty acids on breast milk and liver lipids of rat dams and offspring - a preliminary study

    DEFF Research Database (Denmark)

    Hartvigsen, M.S.; Mu, Huiling; Høy, Carl-Erik


    was based on 10 mol% 18:3n-3 from structured lipid trace levels of 22:6n-3 occurred in breast milk. The 22:6n-3 in liver PL of 1 week old offspring was significantly higher when the diet was based on the specific structured oil (2 mol%) compared to linseed oil. The metabolism of fatty acids may therefore...... be related to their positions in the dietary TAG. In liver PL of 1 week old offspring 22:6n-3 was highest in the groups, in which the breast milk contained pre-formed 22:6n-3. This demonstrates that the milk fatty acids influence the fatty acid composition of liver PL in young offspring. The results showed......The impact of triacylglycerol (TAG) structure and level of n-3 fatty acids on the fatty acid profile of total breast milk lipids and total liver phospholipids (PL) of dams and offspring (1, 3 and 13 weeks of age), when administered during development, was examined. Pregnant rats were fed...

  19. Dietary n-3-polyunsaturated fatty acids and energy balance in overweight or moderately obese men and women: a randomized controlled trial

    Directory of Open Access Journals (Sweden)

    Matthys Colleen C


    Full Text Available Abstract Background Dietary n-3-polyunsaturated fatty acids (n-3-PUFA have been shown to reduce body weight and fat mass in rodents as well as in humans in one small short-term study. We conducted this controlled randomized dietary trial to test the hypothesis that n-3-PUFA lower body weight and fat mass by reducing appetite and ad libitum food intake and/or by increasing energy expenditure. Methods Twenty-six overweight or moderately obese (body mass index 28–33 kg/m2 men and women were included, and received either a diet rich in n-3-PUFA from both plant and marine sources or a control diet. Diets were administered in an isocaloric fashion for 2 weeks followed by 12 weeks of ad libitum intake. The n-3-PUFA and control diets were identical in all regards except for the fatty acid composition. All foods were provided to subjects, and leftovers were weighed back to assess actual food intake accurately for each day of the study. This design gave us 80% power to detect a difference in weight change between the n-3-PUFA and control diet groups of 2.25 kg at an α-error level of 5%. Results Both groups lost similar amounts of weight when these diets were consumed ad libitum for 12 weeks [mean (SD: -3.5 (3.7 kg in the control group vs. -2.8 (3.7 kg in the n-3-PUFA group, F(1,24 = 13.425, p = 0.001 for time effect; F(1,24 = 0.385, p = 0.541 for time × group interaction]. Consistent with this finding, we also found no differences between the n-3-PUFA and control groups with regard to appetite as measured by visual analogue scale, ad libitum food intake, resting energy expenditure as measured by indirect calorimetry, diurnal plasma leptin concentrations, or fasting ghrelin concentrations. Conclusion Our results suggest that dietary n-3-PUFA do not play an important role in the regulation of food intake, energy expenditure, or body weight in humans.

  20. Band-Gap Engineering of Graphene Heterostructures via Substitutional Doping with B3N3. (United States)

    Sawahata, Hisaki; Maruyama, Mina; Omachi, Haruka; Shinohara, Hisanori; Cuong, Nguyen Thanh; Okada, Susumu


    We investigated the energetics and electronic structures of B3N3-doped graphene using the density functional theory with the generalized gradient approximation. Our calculations showed that all of the B3N3-doped graphene structures were semiconductors, irrespective of the periodicity of the B3N3 embedded into the graphene network, in contrast to graphene nanomeshes which are either semiconductors or metals depending on the mesh arrangement. The B3N3-doped graphene has small effective masses for both electron and hole. The band gap in the B3N3-doped graphene networks was inversely proportional to the B3N3 spacing. The total energy of the B3N3-doped graphene was also inversely proportional to the B3N3 spacing. The band gap and total energy further depended on whether the graphene region possessed a Clar structure or not. In particular, the sheets with a Clar structure had a wider band gap and a slightly lower total energy than those without a Clar structure. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  1. Erythrocyte stearidonic acid and other n-3 fatty acids and CHD in the Physicians’ Health Study (United States)

    Intake of marine-based n-3 fatty acids (EPA, docosapentaenoic acid and DHA) is recommended to prevent CHD. Stearidonic acid (SDA), a plant-based n-3 fatty acid, is a precursor of EPA and may be more readily converted to EPA than a-linolenic acid (ALA). While transgenic soyabeans might supply SDA at ...

  2. Fish, n-3 PUFA consumption, and pancreatic cancer risk in Japanese: a large, population-based, prospective cohort study. (United States)

    Hidaka, Akihisa; Shimazu, Taichi; Sawada, Norie; Yamaji, Taiki; Iwasaki, Motoki; Sasazuki, Shizuka; Inoue, Manami; Tsugane, Shoichiro


    Most previous prospective studies in Western countries found no association between consumption of fish and n-3 (ω-3) polyunsaturated fatty acids (PUFAs), such as eicosapentaenoic acid (EPA), docosapentaenoic acid (DPA), and docosahexaenoic acid (DHA), for which the main source is fish, and pancreatic cancer risk. However, prospective evidence is still lacking among populations who have a relatively higher fish consumption. We investigated the association between fish and n-3 PUFA consumption and pancreatic cancer risk in a population-based, prospective study in Japanese men and women. The Japan Public Health Center-based Prospective Study (JPHC study) has enrolled 140,420 subjects. We analyzed data on 82,024 eligible participants aged 45-74 y without a history of cancer who responded to a validated food-frequency questionnaire that included 138 items in 1995 for cohort I and in 1998 for cohort II. Participants were followed through 2010. HRs and corresponding 95% CIs for the highest compared with lowest quartile were calculated by using multivariable-adjusted Cox proportional hazards regression models. During 1,068,774 person-years of follow-up, 449 newly diagnosed pancreatic cancers were identified. After the exclusion of pancreatic cancer cases in the first 3 y of follow-up, we found an inverse association of marine n-3 PUFA (EPA+DPA+DHA) and DHA consumption with pancreatic cancer risk: compared with the lowest quartile, multivariate-adjusted HRs in the highest quartile were 0.70 (95% CI: 0.51, 0.95; P-trend = 0.07) and 0.69 (0.51, 0.94; P-trend = 0.03), respectively. Associations for total fish, n-3 PUFA, EPA, and DPA consumption were similar but were not significant. High n-3 PUFA, especially marine n-3 PUFAs, and DHA consumption was associated with a lower risk of pancreatic cancer in a population with a large variation in fish consumption, although the data apply to only a portion of the JPHC study subjects. © 2015 American Society for Nutrition.

  3. Plasma devices for hydrocarbon reformation

    KAUST Repository

    Cha, Min Suk


    Plasma devices for hydrocarbon reformation are provided. Methods of using the devices for hydrocarbon reformation are also provided. The devices can include a liquid container to receive a hydrocarbon source, and a plasma torch configured to be submerged in the liquid. The plasma plume from the plasma torch can cause reformation of the hydrocarbon. The device can use a variety of plasma torches that can be arranged in a variety of positions in the liquid container. The devices can be used for the reformation of gaseous hydrocarbons and/or liquid hydrocarbons. The reformation can produce methane, lower hydrocarbons, higher hydrocarbons, hydrogen gas, water, carbon dioxide, carbon monoxide, or a combination thereof.

  4. Laser excitation of the n=3 level of positronium for antihydrogen production

    CERN Document Server

    Aghion, S; Ariga, A; Ariga, T; Bonomi, G; Braunig, P; Bremer, J; Brusa, R S; Cabaret, L; Caccia, M; Caravita, R; Castelli, F; Cerchiari, G; Chlouba, K; Cialdi, S; Comparat, D; Consolati, G; Demetrio, A; Di Noto, L; Doser, M; Dudarev, A; Ereditato, A; Evans, C; Ferragut, R; Fesel, J; Fontana, A; Forslund, O K; Gerber, S; Giammarchi, M; Gligorova, A; Gninenko, S N; Guatieri, F; Haider, S; Holmestad, H; Huse, T; Jernelv, I L; Jordan, E; Kellerbauer, A; Kimura, M; Koetting, T; Krasnicky, D; Lagomarsino, V; Lansonneur, P; Lebrun, P; Lehner, S; Liberadzka, J; Malbrunot, C; Mariazzi, S; Marx, L; Matveev, V A; Mazzotta, Z; Nebbia, G; Nedelec, P; Oberthaler, M K; Pacifico, N; Pagano, D; Penasa, L; Petracek, V; Pistillo, C; Prelz, F; Prevedelli, M; Ravelli, L; Resch, L; Rienacker, B; Røhne, O M; Rotondi, A; Sacerdoti, M; Sandaker, H; Santoro, R; Scampoli, P; Smestad, L; Sorrentino, F; Spacek, M; Storey, J; Strojek, I M; Testera, G; Tietje, I; Vamosi, S; Widmann, E; Yzombard, P; Zmeskal, J; Zurlo, N.


    We demonstrate laser excitation of the n=3 state of positronium (Ps) in vacuum. A specially designed high-efficiency pulsed slow positron beam and single shot positronium annihilation lifetime spectroscopy were used to produce and detect Ps. Pulsed laser excitation of n=3 level at 205 nm was monitored via Ps photoionization induced by a second intense laser pulse at 1064 nm. About 15% of the overall positronium emitted in vacuum was excited to n=3 and photoionized. Saturation of both the n=3 excitation and the following photoionization was observed and is explained by a simple rate equation model. Scanning the laser frequency allowed us to extract the positronium transverse temperature related to the width of the Doppler-broadened line. Moreover, preliminary observation of excitation to Rydberg states (n = 15...17) using n=3 as intermediate level was observed, giving an independent confirmation of efficient excitation to the 33P state.

  5. Bariatric surgery reduces fasting total fatty acids and increases n-3 polyunsaturated fatty acids in morbidly obese individuals. (United States)

    Hovland, Anders; Nestvold, Torunn; Bohov, Pavol; Trøseid, Marius; Aukrust, Pål; Berge, Rolf K; Waage-Nielsen, Erik; Retterstøl, Kjetil; Lappegård, Knut Tore


    Obesity is a global pandemic leading to increased mortality and increased risk of cardiovascular disease. Bariatric surgery is an established treatment of obesity leading to weight loss and reduction of mortality. To further elucidate how bariatric surgery improves metabolic control, we explored the fatty acid (FA) profiles in morbidly obese subjects treated with lifestyle intervention and subsequent bariatric surgery. The intervention group consisted of 34 morbidly obese patients scheduled for bariatric surgery and the control group of 17 non-obese patients scheduled for elective laparoscopic procedures. The intervention group had to undergo lifestyle changes preoperatively. Fasting blood samples were drawn at admission, after lifestyle intervention and 1 year after bariatric surgery. At admission, the morbidly obese patients had significantly higher levels of monounsaturated FAs (MUFAs) and lower levels of n-6 polyunsaturated FAs (PUFAs) and n-3 PUFAs than healthy controls (all p-values <.05). In the intervention group, there was a significantly lower level of total FAs after lifestyle intervention, and from admission to 1 year after surgical intervention (both, p < .05), primarily reflecting a lower proportion of saturated FAs (SFAs). Following bariatric surgery, but not after lifestyle changes, there was an increase in the proportion of n-3 PUFA (p < .05) reaching levels not significantly different from healthy controls. Our findings suggest that a reduced proportion of the proposed anti-atherogenic n-3 PUFAs characterizes morbidly obese individuals, and that this FA profile is reversed by bariatric surgery, but not by lifestyle intervention.


    Directory of Open Access Journals (Sweden)

    Eka Yuniasih -


    Full Text Available The purpose of this research was to implement the skimming technique and analyze its influence in the student comprehending reading texts at the eleventh grade (XI TKJ of SMK N 3 Metro. In this research the researcher gave pretest to know the students’ ability in understanding reading texts and posttest to know the result of the students’s ability in reading text after giving the skimming technique.This research was quantitative research which had been conducted in SMK N 3 Metro at the class XI TKJ and followed by 70 students as the sample. The tehnique sampling was cluster random sampling. In collectting the data the researcher used test. The researcher used the test to get the data of student’s reading comprehension through the questions which consisted of 30 multiple choices  about the reading text. This test was used to figure out whether the skimming technique was suitable and could be used by the students in comprehending the reading texts. The analysis which was used by the researcher was t-test. Finally, the data indicates that t observed  = 23.945 is higher than t table = 2.99. Therefore, it can be concluded that Ha is accepted and Ho is rejected. It means that the skimming technique influences the students’ reading comprehension at the eleventh graders of SMK N 3 Metro in the academic year of 2010/2011.

  7. n-3 polyunsaturated fatty acids supplementation enhances hippocampal functionality in aged mice

    Directory of Open Access Journals (Sweden)

    Debora eCutuli


    Full Text Available As major components of neuronal membranes, omega-3 polyunsaturated acids (n-3 PUFA exhibit a wide range of regulatory functions, modulating from synaptic plasticity to neuroinflammation, from oxidative stress to neuroprotection. Recent human and animal studies indicated the n-3 PUFA neuroprotective properties in aging, with a clear negative correlation between n-3 PUFA levels and hippocampal deficits. The present multidimensional study was aimed at associating cognition, hippocampal neurogenesis, volume, neurodegeneration and metabolic correlates to verify n-3 PUFA neuroprotective effects in aging. To this aim 19 month-old mice were given n-3 PUFA mixture, or olive oil or no dietary supplement for 8 weeks during which hippocampal-dependent mnesic functions were tested. At the end of behavioral testing morphological and metabolic correlates were analyzed. n-3 PUFA supplemented aged mice exhibited better object recognition memory, spatial and localizatory memory, and aversive response retention, without modifications in anxiety levels in comparison to controls. These improved hippocampal cognitive functions occurred in the context of an enhanced cellular plasticity and a reduced neurodegeneration. In fact, n-3 PUFA supplementation increased hippocampal neurogenesis and dendritic arborization of newborn neurons, volume, neuronal density and microglial cell number, while it decreased apoptosis, astrocytosis and lipofuscin accumulation in the hippocampus. The increased levels of some metabolic correlates (blood Acetyl-L-Carnitine and brain n-3 PUFA concentrations found in n-3 PUFA supplemented mice also pointed towards an effective neuroprotection.On the basis of the present results n-3 PUFA supplementation appears to be a useful tool in health promotion and cognitive decline prevention during aging.

  8. N-6 and N-3 Fatty Acid Cholesteryl Esters in Relation to Fatal CHD in a Dutch Adult Population: A Nested Case-Control Study and Meta-Analysis

    NARCIS (Netherlands)

    Goede, de J.; Verschuren, W.M.M.; Boer, J.M.A.; Verberne, L.D.M.; Kromhout, D.; Geleijnse, J.M.


    Background: Dietary polyunsaturated fatty acids (PUFA) are inversely related to coronary heart disease (CHD) in epidemiological studies. We examined the associations of plasma n-6 and n-3 PUFA in cholesteryl esters with fatal CHD in a nested case-control study. Additionally, we performed a

  9. High Pancreatic n-3 Fatty Acids Prevent STZ-Induced Diabetes in Fat-1 Mice: Inflammatory Pathway Inhibition (United States)

    Bellenger, Jérôme; Bellenger, Sandrine; Bataille, Amandine; Massey, Karen A.; Nicolaou, Anna; Rialland, Mickaël; Tessier, Christian; Kang, Jing X.; Narce, Michel


    OBJECTIVE Because of confounding factors, the effects of dietary n-3 polyunsaturated fatty acids (PUFA) on type 1 diabetes remain to be clarified. We therefore evaluated whether fat-1 transgenic mice, a well-controlled experimental model endogenously synthesizing n-3 PUFA, were protected against streptozotocin (STZ)-induced diabetes. We then aimed to elucidate the in vivo response at the pancreatic level. RESEARCH DESIGN AND METHODS β-Cell destruction was produced by multiple low-doses STZ (MLD-STZ). Blood glucose level, plasma insulin level, and plasma lipid analysis were then performed. Pancreatic mRNA expression of cytokines, the monocyte chemoattractant protein, and GLUT2 were evaluated as well as pancreas nuclear factor (NF)-κB p65 and inhibitor of κB (IκB) protein expression. Insulin and cleaved caspase-3 immunostaining and lipidomic analysis were performed in the pancreas. RESULTS STZ-induced fat-1 mice did not develop hyperglycemia compared with wild-type mice, and β-cell destruction was prevented as evidenced by lack of histological pancreatic damage or reduced insulin level. The prevention of β-cell destruction was associated with no proinflammatory cytokine induction (tumor necrosis factor-α, interleukin-1β, inducible nitric oxide synthase) in the pancreas, a decreased NF-κB, and increased IκB pancreatic protein expression. In the fat-1–treated mice, proinflammatory arachidonic-derived mediators as prostaglandin E2 and 12-hydroxyeicosatetraenoic acid were decreased and the anti-inflammatory lipoxin A4 was detected. Moreover, the 18-hydroxyeicosapentaenoic acid, precursor of the anti-inflammatory resolvin E1, was highly increased. CONCLUSIONS Collectively, these findings indicate that fat-1 mice were protected against MLD-STZ–induced diabetes and pointed out for the first time in vivo the beneficial effects of n-3 PUFA at the pancreatic level, on each step of the development of the pathology—inflammation, β-cell damage—through cytokine

  10. Progress in Understanding Error-field Physics in NSTX Spherical Torus Plasmas

    Energy Technology Data Exchange (ETDEWEB)

    E. Menard, R.E. Bell, D.A. Gates, S.P. Gerhardt, J.-K. Park, S.A. Sabbagh, J.W. Berkery, A. Egan, J. Kallman, S.M. Kaye, B. LeBlanc, Y.Q. Liu, A. Sontag, D. Swanson, H. Yuh, W. Zhu and the NSTX Research Team


    The low aspect ratio, low magnetic field, and wide range of plasma beta of NSTX plasmas provide new insight into the origins and effects of magnetic field errors. An extensive array of magnetic sensors has been used to analyze error fields, to measure error field amplification, and to detect resistive wall modes in real time. The measured normalized error-field threshold for the onset of locked modes shows a linear scaling with plasma density, a weak to inverse dependence on toroidal field, and a positive scaling with magnetic shear. These results extrapolate to a favorable error field threshold for ITER. For these low-beta locked-mode plasmas, perturbed equilibrium calculations find that the plasma response must be included to explain the empirically determined optimal correction of NSTX error fields. In high-beta NSTX plasmas exceeding the n=1 no-wall stability limit where the RWM is stabilized by plasma rotation, active suppression of n=1 amplified error fields and the correction of recently discovered intrinsic n=3 error fields have led to sustained high rotation and record durations free of low-frequency core MHD activity. For sustained rotational stabilization of the n=1 RWM, both the rotation threshold and magnitude of the amplification are important. At fixed normalized dissipation, kinetic damping models predict rotation thresholds for RWM stabilization to scale nearly linearly with particle orbit frequency. Studies for NSTX find that orbit frequencies computed in general geometry can deviate significantly from those computed in the high aspect ratio and circular plasma cross-section limit, and these differences can strongly influence the predicted RWM stability. The measured and predicted RWM stability is found to be very sensitive to the E × B rotation profile near the plasma edge, and the measured critical rotation for the RWM is approximately a factor of two higher than predicted by the MARS-F code using the semi-kinetic damping model.


    Directory of Open Access Journals (Sweden)

    Asuman Şahan


    Full Text Available The purpose of this study was to investigate the effects of 16 weeks of n-3 LC-PUFA (omega 3 long-chain polyunsaturated fatty acid supplementation on tennis skill acquisition in 10-12 year old girls. This research was a single-blind placebo-controlled trial. 29 girls (10-12 years of age who had never played tennis before took part in the study. Ball Throws to the Target (BTT and Tennis Ability Test (TAT were performed three times. Before participants were allocated to the groups and received n-3 LC-PUFA or olive oil, they underwent preparatory training for three weeks. Anthropometric measurements, nutrition analysis, and 1st BTT and TAT tests were performed and they continued the preparatory training until the 3rd week. Then they were randomly allocated to two groups to receive either n-3 LC-PUFA (omega group; 670 mg · day-1; n=16 or olive oil (placebo group; 670 mg · day-1; n=13 during 16 weeks of tennis training which involved 3 hours per week for 19 weeks. The results show that significant improvements in TAT were found in both groups but the omega group had significantly higher scores than the placebo group at the 3rd measurements. Although there were no differences between groups at all measurements of BTT, the omega group showed significant improvement between the 1st and 3rd measurements. This study suggests that daily 670 mg n-3 LC-PUFA supplementation for 16 weeks might improve tennis ability test scores of 10-12 year old girls.

  12. Rovibrational states of N3- and CO2 up to high J: a theoretical study beyond fc-CCSD(T). (United States)

    Sebald, Peter; Stein, Christopher; Oswald, Rainer; Botschwina, Peter


    An accurate near-equilibrium potential energy surface (PES) has been constructed for the azide ion (N(3)(-)) on the basis of coupled cluster calculations up to CCSDTQ (Kállay, M.; Surján, P. R. J. Chem. Phys. 2001, 115, 2945.), with contributions from inner-shell correlation and special relativity being taken into account as well. A larger number of rovibrational states has been investigated by variational calculations with Watson's isomorphic Hamiltonian for linear molecules. Analogous calculations for CO2 demonstrate the high quality of this type of calculations. The G(v) values of the symmetric stretching and bending vibration of 14N(3)(-) are predicted to be ν1 = 1307.9 cm(-1) and ν2 = 629.3 cm(-1), with an uncertainty of ca. 1 cm(-1). Fermi resonance is less pronounced for the lower polyads of 14N(3)(-) compared with 12C16O2 but is as strong as in CO2 for the lowest diad of isotopologue 15-14-15. The band origin of the antisymmetric stretching vibration of 14N(3)(-) is calculated to be ν3 = 1986.4 cm(-1), only 0.1 cm(-1) lower than the experimental value. The corresponding vibrational transition dipole moment is predicted to be as large as μ = 0.476 D, 46% higher than calculated for CO2. The perturbed combination tone (01(1)1), which was accessible through diode laser IR spectroscopy, undergoes anharmonic interaction with at least two other vibrational states.

  13. Maternal Plasma Phosphatidylcholine Fatty Acids and Atopy and Wheeze in the Offspring at Age of 6 Years

    Directory of Open Access Journals (Sweden)

    Katharine C. Pike


    Full Text Available Variation in exposure to polyunsaturated fatty acids (PUFAs might influence the development of atopy, asthma, and wheeze. This study aimed to determine whether differences in PUFA concentrations in maternal plasma phosphatidylcholine are associated with the risk of childhood wheeze or atopy. For 865 term-born children, we measured phosphatidylcholine fatty acid composition in maternal plasma collected at 34 weeks’ gestation. Wheezing was classified using questionnaires at 6, 12, 24, and 36 months and 6 years. At age of 6 years, the children underwent skin prick testing, fractional exhaled nitric oxide (FENO measurement, and spirometry. Maternal n-6 fatty acids and the ratio of n-3 to n-6 fatty acids were not associated with childhood wheeze. However, higher maternal eicosapentaenoic acid, docosahexaenoic acid, and total n-3 fatty acids were associated with reduced risk of non-atopic persistent/late wheeze (RR 0.57, 0.67 and 0.69, resp. P=0.01, 0.015, and 0.021, resp.. Maternal arachidonic acid was positively associated with FENO (P=0.024. A higher ratio of linoleic acid to its unsaturated metabolic products was associated with reduced risk of skin sensitisation (RR 0.82, P=0.013. These associations provide some support for the hypothesis that variation in exposure to n-6 and n-3 fatty acids during pregnancy influences the risk of childhood wheeze and atopy.

  14. Markers of neuroprotection of combined EPA and DHA provided by fish oil are higher than those of EPA (Nannochloropsis) and DHA (Schizochytrium) from microalgae oils in Wistar rats. (United States)

    Lopes, Paula A; Bandarra, Narcisa M; Martins, Susana V; Martinho, Joana; Alfaia, Cristina M; Madeira, Marta S; Cardoso, Carlos; Afonso, Cláudia; Paulo, Maria C; Pinto, Rui M A; Guil-Guerrero, José L; Prates, José A M


    To overcome the current overexploitation of fish rich in n-3 long chain polyunsaturated fatty acids (LCPUFA), microalgae have become a promising marine lipid source. The purpose of this study was to assess eicosapentaenoic acid (EPA, 20:5n-3) and docosahexaenoic acid (DHA, 22:6n-3), isolated or combined from distinct marine origins, on the promotion of neuroprotective effects. The experiment lasted for 10 weeks and involved 32 Wistar rats, divided into 4 diets (n = 8): a diet rich in milk fat was taken as control (Milk Fat) and compared to n-3 LCPUFA enriched diets, either in EPA + DHA form through fish oil (Fish Oil), or EPA through Nannochloropsis oil (Nanno), or DHA through Schizochytrium oil (Schyzo), while maintaining Milk Fat incorporation. Plasma lipid profile and dopamine levels were more beneficial in Fish Oil diet. In addition, n-3 LCPUFA incorporation was found increased in liver and erythrocytes from Fish Oil fed rats, suggesting that fish oil is a better dietary source for fatty acids deposition in the organism than microalgae. The Forced Swimming Test revealed a positive behavioural action of EPA + DHA, in opposition to Milk Fat and Nanno diets, which had higher immobile times. mRNA levels of serotonin receptors, HT1A and HT2A along with CREB, the transmission factor for learning and memory, were higher in the hippocampus of rats fed n-3 LCPUFA diets comparative to Milk Fat. Taken together, the combination of EPA and DHA from fish oil can counteract the undesirable health effects of saturated fat based diets and benefit, in the long run, neurological function.

  15. Relationships between n-3 polyunsaturated fatty acid intake, serum 25 hydroxyvitamin D, food consumption, and nutritional status among adolescents. (United States)

    Lopes, Mariana P; Giudici, Kelly V; Marchioni, Dirce M; Fisberg, Regina M; Martini, Lígia A


    We have hypothesized that higher n-3 polyunsaturated fatty acid (PUFA) intake is associated with better lipid profile, higher 25 hydroxyvitamin D (25(OH)D) serum concentrations, and healthy food consumption and nutritional status. Thus, this study aimed to evaluate the relationships between n-3 PUFA intake, serum 25(OH)D, lipid profile, nutritional status, and food consumption among adolescents. A total of 198 Brazilian adolescents (51% male), with mean age of 16.3 ± 1.4 years, were enrolled in this cross-sectional study. Blood was collected for 25(OH)D and lipid profile serum measurement. Weight and height were measured, and food consumption was accessed by a 24-hour food record (n = 69). Analysis of variance, the Student t test, and Pearson correlation were performed using SPSS software (SPSS, Chicago, IL, USA). The prevalence of vitamin D inadequacy (25(OH)D, body mass index (r = -0.294; P body mass index (r = -0.286; P = .017), total cholesterol (r = -0.292; P = .015), and low-density lipoprotein cholesterol (r = -0.333; P = .005) and positively correlated with the intake of fat meats and eggs (r = 0.391; P = .006), vegetable proteins (r = 0.297; P = .048), fats/oils (r = 0.574; P nutritional status and favorable lipid profile. Food groups usually found in Brazilian traditional meals (characterized by rice, beans, meat, and vegetables) were associated with higher n-3 PUFA intake, which may contribute to prevent the development of noncommunicable diseases in adolescence and adulthood. Copyright © 2015 Elsevier Inc. All rights reserved.

  16. Healthy yogurt fortified with n-3 fatty acids from vegetable sources. (United States)

    Dal Bello, B; Torri, L; Piochi, M; Zeppa, G


    The concentration of n-3 polyunsaturated fatty acids (PUFA) in yogurt was increased using 5 different vegetable oils obtained from flaxseed, Camelina sativa, raspberry, blackcurrant, and Echium plantagineum. The vegetable oils were added to partially skim milk before lactic fermentation at a concentration adequate enough to cover at least 10% of the recommended daily intake of 2 g/d of α-linolenic acid according to EC regulation no. 432/2012. Microbiological (lactobacilli and streptococci, yeast, and molds), chemical (pH, syneresis, proximate composition, fatty acids, oxidation stability), and sensory evaluations were assessed for all of the fortified yogurts after 0, 7, 14, and 21 d of storage at 4°C. Sensory evaluations were conducted at 21 d of storage at 4°C. Among the yogurts produced, those that were supplemented with flaxseed and blackcurrant oils exhibited the highest α-linolenic acid content (more than 200mg/100 g of yogurt) at the end of storage. The addition of oil did not influence the growth of lactic acid bacteria that were higher than 10(7) cfu/g at 21 d of storage. All of the yogurts were accepted by consumers, except for those supplemented with raspberry and E. plantagineum oils due to the presence of off flavors. Copyright © 2015 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  17. Can long chain n-3 fatty acids from feed be converted into very long chain n-3 fatty acids in fillets from farmed rainbow trout (Oncorhynchus mykiss)? (United States)

    Lušnic Polak, M.; Demšar, L.; Luzar, U.; Polak, T.


    The link between the basic chemical and fatty acid composition of trout feed on one hand and trout (Oncorhynchus mykiss) meat (fillet) was investigated.. The content of 52 fatty acids from feed and trout meat lipids was determined by in-situ transesterification and capillary column gas-liquid chromatography. On average, 100 g of trout feed contained 7.4 g of moisture, 47.7 g of proteins, 6.09 g of ash, 21.4 g of fat, and as for fatty acid composition, 47.8 wt. % were monounsaturated, 34.0 wt. % were polyunsaturated and 18.1 wt. % were saturated fatty acids, with the PS ratio 1.88, n-6/n-3 ratio 1.74, 0.80 wt. % of trans and 3.28 wt. % of very long chain n-3 fatty acids. On average, 100 g of trout meat contained 76.1 g of moisture, 21.4 g of proteins, 1.34 g of ash, 2.52 g of fat, and in the fatty acid composition 42.1 wt. % were monounsaturated, 38.2 wt. % were polyunsaturated and 18.9 wt. % were saturated fatty acids, with the PS ratio 2.02, n-6/n-3 ratio 0.98, 0.95 wt. % of trans and 13.25 wt. % of very long chain n-3 fatty acids.

  18. The ITER 3D Magnetic Diagnostic Response to Applied n=3 and n=4 RMP's

    Energy Technology Data Exchange (ETDEWEB)

    Lazerson, S A [PPPL


    The ITER magnetic diagnostic response to applied n=3 and n=4 RMPs has been calculated for the 15MA scenario. The VMEC code was utilized to calculate free boundary 3D ideal MHD equilibria, where the non-stellarator symmetric terms were included in the calculation. This allows an assessment to be made of the possible boundary displacements due to RMP application in ITER. As the VMEC code assumes a continuous set of nested flux surface, the possibility of island and stochastic region formation is ignored. At the start of the current at-top (L-Mode) application of n = 4 RMP's indicates approximately 1 cm peak-to-peak displacements on the low field side of the plasma while later in the shot (H-mode) perturbations as large as 3 cm are present. Forward modeling of the ITER magnetic diagnostics indicates significant non-axisymmetric plasma response, exceeding 10% the axisymmetric signal in many of the flux loops. Magnetic field probes seem to indicate a greater robustness to 3D effects but still indicate large sensitivities to 3D effects in a number of sensors. Forward modeling of the diagnostics response to 3D equilibria allows assessment of diagnostics design and control scenarios.

  19. Regulation of Cholesterol Metabolism in Liver: Link to NAFLD and Impact of n-3 PUFAs. (United States)

    Bae, Jin-Sik; Oh, Ah-Reum; Cha, Ji-Young


    Non-alcoholic fatty liver disease (NAFLD) is one of the most common causes of chronic liver disease that affects one-third of adults in westernized countries. NAFLD represents a wide spectrum of hepatic alterations, ranging from simple triglyceride accumulation in the liver to steatohepatitis. Several pharmaceutical approaches to NAFLD management have been examined, but no particular treatment has been considered both safe and highly effective. Growing evidence reveal that supplemental fish oil, seal oil and purified n-3 fatty acids can reduce hepatic lipid content in NAFLD through extensive regulation by inhibiting lipogenesis, promoting fatty acid oxidation and suppressing inflammatory responses. Recently, the fat-1 transgenic mice capable of converting n-6 to n-3 polyunsaturated fatty acids (PUFAs) have been used to examine the effects of endogenous n-3 PUFAs on NAFLD. The increased n-3 PUFAs in fat-1 transgenic mice reduced diet-induced hyperlipidemia and fatty liver through induction of CYP7A1 expression and activation of cholesterol catabolism to bile acid. This article introduces the n-3 PUFAs, and addresses the evidence and mechanisms by which endogenously synthesized n-3 PUFAs or increased dietary n-3 PUFAs may ameliorate NAFLD.

  20. Effect of antioxidants on stabilization of meat products fortified with n-3 fatty acids. (United States)

    Lee, S; Faustman, C; Djordjevic, D; Faraji, H; Decker, E A


    The effects of an n-3 oil emulsion, with and without added antioxidants, on lipid oxidation in n-3 polyunsaturated fatty acid (PUFA)-fortified meat products were studied. An emulsion of n-3 PUFAs was prepared (25% algal oil, 2.5% whey protein isolates, 10mM sodium citrate, 0.2% potassium sorbate, 500ppm of 70% mixed tocopherols, 100μM EDTA, pH 3, pasteurized at 75°C for 30min) and incorporated into fresh ground turkey, and fresh pork sausage (20% fat) to achieve a concentration of 500mg n-3 PUFA/110g meat. An antioxidant combination containing rosemary (0.2% w/w; radical quencher), citrate (0.5% w/w; sequestrant) and erythorbate (1g/kg product; reductant) was prepared and incorporated into ground turkey patties (5cm dia, 1.5cm thick) or fresh pork sausages (5cm dia, 1.5cm thick). Meat products were stored at 4°C or -18°C and analyzed for color (L*, a*, b* values), lipid oxidation (TBARS and lipid hydroperoxides) and n-3 PUFA profile. a* Values of refrigerated ground turkey patties decreased with storage, and an antioxidant combination effect was observed after 4 days (Psausages at 4°C, control+antioxidant (CON+ANTI), and n-3+antioxidant (n-3+ANTI) groups showed greater a* values than controls (CON) indicating that the antioxidant combination stabilized meat color. TBARS and lipid hydroperoxides of both n-3 PUFA-enhanced meat products increased with storage (P0.05). These results provide support for including antioxidant protection in n-3 PUFA fortified meat products.

  1. Very low n-3 long-chain polyunsaturated fatty acid status in Austrian vegetarians and vegans. (United States)

    Kornsteiner, Margit; Singer, Ingrid; Elmadfa, Ibrahim


    The objective of the study was to collect data on dietary fat intake of omnivores, vegetarians, vegans and semi-omnivores as well as its impact on n-3 and n-6 fatty acids in long-term markers such as sphingolipids, phosphatidylcholine (PC), phosphatidylserine (PS), phosphatidylethanolamine (PE) as well as the calculated sphingo- and phospholipids (SPL) of erythrocytes. The present observational study included 98 Austrian adult volunteers of both genders, of which 23 were omnivores, 25 vegetarians, 37 vegans, and 13 semi-omnivores. Information on anthropometry using measured body weight and height was obtained. The amount and composition of ingested fat were calculated from 24-hour recalls and the fatty acid pattern in the phospholipids was assessed using gas chromatography. The unbalanced n-6/n-3 ratio and the limited dietary sources of eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA) in vegans and vegetarians led to reductions in C20:5n-3, C22:5n-3, C22:6n-3 and total n-3 fatty acids in SPL, PC, PS and PE compared with omnivores and semi-omnivores. The total content of polyunsaturated fatty acids, monounsaturated fatty acids and saturated fatty acids remained unchanged. The vegetarian diet, with an average n-6/n-3 ratio of 10/1, promotes biochemical n-3 tissue decline. To ensure physical, mental and neurological health vegetarians have to reduce the n-6/n-3 ratio with an additional intake of direct sources of EPA and DHA, regardless of age and gender. (c) 2008 S. Karger AG, Basel.

  2. Higgs boson gluon-fusion production beyond threshold in N$^3$LO QCD

    CERN Document Server

    Anastasiou, Charalampos; Dulat, Falko; Furlan, Elisabetta; Gehrmann, Thomas; Herzog, Franz; Mistlberger, Bernhard


    In this article, we compute the gluon fusion Higgs boson cross-section at N3LO through the second term in the threshold expansion. This calculation constitutes a major milestone towards the full N3LO cross section. Our result has the best formal accuracy in the threshold expansion currently available, and includes contributions from collinear regions besides subleading corrections from soft and hard regions, as well as certain logarithmically enhanced contributions for general kinematics. We use our results to perform a critical appraisal of the validity of the threshold approximation at N3LO in perturbative QCD.

  3. N3 Bias Field Correction Explained as a Bayesian Modeling Method

    DEFF Research Database (Denmark)

    Larsen, Christian Thode; Iglesias, Juan Eugenio; Van Leemput, Koen


    Although N3 is perhaps the most widely used method for MRI bias field correction, its underlying mechanism is in fact not well understood. Specifically, the method relies on a relatively heuristic recipe of alternating iterative steps that does not optimize any particular objective function....... In this paper we explain the successful bias field correction properties of N3 by showing that it implicitly uses the same generative models and computational strategies as expectation maximization (EM) based bias field correction methods. We demonstrate experimentally that purely EM-based methods are capable...... of producing bias field correction results comparable to those of N3 in less computation time....

