WorldWideScience

Sample records for higher basidiomycetes mushrooms

  1. ENZIME ACTIVITY OF HIGHER BASIDIOMYCETES MUSHROOM GRIFOLA FRONDOSA

    Directory of Open Access Journals (Sweden)

    А. Бухало

    2011-02-01

    Full Text Available The purpose of this work was a revelation and evaluation of spectrum and activity of hydrolytic enzymes of higher basidiomycetes  Grifola frondosa in a surface and submerged culture. 8 strains of  Gf. frondosa,  mushrooms from culture collection of mushrooms at the M.G. Kholodny Institute of  Вotany National  Academy of Sciences of the Ukraine were object of investigation. Researches were conducted by standard microbiological, biochemical and biotechnological methods. All strains  on agar mediums were shown the  following enzymes: amylase, caseinase, polygalacturonase, pectattranselyminase, glucosidase, urease,  xylanase, lipase  and endoglucanase. The demonstration of oxidizing enzymes of laccase and tyrosinase  depended on a culture and did not depend on composition of medium. The estimation of presence and level of activity of hydrolytic enzymes at submerged cultivation indicate primary influence of components of complex nourishing medium on enzyme activity of Gr. frondosa. Strains biochemical features show up in the case of  oxidizing enzymes on agar mediums and for endo-1,4-β-glucanase on liquid mediums with glucose and molasses.

  2. Wound healing activity of an aqueous extract of the Lingzhi or Reishi medicinal mushroom Ganoderma lucidum (higher Basidiomycetes).

    Science.gov (United States)

    Gupta, Asheesh; Kirar, Vandana; Keshri, Gaurav Kr; Gola, Shefali; Yadav, Anju; Negi, Prem Singh; Misra, Kshipra

    2014-01-01

    The Lingzhi or Reishi medicinal mushroom Ganoderma lucidum (higher Basidiomycetes) is popular because of its health-promoting properties. The effects of G. lucidum extract on cancer, hypertension, hypercholesterolemia, and hepatitis have been reported by many researchers. This investigation was undertaken to evaluate the healing efficacy of an aqueous lyophilized extract of G. lucidum from the Indian Himalayan region on dermal excision wound in experimental rats. The extract used in the study was found to be rich in total polyphenol and flavonoid contents. The healing efficacy was comparatively assessed with a reference povidone-iodine ointment. The G. lucidum extract showed significant enhanced healing activity, evidenced by an increase in wound contraction, collagen accumulation (hydroxyproline), hexosamine, and total protein contents. Histopathological findings further supported the biochemical indices. The results suggest that aqueous lyophilized extract of G. lucidum possesses significant wound-healing activity.

  3. Shiitake Medicinal Mushroom, Lentinus edodes (Higher Basidiomycetes) Productivity and Lignocellulolytic Enzyme Profiles during Wheat Straw and Tree Leaf Bioconversion.

    Science.gov (United States)

    Elisashvili, Vladimir; Kachlishvili, Eva; Asatiani, Mikheil D

    2015-01-01

    Two commercial strains of Lentinus edodes have been comparatively evaluated for their productivity and lignocellulolytic enzyme profiles in mushroom cultivation using wheat straw or tree leaves as the growth substrates. Both substrates are profitable for recycling into shiitake fruit bodies. L. edodes 3715 gave the lowest yield of mushroom during tree leaves bioconversion with the biological efficiency (BE) 74.8% while the L. edodes 3721 BE achieved 83.4%. Cultivation of shiitake on wheat straw, especially in the presence of additional nitrogen source, increased the L. edodes 3721 BE to 92-95.3% owing to the high hydrolases activity and favorable conditions. Despite the quantitative variations, each strain of L. edodes had a similar pattern for secreting enzymes into the wheat straw and tree leaves. The mushrooms laccase and MnP activities were high during substrate colonization and declined rapidly during primordia appearance and fruit body development. While oxidase activity decreased, during the same period cellulases and xylanase activity raised sharply. Both cellulase and xylanase activity peaked at the mature fruit body stage. When mushrooms again shifted to the vegetative growth, oxidase activity gradually increased, whereas the hydrolases activity dropped rapidly. The MnP, CMCase, and FP activities of L. edodes 3721 during cultivation on wheat straw were higher than those during mushroom growth on tree leaves whereas the laccase activity was rather higher in fermentation of tree leaves. Enrichment of wheat straw with an additional nitrogen source rather favored to laccase, MnP, and FPA secretion during the vegetative stage of the L. edodes 3721 growth.

  4. Effect of light and atmosphere on the cultivation of the golden oyster culinary-medicinal mushroom, Pleurotus citrinopileatus (higher Basidiomycetes).

    Science.gov (United States)

    Hu, Shu-Hui; Wu, Chiu-Yeh; Chen, Yu-Kuei; Wang, Jinn-Chyi; Chang, Sue-Joan

    2013-01-01

    With an aim to explore the productivity and quality of the fruiting body of culinary-medicinal golden oyster mushroom Pleurotus citrinopileatus, the carbon dioxide (CO₂) concentration of the ambient atmosphere was adjusted and a light-emitting diode panel was used to illuminate the colonized mycelium at different wavelengths. Biological efficiency and yield were higher at CO₂ levels of 0.05 and 0.1% than other tested CO₂ levels, and the mature fruiting body showed the highest yellow value at a CO₂ level of 0.1% (of all tested CO₂ levels). The highest biological efficiency and yield was obtained at the 720-nm wavelength. The ergosterol content of the pileus of the fruiting body was higher than that of the stipe in any flush time at a 720-nm wavelength of light and a CO₂ concentration of 0.1%. The decreased percentages of cellulose and lignin at the appearance of primordia were larger than those of mycelial growth duration. The fruiting quality of P. citrinopileatus might thus be enhanced by 720-nm illumination and an atmosphere with a CO₂ concentration of 0.1 to 0.15%.

  5. Submerged Cultivation of Mycelium with High Ergothioneine Content from the Culinary-Medicinal Golden Oyster Mushroom, Pleurotus citrinopileatus (Higher Basidiomycetes).

    Science.gov (United States)

    Lin, Shin-Yi; Chien, Shih-Chang; Wang, Sheng-Yang; Mau, Jeng-Leun

    2015-01-01

    The optimization of submerged culture of the culinary-medicinal golden oyster mushroom, Pleurotus citrinopileatus, was studied using a one-factor-at-a-time, two-stage stimulation and central composite rotatable design to produce mycelia with high ergothioneine content. The optimal culture conditions for mycelia harvested at day 22 were a temperature of 25°C, an inoculation ratio of 5%, 2% glucose, 0.5% yeast extract, and adjustment of the initial pH value to 10. The biomass and ergothioneine content were 8.28 g/L and 10.65 mg/g dry weight (dw), respectively. The addition of an amino acid precursor increased the ergothioneine content of mycelia; cysteine was the most effective. In addition, the results obtained from central composite rotatable design showed that the recommended combination for cysteine, histidine, and methionine was 8, 4, and 0.5 mmol/L, respectively. The predicted ergothioneine content was 13.90 mg/g dw, whereas the experimental maximal ergothioneine content was 14.57 mg/g dw. With the addition of complex precursors and under optimal culture conditions, mycelia harvested at days 16-20 had higher ergothioneine content. Accordingly, the information obtained could be used to produce mycelia with high ergothioneine content.

  6. Development of crossbreeding high-yield-potential strains for commercial cultivation in the medicinal mushroom Wolfiporia cocos (Higher Basidiomycetes).

    Science.gov (United States)

    Xiang, Xiaozhao; Wang, Xiaoxia; Bian, Yinbing; Xu, Zhangyi

    2016-07-01

    Wolfiporia cocos is a well-known medicinal mushroom, and its dried sclerotia has been widely used as a traditional medicine in China, Japan, and other Asian countries for centuries. However, long-term asexual reproduction of the breeding system in W. cocos results in a current universal degeneration of cultivated strains. To develop a W. cocos breeding program that will benefit commercial cultivation, we previously developed an optimum method for indoor induction of W. cocos fruiting bodies and clarified the nature of preponderant binuclear sexual basidiospores. In this paper, we first show that the majority of W. cocos single-spore isolates cannot form sclerotium in field cultivation. We then investigated the possibility of breeding new strains by crossbreeding. Three types of mating reactions were observed in both intra-strain pairings and inter-strain pairings, and a total of fifty-five hybrids were selected by antagonistic testing and allele-specific polymerase chain reaction (PCR). Field cultivation of hybrids demonstrated that some hybrids can form sclerotium via two cultivated methods. Two new high-yield strains were identified. This report will stimulate new thinking on W. cocos and promote further extensive studies on crossbreeding in W. cocos, a new topic related to the development of more efficient protocols for the discrimination of hybrids in W. cocos.

  7. Extraction, Antimicrobial, and Antioxidant Activities of Crude Polysaccharides from the Wood Ear Medicinal Mushroom Auricularia auricula-judae (Higher Basidiomycetes).

    Science.gov (United States)

    Cai, Ming; Lin, Yang; Luo, Yin-long; Liang, Han-hua; Sun, Pei-long

    2015-01-01

    In this study, crude polysaccharides of culinary-medicinal mushroom Auricularia auricular-judae were extracted by hot water extraction and alcohol precipitation, and their antimicrobial and antioxidant activities were investigated. An optimum extraction condition was obtained at a ratio of liquid to solid 70 mL/g, temperature 90°C, time 4 h and extraction number 4. Accordingly, the best yield of crude polysaccharides was 6.89% with 76.12% in purity. Some bacteria and fungi were used for antimicrobial studies. It was found that crude A. auricula-judae had great antimicrobial activities against Escherichia coli and Staphylococcus aureus, but no activities on the others. The inhibitory diameters of antimicrobial zones for the two were 5.55 ± 0.182 and 9.84 ± 0.076 mm, respectively. Moreover, crude A. auricula-judae had significant antioxidant activities in scavenging free radicals, reducing power assays, and Fe2+ chelating ability assay. Results revealed that crude A. auricula-judae has a great potential as antimicrobial and antioxidant, and it can be a supplementary food for human health.

  8. Hypocholesterolemic Effects of the Cauliflower Culinary-Medicinal Mushroom, Sparassis crispa (Higher Basidiomycetes), in Diet-Induced Hypercholesterolemic Rats.

    Science.gov (United States)

    Hong, Ki Bae; Hong, Sung-Yong; Joung, Eun Young; Kim, Byung Hee; Bae, Song-Hwan; Park, Yooheon; Suh, Hyung Joo

    2015-01-01

    The cauliflower culinary-medicinal mushroom, Sparassis crispa, possesses various biological activities that have been widely reported to have therapeutic applications. We examined the effects of S. crispa on serum cholesterol, hepatic enzymes related to cholesterol metabolism, and fecal sterol excretion in rats fed a cholesterol-rich diet for 4 weeks. Male Sprague-Dawley rats (8 weeks old) were randomly divided into 5 groups (n = 6 mice per group): normal diet (normal control [NC]), cholesterol-rich diet (cholesterol control [CC]), cholesterol-rich diet plus S. crispa fruiting body (SC), cholesterol-rich diet plus S. crispa extract (SCE), and cholesterol-rich diet plus S. crispa residue (SCR). SCE supplementation significantly enhanced hepatic cholesterol catabolism through the upregulation of cholesterol 7α-hydroxylase (CYP7A1) messenger RNA (mRNA) expression (2.55-fold compared with that in the NC group; P < 0.05) and the downregulation of 3-hydroxy-3-methylglutaryl coenzyme A (HMG-CoA) reductase mRNA expression (0.57-fold compared with that in the NC group; P < 0.05). Additionally, the SCE diet resulted in the highest fecal excretion of cholesterol and bile acid in hypercholesterolemic rats. In conclusion, mRNA expression of CYP7A1 and HMG-CoA reductase were significantly modulated by the absorption of SCE samples. Also, SCE samples had a significant effect on fecal bile acid and cholesterol excretion. These results suggest that SCE samples can induce hypocholesterolic effects through cholesterol metabolism and the reduction of circulating cholesterol levels.

  9. Notes on a New Productive Strain of King Oyster Mushroom, Pleurotus eryngii (Higher Basidiomycetes), a Prized Italian Culinary-Medicinal Mushroom.

    Science.gov (United States)

    Venturella, Giuseppe; Palazzolo, Eristanna; Saiano, Filippo; Gargano, Maria Letizia

    2015-01-01

    In this paper, the authors provide data on a culinary-medicinal, host-specific variety of P. eryngii species-complex that is known in Italy as "cardoncello". A species description, the techniques of isolation of a new strain (C-142-c), and the preparation of the substratum are illustrated. Data on the productivity of substratum inoculated with C-142-c strain and the nutritional value of cultivated "cardoncello" mushrooms are also provided.

  10. Antioxidant Potential of Lingzhi or Reishi Medicinal Mushroom, Ganoderma lucidum (Higher Basidiomycetes) Cultivated on Artocarpus heterophyllus Sawdust Substrate in India.

    Science.gov (United States)

    Rani, P; Lal, Merlin Rajesh; Maheshwari, Uma; Krishnan, Sreeram

    2015-01-01

    The artificial cultivation of Ganoderma lucidum (MTCC1039) using Artocarpus heterophyllus as sawdust substrate was optimized and free radical scavenging activities of the generated fruiting bodies were investigated. The choice of A. heterophyllus as substrate was due to its easy availability in South India. Sawdust supplemented with dextrose medium yielded better spawn hyphae and early fruiting body initiation (15 days). The biological yield obtained was 42.06 ± 2.14 g/packet and the biological efficiency was 8.41 ± 0.48%. Both aqueous and methanolic extracts of fruiting body were analyzed for radical scavenging activity. Methanolic extract showed maximum scavenging activity for 1,1-diphenyl-2-picrylhydrazyl (IC50 = 290 μg/ml) and 2,2'-azino-bis(3-ethylbenzothiazoline- 6-sulphonic acid (IC50 = 580 μg/ml), whereas aqueous extract had better scavenging for ferric reducing antioxidant power (IC50 = 5 μg/ml). Total phenolic content and total antioxidant capacity were significantly higher in methanolic extract (p < 0.01). A positive correlation existed between the phenolic content and antioxidant activity. Our results indicated that fruiting bodies of G. lucidum cultivated in sawdust medium possess antioxidant property, which can be exploited for therapeutic application.

  11. Antitumor and Immunomodulating Activities of Exopolysaccharide Produced by Big Cup Culinary- Medicinal Mushroom Clitocybe maxima (Higher Basidiomycetes) in Liquid Submerged Culture.

    Science.gov (United States)

    Hu, Shu-Hui; Cheung, Peter Chi Keung; Hung, Raw-Pou; Chen, Yu-Kuei; Wang, Jinn-Chyi; Chang, Sue-Joan

    2015-01-01

    Water-soluble polysaccharides extracted from mushrooms have been found to have some physiological effects. In this study, exopolysaccharides (EPSs) were extracted by alcohol precipitation from cultivated broth of the mushroom Clitocybe maxima. EPSs with molecular weights of 10(4) and 10(5) Da were obtained by ultrafiltration; they are referred to as EPA and EPB, respectively. The major components of these EPSs were glucose, galactose, mannose, rhamnose, and arabinose. ICR mice with artificially induced metastatic pulmonary tumors were fed a daily diet containing EPA or EPB at doses of 8, 20, or 50 mg/kg. Results showed that the proliferation of pulmonary sarcoma lesions was lower in the groups fed EPS. In addition, the numbers of total T cells, CD4+ cells, CD8+ cells, and macrophages significantly increased in EPS-fed mice compared with the negative control group. The antitumor and immunomodulating effects observed in the EPB-fed groups were higher than those of EPA-fed groups. These results demonstrate the ability of EPSs of C. maxima to inhibit tumor cells while enhancing immune response.

  12. Chemical Compositions and Macrophage Activation of Polysaccharides from Leon's Mane Culinary-Medicinal Mushroom Hericium erinaceus (Higher Basidiomycetes) in Different Maturation Stages.

    Science.gov (United States)

    Li, Qiao-Zhen; Wu, Di; Chen, Xia; Zhou, Shuai; Liu, Yanfang; Yang, Yan; Cui, Fengjie

    2015-01-01

    We studied the effect of the maturation stage on the chemical compositions and macrophage activation activity of polysaccharides from the culinary-medicinal mushroom Hericium erinaceus. Results showed that total polysaccharides increased, whereas protein content decreased with the maturation stage development of fruiting body. Nine polysaccharide fractions, 3 from each of the maturity stages IV (small fungal spine stage), V (mid-fungal spine stage) and VI (mature), were prepared using the gradient ethanol precipitation method. The polysaccharide fraction HP4A isolated from the maturating-stage (stage IV) fruiting body had a significant difference from the fractions HP5A (stage V) and HP6A (stage VI) in the molecular weight distribution and monosaccharide compositions. Immunostimulating tests revealed that the polysaccharide fraction HP6 isolated from the mature stage (stage VI) fruiting body presented higher macrophage activation activity. Our findings provided important information for the harvest and use of H. erinaceus with higher qualities and functional benefits.

  13. Immunomodulating and Antiprotozoal Effects of Different Extracts of the Oyster Culinary-Medicinal Mushroom Pleurotus ostreatus (Higher Basidiomycetes) Against Coccidiosis in Broiler.

    Science.gov (United States)

    Ullah, Muhammad Irfan; Akhtar, Masood; Iqbal, Zafar; Shahid, Muhammad; Awais, Mian Muhammad

    2015-01-01

    The culinary-medicinal oyster mushroom Pleurotus ostreatus, procured from local sources, was processed for hot water and methanolic extraction. Extracts obtained were subjected to proximate analysis to determine the amount of crude protein, crude fiber, ash, ether, and nitrogen-free extracts. These extracts were evaluated for immunomodulating and antiprotozoal effects against coccidiosis in a broiler. Cellular immune investigation revealed significantly higher (P 0.05) findings were observed in investigations of lymphoid organs. Antiprotozoal studies revealed a significantly higher (P < 0.05) percentage of protection against coccidiosis in groups administered P. ostreatus extracts when compared with controls. Moreover, lesion scoring and oocysts per gram of droppings observed in the control group were significantly higher (P < 0.05) compared with those in groups administered hot water and methanolic extracts of P. ostreatus. Results concluded that hot water and methanolic extracts of P. ostreatus had strong immune-enhancing activities. Further, these extracts also had excellent antiprotozoal activities against coccidiosis in a broiler.

  14. Submerged cultivation of mycelium with high ergothioneine content from the culinary-medicinal king oyster mushroom Pleurotus eryngii (higher Basidiomycetes) and its composition.

    Science.gov (United States)

    Liang, Chih-Hung; Huang, Ling-Yi; Ho, Kung-Jui; Lin, Shin-Yi; Mau, Jeng-Leun

    2013-01-01

    The culinary-medicinal king oyster mushroom, Pleurotus eryngii, was used to produce mycelia with high ergothioneine content using a one-factor-at-a-time method. The optimal culture conditions for mycelia harvested at day 14 were 25°C, 10% inoculation rate, 2% glucose, 0.5% yeast extract, and no adjustment to the initial pH value. With histidine or amino acid mix added, biomasses and the ergothioneine content of mycelia were higher than those of the control. The ergothioneine content of mycelia harvested at days 16-20 were higher than that of mycelia harvested at day 14. In addition, the ergothioneine content of mycelia from the fermentor (5.84-5.76 mg/g) was much higher than that of mycelia from the shaken flask (4.93-5.04 mg/g). Mycelia with high ergothioneine content showed a profile of proximate composition similar to that of regular mycelia but lost its characteristic umami taste. Overall, mycelia high in ergothioneine could be prepared by optimal culture conditions, the addition of precursors, prolonged harvest, and aeration in the fermentor.

  15. The Effects of Light Intensity, Casing Layers, and Layering Styles on Royal Sun Medicinal Mushroom, Agaricus brasiliensis (Higher Basidiomycetes) Cultivation in Turkey.

    Science.gov (United States)

    Adanacioglu, Neşe; Boztok, Kaya; Akdeniz, Ramazan Cengiz

    2015-01-01

    The aim of this research is to evaluate the effects of light intensity, casing layers, and layering styles on the production of the culinary-medicinal mushroom Agaricus brasiliensis in Turkey. The experiments were designed in split-split plots and replicated twice. Three different light intensities-I1, 350 lux; I2, 450 lux; and I3, 750 lux-were used in main plots as environmental factors. A mixture of 4 different casing layers- peat (100%), peat-perlite (75%:25%), peat-clinoptilolite (75%:25%), and peat-perlite-clinoptilolite (60%:20%:20%)-were used at split plots and at split plots. S1, a flat, 3-cm casing layer; S2, a flat, 5-cm casing layer; and S3, casing soil ridges 10 cm wide × 4 cm high, 10 cm apart, were deposited on top of 1-cm overall soil casing layers. At the end of the harvest phase, the total yield was estimated per 100 kg of substrate. Biological efficiency (percentage) was determined from the fresh weight of the mushrooms and the dry weight of the compost at the end of the harvesting period. The highest total yield (7.2 kg/100 kg compost) and biological efficiency (27.63%) were achieved from I2 × peat-perlite-clinoptilolite × S2 treatment. Influence of light intensity, casing layer, layering style, and their interaction in treatments with color values (L*, a*, b*, chroma*, and hue*) also were examined. It has been shown that within color values, chroma* (saturation) values of mushroom caps were affected by light intensity, casing layer, and layering style treatments and light intensity × casing layer treatments and the brightness of mushroom caps tended to increase as light intensity increased.

  16. Production of biomass and polysaccharides of Lingzhi or Reishi medicinal mushroom, Ganoderma lucidum (W.Curt. :Fr.) P. Karst. (higher Basidiomycetes), by submerged cultivation.

    Science.gov (United States)

    Habijanic, Jozica; Berovic, Marin; Boh, Bojana; Wraber, Branka; Petravic-Tominac, Vlatka

    2013-01-01

    Submerged batch and repeated fed-batch cultivation techniques were used for mycelia cultivation and polysaccharide production of the Lingzhi or Reishi medicinal mushroom Ganoderma lucidum. Although most publications use various Asiatic G. lucidum strains, the growth of the strain Ga.l 4 (Biotechnical Faculty Strain Collection, Ljubljana, Slovenia), originally isolated from the Slovenian forest, is much faster. The results between the batch and repeated fed-batch cultivation are compared with the polysaccharide production in batch cultivation. From the aspect of biomass production, the best results were obtained in repeated fed-batch after 44 days, where 12.4 g/L of dry fungal biomass was obtained.

  17. Hypoglycemic and Hypolipidemic Effects of the Cracked-Cap Medicinal Mushroom Phellinus rimosus (Higher Basidiomycetes) in Streptozotocin-Induced Diabetic Rats.

    Science.gov (United States)

    Rony, Kuttikkadan A; Ajith, Thekkuttuparambil A; Janardhanan, Kainoor K

    2015-01-01

    Phellinus rimosus is a parasitic host specific polypore mushroom with profound antioxidant, antihepatotoxic, anti-inflammatory, antitumor, and antimutagenic activities. This study investigated the hypoglycemic and hypolipidemic activities of the wood-inhabiting polypore mushroom Ph. Rimosus in streptozotocin (STZ)-induced diabetic rats. Diabetes was induced by single intraperitoneal injection of STZ (45 mg/kg) to Wistar rats. The effects of 30 days treatment with Ph. Rimosus (50 and 250 mg/ kg) and glibenclamide (0.65 mg/kg) on blood glucose level, serum insulin, serum lipid profile, liver glycogen, liver function enzymes, and non-enzymic and enzymic antioxidants activities in pancreas, liver, and kidney were evaluated in STZ-induced diabetic rats. Oral administration of Ph. Rimosus extract exhibited a significant reduction in blood glucose, triacylglycerol, total cholesterol, LDL-cholesterol, and liver function enzymes, and increased serum insulin, liver glycogen, and HDL-cholesterol levels in STZ-induced diabetic rats. Furthermore, Ph. Rimosus treatment increased antioxidant status in pancreas, liver, and kidney tissues with concomitant decreases in levels of thiobarbituric acid- reactive substances. Results of this study indicated that Ph. Rimosus possessed significant hypoglycemic and hypolipidemic activities and this effect may be related to its insulinogenic and antioxidant effect.

  18. Optimization of cultivation conditions of fermented shaggy ink cap culinary-medicinal mushroom, Coprinus comatus (O.Mull.:Fr.) Pers. (higher Basidiomycetes) rich in Vanadium.

    Science.gov (United States)

    Zhang, Chunjing; Qi, Xiaodan; Shi, Yan; Sun, Yan; Li, Shuyan; Gao, Xiulan; Yu, Haitao

    2012-01-01

    The present paper is mainly aimed at optimization of cultivation conditions of fermented mushrooms of Coprinus comatus rich in vanadium (CCRV). Initial screening of effects of carbon source, temperature, pH, and inoculum size were done by using a one-factor-at-a-time method. The results obtained in that study showed that the optimal medium composition was 30 g glucose/Lin YEPG medium, initial pH 6.0, inoculum volume 10%, and incubation time 120 h. Then the medium was subjected to screening of the most significant parameters using the L9 orthogonal array to solve multivariable equations simultaneously. The results obtained in this study showed that the optimal medium composition was 0.4% V and 30 g glucose/Lin YEPG medium, initial pH 5.0, inoculum volume 15%, and incubation time 120 h. At this medium composition, the mycelial biomass and V content were 7.18 ± 0.24 g/L and 3786.0 ± 17 μg/g, respectively. The anti-diabetic potential of CCRV produced with the optimal level was tested in alloxan-induced diabetes. After the mice were administered (i.g.) with CCRV, the level of blood sugar in the CCRV group was very close to that of the control group. These findings suggested that CCRV produced with the optimal level is useful in the control of diabetes mellitus.

  19. Antimicrobial Activity of Extracts of the Oyster Culinary Medicinal Mushroom Pleurotus ostreatus (Higher Basidiomycetes) and Identification of a New Antimicrobial Compound.

    Science.gov (United States)

    Younis, Ahmed M; Wu, Fang-Sheng; El Shikh, Hussien H

    2015-01-01

    Pleurotus ostreatus is an edible mushroom that also has high medicinal values. In this study, P. ostreatus was tested for its ability to inhibit the growth of fungi and bacteria. The freeze-dried fruiting body, broth from submerged culture, and mycelial biomass of P. ostreatus were extracted using alcohols and water as solvents. The extracts were then tested for their antimicrobial activity against the growth of fungi and bacteria. It was observed that the water extract from fruiting bodies had the strongest effect in inhibiting the growth of most fungi. The most sensitive test microfungi to the inhibition were Candida albicans, Cryptococcus humicola, and Trichosporon cutaneum, and the most sensitive test bacteria were Staphylococcus aureus followed by Escherichia coli. Water extracts from culture broth or mycelial biomass were moderately inhibitive to the growth of fungi and bacteria. The alcohol-based solvents from all samples had much less antimicrobial activity against most test microorganisms. An antimicrobial compound was purified from the water extracts of fruiting bodies with Sephadex G 100 column chromatography and characterized by infrared absorption spectrum (IR), nuclear magnetic resonance (NMR), and mass spectroscopic analysis. We have identified this compound to be 3-(2-aminopheny1thio)-3-hydroxypropanoic acid. This purified compound had a minimum inhibitory concentration of 30 µg/mL and 20 µg/mL against the growth of fungi and bacteria, respectively.

  20. The influence of the hot water extract from shiitake medicinal mushroom, Lentinus edodes (higher Basidiomycetes) on the food intake, life span, and age-related locomotor activity of Drosophila melanogaster.

    Science.gov (United States)

    Matjuskova, Natalya; Azena, Elena; Serstnova, Ksenija; Muiznieks, Indrikis

    2014-01-01

    Shiitake medicinal mushroom, Lentinus edodes, is among the most widely cultivated edible mushrooms in the world and is a well-studied source of nutrients and biologically active compounds. We have studied the influence of the dietary supplement of the polysaccharides containing a hot water extract of the mushroom L. edodes on the fruit fly Drosophila melanogaster in terms of food intake, body weight, life span, and age-related locomotor activity. L. edodes extract, when added to the D. melanogaster feeding substrate at a 0.003-0.030% concentration (calculated for the dry weight of the polysaccharide fraction) did not influence food intake or body weight of the flies. It increased the life span and locomotor activities of male flies but was associated with early mortality and decreased locomotor activity of female flies. We conclude that the observed anti-aging effects of L. edodes extracts in the male D. melanogaster are not the result of dietary restriction. We propose that D. melanogaster is a suitable model organism for researching the molecular basis of the anti-aging effect of the shiitake mushroom extracts and sex linkage of these effects.

  1. Lion's Mane, Hericium erinaceus and Tiger Milk, Lignosus rhinocerotis (Higher Basidiomycetes) Medicinal Mushrooms Stimulate Neurite Outgrowth in Dissociated Cells of Brain, Spinal Cord, and Retina: An In Vitro Study.

    Science.gov (United States)

    Samberkar, Snehlata; Gandhi, Sivasangkary; Naidu, Murali; Wong, Kah-Hui; Raman, Jegadeesh; Sabaratnam, Vikineswary

    2015-01-01

    Neurodegenerative disease is defined as a deterioration of the nervous system in the intellectual and cognitive capabilities. Statistics show that more than 80-90 million individuals age 65 and above in 2050 may be affected by neurodegenerative conditions like Alzheimer's and Parkinson's disease. Studies have shown that out of 2000 different types of edible and/or medicinal mushrooms, only a few countable mushrooms have been selected until now for neurohealth activity. Hericium erinaceus is one of the well-established medicinal mushrooms for neuronal health. It has been documented for its regenerative capability in peripheral nerve. Another mushroom used as traditional medicine is Lignosus rhinocerotis, which has been used for various illnesses. It has been documented for its neurite outgrowth potential in PC12 cells. Based on the regenerative capabilities of both the mushrooms, priority was given to select them for our study. The aim of this study was to investigate the potential of H. erinaceus and L. rhinocerotis to stimulate neurite outgrowth in dissociated cells of brain, spinal cord, and retina from chick embryo when compared to brain derived neurotrophic factor (BDNF). Neurite outgrowth activity was confirmed by the immu-nofluorescence method in all tissue samples. Treatment with different concentrations of extracts resulted in neuronal differentiation and neuronal elongation. H. erinaceus extract at 50 µg/mL triggered neurite outgrowth at 20.47%, 22.47%, and 21.70% in brain, spinal cord, and retinal cells. L. rhinocerotis sclerotium extract at 50 µg/mL induced maximum neurite outgrowth of 20.77% and 24.73% in brain and spinal cord, whereas 20.77% of neurite outgrowth was observed in retinal cells at 25 µg/mL, respectively.

  2. The protective effects of aqueous extracts of wild-growing and fermented Royal Sun mushroom, Agaricus brasiliensis S. Wasser et al. (higher basidiomycetes), in CCl4-induced oxidative damage in rats.

    Science.gov (United States)

    Zhang, Chunjing; Han, Chunchao; Zhao, Baosheng; Yu, Haitao

    2012-01-01

    Culinary-medicinal Royal Sun mushroom, Agaricus brasiliensis (AbS), has traditionally been used for the prevention of a range of diseases, including cancer, hepatitis, atherosclerosis, hypercholesterolemia, diabetes, and dermatitis. The hepatoprotective effect of the fermented mushroom of A. brasiliensis (FMAE) and wild-growing A. brasiliensis (WMAE) were studied in this paper. An in vivo study of carbon tetrachloride (CCl4)-induced antioxidant activity in 2-month-old rats was conducted by examining the levels of activities of alanine aminotransaminase (ALT) and aspartate aminotransaminase (AST) and the antioxidant enzymes, including glutathione peroxidase (GSHPx) and catalase (CAT). Rats were divided into four groups, each containing six rats. The first group served as a control group. The second group was the CCl4 group. Group I and group II were treated orally with distilled water for 14 days respectively. Group III and Group IV were treated orally by WMAE and FMAE at oral doses of 50 mg/kg-day, respectively. Both WMAE and FMAE could reduce CCl4-induced toxicity, particularly hepatotoxicity, by suppressing ALT and AST activities, and increasing antioxidant enzyme activity. The studies demonstrate that both the fermented and wild-growing A. brasiliensis could protect the liver against CCl4-induced oxidative damage in rats.

  3. Effect of L-Cysteine Pretreatment on the Control of Formaldehyde and Browning of the Culinary-Medicinal Shiitake Mushroom, Lentinus edodes (Higher Basidiomycetes) during Drying and Canning Processes.

    Science.gov (United States)

    Li, Guijie; Wang, Qiang; Sun, Peng; Chen, Feng; Chen, Xiaolin; Wang, Cun; Zhao, Xin

    2015-01-01

    Fresh culinary-medicinal Shiitake mushrooms (Lentinus edodes) were pretreated by soaking in 0.1 mg/mL of L-cysteine solution for 1 hour; then the variation in formaldehyde content and browning degree were studied during hot air-drying and canning processes. The results indicated that L-cysteine pretreatment significantly inhibited the increase of formaldehyde content and browning during the drying process; these increases in the pretreatment groups ranged from 7.0% to 14.0% and 65.4% to 68.9%, respectively, of that of the control groups. While the L-cysteine pretreatment did not seem to have a significant effect on controlling the formaldehyde content during the canning process, the increase of the browning degree of the canned products of the pretreatment groups ranged from 64.8% to 78.5% of that of the control groups, indicating the inhibitive effect of L-cysteine on browning during the canning process of L. edodes. Overall, L-cysteine pretreatment improved the sensory quality of both dried and canned L. edodes.

  4. Alternative substrates for higher mushrooms mycelia cultivation

    Directory of Open Access Journals (Sweden)

    TETIANA KRUPODOROVA

    2015-12-01

    Full Text Available Cultivation of 29 species of higher mushroom mycelia on alternative substrates – wastes of Ukrainian oil-fat industry, has been investigated. The amount of mushroom mycelia obtaining on 12 investigated substrates varied significantly, from 1.0 g/L to 22.9 g/L on the 14th day of cultivation. The superficial cultivation adopted in this study allows for easy to choose appropriate medium (substrate for mycelia production. Alternative substrates (compared to glucose-peptone-yeast medium were selected for all studied species, from soybean cake – most suitable for the mycelial growth of 24 species, to walnut cake − suitable only for 2 species. The utilization of substrates has been evaluated by biological efficiency. The best index of biological efficiency varied from 19.0% to 41.6% depending on the mushroom species. It was established high biological efficiency of mycelia cultivation on substrates: wheat seed cake – Pleurotus djamor, Lyophyllum shimeji, Crinipellis schevczenkovi, Phellinus igniarius, Spongipellis litschaueri; oat seed cake – Ganoderma applanatum and G. lucidum; soybean cake – Hohenbuehelia myxotricha, Trametes versicolor, Morchella esculenta, Cordyceps sinensis, C. militaris, and Agrocybe aegerita; rape seed cake – Auriporia aurea; camelina seed cake – Fomes fomentarius. The cultivation of these species are perspective as a biotechnological process of agricultural wastes converted into mycelia, which could be used in different forms of products with therapeutic action: powder or tablets nutraceuticals or ingredients for functional foods.

  5. Biological potential of extracts of the wild edible Basidiomycete mushroom Grifola frondosa

    NARCIS (Netherlands)

    Klaus, A.; Kozarski, M.; Vunduk, N.; Todorovic, N.; Jakovlejevic, D.; Zizak, Z.; Pavlovic, V.; Levic, S.; Niksic, M.; Griensven, van L.J.L.D.

    2015-01-01

    Partially purified polysaccharides (FP) and hot alkali extract (FNa) obtained from fruiting bodies of the wild basidiomycete Grifola frondosa were examined for their antimicrobial, antioxidant and cytotoxic activity. The structural properties of FP and FNa samples were investigated by FT-IR and high

  6. Cytotoxic activity of methanol extracts from Basidiomycete mushrooms on murine cancer cell lines.

    Science.gov (United States)

    Tomasi, S; Lohézic-Le Dévéhat, F; Sauleau, P; Bézivin, C; Boustie, J

    2004-04-01

    Crude methanol extracts of 58 mushroom species were screened for their cytotoxic activities against two murine cancer cell lines, L1210 and 3LL, using the tetrazolium assay. A majority of extracts (74%) exhibited IC50 > 100 microg/ml against both cell lines. A most marked activity against one of the cell lines was noted for nine species (14% of the tested species). While Amanitales and Russulales tested were not found active, Polyporales and Boletales gave better results. Four species exhibited a significant cytotoxic activity (IC50 Suillus granulatus, S. luteus). The last one had never been investigated for its cytotoxic compounds before.

  7. Cytotoxic grifolin derivatives isolated from the wild mushroom Boletus pseudocalopus (Basidiomycetes).

    Science.gov (United States)

    Song, Junsik; Manir, Md Maniruzzaman; Moon, Surk-Sik

    2009-09-01

    Activity-guided purification of a MeOH extract of the Korean wild mushroom Boletus pseudocalopus afforded three new grifolin derivatives, 1-3, along with four known phenolic compounds 4-7. Their structures were established by a combination of 1H- and 13C-NMR, NOESY, and extensive two-dimensional NMR spectroscopic experiments such as gCOSY, gHSQC, gHMBC, and ROESY. The major metabolites 4 and 5 were subjected to reduction to provide the side chain-reduced compounds 8 and 9 for biological testing. All of the compounds except compound 6 showed anticancer activities in the range of IC(50) 3.5-11.0 microg/ml against human lung carcinoma A549 and mouse melanoma B16F1 cell lines. In addition, all compounds showed moderate radical-scavenging activities determined by DPPH assay.

  8. Taxonomic Identity, Geographic Distribution, and Commercial Exploitation of the Culinary-Medicinal Mushroom Pleurotus nebrodensis (Basidiomycetes).

    Science.gov (United States)

    Venturella, Giuseppe; Zervakis, Georgios I; Polemis, Elias; Gargano, Maria Letizia

    2016-01-01

    An updated overview of the outcome of studies conducted on the culinary-medicinal mushroom Pleurotus nebrodensis is presented by placing emphasis on the clarification of the taxonomic identity of P. nebrodensis and other related taxa possessing entirely white to cream basidiomes, which grow in association with different plants of the family Apiaceae. Cultivation techniques, quality of the product sold and sales price, as well as nutritional and medicinal aspects are discussed. Taking also into consideration the high economic importance of P. nebrodensis, it is essential to proceed with the verification of the commercial strains currently available in the international market under the name of "P. nebrodensis" since it is very probable that many (or most) of them do not represent the real P. nebrodensis. TO confirm this hypothesis, an in silico analysis was conducted on a large of number of ITS1-5.8S-ITS2 rRNA sequences deposited in the National Center for Biotechnology Information database under the name P. nebrodensis. Results demonstrated that all "P nebrodensis" material examined from China (plus several sequences of no reported origin) corresponded to P. eryngii subsp. tuoliensis, with only 2 exceptions, which were grouped within P. eryngii sensu stricto. The real P. nebrodensis biological material from Italy and Greece is certified and is available upon request by the authors at the University of Palermo and the Agricultural University of Athens.

  9. Mushrooms

    Science.gov (United States)

    ... these mushrooms have effects similar to the drug LSD . Sometimes Called: shrooms, magic mushrooms How It's Used: ... this topic for: Teens Drugs: What to Know LSD Dealing With Addiction Marijuana Bath Salts Depressants GHB ...

  10. Functional foods from mushroom

    Science.gov (United States)

    Mushrooms are defined as “a macro fungus with distinctive fruiting bodies that could be hypogeous or epigeous, large enough to be seen by naked eyes and to be picked by hands.” The Basidiomycetes and some species of Ascomycetes are categorized as mushrooms. Mushrooms constitute 22,000 known species ...

  11. Fungicide selective for basidiomycetes.

    Science.gov (United States)

    Edgington, L V; Walton, G S; Miller, P M

    1966-07-15

    Concentrations of 2,3-dihydro-5-carboxanilido-6-methyl-1,4-oxathiin lower than 8 parts per million prevented mycelial growth of a number of Basidiomycetes. By contrast, mycelial growth of various other fungi-Phycomycetes, Ascomycetes, and Deuteromycetes-was 50 percent inhibited only by concentrations of 32 ppm or higher. Two exceptions to this pattern of selective fungitoxicity were found:an isolate of Rhizoctonia solani was not as sensitive as other Basidiomycetes, and the deuteromycete Verticillium alboatrum was inhibited by lower concentrations than affected other fungi in this group. Spore germination of two Basidiomycetes, Uromyces phaseoli and Ustilago nuda, was inhibited 95 percent or more at 10 ppm.

  12. Higher order visual input to the mushroom bodies in the bee, Bombus impatiens.

    Science.gov (United States)

    Paulk, Angelique C; Gronenberg, Wulfila

    2008-11-01

    To produce appropriate behaviors based on biologically relevant associations, sensory pathways conveying different modalities are integrated by higher-order central brain structures, such as insect mushroom bodies. To address this function of sensory integration, we characterized the structure and response of optic lobe (OL) neurons projecting to the calyces of the mushroom bodies in bees. Bees are well known for their visual learning and memory capabilities and their brains possess major direct visual input from the optic lobes to the mushroom bodies. To functionally characterize these visual inputs to the mushroom bodies, we recorded intracellularly from neurons in bumblebees (Apidae: Bombus impatiens) and a single neuron in a honeybee (Apidae: Apis mellifera) while presenting color and motion stimuli. All of the mushroom body input neurons were color sensitive while a subset was motion sensitive. Additionally, most of the mushroom body input neurons would respond to the first, but not to subsequent, presentations of repeated stimuli. In general, the medulla or lobula neurons projecting to the calyx signaled specific chromatic, temporal, and motion features of the visual world to the mushroom bodies, which included sensory information required for the biologically relevant associations bees form during foraging tasks.

  13. Comparative Study of Worldwide Species of Genus Lentinus (=Lentinula, Higher Basidiomycetes) Based on Linear Mycelium Growth.

    Science.gov (United States)

    Mata, Juan Luis; Mishra, Nutan Tulapurkar

    2015-01-01

    Species of mushroom genus Lentinus (=Lentinula) are best known for the commercially important and extensively studied culinary-medicinal shiitake, L. edodes. A few mycelium growth studies have focused on Lentinus boryana, but information is lacking for L. raphanica and L. aciculospora, endemic to the Americas. In this study, 14 dikaryon strains representing 5 Lentinus species were grown on 5 nutritive agar media at increments of 5°C. Growth for each species was significantly slower on corn meal agar, but no differences were found among malt extract, potato dextrose, malt peptone, and yeast malt extract agars. Lentinus aciculospora and L. boryana consistently exhibited the slowest mycelium growth rates among all species and across all temperatures tested, with optima at 15°C and 20°C. The fastest mycelium growth rates for L. edodes, L. novaezelandiae, and L. raphanica occurred at 25°C. Strains of the latter continued to grow well at 30°C, whereas growth of the other 2 species declined significantly. Differences in mycelium growth rates for American strains could be partially explained by their geographic locations, indicating that understanding this physiological parameter has important ramifications for the edible mushroom industry.

  14. Medicinal mushroom science: Current perspectives, advances, evidences, and challenges

    Directory of Open Access Journals (Sweden)

    Solomon P Wasser

    2014-12-01

    Full Text Available The main target of the present review is to draw attention to the current perspectives, advances, evidences, challenges, and future development of medicinal mushroom science in the 21 st century. Medicinal mushrooms and fungi are thought to possess approximately 130 medicinal functions, including antitumor, immunomodulating, antioxidant, radical scavenging, cardiovascular, anti-hypercholesterolemic, antiviral, antibacterial, anti-parasitic, antifungal, detoxification, hepatoprotective, and antidiabetic effects. Many, if not all, higher Basidiomycetes mushrooms contain biologically active compounds in fruit bodies, cultured mycelium, and cultured broth. Special attention is paid to mushroom polysaccharides. The data on mushroom polysaccharides and different secondary metabolites are summarized for approximately 700 species of higher hetero- and homobasidiomycetes. Numerous bioactive polysaccharides or polysaccharide-protein complexes from the medicinal mushrooms described appear to enhance innate and cell-mediated immune responses, and exhibit antitumor activities in animals and humans. Whilst the mechanism of their antitumor actions is still not completely understood, stimulation and modulation of key host immune responses by these mushroom compounds appear central. Polysaccharides and low-molecular-weight secondary metabolites are particularly important due to their antitumor and immunostimulating properties. Several of the mushroom compounds have been subjected to Phase I, II, and III clinical trials, and are used extensively and successfully in Asia to treat various cancers and other diseases. Special attention is given to many important unsolved problems in the study of medicinal mushrooms.

  15. Comparative Genome Analysis of Basidiomycete Fungi

    Energy Technology Data Exchange (ETDEWEB)

    Riley, Robert; Salamov, Asaf; Morin, Emmanuelle; Nagy, Laszlo; Manning, Gerard; Baker, Scott; Brown, Daren; Henrissat, Bernard; Levasseur, Anthony; Hibbett, David; Martin, Francis; Grigoriev, Igor

    2012-03-19

    Fungi of the phylum Basidiomycota (basidiomycetes), make up some 37percent of the described fungi, and are important in forestry, agriculture, medicine, and bioenergy. This diverse phylum includes the mushrooms, wood rots, symbionts, and plant and animal pathogens. To better understand the diversity of phenotypes in basidiomycetes, we performed a comparative analysis of 35 basidiomycete fungi spanning the diversity of the phylum. Phylogenetic patterns of lignocellulose degrading genes suggest a continuum rather than a sharp dichotomy between the white rot and brown rot modes of wood decay. Patterns of secondary metabolic enzymes give additional insight into the broad array of phenotypes found in the basidiomycetes. We suggest that the profile of an organism in lignocellulose-targeting genes can be used to predict its nutritional mode, and predict Dacryopinax sp. as a brown rot; Botryobasidium botryosum and Jaapia argillacea as white rots.

  16. Disease control by chemical and biological fungicides in cultivated mushrooms: Button mushroom, oyster mushroom and shiitake

    OpenAIRE

    Potočnik, Ivana; Stepanović, Miloš; Rekanović, Emil; Todorović, Biljana; Milijašević-Marčić, Svetlana

    2015-01-01

    The most commonly cultivated basidiomycetes worldwide and in Serbia are button mushroom (Agaricus bisporus), oyster mushroom (Pleurotus sp.) and shiitake (Lentinus edodes). Production of their fruiting bodies is severely afflicted by fungal, bacterial, and viral pathogens that are able to cause diseases which affect yield and quality. Major A. bisporus fungal pathogens include Mycogone perniciosa, Lecanicillium fungicola, and Cladobotryum spp., the causal a...

  17. An update on organohalogen metabolites produced by basidiomycetes

    NARCIS (Netherlands)

    Field, J.A.; Wijnberg, J.B.P.A.

    2003-01-01

    Basidiomycetes are an ecologically important group of higher fungi known for their widespread capacity to produce organohalogen metabolites. To date, 100 different organohalogen metabolites (mostly chlorinated) have been identified from strains in 70 genera of Basidiomycetes. This manuscript

  18. Concentration and behavior of radiocesium in higher basidiomycetes in some Kanto and the Koshin districts, Japan

    International Nuclear Information System (INIS)

    Sugiyama, Hideo; Iwashima, Kiyoshi; Shibata, Hisashi.

    1990-01-01

    Concentration of 137 Cs, 134 Cs and potassium were measured in several higher fungi and in substrates, soils, woods and litters in some Kanto and the Koshin districts, Japan, following the Chernobyl accident during October to November 1989. 137 Cs concentrations in fungi were in the range of 0.7-101 Bq kg -1 · fresh. Maximum 137 Cs level in them was observed in Boletopsis leucomelas (Pers.: Fr.) Fayod. Significantly higher levels of concentration ratios of 137 Cs in fungi to substrates (e.g.; 137 Cs concentration · fresh in fungus/ 137 Cs concentration · dry in soil), 10 -1 to 10 x 10 -1 , were found nearly 10 to 1000 times as much as leaf vegetables, root crops and potatoes to substrates. It was confirmed that levels of concentration ratios of potassium were similar to those of 137 Cs. In all fungi, 134 Cs which released from the Chernobyl accident and is not present in nuclear weapons fallout was not detected. (author)

  19. Submerged cultivation of medicinal mushrooms: bioprocesses and products (review).

    Science.gov (United States)

    Elisashvili, Vladimir

    2012-01-01

    Medicinal mushrooms belonging to higher Basidiomycetes are an immensely rich yet largely untapped resource of useful, easily accessible, natural compounds with various biological activities that may promote human well-being. The medicinal properties are found in various cellular components and secondary metabolites (polysaccharides, proteins and their complexes, phenolic compounds, polyketides, triterpenoids, steroids, alkaloids, nucleotides, etc.), which have been isolated and identified from the fruiting bodies, culture mycelium, and culture broth of mushrooms. Some of these compounds have cholesterol-lowering, anti-diabetic, antioxidant, antitumor, immunomodulating, antimicrobial, and antiviral activities ready for industrial trials and further commercialization, while others are in various stages of development. Recently, the submerged cultivation of medicinal mushrooms has received a great deal of attention as a promising and reproducible alternative for the efficient production of mushroom mycelium and metabolites. Submerged cultivation of mushrooms has significant industrial potential, but its success on a commercial scale depends on increasing product yields and development of novel production systems that address the problems associated with this technique of mushroom cultivation. In spite of many researchers' efforts for the production of bioactive metabolites by mushrooms, the physiological and engineering aspects of submerged cultures are still far from being thoroughly studied. The vast majority of studies have focused on polysaccharide and ganoderic acid production in submerged cultivation of medicinal mushrooms, and very little has been written so far on the antioxidant and hemagglutinating activity of submerged mushroom cultures. The purpose of this review is to provide an update of the present state of the art and future prospects of submerged cultivation of medicinal mushrooms to produce mycelium and bioactive metabolites, and to make a

  20. Comparison of the interleukin-1β-inducing potency of allergenic spores from higher fungi (Basidiomycetes) in a cryopreserved human whole blood system

    Science.gov (United States)

    Rivera-Mariani, Félix E.; Vysyaraju, Kranthi; Negherbon, Jesse; Levetin, Estelle; Horner, W. Elliot; Hartung, Thomas; Breysse, Patrick N.

    2014-01-01

    Background Spores from basidiomycete fungi (basidiospores) are highly prevalent in the atmosphere of urban and rural settings. Studies have confirmed their potential to affect human health as allergens. Less is known about their potential to serve as stimuli of the innate immune system and induce pro-inflammatory reactions. Methods In this study, we evaluated the pro-inflammatory potential of spores from 11 allergenic gilled (Pleurotus ostreatus, Oudemansiella radicata, Armillaria tabescens, Coprinus micaceus, Pluteus cervinus, Chlorophyllum molybdites) and non-gilled (Pisolithus arhizus, Merulius tremullosus, Calvatia cyathiformis, Lycoperdon pyriforme, Boletus bicolor) basidiomycetes fungi based on their potency to induce the release of the pro-inflammatory cytokine interleukin (IL)-1β in a cryopreserved human whole blood system. In addition, the role of morphological features of the spores (surface area, shape, and pigmentation) were examined for their role in the spores’ interleukin (IL)-1β-including potency. Peripheral blood from healthy volunteers was collected, pooled, and cryopreserved. After stimulating the cryopreserved pooled blood with 106 to 103 basidiospores/ml, the concentration of IL-1β in culture supernatants was determined with ELISA. Results Basidiospores manifested concentration-dependent IL-1β-inducing potency, which was more noteworthy among basidiospores from gilled basidiomycetes. At higher concentrations of basidiospores, the IL-1β-inducing potency was able to be differentiated in the cryopreserved human whole blood system. Morphological features did not correlate with the IL-1β-inducing potency of the basidiospores, suggesting that non-morphological properties modulate the IL-1β-inducing potency. Conclusion Our data provides evidence of the pro-inflammatory potential of basidiospores, and the utility of cryopreserved human whole blood as a human-based in-vitro system to study the immune reactivity of allergenic basidiospores. PMID

  1. Medicinal Mushroom Cracked-Cap Polypore, Phellinus rimosus (Higher Basidiomycetes) Attenuates Acute Ethanol-Induced Lipid Peroxidation in Mice.