  4. Replenishment of Docosahexaenoic Acid (DHA) in Dietary n-3-Deficient Mice Fed DHA in Triglycerides or Phosphatidylcholines after Weaning. (United States)

    Wang, Dan-Dan; Wu, Fang; Wen, Min; Ding, Lin; Du, Lei; Xue, Chang-Hu; Xu, Jie; Wang, Yu-Ming


    Previous studies have shown that DHA in triglyceride (TG) and phosphatidylcholine (PC) forms are different in their bioavailability. The aim of this study was to investigate the comparative effects of DHA-TG and DHA-PC on tissue DHA accretion in dietary n-3 polyunsaturated fatty acid deficient (n-3 Def) mice. The mice were fed with n-3 Def diet containing DHA-TG or DHA-PC (5 g/kg diet) for 2, 4, 7, or 14 d after weaning, respectively. The DHA levels in the cortex, liver, testis, and erythrocytes were analyzed by gas chromatography. For liver, DHA mainly existed in hepatic phospholipids relative to triglycerides. Both DHA-TG and DHA-PC could recover the hepatic DHA to a normal level. Interestingly, DHA-TG was more effective in increasing the DHA level in hepatic triglycerides, and DHA-PC was more effective in increasing the DHA level in hepatic phospholipids. For erythrocytes, during the first 7 d, no difference was observed after dietary DHA-TG and DHA-PC but a significantly higher DHA percentage was detected in the DHA-PC group after 14 d. For cortex, the DHA-TG group showed a higher cortical DHA level at the 4th day, but the DHA-PC group showed a higher cortical DHA level with a greater slope from Day 7 to Day 14, and the same trend was observed in testis. But unexpectedly, the DHA level in testis showed a downtrend from Day 7 to Day 14. This study suggests that, under dietary n-3-deficient condition, both DHA-TG and DHA-PC could recover the DHA level in tissues after weaning, and DHA-PC showed a better supplemental effect. Dietary DHA is essential for neurodevelopment which is usually accompanied by large amounts of DHA accretion in the brain. Our present study showed that DHA-PC had a better efficiency for DHA accretion in the brain and other tissues compared with DHA-TG. The findings are supposed to pave the way for the DHA in phospholipids as a novel nutrient added into the infant formula and assisted food for neurodevelopment. © 2018 Institute of Food

  5. Plasma physics

    CERN Document Server

    Drummond, James E


    A historic snapshot of the field of plasma physics, this fifty-year-old volume offers an edited collection of papers by pioneering experts in the field. In addition to assisting students in their understanding of the foundations of classical plasma physics, it provides a source of historic context for modern physicists. Highly successful upon its initial publication, this book was the standard text on plasma physics throughout the 1960s and 70s.Hailed by Science magazine as a ""well executed venture,"" the three-part treatment ranges from basic plasma theory to magnetohydrodynamics and microwa

  6. n-3 Fatty acids consumed from fish and risk of atrial fibrillation or flutter

    DEFF Research Database (Denmark)

    Frost, Lars; Vestergaard, Peter


    of 47 949 participants (mean age: 56 y) in the Danish Diet, Cancer, and Health Study, we investigated the relation between the consumption of n-3 fatty acids from fish estimated from a detailed semiquantitative food questionnaire and risk of atrial fibrillation or flutter. The subjects were followed up......BACKGROUND: Experimental studies have shown that n-3 polyunsaturated fatty acids in fish may have antiarrhythmic properties. OBJECTIVE: We examined the association between consumption of n-3 fatty acids from fish and risk of atrial fibrillation or flutter. DESIGN: In a prospective cohort study...... in the Danish National Registry of Patients for the occurrence of atrial fibrillation or flutter and in the Danish Civil Registration System (vital status and emigration). The consumption of n-3 fatty acids from fish was analyzed as sex-specific quintiles with the use of Cox proportional hazards models. RESULTS...

  7. Dietary n-3 fatty acids promote arrhythmias during acute regional myocardial ischemia in isolated pig hearts

    NARCIS (Netherlands)

    Coronel, R.; Wilms-Schopman, F.J.; den Ruijter, H.M.; Belterman, C.N.; Schumacher, C.A.; Opthof, T.; Hovenier, R.; Lemmens, A.G.; Terpstra, A.H.; Katan, M.B.; Zock, P.


    Objective: Dietary supplementation with fish oil-derived n-3 fatty acids reduces mortality in patients with myocardial infarction, but may have adverse effects in angina patients. The underlying electrophysiologic mechanisms are poorly understood. We studied the arrhythmias and the

  8. Flow Simulation of N3-X Hybrid Wing-Body Configuration (United States)

    Kim, Hyoungjin; Liou, Meng-Sing


    System studies show that a N3-X hybrid wing-body aircraft with a turboelectric distributed propulsion system using a mail-slot inlet/nozzle nacelle can meet the environmental and performance goals for N+3 generation transports (three generations beyond the current air transport technology level) set by NASA s Subsonic Fixed Wing Project. In this study, a Navier-Stokes flow simulation of N3-X on hybrid unstructured meshes was conducted, including the mail-slot propulsor. The geometry of the mail-slot propulsor was generated by a CAD (Computer-Aided Design)-free shape parameterization. A body force approach was used for a more realistic and efficient simulation of the turning and loss effects of the fan blades and the inlet-fan interactions. Flow simulation results of the N3-X demonstrates the validity of the present approach.

  9. Beneficial effect of n-3 polyunsaturated fatty acids on inflammation and analgesic use in psoriatic arthritis: a randomized, double blind, placebo-controlled trial. (United States)

    Kristensen, S; Schmidt, E B; Schlemmer, A; Rasmussen, C; Johansen, M B; Christensen, J H


    This study aimed to investigate the effects of marine n-3 polyunsaturated fatty acids (PUFAs) on disease activity, use of analgesics, and inflammatory biomarkers in patients with psoriatic arthritis (PsA). Patients with established PsA (n = 145) were investigated in a randomized, double-blind, placebo-controlled study. The participants received a supplement of 3 g n-3 PUFA/day or 3 g olive oil/day (control) for 24 weeks. Outcome measures for disease activity, use of analgesics, and leukotriene formation from activated granulocytes were assessed at baseline and at study end. In total, 145 patients were included and 133 completed the study. After 24 weeks, the n-3 PUFA group showed a decrease in Disease Activity Score (DAS28-CRP), 68 tender joint count, enthesitis score, and psoriasis area and severity index, although not significantly different from the controls. There was a significant reduction in non-steroidal anti-inflammatory drug (NSAID) and paracetamol use compared with controls (p = 0.04). In addition, the participants in the n-3 PUFA group had significantly lower formation of leukotriene B4 (p = 0.004) from stimulated granulocytes and significantly higher formation of leukotriene B5 (p < 0.001) compared with controls. The n-3 PUFA-supplemented group showed improvement in outcome measures for disease activity, although the difference between the groups was not statistically significant. However, use of NSAIDs and paracetamol was significantly reduced in the n-3 PUFA group compared to the control group. Finally, there was a significant decrease in leukotriene B4 formation in the n-3 PUFA group compared with controls.

  10. Describing Paenibacillus mucilaginosus strain N3 as an efficient plant growth promoting rhizobacteria (PGPR)


    Dweipayan Goswami; Swapnsinh Parmar; Hemendrasinh Vaghela; Pinakin Dhandhukia; Janki N. Thakker


    Bacterium Paenibacillus mucilaginosus strain N3 was isolated from agricultural farm soil (located at Boriavi village, Gujarat, India). Isolate showed an evidence of non-symbiotic nitrogen fixation, when grown in nitrogen-free bromothymol blue growth medium. It was tested positive for direct plant-growth-promoting traits like Indole-3-acetic acid production, solubilization of Tri-calcium-phosphate, and ammonia production. Further, N3 isolate was tested positive for siderophore production of ca...

  11. n-3 fatty acids and cardiovascular outcomes in patients with dysglycemia

    DEFF Research Database (Denmark)

    Bosch, Jackie; Gerstein, Hertzel C; Dagenais, Gilles R


    The use of n-3 fatty acids may prevent cardiovascular events in patients with recent myocardial infarction or heart failure. Their effects in patients with (or at risk for) type 2 diabetes mellitus are unknown.......The use of n-3 fatty acids may prevent cardiovascular events in patients with recent myocardial infarction or heart failure. Their effects in patients with (or at risk for) type 2 diabetes mellitus are unknown....

  12. Are n-3 PUFA dietary recommendations met in in-hospital and school catering? (United States)

    Molendi-Coste, O; Legry, V; Leclercq, I A


    Literature provides compelling evidence for the health benefits of n-3 polyunsaturated fatty acids (PUFA) consumption and low n-6/n-3 ratio, in particular, on inflammation and metabolic syndrome prevention and treatment. Consequently, recommendations were established for adequate n-3 PUFA supplies in the general population. The aim of our study was to evaluate the fatty acid (FA) profile in collective catering in relation to those recommendations. We obtained composition of lunches provided by the Township of Lille (France) to children and adults, and of "standard", "low-fat" and "for diabetic" menus from the catering service of St Luc university hospital (Brussels, Belgium). The average proportions of fish, meat, oils, and dairy were used to estimate total, saturated, monounsaturated and polyunsaturated (n-6 and n-3) FA contents. We used official tables of foodstuffs composition provided by the French Agency for Food Safety, the project "Nutritional Composition of Aquatic Products", the French Institute for Nutrition, and the USDA National Nutrient Database for Standard Reference. French guidelines were taken as reference for daily recommended intakes. n-3 PUFA content in lunches provided by municipal catering and in in-hospital menus were slightly below recommended intakes. In the latter, n-3 PUFA enriched margarine contributed for 50% to daily intakes. Despite, the n-6/n-3 ratio was too high, especially in municipal catering (around 20), related to excessive n-6 PUFA supply. Our results highlight that meeting n-3 PUFA nutritional recommendation remains challenging for collective catering. A detailed analysis of provided menus represents a powerful tool to increase awareness and foster improvement in practice.

  13. Effects of various n-3/n-6 fatty acid ratios in diet on the tissue fatty ...

    African Journals Online (AJOL)

    Gerna Coetzee

    The results of this experiment showed that substitution of Famarol oil with Canola oil in broiler diets can increase the ratio of n-6 to n-3 fatty acids in broiler carcasses and abdominal fat pads to 5:1, a ratio more suitable for human health. Increasing the level of n-3 fatty acids in the diets was also effective in reducing the level ...

  14. Role of n-3 Polyunsaturated Fatty Acids and Exercise in Breast Cancer Prevention: Identifying Common Targets


    Abdelmagid, Salma A.; MacKinnon, Jessica L.; Janssen, Sarah M.; Ma, David W.L.


    Diet and exercise are recognized as important lifestyle factors that significantly influence breast cancer risk. In particular, dietary n-3 polyunsaturated fatty acids (PUFAs) have been shown to play an important role in breast cancer prevention. Growing evidence also demonstrates a role for exercise in cancer and chronic disease prevention. However, the potential synergistic effect of n-3 PUFA intake and exercise is yet to be determined. This review explores targets for breast cancer prevent...

  15. Randomized Controlled Trial Examining the Effects of Fish Oil and Multivitamin Supplementation on the Incorporation of n-3 and n-6 Fatty Acids into Red Blood Cells

    Directory of Open Access Journals (Sweden)

    Andrew Pipingas


    Full Text Available The present randomized, placebo-controlled, double-blind, parallel-groups clinical trial examined the effects of fish oil and multivitamin supplementation on the incorporation of n-3 and n-6 fatty acids into red blood cells. Healthy adult humans (n = 160 were randomized to receive 6 g of fish oil, 6 g of fish oil plus a multivitamin, 3 g of fish oil plus a multivitamin or a placebo daily for 16 weeks. Treatment with 6 g of fish oil, with or without a daily multivitamin, led to higher eicosapentaenoic acid (EPA composition at endpoint. Docosahexaenoic acid (DHA composition was unchanged following treatment. The long chain LC n-3 PUFA index was only higher, compared to placebo, in the group receiving the combination of 6 g of fish oil and the multivitamin. Analysis by gender revealed that all treatments increased EPA incorporation in females while, in males, EPA was only significantly increased by the 6 g fish oil multivitamin combination. There was considerable individual variability in the red blood cell incorporation of EPA and DHA at endpoint. Gender contributed to a large proportion of this variability with females generally showing higher LC n-3 PUFA composition at endpoint. In conclusion, the incorporation of LC n-3 PUFA into red blood cells was influenced by dosage, the concurrent intake of vitamin/minerals and gender.

  16. Cytotoxic and mutagenic properties of regioisomeric O²-, N3- and O⁴-ethylthymidines in bacterial cells. (United States)

    Zhai, Qianqian; Wang, Pengcheng; Wang, Yinsheng


    Exposure to environmental agents and endogenous metabolism can both give rise to DNA alkylation. Thymine is known to be alkylated at O(2), N3 and O(4) positions; however, it remains poorly explored how the regioisomeric alkylated thymidine lesions compromise the flow of genetic information by perturbing DNA replication in cells. Herein, we assessed the differential recognition of the regioisomeric O(2)-, N3- and O(4)-ethylthymidine (O(2)-, N3- and O(4)-EtdT) by the DNA replication machinery of Escherichia coli cells. We found that O(4)-EtdT did not inhibit appreciably DNA replication, whereas O(2)- and N3-EtdT were strongly blocking to DNA replication. In addition, O(4)-EtdT induced a very high frequency of T→C mutation, whereas nucleotide incorporation opposite O(2)- and N3-EtdT was promiscuous. Replication experiments with the use of polymerase-deficient cells revealed that Pol V constituted the major polymerase for the mutagenic bypass of all three EtdT lesions, though Pol IV also contributed to the T→G mutation induced by O(2)- and N3-EtdT. The distinct cytotoxic and mutagenic properties of the three regioisomeric lesions could be attributed to their unique chemical properties. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please email:

  17. Endogenous Production of n-3 Polyunsaturated Fatty Acids Promotes Fracture Healing in Mice

    Directory of Open Access Journals (Sweden)

    Yuhui Chen


    Full Text Available Bone fracture is a global healthcare issue for high rates of delayed healing and nonunions. Although n-3 polyunsaturated fatty acid (PUFA is considered as a beneficial factor for bone metabolism, only few studies till date focused on the effects of n-3 PUFAs on fracture healing. In this study, we investigated the effect of endogenous n-3 PUFAs on fracture healing by measuring femur fracture repair in both fat-1 transgenic mice and WT mice. Proximal femoral fracture model was established in fat-1 transgenic mice and WT mice, respectively, and then the fracture was analyzed by using X-ray, micro-computed tomography (micro-CT, and histological assessment at 7, 14, 21, 28, and 35 days after fixation. The results showed that compared with WT mice, fat-1 mice exhibited acceleration in fracture healing through radiographic and histological analysis (18–21 days versus 21–28 days postfracture. Meanwhile, X-ray and micro-CT analysis that showed better remodeling callus formation were in the fat-1 group compared to WT group. Furthermore, histological analysis revealed that endogenous n-3 PUFAs promoted local endochondral ossification and accelerated the remodeling of calcified calluses after fracture. In conclusion, the present study indicated that endogenously produced n-3 PUFAs promote fracture healing process and accelerate bone remodeling in mice, and supplementation of n-3 PUFAs was positively associated with fracture healing.


    Directory of Open Access Journals (Sweden)

    Roberto eMarchioli


    Full Text Available After the first reports about a protective effect on coronary heart disease (CHD published more than 40 years ago, wide interest in the therapeutic use of n-3 polyunsaturated fatty acids (n-3 PUFA aroused. Since then, many studies and meta-analyses have reported a significantly reduced risk of CHD and CV death due to fish and n-3 PUFA intake. Some of the overviews reported a significant reduction of risk of sudden cardiac death (SCD, all-cause death, and nonfatal CV events. On the other side, recent clinical trials had mixed findings, raising concern about the consistency of the evidence on n-3 PUFA. We critically reviewed recent large clinical trials reporting data on the antiarrhythmic effects of n-3 PUFA in different clinical settings, i.e. patients with CHD, heart failure, with implantable cardioverter defibrillator (ICD, and at risk of atrial fibrillation, in order to summarize the results which are available up to date and possibly give substantiated fuel to the debate on the conflicting results of n-3 PUFA.

  19. Opportunities to enhance alternative sources of long-chain n-3 fatty acids within the diet. (United States)

    Delarue, Jacques; Guriec, Nathalie


    Health benefits or advocated health benefits of long-chain (LC) n-3 PUFA are better known by medical doctors as well as by consumers, so that consumption increases. In addition, the development of aquaculture requires more fishmeal and fish oil. Humanisation of care of companion animals is also associated with addition of LC n-3 PUFA in pet foods. The risk of the increased demand for LC n-3 PUFA is the excess harvesting of natural sources, especially of marine origin (oily fishes, krill). In order to improve sustainability, alternative sources of LC n-3 PUFA have been developed. These alternative sources are: (a) terrestrial plants naturally or genetically enriched in stearidonic acid (SDA), which bypasses the first limiting step of (i.e. ∆6 desaturase) of the biosynthesis of LC n-3 PUFA; (b) single-cell oils rich in LC n-3 PUFA (microalgae, Escherichia coli) and krill. Currently, plants rich in SDA are expensive, metabolic engineering is unfavourably accepted by consumers in many countries, cultivation of microalgae is very expensive even though their ability (for some of them) to synthesise biofuels could induce a decrease in industrial costs, and Antarctic krill harvest must be restricted. Thus, it is difficult to predict their real development in the future.

  20. The Role of n-3 Polyunsaturated Fatty Acids in the Prevention and Treatment of Breast Cancer

    Directory of Open Access Journals (Sweden)

    Jiajie Liu


    Full Text Available Breast cancer (BC is the most common cancer among women worldwide. Dietary fatty acids, especially n-3 polyunsaturated fatty acids (PUFA, are believed to play a role in reducing BC risk. Evidence has shown that fish consumption or intake of long-chain n-3 PUFA, such as eicosapentaenoic acid (EPA and docosahexaenoic acid (DHA, are beneficial for inhibiting mammary carcinogenesis. The evidence regarding α-linolenic acid (ALA, however, remains equivocal. It is essential to clarify the relation between ALA and cancer since ALA is the principal source of n-3 PUFA in the Western diet and the conversion of ALA to EPA and DHA is not efficient in humans. In addition, the specific anticancer roles of individual n-3 PUFA, alone, have not yet been identified. Therefore, the present review evaluates ALA, EPA and DHA consumed individually as well as in n-3 PUFA mixtures. Also, their role in the prevention of BC and potential anticancer mechanisms of action are examined. Overall, this review suggests that each n-3 PUFA has promising anticancer effects and warrants further research.

  1. Enhancement of n-3 polyunsaturated fatty acid glycerides in Sardine oil by a bioimprinted cross-linked Candida rugosa lipase. (United States)

    Sampath, Charanyaa; Belur, Prasanna D; Iyyasami, Regupathi


    Considering the advantages of bioimprinting and carrier free immobilization, cross-linked enzyme aggregates (CLEA) were prepared by using bioimprinted Candida rugosa lipase (CRL) with Bovine serum albumin (BSA), Polyethyleneimine and glutaraldehyde. Effect of various factors such as CRL-Oleic acid ratio, CRL-BSA ratio, CRL- Polyethyleneimine ratio, glutaraldehyde loading, cross-linking time etc., on lipase activity recovery and aggregate yield were studied and optimized. This immobilized lipase (CRL-CLEA) was used for the selective hydrolysis of ester linkages of non-PUFA glycerides, with an aim to concentrate EPA and DHA glycerides in the Sardine oil. Imprinting with oleic acid in the presence of ethanol and Tween 60, and further immobilization with co-aggregates and cross-linking agent showed 10.4 times higher degree of hydrolysis compared to free enzyme. As result, 2.83-fold increase of n-3 PUFA content in deacidified oil was obtained by using CRL-CLEA. The resultant oil had negligible di- and triglycerides content, proving higher efficiency in hydrolysing ester bonds of fatty acids, other than n-3 PUFA. Reusability studies showed CRL-CLEA could be reused up to 5 runs without a substantial reduction in its performance. Improvement in degree of hydrolysis, thermostability, efficiency of hydrolysis and reusability were achieved due to bioimprinting and subsequent immobilization of CRL in the form of CLEA. Copyright © 2017 Elsevier Inc. All rights reserved.

  2. Brain and Hepatic Mt mRNA Is Reduced in Response to Mild Energy Restriction and n-3 Polyunsaturated Fatty Acid Deficiency in Juvenile Rats

    Directory of Open Access Journals (Sweden)

    Aaron A. Mehus


    Full Text Available Metallothioneins (MTs perform important regulatory and cytoprotective functions in tissues including the brain. While it is known that energy restriction (ER and dietary n-3 polyunsaturated fatty acid (PUFA deficiency impact postnatal brain growth and development, little data exist regarding the impact of undernutrition upon MT expression in growing animals. We tested the hypothesis that ER with and without dietary n-3 PUFA deficiency reduces MT expression in juvenile rats. ER rats were individually pair-fed at 75% of the ad libitum (AL intake of control rats provided diets consisting of either soybean oil (SO that is α-linolenic acid (ALA; 18:3n-3 sufficient or corn oil (CO; ALA-deficient. Fatty acids (FA and metal concentrations of liver and brain regions were analyzed. Tissue expression of MTs (Mt1-3 and modulators of MT expression including glucocorticoid receptors (Nr3c1 and Nr3c2 and several mediators of thyroid hormone regulation (Dio1-3, Mct8, Oatp1c1, Thra, and Thrb were measured. Plasma corticosterone and triiodothyronine levels were also evaluated. ER, but not metal deficiency, reduced Mt2 expression in the cerebellum (50% and cerebral cortex (23%. In liver, a reduction in dietary n-3 PUFA reduced Mt1, Mt2, Nr3c1, Mct8, and Thrb. ER elevated Nr3c1, Dio1, and Thrb and reduced Thra in the liver. Given MT’s role in cellular protection, further studies are needed to evaluate whether ER or n-3 PUFA deficiency may leave the juvenile brain and/or liver more susceptible to endogenous or environmental stressors.

  3. catena-Poly[[(dimethylformamide-κOcobalt(II]-bis[μ-(4-nitrophenylcyanamido]-κ2N1:N3;κ2N3:N1

    Directory of Open Access Journals (Sweden)

    Hamid Reza Khavasi


    Full Text Available In the title coordination polymer, [Co(C7H4N3O22(C3H7NO]n, the CoII atom is five-coordinated in a distorted square-pyramidal CoON4 geometry with the O atom from a dimethylformamide molecule in an equatorial position. The bridging phenylcyanamide anions generate an infinite chain propagating in [001].

  4. Plasma is a strategic resource. (United States)

    Strengers, Paul F W; Klein, Harvey G


    Plasma-derived medicinal products (PDMPs) such as immunoglobulins and clotting factors are listed by the World Health Organization as essential medicines. These and other PDMPs are crucial for the prophylaxis and treatment of patients with bleeding disorders, immune deficiencies, autoimmune and inflammatory diseases, and a variety of congenital deficiency disorders. While changes in clinical practice in developed countries have reduced the need for red blood cell transfusions thereby significantly reducing the collection volumes of whole blood and recovered plasma suitable for fractionation, the need for PDMPs worldwide continues to increase. The majority of plasma supplies for the manufacture of PDMPs is met by the US commercial plasma industry. However, geographic imbalance in the collection of plasma raises concerns that local disruptions of plasma supplies could result in regional and global shortages of essential PDMPs. Plasma, which fits the definition of a strategic resource, that is, "an economically important raw material which is subject to a higher risk of supply interruption," should be considered a strategic resource comparable to energy and drinking water. Plasma collections should be increased outside the United States, including in low- and middle-income countries. The need for capacity building in these countries is an essential part to strengthen quality plasma collection. This will require changes in national and regional policies. We advocate the need for the restoration of an equitable balance of the international plasma supply to reduce the risk of supply shortages worldwide. Strategic independence of plasma should be endorsed on a global level. © 2016 AABB.

  5. Plasma spectroscopy

    CERN Document Server

    Fujimoto, Takashi


    Plasma is ubiquitous, whether it occurs in cooking gas flames, fluorescent lamps or in the sun and the stars. This book deals with the light that these plasmas emit, the characteristics of the light, and why it occurs. The author provides a framework from which a coherent account of this phenomena can be made.

  6. PLASMA ENERGIZATION (United States)

    Furth, H.P.; Chambers, E.S.


    BS>A method is given for ion cyclotron resonance heatthg of a magnetically confined plasma by an applied radio-frequency field. In accordance with the invention, the radiofrequency energy is transferred to the plasma without the usual attendent self-shielding effect of plasma polarlzatlon, whereby the energy transfer is accomplished with superior efficiency. More explicitly, the invention includes means for applying a radio-frequency electric field radially to an end of a plasma column confined in a magnetic mirror field configuration. The radio-frequency field propagates hydromagnetic waves axially through the column with the waves diminishing in an intermediate region of the column at ion cyclotron resonance with the fleld frequency. In such region the wave energy is converted by viscous damping to rotational energy of the plasma ions. (AEC)

  7. Effects of n-3 polyunsaturated fatty acids on cardiac ion channels

    Directory of Open Access Journals (Sweden)

    Cristina eMoreno


    Full Text Available Dietary n-3 polyunsaturated fatty acids (PUFAs have been reported to exhibit antiarrhythmic properties, attributed to their capability to modulate ion channels. In the present review, we will focus on the effects of PUFAs on cardiac sodium channel (Nav1.5 and two potassium channels (Kv (Kv1.5 and Kv11.1. n-3 marine (docohexaenoic and eicohexapentaenoic acid and plant origin (alpha-linolenic acid PUFAs block Kv1.5 and Kv11.1 channels at physiological concentrations. Also, DHA and EPA decreased Nav1.5 and calcium channels. These effects on Na and Ca channels theoretically should shorten the cardiac APD, whereas the blocking actions of n-3 PUFAs of Kv channels should lengthen the cardiac action potential. Experiments performed in female rabbits fed with a diet rich in n-3 PUFAs show a longer cardiac action potential and effective refractory period. This study was performed to analyze if their antiarrhythmic effects are due to a reduction of triangulation, reverse use-dependence, instability and dispersion of the cardiac action potential (TRIaD as a measure of proarrhythmic effects. Dietary n-3 PUFAs supplementation markedly reduced dofetilide-induced TRIaD and abolished dofetilide-induced torsades de pointes (TdP. Ultrafast sodium channel block by DHA may account for the antiarrhythmic protection of dietary supplements of n-3 PUFAs against dofetilide induced proarrhythmia observed in this animal model. The cardiac effects of n-3 PUFAs resemble those of amiodarone: both block sodium, calcium and potassium channels, have anti-adrenergic properties, can prolong the cardiac action potential, reverse TRIaD and suppress TdP. The main difference is that sodium channel block by n-3 PUFAs has a much faster onset and offset kinetics. Therefore, the electrophysiological profile of n-3 PUFAs appears more desirable: the duration of reduced sodium current (facilitates re-entry is much shorter. The n-3 PUFAs appear as a safer alternative to other antiarrhythmic

  8. The specificity of Several Kinds Lipases on n-3 Polyunsaturated Fatty Acids

    Directory of Open Access Journals (Sweden)

    Jenny Elisabeth, T Yuliani, P M Tambunan, J M Purba


    Full Text Available Several lipases from microbial and plant, i.e Rhizomucor miehei, Pseudomonas sp., Candida antartica, rice bran, and Carica papaya latex (CPL were examined for synthesis of omega-3 (n-3 PUFA-rich glyceride by hydrolysis and acidolysis reaction. Tuna oil was used in hydrolysis reaction, whereas tuna and palm oils were used as source of triglyceride (TAG molecules and n-3 PUFA concentrate from tuna oil as source of EPA and DHA in acidolysis reaction.For hydrolysis reaction, the rice bran and CPL lipases showed the lowest hydrolytic activity of the tuna oil, whereas the R. miehei lipase showed the highest hydrolytic activity but was unable to hydrolyze EPA and DHA. On the contrary, the C. antartica and Pseudomonas sp. lipases acted stronger on hydrolysis of DHA ester bond than EPA.For acidolysis reaction, all the lipases showed ability to incorporate n-3 PUFA into tuna and palm oils. C. antartica lipase had the maximum DHA incorporation into tuna and palm oils, rice bran lipase had relatively similar ability with R. miehei lipase, and the CPL lipase had the lowest ability. This study proved that rice bran and CPL lipases also had transesterification activity and showed the feasibility of the rice bran lipase to be a biocatalyst for n-3 PUFA-rich glyceride production. Increasing the substrate ratio, of n-3 PUFA concentrate and tuna or palm oil, could increase the EPA and DHA incorporation. The R. miehei, rice bran, and CPL lipases unabled to incorporate DHA into DHA-containing glyceride molecule, whereas C. antartica lipase had the capability in high ratio of n-3 PUFA concentrate to oil. Therefore, the lipases were easier to incorporate n-3 PUFA into palm oil than tuna oil, since the TAG molecules of palm oil was not as complex as tuna oil. It could be suggested that the lipases did not only have acyl chain and positional specificity, but also the whole glyceride structure specificity.

  9. Conversion of α-linolenic acid to long-chain omega-3 fatty acid derivatives and alterations of HDL density subfractions and plasma lipids with dietary polyunsaturated fatty acids in Monk parrots (Myiopsitta monachus). (United States)

    Petzinger, C; Larner, C; Heatley, J J; Bailey, C A; MacFarlane, R D; Bauer, J E


    The effect of α-linolenic acid from a flaxseed (FLX)-enriched diet on plasma lipid and fatty acid metabolism and possible atherosclerosis risk factors was studied in Monk parrots (Myiopsitta monachus). Twenty-four Monk parrots were randomly assigned to diets containing either 10% ground SUNs or 10% ground FLXs. Feed intake was calculated daily. Blood samples, body condition scores and body weights were obtained at -5 weeks, day 0, 7, 14, 28, 42 and 70. Plasma samples were analysed for total cholesterol, free cholesterol, triacylglycerols and lipoproteins. Phospholipid subfraction fatty acid profiles were determined. By day 70, the FLX group had significantly higher plasma phospholipid fatty acids including 18:3n-3 (α-linolenic acid), 20:5n-3 (eicosapentaenoic acid) and 22:6n-3 (docosahexaenoic acid). The sunflower group had significantly higher plasma phospholipid levels of 20:4n-6 (arachidonic acid). By day 70, the high-density lipoprotein (HDL) peak shifted resulting in significantly different HDL peak densities between the two experimental groups (1.097 g/ml FLX group and 1.095 g/ml SUN group, p = 0.028). The plasma fatty acid results indicate that Monk parrots can readily convert α-linolenic acid to the long-chain omega-3 derivatives including docosahexaenoic acid and reduce 20:4n-6 accumulation in plasma phospholipids. The reason for a shift in the HDL peak density is unknown at this time. Journal of Animal Physiology and Animal Nutrition © 2013 Blackwell Verlag GmbH.

  10. Dietary a-linolenic acid, linoleic acid, and n-3 long-chain PUFA and risk of ischemic heart disease

    DEFF Research Database (Denmark)

    Vedtofte, Mia Sadowa; Jakobsen, Marianne Uhre; Lauritzen, Lotte


    n-3 (omega-3) PUFA has been proposed as having health-promoting effects, primarily in relation to ischemic heart disease (IHD). Whether these benefits can be achieved by both α-linolenic acid (ALA, 18:3n-3) and n-3 long-chain PUFA (LC-PUFA) is debatable.......n-3 (omega-3) PUFA has been proposed as having health-promoting effects, primarily in relation to ischemic heart disease (IHD). Whether these benefits can be achieved by both α-linolenic acid (ALA, 18:3n-3) and n-3 long-chain PUFA (LC-PUFA) is debatable....

  11. Effect of artificial regulations of Artemia n-3 HUFA content on growth and survival of black seabream ( Sparus macrocephalus) larvae (United States)

    Liu, Jing-Ke


    The requirement for dietary n-3 HUFA (highly unsaturated fatty acid) for growth and survival of black seabream ( Sparus macrocephalus) larvae was tested using Artemia with various levels of n-3 HUFA. Four treatments with Artemia differing in their n-3 HUFA were prepared by feeding them various oil emulsions. The results indicated that dietary n-3 HUFA significantly influences fish n-3 HUFA levels and are necessary for good growth and survival of black seabream larvae. The proper value of n-3 HUFA level and DHA, EPA level in Artemia should be 4.273% and 0.873% (wet weight) for good growth and survival in black seabream larvae respectively.

  12. n-3 PUFA added to high-fat diets affect differently adiposity and inflammation when carried by phospholipids or triacylglycerols in mice

    Directory of Open Access Journals (Sweden)

    Awada Manar


    Full Text Available Abstract Background Dietary intake of n-3 polyunsaturated fatty acids (PUFA is primarily recognized to protect against cardiovascular diseases, cognitive dysfunctions and the onset of obesity and associated metabolic disorders. However, some of their properties such as bioavailability can depend on their chemical carriers. The objective of our study was to test the hypothesis that the nature of n-3 PUFA carrier results in different metabolic effects related to adiposity, oxidative stress and inflammation. Methods 4 groups of C57BL/6 mice were fed for 8 weeks low fat (LF diet or high-fat (HF, 20% diets. Two groups of high-fat diets were supplemented with long-chain n-3 PUFA either incorporated in the form of phospholipids (HF-ω3PL or triacylglycerols (HF-ω3TG. Results Both HF-ω3PL and HF-ω3TG diets reduced the plasma concentrations of (i inflammatory markers such as monocyte chemoattractant protein-1 (MCP-1 and interleukin 6 (IL-6, (ii leptin and (iii 4-hydroxy-2-nonenal (4-HNE, a marker of n-6 PUFA-derived oxidative stress compared with the control HF diet. Moreover, in both HF-ω3PL and HF-ω3TG groups, MCP-1 and IL-6 gene expressions were decreased in epididymal adipose tissue and the mRNA level of gastrointestinal glutathione peroxidase GPx2, an antioxidant enzyme, was decreased in the jejunum compared with the control HF diet. The type of n-3 PUFA carrier affected other outcomes. The phospholipid form of n-3 PUFA increased the level of tocopherols in epididymal adipose tissue compared with HF-ω3TG and resulted in smaller adipocytes than the two others HF groups. Adipocytes in the HF-ω3PL and LF groups were similar in size distribution. Conclusion Supplementation of mice diet with long-chain n-3 PUFA during long-term consumption of high-fat diets had the same lowering effects on inflammation regardless of triacyglycerol or phospholipid carrier, whereas the location of these fatty acids on a PL carrier had a major effect on decreasing

  13. Maternal High Fat Diet Is Associated with Decreased Plasma n–3 Fatty Acids and Fetal Hepatic Apoptosis in Nonhuman Primates


    Wilmon F Grant; Gillingham, Melanie B.; Batra, Ayesha K; Natasha M Fewkes; Comstock, Sarah M.; Diana Takahashi; Braun, Theodore P.; Grove, Kevin L.; Friedman, Jacob E.; Marks, Daniel L.


    To begin to understand the contributions of maternal obesity and over-nutrition to human development and the early origins of obesity, we utilized a non-human primate model to investigate the effects of maternal high-fat feeding and obesity on breast milk, maternal and fetal plasma fatty acid composition and fetal hepatic development. While the high-fat diet (HFD) contained equivalent levels of n-3 fatty acids (FA's) and higher levels of n-6 FA's than the control diet (CTR), we found signific...

  14. Relationship between Long Chain n-3 Polyunsaturated Fatty Acids and Autism Spectrum Disorder: Systematic Review and Meta-Analysis of Case-Control and Randomised Controlled Trials

    Directory of Open Access Journals (Sweden)

    Hajar Mazahery


    Full Text Available Omega-3 long chain polyunsaturated fatty acid supplementation (n-3 LCPUFA for treatment of Autism Spectrum Disorder (ASD is popular. The results of previous systematic reviews and meta-analyses of n-3 LCPUFA supplementation on ASD outcomes were inconclusive. Two meta-analyses were conducted; meta-analysis 1 compared blood levels of LCPUFA and their ratios arachidonic acid (ARA to docosahexaenoic acid (DHA, ARA to eicosapentaenoic acid (EPA, or total n-6 to total n-3 LCPUFA in ASD to those of typically developing individuals (with no neurodevelopmental disorders, and meta-analysis 2 compared the effects of n-3 LCPUFA supplementation to placebo on symptoms of ASD. Case-control studies and randomised controlled trials (RCTs were identified searching electronic databases up to May, 2016. Mean differences were pooled and analysed using inverse variance models. Heterogeneity was assessed using I2 statistic. Fifteen case-control studies (n = 1193 were reviewed. Compared with typically developed, ASD populations had lower DHA (−2.14 [95% CI −3.22 to −1.07]; p < 0.0001; I2 = 97%, EPA (−0.72 [95% CI −1.25 to −0.18]; p = 0.008; I2 = 88%, and ARA (−0.83 [95% CI, −1.48 to −0.17]; p = 0.01; I2 = 96% and higher total n-6 LCPUFA to n-3 LCPUFA ratio (0.42 [95% CI 0.06 to 0.78]; p = 0.02; I2 = 74%. Four RCTs were included in meta-analysis 2 (n = 107. Compared with placebo, n-3 LCPUFA improved social interaction (−1.96 [95% CI −3.5 to −0.34]; p = 0.02; I2 = 0 and repetitive and restricted interests and behaviours (−1.08 [95% CI −2.17 to −0.01]; p = 0.05; I2 = 0. Populations with ASD have lower n-3 LCPUFA status and n-3 LCPUFA supplementation can potentially improve some ASD symptoms. Further research with large sample size and adequate study duration is warranted to confirm the efficacy of n-3 LCPUFA.

  15. Development of Rabbit Meat Products Fortified With n-3 Polyunsaturated Fatty Acids

    Directory of Open Access Journals (Sweden)

    Massimiliano Petracci


    Full Text Available Rabbit meat is a highly digestible, tasty, low-calorie food, often recommended by nutritionists over other meats. Currently research in the rabbit sector is interested in developing feeding strategies aiming to further increase the nutritional value of rabbit meat as a “functional food” by including n-3 polyunsaturated fatty acids (n-3 PUFA, conjugated linoleic acid (CLA, vitamins and antioxidants in rabbit diets and assessing their effects on both raw and stored/processed meat quality properties. Our recent studies indicate that the dietary inclusion from 3 to 6% of linseed might be considered as a way to achieve the enrichment of the meat with α-linolenic acid and to guarantee satisfactory product stability during further processing and storage. Considering that 6% dietary linseed corresponds to a n-3 PUFA content of 8.5% of the total fatty acids and a lipid content of 4.7 g/100 g of leg meat, a content of 396 mg n-3 PUFA/100g meat can be estimated, which represents about 19% of the recommended daily allowance (RDA for n-3 PUFA.

  16. N-3 Polyunsaturated Fatty Acids and Inflammation in Obesity: Local Effect and Systemic Benefit

    Directory of Open Access Journals (Sweden)

    Yue Wang


    Full Text Available Overwhelming consensus emerges among countless evidences that obesity is characterized by a chronic low-grade inflammation in the adipose tissue (AT, which subsequently develops into a systemic inflammatory state contributing to obesity-associated diseases. N-3 Polyunsaturated fatty acids (n-3 PUFA, known as important modulators participating in inflammatory process, turn out to be an effective mitigating strategy dealing with local and systemic inflammation observed in obesity. Some of the effects of n-3 PUFA are brought about by regulation of gene expression through interacting with nuclear receptors and transcription factors; other effects are elicited by modulation of the amount and type of mediator derived from PUFAs. The metabolic effects of n-3 PUFA mainly result from their interactions with several organ systems, not limited to AT. Notably, the attenuation of inflammation in hard-hit AT, in turn, contributes to reducing circulating concentrations of proinflammatory cytokines and detrimental metabolic derivatives, which is beneficial for the function of other involved organs. The present review highlights a bridging mechanism between n-3 PUFA-mediated inflammation relief in AT and systemic benefits.

  17. Fit with good fat? The role of n-3 polyunsaturated fatty acids on exercise performance. (United States)

    Da Boit, Mariasole; Hunter, Angus M; Gray, Stuart R


    N-3 PUFA (n-3) polyunsaturated fatty acids (PUFA) are a family of fatty acids mainly found in oily fish and fish oil supplements. The effects of n-3 PUFA on health are mainly derived from its anti-inflammatory proprieties and its influence on immune function. Lately an increased interest in n-3 PUFA supplementation has reached the world of sport nutrition, where the majority of athletes rely on nutrition strategies to improve their training and performance. A vast amount of attention is paid in increasing metabolic capacity, delaying the onset of fatigue, and improving muscle hypertrophy and neuromuscular function. Nutritional strategies are also frequently considered for enhancing recovery, improving immune function and decreasing oxidative stress. The current review of the literature shows that data regarding the effects of n-3PUFA supplementation are conflicting and we conclude that there is, therefore, not enough evidence supporting a beneficial role on the aforementioned aspects of exercise performance. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  18. Combined deficiency of iron and (n-3) fatty acids in male rates disrupts brain monoamine metabolism and produces greater memory deficits than iron deficiency or (n-3) fatty acid deficiency alone

    NARCIS (Netherlands)

    Baumgartner, J.; Smuts, C.M.; Malan, L.; Arnold, M.; Yee, B.K.; Bianco, L.E.; Boekschoten, M.V.; Muller, M.R.; Langhans, W.; Hurrell, R.F.; Zimmermann, M.B.


    Deficiencies of iron (Fe) (ID) and (n-3) fatty acids (FA) [(n-3)FAD] may impair brain development and function through shared mechanisms. However, little is known about the potential interactions between these 2 common deficiencies. We studied the effects of ID and (n-3)FAD, alone and in

  19. Combined deficiency of iron and (n-3) fatty acids in male rats disrupts brain monoamine metabolism and produces greater memory deficits than iron deficiency or (n-3) fatty acid deficiency alone. (United States)

    Baumgartner, Jeannine; Smuts, Cornelius M; Malan, Linda; Arnold, Myrtha; Yee, Benjamin K; Bianco, Laura E; Boekschoten, Mark V; Müller, Michael; Langhans, Wolfgang; Hurrell, Richard F; Zimmermann, Michael B


    Deficiencies of iron (Fe) (ID) and (n-3) fatty acids (FA) [(n-3)FAD] may impair brain development and function through shared mechanisms. However, little is known about the potential interactions between these 2 common deficiencies. We studied the effects of ID and (n-3)FAD, alone and in combination, on brain monoamine pathways (by measuring monoamines and related gene expression) and spatial working and reference memory (by Morris water maze testing). Using a 2 × 2 design, male rats were fed an ID, (n-3)FAD, ID+(n-3)FAD, or control diet for 5 wk postweaning (postnatal d 21-56) after (n-3)FAD had been induced over 2 generations. The (n-3)FAD and ID diets decreased brain (n-3) FA by 70-76% and Fe by 20-32%, respectively. ID and (n-3)FAD significantly increased dopamine (DA) concentrations in the olfactory bulb (OB) and striatum, with an additive 1- to 2-fold increase in ID+(n-3)FAD rats compared with controls (P working memory performance and the impairment positively correlated with DA concentrations in FC (r = 0.39; P = 0.026). Reference memory was impaired in the ID+(n-3)FAD rats (P memory than ID or (n-3)FAD alone.

  20. Plasma chromograninx

    DEFF Research Database (Denmark)

    Goetze, Jens P; Hilsted, Linda M; Rehfeld, Jens F


    Cardiovascular risk assessment remains difficult in elderly patients. We examined whether chromogranin A (CgA) measurement in plasma may be valuable in assessing risk of death in elderly patients with symptoms of heart failure in a primary care setting. A total of 470 patients (mean age 73 years......) were followed for 10 years. For CgA plasma measurement, we used a two-step method including a screening test and a confirmative test with plasma pre-treatment with trypsin. Cox multivariable proportional regression and receiver-operating curve (ROC) analyses were used to assess mortality risk...... of follow-up showed significant additive value of CgA confirm measurements compared with NT-proBNP and clinical variables. CgA measurement in the plasma of elderly patients with symptoms of heart failure can identify those at increased risk of short- and long-term mortality....

  1. Plasma Cleaning (United States)

    Hintze, Paul E.


    NASA's Kennedy Space Center has developed two solvent-free precision cleaning techniques: plasma cleaning and supercritical carbon dioxide (SCCO2), that has equal performance, cost parity, and no environmental liability, as compared to existing solvent cleaning methods.

  2. Synthesis of ReN3 Thin Films by Magnetron Sputtering

    Directory of Open Access Journals (Sweden)

    G. Soto


    Full Text Available In this work ReNx films were prepared by reactive magnetron sputtering at room temperature and deposited on a silicon wafer. It was found that the diffractograms of the nitrogen-rich rhenium film are consistent with those produced by high-pressure high-temperature methods, under the assumption that the film is oriented on the substrate. Using density functional calculations it was found that the composition of this compound could be ReN3, instead of ReN2, as stated on previous works. The ReN3 compound fits in the Ama2 (40 orthorhombic space group, and due to the existence of N3 anions between Re layers it should be categorized as an azide. The material is exceptionally brittle and inherently unstable under indentation testing.

  3. arXiv Differential Higgs production at $N^3$LO beyond threshold

    CERN Document Server

    Dulat, Falko; Pelloni, Andrea

    We present several key steps towards the computation of differential Higgs boson cross sections at N$^3$LO in perturbative QCD. Specifically, we work in the framework of Higgs-differential cross sections that allows to compute precise predictions for realistic LHC observables. We demonstrate how to perform an expansion of the analytic N$^3$LO coefficient functions around the production threshold of the Higgs boson. Our framework allows us to compute to arbitrarily high order in the threshold expansion and we explicitly obtain the first two expansion coefficients in analytic form. Furthermore, we assess the phenomenological viability of threshold expansions for differential distributions. In addition, we report on an interesting obstacle for the computation of N$^3$LO corrections with LHAPDF parton distribution functions and our solution. We provide files containing the analytic expressions for the partonic cross sections together with the arXiv submission.

  4. A Noise and Emissions Assessment of the N3-X Transport (United States)

    Berton, Jeffrey J.; Haller, William J.


    Analytical predictions of certification noise and exhaust emissions for NASA's N3-X - a notional, hybrid wingbody airplane - are presented in this paper. The N3-X is a 300-passenger concept transport propelled by an array of fans distributed spanwise near the trailing edge of the wingbody. These fans are driven by electric motors deriving power from twin generators driven by turboshaft engines. Turboelectric distributed hybrid propulsion has the potential to dramatically increase the propulsive efficiency of aircraft. The noise and exhaust emission estimates presented here are generated using NASA's conceptual design systems analysis tools with several key modifications to accommodate this unconventional architecture. These tools predict certification noise and the emissions of oxides of nitrogen by leveraging data generated from a recent analysis of the N3-X propulsion system.

  5. Some strategies for the stabilization of long chain n-3 PUFA-enriched foods: A review

    DEFF Research Database (Denmark)

    Jacobsen, Charlotte


    to reduce or inhibit lipid oxidation by: (1) optimizing the processing conditions; (2) utilizing n-3 PUFA delivery systems; and (3) addition of antioxidants. Practical applications: This review provides an overview of how food producers can inhibit or reduce lipid oxidation in various real foods enriched......, light, temperature, oxygen, and is also affected by pH, droplet size, and numerous other factors related to the composition of the emulsion. During the last decade, marine polyunsaturated n-3 polyunsaturated fatty acids (PUFA) have increasingly been incorporated into emulsified foods in order to address...... recent nutritional recommendations. The increased use of n-3 PUFA has resulted in new challenges for the food industry with respect to avoiding lipid oxidation. This review provides an overview of results obtained primarily in the author's own lab on the use of the following different strategies...

  6. Echium Oil Reduces Plasma Triglycerides by Increasing Intravascular Lipolysis in apoB100-Only Low Density Lipoprotein (LDL Receptor Knockout Mice

    Directory of Open Access Journals (Sweden)

    John S. Parks


    Full Text Available Echium oil (EO, which is enriched in SDA (18:4 n-3, reduces plasma triglyceride (TG concentrations in humans and mice. We compared mechanisms by which EO and fish oil (FO reduce plasma TG concentrations in mildly hypertriglyceridemic male apoB100-only LDLrKO mice. Mice were fed one of three atherogenic diets containing 0.2% cholesterol and palm oil (PO; 20%, EO (10% EO + 10% PO, or FO (10% FO + 10% PO. Livers from PO- and EO-fed mice had similar TG and cholesteryl ester (CE content, which was significantly higher than in FO-fed mice. Plasma TG secretion was reduced in FO vs. EO-fed mice. Plasma very low density lipoprotein (VLDL particle size was ordered: PO (63 ± 4 nm > EO (55 ± 3 nm > FO (40 ± 2 nm. Post-heparin lipolytic activity was similar among groups, but TG hydrolysis by purified lipoprotein lipase was significantly greater for EO and FO VLDL compared to PO VLDL. Removal of VLDL tracer from plasma was marginally faster in EO vs. PO fed mice. Our results suggest that EO reduces plasma TG primarily through increased intravascular lipolysis of TG and VLDL clearance. Finally, EO may substitute for FO to reduce plasma TG concentrations, but not hepatic steatosis in this mouse model.

  7. Involvement of N6 and N3 polyunsaturated faty acids on the lipidic profile in central nervous system of the animals of experience

    Directory of Open Access Journals (Sweden)

    G. Iamandei1, Veronica Mocanu1, T. Oboroceanu2, Veronica Luca1


    Full Text Available AbstractIntroduction: N-3 and N-6polyunsaturated fatty acids has manyinvolvements in activities within orentering in regulating various physiologicalprocesses and in certain pathologies.Among systemic physiological effects inwhich they are involved we mention thecentral nervous system development andrecall of the retina, regulating plasma lipidlevels, cardiovascular and immune systemfunctions, regulating the activity of insulin.Material and methods: The experimentthere were used 60 male Wistar rats , weight180 ± 20 grams, procured from the animalfarm of the Department ofPathophysiology, University of Medicineand Pharmacy “Gr.T. Popa”, Iaşi.Male Wistar rats were divided into twostudy groups: normal control animals (Mand test animals.Test group was further divided intothree groups - each group being composedof 15 animals.Administration of the substances wasmade for 36 weeks (nine months, afterwhich the animals were evaluated andsubsequently sacrificed.Results: Following statistical analysis, wedetermined the following:• Averages of AGP n3 were significantlyhigher in groups 2 (p <0.001 and 3 (p<0.001 compared with group 4• Averages ratio n6: n3 in nerve cellmembrane were significantly lower ingroups 2 (p <0.001 and 3 (p <0.001compared with group 4Discussions: Our experimentdemonstrates that increased amounts ofpolyunsaturated fatty acids in themembranes of nerve cells which can justifythe positive evolution of animals inassessing the performance of concomitantbehavioral tests.Conclusions: This study brings new lighton the importance of the existence of abalance between PUFA intake and dailydiet.

  8. Is it possible to increase the n-3 fatty acid content of eggs without affecting their technological and/or sensorial quality and the laying performance of hens? (United States)

    Baeza, E; Chartrin, P; Lessire, M; Meteau, K; Chesneau, G; Guillevic, M; Mourot, J


    The aim of this study was to increase the n-3 fatty acid (n-3 FA) content of eggs without affecting their sensorial and/or technological properties or the laying performance of hens. Laying hens from line 477 were divided into 5 groups corresponding to 5 different diets over the laying period: control diet (C) and diets containing extruded linseed with a high level of fibre (ELHF), extruded linseed with a low level of fibre (ELLF), microalgae, or a combination of 75% ELLF and 25% MA (ELLF+MA). Dietary enrichment with n-3 FA had no effect on the laying performance, hen body weight or egg white viscosity. The egg yolks produced by hens fed the diet containing microalgae were redder than egg yolks from the other groups, suggesting the presence of red pigments in the microalgae preparation. However, the colour difference was low and not perceptible to the human eye. Moreover, colour measurement of egg yolks by sensorial analysis panellists using the Roche colour fan did not reveal a diet effect on this parameter. Egg yolk lipid content was not affected by diet. The egg yolk of hens fed on diets containing linseed and/or microalgae had greater n-3 FA content (×2.5 to 2.9 compared to group C). Linseed mainly increased the linolenic acid content (×3.0 to 3.4 compared to group C) and the microalgae increased the LC n-3 FA content (×4.1 compared to group C). Dietary enrichment with n-3 FA had no effect on the sensorial quality of shell cooked eggs except for the "unusual flavour" criterion for which the score was higher for the MA group compared to the other groups and corresponded to a fishy flavour.

  9. Acides gras de la famille n-3 : alphalinolénique (ALA) d’origine végétale et longues chaînes n-3 (LC-n-3)


    Delplanque Bernadette


    Les acides gras polyinsaturés (AGPI) de la famille n-3 (oméga 3) sont des acides gras impliqués dans de multiples processus physiologiques qui ont un impact de prévention sur la santé et\\\\ou de traitement de maladies chroniques. Depuis 50 ans, le développement de toutes ces maladies explose dans le monde occidental, en même temps que la consommation d’oméga 6 a augmenté, alors que celle des oméga 3 a été oubliée, induisant un rapport n-6\\\

  10. Plasma confinement

    CERN Document Server

    Hazeltine, R D


    Detailed and authoritative, this volume examines the essential physics underlying international research in magnetic confinement fusion. It offers readable, thorough accounts of the fundamental concepts behind methods of confining plasma at or near thermonuclear conditions. Designed for a one- or two-semester graduate-level course in plasma physics, it also represents a valuable reference for professional physicists in controlled fusion and related disciplines.

  11. Endogenous n-3 polyunsaturated fatty acids attenuate T cell-mediated hepatitis via autophagy activation

    Directory of Open Access Journals (Sweden)

    Yanli Li


    Full Text Available Omega-3 polyunsaturated fatty acids (n-3 PUFAs exert anti-inflammatory effects in several liver disorders, including cirrhosis, acute liver failure, and fatty liver disease. To date, little is known about their role in immune-mediated liver diseases. In this study, we used fat-1 transgenic mice rich in endogenous n-3 PUFAs to examine the role of n-3 PUFAs in immune-mediated liver injury. Concanavalin A (Con A was administered intravenously to wild-type (WT and fat-1 transgenic mice to induce T cell-mediated hepatitis. Reduced liver damage was shown in Con A-administrated fat-1 transgenic mice, as evidenced by decreased mortality, attenuated hepatic necrosis, lessened serum alanine aminotransferase (ALT activity, and inhibited production of pro-inflammatory cytokines (e.g. TNF-α, IL-6, IL-17A and IFN-γ. In vivo and in vitro studies demonstrated that n-3 PUFAs significantly inhibited the activation of hepatic T cells and the differentiation of Th1 cells after Con A challenge. Further studies showed that n-3 PUFAs markedly increased autophagy level in Con A-treated fat-1 T cells compared with the WT counterparts. Blocking hepatic autophagy activity with chloroquine diminished the differences in T cell activation and liver injury between Con A-injected WT and fat-1 transgenic mice. We conclude that n-3 PUFAs limit Con A-induced hepatitis via an autophagy-dependent mechanism, and could be exploited as a new therapeutic approach for autoimmune hepatitis.

  12. Electron Beam Propagation in a Plasma

    Directory of Open Access Journals (Sweden)

    Kyoung W. Min


    Full Text Available Electron beam propagation in a fully ionized plasma has been studied using a one-dimensional particle simulation model. We compare the results of electrostatic simulations to those of electromagnetic simulations. The electrostatic results show the essential features of beam-plasma instability which accelerates ambient plasmas. The results also show the heating of ambient plasmas and the trapping of plasmas due to the locally generated electric field. The level of the radiation generated by the same non-relativistic beam is slightly higher than the noise level. We discuss the results in context of the heating of coronal plasma during solar flares.

  13. (n-3) fatty acids and cardiovascular health: are effects of EPA and DHA shared or complementary? (United States)

    Mozaffarian, Dariush; Wu, Jason H Y


    Considerable research supports cardiovascular benefits of consuming omega-3 PUFA, also known as (n-3) PUFA, from fish or fish oil. Whether individual long-chain (n-3) PUFA have shared or complementary effects is not well established. We reviewed evidence for dietary and endogenous sources and cardiovascular effects on biologic pathways, physiologic risk factors, and clinical endpoints of EPA [20:5(n-3)], docosapentaenoic acid [DPA, 22:5(n-3)], and DHA [22:6(n-3)]. DHA requires direct dietary consumption, with little synthesis from or retroconversion to DPA or EPA. Whereas EPA is also largely derived from direct consumption, EPA can also be synthesized in small amounts from plant (n-3) precursors, especially stearidonic acid. In contrast, DPA appears principally derived from endogenous elongation from EPA, and DPA can also undergo retroconversion back to EPA. In experimental and animal models, both EPA and DHA modulate several relevant biologic pathways, with evidence for some differential benefits. In humans, both fatty acids lower TG levels and, based on more limited studies, favorably affect cardiac diastolic filling, arterial compliance, and some metrics of inflammation and oxidative stress. All three (n-3) PUFA reduce ex vivo platelet aggregation and DHA also modestly increases LDL and HDL particle size; the clinical relevance of such findings is uncertain. Combined EPA+DHA or DPA+DHA levels are associated with lower risk of fatal cardiac events and DHA with lower risk of atrial fibrillation, suggesting direct or indirect benefits of DHA for cardiac arrhythmias (although not excluding similar benefits of EPA or DPA). Conversely, EPA and DPA, but not DHA, are associated with lower risk of nonfatal cardiovascular endpoints in some studies, and purified EPA reduced risk of nonfatal coronary syndromes in one large clinical trial. Overall, for many cardiovascular pathways and outcomes, identified studies of individual (n-3) PUFA were relatively limited, especially

  14. Higgs boson gluon–fusion production at threshold in N$^3$LO QCD

    CERN Document Server

    Anastasiou, Charalampos; Dulat, Falko; Furlan, Elisabetta; Gehrmann, Thomas; Herzog, Franz; Mistlberger, Bernhard


    We present the cross-section for the threshold production of the Higgs boson at hadron-colliders at next-to-next-to-next-to-leading order (N3LO) in perturbative QCD. We present an analytic expression for the partonic cross-section at threshold and the impact of these corrections on the numerical estimates for the hadronic cross-section at the LHC. With this result we achieve a major milestone towards a complete evaluation of the cross-section at N3LO which will reduce the theoretical uncertainty in the determination of the strengths of the Higgs boson interactions.

  15. Reducing dietary intake of linoleic acid of mouse dams during lactation increases offspring brain n-3 LCPUFA content

    NARCIS (Netherlands)

    Schipper, L.; Oosting, A.; Scheurink, A J W; van Dijk, G.; van der Bee, E. M.

    Omega (n-)3 and n-6 long chain polyunsaturated fatty acids (LCPUFA) accumulation in the infant brain after birth is strongly driven by dietary supply of n-3 and n-6 LCPUFAs and their C18 precursors through breast milk or infant formula. n-3 LCPUFA accretion is associated with positive effects on

  16. Fatty acid profile of plasma, muscle and adipose tissues in Chilota lambs grazing on two different low quality pasture types in Chiloé Archipelago (Chile). (United States)

    Gallardo, Maria A; Dannenberger, Dirk; Rivero, Jordana; Pulido, Ruben; Nuernberg, Karin


    There is no information about the effect of different pasture types on tissue fatty acid profiles of a native rustic lamb breed of the Chiloe Archipelago, the Chilota. Eight Chilota lambs were grazed on a 'Calafatal' pasture (CP), a typical secondary succession of Chiloé Archipelago (Chile) and eight Chilota lambs were located to graze on naturalized pasture (NP) of Chiloé. Botanical, chemical and lipid composition of the two types of pastures and of different lamb tissues (muscle, subcutaneous - and tail adipose tissues) and plasma were performed. Both pasture types induced high n-3 polyunsaturated fatty acids (PUFA) and CLAcis-9,trans-11 proportions in Chilota meat. Thus, in muscle, Chilota lambs grazing CP showed higher sum PUFA, sum n-6 PUFA proportion and n-6/n-3 PUFA ratio compared with Chilota lambs grazing NP. In tail fats of Chilota lambs grazing CP significantly higher proportions of 18:3n-3, sum saturated fatty acids, sum PUFA, n-3 and n-6 PUFA were detected compared with Chilota lambs grazing NP. Feeding of different pasture types (CP vs. NP) caused significant differences in fatty acid composition of muscle and the two fat depots in Chilota lambs, but also point to tissue-specific responses of de novo synthesized fatty acid deposition in the tissues. © 2014 Japanese Society of Animal Science.

  17. Electron density and plasma dynamics of a colliding plasma experiment

    Energy Technology Data Exchange (ETDEWEB)

    Wiechula, J., E-mail:; Schönlein, A.; Iberler, M.; Hock, C.; Manegold, T.; Bohlender, B.; Jacoby, J. [Plasma Physics Group, Institute of Applied Physics, Goethe University, 60438 Frankfurt am Main (Germany)


    We present experimental results of two head-on colliding plasma sheaths accelerated by pulsed-power-driven coaxial plasma accelerators. The measurements have been performed in a small vacuum chamber with a neutral-gas prefill of ArH{sub 2} at gas pressures between 17 Pa and 400 Pa and load voltages between 4 kV and 9 kV. As the plasma sheaths collide, the electron density is significantly increased. The electron density reaches maximum values of ≈8 ⋅ 10{sup 15} cm{sup −3} for a single accelerated plasma and a maximum value of ≈2.6 ⋅ 10{sup 16} cm{sup −3} for the plasma collision. Overall a raise of the plasma density by a factor of 1.3 to 3.8 has been achieved. A scaling behavior has been derived from the values of the electron density which shows a disproportionately high increase of the electron density of the collisional case for higher applied voltages in comparison to a single accelerated plasma. Sequences of the plasma collision have been taken, using a fast framing camera to study the plasma dynamics. These sequences indicate a maximum collision velocity of 34 km/s.

  18. Plasma contactor research, 1990 (United States)

    Williams, John D.; Wilbur, Paul J.


    Emissive and Langmuir probes were used to measure plasma potential profiles, plasma densities, electron energy distributions, and plasma noise levels near a hollow cathode-based plasma contactor emitting electrons. The effects of electron emission current (100 to 1500 mA) and contactor flowrate (2 to 10 sccm (Xenon)) on these data are examined. Retarding potential analyzer (RPA) measurements showing that high energy ions generally stream from a contactor along with the electrons being emitted are also presented, and a mechanism by which this occurs is postulated. This mechanism, which involves a high rate of ionization induced between electrons and atoms flowing together from the hollow cathode orifice, results in a region of high positive space charge and high positive potential. Langmuir and RPA probe data suggests that both electrons and ions expand spherically from this potential hill region. In addition to experimental observations, a simple one-dimensional model which describes the electron emission process and predicts the phenomena just mentioned is presented and is shown to agree qualitatively with these observations. Experimental results of the first stage of bilateral cooperation with the Italian Institute of Interplanetary Space Physics (IFSI CNR) are presented. Sharp, well-defined double layers were observed downstream of a contactor collecting electrons from an ambient plasma created in the IFSI Facility. The voltage drop across these double layers was observed to increase with the current drawn from the ambient plasma. This observation, which was not as clear in previous IFSI tests conducted at higher neutral pressures, is in agreement with previous experimental observations made at both Colorado State University and NASA Lewis Research Center. Greater double layer voltage drops, multiple double layers, and higher noise levels in the region near the double layers were also observed when a magnetic field was imposed and oriented perpendicular to the

  19. n-3 polyunsaturated fatty acids supplementation decreases asymmetric dimethyl arginine and arachidonate accumulation in aging spontaneously hypertensive rats. (United States)

    Raimondi, Laura; Lodovici, Maura; Visioli, Francesco; Sartiani, Laura; Cioni, Laura; Alfarano, Chiara; Banchelli, Grazia; Pirisino, Renato; Cecchi, Enrica; Cerbai, Elisabetta; Mugelli, Alessandro


    Plasma accumulation of asymmetric dimethyl arginine (ADMA) is considered as a risk factor for endothelial dysfunction and a strong predictor for coronary heart diseases. Eicosapentaenoic (EPA) and docosahexaenoic (DHA) increasing plasma levels have been positively associated with reduced cardiovascular mortality with a mechanism( s) yet unclear. We hypothesised that ADMA reduction might be a part of EPA and DHA beneficial effects on the cardiovascular system. To verify this hypothesis we measured ADMA plasma levels in aged spontaneously hypertensive rats (SHR) supplemented for 8 weeks with EPA and DHA. 16-month-old SHR were supplemented with EPA and DHA (EPA-DHA) or with olive oil (1 g/kg/day; OLIVE). At the end of the treatments, the plasma of each animal was analysed for 1) the total fatty acid composition, by gas-cromatography, 2) ADMA levels, by high pressure liquid chromatography, 3) nitrite and homocysteine concentration by chemiluminescence and by polarisation immunoassay respectively. Moreover, the activity of dimethyl arginine dimethyl amino hydrolase, the main enzyme involved in ADMA metabolism, was measured spectrophotometrically in the kidney from each rat. Animals supplemented with EPA and DHA showed: 1) lower ADMA and arachidonate plasma levels (587.4 +/- 113.7 nM and 0.49 +/- 0.11 mM respectively) than the values found in OLIVE rats (1365 +/- 399 nM and 1.07 +/- 0.07 mM respectively) 2) higher nitrite content (0.73 +/- 0.05 microM) than OLIVE (0.23 +/- 0.08 microM). EPA and DHA supplementation reduced ADMA accumulation in SHR in parallel with a decrease of arachidonate availability. This finding suggests that the control of the inflammatory ground of endothelium might play an important role in EPA and DHA effect on this novel and highly predictive cardiovascular risk factor.

  20. The effects of n-3 long-chain polyunsaturated fatty acid supplementation on AGEs and sRAGE in type 2 diabetes mellitus. (United States)

    Kurt, Asuman; Andican, Gülnur; Siva, Zeynep Oşar; Andican, Ahat; Burcak, Gülden


    In diabetes mellitus, chronic hyperglycemia leads to formation of advanced glycation end products (AGEs). Binding of AGEs to receptors of AGE (RAGE) causes deleterious effects. In populations with a high consumption of n-3 long-chain polyunsaturated fatty acids, a lower prevalence of diabetes mellitus has been reported. We aimed to investigate the effects of n-3 fatty acid (EPA and DHA) supplementation on the levels of AGEs (carboxymethyl lysine (CML) and pentosidine), sRAGE, and nuclear factor kappa B (NF-kB) in type 2 diabetes mellitus (T2DM). T2DM patients (n = 38) treated with oral hypoglycemic agents, without insulin were supplemented with n-3 fatty acids (1.2 g/day) for 2 months. Plasma CML, pentosidine, sRAGE, and NF-kB levels were measured by ELISA both before and after the supplementation. n-3 fatty acid supplementation significantly reduced fasting glucose (p < 0.01), glycated hemoglobin (HbA1c) (p < 0.05), and pentosidine (p < 0.05) levels. The supplementation induced percentage changes in pentosidine and HbA1c and in pentosidine and creatinine were observed to be correlated (r = 0.349, p < 0.05) and (r = 0.377, p < 0.05), respectively. Waist circumference and systolic and diastolic pressures were significantly decreased due to n-3 supplementation (p < 0.001, p < 0.01, p < 0.01), respectively. Our results show that supplementation with n-3 fatty acid has beneficial effects on waist circumference; systolic and diastolic blood pressures; and the levels of glucose, HbA1c, and pentosidine in T2DM patients. However, the supplementation failed to decrease these parameters to the reference ranges for healthy subjects. In addition, the supplementation did not appear to induce any significant differences in CML, sRAGE, or NF-kB.

  1. Effects of dietary conjugated linoleic acid (CLA), n-3 and n-6 fatty ...

    African Journals Online (AJOL)

    ajl yemi


    Nov 28, 2011 ... Hulan HW, Ackman RG, Ratnayake WMN, Proudfoot FG (1988). Omega-3 fatty acid levels and performance of broilers chickens fed redfish meal or redfish oil. Can. J. Animal Sci. 68: 533-547. Kinsella JE, Lokesh B, Stone RA (1990). Dietary n-3 polyunsaturated fatty-acids and amelioration of cardiovascular ...

  2. n-3 Fatty acid derived endocannabinoids: a new link between fish oil and inflammation

    NARCIS (Netherlands)

    Balvers, M.G.J.


    Inflammatory processes are critical components of many illnesses, and dietary n-3 fatty acids have been shown to contribute to a reduction of the inflammatory status, both in in vivo and in vitro studies. The mechanisms underlying the modulation of inflammation are not completely understood, but it

  3. Describing Paenibacillus mucilaginosus strain N3 as an efficient plant growth promoting rhizobacteria (PGPR

    Directory of Open Access Journals (Sweden)

    Dweipayan Goswami


    Full Text Available Bacterium Paenibacillus mucilaginosus strain N3 was isolated from agricultural farm soil (located at Boriavi village, Gujarat, India. Isolate showed an evidence of non-symbiotic nitrogen fixation, when grown in nitrogen-free bromothymol blue growth medium. It was tested positive for direct plant-growth-promoting traits like Indole-3-acetic acid production, solubilization of Tri-calcium-phosphate, and ammonia production. Further, N3 isolate was tested positive for siderophore production of catecholate type and catalase production as an indirect plant-growth-promoting trait. Biochemical tests along with 16s rRNA gene sequence analysis confirmed the strain N3 to be P. mucilaginosus. To determine its efficacy as a plant-growth-promoting rhizobacteria (PGPR, its talc-based biofertilizer was prepared and tested on the growth of green gram (Vigna radiata. Seeds treated with this biofertilizer showed an increase in overall dry biomass by 17% and sapling length by 28% (as compared to non-treated controls after 10 days of sowing in pots. Thus, multiple plant-growth-promoting traits of P. mucilaginosus N3 determined in vitro along with its ability to promote growth in green gram in vivo we characterize this strain as an efficient PGPR.

  4. Pharmacological Studies of p, N-(3, 4-Methylenedioxy phenyl Benzoic Acid (RRL-1364 - Part-I

    Directory of Open Access Journals (Sweden)

    Dahanukar Sharadini


    Full Text Available Detailed pharmacological investigations of p-N-(3, 4-methylene dioxy phenyl benzoic acid revealed marked hypotensive action which was dose dependent and most marked in cats; it was absent in rats. Atropine could block this hypotensive action, thus suggest-ing cholinomimetic mechanism. Further studies indicated that the hypotension produced was central and possibly medullary in origin.

  5. The Delfi-n3Xt nanosatellite : Space weather research and qualification of microtechnology

    NARCIS (Netherlands)

    De Jong, S.; Maddox, E.; Vollmuller, G.J.; Schuurbiers, C.A.H.; Van Swaaij, R.A.C.M.M.; Ubbels, W.J.; Hamann, R.J.


    The Delfi-C3 nanosatellite successor, Delfi-n3Xt, is currently under development at Delft University of Technology and scheduled for launch in the first half of 2010. This improved three-unit CubeSat platform allows novel technology qualification for future small satellites and innovative scientific

  6. Improved command and data handling system for the Delfi-n3Xt nanosatellite

    NARCIS (Netherlands)

    De Jong, S.; Aalbers, G.T.; Bouwmeester, J.


    The Delfi-C3 nanosatellite successor, Delfi-n3Xt, is currently under development at Delft University of Technology. This nanosatellite based on a three-unit CubeSat form factor has been improved through the implementation of a high-speed downlink, three-axis active attitude control and a

  7. Delfi?n3Xt Nanosatellite Subsystems : Buying, Outsourcing or Internal Development

    NARCIS (Netherlands)

    Bouwmeester, J.; Hamann, R.J.


    This paper provides the results of a study of project management and systems engineering effectiveness regarding the allocation of work and procurement policy of a nanosatellite project. The Delfi-n3Xt nanosatellite is currently under development at Delft University of Technology (TU Delft) and will

  8. Effects on n-3 fatty acids on depressive symptoms and dispositional optimism after myocardial infarction

    NARCIS (Netherlands)

    Giltay, E.J.; Geleijnse, J.M.; Kromhout, D.


    Background: In patients who have experienced a myocardial infarction (MI), n-3 (omega-3) PUFA status is low, whereas the risk of depression is increased. Objective: The objective was to assess whether the plant-derived a-linolenic acid (ALA) and the fish fatty acids EPA and DHA would improve

  9. Effects of various dietary n-3 / n-6 fatty acid ratios on the ...

    African Journals Online (AJOL)

    Different combinations of saturated and unsaturated fatty acids were fed to broilers to establish their effect on the fatty acid composition of the broiler carcass and the abdominal fat pad. Six combinations of Canola acid oil (CAO, high levels of C18:3n-3 and monounsaturated fatty acids) and Famarol acid oil (FAO, high levels ...

  10. Relieving the frustration through M n3 + substitution in holmium gallium garnet (United States)

    Mukherjee, Paromita; Glass, Hugh F. J.; Suard, Emmanuelle; Dutton, Siân E.


    We present a Rapid Communication on the impact of M n3 + substitution in the geometrically frustrated Ising garnet H o3G a5O12 using bulk magnetic measurements and low-temperature powder neutron diffraction. We find that the transition temperature TN=5.8 K for H o3MnG a4O12 is raised by a factor of almost 20 when compared to H o3G a5O12 . Powder neutron diffraction on H o3M nxG a5 -xO12 (x =0.5 ,1 ) below TN shows the formation of a long-range-ordered state with k =(0 ,0 ,0 ) . H o3 + spins are aligned antiferromagnetically along the six crystallographic axes with no resultant moment, whereas the M n3 + spins are oriented along the body diagonals such that there is a net moment along [111]. The magnetic structure can be visualized as ten-membered rings of corner-sharing triangles of H o3 + spins with the M n3 + spins ferromagnetically coupled to each individual H o3 + spin in the triangle. Substitution of M n3 + completely relieves the magnetic frustration with f =θCW/TN˜1.1 for H o3MnG a4O12 .

  11. Historical perspectives on the impact of n-3 and n-6 nutrients on health. (United States)

    Lands, Bill


    Current public advice from the Food and Nutrition Board (FNB) about essential fatty acids (EFA) has limited quantitative details about three processes: (1) similar dynamics for n-3 linolenic and n-6 linoleic polyunsaturated fatty acids (PUFA) in maintaining 20- and 22-carbon n-3 and n-6 highly unsaturated fatty acids (HUFA) in tissues; (2) different dynamics for tissue n-3 and n-6 HUFA during formation and action of hormone-like eicosanoids; (3) simultaneous formation of non-esterified fatty acids (NEFA) and low density lipoprotein (LDL) from very low density lipoprotein (VLDL) formed from excess food energy and secreted by the liver. This report reviews evidence that public health may benefit from advice to eat less n-6 nutrients, more n-3 nutrients and fewer calories per meal. Explicit data for linoleic acid fit an Estimated Average Requirement (EAR) near 0.1 percent of daily food energy (en%) meeting needs of half the individuals in a group, a Recommended Dietary Allowance (RDA) near 0.5 en% meeting needs of 97-98 percent of individuals, and a Tolerable Upper Intake Level (UL) near 2 en% having no likely risk of adverse health effects. Quantitative tools help design and monitor explicit interventions that could beneficially replace imprecise advice on "healthy foods" with explicit preventive nutrition. Copyright © 2014 The Author. Published by Elsevier Ltd.. All rights reserved.

  12. (Z-N-[3-(4-Bromobenzoyl-1,3-thiazolidin-2-ylidene]cyanamide

    Directory of Open Access Journals (Sweden)

    Ling Xu


    Full Text Available In the title compound, C11H8BrN3OS, the dihedral angle between the benzene and thiazolidine rings is 63.4 (2°. Intermolecular C—H...N interactions help to stabilize the crystal structure.

  13. Intake of very long chain n-3 fatty acids from fish en incidence of heart failure

    NARCIS (Netherlands)

    Dijkstra, S.C.; Brouwer, I.A.; van Rooij, F.J.A.; Witteman, J.C.M.; Geleijnse, J.M.


    Aims Evidence is accumulating for a cardioprotective effect of fish or its n-3 fatty acids, eicosapentaenoic acid (EPA) plus docosahexaenoic acid (DHA). We examined EPA plus DHA and fish intake in relation to incident heart failure in the population-based Rotterdam Study.Methods and resultsThe

  14. Attitude control system of the Delfi-n3Xt satellite

    NARCIS (Netherlands)

    Reijneveld, J.; Choukroun, D.