    Science.gov (United States)

    Ajith, Thekkuttuparambil A; Janardhanan, Kainoor K

    2015-01-01

    Alcohol abuse and alcoholism remain one of the major health issues worldwide, especially in developing countries. The protective effect of Phellinus rimosus against acute alcohol-induced lipid peroxidation in the liver, kidney, and brain as well as its effect against antioxidant enzyme activity such as superoxide (SOD) and catalase (CAT) in the liver was evaluated in mice. Ethyl acetate extract of Ph. Rimosus (50 mg/kg body wt, p.o.) 1 h before each administration of alcohol (3 mL/kg, p.o.; total 2 doses at 24-h intervals) protected against lipid peroxidation in all organs and attenuated the decline of SOD and CAT activity in the liver. The fold increase in lipid peroxidation, including conjugated diene and thiobarbituric acid reactive substance (TBARS) levels, was highest in the liver. There were 2.6- and 1.5- fold increases in TBARS levels in the liver of the alcohol alone- and alcohol+Ph. Rimosus-treated groups, compared with that of the normal group. Activity of SOD and CAT in the liver of alcohol- and alcohol+Ph. Rimosus- treated animals was 9.05±1.38, 18.76±1.71, and 11.26±1.02, 31.58±3.35 IU/mg protein, respectively. Extract at 1 mg/mL inhibited 50.6% activity of aniline hydroxylase (CYP2E1) in liver homogenate. From these results, we concluded that the extract significantly protected against the lipid peroxidation. Protection in the liver may be due to the inhibitory effect on CYP2E1 as well as the direct radical scavenging effect of Ph. Rimosus, which warrants further research.

  2. Current Advances in the Antimicrobial Potential of Species of Genus Ganoderma (Higher Basidiomycetes) against Human Pathogenic Microorganisms (Review).

    Science.gov (United States)

    Rai, Mahendra K; Gaikwad, Swapnil; Nagaonkar, Dipali; dos Santos, Carolina Alves

    2015-01-01

    Ganoderma spp. are very important therapeutic mushrooms and have been used traditionally for 4000 years in the treatment of various human disorders. Different species of Ganoderma possess bioactive compounds, which have already demonstrated antiviral, antibacterial, and antifungal activities. Various bioactive compounds such as triterpenoids, colossolactones, and polysaccharides, which are responsible for the antimicrobial potential of the genus, are discussed here in detail. Some Ganoderma spp. have been reported to be potential agents for the synthesis of metal nanoparticles. These nanoparticles have demonstrated antimicrobial activity and also are reviewed herein. The main aim of this review is to discuss the possible use of Ganoderma extracts and their active principles in antimicrobial therapy.

  3. Immunomodulatory activities of different solvent extracts from Tricholoma matsutake (S. Ito et S. Imai) singer (higher basidiomycetes) on normal mice.

    Science.gov (United States)

    Yin, Xiulian; You, Qinghong; Jiang, Zhonghai

    2012-01-01

    The immunomodulatory activities of different solvent extracts from the culinary-medicinal mushroom Tricholoma matsutake were studied in vivo in normal mice. The extracts were prepared using different solvents in an order of increasing polarity. The immunomodulatory activities were investigated by measuring the thymus and spleen index, phagocytic rate of macrophage phagocytosis, delayed-type hypersensitivity, plaque-forming cell, and proliferation of splenocytes. Results demonstrated that water extract (WE) and n-butyl alcohol extract (BAE) of T. matsutake could enhance the immunity of mice significantly compared with the control group. Main components of WE and BAE were polysaccharides, proteins, and flavonoids; we presume that these may be the main immunomodulating and immuno-enhancing agents in T. matsutake.

  4. Influence of deposits quantity and air temperature on 137Cs accumulation by the higher mushrooms

    Directory of Open Access Journals (Sweden)

    N. E. Zarubina

    2012-12-01

    Full Text Available Researches of the influence of weather conditions (amount of precipitation, air temperature on 137Cs content’s magnitude in fruit bodies of mushrooms: Boletus edulis Bull.: Fr., Suillus luteus (L.: Fr. S.F.Gray, Xerocomus badius (Fr. Kuhn. ex Gilb., Tricholoma flavovirens (Pers.: Fr. Lund., Cantharellus cibarius Fr. at the territory of Chernobyl alienation zone and «southern trace» are performed. Correlation factors, determination factors between specific activity 137Cs at mushrooms and quantity of deposits (mm and the maximum temperature of air (0С are calculated. At calculations the decrease of the content of 137Cs in mushrooms at the expense of disintegration of this isotope has been considered. As a result of researches the authentic dependence of specific activity 137Cs in fruit bodies of the studied kinds of mushrooms from quantity of deposits and from air temperature has not been established.

  5. Influence of deposits quantity and air temperature on 137Cs accumulation by the higher mushrooms

    International Nuclear Information System (INIS)

    Zarubina, N.E.

    2012-01-01

    Researches of the influence of weather conditions (amount of precipitation, air temperature) on 137 Cs content magnitude in fruit bodies of mushrooms: Boletus edulis Bull.: Fr., Suillus luteus (L.: Fr.) S.F.Gray, Xerocomus badius (Fr.) Kuhn. ex Gilb., Tricholoma flavovirens (Pers.: Fr.) Lund., Cantharellus cibarius Fr. at the territory of Chernobyl alienation zone and 'southern trace are performed. Correlation factors, determination factors between specific activity 137 Cs at mushrooms and quantity of deposits (mm) and the maximum temperature of air ( o C) are calculated. At calculations the decrease of the content of 137 Cs in mushrooms at the expense of disintegration of this isotope has been considered. As a result of researches the authentic dependence of specific activity 137 Cs in fruit bodies of the studied kinds of mushrooms from quantity of deposits and from air temperature has not been established.

  6. The role of culinary-medicinal mushrooms on human welfare with a pyramid model for human health.

    Science.gov (United States)

    Chang, Shu Ting; Wasser, Solomon P

    2012-01-01

    Mushrooms are part of fungal biota characterized by wonder. They rise up from lignocellulosic wastes: yet they become so bountiful and nourishing. Mushrooms are environmentally friendly. They biosynthesize their own food from agricultural crop residues, which would otherwise cause health hazards. The extant records show the continued use of some mushrooms, e.g., Lentinus edodes, Ganoderma lucidum, and Cordyceps sinensis are now centuries old. This review presents a pyramid model for mushroom uses (industries), as food, dietary supplements (tonic), and medicine. A regular intake of mushrooms can make us healthier, fitter, and happier, and help us live longer. The sense of purpose and vision for the mushroom industries is also briefly discussed. A variety of mushrooms have been used traditionally in many different cultures for the maintenance of health and in the prevention and treatment of various diseases. A total of 126 medicinal functions are thought to be produced by medicinal mushrooms (MM) and fungi, including antitumor, immunomodulating, antioxidant, radical scavenging, cardiovascular, anti-hypercholesterolemia, antiviral, antibacterial, anti-parasitic, antifungal, detoxification, hepatoprotective, and anti-diabetic effects. Special attention is paid to mushroom polysaccharides. Many, if not all, higher Basidiomycetes mushrooms contain biologically active polysaccharides in fruit bodies, cultured mycelium, and cultured broth. The data on mushroom polysaccharides are summarized for approximately 700 species of higher Hetero- and Homobasidiomycetes. In particular, the most important for modern medicine are polysaccharides with antitumor and immunostimulating properties. Several of the mushroom polysaccharide compounds have proceeded through phase I, II, and III clinical trials and are used extensively and successfully as drugs in Asia to treat various cancers and other diseases. Mushrooms are superior sources of different types of dietary supplements (DSs

  7. On the asymmetry of mating in natural populations of the mushroom fungus Schizophyllum commune

    NARCIS (Netherlands)

    Nieuwenhuis, B.P.S.; Nieuwhof, S.; Aanen, D.K.

    2013-01-01

    Before a mycelium of a mushroom-forming basidiomycete develops mushrooms, the monokaryotic mycelium needs to become fertilized. Although the mechanistic details of mating in mushrooms have been studied thoroughly in laboratory research, very little is known on mating patterns in nature. In this

  8. A highly conserved basidiomycete peptide synthetase produces a trimeric hydroxamate siderophore.

    Science.gov (United States)

    Brandenburger, Eileen; Gressler, Markus; Leonhardt, Robin; Lackner, Gerald; Habel, Andreas; Hertweck, Christian; Brock, Matthias; Hoffmeister, Dirk

    2017-08-25

    The model white-rot basidiomycete Ceriporiopsis ( Gelatoporia ) subvermispora B encodes putative natural product biosynthesis genes. Among them is the gene for the seven-domain nonribosomal peptide synthetase CsNPS2. It is a member of the as-yet uncharacterized fungal type VI siderophore synthetase family which is highly conserved and widely distributed among the basidiomycetes. These enzymes include only one adenylation (A) domain, i.e., one complete peptide synthetase module and two thiolation/condensation (T-C) di-domain partial modules which, together, constitute an AT 1 C 1 T 2 C 2 T 3 C 3 domain setup. The full-length CsNPS2 enzyme (274.5 kDa) was heterologously produced as polyhistidine fusion in Aspergillus niger as soluble and active protein. N 5 -acetyl- N 5 -hydroxy-l-ornithine (l-AHO) and N 5 - cis -anhydromevalonyl- N 5 -hydroxy-l-ornithine (l-AMHO) were accepted as substrates, as assessed in vitro using the substrate-dependent [ 32 P]ATP-pyrophosphate radioisotope exchange assay. Full-length holo -CsNPS2 catalyzed amide bond formation between three l-AHO molecules to release the linear l-AHO trimer, called basidioferrin, as product in vitro , which was verified by LC-HRESIMS. Phylogenetic analyses suggest that type VI family siderophore synthetases are widespread in mushrooms and have evolved in a common ancestor of basidiomycetes. Importance : The basidiomycete nonribosomal peptide synthetase CsNPS2 represents a member of a widely distributed but previously uninvestigated class (type VI) of fungal siderophore synthetases. Genes orthologous to CsNPS2 are highly conserved across various phylogenetic clades of the basidiomycetes. Hence, our work serves as a broadly applicable model for siderophore biosynthesis and iron metabolism in higher fungi. Also, our results on the amino acid substrate preference of CsNPS2 supports further understanding of the substrate selectivity of fungal adenylation domains. Methodologically, this report highlights the

  9. Phylogeny and comparative genome analysis of a Basidiomycete fungi

    Energy Technology Data Exchange (ETDEWEB)

    Riley, Robert W.; Salamov, Asaf; Grigoriev, Igor; Hibbett, David

    2011-03-14

    Fungi of the phylum Basidiomycota, make up some 37percent of the described fungi, and are important from the perspectives of forestry, agriculture, medicine, and bioenergy. This diverse phylum includes the mushrooms, wood rots, plant pathogenic rusts and smuts, and some human pathogens. To better understand these important fungi, we have undertaken a comparative genomic analysis of the Basidiomycetes with available sequenced genomes. We report a phylogeny that sheds light on previously unclear evolutionary relationships among the Basidiomycetes. We also define a `core proteome? based on protein families conserved in all Basidiomycetes. We identify key expansions and contractions in protein families that may be responsible for the degradation of plant biomass such as cellulose, hemicellulose, and lignin. Finally, we speculate as to the genomic changes that drove such expansions and contractions.

  10. Nutritional and neutraceutical composition of five wild culinary-medicinal species of genus Pleurotus (higher Basidiomycetes) from northwest India.

    Science.gov (United States)

    Atri, N; Sharma, Sapan Kumar; Joshi, Robin; Gulati, Ashu; Gulati, Arvind

    2013-01-01

    Five wild culinary-medicinal species of genus Pleurotus (Fr.) P. Kumm. (P. floridanus Singer, P. pulmonarius (Fr.) Quél., P. sapidus Quél., P. cystidiosus O.K. Miller, and P. sajor-caju (Fr.) Singer), collected from different localities of Northwest India, were studied for their nutritional and nutraceutical composition. Composition analysis of nutrients involved determining proteins, fats, ash, fiber, and carbohydrates using standard biochemical techniques. Minerals were estimated by an atomic absorption spectrophotometer and toxic metals were determined by the Reinsch test method. The analysis of nutraceuticals included determination of sugars by high-performance liquid chromatography, fatty acids by gas chromatography, and antioxidants such as β-carotene, lycopene, and total phenolic compounds with methanolic extract using a colorimetric assay. In the samples analyzed, carbohydrates dominated over protein and other macronutrients. Carbohydrates ranged from 85.86 to 88.38%, protein 0.98 to 2.17%, crude fat 0.62 to 0.84%, crude fibers 2.76 to 3.12%, and ash content 1.03 to 2.20%. Macro- and microminerals (calcium, magnesium, sodium, potassium, copper, zinc, and iron) also were found in substantial amount, whereas toxic metals (lead, silver, arsenic, mercury, and antimony) were not detected. Three main sugars-sucrose (0.338-2.011%), glucose (0.553-0.791%), and xylose (0.01%)-were detected. Among fatty acids, monounsaturated fatty (37.17-68.29%) acids were documented in a higher proportion than saturated fatty acids (26.07-47.77%). In terms of antioxidant composition, all species contained ascorbic acid, phenols, carotene, and lycopene. Ascorbic acid content ranged from 0.46 to 0.49 mg/100 g, total phenolic compounds ranged from 6.76 to 16.92 mg/100 g of gallic acid, β-carotene ranged from 0.134 to 0.221 μg/100 g, and lycopene from 0.055 to 0 .075 μg/100 g.

  11. HS/GC-MS analyzed chemical composition of the aroma of fruiting bodies of two species of genus Lentinus (Higher Basidiomycetes).

    Science.gov (United States)

    Mata, Gerardo; Valdez, Karina; Mendoza, Remedios; Trigos, Ángel

    2014-01-01

    The chemical composition of the aroma of fresh fruiting bodies of the cultivated mushroom Lentinus boryanus is described here and compared with medicinal shiitake mushroom L. edodes. Volatile compounds were analyzed through headspace sampling coupled with gas chromatography-mass spectrometry. The mushrooms under study were grown on different substrates based on barley straw, sugarcane bagasse, oak wood sawdust, and beech leaf litter. It was determined that L. boryanus as well as L. edodes contain an abundant amount of a volatile compound identified as 3-octanone with a sweet fruity aroma. On the other hand, only L. boryanus produced 3-octanol a characteristic aroma of cod liver oil. In total, 10 aromatic compounds were identified, some of which were obtained exclusively in one species or substrate.

  12. Effect of Different Proportions of Agrowaste on Cultivation Yield and Nutritional Composition of the Culinary-Medicinal Jelly Mushroom Auricularia polytricha (Higher Basidiomycetes).

    Science.gov (United States)

    Wu, Chiu-Yeh; Liang, Chih-Hung; Wu, Kuan-Jzen; Shih, Hsin-Der; Liang, Zeng-Chin

    2017-01-01

    In this study, Auricularia polytricha was cultivated on a sawdust basal substrate supplemented with different proportions (30%, 45%, and 60%, respectively) of agrowastes-sugarcane bagasse (SB), rice straw (RS), and rice husk (RH)-to evaluate the alternative substrates. The mycelial growth rate, total colonization time, time to first primordia, biological efficiency, and chemical composition of the fruiting bodies were determined. Results indicated that the 60% SB substrate was the best substrate for mycelial growth of A. polytricha, with a corresponding total colonization period of 35.2 days, followed by the control (35.5 days) and 45% SB (36.2 days) substrates. The most suitable substrate with a high biological efficiency was 60% RS substrate (159.14%), followed by the 45% SB (128.45%), and 20% RH (124.47%) substrates. The nutrient values of fruiting bodies showed the largest amounts of ash, protein, fat, carbohydrates, and energy cultivated on 60% SB, 60% SB, 30% SB, 30% RH, and 30% RH/the control substrates, respectively. The results indicated that 60% RS was an appropriate substrate for A. polytricha cultivation.

  13. Systemic Screening of Strains of the Lion's Mane Medicinal Mushroom Hericium erinaceus (Higher Basidiomycetes) and Its Protective Effects on Aβ-Triggered Neurotoxicity in PC12 Cells.

    Science.gov (United States)

    Liu, Zongying; Wang, Qinglong; Cui, Jian; Wang, Lili; Xiong, Lili; Wang, Wei; Li, Diqiang; Liu, Na; Wu, Yiran; Mao, Canquan

    2015-01-01

    Hericium erinaceus possesses multiple medicinal values. To date, however, there have been few studies of the systemic screening of H. erinaceus strains, and the neuroprotective effects of H. erinaceus prepared from homogenized, fresh fruiting bodies are not fully understood. In this study, 4 random primers were selected and used in random amplified polymorphic DNA (RAPD) polymerase chain reaction (PCR) to screen and evaluate the genetic diversity of 19 commercial strains of H. erinaceus from different localities in China. A total of 66 bands were obtained, and the percentage of polymorphic loci reached 80.30%. Five dendrograms were constructed based on RAPD by Jaccard cluster and within-group linkage analysis. Primer S20 as well as all 4 primers had great potential as specific primers for RAPD-PCR molecular identification and differentiation of H. erinaceus strains. Based on the results of submerged culture and fruiting body cultivation, strains HT-N, HT-J1, HT-C, and HT-M were identified as superior among the 19 H. erinaceus strains. Further study showed that the oral preparation of homogenized, fresh fruiting bodies of H. erinaceus could attenuate the Aβ25-35-triggered damage in PC12 cells by significantly increasing cell viability and by decreasing the release of lactate dehydrogenase. In conclusion, RAPD-PCR combined with liquid and solid cultures can be used well in the screening and identification of H. erinaceus strains, and products prepared from homogenized, fresh fruiting bodies of H. erinaceus had neuroprotective effects on PC12 cells.

  14. Evaluation of the antigenotoxic effects of the royal sun mushroom, agaricus brasiliensis (Higher basidiomycetes) in human lymphocytes treated with thymol in the comet assay

    NARCIS (Netherlands)

    Radaković, Milena; Stevanović, Jevrosima; Soković, Marina; Radović, Dejan; Griensven, Van Leo J.L.D.; Stanimirović, Zoran

    2015-01-01

    The aim of this investigation was to evaluate the possible protective activity of Agaricus brasiliensis (=A. blazei sensu Murrill) ethanol extract against thymol-induced DNA damage in human lymphocytes. Before we studied the possible interaction of thymol and A. brasiliensis extract, each

  15. Inhibiting effect of bioactive metabolites produced by mushroom cultivation on bacterial quorum sensing-regulated behaviors.

    Science.gov (United States)

    Zhu, Hu; Wang, Shou-Xian; Zhang, Shuai-Shuai; Cao, Chun-Xu

    2011-01-01

    This study aimed to search for novel quorum sensing (QS) inhibitors from mushroom and to analyze their inhibitory activity, with a view to their possible use in controlling detrimental infections. The bioactive metabolites produced by mushroom cultivation were tested for their abilities to inhibit QS-regulated behavior. All mushroom strains were cultivated in potato-dextrose medium by large-scale submerged fermentation. The culture supernatant was condensed into 0.2 vol by freeze-drying. The condensed supernatant was sterilized by filtration through a 0.22-μm membrane filter and added to Chromobacterium violaceum CV026 cultures, which were used to monitor QS inhibition. Inhibitory activity was measured by quantifying violacein production using a microplate reader. The results have revealed that, of 102 mushroom strains, the bioactive metabolites produced by 14 basidiomycetes were found to inhibit violacein production, a QS-regulated behavior in C. violaceum. Higher fungi can produce QS-inhibitory compounds. Copyright © 2011 S. Karger AG, Basel.

  16. Disease control by chemical and biological fungicides in cultivated mushrooms: button mushroom, oyster mushroom and shiitake

    Directory of Open Access Journals (Sweden)

    Ivana Potočnik

    2015-12-01

    Full Text Available The most commonly cultivated basidiomycetes worldwide and in Serbia are button mushroom (Agaricus bisporus, oyster mushroom (Pleurotus sp. and shiitake (Lentinus edodes. Production of their fruiting bodies is severely afflicted by fungal, bacterial, and viral pathogens that are able to cause diseases which affect yield and quality. Major A. bisporus fungal pathogens include Mycogone perniciosa, Lecanicillium fungicola, and Cladobotryum spp., the causal agents of dry bubble, wet bubble, and cobweb disease, respectively. Various Trichoderma species, the causal agents of green mould, also affect all three kinds of edible mushrooms. Over the past two decades, green mould caused by T. aggressivum has been the most serious disease of button mushroom. Oyster mushroom is susceptible to T. pleurotum and shiitake to T. harzianum. The bacterial brawn blotch disease, caused by Pseudomonas tolaasii, is distributed globally. Disease control on mushroom farms worldwide is commonly based on the use of fungicides. However, evolution of pathogen resistance to fungicides after frequent application, and host sensitivity to fungicides are serious problems. Only a few fungicides are officially recommended in mushroom production: chlorothalonil and thiabendazol in North America and prochloraz in the EU and some other countries. Even though decreased sensitivity levels of L. fungicola and Cladobotryum mycophilum to prochloraz have been detected, disease control is still mainly provided by that chemical fungicide. Considering such resistance evolution, harmful impact to the environment and human health, special attention should be focused on biofungicides, both microbiological products based on Bacillus species and various natural substances of biological origin, together with good programs of hygiene. Introduction of biofungicides has created new possibilities for crop protection with reduced application of chemicals.

  17. Are mushrooms radioactive?

    International Nuclear Information System (INIS)

    Randa, Z.; Benada, J.; Singert, M.; Horyna, J.

    1988-01-01

    Tabulated is the content of 137 Cs in dry matter of higher mushrooms collected in the years 1986 to 1987. The radioactive level of mushrooms collected in Czechoslovakia such as Boletus badius and B. chrysenteron reached 20 to 50 kBq/kg of dry matter. The individual dose at mean consumption of these mushrooms was estimated at 0.2 to 0.3 mSv/year which amounted to 20 to 30% of the dose from the natural background. (J.B.). 1 tab

  18. ENDOGENOUS CYTOKININS IN MEDICINAL BASIDIOMYCETES MYCELIAL BIOMASS

    Directory of Open Access Journals (Sweden)

    N. P.

    2016-02-01

    Full Text Available The aim of the research was to study the cytokinins production by medicinal basidial mushrooms. Cytokinins were for the first time identified and quantified in mycelial biomass of six species (Ganoderma lucidum, Trametes versicolor, Fomitopsis officinalis, Pleurotus nebrodensis, Grifola frondosa, Sparassis crispa using HPLC. Trans- and cis-zeatin, zeatin riboside, zeatin-O-glucoside, isopentenyladenosine, isopentenyladenine were found but only one species (G. lucidum, strain 1900 contained all these substances. The greatest total cytokinin quantity was detected in F. officinalis, strain 5004. S. crispa, strain 314, and F. officinalis, strain 5004, mycelial biomass was revealed to have the highest level of cytokinin riboside forms (zeatin riboside and isopentenyladenosine. The possible connection between medicinal properties of investigated basidiomycetes and of cytokinins is discussed. S. crispa, strain 314, and F. officinalis, strain 5004, are regarded as promising species for developing biotechnological techniques to produce biologically active drugs from their mycelial biomass. As one of the potential technological approaches there is proposed fungal material drying.

  19. [Hallucinogenic mushrooms].

    Science.gov (United States)

    Reingardiene, Dagmara; Vilcinskaite, Jolita; Lazauskas, Robertas

    2005-01-01

    The group of hallucinogenic mushrooms (species of the genera Conocybe, Gymnopilus, Panaeolus, Pluteus, Psilocybe, and Stropharia) is psilocybin-containing mushrooms. These "magic", psychoactive fungi have the serotonergic hallucinogen psilocybin. Toxicity of these mushrooms is substantial because of the popularity of hallucinogens. Psilocybin and its active metabolite psilocin are similar to lysergic acid diethylamide. These hallucinogens affect the central nervous system rapidly (within 0.5-1 hour after ingestion), producing ataxia, hyperkinesis, and hallucinations. In this review article there are discussed about history of use of hallucinogenic mushrooms and epidemiology; pharmacology, pharmacodynamics, somatic effects and pharmacokinetics of psilocybin, the clinical effects of psilocybin and psilocin, signs and symptoms of ingestion of hallucinogenic mushrooms, treatment and prognosis.

  20. Higher marine fungi from mangroves (Manglicolous fungi)

    Digital Repository Service at National Institute of Oceanography (India)

    ChinnaRaj, S.

    of higher marine fungi which included 23 Ascomycetes, 2 Basidiomycetes and 17 Deuteromycetes (Kohlmeyer and Kohlmeyer, 1979). Hyde (1990a) listed 120 species from 29 mangroves from all over the World this includes 87 Ascomycetes, 2 Basidiomycetes and 31...

  1. Armillaria mellea: an ozonophilic basidiomycete

    Energy Technology Data Exchange (ETDEWEB)

    Berliner, M D

    1963-01-19

    Armillaria mellea, a luminescent basidiomycete grown in culture, had its light emission stimulated by high ozone concentrations and survived long ozone exposures without apparent lasting ill-effect. There is a strong possibility that a pigment acts as an ozone protecting substance by preventing the formation of free radicals and peroxides.

  2. Analysis of basidiomycete pigments in situ by Raman spectroscopy.

    Science.gov (United States)

    Tauber, James P; Matthäus, Christian; Lenz, Claudius; Hoffmeister, Dirk; Popp, Jürgen

    2018-02-07

    Basidiomycetes, that is, mushroom-type fungi, are known to produce pigments in response to environmental impacts. As antioxidants with a high level of unsaturation, these compounds can neutralize highly oxidative species. In the event of close contact with other microbes, the enzymatically controlled pigment production is triggered and pigment secretion is generated at the interaction zone. The identification and analysis of these pigments is important to understand the defense mechanism of fungi, which is essential to counteract an uncontrolled spread of harmful species. Usually, a detailed analysis of the pigments is time consuming as it depends on laborious sample preparation and isolation procedures. Furthermore, the applied protocols often influence the chemical integrity of the compound of interest. A possibility to noninvasively investigate the pigmentation is Raman microspectroscopy. The methodology has the potential to analyze the chemical composition of the sample spatially resolved at the interaction zone. After the acquisition of a representative spectroscopic library, the pigment production by basidiomycetes was monitored for during response to different fungi and bacteria. The presented results describe a very efficient noninvasive way of pigment analysis which can be applied with minimal sample preparation. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  3. Solid-substrate fermentation of wheat grains by mycelia of indigenous species of the genus Ganoderma (higher Basidiomycetes) to enhance the antioxidant activities.

    Science.gov (United States)

    Subramaniam, Sarasvathy; Sabaratnam, Vikineswary; Kuppusamy, Umah Rani; Tan, Yee Shin

    2014-01-01

    Species of the genus Ganoderma are a cosmopolitan wood decaying white rot fungi, which has been used by the Asians for therapeutic purposes for centuries. In the present study, solid-substrate fermentation (SSF) of wheat grains (Triticum aestivum L.) was carried out with indigenous Ganoderma australe (KUM60813) and G. neo-japonicum (KUM61076) selected based on ethnomycological knowledge. G. lucidum (VITA GL) (a commercial strain) was also included in the study. Antioxidant activities of the crude ethanol and aqueous extracts of the fermented and unfermented wheat grains were investigated by ferric reducing antioxidant power (FRAP), Trolox equivalent antioxidant capacity (TEAC), diphenyl-1-picryl-hydrazyl (DPPH) free radical scavenging ability, and lipid peroxidation assay. Among the six mycelia extracts tested, the ethanol extract from wheat fermented with KUM61076 mycelia showed the most potent antioxidant activities, whereas the ethanol extract of wheat grains fermented with KUM60813 mycelia has a good potential in protecting frying oils against oxidation. Total phenolic content (TPC) in the ethanol extracts were higher than that in the aqueous extract. The wheat grains fermented with G. australe (KUM60813) and G. neo-japonicum KUM61076 have greater antioxidant potential compared to the commercially available G. lucidum (VITA GL). The antioxidant activities of the mycelia extracts had a positive correlation with their phenolic contents. Thus phenolic compounds may play a vital role in the antioxidant activities of the selected Ganoderma spp.

  4. Lectins from Mycelia of Basidiomycetes

    Directory of Open Access Journals (Sweden)

    Valentina E. Nikitina

    2017-06-01

    Full Text Available Lectins are proteins of a nonimmunoglobulin nature that are capable of specific recognition of and reversible binding to the carbohydrate moieties of complex carbohydrates, without altering the covalent structure of any of the recognized glycosyl ligands. They have a broad range of biological activities important for the functioning of the cell and the whole organism and, owing to the high specificity of reversible binding to carbohydrates, are valuable tools used widely in biology and medicine. Lectins can be produced by many living organisms, including basidiomycetes. Whereas lectins from the fruit bodies of basidiomycetes have been studied sufficiently well, mycelial lectins remain relatively unexplored. Here, we review and comparatively analyze what is currently known about lectins isolated from the vegetative mycelium of macrobasidiomycetes, including their localization, properties, and carbohydrate specificities. Particular attention is given to the physiological role of mycelial lectins in fungal growth and development.

  5. How (post-)genomic insights can provide new leads for improvements of mushroom cultivation

    NARCIS (Netherlands)

    Patyshakuliyeva, A.; Post, H.; Zhou, Miaomiao; Jurak, E.; Heck, A.; Hildén, K.; Kabel, M.A.; Makela, M.R.; Altelaar, Maarten; Vries, De Ronald P.

    2016-01-01

    The economically important edible basidiomycete mushroom Agaricus bisporus thrives on
    decaying plant material in forests and grasslands of North America and Europe. It degrades forest
    litter and contributes to global carbon recycling, depolymerizing (hemi-)cellulose and lignin in

  6. How (post-)genomic insights can provide new leads for improvements of mushroom cultivation

    NARCIS (Netherlands)

    Patyshakuliyeva, A.; Post, Harm; Zhou, Miaomiao; Jurak, Edita; Heck, Albert; Hildén, Kristiina S.; Kabel, Mirjam; Mäkelä, Miia R.; Altelaar, Maarten; de Vries, R.P.

    2016-01-01

    The economically important edible basidiomycete mushroom Agaricus bisporus thrives on decaying plant material in forests and grasslands of North America and Europe. It degrades forest litter and contributes to global carbon recycling, depolymerizing (hemi-)cellulose and lignin in plant biomass.

  7. The yeast flora of some decaying mushrooms on trunks of living trees

    NARCIS (Netherlands)

    Middelhoven, W.J.

    2004-01-01

    Several ascomycetous and basidiomycetous yeasts were isolated from rotten mushrooms on the trunks of beech and tamarisk trees. One strain, identified as the novel species Cryptococcus allantoinivorans, assimilated allantoin as the sole carbon source. Phylogenetically it belongs to the C. laurentii

  8. Oyster Mushroom

    African Journals Online (AJOL)

    The pastoralists have been hopelessly trying to get rid of the bush through ... mushroom cultivation the mentioned problems can be solved yielding nutritious ..... Mean values within the same column with no common superscript letter differ at the 95% confidence level and the .... Encroachment in the Borana Low Land.

  9. Plant-Polysaccharide-Degrading Enzymes from Basidiomycetes

    Science.gov (United States)

    Rytioja, Johanna; Hildén, Kristiina; Yuzon, Jennifer; Hatakka, Annele; de Vries, Ronald P.

    2014-01-01

    SUMMARY Basidiomycete fungi subsist on various types of plant material in diverse environments, from living and dead trees and forest litter to crops and grasses and to decaying plant matter in soils. Due to the variation in their natural carbon sources, basidiomycetes have highly varied plant-polysaccharide-degrading capabilities. This topic is not as well studied for basidiomycetes as for ascomycete fungi, which are the main sources of knowledge on fungal plant polysaccharide degradation. Research on plant-biomass-decaying fungi has focused on isolating enzymes for current and future applications, such as for the production of fuels, the food industry, and waste treatment. More recently, genomic studies of basidiomycete fungi have provided a profound view of the plant-biomass-degrading potential of wood-rotting, litter-decomposing, plant-pathogenic, and ectomycorrhizal (ECM) basidiomycetes. This review summarizes the current knowledge on plant polysaccharide depolymerization by basidiomycete species from diverse habitats. In addition, these data are compared to those for the most broadly studied ascomycete genus, Aspergillus, to provide insight into specific features of basidiomycetes with respect to plant polysaccharide degradation. PMID:25428937

  10. The Edible Mushroom Book

    DEFF Research Database (Denmark)

    Conte, Anna Del; Læssøe, Thomas

    A gourmet's guide to foraging and cooking mushrooms. It helps readers find out how to forage, prepare and cook mushrooms that are wild, fresh and free. It features photographs, which show edible mushrooms in their natural habitats.......A gourmet's guide to foraging and cooking mushrooms. It helps readers find out how to forage, prepare and cook mushrooms that are wild, fresh and free. It features photographs, which show edible mushrooms in their natural habitats....

  11. Oyster mushroom (Pleurotus spp.) cultivation technique using re ...

    African Journals Online (AJOL)

    SARAH

    2014-08-31

    Aug 31, 2014 ... using re-usable substrate containers and comparison of ... oyster mushrooms in combination with other vegetables complements availability of various essential ..... higher than from oyster mushrooms produced from any.

  12. Formation of mushrooms and lignocellulose degradation encoded in the genome sequence of Schizophyllum commune

    Energy Technology Data Exchange (ETDEWEB)

    Ohm, Robin A.; de Jong, Jan F.; Lugones, Luis G.; Aerts, Andrea; Kothe, Erika; Stajich, Jason E.; de Vries, Ronald P.; Record, Eric; Levasseur, Anthony; Baker, Scott E.; Bartholomew, Kirk A.; Coutinho, Pedro M.; Erdmann, Susann; Fowler, Thomas J.; Gathman, Allen C.; Lombard, Vincent; Henrissat, Bernard; Knabe, Nicole; Kues, Ursula; Lilly, Walt W.; Lindquist, Erika; Lucas, Susan; Magnuson, Jon K.; Piumi, Francois; Raudaskoski, Marjatta; Salamov, Asaf; Schmutz, Jeremy; Schwarze, Francis W.M.R.; van Kuyk, Patricia A.; Horton, J. Stephen; Grigoriev, Igor V.; Wosten, Han A.B.

    2010-07-12

    The wood degrading fungus Schizophyllum commune is a model system for mushroom development. Here, we describe the 38.5 Mb assembled genome of this basidiomycete and application of whole genome expression analysis to study the 13,210 predicted genes. Comparative analyses of the S. commune genome revealed unique wood degrading machinery and mating type loci with the highest number of reported genes. Gene expression analyses revealed that one third of the 471 identified transcription factor genes were differentially expressed during sexual development. Two of these transcription factor genes were deleted. Inactivation of fst4 resulted in the inability to form mushrooms, whereas inactivation of fst3 resulted in more but smaller mushrooms than wild-type. These data illustrate that mechanisms underlying mushroom formation can be dissected using S. commune as a model. This will impact commercial production of mushrooms and the industrial use of these fruiting bodies to produce enzymes and pharmaceuticals.

  13. The Anti-Inflammatory Effects of Lion's Mane Culinary-Medicinal Mushroom, Hericium erinaceus (Higher Basidiomycetes) in a Coculture System of 3T3-L1 Adipocytes and RAW264 Macrophages.

    Science.gov (United States)

    Mori, Koichiro; Ouchi, Kenji; Hirasawa, Noriyasu

    2015-01-01

    Chronic low-grade inflammation in the adipose tissue accompanying obesity is thought to be an underlying driver of metabolic diseases. In this study, we aimed to investigate the efficacy of Hericium erinaceus on adipose tissue inflammation. The anti-inflammatory effects of the ethyl acetate soluble fraction of H. erinaceus (EAHE) were examined using cocultures of 3T3-L1 adipocytes and RAW264 macrophages. EAHE significantly suppressed tumor necrosis factor (TNF)-α and interleukin (IL)-6 production in cultured RAW264 macrophages stimulated by lipopolysaccharide (LPS). EAHE also caused notable inhibition of c-Jun N-terminal kinase (JNK) activation, which is thought to be involved in the suppression of proinflammatory cytokines by EAHE. In a coculture system with 3T3-L1 and RAW264 cells stimulated with LPS, EAHE reduced TNF-α and IL-6 concentrations in the conditioned medium and lowered the gene expression levels of these cytokines in 3T3-L1 adipocytes. Furthermore, EAHE suppressed the LPS-induced reduction of adiponectin mRNA levels in 3T3-L1 adipocytes cocultured with RAW264 macrophages. However, in 3T3-L1 adipocytes cultured alone, the concentration of LPS used in this study did not affect the gene expression levels of these adipokines. We attributed the anti-inflammatory effects of EAHE on 3T3-L1 adipocytes cocultured with RAW264 macrophages to the suppression of Toll-like receptor 4 (TLR4) signaling and subsequent proinflammatory cytokine secretion in RAW264 cells. Our findings indicate the possibility that H. erinaceus exerts anti-inflammatory effects on macrophages through the inhibition of TLR4-JNK signaling and prevents or ameliorates adipose tissue inflammation associated with obesity.

  14. Characterization and cultivation of a wild mushroom species isolated in Brazil
    Caracterização e cultivo de uma espécie de cogumelo silvestre isolado no Brasil

    OpenAIRE

    Luzia Doretto Paccola-Meirelles; Cristina Sayuri Maki

    2002-01-01

    Wild mushrooms were collected close to cattle manure in pasture areas in Tamarana (Paraná/Brazil), with the objective of finding and domesticating new non-exploited basidiomycetes. An edible basidiomycete of the Agaricales order was classified as belonging to the Macrolepiota bonaerensis species (=Lepiota procera, form bonaerensis (Speg.) Rick or M. procera (Scop.:Fr) Sing.). The mycelia was isolated and characterized for growth rate in different culture media. A vigorous growth was observed ...

  15. The yeast flora of some decaying mushrooms on trunks of living trees

    OpenAIRE

    Middelhoven, W.J.

    2004-01-01

    Several ascomycetous and basidiomycetous yeasts were isolated from rotten mushrooms on the trunks of beech and tamarisk trees. One strain, identified as the novel species Cryptococcus allantoinivorans, assimilated allantoin as the sole carbon source. Phylogenetically it belongs to the C. laurentii complex, Papiliotrema bandonii being the closest relative. Some ascomycetous strains could not be distinguished from Pichia guillermondii, but deviated considerably in rDNA sequences. In addition to...

  16. Wild growing mushrooms for the Edible City? Cadmium and lead content in edible mushrooms harvested within the urban agglomeration of Berlin, Germany

    International Nuclear Information System (INIS)

    Schlecht, Martin Thomas; Säumel, Ina

    2015-01-01

    Health effects by consuming urban garden products are discussed controversially due to high urban pollution loads. We sampled wild edible mushrooms of different habitats and commercial mushroom cultivars exposed to high traffic areas within Berlin, Germany. We determined the content of cadmium and lead in the fruiting bodies and analysed how the local setting shaped the concentration patterns. EU standards for cultivated mushrooms were exceeded by 86% of the wild mushroom samples for lead and by 54% for cadmium but not by mushroom cultures. We revealed significant differences in trace metal content depending on species, trophic status, habitat and local traffic burden. Higher overall traffic burden increased trace metal content in the biomass of wild mushrooms, whereas cultivated mushrooms exposed to inner city high traffic areas had significantly lower trace metal contents. Based on these we discuss the consequences for the consumption of mushrooms originating from urban areas. - Highlights: • Popular edible mushrooms display large variations in Cd and Pb content. • Low accumulating species are Sparassis crispa, Boletus luridus, or Boletus badius. • High accumulating species are Agaricus ssp., Russula vesca, or Calvatia gigantea. • Cd and Pb content in wild growing edible mushrooms were mostly above EU limits for cultivated mushrooms. • Cd and Pb content in commercial mushrooms cultures were regularly below EU limits for cultivated mushrooms. - Commercial mushroom cultures can be integrated into ‘Edible City’ approaches, but majority of wild growing mushroom samples highly accumulate trace metals

  17. Degradation of cellulose by basidiomycetous fungi

    Czech Academy of Sciences Publication Activity Database

    Baldrian, Petr; Valášková, Vendula

    2008-01-01

    Roč. 32, č. 3 (2008), s. 501-521 ISSN 0168-6445 R&D Projects: GA MŠk LC06066; GA MZe QH72216 Institutional research plan: CEZ:AV0Z50200510 Keywords : cellobiohydrolase * cellulose dehydrogenase * basidiomycetes Subject RIV: EE - Microbiology, Virology Impact factor: 7.963, year: 2008

  18. Comparative genome analysis of Basidiomycete fungi

    Energy Technology Data Exchange (ETDEWEB)

    Riley, Robert; Salamov, Asaf; Henrissat, Bernard; Nagy, Laszlo; Brown, Daren; Held, Benjamin; Baker, Scott; Blanchette, Robert; Boussau, Bastien; Doty, Sharon L.; Fagnan, Kirsten; Floudas, Dimitris; Levasseur, Anthony; Manning, Gerard; Martin, Francis; Morin, Emmanuelle; Otillar, Robert; Pisabarro, Antonio; Walton, Jonathan; Wolfe, Ken; Hibbett, David; Grigoriev, Igor

    2013-08-07

    Fungi of the phylum Basidiomycota (basidiomycetes), make up some 37percent of the described fungi, and are important in forestry, agriculture, medicine, and bioenergy. This diverse phylum includes symbionts, pathogens, and saprotrophs including the majority of wood decaying and ectomycorrhizal species. To better understand the genetic diversity of this phylum we compared the genomes of 35 basidiomycetes including 6 newly sequenced genomes. These genomes span extremes of genome size, gene number, and repeat content. Analysis of core genes reveals that some 48percent of basidiomycete proteins are unique to the phylum with nearly half of those (22percent) found in only one organism. Correlations between lifestyle and certain gene families are evident. Phylogenetic patterns of plant biomass-degrading genes in Agaricomycotina suggest a continuum rather than a dichotomy between the white rot and brown rot modes of wood decay. Based on phylogenetically-informed PCA analysis of wood decay genes, we predict that that Botryobasidium botryosum and Jaapia argillacea have properties similar to white rot species, although neither has typical ligninolytic class II fungal peroxidases (PODs). This prediction is supported by growth assays in which both fungi exhibit wood decay with white rot-like characteristics. Based on this, we suggest that the white/brown rot dichotomy may be inadequate to describe the full range of wood decaying fungi. Analysis of the rate of discovery of proteins with no or few homologs suggests the value of continued sequencing of basidiomycete fungi.

  19. Diseases and pests noxious to Pleurotus spp. mushroom crops.

    Science.gov (United States)

    Bellettini, Marcelo B; Bellettini, Sebastião; Fiorda, Fernanda A; Pedro, Alessandra C; Bach, Fabiane; Fabela-Morón, Miriam F; Hoffmann-Ribani, Rosemary

    The Pleurotus genus is one of most extensively studied white-rot fungi due to its exceptional ligninolytic properties. It is an edible mushroom that possesses biological effects, as it contains important bioactive molecules. It is a rich source of nutrients, particularly proteins, minerals as well as vitamins B, C and D. In basidiomycete fungi, intensive cultivations of edible mushrooms can often be affected by some bacterial, mold and virus diseases that rather frequently cause dramatic production loss. These infections are facilitated by the particular conditions under which mushroom cultivation is commonly carried out such as warm temperatures, humidity, carbon dioxide (CO 2 ) levels and presence of pests. There is not much bibliographic information related to pests of mushrooms and their substrates. The updated review presents a practical checklist of diseases and pests of the Pleurotus genus, providing useful information that may help different users. Copyright © 2017 Asociación Argentina de Microbiología. Publicado por Elsevier España, S.L.U. All rights reserved.

  20. Diversity and associations between Drosophilidae (Diptera species and Basidiomycetes in a Neotropical forest

    Directory of Open Access Journals (Sweden)

    FELIPE B. VALER

    2016-01-01

    Full Text Available ABSTRACT Drosophilidae is one of the most representative families of insects that occurs in fungal fruiting bodies of Basidiomycetes; however, the diversity and community structure of mycophagous Drosophilidae in the Neotropical region is poorly known. The aims of the present study were to describe the diversity of mycophagous Drosophilidae and to investigate its colonization of fungal hosts in a forest of southern Brazil. From 120 fungal samples (patches of mushrooms of 17 Basidiomycetes genera, flies were recorded emerging from 70 samples and collected in adult stages of 25 fungal samples, for a total of 4897 drosophilids belonging to 31 species and 5 genera. Drosophila Fallén was the most species-rich genus, whereas Hirtodrosophila Duda was the dominant genus. Studies performed in the Holarctic region indicate that mycophagous drosophilid have generalist habits; however, our results showed that most drosophilids use fewer than two fungal hosts, and most species of Hirtodrosophila and Leucophenga were restricted to abundant fungal species, suggesting a specialization for these resources. The most specialized fauna emerged from Auricularia, which was the most frequent fungal genus in our collection, and this result supports the assumption that specialization depends on the availability of fungal resources over time.

  1. Mushrooms, trees, and money: value estimates of commercial mushrooms and timber in the pacific northwest.

    Science.gov (United States)

    Alexander, Susan J; Pilz, David; Weber, Nancy S; Brown, Ed; Rockwell, Victoria A

    2002-07-01

    Wild edible mushrooms are harvested in the forests of the Pacific Northwest, where both trees and mushrooms grow in the same landscape. Although there has been some discussion about the value of trees and mushrooms individually, little information exists about the joint production of, and value for, these two forest products. Through four case studies, the information needed to determine production and value for three wild mushroom species in different forests of the Pacific Northwest is described, and present values for several different forest management scenarios are presented. The values for timber and for mushrooms are site- and species-specific. On the Olympic Peninsula in Washington, timber is highly valued and chanterelles are a low-value product by weight; timber has a soil expectation value (SEV) 12 to 200 times higher than chanterelles. In south-central Oregon, timber and American matsutake mushrooms have the potential to have about the same SEV. In eastern Oregon, timber is worth 20 to 110 times as much as the morels that grow in the forest. Production economics is concerned with choices about how much and what to produce with what resources. The choices are influenced by changes in technical and economic circumstances. Through our description and analysis of the necessary definitions and assumptions to assess value in joint production of timber and wild mushrooms, we found that values are sensitive to assumptions about changes in forest management, yields for mushrooms and trees, and costs.

  2. Concentration of radiocesium in cultivated mushrooms and substrates

    International Nuclear Information System (INIS)

    Miyake, Sadaaki; Higasa, Mamoru; Urabe, Ken-ichi; Haraguchi, Masato; Omura, Toshitaka

    2008-01-01

    Concentrations of 134 Cs, 137 Cs and 40 K in mushrooms cultivated in Saitama prefecture and those substrates were measured by gamma-ray spectrometry. In all mushrooms and substrates, 134 Cs was not detected. Concentrations of 137 Cs in mushrooms were in the range of 0.012 - 2.1 Bq/kg·fresh, and those in substrates were in the range of 0.080 - 1.8 Bq/kg·dry. Concentrations of 137 Cs in mushrooms varied widely with mushroom species, and the average concentration of 137 Cs in Lentinus edodes (Shiitake) was over 30 times higher than that in Pleurotus ostreatus (Hiratake). Mushroom-to-substrate concentration ratios of 137 Cs (fresh/dry) were 0.11-0.53. They were higher than the reported transfer factors for common agricultural plants. (author)

  3. Integrated control of wood destroying basidiomycetes combining Cu-based wood preservatives and Trichoderma spp.

    Directory of Open Access Journals (Sweden)

    Javier Ribera

    Full Text Available The production of new generation of wood preservatives (without addition of a co-biocide in combination with an exchange of wood poles on identical sites with high fungal inoculum, has resulted in an increase of premature failures of wood utility poles in the last decades. Wood destroying basidiomycetes inhabiting sites where poles have been installed, have developed resistance against wood preservatives. The objective of the in vitro studies was to identify a Trichoderma spp. with a highly antagonistic potential against wood destroying basidiomycetes that is capable of colonizing Cu-rich environments. For this purpose, the activity of five Trichoderma spp. on Cu-rich medium was evaluated according to its growth and sporulation rates. The influence of the selected Trichoderma spp. on wood colonization and degradation by five wood destroying basidiomycetes was quantitatively analyzed by means of dry weight loss of wood specimens. Furthermore, the preventative effect of the selected Trichoderma spp. in combination with four Cu-based preservatives was also examined by mass loss and histological changes in the wood specimens. Trichoderma harzianum (T-720 was considered the biocontrol agent with higher antagonistic potential to colonize Cu-rich environments (up to 0.1% CuSO4 amended medium. T. harzianum demonstrated significant preventative effect on wood specimens against four wood destroying basidiomycetes. The combined effect of T. harzianum and Cu-based wood preservatives demonstrated that after 9 months incubation with two wood destroying basidiomycetes, wood specimens treated with 3.8 kg m-3 copper-chromium had weight losses between 55-65%, whereas containers previously treated with T. harzianum had significantly lower weight losses (0-25%. Histological studies on one of the wood destroying basidiomycetes revealed typical decomposition of wood cells by brown-rot fungi in Cu-impregnated samples, that were notably absent in wood specimens

  4. Integrated control of wood destroying basidiomycetes combining Cu-based wood preservatives and Trichoderma spp.

    Science.gov (United States)

    Ribera, Javier; Fink, Siegfried; Bas, Maria Del Carmen; Schwarze, Francis W M R

    2017-01-01

    The production of new generation of wood preservatives (without addition of a co-biocide) in combination with an exchange of wood poles on identical sites with high fungal inoculum, has resulted in an increase of premature failures of wood utility poles in the last decades. Wood destroying basidiomycetes inhabiting sites where poles have been installed, have developed resistance against wood preservatives. The objective of the in vitro studies was to identify a Trichoderma spp. with a highly antagonistic potential against wood destroying basidiomycetes that is capable of colonizing Cu-rich environments. For this purpose, the activity of five Trichoderma spp. on Cu-rich medium was evaluated according to its growth and sporulation rates. The influence of the selected Trichoderma spp. on wood colonization and degradation by five wood destroying basidiomycetes was quantitatively analyzed by means of dry weight loss of wood specimens. Furthermore, the preventative effect of the selected Trichoderma spp. in combination with four Cu-based preservatives was also examined by mass loss and histological changes in the wood specimens. Trichoderma harzianum (T-720) was considered the biocontrol agent with higher antagonistic potential to colonize Cu-rich environments (up to 0.1% CuSO4 amended medium). T. harzianum demonstrated significant preventative effect on wood specimens against four wood destroying basidiomycetes. The combined effect of T. harzianum and Cu-based wood preservatives demonstrated that after 9 months incubation with two wood destroying basidiomycetes, wood specimens treated with 3.8 kg m-3 copper-chromium had weight losses between 55-65%, whereas containers previously treated with T. harzianum had significantly lower weight losses (0-25%). Histological studies on one of the wood destroying basidiomycetes revealed typical decomposition of wood cells by brown-rot fungi in Cu-impregnated samples, that were notably absent in wood specimens previously exposed to T

  5. Two New Cyathane Diterpenoids from Mycelial Cultures of the Medicinal Mushroom Hericium erinaceus and the Rare Species, Hericium flagellum

    OpenAIRE

    Rupcic, Zeljka; Rascher, Monique; Kanaki, Sae; Köster, Reinhard W.; Stadler, Marc; Wittstein, Kathrin

    2018-01-01

    Basidiomycetes of the genus Hericium are among the most praised medicinal and edible mushrooms, which are known to produce secondary metabolites with the potential to treat neurodegenerative diseases. This activity has been attributed to the discovery of various terpenoids that can stimulate the production of nerve growth factor (NGF) or (as established more recently) brain-derived neurotrophic factor (BDNF) in cell-based bioassays. The present study reports on the metabolite profiles of a Li...

  6. Bioremediation of lignosulphonates by lignin-degrading basidiomycetous fungi.

    Science.gov (United States)

    Eugenio, M E; Carbajo, J M; Terrón, M C; González, A E; Villar, J C

    2008-07-01

    The capability of some ligninolytic fungi to degrade lignosulphonates has been studied. Three lignosulphonates concentrations, three culture media and seven different basidiomycetes in solid-cultures have been assayed to select the conditions for further experiments on submerged cultures. The best results of growth and lignosulphonate decolourization in solid-cultures were obtained with Pycnoporus sanguineus, Coriolus pubescens and Trametes sp. I-62 on Kirk's medium and 1% and 2% of lignosulphonate concentrations. In submerged cultures the lignosulphonate decolourization rate was generally higher when it was added on the 6th day, rather than when it was added from the beginning of the incubation and C. pubescens and P. sanguineus showed again the optimum results of decolourization. Extracellular laccase activity increased with lignosulphonate concentration in all assayed fungi, suggesting that lignosulphonate act as inductors of laccase activity.

  7. Radiation damage to mushrooms

    International Nuclear Information System (INIS)

    Sattler, P.W.

    1986-01-01

    This document contains newspaper cuttings and correspondence with various ministries in Hessen on the subject of radiation damage to mushrooms from the Odenwald area. The reader is given, amongst other things, detailed information on radiation damage to different types of mushroom in 1986. (MG) [de

  8. Radiocesium uptake mechanisms in wild and culture mushrooms

    International Nuclear Information System (INIS)

    Sugiyama, Hideo; Terada, Hiroshi; Isomura, Kimio; Tsukada, Hirofumi; Shibata, Hisashi.

    1993-01-01

    Concentrations of 137 Cs and stable Cs in wild mushrooms, cultivated mushrooms and those substrates were measured by gamma-ray spectrometry and neutron activation analysis. The average concentration of 137 Cs in 80 wild mushrooms in Japan was 87.5 Bq/kg (wet wt.), and concentration of 137 Cs in mycorrhizal mushrooms was higher than that of saprophytic mushrooms. High concentrations of 137 Cs were found in Pleurotus ostreatus (Fr.) Kummer Y-1, saprophytic mushrooms, cultivated in culture substrates containing high 137 Cs. Clear correlations with 5% level of significance were found between wild mushroom-to-substrate ratios (wet/dry) of 137 Cs concentration and those of stable Cs. Cultivated P. ostreatus-to-culture substrate ratios (wet/wet) of 137 Cs concentration were stable in the order of 10 0 when the culture substrate was containing 10 000 Bq/kg (wet wt.) of 137 Cs or 1 000 mg/kg (wet wt.) of stable Cs. The ratios of 137 Cs concentration in cultivated mushrooms were about equal to those in wild mushrooms. Higher concentration of 137 Cs in culture substrate after sampling P. ostreatus was observed at the upper layer where mycelium density was high. (author)

  9. Hepatoprotective Effects of Mushrooms

    Directory of Open Access Journals (Sweden)

    Rosane Marina Peralta

    2013-07-01

    Full Text Available The particular characteristics of growth and development of mushrooms in nature result in the accumulation of a variety of secondary metabolites such as phenolic compounds, terpenes and steroids and essential cell wall components such as polysaccharides, b-glucans and proteins, several of them with biological activities. The present article outlines and discusses the available information about the protective effects of mushroom extracts against liver damage induced by exogenous compounds. Among mushrooms, Ganoderma lucidum is indubitably the most widely studied species. In this review, however, emphasis was given to studies using other mushrooms, especially those presenting efforts of attributing hepatoprotective activities to specific chemical components usually present in the mushroom extracts.

  10. FUNGI: A REVIEW ON MUSHROOMS

    OpenAIRE

    Abulude, F. Olawale; Ndamitso, M. Muhammed

    2017-01-01

    This paper reviews a fungus – mushrooms. In this paper, identification, cultivation, uses, side effects, nutritional and medicinal values, storage, marketing and other uses of mushrooms were discussed. From the review too it was observed that its usefulness surpasses the side effects. These side effects could be eliminated if proper ‘processing’ could be employed. Due to advances in both basic knowledge and practical technology relevant to mushroom farming, mushroom products and mushroom bior...

  11. Cultivation experiments on uptake of radionuclides by mushrooms

    International Nuclear Information System (INIS)

    Ban-nai, Tadaaki; Yoshida, Satoshi; Muramatsu, Yasuyuki

    1994-01-01

    After the Chernobyl accident, high concentrations of radiocesium in mushrooms were found in Europe. In our previous studies, we found that 137 Cs concentrations in mushrooms were markedly higher than autotrophic plants. In order to study radionuclide uptake by mushrooms, cultivation experiments in flasks were carried out using radiotracers, 137 Cs, 85 Sr, 60 Co, 54 Mn and 65 Zn. Three mushroom species Hebeloma vinosophyllum, Flammulina velutipes and Coprinus phlyctidosporus were used. In addition, a plant sample, Medicago sativa, was also tested. We found mushrooms tended to accumulate Cs, although there was a large difference between mushroom species. The concentration ratio, which was defined as 'activity of radionuclide in mushroom (Bq/g, wet wt.)' divided by 'activity of radionuclide in medium (Bq/g, wet wt.)', had the highest value of 21 for Cs in H. vinosophyllum. The value was much higher than that in the plant sample. The present findings agreed with previous observations in which Hebeloma species collected in forests contained large amount of 137 Cs. Considerable accumulations were not found for Sr and Co. The concentration ratio of Mn for the mushrooms was about 10, while the ratio of Zn ranged from 15 to 30. The effects of stable elements in the medium on the accumulations were investigated and was found the concentration ratios of Cs, Sr and Co were not influenced highly by coexisting stable elements in the medium. But the concentration ratio of Mn decreased as the amount of coexisting stable elements in the medium was increased. (author)

  12. Cesium fixation in mushrooms

    International Nuclear Information System (INIS)

    Keller, C.

    1990-01-01

    It has been found that the various mushroom species accumulate Cs-137 in very different quantities. Whereas specimens of the species Xeromus badius always contained high amounts of Cs-137, analyses of specimens of the related species Boletus edulis showed only weak accumulation of the radionuclide. It is assumed that this general difference in accumulation of Cs-137 is due to a difference in the organic constituents of the mushrooms. (orig.) [de

  13. Medium selection for exopolysaccharide and biomass production in submerged cultures of culinary-medicinal mushrooms from Turkey

    NARCIS (Netherlands)

    Kizilcik, M.; Yamaç, M.; Griensven, van L.J.L.D.

    2010-01-01

    The present study investigates the exopolysaccharide (EPS) and biomass production of 18 strains of 15 species of culinary-medicinal higher Basidiomycetes in submerged culture under four different media. Gloeophyllum abietinum and Schizophyllum commune produced the highest EPS and biomass

  14. Selenium in edible mushrooms.

    Science.gov (United States)

    Falandysz, Jerzy

    2008-01-01

    Selenium is vital to human health. This article is a compendium of virtually all the published data on total selenium concentrations, its distribution in fruitbody, bioconcentration factors, and chemical forms in wild-grown, cultivated, and selenium-enriched mushrooms worldwide. Of the 190 species reviewed (belonging to 21 families and 56 genera), most are considered edible, and a few selected data relate to inedible mushrooms. Most of edible mushroom species examined until now are selenium-poor (cesarea, A. campestris, A. edulis, A. macrosporus, and A. silvaticus. A particularly rich source of selenium could be obtained from selenium-enriched mushrooms that are cultivated on a substrate fortified with selenium (as inorganic salt or selenized-yeast). The Se-enriched Champignon Mushroom could contain up to 30 or 110 microg Se/g dw, while the Varnished Polypore (Ganoderma lucidum) could contain up to 72 microg Se/g dw. An increasingly growing database on chemical forms of selenium of mushrooms indicates that the seleno-compounds identified in carpophore include selenocysteine, selenomethionine, Se-methylselenocysteine, selenite, and several unidentified seleno-compounds; their proportions vary widely. Some aspects of environmental selenium occurrence and human body pharmacokinetics and nutritional needs will also be briefly discussed in this review.

  15. SEARCH PRODUCERS OF POLYPHENOLS AND SOME PIGMENTS AMONG BASIDIOMYCETES

    Directory of Open Access Journals (Sweden)

    Fedotov О. V.

    2014-02-01

    Full Text Available General content of polyphenols, carotenoids and melanin in basidiomycetes carpophorus was determined. 50 species were studied, 27 of which belong to the Polyporales form and 23 are to the Agaricales form. In order to determine the total content of phenolic substances spectrophotometric methods were used. Polyphenols were studied in alcoholic extracts through the modified Folin-Chokalteu procedure; melanin — by alkaline hydrolysis and calculated using a calibration curve (by pyrocatechol, carotenoids were studied in acetone extracts and calculated by the Vetshteyn formula. Statistical and cluster analysis of the data enabled to identify species of basidiomycetes that are perspective for biotechnology. The most promising in terms of total polyphenols, carotenoids and melanins of poliporal basidiomycetes are species Fomes fomentarius, Ganoderma applanatum, Ganoderma lucidum and Laetiporus sulphureus, and among agarikal fungi — Fistulina hepatica, Flammulina velutipes, Pleurotus ostreatus, Stropharia rugosoannulata, Agrocybe cylindracea and Tricholoma flavovirens. These species of Basidiomycetes were isolated in pure mycelia culture to find out their biosynthetic activity.

  16. Cytotoxic Effect on Human Myeloma Cells and Leukemic Cells by the Agaricus blazei Murill Based Mushroom Extract, Andosan™

    Directory of Open Access Journals (Sweden)

    Jon-Magnus Tangen

    2017-01-01

    Full Text Available Agaricus blazei Murill is an edible mushroom of the Basidiomycetes family, which has been found to contain a number of compounds with antitumor properties, such as proteoglycans and ergosterol. In the present investigation, we show that the commercial mushroom product Andosan, which contains 82.4% Agaricus blazei Murill, together with medicinal mushrooms Hericium erinaceus (14.7% and Grifola frondosa (2.9%, has a cytotoxic effect on primary myeloma cells, other myeloma cell lines, and leukemia cell lines in vitro. Although the exact content and hence the mechanisms of action of the Andosan extract are unknown, we have found in this investigation indications of cell cycle arrest when myeloma cell lines are cultivated with Andosan. This may be one of the possible explanations for the cytotoxic effects of Andosan.

  17. Molecular phylogenetic analysis of fleshy pored mushrooms: Neoboletus luridiformis and Hortiboletus rubellus from western Himalayan range of Pakistan

    International Nuclear Information System (INIS)

    Sarwar, S.; Khalid, N.; Dentinger, B.M.

    2016-01-01

    Fleshy pored mushrooms is the name given to boletes due to their porous hymenium and fleshy nature. These are ectomycorrhizal basidiomycetes found in all continents except Antarctica. These mushrooms are important economically due to their edibility and medicinal value. This research work highlights the diversity of boletes in Pakistan and their correct identification by using molecular phylogenetic techniques. Western Himalayan range (WHR) of Pakistan is considered as diversity rich area. During present investigation regarding diversity of boletes in these areas, two bolete taxa viz. Hortiboletus rubellus and Neoboletus luridiformis were found under conifers. These mushrooms were collected and analyzed morphologically as well as phylogenetically by using Internal Transcribed Spacer (ITS) region of nrDNA sequences, and compared with their allies. All description and comparison with related taxa is provided in detail. These boletes are first time analyzed using molecular method from Pakistan. (author)

  18. The Medicinal Values of Culinary-Medicinal Royal Sun Mushroom (Agaricus blazei Murrill

    Directory of Open Access Journals (Sweden)

    Hang Wang

    2013-01-01

    Full Text Available Agaricus blazei Murrill (ABM, a mushroom native to Brazil, is a basidiomycete brown fungus, which is popularly known as “Cogumelo do Sol” in Brazil or “Himematsutake” in Japan, and there has been a prominent increase in the use of ABM for therapeutic and medicinal purposes. ABM is useful against a variety of diseases like cancer, tumor, chronic hepatitis, diabetes, atherosclerosis, hypercholesterolemia, and so on. In this review, we demonstrated various pharmacological effects of ABM, so that we can use different effects of ABM against different diseases and provide reference for the study of ABM in the future.

  19. Mineral Composition of Four Edible Mushrooms

    Directory of Open Access Journals (Sweden)

    S. E. Mallikarjuna

    2013-01-01

    Full Text Available Two cultivated mushroom species, namely, Lentinula edodes and Pleurotus florida and two wild growing species Lentinus cladopus and Pleurotus djamor were studied for their mineral contents such as Ca, Mg, Na, K, Fe, Zn, Mn, Cu, Ni, Se, Pb, and Cd by Inductive Coupled Plasma Atomic Emission Spectroscopy (ICP-AES and also Atomic Absorption Spectroscopy, (AAS. Phosphorus was estimated by spectrophotometric method. K, Ca, Na, and P were in higher concentrations ranging from 59.3 mg to 3634 mg, 8.27 mg–174.9 mg, 22.2 mg–327.4 mg, and 100.5 mg–769.9 mg/100 g dry weight respectively in the four mushroom species studied. Fe, Zn, Mg and Se were ranging from 6.27 mg to 35.3 mg, 1.58 mg–9.44 mg, 21.1 mg–40.7 mg and 0.048 mg–0.182 mg/100 g dry weight, respectively, amongst the mushroom species analyzed. However, Ni, Cu, and Mn contents showed relatively lower concentrations, whereas Pb and Cd were below detectable level. The mushrooms were safe for consumption, in accordance with the permissible tolerance limits of the estimated toxic metals. Implications of the mineral contents on mushroom nutritional value are highlighted.

  20. Oyster mushroom cultivation with rice and wheat straw.

    Science.gov (United States)

    Zhang, Ruihong; Li, Xiujin; Fadel, J G

    2002-05-01

    Cultivation of the oyster mushroom, Pleurotus sajor-caju, on rice and wheat straw without nutrient supplementation was investigated. The effects of straw size reduction method and particle size, spawn inoculation level, and type of substrate (rice straw versus wheat straw) on mushroom yield, biological efficiency, bioconversion efficiency, and substrate degradation were determined. Two size reduction methods, grinding and chopping, were compared. The ground straw yielded higher mushroom growth rate and yield than the chopped straw. The growth cycles of mushrooms with the ground substrate were five days shorter than with the chopped straw for a similar particle size. However, it was found that when the straw was ground into particles that were too small, the mushroom yield decreased. With the three spawn levels tested (12%, 16% and 18%), the 12% level resulted in significantly lower mushroom yield than the other two levels. Comparing rice straw with wheat straw, rice straw yielded about 10% more mushrooms than wheat straw under the same cultivation conditions. The dry matter loss of the substrate after mushroom growth varied from 30.1% to 44.3%. The straw fiber remaining after fungal utilization was not as degradable as the original straw fiber, indicating that the fungal fermentation did not improve the feed value of the straw.

  1. SCREENING OF CONTENT AND DYNAMIC OF ACCUMULATION OF POLYPHENOLS IN SOME BASIDIOMYCETES SPECIES

    Directory of Open Access Journals (Sweden)

    A. K. Veligodska

    2015-11-01

    Full Text Available The aim of the study was to investigate the total content of polyphenolic substances in Basidiomycetes carpophores from 50 species, of which 27 belong to the order Polyporales and 23 to the order Agaricales. Introduced 23 strains of 8 species of Basidiomycetes. Methods. Gathered wild carpophores dried and crushed to a particle size of 0,1 till 0,01 mm and searching strains were cultured in Erlenmeyyers flasks by surface method on standard glucose-peptone culture medium. Determination of total content of polyphenolic compounds was carried out in ethanol extracts of mycological material by a modified method of Folin-Chokalteu. Completely dry biomass of carpophores and mycelium was determined gravimetrically. Results. There was identified the species of polyporal fungi Ganoderma applanatum, Ganoderma lucidum, Laetiporus sulphureus and Fomes fomentarius and types of agarical mushrooms Stropharia rugosoannulata, Agrocybe cylindracea, Tricholoma flavovirens, Flammulina velutipes, Pleurotus ostreatus and Fistulina hepatica high in polyphenolic compounds. It was determined the content of polyphenols ranging from more than 60 mg / g completely dry biomass. For introduced strains established dynamics of growth and accumulation of polyphenolic compounds in the mycelium and culture filtrate during fermentation on glucose-peptone medium. All cultures reach a maximum accumulation of biomass on the 12th day of growth. Shizophyllum commune Sc-1101 and 10 and F. velutipes F-202 have been identified as the most productive strains. The lowest accumulation of absolutely dry biomass was recorded for strain P. ostreatus P-192 and strain F. fomentarius Ff-09. Cultures have investigated individual value growth such as biomass accumulation in the applied cultivation conditions, which probably reflects the suitability of the medium for their growth and genotypic characteristics. Strains are overwhelmingly able to accumulate polyphenolic compounds in both mycelium and

  2. Effect of Cold Stress on Fruiting Body Production by Medicinal Basidiomycetes in Submerged and Solid-phase Culture

    Directory of Open Access Journals (Sweden)

    E.P. Vetchinkina

    2017-05-01

    Full Text Available The ability of the medicinal xylotrophic basidiomycetes Lentinus edodes, Pleurotus ostreatus, Ganoderma lucidum and Grifola frondosa to produce typical and atypical fruiting bodies with viable basidiospores in submerged and solid-phase culture under stationary conditions in a beer wort-containing medium under cold stress was shown. The examined mushrooms, when not exposed to temperature stress, did not form fruiting bodies. In solid-phase culture in an agarized medium after cold treatment, the basidiome formation period was shortened by 1.5–2 times. Furthermore, the use of a mycelium subjected to temperature stress for inoculation induced and accelerated the formation of fruiting bodies on an industrial wood substrate, which is of great biotechnological importance.

  3. Radiocaesium - 137 in cultivated and woodland mushrooms

    International Nuclear Information System (INIS)

    Stankovic, S.; Stankovic, A.

    1997-01-01

    In the present work the results obtained for activity levels of 137 Cs in samples of cultivated mushrooms (Champignons - Agaricus Silvicola Vitt. Peck.) and woodland fruits ( Chantarelle - Cantarelus Cibarius Fr.; Bollets -Boletus Edulis. ex Fr. and Black Trumpets - Cratarelus Conucopioides) are presented. These samples were collected from 1991 to 1996. Biodiversity of the mushrooms regarding their uptake of radionuclides was found. Thus, the maximum value of 137 Cs activity was found in the sample of dry Bollets 375 Bq/kg in 1993. Moreover, the mean activity level of this species was much higher (126 + - 10 Bq/kg) in 1996. than, levels found in any samples taken from the same environment. (author)

  4. Antioxidants of Edible Mushrooms

    Directory of Open Access Journals (Sweden)

    Maja Kozarski

    2015-10-01

    Full Text Available Oxidative stress caused by an imbalanced metabolism and an excess of reactive oxygen species (ROS lead to a range of health disorders in humans. Our endogenous antioxidant defense mechanisms and our dietary intake of antioxidants potentially regulate our oxidative homeostasis. Numerous synthetic antioxidants can effectively improve defense mechanisms, but because of their adverse toxic effects under certain conditions, preference is given to natural compounds. Consequently, the requirements for natural, alternative sources of antioxidant foods identified in edible mushrooms, as well as the mechanistic action involved in their antioxidant properties, have increased rapidly. Chemical composition and antioxidant potential of mushrooms have been intensively studied. Edible mushrooms might be used directly in enhancement of antioxidant defenses through dietary supplementation to reduce the level of oxidative stress. Wild or cultivated, they have been related to significant antioxidant properties due to their bioactive compounds, such as polyphenols, polysaccharides, vitamins, carotenoids and minerals. Antioxidant and health benefits, observed in edible mushrooms, seem an additional reason for their traditional use as a popular delicacy food. This review discusses the consumption of edible mushrooms as a powerful instrument in maintaining health, longevity and life quality.

  5. Recycling of Vineyard and Winery Wastes as Nutritive Composts for Edible Mushroom Cultivation

    Science.gov (United States)

    Petre, Marian; Teodorescu, Alexandru

    2011-01-01

    Every year, in Romania huge amounts of wine and vine wastes cause serious environmental damages in vineyards as well as nearby winery factories, for instance, by their burning on the soil surface or their incorporation inside soil matrix. The optimal and efficient way to solve these problems is to recycle these biomass wastes as main ingredients in nutritive composts preparation that could be used for edible mushrooms cultivation. In this respect, the main aim of this work was to establish the best biotechnology of winery and vine wastes recycling by using them as appropriate growth substrata for edible and medicinal mushrooms. According to this purpose, two mushroom species of Basidiomycetes, namely Lentinula edodes as well as Pleurotus ostreatus were used as pure mushroom cultures in experiments. The experiments of inoculum preparation were set up under the following conditions: constant temperature, 23° C; agitation speed, 90-120 rev min-1 pH level, 5.0-6.0. All mycelia mushroom cultures were incubated for 120-168 h. In the next stage of experiments, the culture composts for mushroom growing were prepared from the lignocellulose wastes as vine cuttings and marc of grapes in order to be used as substrata in mycelia development and fruit body formation. The tested culture variants were monitored continuously to keep constant the temperature during the incubation as well as air humidity, air pressure and a balanced ratio of the molecular oxygen and carbon dioxide. In every mushroom culture cycle all the physical and chemical parameters that could influence the mycelia growing as well as fruit body formation of L. edodes and P. ostreatus were compared to the same fungal cultures that were grown on poplar logs used as control samples.

  6. Selenium content of mushrooms.

    Science.gov (United States)

    Stijve, T

    1977-07-29

    The selenium contents of 83 species of wild mushrooms were determined by oxygen combustion of the sample, followed by conversion of selenite to bromopiazselenol and final estimation by electron capture gas-liquid chromatography. Selenium concentration were found to range from 0.012-20.0 mg/kg dry weight. Selenium content was species-dependent. High concentrations were found in Agaricaceae and in certain Boletaceae of the genus Tubiporus, whereas in Russulaceae, Amanitaceae and Cantharellaceae selenium-rich species were absent or rare. Ascomycetes and all mushrooms growing on wood had a very low selenium content. The highest selenium concentrations (up to 20 ppm) were found in Boletus (Tubiporus) edulis, a most popular edible mushroom. Analyses of various parts of carpophores of B. edulis, Suillus luteus and Amanita muscaria indicate that in all three species the stalk contains less selenium than the fleshy part of the cap. In Boletus and Suillus the highest selenium content was found in the tubes.

  7. Sequencing and comparative analysis of the straw mushroom (Volvariella volvacea genome.

    Directory of Open Access Journals (Sweden)

    Dapeng Bao

    Full Text Available Volvariella volvacea, the edible straw mushroom, is a highly nutritious food source that is widely cultivated on a commercial scale in many parts of Asia using agricultural wastes (rice straw, cotton wastes as growth substrates. However, developments in V. volvacea cultivation have been limited due to a low biological efficiency (i.e. conversion of growth substrate to mushroom fruit bodies, sensitivity to low temperatures, and an unclear sexuality pattern that has restricted the breeding of improved strains. We have now sequenced the genome of V. volvacea and assembled it into 62 scaffolds with a total genome size of 35.7 megabases (Mb, containing 11,084 predicted gene models. Comparative analyses were performed with the model species in basidiomycete on mating type system, carbohydrate active enzymes, and fungal oxidative lignin enzymes. We also studied transcriptional regulation of the response to low temperature (4°C. We found that the genome of V. volvacea has many genes that code for enzymes, which are involved in the degradation of cellulose, hemicellulose, and pectin. The molecular genetics of the mating type system in V. volvacea was also found to be similar to the bipolar system in basidiomycetes, suggesting that it is secondary homothallism. Sensitivity to low temperatures could be due to the lack of the initiation of the biosynthesis of unsaturated fatty acids, trehalose and glycogen biosyntheses in this mushroom. Genome sequencing of V. volvacea has improved our understanding of the biological characteristics related to the degradation of the cultivating compost consisting of agricultural waste, the sexual reproduction mechanism, and the sensitivity to low temperatures at the molecular level which in turn will enable us to increase the industrial production of this mushroom.

  8. Sequencing and Comparative Analysis of the Straw Mushroom (Volvariella volvacea) Genome

    Science.gov (United States)

    Bao, Dapeng; Gong, Ming; Zheng, Huajun; Chen, Mingjie; Zhang, Liang; Wang, Hong; Jiang, Jianping; Wu, Lin; Zhu, Yongqiang; Zhu, Gang; Zhou, Yan; Li, Chuanhua; Wang, Shengyue; Zhao, Yan; Zhao, Guoping; Tan, Qi

    2013-01-01

    Volvariella volvacea, the edible straw mushroom, is a highly nutritious food source that is widely cultivated on a commercial scale in many parts of Asia using agricultural wastes (rice straw, cotton wastes) as growth substrates. However, developments in V. volvacea cultivation have been limited due to a low biological efficiency (i.e. conversion of growth substrate to mushroom fruit bodies), sensitivity to low temperatures, and an unclear sexuality pattern that has restricted the breeding of improved strains. We have now sequenced the genome of V. volvacea and assembled it into 62 scaffolds with a total genome size of 35.7 megabases (Mb), containing 11,084 predicted gene models. Comparative analyses were performed with the model species in basidiomycete on mating type system, carbohydrate active enzymes, and fungal oxidative lignin enzymes. We also studied transcriptional regulation of the response to low temperature (4°C). We found that the genome of V. volvacea has many genes that code for enzymes, which are involved in the degradation of cellulose, hemicellulose, and pectin. The molecular genetics of the mating type system in V. volvacea was also found to be similar to the bipolar system in basidiomycetes, suggesting that it is secondary homothallism. Sensitivity to low temperatures could be due to the lack of the initiation of the biosynthesis of unsaturated fatty acids, trehalose and glycogen biosyntheses in this mushroom. Genome sequencing of V. volvacea has improved our understanding of the biological characteristics related to the degradation of the cultivating compost consisting of agricultural waste, the sexual reproduction mechanism, and the sensitivity to low temperatures at the molecular level which in turn will enable us to increase the industrial production of this mushroom. PMID:23526973

  9. Proximate compositions and bioactive compounds of edible wild and cultivated mushrooms from Northeast Thailand

    Directory of Open Access Journals (Sweden)

    Amporn Srikram

    2016-11-01

    Full Text Available Mushrooms are known as an excellent source of nutrients including macronutrients and bioactive compounds. Nutritional values were investigated involving proximate analysis, total antioxidant capacity (TAC, total phenol content (TPC and total flavonoid content (TFC of 10 edible wild mushroom species—Amanita calyptroderma Ark. et al., Amanita princeps Corner et Bas, A., Astraeus odoratus, Heimiella retispora (Pat. et. Bak. Boedijn., Mycoamaranthus cambodgensis (Pat. Trappe, Russula alboareolata Hongo, Russula cyanoxantha Schaeff.ex.Fr., Russula emetic (Schaeff. ex Fr. S.F.Gray., Russula virescens (Schaeff. fr., Termitomyces clypeatus Heim—and five cultivated mushroom species—Auricularia auricula-judae, Lentinus polychrous Lev., Lentinus squarrosulus Mont., Pleurotus sajor-caju (Fr. Sing, Volvariella vovacea (Bull. Ex.Fr. Sing. From the proximate analysis, the moisture contents of both wild and cultivated mushrooms ranged from 84.15% fresh weight (FW to 90.21% FW. The ash, crude protein, fat, crude fiber and carbohydrate contents of both wild and cultivated mushrooms were in the dry weight ranges 2.56–13.96%, 11.16–50.29%, 1.43–21.94%, 2.11–38.11% and 9.56–59.73%, respectively, and the contents of macronutrients in the mushrooms varied by variety. Wild mushrooms had a high fiber content compared to cultivated mushrooms. The contents of biologically active compounds of both wild and cultivated mushrooms also varied depending on the variety. Values for the TAC, TPC and TFC of wild mushrooms were higher than those of cultivated mushrooms. In conclusion, the proximate analysis for both wild and cultivated mushrooms was variety dependent and wild mushrooms contained a higher fiber content and more biologically active compounds than cultivated mushrooms.

  10. Halotolerance, ligninase production and herbicide degradation ability of basidiomycetes strains.

    Science.gov (United States)

    Arakaki, R L; Monteiro, D A; Boscolo, M; Dasilva, R; Gomes, E

    2013-12-01

    Fungi have been recently recognized as organisms able to grow in presence of high salt concentration with halophilic and halotolerance properties and their ligninolytic enzyme complex have an unspecific action enabling their use to degradation of a number of xenobiotic compounds. In this work, both the effect of salt and polyols on growth of the basidiomycetes strains, on their ability to produce ligninolytic enzyme and diuron degradation were evaluated. Results showed that the presence of NaCl in the culture medium affected fungal specimens in different ways. Seven out of ten tested strains had growth inhibited by salt while Dacryopinax elegans SXS323, Polyporus sp MCA128 and Datronia stereoides MCA167 fungi exhibited higher biomass production in medium containing 0.5 and 0.6 mol.L(-1) of NaCl, suggesting to be halotolerant. Polyols such as glycerol and mannitol added into the culture media improved the biomass and ligninases production by D. elegans but the fungus did not reveal consumption of these polyols from media. This fungus degraded diuron in medium control, in presence of NaCl as well as polyols, produced MnP, LiP and laccase.

  11. Halotolerance, ligninase production and herbicide degradation ability of basidiomycetes strains

    Directory of Open Access Journals (Sweden)

    R.L. Arakaki

    2013-12-01

    Full Text Available Fungi have been recently recognized as organisms able to grow in presence of high salt concentration with halophilic and halotolerance properties and their ligninolytic enzyme complex have an unspecific action enabling their use to degradation of a number of xenobiotic compounds. In this work, both the effect of salt and polyols on growth of the basidiomycetes strains, on their ability to produce ligninolytic enzyme and diuron degradation were evaluated. Results showed that the presence of NaCl in the culture medium affected fungal specimens in different ways. Seven out of ten tested strains had growth inhibited by salt while Dacryopinax elegans SXS323, Polyporus sp MCA128 and Datronia stereoides MCA167 fungi exhibited higher biomass production in medium containing 0.5 and 0.6 mol.L-1 of NaCl, suggesting to be halotolerant. Polyols such as glycerol and mannitol added into the culture media improved the biomass and ligninases production by D. elegans but the fungus did not reveal consumption of these polyols from media. This fungus degraded diuron in medium control, in presence of NaCl as well as polyols, produced MnP, LiP and laccase.

  12. Preservation of live cultures of basidiomycetes - recent methods.

    Science.gov (United States)

    Homolka, Ladislav

    2014-02-01

    Basidiomycetes are used in industrial processes, in basic or applied research, teaching, systematic and biodiversity studies. Efficient work with basidiomycete cultures requires their reliable source, which is ensured by their safe long-term storage. Repeated subculturing, frequently used for the preservation, is time-consuming, prone to contamination, and does not prevent genetic and physiological changes during long-term maintenance. Various storage methods have been developed in order to eliminate these disadvantages. Besides lyophilization (unsuitable for the majority of basidiomycetes), cryopreservation at low temperatures seems to be a very efficient way to attain this goal. Besides survival, another requirement for successful maintenance of fungal strains is the ability to preserve their features unchanged. An ideal method has not been created so far. Therefore it is highly desirable to develop new or improve the current preservation methods, combining advantages and eliminate disadvantages of individual techniques. Many reviews on preservation of microorganisms including basidiomycetes have been published, but the progress in the field requires an update. Although herbaria specimens of fungi (and of basidiomycetes in particular) are very important for taxonomic and especially typological studies, this review is limited to live fungal cultures. Copyright © 2013 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

  13. Nutritional value of huitlacoche, maize mushroom caused by Ustilago maydis

    Directory of Open Access Journals (Sweden)

    Mehmet AYDOĞDU

    2017-09-01

    Full Text Available Abstract Smutty maize cobs, caused by Ustilago maydis ((DC Corda., a fungus belonging to Basidiomycetes, can be seen wherever maize is grown. It is considered as a fungal disease limiting maize yield worldwide. However, in Mesoamerica, it is called as “huitlacoche” and evaluated as an edible mushroom. The present study was conducted to examine nutritional characteristics of this mushroom. In the study, smutty cobs naturally infected by U. maydis were randomly gleaned from plants in maize producing areas in the Mediterranean region of Turkey, in 2015. Huitlacoche was analyzed in terms of proximate composition, fatty acids, mineral elements, total phenolic and flavonoid matters and antioxidant activity. Average protein content was 12%, while fatty acids ranged from 0.44 to 42.49% (dry basis. Of the 11 fatty acids, oleic and linoleic acids had the highest percentages. Phosphorus (342.07 mg/kg and magnesium (262.69 mg/kg were found in high quantities. As for total phenolic and flavonoid matters were 113.11 mg GAE/kg and 28.51 mg CE/kg, respectively. The study suggests that huitlacoche has numerous good nutritional features for human diet, thus, it can be evaluated as a valuable food source in international cuisines.

  14. Comparison of the Diversity of Basidiomycetes from Dead Wood of the Manchurian fir (Abies holophylla) as Evaluated by Fruiting Body Collection, Mycelial Isolation, and 454 Sequencing.

    Science.gov (United States)

    Jang, Yeongseon; Jang, Seokyoon; Min, Mihee; Hong, Joo-Hyun; Lee, Hanbyul; Lee, Hwanhwi; Lim, Young Woon; Kim, Jae-Jin

    2015-10-01

    In this study, three different methods (fruiting body collection, mycelial isolation, and 454 sequencing) were implemented to determine the diversity of wood-inhabiting basidiomycetes from dead Manchurian fir (Abies holophylla). The three methods recovered similar species richness (26 species from fruiting bodies, 32 species from mycelia, and 32 species from 454 sequencing), but Fisher's alpha, Shannon-Wiener, Simpson's diversity indices of fungal communities indicated fruiting body collection and mycelial isolation displayed higher diversity compared with 454 sequencing. In total, 75 wood-inhabiting basidiomycetes were detected. The most frequently observed species were Heterobasidion orientale (fruiting body collection), Bjerkandera adusta (mycelial isolation), and Trichaptum fusco-violaceum (454 sequencing). Only two species, Hymenochaete yasudae and Hypochnicium karstenii, were detected by all three methods. This result indicated that Manchurian fir harbors a diverse basidiomycetous fungal community and for complete estimation of fungal diversity, multiple methods should be used. Further studies are required to understand their ecology in the context of forest ecosystems.

  15. Uptake and transfer factors of 137Cs by mushrooms

    International Nuclear Information System (INIS)

    Heinrich, G.

    1991-01-01

    The 137 Cs content of 118 species (668 samples) of higher fungi collected in the period from August 1984 to October 1989 at three different locations in Styria, Austria, was determined by gamma-spectrometry. The Cs-content of most mushrooms has been increasing since September 1986. In order to find out which factors determine the 137 Cs-contamination of mushrooms and the transfer-value soil to mushroom, the concentration of total and plant-available radiocesium in soils as well as the pH-value, the content of humus, clay, silt, sand, exchangeable cations, the composition of the clay minerals, and the particle size distribution of the soils of two different locations were examined. The higher the 137 Cs contamination of the soil, the thicker the layer of humus and the higher the content of humus, the lower the pH-value, and the lower the amount of essential cations, especially of K + , the higher the amount of 137 Cs plant-available will be. Therefore, the contamination of the mushrooms in the coniferous forest of Koralpenblick (1000 m) is higher than in the mixed forest at the Rosenberg around Graz at approx. 500 m height. Of 26 different species of mushrooms measured at both sites, only 61% show the highest TF-values soil to mushrooms also at the Koralpenblick. In the spruce forest at Koralpenblick there are many species of mushrooms with high 137 Cs-contamination which were not found at the Rosenberg. However, the properties of the species to which a mushroom belongs are more important than environmental conditions and soil properties. The transfer values of 40 K stay within narrow bounds, whereas those of 137 Cs differ widely. (orig.)

  16. Diversity and evolution of ABC proteins in basidiomycetes.

    Science.gov (United States)

    Kovalchuk, Andriy; Lee, Yong-Hwan; Asiegbu, Fred O

    2013-01-01

    ABC proteins constitute one of the largest families of proteins. They are implicated in wide variety of cellular processes ranging from ribosome biogenesis to multidrug resistance. With the advance of fungal genomics, the number of known fungal ABC proteins increases rapidly but the information on their biological functions remains scarce. In this work we extended the previous analysis of fungal ABC proteins to include recently sequenced species of basidiomycetes. We performed an identification and initial cataloging of ABC proteins from 23 fungal species representing 10 orders within class Agaricomycotina. We identified more than 1000 genes coding for ABC proteins. Comparison of sets of ABC proteins present in basidiomycetes and ascomycetes revealed the existence of two groups of ABC proteins specific for basidiomycetes. Results of survey should contribute to the better understanding of evolution of ABC proteins in fungi and support further experimental work on their characterization.

  17. Amanitin and phallotoxin concentration in Amanita phalloides var. alba mushroom.

    Science.gov (United States)

    Kaya, Ertugrul; Yilmaz, Ismail; Sinirlioglu, Zeynep Aydin; Karahan, Selim; Bayram, Recep; Yaykasli, Kursat Oguz; Colakoglu, Serdar; Saritas, Ayhan; Severoglu, Zeki

    2013-12-15

    Although rarely seen, Amanita phalloides var. alba, a variety of A. phalloides type mushrooms, causes mushroom poisoning resulting in death. Since it is frequently confused with some edible mushrooms due to its white colored cap and macroscopic appearance, it becomes important in toxicological terms. Knowledge of the toxin amount contained in this mushroom type is invaluable in the treatment of cases involving poisoning. In this study, we examined the toxin levels of various parts of the A. phalloides var. alba mushroom growing Duzce region of Turkey. Toxin analyses were carried out for A. phalloides var. alba, which were collected from the forests Duzce region of Turkey in 2011, as a whole and also separately in its spore, pileus, gills, stipe and volva parts. The alpha amanitin, beta amanitin, gamma amanitin, phalloidin and phallacidine analyses of the mushrooms were carried out using the RP-HPLC method. A genetic analysis of the mushroom showed that it had similar genetic characteristics as A. phalloides and was a variety of it. The lowest toxins quantity was detected in spores, volva and stipe among all parts of the mushroom. The maximum amount of amatoxins was measured in the gills. The pileus also contained a high amount of amatoxins. Generally, amatoxins and phallotoxin concentrations were lower as compared to A. phalloides, but interestingly all toxins other than gamma toxin were higher in the spores of A. phalloides var. alba. The amount of toxin in all of its parts had sufficient concentrations to cause death. With this study, the amatoxin and phallotoxin concentrations in A. phalloides var. alba mushroom and in its parts have been revealed in detail for the first time. Copyright © 2013 Elsevier Ltd. All rights reserved.

  18. Accumulation of radiocesium and trace elements in mushrooms collected from Japanese forests

    International Nuclear Information System (INIS)

    Yoshida, S.; Muramatsu, Y.; Ban-Nai, T.

    1996-01-01

    Concentrations of 137 Cs, 134 Cs and 40 K for 124 mushroom species (284 samples) collected from Japanese forests during 1989 to 1991 were studied. The levels of 137 Cs m mushrooms varied very widely ranging from 40 K were relatively constant. The median concentrations of 137 Cs and 40 K were 53 and 1180 Bq/kg (dry wt), respectively. The 134 Cs discharged through the Chernobyl accident was detected only in 33 mushroom samples. The proportions of 137 Cs originating from the Chernobyl accident m these mushrooms were in the range 137 Cs concentrations in mycorrhizal fungi tended to be higher than those in saprophytes. The concentrations in many mushrooms reflected the layers m which their mycelia were growing. In addition to the radionuclides, many stable elements including stable Cs in mushroom and soil samples were determined. A good correlation between 137 Cs and stable Cs was observed for 33 mushrooms collected from a pine forest on sandy soil near coast in Tokai-mura, Ibaraki, indicating that mushroom available Cs is recycling in the pine forest with the constant 137 Cs/stable Cs ratio. Accumulations from soil to mushrooms were observed for Cd, Rb, Zn, Cu. Cs, K, Mg, Mn, Ni and Tl. Through cultivation experiments in flasks using radiotracers, 137 Cs, 65 Zn and 54 Mn were observed to be accumulated in mushrooms. (author)

  19. Occurrence of indoor wood decay basidiomycetes in Europe

    Czech Academy of Sciences Publication Activity Database

    Gabriel, Jiří; Švec, Karel

    2017-01-01

    Roč. 31, č. 4 (2017), s. 212-217 ISSN 1749-4613 R&D Projects: GA ČR(CZ) GA17-05497S Institutional support: RVO:61388971 Keywords : Basidiomycetes * Fungi * Serpula lacrymans Subject RIV: EE - Microbiology, Virology OBOR OECD: Microbiology Impact factor: 3.231, year: 2016

  20. Bacterial communities in the fruit bodies of ground basidiomycetes

    Science.gov (United States)

    Zagryadskaya, Yu. A.; Lysak, L. V.; Chernov, I. Yu.

    2015-06-01

    Fruit bodies of basidiomycetes at different stages of decomposition serve as specific habitats in forest biocenoses for bacteria and differ significantly with respect to the total bacterial population and abundance of particular bacterial genera. A significant increase in the total bacterial population estimated by the direct microscopic method with acridine orange staining and in the population of saprotrophic bacteria (inoculation of glucose peptone yeast agar) in fruit bodies of basidiomycetes Armillaria mellea and Coprinus comatus was recorded at the final stage of their decomposition in comparison with the initial stage. Gramnegative bacteria predominated in the tissues of fruit bodies at all the stages of decomposition and were represented at the final stage by the Aeromonas, Vibrio, and Pseudomonas genera (for fruit bodies of A. mellea) the Pseudomonas genus (for fruit bodies of C. comatus). The potential influence of bacterial communities in the fruit bodies of soil basidiomycetes on the formation of bacterial communities in the upper soil horizons in forest biocenoses is discussed. The loci connected with the development and decomposition of fruit bodies of basidiomycetes on the soil surface are promising for targeted search of Gram-negative bacteria, the important objects of biotechnology.

  1. [The composition of volatile components of cepe (Boletus edulis) and oyster mushrooms (Pleurotus ostreatus)].

    Science.gov (United States)

    Misharina, T A; Mukhutdinova, S M; Zharikova, G G; Terenina, M B; Krikunova, N I

    2009-01-01

    The composition of aroma compounds in cooked and canned cepe (Boletus edulis) and in cooked oyster mushrooms (Pleurotus ostreatus) is studied using capillary gas chromatography and chromatography-mass spectrometry. It is found that unsaturated alcohols and ketones containing eight atoms of carbon determine the aroma of raw mushrooms and take part in the formation of the aroma of cooked mushrooms as well. The content of these compounds was the highest in canned cepes. In oyster mushrooms, the concentration of these alcohols and ketones was lower in comparison with cepes. The content of aliphatic and aromatic aldehydes was much higher in oyster mushrooms. Volatile aliphatic and heterocyclic Maillard reaction products and isomeric octenols and octenones formed the aroma of cooked and canned mushrooms.

  2. SCREENING OF CONTENT AND DYNAMIC OF ACCUMULATION OF POLYPHENOLS IN SOME BASIDIOMYCETES SPECIES

    Directory of Open Access Journals (Sweden)

    Veligodska A. K.

    2015-12-01

    Full Text Available The aim of the study was to investigate the total content of polyphenolic substances in Basidiomycetes carpophores from 50 species, of which 27 belong to the order Polyporales and 23 to the order Agaricales. Introduced 23 strains of 8 species of Basidiomycetes. Methods. Gathered wild carpophores dried and crushed to a particle size of 0,1 till 0,01 mm and searching strains were cultured in Erlenmeyyers flasks by surface method on standard glucose-peptone culture medium. Determination of total content of polyphenolic compounds was carried out in ethanol extracts of mycological material by a modified method of Folin-Chokalteu. Completely dry biomass of carpophores and mycelium was determined gravimetrically. Results. There was identified the species of polyporal fungi Ganoderma applanatum, Ganoderma lucidum, Laetiporus sulphureus and Fomes fomentarius and types of agarical mushrooms Stropharia rugosoannulata, Agrocybe cylindracea, Tricholoma flavovirens, Flammulina velutipes, Pleurotus ostreatus and Fistulina hepatica high in polyphenolic compounds. It was determined the content of polyphenols ranging from more than 60 mg / g completely dry biomass. For introduced strains established dynamics of growth and accumulation of polyphenolic compounds in the mycelium and culture filtrate during fermentation on glucose-peptone medium. All cultures reach a maximum accumulation of biomass on the 12th day of growth. Shizophyllum commune Sc-1101 and 10 and F. velutipes F-202 have been identified as the most productive strains. The lowest accumulation of absolutely dry biomass was recorded for strain P. ostreatus P-192 and strain F. fomentarius Ff-09. Cultures have investigated individual value growth such as biomass accumulation in the applied cultivation conditions, which probably reflects the suitability of the medium for their growth and genotypic characteristics. Strains are overwhelmingly able to accumulate polyphenolic compounds in both mycelium and

  3. Global collection of mushroom pathogens

    NARCIS (Netherlands)

    Baars, J.J.P.; Hendrickx, P.M.; Sonnenberg, A.S.M.; Korsten, L.

    2013-01-01

    In many places in the world, increasingly less chemical crop protection agents are available for use in mushroom cultivation. As a consequence, mushroom cultivation will loose the ability to use crop protection agents. As a consequence, good hygiene management, early detection and monitoring of

  4. Accumulation of mercury and methylmercury by mushrooms and earthworms from forest soils

    International Nuclear Information System (INIS)

    Rieder, Stephan R.; Brunner, Ivano; Horvat, Milena; Jacobs, Anna; Frey, Beat

    2011-01-01

    Accumulation of total and methyl-Hg by mushrooms and earthworms was studied in thirty-four natural forest soils strongly varying in soil physico-chemical characteristics. Tissue Hg concentrations of both receptors did hardly correlate with Hg concentrations in soil. Both total and methyl-Hg concentrations in tissues were species-specific and dependent on the ecological groups of receptor. Methyl-Hg was low accounting for less than 5 and 8% of total Hg in tissues of mushrooms and earthworms, respectively, but with four times higher concentrations in earthworms than mushrooms. Total Hg concentrations in mushrooms averaged 0.96 mg Hg kg -1 dw whereas litter decomposing mushrooms showed highest total Hg and methyl-Hg concentrations. Earthworms contained similar Hg concentrations (1.04 mg Hg kg -1 dw) whereas endogeic earthworms accumulated highest amounts of Hg and methyl-Hg. - Highlights: → Hg and MeHg concentrations in mushrooms and earthworms at unpolluted forest soils. → Mushrooms and earthworms contained similar Hg concentrations. → MeHg was present in traces but four times higher in earthworms than in mushrooms. → Ecophysiological group influenced Hg and MeHg concentration in both receptors. - Accumulation of Hg and methyl-Hg by mushrooms and earthworms is species- and ecophysiological group dependent.

  5. Accumulation of mercury and methylmercury by mushrooms and earthworms from forest soils

    Energy Technology Data Exchange (ETDEWEB)

    Rieder, Stephan R. [Rhizosphere Processes Group, Swiss Federal Research Institute WSL, 8903 Birmensdorf (Switzerland); Institute for Biogeochemistry and Pollutant Dynamics, ETH Zuerich, 8092 Zuerich (Switzerland); Brunner, Ivano [Rhizosphere Processes Group, Swiss Federal Research Institute WSL, 8903 Birmensdorf (Switzerland); Horvat, Milena [Jozef Stefan Institute, 1001 Ljubliana (Slovenia); Jacobs, Anna [Rhizosphere Processes Group, Swiss Federal Research Institute WSL, 8903 Birmensdorf (Switzerland); Department of Environmental Chemistry, University of Kassel, 37213 Witzenhausen (Germany); Frey, Beat, E-mail: beat.frey@wsl.ch [Rhizosphere Processes Group, Swiss Federal Research Institute WSL, 8903 Birmensdorf (Switzerland)

    2011-10-15

    Accumulation of total and methyl-Hg by mushrooms and earthworms was studied in thirty-four natural forest soils strongly varying in soil physico-chemical characteristics. Tissue Hg concentrations of both receptors did hardly correlate with Hg concentrations in soil. Both total and methyl-Hg concentrations in tissues were species-specific and dependent on the ecological groups of receptor. Methyl-Hg was low accounting for less than 5 and 8% of total Hg in tissues of mushrooms and earthworms, respectively, but with four times higher concentrations in earthworms than mushrooms. Total Hg concentrations in mushrooms averaged 0.96 mg Hg kg{sup -1} dw whereas litter decomposing mushrooms showed highest total Hg and methyl-Hg concentrations. Earthworms contained similar Hg concentrations (1.04 mg Hg kg{sup -1} dw) whereas endogeic earthworms accumulated highest amounts of Hg and methyl-Hg. - Highlights: > Hg and MeHg concentrations in mushrooms and earthworms at unpolluted forest soils. > Mushrooms and earthworms contained similar Hg concentrations. > MeHg was present in traces but four times higher in earthworms than in mushrooms. > Ecophysiological group influenced Hg and MeHg concentration in both receptors. - Accumulation of Hg and methyl-Hg by mushrooms and earthworms is species- and ecophysiological group dependent.

  6. Electrical stimulation in white oyster mushroom (Pleurotus florida) production

    Science.gov (United States)

    Roshita, I.; Nurfazira, K. M. P.; Fern, C. Shi; Ain, M. S. Nur

    2017-09-01

    White oyster mushroom (Pleurotus florida) is an edible mushroom that gained popularity due to its nutritional values, low production cost and ease of cultivation. There are several research reported on the mushroom fruiting bodies which were actively developed when applying electrical shock treatment. This study was aimed to investigate the effects of different electrical voltages on the growth and yield of white oyster mushroom (Pleurotus florida). Five different electrical voltages had been applied during spawning period which were 6V, 9V, 12V, 15V and mushroom bags without any treatment served as control. Treatment at 6V showed the highest rate for mycelium growth while 15V took the shortest time for fruiting body formation. However, no significant different (P>0.05) among all the treatments was observed for the time taken for the mycelium to fill-up the bag and pinhead emergence. The total fresh weight and percentage of biological efficiency for treatment at 9V showed higher values compared to control. Treatment at 9V also showed the largest pileus diameter and the most firm in the pileus texture. Meanwhile, treatment at 6V showed the highest a* value (redness). In addition, different electrical voltage treatments applied did not show any significant effect on substrate utilization efficiency, colour L* and b* values. In conclusion, among all the electrical treatments applied, 9V could be considered as the best treatment to enhance the yield of white oyster mushroom.

  7. Biotechnology for in vitro growing of edible and medicinal mushrooms on wood wastes

    Directory of Open Access Journals (Sweden)

    Marian Petre

    2009-11-01

    Full Text Available The aim of this work was focused on finding out the best way to convert the wood wastes into useful food supplements, such as mushroom fruit bodies, by using them as growing sources for the edible and medicinal mushrooms. According to this purpose, three fungal species from Basidiomycetes, namely Ganoderma lucidum (Curt.:Fr. P. Karst, Lentinus edodes (Berkeley Pegler and Pleurotus ostreatus (Jacquin ex Fries Kummer were tested to determine their biological potential to grow on substrates made of wood wastes (sawdusts as well as shavings which could be used in this way as main ingredients for preparation of natural culture composts.The experiments were achieved by in vitro growing of all these fungal species in special rooms, where the main culture parameters were kept at optimal levels in order to get the highest production of mushroom fruit bodies. The effects of culture compost composition (carbon, nitrogen and mineral sources as well as other physical and chemical factors (such as: temperature, inoculum amount, pH level and incubation time, etc. on mycelial net formation and especially on fruit body induction, were investigated. From all these fungal species tested in our experiments, P. ostreatus was registered as the fastest mushroom culture, then L. edodes and finally, G. lucidum asthe longest mushroom culture. During the experiments, different logs of the same species were used as control samples for each culture compost variants. Applying such biotechnology, the environmental problems generated by the plant wastes accumulation in wood industry could be solved only by using biological means for theirvalorising, simultaneously with food supplements producing having high nutritive values as well as healing effects by increasing the consumers` health.