    This work is concerned with the development of the attitude control algorithms that will be implemented on board of the Delfi-n3xt nanosatellite, which is to be launched in 2013. One of the mission objectives is to demonstrate Sun pointing and three axis stabilization. The attitude control modes and

  15. Gestational age in relation to marine n-3 fatty acids in maternal erythrocytes

    DEFF Research Database (Denmark)

    Olsen, S.F.; Hansen, Harald S.; Sommer, S.


    Gestation is longer in Faroese than Danish women, possibly because of the high intake of marine long-chain n-3 fatty acids that down regulates formation of prostaglandins from arachidonic acid. Polyunsaturated fatty acids were quantified in erythrocytes obtained within 2 days of delivery from...

  16. Dietary n-3 fatty acids promote arrhythmias during acute regional myocardial ischemia in isolated pig hearts

    NARCIS (Netherlands)

    Coronel, R.; Wilms-Schopman, F.J.G.; Ruijter, den H.M.; Belterman, C.N.; Schumacher, C.A.; Opthof, T.; Hovernier, R.; Lemmens, A.G.; Terpstra, A.H.M.; Katan, M.B.; Zock, P.L.


    Objective Dietary supplementation with fish oil-derived n-3 fatty acids reduces mortality in patients with myocardial infarction, but may have adverse effects in angina patients. The underlying electrophysiologic mechanisms are poorly understood. We studied the arrhythmias and the electrophysiologic

  17. Long-chain n-3 fatty acids - New anabolic compounds improving protein metabolism (United States)

    Previous animal studies demonstrated that chronic feeding of long-chain n-3 polyunsaturated fatty acids (LCn-3PUFA) that modifies muscle membrane fatty acid composition promotes protein anabolism by blunting the age-associated deterioration in insulin sensitivity. The current study assessed, as a pr...

  18. n-3 LCPUFA in the reversal of hepatic steatosis: the role of ACOX and CAT-1

    Energy Technology Data Exchange (ETDEWEB)

    Tapia, G.S.; Gonzalez Mañan, D.; D' Espessailles, A.; Dossi, D.G.


    The aim of this study was to investigate the roles of the Acyl co-enzyme A oxidase (ACOX), carnitine acyl transferase I (CAT-1) and activating protein 1 (AP-1) in the reversal of hepatic steatosis with dietary change and n-3 long chain polyunsaturated fatty acid (n-3 LCPUFA) supplementation. Male C57BL/6J mice were given either a control diet (CD) or a high fat diet (HFD) for 12 weeks, and then continued with the CD or CD plus n-3 LCPUFA for eight weeks. After this period, body and adipose visceral tissue weight were analyzed and liver samples were taken to measure ACOX, CAT-1 and c-jun levels. The dietary change from HFD to a norm caloric diet plus n-3 LCPUFA supplementation significantly reduced liver steatosis and adipose tissue: body weight ratio, along with an increase in the hepatic ACOX and CAT-1 levels and normalization of AP-1 expression that could favor the fatty acid beta-oxidation over lipogenesis and regulate inflammation. (Author)

  19. Alternative Sources of n-3 Long-Chain Polyunsaturated Fatty Acids in Marine Microalgae

    Directory of Open Access Journals (Sweden)

    João Varela


    Full Text Available The main source of n-3 long-chain polyunsaturated fatty acids (LC-PUFA in human nutrition is currently seafood, especially oily fish. Nonetheless, due to cultural or individual preferences, convenience, geographic location, or awareness of risks associated to fatty fish consumption, the intake of fatty fish is far from supplying the recommended dietary levels. The end result observed in most western countries is not only a low supply of n-3 LC-PUFA, but also an unbalance towards the intake of n-6 fatty acids, resulting mostly from the consumption of vegetable oils. Awareness of the benefits of LC-PUFA in human health has led to the use of fish oils as food supplements. However, there is a need to explore alternatives sources of LC-PUFA, especially those of microbial origin. Microalgae species with potential to accumulate lipids in high amounts and to present elevated levels of n-3 LC-PUFA are known in marine phytoplankton. This review focuses on sources of n-3 LC-PUFA, namely eicosapentaenoic and docosahexaenoic acids, in marine microalgae, as alternatives to fish oils. Based on current literature, examples of marketed products and potentially new species for commercial exploitation are presented.

  20. Alternative Sources of n-3 Long-Chain Polyunsaturated Fatty Acids in Marine Microalgae (United States)

    Martins, Dulce Alves; Custódio, Luísa; Barreira, Luísa; Pereira, Hugo; Ben-Hamadou, Radhouan; Varela, João; Abu-Salah, Khalid M.


    The main source of n-3 long-chain polyunsaturated fatty acids (LC-PUFA) in human nutrition is currently seafood, especially oily fish. Nonetheless, due to cultural or individual preferences, convenience, geographic location, or awareness of risks associated to fatty fish consumption, the intake of fatty fish is far from supplying the recommended dietary levels. The end result observed in most western countries is not only a low supply of n-3 LC-PUFA, but also an unbalance towards the intake of n-6 fatty acids, resulting mostly from the consumption of vegetable oils. Awareness of the benefits of LC-PUFA in human health has led to the use of fish oils as food supplements. However, there is a need to explore alternatives sources of LC-PUFA, especially those of microbial origin. Microalgae species with potential to accumulate lipids in high amounts and to present elevated levels of n-3 LC-PUFA are known in marine phytoplankton. This review focuses on sources of n-3 LC-PUFA, namely eicosapentaenoic and docosahexaenoic acids, in marine microalgae, as alternatives to fish oils. Based on current literature, examples of marketed products and potentially new species for commercial exploitation are presented. PMID:23807546

  1. Metabolic switching of human myotubes is improved by n-3 fatty acids

    NARCIS (Netherlands)

    Hessvik, N.P.; Bakke, S.S.; Fredriksson, K.; Boekschoten, M.V.; Fjorkenstad, A.; Koster, G.; Hesselink, M.K.; Kersten, A.H.; Kase, E.T.; Rustan, A.C.; Thoresen, G.H.


    The aim of the present study was to examine whether pretreatment with different fatty acids, as well as the liver X receptor (LXR) agonist T0901317, could modify metabolic switching of human myotubes. The n-3 FA eicosapentaenoic acid (EPA) increased suppressibility, the ability of glucose to

  2. N-3 fatty acids, neuronal activity and energy metabolism in the brain

    Directory of Open Access Journals (Sweden)

    Harbeby Emilie


    Full Text Available The content of docosahexaenoic acid (DHA in brain membranes is of crucial importance for the optimum development of brain functions. A lack of DHA accretion in the brain is accompanied by deficits in learning behavior linked to impairments in neurotransmission processes, which might result from alteration of brain fuel supply and hence energy metabolism. Experimental data we published support the hypothesis that n-3 fatty acids may modulate brain glucose utilization and metabolism. Indeed rats made deficient in DHA by severe depletion of total n-3 fatty acid intake have 1 a lower brain glucose utilization, 2 a decrease of the glucose transporter protein content GLUT1 both in endothelial cells and in astrocytes, 3 a repression of GLUT1 gene expression in basal state as well as upon neuronal activation. This could be due to the specific action of DHA on the regulation of GLUT1 expression since rat brain endothelial cells cultured with physiological doses of DHA had an increased GLUT1 protein content and glucose transport when compared to non-supplemented cells. These experimental data highlight the impact of n-3 fatty acids on the use of brain glucose, thereby constituting a key factor in the control of synaptic activity. This emerging role suggests that dietary intake of n-3 fatty acids can help to reduce the cognitive deficits in the elderly and possibly symptomatic cerebral metabolic alterations in Alzheimer disease by promoting brain glucose metabolism.

  3. Business clustering along the M1-N3-N1 corridor between ...

    African Journals Online (AJOL)

    As a communication axis between Pretoria and Johannesburg the Old Pretoria Main Road always served as a linear force of attraction of urban development. This force was subsequently strengthened, first by the construction of the M1 and N1 motorways and later by the N3. Anecdotal evidence points to these sections of ...

  4. A new piece in the puzzling effect of n-3 fatty acids on atherosclerosis? (United States)

    Le Goff, Wilfried


    Omega-3 fatty acids (n-3) FA are reported to be protective against cardiovascular disease (CVD), notably through their beneficial action on atherosclerosis development. In this context dietary intake of long-chain marine eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA) is recommended and randomised trials largely support that EPA and DHA intake is associated with a reduction of CVD. However, mechanisms governing the atheroprotective action of n-3 FA are still unclear and numerous studies using mouse models conducted so far do not allow to reach a precise view of the cellular and molecular effects of n-3 FA on atherosclerosis. In the current issue of Atherosclerosis, Chang et al. provide important new information on the anti-atherogenic properties of n-3 FA by analysing the incremental replacement of saturated FA by pure fish oil as a source of EPA and DHA in Ldlr(-/-) mice fed a high fat/high cholesterol diet. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  5. Effect of dietary n-6 to n-3 polyunsaturated fatty acid ratio on ...

    African Journals Online (AJOL)

    The peroxisome proliferator-activated receptors (PPARs) are a family of nuclear transcription factors thought to act as receptors for polyunsaturated fatty acids and to reduce production of series 2 prostaglandins (PG). The objective of this study was to investigate the effect of different ratio n-6:n-3 on the PPAR expression of ...

  6. Synthesis and crystal structure of N-(3-benzylamino-2- cyano-3 ...

    African Journals Online (AJOL)

    Phenylurea groups were introduced into the frame of traditional cyanoacrylate and a series of N-(3-benzylamino-2-cyano-3-methylthioacrylyl)-N'-(substituted phenyl)ureas were synthesized. All compounds are new and their structures were confirmed by 1H NMR, 13C NMR and mass spectral analyses. KEY WORDS: ...

  7. Influence of different levels of n-3 supplemented (fish oil) diet on ...

    African Journals Online (AJOL)

    An experiment was conducted to evaluate fish oil as n-3 fatty acids source on some performance, carcass and serum parameters in broilers. One-day old Ross strain male broiler chickens (n = 120) were randomly arranged in four dietary treatments (0, 1.5, 3 and 4.5 percent fish oil), with three replicates for each treatment.

  8. Regeneration of plantlets under NaCl stress from NaN3 treated ...

    African Journals Online (AJOL)



    Nov 16, 2011 ... plant regeneration under NaCl stressed conditions was assessed in some sugarcane (Saccharum officinarum L.) cultivars ... cell is a useful work for the establishment of pure form of species. It can facilitate .... Sub-cultures of NaN3 treated explants on different NaCl stressed cultures a. Callus proliferation ...

  9. Direct computation of length-N DHT from three adjacent length-N/3 DHT coefficients


    Wu, Jiasong; Wang, Lu; Shu, Huazhong; Senhadji, Lotfi


    International audience; A fast direct method for obtaining the length-N discrete Hartley transform (DHT) coefficients from three adjacent length-N/3 DHT coefficients is presented. The proposed method reduces significantly the number of arithmetic operations compared to the traditional approach. Furthermore, it is easy to implement.

  10. Lipid Class Specific Quantitative Analysis of n-3 Polyunsaturated Fatty Acids in Food Supplements. (United States)

    Kutzner, Laura; Ostermann, Annika I; Konrad, Thade; Riegel, Dieter; Hellhake, Stefan; Schuchardt, Jan Philipp; Schebb, Nils Helge


    Supplementation products containing n-3 PUFA from marine sources serve a large market. Although the amount of eicosapentaenoic acid and docosahexaenoic acid in the products is provided by the manufacturer, no or little information is available on their lipid pattern. Therefore, we quantitatively analyzed the fatty acid pattern in the lipid fractions triglycerides, phospholipids, ethyl esters, and free fatty acids in supplementation products by means of solid phase extraction and gas chromatography. Twelve products from the European and U.S. markets containing fish, krill, algal, or plant oil were analyzed. Total n-3 PUFA content ranged from 68 g/100 g fat (fish oil) to 42 g/100 g fat (algal oil) to 17 g/100 g fat (krill oil). On the basis of the n-3 PUFA containing lipid class, the supplements can be separated dominantly in ethyl ester, re-esterified triglyceride, triglyceride, and phospholipid containing products. Algae-based products contained natural triglycerides, krill oils a complex mixture of phospholipids, triglycerides, and free fatty acids, and fish oil products either ethyl esters, re-esterified triglycerides, or triglycerides. Even products of the same class and source showed distinct differences in their lipid pattern. A specification of the lipid composition of n-3 PUFA products would allow distinguishing the different (qualities of) supplements.

  11. Space plasma contactor research, 1987 (United States)

    Wilbur, Paul J.


    A simple model describing the process of electron collection from a low pressure ambient plasma in the absence of magnetic field and contactor velocity effects is presented. Experimental measurments of the plasma surrounding the contactor are used to demonstrate that a double-sheath generally develops and separates the ambient plasma from a higher density, anode plasma located adjacent to the contactor. Agreement between the predictions of the model and experimental measurements obtained at the electron collection current levels ranging to 1 A suggests the surface area at the ambient plasma boundary of the double-sheath is equal to the electron current being collected divided by the ambient plasma random electron current density; the surface area of the higher density anode plasma boundary of the double-sheath is equal to the ion current being emitted across this boundary divided by the ion current density required to sustain a stable sheath; and the voltage drop across the sheath is determined by the requirement that the ion and electron currents counterflowing across the boundaries be at space-charge limited levels. The efficiency of contactor operation is shown to improve when significant ionization and excitation is induced by electrons that stream from the ambient plasma through the double-sheath and collide with neutral atoms being supplied through the hollow cathode.

  12. The inhibition of fat cell proliferation by n-3 fatty acids in dietary obese mice

    Directory of Open Access Journals (Sweden)

    Kopecky Jan


    Full Text Available Abstract Background Long-chain n-3 polyunsaturated fatty acids (LC n-3 PUFA of marine origin exert multiple beneficial effects on health. Our previous study in mice showed that reduction of adiposity by LC n-3 PUFA was associated with both, a shift in adipose tissue metabolism and a decrease in tissue cellularity. The aim of this study was to further characterize the effects of LC n-3 PUFA on fat cell proliferation and differentiation in obese mice. Methods A model of inducible and reversible lipoatrophy (aP2-Cre-ERT2 PPARγL2/L2 mice was used, in which the death of mature adipocytes could be achieved by a selective ablation of peroxisome proliferator-activated receptor γ in response to i.p. injection of tamoxifen. Before the injection, obesity was induced in male mice by 8-week-feeding a corn oil-based high-fat diet (cHF and, subsequently, mice were randomly assigned (day 0 to one of the following groups: (i mice injected by corn-oil-vehicle only, i.e."control" mice, and fed cHF; (ii mice injected by tamoxifen in corn oil, i.e. "mutant" mice, fed cHF; (iii control mice fed cHF diet with15% of dietary lipids replaced by LC n-3 PUFA concentrate (cHF+F; and (iv mutant mice fed cHF+F. Blood and tissue samples were collected at days 14 and 42. Results Mutant mice achieved a maximum weight loss within 10 days post-injection, followed by a compensatory body weight gain, which was significantly faster in the cHF as compared with the cHF+F mutant mice. Also in control mice, body weight gain was depressed in response to dietary LC n-3 PUFA. At day 42, body weights in all groups stabilized, with no significant differences in adipocyte size between the groups, although body weight and adiposity was lower in the cHF+F as compared with the cHF mice, with a stronger effect in the mutant than in control mice. Gene expression analysis documented depression of adipocyte maturation during the reconstitution of adipose tissue in the cHF+F mutant mice. Conclusion

  13. Plasma metallization

    CERN Document Server

    Crowther, J M


    Many methods are currently used for the production of thin metal films. However, all of these have drawbacks associated with them, for example the need for UHV conditions, high temperatures, exotic metal precursors, or the inability to coat complex shaped objects. Reduction of supported metal salts by non-isothermal plasma treatment does not suffer from these drawbacks. In order to produce and analyse metal films before they become contaminated, a plasma chamber which could be attached directly to a UHV chamber with XPS capability was designed and built. This allowed plasma treatment of supported metal salts and surface analysis by XPS to be performed without exposure of the metal film to the atmosphere. Non-equilibrium plasma treatment of Nylon 66 supported gold(lll) chloride using hydrogen as the feed gas resulted in a 95% pure gold film, the remaining 5% of the film being carbon. If argon or helium were used as the feed gases during plasma treatment the resultant gold films were 100% pure. Some degree of s...

  14. Immunoregulatory and anti-inflammatory effects of n-3 polyunsaturated fatty acids

    Directory of Open Access Journals (Sweden)

    P.C. Calder


    Full Text Available 1. Fish oils are rich in the long-chain n-3 polyunsaturated fatty acids (PUFAs, eicosapentaenoic (20:5n-3 and docosahexaenoic (22:6n-3 acids. Linseed oil and green plant tissues are rich in the precursor fatty acid, a-linolenic acid (18:3n-3. Most vegetable oils are rich in the n-6 PUFA linoleic acid (18:2n-6, the precursor of arachidonic acid (20:4n-6. 2. Arachidonic acid-derived eicosanoids such as prostaglandin E2 are pro-inflammatory and regulate the functions of cells of the immune system. Consumption of fish oils leads to replacement of arachidonic acid in cell membranes by eicosapentaenoic acid. This changes the amount and alters the balance of eicosanoids produced. 3. Consumption of fish oils diminishes lymphocyte proliferation, T-cell-mediated cytotoxicity, natural killer cell activity, macrophage-mediated cytotoxicity, monocyte and neutrophil chemotaxis, major histocompatibility class II expression and antigen presentation, production of pro-inflammatory cytokines (interleukins 1 and 6, tumour necrosis factor and adhesion molecule expression. 4. Feeding laboratory animals fish oil reduces acute and chronic inflammatory responses, improves survival to endotoxin and in models of autoimmunity and prolongs the survival of grafted organs. 5. Feeding fish oil reduces cell-mediated immune responses. 6. Fish oil supplementation may be clinically useful in acute and chronic inflammatory conditions and following transplantation. 7. n-3 PUFAs may exert their effects by modulating signal transduction and/or gene expression within inflammatory and immune cells.

  15. A pilot study investigating early postoperative changes of plasma polyunsaturated fatty acids after laparoscopic sleeve gastrectomy. (United States)

    Aslan, Mutay; Aslan, Ibrahim; Özcan, Filiz; Eryılmaz, Ramazan; Ensari, Cemal Ozben; Bilecik, Tuna


    This study aimed to determine early postoperative changes of plasma polyunsaturated fatty acids (PUFAs) following laparoscopic sleeve gastrectomy (LSG). Ten obese patients (mean BMI: 51.10 ± 11.59 kg/m²) underwent LSG and eleven normal weight control patients (mean BMI: 24.37 ± 2.33 kg/m²) underwent laparoscopic abdominal surgery. Fasting blood samples were collected prior to surgery, at day 1 after surgery and after postoperation oral feeding. Plasma levels of arachidonic acid (AA, C20:4n6), dihomo-gamma-linolenic acid (DGLA, C20:3n6), eicosapentaenoic acid (EPA, C20:5n3) and docosahexaenoic acid (DHA, C22:6n3) were determined by an optimized multiple reaction monitoring (MRM) method using ultra fast-liquid chromatography (UFLC) coupled with tandem mass spectrometry (MS/MS). Prostaglandin E₂ (PGE2) was measured in serum samples by enzyme immunoassay. A significant decrease was observed in insulin and HOMA IR levels in sleeve gastrectomy patients after postoperation oral feeding compared to preoperation. Plasma AA levels and AA/EPA ratio were significantly increased in sleeve gastrectomy patients after postoperation oral feeding compared to postoperation day 1. Serum PGE2 levels and AA/DHA ratio was significantly higher in sleeve gastrectomy patients at preoperation, postoperation day 1 and after postoperation oral feeding when compared to control group patients. Increased peripheral insulin sensitivity associated with LSG may play a role in the significant increase of plasma AA levels in sleeve gastrectomy patients following postoperation oral feeding. The significant increase in PGE2 levels and AA/DHA ratio in sleeve gastrectomy group patients also confirms the presence of a proinflammatory state in obesity.

  16. Effect of dietary intervention to reduce the n-6/n-3 fatty acid ratio on maternal and fetal fatty acid profile and its relation to offspring growth and body composition at 1 year of age. (United States)

    Much, D; Brunner, S; Vollhardt, C; Schmid, D; Sedlmeier, E-M; Brüderl, M; Heimberg, E; Bartke, N; Boehm, G; Bader, B L; Amann-Gassner, U; Hauner, H


    Evidence is accumulating that the long-chain PUFA (LCPUFA) are associated with offspring growth and body composition. We investigated the relationship between LCPUFAs in red blood cells (RBCs) of pregnant women/breastfeeding mothers and umbilical cord RBCs of their neonates with infant growth and body composition ≤ 1 year of age. In an open-label randomized, controlled trial, 208 healthy pregnant women received a dietary intervention (daily supplementation with 1200 mg n-3 LCPUFAs and dietary counseling to reduce arachidonic acid (AA) intake) from the 15th week of gestation until 4 months of lactation or followed their habitual diet. Fatty acids of plasma phospholipids (PLs) and RBCs from maternal and cord blood were determined and associated with infant body weight, body mass index (BMI), lean body mass and fat mass assessed by skinfold thickness measurements and ultrasonography. Dietary intervention significantly reduced the n-6/n-3 LCPUFA ratio in maternal and cord-blood plasma PLs and RBCs. Maternal RBCs docosahexaenoic acid (DHA), n-3 LCPUFAs and n-6 LCPUFAs at the 32nd week of gestation were positively related to birth weight. Maternal n-3 LCPUFAs, n-6 LCPUFAs and AA were positively associated with birth length. Maternal RBCs AA and n-6 LCPUFAs were significantly negatively related to BMI and Ponderal Index at 1 year postpartum, but not to fat mass. Maternal DHA, AA, total n-3 LCPUFAs and n-6 LCPUFAs might serve as prenatal growth factors, while n-6 LCPUFAs also seems to regulate postnatal growth. The maternal n-6/n-3 LCPUFA ratio does not appear to have a role in adipose tissue development during early postnatal life.

  17. (1H-Benzimidazole-5-carboxylic acid-κN3(1H-benzimidazole-6-carboxylic acid-κN3silver(I perchlorate

    Directory of Open Access Journals (Sweden)

    Li Ma


    Full Text Available The reaction of 1H-benzimidazole-5-carboxylic acid with silver nitrate in the presence of perchloric acid under hydrothermal conditions yielded the title complex, [Ag(C8H6N2O22]ClO4, which comprises of an [Ag(C8H6N2O22] mononuclear cation and a perchlorate anion. The AgI ion is coordinated by two N atoms from two different neutral 1H-benzimidazole-5-carboxylic acid ligands with an N—Ag—N bond angle of 163.21 (14°, forming an [Ag(C8H6N2O22] mononuclear cation. Although both ligands in the mononuclear cation are monodentate with one N atom coordinated to the metal ion, they are different: one is N3 coordinated to the Ag I ion and the N1 atom protonated, the other with the N1 coordinated to the Ag I ion and the N3 atom protonated (and thus formally a 1H-benzimidazole-6-carboxylic acid rather than a 1H-benzimidazole-5-carboxylic acid ligand. The planes of the two planar ligands are roughly perpendicular, making a dihedral angle of 84.97 (2°. The packing of the ions is stablized by extensive O—H...O, N—H...O and C—H...O hydrogen bonds, and by remote Ag...O interactions [3.002 (3, 3.581 (5 and 3.674 (5 Å].

  18. n-3 LCPUFA in the reversal of hepatic steatosis: the role of ACOX and CAT-1

    Directory of Open Access Journals (Sweden)

    Tapia, G. S.


    Full Text Available The aim of this study was to investigate the roles of the Acyl co-enzyme A oxidase (ACOX, carnitine acyl transferase I (CAT-1 and activating protein 1 (AP-1 in the reversal of hepatic steatosis with dietary change and n-3 long chain polyunsaturated fatty acid (n-3 LCPUFA supplementation. Male C57BL/6J mice were given either a control diet (CD or a high fat diet (HFD for 12 weeks, and then continued with the CD or CD plus n-3 LCPUFA for eight weeks. After this period, body and adipose visceral tissue weight were analyzed and liver samples were taken to measure ACOX, CAT-1 and c-jun levels. The dietary change from HFD to a norm caloric diet plus n-3 LCPUFA supplementation significantly reduced liver steatosis and adipose tissue: body weight ratio, along with an increase in the hepatic ACOX and CAT-1 levels and normalization of AP-1 expression that could favor the fatty acid beta-oxidation over lipogenesis and regulate inflammation. These results provide new data on the enzymatic metabolism underlying dietary change to a norm caloric diet plus n-3 LCPUFA supplementation.El objetivo de este estudio fue investigar el rol de las enzimas Acil coenzima A oxidasa (ACOX y Acil carnitina transferasa 1 (CAT-1, además del factor de transcripción, Proteína activadora 1 (AP-1 en la reversión de la esteatosis hepática mediante cambio de dieta más suplementación con Ácidos grasos poliinsaturados de cadena larga omega tres (AGPICL n-3. Ratones macho de la cepa C57BL/6J fueron alimentados con dieta control (DC o alta en grasas (DAG durante 12 semanas, luego continuaron con DC con o sin suplementación de AGPICL n-3 durante 8 semanas. Después de este período, se analizó el peso corporal y del tejido adiposo visceral; en las muestras hepáticas se evaluaron los niveles de ACOX, CAT-1 y AP-1. El cambio a dieta control más suplementación con AGPICL n-3 reduce significativamente la esteatosis hepática y la relación tejido adiposo/peso corporal, acompa

  19. Surface plasma source with saddle antenna radio frequency plasma generatora) (United States)

    Dudnikov, V.; Johnson, R. P.; Murray, S.; Pennisi, T.; Piller, C.; Santana, M.; Stockli, M.; Welton, R.


    A prototype RF H- surface plasma source (SPS) with saddle (SA) RF antenna is developed which will provide better power efficiency for high pulsed and average current, higher brightness with longer lifetime and higher reliability. Several versions of new plasma generators with small AlN discharge chambers and different antennas and magnetic field configurations were tested in the plasma source test stand. A prototype SA SPS was installed in the Spallation Neutron Source (SNS) ion source test stand with a larger, normal-sized SNS AlN chamber that achieved unanalyzed peak currents of up to 67 mA with an apparent efficiency up to 1.6 mA/kW. Control experiments with H- beam produced by SNS SPS with internal and external antennas were conducted. A new version of the RF triggering plasma gun has been designed. A saddle antenna SPS with water cooling is fabricated for high duty factor testing.

  20. A Multibunch Plasma Wakefield Accelerator

    CERN Document Server

    Kallos, Efthymios; Ben-Zvi, Ilan; Katsouleas, Thomas C; Kimura, Wayne D; Kusche, Karl; Muggli, Patric; Pavlishin, Igor; Pogorelsky, Igor; Yakimenko, Vitaly; Zhou, Feng


    We investigate a plasma wakefield acceleration scheme where a train of electron microbunches feeds into a high density plasma. When the microbunch train enters such a plasma that has a corresponding plasma wavelength equal to the microbunch separation distance, a strong wakefield is expected to be resonantly driven to an amplitude that is at least one order of magnitude higher than that using an unbunched beam. PIC simulations have been performed using the beamline parameters of the Brookhaven National Laboratory Accelerator Test Facility operating in the configuration of the STELLA inverse free electron laser (IFEL) experiment. A 65 MeV electron beam is modulated by a 10.6 um CO2 laser beam via an IFEL interaction. This produces a train of ~90 microbunches separated by the laser wavelength. In this paper, we present both a simple theoretical treatment and simulation results that demonstrate promising results for the multibunch technique as a plasma-based accelerator.

  1. Responses to n-3 fatty acid (LCPUFA) supplementation of gestating gilts, and lactating and weaned sows. (United States)

    Smit, M N; Patterson, J L; Webel, S K; Spencer, J D; Cameron, A C; Dyck, M K; Dixon, W T; Foxcroft, G R


    Feeding n-3 long-chain polyunsaturated fatty acids (LCPUFA) to gilts or sows has shown different responses to litter growth, pre-weaning mortality and subsequent reproductive performance of the sow. Two hypotheses were tested: (1) that feeding a marine oil-based supplement rich in protected n-3 LCPUFAs to gilts in established gestation would improve the growth performance of their litters; and (2) that continued feeding of the supplement during lactation and after weaning would offset the negative effects of lactational catabolism induced, using an established experimental model involving feed restriction of lactating primiparous sows. A total of 117 primiparous sows were pair-matched at day 60 of gestation by weight, and when possible, litter of origin, and were allocated to be either control sows (CON) fed standard gestation and lactation diets, or treated sows (LCPUFA) fed the standard diets supplemented with 84 g/day of a n-3 LCPUFA rich supplement, from day 60 of first gestation, through a 21-day lactation, and until euthanasia at day 30 of their second gestation. All sows were feed restricted during the last 7 days of lactation to induce catabolism, providing a background challenge against which to determine beneficial effects of n-3 LCPUFA supplementation on subsequent reproduction. In the absence of an effect on litter size or birth weight, n-3 LCPUFA tended to improve piglet BW gain from birth until 34 days after weaning (P = 0.06), while increasing pre-weaning mortality (P = 0.05). It did not affect energy utilization by the sow during lactation, thus not improving the catabolic state of the sows. Supplementation from weaning until day 30 of second gestation did not have an effect on embryonic weight, ovulation rate or early embryonic survival, but did increase corpora lutea (CL) weight (P = 0.001). Eicosapentaenoic acid and docosahexaenoic acid (DHA) levels were increased in sow serum and CL (P < 0.001), whereas only DHA levels increased in embryos (P

  2. Radiation phenomena in plasmas

    National Research Council Canada - National Science Library

    Ohnuma, Toshiro; Ohnuma, T


    ... electromagnetic and electrostatic waves can propagate. In the development of space sciences, processing plasmas and fusion plasmas etc., plasmas have been investigated in many problems and practic...

  3. Plasma physics and engineering

    CERN Document Server

    Fridman, Alexander


    Part I: Fundamentals of Plasma Physics and Plasma ChemistryPlasma in Nature, in the Laboratory, and in IndustryOccurrence of Plasma: Natural and Man MadeGas DischargesPlasma Applications, Plasmas in IndustryPlasma Applications for Environmental ControlPlasma Applications in Energy ConversionPlasma Application for Material ProcessingBreakthrough Plasma Applications in Modern TechnologyElementary Processes of Charged Species in PlasmaElementary Charged Particles in Plasma and Their Elastic and Inelastic CollisionsIonization ProcessesMechanisms of Electron Losses: The Electron-Ion RecombinationEl


    NARCIS (Netherlands)

    Jaspers, R. J. E.


    A brief introduction into the spectroscopy of fusion plasmas is presented. Basic principles of the emission of ionic, atomic and molecular radiation is explained and a survey of the effects, which lead to the population of the respective excited levels, is given. Line radiation, continuum radiation,

  5. Effects of an n-3-deficient diet on brain, retina, and liver fatty acyl composition in artificially reared rats. (United States)

    Moriguchi, Toru; Lim, Sun-Young; Greiner, Rebecca; Lefkowitz, William; Loewke, James; Hoshiba, Junji; Salem, Norman


    Rat pups born to dams fed a diet with 3.1% of total fatty acids as alpha-linolenic acid (LNA) were fed, using an artificial rearing system, either an n-3-deficient (n-3-Def) or an n-3-adequate (n-3-Adq) diet. Both diets contained 17.1% linoleic acid, but the n-3-Adq diet also contained 3.1% LNA. The percentage of brain docosahexaenoic acid (DHA) continuously decreased (71%) with time over the 29 days of the experiment, with concomitant increases in docosapentaenoic acid (DPAn-6). In the retina, the percentage of DHA rose in the n-3-Adq group, with an apparent increased rate around the time of eye opening. However, there was a flat curve for the percentage of DHA in the n-3-Def group and a rising DPAn-6 with time. Liver DHA was highest at the time of birth in the n-3-Adq group but fell off somewhat over the course of 29 days. This decrease was more pronounced in the n-3-Def group, and the DPAn-6 rose considerably during the second half of the experiment. This method presents a first-generation model for n-3 deficiency that is more similar to the case of human nutrition than is the commonly employed two-generation model. Copyright 2004 American Society for Biochemistry and Molecular Biology, Inc.

  6. Plasma norepinephrine in humans: limitations in assessment of whole body norepinephrine kinetics and plasma clearance

    DEFF Research Database (Denmark)

    Henriksen, Jens Henrik; Christensen, N J


    ]IP and 131I-hippurate, whole body clearance from plasma of [3H]NE, as obtained from infusion rate divided by plasma concentration of tracer [1.74 +/- 0.64 (SD) 1/min] was significantly higher than the value obtained by total tracer infusion divided by total plasma area of tracer (1.27 +/- 0.51, P less than 0...

  7. Effect of n-3 polyunsaturated fatty acids on the lipidic profile of healthy Mexican volunteers

    Directory of Open Access Journals (Sweden)



    Full Text Available Objective. The effect of n-3 polyunsaturated fatty acids on the serum lipid profile in a Mexican population was evaluated. Material and methods. Three g of salmon oil was the daily intake during four weeks. Total cholesterol, triglycerides, low density lipoproteins, high density lipoproteins and erythrocyte fatty acid composition were analyzed. Results. The hypertriglyceridemic group showed a statistically significant (p< 0.05 reduction of triglycerides and significant (p< 0.01 elevation of high density lipoproteins. The hypercholesterolemic group reduced significantly the levels of cholesterol and triglycerides; high density lipoproteins were augmented by 11.6%. Conclusions. The hipolipidemic effect of n-3 polyunsaturated fatty acids was manifest in the Mexican volunteers under the conditions here evaluated.

  8. Simple preparation of new N-aryl-N-(3-indolmethyl acetamides and their spectroscopic analysis

    Directory of Open Access Journals (Sweden)

    José A. Henao


    Full Text Available To prepare new indolic molecules and characterize them by spectroscopic methods. Materials and methods: All reagentswere purchased from Aldrich, commercial grade. The purity of the products and the composition of the reaction mixtures were monitoredby thin layer chromatography over Silufol UV254 0.25 mm-thick chromatoplates. Product isolation and purification were performed bycolumn chromatography (SiO2, using ethyl acetate-petroleum ether mixtures as eluents. Results. The synthesis of new N-aryl-N-(3-indolmethyl acetamides based on first step iminization reaction of indol-3-carbaldehyde is accomplished. The structures of the C-3substituted indoles were confirmed by 1H-NMR and 13C-NMR studies supported by inverse-detected 2D NMR experiments and alsothrough monocrystal X-ray diffraction. Conclusions. An efficient, economic, and fast synthetic route was designed to the construction ofthe N-aryl-N-(3-indolmethyl acetamides, structural analogues of some alkaloids.

  9. Combined deficiency of iron and (n-3) fatty acids in male rats disrupts brain monoamine metabolism and produces greater memory deficits than iron deficiency or (n-3) fatty acid deficiency alone1-3


    Baumgartner, Jeannine; Smuts, Cornelius M; Malan, Linda; Arnold, Myrtha; Yee, Benjamin K


    Deficiencies of iron (Fe) (ID) and (n-3) fatty acids (FA) [(n-3)FAD] may impair brain development and function through shared mechanisms. However, little is known about the potential interactions between these 2 common deficiencies. We studied the effects of ID and (n-3)FAD, alone and in combination, on brain monoamine pathways (by measuring monoamines and related gene expression) and spatial working and reference memory (by Morris water maze testing). Using a 2 × 2 design, male rats were fed...

  10. Fatty acid patterns of dog erythrocyte membranes after feeding of a fish-oil based DHA-rich supplement with a base diet low in n-3 fatty acids versus a diet containing added n-3 fatty acids


    Fuhrmann Herbert; Nielsen Leif; Stoeckel Katja; Bachmann Lisa


    Abstract Background In dogs, increasing the tissue n-3 fatty acid (FA) content is associated with potential benefit in some medical conditions, e.g. atopic dermatitis, cancer or heart disease. Therefore effectively and conveniently increasing tissue n-3 FA levels in dogs is of interest. Incorporation of dietary n-3 FA into cell membranes may be studied by FA analysis of erythrocyte membranes (EM), because of the correlation of its FA composition with the FA composition of other cells. Aim of ...

  11. Topochemical Nitridation with Anion Vacancy-Assisted N(3-)/O(2-) Exchange. (United States)

    Mikita, Riho; Aharen, Tomoko; Yamamoto, Takafumi; Takeiri, Fumitaka; Ya, Tang; Yoshimune, Wataru; Fujita, Koji; Yoshida, Suguru; Tanaka, Katsuhisa; Batuk, Dmitry; Abakumov, Artem M; Brown, Craig M; Kobayashi, Yoji; Kageyama, Hiroshi


    We present how the introduction of anion vacancies in oxyhydrides enables a route to access new oxynitrides, by conducting ammonolysis of perovskite oxyhydride EuTiO3-xHx (x ∼ 0.18). At 400 °C, similar to our studies on BaTiO3-xHx, hydride lability enables a low temperature direct ammonolysis of EuTi(3.82+)O2.82H0.18, leading to the N(3-)/H(-)-exchanged product EuTi(4+)O2.82N0.12□0.06. When the ammonolysis temperature was increased up to 800 °C, we observed a further nitridation involving N(3-)/O(2-) exchange, yielding a fully oxidized Eu(3+)Ti(4+)O2N with the GdFeO3-type distortion (Pnma) as a metastable phase, instead of pyrochlore structure. Interestingly, the same reactions using the oxide EuTiO3 proceeded through a 1:1 exchange of N(3-) with O(2-) only above 600 °C and resulted in incomplete nitridation to EuTiO2.25N0.75, indicating that anion vacancies created during the initial nitridation process of EuTiO2.82H0.18 play a crucial role in promoting anion (N(3-)/O(2-)) exchange at high temperatures. Hence, by using (hydride-induced) anion-deficient precursors, we should be able to expand the accessible anion composition of perovskite oxynitrides.

  12. N-acyl amines of docosahexaenoic acid and other n-3 polyunsatured fatty acids – From fishy endocannabinoids to potential leads

    NARCIS (Netherlands)

    Meijerink, J.; Balvers, M.G.J.; Witkamp, R.F.