  8. Biotechnology for in vitro growing of edible and medicinal mushrooms on wood wastes

    Directory of Open Access Journals (Sweden)

    Marian Petre

    2009-12-01

    Full Text Available The aim of this work was focused on finding out the best way to convert the wood wastes into useful food supplements, such as mushroom fruit bodies, by using them as growing sources for the edible and medicinal mushrooms. According to this purpose, three fungal species from Basidiomycetes, namely Ganoderma lucidum (Curt.:Fr. P. Karst, Lentinus edodes (Berkeley Pegler and Pleurotus ostreatus (Jacquin ex Fries Kummer were tested to determine their biological potential to grow on substrates made of wood wastes (sawdusts as well as shavings which could be used in this way as main ingredients for preparation of natural culture composts. The experiments were achieved by in vitro growing of all these fungal species in special rooms, where the main culture parameters were kept at optimal levels in order to get the highest production of mushroom fruit bodies. The effects of culture compost composition (carbon, nitrogen and mineral sources as well as other physical and chemical factors (such as: temperature, inoculum amount, pH level and incubation time, etc. on mycelial net formation and especially on fruit body induction, were investigated. From all these fungal species tested in our experiments, P. ostreatus was registered as the fastest mushroom culture, then L. edodes and finally, G. lucidum as the longest mushroom culture. During the experiments, different logs of the same species were used as control samples for each culture compost variants. Applying such biotechnology, the environmental problems generated by the plant wastes accumulation in wood industry could be solved only by using biological means for their valorising, simultaneously with food supplements producing having high nutritive values as well as healing effects by increasing the consumers` health.

  9. Radioactive cesium in Finnish mushrooms

    International Nuclear Information System (INIS)

    Kostiainen, E.; Ylipieti, J.

    2010-02-01

    Surveillance of radioactive cesium in Finnish mushrooms was started in 1986 at STUK. Results of the surveillance programs carried out in Lapland and other parts of Finland are given in this report. More than 2000 samples of edible mushrooms have been analysed during 1986-2008. The 137 Cs detected in the mushrooms mainly originates from the 137 Cs deposition due to the accident at the Chernobyl nuclear power plant in 1986. The 137 Cs concentrations of mushrooms in the end of 1970s and in the beginning of 1980s varied from some ten to two hundred becquerels per kilogram originating from the nuclear weapon test period. The uneven division of the Chernobyl fallout is seen in the areal variation of 137 Cs concentrations of mushrooms, the 137 Cs concentrations being about tenfold in the areas with the highest deposition compared to those where the deposition was lowest. After the Chernobyl accident the maximum values in the 137 Cs concentrations were reached during 1987-88 among most species of mushrooms. The 137 Cs concentrations have decreased slowly, being in 2008 about 40 per cent of the maximum values. The 137 Cs concentrations may be tenfold in the mushroom species with high uptake of cesium (Rozites caperatus, Hygrophorus camarophyllus, Lactarius trivialis) compared to the species with low uptake (Albatrellus ovinus, Leccinum sp.) picked in the same area. The 137 Cs contents in certain species of commercial mushrooms in Finland still exceed the maximum permitted level, 600 Bq/kg, recommended to be respected when placing wild game, wild berries, wild mushrooms and lake fish on the market (Commission recommendation 2003/274/Euratom). Therefore, the 137 Cs concentrations of mushrooms should be measured before placing them on the market in the areas of the highest 137 Cs deposition, except for Albatrellus ovinus, Boletus sp. and Cantharellus cibarius. The 137 Cs concentrations of common commercial mushroom species, Cantharellus tubaeformis and Craterellus

  10. Phenolic compounds present in medicinal mushroom extracts generate reactive oxygen species in human cells in vitro

    NARCIS (Netherlands)

    Wei, S.; Helsper, J.P.F.G.; Griensven, van L.J.L.D.

    2008-01-01

    Hot-water extracts of the higher Basidiomycetes Agaricus bisporus (J. Lge) Imbach, A. brasiliensis S. Wasser et al., Coprinus comatus (O.F. Mull.) Pers., Ganoderma lucidum (W. Curt.: Fr.) P. Karst., and Phellinus linteus (Berk. et Curt.) Teng were made, and the resulting polysaccharide mixtures were

  11. Contamination of mushrooms with radionuclides

    International Nuclear Information System (INIS)

    Benova, K.

    2013-01-01

    There is 27 years after the Chernobyl nuclear accident and the half-life of 137 Cs is 30 years. The radioactive cloud hit both former Czechoslovakia, but also very distant cities throughout Europe. In this work, author focused on recovery of radiocesium content in mushrooms from various sites in Slovakia, Poland and England. Author evaluated 28 samples of dried mushrooms. 137 Cs was measured by gamma spectrometry (Canberra). Elevated levels have been reported occasionally in mushroom not only in Slovakia but also in distant England. The values obtained are lower than recommended standard (author)

  12. Biotechnology of non-Saccharomyces yeasts-the basidiomycetes.

    Science.gov (United States)

    Johnson, Eric A

    2013-09-01

    Yeasts are the major producer of biotechnology products worldwide, exceeding production in capacity and economic revenues of other groups of industrial microorganisms. Yeasts have wide-ranging fundamental and industrial importance in scientific, food, medical, and agricultural disciplines (Fig. 1). Saccharomyces is the most important genus of yeast from fundamental and applied perspectives and has been expansively studied. Non-Saccharomyces yeasts (non-conventional yeasts) including members of the Ascomycetes and Basidiomycetes also have substantial current utility and potential applicability in biotechnology. In an earlier mini-review, "Biotechnology of non-Saccharomyces yeasts-the ascomycetes" (Johnson Appl Microb Biotechnol 97: 503-517, 2013), the extensive biotechnological utility and potential of ascomycetous yeasts are described. Ascomycetous yeasts are particularly important in food and ethanol formation, production of single-cell protein, feeds and fodder, heterologous production of proteins and enzymes, and as model and fundamental organisms for the delineation of genes and their function in mammalian and human metabolism and disease processes. In contrast, the roles of basidiomycetous yeasts in biotechnology have mainly been evaluated only in the past few decades and compared to the ascomycetous yeasts and currently have limited industrial utility. From a biotechnology perspective, the basidiomycetous yeasts are known mainly for the production of enzymes used in pharmaceutical and chemical synthesis, for production of certain classes of primary and secondary metabolites such as terpenoids and carotenoids, for aerobic catabolism of complex carbon sources, and for bioremediation of environmental pollutants and xenotoxicants. Notwithstanding, the basidiomycetous yeasts appear to have considerable potential in biotechnology owing to their catabolic utilities, formation of enzymes acting on recalcitrant substrates, and through the production of unique primary

  13. DEGRADATION OF TEXTILE DYES BY WHITE ROT BASIDIOMYCETES

    OpenAIRE

    B.P. PARMAR, P.N. MERVANA B.R.M. VYAS*

    2014-01-01

    ABSTRACT: Dyes released by the textile industries pose a threat to environmental quality. Ligninolytic white-rot basidiomycetes can effectively degrade colored effluents and conventional dyes. White-rot fungi produce various isoforms of extracellular oxidases including laccase, Mn peroxidase and lignin peroxidase (LiP), which are involved in the degradation of lignin in their natural lignocellulosic substrates.  The textile industry, by far the most avid user of synthetic dyes, is in need...

  14. Basidiomycete fungal communities in Australian sclerophyll forest soil are altered by repeated prescribed burning.

    Science.gov (United States)

    Anderson, Ian C; Bastias, Brigitte A; Genney, David R; Parkin, Pamela I; Cairney, John W G

    2007-04-01

    Soil basidiomycetes play key roles in forest nutrient and carbon cycling processes, yet the diversity and structure of below ground basidiomycete communities remain poorly understood. Prescribed burning is a commonly used forest management practice and there is evidence that single fire events can have an impact on soil fungal communities but little is known about the effects of repeated prescribed burning. We have used internal transcribed spacer (ITS) terminal restriction fragment length polymorphism (T-RFLP) analysis to investigate the impacts of repeated prescribed burning every two or four years over a period of 30 years on soil basidiomycete communities in an Australian wet sclerophyll forest. Detrended correspondence analysis of ITS T-RFLP profiles separated basidiomycete communities in unburned control plots from those in burned plots, with those burned every two years being the most different from controls. Burning had no effect on basidiomycete species richness, thus these differences appear to be due to changes in community structure. Basidiomycete communities in the unburned control plots were vertically stratified in the upper 20 cm of soil, but no evidence was found for stratification in the burned plots, suggesting that repeated prescribed burning results in more uniform basidiomycete communities. Overall, the results demonstrate that repeated prescribed burning alters soil basidiomycete communities, with the effect being greater with more frequent burning.

  15. Behaviour of Listeria monocytogenes in packaged fresh mushrooms (Agaricus bisporus).

    Science.gov (United States)

    González-Fandos, E; Olarte, C; Giménez, M; Sanz, S; Simón, A

    2001-11-01

    The aim of this study was to evaluate the potential of Listeria monocytogenes to grow in mushrooms packaged in two different types of PVC films when stored at 4 degrees C and 10 degrees C. Mushrooms were packed in two polymeric films (perforated and nonperforated PVC) and stored at 4 degrees C and 10 degrees C. The carbon dioxide and oxygen content inside the packages, aerobic mesophiles, psychrotrophs, Pseudomonas spp., Listeria monocytogenes, faecal coliforms, Escherichia coli, anaerobic spores and major sensory factors were determined. The mushrooms packaged in nonperforated film and stored at 4 degrees C had the most desirable quality parameters (texture, development stage and absence of moulds). Listeria monocytogenes was able to grow at 4 degrees C and 10 degrees C in inoculated mushrooms packaged in perforated and nonperforated films between 1 and 2 log units during the first 48 h. After 10 d of storage, the populations of L. monocytogenes were higher in mushrooms packaged in nonperforated film and stored at 10 degrees C. MAP followed by storage at 4 degrees C or 10 degrees C extends the shelf life by maintaining an acceptable appearance, but allows the growth and survival of L. monocytogenes. According to this study additional hurdles must be studied in order to prevent the growth of L. monocytogenes.

  16. The evolution of non-reciprocal nuclear exchange in mushrooms as a consequence of genomic conflict

    DEFF Research Database (Denmark)

    Aanen, Duur Kornelis; Kuyper, T.W.; Debets, A.J.M.

    2004-01-01

    nucleo-mitochondrial conflict, mitochondrial inheritance, doubly uniparental inheritance, basidiomycetes, cytoplasmic male sterility......nucleo-mitochondrial conflict, mitochondrial inheritance, doubly uniparental inheritance, basidiomycetes, cytoplasmic male sterility...

  17. ACCUMULATION OF RADIOCESIUM BY MUSHROOMS IN THE ENVIRONMENT: A LITERATURE REVIEW

    Energy Technology Data Exchange (ETDEWEB)

    Duff, M

    2007-05-28

    During the last 50 years, a large amount of information on radionuclide accumulators or ''sentinel-type'' organisms in the environment has been published. Much of this work focused on the risks of food-chain transfer of radionuclides to higher organisms such as reindeer and man. However, until the 1980's and 1990's, there has been little published data on the radiocesium ({sup 134}Cs and {sup 137}Cs) accumulation by mushrooms. This presentation will consist of a review of the published data for {sup 134,137}Cs accumulation by mushrooms in nature. This review will discuss the aspects that promote {sup 134,137}Cs uptake by mushrooms and focus on mushrooms that demonstrate a large propensity for use in the environmental biomonitoring of radiocesium contamination. It will also provide descriptions of habitats for many of these mushrooms and discuss on how growth media and other conditions relate to Cs accumulation.

  18. 137Cs and 90Sr distribution in edible mushrooms at the territory of the Lithuanian SSR

    International Nuclear Information System (INIS)

    Dauskurdis, S.I.; Tamulenajte, O.P.; Nedvetskajte, T.N.

    1989-01-01

    Results of studying 90 Sr and 137 Cs content in edible mushrooms in Lithuania before and after the Chernobyl accident (1984-1986) are presented. It is shown that after accident release in 1986 mushroom contamination with cesium isotopes increased about 4 times as compared to 1985 and 90 Sr activity preserved the same level. Radioisotope accumulation in mushrooms after the Chernobyl accident is studied depending on the mechanical composition of soil, pH and Ca quantity. It is ascertained that in carbonate, alkaline, reach with Ca and K soils 90 Sr and 137 Cs mobility is reduced and their absorption by mushroom is weakened. In light by mechanical composition (sandy), depleted by Ca soil 90 Sr arrival to mushrooms is 2.4 times higher than in soils with high Ca content. The quantity of water-soluble 90 Sr is maximal in soil with low pH and minimal content of exchange Ca. Radioactive contamination of mushrooms depends on the terrain relief and type of mushrooms. It is shown that radioactive contamination of mushrooms in 1986 did not exceede the admissible standard. 7 refs.; 4 figs.; 2 tabs

  19. Nutritional Composition of Three Domesticated Culinary-Medicinal Mushrooms: Oudemansiella sudmusida, Lentinus squarrosulus, and Tremella aurantialba.

    Science.gov (United States)

    Zhou, Shuai; Tang, Qing-Jiu; Zhang, Zhong; Li, Chuan-hua; Cao, Hui; Yang, Yan; Zhang, Jing-Song

    2015-01-01

    The nutritional composition of three recently domesticated culinary-medicinal mushroom species (Oudemansiella sudmusida, Lentinus squarrosulus, and Tremella aurantialba) was evaluated for contents of protein, fiber, fat, total sugar content, amino acid, carbohydrate, and nucleotide components. The data indicated that fruiting bodies of these three mushroom species contained abundant nutritional substances. The protein contents of L. squarrosulus and O. submucida were 26.32% and 14.70%, which could be comparable to other commercially cultivated species. T. aurantialba contained 74.11% of carbohydrate, of which soluble polysaccharide was 40.55%. Oudemansiella sudmusida contained 15.95% of arabitol as the highest sugar alcohol in three mushrooms. These mushrooms also possessed distinct taste by their flavor component composition. Among them, L. squarrosulus contained 10.68% and 9.25% of monosodium glutamate-like and sweet amino acids, which were higher than the other two mushrooms. However, the nucleotide amounts of the three mushrooms were all lower than those of other commercially cultivated mushrooms. Among them, L. squarrosulus contained the highest amount of flavor nucleotides, which was 1.01‰. Results revealed that these three mushroom species are potentially suitable resources for commercial cultivation and healthy food.

  20. Fatty Acid Compositions of Six Wild Edible Mushroom Species

    Science.gov (United States)

    Günç Ergönül, Pelin; Akata, Ilgaz; Kalyoncu, Fatih; Ergönül, Bülent

    2013-01-01

    The fatty acids of six wild edible mushroom species (Boletus reticulatus, Flammulina velutipes var. velutipes, Lactarius salmonicolor, Pleurotus ostreatus, Polyporus squamosus, and Russula anthracina) collected from different regions from Anatolia were determined. The fatty acids were identified and quantified by gas chromatography and studied using fruit bodies. Fatty acid composition varied among species. The dominant fatty acid in fruit bodies of all mushrooms was cis-linoleic acid (18 : 2). Percentage of cis-linoleic acid in species varied from 22.39% to 65.29%. The other major fatty acids were, respectively, cis-oleic, palmitic, and stearic acids. Fatty acids analysis of the mushrooms showed that the unsaturated fatty acids were at higher concentrations than saturated fatty acids. PMID:23844377

  1. Fatty Acid Compositions of Six Wild Edible Mushroom Species

    Directory of Open Access Journals (Sweden)

    Pelin Günç Ergönül

    2013-01-01

    Full Text Available The fatty acids of six wild edible mushroom species (Boletus reticulatus, Flammulina velutipes var. velutipes, Lactarius salmonicolor, Pleurotus ostreatus, Polyporus squamosus, and Russula anthracina collected from different regions from Anatolia were determined. The fatty acids were identified and quantified by gas chromatography and studied using fruit bodies. Fatty acid composition varied among species. The dominant fatty acid in fruit bodies of all mushrooms was cis-linoleic acid (18 : 2. Percentage of cis-linoleic acid in species varied from 22.39% to 65.29%. The other major fatty acids were, respectively, cis-oleic, palmitic, and stearic acids. Fatty acids analysis of the mushrooms showed that the unsaturated fatty acids were at higher concentrations than saturated fatty acids.

  2. Mushrooms: significant source of internal contamination by radiocaesium

    International Nuclear Information System (INIS)

    Randa, Zdenek; Benada, Jaroslav; Horyna, Jan; Klan, Jaroslav

    1990-01-01

    Various species of mushrooms and soils were analyzed for alkali elements (Rb, K) by means of Instrumental Neutron Activation Analysis (INAA) and for radiocaesium by means of gamma-ray spectrometry. There are differences between uptake of non-radioactive Cs and radiocaesium. Concentration factors for radiocaesium were higher than those for non-radioactive Cs. The highest accumulation of radio-caesium was observed in some species of the Boletus genus, Laccaria spp., Paxillus involutus, Cortinarius spp., Tylopilus felleus and in some species of the Lactarius genus. The consumption of some wild-growing mushrooms can be the most significant contribution to the exposure of population from Chernobyl fallout. (author)

  3. Effectiveness of Training Programme on Mushroom Cultivation

    OpenAIRE

    Rahman, Md. Sazzadur; Hossain, Kh. Zulfikar; Ali, Md. Sekender; Afroz, Fauzia

    2017-01-01

    Effectiveness is one of the key parameters to assess success of any programs. However, the effectiveness of training programme on mushroom cultivation was not well addressed. The purposes of this study were to investigate the effectiveness of training programme on mushroom cultivation and to explore the relationships of each of the selected characteristics of the trained mushroom farmers with their effectiveness of training programme. Data were collected from the trained mushroom farmers of s...

  4. Wild and domesticated mushroom consumption in Nigeria ...

    African Journals Online (AJOL)

    African Crop Science Journal ... On the other hand, if nutrition analysis reveals different nutrition parameters for both types of mushrooms, 43.3% opted for cultivated mushroom, 42.2%, wild; 12.2% both; while 2.2% would eat ... Keywords: Consumption pattern, Lentinus squarrosulus, nutrition, perception, wild mushroom ...

  5. Altered Phenotypes in Saccharomyces cerevisiae by Heterologous Expression of Basidiomycete Moniliophthora perniciosa SOD2 Gene

    Directory of Open Access Journals (Sweden)

    Sônia C. Melo

    2015-06-01

    Full Text Available Heterologous expression of a putative manganese superoxide dismutase gene (SOD2 of the basidiomycete Moniliophthora perniciosa complemented the phenotypes of a Saccharomyces cerevisiae sod2Δ mutant. Sequence analysis of the cloned M. perniciosa cDNA revealed an open reading frame (ORF coding for a 176 amino acid polypeptide with the typical metal-binding motifs of a SOD2 gene, named MpSOD2. Phylogenetic comparison with known manganese superoxide dismutases (MnSODs located the protein of M. perniciosa (MpSod2p in a clade with the basidiomycete fungi Coprinopsis cinerea and Laccaria bicolor. Haploid wild-type yeast transformants containing a single copy of MpSOD2 showed increased resistance phenotypes against oxidative stress-inducing hydrogen peroxide and paraquat, but had unaltered phenotype against ultraviolet–C (UVC radiation. The same transformants exhibited high sensitivity against treatment with the pro-mutagen diethylnitrosamine (DEN that requires oxidation to become an active mutagen/carcinogen. Absence of MpSOD2 in the yeast sod2Δ mutant led to DEN hyper-resistance while introduction of a single copy of this gene restored the yeast wild-type phenotype. The haploid yeast wild-type transformant containing two SOD2 gene copies, one from M. perniciosa and one from its own, exhibited DEN super-sensitivity. This transformant also showed enhanced growth at 37 °C on the non-fermentable carbon source lactate, indicating functional expression of MpSod2p. The pro-mutagen dihydroethidium (DHE-based fluorescence assay monitored basal level of yeast cell oxidative stress. Compared to the wild type, the yeast sod2Δ mutant had a much higher level of intrinsic oxidative stress, which was reduced to wild type (WT level by introduction of one copy of the MpSOD2 gene. Taken together our data indicates functional expression of MpSod2 protein in the yeast S. cerevisiae.

  6. [Mercury content in edible mushrooms in the Wyzyna Wieluńska region].

    Science.gov (United States)

    Falandysz, J; Hałaczkiewicz, J

    1999-01-01

    Mercury concentration was determined in the caps and stalks of nine species of edible mushrooms collected at the area of Wieluńska Upland in district of Czestochowa in 1995-96. The mushroom species examined were such as: yellow-cracking bolete Xerocomus subtomentosus, brown birch scaber stalk Leccinum scabrum, slippery Jack Suillus luteus, larch bolete Suillus grevillei, gray knight-cap Tricholoma terreum, parasol mushroom Macrolepiota procera, horse mushroom Agaricus arvensis, fennel funnel cap Clitocybe odora, fairy-ring mushroom Marasmius oreades and tacky green brittle gills Russula aereuginea. The method of mercury measurement was cold-vapour atomic absorption spectroscopy (CV-AAS) after wet digestion of the samples with concentrated nitric acid in a whole glass system. The parasol mushroom and horse mushroom showed a highest mercury concentrations and contained, respectively, 4500 +/- 1700 and 4400 +/- 2400 ng/g dry wt in caps, and 2800 +/- 1300 and 2800 +/- 2100 ng/g dry wt in stalks. In the case of fennel funnel cap and fairy-ring mushroom the mean total mercury concentrations in caps was above 500 ng/g dry wt, and for other species were between 150 +/- 50 and 500 +/- 230 ng/g dry wt. The stalks of the mushroom species examined in all cases showed lower contamination with mercury than caps. The mean total mercury concentrations noted in caps and stalks of mushrooms examined were usually higher than was reported till now in the same species elsewhere in Poland, while a maximum values found in an individual fruiting bodies are within the range of the concentrations noted in specimens collected from an unpolluted areas.

  7. Culinary-Medicinal Mushroom Products as a Potential Source of Vitamin D.

    Science.gov (United States)

    Bernas, Emilia; Jaworska, Grażyna

    2017-01-01

    The incidence of vitamin D deficiency has increased in recent years, mainly in Europe. The consumption of processed mushrooms may play an important role in preventing diseases associated with vitamin D deficiency. We determined the effects of 2 kinds of freezing (blast, cryogenic), canning (mild and strong brine), and drying (air-drying, freeze-drying) on the retention of vitamin D2 and ergosterol in Agaricus bisporus. Fresh and processed A. bisporus mushrooms can be a good dietary source of vitamin D2. After 12 months of storage, canned mushrooms retained the largest amount of vitamin D2 and ergosterol, whereas the smallest amount was retained in dried mushrooms. Cryogenic freezing resulted in higher levels of vitamin D2, whereas ergosterol levels were higher using air-blast freezing. The drying method had a significant effect only on ergosterol levels, which were higher in the case of freeze-drying. Room temperature gave the best results for storing dried mushrooms. In canned mushrooms, the type of brine had an effect only on levels of vitamin D2; retention was higher using the strong brine. Retention of vitamin D2 was higher at cool temperatures, whereas room temperature resulted in higher retention of ergosterol in the canned products.

  8. WILD EDIBLE MUSHROOMS OF MEGHALAYA

    Science.gov (United States)

    Barua, Paran; Adhikary, R.K; Kalita, Pabitra; Bordoloi, Dalimi; Gogoi, P.; Singh, R.S.; Ghosh, A.C.

    1998-01-01

    Different flesh mushrooms grow widely in Meghalaya. Altogether fie edible species were collected and identified which were found abundantly in forest and are known to be consumed by local people for time immemorial, The species identified are lentinus edodes (Berk) Sing., Boletus edulis Bull ex Fr., Clavaria cinerea (Fr.) Schroet, Clavaria aurea (F) Quet and cantharellus floccosus Juss. PMID:22556840

  9. Antimicrobial activity and mineral composition of shiitake mushrooms cultivated on agricultural waste

    Directory of Open Access Journals (Sweden)

    Kérley Braga Pereira Bento Casaril

    2011-10-01

    Full Text Available The antimicrobial activity and mineral composition of shiitake mushrooms were evaluated in four isolates of Lentinula edodes. Mushrooms were cultivated on artificial logs, based on eucalyptus sawdust enriched with 20% rice, wheat, or soybean bran, or combination of 10% of two of these supplements. The substrates were humidified with a 0.1% mate tea extract or water. Logs of Eucalyptus grandis were also used to cultivate the shiitake mushrooms. The antimicrobial activity of an aqueous extract, corresponding to 40 mg of mushroom dry matter, was in some cases, depending on the isolate, able to inhibit both Bacillus subtilis and Escherichia coli K-12, independent of substrate composition or the growth stage of the mushrooms. Nitrogen, phosphorus, potassium, magnesium and calcium concentrations varied according to the substrate on which the mushrooms were cultivated, being, generally, higher with cultivation on artificial rather than natural eucalyptus logs. It could be concluded that, in addition to the fungal isolate, substrate composition and, processing methods must be considered during the production of antimicrobial substance(s as well as in the mushroom nutritional composition.

  10. Investigation of antioxidative, antityrosinase and cytotoxic effects of extract of irradiated oyster mushroom

    Directory of Open Access Journals (Sweden)

    Nutsuda Banlangsawan

    2016-02-01

    Full Text Available Oyster mushroom (Pleurotus ostreatus Fries. is rich in nutrition and has many medicinal properties such as antioxidant and anticancer activities. It also contains a high amount of ergosterol which can be converted to vitamin D2 when exposing to UV light. Oyster mushroom powder was irradiated with UV-B for 180 min and extracted with 95% ethanol. Mushroom extract was determined for vitamin D2 concentration, total phenolic compound, antioxidative activity, tyrosinase inhibitory property and cytotoxicity effect on human keratinocytes (HaCaT and murine melanoma cells (B16F10 by MTT assay. The results demonstrated that the concentration of vitamin D2 of irradiated oyster mushroom extract was 153.96 µg/g, which is 13 times higher than that of non-irradiated mushroom extract. Total phenolic content, antioxidative and tyrosinase inhibitory activities of the two mushroom extracts were not significantly different. Neither oyster mushroom extract had a cytotoxic effect on keratinocytes, but on the other hand both inhibited the growth of murine melanoma cells.

  11. Wild Mushrooms in Nepal: Some Potential Candidates as Antioxidant and ACE-Inhibition Sources

    Directory of Open Access Journals (Sweden)

    Tran Hai Bang

    2014-01-01

    Full Text Available Twenty-nine mushrooms collected in the mountainous areas of Nepal were analyzed for antioxidant activity by different methods, including Folin-Ciocalteu, ORAC, ABTS, and DPPH assays. Intracellular H2O2-scavenging activity was also performed on HaCaT cells. The results showed that phenolic compounds are the main antioxidant of the mushrooms. Among studied samples, Inonotus andersonii, and Phellinus gilvus exhibited very high antioxidant activity with the phenolic contents up to 310.8 and 258.7 mg GAE/g extracts, respectively. The H2O2-scavenging assay on cells also revealed the potential of these mushrooms in the prevention of oxidative stress. In term of ACE-inhibition, results showed that Phlebia tremellosa would be a novel and promising candidate for antihypertensive studies. This mushroom exhibited even higher in vitro ACE-inhibition activity than Ganoderma lingzhi, with the IC50 values of the two mushrooms being 32 μg/mL and 2 μg/mL, respectively. This is the first time biological activities of mushrooms collected in Nepal were reported. Information from this study should be a valuable reference for future studies on antioxidant and ACE-inhibitory activities of mushrooms.

  12. The geographical origin and chemical composition in phellinus mushrooms measured by instrumental neutron activation analysis

    International Nuclear Information System (INIS)

    Lim, J.M.; Sun, G.M.; Moon, J.H.; Chung, Y.S.; Lee, J.H.; Kim, K.H.

    2012-01-01

    In order to expand the utilization of phellinus mushrooms as a dietary supplement, we attempted to evaluate the chemical composition by measuring its inorganic elemental content with the aid of instrumental neutron activation analysis (INAA). Twenty seven phellinus mushrooms samples were collected from Korea, Cambodia, and Vietnam. A total of 28 elements were analyzed in the phellinus mushroom samples using the INAA. The concentrations of Ca, K, and Mg are much higher than those of other elements in phellinus mushroom samples. The sum of determined elemental concentration in Cambodia samples was about 2-6 times higher than those in Korea and Vietnam samples, respectively. Based on our measurement data, we attempted to discriminate the geographical origin using principal components analysis (PCA) and linear discriminant analysis (LDA). The geographical origins of all samples were clearly classified with correct classification rate of 100%. (author)

  13. Usage of Edible Mushrooms in Various Food Products

    Directory of Open Access Journals (Sweden)

    Özge Süfer

    2016-03-01

    Full Text Available Using of edible mushrooms which are generally consumed in houses in dried form is based on mainly instant soup and sauce formulations. Recently, the cultivations of Agaricus bisporus and Pleurotus ostreatus species have become widespread. Utilization of these cultivated mushrooms in recipes would bring added value to related food products. For this purpose, Agaricus bisporus and Pleurotus ostreatus species farmed in Osmaniye Korkut Ata University Mushroom House were dried and then pulverized. Firstly, a snack was prepared with Agaricus bisporus powder. Agaricus bisporus powder was substituted for wheat flour at the rates of 5 %, 10 %, 20 % and 30 % and thus the potential of food product which had relatively lower carbohydrate and fat level and higher fiber content was investigated. In the second part of the study, either 5 %, 10 % of Agaricus bisporus powder or 5 %, 10 % of Pleurotus ostreatus powder were added into traditional Turkish meatball (beef mince, salt which was cooked in conventional oven, so meat flavor could be replaced by herbal flavor coming from mushroom. This property mat obey the purpose that, the created new product will be consumed fondly especially by children. Sensory and physical (colour and texture analysis were performed in both snack and meatball samples and the results were evaluated statistically.

  14. Microbial Community Structure of Casing Soil During Mushroom Growth

    Institute of Scientific and Technical Information of China (English)

    CAI Wei-Ming; YAO Huai-Ying; FENG Wei-Lin; JIN Qun-Li; LIU Yue-Yan; LI Nan-Yi; ZHENG Zhong

    2009-01-01

    The culturable bacterial population and phospholipid fatty acid (PLFA)profile of casing soil were investigated at different mushroom (Agaricus bisporusI cropping stages.The change in soil bacterial PLFAs was always accompanied by a change in the soil culturable bacterial population in the first flush.Comparatively higher culturable bacterial population and bacterial PLFAs were found in the casing soil at the primordia formation stage of the first flush.There was a significant increase in the ratio of fungal to bacterial PLFAs during mushroom growth.Multivariate analysis of PLFA data demonstrated that the mushroom cropping stage could considerably affect the microbial community structure of the casing soil.The bacterial population increased significantly from casing soil application to the primordia formation stage of the first flush.Casing soil application resulted in an increase in the ratio of gram-negative bacterial PLFAs to gram-positive bacterial PLFAs,suggesting that some gram-negative bacteria might play an important role in mushroom sporophore initiation.

  15. Mushroom dehydration in a hybrid-solar dryer

    International Nuclear Information System (INIS)

    Reyes, Alejandro; Mahn, Andrea; Cubillos, Francisco; Huenulaf, Pedro

    2013-01-01

    Highlights: ► Mushrooms (Paris variety) were dehydrated in a hybrid solar dryer. ► Effective diffusivity was estimated by the Constant Diffusivity Model. ► Drying kinetics were adjusted by a semi-theoretical and the empirical Page model. ► Temperature, thickness and air recycle significantly affected critical moisture. ► The input of solar energy resulted in 3.5–12.5% electrical energy saving. - Abstract: Mushrooms (Paris variety) were dehydrated in a hybrid solar dryer (HSD) provided with a 3 m 2 solar panel and electric resistances. Mushrooms were cut in 8 mm or 4 mm thickness slices. At the outlet of the tray dryer 80–90% air was recycled and the air temperature was adjusted to the pre-defined levels (50 or 60 °C). At the outlet of the solar panel the air temperature raised between 2 and 20 °C above the ambient temperature, depending mainly of solar radiation level. Temperature, slices thickness and air recycle level had statistically significant effects on critical moisture content (X c ), as well as on the time necessary to reach a moisture content of 0.1 (wb). The color parameters of dehydrated mushroom indicate a notorious darkening, in all runs. Rehydration assays at 35 °C showed that in less than 30 min rehydrated mushrooms reached a moisture content of 0.8 (wb). Effective diffusivity (D eff ) was estimated by the Simplified Constant Diffusivity Model (SCDM), and it ranged between 6E−10 and 40E−10 m 2 /s, with R 2 higher than 0.98, agreeing with literature. The adjustment of experimental drying kinetics with the empirical Page’s model resulted in R 2 higher than 0.997. Finally, the input of solar energy resulted in 3.5–12.5% energy saving. These values could even be improved by increasing the agro-product load in the HSD

  16. BASIDIOMYCETE-BASED METHOD FOR BIOCONTROL OF PHYTOPATHOGENIC NEMATODES

    Directory of Open Access Journals (Sweden)

    Tiberius BALAEŞ

    2015-12-01

    Full Text Available Phytopathogenic nematodes represent one of the most important groups of pathogens in crops. The use of chemical to control the nematodes attack in crops is decreasing every year due to the concern of the toxicity and side effects of such compounds. In the course for finding alternatives to the use of chemicals, biological control of nematodes is gaining much attention. Some saprotrophic fungi are able to feed on invertebrates, thus becoming efficient agents of control. In this study, three species of basidiomycetes were analyzed for their potential to be used as control agents of phytopathogenic nematodes. Through on in vitro investigation of these potential, one strain – Gymnopilus junonius was further selected for a pot test against Meloidogyne incognita, a very important phytopathogenic species of nematodes. The fungal treatment strongly decreased the M. incognita population on the tested pots, proving the potential of G. junonius strain to be used in biocontrol.

  17. DNA quantification of basidiomycetous fungi during storage of logging residues

    Directory of Open Access Journals (Sweden)

    Isabella Børja

    2015-04-01

    Full Text Available The demand for bioenergy caused an increased use of logging residues, branches and treetops that were previously left on the ground after harvesting. Residues are stored outdoors in piles and it is unclear to what extent fungi transform this material. Our objective was to quantify the amount of wood degrading fungi during storage using quantitative real-time PCR (qPCR to detect basidiomycetous DNA in logging residues, a novel approach in this field. We found that the qPCR method was accurate in quantifying the fungal DNA during storage. As the moisture content of the piled logging residues decreased during the storage period, the fungal DNA content also decreased. Scots pine residues contained more fungal DNA than residues from Norway spruce. Loose piles had generally more fungal DNA than bundled ones.

  18. Bioactive metabolites from the mycelia of the basidiomycete Hericium erinaceum.

    Science.gov (United States)

    Lu, Qiang-Qiang; Tian, Jun-Mian; Wei, Jing; Gao, Jin-Ming

    2014-01-01

    Seven known compounds, three diketopiperazine alkaloids, 12β-hydroxyverruculogen TR-2 (1), fumitremorgin C (2) and methylthiogliotoxin (5), two hetero-spirocyclic γ-lactam alkaloids, pseurotin A (3) and FD-838 (4), and cerevisterol (6) and herierin IV (7), were isolated from the mycelia of the basidiomycete Hericium erinaceum and identified by spectroscopic analyses. The antioxidant and antifungal activities of compounds 1-6 were evaluated. The results indicated that compounds 1, 3 and 6 exhibited potential antioxidant activity against DPPH (2, 2-diphenyl-1-picrylhydrazyl) radical with their IC50 data of ca. 12 μM, compared with positive control tertiary butylhydroquinone. In addition, compound 4 significantly inhibited the growth of two plant fungal pathogens Botrytis cinerea and Glomerella cingulata with an minimum inhibitory concentration of 6.25 μM for each, similar to that of the positive fungicide, carbendazim. Compounds 1-5 were isolated from the genus Hericium for the first time.

  19. Commercial Scale Production of Mushroom Liquid Seeds

    International Nuclear Information System (INIS)

    Rosnani Abdul Rashid; Hassan Hamdani Hassan Mutaat; Mohd Meswan Maskom; Khairuddin Abdul Rahim

    2015-01-01

    Mushroom liquid seed production technology was developed by Malaysian Nuclear Agency (Nuclear Malaysia) in the late 1990s. Initially, the liquid seeds were used mainly in the solid state fermentation process for converting oil palm empty fruit bunch fibres into ruminant feed. Considering widespread problems encountered by mushroom growers from use of solid seeds, especially in cases of contaminant agents infecting cultivated bags and inconsistencies in yield, we diverted our focus to utilising liquid seeds as alternative inocula for mushroom cultivation. These problems provide us opportunities to look into the issues and address the problems faced by mushroom growers. However, the technology of producing liquid seed at laboratory scale needs to be primed for commercial production. This paper discusses developmental aspects of mushroom liquid seed at commercial scale for the advancement of the country's mushroom industry. (author)

  20. Economic assessment of mushroom project commercialisation

    International Nuclear Information System (INIS)

    Mat Rasol Awang; Rosnani Abdul Rashid; Hassan Hamdani Hassan Mutaat; Meswan Maskom

    2010-01-01

    The market value of mushroom is worth US $45 billion comprising: US $28-30 billion from food, US $9-10 billion from medicinal products and US $3.5-4 billion from wild mushroom. Malaysian import deficit of mushroom over the year 2001-2007 was 40,933 metric ton that worth of RM 187.7 million. The existing local market is lucrative and the potential world market is very large. Having cultivation technology in placed, understanding key value chains of cultivation technology processes, this paper assesses the case study of project economic of mushroom commercialization. (author)

  1. Cadmium determination in Lentinus edodes mushroom species

    Directory of Open Access Journals (Sweden)

    Vera Akiko Maihara

    2012-09-01

    Full Text Available Many studies have drawn attention to the occurrence and concentration of toxic elements found in the fruiting body of mushrooms. Some edible mushroom species are known to accumulate high levels of inorganic contaminants, mainly cadmium, mercury, and lead. There are about 2,000 known edible mushroom species, but only 25 of them are cultivated and used as food. In Brazil, the most marketed and consumed mushroom species are Agaricus bisporus, known as Paris champignon, Lentinus edodes, or Shitake and Pleurotus sp, also called Shimeji or Hiratake. In this study, the concentration of cadmium was determined in Lentinus edodes mushrooms from different cities in São Paulo state and some samples imported from Japan and China. The analyses were performed by graphite furnace atomic absorption spectrometry after HNO3-H2O2 digestion. The results showed a lower concentration of Cd in the mushrooms cultivated in São Paulo (0.0079 to 0.023 mg.kg-1 in natura than that of the mushrooms cultivated abroad (0.125 to 0.212 mg.kg-1 in natura. Although there is no tolerance limit for Cd in mushrooms in Brazil, the results show that Lentinus edodes mushrooms can be safely consumed.

  2. Wild Mushroom Extracts as Inhibitors of Bacterial Biofilm Formation

    Directory of Open Access Journals (Sweden)

    Maria José Alves

    2014-08-01

    Full Text Available Microorganisms can colonize a wide variety of medical devices, putting patients in risk for local and systemic infectious complications, including local-site infections, catheter-related bloodstream infections, and endocarditis. These microorganisms are able to grow adhered to almost every surface, forming architecturally complex communities termed biofilms. The use of natural products has been extremely successful in the discovery of new medicine, and mushrooms could be a source of natural antimicrobials. The present study reports the capacity of wild mushroom extracts to inhibit in vitro biofilm formation by multi-resistant bacteria. Four Gram-negative bacteria biofilm producers (Escherichia coli, Proteus mirabilis, Pseudomonas aeruginosa, and Acinetobacter baumannii isolated from urine were used to verify the activity of Russula delica, Fistulina hepatica, Mycena rosea, Leucopaxilus giganteus, and Lepista nuda extracts. The results obtained showed that all tested mushroom extracts presented some extent of inhibition of biofilm production. Pseudomonas aeruginosa was the microorganism with the highest capacity of biofilm production, being also the most susceptible to the extracts inhibition capacity (equal or higher than 50%. Among the five tested extracts against E. coli, Leucopaxillus giganteus (47.8% and Mycenas rosea (44.8% presented the highest inhibition of biofilm formation. The extracts exhibiting the highest inhibitory effect upon P. mirabilis biofilm formation were Sarcodon imbricatus (45.4% and Russula delica (53.1%. Acinetobacter baumannii was the microorganism with the lowest susceptibility to mushroom extracts inhibitory effect on biofilm production (highest inhibition—almost 29%, by Russula delica extract. This is a pioneer study since, as far as we know, there are no reports on the inhibition of biofilm production by the studied mushroom extracts and in particular against multi-resistant clinical isolates; nevertheless, other

  3. Effect of gamma radiations on some organoleptic qualities of mushroom (Agraricus Bisporus)

    International Nuclear Information System (INIS)

    Wahid, M.

    1985-01-01

    Edible mushrooms were picked at a stretched-veil stage and irradiated at 0, 0.5, 1.0 and 2.5 kGy. The samples were studied for the organileptic characteristics in function of storage time and irradiation doses. No significant difference of irradiation was observed immediately on the colour, odour, flavour or texture of mushrooms. During storage the colour and texture of irradiated lots were superior as compared to unirradiated samples. Higher doses of irradiation brought about significantly favourable results in these qualities during storage. Odour and flavour did not differ significantly in all the treatments. Irradiated mushrooms were found to be better (hard) in texture when the measurements were made with a texturometer. Ionizing radiation exerted a favourable influence upon the organoleptic properties of picked mushrooms. (author)

  4. Concentration and behavior of radioactive cesium in several kinds of mushrooms in Hokkaido, (2)

    International Nuclear Information System (INIS)

    Okui, Toyo; Kobayashi, Satoshi; Takizawa, Namio.

    1991-01-01

    Concentrations of 137 Cs, 134 Cs and potassium were measured in cultivated and wild mushrooms and their matrixes (soils or woods) collected from Hokkaido in 1990. The 137 Cs concentrations in mushrooms were in the range of 0.07-188.9Bq/kg fresh weight. The highest 137 Cs concentration was observed in Clitocybe clavipes. The 137 Cs concentration ratios of the wood rotting fungi and the actomycorrhizal fungi were 0.8-5.0 and 0.3-1.1, respectively. Both values of mushrooms were remarkably higher than that of leafvegetables (10 -2 ∼10 -3 ). The potassium concentrations in mushrooms were in the range of 0.08-0.63 %. 134 Cs released from the Chernobyl atomic power plant stationin 1986 was observed in only Clitocybe clavipes. (author)

  5. Difference in the volatile composition of pine-mushrooms (Tricholoma matsutake Sing.) according to their grades.

    Science.gov (United States)

    Cho, In Hee; Choi, Hyung-Kyoon; Kim, Young-Suk

    2006-06-28

    The differences in volatile components of pine-mushrooms (Tricholoma matsutake Sing.) according to their grades were observed by applying multivariate statistical methods to GC-MS data sets. A total of 35 and 37 volatile components were identified in raw and cooked pine-mushrooms, respectively. The volatile components in pine-mushrooms were primarily composed of C8 species, such as 3-octanol, 1-octen-3-ol, 1-octanol, (E)-2-octen-1-ol, 3-octanone, 1-octen-3-one, (E)-2-octenal, and octanoic acid. The levels of ethyl octanoate, junipene, and 3-methyl-3-buten-2-one were much higher in raw pine-mushroom of higher grades, whereas the reverse was true for C8 components. On the other hand, furfuryl alcohol, benzyl alcohol, phenylethyl alcohol, dihydro-5-methyl-2(3H)-furanone, 2(5H)-furanone, (E)-2-methyl-2-butenal, furfural, phenylacetaldehyde, benzoic acid methyl ester, camphene, and beta-pinene were the major components of cooked mushrooms. These volatile components formed by various thermal reactions could be mainly responsible for the difference in volatile components of cooked pine-mushrooms according to their grades.

  6. A survey of domestic species of Basidiomycetes fungi for the presence of lectins inn their carpophores

    Directory of Open Access Journals (Sweden)

    Grażyna Końska

    2014-01-01

    Full Text Available Preliminary investigations were conducted to determine the presence of active lectins in carpophores of fungi from the class Basidiomycetes, collected from natural localities in southern and south-eastern Poland. The degree of agglutination activity (expressed as the titre of agglutination of aqueous extracts was determined at room temperature (18-20°C and at +4°C in respect to human and animal erythrocytes suspended in physiological saline, part of which were additionally treated with proteolytic enzymes. From among the 104 tested species, extracts from 41 of them showed agglutination activity, among which 18 were high. In six cases, specific activity against human ABH group antigens was found. Extracts from 5 species agglutinated only animal erythrocytes, with pigeon erythrocytes being exceptionally sensitive to the lectins. Extracts from two species had distinctly higher agglutination activity at 4°C, which suggests that lectins of the "cold" agglutinin type are present in these species. Analysis of extracts from caps and stems showed that caps had a higher lectin content.

  7. Fresh-keeping of mushroom by irradiation

    International Nuclear Information System (INIS)

    Liu Chao; Xu Hongqing; Wang Hong; Cai Jian

    2003-01-01

    The effect of 60 Co γ irradiation on the preservation of Agaricus bisporus were studied. The results showed that after irradiation the mushroom had lower rates of membrane split, opening of pilei, browning, decomposition and lose of fresh weight. The fresh keeping period of mushroom irradiated with 1.2 kGy and stored at 4 degree C was prolonged to 30 days

  8. Accuracy of sampling during mushroom cultivation

    NARCIS (Netherlands)

    Baars, J.J.P.; Hendrickx, P.M.; Sonnenberg, A.S.M.

    2015-01-01

    Experiments described in this report were performed to increase the accuracy of the analysis of the biological efficiency of Agaricus bisporus strains. Biological efficiency is a measure of the efficiency with which the mushroom strains use dry matter in the compost to produce mushrooms (expressed

  9. 7 CFR 1209.11 - Mushrooms.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false Mushrooms. 1209.11 Section 1209.11 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (MARKETING AGREEMENTS... CONSUMER INFORMATION ORDER Mushroom Promotion, Research, and Consumer Information Order Definitions § 1209...

  10. Temperature Control System for Mushroom Dryer

    Science.gov (United States)

    Wibowo, I. A.; Indah, Nur; Sebayang, D.; Adam, N. H.

    2018-03-01

    The main problem in mushroom cultivation is the handling after the harvest. Drying is one technique to preserve the mushrooms. Traditionally, mushrooms are dried by sunshine which depends on the weather. This affects the quality of the dried mushrooms. Therefore, this paper proposes a system to provide an artificial drying for mushrooms in order to maintain their quality. The objective of the system is to control the mushroom drying process to be faster compared to the natural drying at an accurate and right temperature. A model of the mushroom dryer has been designed, built, and tested. The system comprises a chamber, heater, blower, temperature sensor and electronic control circuit. A microcontroller is used as the controller which is programmed to implement a bang-bang control that regulates the temperature of the chamber. A desired temperature is inputted as a set point of the control system. Temperature of 45 °C is chosen as the operational drying temperature. Several tests have been carried out to examine the performance of the system including drying speed, the effects of ambient conditions, and the effects of mushroom size. The results show that the system can satisfy the objective.

  11. Phenylhydrazines in the cultivated mushroom (Agaricus bisporus)

    DEFF Research Database (Denmark)

    Andersson, H. C.; Gry, Jørn

    2004-01-01

    In 1991, the Nordic Working Group on Food Toxicology and Risk Evaluation (NNT) reviewed the available data on phenylhydrazines naturally occurring in the cultivated mushroom. It was concluded that the mushroom may contain about 500 mg of the hydrazine derivatives per kg fresh weight. The hydrazine...... derivatives as well as extracts of the cultivated mushroom were mutagenic to a variable degree in most of the reported short-term tests. The raw mushroom and several of the hydrazines induced tumours when administered to Swiss mice as reported by American scientists. However, reservations were expressed...... as to the design of the studies. Based on this review, and due to the concern expressed, a Nordic project (coordinated by Jørn Gry, Danish Veterinary and Food Administration) was initiated dealing with toxicological and chemical studies on the cultivated mushroom and its phenylhydrazine derivatives in order...

  12. Mushroom immunomodulators: unique molecules with unlimited applications.

    Science.gov (United States)

    El Enshasy, Hesham A; Hatti-Kaul, Rajni

    2013-12-01

    For centuries, mushrooms have been used as food and medicine in different cultures. More recently, many bioactive compounds have been isolated from different types of mushrooms. Among these, immunomodulators have gained much interest based on the increasing growth of the immunotherapy sector. Mushroom immunomodulators are classified under four categories based on their chemical nature as: lectins, terpenoids, proteins, and polysaccharides. These compounds are produced naturally in mushrooms cultivated in greenhouses. For effective industrial production, cultivation is carried out in submerged culture to increase the bioactive compound yield, decrease the production time, and reduce the cost of downstream processing. This review provides a comprehensive overview on mushroom immunomodulators in terms of chemistry, industrial production, and applications in medical and nonmedical sectors. Copyright © 2013 Elsevier Ltd. All rights reserved.

  13. Mushroom flora and associated insect fauna in Nsukka Urban ...

    African Journals Online (AJOL)

    The mushroom flora and associated insect pests of mushrooms in Nsukka urban was studied. The abundance of mushrooms from sampled communites is indicaed with the family, Agaricaceae predominating “out of home” environment yielded more mushrooms (4.62) than the homestead environment (3.26). Insect pests ...

  14. Current Overview of Mushroom Production in the World

    NARCIS (Netherlands)

    Royse, Daniel J.; Baars, J.J.P.; Tan, Qi

    2017-01-01

    Edible, medicinal, and wild mushrooms are the three major components of the global mushroom industry. World production of cultivated, edible mushrooms has increased more than 30‐fold since 1978. China is the main producer of cultivated, edible mushrooms. Lentinus edodes is now the world's leading

  15. Polycyclic aromatic hydrocarbons degradation by marine-derived basidiomycetes: optimization of the degradation process.

    Science.gov (United States)

    Vieira, Gabriela A L; Magrini, Mariana Juventina; Bonugli-Santos, Rafaella C; Rodrigues, Marili V N; Sette, Lara D

    2018-05-03

    Pyrene and benzo[a]pyrene (BaP) are high molecular weight polycyclic aromatic hydrocarbons (PAHs) recalcitrant to microbial attack. Although studies related to the microbial degradation of PAHs have been carried out in the last decades, little is known about degradation of these environmental pollutants by fungi from marine origin. Therefore, this study aimed to select one PAHs degrader among three marine-derived basidiomycete fungi and to study its pyrene detoxification/degradation. Marasmiellus sp. CBMAI 1062 showed higher levels of pyrene and BaP degradation and was subjected to studies related to pyrene degradation optimization using experimental design, acute toxicity, organic carbon removal (TOC), and metabolite evaluation. The experimental design resulted in an efficient pyrene degradation, reducing the experiment time while the PAH concentration applied in the assays was increased. The selected fungus was able to degrade almost 100% of pyrene (0.08mgmL -1 ) after 48h of incubation under saline condition, without generating toxic compounds and with a TOC reduction of 17%. Intermediate metabolites of pyrene degradation were identified, suggesting that the fungus degraded the compound via the cytochrome P450 system and epoxide hydrolases. These results highlight the relevance of marine-derived fungi in the field of PAH bioremediation, adding value to the blue biotechnology. Copyright © 2018. Published by Elsevier Editora Ltda.

  16. Long term repeated prescribed burning increases evenness in the basidiomycete laccase gene pool in forest soils.

    Science.gov (United States)

    Artz, Rebekka R E; Reid, Eileen; Anderson, Ian C; Campbell, Colin D; Cairney, John W G

    2009-03-01

    Repeated prescribed burning alters the biologically labile fraction of nutrients and carbon of soil organic matter (SOM). Using a long-term (30 years) repeated burning experiment where burning has been carried out at a 2- or 4-year frequency, we analysed the effect of prescribed burning on gross potential C turnover rates and phenol oxidase activity in relation to shifts in SOM composition as observed using Fourier-transform infrared spectroscopy. In tandem, we assessed the genetic diversity of basidiomycete laccases. While the overall effect of burning was a decline in phenol oxidase activity, Shannon diversity and evenness of laccases was significantly higher in burned sites. Co-correspondence analysis of SOM composition and laccase operational taxonomic unit frequency data also suggested a strong correlation. While this correlation could indicate that the observed increase in laccase genetic diversity due to burning is due to increased resource diversity, a temporal replacement of the most abundant members of the assembly by an otherwise dormant pool of fungi cannot be excluded. As such, our results fit the intermediate disturbance hypothesis. Effects were stronger in plots burned in 2-year rotations, suggesting that the 4-year burn frequency may be a more sustainable practice to ensure the long-term stability of C cycling in such ecosystems.

  17. Comparative Analysis of 35 Basidiomycete Genomes Reveals Diversity and Uniqueness of the Phylum

    Energy Technology Data Exchange (ETDEWEB)

    Riley, Robert; Salamov, Asaf; Otillar, Robert; Fagnan, Kirsten; Boussau, Bastien; Brown, Daren; Henrissat, Bernard; Levasseur, Anthony; Held, Benjamin; Nagy, Laszlo; Floudas, Dimitris; Morin, Emmanuelle; Manning, Gerard; Baker, Scott; Martin, Francis; Blanchette, Robert; Hibbett, David; Grigoriev, Igor V.

    2013-03-11

    Fungi of the phylum Basidiomycota (basidiomycetes), make up some 37percent of the described fungi, and are important in forestry, agriculture, medicine, and bioenergy. This diverse phylum includes symbionts, pathogens, and saprobes including wood decaying fungi. To better understand the diversity of this phylum we compared the genomes of 35 basidiomycete fungi including 6 newly sequenced genomes. The genomes of basidiomycetes span extremes of genome size, gene number, and repeat content. A phylogenetic tree of Basidiomycota was generated using the Phyldog software, which uses all available protein sequence data to simultaneously infer gene and species trees. Analysis of core genes reveals that some 48percent of basidiomycete proteins are unique to the phylum with nearly half of those (22percent) comprising proteins found in only one organism. Phylogenetic patterns of plant biomass-degrading genes suggest a continuum rather than a sharp dichotomy between the white rot and brown rot modes of wood decay among the members of Agaricomycotina subphylum. There is a correlation of the profile of certain gene families to nutritional mode in Agaricomycotina. Based on phylogenetically-informed PCA analysis of such profiles, we predict that that Botryobasidium botryosum and Jaapia argillacea have properties similar to white rot species, although neither has liginolytic class II fungal peroxidases. Furthermore, we find that both fungi exhibit wood decay with white rot-like characteristics in growth assays. Analysis of the rate of discovery of proteins with no or few homologs suggests the high value of continued sequencing of basidiomycete fungi.

  18. [The structure of micromycete communities and their synecologic interactions with basidiomycetes during decomposition of plant debris].

    Science.gov (United States)

    Terekhova, V A; Semenova, T A

    2005-01-01

    We investigated the interactions between micromycetes and basidiomycete mycelium on plant substrates in the course of their 3-year incubation in the litter of ecologically intact spruce forests of the Central State Biosphere Forest Sanctuary (Nelidovo District, Tver oblast). Only 40-60% of the micromycetes were involved in direct antagonistic interactions with basidiomycetous fungi. In terms of the ratio between physiologically active strains and those which did not interact with basidiomycete mycelium, we revealed differences in the structure of micromycete communities developing on various types of substrates (xylem, bark, sphagnum, leaves, needles, litter, and cotton grass). The micromycetes tested belonged to 49 species. At the end of the observation period, the fraction of microscopic fungi that actively influenced basidiomycete mycelium was four times lower in the inactive litter fraction (lignin-containing xylem debris) than in the active fraction (grass substrates). The mechanisms of indirect regulation of the structure and functions of micromycete communities are discussed, which may be based on the accumulation of phenolic compounds in the medium and changes in the enzyme activities of basidiomycete mycelium.

  19. Shelf life extension of mushrooms (agaricus bisporus) by gamma irradiation

    International Nuclear Information System (INIS)

    Wahid, M.; Kovacs, E.

    1980-01-01

    Fresh mushrooms were irradiated (0, 1.0, 2.5 kGy) and kept for 8 days at 287 K (14 deg C). The stored samples were studied for different quality parameters. It was observed that the growth rate was higher in the pileus than in the stipe portion of mushrooms. Veils started unstretching on the first day, and on the second day all were open in the control samples. An irradiation dose of 2.5 kGy strongly inhibited the veil opening throughout the storage period. Highly significant moisture loss occurred during storage. Irradiation significant reduced the weight loss after 2 days of storage. Highly significantly softening occurred in storage, but irradiation improved this condition. The irradiation dose of 2.5 kGy showed better results than 1.0 kGy. (author)

  20. Extensive sampling of basidiomycete genomes demonstrates inadequacy of the white rot/brown rot paradigm for wood decay fungi

    Science.gov (United States)

    Basidiomycota (basidiomycetes) make up 32% of the described fungi and include most wood decaying species, as well as pathogens and mutualistic symbionts. Wood-decaying basidiomycetes have typically been classified as either white rot or brown rot, based on the ability (in white rot only) to degrade ...

  1. Extensive sampling of basidiomycete genomes demonstrates inadequacy of the white-rot/brown-rot paradigm for wood decay fungi

    Science.gov (United States)

    Robert Riley; Asaf A. Salamov; Daren W. Brown; Laszlo G. Nagy; Dimitrios Floudas; Benjamin W. Held; Anthony Levasseur; Vincent Lombard; Emmanuelle Morin; Robert Otillar; Erika A. Lindquist; Hui Sun; Kurt M. LaButti; Jeremy Schmutz; Dina Jabbour; Hong Luo; Scott E. Baker; Antonio G. Pisabarro; Jonathan D. Walton; Robert A. Blanchette; Bernard Henrissat; Francis Martin; Daniel Cullen; David S. Hibbett; Igor V. Grigoriev

    2014-01-01

    Basidiomycota (basidiomycetes) make up 32% of the described fungi and include most wood-decaying species, as well as pathogens and mutualistic symbionts. Wood-decaying basidiomycetes have typically been classified as either white rot or brown rot, based on the ability (in white rot only) to degrade lignin along with cellulose and hemicellulose. Prior genomic...

  2. Glycosylated yellow laccases of the basidiomycete Stropharia aeruginosa.

    Science.gov (United States)

    Daroch, Maurycy; Houghton, Catharine A; Moore, Jonathan K; Wilkinson, Mark C; Carnell, Andrew J; Bates, Andrew D; Iwanejko, Lesley A

    2014-05-10

    Here we describe the identification, purification and characterisation of glycosylated yellow laccase proteins from the basidiomycete fungus Stropharia aeruginosa. Biochemical characterisation of two yellow laccases, Yel1p and Yel3p, show that they are both secreted, monomeric, N-glycosylated proteins of molecular weight around 55kDa with substrate specificities typical of laccases, but lacking the absorption band at 612nm typical of the blue laccase proteins. Low coverage, high throughput 454 transcriptome sequencing in combination with inverse-PCR was used to identify cDNA sequences. One of the cDNA sequences has been assigned to the Yel1p protein on the basis of identity between the translated protein sequence and the peptide data from the purified protein, and the full length gene sequence has been obtained. Biochemical properties, substrate specificities and protein sequence data have been used to discuss the unusual spectroscopic properties of S. aeruginosa proteins in the context of recent theories about the differences between yellow and blue laccases. Copyright © 2014 Elsevier Inc. All rights reserved.

  3. Influence of soil fungi (basidiomycetes) on the migration of Cs 134 + 137 and Sr 90 in coniferous forest soils

    International Nuclear Information System (INIS)

    Roemmelt, R.; Hiersche, L.; Schaller, G.; Wirth, E.

    1990-01-01

    During the first three years after the Chernobyl event high Cs 134 + 137 activities in fruitbodies of basidiomycetes have been measured. A decline of activities with time has not yet been observed. The activities are considerably higher compared to agricultural products from the same area. In order to study the movement of radiocesium in coniferous forest sites, the activities in soil, fungi, and plants have been measured. Based on these results a model to describe the cesium cycling in coniferous forest ecosystems is proposed with special emphasis on the influence of soil fungi and plants on the migration of cesium. As measurements of Sr 90 in forest ecosystems are rare this nuclide has been included in the investigations. (author)

  4. Oil palm empty fruit bunch as media for mushroom cultivation

    International Nuclear Information System (INIS)

    Mat Rasol Awang; Wan Badrin Wan Husin; Tajuddin Osman; Tamikazu Kume; Shinpei Matsuhashi

    1998-01-01

    The mushroom strains Pleurotus sajor caju(grey oyster mushroom), Pleurotus flavellatus((pink oyster mushroom), Pleurotus cystidiosus(abalone mushroom) and Auricularia polytricha (black jelly mushroom) grow satisfactorily on the EFB media treated with lime. Based on their Biological Efficiency (BE) or yield, the strain Pleurotus sajor caju was selected for further investigation. The BE of the Pleurotus sajor caju was 73.8 %. The lime treatment, aeration and four weeks incubation period was necessary for fruiting

  5. INTENSIFICATION OF JELLY MUSHROOM CULTIVATION IN PAKEM SLEMAN

    OpenAIRE

    Sulistiya; Retno Lantarsih; Titop Dwiwinarno*

    2015-01-01

    Mushroom cultivation is long enough to be a source of income for some people in Pakem, Sleman. However, cultivation techniques that do not yet meet the standards for technical, so that productivity is still low. Marketing mushrooms are limited to the traditional market. Waste mushroom has not been used well, so potentially to pollute the environment mushroom. This service activities include the provision of mushroom cultivation equipment, such as water pumps and termohygrome...

  6. Performance of mushroom fruiting for large scale commercial production

    International Nuclear Information System (INIS)

    Mat Rosol Awang; Rosnani Abdul Rashid; Hassan Hamdani Mutaat; Mohd Meswan Maskom

    2012-01-01

    The paper described the determination of mushroom fruiting yield, which is vital to economics of mushroom production. Consistency in mushroom yields enabling an estimation to be made for revenues and hence profitability could be predicted. It has been reported by many growers, there are a large variation in mushroom yields over different times of production. To assess such claims we have run four batches of mushroom fruiting and the performance fruiting body productions are presented. (author)

  7. Bioconcentration of artificial radionuclides in edible mushrooms: in situ and in vitro studies

    Energy Technology Data Exchange (ETDEWEB)

    Dementyev, Dmitry V.; Manukovsky, Nikolai S.; Bolsunovsky, Alexander Ya.; Alexandrova, Yuliyana V. [Institute of Biophysics, Siberian Branch of the Russian Academy of Sciences, 660036, Krasnoyarsk (Russian Federation)

    2014-07-01

    Some areas of the Yenisei River basin are affected by the operation of the Mining-and-Chemical Combine (MCC), producing weapons-grade plutonium. Flood plain soils of the Yenisei contain a wide range of artificial radionuclides, including transuranium elements, which can be accumulated by living organisms. Concentrations of artificial radionuclides and heavy metals accumulated by mushrooms may be several orders of magnitude higher than those accumulated by plants, and, thus, mushrooms may be used as bio-concentrators of radionuclides and heavy metals for bioremediation of contaminated areas. The purposes of this study were to investigate 1) species specificity of accumulation of artificial radionuclides by edible mushrooms in radioactively contaminated areas of the Yenisei River flood plain and 2) accumulation rates of artificial radionuclides, including transuranium elements, in mushrooms under laboratory conditions. Species specificity of accumulation of artificial radionuclides and uranium by mushrooms was analyzed for 12 species of edible mushrooms. The study was performed at the sites affected by MCC operation, which were divided into two groups: 1) the sites only affected by aerosol-bound radionuclides and 2) the sites that also received waterborne radionuclides. Field studies showed great interspecific variations in Cs-137 accumulation by mushrooms. Activity concentrations of Cs-137 in bioindicator species Suillus granulatus and S. Luteus reached 10 kBq/kg dry weight. S. granulatus and S. luteus are concentrators of Cs-137, as suggested by the analysis of concentration factors (CFs), which reached 0.7-16 for these mushroom species. The CF of U-238 in fruiting bodies of the mushrooms was no greater than 0.11. Yenisei flood plain soils contain a wide range of transuranium elements, which can accumulate in environmental objects. Laboratory experiments on accumulation of Am-241 from solution by mycelium and Am-241 accumulation by fruiting bodies of mushrooms

  8. BIOTECHNOLOGICAL ASPECTS OF INTERFACIAL TENSIOMETRY AND RHEOMETRY OF XYLOTROPHIC BASIDIOMYCETES CULTURE FLUID

    Directory of Open Access Journals (Sweden)

    Chaika A. V.

    2013-12-01

    Full Text Available The tensio-rheometric characteristics of 63 strains belonging to 19 basidiomycetes species submerged culture filtrate were investigated by the axisymmetric pendent drop profile analysis. The method showed required high sensitivity with mycological material. It was found that the interfacial tensiometric and rheometric parameters depend significantly on culture species, hence it is proposed to use ones complex for systematic identification of cultures and as a selection criterion for biosurfactantsproducing strains of basidiomycetes. Correlations of tensio-rheometric characteristics both among themselves and with the culture growth and lipid peroxidation rates were found. This provides an integrated indicator of the submerged culture metabolic state. By the results of the study several strains of basidiomycetes — potential producers of biosurfactants with a high growth rate and intensity of lipid peroxidation were selected for biotechnological manufacture.

  9. Two New Cyathane Diterpenoids from Mycelial Cultures of the Medicinal Mushroom Hericium erinaceus and the Rare Species, Hericium flagellum

    Directory of Open Access Journals (Sweden)

    Zeljka Rupcic

    2018-03-01

    Full Text Available Basidiomycetes of the genus Hericium are among the most praised medicinal and edible mushrooms, which are known to produce secondary metabolites with the potential to treat neurodegenerative diseases. This activity has been attributed to the discovery of various terpenoids that can stimulate the production of nerve growth factor (NGF or (as established more recently brain-derived neurotrophic factor (BDNF in cell-based bioassays. The present study reports on the metabolite profiles of a Lion’s Mane mushroom (Hericium erinaceus strain and a strain of the rare species, Hericium flagellum (synonym H. alpestre. While we observed highly similar metabolite profiles between the two strains that were examined, we isolated two previously undescribed metabolites, given the trivial names erinacines Z1 and Z2. Their chemical structures were elucidated by means of nuclear magnetic resonance (NMR spectroscopy and high resolution mass spectrometry. Along with six further, previously identified cyathane diterpenes, the novel erinacines were tested for neurotrophin inducing effects. We found that erinacines act on BDNF, which is a neurotrophic factor that has been reported recently by us to be induced by the corallocins, but as well on NGF expression, which is consistent with the literature.

  10. Two New Cyathane Diterpenoids from Mycelial Cultures of the Medicinal Mushroom Hericium erinaceus and the Rare Species, Hericium flagellum.

    Science.gov (United States)

    Rupcic, Zeljka; Rascher, Monique; Kanaki, Sae; Köster, Reinhard W; Stadler, Marc; Wittstein, Kathrin

    2018-03-06

    Basidiomycetes of the genus Hericium are among the most praised medicinal and edible mushrooms, which are known to produce secondary metabolites with the potential to treat neurodegenerative diseases. This activity has been attributed to the discovery of various terpenoids that can stimulate the production of nerve growth factor ( NGF ) or (as established more recently) brain-derived neurotrophic factor ( BDNF ) in cell-based bioassays. The present study reports on the metabolite profiles of a Lion's Mane mushroom ( Hericium erinaceus ) strain and a strain of the rare species, Hericium flagellum (synonym H. alpestre ). While we observed highly similar metabolite profiles between the two strains that were examined, we isolated two previously undescribed metabolites, given the trivial names erinacines Z1 and Z2. Their chemical structures were elucidated by means of nuclear magnetic resonance (NMR) spectroscopy and high resolution mass spectrometry. Along with six further, previously identified cyathane diterpenes, the novel erinacines were tested for neurotrophin inducing effects. We found that erinacines act on BDNF , which is a neurotrophic factor that has been reported recently by us to be induced by the corallocins, but as well on NGF expression, which is consistent with the literature.

  11. Mushrooms dehydration in a hybrid-solar dryer, using a phase change material

    International Nuclear Information System (INIS)

    Reyes, Alejandro; Mahn, Andrea; Vásquez, Francisco

    2014-01-01

    Highlights: • Mushroom slices were dehydrated in a hybrid solar dryer. • Drying and dehydrated kinetics were adjusted with models. • Effective diffusivity, were estimated considering or not shrinkage. • Paraffin wax as a phase change material was used in an accumulator of solar energy. - Abstract: Mushrooms were dehydrated in a hybrid solar dryer provided with a solar panel of a total exposed surface of 10 m 2 , electric resistances and paraffin wax as a phase change material. Mushrooms were cut in 8 mm or 12 mm slices. At the outlet of the drying chamber the air was recycled (70% or 80%) and the air temperature was adjusted to 60 °C. At the outlet of the solar panel the air temperature rose up to 30 °C above the ambient temperature, depending on solar radiation level. The effective diffusivity, estimated by the Simplified Constant Diffusivity Model, considering or not shrinkage, fluctuated between 2.5 · 10 −10 m 2 /s and 8.4 · 10 −10 m 2 /s with R 2 higher than 0.99, agreeing with values reported in literature. The empirical Page’s model resulted in a better adjustment, with R 2 above 0.998. In all runs the dehydrated mushrooms showed a notorious darkening and shrinkage. Rehydration assays at 30 °C showed that in less than 30 min rehydrated mushrooms reached a moisture content of 1.91 (dry basis). Rehydrated mushrooms had a higher hardness compared with fresh mushrooms. The Simplified Constant Diffusivity Model and the Peleg’s model adjusted to the rehydration data with RMSE values below 0.080. Thermal efficiency fluctuated between 22% and 62%, while the efficiency of the accumulator panel varied between 10% and 21%. The accumulator allowed reducing the electric energy input

  12. Reducing Shrinkage in Canned and Frozen Mushrooms

    OpenAIRE

    Gormley, T. R. (Thomas Ronan); Walshe, P.E.

    1982-01-01

    The process involving a preliminary soaking of the mushrooms in water for 20 min followed by a chill storage period followed by a further water soak for 2 hr, and known as the 3S process, gave a considerable reduction in total shrinkage in both brown and white strain canned mushrooms compared with the control samples. Water uptake by the mushrooms in the 3S process was greatest when the soaking water temperature was between 20 and 30°C and had a pH of 8. Citric acid in the blanch water enhanc...

  13. Optimization of substrate preparation for oyster mushroom (Pleurotus ostreatus) cultivation by studying different raw materials and substrate preparation conditions (composting: phases I and II).

    Science.gov (United States)

    Vieira, Fabrício Rocha; de Andrade, Meire Cristina Nogueira

    2016-11-01

    In recent years, oyster mushroom (Pleurotus ostreatus) has become one of the most cultivated mushrooms in the world, mainly in Brazil. Among many factors involved in a mushroom production, substrate preparation is the most critical step, which can be influenced by composting management techniques. Looking forward to optimizing the substrate preparation process, were tested different composting conditions (7 and 14 days of composting with or without conditioning), potential raw materials (decumbens grass, brizantha grass and sugarcane straw) and nitrogen supplementation (with or without wheat bran) on oyster mushroom yield and biological efficiency (BE). The substrate composted for 7 days with conditioning showed higher yield and biological efficiency of mushroom (24.04 and 100.54 %, respectively). Substrates without conditioning (7 and 14 days of composting) showed smaller mushroom yield and biological efficiency. Among the raw materials tested, brizantha grass showed higher mushroom yield followed by decumbens grass, sugarcane straw and wheat straw (28.5, 24.32, 23.5 and 19.27 %, respectively). Brizantha grass also showed higher biological efficiency followed by sugarcane straw, decumbens grass and wheat straw (123.95, 103.70, 96.90 and 86.44 %, respectively). Supplementation with wheat bran improved yield and biological efficiency in all substrate formulations tested; thus, oyster mushroom yield and biological efficiency were influenced by substrate formulation (raw materials), supplementation and composting conditions.

  14. Mercury in mushrooms and soil from the Wieluńska Upland in south-central Poland.

    Science.gov (United States)

    Falandysz, Jerzy; Bielawski, Leszek; Kawano, Masabide; Brzostowski, Andrzej; Chudzyński, Krzysztof

    2002-09-01

    Concentrations of mercury were determined in the fruiting bodies of 15 species of higher mushrooms and underlying soil substrate collected from Wieluńska Upland in northern part of Sandomierska Valley in south-central Poland in 1995. A total of 197 samples of caps, 197 stalks, 30 whole fruiting bodies and 227 soil (0-10 cm layer) were analyzed. Mean mercury concentrations in soil substrate corresponding to 15 mushroom species were between 28 +/- 17 and 85 +/- 62 ng/g dry matter (total range between 3.0-190 ng/g). The average cap to stalk concentration quotients of Hg were around 2 (range between 1.1 +/- 1.1 and 2.8 +/- 1.4). However, this quotient in Larch bolete (Suillus grevillei) was 4.4 +/- 6.3. Concentrations of Hg varied depending on the mushroom species. Parasol Mushroom (Macrolepiota procera) and Horse mushroom (Agaricus arvensis) contained the greatest mean mercury concentrations both in caps (between 4500 +/- 1700 and 4400 +/- 2400 ng/g dry matter) and stalks (between 2800 +/- 1300 and 3000 +/- 2000 ng/g dry matter). Both the Parasol Mushroom and Horse mushroom were characterised also by a greater potential to bioconcentrate mercury from soils as evidenced by great bioconcentration factors (BCFs), which were between 170 +/- 160 and 130 +/- 120 for caps, and 110 +/- 97 and 89 +/- 92 for stalks. Mercury concentrations in caps and stalks of False death cap (Amanita citrina) increased (p Suillus luteus).

  15. INTENSIFICATION OF JELLY MUSHROOM CULTIVATION IN PAKEM SLEMAN

    Directory of Open Access Journals (Sweden)

    Sulistiya

    2015-01-01

    Full Text Available Mushroom cultivation is long enough to be a source of income for some people in Pakem, Sleman. However, cultivation techniques that do not yet meet the standards for technical, so that productivity is still low. Marketing mushrooms are limited to the traditional market. Waste mushroom has not been used well, so potentially to pollute the environment mushroom. This service activities include the provision of mushroom cultivation equipment, such as water pumps and termohygrometer and nozzle, and education and training bookkeeping, marketing, and processing waste into mushroom compost. The results showed an increase in the production of mushroom seen from the Biological Conversion Efficiency (BCE are in the top 30 percent. Partners also has a business bookkeeping and have Blog to market the mushroom by on-line. Partners also have the skills to process the manure (compost made from the waste of mushroom which can be used to help fertilize their crops.

  16. Ameliorative Effect of Different Concentration of Mushroom ...

    African Journals Online (AJOL)

    Prof. Ogunji

    ameliorative effect of mushroom in the post-experimental stage. Samples of liver and ... except in the liver which showed mild periportal chronic inflammatory cell. However, the .... alcohol for 12 hours and through absolute alcohol to remove ...

  17. Investigations on Mushroom Storage and Quality Parameters

    Directory of Open Access Journals (Sweden)

    Ömür Dündar

    2016-03-01

    Full Text Available In this study, researchers on storage and quality properties of mushrooms cultivated in the world and Turkey have been investigated. Mushrooms contain some important minerals and vitamins such as iron, calcium, phosphorus, potassium, copper and folate, thiamine, riboflavin, niacin, vitamin B, C, D and also they are a good source of carbohydrate and protein. After harvest, to extend the shelf life of mushrooms, some applications such as pre-cooling, storage in appropriate temperature, use of different types of polyethylene packaging, modified atmosphere packaging, nitric oxide and UV light applications were done on mushrooms. The effects of these applications on physical and chemical features such as like weight loss, firmness, cap opening rate, cap diameter, stem diameter, browning, colour, respiration rate, enzymatic reactions, total phenols, total sugars, aminoacid content were investigated.

  18. Antibacterial, Antiradical Potential and Phenolic Compounds of Thirty-One Polish Mushrooms.

    Directory of Open Access Journals (Sweden)

    Natalia Nowacka

    Full Text Available Among many sources of natural bioactive substances, mushrooms constitute a huge and almost unexplored group. Fungal compounds have been repeatedly reported to exert biological effects which have prompted their use in pharmaceutical and cosmetic industry. Therefore, the aim of this study was analysis of chemical composition and biological activity of 31 wild growing mushroom species (including saprophytic and parasitic from Poland.Qualitative and quantitative LC-ESI-MS/MS analysis of fourteen phenolic acids in the mushrooms analysed was performed. Moreover, total phenolic content was determined by the modified Folin-Ciocalteau method. Antioxidative activity of ethanolic extracts towards DPPH• free radical was examined. Antibacterial activity against Gram-positive (S. epidermidis, S. aureus, B. subtilis, M. luteus and Gram-negative (E. coli, K. pneumoniae, P. aeruginosa, P. mirabilis microbial strains was analyzed.As a result, the first such broad report on polyphenolic composition, antiradical and antimicrobial potential of wild growing Polish mushrooms was developed. Mushroom extracts were found to contain both benzoic (protocatechuic, 4-OH-benzoic, vanillic, syringic and cinnamic acid derivatives (caffeic, p-coumaric, ferulic. Total phenolic content in mushrooms ranged between 2.79 and 53.13 mg gallic acid equivalent /g of dried extract in Trichaptum fuscoviolaceum and Fomes fomentarius, respectively. Fungi showed much differentiated antiradical activity, from highly active F. fomentarius to poorly effective Russula fragilis (IC50 1.39 to 120.54 mg per mg DPPH•, respectively. A quite considerable relationship between phenolic content and antiradical activity has been demonstrated. Mushrooms varied widely in antimicrobial potential (MIC from 0.156 to 5 mg/ml. Generally, a slightly higher activity against Gram-positive than Gram-negative strains was observed. This is the first study concerning the chemical composition and biological activity

  19. [Effect of cultivation in zinc media on the growth of and the degree of zinc in organic form in transgenic metallothionein mushroom].

    Science.gov (United States)

    Sheng, Ji-Ping; Shen, Lin; Ru, Bing-Gen

    2009-03-01

    Metallothioneins (MTs) are a family of low molecular weight, cysteine-rich and metal-binding functional proteins. Transgenic MT mushroom can be used as functional food additives, but its zinc-enriching ability has not been studied systemically until now. The zinc contents in mycelia of transgenic MT mushroom (Pleurotus ostreatus) and wild type mushroom mycelia cultivated in different zinc concentration media were analyzed by ICP-OES. The growth status, zinc-enriching ability and degree of zinc in organic form (DZOF) were also analyzed. Results showed that MT mushroom mycelia grew rapidly, but the growth was inhibited when the zinc content in solid media was higher than 1.6 mmol x L(-1). MT mushroom mycelia could enrich more zinc than that of wild type, and the zinc content in MT mushroom mycelia could be 2.56-27.49 mg x kg(-1) when it was cultivated in a liquid media with 0.6-1.2 mmol x L(-1) zinc. DZOF of MT mushroom mycelia in a liquid media with 0.6 mmol x L(-1) zinc at 7 d was significantly higher (88.7%) than that in the wild type (82.1%, alpha = 0.05), but there was no significant difference in DZOF when the MT mushroom mycelia was cultivated in a liquid media with different zinc content at 7 d.

  20. Flagellate dermatitis following consumption of shiitake mushroom

    Directory of Open Access Journals (Sweden)

    Hui Voon Loo

    2011-10-01

    Full Text Available Japanese dermatologists were the first to describe the very characteristic flagellate dermatitis following consumption of under-cooked or raw shiitake mushroom (Lentinus edodes. These similar eruptions were also reported in patients treated with bleomycin, in dermatomyositis and adult onset Still’s disease. We report a case where a 40 year old chinese female developed flagellate dermatitis following ingestion of a bun containing shiitake mushroom.

  1. Use of molecular markers for the study of wild fungus basidiomycetes

    Directory of Open Access Journals (Sweden)

    Blanca Estela Gómez Luna

    2012-09-01

    Full Text Available Molecular marker techniques in the study of wild basidiomycete, are increasingly applied to ecology projects, with special focus on analysis of genetic diversity. Often require specialized methods for extracting the DNA of organisms of natural environments, because of the complex compounds that are (carbohydrate polymers and contaminants from the environment (soil particles. Biological materials used were basidiocarps collected in the forest of Santa Rosa, Guanajuato. And mycelium isolated from these basidiocarps. In this work we used a DNA extraction method that allowed the PCR amplification, restriction enzyme digestion and Southern hybridization by non-radioactive method. The results were obtained: Amplification of the ITS1 region of ribosomal unit of the different species of Basidiomycetes. It was possible to observe the genetic diversity among different species of basidiomycetes and the mycelia. Furthermore, the results also suggest differences in DNA methylation between the vegetative mycelium and mycelium of basidiocarp. Finally it is noteworthy that there were no previous work on the application of methods of non-radioactive Southern hybridization for analysis of wild Basidiomycetes and this pioneering work in applying this technique.

  2. Differential stress-induced regulation of two quinone reductases in the brown rot Basidiomycete Gloeophyllum trabeum

    Science.gov (United States)

    Roni Cohen; Melissa R. Suzuki; Kenneth E. Hammel

    2004-01-01

    Quinone reductases (QRDs) have two important functions in the basidiomycete Gloeophyllum trabeum, which causes brown rot of wood. First, a QRD is required to generate biodegradative hydroxyl radicals via redox cycling between two G. trabeum extracellular metabolites, 2,5-dimethoxyhydroquinone (2,5-DMHQ) and 2,5-dimethoxy-1,4-benzoquinone (2,5- DMBQ). Second, because 2,...

  3. A Comparative Study of the Cell Wall Structure of Basidiomycetous and Related Yeasts

    NARCIS (Netherlands)

    Kreger-van Rij, N.J.W.; Veenhuis, M.

    1971-01-01

    The wall of basidiomycetous and related yeasts showed a lamellar structure in sections of both budding cells and hyphae fixed with potassium permanganate. The yeasts also had a typical way of bud formation and septation. These features differ from those recorded for ascomycetous yeasts. In the

  4. Prospects for bioprocess development based on recent genome advances in lignocellulose degrading basidiomycetes

    Science.gov (United States)

    Chiaki Hori; Daniel Cullen

    2016-01-01

    Efficient and complete degradation of woody plant cell walls requires the concerted action of hydrolytic and oxidative systems possessed by a relatively small group of filamentous basidiomycetous fungi. Among these wood decay species, Phanerochaete chrysosporium was the first to be sequenced (Martinez et al. 2004). In...

  5. Antioxidative activities and chemical characterization of polysaccharides extracted from the basidiomycete Schizophyllum commune

    NARCIS (Netherlands)

    Klaus, A.; Kozarski, M.; Niksic, M.; Jakovljevic, D.; Todorovic, N.; Griensven, van L.J.L.D.

    2011-01-01

    Antioxidant properties of hot water extract (HWE), hot water extracted polysaccharides (HWP) and hot alkali extracted polysaccharides (HWAE) were obtained from fruiting bodies of the wild basidiomycete Schizophyllum commune. All extracts contained both a- and ß-glucans as determined by Megazyme

  6. Hirsutane Sesquiterpenes from Cultures of the Basidiomycete Marasmiellus sp. BCC 22389

    Directory of Open Access Journals (Sweden)

    Masahiko Isaka

    2016-08-01

    Full Text Available Abstract Two new hirsutane sesquiterpenes, marasmiellins A (1 and B (2, were isolated from cultures of the basidiomycete Marasmiellus sp. BCC 22389. The structures were elucidated on the basis of NMR spectroscopic and mass spectrometry data. The absolute configuration of marasmiellin B was determined by application of the modified Mosher’s method. Graphical Abstract

  7. Nectar sugars and bird visitation define a floral niche for basidiomycetous yeast on the Canary Islands.

    Science.gov (United States)

    Mittelbach, Moritz; Yurkov, Andrey M; Nocentini, Daniele; Nepi, Massimo; Weigend, Maximilian; Begerow, Dominik

    2015-02-01

    Studies on the diversity of yeasts in floral nectar were first carried out in the late 19th century. A narrow group of fermenting, osmophilous ascomycetes were regarded as exclusive specialists able to populate this unique and species poor environment. More recently, it became apparent that microorganisms might play an important role in the process of plant pollination. Despite the importance of these nectar dwelling yeasts, knowledge of the factors that drive their diversity and species composition is scarce. In this study, we linked the frequencies of yeast species in floral nectars from various host plants on the Canary Islands to nectar traits and flower visitors. We estimated the structuring impact of pollination syndromes (nectar volume, sugar concentration and sugar composition) on yeast diversity.The observed total yeast diversity was consistent with former studies, however, the present survey yielded additional basidiomycetous yeasts in unexpectedly high numbers. Our results show these basidiomycetes are significantly associated with ornithophilous flowers. Specialized ascomycetes inhabit sucrose-dominant nectars, but are surprisingly rare in nectar dominated by monosaccharides. There are two conclusions from this study: (i) a shift of floral visitors towards ornithophily alters the likelihood of yeast inoculation in flowers, and (ii) low concentrated hexose-dominant nectar promotes colonization of flowers by basidiomycetes. In the studied floral system, basidiomycete yeasts are acknowledged as regular members of nectar. This challenges the current understanding that nectar is an ecological niche solely occupied by ascomycetous yeasts.

  8. Nitrogen availability alters macrofungal basidiomycete Blackwell Publishing, Ltd. community structure in optimally fertilized loblolly pine forests

    Science.gov (United States)

    Ivan P. Edwards; Jennifer L. Cripliver; Andrew R. Gillespie; Kurt H. Johnsen; M. Scholler; Ronald F. Turco

    2004-01-01

    We investigated the effect of an optimal nutrition strategy designed to maximize loblolly pine (Pinus taeda) growth on the rank abundance structure and diversity of associated basidiomycete communities.We conducted both small- and large-scale below-ground surveys 10 years after the initiation of optimal...

  9. Assessment of wood-inhabiting Basidiomycetes for biokraft pulping of softwood chips

    CSIR Research Space (South Africa)

    Wolfaardt, F

    2004-10-01

    Full Text Available Wood-inhabiting Basidiomycetes have been screened for various applications in the pulp and paper industry and it is evident that different fungi need to be used to suit the specific requirements of each application. This study assessed...

  10. Mushroom's spore size and time of fruiting are strongly related: is moisture important?

    Science.gov (United States)

    Kauserud, Håvard; Heegaard, Einar; Halvorsen, Rune; Boddy, Lynne; Høiland, Klaus; Stenseth, Nils Chr

    2011-04-23

    Most basidiomycete fungi produce annual short-lived sexual fruit bodies from which billions of microscopic spores are spread into the air during a short time period. However, little is known about the selective forces that have resulted in some species fruiting early and others later in the fruiting season. This study of relationships between morphological and ecological characteristics, climate factors and time of fruiting are based upon thorough statistical analyses of 66 520 mapped records from Norway, representing 271 species of autumnal fruiting mushroom species. We found a strong relationship between spore size and time of fruiting; on average, a doubling of spore size (volume) corresponded to 3 days earlier fruiting. Small-spored species dominate in the oceanic parts of Norway, whereas large-spored species are typical of more continental parts. In separate analyses, significant relationships were observed between spore size and climate factors. We hypothesize that these relationships are owing to water balance optimization, driven by water storage in spores as a critical factor for successful germination of primary mycelia in the drier micro-environments found earlier in the fruiting season and/or in continental climates.

  11. Effects of Ganodermanondiol, a New Melanogenesis Inhibitor from the Medicinal Mushroom Ganoderma lucidum

    Directory of Open Access Journals (Sweden)

    Ji-Woong Kim

    2016-10-01

    Full Text Available Ganoderma lucidum, a species of the Basidiomycetes class, has been attracting international attention owing to its wide variety of biological activities and great potential as an ingredient in skin care cosmetics including “skin-whitening” products. However, there is little information available on its inhibitory effect against tyrosinase activity. Therefore, the objectives of this study were to investigate the chemical composition of G. lucidum and its inhibitory effects on melanogenesis. We isolated the active compound from G. lucidum using ethanol extraction and ethyl acetate fractionation. In addition, we assayed its inhibitory effects on tyrosinase activity and melanin biosynthesis in B16F10 melanoma cells. In this study, we identified a bioactive compound, ganodermanondiol, which inhibits the activity and expression of cellular tyrosinase and the expression of tyrosinase-related protein-1 (TRP-1, TRP-2, and microphthalmia-associated transcription factor (MITF, thereby decreasing melanin production. Furthermore, ganodermanondiol also affected the mitogen-activated protein kinase (MAPK cascade and cyclic adenosine monophosphate (cAMP-dependent signaling pathway, which are involved in the melanogenesis of B16F10 melanoma cells. The finding that ganodermanondiol from G. lucidum exerts an inhibitory effect on tyrosinase will contribute to the use of this mushroom in the preparation of skin care products in the future.

  12. Lignin-modifying enzymes of the white rot basidiomycete Ganoderma lucidum

    Energy Technology Data Exchange (ETDEWEB)

    D/Souza, T.M.; Merritt, C.S.; Reddy, C.A.

    1999-12-01

    Ganoderma lucidum, a white rot basidiomycete widely distributed worldwide, was studied for the production of the lignin-modifying enzymes laccase, manganese-dependent peroxidase (MnP), and lignin peroxidase (LiP). Laccase levels observed in high-nitrogen shaken cultures were much greater than those seen in low-nitrogen, malt extract, or wool-grown cultures and those reported for most other white rot fungi to date. Laccase production was readily seen in cultures grown with pine or poplar as the sole carbon and energy source. Cultures containing both pine and poplar showed 5- to 10-fold-higher levels of laccase than cultures containing pine or poplar alone. Since syringyl units are structural components important in poplar lignin and other hardwoods but much less so in pine lignin and other softwoods, pine cultures were supplemented with syringic acid, and this resulted in laccase levels comparable to those seen in pine-plus-poplar cultures. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis of concentrated extracellular culture fluid from HM cultures showed two laccase activity bands, where as isoelectric focusing revealed five major laccase activity bands with estimated pIs of 3.0, 4.25, 4.5, and 5.1. Low levels of MnP activity were detected in poplar-grown cultures but not in cultures grown with pine, with pine plus syringic acid, or in HN medium. No LiP activity was seen in any of the media tested; however, probing the genomic DNA with the LiP cDNA (CLG4) from the white rot fungus Phanerochaete chrysosporium showed distinct hybridization bands suggesting the presence of lip-like sequences in G. lucidum.

  13. ACCUMULATION OF RADIOCESIUM BY MUSHROOMS IN THE ENVIRONMENT: A LITERATURE REVIEW AND IMAGE GALLERY

    Energy Technology Data Exchange (ETDEWEB)

    Duff, M; Mary Ramsey, M

    2006-11-05

    During the last 50 years, a large amount of information on radionuclide accumulators or 'sentinel-type' organisms in the environment has been published. Much of this work focused on the risks of food-chain transfer of radionuclides to higher organisms such as reindeer and man. However, until the 1980's and 1990's, there has been little published data on the radiocesium ({sup 134}Cs and {sup 137}Cs) accumulation by mushrooms. This presentation will consist of a review of the published data for {sup 134,137}Cs accumulation by mushrooms in nature. The review will consider the time of sampling, sample location characteristics, the radiocesium source term and other aspects that promote {sup 134,137}Cs uptake by mushrooms. This review will focus on published data for mushrooms that demonstrate a large propensity for use in the environmental biomonitoring of radiocesium contamination. It will also provide photographs and descriptions of habitats for many of these mushrooms to facilitate their collection for biomonitoring.

  14. Lack of energy compensation over 4 days when white button mushrooms are substituted for beef.

    Science.gov (United States)

    Cheskin, Lawrence J; Davis, Lisa M; Lipsky, Leah M; Mitola, Andrea H; Lycan, Thomas; Mitchell, Vanessa; Mickle, Brooke; Adkins, Emily

    2008-07-01

    Increasing intake of low energy density (ED) foods in place of high ED foods has been proposed as a strategy for preventing or treating obesity. This study investigated how substituting mushrooms for beef in a test lunch affected energy intake, fat intake, palatability, appetite, satiation and satiety in normal weight, overweight and obese adults. Each subject consumed a total of eight test lunches in our lab over two consecutive weeks. The order of presentation of four consecutive meat lunches and four consecutive mushroom lunches was randomized. Energy content of meat and mushroom lunches varied (783 kcal versus 339 kcal), while volume was held constant. Energy intakes were significantly higher during meat lunches than mushroom lunches (730+/-7.9 kcal versus 310+/-5.8 kcal). Subjects exhibited only partial compensation (11.4+/-12.0%) for this difference over 4 days. Total daily energy intake and fat intake were significantly greater in the meat condition than in the mushroom condition, while ratings of palatability, appetite, satiation and satiety did not differ significantly. These results suggest that substituting low ED foods for high ED foods in otherwise similar recipes can be an effective method for reducing daily energy and fat intake.

  15. Effect of Different Packaging Films on Storability of Mushroom (Agaricus bisporus

    Directory of Open Access Journals (Sweden)

    R. Aminzadeh

    2014-02-01

    Full Text Available The button mushroom is rich food full of nutrient but compared with other fruits and vegetables, mushroom has a higher respiration rate and due to the lack of protective layer to prevent water loss, decay occurs quickly. It seems that suitable coating film is the one way for increase the storage life of mushroom. Therefore present research was carried out as split plot design in farme of CRD to find the best coating film in order to increase the storage life. In this research, the treatments were: control (package with Selefon, Poly Ethylene (PE with 40 and 65 micron thickness, Biaxially Oriented Polypropylene (BOPP with 25, 35 and 40 micron thickness, Cast PolyPropylen (CPP with 25 and 40 micron thickness, Poly Ester (PET with 12 and 24 micron thickness and Poly Vinyl Chloride (PVC with 30 micron thickness. The samples were estimated after 0, 10, 15, 20 and 25 days storage at 1°C and 90 % RH in 3 replications. The results showed that the types of plastic coating had significant effects on all measured characteristics as campared to that of control. Highest firmness value, Soluble Solid Content (SSC, titratable acidity, acidity (pH, and lowest weight less and decay were observed in packet mushroom with the coating film: BOPP and CPP and the lowest amounts were observed in the mushroom packed with control, PVC, PET and PE films. The effects of time on all of the measured during the storage period, were significant too.

  16. Activity of 137Cs in Forest Mushrooms in Poland in 2000

    International Nuclear Information System (INIS)

    Grabowski, D.; Kurowski, W.; Muszynski, W.; Rubel, B.; Smagala, G.; Swietochowska, J.

    2001-01-01

    Full text: The radiocaesium in mushrooms has been monitored in Poland after the Chernobyl accident. The samples of mushrooms were collected all over the territory of Poland during the period 1986-2000. Activity of 137 Cs was much higher than in other foodstuff. This is connected with specific forest ecosystem and tendency to accumulate caesium by some kinds of mushrooms. The significant variations were observed in different species of mushrooms collected at the same area and time. This paper presents the activity of 137 Cs in Xerocomus badius, Boletus edulis and Cantharellus cibarius in Poland in 2000. The samples had been analysed during mushroom-season (June-September). Activities of 137 Cs were measured by gamma spectrometry with HPGe or NaI(Tl) detectors. The activity of 137 Cs was in range 24-472 Bq/kg for Xerocomus badius, 1-678 Bq/kg for Boletus edulis and 1-557 Bq/kg for Cantharellus cibarius. The results were compared to the data from previous years. (author)

  17. Composition and antioxidant properties of wild mushrooms Boletus edulis and Xerocomus badius prepared for consumption.

    Science.gov (United States)

    Jaworska, Grażyna; Pogoń, Krystyna; Skrzypczak, Aleksandra; Bernaś, Emilia

    2015-12-01

    Wild edible mushrooms Boletus edulis and Xerocomus badius were prepared for consumption by braising with 10 % canola oil (half of the batch was blanched prior to braising). Fresh X.badius had comparable to B.edulis amounts of proximate components and higher levels of most B-group vitamins and antioxidants. Analyzed mushrooms prepared for consumption fulfilled 7-14 % RDA of vitamin B1 for healthy adults and 15-35, 18-37 and 1 % RDA of B2, B3 and B3 respectively. Prepared for consumption mushrooms were rich in antioxidants containing in 100 g dry weight 164,601 mg total polyphenols, 19-87 mg total flavonoids, 22.1-27.4 mg L-ascorbic acid, 0.531-1.031 mg β-carotene, 0.325-0.456 mg lycopene and 38.64-44.49 mg total tocopherols and presented high antioxidant activity against ABTS (4.9-36.5 mmol TE), against DPPH (7.8-21.3 mmol TE) and in FRAP assay (15.0-28.1 mmol Fe(2+)). Mushrooms prepared for consumption with blanching prior to culinary treatment showed lower antioxidant properties and vitamin content in comparison to mushrooms braised raw.

  18. Effect of gamma irradiation on the appearance and composition of edible mushrooms

    International Nuclear Information System (INIS)

    Wahid, M.; Darwish, Y.M.A.

    1981-01-01

    Fresh edible mushrooms picked with closed caps, and irradiated at 0, 1.0 and 2.5 kGy doses were stored for 8 days at 20+-2 0 C and investigated for the changes in ascorbic acid, protein contents, free alpha-amino N and total phenols. It was observed that during storage free alpha-amino N decreased significantly, while the protein contents remained somewhat constant till 4th day of storage. The ascorbic acid increased in the beginning and then decreased significantly. Total phenols decreased in the beginning and then accumulated during further storage. Irradiation had no effect on the proteins, but decreased ascorbic acid contents of mushrooms. The levels of free alpha-amino N and total phenols were significantly higher in irradiated treatments as compared to unirradiated mushrooms. (author)

  19. Accumulation of 90Sr and 137Cs by fruit bodies of mushrooms

    International Nuclear Information System (INIS)

    Kozhevnikova, T.L.; Mishenkov, N.N.; Martyushova, L.N.; Krivolutskii, D.A.

    1994-01-01

    The dimensions of accumulation of 90 Sr and 137 Cs by mushrooms depends on the stores of forest litter: The greater they are, the higher the concentration. As the nuclides migrate from the forest litter, the dimensions of their accumulation decrease: In the tenth year of the investigation the concentration of 90 Sr in mushrooms had diminished by 1.5-3 times; and 137 Cs, by as much as 30 times. The fruit bodies of mushrooms accumulate 2.5-5 times more 137 Cs, and in individual cases up to 40 times more, than 90 Sr. The maximum amount of 90 Sr and 137 Cs is accumulated by annulated boletus; the minimum amount, by rough boletus

  20. Reduction of energy use in mushroom cultivation; Reductie energiegebruik in de champignonteelt

    Energy Technology Data Exchange (ETDEWEB)

    Baar, J; Amsing, J G.M.; Rutjens, A J

    2005-01-15

    The aim of this project was to examine options for reducing energy use in mushroom cultivation. The project focused particularly on the reduction of energy use in making the mushrooms disease-free through use of steam prior to the next cultivation round. To this end, various methods were examined that could lead to a 50% energy use reduction for mushroom cultivation, or higher [Dutch] Het doel van dit project was om te onderzoeken welke mogelijkheden er zijn om het energiegebruik in de teelt van champignons te verminderen. Met name richtte het project zich op de reductie van het energiegebruik bij het ziektevrij maken van de teeltcellen door stomen voorafgaande aan de volgende teelt. Hiertoe werden diverse methoden onderzocht die kunnen leiden tot een reductie van het energieverbruik van 50% of meer voor de champignonteelt.

  1. Cultivation of Pleurotus ostreatus and other edible mushrooms.

    Science.gov (United States)

    Sánchez, Carmen

    2010-02-01

    Pleurotus ostreatus is the second most cultivated edible mushroom worldwide after Agaricus bisporus. It has economic and ecological values and medicinal properties. Mushroom culture has moved toward diversification with the production of other mushrooms. Edible mushrooms are able to colonize and degrade a large variety of lignocellulosic substrates and other wastes which are produced primarily through the activities of the agricultural, forest, and food-processing industries. Particularly, P. ostreatus requires a shorter growth time in comparison to other edible mushrooms. The substrate used for their cultivation does not require sterilization, only pasteurization, which is less expensive. Growing oyster mushrooms convert a high percentage of the substrate to fruiting bodies, increasing profitability. P. ostreatus demands few environmental controls, and their fruiting bodies are not often attacked by diseases and pests, and they can be cultivated in a simple and cheap way. All this makes P. ostreatus cultivation an excellent alternative for production of mushrooms when compared to other mushrooms.

  2. Effect of oyster mushroom ( Pleurotus ostreatus ) mycelia on ...

    African Journals Online (AJOL)

    Effect of oyster mushroom ( Pleurotus ostreatus ) mycelia on petroleum ... of chains of hydrocarbon in a petroleum-hydrocarbon-contaminated substrate over time. ... Keywords: Mycoremediation, Mycelia, Contaminated Soil, Oyster Mushroom ...

  3. Indole compounds in some culinary-medicinal higher basidiomycetes from Poland.

    Science.gov (United States)

    Muszynska, Bozena; Sutkowska-Ziaja, Katarzyna; Ekiert, Halina

    2011-01-01

    Methanolic extracts of two species collected from natural habitats in Poland, Boletus edulis and Suillus luteus, and one species from a commercial source, Pleurotus ostreatus, were analyzed for the presence of non-hallucinogenic indole compounds. The contents of indole compounds in these species were both qualitatively and quantitatively diverse, ranging from 0.01 to 34.11 mg/100 g d.w. Two of 11 tested indole compounds, 5-hydroxytryptophan (0.18, 2.08, 1.63 mg/100 g d.w.) and serotonin (6.52, 10.14, 34.11 mg/100 g d.w.), were present in all three species under study. B. edulis and S. luteus were found to contain L-tryptophan (0.39 and 2.61 mg/100g d.w.) and melatonin (0.68 and 0.71 mg/100 g d.w.). Tryptamine was present in two species, i.e., B. edulis (1.17 mg/100 g d.w.) and in P. ostreatus (0.91 mg/100 g d.w.), in which slight amounts of indole acetonitrile (0.04 and 0.01 mg/100 g d.w., respectively) were also identified. Indoleacetic acid was a common metabolite for P. ostreatus and S. luteus and its contents amounted to 0.21 and 0.04 mg/100 g d.w., respectively. Indole compounds degradation products kynurenic acid (2.63 mg/100 g d.w.) and kynurenine sulfate were (19.57 mg/100 g d.w.) were observed only in S. luteus.

  4. Mushroom as a product and their role in mycoremediation

    OpenAIRE

    Kulshreshtha, Shweta; Mathur, Nupur; Bhatnagar, Pradeep

    2014-01-01

    Mushroom has been used for consumption as product for a long time due to their flavor and richness in protein. Mushrooms are also known as mycoremediation tool because of their use in remediation of different types of pollutants. Mycoremediation relies on the efficient enzymes, produced by mushroom, for the degradation of various types of substrate and pollutants. Besides waste degradation, mushroom produced a vendible product for consumption. However, sometimes they absorb the pollutant in t...

  5. Mushroom cultivation in Brazil: challenges and potential for growth

    OpenAIRE

    Dias,Eustáquio Souza

    2010-01-01

    Mushroom cultivation is rapidly expanding in Brazil because Brazilians have discovered the medicinal and culinary value of mushrooms and their economic situation has improved. However, the horticultural technology for cultivating mushrooms under Brazilian conditions is lacking. For many years, the mushroom cultivation technology used in Brazil was adapted from developed countries whose materials and climate were different from those of Brazil. In order to exploit the Brazilian potential for m...

  6. Dung-associated, Potentially Hallucinogenic Mushrooms from Taiwan

    OpenAIRE

    Yen-Wen Wang; Shean-Shong Tzean

    2015-01-01

    To identify potentially hallucinogenic mushrooms, dung-associated mushrooms collected from Qingtiangang, Yangmingshan National Park were subjected to a detailed morphological investigation and phylogentic analysis. The investigation identified four taxa: a recorded species (Panaeolus antillarum); a new combination (Conocybe nitrophila); and two new species (Psilocybe angulospora, Protostropharia ovalispora). Morphological and molecular characteristics of the collected mushrooms were compared ...

  7. Cultivation of oyster mushroom ( Pleurotus spp.) on palm oil ...

    African Journals Online (AJOL)

    Oyster mushroom is a popular mushroom due to its nutritional, medicinal and potential commercial value. In Malaysia, the fungus is currently cultivated on sawdust and rice husk. In this study, the efficiency of cultivating oyster mushroom was assessed using palm oil mesocarp fibre as a substrate. The experiment consisted ...

  8. A resource efficiency assessment of the industrial mushroom production chain

    NARCIS (Netherlands)

    Zisopoulos, Filippos K.; Becerra Ramírez, Henry A.; Goot, van der Atze Jan; Boom, Remko M.