    N-3 long chain polyunsaturated fatty acids (n-3 LC PUFAs), in particular a-linolenic acid (18:3n-3), eicosapentaenoic acid (EPA; 20:5n-3) and docosahexaenoic acid (DHA; 22:6n-3) are receiving much attention because of their presumed beneficial health effects. To explain these, a variety of

  13. Plasma treatment of crane rails

    Directory of Open Access Journals (Sweden)

    Владислав Олександрович Мазур


    Full Text Available Crane operation results in wear and tear of rails and crane wheels. Renovation and efficiency of these details is therefore relevant. Modern technologies of wheels and rails restoration use surfacing or high-frequency currents treatment. Surface treatment with highly concentrated streams of energy- with a laser beam, plasma jet- is a promising direction.. It is proposed to increase the efficiency of crane rails by means of surface plasma treatment. The modes of treatment have been chosen.. Modelling of plasma jet thermal impact on a solid body of complex shape has been made. Plasma hardening regimes that meet the requirements of production have been defined. Structural transformation of the material in the crane rails on plasma treatment has been investigated. It has been concluded that for carbon and low alloy crane steels the plasma exposure zone is characterized by a high degree of hardened structure dispersion and higher hardness as compared to the hardness after high-frequency quenching. As this takes place phase transformations are both shift (in the upper zone of plasma influence and fluctuation (in the lower zone of the plasma. With high-speed plasma heating granular or lamellar pearlite mainly transforms into austenite. The level of service characteristics of hardened steel, which is achieved in this case is determined by the kinetics and completeness of pearlite → austenite transformation. For carbon and low alloy rail steels plasma hardening can replace bulk hardening, hardening by high-frequency currents, or surfacing. The modes for plasma treatment which make it possible to obtain a surface layer with a certain service characteristics have been defined

  14. n-3 LCPUFA improves cognition: the young, the old and the sick. (United States)

    Joffre, C; Nadjar, A; Lebbadi, M; Calon, F; Laye, S


    Due to the implication of docosahexaenoic acid (DHA) in neurogenesis, synaptogenesis, neurite outgrowth and to its high incorporation into the brain, this n-3 long chain polyunsaturated fatty acid (LCPUFA) is considered as crucial in the development and maintenance of the learning memory performance throughout life. In the present chapter we aimed at reviewing data investigating the relation between DHA and cognition during the perinatal period, young adult- and adulthood and neurodegenerative diseases such as Alzheimer disease (AD). In Humans, dietary DHA supplementation from the perinatal period to adulthood does not reveal a clear and consistent memory improvement whereas it is the case in animal studies. The positive effects observed in animal models may have been enhanced by using n-3 PUFA deficient animal models as controls. In animal models of AD, a general consensus on the beneficial effects of n-3 LCPUFA in attenuating cognitive impairment was established. These studies make DHA a potential suitable micronutrient for the maintenance of cognitive performance at all periods of life. Copyright © 2014 Elsevier Ltd. All rights reserved.

  15. Neuroinflammation and aging: influence of dietary n-3 polyunsaturated fatty acid*

    Directory of Open Access Journals (Sweden)

    Layé Sophie


    Full Text Available The innate immune system of the brain is principally composed of microglial cells and astrocytes, which, once activated, protect neurons against noxious agents or lesions. Activated glial cells produce inflammatory cytokines that act specifically through receptors expressed in the brain, leading to the development of altered emotional and cognitive behavior. These behavioral alterations cease along with the synthesis of brain cytokines. When the level of expression of these cytokines remains high, they become toxic to neurons possibly leading to neuronal death, as observed in neurodegenerative disorders such as Alzheimer’s disease. Omega-3 (n-3 type polyunsaturated fatty acids (PUFAs are essential nutrients and fundamental components of neuronal and glial cell membranes. Additionally, they have immunomodulatory properties. They accumulate in the brain during the perinatal period in a dietary supply-dependant fashion. Their brain levels diminish with age, but can be corrected by a diet enriched in n-3 PUFAs. The increasing exposure of the population to diets unbalanced in n-3 PUFAs could contribute to the deleterious effect of inflammatory cytokines in the brain.

  16. In-orbit results of Delfi-n3Xt: Lessons learned and move forward (United States)

    Guo, Jian; Bouwmeester, Jasper; Gill, Eberhard


    This paper provides an update of the Delfi nanosatellite programme of the Delft University of Technology (TU Delft), with a focus on the recent in-orbit results of the second TU Delft satellite Delfi-n3Xt. In addition to the educational objective that has been reached with more than 80 students involved in the project, most of the technological objectives of Delfi-n3Xt have also been fulfilled with successful in-orbit demonstrations of payloads and platform. Among these demonstrations, four are highlighted in this paper, including a solid cool gas micropropulsion system, a new type of solar cell, a more robust Command and Data Handling Subsystem (CDHS), and a highly integrated Attitude Determination and Control Subsystem (ADCS) that performs three-axis active control using reaction wheels. Through the development of Delfi-n3Xt, significant experiences and lessons have been learned, which motivated a further step towards DelFFi, the third Delfi CubeSat mission, to demonstrate autonomous formation flying using two CubeSats named Delta and Phi. A brief update of the DelFFi mission is also provided.

  17. The Effect of Marine Derived n-3 Fatty Acids on Adipose Tissue Metabolism and Function

    Directory of Open Access Journals (Sweden)

    Marijana Todorčević


    Full Text Available Adipose tissue function is key determinant of metabolic health, with specific nutrients being suggested to play a role in tissue metabolism. One such group of nutrients are the n-3 fatty acids, specifically eicosapentaenoic acid (EPA; 20:5n-3 and docosahexaenoic acid (DHA; 22:6n-3. Results from studies where human, animal and cellular models have been utilised to investigate the effects of EPA and/or DHA on white adipose tissue/adipocytes suggest anti-obesity and anti-inflammatory effects. We review here evidence for these effects, specifically focusing on studies that provide some insight into metabolic pathways or processes. Of note, limited work has been undertaken investigating the effects of EPA and DHA on white adipose tissue in humans whilst more work has been undertaken using animal and cellular models. Taken together it would appear that EPA and DHA have a positive effect on lowering lipogenesis, increasing lipolysis and decreasing inflammation, all of which would be beneficial for adipose tissue biology. What remains to be elucidated is the duration and dose required to see a favourable effect of EPA and DHA in vivo in humans, across a range of adiposity.

  18. Consumer perception and sensory effect of oxidation in savory-flavored yogurt enriched with n-3 lipids. (United States)

    Rognlien, M; Duncan, S E; O'Keefe, S F; Eigel, W N


    The objective of this study was to determine the effects of different oils (butter, fish, and oxidized fish) on sensory characteristics of a savory [chile-lime (CL)] low-fat yogurt using descriptive (unstructured line scales, 5 attributes) and affective (hedonic) sensory testing methods. Yogurts were each manufactured at low [1.1-1.2% total fat; 0.43% added oil (wt/wt)] or high [1.6% total fat; 1% added oil (wt/wt)] levels of fish oil, with high levels of fish oil targeted to deliver 145 mg of docosahexaenoic acid+eicosapentaenoic acid/170 g of yogurt. In a preliminary study, untrained panelists (n=31), using triangle tests, did not discriminate between low levels of fish and butter oils in unflavored yogurts but could discern yogurt with oxidized fish oil, even at the low level. Trained panelists (n=12) described lower lime and acid flavor characteristics in CL-flavored yogurts containing 1% oxidized fish oil compared with yogurts containing low levels of oxidized fish oil and low or high levels of butter and fish oils. Oxidized flavor was higher in CL-flavored yogurts with oxidized fish oil (low and high) and with the high level of fish oil. Consumer ratings (n=100; 9-point hedonic scale; 9="like extremely) of overall acceptability and flavor acceptability were bimodally distributed, with overall means between 4 and 5 ("neither like nor dislike") for CL-flavored yogurt with butter or fish oils (high level). The upper 50% of responses for yogurt with butter or fish oil were 6.51 and 6.31, respectively, for overall acceptability ("like slightly"), and 7.02 and 6.56, respectively, for flavor acceptability. A large segment of consumers may be interested in incorporating heart-healthy n-3 lipids in their diets through frequent consumption of a savory yogurt enriched with n-3 fatty acids. Copyright © 2012 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  19. The effects of n-3 fatty acids on inflammatory cytokines in osteoporotic spinal cord injured patients: A randomized clinical trial

    Directory of Open Access Journals (Sweden)

    Hadis Sabour


    Full Text Available Background: Clinical studies have reported that osteoporosis after spinal cord injury (SCI can be the inflammation-induced base condition and n-3 polyunsaturated fatty acids (PUFAs suppress the production of pro-inflammatory cytokines. This study documents the effects of n-3 PUFAs on cytokines in a group of patients after chronic SCI. Methods: This double-blind, placebo- controlled trial was designed in 82 (69 males and 13 females osteoporotic patients with SCI for 4 months. All participants received 1000 mg calcium and 400 IU vitamin D daily. The patients received two MorDHA capsules (435 g of DHA and 65 mg of EPA per day or two placebo capsules (one with lunch, and the other with dinner in the treatment and control groups, respectively. Serum interleukins and Dietary intakes were assessed in the beginning and end of the study. Mean difference for each group was compared by using Student′s t test. Results: A total of 75 (13 females, 62 males participants completed the study over 4 months. The supplemented and control groups did not show any difference in their baseline characteristics. There were significant difference neither between two groups at the end of the study nor in each group between beginning and end of the study. Conclusins: MorDHA supplementation for 4 months had no significant effect on inflammatory markers. Although mean difference in all pro-inflammatory cytokines were not significant in both treatment and control groups during the study (P>0.05, the decrease in treatment group was weakly higher that it may be important in point of clinical view.

  20. Electrosurgical plasmas

    Energy Technology Data Exchange (ETDEWEB)

    Stalder, Kenneth R; McMillen, Donald F; Woloszko, Jean [ArthroCare Corp., Sunnyvale, CA 94085-3523 (United States)


    Electrosurgical medical devices based on repetitively pulsed nonequilibrium micron-scale to millimetre-scale plasma discharges in saline solutions are described. The formation of vapour layers (bubbles) around active electrodes appears to be a common feature at moderate (<300 V rms) voltages, and dissociation, excitation and ionization of the vapour in these bubbles produces chemical conditions that are thought to be the source of beneficial tissue removal and treatment. Experimental data are discussed, as are the results of modelling efforts of the plasma chemistry. Hydroxyl radicals, hydrogen atoms and other species are observed spectroscopically and their interactions with collagen, a common component of tissue encountered in surgical situations, are considered. Several pathways by which hydroxyl radicals interacting with collagen can lead to tissue removal are discussed.

  1. Fusion plasmas (United States)

    Engelmann, F.


    In the following, a synthetic review of the information reported at the Conference will be given. No attempt is made to summarize specific contributions; rather the material contributed will be looked at from a few different angles. All areas of fusion plasma physics were represented: there were experimental results on magnetic confinement (tokamaks; stellarators; mirrors; reversed field pinches; field reversed configurations; Z-pinches, with emphasis on the dense Z-pinch; plasma focus, ect.) and on inertial confinement; related modelling and diagnolstics development; theory, as well as some technological activities (power generators; RF sources, etc.) and component (e.g. antennae) development for smaller fusion devices. In particular, fusion-related research in Latin America was exhaustively covered. In addition, large future projects in fusion research were summarized. (AIP)

  2. Long-term survival with surgery as part of a multimodality approach for N3 lung cancer. (United States)

    Riquet, Marc; Mordant, Pierre; Fabre-Guillevin, Elizabeth; Arame, Alex; Foucault, Christophe; Dujon, Antoine; Le Pimpec Barthes, Françoise


    The extension of non-small-cell lung cancer (NSCLC) to supraclavicular (SC) and contralateral (CL) mediastinal lymph nodes is termed N3 and usually forbids surgical resection. However, scarce surgical series have reported encouraging results, and we sought to analyse our experience with this particular subgroup of patients. We retrospectively reviewed the charts of 5857 patients undergoing surgery for NSCLC during the last 30 years in two French centres. Eleven patients presenting with pathological-N3 were found, and more closely analysed concerning lymphatic spread, surgical indication and prognosis. N3 consisted of tumoural extension to the SC (n = 5), CL mediastinal (n = 5) or both (SC + CL, n = 1) stations. Patients underwent induction treatment with chemotherapy alone (n = 4), chemoradiotherapy (n = 3) or first-line surgery (n = 4). All patients underwent a complete surgical resection of the tumour associated with ipsilateral systematic mediastinal lymph node dissection. Additional resection of N3 lymph nodes was performed in 8 cases. Adjuvant treatment included chemoradiotherapy (n = 6), chemotherapy alone (n = 1) or radiation therapy alone (n = 1). All 5 patients with SC-N3 presented with ipsilateral disease; 3 of them survived 5 years. Four patients with CL-N3 presented with left-sided tumour and nodal extension to the 4R station, and none of them survived. Some N3-patients with specific anatomical location may benefit from multimodality treatment including surgery. These results support further prospective studies for selected N3-patients.

  3. Red Blood Cell Docosapentaenoic Acid (DPA n-3) is Inversely Associated with Triglycerides and C-reactive Protein (CRP) in Healthy Adults and Dose-Dependently Increases Following n-3 Fatty Acid Supplementation (United States)

    Skulas-Ray, Ann C.; Flock, Michael R.; Richter, Chesney K.; Harris, William S.; West, Sheila G.; Kris-Etherton, Penny M.


    The role of the long-chain omega-3 (n-3) fatty acids eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA) in lipid metabolism and inflammation has been extensively studied; however, little is known about the relationship between docosapentaenoic acid (DPA, 22:5 n-3) and inflammation and triglycerides (TG). We evaluated whether n-3 DPA content of red blood cells (RBC) was associated with markers of inflammation (interleukin-6 (IL-6), tumor necrosis factor α (TNF-α), and C-reactive protein (CRP) and fasting TG prior to n-3 supplementation in two studies (Study 1: n = 115, aged 20–44 years, body mass index (BMI) 20–30 kg/m2, TG = 34–176 mg/dL; Study 2: n = 28, aged 22–65 years, BMI 24–37 kg/m2, TG = 141–339 mg/dL). We also characterized the dose-response effects of n-3 fatty acid supplementation on RBC n-3 DPA after five months of supplementation with fish oil (Study 1: 0, 300, 600, 900, and 1800 mg/day EPA + DHA) and eight weeks of prescription n-3 ethyl esters (Study 2: 0, 850, and 3400 mg/day EPA + DHA). In Study 1, RBC n-3 DPA was inversely correlated with CRP (R2 = 36%, p < 0.001) and with fasting TG (r = −0.30, p = 0.001). The latter finding was replicated in Study 2 (r = −0.33, p = 0.04). In both studies, n-3 supplementation significantly increased RBC n-3 DPA dose-dependently. Relative increases were greater for Study 1, with increases of 29%–61% vs. 14%–26% for Study 2. The associations between RBC n-3 DPA, CRP, and fasting TG may have important implications for the prevention of atherosclerosis and chronic inflammatory diseases and warrant further study. PMID:26247967

  4. Plasma physics

    CERN Document Server

    Cairns, R A


    This book is intended as an introduction to plasma physics at a level suitable for advanced undergraduates or beginning postgraduate students in physics, applied mathematics or astrophysics. The main prerequisite is a knowledge of electromagnetism and of the associated mathematics of vector calculus. SI units are used throughout. There is still a tendency amongst some plasma physics researchers to· cling to C.g.S. units, but it is the author's view that universal adoption of SI units, which have been the internationally agreed standard since 1960, is to be encouraged. After a short introductory chapter, the basic properties of a plasma con­ cerning particle orbits, fluid theory, Coulomb collisions and waves are set out in Chapters 2-5, with illustrations drawn from problems in nuclear fusion research and space physics. The emphasis is on the essential physics involved and (he theoretical and mathematical approach has been kept as simple and intuitive as possible. An attempt has been made to draw attention t...

  5. Effect of intravenous injection of galanin on plasma concentrations ...

    African Journals Online (AJOL)

    The goal of this study was to determine whether intravenously galanin injection effect on plasma concentrations of growth hormone (GH), thyroxine (T4), triiodothyronine (T3) and milk production in the. Saanen goats. Fifteen Saanen goats were randomly divided into 5 groups (n = 3 in each group). Each group received daily ...

  6. Prognostic implications of plasma fibrinogen and serum C- reactive ...

    African Journals Online (AJOL)

    Key words: Plasma fibrinogen, serum C-reactive protein, biomarker, non-small cell lung cancer. Tropical Journal of Pharmaceutical Research is ... showing coexistence of any cancer apart from. NSCLC, treated by radiotherapy or ... suspected of having N2-N3 disease, cervical mediastinoscopy was performed. The final.

  7. In male rats with concurrent iron and (n-3) fatty acid deficiency, provision of either iron or (n-3) fatty acids alone alters monoamine metabolism and exacerbates the cognitive deficits associated with combined deficiency

    NARCIS (Netherlands)

    Baumgartner, J.; Smuts, C.M.; Malan, L.; Arnold, M.; Yee, B.K.; Bianco, L.E.; Boekschoten, M.V.; Muller, M.R.; Langhans, W.; Hurrell, R.F.; Zimmermann, M.B.


    Concurrent deficiencies of iron (Fe) (ID) and (n-3) fatty acids [(n-3)FAD)] in rats can alter brain monoamine pathways and impair learning and memory. We examined whether repletion with Fe and DHA/EPA, alone and in combination, corrects the deficits in brain monoamine activity (by measuring

  8. Fatty acid patterns of dog erythrocyte membranes after feeding of a fish-oil based DHA-rich supplement with a base diet low in n-3 fatty acids versus a diet containing added n-3 fatty acids. (United States)

    Stoeckel, Katja; Nielsen, Leif Højvang; Fuhrmann, Herbert; Bachmann, Lisa


    In dogs, increasing the tissue n-3 fatty acid (FA) content is associated with potential benefit in some medical conditions, e.g. atopic dermatitis, cancer or heart disease. Therefore effectively and conveniently increasing tissue n-3 FA levels in dogs is of interest. Incorporation of dietary n-3 FA into cell membranes may be studied by FA analysis of erythrocyte membranes (EM), because of the correlation of its FA composition with the FA composition of other cells. Aim of the study was to determine whether an n-3 FA additive added to a control diet is as effective in increasing EM n-3 FA content as feeding an n-3 FA enriched diet. Furthermore the time course of the incorporation of dietary n-3 FA into canine EM was investigated. Thirty dogs were randomly divided into three dietary groups with ten dogs per group. CONT got a dry dog food diet which did not contain EPA or DHA. FO got a dry dog food diet with a high EPA and DHA content. ADD got the CONT diet combined with an n-3 FA additive rich in DHA and EPA. After a feeding period of 12 weeks the additive was discontinued in ADD and these dogs were fed CONT diet for another four weeks to observe washout effects. Erythrocyte lipids were extracted from venous blood samples and their FA composition was determined by gas chromatography. The Mann-Whitney-U-test was used to detect significant differences between the different groups and time points. After one week the proportions of n-3 FA, DHA and EPA were already significantly increased in ADD and FO, apparently reaching a plateau within eight weeks. In our study DHA and not EPA was preferably incorporated into the EM. After discontinuing the administration of the additive in ADD, the n-3 FA values declined slowly without reaching baseline levels within four weeks. In dogs, an increase of dietary n-3 FA content leads to a rapid inclusion of n-3 FA into EM, regardless of whether the n-3 FA are offered as an enriched diet or as a normal diet supplemented with an n-3 FA

  9. Fatty acid patterns of dog erythrocyte membranes after feeding of a fish-oil based DHA-rich supplement with a base diet low in n-3 fatty acids versus a diet containing added n-3 fatty acids

    Directory of Open Access Journals (Sweden)

    Fuhrmann Herbert


    Full Text Available Abstract Background In dogs, increasing the tissue n-3 fatty acid (FA content is associated with potential benefit in some medical conditions, e.g. atopic dermatitis, cancer or heart disease. Therefore effectively and conveniently increasing tissue n-3 FA levels in dogs is of interest. Incorporation of dietary n-3 FA into cell membranes may be studied by FA analysis of erythrocyte membranes (EM, because of the correlation of its FA composition with the FA composition of other cells. Aim of the study was to determine whether an n-3 FA additive added to a control diet is as effective in increasing EM n-3 FA content as feeding an n-3 FA enriched diet. Furthermore the time course of the incorporation of dietary n-3 FA into canine EM was investigated. Methods Thirty dogs were randomly divided into three dietary groups with ten dogs per group. CONT got a dry dog food diet which did not contain EPA or DHA. FO got a dry dog food diet with a high EPA and DHA content. ADD got the CONT diet combined with an n-3 FA additive rich in DHA and EPA. After a feeding period of 12 weeks the additive was discontinued in ADD and these dogs were fed CONT diet for another four weeks to observe washout effects. Erythrocyte lipids were extracted from venous blood samples and their FA composition was determined by gas chromatography. The Mann-Whitney-U-test was used to detect significant differences between the different groups and time points. Results After one week the proportions of n-3 FA, DHA and EPA were already significantly increased in ADD and FO, apparently reaching a plateau within eight weeks. In our study DHA and not EPA was preferably incorporated into the EM. After discontinuing the administration of the additive in ADD, the n-3 FA values declined slowly without reaching baseline levels within four weeks. Conclusions In dogs, an increase of dietary n-3 FA content leads to a rapid inclusion of n-3 FA into EM, regardless of whether the n-3 FA are offered as

  10. A quantitative analysis of prenatal intake of n-3 polyunsaturated fatty acids and cognitive development. (United States)

    Cohen, Joshua T; Bellinger, David C; Connor, William E; Shaywitz, Bennett A


    Although a rich source of n-3 polyunsaturated fatty acids (PUFAs) that may confer multiple health benefits, some fish also contain methyl mercury (MeHg), which may harm the developing fetus. U.S. government recommendations for women of childbearing age are to modify consumption of high-MeHg fish to reduce MeHg exposure, while recommendations encourage fish consumption among the general population because of the nutritional benefits. The Harvard Center for Risk Analysis convened an expert panel (see acknowledgements) to quantify the net impact of resulting hypothetical changes in fish consumption across the population. This paper estimates the impact of prenatal n-3 intake on cognitive development. Other papers quantify the negative impact of prenatal exposure to MeHg on cognitive development, and the extent to which fish consumption protects against coronary heart disease mortality and stroke in adults. This paper aggregates eight randomized controlled trials (RCTs) comparing cognitive development in controls and in children who had received n-3 PUFA supplementation (seven studies of formula supplementation and one study of maternal dietary supplementation). Our analysis assigns study weights accounting for statistical precision, relevance of three endpoint domains (general intelligence, verbal ability, and motor skills) to prediction of IQ, and age at evaluation. The study estimates that increasing maternal docosahexaenoic acid (DHA) intake by 100 mg/day increases child IQ by 0.13 points. The paper notes that findings were inconsistent across the RCTs evaluated (although our findings were relatively robust to changes in the weighting scheme used). Also, for seven of the eight studies reviewed, effects are extrapolated from formula supplementation to maternal dietary intake.

  11. The beneficial effects of n-3 polyunsaturated fatty acids on diet induced obesity and impaired glucose control do not require Gpr120.

    Directory of Open Access Journals (Sweden)

    Mikael Bjursell

    Full Text Available GPR120 (Ffar4 has been postulated to represent an important receptor mediating the improved metabolic profile seen upon ingestion of a diet enriched in polyunsaturated fatty acids (PUFAs. GPR120 is highly expressed in the digestive system, adipose tissue, lung and macrophages and also present in the endocrine pancreas. A new Gpr120 deficient mouse model on pure C57bl/6N background was developed to investigate the importance of the receptor for long-term feeding with a diet enriched with fish oil. Male Gpr120 deficient mice were fed two different high fat diets (HFDs for 18 weeks. The diets contained lipids that were mainly saturated (SAT or mainly n-3 polyunsaturated fatty acids (PUFA. Body composition, as well as glucose, lipid and energy metabolism, was studied. As expected, wild type mice fed the PUFA HFD gained less body weight and had lower body fat mass, hepatic lipid levels, plasma cholesterol and insulin levels and better glucose tolerance as compared to those fed the SAT HFD. Gpr120 deficient mice showed a similar improvement on the PUFA HFD as was observed for wild type mice. If anything, the Gpr120 deficient mice responded better to the PUFA HFD as compared to wild type mice with respect to liver fat content, plasma glucose levels and islet morphology. Gpr120 deficient animals were found to have similar energy, glucose and lipid metabolism when fed HFD PUFA compared to wild type mice. Therefore, GPR120 appears to be dispensable for the improved metabolic profile associated with intake of a diet enriched in n-3 PUFA fatty acids.

  12. Crystal structure of N-(3-chloro-1-methyl-1H-indazol-5-yl-4-methoxybenzenesulfonamide

    Directory of Open Access Journals (Sweden)

    Hakima Chicha


    Full Text Available In the title compound, C15H14ClN3O3S, the dihedral angle between the planes of the indazole ring system (r.m.s. deviation = 0.007 Å and the benzene ring is 89.05 (7°. The methoxy C atom deviates from its attached ring by 0.196 (3 Å. In the crystal, inversion dimers linked by pairs of N—H...O hydrogen bonds generate R22(8 loops. The dimers are connected into [010] chains by C—H...O interactions.

  13. N-(3-Chloro-1-methyl-1H-indazol-5-yl-4-methylbenzenesulfonamide

    Directory of Open Access Journals (Sweden)

    Hakima Chicha


    Full Text Available The asymmetric unit of the title compound, C15H14ClN3O2S, contains two independent molecules showing different conformations: in one molecule, the indazole ring system makes a dihedral angle of 51.5 (1° with the benzene ring whereas in the other, the indazole unit is almost perpendicular to the benzene ring [dihedral angle 77.7 (1°]. In the crystal, the molecules are linked by N—H...N and N—H...O hydrogen bonds, forming a set of four molecules linked in pairs about an inversion centre.

  14. Perspectivas para la impresión 3D en la construcción


    Nadal Serrano, Adolfo; Pavón, Juan; Liébana Carrasco, Óscar


    Las técnicas y aplicaciones de impresión 3D para construcción se encuentran en una fase inicial de desarrollo. Especialmente en lo referente a materiales como a procedimientos constructivos, hay mucho espacio de desarrollo. Esto se debe diversos factores: la especificidad del sector, el coste de la maquinaria necesaria, y una ausencia de un patrón procedimental característico. El artículo presenta una metodología innovadora para superar estas limitaciones mediante un flujo de trabajo sencillo...

  15. Synthesis and Pharmacological Activities of N-(3-Hydroxyphenyl)Benzamide and its 3-O-Derivatives


    M. A. Abbasi; Aziz-ur-Rehman,; M. Irshad; S. Z. Siddiqui; Ashraf, M


    N-(3-hydroxyphenyl) benzamide (3) was synthesized by the condensation of 3-hydroxyaniline (1) with benzoyl chloride (2) in aqueous medium. From this parent molecule 3, various 3-O-derivatives, 5a-f, were prepared via O-alkylation, by reacting it with different alkyl halides, 4a-f, for 2 h under reflux conditions in the presence of mixture of Na-ethoxide and C2H5OH as solvent. The synthesized compounds were characterized by using different spectroscopic techniques and were subjected to enzyme ...

  16. Damiia: Proceso de producción para animación 3D.




    Damiia es una producción personal en animación 3D pensada para plasmar mi interés por la animación profesional a través de un entendimiento de todas sus fases y procesos. Nace con la intención de desarrollar cierta destreza multidisciplinar en el arte digital 3D y demostrar los conocimientos adquiridos durante estos 4 años de carrera. Damiia is a personal production in 3D animation designed to capture my interest in professional animation through an understanding of all its phases and proc...

  17. Destruction of Sun-Grazing Comet C-2011 N3 (SOHO) Within the Low Solar Corona (United States)

    Schrijver, C. J.; Brown, J. C.; Battams, K.; Saint-Hilaire, P.; Liu, W.; Hudson, H.; Pesnell, W. D.


    Observations of comets in Sun-grazing orbits that survive solar insolation long enough to penetrate into the Suns inner corona provide information on the solar atmosphere and magnetic field as well as on the makeup of the comet. On 6 July 2011, the Solar Dynamics Observatory (SDO) observed the demise of comet C2011 N3 (SOHO) within the low solar corona in five wavelength bands in the extreme ultraviolet (EUV). The comet penetrated to within 0.146 solarradius (100,000 kilometers) of the solar surface before its EUV signal disappeared.

  18. Maternal and neonatal plasma antioxidant levels in normal pregnancy, and the relationship with fatty acid unsaturation

    NARCIS (Netherlands)

    Oostenbrug, G.S.; Mensink, R.P.; Al, M.D.M.; Houwelingen, A.C. van; Hornstra, G.


    During pregnancy, maternal plasma concentrations of the peroxidation-susceptible polyunsaturated fatty acids (polyenes) increase. In addition, the proportion of polyenes is higher in neonatal plasma than in maternal plasma. To study whether these increased amounts of polyenes affect antioxidant

  19. No effects of n)3 fatty acid supplementation on serum total testosterone levels in older men: the Alpha Omega Trial

    NARCIS (Netherlands)

    Giltay, E.J.; Geleijnse, J.M.; Heijboer, A.C.; Goede, de J.; Oude Griep, L.M.; Blankenstein, M.A.; Kromhout, D.


    The intake of the n-3 fatty acids alpha-linolenic acid (ALA), acid (EPA) and docosahexaenoic acid (DHA) has been related to testosterone levels in epidemiological analyses. The aim of this study was to assess whether the n-3 fatty acids affects testosterone levels in post-myocardial infarction (MI)

  20. Effect of feeding system and breed on n-3 and n-6 polyunsaturated fatty acid content of lamb muscles (United States)

    Katahdin (KK, n=6), Katahdin x Suffolk (KS, n=6), Suffolk x Katahdin (SK, n=6) and Suffolk (SS, n=6) wethers were used to evaluate omega-3 (n-3) and omega-6 (n-6) polyunsaturated fatty acid content, and the ratio of n-6 to n-3 in muscles of these lambs, raised on concentrate or forage diets. Lambs ...

  1. No effects of n-3 fatty acid supplementation on serum total testosterone levels in older men: the Alpha Omega Trial

    NARCIS (Netherlands)

    Giltay, E. J.; Geleijnse, J. M.; Heijboer, A. C.; de Goede, J.; Oude Griep, L. M.; Blankenstein, M. A.; Kromhout, D.


    The intake of the n-3 fatty acids alpha-linolenic acid (ALA), acid (EPA) and docosahexaenoic acid (DHA) has been related to testosterone levels in epidemiological analyses. The aim of this study was to assess whether the n-3 fatty acids affects testosterone levels in post-myocardial infarction (MI)

  2. Fish Consumption, n-3 Fatty Acids, and Colorectal Cancer: A Meta-Analysis of Prospective Cohort Studies

    NARCIS (Netherlands)

    Geelen, A.; Schouten, J.M.; Kamphuis, C.; Stam, B.E.; Burema, J.; Renkema, J.M.S.; Bakker, E.J.; Veer, van 't P.; Kampman, E.


    Animal studies show favorable effects of n-3 fatty acids on inflammation and cancer, but results from epidemiologic studies appear to be inconsistent. The authors conducted meta-analyses of prospective cohort studies that evaluated the association between fish consumption or n-3 fatty acids and

  3. Camelina meal increases egg n-3 fatty acid content without altering egg quality or production in laying hens (United States)

    Camelina sativa is an oilseed plant rich in n-3 and n-6-fatty acids and extruding defatted seed meal results in high protein meal (~40%) containing residual n-3 fatty acids. We examined the effects of feeding extruded defatted camelina seed meal to commercial laying hens on egg production, quality, ...

  4. Maternal fish oil supplementation in lactation: Effect on visual acuity and n-3 fatty acid content of infant erythrocytes

    DEFF Research Database (Denmark)

    Lauritzen, L.; Jørgensen, M.H.; Mikkelsen, T.B.


    of fish oil (FO) supplements in lactating mothers. In this double-blinded randomized trial, Danish mothers with habitual fish intake below the 50th percentile of the Danish National Birth Cohort were randomized to microencapsulated FO [1.3 g/d long-chain n-3 FA (n-3 LCPUFA)] or olive oil (00...

  5. Balancing the benefits of n-3 polyunsaturated fatty acids and the risks of methylmercury exposure from fish consumption

    DEFF Research Database (Denmark)

    Mahaffey, K. R.; Sunderland, E. M.; Chan, H. M.


    for perinatal development of infants. It is possible to choose fish species that are both high in n-3 PUFAs and low in MeHg. A framework for providing dietary advice for women of childbearing age on how to maximize the dietary intake of n-3 PUFAs while minimizing MeHg exposures is suggested. (C) 2011...

  6. Providing male rats deficient in iron and n-3 fatty acids with iron and alpha-linolenic acid alone affects brain serotonin and cognition differently from combined provision. (United States)

    Baumgartner, Jeannine; Smuts, Cornelius M; Zimmermann, Michael B


    We recently showed that a combined deficiency of iron (ID) and n-3 fatty acids (n-3 FAD) in rats disrupts brain monoamine metabolism and produces greater memory deficits than ID or n-3 FAD alone. Providing these double-deficient rats with either iron (Fe) or preformed docosahexaenoic acid (DHA)/eicosapentaenoic acid (EPA) alone affected brain monoamine pathways differently from combined repletion and even exacerbated cognitive deficits associated with double-deficiency. Iron is a co-factor of the enzymes responsible for the conversion of alpha-linolenic acid (ALA) to EPA and DHA, thus, the provision of ALA with Fe might be more effective in restoring brain EPA and DHA and improving cognition in double-deficient rats than ALA alone. In this study we examined whether providing double-deficient rats with ALA and Fe, alone or in combination, can correct deficits in monoamine metabolism and cognition associated with double-deficiency. Using a 2 × 2 design, male rats with concurrent ID and n-3 FAD were fed an Fe + ALA, Fe + n-3 FAD, ID + ALA, or ID + n-3 FAD diet for 5 weeks (postnatal day 56-91). Biochemical measures, and spatial working and reference memory (using the Morris water maze) were compared to age-matched controls. In the hippocampus, we found a significant Fe × ALA interaction on DHA: Compared to the group receiving ALA alone, DHA was significantly higher in the Fe + ALA group. In the brain, we found significant antagonistic Fe × ALA interactions on serotonin concentrations. Provision of ALA alone impaired working memory compared with age-matched controls, while in the reference memory task ALA provided with Fe significantly improved performance. These results indicate that providing either iron or ALA alone to double-deficient rats affects serotonin pathways and cognitive performance differently from combined provision. This may be partly explained by the enhancing effect of Fe on the conversion of ALA to EPA and DHA.

  7. Crystal Structure, Defects, Magnetic and Dielectric Properties of the Layered Bi3n+1Ti7Fe3n-3O9n+11 Perovskite-Anatase Intergrowths. (United States)

    Batuk, Dmitry; Batuk, Maria; Filimonov, Dmitry S; Zakharov, Konstantin V; Volkova, Olga S; Vasiliev, Alexander N; Tyablikov, Oleg A; Hadermann, Joke; Abakumov, Artem M


    The Bi3n+1Ti7Fe3n-3O9n+11 materials are built of (001)p plane-parallel perovskite blocks with a thickness of n (Ti,Fe)O6 octahedra, separated by periodic translational interfaces. The interfaces are based on anatase-like chains of edge-sharing (Ti,Fe)O6 octahedra. Together with the octahedra of the perovskite blocks, they create S-shaped tunnels stabilized by lone pair Bi3+ cations. In this work, the structure of the n = 4-6 Bi3n+1Ti7Fe3n-3O9n+11 homologues is analyzed in detail using advanced transmission electron microscopy, powder X-ray diffraction, and Mössbauer spectroscopy. The connectivity of the anatase-like chains to the perovskite blocks results in a 3ap periodicity along the interfaces, so that they can be located either on top of each other or with shifts of ±ap along [100]p. The ordered arrangement of the interfaces gives rise to orthorhombic Immm and monoclinic A2/m polymorphs with the unit cell parameters a = 3ap, b = bp, c = 2(n + 1)cp and a = 3ap, b = bp, c = 2(n + 1)cp - ap, respectively. While the n = 3 compound is orthorhombic, the monoclinic modification is more favorable in higher homologues. The Bi3n+1Ti7Fe3n-3O9n+11 structures demonstrate intricate patterns of atomic displacements in the perovskite blocks, which are supported by the stereochemical activity of the Bi3+ cations. These patterns are coupled to the cationic coordination of the oxygen atoms in the (Ti,Fe)O2 layers at the border of the perovskite blocks. The coupling is strong in the n = 3, 4 homologues, but gradually reduces with the increasing thickness of the perovskite blocks, so that, in the n = 6 compound, the dominant mode of atomic displacements is aligned along the interface planes. The displacements in the adjacent perovskite blocks tend to order antiparallel, resulting in an overall antipolar structure. The Bi3n+1Ti7Fe3n-3O9n+11 materials demonstrate an unusual diversity of structure defects. The n = 4-6 homologues are robust antiferromagnets below TN = 135, 220, and

  8. Rye polyphenols and the metabolism of n-3 fatty acids in rats: a dose dependent fatty fish-like effect. (United States)

    Ounnas, Fayçal; de Lorgeril, Michel; Salen, Patricia; Laporte, François; Calani, Luca; Mena, Pedro; Brighenti, Furio; Del Rio, Daniele; Demeilliers, Christine


    As long-chain fatty acids (LCFA) of the n-3 series are critically important for human health, fish consumption has considerably increased in recent decades, resulting in overfishing to respond to the worldwide demand, to an extent that is not sustainable for consumers' health, fisheries economy, and marine ecology. In a recent study, it has been shown that whole rye (WR) consumption improves blood and liver n-3 LCFA levels and gut microbiota composition in rats compared to refined rye. The present work demonstrates that specific colonic polyphenol metabolites may dose dependently stimulate the synthesis of n-3 LCFA, possibly through their microbial and hepatic metabolites in rats. The intake of plant n-3 alpha-linolenic acid and WR results in a sort of fatty fish-like effect, demonstrating that the n-3 LCFA levels in blood and tissues could be increased without eating marine foods, and therefore without promoting unsustainable overfishing, and without damaging marine ecology.