    2016-01-01

    We compare the exergetic performance of a conventional industrial mushroom production chain with a mushroom production chain where part of the compost waste is recycled and reused as raw material. The critical exergy loss points (CEPs) identified are the cooking-out process of the spent mushroom

  9. Proximate and mineral composition of four edible mushroom species

    African Journals Online (AJOL)

    Owner

    Key words: Edible mushrooms; food composition. INTRODUCTION. Mushrooms are saprophytes. ... riboflavin, biotin and thiamine (Chang and Buswell,. 1996). Ogundana and Fagade (1981) indicated that ... Four edible mushroom species were analyzed for food composition according to the Association of Official Analytical ...

  10. Vitamin D-fortified chitosan films from mushroom waste

    Science.gov (United States)

    Brown mushroom (Agaricus bisporus) stalk bases from mushroom waste were treated with UV-B light to rapidly increase vitamin D2 content. Chitin was also recovered from this waste and converted into chitosan by N-deacetylation. FTIR spectra showed that the mushroom chitosan were similar to chitosan fr...

  11. Symbiosis and synergy: Can mushrooms and timber be managed together?

    Science.gov (United States)

    Sally. Duncan

    2000-01-01

    Recreational and tribal use of mushrooms has been historically important, and during the last two decades, commercial demand for mushrooms has burgeoned. A large nontimber forest product market in the Pacific Northwest is for various species of wild edible mushrooms. Many of these species grow symbiotically with forest trees by forming nutrient exchange structures...

  12. 210Po, 210Pb, 40K and 137Cs in edible wild berries and mushrooms and ingestion doses to man from high consumption rates of these wild foods

    International Nuclear Information System (INIS)

    Gwynn, Justin P.; Nalbandyan, Anna; Rudolfsen, Geir

    2013-01-01

    This paper discusses activity concentrations of 210 Po, 210 Pb, 40 K and 137 Cs in edible wild berries and mushrooms collected from Øvre Dividalen national park, Northern Norway and derives committed effective ingestion doses to man based on high consumption rates of these wild foods. Edible wild berries and mushrooms accumulated similar levels of 210 Pb, but mushrooms accumulated higher levels of 210 Po and 40 K than berries. There appears to be a clear difference in the ability of Leccinum spp. of fungi to accumulate 210 Po and/or translocate 210 Po to mushrooms compared to Russula spp. of fungi. Activity concentrations of 137 Cs in edible wild berries and mushrooms from Øvre Dividalen national park reflected the lower levels of fallout of this radionuclide in Northern Norway compared to more central areas following the Chernobyl accident. For mushrooms, ingestion doses are dominated by 210 Po, while for berries, 40 K is typically the main contributor to dose. Based on high consumption rates, ingestion doses arising from the combination of 210 Po, 210 Pb and 40 K were up to 0.05 mSv/a for berries and 0.50 mSv/a for mushrooms. Consumption of such wild foods may result in a significant contribution to total annual doses when consumed in large quantities, particularly when selecting mushrooms species that accumulate high activity concentrations of 210 Po. - Highlights: ► 210 Po/ 210 Pb activity ratios were typically less than one for berries. ► 210 Po/ 210 Pb activity ratios were all greater than one for mushrooms. ► Dose rates from mushrooms were dominated by 210 Po and by 40 K for berries. ► Wild foods can give a significant contribution to total annual ingestion dose.

  13. Radiotracer experiments on the uptake of radionuclides by mushrooms and vegetables

    International Nuclear Information System (INIS)

    Ban-Nai, Tadaaki; Muramatsu, Yasuyuki; Yoshida, Satoshi; Yanagisawa, Kei

    1996-01-01

    Radiotracer experiments were performed to study radionuclide uptake by mushrooms and plants. Four mushroom species, Hebeloma vinosophyllum, Flammulina velutipes, Agrocybe cylindracea and Coprinus phlyctidosporus were cultivated in a flask containing medium with the radiotracers 137 Cs, 85 Sr, 54 Mn, 60 Co and 65 Zn. Mushrooms tended to accumulate Cs, Mn and Zn. The concentration ratio of Cs between mushroom and medium ranged from 2.6 to 21. The highest was observed in H. vinospohyllum. The concentration ratio of Mn was about 10, while the ratio of Zn ranged from 15 to 30. No noticeable accumulations were found for Sr or Co. Transfer factors (TFs) of radionuclides from soil to leaf vegetables (cabbage, Chinese cabbage, komatsuna, spinach and lettuce) were also studied using Andosol (a representative Japanese soil). The TFs of 137 Cs, 85 Sr, 54 Mn, 60 Co and 65 Zn for edible parts of these vegetables were (mean value) 0.11, 0.24, 0.61, 0.05 and 0.52, respectively. The TFs of Mn, Co and Zn for spinach were higher than those for the other vegetables. The distributions of Cs in different organs of the leaf vegetables were rather uniform. The TFs of Sr and Mn were higher for older (outer) leaves than younger (inner) ones. In contrast to Sr and Mn, TFs of Zn for younger leaves were higher than those for older ones

  14. Rating of cesium contamination of wild mushrooms

    International Nuclear Information System (INIS)

    Henrich, E.; Zapletal, M.; Friedrich, M.; Haider, W.

    1988-08-01

    'Rating' means here a 5-fold scale with the ranges: more than 100 nCi/kg raw weight - 'very high'; 300 - 100; 3 - 30; 1 - 3; less than 1 nCi/kg - 'very low'. A list of some 50 - 60 different kinds of mushrooms are listed and evaluated in this scale, as from 1988 and from a region with a high Chernobyl fallout. As a comparison, contamination values of 12 mushroom sorts from before the Chernobyl accident, coming from atmospheric nuclear weapons tests, are also given. 2 figs., 5 tabs. (qui)

  15. Peel testing behavior of mushroom-top terminated structured adhesives

    Science.gov (United States)

    Hossfeld, Craig Kenneth

    Synthetic structured surfaces have been created based on the extraordinary adhesive ability exhibited by insects, spiders, and geckos. The adhesion of synthetic and natural structured adhesives is attributed to the cumulative addition of van der Waals forces acting on the structures of the surface. It has been shown that for synthetic surfaces a "mushroom top" or "flanged" terminating structure exhibits the highest adhesion. Unfortunately, due to the variety of testing and fabrication techniques and the small scale of previous studies, the detachment behavior of these structures is not well understood. This research systematically investigated the effect of peel angle, pillar diameter, flange diameter, and pillar aspect ratio on the force required for peeling. Explicit emphasis was placed on relatively large pillar structures to allow for in situ optical visualization in order to gain insights into fundamental mechanisms which dictate peeling. Traditional molding techniques were used to fabricate optical-scale mushroom terminated structures with pillar diameters of 1mm and 400microm and aspect ratios of 1, 3, and 5. Results were quantitatively compared to peel testing theory for conventional adhesives. It was convincingly demonstrated that the adhesive energy of a patterned surface changes as function of angle, and cannot be treated as a constant. The variability in the energy was linked to mechanistic differences in detachment through in situ observations and finite element analysis. Experimental results show that smaller pillars do not necessarily lead to higher adhesion during peeling, aspect ratio plays little role in peeling adhesive behavior, and pillar flange size is critical to adhesion. The conclusions from this study outline design parameters for mushroom topped dry adhesives in peeling applications.

  16. The mechanics of anaphase B in a basidiomycete as revealed by laser microbeam microsurgery

    International Nuclear Information System (INIS)

    Bayles, C.J.; Aist, J.R.; Berns, M.W.

    1993-01-01

    Bayles, C. J., Aist, J. R., and Berns, M. W. 1993. The mechanics of anaphase B in a basidiomycete as revealed by laser microbeam microsurgery. Experimental Mycology 17, 191-199. Cytoplasmic forces were found to be actively pulling on the spindle pole bodies during anaphase B in the dikaryotic, basidiomycete fungus, Helicobasidium mompa. When the spindle of one nucleus was severed with a laser microbeam at mid anaphase B, its two spindle pole bodies separated at a much faster rate than did those of the intact spindle in the other nucleus of the same cell. Since astral microtubule populations apparently reach their maximum during anaphase B in this fungus, we suggest that these microtubules may be involved in the cytoplasmic pulling forces. The spindle appears to act primarily as a governor, regulating the rate at which the spindle pole bodies are separated

  17. Characteristics of radiocesium concentration by mushrooms and microorganisms

    International Nuclear Information System (INIS)

    Sugiyama, Hideo; Terada, Hiroshi; Kuwahara, Chikako; Shibata, Hisashi; Maeda, Yoko; Kato, Fumio

    2000-01-01

    The 137 Cs values in cultured edible fruiting bodies of Pleurotus ostreatus (Fr.) Kummer Y-1 (P. ostreatus) were 2-3 orders of magnitude higher than those in the wild mushrooms. The concentration ratio (CR, 137 Cs or Cs concentration in the dried cultured fruiting bodies or mycelia/ 137 Cs or Cs concentration in the fresh medium) suggested that 137 Cs in the medium actively migrated into the mushroom. The 137 Cs and stable Cs uptake by the cultured fruiting bodies of P. ostreatus were affected by the presence of K the same as the mycelia. Streptomyces lividans TK24 (S.lividans) and Streptomyces sp. TOHO-2 (Streptomyces sp.), one of the soil microorganisms, grown in the presence of Cs showed high accumulation of Cs in the mycelia. Elementary analysis of P. ostreatus and S. lividans were performed using a scanning electron microscopy-energy dispersive X-ray microanalyzer. The ratio of Cs in the stationary phase to that in the proliferation phase at the mycelial root of P. ostreatus formed in the early stage was about five times that at the mycelial tip. S. lividans and Streptomyces sp. grown on the YM agar plate containing CsCl showed white spots locating at a similar intervals. Concentrations of Cs, P, O and Mg in the white spots were higher than those in other regions. (author)

  18. Microcontroller based automatic temperature control for oyster mushroom plants

    Science.gov (United States)

    Sihombing, P.; Astuti, T. P.; Herriyance; Sitompul, D.

    2018-03-01

    In the cultivation of Oyster Mushrooms need special treatment because oyster mushrooms are susceptible to disease. Mushroom growth will be inhibited if the temperature and humidity are not well controlled because temperature and inertia can affect mold growth. Oyster mushroom growth usually will be optimal at temperatures around 22-28°C and humidity around 70-90%. This problem is often encountered in the cultivation of oyster mushrooms. Therefore it is very important to control the temperature and humidity of the room of oyster mushroom cultivation. In this paper, we developed an automatic temperature monitoring tool in the cultivation of oyster mushroom-based Arduino Uno microcontroller. We have designed a tool that will control the temperature and humidity automatically by Android Smartphone. If the temperature increased more than 28°C in the room of mushroom plants, then this tool will turn on the pump automatically to run water in order to lower the room temperature. And if the room temperature of mushroom plants below of 22°C, then the light will be turned on in order to heat the room. Thus the temperature in the room oyster mushrooms will remain stable so that the growth of oyster mushrooms can grow with good quality.

  19. Mushroom Shiitake, is it mutagenic or antimutagenic agent? Shiitake, um cogumelo mutagênico ou antimutagênico?

    Directory of Open Access Journals (Sweden)

    Ilce Mara de Syllos Cólus

    2001-11-01

    Full Text Available Mushrooms have been consumed by eastern populations due to their edible and medicinal properties, for a long time. Over the years, there has also been a gradual increase in the consumption of mushrooms in the western countries, including Brazil. However, the benefits or harms that these mushrooms may cause to the human health are still uncertain. Shiitake (Lentinula edodes (Berk. Pegler is one of the most appreciated fungi in the Brazilian cuisine and its functional and nutritional properties have been extensively studied. Other characteristics of this basidiomycet have also been reported, including its antitumoral, antiviral, bactericidal properties, as well as being a homeostasis and biorhythm regulator. However, studies regarding its mutagenic and antimutagenic potential in prokaryotic and eukaryotic organisms are scarce. Knowledge of these biological properties is essential before a product can be recommended as food and/or drug. Therefore, its indication as a beneficial product to human health is premature since it is necessary to broaden studies on the mutagenic and antimutagenic activities of the mushroom Shiitake or of its active compounds.   Desde a antigüidade, os cogumelos vêm sendo consumidos pelos povos orientais devido às suas  propriedades medicinais e comestíveis e ao longo dos anos tem-se observado um aumento gradativo no consumo também nos países ocidentais, inclusive o Brasil. No entanto, ainda há dúvidas quanto aos benefícios ou prejuízos à saúde, decorrentes do uso destes cogumelos pelas populações humanas. Entre os cogumelos muito apreciados na culinária brasileira, destaca-se o Shiitake (Lentinula edodes (Berk. Pegler, um dos fungos comestíveis mais estudados quanto às suas propriedades funcionais e nutricionais. Já se tem conhecimento sobre várias atividades deste basidiomiceto superior, como antitumoral, antiviral, bactericida, regulador da homeostase e do biorritmo. No entanto, poucos trabalhos

  20. Gamma-ray induced delay of fruiting body initiation in a basidiomycete, Hebeloma vinosophyllum

    International Nuclear Information System (INIS)

    Takimoto, K.

    1980-01-01

    The effect of gamma-radiation on fruiting body initiation in a basidiomycete, Hebeloma vinosophyllum, was investigated. Fruiting of this fungus is induced by visible light, but irradiation of the mycelium before or after light treatment delayed fruiting body initiation. The time required for fruiting body initiation increased with the radiation dose. The induction of fruiting bodies had two gamma-radiation sensitive stages, one immediately before fruiting body initiation and the other 15 to 20 h after the start of photoinduction. (author)

  1. Isolation and characterization of microsatellite loci from the ectomycorrhizal basidiomycete Suillus luteus

    OpenAIRE

    Muller, L.; LAMBAERTS, Marc; VANGRONSVELD, Jaco; COLPAERT, Jan

    2006-01-01

    Eight microsatellite loci were isolated from the ectomycorrhizal basidiomycete Suillus luteus using a dual-suppression-polymerase chain reaction (PCR) method. In a test sample of 40 isolates, the total number of alleles per locus and the expected heterozygosities ranged from five to 16 and from 0.532 to 0.811, respectively. These highly polymorphic markers allow an accurate description of the genetic diversity and structure of S. luteus populations.

  2. The Genome of the Basidiomycetous Yeast and Human Pathogen Cryptococcus neoformans

    OpenAIRE

    Loftus, Brendan J.; Fung, Eula; Roncaglia, Paola; Rowley, Don; Amedeo, Paolo; Bruno, Dan; Vamathevan, Jessica; Miranda, Molly; Anderson, Iain J.; Fraser, James A.; Allen, Jonathan E.; Bosdet, Ian E.; Brent, Michael R.; Chiu, Readman; Doering, Tamara L.

    2005-01-01

    Cryptococcus neoformans is a basidiomycetous yeast ubiquitous in the environment, a model for fungal pathogenesis, and an opportunistic human pathogen of global importance. We have sequenced its ~20-megabase genome, which contains ~6500 intron-rich gene structures and encodes a transcriptome abundant in alternatively spliced and antisense messages. The genome is rich in transposons, many of which cluster at candidate centromeric regions. The presence of these transposons may drive karyotype i...

  3. Diversity and decay ability of basidiomycetes isolated from lodgepole pines killed by the mountain pine beetle.

    Science.gov (United States)

    Son, E; Kim, J-J; Lim, Y W; Au-Yeung, T T; Yang, C Y H; Breuil, C

    2011-01-01

    When lodgepole pines (Pinus contorta Douglas ex Louden var. latifolia Engelm. ex S. Watson) that are killed by the mountain pine beetle (Dendroctonus ponderosae) and its fungal associates are not harvested, fungal decay can affect wood and fibre properties. Ophiostomatoids stain sapwood but do not affect the structural properties of wood. In contrast, white or brown decay basidiomycetes degrade wood. We isolated both staining and decay fungi from 300 lodgepole pine trees killed by mountain pine beetle at green, red, and grey stages at 10 sites across British Columbia. We retained 224 basidiomycete isolates that we classified into 34 species using morphological and physiological characteristics and rDNA large subunit sequences. The number of basidiomycete species varied from 4 to 14 species per site. We assessed the ability of these fungi to degrade both pine sapwood and heartwood using the soil jar decay test. The highest wood mass losses for both sapwood and heartwood were measured for the brown rot species Fomitopsis pinicola and the white rot Metulodontia and Ganoderma species. The sap rot species Trichaptum abietinum was more damaging for sapwood than for heartwood. A number of species caused more than 50% wood mass losses after 12 weeks at room temperature, suggesting that beetle-killed trees can rapidly lose market value due to degradation of wood structural components.

  4. Hypersensitivity pneumonitis associated with mushroom worker's lung: an update on the clinical significance of the importation of exotic mushroom varieties.

    Science.gov (United States)

    Moore, John E; Convery, Rory P; Millar, B Cherie; Rao, Juluri R; Elborn, J Stuart

    2005-01-01

    Hypersensitivity pneumonitis remains an important industrial disease in mushroom workers. It has a significant morbidity, and early diagnosis and removal from exposure to the antigen are critically important in its management. Recently, several new allergens have been described, particularly those from mushroom species originating in the Far East, which are of clinical significance to workers occupationally exposed to such allergens in cultivation, picking, and packing of commercial mushroom crops. Importing of exotic mushrooms including Shiitake is common in EU countries, and some of the exotic species of mushrooms are cultivated for local markets. This practice may contribute to an increase in clinical cases of mushroom hypersensitivity pneumonitis. This update reviews the recent literature and examines changing trends of mushroom worker's lung, with increased movement of commercial product and labour markets worldwide.

  5. Yield and size of oyster mushroom grown on rice/wheat straw basal substrate supplemented with cotton seed hull.

    Science.gov (United States)

    Yang, Wenjie; Guo, Fengling; Wan, Zhengjie

    2013-10-01

    Oyster mushroom (Pleurotus ostreatus) was cultivated on rice straw basal substrate, wheat straw basal substrate, cotton seed hull basal substrate, and wheat straw or rice straw supplemented with different proportions (15%, 30%, and 45% in rice straw substrate, 20%, 30%, and 40% in wheat straw substrate) of cotton seed hull to find a cost effective substrate. The effect of autoclaved sterilized and non-sterilized substrate on growth and yield of oyster mushroom was also examined. Results indicated that for both sterilized substrate and non-sterilized substrate, oyster mushroom on rice straw and wheat basal substrate have faster mycelial growth rate, comparatively poor surface mycelial density, shorter total colonization period and days from bag opening to primordia formation, lower yield and biological efficiency, lower mushroom weight, longer stipe length and smaller cap diameter than that on cotton seed hull basal substrate. The addition of cotton seed hull to rice straw and wheat straw substrate slowed spawn running, primordial development and fruit body formation. However, increasing the amount of cotton seed hull can increase the uniformity and white of mycelium, yield and biological efficiency, and increase mushroom weight, enlarge cap diameter and shorten stipe length. Compared to the sterilized substrate, the non-sterilized substrate had comparatively higher mycelial growth rate, shorter total colonization period and days from bag opening to primordia formation. However, the non-sterilized substrate did not gave significantly higher mushroom yield and biological efficiency than the sterilized substrate, but some undesirable characteristics, i.e. smaller mushroom cap diameter and relatively long stipe length.

  6. 21 CFR 155.201 - Canned mushrooms.

    Science.gov (United States)

    2010-04-01

    ... percent of the water capacity of the container. (iii) Determine drained weight as specified in § 155.3(a..., packed with a suitable liquid medium which may include water; and may contain one or more safe and... to promote color retention. (4) Labeling requirements. (i) The name of the food is mushrooms. The...

  7. Water retention in mushroom during sustainable processing

    NARCIS (Netherlands)

    Paudel, E.

    2015-01-01

    This thesis deals with the understanding of the water holding capacity of mushroom, in the context of a redesign of their industrial processing. For designing food process the retention of food quality is of the utmost importance. Water holding capacity is an important quality aspect of

  8. Antimicrobial activities of some selected Nigerian mushrooms ...

    African Journals Online (AJOL)

    ... were either weakly inhibited or not inhibited at all. The minimum inhibitory concentration (MIC) ranged between 1.25 and 9.00mg/ml for bacteria and between 10.50 and 17.50mg/ml for fungi. These results are discussed in relation to therapeutic value of the studied mushrooms. African Journal of Biomedical Research Vol.

  9. Neuroscience: Intelligence in the Honeybee Mushroom Body

    OpenAIRE

    Caron, Sophie; Abbott, Larry F.

    2017-01-01

    Intelligence, in most people’s conception, involves combining pieces of evidence to reach non-obvious conclusions. A recent theoretical study shows that intelligence-like brain functions can emerge from simple neural circuits, in this case the honeybee mushroom body.

  10. 137Cs in mushrooms from Croatia sampled 15-30 years after Chernobyl.

    Science.gov (United States)

    Tucaković, Ivana; Barišić, Delko; Grahek, Željko; Kasap, Ante; Širić, Ivan

    2018-01-01

    The aim of this study was to select species with higher potential to accumulate 137 Cs among the available mushroom species, by determining the activity concentrations of 137 Cs in mushrooms collected along north and north-western part of Croatia. A total of 55 samples of 14 different species were analyzed and the potential of mycorrhizal and saprotrophic species to accumulate 137 Cs was compared. A wide range of the dry weight activity concentrations of 137 Cs was detected, ranging from 0.95 to 1210 Bq/kg (154 Bq/kg mean value; 52.3 Bq/kg geometric mean) in mycorrhizal and 1.05-36.8 Bq/kg (8.90 Bq/kg mean value; 5.49 Bq/kg geometric mean) in saprotrophic species. Statistical analyses showed that mycorrhizal species accumulate significantly higher concentrations of 137 Cs and thus could perform better as long-term bioindicators of environmental pollution by radiocaesium then saprotrophic species. The comparison of Boletus sp. and Hydnum repandum (both mycorrhizal species commonly found in Croatia) showed, in general order of magnitude, higher accumulation in Hydnum repandum. Clearly, mushrooms, especially mycorrhizal species, can be used as significant indicators even decades after the occurrence of any serious 137 Cs contamination event. However, as a wide range of values indicates that various parameters may influence the total uptake of the 137 Cs into the mushroom fruit bodies, it is necessary to emphasize that 137 Cs activity detected in a single mushroom sample is very site-specific. Copyright © 2017 Elsevier Ltd. All rights reserved.

  11. Influence of pH on the growth, laccase activity and RBBR decolorization by tropical basidiomycetes

    Directory of Open Access Journals (Sweden)

    Sérgio Luiz Moreira Neto

    2009-10-01

    Full Text Available The basidiomycete fungi Lentinus crinitus and Psilocybe castanella are being evaluated in a bioremediation process of soils contaminated with organochlorine industrial residues in the Baixada Santista, São Paulo. The aim of the present study was to determine the influence of pH on the fungal growth, in vitro decolorization of anthraquinonic dye Remazol Brilliant Blue R (RBBR and laccase activity. The pH of the culture medium influenced the growth of L. crinitus and P. castanella, which presented less growth at pH 5.9 and pH 2.7, respectively. The fungi were able to modify the pH of the culture medium, adjusting it to the optimum pH for growth which was close to 4.5. Decolorization of the RBBR was maximal at a pH of 2.5 to 3.5. Higher laccase activity was observed at pH 3.5 and pH 4.5 for L. crinitus and P. castanella, respectively. pH was found to be an important parameter for both the growth of these fungi and the enzymatic system involved in RBBR decolorization.Os fungos basidiomicetos Lentinus crinitus e Psilocybe castanella estão sendo avaliados em processo de biorremediação de solos contaminados com resíduos industriais organoclorados, na Baixada Santista, SP. O presente estudo avaliou a influência do pH no crescimento, na descoloração in vitro do corante Azul Brilhante de Remazol R (RBBR e na atividade de lacase durante cultivo destes fungos, de forma a subsidiar a otimização do processo. O pH do meio influenciou o crescimento de L. crinitus e de P. castanella, com menor biomassa em pH 5,9 e pH 2,7, respectivamente. Os fungos foram capazes de modificar o pH inicial do meio de cultura, de modo a ajustá-lo ao valor ótimo de crescimento, próximo a 4,5. Descoloração in vitro do RBBR foi máxima em pH 2,5 e 3,5. Maiores atividades de lacase foram obtidas em pH 3,5 e em pH 4,5 para L. crinitus e P. castanella, respectivamente. Evidenciou-se que o pH é um parâmetro importante para o crescimento destes fungos, atividade de lacase

  12. Evaluation of casing materials made from spent mushroom substrate and coconut fibre pith for use in production of Agaricus bisporus (Lange) Imbach

    Energy Technology Data Exchange (ETDEWEB)

    Pardo-Gimenez, A.; Pardo-Gonzalez, J. E.

    2008-07-01

    The agronomic performance of different proportions of mixtures of coconut fibre (CF) pith and spent mushroom substrate (SMS) was studied for their use as casing material in mushroom cultivation. After chemical and biological characterisation of the casing substrates qualitative and quantitative production parameters were evaluated in a cycle of Agaricus production. An increase in the proportion of SMS reduced the number of carpophores and overall yield; while the first flush was delayed, mushroom size tended to increase and the mushrooms had a higher dry matter content and a better texture, although their colour was worse. Combinations of CF pith and SMS of 4:1 and 3:2 (v/v) gave biological efficiencies of 92.9 and 82.6 kg 100 kg-1 compost, respectively. These values compare well with that obtained from the commercial casings used as a control. The high electrical conductivity of the mixture containing the highest proportion of SMS would limit its use. However, the results indicate the viability of reusing SMS as an ingredient of casing material for mushroom cultivation. This alternative could be considered to partially replace the organic substrates normally used for mushroom cultivation, with the double advantage of decreasing cost and reducing the environmental impact of waste disposal. Additional key words: alternative casing, compost reuse, mushroom cultivation. (Author) 31 refs.

  13. Map of radioactive contamination in mushrooms of Poland in 1991

    International Nuclear Information System (INIS)

    Mietelski, J.W.; Jasinska, M.; Kubica, B.; Kozak, K.; Macharski, P.

    1992-01-01

    Results from part of the Polish Government programme for forests radioactive contamination studies are presented. 278 samples of edible mushroom (Xerocomus badius) were analysed for radiocesium 137 Cs and 134 Cs) and 40 K using low-background gamma spectrometer with a germanium detector. Samples were collected from all districts of Poland in October 1991 by forest inspectors. In consequence maps of 137 Cs, 134 Cs and for 40 K concentration in ''Xerocomus badius'' are presented. The method of measurements is also presented. Large differences in radiocesium contamination levels are observed for various parts of the country. The higher radiocesium contamination level is observed in Czestochowa-Opole region. Maximum value for 137 Cs is equal to 157 kBq/kg d.m. and that for 134 Cs is equal to 16.3 kBq/kg d.m. The 40 K content level is nearly constant and equal to c.a. 1.3 kBq/kg d.m. Minimum values for caesium contamination were observed in the Bieszczady Mountains. The effective dose equivalent estimation due to the consumption of mushrooms is performed. The limits of ingestion amounts are calculated. (author). 15 refs, 15 figs, 6 tabs

  14. Increase of vitamin D2 by UV-B exposure during the growth phase of white button mushroom (Agaricus bisporus

    Directory of Open Access Journals (Sweden)

    Hanne L. Kristensen

    2012-04-01

    Full Text Available Background: Mushrooms are the only non-animal food source of vitamin D. Wild mushrooms have naturally high vitamin D2 content, and cultivated mushrooms produce vitamin D2 from ergosterol when exposed to supplementary UV-B during the post-harvest phase.Objectives: This study investigated the effects of providing supplementary UV-B during the growth phase on vitamin D2 formation and the interactions with growth of mushrooms, as compared to supplementary UV-B during the post-harvest phase or exposure to sunlight for both cultivated and wild mushrooms.Methods: Experiments were carried out with exposure to supplementary UV-B just prior to harvest in the range of 0–2,400 mJ cm−2. Mushrooms grew for 2 days with or without repeated UV-B exposure each day. Vitamin D2 and growth rate were determined. In addition, some mushrooms were post-harvest treated by exposure at 200 mJ cm−2 supplementary UV-B or natural sunlight, prior to vitamin D2 determination.Results: The content of vitamin D2 was 0.2–164 µg 100 g−1 fresh weight, and there was a linear relationship between UV-dose up to 1,000 mJ cm−2 and vitamin D2 content. The fast growth rate of the mushrooms diluted the vitamin D2 from 24 to 3 µg 100 g−1 within 2 days of exposure at 200 mJ cm−2. Following repeated UV-B exposure, vitamin D2 increased to 33 µg vitamin D2 100 g−1. Growth was unaffected by UV-B. Post-harvest exposure to supplementary UV-B resulted in a higher vitamin D2 content of 32 µg 100 g−1 compared to the 24 µg 100 g−1 obtained from exposure to UV-B during the growth phase. In contrast, wild and cultivated mushrooms with and without exposure to sunlight had vitamin D2 content in the range of 0.2–1.5 µg vitamin D2 100 g−1.Conclusions: This study showed that mushrooms with a well-defined content of vitamin D2 can be obtained by exposure to supplementary UV-B just prior to harvest.

  15. Identification of medicinal and poisonous mushroom from Khorramabad, Iran

    Directory of Open Access Journals (Sweden)

    seyede zahra Hosseini

    2010-03-01

    Full Text Available Mushrooms grow in a very wide range of ecological conditions, however their growth vary in different conditions. Mushrooms are a valuable source for antibiotics and they are known as drugs in traditional medicine. Identification and characterization of mushrooms is the first step of their exploitations in drug industry. There are many poisonous species of mushrooms, so their identification is essential for better health of societies and also a good indication for physicians in identification of mushroom poisonings and their cure. Material and Method: In this research the samples of mushroom were collected in Khorramabad district during spring and fall of 2008 and 2009. The macroscopic and microscopic characters of collected mushrooms were observed in field and laboratory and these criteria aligned to the species characters in scientific resources. Results: eight mushroom species namely Collybia maculate coprinus atramentarius three species of Boletus (B. luridus, B. felleus and B. satanas two species of Lactarius (L. piperatus and L. vellereus and Hypholoma capnoides were identified . Discussions: Based on the results of biodiversity of mushrooms in khorramabad district found in the present research, it is concluded that there are valuable resources of mushrooms for medicinal purposes in this area.

  16. Determination of 228Th, 232Th, and228Ra in wild mushroom from a naturally high radioactive region in Brazil

    International Nuclear Information System (INIS)

    Rosa, Mychelle M.L.; Taddei, Maria Helena T.; Silva, Marco A.; Ferreira, Marcelo T.

    2011-01-01

    Mushrooms are fungi which efficiently accumulate radionuclides, as verified by radiochemistry analyses of specimens collected in contaminated areas, specifically after the Chernobyl nuclear accident. Many studies have demonstrated that mushrooms can be used in monitoring of ecosystem contamination and quality. The present paper is part of a broader study conducted in the Pocos de Caldas plateau region in Minas Gerais, Brazil, investigating assimilation of natural Uranium and Thorium radionuclide series by mushrooms. This region has elevated natural radioactivity due to the presence of radiological anomalies of volcanic origin. These anomalies are ore bodies containing Uranium and Thorium, the later being highly predominant. Many researchers have been conducted concerning radionuclide incorporation by agricultural products on the plateau. The present paper aims to determine 232 Th, 228 Th, and 228 Ra radionuclides in wild mushrooms collected at different locations in the plateau region. 228 Ra was determined by radiochemical separation using sulphate coprecipitation followed by beta radiometry. 232 Th and 228 Th were determined using anion exchange resin purification followed by alpha spectrometry. Higher values were obtained to 228 Th than to 232 Th. This is due to higher 228 Ra mobility, which decays to 228 Th. The accuracy of the analytical methods employed was evaluated using the reference sample IAEA Soil 327. These methods had high chemical recovery and high sensitivity. It was possible to confirm that mushrooms accumulate radionuclide and so can be used in environmental contamination and quality assessment. (author)

  17. Cultivation of different strains of king oyster mushroom (Pleurotus eryngii) on saw dust and rice straw in Bangladesh.

    Science.gov (United States)

    Moonmoon, Mahbuba; Uddin, Md Nazim; Ahmed, Saleh; Shelly, Nasrat Jahan; Khan, Md Asaduzzaman

    2010-10-01

    Pleurotus eryngii is a popular mushroom due to its excellent consistency of cap and stem, culinary qualities and longer shelf life. In Bangladesh, where Pleurotus mushrooms are very popular, P. eryngii may take position among the consumers, but currently this mushroom is not cultivated in large scale there. In this study, 3 strains of P. eryngii such as Pe-1 (native to Bangladesh), Pe-2 (germplasm collected from China) and Pe-3 (germplasm collected from Japan) were cultivated on saw dust and rice straw and their growth and yield parameters were investigated. Pe-1 on saw dust showed the highest biological yield and efficiency (73.5%) than other strains. Also, the mycelium run rate and number of fruiting bodies were higher in Pe-1 than other two strains. The quality of mushroom strains was near about similar. On saw dust, the yield and efficiency were better than those cultivated on rice straw, however, on straw; the mushroom fruiting bodies were larger in size. This study shows the prospects of P. eryngii cultivation in Bangladesh and suggests further study in controlled environment for higher yield and production.

  18. Recycling of Date-Palm Fiber to Produce Pleurotus Cornucopiae Var. Citrinopileatus Mushroom

    Directory of Open Access Journals (Sweden)

    Mustafa Nadhim Owaid

    2017-01-01

    Full Text Available In this study, some local available organic matters, which are including wheat straw (Triticum aestivum, sawdust, and fiber of date palm (Phoenix dactylifera L., were used for growing and cultivating of bright yellow oyster mushroom Pleurotus cornucopiae var. citrinopileatus. The possibility of using date palm fiber (in mixtures with other organic residues as a substrate for the cultivation and production of fruiting bodies of P. cornucopiae var. citrinopileatus was investigated. This mushroom is capable of biorecycling and utilization of some mixtures of lignocellulosic substrates successfully, especially the mixture S3 (50% wheat straw, 30% sawdust, and 20% date palm fiber. The lower mycelia completion time was 17 days, that shown in bags of the S3 substrate. Date-palm fiber substrate exhibited best growth intensity level (moderate significantly (p<0.05. The total yield and biological efficiency percent recorded approx. 90 g and 23% on the S3 substrate respectively, as a higher percent significantly (p<0.05, while sawdust substrate alone was an unsuitable medium for cultivation and production of this mushroom. Finally, the use of date-palm fibers in mixtures is usefulness in producing a fresh edible and medicinal mushroom.INTERNATIONAL JOURNAL OF ENVIRONMENTVolume-5, Issue-4, Sep-Nov 2016, page: 56-65

  19. Lead and cadmium in mushrooms from the vicinity of two large emission sources in Slovenia

    International Nuclear Information System (INIS)

    Petkovšek, Samar Al Sayegh; Pokorny, Boštjan

    2013-01-01

    Cd and Pb contents were determined in 699 samples of fruiting bodies of 55 mushrooms species, collected in the period 2000–2007 in the vicinity of the largest Slovenian thermal power plant (the Šalek Valley) and near an abandoned lead smelter (the Upper Meža Valley). The present study is the first regarding lead and cadmium in mushrooms from those exposed areas. Therefore, there was a significant lack of prior data. Among 55 studied mushroom species 36 species are edible and important from an ecotoxicological perspective. However, the remaining non-edible species are important for bioindication and allowed us to compare our results with other studies carried out in other polluted areas in Europe. The highest contents of Cd were found in Agaricus arvensis Schff.: Fr. (117 mg/kg dw) and Agaricus silvicola L.: Fr. (67.9 mg/kg dw), while the highest contents of Pb were found in Macrolepiota procera (Scop.) Singer (53.8 mg/kg dw) and Lycoperdon perlatum Pers. (50 mg/kg dw), respectively. Considering the high contents of both metals in fruiting bodies of edible fungi, together with FAO/WHO directives on tolerable levels of weekly intake of Pb/Cd by humans, it is evident that consumption of some mushroom species originating from both study areas may pose a significant human health risk. A. arvensis Schff.: Fr., A. silvicola L.: Fr. and Cortinarius caperatus (Pers.) Fr. originating from the Šalek Valley, and Armillaria mellea Vahl. P. Kumm., Boletus edulis Bull., L. perlatum Pers., Leccinum versipelle (Fr. and Hök) Snell, and M. procera (Scop.) Singer originating from the Upper Meža Valley should not be consumed at all. Our findings are consistent with some other studies, which emphasized that mushrooms from heavily polluted areas, such as in the vicinity of smelters, accumulate extremely high amounts of metals, and should therefore be omitted from human consumption. - Highlights: ► The Pb contents were higher in saprophytic fungi in comparison with mycorrhizal

  20. Radioisotopes of the U, Th, Pu, Am in the mushrooms

    International Nuclear Information System (INIS)

    Galanda, D.; Matel, L.

    2001-01-01

    The present work is devoted the estimation of the data about radioactive contamination in different species of mushrooms with the aim to analyzing the influence of soil properties. The radioactive plutonium, uranium, thorium and americium was assayed in the dried mushrooms collected in areas of East and West Slovakia in 1998 -2000, and examined the effectiveness of this mushroom as a possible indicator of radioactive contamination of environment due to nuclear contamination of biosphere. Were determined the mushrooms of canes: Suillus, Leccinum, Baletus, Armillariella, Xerocomus and Craterellus. The mushrooms were dried and prepared by liquid extraction with Aliquat 336. The samples were measured by α-barrier spectrometry. The results of specific activity of plutonium, thorium, uranium and americium in the mushrooms and the layers of forest litter were summarized. (authors)

  1. Household methods to reduce {sup 137}Cs contents of mushrooms

    Energy Technology Data Exchange (ETDEWEB)

    Kostiainen, E. [Radiation and Nuclear Safety Authority - STUK, Helsinki (Finland)

    2005-09-15

    High radiocaesium contents in different species of mushrooms have been observed in areas contaminated by radiocaesium deposition after the Chernobyl accident in 1986. There has been no significant reduction in the {sup 137}Cs contents of mushrooms during the past ten years, besides via radioactive decay. The internal radiation dose received via mushrooms can be reduced by processing mushrooms before consumption. Various household methods were studied to find out their efficiency to reduce {sup 137}Cs contents of mushrooms. The methods tested were the same as normally used in cooking. The tests were made for the species of edible mushrooms widely consumed. The retention factors for the treatments tested were in most cases 0.2-0.3. The efficiency of treatments in reducing the {sup 137}Cs contents increased with larger water volumes and prolonged treatment times.

  2. Household methods to reduce 137Cs contents of mushrooms

    International Nuclear Information System (INIS)

    Kostiainen, E.

    2005-01-01

    High radiocaesium contents in different species of mushrooms have been observed in areas contaminated by radiocaesium deposition after the Chernobyl accident in 1986. There has been no significant reduction in the 137 Cs contents of mushrooms during the past ten years, besides via radioactive decay. The internal radiation dose received via mushrooms can be reduced by processing mushrooms before consumption. Various household methods were studied to find out their efficiency to reduce 137 Cs contents of mushrooms. The methods tested were the same as normally used in cooking. The tests were made for the species of edible mushrooms widely consumed. The retention factors for the treatments tested were in most cases 0.2-0.3. The efficiency of treatments in reducing the 137 Cs contents increased with larger water volumes and prolonged treatment times

  3. Dung-associated, Potentially Hallucinogenic Mushrooms from Taiwan

    Directory of Open Access Journals (Sweden)

    Yen-Wen Wang

    2015-12-01

    Full Text Available To identify potentially hallucinogenic mushrooms, dung-associated mushrooms collected from Qingtiangang, Yangmingshan National Park were subjected to a detailed morphological investigation and phylogentic analysis. The investigation identified four taxa: a recorded species (Panaeolus antillarum; a new combination (Conocybe nitrophila; and two new species (Psilocybe angulospora, Protostropharia ovalispora. Morphological and molecular characteristics of the collected mushrooms were compared with allied fungal taxa.

  4. Mushroom refinement endeavor auspicate non green revolution in the offing

    OpenAIRE

    SHAUKET AHMED PALA; ABDUL HAMID WANI; ROUF HAMZA BODA; BILAL AHMAD WANI

    2014-01-01

    Pala SA, Wani AH, Boda RH, Wani BA. 2014. Mushroom refinement endeavor auspicate non green revolution in the offing. Nusantara Bioscience 6: 173-185. Mushroom can serve as food, tonic, and as medicine thus make people healthier, fitter and happier. They have a cracking potential for generating great socioeconomic impact in human welfare at local, national and international level. With the help of allied mushroom farming we can easily tackle the problem of food for growing world population; re...

  5. Accumulation of Heavy Metals by Wild Mushrooms in Ibadan, Nigeria

    OpenAIRE

    Chinatu Charity Ndimele; Prince Emeka Ndimele; Kanayo Stephen Chukwuka

    2017-01-01

    Background. Many companies in Nigeria generate industrial effluents, including heavy metals. These metals can be accumulated by biota such as mushrooms, which are then eaten by the populace. Objectives. The present study investigates the metal content of wild mushrooms in order to educate the local population on the safety of their consumption. Methods. Seven different species of wild mushrooms (Cortinarius melliolens, Chlorophyllum brunneum, Pleurotus florida, Volvariella speciosa, Can...

  6. 137Cs content in edible mushrooms of the Transcarpathian region

    Directory of Open Access Journals (Sweden)

    O. O. Parlag

    2013-03-01

    Full Text Available Edible mushrooms (Boletus edulis Bull.: Fr. and Leccinum scabrum (Bull.: Fr. S.F.Gray of Transcarpathian region were analyzed on content of 137Cs. Specific activity of 137Cs in collected mushrooms did not exceed 354 ± 53 Bq/kg (dry substance. Estimation of the contribution into internal exposure dose of population for the condi-tion of 1 kg of mushrooms consumption is carried out.

  7. A termite symbiotic mushroom maximizing sexual activity at growing tips of vegetative hyphae.

    Science.gov (United States)

    Hsieh, Huei-Mei; Chung, Mei-Chu; Chen, Pao-Yang; Hsu, Fei-Man; Liao, Wen-Wei; Sung, Ai-Ning; Lin, Chun-Ru; Wang, Chung-Ju Rachel; Kao, Yu-Hsin; Fang, Mei-Jane; Lai, Chi-Yung; Huang, Chieh-Chen; Chou, Jyh-Ching; Chou, Wen-Neng; Chang, Bill Chia-Han; Ju, Yu-Ming

    2017-09-19

    Termitomyces mushrooms are mutualistically associated with fungus-growing termites, which are widely considered to cultivate a monogenotypic Termitomyces symbiont within a colony. Termitomyces cultures isolated directly from termite colonies are heterokaryotic, likely through mating between compatible homokaryons. After pairing homokaryons carrying different haplotypes at marker gene loci MIP and RCB from a Termitomyces fruiting body associated with Odontotermes formosanus, we observed nuclear fusion and division, which greatly resembled meiosis, during each hyphal cell division and conidial formation in the resulting heterokaryons. Surprisingly, nuclei in homokaryons also behaved similarly. To confirm if meiotic-like recombination occurred within mycelia, we constructed whole-genome sequencing libraries from mycelia of two homokaryons and a heterokaryon resulting from mating of the two homokaryons. Obtained reads were aligned to the reference genome of Termitomyces sp. J132 for haplotype reconstruction. After removal of the recombinant haplotypes shared between the heterokaryon and either homokaryons, we inferred that 5.04% of the haplotypes from the heterokaryon were the recombinants resulting from homologous recombination distributed genome-wide. With RNA transcripts of four meiosis-specific genes, including SPO11, DMC1, MSH4, and MLH1, detected from a mycelial sample by real-time quantitative PCR, the nuclear behavior in mycelia was reconfirmed meiotic-like. Unlike other basidiomycetes where sex is largely restricted to basidia, Termitomyces maximizes sexuality at somatic stage, resulting in an ever-changing genotype composed of a myriad of coexisting heterogeneous nuclei in a heterokaryon. Somatic meiotic-like recombination may endow Termitomyces with agility to cope with termite consumption by maximized genetic variability.

  8. Characterization of CoPK02, a Ca2+/calmodulin-dependent protein kinase in mushroom Coprinopsis cinerea.

    Science.gov (United States)

    Yamashita, Masashi; Sueyoshi, Noriyuki; Yamada, Hiroki; Katayama, Syouichi; Senga, Yukako; Takenaka, Yasuhiro; Ishida, Atsuhiko; Kameshita, Isamu; Shigeri, Yasushi

    2018-04-20

    We surveyed genome sequences from the basidiomycetous mushroom Coprinopsis cinerea and isolated a cDNA homologous to CMKA, a calmodulin-dependent protein kinase (CaMK) in Aspergillus nidulans. We designated this sequence, encoding 580 amino acids with a molecular weight of 63,987, as CoPK02. CoPK02 possessed twelve subdomains specific to protein kinases and exhibited 43, 35, 40% identity with rat CaMKI, CaMKII, CaMKIV, respectively, and 40% identity with CoPK12, one of the CaMK orthologs in C. cinerea. CoPK02 showed significant autophosphorylation activity and phosphorylated exogenous proteins in the presence of Ca 2+ /CaM. By the CaM-overlay assay we confirmed that the C-terminal sequence (Trp346-Arg358) was the calmodulin-binding site, and that the binding of Ca 2+ /CaM to CoPK02 was reduced by the autophosphorylation of CoPK02. Since CoPK02 evolved in a different clade from CoPK12, and showed different gene expression compared to that of CoPK32, which is homologous to mitogen-activated protein kinase-activated protein kinase, CoPK02 and CoPK12 might cooperatively regulate Ca 2+ -signaling in C. cinerea.

  9. Composition and expression of genes encoding carbohydrate-active enzymes in the straw-degrading mushroom Volvariella volvacea.

    Directory of Open Access Journals (Sweden)

    Bingzhi Chen

    Full Text Available Volvariella volvacea is one of a few commercial cultivated mushrooms mainly using straw as carbon source. In this study, the genome of V. volcacea was sequenced and assembled. A total of 285 genes encoding carbohydrate-active enzymes (CAZymes in V. volvacea were identified and annotated. Among 15 fungi with sequenced genomes, V. volvacea ranks seventh in the number of genes encoding CAZymes. In addition, the composition of glycoside hydrolases in V. volcacea is dramatically different from other basidiomycetes: it is particularly rich in members of the glycoside hydrolase families GH10 (hemicellulose degradation and GH43 (hemicellulose and pectin degradation, and the lyase families PL1, PL3 and PL4 (pectin degradation but lacks families GH5b, GH11, GH26, GH62, GH93, GH115, GH105, GH9, GH53, GH32, GH74 and CE12. Analysis of genome-wide gene expression profiles of 3 strains using 3'-tag digital gene expression (DGE reveals that 239 CAZyme genes were expressed even in potato destrose broth medium. Our data also showed that the formation of a heterokaryotic strain could dramatically increase the expression of a number of genes which were poorly expressed in its parental homokaryotic strains.

  10. Bioremediation of aflatoxin B1-contaminated maize by king oyster mushroom (Pleurotus eryngii.

    Directory of Open Access Journals (Sweden)

    Maria Teresa Branà

    Full Text Available Aflatoxin B1 (AFB1 is the most harmful mycotoxin that occurs as natural contaminant of agricultural commodities, particularly maize. Practical solutions for detoxification of contaminated staples and reduction of agricultural wastes are scarce. We investigated the capability of the white-rot and edible fungus Plerotus eryngii (king oyster mushroom to degrade AFB1 both in vitro and in a laboratory-scale mushroom cultivation, using a substrate similar to that routinely used in mushroom farms. In malt extract broth, degradation of AFB1 (500 ng/mL by nine isolates of P. eryngii ranged from 81 to 99% after 10 days growth, and reached 100% for all isolates after 30 days. The growth of P. eryngii on solid medium (malt extract-agar, MEA was significantly reduced at concentrations of AFB1 500 ng/mL or higher. However, the addition of 5% wheat straw to the culture medium increased the tolerance of P. eryngii to AFB1 and no inhibition was observed at a AFB1 content of 500 ng/mL; degradation of AFB1 in MEA supplemented with 5% wheat straw and 2.5% (w/v maize flour was 71-94% after 30 days of growth. Further, AFB1 degradation by P. eryngii strain ITEM 13681 was tested in a laboratory-scale mushroom cultivation. The mushroom growth medium contained 25% (w/w of maize spiked with AFB1 to the final content of 128 μg/kg. Pleurotus eryngii degraded up to 86% of the AFB1 in 28 days, with no significant reduction of either biological efficiency or mushroom yield. Neither the biomass produced on the mushroom substrate nor the mature basidiocarps contained detectable levels of AFB1 or its metabolite aflatoxicol, thus ruling out the translocation of these toxins through the fungal thallus. These findings make a contribution towards the development of a novel technology for remediation of AFB1- contaminated corn through the exploitation of the degradative capability of P. eryngii and its bioconversion into high nutritional value material intended for feed production.

  11. Accumulation of radiocesium in wild mushrooms collected from a Japanese forest and cesium uptake by microorganisms isolated from the mushroom-growing soils

    International Nuclear Information System (INIS)

    Kuwahara, Chikako; Fukumoto, Atsushi; Ohsone, Ayako; Furuya, Nobutaka; Shibata, Hisashi; Sugiyama, Hideo; Kato, Fumio

    2005-01-01

    Mushrooms and soils samples collected from a sub-alpine forest of Mt. Fuji in Japan were measured for 137 Cs and stable Cs. The ranges of 137 Cs specific activities and stable Cs concentrations in the mushrooms were 291-7950 Bq kg -1 dry weight and 4.69-58.1 mg kg -1 dry weight, respectively. Both 137 Cs specific activities and stable Cs concentrations in the mushrooms were higher than those in common agricultural plants. The 137 Cs specific activities and stable Cs concentrations in the soils were 3.18-149 Bq kg -1 dry weight and 0.618-2.18 mg kg -1 dry weight, respectively. The appearance frequencies of filamentous actinomycetes and planktonic bacteria from the soils decreased according to increasing Cs contents in the medium. No relationship was observed between the appearance frequencies of those and the stable Cs concentrations in the soils. The filamentous actinomycetes from any soil sample could not grow in the presence of 25 mM Cs, although the planktonic bacteria from the soil samples could grow with up to 50 mM Cs in YM agar. In addition, the planktonic bacteria from approximately 70% of the soil samples could grow even in the presence of 100 mM Cs. Filamentous actinomycetes were more sensitive to Cs than planktonic bacteria. In in vitro experiments, Cs uptake by these strains of filamentous actinomycetes and planktonic bacteria was high in the presence of 5 mM CsCl and the strains accumulated Cs, the same as in mushrooms. Our results indicate that filamentous actinomycetes in the soils have higher sensitivity to Cs than planktonic bacteria, and several strains of filamentous actinomycetes have a high Cs accumulation in the presence of 5 mM Cs

  12. Neuronal health - can culinary and medicinal mushrooms help?

    Science.gov (United States)

    Sabaratnam, Vikineswary; Kah-Hui, Wong; Naidu, Murali; Rosie David, Pamela

    2013-01-01

    Hericium erinaceus a culinary and medicinal mushroom is a well established candidate for brain and nerve health. Ganoderma lucidum, Grifola frondosa and Sarcodon scabrosus have been reported to have neurite outgrowth and neuronal health benefits. The number of mushrooms, however, studied for neurohealth activity are few compared to the more than 2 000 species of edible and / or medicinal mushrooms identified. In the on-going search for other potent culinary and / or medicinal mushrooms, indigenous mushrooms used in traditional medicines such as Lignosus rhinocerotis and Ganoderma neo-japonicum are also being investigated. Further, the edible mushroom, Pleurotus giganteus can be a potential candidate, too. Can these edible and medicinal mushrooms be tapped to tackle the health concerns of the aging population which is projected to be more than 80-90 million of people age 65 and above in 2050 who may be affected by age-related neurodegenerative disorders. Scientific validation is needed if these mushrooms are to be considered and this can be achieved by understanding the molecular and biochemical mechanisms involved in the stimulation of neurite outgrowth. Though it is difficult to extrapolate the in vitro studies to what may happen in the human brain, studies have shown that there can be improvement in cognitive abilities of the aged if the mushroom is incorporated in their daily diets.

  13. Neuronal Health – Can Culinary and Medicinal Mushrooms Help?

    Science.gov (United States)

    Sabaratnam, Vikineswary; Kah-Hui, Wong; Naidu, Murali; Rosie David, Pamela

    2013-01-01

    Hericium erinaceus a culinary and medicinal mushroom is a well established candidate for brain and nerve health. Ganoderma lucidum, Grifola frondosa and Sarcodon scabrosus have been reported to have neurite outgrowth and neuronal health benefits. The number of mushrooms, however, studied for neurohealth activity are few compared to the more than 2 000 species of edible and / or medicinal mushrooms identified. In the on-going search for other potent culinary and / or medicinal mushrooms, indigenous mushrooms used in traditional medicines such as Lignosus rhinocerotis and Ganoderma neo-japonicum are also being investigated. Further, the edible mushroom, Pleurotus giganteus can be a potential candidate, too. Can these edible and medicinal mushrooms be tapped to tackle the health concerns of the aging population which is projected to be more than 80-90 million of people age 65 and above in 2050 who may be affected by age-related neurodegenerative disorders. Scientific validation is needed if these mushrooms are to be considered and this can be achieved by understanding the molecular and biochemical mechanisms involved in the stimulation of neurite outgrowth. Though it is difficult to extrapolate the in vitro studies to what may happen in the human brain, studies have shown that there can be improvement in cognitive abilities of the aged if the mushroom is incorporated in their daily diets. PMID:24716157

  14. Edible Mushrooms: Improving Human Health and Promoting Quality Life

    Directory of Open Access Journals (Sweden)

    María Elena Valverde

    2015-01-01

    Full Text Available Mushrooms have been consumed since earliest history; ancient Greeks believed that mushrooms provided strength for warriors in battle, and the Romans perceived them as the “Food of the Gods.” For centuries, the Chinese culture has treasured mushrooms as a health food, an “elixir of life.” They have been part of the human culture for thousands of years and have considerable interest in the most important civilizations in history because of their sensory characteristics; they have been recognized for their attractive culinary attributes. Nowadays, mushrooms are popular valuable foods because they are low in calories, carbohydrates, fat, and sodium: also, they are cholesterol-free. Besides, mushrooms provide important nutrients, including selenium, potassium, riboflavin, niacin, vitamin D, proteins, and fiber. All together with a long history as food source, mushrooms are important for their healing capacities and properties in traditional medicine. It has reported beneficial effects for health and treatment of some diseases. Many nutraceutical properties are described in mushrooms, such as prevention or treatment of Parkinson, Alzheimer, hypertension, and high risk of stroke. They are also utilized to reduce the likelihood of cancer invasion and metastasis due to antitumoral attributes. Mushrooms act as antibacterial, immune system enhancer and cholesterol lowering agents; additionally, they are important sources of bioactive compounds. As a result of these properties, some mushroom extracts are used to promote human health and are found as dietary supplements.

  15. The first report on mushroom green mould disease in Croatia.

    Science.gov (United States)

    Hatvani, Lóránt; Sabolić, Petra; Kocsubé, Sándor; Kredics, László; Czifra, Dorina; Vágvölgyi, Csaba; Kaliterna, Joško; Ivić, Dario; Đermić, Edyta; Kosalec, Ivan

    2012-12-01

    Green mould disease, caused by Trichoderma species, is a severe problem for mushroom growers worldwide, including Croatia. Trichoderma strains were isolated from green mould-affected Agaricus bisporus (button or common mushroom) compost and Pleurotus ostreatus (oyster mushroom) substrate samples collected from Croatian mushroom farms. The causal agents of green mould disease in the oyster mushroom were T. pleurotum and T. pleuroticola, similar to other countries. At the same time, the pathogen of A. bisporus was exclusively the species T. harzianum, which is different from earlier findings and indicates that the range of mushroom pathogens is widening. The temperature profiles of the isolates and their hosts overlapped, thus no range was found that would allow optimal growth of the mushrooms without mould contamination. Ferulic acid and certain phenolic compounds, such as thymol showed remarkable fungistatic effect on the Trichoderma isolates, but inhibited the host mushrooms as well. However, commercial fungicides prochloraz and carbendazim were effective agents for pest management. This is the first report on green mould disease of cultivated mushrooms in Croatia.

  16. Neuronal Health – Can Culinary and Medicinal Mushrooms Help?

    Directory of Open Access Journals (Sweden)

    Vikineswary Sabaratnam

    2013-01-01

    Full Text Available Hericium erinaceus a culinary and medicinal mushroom is a well established candidate for brain and nerve health. Ganoderma lucidum, Grifola frondosa and Sarcodon scabrosus have been reported to have neurite outgrowth and neuronal health benefits. The number of mushrooms, however, studied for neurohealth activity are few compared to the more than 2 000 species of edible and / or medicinal mushrooms identified. In the on-going search for other potent culinary and / or medicinal mushrooms, indigenous mushrooms used in traditional medicines such as Lignosus rhinocerotis and Ganoderma neo-japonicum are also being investigated. Further, the edible mushroom, Pleurotus giganteus can be a potential candidate, too. Can these edible and medicinal mushrooms be tapped to tackle the health concerns of the aging population which is projected to be more than 80-90 million of people age 65 and above in 2050 who may be affected by age-related neurodegenerative disorders. Scientific validation is needed if these mushrooms are to be considered and this can be achieved by understanding the molecular and biochemical mechanisms involved in the stimulation of neurite outgrowth. Though it is difficult to extrapolate the in vitro studies to what may happen in the human brain, studies have shown that there can be improvement in cognitive abilities of the aged if the mushroom is incorporated in their daily diets.

  17. The role of Drosophila mushroom body signaling in olfactory memory.

    Science.gov (United States)

    McGuire, S E; Le, P T; Davis, R L

    2001-08-17

    The mushroom bodies of the Drosophila brain are important for olfactory learning and memory. To investigate the requirement for mushroom body signaling during the different phases of memory processing, we transiently inactivated neurotransmission through this region of the brain by expressing a temperature-sensitive allele of the shibire dynamin guanosine triphosphatase, which is required for synaptic transmission. Inactivation of mushroom body signaling through alpha/beta neurons during different phases of memory processing revealed a requirement for mushroom body signaling during memory retrieval, but not during acquisition or consolidation.

  18. [The Kombucha mushroom: two different opinions].

    Science.gov (United States)

    Gamundi, R; Valdivia, M

    1995-01-01

    Positive and negative views of the Kombucha mushroom, a popular remedy in Asia, are expressed. The Kombucha mushroom, used for centuries, is believed to have antibiotic tendencies and to strengthen the immune and metabolic systems. Studies show that the tea, made from fermented fungus, has high levels of B vitamins. Caution should be used during fermentation because exposing the fungus to sunlight may adversely affect the process. The mold in which the fungus grows may contain aspergillus, a fungal infection which may be fatal to HIV-positive persons. The tea is being commercialized as a stimulant of the immune system but is unpopular in the U.S. due to its toxicity risks. Public awareness messages must convey the danger of overstimulating the immune system of HIV-positive patients, whose immune systems are already overstimulated. Furthermore, the process of fermentation may encourage the growth of other organisms which produce medical complications in HIV-positive patients.

  19. Changes in non-volatile taste components of button mushroom (Agaricus bisporus) during different stages of freeze drying and freeze drying combined with microwave vacuum drying.

    Science.gov (United States)

    Pei, Fei; Shi, Ying; Gao, Xingyang; Wu, Fangning; Mariga, Alfred Mugambi; Yang, Wenjian; Zhao, Liyan; An, Xinxin; Xin, Zhihong; Yang, Fangmei; Hu, Qiuhui

    2014-12-15

    Button mushroom slices were dehydrated using freeze drying (FD) or FD combined with microwave vacuum drying (FMVD), and the non-volatile component profiles were studied. The results showed that the level of non-volatile components in button mushroom firstly increased during sublimation of FD/FMVD process and then fell during desorption in FD process and MVD in FMVD process. Compared to FD products, the contents of soluble sugars and polyols in FMVD products were relatively low, whereas the contents of total free amino acids were significantly higher, close to the level of fresh mushroom. However, there was no significant difference in the contents of 5'-nucleotides and organic acids between FD and FMVD products. The equivalent umami concentration (EUC) values for FD and FMVD products did not differ from fresh, indicating that both drying methods could effectively preserve MSG (monosodium glutamate)-like components in button mushroom. Copyright © 2014 Elsevier Ltd. All rights reserved.

  20. Geographic identification of Boletus mushrooms by data fusion of FT-IR and UV spectroscopies combined with multivariate statistical analysis

    Science.gov (United States)

    Yao, Sen; Li, Tao; Li, JieQing; Liu, HongGao; Wang, YuanZhong

    2018-06-01

    Boletus griseus and Boletus edulis are two well-known wild-grown edible mushrooms which have high nutrition, delicious flavor and high economic value distributing in Yunnan Province. In this study, a rapid method using Fourier transform infrared (FT-IR) and ultraviolet (UV) spectroscopies coupled with data fusion was established for the discrimination of Boletus mushrooms from seven different geographical origins with pattern recognition method. Initially, the spectra of 332 mushroom samples obtained from the two spectroscopic techniques were analyzed individually and then the classification performance based on data fusion strategy was investigated. Meanwhile, the latent variables (LVs) of FT-IR and UV spectra were extracted by partial least square discriminant analysis (PLS-DA) and two datasets were concatenated into a new matrix for data fusion. Then, the fusion matrix was further analyzed by support vector machine (SVM). Compared with single spectroscopic technique, data fusion strategy can improve the classification performance effectively. In particular, the accuracy of correct classification of SVM model in training and test sets were 99.10% and 100.00%, respectively. The results demonstrated that data fusion of FT-IR and UV spectra can provide higher synergic effect for the discrimination of different geographical origins of Boletus mushrooms, which may be benefit for further authentication and quality assessment of edible mushrooms.

  1. Traceability of Boletaceae mushrooms using data fusion of UV-visible and FTIR combined with chemometrics methods.

    Science.gov (United States)

    Yao, Sen; Li, Tao; Liu, HongGao; Li, JieQing; Wang, YuanZhong

    2018-04-01

    Boletaceae mushrooms are wild-grown edible mushrooms that have high nutrition, delicious flavor and large economic value distributing in Yunnan Province, China. Traceability is important for the authentication and quality assessment of Boletaceae mushrooms. In this study, UV-visible and Fourier transform infrared (FTIR) spectroscopies were applied for traceability of 247 Boletaceae mushroom samples in combination with chemometrics. Compared with a single spectroscopy technique, data fusion strategy can obviously improve the classification performance in partial least square discriminant analysis (PLS-DA) and grid-search support vector machine (GS-SVM) models, for both species and geographical origin traceability. In addition, PLS-DA and GS-SVM models can provide 100.00% accuracy for species traceability and have reliable evaluation parameters. For geographical origin traceability, the accuracy of prediction in the PLS-DA model by data fusion was just 64.63%, but the GS-SVM model based on data fusion was 100.00%. The results demonstrated that the data fusion strategy of UV-visible and FTIR combined with GS-SVM could provide a higher synergic effect for traceability of Boletaceae mushrooms and have a good generalization ability for the comprehensive quality control and evaluation of similar foods. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

  2. Optimization of the cultivation conditions for mushroom production with European wild strains of Agaricus subrufescens and Brazilian cultivars.

    Science.gov (United States)

    Llarena-Hernández, Carlos R; Largeteau, Michèle L; Ferrer, Nathalie; Regnault-Roger, Catherine; Savoie, Jean-Michel

    2014-01-15

    The almond mushroom Agaricus subrufescens (formerly Agaricus blazei or Agaricus brasiliensis) is cultivated at commercial level in Brazil and some Asian countries on local substrates and casing mixtures. Despite its tropical origin, A. subrufescens might be a seasonal option for mushroom growers in western countries, where some wild strains have been isolated. For this purpose, cultivation conditions were developed starting from the substrate and casing mixture commonly used for commercial production of the button mushroom Agaricus bisporus in France. The commercial compost, based on wheat straw and horse manure, used for A. bisporus and the casing mixture (peat and limestone) supplemented with fine sand proved efficient to grow A. subrufescens. Increasing the depth of the casing layer improved significantly the yield and time to fruiting. Daily variations in temperature did not markedly modify the yield. Significantly higher mushroom biomass was obtained with three wild European strains compared with three Brazilian cultivars. The very productive wild strain CA438-A gave mushrooms of size and dry matter content comparable to those of a cultivar. Commercial production of A. subrufescens can be developed in western countries on the wheat straw-based substrate commonly used for A. bisporus in these regions, by a simple modification of the casing mixture and maintaining the incubation temperature throughout the crop, which is expected to save energy during summer. Good yields were obtained cultivating European strains under optimised parameters. © 2013 Society of Chemical Industry.

  3. Influence of calcium and silicon supplementation into Pleurotus ostreatus substrates on quality of fresh and canned mushrooms.

    Science.gov (United States)

    Thongsook, T; Kongbangkerd, T

    2011-08-01

    Supplements of gypsum (calcium source), pumice (silicon source) and pumice sulfate (silicon and calcium source) into substrates for oyster mushrooms (Pleurotus ostreatus) were searched for their effects on production as well as qualities of fresh and canned mushrooms. The addition of pumice up to 30% had no effect on total yield, size distribution and cap diameters. The supplementation of gypsum at 10% decreased the total yield; and although gypsum at 5% did not affect total yield, the treatment increased the proportion of large-sized caps. High content (>10%) of pumice sulfate resulted in the lower yield. Calcium and silicon contents in the fruit bodies were not influenced by supplementations. The centrifugal drip loss values and solid content of fresh mushrooms, and the percentage of weight gained and firmness of canned mushrooms, cultivated in substrates supplemented with gypsum, pumice and pumice sulfate were significantly (p≤0.05) higher than those of the control. Scanning electron micrographs revealed the more compacted hyphae of mushroom stalks supplemented with silicon and/or calcium after heat treatment, compared to the control. Supplementation of P. ostreatus substrates with 20% pumice was the most practical treatment because it showed no effect on yield and the most cost-effective.

  4. Diversity of edible mushrooms in pakistan

    International Nuclear Information System (INIS)

    Sultana, K.; Shinwari, Z.K.; Iftikhar, F.

    2007-01-01

    Fifty six edible species of mushrooms are reported from Pakistan including four from Balochistan, three from Sindh, five from Punjab and 44 from NWFP and Azad Kashmir. Some of species being commercially exploited in the world are Agaricus bisporus, Auricularia spp. Coprinus comatus, Flammulina vellutipes, Lentinus edodes, Phellorina inquinans, Pleurotus ostreatus, Stropharia rugosoannulata, Volvariella volvacea. Because of over collection, urbanization and deforestation, some of species are threatened of extinction. (author)

  5. Mushrooms as Possible Antioxidant and Antimicrobial Agents

    Science.gov (United States)

    Kosanić, Marijana; Ranković, Branislav; Dašić, Marko

    2012-01-01

    The aim of the study is to examine in-vitro antioxidant and antimicrobial activity of the acetonic and methanolic extracts of the mushrooms Boletus aestivalis, Boletus edulis and Leccinum carpini. Antioxidant activity was evaluated by using free radical scavenging activity and reducing power. In addition, total content of phenol and flavonoid in extracts were determined as pyrocatechol equivalent, and as rutin equivalent, respectively. As a result of the study acetonic extracts from Boletus edulis was more powerful antioxidant activity with IC50 value of 4.72 μg/mL which was similar or greater than the standard antioxidants, ascorbic acid (IC50 = 4.22 μg/mL), BHA (IC50 = 6.42 μg/mL) and α-tocopherol (IC50 = 62.43 μg/mL). Moreover, the tested extracts had effective reducing power. A significant relationship between total phenolic and flavonoid contents and their antioxidative activities was significantly observed. The antimicrobial activity of each extract was estimated by determination of the minimum inhibitory concentration by using microdilution plate method against five species of bacteria and five species of fungi. Generally, the tested mushroom extracts had relatively strong antimicrobial activity against the tested microorganisms. The minimum inhibitory concentration for both extracts related to the tested bacteria and fungi were 1.25 - 10 mg/ mL. The present study shows that tested mushroom species demonstrated a strong antioxidant and antimicrobial activity. It suggests that mushroom may be used as good sources of natural antioxidants and for pharmaceutical purposes in treating of various deseases. PMID:24250542

  6. DEHYDRATION OF EDIBLE MUSHROOMS (PLEUROTUS OSTREATUS)

    OpenAIRE

    Salas de la Torre, N.; Bazán, D.; Osorio, A.; Cornejo, O.; Carrero, E.

    2014-01-01

    The edible mushroom Pleurotus ostreatus have been subjected to thermal, chemical and thermal-chemical treatment. The results show that the chemical treatment produces a more effective enzymatic inactivation compared to the other two treatments. Also, the experimental study of fungi dehydration carried out at 55 ° C reveals that the critical moisture content is 10.4 kg water / kg dry solids, the equilibrium moisture is 0.22 kg water / kg of solid . Los hongos comestibles Pleurotus ostreatus...

  7. The Genome of the Basidiomycetous Yeast and Human Pathogen Cryptococcus neoformans

    Science.gov (United States)

    Loftus, Brendan J.; Fung, Eula; Roncaglia, Paola; Rowley, Don; Amedeo, Paolo; Bruno, Dan; Vamathevan, Jessica; Miranda, Molly; Anderson, Iain J.; Fraser, James A.; Allen, Jonathan E.; Bosdet, Ian E.; Brent, Michael R.; Chiu, Readman; Doering, Tamara L.; Donlin, Maureen J.; D’Souza, Cletus A.; Fox, Deborah S.; Grinberg, Viktoriya; Fu, Jianmin; Fukushima, Marilyn; Haas, Brian J.; Huang, James C.; Janbon, Guilhem; Jones, Steven J. M.; Koo, Hean L.; Krzywinski, Martin I.; Kwon-Chung, June K.; Lengeler, Klaus B.; Maiti, Rama; Marra, Marco A.; Marra, Robert E.; Mathewson, Carrie A.; Mitchell, Thomas G.; Pertea, Mihaela; Riggs, Florenta R.; Salzberg, Steven L.; Schein, Jacqueline E.; Shvartsbeyn, Alla; Shin, Heesun; Shumway, Martin; Specht, Charles A.; Suh, Bernard B.; Tenney, Aaron; Utterback, Terry R.; Wickes, Brian L.; Wortman, Jennifer R.; Wye, Natasja H.; Kronstad, James W.; Lodge, Jennifer K.; Heitman, Joseph; Davis, Ronald W.; Fraser, Claire M.; Hyman, Richard W.

    2012-01-01

    Cryptococcus neoformans is a basidiomycetous yeast ubiquitous in the environment, a model for fungal pathogenesis, and an opportunistic human pathogen of global importance. We have sequenced its ~20-megabase genome, which contains ~6500 intron-rich gene structures and encodes a transcriptome abundant in alternatively spliced and antisense messages. The genome is rich in transposons, many of which cluster at candidate centromeric regions. The presence of these transposons may drive karyotype instability and phenotypic variation. C. neoformans encodes unique genes that may contribute to its unusual virulence properties, and comparison of two phenotypically distinct strains reveals variation in gene content in addition to sequence polymorphisms between the genomes. PMID:15653466

  8. Use of oil palm kernel meal as a supplement material for abalone mushroom (Pleurotus cystidiosus O.K. Miller cultivation

    Directory of Open Access Journals (Sweden)

    Petcharat, V. and

    2004-09-01

    Full Text Available The objective of this study was to determine the optimum rate of oil palm kernel meal, for an abalone mushroom (Pleurotus cystidiosus cultivation. Different concentrations of oil palm kernel meal (5- 20% were added to pararubber sawdust and used to grow the abalone mushroom in plastic bags. Growth rate of the mycelia, number of days from watering to harvesting and yield were compared to those on 94% sawdust + 5% rice bran + 1% Ca(OH2. The results showed that 10% oil palm kernel meal was the optimum concentration for abalone mushroom cultivation. Yield on 950 g/bag of 89% sawdust + 10% oil palm kernel meal + 1% Ca(OH2 was 202.12 g/bag (B.E. = 60.79% during 120 days of havesting time. Addition of higher concentration of oil palm kernel meal (15-20% did not increase yield of the basidiocarps.

  9. Complete Mitochondrial Genome of the Medicinal Mushroom Ganoderma lucidum

    Science.gov (United States)

    Chen, Haimei; Chen, Xiangdong; Lan, Jin; Liu, Chang

    2013-01-01

    Ganoderma lucidum is one of the well-known medicinal basidiomycetes worldwide. The mitochondrion, referred to as the second genome, is an organelle found in most eukaryotic cells and participates in critical cellular functions. Elucidating the structure and function of this genome is important to understand completely the genetic contents of G. lucidum. In this study, we assembled the mitochondrial genome of G. lucidum and analyzed the differential expressions of its encoded genes across three developmental stages. The mitochondrial genome is a typical circular DNA molecule of 60,630 bp with a GC content of 26.67%. Genome annotation identified genes that encode 15 conserved proteins, 27 tRNAs, small and large rRNAs, four homing endonucleases, and two hypothetical proteins. Except for genes encoding trnW and two hypothetical proteins, all genes were located on the positive strand. For the repeat structure analysis, eight forward, two inverted, and three tandem repeats were detected. A pair of fragments with a total length around 5.5 kb was found in both the nuclear and mitochondrial genomes, which suggests the possible transfer of DNA sequences between two genomes. RNA-Seq data for samples derived from three stages, namely, mycelia, primordia, and fruiting bodies, were mapped to the mitochondrial genome and qualified. The protein-coding genes were expressed higher in mycelia or primordial stages compared with those in the fruiting bodies. The rRNA abundances were significantly higher in all three stages. Two regions were transcribed but did not contain any identified protein or tRNA genes. Furthermore, three RNA-editing sites were detected. Genome synteny analysis showed that significant genome rearrangements occurred in the mitochondrial genomes. This study provides valuable information on the gene contents of the mitochondrial genome and their differential expressions at various developmental stages of G. lucidum. The results contribute to the understanding of the

  10. The Economic Empowerment of Women in Uganda Through Mushroom Production

    Directory of Open Access Journals (Sweden)

    Ibarahim Mayanja

    2017-11-01

    Full Text Available This study focuses on empowering women both in peri-urban and rural areas through mushroom production. It was conducted in Kampala Metropolitan area-Uganda, during October 2016. It focused on estimating profits, conducting benefit-cost analysis/ratio (BCR and return on investment (ROI, finding reasons as to why women involved in the mushroom production and identifying the constraints of mushroom farming from the perspective of women as well as the possible solutions to the constraints. 29 women were interviewed face to face through the use of the questionnaires. The study revealed an average net profit of 3,464.28 US dollars, BCR of 3.84 and ROI of 2.84 per farm in a period of three months. Our study revealed that mushroom production is a profitable enterprise for women. The major reason for women to involve in mushroom was to earn income. However, a range of other reasons was given such as fast maturity of mushrooms, availability of market, healthy benefits of mushrooms, etc. were the most important reasons. The problems faced by women farmers were ranked from the most pressing problem to the least pressing problem in this order; Low market prices per kilogram of mushroom, scarcity of cotton during some seasons, poor quality mushroom spawn supplied to farmers by breeders, inadequate extension, and advisory services were the most observed problems among others. The suggested solutions were organizing farmers into groups or cooperatives in order to negotiate for better markets locally and abroad together with the help of government, researchers to carry out more research on the suitability of other substrates like bagasse other than relying on only cotton, ensuring that mushroom spawn breeders conform to the set standards of quality spawn production and re-equipping local extension workers with knowledge regarding mushroom production among others.

  11. Enrichment of Bread with Nutraceutical-Rich Mushrooms: Impact of Auricularia auricula (Mushroom) Flour Upon Quality Attributes of Wheat Dough and Bread.

    Science.gov (United States)

    Yuan, Biao; Zhao, Liyan; Yang, Wenjian; McClements, David Julian; Hu, Qiuhui

    2017-09-01

    Edible mushrooms contain a variety of bioactive molecules that may enhance human health and wellbeing. Consequently, there is increasing interest in fortifying functional foods with these nutraceutical-rich substances. However, incorporation of mushroom-based ingredients into foods should not adversely affect the quality attributes of the final product. In this study, the impact of incorporating powdered Auricularia auricula, a widely consumed edible mushroom, into bread products was examined. The rheological and structural properties of wheat dough and bread supplemented with 0% to 10% (w/w) A. auricula flour were measured. Supplementation of wheat doughs with A. auricula flour increased the peak viscosity and enhanced their water holding capacity. Rapid viscosity analysis showed that peak and final viscosities of the blended flour (wheat flour with A. auricula flour) were higher than wheat flour alone. However, dough stability and elastic modulus were reduced by blending wheat flour with A. auricula flour. SEM observation showed that doughs with up to 5% (w/w) A. auricula flour had acceptable gluten network microstructure. Characterization of the quality attributes of bread indicated that incorporation of A. auricula flour at levels >5% negatively impacted bread volume, height, texture, and appearance. © 2017 Institute of Food Technologists®.

  12. More efficient mushroom canning through pinch and exergy analysis

    NARCIS (Netherlands)

    Paudel, Ekaraj; Sman, van der Ruud G.M.; Westerik, Nieke; Awasthi, Ashutosh; Dewi, Belinda P.C.; Boom, Remko M.

    2017-01-01

    Conventional production of canned mushrooms involves multiple processing steps as vacuum hydration, blanching, sterilization, etc. that are intensive in energy and water usage. We analyzed the current mushroom processing technique plus three alternative scenarios via pinch and exergy analysis.

  13. wild and domesticated mushroom consumption in nigeria abstract

    African Journals Online (AJOL)

    USER

    of awareness, consumption history, wild or ... 15.6% were students and 11.1% business ... 1.1. N/A. 5. 5.6. NA = Not applicable mushrooms for over 10 years; whereas 13.3% ... Consumption history of wild and cultivated mushrooms in Nigeria.

  14. Mushroom refinement endeavor auspicate non green revolution in the offing

    Directory of Open Access Journals (Sweden)

    SHAUKET AHMED PALA

    2014-11-01

    Full Text Available Pala SA, Wani AH, Boda RH, Wani BA. 2014. Mushroom refinement endeavor auspicate non green revolution in the offing. Nusantara Bioscience 6: 173-185. Mushroom can serve as food, tonic, and as medicine thus make people healthier, fitter and happier. They have a cracking potential for generating great socioeconomic impact in human welfare at local, national and international level. With the help of allied mushroom farming we can easily tackle the problem of food for growing world population; reduce environmental pollution by bioconversion of huge organic wastes into mushrooms; recycle huge quantity of organic wastes to mushroom crops, biofertilizers, and biogas; restore damaged environment by mushroom mycelia through mycoforestry, mycoremediation, mycofiltration and mycopesticides in a zero emission fashion. They can be used to degrade radioactive industrial biocide wastes in an eco-friendly fashion. Since mushroom cultivation is an indoor agribusiness, it could have great economic impact by generating employment, income and functional food requirements for rural people especially in developing countries. How far mushroom cultivation can meet the functional food requirements; address the domestic food challenges, rising food prices and crisis vis a vis environmental sustainability will be thrust areas of this communication.

  15. Proximate and mineral analysis of some wild edible mushrooms

    African Journals Online (AJOL)

    israelikk

    2012-04-12

    Apr 12, 2012 ... Key words: Edible mushroom, mineral composition, proximate analysis. ... than beef, pork and chicken that contain similar nutrients. .... legumes and meat. In earlier studies, Gruen and Wong. (1982) indicated that edible mushrooms were highly nutritional and compared favourably with meat, egg and milk.

  16. DRYING CHARACTERISTICS OF CAP AND STEM OF MUSHROOM

    African Journals Online (AJOL)

    Administrator

    mushrooms are not immediately processed. Drying is the most commonly used method of preservation of mushrooms. Dehydrated mush- rooms are used as an important ingredient in several food formulations including instant soups, pasta salads, snack seasonings, stuffing, casseroles, and meat and rice dishes (Tuley,.

  17. analysis of edible mushroom marketing in three villages in central

    African Journals Online (AJOL)

    BARTH

    Furthermore, extension agents should monitor beneficiaries of such loans to ensure ... Mushrooms belong to a group of living things ... environment, knowledge of simple and low cost .... =Taxes (naira) ... Inheritance ... Table 7 revealed that Alesi marketers made profit margin of N 60,000.00 per .... Guide to Edible Mushroom.

  18. Yield response of mushroom (Agaricus bisporus) on wheat straw ...

    African Journals Online (AJOL)

    SERVER

    2008-01-18

    Jan 18, 2008 ... 1Mugla University, Faculty of Technical Education, Kotekli, 48000, Mugla, Turkey. 2Mugla University, Mushroom ..... Hayes WA, Shandilya TR (1977). Casing soil and compost substrates used in the artifical culture of Agaricus bisporus, the cultivated mushroom. Indian J. Mycol. Plant Pathol. 7: 5-10. Lambert ...

  19. Indigenous knowledge and utilization of edible mushrooms in parts ...

    African Journals Online (AJOL)

    Heim and Coprinus disseminatus (Pers.: Fr.) S. F. Gray. Among the local people, names of edible mushrooms are based on the substrates on which they grow, their association with insects, and unrelated taxa are given collective names. Rural people believe mushrooms have medicinal values and can serve as blood tonic, ...

  20. Essential trace elements in edible mushrooms by Neutron Activation Analysis

    Energy Technology Data Exchange (ETDEWEB)

    Moura, Patricia L.C.; Maihara, Vera A.; Castro, Lilian P. de [Instituto de Pesquisa e Energetica e Nucleares (IPEN/CNEN-SP), Sao Paulo, SP (Brazil)]. E-mail: patricialandim@ig.com.br; vmaihara@ipen.br; lilian.Pavanelli@terra.com.br; Figueira, Rubens C.L. [Universidade Cruzeiro do Sul, Sao Paulo, SP (Brazil)]. E-mail: figueiraru@yahoo.com.br

    2007-07-01

    Mushrooms are excellent nutritional sources since they provide proteins, fibers and mineral, such as K, P, Fe. They have also been the focus of medical research. In Brazil mushrooms are not consumed in large quantities by the general population since people know little about the nutritional and medicinal benefits that mushrooms offer. Hence, this study intends to contribute to a better understanding of the essential element content in edible mushrooms, which are currently commercialized in Sao Paulo state. Br Fe, K, Na and Zn concentrations were determined by Instrumental Neutron Activation Analysis in the following mushroom species: Shitake (Lentinus edodes), Shimeji (Pleurotus ssp), Paris Champignon (Agaricus bisporus), Hiratake ( Pleurotus ssp) and Eringue (Pleurotus Eryngu. The mushroom samples were acquired from commercial establishments in the city of Sao Paulo and directly from the producers. Essential element contents in mushrooms varied between Br 0.03 to 4.1 mg/kg; Fe 20 to 267 mg/kg; K 1.2 to 5.3 g/kg, Na 10 to 582 mg/kg and Zn 60 to 120 mg/kg. The results confirm that mushrooms can be considered a good source of K, Fe and Zn. The low Na level is a good nutritional benefit for the consumer. (author)

  1. Assessing the potential of mushroom cultivation in improving ...

    African Journals Online (AJOL)

    Mo

    Department of Agricultural Extension Education, Faculty of Agriculture, Makerere University, P.O Box ... requires little land space, earns high income, and provides ... mushroom growing is one of the enterprises that would fit .... Children. 2. 3.30. Relative. 3. 5.00. Table 1. Availability of wild mushrooms now and in the past.

  2. VITAMIN EFFECT ON THE SYNTHESIS ОF POLYPHENOLIC SUBSTANCES BY BASIDIOMYCETES

    Directory of Open Access Journals (Sweden)

    Veligodska A. K.

    2013-12-01

    Full Text Available We studied the influence of certain vitamins on the intensity of the synthesis of polyphenolic compounds and carotenoids by some Basidiomycetes strains, such as Laetiporus sulphureus Ls-08, Fomes fomentarius Ff-1201 and Fistulina hepatica Fh-18. The registration of accumulation of dry biomass and content of polyphenols and carotenoids in the mycelia and culture filtrate of strains that were cultivated on glucose-peptone substrates (GPS with vitamins was performed. The vitamins A, E, C, B1, B12, and PP at the concentration of 0.005, 0.01 and 0.05 g/l were applied as modification of GPS. We founded the species effect on the synthesis of vitamins, polyphenols, and carotenoids. We suggested separate application of vitamins A, E, B1, and B12 at concentration of 0.01 g/ l to induce the synthesis of polyphenols and carotenoids. Results of the study will be used to develop a modification of GPS for the cultivation of strains of polyphenolic substances of basidiomycete origin.

  3. [Oil degradation by basidiomycetes in soil and peat at low temperatures].

    Science.gov (United States)

    Kulikova, N A; Klein, O I; Pivchenko, D V; Landesman, E O; Pozdnyakova, N N; Turkovskaya, O V; Zaichik, B Ts; Ruzhitskii, A O; Koroleva, O V

    2016-01-01

    A total of 17 basidiomycete strains causing white rot and growing on oil-contaminated substrates have been screened. Three strains with high (Steccherinum murashkinskyi), average (Trametes maxima), and low (Pleurotus ostreatus) capacities for the colonization of oil-contaminated substrates have been selected. The potential for degrading crude oil hydrocarbons has been assessed with the use of fungi grown on nonsterile soil and peat at low temperatures. Candida sp. and Rhodococcus sp. commercial strains have been used as reference organisms with oil-degrading ability. All microorganisms introduced in oil-contaminated soil have proved to be ineffective, whereas the inoculation of peat with basidiomycetes and oil-degrading microorganisms accelerated the destruction of oil hydrocarbons. The greatest degradation potential of oil-aliphatic hydrocarbons has been found in S. murashlinskyi. T. maxima turned out to be the most successful in degrading aromatic hydrocarbons. It has been suggested that aboriginal microflora contributes importantly to the effectiveness of oil-destructing microorganisms. T. maxima and S. murashkinskyi strains are promising for further study as oil-oxidizing agents during bioremediation of oil-contaminated peat soil under conditions of low temperatures.

  4. Accumulation of elements by edible mushroom species: part I. Problem of trace element toxicity in mushrooms.

    Science.gov (United States)

    Mleczek, Mirosław; Siwulski, Marek; Stuper-Szablewska, Kinga; Rissmann, Iwona; Sobieralski, Krzysztof; Goliński, Piotr

    2013-01-01

    The aim of this study was to evaluate Cd, Co, Cu, Hg, Ni, Pb, Sr and Zn accumulation in six edible mushroom species and to assess their risk and benefits to human consumers. Mushrooms (Leccinium aurantiacum, Xerocomus badius, Lactarius deliciosus, Boletus edulis, Cantharellus cibarius and Suillus luteus) were collected from selected regions of Poland during 1990-2010. The highest diversity between studied mushroom species was observed in terms of Cu and Zn accumulation. Significant differences in the accumulation efficiency were found among the six mushroom species examined. The most efficient were Boletus edulis (Cd and Hg), Suillus luteus (Cu and Sr), and Lactarius deliciosus (Pb and Zn). In the case of Co and Ni, the most effective were Xerocomus badius and Leccinium aurantiacum, respectively. The calculated bioconcentration factor (BCF) values of Cd, Cu, Hg, Sr and Zn were > 1 for all species in this study while Co, Ni and Pb usually were bioexcluded (BCF luteus collected in Poland is safe and this finding largely agrees with results from recent studies by other authors.

  5. Cloning and Expression Analysis of Phenylalanine Ammonia-Lyase Gene in the Mycelium and Fruit Body of the Edible Mushroom Flammulina velutipes

    Science.gov (United States)

    Yun, Yeo Hong; Koo, Ja Sun

    2015-01-01

    Phenylalanine ammonia-lyase (PAL) gene is known to be expressed in plants, and is involved in the differentiation, growth and synthesis of secondary metabolites. However, its expression in fungi remains to be explored. To understand its expression in mushroom fungi, the PAL gene of the edible mushroom Flammulina velutipes (Fvpal) was cloned and characterized. The cloned Fvpal consists of 2,175 bp, coding for a polypeptide containing 724 amino acids and having 11 introns. The translated amino acid sequence of Fvpal shares a high identity (66%) with that of ectomycorrhizal fungus Tricholoma matsutake. Distinctively, the Fvpal expression in the mycelium was higher in minimal medium supplemented with L-tyrosine than with other aromatic amino acids. During cultivation of the mushroom on sawdust medium, Fvpal expression in the fruit body correspondingly increased as the mushroom grew. In the fruiting body, Fvpal was expressed more in the stipe than in the pileus. These results suggest that F. velutipes PAL activity differs in the different organs of the mushroom. Overall, this is first report to show that the PAL gene expression is associated with mushroom growth in fungi. PMID:26539050

  6. Antioxidant capacity and mineral contents of edible wild Australian mushrooms.

    Science.gov (United States)

    Zeng, X; Suwandi, J; Fuller, J; Doronila, A; Ng, K

    2012-08-01

    Five selected edible wild Australian mushrooms, Morchella elata, Suillus luteus, Pleurotus eryngii, Cyttaria gunnii, and Flammulina velutipes, were evaluated for their antioxidant capacity and mineral contents. The antioxidant capacities of the methanolic extracts of the dried caps of the mushrooms were determined using a number of different chemical reactions in evaluating multi-mechanistic antioxidant activities. These included the Trolox equivalent antioxidant capacity, ferric ion reducing antioxidant power, and ferrous ion chelating activity. Mineral contents of the dried caps of the mushrooms were also determined by inductively coupled plasma-optical emission spectroscopy. The results indicated that these edible wild mushrooms have a high antioxidant capacity and all, except C. gunnii, have a high level of several essential micro-nutrients such as copper, magnesium, and zinc. It can be concluded that these edible wild mushrooms are good sources of nutritional antioxidants and a number of mineral elements.

  7. Extensive sampling of basidiomycete genomes demonstrates inadequacy of the white-rot/brown-rot paradigm for wood decay fungi

    Science.gov (United States)

    Fungi of the phylum Basidiomycota (basidiomycetes) make up some 37% of the described fungi and are important in forestry, agriculture, medicine, and bioenergy. This diverse phylum includes symbionts, pathogens, and saprotrophs including the majority of wood decaying and ectomycorrhizal species. To b...

  8. Novel root-fungus symbiosis in Ericaceae: sheathed ericoid mycorrhiza formed by a hitherto undescribed basidiomycete with affinities to Trechisporales

    Czech Academy of Sciences Publication Activity Database

    Vohník, Martin; Sadowsky, J. J.; Kohout, Petr; Lhotáková, Z.; Nestby, R.; Kolařík, Miroslav

    2012-01-01

    Roč. 7, č. 6 (2012), e39524 E-ISSN 1932-6203 R&D Projects: GA ČR GP206/09/P340 Institutional support: RVO:67985939 ; RVO:61388971 Keywords : ericoid mycorrhiza * Ericaceae * Basidiomycetes Subject RIV: EF - Botanics; EE - Microbiology, Virology (MBU-M) Impact factor: 3.730, year: 2012

  9. 77 FR 66580 - Certain Preserved Mushrooms From India: Preliminary Results of Antidumping Duty Administrative...

    Science.gov (United States)

    2012-11-06

    ... DEPARTMENT OF COMMERCE International Trade Administration [A-533-813] Certain Preserved Mushrooms... preserved mushrooms (mushrooms) from India. The period of review (POR) is February 1, 2011, through January... Preliminary Results of Antidumping Duty Administrative Review: Certain Preserved Mushrooms from India...

  10. 77 FR 19620 - Certain Preserved Mushrooms from the People's Republic of China: Initiation of Antidumping Duty...

    Science.gov (United States)

    2012-04-02

    ... DEPARTMENT OF COMMERCE International Trade Administration [A-570-851] Certain Preserved Mushrooms... certain preserved mushrooms from the People's Republic of China (PRC). In accordance with section 751(a)(2... mushrooms from the PRC.\\1\\ The antidumping duty order on certain preserved mushrooms from the PRC therefore...

  11. Novel root-fungus symbiosis in Ericaceae: sheathed ericoid mycorrhiza formed by a hitherto undescribed basidiomycete with affinities to Trechisporales.

    Directory of Open Access Journals (Sweden)

    Martin Vohník

    Full Text Available Ericaceae (the heath family are widely distributed calcifuges inhabiting soils with inherently poor nutrient status. Ericaceae overcome nutrient limitation through symbiosis with ericoid mycorrhizal (ErM fungi that mobilize nutrients complexed in recalcitrant organic matter. At present, recognized ErM fungi include a narrow taxonomic range within the Ascomycota, and the Sebacinales, basal Hymenomycetes with unclamped hyphae and imperforate parenthesomes. Here we describe a novel type of basidiomycetous ErM symbiosis, termed 'sheathed ericoid mycorrhiza', discovered in two habitats in mid-Norway as a co-dominant mycorrhizal symbiosis in Vaccinium spp. The basidiomycete forming sheathed ErM possesses clamped hyphae with perforate parenthesomes, produces 1- to 3-layer sheaths around terminal parts of hair roots and colonizes their rhizodermis intracellularly forming hyphal coils typical for ErM symbiosis. Two basidiomycetous isolates were obtained from sheathed ErM and molecular and phylogenetic tools were used to determine their identity; they were also examined for the ability to form sheathed ErM and lignocellulolytic potential. Surprisingly, ITS rDNA of both conspecific isolates failed to amplify with the most commonly used primer pairs, including ITS1 and ITS1F + ITS4. Phylogenetic analysis of nuclear LSU, SSU and 5.8S rDNA indicates that the basidiomycete occupies a long branch residing in the proximity of Trechisporales and Hymenochaetales, but lacks a clear sequence relationship (>90% similarity to fungi currently placed in these orders. The basidiomycete formed the characteristic sheathed ErM symbiosis and enhanced growth of Vaccinium spp. in vitro, and degraded a recalcitrant aromatic substrate that was left unaltered by common ErM ascomycetes. Our findings provide coherent evidence that this hitherto undescribed basidiomycete forms a morphologically distinct ErM symbiosis that may occur at significant levels under natural conditions, yet

  12. Influence of growing conditions on heavy metals content in cultivated mushrooms

    International Nuclear Information System (INIS)

    Kmitene, L.

    1997-01-01

    The aim of the research was to investigate the influence of growing terms, microclimate conditions and growing medium on the mushroom harvest and quality. Champignons were grown according to the Polish technology. Pleurotus ostreatus was grown in perforate sacks using chopped wheat straw. Mycelium was sowed in different terms. It was established that the harvest of mushrooms, especially their quality, depends not only on growing conditions, but also on the kind of mushrooms, composte quality, mushroom size (diameter of cap), picking of mushrooms, storage time and other conditions. The technology of mushroom growing will be developed after studying all the factors determining the content of heavy metals and radiation in mushrooms

  13. Relative Numbers of Certain Microbial Groups Present in Compost Used for Mushroom (Agaricus bisporus) Propagation

    Science.gov (United States)

    Fordyce, C.

    1970-01-01

    The relative numbers of microorganisms associated with compost during mushroom production were studied by the dilution plate method. Thermophilic actinomycetes and fungi were isolated with a very high frequency early in the growing season. Although numbers of thermophilic bacteria diminished slowly during the season, the thermophilic fungi and actinomycetes diminished rapidly with the latter disappearing after 6 weeks. Mesophilic fungi other than Agaricus or Trichoderma remained relatively stable throughout the growing period. Agaricus could be isolated between the first and third break. Trichoderma became dominant after the fourth break. The mesophilic bacterial counts diminished during the most productive portion of the mushroom cropping season and then increased to much higher numbers toward the end of the season. PMID:5529631

  14. THE BIOMINERAL CONCENTRATIONS AND ACCUMULATION IN SOME WILD GROWING EDIBLE SPECIES OF MUSHROOMS

    Directory of Open Access Journals (Sweden)

    Carmen Cristina Elekes

    2010-01-01

    Full Text Available Many mushrooms species are known to accumulate metals to a higher level than the plants and are considered as a source of proteins, vitamins – riboflavin, biotin and thiamine, fats, carbohydrates, amino acids and minerals. The trace metals concentrations were established by Inductively Coupled Plasma - Atomic Emission Spectrometry method. The aim of this paper is to determinate the minerals content of some wild growing mushrooms, which may be useful in the phytopharmaceutical biotechnologies in order to obtain important quantities of biominerals accessible for the human body. The results are varying with the analyzed species of mushrooms between 11869.85 and 32088.68 mg/kg for potassium, 240.81 to 716.98 mg/kg for calcium and between 0 to 5350 mg/kg for phosphorus. The highest concentration if potassium was founded in B. griseus species, 32088.68 mg/kg. Only two species, Hygrophorus virgineus and Marasmius oreades show a phosphorus concentration in the fruiting body higher than in soil, indicating the accumulation capacity.

  15. Selenium and Zinc content and radical scavenging capacity of edible mushrooms Armilaria mellea and Lycoperdon saccatum

    Directory of Open Access Journals (Sweden)

    Z. Zeković

    2010-01-01

    Full Text Available Armillaria mellea and Lycoperdon saccatum are two delicious mushrooms growing widely trough all Balkan region. Investigation of A. mellea and L. saccatum antioxidant properties includes preparation of mushrooms extracts, determination of Selenium and Zinc content and evaluation of theirs antioxidant activity involving scavenging activity of ˙O2- radicals, DPPH and reducing power assay. Higher extraction yield of 24.48 % has been achieved for L. saccatum, but higher content of Selenium and Zinc was determined in A. mallea extract, 2.359 mg/kg and 50.380 mg/kg, respectively. The radical scavenging activity was found to exhibit 50 % of inhibition value (IC50 value at the extracts concentration of 0.0161±0.0001 mg/ml for the L. saccatum extract and 0.0108±0.0002 mg/ml for A. mallea extract. The determined relative inhibition of ˙O2- radicals for L. sacatum extract is lower than for A. malea. It was determined that both mushrooms extract posses’ reductive capabilities and thus were capable of reducing iron (III.

  16. Mushrooms pollution by radioactivity and heavy metals

    International Nuclear Information System (INIS)

    Delatouche, L.

    2001-01-01

    Some basic notions of radioactivity are recalled first (definition, origin, measurement units, long- and short-term effects..). Then, the pedology of soils and the properties and toxicity of 3 heavy metals (lead, cadmium, mercury) are presented to better understand the influence of some factors (genre, age, ecological type, pollution, conservation..) on the contamination of macro-mycetes by radioactivity and heavy metals. The role of chemists is to inform the consumers about these chemical and radioactive pollutions and to give some advices about the picking up (quantities, species and places to avoid) and the cooking of mushrooms. (J.S.)

  17. Mercury in wild mushrooms and underlying soil substrate from Koszalin, North-central Poland.

    Science.gov (United States)

    Falandysz, Jerzy; Jedrusiak, Aneta; Lipka, Krzysztof; Kannan, Kurunthachalam; Kawano, Masahide; Gucia, Magdalena; Brzostowski, Andrzej; Dadej, Monika

    2004-01-01

    Concentrations of total mercury were determined by cold-vapour atomic absorption spectroscopy (CV-AAS) in 221 caps and 221 stalks of 15 species of wild growing higher fungi/mushrooms and 221 samples of corresponding soil substrate collected in 1997-98 in Manowo County, near the city of Koszalin in North-central Poland. Mean mercury concentrations in caps and stalks of the mushroom species examined and soils varied between 30+/-31 and 920+/-280, 17+/-11 and 560+/-220, and 10+/-9 and 170+/-110 ng/g dry matter, respectively. Cap to stalk mercury concentration quotients were from 1.0+/-0.4 in poison pax (Paxillus involutus) to 2.8+/-0.7 in slippery jack (Suillus luteus). Brown cort (Cortinarius malicorius), fly agaric (Amanita muscaria), orange-brown ringless amanita (A. fulva), red-aspen bolete (Leccinum rufum) and mutagen milk cap (Lactarius necator) contained the highest concentrations of mercury both in caps and stalks, and mean concentrations varied between 600+/-750 and 920+/-280 and 370+/-470 and 560+/-220 ng/g dry matter, respectively. An estimate of daily intake of mercury from mushroom consumption indicated that the flesh of edible species of mushrooms may not pose hazards to human health even at a maximum consumption rate of 28 g/day. However, it should be noted that mercury intake from other foods will augment the daily intake rates. Species such as the sickener (Russula emetica), Geranium-scented russula (R. fellea) and poison pax (P. involutus) did not concentrate mercury as evidenced from the bioconcentration factors (BCFs: concentrations in mushroom/concentration in soil substrate), which were less than 1. Similarly, red-hot milk cap (L. rufus), rickstone funnel cap (Clitocybe geotropa) and European cow bolete (S. bovinus) were observed to be weak accumulators of mercury. Fly agaric (A. muscaria) accumulated great concentrations of mercury with BCFs reaching 73+/-42 and 38+/-22 in caps and stalks, respectively. Mercury BCFs of between 4.0+/-2.3 and 23

  18. Effect of Edible Mushroom (Pleurotus ostreatus on Type-2 Diabetics

    Directory of Open Access Journals (Sweden)

    M. Abu Sayeed

    2014-01-01

    Full Text Available The prevalence of non-communicable diseases (NCD like diabetes, hypertension, dyslipidemia and atherosclerotic cardiovascular diseases (CVD are on the increase globally and predominantly in the South East Asian Region (SEAR. The increasing NCD and its complications burdened the health cost of Bangladesh. The available literatures suggest that edible mushrooms are effective in controlling metabolic risks like hyperglycemia and hypercholesterolemia. The study addressed the metabolic effects of edible oyster mushroom (Pleurotus ostreatus in diabetic individuals and to assess the undesirable effects of mushroom. A total of 5000 newly registered diabetic women were screened for eligible participants (urban housewives, age 30 – 50y, BMI 22 – 27, FBG 8 – 12 mmol/l; free from complications or systemic illnesses and agreed to adhere to the study for 360 days. The investigations included weight and height for BMI, waist- and hip-girth for WHR, BP, FBG, 2ABF, T-chol, TG, HDL, LDL, ALT and Creatinine starting from the day 0 (baseline and each subsequent follow-up days: 60, 120, 180, 240, 300 and 360 for comparison between placebo and mushroom groups and also within group (baseline vs. follow up days, individually for placebo and mushroom. The daily intake of mushroom was 200g for the mushroom group and an equivalent calorie of vegetables for the placebo group. Overall, 73 diabetic housewives (mushroom / placebo = 43 /30 volunteered. The mean (with SEM values of BMI, WHR, BP, FBG, 2ABF, T-chol, TG, HDL, LDL, ALT and Creatinine of the placebo group were compared with the mushroom group. Compared with the placebo, the mushroom group showed significant reductions of FBG (p<0.001, 2ABF (p<0.001, T-chol (p<0.001, TG (p=0.03 and LDL (p<0.001; whereas, no difference was observed for BMI, SBP, DBP, HDL, Hb, creatinine and ALT. The comparison within groups (baseline vs. follow-up there were significant reduction of these variables in mushroom but not in the

  19. Distribution of 210Pb and 210Po concentrations in wild berries and mushrooms in boreal forest ecosystems

    International Nuclear Information System (INIS)

    Vaaramaa, Kaisa; Solatie, Dina; Aro, Lasse

    2009-01-01

    The activity concentrations and distribution of 210 Pb and 210 Po in wild berries and edible mushrooms were investigated in Finnish forests. The main study areas were located in Scots pine (Pinus sylvestris L.) forests in southern and northern Finland. The activity concentrations of 210 Pb and 210 Po in blueberry (Vaccinium myrtillus L.) and lingonberry (Vaccinium vitis-idaea L.) samples decreased in the order: stems > leaves > berries (i.e. fruits). The activity ratios of 210 Po/ 210 Pb in the wild berry samples were mainly higher than one, indicating elevated activity concentrations of polonium in the samples. In mushrooms the activity concentrations of 210 Pb and especially 210 Po were higher than in fruits of the wild berries. The highest activity concentration of 210 Pb was detected in Cortinarius armillatus L. (16.2 Bq kg -1 d.w.) and the lowest in Leccinum vulpinum L. (1.38 Bq kg -1 d.w.). The 210 Po activity concentrations of the whole fruiting bodies ranged from 7.14 Bq kg -1 d.w. (Russula paludosa L.) to 1174 Bq kg -1 d.w. (L. vulpinum L.). In general, the highest activity concentrations of 210 Po were recorded in boletes. The caps of mushrooms of the Boletaceae family showed higher activity concentrations of 210 Po compared to the stipes. In most of the mushrooms analyzed, the activity concentrations of 210 Po were higher than those of 210 Pb. 210 Po and 210 Pb dominate the radiation doses received via ingestion of wild berries and mushrooms in northern Finland, while in southern Finland the ingested dose is dominated by 137 Cs from the Chernobyl fallout.