  9. On Connected m-HPK(n1,n2,n3,n4[Kt]-Residual Graphs

    Directory of Open Access Journals (Sweden)

    Huiming Duan


    Full Text Available We define m-HPK(n1,n2,n3,n4[Kt]-residual graphs in which HPK is a hyperplane complete graph. We extend P. Erdös, F. Harary, and M. Klawe's definition of plane complete residual graph to hyperplane and obtain the hyperplane complete residual graph. Further, we obtain the minimum order of HPK(n1,n2,n3,n4[Kt]-residual graphs and m-HPK(n1,n2,n3,n4[Kt]-residual graphs. In addition, we obtain a unique minimal HPK(n1,n2,n3,n4[Kt]-residual graphs and a unique minimal m-HPK(n1,n2,n3,n4[Kt]-residual graphs.

  10. A Novel Process for the Synthesis of Highly Pure n-3 Polyunsaturated Fatty Acid (PUFA)-Enriched Triglycerides by Combined Transesterification and Ethanolysis. (United States)

    Li, Daoming; Wang, Weifei; Qin, Xiaoli; Li, Xingxing; Yang, Bo; Wang, Yonghua


    In this study, a novel two-step enzymatic reaction was developed for the synthesis of highly pure triacylglycerols (TAGs) with a high content of n-3 polyunsaturated fatty acids (PUFAs). Glyceride mixtures were primarily synthesized by Novozym 435-catalyzed transesterification of glycerol and DHA/EPA-rich ethyl esters (EEs), followed by removal of partial glycerides, for the first time, by immobilized mono- and diacylglycerol lipase SMG1-F278N-catalyzed ethanolysis. TAG yield as high as 98.66% was achieved under the optimized conditions, and highly pure (98.75%) n-3 PUFA-enriched TAGs with 88.44% of n-3 PUFA was obtained after molecular distillation at lower temperature (140 °C). In addition, the EEs produced during ethanolysis had a FA composition similar to that of the original EEs, making them feasible for cyclic utilization. This was the first study reporting removal of partial glycerides by ethanolysis. Through ethanolysis, a higher purity product could be easily obtained at a relatively low temperature compared with the conventional high-temperature molecular distillation.

  11. Effect of n-3 fatty acid enriched eggs and organic eggs on serum lutein in free-living lacto-ovo vegetarians. (United States)

    Burns-Whitmore, B L; Haddad, E H; Sabaté, J; Jaceldo-Siegl, K; Tanzman, J; Rajaram, S


    Lutein is a xanthophyll found in the chloroplasts of dark green leafy vegetables, chromoplasts of fruits, and egg yolk. Dietary, serum and macular lutein are inversely related to the risk of age-related macular degeneration. Although the lutein from egg is known to be more bioavailable than that from spinach, not much is known about lutein bioavailability from n-3 fatty acid enriched eggs and organic eggs, both of which are increasingly available to consumers. We determined the effects of feeding n-3 fatty acid-enriched eggs and organic eggs on serum lutein, zeaxanthin and β-carotene in 20 healthy lacto-ovo-vegetarian (LOV) adults using a single-blind, randomized, crossover study design with a 4-week washout between treatments: six organic eggs or six n-3 fatty acid enriched eggs per week or no egg control for 8 weeks each. Serum lutein was significantly higher in both egg treatments (Phealthy LOV consuming a predominately plant-based diet.

  12. The space of vacua of 3d N=3 abelian theories (United States)

    Assel, Benjamin


    We use brane techniques to study the space of vacua of abelian 3d N=3 gauge theories. The coordinates on these spaces are the vevs of chiral monopole and meson operators, which are realized in the type IIB brane configuration of the theory by adding semi-infinite (1 , k) strings or F1 strings. The study of various brane setups allows us to determine a basis of chiral operators and chiral ring relations relevant to each branch of vacua, leading to the algebraic description of these branches. The method is mostly graphical and does not require actual computations. We apply it and provide explicit results in various examples. For linear quivers we find that the space of vacua has in general a collection of Coulomb-like branches, a Higgs branch and mixed branches. For circular quivers we find an extra branch, the geometric branch, parametrized by monopoles with equal magnetic charges in all U(1) nodes and meson operators. We explain how to include FI and mass deformations. We also study N=3 theories realized with ( p, q) 5-branes.

  13. An elementary proof of MinVol(Rn = 0 for n > 3

    Directory of Open Access Journals (Sweden)

    Jiaqiang Mei


    Full Text Available In this paper, we give an elementary proof of the result that the minimal volumes of R³ and R4 are zero. The approach is to construct a sequence of explicit complete metrics on them such that the sectional curvatures are bounded in absolute value by 1 and the volumes tend to zero. As a direct consequence, we get that MinVol (Rn = 0 for n > 3.Neste artigo fornecemos uma demonstração elementar do resultado de que os volumes minimais de R³ e R4 são ambos iguais a zero. A abordagem consiste na construção de uma seqüência de métricas completas explícitas nesses espaços cujas curvaturas seccionais são limitadas em valor absoluto por 1 e os volumes tendem a zero. Como conseqüência direta, estabelecemos que MinVol(Rn = 0 para n > 3.

  14. Periodontal disease: modulation of the inflammatory cascade by dietary n-3 polyunsaturated fatty acids. (United States)

    Sculley, D V


    Periodontal disease, including gingivitis and periodontitis, is caused by the interaction between pathogenic bacteria and the host immune system. The ensuing oxidative stress and inflammatory cascade result in the destruction of gingival tissue, alveolar bone and periodontal ligament. This article reviews the underlying mechanisms and host-bacteria interactions responsible for periodontal disease and evidence that nutritional supplementation with fish oil may provide a protective effect. Historical investigations of diet and disease have highlighted an inverse relationship between ingestion of fish oil, which is high in n-3 polyunsaturated fatty acids, and the incidence of typical inflammatory diseases such as arthritis and coronary heart disease. Ingestion of n-3 polyunsaturated fatty acids, such as docosahexaenoic acid and eicosapentaenoic acid, results in their incorporation into membrane phospholipids, which can alter eicosanoid production after stimulation during the immune response. These eicosanoids promote a reduction in chronic inflammation, which has led to the proposal that fish oil is a possible modulator of inflammation and may reduce the severity of periodontal diseases. Tentative animal and human studies have provided an indication of this effect. Further human investigation is needed to establish the protective effects of fish oil in relation to periodontal disease. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  15. Towards completing the cyclopropenylidene cycle: rovibrational analysis of cyclic N3(+), CNN, HCNN(+), and CNC(). (United States)

    Fortenberry, Ryan C; Lee, Timothy J; Huang, Xinchuan


    The simple aromatic hydrocarbon, cyclopropenylidene (c-C3H2), is a known, naturally-occurring molecule. The question remains as to whether its isoelectronic, cyclic, fellow aromatics of c-N3(+), c-CNN, HCNN(+), and c-CNC(-) are as well. Each of these are exciting objects for observation of Titan, and the rotational constants and vibrational frequencies produced here will allow for remote sensing of Titan's atmosphere or other astrophysical or terrestrial sources. None of these four aromatic species are vibrationally strong absorbers/emitters, but the two ions, HCNN(+) and c-CNC(-), have dipole moments of greater than 3 D and 1 D, respectively, making them good targets for rotational spectroscopic observation. Each of these molecules is shown here to exhibit its own, unique vibrational properties, but the general trends put the vibrational behavior for corresponding fundamental modes within close ranges of one another, even producing nearly the same heavy atom, symmetric stretching frequencies for HCNN(+) and c-C3H2 at 1600 cm(-1). The c-N3(+) cation is confirmed to be fairly unstable and has almost no intensity in its ν2 fundamental. Hence, it will likely remain difficult to characterize experimentally.

  16. Gene transfer of Chlorella vulgaris n-3 fatty acid desaturase optimizes the fatty acid composition of human breast cancer cells

    Directory of Open Access Journals (Sweden)

    Meilan Xue


    Full Text Available Chlorella vulgaris has the gene of n-3 fatty acid desaturase (CvFad3, which can synthesize the precursor of n-3 polyunsaturated fatty acids (PUFAs or convert n-6 to n-3 PUFAs. The objective of the present study was to examine whether the CvFad3 gene from C. vulgaris can be functionally and efficiently expressed in human breast cancer cells and whether its expression can exert a significant effect on cell fatty acid composition. We inserted the CvFad3 gene into the plasmid pEGFP-C3 to construct the eukaryotic expression vector pEGFP-C3-n-3 and to express the n-3 Fad gene in human breast cancer cells (MCF-7 cells. Transfection of MCF-7 cells with the recombinant vector resulted in a high expression of n-3 fatty acid desaturase. Lipid analysis indicated that the ratio of n-6/n-3 PUFAs was decreased from 6:1 in the control cells to about 1:1 in the cells expressing the n-3 fatty acid desaturase. Accordingly, the CvFad3 gene significantly decreased the ratio of n-6/n-3 PUFAs of the MCF-7 cell membrane. The expression of the CvFad3 gene can decrease cell proliferation and promote cell apoptosis. This study demonstrates that the CvFad3 gene can dramatically balance the ratio of n-6/n-3 PUFAs and may provide an effective approach to the modification of the fatty acid composition of mammalian cells, also providing a basis for potential applications of its transfer in experimental and clinical settings.

  17. Gene transfer of Chlorella vulgaris n-3 fatty acid desaturase optimizes the fatty acid composition of human breast cancer cells

    Energy Technology Data Exchange (ETDEWEB)

    Xue, Meilan; Ge, Yinlin; Zhang, Jinyu [Department of Biochemistry and Molecular Biology, Medical College, Qingdao University, Qingdao Shandong (China); Wang, Qing [Affiliated Hospital of Qingdao University, Qingdao Shandong (China); Hou, Lin [Department of Biochemistry and Molecular Biology, Medical College, Qingdao University, Qingdao Shandong (China)


    Chlorella vulgaris has the gene of n-3 fatty acid desaturase (CvFad3), which can synthesize the precursor of n-3 polyunsaturated fatty acids (PUFAs) or convert n-6 to n-3 PUFAs. The objective of the present study was to examine whether the CvFad3 gene from C. vulgaris can be functionally and efficiently expressed in human breast cancer cells and whether its expression can exert a significant effect on cell fatty acid composition. We inserted the CvFad3 gene into the plasmid pEGFP-C3 to construct the eukaryotic expression vector pEGFP-C3-n-3 and to express the n-3 Fad gene in human breast cancer cells (MCF-7 cells). Transfection of MCF-7 cells with the recombinant vector resulted in a high expression of n-3 fatty acid desaturase. Lipid analysis indicated that the ratio of n-6/n-3 PUFAs was decreased from 6:1 in the control cells to about 1:1 in the cells expressing the n-3 fatty acid desaturase. Accordingly, the CvFad3 gene significantly decreased the ratio of n-6/n-3 PUFAs of the MCF-7 cell membrane. The expression of the CvFad3 gene can decrease cell proliferation and promote cell apoptosis. This study demonstrates that the CvFad3 gene can dramatically balance the ratio of n-6/n-3 PUFAs and may provide an effective approach to the modification of the fatty acid composition of mammalian cells, also providing a basis for potential applications of its transfer in experimental and clinical settings.

  18. On the origin of plasma density blobs

    Energy Technology Data Exchange (ETDEWEB)

    Krasheninnikov, S.I., E-mail:


    By keeping nonlinear Boltzmann factor in electron density dependence on electrostatic potential it is demonstrated that large plasma density blobs, often seen in experiment inside separatrix, can exist within the framework of drift wave dynamics. The estimates show that plasma density in a blob can be ∼3 times higher that average plasma density, but hardly exceeds this limit, which in a ball park is in agreement with experimental observations.

  19. Plasma clearance of noradrenaline does not change with age in normal subjects

    DEFF Research Database (Denmark)

    Hilsted, J; Christensen, N J; Larsen, S


    Noradrenaline kinetics (plasma concentrations, plasma clearance and appearance rates) were investigated in seven elderly healthy subjects and in six young healthy subjects. Forearm venous plasma noradrenaline concentrations were higher in the elderly subjects compared with the young subjects....... Plasma clearance of noradrenaline was identical in the two groups. The increase in plasma noradrenaline concentration, with age, probably reflects an increased sympathetic nervous activity....

  20. Effects of krill oil intake on plasma cholesterol and glucose levels in rats fed a high-cholesterol diet. (United States)

    Li, Dong-Mei; Zhou, Da-Yong; Zhu, Bei-Wei; Chi, Ya-Li; Sun, Li-Ming; Dong, Xiu-Ping; Qin, Lei; Qiao, Wei-Zhou; Murata, Yoshiyuki


    In this study, whole krill oil (WKO) and phospholipid-type krill oil (PKO) with different lipid composition were prepared. The effects of KO intake on plasma cholesterol and glucose levels in Wistar rats fed a high-cholesterol diet (HCD) were investigated. WKO contained 37.63% triglycerides, 48.37% phospholipids, 13.54% free fatty acids and 0.66% cholesterol, whereas the corresponding values for PKO were 0.59, 69.80, 28.53 and 1.09% respectively. Meanwhile, PKO contained much more polyunsaturated fatty acids (PUFA, 37.76%) than WKO (28.36%). After 4 weeks of HCD consumption, plasma levels of total cholesterol (TC), low-density lipoprotein cholesterol (LDL-C) and glucose increased significantly, but that of high-density lipoprotein cholesterol (HDL-C) decreased significantly. The intake of PKO and WKO for 4 weeks caused a significant reduction in body weight gain and plasma levels of TC and LDL-C in HCD-fed rats. Compared with WKO, PKO was more effective in decreasing plasma TC and LDL-C levels. PKO showed better overall cholesterol-lowering effects than WKO, which may be due to its higher n-3 PUFA levels. © 2013 Society of Chemical Industry.

  1. Fish intake guidelines: incorporating n-3 fatty acid intake and contaminant exposure in the Korean and Japanese communities. (United States)

    Tsuchiya, Ami; Hardy, Joan; Burbacher, Thomas M; Faustman, Elaine M; Mariën, Koenraad


    Fish consumption advisories are developed to prevent overexposure to various contaminants. Recently, discussion has centered on the need to consider the benefits of fish consumption alongside possible risks when providing guidance. As part of the Arsenic Mercury Intake Biometric Study involving the Japanese and Korean communities living in Washington State, we obtained fish and nutrient intake data. Japanese and Korean women of childbearing age (n = 214) participated in this longitudinal study. We used these data, along with hair-mercury data to determine the need for both the nutritional benefits and concern about contaminants to be included when providing guidance. We examined the intake of 2 n-3 long-chain fatty acids, eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA), found in fish and associated with a variety of beneficial health effects. Intakes of these lipids were used as surrogates to characterize the beneficial effect from fish consumption, and the intake of mercury was used to establish the risk from consumption. These 2 populations provided an ideal basis from which to examine this issue because their fish consumption rates were identical and higher than national rates, but their mercury intakes vary substantially because of different consumption behaviors. Results indicate that basing fish consumption guidelines on contaminant concentrations alone can have the unintended consequence of causing a portion of the population to have inadequate intake of required nutrients. Public health goals may be better served if nutritional elements and contaminant concerns are quantitatively incorporated into fish consumption guidelines.

  2. Women who take n-3 long-chain polyunsaturated fatty acid supplements during pregnancy and lactation meet the recommended intake. (United States)

    Jia, Xiaoming; Pakseresht, Mohammadreza; Wattar, Nour; Wildgrube, Jamie; Sontag, Stephanie; Andrews, Murphy; Subhan, Fatheema Begum; McCargar, Linda; Field, Catherine J


    The aim of the current study was to estimate total intake and dietary sources of eicosapentaenoic acid (EPA), docosapentanoic (DPA), and docosahexaenoic acid (DHA) and compare DHA intakes with the recommended intakes in a cohort of pregnant and lactating women. Twenty-four-hour dietary recalls and supplement intake questionnaires were collected from 600 women in the Alberta Pregnancy Outcomes and Nutrition (APrON) cohort at each trimester of pregnancy and 3 months postpartum. Dietary intake was estimated in 2 ways: by using a commercial software program and by using a database created for APrON. Only 27% of women during pregnancy and 25% at 3 months postpartum met the current European Union (EU) consensus recommendation for DHA. Seafood, fish, and seaweed products contributed to 79% of overall n-3 long-chain polyunsaturated fatty acids intake from foods, with the majority from salmon. The estimated intake of DHA and EPA was similar between databases, but the estimated DPA intake was 20%-30% higher using the comprehensive database built for this study. Women who took a supplement containing DHA were 10.6 and 11.1 times more likely to meet the current EU consensus recommendation for pregnancy (95% confidence interval (CI): 6.952-16.07; Pmeeting the EU recommendation for DHA during pregnancy and lactation, but taking a supplement significantly improved the likelihood that they would meet recommendations.

  3. Detached divertor plasmas in JET

    Energy Technology Data Exchange (ETDEWEB)

    Horton, L.D.; Borrass, K.; Corrigan, G.; Gottardi, N.; Lingertat, J.; Loarte, A.; Simonini, R.; Stamp, M.F.; Taroni, A. [Commission of the European Communities, Abingdon (United Kingdom). JET Joint Undertaking; Stangeby, P.C. [Toronto Univ., ON (Canada). Inst. for Aerospace Studies


    In simulations with high radiated power fractions, it is possible to produce the drop in ion current to the divertor targets typical of detached plasmas. Despite the fact that these experiments are performed on beryllium target tiles, radiation from deuterium and beryllium cannot account for the measured power losses. The neutral deuterium levels in the SOL in these plasmas are higher than the model predicts. This may be due to leakage from the divertor or to additional wall sources related to the non-steady nature of these plasmas. In contrast, a surprisingly high level of carbon is present in these discharges; higher even than would be predicted are the divertor target tiles pure carbon. This level may well be large enough to produce the measured radiation. (authors). 6 refs., 2 figs., 1 tab.

  4. Laboratory Plasma Studies (United States)


    Claw ) in the right-hand side of (40). the growth simply depends on An electron at the higher energy state is an emitter for the energy distribution of...oranges at the low levels to bright blues and violets at the highest levels, so the intensities are similar to what would be used for a "gray" scale plot...details of a ], 0 ns). growth rates factors 6 or more than "YMHD. A found in the Crab Nebula (1054 AD). result from laser-plasma experiment was

  5. In vivo antioxidant potential of Sweet chestnut (Castanea sativa Mill.) wood extract in young growing pigs exposed to n-3 PUFA-induced oxidative stress. (United States)

    Frankič, Tamara; Salobir, Janez


    Farm animals in intensive farming systems are frequently exposed to oxidative stress, which demands adequate antioxidant protection. The aim of this study was to evaluate the antioxidant potential of different concentrations of Sweet chestnut wood extract (SCW; 0.75, 1.5 and 3 g kg⁻¹) in case of n-3 PUFA-induced oxidative stress in young pigs. The highest concentration (3 g kg⁻¹) of SCW decreased malondialdehyde excretion in urine by 31.7%, but had no effect on plasma malondialdehyde. A linear trend towards decrease of urine isoprostanes iPF(2α)-VI was observed with the addition of SCW. All three concentrations of SCW efficiently protected blood lymphocytes from DNA damage and lowered plasma alanine aminotransferase levels. The antioxidative and antigenotoxic effect of 3 g SCW kg⁻¹ feed was comparable to the effect of 90.4 mg kg⁻¹ of added vitamin E. The results from this study show that, besides being known as antihelmintic, antimicrobial and antiviral agent, Sweet chestnut wood extract could also be considered as a promising natural antioxidant in animal nutrition. Copyright © 2011 Society of Chemical Industry.

  6. A short food frequency questionnaire to assess intake of seafood and n-3 supplements: validation with biomarkers

    Directory of Open Access Journals (Sweden)

    Dahl Lisbeth


    Full Text Available Abstract Background Seafood intake is associated with beneficial effects for human health. Seafood provides a number of nutrients beyond the traditionally known long chain marine n-3 fatty acids EPA, DPA and DHA, such as protein, vitamin D, iodine, selenium and vitamin B12. Valid assessment of dietary seafood and n-3 supplement intakes are becoming increasingly crucial when giving recommendations to populations as seafood consumption is regarded as an important part of a healthy and balanced diet. Methods The aim was to validate a short FFQ developed for assessment of dietary intake of seafood and n-3 supplements using the biomarkers marine n-3 fatty acids in erythrocytes and 25(OHD in serum. Results Fifty-three healthy Norwegians aged 30-64 years with a mean BMI of 25 kg/m2 were compliant with the study protocol. 70% reported eating seafood for dinner one to two times per week, and 45% reported to eat seafood as spread, in salads or as snack meal three to five times or more per week. The FFQ correlated significantly with both the levels of marine n-3 fatty acids (r = 0.73, p Conclusion The present short FFQ predicted strongly the levels of marine n-3 fatty acids in erythrocytes, and predicted fairly good the level of serum 25(OHD and may therefore be a valid method for assessment of seafood and n-3 supplements intake among adults.

  7. Endogenous n-3 Fatty Acids Alleviate Carbon-Tetrachloride-Induced Acute Liver Injury in Fat-1 Transgenic Mice

    Directory of Open Access Journals (Sweden)

    Ruibing Feng


    Full Text Available n-3 polyunsaturated fatty acids (PUFAs are beneficial for numerous models of liver diseases. The probable protective effects of n-3 PUFA against carbon-tetrachloride- (CCl4- induced acute liver injury were evaluated in a fat-1 transgenic mouse that synthesizes endogenous n-3 from n-6 PUFA. Fat-1 mice and their WT littermates were fed a modified AIN93 diet containing 10% corn oil and were injected intraperitoneally with a single dose of CCl4 or vehicle. CCl4 challenge caused severe liver injury in WT mice, as indicated by serum parameters and histopathological changes, which were remarkably ameliorated in fat-1 mice. Endogenous n-3 PUFA decreased the elevation of oxidative stress induced by CCl4 challenge, which might be attributed to the activation of Nrf2/keap1 pathway. Additionally, endogenous n-3 PUFA reduces hepatocyte apoptosis via suppressing MAPK pathway. These findings indicate that n-3 PUFA has potent protective effects against acute liver injury induced by CCl4 in mice, suggesting that n-3 PUFA can be used for the prevention and treatment of liver injury.

  8. Effects of n-3 PUFAs on Intestinal Mucosa Innate Immunity and Intestinal Microbiota in Mice after Hemorrhagic Shock Resuscitation

    Directory of Open Access Journals (Sweden)

    Feng Tian


    Full Text Available n-3 polyunsaturated fatty acids (PUFAs can improve the function of the intestinal barrier after damage from ischemia-reperfusion or hemorrhagic shock resuscitation (HSR. However, the effects of n-3 PUFAs on intestinal microbiota and the innate immunity of the intestinal mucosa after HSR remain unclear. In the present study, 40 C57BL/6J mice were randomly assigned to five groups: control, sham, HSR, HSR + n-3 PUFAs and HSR + n-6 PUFAs. Mice were sacrificed 12 h after HSR. Liver, spleen, mesenteric lymph nodes and terminal ileal tissues were collected. Intestinal mucosae were scraped aseptically. Compared with the HSR group, the number of goblet cells increased, expression of mucin 2 was restored and disturbed intestinal microbiota were partly stabilized in the PUFA-administered groups, indicating that both n-3 and n-6 PUFAs reduced overproliferation of Gammaproteobacteria while promoting the growth of Bacteroidetes. Notably, n-3 PUFAs had an advantage over n-6 PUFAs in improving ileal tissue levels of lysozyme after HSR. Thus, PUFAs, especially n-3 PUFAs, partly improved the innate immunity of intestinal mucosa in mice after HSR. These findings suggest a clinical rationale for providing n-3 PUFAs to patients recovering from ischemia-reperfusion.

  9. EPA, DHA, and Lipoic Acid Differentially Modulate the n-3 Fatty Acid Biosynthetic Pathway in Atlantic Salmon Hepatocytes. (United States)

    Bou, Marta; Østbye, Tone-Kari; Berge, Gerd M; Ruyter, Bente


    The aim of the present study was to investigate how EPA, DHA, and lipoic acid (LA) influence the different metabolic steps in the n-3 fatty acid (FA) biosynthetic pathway in hepatocytes from Atlantic salmon fed four dietary levels (0, 0.5, 1.0 and 2.0%) of EPA, DHA or a 1:1 mixture of these FA. The hepatocytes were incubated with [1-14C] 18:3n-3 in the presence or absence of LA (0.2 mM). Increased endogenous levels of EPA and/or DHA and LA exposure both led to similar responses in cells with reduced desaturation and elongation of [1-14C] 18:3n-3 to 18:4n-3, 20:4n-3, and EPA, in agreement with reduced expression of the Δ6 desaturase gene involved in the first step of conversion. DHA production, on the other hand, was maintained even in groups with high endogenous levels of DHA, possibly due to a more complex regulation of this last step in the n-3 metabolic pathway. Inhibition of the Δ6 desaturase pathway led to increased direct elongation to 20:3n-3 by both DHA and LA. Possibly the route by 20:3n-3 and then Δ8 desaturation to 20:4n-3, bypassing the first Δ6 desaturase step, can partly explain the maintained or even increased levels of DHA production. LA increased DHA production in the phospholipid fraction of hepatocytes isolated from fish fed 0 and 0.5% EPA and/or DHA, indicating that LA has the potential to further increase the production of this health-beneficial FA in fish fed diets with low levels of EPA and/or DHA.

  10. Nutritional n-3 PUFAs deficiency during perinatal periods alters brain innate immune system and neuronal plasticity-associated genes. (United States)

    Madore, Charlotte; Nadjar, Agnès; Delpech, Jean-Christophe; Sere, A; Aubert, A; Portal, Céline; Joffre, Corinne; Layé, Sophie


    Low dietary intake of the n-3 polyunsaturated fatty acids (PUFAs) is a causative factor of neurodevelopmental disorders. However the mechanisms linking n-3 PUFAs low dietary intake and neurodevelopmental disorders are poorly understood. Microglia, known mainly for their immune function in the injured or infected brain, have recently been demonstrated to play a pivotal role in regulating maturation of neuronal circuits during normal brain development. Disruption of this role during the perinatal period therefore could significantly contribute to psychopathologies with a neurodevelopmental neurodevelopmental component. N-3 PUFAs, essential lipids and key structural components of neuronal membrane phospholipids, are highly incorporated in cell membranes during the gestation and lactation phase. We previously showed that in a context of perinatal n-3 PUFAs deficiency, accretion of these latter is decreased and this is correlated to an alteration of endotoxin-induced inflammatory response. We thus postulated that dietary n-3 PUFAs imbalance alters the activity of microglia in the developing brain, leading to abnormal formation of neuronal networks. We first confirmed that mice fed with a n-3 PUFAs deficient diet displayed decreased n-3 PUFAs levels in the brain at post-natal days (PND)0 and PND21. We then demonstrated that n-3 PUFAs deficiency altered microglia phenotype and motility in the post-natal developing brain. This was paralleled by an increase in pro-inflammatory cytokines expression at PND21 and to modification of neuronal plasticity-related genes expression. Overall, our findings show for the first time that a dietary n-3 PUFAs deficiency from the first day of gestation leads to the development of a pro-inflammatory condition in the central nervous system that may contribute to neurodevelopmental alterations. Copyright © 2014 Elsevier Inc. All rights reserved.

  11. Maternal and neonatal dietary intake of balanced n-6/n-3 fatty acids modulates experimental colitis in young adult rats. (United States)

    Reddy, K Vijay Kumar; Naidu, K Akhilender


    The imbalance of n-6 and n-3 polyunsaturated fatty acids in the maternal diet impairs intestinal barrier development and sensitizes the colon response to inflammatory insults in the young rats. With a view to overcoming this issue, we designed this study to investigate the effect of maternal and neonatal intake of different proportions of n-6/n-3 fatty acids on colon inflammation in the young adult rats. Female Wistar rats were assigned into four groups, and each group fed one of four semisynthetic diets, namely n-6, low n-3, n-6/n-3 and n-3 fatty acids for 8 weeks prior to mating, during gestation and lactation periods. At weaning, the pups were separated from the dams and fed diet similar to the mothers. Colitis was induced on postnatal day 35, by administering 2 % dextran sulfate sodium in drinking water for 10 days. Colitis was assessed based on the clinical and inflammatory markers in the colon. Fatty acid analysis was done in liver, RBC, colon and spleen. A balanced n-6/n-3 PUFA diet significantly improved the body weight loss, rectal bleeding and mortality in rats. This was associated with lower myeloperoxidase activity, nitric oxide, prostaglandin E2, TNF-α and IL-6, IL-8, COX-2 and iNOS levels in the colon tissues. Fatty acid analysis has shown that the arachidonic acid/docosahexaenoic acid ratio was significantly lower in liver, RBC, colon and spleen in n-6/n-3 and n-3 diet groups. We demonstrate that balanced n-6/n-3 PUFA supplementation in maternal and neonatal diet alters systemic AA/DHA ratio and attenuates colon inflammation in the young adult rats.

  12. Digitalización 3D en Arqueología

    Directory of Open Access Journals (Sweden)

    Lluís Vila Bonamusa


    Full Text Available El objeto de la comunicación es poner de manifiesto, a partir de varios proyectos arqueológicos, los resultados conseguidos en colaboración entre dos empresas especializadas en disciplinas diferentes: una en arqueología y patrimonio cultural y la otra en medición y digitalización 3D. El conjunto de elementos que se van a describir corresponden a proyectos que se encuentran en fase de ejecución, por lo que su nivel de desarrollo no es aún suficiente para poder presentar unas conclusiones que nos permitan valorar y profundizar el resultado de los trabajos desarrollados entre ambas empresa.

  13. N-(3-Chloro-4-ethoxy-1-methyl-1H-indazol-5-yl-4-methoxybenzenesulfonamide

    Directory of Open Access Journals (Sweden)

    Hakima Chicha


    Full Text Available The indazole ring system of the title compound, C17H18ClN3O4S, is almost planar (r.m.s. deviation = 0.0113 Å and forms dihedral angles of 32.22 (8 and 57.5 (3° with the benzene ring and the mean plane through the 4-ethoxy group, respectively. In the crystal, molecules are connected by pairs of N—H...O hydrogen bonds into inversion dimers, which are further linked by π–π interactions between the diazole rings [intercentroid distance = 3.4946 (11 Å], forming chains parallel to [101].

  14. Emulsifier type, metal chelation and pH affect oxidative stability of n-3-enriched emulsions

    DEFF Research Database (Denmark)

    Haahr, Anne-Mette; Jacobsen, Charlotte


    -enriched oil-in-water emulsion. The selected food emulsifiers were Tween 80, Citrem, sodium caseinate and lecithin. Lipid oxidation was evaluated by determination of peroxide values and secondary volatile oxidation products. Moreover, the zeta potential and the droplet sizes were determined. Twen resulted......Recent research has shown that the oxidative stability of oil-in-water emulsions is affected by the type of surfactant used as emulsifier. The aim of this study was to evaluate the effect of real food emulsifiers as well as metal chelation by EDTA and pH on the oxidative stability of a 10% n-3...... in the least oxidatively stable emulsions, followed by Citrem. When iron was present, caseinate-stabilized emulsions oxidized slower than lecithin emulsions at pH 3, whereas the opposite was the case at pH 7. Oxidation generally progressed faster at pH 3 than at pH 7, irrespective of the addition of iron. EDTA...

  15. Real-Virtual contributions to the inclusive Higgs cross-section at N3LO

    CERN Document Server

    Anastasiou, Charalampos; Dulat, Falko; Herzog, Franz; Mistlberger, Bernhard


    We compute the contributions to the N3LO inclusive Higgs boson cross-section from the square of one-loop amplitudes with a Higgs boson and three QCD partons as external states. Our result is a Taylor expansion in the dimensional regulator epsilon, where the coefficients of the expansion are analytic functions of the ratio of the Higgs boson mass and the partonic center of mass energy and they are valid for arbitrary values of this ratio. We also perform a threshold expansion around the limit of soft-parton radiation in the final state. The expressions for the coefficients of the threshold expansion are valid for arbitrary values of the dimension. As a by-product of the threshold expansion calculation, we have developed a soft expansion method at the integrand level by identifying the relevant soft and collinear regions for the loop-momentum.

  16. Fish, n-3 fatty acids, and cardiovascular diseases in women of reproductive age

    DEFF Research Database (Denmark)

    Strøm, Marin; Halldorsson, Thorhallur I; Mortensen, Erik L


    Previous studies have indicated a protective effect of long-chain n-3 polyunsaturated fatty acids (LCn3FAs) against cardiovascular disease; however, women are underrepresented in cardiovascular research. The aim of this study was to explore the association between intake of LCn3FAs and the risk...... of cardiovascular disease in a large prospective cohort of young women (mean age at baseline: 29.9 years [range: 15.7-46.9]). Exposure information on 48 627 women from the Danish National Birth Cohort was linked to the Danish National Patients Registry for information on events of hypertensive, cerebrovascular......, and ischemic heart disease used to define a combined measure of cardiovascular diseases. Intake of fish and LCn3FAs was assessed by a food-frequency questionnaire and telephone interviews. During follow-up (1996-2008; median: 8 years), 577 events of cardiovascular disease were identified. Low LCn3FA intake...

  17. Millimeter-Wave Spectroscopy of Formyl Azide (HC(O)N_3) (United States)

    Walters, Nicholas A.; Amberger, Brent K.; Esselman, Brian J.; Woods, R. Claude; McMahon, Robert J.


    Formyl azide (HC(O)N_3) is a highly unstable molecule (t1/2˜2 hours at room temperature as a gas) that has only recently been studied spectroscopically by UV, IR, Raman and NMR methods. We have synthesized formyl azide and obtained its absorption spectrum at room temperature over the range 250-360 GHz. As in the case of carbonyl diazide, two conformers are expected for HC(O)N_3, with the syn-isomer 2.8 kcal/mol lower in energy than the anti-isomer (CCSD(T)/ANO1). Calculations at the same level of theory and the same basis set predict the dipole moments for the syn-isomer (μ = 1.56 D) and anti-isomer (μ = 2.56 D). These calculations also indicate that b-type transitions should dominate the syn-isomer spectrum, while a-type transitions become more significant in the case of the anti-isomer. Despite the anti-isomer having a larger dipole moment, the syn-isomer still gives rise to all the dominant features of the spectrum. Thus far, five vibrational states (νb{9}, νb{12}, 2νb{9}, νb{9} + νb{12}, νb{11}) have been studied for the syn-isomer, with the highest energy state νb{11} = 582.6 wn. Searches for the spectra of the anti-isomer are ongoing. Banert, K. et al. Angew. Chem. Int. Ed. 2012, 51, 4718-4721 Zeng, X. et al. Angew. Chem. Int. Ed. 2013, 52, 3503-3506 Amberger, B.K. et al. J. Mol. Spectrosc. 259, (2014) 15-20

  18. Ligand promiscuity through the eyes of the aminoglycoside N3 acetyltransferase IIa. (United States)

    Norris, Adrianne L; Serpersu, Engin H


    Aminoglycoside-modifying enzymes (AGMEs) are expressed in many pathogenic bacteria and cause resistance to aminoglycoside (AG) antibiotics. Remarkably, the substrate promiscuity of AGMEs is quite variable. The molecular basis for such ligand promiscuity is largely unknown as there is not an obvious link between amino acid sequence or structure and the antibiotic profiles of AGMEs. To address this issue, this article presents the first kinetic and thermodynamic characterization of one of the least promiscuous AGMEs, the AG N3 acetyltransferase-IIa (AAC-IIa) and its comparison to two highly promiscuous AGMEs, the AG N3-acetyltransferase-IIIb (AAC-IIIb) and the AG phosphotransferase(3')-IIIa (APH). Despite having similar antibiotic selectivities, AAC-IIIb and APH catalyze different reactions and share no homology to one another. AAC-IIa and AAC-IIIb catalyze the same reaction and are very similar in both amino acid sequence and structure. However, they demonstrate strong differences in their substrate profiles and kinetic and thermodynamic properties. AAC-IIa and APH are also polar opposites in terms of ligand promiscuity but share no sequence or apparent structural homology. However, they both are highly dynamic and may even contain disordered segments and both adopt well-defined conformations when AGs are bound. Contrary to this AAC-IIIb maintains a well-defined structure even in apo form. Data presented herein suggest that the antibiotic promiscuity of AGMEs may be determined neither by the flexibility of the protein nor the size of the active site cavity alone but strongly modulated or controlled by the effects of the cosubstrate on the dynamic and thermodynamic properties of the enzyme. Copyright Copyright © 2013 The Protein Society.

  19. n-3 long-chain fatty acids and regulation of glucose transport in two models of rat brain endothelial cells. (United States)

    Pifferi, Fabien; Jouin, Mélanie; Alessandri, Jean-Marc; Roux, Françoise; Perrière, Nicolas; Langelier, Bénédicte; Lavialle, Monique; Cunnane, Stephen; Guesnet, Philippe


    Several in vivo studies suggest that docosahexaenoic acid (22:6 n-3), the main n-3 long-chain polyunsaturated fatty acids (LC-PUFA) of brain membranes, could be an important regulator of brain energy metabolism by affecting glucose utilization and the density of the two isoforms of the glucose transporter-1 (GLUT1) (endothelial and astrocytic). This study was conducted to test the hypothesis that 22:6 n-3 in membranes may modulate glucose metabolism in brain endothelial cells. It compared the impact of 22:6 n-3 and the other two main LC-PUFA, arachidonic acid (20:4 n-6) and eicosapentaenoic acid (20:5 n-3), on fatty acid composition of membrane phospholipids, glucose uptake and expression of 55-kDa GLUT1 isoform in two models of rat brain endothelial cells (RBEC), in primary culture and in the immortalized rat brain endothelial cell line RBE4. Without PUFA supplementation, both types of cerebral endothelial cells were depleted in 22:6 n-3, RBE4 being also particularly low in 20:4 n-6. After exposure to supplemental 20:4 n-6, 20:5 n-3 or 22:6 n-3 (15microM, i.e. a physiological dose), RBEC and RBE4 avidly incorporated these PUFA into their membrane phospholipids thereby resembling physiological conditions, i.e. the PUFA content of rat cerebral microvessels. However, RBE4 were unable to incorporate physiological level of 20:4 n-6. Basal glucose transport in RBEC (rate of [(3)H]-3-o-methylglucose uptake) was increased after 20:5 n-3 or 22:6 n-3 supplementation by 50% and 35%, respectively, whereas it was unchanged with 20:4 n-6. This increase of glucose transport was associated with an increased GLUT1 protein, while GLUT1 mRNA was not affected. The different PUFA did not impact on glucose uptake in RBE4. Due to alterations in n-6 PUFA metabolism and weak expression of GLUT1, RBE4 seems to be less adequate than RBEC to study PUFA metabolism and glucose transport in brain endothelial cells. Physiological doses of n-3 LC-PUFA have a direct and positive effect on glucose

  20. Improved plasma accelerator (United States)

    Cheng, D. Y.


    Converging, coaxial accelerator electrode configuration operates in vacuum as plasma gun. Plasma forms by periodic injections of high pressure gas that is ionized by electrical discharges. Deflagration mode of discharge provides acceleration, and converging contours of plasma gun provide focusing.

  1. The Diagnostics of the External Plasma for the Plasma Rocket (United States)

    Karr, Gerald R.


    Three regions of plasma temperature/energy are being investigated to understand fully the behavior of the plasma created by the propulsion device and the operation of the RPA. Each type of plasma has a RPA associated with it; i.e. a thermal RPA, a collimated RPA, and a high temperature RPA. Through the process of developing the thermal and collimated RPAs, the proper knowledge and experience has been gained to not only design a high temperature RPA for the plasma rocket, but to understand its operation, results, and uncertainty. After completing a literature search for, reading published papers on, and discussing the operation of the RPA with electric propulsion researchers, I applied the knowledge gained to the development of a RPA for thermal plasma. A design of a thermal RPA was made which compensates for a large Debye length and low ionized plasma. From this design a thermal RPA was constructed. It consists of an outer stainless steel casing, a phenolic insulator (outgases slightly), and stainless steel mesh for the voltage screens. From the experience and knowledge gained in the development of the thermal RPA, a RPA for collimated plasma was developed. A collimated RPA has been designed and constructed. It compensate for a smaller Debye length and much higher ionization than that existing in the thermal plasma. It is 17% of the size of the thermal RPA. A stainless steel casing shields the detector from impinging electrons and ions. An insulating material, epoxy resin, was utilized which has a negligible outgassing. This material can be molded in styrofoam and machined quite nicely. It is capable of withstanding moderately high temperatures. Attached to this resin insulator are inconel screens attached by silver plated copper wire to a voltage supply. All the work on the RPAs and thermal ion source, I performed in the University of Alabama in Huntsville's (UAH) engineering machine shop.

  2. Plasma physics and fusion plasma electrodynamics

    CERN Document Server

    Bers, Abraham


    Plasma is a ubiquitous state of matter at high temperatures. The electrodynamics of plasmas encompasses a large number of applications, from understanding plasmas in space and the stars, to their use in processing semiconductors, and their role in controlled energy generation by nuclear fusion. This book covers collective and single particle dynamics of plasmas for fully ionized as well as partially ionized plasmas. Many aspects of plasma physics in current fusion energy generation research are addressed both in magnetic and inertial confinement plasmas. Linear and nonlinear dynamics in hydrodynamic and kinetic descriptions are offered, making both simple and complex aspects of the subject available in nearly every chapter. The approach of dividing the basic aspects of plasma physics as "linear, hydrodynamic descriptions" to be covered first because they are "easier", and postponing the "nonlinear and kinetic descriptions" for later because they are "difficult" is abandoned in this book. For teaching purpose...

  3. Recycling perturbations of supershot plasmas

    Energy Technology Data Exchange (ETDEWEB)

    Scott, S.D.; McCune, D.C.; Bell, M.G.; Bell, R.; Budny, R.V.; Fredrickson, E.; Grek, B.; Hill, K.W.; Jassby, D.; Jobes, F.; Johnson, D.W.; Johnson, L.C.; Mansfield, H.K.; Park, H.K.; Ramsey, A.T.; Stratton, B.E.; Synakowski, E.J.; Taylor, G.; Towner, H.H.; Zarnstorff, M.C. [Princeton Univ., NJ (United States). Plasma Physics Lab.; Snipes, J.A. [Massachusetts Inst. of Tech., Cambridge, MA (United States)


    Thermal heat transport in the core (r/a {le} 0.5) of beam-heated TFTR plasmas vanes by more than a factor of five between L-mode and supershot plasmas for the same I{sub p}, B{sub T}, and P{sub b}. Operationally, this variation is strongly correlated with the particle recycling coefficient of the carbon-carbon composite inner bumper limiter. The mechanisms underlying this correlation are not understood. This paper describes studies of the edge ion temperature, which is an important parameter if {tau}{sub E} is controlled by ion temperature gradient driven turbulence. We find that a edge electron temperature scales simply with power per electron, irrespective of the recycling state of the limiter. By contrast, the scaling of edge ion temperature is strongly affected by the recycling state of the limiter. Much higher edge ion temperatures are attained in low-recycling plasmas for the same power per particle. In addition, perturbative studies of recycling effects on transport have been carried out by puffing in large amounts of helium into a supershot plasma. The local core transport coefficients increase on a transport time scale ({approximately}100 ms), much faster than the current relaxation time scale. This suggests that the current profile is not responsible for the favorable energy confinement of supershot plasmas relative to L-mode plasmas.

  4. Recycling perturbations of supershot plasmas

    Energy Technology Data Exchange (ETDEWEB)

    Scott, S.D.; McCune, D.C.; Bell, M.G.; Bell, R.; Budny, R.V.; Fredrickson, E.; Grek, B.; Hill, K.W.; Jassby, D.; Jobes, F.; Johnson, D.W.; Johnson, L.C.; Mansfield, H.K.; Park, H.K.; Ramsey, A.T.; Stratton, B.E.; Synakowski, E.J.; Taylor, G.; Towner, H.H.; Zarnstorff, M.C. (Princeton Univ., NJ (United States). Plasma Physics Lab.); Snipes, J.A. (Massachusetts Inst. of Tech., Cambridge, MA (United States))


    Thermal heat transport in the core (r/a [le] 0.5) of beam-heated TFTR plasmas vanes by more than a factor of five between L-mode and supershot plasmas for the same I[sub p], B[sub T], and P[sub b]. Operationally, this variation is strongly correlated with the particle recycling coefficient of the carbon-carbon composite inner bumper limiter. The mechanisms underlying this correlation are not understood. This paper describes studies of the edge ion temperature, which is an important parameter if [tau][sub E] is controlled by ion temperature gradient driven turbulence. We find that a edge electron temperature scales simply with power per electron, irrespective of the recycling state of the limiter. By contrast, the scaling of edge ion temperature is strongly affected by the recycling state of the limiter. Much higher edge ion temperatures are attained in low-recycling plasmas for the same power per particle. In addition, perturbative studies of recycling effects on transport have been carried out by puffing in large amounts of helium into a supershot plasma. The local core transport coefficients increase on a transport time scale ([approximately]100 ms), much faster than the current relaxation time scale. This suggests that the current profile is not responsible for the favorable energy confinement of supershot plasmas relative to L-mode plasmas.

  5. Effects of dietary n-3 highly unsaturated fatty acids on growth, nonspecific immunity, expression of some immune related genes and disease resistance of large yellow croaker (Larmichthys crocea) following natural infestation of parasites (Cryptocaryon irritans). (United States)

    Zuo, Rantao; Ai, Qinghui; Mai, Kangsen; Xu, Wei; Wang, Jun; Xu, Houguo; Liufu, Zhiguo; Zhang, Yanjiao


    The study was conducted to investigate the effects of dietary n-3 highly unsaturated fatty acid (n-3 HUFA) on growth, nonspecific immunity, expression of some immune related genes and disease resistance of juvenile large yellow croaker (Larmichthys crocea) following natural infestation of parasites (Cryptocaryon irritans). Six isoproteic and isolipidic diets were formulated with graded levels of n-3 HUFA ranging from 0.15% to 2.25% of the dry weight and the DHA/EPA was approximately fixed at 2.0. Each diet was randomly allocated to triplicate groups of fish in floating sea cages (1.0 × 1.0 × 1.5 m), and each cage was stocked with 60 fish (initial average weight 9.79 ± 0.6 g). Fish were fed twice daily (05:00 and 17:00) to apparent satiation for 58 days. Results showed that moderate n-3 HUFA level (0.98%) significantly enhanced growth compared with the control group (0.15% HUFA) (P  0.05). Nitro blue tetrazolium (NBT) positive leucocytes percentage of head kidney and serum superoxide dismutase (SOD) activity increased with increasing n-3 HUFA from 0.15% to 0.60%, and decreased with further increase of n-3 HUFA from 0.60% to 2.25% (P  0.05). There were no significant differences in phagocytosis index (PI) of head kidney leucocytes among dietary treatments (P > 0.05). The hepatic mRNA expression of Toll-like receptor 22 (TLR22) and Myeloid differentiation factor 88 (MyD88) was significantly up-regulated in fish fed the diets with low or moderate levels, while in kidney this increment was only found at specific sampling time during the natural infestation of parasites. The 13 d cumulative mortality rate following natural infestation of parasites decreased with n-3 HUFA increased from 0.15% to 0.60% (P < 0.05), and significantly increased with n-3 HUFA from 0.60% to 2.25% (P < 0.05). Results of this study suggested that fish fed low or moderate dietary n-3 HUFA had higher growth, nonspecific immune responses, expression levels of some immune

  6. Plasma Hypoxanthine-Guanine Phosphoribosyl Transferase Activity in Bottlenose Dolphins Contributes to Avoiding Accumulation of Non-recyclable Purines

    National Research Council Canada - National Science Library

    López-Cruz, Roberto I; Crocker, Daniel E; Gaxiola-Robles, Ramón; Bernal, Jaime A; Real-Valle, Roberto A; Lugo-Lugo, Orlando; Zenteno-Savín, Tania


    ... were examined in plasma and red blood cells from bottlenose dolphins (Tursiops truncatus) and humans. Hypoxanthine and inosine monophosphate concentrations were higher in plasma from dolphins than humans...

  7. Mind-body interface: the role of n-3 fatty acids in psychoneuroimmunology, somatic presentation, and medical illness comorbidity of depression. (United States)

    Su, Kuan-Pin


    With the unsatisfaction of monoamine-based pharmacotherapy and the high comorbidity of other medical illness in depression, the serotonin hypothesis seems to fail in approaching the aetiology of depression. Based upon the evidence from epidemiological data, case-control studies of phospholipid polyunsaturated fatty acids (PUFAs) levels in human tissues, and antidepressant effect in clinical trials, PUFAs have shed a light to discover the unsolved of depression and connect the mind and body. Briefly, the deficit of n-3 PUFAs has been reported to be associated with neurological, cardiovascular, cerebrovascular, autoimmune, metabolic diseases and cancers. Recent studies revealed that the deficit of n-3 PUFAs is also associated with depression. For example, societies that consume a small amount of omega-3 PUFAs appear to have a higher prevalence of major depressive disorder. In addition, depressive patients had showed a lower level of omega-3 PUFAs; and the antidepressant effect of PUFAs had been reported in a number of clinical trials. The PUFAs are classified into n-3 (or omega-3) and n-6 (or omega-6) groups. Eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA), the major bioactive components of n-3 PUFAs, are not synthesized in human body and can only be obtained directly from the diet, particularly by consuming fish. DHA deficit is associated with dysfunctions of neuronal membrane stability and transmission of serotonin, norepinephrine and dopamine, which might connect to the aetiology of mood and cognitive dysfunction of depression. On the other hand, EPA is important in balancing the immune function and physical healthy by reducing arachidonic acid (AA, an n-6 PUFA) level on cell membrane and prostaglandin E2 (PGE2) synthesis. Interestingly, animals fed with high AA diet or treated with PGE2 were observed to present sickness behaviours of anorexia, low activity, change in sleep pattern and attention, which are similar to somatic symptoms of depression in

  8. Effects of dietary enrichment with n-3 fatty acids on the quality of raw and processed breast meat of high and low growth rate chickens. (United States)

    Baeza, E; Chartrin, P; Gigaud, V; Tauty, S; Meteau, K; Lessire, M; Berri, C


    1. The enrichment of raw poultry meat with n-3 fatty acids (n-3 FA) has been investigated in detail, particularly in high growth rate genotype standard broiler chickens, whereas low growth rate genotype Label Rouge chickens have received less attention. With the increased development of processed poultry products, it is necessary to ensure that the nutritional and sensory quality of meat enriched with n-3 FA is not affected by processing. 2. Two experiments were undertaken for this purpose. In the first experiment, 696 male Ross 708 chickens were reared under standard conditions, and in the second, 750 male JA 657 chickens were reared under Label Rouge conditions. All birds received the same starting and growing diets containing palm and soya oils in each experiment. Birds were distributed into three groups from 21 or 57 d of age for standard and Label Rouge chickens, respectively, and given a control, linseed oil or extruded linseed diet. Diets were also supplemented with vitamin E (100-200 mg/kg). Birds were slaughtered at 56 or 84 d of age for standard and Label Rouge chickens, respectively. A total amount of 60 kg of breast meat from each group was processed into white cured-cooked meat. 3. The dietary treatment had no effect on the growth performance of chickens or meat yield. The use of extruded linseed or linseed oil only decreased the carcass fatness of the standard chickens but had no effect on the carcass fatness of Label Rouge chickens. The nutritional quality of raw and cured-cooked meat was improved (increased concentration of n-3 FA), whereas the technological quality of the meat (pH, juice loss after cold storage, susceptibility to oxidation, colour, processing yield and shear force value) and sensory quality of the processed products were not or slightly affected. 4. Linked to lower breast yield, to lower lipid content in breast meat and to higher slaughter age, Label Rouge chickens seemed to be less efficient for n-3 FA deposition in breast muscles

  9. Differential induction of electrophile-responsive element-regulated genes by n-3 and n-6 polyunsaturated fatty acids. (United States)

    van Beelen, Vincent A; Aarts, Jac M M J G; Reus, Astrid; Mooibroek, Hans; Sijtsma, Lolke; Bosch, Dirk; Rietjens, Ivonne M C M; Alink, Gerrit M


    In this study the n-3 polyunsaturated fatty acids (PUFAs) eicosapentaenoic acid and docosahexaenoic acid appear to be effective inducers of electrophile-responsive element (EpRE) regulated genes, whereas the n-6 PUFA arachidonic acid is not. These n-3 PUFAs need to be oxidized to induce EpRE-regulated gene expression, as the antioxidant vitamin E can partially inhibit the PUFA induced dose-dependent effect. Results were obtained using a reporter gene assay, real-time RT-PCR and enzyme activity assays. The induction of EpRE-regulated phase II genes by n-3 PUFAs may be a major pathway by which n-3 PUFAs, in contrast to n-6 PUFAs, are chemopreventive and anticarcinogenic.

  10. Changes in milk and plasma fatty acid profile in response to fish and soybean oil supplementation in dairy sheep. (United States)

    Tsiplakou, Eleni; Zervas, George


    An effective strategy for enhancing the bioactive fatty acids (FA) in sheep milk could be dietary supplementation with a moderate level of a combination of soybean oil with fish oil (SFO) without negative effects on milk yield and its chemical composition. Thus, the objective of this study was to determine the effects of a moderate forage diet supplementation with SFO on milk chemical composition and FA profile, as well as on plasma FA. Twelve dairy sheep were assigned to two homogenous sub-groups. Treatments involved a control diet without added oil, and a diet supplemented with 23.6 g soybean oil and 4.7 g fish oil per kg dry matter (DM) of the total ration. The results showed that SFO diet had no effect on milk yield and chemical composition. In blood plasma the concentrations of trans-11 C(18:2) (VA), C(18:2n-6), C(20:5n-3) (EPA) and C(22:6n-3) (DHA) were significantly higher while those of C(14:0), C(16:0) and C(18:0) were lower in sheep fed with SFO diet compared with control. The SFO supplementation of sheep diet increased the concentrations of VA, cis-9, trans-11 C(18:2) CLA, trans-10, cis-12, C(18:2) CLA, EPA, DHA, monounsaturated FA (MUFA), polyusaturated fatty acids (PUFA) and n-3 FA and decreased those of short chain FA (SCFA), medium chain FA (MCFA), the saturated/unsaturated ratio and the atherogenicity index value in milk compared with the control. In conclussion, the SFO supplementation at the above levels in a sheep diet, with moderate forage to concentrate ratio, improved the milk FA profile from human health standpoint without negative effects on its chemical composition.

  11. Cholecystokinin elevates mouse plasma lipids.

    Directory of Open Access Journals (Sweden)

    Lichun Zhou

    Full Text Available Cholecystokinin (CCK is a peptide hormone that induces bile release into the intestinal lumen which in turn aids in fat digestion and absorption in the intestine. While excretion of bile acids and cholesterol into the feces eliminates cholesterol from the body, this report examined the effect of CCK on increasing plasma cholesterol and triglycerides in mice. Our data demonstrated that intravenous injection of [Thr28, Nle31]-CCK at a dose of 50 ng/kg significantly increased plasma triglyceride and cholesterol levels by 22 and 31%, respectively, in fasting low-density lipoprotein receptor knockout (LDLR(-/- mice. The same dose of [Thr28, Nle31]-CCK induced 6 and 13% increases in plasma triglyceride and cholesterol, respectively, in wild-type mice. However, these particular before and after CCK treatment values did not achieve statistical significance. Oral feeding of olive oil further elevated plasma triglycerides, but did not alter plasma cholesterol levels in CCK-treated mice. The increased plasma cholesterol in CCK-treated mice was distributed in very-low, low and high density lipoproteins (VLDL, LDL and HDL with less of an increase in HDL. Correspondingly, the plasma apolipoprotein (apo B48, B100, apoE and apoAI levels were significantly higher in the CCK-treated mice than in untreated control mice. Ligation of the bile duct, blocking CCK receptors with proglumide or inhibition of Niemann-Pick C1 Like 1 transporter with ezetimibe reduced the hypercholesterolemic effect of [Thr28, Nle31]-CCK in LDLR(-/- mice. These findings suggest that CCK-increased plasma cholesterol and triglycerides as a result of the reabsorption of biliary lipids from the intestine.

  12. Incorporation of n-3 PUFA and γ-linolenic acid in blood lipids and red blood cell lipids together with their influence on disease activity in patients with chronic inflammatory arthritis - a randomized controlled human intervention trial

    Directory of Open Access Journals (Sweden)

    Springer Monika


    Full Text Available Abstract Background and aim Marine n-3 fatty acids and γ-linolenic acid both have anti-inflammatory effects and may be useful to help treat inflammatory diseases. The effects of these alone or combined were examined in patients with arthritis in a randomized controlled trial. Design Patients with rheumatoid arthritis or psoriatic arthritis were randomized into four groups in a double-blind, placebo-controlled parallel designed study. Patients received the respective capsules (1: 3.0 g n-3 LC-PUFA/d; 2: 3.2 g γ-linolenic acid/d; 3: 1.6 g n-3 LC-PUFA + 1.8 g γ-linolenic acid/d; 4: 3.0 g olive oil for a twelve week period. Clinical status was evaluated and blood samples were taken at the beginning and at the end of the period. Differences before and after intervention were tested with paired t-test or with Wilcoxon test for non-normal data distribution. Results 60 patients (54 rheumatoid arthritis, 6 psoriatic arthritis were randomised, 47 finished per protocol. In group 1, the ratio of arachidonic acid (AA/eicosapentaenoic acid (EPA decreased from 6.5 ± 3.7 to 2.7 ± 2.1 in plasma lipids and from 25.1 ± 10.1 to 7.2 ± 4.7 in erythrocyte membranes (p ≤ 0.001. There was no significant influence on AA/EPA ratio due to interventions in group 2-4. In group 2, the intake of γ-linolenic acid resulted in a strong rise of γ-linolenic acid and dihomo-γ-linolenic acid concentrations in plasma lipids, cholesteryl esters, and erythrocyte membranes. The combination of n-3 LC-PUFA and γ-linolenic acid (group 3 led to an increase of γ-linolenic acid and dihomo-γ-linolenic acid concentrations in plasma lipids, cholesteryl esters, and erythrocyte mem-branes. This increase was only half of that in group 2. Conclusions Incorporation of eicosanoid precursor FAs was influenced by an intake of n-3 LC-PUFA and γ-linolenic acid suggesting a possible benefit for therapy of chronic inflammatory diseases. Trial Registration ClinicalTrials NCT01179971

  13. Globalisation and Higher Education

    NARCIS (Netherlands)

    Marginson, Simon; van der Wende, Marijk


    Economic and cultural globalisation has ushered in a new era in higher education. Higher education was always more internationally open than most sectors because of its immersion in knowledge, which never showed much respect for juridical boundaries. In global knowledge economies, higher education

  14. India's Higher Education Challenges (United States)

    Altbach, Philip G.


    India, with the world's second largest higher education system and a rapidly growing economy as one of the BRIC nations, faces significant challenges in building both capacity and excellence in higher education. India's higher education system is characterized by "islands of excellence in a sea of mediocrity." The mainstream universities…

  15. Experimental studies of collisional plasma shocks and plasma interpenetration via merging supersonic plasma jets (United States)

    Hsu, S. C.; Moser, A. L.; Merritt, E. C.; Adams, C. S.


    Over the past 4 years on the Plasma Liner Experiment (PLX) at LANL, we have studied obliquely and head-on-merging supersonic plasma jets of an argon/impurity or hydrogen/impurity mixture. The jets are formed/launched by pulsed-power-driven railguns. In successive experimental campaigns, we characterized the (a) evolution of plasma parameters of a single plasma jet as it propagated up to ~ 1 m away from the railgun nozzle, (b) density profiles and 2D morphology of the stagnation layer and oblique shocks that formed between obliquely merging jets, and (c) collisionless interpenetration transitioning to collisional stagnation between head-on-merging jets. Key plasma diagnostics included a fast-framing CCD camera, an 8-chord visible interferometer, a survey spectrometer, and a photodiode array. This talk summarizes the primary results mentioned above, and highlights analyses of inferred post-shock temperatures based on observations of density gradients that we attribute to shock-layer thickness. We also briefly describe more recent PLX experiments on Rayleigh-Taylor-instability evolution with magnetic and viscous effects, and potential future collisionless shock experiments enabled by low-impurity, higher-velocity plasma jets formed by contoured-gap coaxial guns. Supported by DOE Fusion Energy Sciences and LANL LDRD.

  16. Cytocompatibility of Plasma and Thermally Treated Biopolymers

    Directory of Open Access Journals (Sweden)

    Petr Slepička


    Full Text Available This paper is focused on the surface characterization of plasma and consequently thermally treated biocompatible polymers. PLLA (poly(L-lactide acid and PMP (poly-4-methyl-1-pentene are studied. The influence of Ar plasma treatment on the surface polarity of substrate measured immediately after treatment and during the polymer surface aging is studied. Surface roughness, morphology, wettability, and surface chemistry were determined. Plasma treatment leads to significant changes in PLLA surface morphology and chemistry, with the PMP being slightly affected. The higher resistance to plasma fluence results in smaller ablation of PMP than that of PLLA. The plasma treatment improves cell adhesion and proliferation on the PMP. Plasma treatment of PLLA influences mostly the homogeneity of adhered and proliferated VSMC.

  17. Cytotoxic and mutagenic properties of regioisomeric O 2-, N3- and O 4-ethylthymidines in bacterial cells (United States)

    Zhai, Qianqian; Wang, Pengcheng; Wang, Yinsheng


    Exposure to environmental agents and endogenous metabolism can both give rise to DNA alkylation. Thymine is known to be alkylated at O 2, N3 and O 4 positions; however, it remains poorly explored how the regioisomeric alkylated thymidine lesions compromise the flow of genetic information by perturbing DNA replication in cells. Herein, we assessed the differential recognition of the regioisomeric O 2-, N3- and O 4-ethylthymidine (O 2-, N3- and O 4-EtdT) by the DNA replication machinery of Escherichia coli cells. We found that O 4-EtdT did not inhibit appreciably DNA replication, whereas O 2- and N3-EtdT were strongly blocking to DNA replication. In addition, O 4-EtdT induced a very high frequency of T→C mutation, whereas nucleotide incorporation opposite O 2- and N3-EtdT was promiscuous. Replication experiments with the use of polymerase-deficient cells revealed that Pol V constituted the major polymerase for the mutagenic bypass of all three EtdT lesions, though Pol IV also contributed to the T→G mutation induced by O 2- and N3-EtdT. The distinct cytotoxic and mutagenic properties of the three regioisomeric lesions could be attributed to their unique chemical properties. PMID:24710626

  18. Variation Quality and Kinetic Parameter of Commercial n-3 PUFA-Rich Oil during Oxidation via Rancimat. (United States)

    Yang, Kai-Min; Chiang, Po-Yuan


    Different biological sources of n -3 polyunsaturated fatty acids ( n -3 PUFA) in mainstream commercial products include algae and fish. Lipid oxidation in n -3 PUFA-rich oil is the most important cause of its deterioration. We investigated the kinetic parameters of n -3 PUFA-rich oil during oxidation via Rancimat (at a temperature range of 70~100 °C). This was done on the basis of the Arrhenius equation, which indicates that the activation energies ( E a) for oxidative stability are 82.84-96.98 KJ/mol. The chemical substrates of different oxidative levels resulting from oxidation via Rancimat at 80 °C were evaluated. At the initiation of oxidation, the tocopherols in the oil degraded very quickly, resulting in diminished protection against further oxidation. Then, the degradation of the fatty acids with n -3 PUFA-rich oil was evident because of decreased levels of PUFA along with increased levels of saturated fatty acids (SFA). The quality deterioration from n -3 PUFA-rich oil at the various oxidative levels was analyzed chemometrically. The anisidine value (p-AV, r: 0.92) and total oxidation value (TOTOX, r: 0.91) exhibited a good linear relationship in a principal component analysis (PCA), while oxidative change and a significant quality change to the induction period (IP) were detected through an agglomerative hierarchical cluster (AHC) analysis.

  19. n-3 polyumaettede fedtsyrer, hjertefrekvensvariabilitet og ventrikulaere arytmier hos post-AMI-patienter. Et klinisk kontrolleret studie

    DEFF Research Database (Denmark)

    Christensen, Jeppe Hagstrup; Gustenhoff, P; Korup, E


    . Fifty-five patients were randomized to receive either 5.2 g of n-3 PUFA daily for 12 weeks or placebo in a double blind, placebo-controlled study. Prior to randomization a 24-hour Holter recording was obtained, and this was repeated at the end of the study. The major end-points were the number......There is evidence for an antiarrhythmic effect of n-3 polyunsaturated fatty acids (n-3 PUFA) in animals. The aim of the present study was to investigate the effect of dietary n-3 PUFA on ventricular arrhythmias and heart rate variability (HRV) in patients with a previous myocardial infarction...... of ventricular extrasystoles (VE)/24 hours and the 24-hour HRV. A non-significant decrease in VE/24 hours was found in both the n-3 PUFA group and among controls after dietary supplementation, whereas HRV significantly increased after n-3 PUFA compared to both baseline values (p = 0.04) and to controls (p = 0...

  20. Fusion plasma physics

    CERN Document Server

    Stacey, Weston M


    This revised and enlarged second edition of the popular textbook and reference contains comprehensive treatments of both the established foundations of magnetic fusion plasma physics and of the newly developing areas of active research. It concludes with a look ahead to fusion power reactors of the future. The well-established topics of fusion plasma physics -- basic plasma phenomena, Coulomb scattering, drifts of charged particles in magnetic and electric fields, plasma confinement by magnetic fields, kinetic and fluid collective plasma theories, plasma equilibria and flux surface geometry, plasma waves and instabilities, classical and neoclassical transport, plasma-materials interactions, radiation, etc. -- are fully developed from first principles through to the computational models employed in modern plasma physics. The new and emerging topics of fusion plasma physics research -- fluctuation-driven plasma transport and gyrokinetic/gyrofluid computational methodology, the physics of the divertor, neutral ...

  1. Ion Scattering in a Self-Consistent Cylindrical Plasma Sheath

    National Research Council Canada - National Science Library

    Figueroa, Shana S; Cooke, D. L; Gatsonis, Nikos A


    .... Results indicate that higher plasma shielding limits the range of impact parameters that experience significant scattering, and that attracted particles entering tangent to the sheath experience increased scattering...

  2. Maternal supplementation with n-3 long chain polyunsaturated fatty acids during perinatal period alleviates the metabolic syndrome disturbances in adult hamster pups fed a high-fat diet after weaning. (United States)

    Kasbi-Chadli, Fatima; Boquien, Clair-Yves; Simard, Gilles; Ulmann, Lionel; Mimouni, Virginie; Leray, Véronique; Meynier, Anne; Ferchaud-Roucher, Véronique; Champ, Martine; Nguyen, Patrick; Ouguerram, Khadija


    Perinatal nutrition is thought to affect the long-term risk of the adult to develop metabolic syndrome. We hypothesized that maternal supplementation with eicosapentaenoic acid and docosahexaenoic acid during pregnancy and lactation would protect offspring fed a high-fat diet from developing metabolic disturbances. Thus, two groups of female hamsters were fed a low-fat control diet, either alone (LC) or enriched with n-3 long chain polyunsaturated fatty acids (LC-PUFA) (LO), through the gestational and lactation periods. After weaning, male pups were randomized to separate groups that received either a control low-fat diet (LC) or a high-fat diet (HC) for 16 weeks. Four groups of pups were defined (LC-LC, LC-HC, LO-LC and LO-HC), based on the combinations of maternal and weaned diets. Maternal n-3 LC-PUFA supplementation was associated with reduced levels of basal plasma glucose, hepatic triglycerides secretion and postprandial lipemia in the LO-HC group compared to the LC-HC group. Respiratory parameters were not affected by maternal supplementation. In contrast, n-3 LC-PUFA supplementation significantly enhanced the activities of citrate synthase, isocitrate dehydrogenase and α-ketoglutarate dehydrogenase compared to the offspring of unsupplemented mothers. Sterol regulatory element binding protein-1c, diacylglycerol O-acyltransferase 2, fatty acid synthase, stearoyl CoA desaturase 1 and tumor necrosis factor α expression levels were not affected by n-3 LC-PUFA supplementation. These results provide evidence for a beneficial effect of n-3 LC-PUFA maternal supplementation in hamsters on the subsequent risk of metabolic syndrome. Underlying mechanisms may include improved lipid metabolism and activation of the mitochondrial oxidative pathway. Copyright © 2014 Elsevier Inc. All rights reserved.

  3. Reactions of N+ (3P) ions with H2 and HD molecules at low temperatures (United States)

    Grozdanov, Tasko P.; McCarroll, Ronald; Roueff, Evelyne


    Context. This work is motivated by the necessity to take account of both the nuclear spin symmetries of H2 and the spin-orbit interaction of N+ ions in order to investigate gas phase reactions in interstellar chemistry, leading to the formation of nitrogenous and deuterated compounds. Aims: The main objective in this work is to determine the rate coefficients for each possible initial quantum state of the reactants N+ (3Pj) + H2 (J) (and their isotopic variants). Only in this way does it become possible both to analyse experimental data and to develop realistic applications to interstellar chemical models to constrain the gas phase chemistry of ammonia and its isotopologues. Methods: A statistical treatment is presented of state selective reactive collisions involving N+ ions in fine structure state j with H2 or HD molecules in a rotation level J of the ground vibration state, leading either to the production of NH+ ions and H in the case of the H2 reactant, and to the production of either NH+ ions or ND+ in the case of the HD reactant. The energies of fine structure states (j = 0,1,2) of the N+ ions are treated on an equal footing with the other energies of internal motions. All fine structure states are considered to be reactive. Results: Cross sections for state-to-state collisions are calculated for collision energies ranging from 0.1-30 meV. These cross sections are then averaged over the kinetic energies of the reactants for each (J,j) to obtain the rate coefficients for a range of kinetic temperatures 10-200 K. The exo/endothermicity of the reactions involving N+ (3Pj) + H2 (J) (and isotopic variants) is derived from the difference ΔEe between the dissociation energies of the electronic molecular potentials of NH+ and H2. The value ΔEe = 101 meV is found to satisfactorily reproduce the experiments performed with ortho-H2 and to a lesser extent with para-H2. This value is used to determine the rate coefficient of the N+ + HD reaction leading to the

  4. [Higher Brain Dysfunction]. (United States)

    Kashima, Haruo


    The technical term "higher brain dysfunction" is used widely in Japan. However, it is not always clear what "higher" means. The author thinks that the term "higher" is understood as being associated with a meaning. In this article, the differences between higher brain dysfunctions and elementary brain dysfunctions are discussed from the point of view of lesion localization and the consistency of symptoms. The psychiatric approach is indispensable for the assessment of higher brain dysfunction. A simple test for mild Alzheimer-type dementia is also introduced.

  5. n-3 Fatty Acids Induce Neurogenesis of Predominantly POMC-Expressing Cells in the Hypothalamus. (United States)

    Nascimento, Lucas F R; Souza, Gabriela F P; Morari, Joseane; Barbosa, Guilherme O; Solon, Carina; Moura, Rodrigo F; Victório, Sheila C; Ignácio-Souza, Letícia M; Razolli, Daniela S; Carvalho, Hernandes F; Velloso, Lício A


    Apoptosis of hypothalamic neurons is believed to play an important role in the development and perpetuation of obesity. Similar to the hippocampus, the hypothalamus presents constitutive and stimulated neurogenesis, suggesting that obesity-associated hypothalamic dysfunction can be repaired. Here, we explored the hypothesis that n-3 polyunsaturated fatty acids (PUFAs) induce hypothalamic neurogenesis. Both in the diet and injected directly into the hypothalamus, PUFAs were capable of increasing hypothalamic neurogenesis to levels similar or superior to the effect of brain-derived neurotrophic factor (BDNF). Most of the neurogenic activity induced by PUFAs resulted in increased numbers of proopiomelanocortin but not NPY neurons and was accompanied by increased expression of BDNF and G-protein-coupled receptor 40 (GPR40). The inhibition of GPR40 was capable of reducing the neurogenic effect of a PUFA, while the inhibition of BDNF resulted in the reduction of global hypothalamic cell. Thus, PUFAs emerge as a potential dietary approach to correct obesity-associated hypothalamic neuronal loss. © 2016 by the American Diabetes Association. Readers may use this article as long as the work is properly cited, the use is educational and not for profit, and the work is not altered.

  6. N-3 Polyunsaturated Fatty Acids of Marine Origin and Multifocality in Human Breast Cancer.

    Directory of Open Access Journals (Sweden)

    Lobna Ouldamer

    Full Text Available The microenvironment of breast epithelial tissue may contribute to the clinical expression of breast cancer. Breast epithelial tissue, whether healthy or tumoral, is directly in contact with fat cells, which in turn could influence tumor multifocality. In this pilot study we investigated whether the fatty acid composition of breast adipose tissue differed according to breast cancer focality.Twenty-three consecutive women presenting with non-metastatic breast cancer underwent breast-imaging procedures including Magnetic Resonance Imaging prior to treatment. Breast adipose tissue specimens were collected during breast surgery. We established a biochemical profile of adipose tissue fatty acids by gas chromatography. We assessed whether there were differences according to breast cancer focality.We found that decreased levels in breast adipose tissue of docosahexaenoic and eicosapentaenoic acids, the two main polyunsaturated n-3 fatty acids of marine origin, were associated with multifocality.These differences in lipid content may contribute to mechanisms through which peritumoral adipose tissue fuels breast cancer multifocality.

  7. Structural and Theoretical Evidence of the Depleted Proton Affinity of the N3-Atom in Acyclovir

    Directory of Open Access Journals (Sweden)

    Esther Vílchez-Rodríguez


    Full Text Available The hydronium salt (H3O2[Cu(N7–acv2(H2O2(SO42]·2H2O (1, acv = acyclovir has been synthesized and characterized by single-crystal X-ray diffraction and spectral methods. Solvated Cu(OH2 is a by-product of the synthesis. In the all-trans centrosymmetric complex anion, (a the Cu(II atom exhibits an elongated octahedral coordination; (b the metal-binding pattern of acyclovir (acv consists of a Cu–N7(acv bond plus an (aquaO–H···O6(acv interligand interaction; and (c trans-apical/distal sites are occupied by monodentate O-sulfate donor anions. Neutral acyclovir and aqua-proximal ligands occupy the basal positions, stabilizing the metal binding pattern of acv. Each hydronium(1+ ion builds three H-bonds with O–sulfate, O6(acv, and O–alcohol(acv from three neighboring complex anions. No O atoms of solvent water molecules are involved as acceptors. Theoretical calculations of molecular electrostatic potential surfaces and atomic charges also support that the O-alcohol of the N9(acv side chain is a better H-acceptor than the N3 or the O-ether atoms of acv.

  8. A N3S(thioether)-Ligated CuII-Superoxo with Enhanced Reactivity (United States)

    Kim, Sunghee; Lee, Jung Yoon; Cowley, Ryan E.; Ginsbach, Jake W.; Siegler, Maxime A.; Solomon, Edward I.; Karlin, Kenneth D.


    Previous efforts to synthesize a cupric superoxide complex possessing a thioether donor have resulted in the formation of an end-on trans-peroxodicopper(II) species, [{(Ligand)CuII}2(μ-1,2-O22−)]2+. Redesign/modification of previous N3S tetradentate ligands has now allowed for the stabilization of the monomeric, superoxide product possessing a S(thioether)-ligation, [(DMAN3S)CuII(O2•−)]+ (2S), as characterized by UV-vis and resonance Raman (rR) spectroscopies. This complex mimics the putative CuII(O2•−) active species of the copper monooxygenase PHM and exhibits enhanced reactivity towards both O-H and C-H substrates in comparison to close analogues [(L)CuII(O2•−)]+, where L contains only nitrogen donor atoms. Cu-S(thioether) ligation with its weaker donor ability (relative to an N-donor) are demonstrated by comparisons to the chemistry of analogue compounds. PMID:25697226

  9. [The Vishnevsky Central Military Clinical Hospital N 3 celebrates the 45th anniversary]. (United States)

    Beliakin, S A; Frolkin, M N


    The article is dedicated to the history of the Vishnevsky Central Military Clinical Hospital N 3. N.M.Nevskiy, the head of the 2nd Central military clinical hospital n.a. P. V. Mandryka, suggested to groud a military diagnostic and treatment complex in the countryside. It was caused by the exceeding demand for hospitalization for military personnel. The new hospital was built in 4 years and launched on 20 June 1968. The Central military clinical hospital of n.a. P. V.M andryka was transformed to the staff N 27/705 with 925 beds. This staff consisted of main treatment department with 655 beds (Krasnogorsk), branch of the 1st hospital with 120 beds (Moscow), branch of 2nd hospital with 100 beds and sanitary department with 50 beds (Bolshevo, the Moscow Region). In 1970 branch of the 1st 2nd hospitals were excluded from the staff. The name of hospital was changed for "Central clinical military hospital". In 1976 hospital was named after the prominent military surgeon A.A. Vishnevsky. Nowadays hospital is a multi-field medical and preventive treatment facility, one of the highest technological medical centers of the Armed Forces of the Russian Federation. This hospital provides a qualified medical treatment for servicemen, their families and other categories of employee of the Armed Forces. Hospital consists of 18 specialized centers, 110 diagnostic and treatment departments, 1 outpatient hospital and 6 branches.

  10. Effect of soya bean and fish oil inclusion in diets on milk and plasma enzymes from sheep and goat related to oxidation. (United States)

    Tsiplakou, E; Chatzikonstantinou, M; Mitsiopoulou, C; Karaiskou, C; Mavrommatis, A; Sotirakoglou, K; Labrou, N; Zervas, G


    This study investigated the effects of dietary inclusion of soya bean oil combined with fish oil (SFO) on the activities of a) superoxide dismutase (SOD), glutathione reductase (GR), catalase (CAT) and glutathione transferase (GST) in blood plasma and b) SOD, GR, CAT and lactoperoxidase (LPO) in the milk of sheep and goats. Furthermore, the oxidative stress indicators for measuring total antioxidant activity and free radical scavenging activity [ferric reducing ability of plasma (FRAP) and 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid) (ABTS) assays] and oxidative stress biomarkers [malondialdehyde (MDA) and protein carbonyl (PC)] were also determined in the blood plasma and milk of the animals. For this purpose, twelve dairy sheep and twelve dairy goats were assigned each to two homogenous subgroups. Treatments in both animal species involved a control diet without added oil and a diet supplemented with 5% soya bean oil and 1% fish oil. The results showed that the inclusion of SFO in the diets of sheep and goats increased significantly the activities of CAT and GR in their blood plasma. The same effect was observed for the activities of GST and FRAP in the blood plasma of goats. Moreover, the fact that the goats had significantly higher average daily PUFA intake (3.62 g/kg BW 0.75 ) compared to sheep (2.51 g/kg BW 0.75 ) resulted in an enhancement in the MDA content in their plasma. A significant increase in CAT activity in the milk in both animal species fed with SFO diets was also found. Finally, due to the higher apparent transfer rate of n-3 FA from the diet to the milk in sheep, the PC concentrations were found to be enhanced in their plasma and milk. In conclusion, the impact of dietary SFO supplementation on the oxidative status of body and/or on the milk of small ruminants depends not only on the daily PUFA intake, but also on the amount of n-3 FA that reach their milk. Journal of Animal Physiology and Animal Nutrition © 2016 Blackwell Verlag

  11. Antidegradation and reinforcement effects of phenyltrimethoxysilane- or N-[3-(trimethoxysilyl)propyl]aniline-modified silica particles in natural rubber composites

    Energy Technology Data Exchange (ETDEWEB)

    Tunlert, Apinya [Program in Petrochemistry and Polymer Science, Chulalongkorn University, Bangkok 10330 (Thailand); Prasassarakich, Pattarapan [Department of Chemical Technology, Faculty of Science, Chulalongkorn University, Bangkok 10330 (Thailand); Poompradub, Sirilux, E-mail: [Department of Chemical Technology, Faculty of Science, Chulalongkorn University, Bangkok 10330 (Thailand); Center for Petroleum, Petrochemical and Advanced Material, Chulalongkorn University Bangkok 10330 (Thailand)


    The modification of silica particles with phenyltrimethoxysilane or N-[3-(trimethoxysilyl)propyl]aniline via a sol–gel reaction was performed in order to improve the dispersion of silica and antidegradation in natural rubber (NR). The functional groups on the modified silica surface were characterized by Fourier transform infrared spectroscopy, while the morphology was evaluated by scanning and transmission electron microscopy. The surface properties and antioxidant activity of the modified silica particles were determined by the water contact angle and 2, 2-diphenyl-1-picrylhydrazyl assay, respectively. The modified silica particles exhibited a higher hydrophobicity and a decreased interfacial adhesion energy compared with the unmodified silica particles. The modified silica particles were then incorporated into NR. The better dispersion of the modified silica particles than the unmodified ones in the NR matrix resulted in improved mechanical properties in terms of the modulus at 300% elongation (2.9 ± 0.02 MPa), hardness (52.5 ± 0.2 Shore A), abrasion resistance (241 ± 8 mm{sup 3}) and compression set (20.2 ± 0.6%). In addition, the inclusion of the modified silica particles in the NR matrix gave a high initial temperature of decomposition and retarded the ozone-induced degradation compared with the NR filled with unmodified silica particles. - Highlights: • Silica was surface modified with PhTMS or ATMS via a sol–gel reaction. • Modified silica showed a decreased interfacial adhesion energy. • Modified silica showed an enhanced free radical scavenging activity. • Modified silica improved the mechanical properties, thermal stability and ozone resistance in NR vulcanizates.

  12. Communication through plasma sheaths


    Korotkevich, A. O.; Newell, A. C.; Zakharov, V. E.


    We wish to transmit messages to and from a hypersonic vehicle around which a plasma sheath has formed. For long distance transmission, the signal carrying these messages must be necessarily low frequency, typically 2 GHz, to which the plasma sheath is opaque. The idea is to use the plasma properties to make the plasma sheath appear transparent.

  13. Lack of effects of a single high-fat meal enriched with vegetable n-3 or a combination of vegetable and marine n-3 fatty acids on intestinal peptide release and adipokines in healthy female subjects

    Directory of Open Access Journals (Sweden)

    Ingunn Naverud


    Full Text Available Peptides released from the small intestine and colon regulate short-term food intake by suppressing appetite and inducing satiety. Intake of marine omega-3 (n-3 fatty acids from fish and fish oils is associated with beneficial health effects, whereas the relation between intake of the vegetable n-3 fatty acid α-linolenic acid and diseases is less clear. The aim of the present study was to investigate the postprandial effects of a single high-fat meal enriched with vegetable n-3 or a combination of vegetable and marine n-3 fatty acids with their different unsaturated fatty acid composition on intestinal peptide release and the adipose tissue. Fourteen healthy lean females consumed three test meals with different fat quality in a fixed order. The test meal consisted of three cakes enriched with coconut fat, linseed oil and a combination of linseed and cod liver oil. The test days were separated by two weeks. Fasting and postprandial blood samples at three and six hours after intake were analysed. A significant postprandial effect was observed for cholecystokinin, peptide YY, glucose-dependent insulinotropic polypeptide, amylin and insulin which increased, while leptin decreased postprandially independent of the fat composition in the high-fat meal. In conclusion, in healthy, young, lean females, an intake of a high-fat meal enriched with n-3 fatty acids from different origin stimulates intestinal peptide release without any difference between the different fat compositions.

  14. Plasma Response to Lithium-Coated Plasma-Facing Components in the National Spherical Torus Experiment

    Energy Technology Data Exchange (ETDEWEB)

    M.G. Bell, H.W. Kugel, R. Kaita, L.E. Zakharov, H. Schneider, B.P. LeBlanc, D. Mansfield, R.E. Bell, R. Maingi, S. Ding, S.M. Kaye, S.F. Paul, S.P. Gerhardt, J.M. Canik, J.C. Hosea, G. Taylor and the NSTX Research Team


    Experiments in the National Spherical Torus Experiment (NSTX) have shown beneficial effects on the performance of divertor plasmas as a result of applying lithium coatings on the graphite and carbonfiber- composite plasma-facing components. These coatings have mostly been applied by a pair of lithium evaporators mounted at the top of the vacuum vessel which inject collimated streams of lithium vapor towards the lower divertor. In NBI-heated, deuterium H-mode plasmas run immediately after the application of lithium, performance modifications included decreases in the plasma density, particularly in the edge, and inductive flux consumption, and increases in the electron and ion temperatures and the energy confinement time. Reductions in the number and amplitude of ELMs were observed, including complete ELM suppression for periods up to 1.2 s, apparently as a result of altering the stability of the edge. However, in the plasmas where ELMs were suppressed, there was a significant secular increase in the effective ion charge Zeff and the radiated power as a result of increases in the carbon and medium-Z metallic impurities, although not of lithium itself which remained at a very low level in the plasma core, <0.1%. The impurity buildup could be inhibited by repetitively triggering ELMs with the application of brief pulses of an n = 3 radial field perturbation. The reduction in the edge density by lithium also inhibited parasitic losses through the scrape-off layer of ICRF power coupled to the plasma, enabling the waves to heat electrons in the core of H-mode plasmas produced by NBI. Lithium has also been introduced by injecting a stream of chemically stabilized, fine lithium powder directly into the scrape-off layer of NBI-heated plasmas. The lithium was ionized in the SOL and appeared to flow along the magnetic field to the divertor plates. This method of coating produced similar effects to the evaporated lithium but at lower amounts.

  15. MHD instabilities and their effects on plasma confinement in the large helical device plasmas

    Energy Technology Data Exchange (ETDEWEB)

    Toi, K.; Ohdachi, S. [National Inst. for Fusion Science, Toki, Gifu (Japan); Yamamoto, S. [Nagoya Univ., Dept. of Energy Engineering and Science, Nagoya, Aichi (JP)] [and others


    Characteristics of MHD instabilities and their impacts on plasma confinement are studied in current free plasmas of the Large Helical Device (LHD). Spontaneous L-H transition is often observed in high beta plasmas in the range of 2% averaged beta at low toroidal field (B{sub t} {<=} 0.6T). The stored energy rapidly rises with the transition, but quickly saturates due to the growth of m=2/n=3 and m=2/n=2 modes (m and n: poloidal and toroidal mode numbers) excited in the plasma edge region. Even in low beta plasmas, ELM activities are sometimes induced in high performance plasmas with a steep edge pressure gradient, and transiently reduce the stored energy by about 10%. Energetic ion driven MHD modes such as Alfven eigenmodes are studied in the very wide range of characteristic parameters: the averaged beta of energetic ions <{beta}{sub b//}> up to 5% and the ratio of energetic ion velocity to the Alfven velocity V{sub b//}/V{sub A} up to 2.5. In addition to the observation of toroidicity induced Alfven eigenmodes (TAEs), coherent magnetic fluctuations of helicity induced Alfven eigenmodes (HAEs) have been observed for the first time in NBI heated plasmas. The transition of the TAE to the global Alfven eigenmode (GAE) is also observed in a discharge with temporal evolution of the rotational transform profile, having a similarity to the phenomenon in a reversed shear tokamak. At low magnetic field, bursting TAEs transiently induce a significant loss of energetic ions, but lead to the transient improvement of bulk plasma confinement in the plasma central region. (author)

  16. MHD instabilities and their effects on plasma confinement in the large helical device plasmas

    Energy Technology Data Exchange (ETDEWEB)

    Toi, K.; Ohdachi, S. [National Inst. for Fusion Science, Toki, Gifu (Japan); Yamamoto, S. [Nagoya Univ., Dept. of Energy Engineering and Science, Nagoya, Aichi (JP)] [and others


    Characteristics of MHD instabilities and their impacts on plasma confinement are studied in current free plasmas of the Large Helical Device (LHD). Spontaneous L-H transition is often observed in high beta plasmas in the range of 2% averaged beta at low toroidal field (B{sub t} {<=} 0.6 T). The stored energy rapidly rises by the transition, but quickly saturates by the growth of m=2/n=3 and m=2/n=2 modes (m and n: poloidal and toroidal mode numbers) excited in the plasma edge region. Even low beta plasmas, ELM like activities are sometimes induced in high performance plasmas with high edge pressure pedestal, and transiently reduce the stored energy by about 10%. Energetic ion driven MHD modes such as Alfven eigenmodes are studied in the very wide parameter range of the averaged beta of energetic ions <{beta}{sub b} sub (parallel)> up to 5% and the ratio of energetic ion velocity to the Alfven velocity V{sub b} sub (parallel)/V{sub A} up to 2.5. In addition to the observation of toroidicity induced Alfven eigenmodes (TAEs), coherent magnetic fluctuations of helicity induced Alfven eigenmodes (HAEs) have been observed for the first time in NBI heated plasmas. Transition of TAE to global Alfven eigenmode (GAE) is also observed in a discharge with temporal evolution of the rotational transform profile, having a similarity to the phenomenon in a reversed shear tokamak. At the low magnetic field, bursting TAEs enhance energetic ion loss transiently, but lead to the transient improvement of bulk plasma confinement in the plasma central region. (author)

  17. Higher derivative mimetic gravity (United States)

    Gorji, Mohammad Ali; Mansoori, Seyed Ali Hosseini; Firouzjahi, Hassan


    We study cosmological perturbations in mimetic gravity in the presence of classified higher derivative terms which can make the mimetic perturbations stable. We show that the quadratic higher derivative terms which are independent of curvature and the cubic higher derivative terms which come from curvature corrections are sufficient to remove instabilities in mimetic perturbations. The classified higher derivative terms have the same dimensions but they contribute differently in the background and perturbed equations. Therefore, we can control both the background and the perturbation equations allowing us to construct the higher derivative extension of mimetic dark matter and the mimetic nonsingular bouncing scenarios. The latter can be thought as a new higher derivative effective action for the loop quantum cosmology scenario in which the equations of motion coincide with those suggested by loop quantum cosmology. We investigate a possible connection between the mimetic cosmology and the Randall-Sundrum cosmology.

  18. Higher Spin Matrix Models

    Directory of Open Access Journals (Sweden)

    Mauricio Valenzuela


    Full Text Available We propose a hybrid class of theories for higher spin gravity and matrix models, i.e., which handle simultaneously higher spin gravity fields and matrix models. The construction is similar to Vasiliev’s higher spin gravity, but part of the equations of motion are provided by the action principle of a matrix model. In particular, we construct a higher spin (gravity matrix model related to type IIB matrix models/string theory that have a well defined classical limit, and which is compatible with higher spin gravity in A d S space. As it has been suggested that higher spin gravity should be related to string theory in a high energy (tensionless regime, and, therefore to M-Theory, we expect that our construction will be useful to explore concrete connections.

  19. Plasma sweeper. [Patents (United States)

    Motley, R.W.; Glanz, J.


    A device is described for coupling RF power (a plasma sweeper) from RF power introducing means to a plasma having a magnetic field associated therewith comprises at least one electrode positioned near the plasma and near the RF power introducing means. Means are described for generating a static electric field at the electrode directed into the plasma and having a component substantially perpendicular to the plasma magnetic field such that a non-zero vector cross-product of the electric and magnetic fields exerts a force on the plasma causing the plasma to drift.

  20. Introduction to plasma dynamics

    CERN Document Server

    Morozov, A I


    As the twenty-first century progresses, plasma technology will play an increasing role in our lives, providing new sources of energy, ion-plasma processing of materials, wave electromagnetic radiation sources, space plasma thrusters, and more. Studies of the plasma state of matter not only accelerate technological developments but also improve the understanding of natural phenomena. Beginning with an introduction to the characteristics and types of plasmas, Introduction to Plasma Dynamics covers the basic models of classical diffuse plasmas used to describe such phenomena as linear and shock w

  1. Cellulose biosynthesis in higher plants

    Directory of Open Access Journals (Sweden)

    Krystyna Kudlicka


    Full Text Available Knowledge of the control and regulation of cellulose synthesis is fundamental to an understanding of plant development since cellulose is the primary structural component of plant cell walls. In vivo, the polymerization step requires a coordinated transport of substrates across membranes and relies on delicate orientations of the membrane-associated synthase complexes. Little is known about the properties of the enzyme complexes, and many questions about the biosynthesis of cell wall components at the cell surface still remain unanswered. Attempts to purify cellulose synthase from higher plants have not been successful because of the liability of enzymes upon isolation and lack of reliable in vitro assays. Membrane preparations from higher plant cells incorporate UDP-glucose into a glucan polymer, but this invariably turns out to be predominantly β -1,3-linked rather than β -1,4-linked glucans. Various hypotheses have been advanced to explain this phenomenon. One idea is that callose and cellulose-synthase systems are the same, but cell disruption activates callose synthesis preferentially. A second concept suggests that a regulatory protein as a part of the cellulose-synthase complex is rapidly degraded upon cell disruption. With new methods of enzyme isolation and analysis of the in vitro product, recent advances have been made in the isolation of an active synthase from the plasma membrane whereby cellulose synthase was separated from callose synthase.

  2. [Algicidal activity against red-tide algaes by marine bacterial strain N3 isolated from a HABs area, southern China]. (United States)

    Shi, Rong-jun; Huang, Hong-hui; Qi, Zhan-hui; Hu, Wei-an; Tian, Zi-yang; Dai, Ming


    A marine algicidal bacterium N3 was isolated from a HABs area in Mirs Bay, a subtropical bay, in southern China. Algicidal activity and algicidal mode against Phaeodactylum tricornutum, Scrippsiella trochoidea, Prorocentrum micans and Skeletonema costatum were observed by the liquid infection method. The results showed that there were no algicidal activities against P. tricornutum and S. costatum. However, when the bacterial volume fractions were 2% and 10% , S. trochoidea and P. micans could be killed, respectively. S. trochoidea cells which were exposed to strain N3 became irregular in shape and the cellular components lost their integrity and were decomposed. While, the P. micans cells became inflated and the cellular components aggregated, followed by cell lysis. Strain N3 killed S. trochoidea and P. micans directly, and the algicidal activities of the bacterial strain N3 was concentration-dependent. To S. trochoidea, 2% (V/V) of bacteria in algae showed the strongest algicidal activity, all of the S. trochoidea cells were killed within 120 h. But the growth rates of cells, in the 1% and 0. 1% treatment groups, were only slightly lower than that in the control group. In all treatment groups, the densities of strain N3 were in declining trends. While, to P. micans, 10% and 5% of bacteria in algae showed strong algicidal activities, 78% and 70% of the S. trochoidea were killed within 120 h, respectively. However, the number of S. trochoidea after exposure to 1% of bacterial cultures still increased up to 5 incubation days. And in the three treatment groups, the densities of strain N3 experienced a decrease process. The isolated strain N3 was identified as Bacillus sp. by morphological observation, physiological and biochemical characterization, and homology comparisons based on 16S rRNA sequences.

  3. Collisionless plasmas in astrophysics

    CERN Document Server

    Belmont, Gerard; Mottez, Fabrice; Pantellini, Filippo; Pelletier, Guy


    Collisionless Plasmas in Astrophysics examines the unique properties of media without collisions in plasma physics. Experts in this field, the authors present the first book to concentrate on collisionless conditions in plasmas, whether close or not to thermal equilibrium. Filling a void in scientific literature, Collisionless Plasmas in Astrophysics explains the possibilities of modeling such plasmas, using a fluid or a kinetic framework. It also addresses common misconceptions that even professionals may possess, on phenomena such as "collisionless (Landau) damping". Abundant illustrations

  4. Higher dimensional higher derivative ϕ4 theory (United States)

    Gracey, J. A.; Simms, R. M.


    We construct several towers of scalar quantum field theories with an O (N ) symmetry which have higher derivative kinetic terms. The Lagrangians in each tower are connected by lying in the same universality class at the d -dimensional Wilson-Fisher fixed point. Moreover the universal theory is studied using the large N expansion and we determine d -dimensional critical exponents to O (1 /N2). We show that these new universality classes emerge naturally as solutions to the linear relation of the dimensions of the fields deduced from the underlying force-matter interaction of the universal critical theory. To substantiate the equivalence of the Lagrangians in each tower we renormalize each to several loop orders and show that the renormalization group functions are consistent with the large N critical exponents. While we focus on the first two new towers of theories and renormalize the respective Lagrangians to 16 and 18 dimensions there are an infinite number of such towers. We also briefly discuss the conformal windows and the extension of the ideas to theories with spin-1/2 and spin-1 fields as well as the idea of lower dimension completeness.

  5. Maternal liver docosahexaenoic acid (DHA) stores are increased via higher serum unesterified DHA uptake in pregnant long Evans rats. (United States)

    Metherel, Adam H; Kitson, Alex P; Domenichiello, Anthony F; Lacombe, R J Scott; Hopperton, Kathryn E; Trépanier, Marc-Olivier; Alashmali, Shoug M; Lin, Lin; Bazinet, Richard P


    Maternal docosahexaenoic acid (DHA, 22:6n-3) supplies the developing fetus during pregnancy; however, the mechanisms are unclear. We utilized pregnant rats to determine rates of DHA accretion, tissue unesterified DHA uptake and whole-body DHA synthesis-secretion. Female rats maintained on a DHA-free, 2% α-linolenic acid diet were either:1) sacrificed at 56 days for baseline measures, 2) mated and sacrificed at 14-18 days of pregnancy or 3) or sacrificed at 14-18 days as age-matched virgin controls. Maternal brain, adipose, liver and whole body fatty acid concentrations was determined for balance analysis, and kinetic modeling was used to determine brain and liver plasma unesterified DHA uptake and whole-body DHA synthesis-secretion rates. Total liver DHA was significantly higher in pregnant (95±5 μmol) versus non-pregnant (49±5) rats with no differences in whole-body DHA synthesis-secretion rates. However, liver uptake of plasma unesterified DHA was 3.8-fold higher in pregnant animals compared to non-pregnant controls, and periuterine adipose DHA was lower in pregnant (0.89±0.09 μmol/g) versus non-pregnant (1.26±0.06) rats. In conclusion, higher liver DHA accretion during pregnancy appears to be driven by higher unesterified DHA uptake, potentially via DHA mobilization from periuterine adipose for delivery to the fetus during the brain growth spurt. Copyright © 2017 Elsevier Inc. All rights reserved.

  6. N-3 poly-unsaturated fatty acids shift estrogen signaling to inhibit human breast cancer cell growth.

    Directory of Open Access Journals (Sweden)

    Wenqing Cao

    Full Text Available Although evidence has shown the regulating effect of n-3 poly-unsaturated fatty acid (n-3 PUFA on cell signaling transduction, it remains unknown whether n-3 PUFA treatment modulates estrogen signaling. The current study showed that docosahexaenoic acid (DHA, C22:6, eicosapentaenoic acid (EPA, C20:5 shifted the pro-survival and proliferative effect of estrogen to a pro-apoptotic effect in human breast cancer (BCa MCF-7 and T47D cells. 17 β-estradiol (E2 enhanced the inhibitory effect of n-3 PUFAs on BCa cell growth. The IC50 of DHA or EPA in MCF-7 cells decreased when combined with E2 (10 nM treatment (from 173 µM for DHA only to 113 µM for DHA+E2, and from 187 µm for EPA only to 130 µm for EPA+E2. E2 also augmented apoptosis in n-3 PUFA-treated BCa cells. In contrast, in cells treated with stearic acid (SA, C18:0 as well as cells not treated with fatty acid, E2 promoted breast cancer cell growth. Classical (nuclear estrogen receptors may not be involved in the pro-apoptotic effects of E2 on the n-3 PUFA-treated BCa cells because ERα agonist failed to elicit, and ERα knockdown failed to block E2 pro-apoptotic effects. Subsequent studies reveal that G protein coupled estrogen receptor 1 (GPER1 may mediate the pro-apoptotic effect of estrogen. N-3 PUFA treatment initiated the pro-apoptotic signaling of estrogen by increasing GPER1-cAMP-PKA signaling response, and blunting EGFR, Erk 1/2, and AKT activity. These findings may not only provide the evidence to link n-3 PUFAs biologic effects and the pro-apoptotic signaling of estrogen in breast cancer cells, but also shed new insight into the potential application of n-3 PUFAs in BCa treatment.

  7. Cost in Higher Education (United States)


    standardize methodology and accountability used nationwide by institutions of higher education . The aim is to review existing cost criteria and procedures...task. The objective of this research is to look into the cost structure used presently by two institutions of higher education , namely the Naval

  8. Higher Education in California (United States)

    Public Policy Institute of California, 2016


    Higher education enhances Californians' lives and contributes to the state's economic growth. But population and education trends suggest that California is facing a large shortfall of college graduates. Addressing this short­fall will require strong gains for groups that have been historically under­represented in higher education. Substantial…

  9. Reputation in Higher Education

    DEFF Research Database (Denmark)

    Plewa, Carolin; Ho, Joanne; Conduit, Jodie


    Reputation is critical for institutions wishing to attract and retain students in today's competitive higher education setting. Drawing on the resource based view and configuration theory, this research proposes that Higher Education Institutions (HEIs) need to understand not only the impact...

  10. Happiness in Higher Education (United States)

    Elwick, Alex; Cannizzaro, Sara


    This paper investigates the higher education literature surrounding happiness and related notions: satisfaction, despair, flourishing and well-being. It finds that there is a real dearth of literature relating to profound happiness in higher education: much of the literature using the terms happiness and satisfaction interchangeably as if one were…

  11. Reimagining Christian Higher Education (United States)

    Hulme, E. Eileen; Groom, David E., Jr.; Heltzel, Joseph M.


    The challenges facing higher education continue to mount. The shifting of the U.S. ethnic and racial demographics, the proliferation of advanced digital technologies and data, and the move from traditional degrees to continuous learning platforms have created an unstable environment to which Christian higher education must adapt in order to remain…

  12. Consumerism in Higher Education (United States)

    Green, Mark


    In considering consumerism in higher education, the student becomes the consumer,'' the university the corporation,'' and higher education the education industry.'' Other members of the education fraternity become investors, management, workers, direct consumers, and indirect consumers. This article proposes that it behooves the student to…

  13. The effects of isotope-labeled analogs on the LC-IDMS measurement by comparison of ESI responses and matrix effect of melamine, 13C3-melamine, 13C3+15N3-melamine, and 15N3-melamine. (United States)

    Li, Xiu Qin; Zhang, Qing He; Yang, Zong; Li, Hong Mei; Huang, Dong Feng


    In this paper, the effect of isotope-labeled analogs on the liquid chromatography-isotope dilution mass spectrometry (LC-IDMS) measurement was evaluated based on the comparison research of electrospray ionization responses (ESI) and matrix effect of melamine, 13C3-melamine, 13C3+15N3-melamine, and 15N3-melamine. The isotope-labeled melamines had similar ionization efficiency with melamine in the electrospray ionization source, but the intensity of corresponding quantitative fragment ions had distinctive differences. Based on the density functional theory at the B3LYP/6-311+G** level, this phenomenon was explained very well. The rare cleavage pathways of melamine, which just could be exactly identified by 15N-labeled melamines, resulted in the difference of quantitative fragment ions between 15N-labeled melamines and melamine. The interaction of ESI response between melamine and isotope-labeled melamines was investigated using MRM monitor mode. 15N-labeled melamine had significant ion inter-suppression effect on melamine, while 13C-labeled melamine had little influence on melamine. Finally, the influence of different isotope-labeled melamines on the LC-IDMS result was evaluated using the IDMS correction factor (θ). Taking the determination of melamine in milk powder as an example, the matrix effects of different isotope-labeled melamines and melamine had notable difference and the impact of this difference on the measurement results depended on the concentrations of analyte and matrix solution. It was worth noting that 15N3-melamine exhibited significant ion suppression to melamine in matrix solution. The deviation of the results from IDMS method might reach 59% using 15N3-melamine as internal standard in special matrix solution. Graphical Abstract The comparison of ESI responses of melamine, 13C3-melamine, 13C3+15N3-melamine and 15N3-melamine.

  14. Alpha linolenic acid (ALA) from Rosa canina, sacha inchi and chia oils may increase ALA accretion and its conversion into n-3 LCPUFA in diverse tissues of the rat. (United States)

    Valenzuela B, Rodrigo; Barrera R, Cynthia; González-Astorga, Marcela; Sanhueza C, Julio; Valenzuela B, Alfonso


    Alpha-linolenic acid (ALA) is an essential n-3 PUFA; its n-3 LCPUFA derivatives EPA and DHA, which have diverse beneficial effects, are scarce in the human diet. In recent years nontraditional vegetable oils rich in ALA (up to 45%) have been developed as new alternatives to increase ALA consumption. This work evaluated the accretion of ALA, EPA and DHA into the phospholipids extracted from erythrocytes, liver, kidney, small intestine, heart, quadriceps and the brain in rats fed sunflower (SFO), canola (CO), Rosa canina (RCO), sacha inchi (Plukenetia volubilis, SIO) and chia (Salvia hispánica, ChO) oils. Five experimental groups (n = 12 per group) were fed for 21 days with SFO (1% ALA), CO (10% ALA), RCO (33% ALA), SIO (49% ALA), and ChO (64% ALA). SIO and ChO allowed higher ALA accretion in all tissues, except the brain, and a reduction in the content of arachidonic acid in all tissues except the brain. EPA was increased in erythrocytes, liver, kidney, small intestine, heart and quadriceps, but not in the brain. DHA was increased in the liver, small intestine and brain tissues. Our results demonstrate that ALA, when provided in significant amounts, can be converted into n-3 LCPUFA, mostly DHA in the liver and brain. It is suggested that oils rich in ALA, such as SIO and ChO, are good sources for obtaining higher tissue levels of ALA, also allowing its selective conversion into n-3 LCPUFA in some tissues of the rat.

  15. Ionic ASi2N3 (A=Li, Na, K and Rb) stabilized by the covalent Si-N bonding: First-principles calculations (United States)

    Zhang, Huijun; Ren, Jiadong; Wu, Lailei; Zhang, Jingwu


    The structural, elastic and electronic properties of LiSi2N3 and its substitutions by Na, K and Rb were investigated through first-principles computations. The expansion of lattice parameters of ASi2N3 from Li, Na, K to Rb is found to be determined by the bond angle of Si-N1-Si, which suggests a possible way to improve the lithium ionic conductivity by substitutions. ASi2N3 (A=Li, Na, K and Rb) shows the similar elastic behaviors, while the electronic band gap gradually decreases from 5.1 to 3.4 eV from LiSi2N3 to RbSi2N3. Interestingly, the analysis of electronic structure, crystal orbital Hamiltonian populations and Bader charges shows that the covalence of Si-N bonding is critical for the stability of ASi2N3 phase. Among ASi2N3 phases, there is a relatively high ionicity in NaSi2N3; the Si-N bond strength in [Si2N3]- net for KSi2N3 and RbSi2N3 is comparable to LiSi2N3, but stronger than NaSi2N3.

  16. Quality Changes of N-3 PUFAs Enriched and Conventional Eggs under Different Home Storage Conditions with Wireless Sensor Network

    Directory of Open Access Journals (Sweden)

    Wenkang Li


    Full Text Available Omega-3 polyunsaturated fatty acids (n-3 PUFAs enriched eggs are popular for their enrichment of PUFAs, but their freshness and quality are prone to decline with time, particularly if storage conditions are not well maintained. Home storage is the last but a neglected important tach in eggs supply chain, but few studies are available on the egg storage in the home stage. This study aimed to evaluate the internal quality change of both n-3 PUFAs enriched and conventional eggs by simulating eggs stored at consumers’ home in refrigeration and under room temperature. The egg quality indices (Haugh unit, yolk index, weight, and albumen pH were adopted and analyzed for both storage conditions. Wireless sensor network (WSN was used for real-time monitoring of the temperature and humidity during storage. The results showed that temperature, humidity and time of storage all have an influence on the freshness of both n-3 PUFAs enriched and conventional eggs and there is no significant difference happened to n-3 PUFAs enriched eggs and conventional eggs. Refrigeration can decelerate the quality deterioration of both n-3 PUFAs enriched and conventional eggs and consumers should be educated about how to maintain the internal quality of eggs during home storage.

  17. Modelling of three dimensional equilibrium and stability of MAST plasmas with magnetic perturbations using VMEC and COBRA (United States)

    Ham, C. J.; Chapman, I. T.; Kirk, A.; Saarelma, S.


    It is known that magnetic perturbations can mitigate edge localized modes (ELMs) in experiments, for example, MAST [Kirk et al., Nucl. Fusion 53, 043007 (2013)]. One hypothesis is that the magnetic perturbations cause a three dimensional corrugation of the plasma and this corrugated plasma has different stability properties to peeling-ballooning modes compared to an axisymmetric plasma. It has been shown in an up-down symmetric plasma that magnetic perturbations in tokamaks will break the usual axisymmetry of the plasma causing three dimensional displacements [Chapman et al., Plasma Phys. Controlled Fusion 54, 105013 (2012)]. We produce a free boundary three-dimensional equilibrium of a lower single null MAST relevant plasma using VMEC [S. P. Hirshman and J. C. Whitson, Phys. Fluids 26, 3553 (1983)]. The safety factor and pressure profiles used for the modelling are similar to those deduced from axisymmetric analysis of experimental data with ELMs. We focus on the effect of applying n = 3 and n = 6 magnetic perturbations using the resonant magnetic perturbation (RMP) coils. A midplane displacement of over ±1 cm is seen when the full current is applied. The current in the coils is scanned and a linear relationship between coil current and midplane displacement is found. The pressure gradient in real space in different toroidal locations is shown to change when RMPs are applied. This effect should be taken into account when diagnosing plasmas with RMPs applied. The helical Pfirsch-Schlüter currents which arise as a result of the assumption of nested flux surfaces are estimated for this equilibrium. The effect of this non-axisymmetric equilibrium on infinite n ballooning stability is investigated using COBRA [Sanchez et al., J. Comput. Phys. 161, 576-588 (2000)]. The infinite n ballooning stability is analysed for two reasons; it may give an indication of the effect of non-axisymmetry on finite n peeling-ballooning modes, responsible for ELMs; and infinite n

  18. Plasma MMP1 and MMP8 expression in breast cancer: Protective role of MMP8 against lymph node metastasis

    Directory of Open Access Journals (Sweden)

    Christiaens Marie-Rose


    Full Text Available Abstract Background Elevated levels of matrix metalloproteinases have been found to associate with poor prognosis in various carcinomas. This study aimed at evaluating plasma levels of MMP1, MMP8 and MMP13 as diagnostic and prognostic markers of breast cancer. Methods A total of 208 breast cancer patients, of which 21 with inflammatory breast cancer, and 42 healthy controls were included. Plasma MMP1, MMP8 and MMP13 levels were measured using ELISA and correlated with clinicopathological characteristics. Results Median plasma MMP1 levels were higher in controls than in breast cancer patients (3.45 vs. 2.01 ng/ml, while no difference was found for MMP8 (10.74 vs. 10.49 ng/ml. ROC analysis for MMP1 revealed an AUC of 0.67, sensitivity of 80% and specificity of 24% at a cut-off value of 4.24 ng/ml. Plasma MMP13 expression could not be detected. No correlation was found between MMP1 and MMP8 levels. We found a trend of lower MMP1 levels with increasing tumour size (p = 0.07; and higher MMP8 levels with premenopausal status (p = 0.06 and NPI (p = 0.04. The median plasma MMP1 (p = 0.02 and MMP8 (p = 0.007 levels in the non-inflammatory breast cancer patients were almost twice as high as those found in the inflammatory breast cancer patients. Intriguingly, plasma MMP8 levels were positively associated with lymph node involvement but showed a negative correlation with the risk of distant metastasis. Both controls and lymph node negative patients (pN0 had lower MMP8 levels than patients with moderate lymph node involvement (pN1, pN2 (p = 0.001; and showed a trend for higher MMP8 levels compared to patients with extensive lymph node involvement (pN3 and a strong predisposition to distant metastasis (p = 0.11. Based on the hypothesis that blood and tissue protein levels are in reverse association, these results suggest that MMP8 in the tumour may have a protective effect against lymph node metastasis. Conclusion In summary, we observed differences in MMP1

  19. Quality of Higher Education

    DEFF Research Database (Denmark)

    Zou, Yihuan

    is about constructing a more inclusive understanding of quality in higher education through combining the macro, meso and micro levels, i.e. from the perspectives of national policy, higher education institutions as organizations in society, individual teaching staff and students. It covers both......Quality in higher education was not invented in recent decades – universities have always possessed mechanisms for assuring the quality of their work. The rising concern over quality is closely related to the changes in higher education and its social context. Among others, the most conspicuous...... changes are the massive expansion, diversification and increased cost in higher education, and new mechanisms of accountability initiated by the state. With these changes the traditional internally enacted academic quality-keeping has been given an important external dimension – quality assurance, which...

  20. Effect of n-3 HUFA levels in rotifers and Artemia on growth and survival of larval black sea bream ( Sparus macrocephalus) (United States)

    Liu, Jingke; Li, Kuiran; Huang, Bingxin; Chen, Xiaolin


    Requirement for dietary n-3 HUFA (n-3 highly unsaturated fatty acid) for growth and survival of black sea bream ( Sparus macrocephalus) larvae was studied using rotifers and Artemia at various levels of n-3 HUFA. Five treatments with rotifers and Artemia differing in n-3 HUFA were prepared by enriching them with various oil emulsions. Results indicated that dietary n-3 HUFA significantly influence fish n-3 HUFA levels and are essential for growth and survival of black sea bream larvae. The results also indicated that the incorporation of n-3HUFA TG (triacylglycerols) into tissues of larval black sea bream was more effective from natural fish oil in comparison with n-3 HUFA fatty acid ethyl esters from ethyl-esterified oil.