  20. Distribution of {sup 210}Pb and {sup 210}Po concentrations in wild berries and mushrooms in boreal forest ecosystems

    Energy Technology Data Exchange (ETDEWEB)

    Vaaramaa, Kaisa, E-mail: Kaisa.Vaaramaa@Helsinki.fi [Laboratory of Radiochemistry, Department of Chemistry, P.O. Box 55, FI-00014 University of Helsinki (Finland); Solatie, Dina [STUK-Radiation and Nuclear Safety Authority, Regional Laboratory in Northern Finland, FI-96500 Rovaniemi (Finland); Aro, Lasse [Finnish Forest Research Institute (METLA), Parkano Research Unit, FI-39700 Parkano (Finland)

    2009-12-15

    The activity concentrations and distribution of {sup 210}Pb and {sup 210}Po in wild berries and edible mushrooms were investigated in Finnish forests. The main study areas were located in Scots pine (Pinus sylvestris L.) forests in southern and northern Finland. The activity concentrations of {sup 210}Pb and {sup 210}Po in blueberry (Vaccinium myrtillus L.) and lingonberry (Vaccinium vitis-idaea L.) samples decreased in the order: stems > leaves > berries (i.e. fruits). The activity ratios of {sup 210}Po/{sup 210}Pb in the wild berry samples were mainly higher than one, indicating elevated activity concentrations of polonium in the samples. In mushrooms the activity concentrations of {sup 210}Pb and especially {sup 210}Po were higher than in fruits of the wild berries. The highest activity concentration of {sup 210}Pb was detected in Cortinarius armillatus L. (16.2 Bq kg{sup -1} d.w.) and the lowest in Leccinum vulpinum L. (1.38 Bq kg{sup -1} d.w.). The {sup 210}Po activity concentrations of the whole fruiting bodies ranged from 7.14 Bq kg{sup -1} d.w. (Russula paludosa L.) to 1174 Bq kg{sup -1} d.w. (L. vulpinum L.). In general, the highest activity concentrations of {sup 210}Po were recorded in boletes. The caps of mushrooms of the Boletaceae family showed higher activity concentrations of {sup 210}Po compared to the stipes. In most of the mushrooms analyzed, the activity concentrations of {sup 210}Po were higher than those of {sup 210}Pb. {sup 210}Po and {sup 210}Pb dominate the radiation doses received via ingestion of wild berries and mushrooms in northern Finland, while in southern Finland the ingested dose is dominated by {sup 137}Cs from the Chernobyl fallout.

  1. Comparison of Different Drying Methods for Recovery of Mushroom DNA.

    Science.gov (United States)

    Wang, Shouxian; Liu, Yu; Xu, Jianping

    2017-06-07

    Several methods have been reported for drying mushroom specimens for population genetic, taxonomic, and phylogenetic studies. However, most methods have not been directly compared for their effectiveness in preserving mushroom DNA. In this study, we compared silica gel drying at ambient temperature and oven drying at seven different temperatures. Two mushroom species representing two types of fruiting bodies were examined: the fleshy button mushroom Agaricus bisporus and the leathery shelf fungus Trametes versicolor. For each species dried with the eight methods, we assessed the mushroom water loss rate, the quality and quantity of extracted DNA, and the effectiveness of using the extracted DNA as a template for PCR amplification of two DNA fragments (ITS and a single copy gene). Dried specimens from all tested methods yielded sufficient DNA for PCR amplification of the two genes in both species. However, differences among the methods for the two species were found in: (i) the time required by different drying methods for the fresh mushroom tissue to reach a stable weight; and (ii) the relative quality and quantity of the extracted genomic DNA. Among these methods, oven drying at 70 °C for 3-4 h seemed the most efficient for preserving field mushroom samples for subsequent molecular work.

  2. Radiopasteurization of sawdust media used in propagation of mushrooms

    International Nuclear Information System (INIS)

    Ito, Hitoshi; Sato, Tomotaro

    1975-01-01

    In our country, cultivation of mushrooms such as Pleurotus ostreatus, Kuehneromyces nameko, and Lentinus edodes (Cortinellus shiitake) are expanding, and has reached considerable amounts. These mushrooms are cultivated generally on decaying logs of broad leaf trees. Recently, these mushrooms are also cultivated artificially on the sawdust-media containing rice bran and other nutrient in the room of which temperature is controlled. However, these artificial culture media must be germicidated for 2 or 6 hours at 100 to 120 0 C before inoculation of mushroom spawn. In this study, attempts were made to cultivate Pleurotus ostreatus on the sawdust-media pasteurized by ionizing radiation. Inhibition of mushrooms growth were caused mainly by multiplication of Citrobacter and Fusarium, and these organisms were eliminated by a dose of 0.5 Mrad gamma irradiation. A surprising result was that many of sawdust media subjected to 0.5, 1.0 and 2.0 Mrad increased mycelial growth rates more than heat treatments, and also mushroom yields were enhanced. The multiplication of remaining microorganisms such as Bacillus and yeasts after irradiation with a dose of 0.5 Mrad or 1.0 Mrad did not inhibit the mycelial growth of mushrooms. (auth.)

  3. Radiocaesium and natural gamma emitters in mushrooms collected in Spain

    Energy Technology Data Exchange (ETDEWEB)

    Baeza, Antonio; Guillen, Fco. Javier [Department of Physics, Faculty of Veterinary, University of Extremadura, Avda de la Universidad s/n, Caceres 10071 (Spain); Hernandez, Santiago [Department of Techniques, Means and Elements of Construction, Polytechnical School, University de Extremadura, Avda de la Universidad s/n, Caceres 10071 (Spain); Moreno, Gabriel; Manjon, Jose Luis [Department of Plant Biology, Faculty of Sciences, University of Alcala, Alcala de Henares, Madrid 28871 (Spain); Pascual, Rosario [Department of Zootechnics, Faculty of Veterinary, University of Extremadura, Avda de la Universidad s/n, Caceres 10071 (Spain)

    2004-01-05

    Mushrooms can accumulate heavy metals in general, including radionuclides found in the nature. However, little attention has been paid to the radioactive content of mushrooms collected in Spain and the dose for the population due to their ingestion. To address this, we analysed the contents of {sup 137}Cs, {sup 40}K, {sup 226}Ra and {sup 7}Be present in different species of mushrooms, according to their genus and nutritional mechanism. We observed that mycorrhizal mushrooms accumulate {sup 137}Cs more than saprophytes, and vice versa for {sup 7}Be. {sup 40}K and {sup 226}Ra are accumulated to the same degree by the two groups of mushrooms. We estimated the dose due to ingestion of mushrooms in Spain to be 2 {mu}Sv/year, and the contribution of {sup 40}K and {sup 226}Ra to be generally greater than that of {sup 137}Cs. The contribution of {sup 137}Cs to the dose was calculated by taking into account the results of an experiment carried out under the controlled laboratory conditions, which showed that approximately 98% of {sup 134}Cs was associated with the readily digestible fraction of the mushrooms.

  4. Linhchi mushrooms as biological monitors for 137Cs pollution

    International Nuclear Information System (INIS)

    Tran Van, L.; Le Duy, T.

    1991-01-01

    Radioactivity of Linhchi mushrooms (Ganoderma Lucidum) cultivated in laboratory and production conditions has been measured in the Environmental Laboratory of Nuclear Research Institute (NRI), Dalat, Vietnam. The results showed that Linhchi mushroom has a high radioactive concentration of 137 Cs, which is about 20 Bq kg -1 fresh weight. In addition, the radioactive contents of substrata before and after cultivation were insignificant. This suggested that Linhchi mushroom should only accumulate the 137 Cs radioisotope from the atmosphere, directly. Therefore, it should be considered as a bio-indicator for environmental monitoring. (author) 13 refs.; 3 figs.; 2 tabs

  5. Olive Mill Waste Enhances α-Glucan Content in the Edible Mushroom Pleurotus eryngii

    Directory of Open Access Journals (Sweden)

    Sharon Avni

    2017-07-01

    Full Text Available Mushroom polysaccharides are edible polymers that have numerous reported biological functions; the most common effects are attributed to β-glucans. In recent years, it became apparent that the less abundant α-glucans also possess potent effects in various health conditions. Here we explore several Pleurotus species for their total, β and α-glucan content. Pleurotus eryngii was found to have the highest total glucan concentrations and the highest α-glucans proportion. We also found that the stalks (stipe of the fruit body contained higher glucan content then the caps (pileus. Since mushrooms respond markedly to changes in environmental and growth conditions, we developed cultivation methods aiming to increase the levels of α and β-glucans. Using olive mill solid waste (OMSW from three-phase olive mills in the cultivation substrate. We were able to enrich the levels mainly of α-glucans. Maximal total glucan concentrations were enhanced up to twice when the growth substrate contained 80% of OMSW compared to no OMSW. Taking together this study demonstrate that Pleurotus eryngii can serve as a potential rich source of glucans for nutritional and medicinal applications and that glucan content in mushroom fruiting bodies can be further enriched by applying OMSW into the cultivation substrate.

  6. Forest farming of shiitake mushrooms: an integrated evaluation of management practices.

    Science.gov (United States)

    Bruhn, J N; Mihail, J D; Pickens, J B

    2009-12-01

    Two outdoor shiitake (Lentinula edodes) cultivation experiments, established in Missouri USA in 1999 and 2000, produced mushrooms in 2000-2005. We examined shiitake production in response to substrate species, inoculum form, inoculum strain, and inoculation timing, using total mushroom weight per log as the primary response variable with log characteristics as covariates. The significantly greater mushroom weight produced by sugar maple logs compared with white or northern red oak was attributable to the higher proportion of undiscolored wood volume in the maple logs, rather than to bark thickness or log diameter. The "wide temperature range" shiitake strain produced significantly greater yield compared with the "warm" or "cold" weather strains. Both the wide-range and warm-weather strains were stimulated to fruit by significant rain events, while the cold-weather strain was responsive to temperature. Inoculation with sawdust spawn gave significantly greater yield than colonized wooden dowels or pre-packaged "thimble" plug inoculum. The second and third full years following inoculation were the most productive.

  7. High microbial loads found in minimally-processed sliced mushrooms from Italian market

    Directory of Open Access Journals (Sweden)

    Haiyang Jiang

    2018-04-01

    Full Text Available There is an increased consumer interest in minimally processed vegetables that has led to the development of products, such as pre-cut sliced mushrooms. Few data are available on the hygienic condition and the presence of foodborne pathogens in such products. Therefore, the current study aimed to evaluate the safety and hygienic characteristics of both ready-to-eat and ready-to-cook, pre-cut sliced mushrooms obtained from a local Italian market. For the evaluation of the hygienic condition, the aerobic mesophilic bacteria, aerobic psychrotrophic bacteria and Escherichia coli enumerations were performed. Salmonella spp., Listeria monocytogenes and Campylobacter spp. were considered in the assessment of the foodborne pathogens. High microbial loads were detected, including counts higher than 5 log CFU/g for E. coli and 6 log CFU/g for the other bacteria counts considered, but no pathogens were found. Ready-to-eat and ready-to-cook products differed only for aerobic mesophilic counts (7.87 and 8.26 log CFU/g, respectively, P=0.003. Strategies to enhance the hygienic level of the mushrooms, particularly the ready-to-eat products, are needed.

  8. Purification and Characterization of Fibrinolytic Proteases from Mushroom Volvariela volvaceae Extract.

    Directory of Open Access Journals (Sweden)

    Willy Praira

    2010-11-01

    Full Text Available Purification and Characterization of Fibrinolytic Proteases from Mushroom Volvariela volvaceae Extract. Ediblestraw mushroom (V. volvaceae has been known used for improvement of blood circulation due to its fibrinolyticcontent. The objective of the study is to purify and characterize fibrinolytic protease from straw mushroom extract.Purification were performed through several steps, i.e. precipitation using ammonium sulphate 75%, dialyzed membran(cut-off 10 kDa, and ion-exchange chromatography using DEAE Sepharose. The active fraction of DEAE-Sepharosecontains two purified protein bands with molecular weight of 12.9 and 15.8 kDa. The active fraction has specificactivity of 0.383 U/mg with 2.7 fold higher purification compared to its crude extract. Both crude and purified enzymeshad optimum activity at temperature of 50 ºC and pH 7 in 10 minutes of incubation. Fibrin zymographic profiledemonstrated that the enzyme hydrolyzed fibrin, as well as casein, indicating their potent fibrinolytic activity. Theenzyme was strongly inhibited by phenilmethylsulphonyl fluoride and N-p-tosil-L-lysinchloromethyl keton. Thissuggested that it was a serine protease. In summary, these results showed that crude and purified protease of strawmushroom (V. volvaceae has fibrinolytic activities that can be applied for alternative thrombolytic therapy.

  9. Antioxidant activities of extracts from five edible mushrooms using different extractants

    Directory of Open Access Journals (Sweden)

    Suphaphit Boonsong

    2016-03-01

    Full Text Available Extractions were performed of the total phenolic and flavonoid contents and antioxidant properties of five edible mushroom samples—Lentinus edodes, Volvariella volvacea, Pleurotus eous, Pleurotus sajor-caju and Auricularia auricular—using three different extractants. Among the three different extractants, 50% (volume per volume; v/v ethanol was the most suitable for antioxidant extraction from the mushroom samples. The 50% (v/v ethanolic extract of dried L. edodes contained higher total phenolic and flavonoid contents than in the other mushroom extract samples. The antioxidant activities of 50% (v/v ethanolic extract of dried L. edodes showed the strongest 2,2-diphenyl-1-picrylhydrazyl radical-scavenging assay (64.34% compared to butylated hydroxyanisole (BHA and α-tocopherol at 500 μg/mL. The ethanolic extract showed a lower reducing power of 0.10 compared to BHA and α-tocopherol at 500 μg/mL. Moreover, the L. edodes ethanolic extract also had the highest chelating ability (66.28% which was lower than for ethylenediaminetetraacetic acid at 500 μg/mL and showed the strongest superoxide radical-scavenging activity (64.17% compared to BHA and α-tocopherol. Therefore, the 50% (v/v ethanolic extract of L. edodes could be used as a potential natural antioxidative source or as an ingredient in the fish and fishery product industries.

  10. High microbial loads found in minimally-processed sliced mushrooms from Italian market.

    Science.gov (United States)

    Jiang, Haiyang; Miraglia, Dino; Ranucci, David; Donnini, Domizia; Roila, Rossana; Branciari, Raffaella; Li, Cheng

    2018-03-31

    There is an increased consumer interest in minimally processed vegetables that has led to the development of products, such as pre-cut sliced mushrooms. Few data are available on the hygienic condition and the presence of foodborne pathogens in such products. Therefore, the current study aimed to evaluate the safety and hygienic characteristics of both ready-to-eat and ready-to-cook, pre-cut sliced mushrooms obtained from a local Italian market. For the evaluation of the hygienic condition, the aerobic mesophilic bacteria, aerobic psychrotrophic bacteria and Escherichia coli enumerations were performed. Salmonella spp., Listeria monocytogenes and Campylobacter spp. were considered in the assessment of the foodborne pathogens. High microbial loads were detected, including counts higher than 5 log CFU/g for E. coli and 6 log CFU/g for the other bacteria counts considered, but no pathogens were found. Ready-to-eat and ready-to-cook products differed only for aerobic mesophilic counts (7.87 and 8.26 log CFU/g, respectively, P=0.003). Strategies to enhance the hygienic level of the mushrooms, particularly the ready-to-eat products, are needed.

  11. Fatty Acid Composition of Fourteen Wood-decaying Basidiomycete Species Growing in Permafrost Conditions

    Directory of Open Access Journals (Sweden)

    Daniil N. Olennikov

    2014-03-01

    Full Text Available The fatty acid (FA compositions of 14 wild wood-decaying basidiomycete species (Bjerkandera adusta, Daedaleopsis septentrionalis, Dichomitus squalens, Inonotus hispidus, I.radiatus, Irpex lacteus, Fomitopsis cajanderi, F.pinicola, F. rosea, Gloeophyllum protractum, Lenzites betulina, Phellinus pini, Trametes gibbosa, T. ochracea growing in permafrost conditions in Katanga region (Russian Federation were investigated using GC-MS. Generally, C18:2 ω 6 (linoleic acid, C18:1 ω 9 (oleic acid, C16:0 (palmitic acid and C20:0 (arachinic acid were found to be the major FA in fungal species. Data about chemical components of Daedaleopsis septentrionalis , Fomitopsis cajanderi and Gloeophyllum protractum were obtained at the first time. Increased level of degree of FA unsaturation was probably a result of extreme environmental conditions.

  12. Effects of glucose on the Reactive Black 5 (RB5 decolorization by two white rot basidiomycetes

    Directory of Open Access Journals (Sweden)

    Tony Hadibarata

    2011-11-01

    Full Text Available The capacities of glucose in the decolorization process of an azo dye, Reactive Black 5 (RB5, by two white rot basidiomycetes, Pleurotus sp. F019 and Trametes sp. F054 were investigated. The results indicated that the dye degradation by the two fungi was extremely correlated with the presence of glucose in the culture and the process of fungi growth. Decolorization of 200 mg dye/l was increased from 62% and 69% to 100% within 20–25 h with the increase of glucose from 5 to 15 g/l, and the activity of manganese dependent peroxidase (MnP increased by 2–9 fold in this case. Hydrogen peroxide of 0.55 mg/l and 0.43 mg/l were detected in 10 h in Pleurotus sp. F019 and Trametes sp. F054 cultures.

  13. Rhodotorula portillonensis sp. nov., a basidiomycetous yeast isolated from Antarctic shallow-water marine sediment.

    Science.gov (United States)

    Laich, Federico; Vaca, Inmaculada; Chávez, Renato

    2013-10-01

    During the characterization of the mycobiota associated with shallow-water marine environments from Antarctic sea, a novel pink yeast species was isolated. Sequence analysis of the D1/D2 domain of the LSU rDNA gene and 5.8S-ITS regions revealed that the isolated yeast was closely related to Rhodotorula pallida CBS 320(T) and Rhodotorula benthica CBS 9124(T). On the basis of morphological, biochemical and physiological characterization and phylogenetic analyses, a novel basidiomycetous yeast species, Rhodotorula portillonensis sp. nov., is proposed. The type strain is Pi2(T) ( = CBS 12733(T)  = CECT 13081(T)) which was isolated from shallow-water marine sediment in Fildes Bay, King George Island, Antarctica.

  14. Enzymatic formation of gold nanoparticles by submerged culture of the basidiomycete Lentinus edodes.

    Science.gov (United States)

    Vetchinkina, Elena P; Loshchinina, Ekaterina A; Burov, Andrey M; Dykman, Lev A; Nikitina, Valentina E

    2014-07-20

    We report for the first time that the medicinal basidiomycete Lentinus edodes can reduce Au(III) from chloroauric acid (HAuCl4) to elemental Au [Au(0)], forming nanoparticles. Several methods, including transmission electron microscopy, electron energy loss spectroscopy, X-ray fluorescence, and dynamic light scattering, were used to show that when the fungus was grown submerged, colloidal gold accumulated on the surface of and inside the mycelial hyphae as electron-dense particles mostly spherical in shape, with sizes ranging from 5 to 50nm. Homogeneous proteins (the fungal enzymes laccase, tyrosinase, and Mn-peroxidase) were found for the first time to be involved in the reduction of Au(III) to Au(0) from HAuCl4. A possible mechanism forming Au nanoparticles is discussed. Copyright © 2014 Elsevier B.V. All rights reserved.

  15. Induction and catabolite repression of cellulase and xylanase synthesis in the selected white-rot basidiomycetes

    Directory of Open Access Journals (Sweden)

    Aza Kobakhidze

    2016-09-01

    Full Text Available This paper reports regulation of endoglucanase (EC 3.2.1.4 and xylanase (EC 3.2.1.8 production in submerged cultivation of four white-rot basidiomycetes. Among carbon sources tested, the Avicel-based medium provided the highest levels of both hydrolases activities in all fungal cultures. However, the maximum endoglucanase and xylanase activities of the tested basidiomycetes varied from 3.9 U/ml and 7.4 U/ml in Fomes fomentarius to 34.2 U/ml and 29.5 U/ml in Pseudotrametes gibbosa, respectively (P. gibbosa specific cellulase and xylanase activities achieved 8.55 and 7.38 U/mg, respectively. Replacement of Avicel in the medium with carboxymethyl cellulose or xylan significantly lowered the enzyme yield of the tested fungi. Moreover, xylan did not ensure high xylanase activity of these fungi. Lignocellulosic substrates used as a carbon source provided poorer productivity (the specific CMCase activity was 1.12–3.62 U/mg and the specific xylanase activity was 1.95–3.32 U/mg. Expression of endoglucanase and xylanase synthesis in Panus lecometei and P. gibbosa was inducible; supplementation of the glycerol-containing medium with Avicel accompanied with a sharp increase of the fungal specific CMCase and xylanase activities from 0.02–0.04 U/mg to 1.30–8.55 U/mg. Supplementation of the Avicel-induced cultures with glucose or glycerol caused a catabolite repression of the cellulase and xylanase formation by P. gibbosa and P. lecometei. The enzyme synthesis resumed only after depletion of easily metabolizable carbon source, glucose or glycerol, from the medium. The data received suggest that in the tested fungi endoglucanase and xylanase synthesis is under control by a common regulatory mechanism.

  16. Genome-Wide Annotation and Comparative Analysis of Cytochrome P450 Monooxygenases in Basidiomycete Biotrophic Plant Pathogens.

    Directory of Open Access Journals (Sweden)

    Lehlohonolo Benedict Qhanya

    Full Text Available Fungi are an exceptional source of diverse and novel cytochrome P450 monooxygenases (P450s, heme-thiolate proteins, with catalytic versatility. Agaricomycotina saprophytes have yielded most of the available information on basidiomycete P450s. This resulted in observing similar P450 family types in basidiomycetes with few differences in P450 families among Agaricomycotina saprophytes. The present study demonstrated the presence of unique P450 family patterns in basidiomycete biotrophic plant pathogens that could possibly have originated from the adaptation of these species to different ecological niches (host influence. Systematic analysis of P450s in basidiomycete biotrophic plant pathogens belonging to three different orders, Agaricomycotina (Armillaria mellea, Pucciniomycotina (Melampsora laricis-populina, M. lini, Mixia osmundae and Puccinia graminis and Ustilaginomycotina (Ustilago maydis, Sporisorium reilianum and Tilletiaria anomala, revealed the presence of numerous putative P450s ranging from 267 (A. mellea to 14 (M. osmundae. Analysis of P450 families revealed the presence of 41 new P450 families and 27 new P450 subfamilies in these biotrophic plant pathogens. Order-level comparison of P450 families between biotrophic plant pathogens revealed the presence of unique P450 family patterns in these organisms, possibly reflecting the characteristics of their order. Further comparison of P450 families with basidiomycete non-pathogens confirmed that biotrophic plant pathogens harbour the unique P450 families in their genomes. The CYP63, CYP5037, CYP5136, CYP5137 and CYP5341 P450 families were expanded in A. mellea when compared to other Agaricomycotina saprophytes and the CYP5221 and CYP5233 P450 families in P. graminis and M. laricis-populina. The present study revealed that expansion of these P450 families is due to paralogous evolution of member P450s. The presence of unique P450 families in these organisms serves as evidence of how a host

  17. Traditional knowledge and use of wild mushrooms by Mixtecs or Ñuu savi, the people of the rain, from Southeastern Mexico.

    Science.gov (United States)

    Santiago, Faustino Hernández; Moreno, Jesús Pérez; Cázares, Beatriz Xoconostle; Suárez, Juan José Almaraz; Trejo, Enrique Ojeda; de Oca, Gerardo Mata Montes; Aguilar, Irma Díaz

    2016-09-05

    Mexico is an important global reservoir of biological and cultural richness and traditional knowledge of wild mushrooms. However, there is a high risk of loss of this knowledge due to the erosion of traditional human cultures which is related with the rapid acculturation linked to high migration of rural populations to cities and the U.S.A., and the loss of natural ecosystems. The Mixtec people, the third largest native group in Mexico only after the Nahua and the Maya, maintain ancient traditions in the use and knowledge of wild mushrooms. Paradoxically, there are few studies of the Mixtec ethnomycology. This study shows our ethnomycological research, mainly focused on knowledge and use of wild mushrooms in communities of the Mixteca Alta, in southeastern Mexico. We hypothesized that among the studied communities those with a combination of higher vegetation cover of natural pine and oak forests, lower soil erosion and higher economic margination had a greater richness and knowledge of wild mushrooms. Our study therefore aimed to record traditional knowledge, use, nomenclature and classification of wild mushrooms in four Mixtec communities and to analyze how these aspects vary according to environmental and cultural conditions among the studied communities. In order to analyze the cultural significance of wild mushrooms for the Mixtec people, 116 non-structured and semi-structured interviews were performed from 2009 to 2014. Information about the identified species, particularly the regional nomenclature and classification, their edibility, toxicity and ludic uses, the habitat of useful mushrooms, traditional recipes and criteria to differentiate between toxic and edible species, and mechanisms of knowledge transmission were studied. The research had the important particularity that the first author is Mixtec, native of the study area. A comparative qualitative analysis between the richness of fungal species used locally and the official information of the natural

  18. Radiocesium concentrations in wild mushrooms and characteristics of cesium accumulation by the edible mushroom (Pleurotus ostreatus)

    International Nuclear Information System (INIS)

    Sugiyama, Hideo; Terada, Hiroshi; Shibata, Hisashi; Morita, Yohoji; Kato, Fumio

    2000-01-01

    Mushrooms collected from a sub-alpine forest of Mt. Fuji and some other locations in Japan in 1996 were analyzed for radiocesium. The 137 Cs concentrations in 37 mushrooms varied widely from 1.6 to 783 Bqkg -1 fresh wt. The characteristics of Cs accumulation were analyzed by culturing fruiting bodies of the edible mushroom Pleurotus ostreatus (Fr.) Kummer Y-1 (P. ostreatus Y-1). The 137 Cs and stable Cs accumulation expressed as the concentration ratio (CR, 137 Cs or Cs concentration in the dried fruiting body/ 137 Cs or Cs concentration in the fresh medium) were in good agreement, indicating similar migration. The CR of Cs grown on medium containing both 0.1% Cs and 0.1% K, 10.2, showed a decrease of about 30 percent as compared with that containing 0.1% Cs only. These CR values suggested that Cs accumulation by the fruiting bodies of P. ostreatus Y-1 is affected by the presence of K similarly to previous observations in the mycelia. The 133 Cs-NMR spectra from the fruiting bodies of P. ostreatus Y-1 showed two resonance signals, whereas those from the media after harvesting of fruiting bodies showed only one signal. Just before growth of the fruiting bodies, bunches consisting of many mycelia were observed by scanning electron microscopy (SEM). No significant differences in the elemental distribution (Cs, K, P and C) were detected in the mycelium surface by SEM equipped with an energy dispersive X-ray microanalyzer. (author)

  19. Statistical optimization of ultraviolet irradiate conditions for vitamin D₂ synthesis in oyster mushrooms (Pleurotus ostreatus using response surface methodology.

    Directory of Open Access Journals (Sweden)

    Wei-Jie Wu

    Full Text Available Response surface methodology (RSM was used to determine the optimum vitamin D2 synthesis conditions in oyster mushrooms (Pleurotus ostreatus. Ultraviolet B (UV-B was selected as the most efficient irradiation source for the preliminary experiment, in addition to the levels of three independent variables, which included ambient temperature (25-45°C, exposure time (40-120 min, and irradiation intensity (0.6-1.2 W/m2. The statistical analysis indicated that, for the range which was studied, irradiation intensity was the most critical factor that affected vitamin D2 synthesis in oyster mushrooms. Under optimal conditions (ambient temperature of 28.16°C, UV-B intensity of 1.14 W/m2, and exposure time of 94.28 min, the experimental vitamin D2 content of 239.67 µg/g (dry weight was in very good agreement with the predicted value of 245.49 µg/g, which verified the practicability of this strategy. Compared to fresh mushrooms, the lyophilized mushroom powder can synthesize remarkably higher level of vitamin D2 (498.10 µg/g within much shorter UV-B exposure time (10 min, and thus should receive attention from the food processing industry.

  20. Mushroom Lectins: Specificity, Structure and Bioactivity Relevant to Human Disease

    Directory of Open Access Journals (Sweden)

    Mohamed Ali Abol Hassan

    2015-04-01

    Full Text Available Lectins are non-immunoglobulin proteins that bind diverse sugar structures with a high degree of selectivity. Lectins play crucial role in various biological processes such as cellular signaling, scavenging of glycoproteins from the circulatory system, cell–cell interactions in the immune system, differentiation and protein targeting to cellular compartments, as well as in host defence mechanisms, inflammation, and cancer. Among all the sources of lectins, plants have been most extensively studied. However, more recently fungal lectins have attracted considerable attention due to their antitumor, antiproliferative and immunomodulatory activities. Given that only 10% of mushroom species are known and have been taxonomically classified, mushrooms represent an enormous unexplored source of potentially useful and novel lectins. In this review we provide an up-to-date summary on the biochemical, molecular and structural properties of mushroom lectins, as well as their versatile applications specifically focusing on mushroom lectin bioactivity.

  1. Cultivation of three types of indigenous wild edible mushrooms ...

    African Journals Online (AJOL)

    STORAGESEVER

    2008-12-17

    Dec 17, 2008 ... effects related to their disposal (Mshandete et al., 2008). Cultivation of mushroom can .... The holes facilitated drainage, aeration (free diffusion of gases and .... sium, iron, copper, manganese, zinc and cobalt) were determined.

  2. Evaluating the production of Ganoderma mushroom on corn cobs

    African Journals Online (AJOL)

    SAM

    2014-05-28

    May 28, 2014 ... Full Length Research Paper. Evaluating the production ... Key words: Ganoderma, corn cobs, substrate, mushrooms, sawdust, basidiocarp. INTRODUCTION .... those which have high lignin and low cellulose. This is because ...

  3. Application of ionizing radiation to preservation of mushrooms

    International Nuclear Information System (INIS)

    Smierzchalska, K.; Gubrynowicz, E.

    1979-01-01

    The influence of ionizing radiation on prolongation of preservation time and quality of mushrooms is discussed. Some numerical data are cited. The influence of ionizing radiation on growth rate and physiological processes is also presented. (A.S.)

  4. Economic feasibility of small scale button mushroom production in pakistan

    International Nuclear Information System (INIS)

    Tahir, A.; Hassan, S.

    2013-01-01

    Abstract:- Mushroom is widely cultivated as a proteineous vegetable in many countries of the world including Pakistan. Its cultivation requires less space, care, equipment and cost compared to many other crops and livestock. The present study was conducted in 2010 to estimate the profitability of small scale button mushroom production at National Agricultural Research Centre (NARC) Islamabad, Pakistan. The cost of production methodology was used for this study. The yield and gross return of mushroom was estimated at 155.6 kg ha and Rs.77,800 ha , respectively. The results indicated the fact that mushroom production is very much remunerative to its producers as it can give maximum net return by reducing their cost of production as its cultivation is dependent on the agricultural raw material which is cheaply available. (author)

  5. Induction and evaluation of beneficial mutations in Volvariella volvacea mushroom

    International Nuclear Information System (INIS)

    Borromeo, J.D.

    1976-03-01

    The present strains of Volvariella volvacea are difficult to grow, hence the need for developing a wild-type mushroom that can be grown without the stringent cultural requirements. This would be suitable for backyard or small-scale production. A vigorous white mushroom that responds to the controlled conditions in mushroom houses is appropriate for large-scale or commercial production. The percentages success in getting the ''first flushes'' has been no more than 30%. There was a certain amount of difficulty in recognizing mutants based on their morphological features in laboratory culture. The first irradiation series utilizing 200 and 400 kR and using the box-type method of cultivation in growing the mushroom have given us the needed information in planning the next irradiation series

  6. The Edibility and Cultivation of the Oyster Mushroom.

    Science.gov (United States)

    Brenneman, James; Guttman, Mark C.

    1994-01-01

    Describes an enjoyable and fascinating experience that involves the cultivation of oyster mushrooms. By allowing students to participate in this process, the students are able to better understand the biology and utility of fungi. (ZWH)

  7. Food, medicinal and environmental values of mushrooms Pleurotus ostreatus

    Directory of Open Access Journals (Sweden)

    O. M. Alekseenko

    2010-07-01

    Full Text Available We present the literature review describing food, medicinal and ecological properties of the fungus Pleurotus ostreatus (oyster mushroom. It is shown that the mushroom is adequate foodstuff for human beings. It provides with proteins, carbohydrates, fats, vitamins and mineral salts. Protein of the oyster mushrooms’ mycothallus contains 18 amino acids, eight of which were essential (isoleucine, leucine, lysine, methionine, phenylalanine, tryptophan, threonine, and valine. Therapeutic value of the mushroom is characterised by a content of water-soluble (thiamine B1, riboflavin B2, niacin, B5, PP, pyridoxine B6, biotin B7, ascorbic and pantothenic acid and liposoluble (calciferol, ergosterol, tocopherol vitamins. The considerable gains from the farm wastes use for the mushrooms raising with subsequent application of the substrate in plant cultivation and animal husbandry are stated.

  8. Effects of Ganoderma lucidum Spent Mushroom Substrate Extract on ...

    African Journals Online (AJOL)

    Effects of Ganoderma lucidum Spent Mushroom Substrate Extract on Milk and ... Serum antioxidant activity as well as milk and serum immunoglobulin levels were ... total antioxidant capacity (TAC) and mean serum TAC concentration among ...

  9. Chemical Composition and Bioactive Compounds of Some Wild Edible Mushrooms

    Directory of Open Access Journals (Sweden)

    Melinda NAGY

    2017-05-01

    Full Text Available Over the last decades, the consumption of mushrooms has significantly increased due to the scientific evidence of their ability to help the organism in the combat and prevention of several diseases (Kalac, 2009. Fruiting bodies of mushrooms are consumed as a delicacy for their texture and flavour, but also for their nutritional properties that makes them even more attractable (Heleno S. 2015. In this paper data were collected from several scientific studies with the aim to characterize the chemical composition and content of bioactive compounds of various mushrooms species: Agaricus bisporus, Boletus edulis, Cantharellus cibarius, Pleurotus ostreatus, Lactarius piperatus. The chemical composition of 5 wild edible studied mushrooms, including moisture, ash, total carbohydrates, total sugars, crude fat, crude protein and energy were determined according to AOAC procedures.

  10. Yield response of mushroom ( Agaricus bisporus ) on wheat straw ...

    African Journals Online (AJOL)

    Yield response of mushroom ( Agaricus bisporus ) on wheat straw and waste tea leaves based composts using supplements of some locally available peats and their mixture with some secondary casing materials.

  11. Cultivation of mushroom (Volvariella volvacea) on banana leaves

    African Journals Online (AJOL)

    SERVER

    percentage of the fibre components being degraded. The crude protein ... incubation of the mushroom due probably to the addition of microbial protein. The acid ... a plastic or tent-like construction or bamboo frame stretched with plastic film ...

  12. Shiitake mushroom production on small diameter oak logs in Ohio

    Science.gov (United States)

    S.M. Bratkovich

    1991-01-01

    Yields of different strains of shiitake mushrooms (Lentinus edodes) were evaluated when produced on small diameter oak logs in Ohio. Logs averaging between 3-4 inches in diameter were inoculated with four spawn strains in 1985.

  13. Identifying 8-hydroxynaringenin as a suicide substrate of mushroom tyrosinase.

    Science.gov (United States)

    Chang, Te-Sheng; Lin, Meng-Yi; Lin, Hsuan-Jung

    2010-01-01

    A biotransformed metabolite of naringenin was isolated from the fermentation broth of Aspergillus oryzae, fed with naringenin, and identified as 8-hydroxynaringenin based on the mass and (1)H- and (13)C-NMR spectral data. The compound showed characteristics of both an irreversible inhibitor and a substrate of mushroom tyrosinase in preincubation and HPLC analysis. These results demonstrate that 8-hydroxynaringenin belongs to a suicide substrate of mushroom tyrosinase. The partition ratio between the compound's molecules in the formation of product and in the inactivation of the enzyme was determined to be 283 +/- 21. The present study's results, together with our previous findings, which proved that both 8-hydroxydaidzein and 8-hydroxygenistein are suicide substrates of mushroom tyrosinase, show that 7,8,4'-trihydroxyl functional groups on flavonoids' skeletons play important roles in producing suicide substrate properties toward mushroom tyrosinase.

  14. Molecular and Antibacterial Profile of Edible Oyster Mushrooms ...

    African Journals Online (AJOL)

    2012r

    2014-09-24

    Sep 24, 2014 ... Phenol/Chloroform DNA extraction protocol and the DNA was ... DNA from oyster mushroom fermentation broth, mycelia or fruiting bodies. .... Sample preparation: The different strains of Pleurotus were obtained in test- tubes.

  15. Effects of a high O2 dynamic-controlled atmosphere technology on the browning of postharvest white mushroom ( Agaricus bisporus) in relation to energy metabolism.

    Science.gov (United States)

    Li, Ling; Sun, Han; Kitazawa, Hiroaki; Wang, Xiangyou

    2017-07-01

    Browning is one of the main problems in senescence of mushrooms, and it is also one of the most important attributes accounting for the loss of the quality and reduction in market value. In order to study the relationship between the energy metabolism and the browning of white mushroom under high O 2 dynamic-controlled atmosphere (HO-DCA), mushrooms were stored in 100% O 2 (SCA1), 80% O 2  + 20% CO 2 (SCA2), 100% O 2 for three days and then transferred into the treatment of 80% O 2  + 20% CO 2 (HO-DCA) at 2 ± 1 ℃ and air as control. In this study, adenosine triphosphate (ATP) content, energy charge level, sensory evaluation, browning of surface and flesh, cell membrane integrity, exogenous ATP, polyphenol oxidase (PPO) and peroxidase (POD) activity and genes encoding PPO of the white mushroom were investigated. These were all closely related to the browning of products. The optimal storage condition of the HO-DCA treatment could delay the browning of pericarp and flesh tissues of the mushrooms, inhibit PPO activity and reduce the relative expression levels of the three genes encoding PPO. Meanwhile, it maintained moderate POD activity, good sensory properties and cell membrane integrity in a certain extent and thus slowed down the senescence of mushrooms. Results indicated that there was a positive correlation between the ATP content and whitening index ( r = 0.901). In addition, HO-DCA maintained a higher ATP level, prolonged the storage time to 28 days and it might be an ideal strategy for preserving the quality of mushroom during storage.

  16. Comparative study of wild edible mushrooms as sources of antioxidants.

    Science.gov (United States)

    Witkowska, Anna M; Zujko, Małgorzata E; Mirończuk-Chodakowska, Iwona

    2011-01-01

    The purpose of the study was to explore sixteen of the most popular edible species of wild-growing mushrooms as potential sources of antioxidants. Among the mushrooms tested, the highest total polyphenol contents, exceeding 100 mg/100 g fresh mass, were found in five mushrooms: Boletus chrysenteron, B. edulis, Leccinum scabrum, L. aurantiacum, and Macrolepiota procera. Antioxidant activity was measured with the FRAP, TEAC, DPPH scavenging ability and ferrous ions chelating ability assays. Results of the study show that wild mushrooms vary according to their antioxidant properties. The highest FRAP potentials, exceeding 1 mmol/100 g, were found in five species ofBoletales: Boletus edulis, B. chrysenteron, Leccinum scabrum, L. aurantiacum, and Suillus grevillei. TEAC values were from 1.07 to 4.01 mmol/100 g fresh mass. High TEAC values (>2.3 mmol/100 g) were found in Leccinum scabrum, L. aurantiacum, Macrolepiota procera, Boletus chrysenteron, and B. edulis. The DPPH radical scavenging effectiveness of mushroom extracts, expressed as EC50 values, was in range 2.91-13.86 mg/mL. Scavenging ability was the highest for B. edulis and B. chrysenteron. The metal chelating ability of mushroom extracts expressed as ECso values of chelating ability on ferrous ions were from 8.02 mg/mL in Cantharellus cibarius to 12.10 mg/mL in Suillus luteus. Among the mushrooms tested, Boletus chrysenteron and B. edulis were characterized by high scores of polyphenol contents and antioxidant activity in the FRAP, TEAC, and DPPH assays. These results place these culinary species of wild-growing mushrooms among products with considerable antioxidant potential.

  17. Activity of 137Cs in mushrooms from Slovak Republic

    International Nuclear Information System (INIS)

    Benova, K.; Novakova, J.; Dvorak, P.

    2006-01-01

    In this paper, activity concentrations of radiocesium in mushrooms from various locations in the Slovak Republic during the year 2001 are presented. The highest activity concentration of 137 Cs measured was 966 Bq/kg, for Suillus luteus from Senica. Mushrooms belonging to Boletaceae which grow in Central Europe are not only bio-indicators of the environmental contamination with radiocesium, but might also represent depending on their actual radiocesium contamination - some risk factor if consumed too extensively. (authors)

  18. ANTAGONISTIC EFFECT OF EDIBLE MUSHROOM EXTRACT ON CANDIDA ALBICANS GROWTH

    Directory of Open Access Journals (Sweden)

    Paccola Edneia A. de Souza

    2001-01-01

    Full Text Available Five species of edible mushrooms, Lentinula edodes, Pleurotus ostreatus, Pholiota nameko, Macrolepiota bonaerensis and Agaricus blazei, were tested for their potential to inhibit the in vitro growth of the pathogenic yeast Candida albicans. Only L. edodes had a fungistatic effect on this human pathogen. The inhibitory compound was produced intra and extracellularly in submersed L. edodes culture, and was also present in fresh and dehydrated mushroom basidiocarps. The fungistatic compound was heat sensitive and lost activity after 72 hours.

  19. The use of the ITS region in marketable mushrooms authenticity

    OpenAIRE

    Nogueira, Liliana; Oliveira, Ivo; Baptista, Paula

    2010-01-01

    Edible mushrooms, due to their flavour and nutritional characteristics, are very popular in many dishes. Some species are high valuated and reaching high market values. There are frequent reports of adulteration of these kinds of products due to the presence of fungal species less expensive among others with high-value market. This adulteration occurs especially in products in which the flavour is not prominent and in which the mushrooms are difficult to examine. In this work we utilized the ...

  20. Bioremediation of industrial waste through mushroom cultivation.

    Science.gov (United States)

    Kulshreshtha, Shweta; Mathur, Nupur; Bhatnagar, Pradeep; Jain, B L

    2010-07-01

    Handmade paper and cardboard industries are involved in processing of cellulosic and ligno-cellulosic substances for making paper by hand or simple machinery. In the present study solid sludge and effluent of both cardboard and handmade paper industries was collected for developing a mushroom cultivation technique to achieve zero waste discharges. Findings of present research work reveals that when 50% paper industries waste is used by mixing with 50% (w/w) wheat straw, significant increase (96.38%) in biological efficiency over control of wheat straw was observed. Further, cultivated basidiocarps showed normal morphology of stipe and pileus. Cross section of lamellae did not show any abnormality in the attachment of basidiospores, hymenal trama and basidium. No toxicity was found when fruiting bodies were tested chemically.

  1. USE OF ARTIFICIAL LIGHT IN MUSHROOM CULTIVATION

    Directory of Open Access Journals (Sweden)

    N. L. Poyedinok

    2013-12-01

    Full Text Available Artificial light is used in greenhouses to increase productivity and quality of agricultural and ornamental plants. Despite the awareness of the fact that light also plays important role in the life of nonhotosynthetic organisms, such as fungi, its using in their biotechnology cultivation is currently limited. Science has quite a large amount information about the influence of artificial light of different nature on morphogenesis, metabolic processes and productivity of more than 100 species of fungi, many of which are valuable producers of biologically active compounds. Themechanisms of photoreactions of various fungi, which is an integral part of a purposeful photoregulation their activity in biotechnological processes are described. The analysis of the researches and of the experience of their practical application allows predicting potential of using artificial light in mushroom growing industry, as well as in creating highly productive, environmentally clean technologies of targeted synthesis of the final product.

  2. Toxic isolectins from the mushroom Boletus venenatus.

    Science.gov (United States)

    Horibe, Masashi; Kobayashi, Yuka; Dohra, Hideo; Morita, Tatsuya; Murata, Takeomi; Usui, Taichi; Nakamura-Tsuruta, Sachiko; Kamei, Masugu; Hirabayashi, Jun; Matsuura, Masanori; Yamada, Mina; Saikawa, Yoko; Hashimoto, Kimiko; Nakata, Masaya; Kawagishi, Hirokazu

    2010-04-01

    Ingestion of the toxic mushroom Boletus venenatus causes a severe gastrointestinal syndrome, such as nausea, repetitive vomiting, diarrhea, and stomachache. A family of isolectins (B. venenatus lectins, BVLs) was isolated as the toxic principles from the mushroom by successive 80% ammonium sulfate-precipitation, Super Q anion-exchange chromatography, and TSK-gel G3000SW gel filtration. Although BVLs showed a single band on SDS-PAGE, they were further divided into eight isolectins (BVL-1 to -8) by BioAssist Q anion-exchange chromatography. All the isolectins showed lectin activity and had very similar molecular weights as detected by matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF-MS) analysis. Among them, BVL-1 and -3 were further characterized with their complete amino acid sequences of 99 amino acids determined and found to be identical to each other. In the hemagglutination inhibition assay, both proteins failed to bind to any mono- or oligo-saccharides tested and showed the same sugar-binding specificity to glycoproteins. Among the glycoproteins examined, asialo-fetuin was the strongest inhibitor. The sugar-binding specificity of each isolectin was also analyzed by using frontal affinity chromatography and surface plasmon resonance analysis, indicating that they recognized N-linked sugar chains, especially Galbeta1-->4GlcNAcbeta1-->4Manbeta1-->4GlcNAcbeta1-->4GlcNAc (Type II) residues in N-linked sugar chains. BVLs ingestion resulted in fatal toxicity in mice upon intraperitoneal administration and caused diarrhea upon oral administration in rats. Copyright 2009 Elsevier Ltd. All rights reserved.

  3. Antifatigue Functions and Mechanisms of Edible and Medicinal Mushrooms

    Directory of Open Access Journals (Sweden)

    Ping Geng

    2017-01-01

    Full Text Available Fatigue is the symptom of tiredness caused by physical and/or psychological stresses. As fatigue is becoming a serious problem in the modern society affecting human health, work efficiency, and quality of life, effective antifatigue remedies other than pharmacological drugs or therapies are highly needed. Mushrooms have been widely used as health foods, because of their various bioactive constituents such as polysaccharides, proteins, vitamins, minerals, and dietary fiber. This paper reviews the major findings from previous studies on the antifatigue effects, the active components of mushrooms, and the possible mechanisms. Many studies have demonstrated the antifatigue effects of edible and medicinal mushrooms. These mushrooms probably mitigate human fatigue through effects on the functional systems, including the muscular, cardiovascular, hormone, and immune system. The bioactive constituents that contribute to the antifatigue effects of mushrooms may include polysaccharides, peptides, nucleosides, phenolic compounds, and triterpenoids. Further research is still needed to identify the active ingredients and to investigate their mechanism of action on the antifatigue effects. Since most previous studies have been carried out in animal models, more human trials should be performed to verify the antifatigue function of edible and medicinal mushrooms.

  4. Cobweb, a serious pathology in mushroom crops: A review

    International Nuclear Information System (INIS)

    Carrasco, J.; Navarro, M.J.; Gea, F.

    2017-01-01

    Cobweb is a fungal disease of commercially cultivated mushrooms. Several members of the ascomycete genus Cladobotryum sp. have been reported as causal agents. White button mushroom is the most frequently cited host, but a wide range of cultivated edible mushrooms suffer cobweb. The pathology causes production losses and reduces the crop surface available. The parasite produces a great number of harmful conidia that can be released easily and distributed throughout the mushroom farm to generate secondary points of infection. To prevent initial outbreaks, hygiene is of primary importance within the facilities dedicated to mushroom cultivation, while additional measures must be implemented to control and reduce cobweb if there is an outbreak, including chemical and biological methods. This review summarizes and discusses the knowledge available on the historic occurrence of cobweb and its impact on commercial mushroom crops worldwide. Causal agents, disease ecology, including the primary source of infection and the dispersal of harmful conidia are also reviewed. Finally, control treatments to prevent the disease from breaking out are discussed.

  5. Cobweb, a serious pathology in mushroom crops: A review

    Energy Technology Data Exchange (ETDEWEB)

    Carrasco, J.; Navarro, M.J.; Gea, F.

    2017-07-01

    Cobweb is a fungal disease of commercially cultivated mushrooms. Several members of the ascomycete genus Cladobotryum sp. have been reported as causal agents. White button mushroom is the most frequently cited host, but a wide range of cultivated edible mushrooms suffer cobweb. The pathology causes production losses and reduces the crop surface available. The parasite produces a great number of harmful conidia that can be released easily and distributed throughout the mushroom farm to generate secondary points of infection. To prevent initial outbreaks, hygiene is of primary importance within the facilities dedicated to mushroom cultivation, while additional measures must be implemented to control and reduce cobweb if there is an outbreak, including chemical and biological methods. This review summarizes and discusses the knowledge available on the historic occurrence of cobweb and its impact on commercial mushroom crops worldwide. Causal agents, disease ecology, including the primary source of infection and the dispersal of harmful conidia are also reviewed. Finally, control treatments to prevent the disease from breaking out are discussed.

  6. Cobweb, a serious pathology in mushroom crops: A review

    Directory of Open Access Journals (Sweden)

    Jaime Carrasco

    2017-07-01

    Full Text Available Cobweb is a fungal disease of commercially cultivated mushrooms. Several members of the ascomycete genus Cladobotryum sp. have been reported as causal agents. White button mushroom is the most frequently cited host, but a wide range of cultivated edible mushrooms suffer cobweb. The pathology causes production losses and reduces the crop surface available. The parasite produces a great number of harmful conidia that can be released easily and distributed throughout the mushroom farm to generate secondary points of infection. To prevent initial outbreaks, hygiene is of primary importance within the facilities dedicated to mushroom cultivation, while additional measures must be implemented to control and reduce cobweb if there is an outbreak, including chemical and biological methods. This review summarizes and discusses the knowledge available on the historic occurrence of cobweb and its impact on commercial mushroom crops worldwide. Causal agents, disease ecology, including the primary source of infection and the dispersal of harmful conidia are also reviewed. Finally, control treatments to prevent the disease from breaking out are discussed.

  7. Antiproliferative and Antioxidant Activities of Wild Boletales Mushrooms from France.

    Science.gov (United States)

    Morel, Sylvie; Arnould, Stéphanie; Vitou, Manon; Boudard, Frédéric; Guzman, Caroline; Poucheret, Patrick; Fons, Françoise; Rapior, Sylvie

    2018-01-01

    We selected edible and inedible mushrooms growing in the Mediterranean area of France to screen their biological activity: Caloboletus calopus, Rubroboletus lupinus, R. pulchrotinctus, R. satanas, Gyroporus castaneus, Suillus luteus, and Omphalotus olearius. Mushrooms were sequentially extracted using cyclohexane, chloroform, ethanol, and water. The antiproliferative activity against the HCT116 colon adenocarcinoma cell line and the antioxidant properties (DPPH radical scavenging assay, Folin-Ciocalteu assay, and oxygen radical absorbance capacity) of the Boletales extracts were evaluated and compared. Among the 28 mushroom extracts evaluated, 11 presented antiproliferative activity against HCT116 cells. These activities were not linked to antioxidant capacity. Among the antioxidant extracts, most were aqueous extracts in the oxygen radical absorbance capacity assay, whereas the highest values on the Folin-Ciocalteu and DPPH assays were noted for chloroform, ethanol, or aqueous extracts, depending on the mushroom species. Further studies are necessary to identify bioactive compounds and to valorize the mushrooms-for edible species, directly as health foods, or, for inedible mushrooms, as ingredients in the pharmaceutical and food industries.

  8. Chernobyl is still haunting us. Radionuclides in Estonian mushrooms

    International Nuclear Information System (INIS)

    Martin, J.; Vilde, R.; Martin, L.; Aaspollu, J.; Tekko, S.

    1993-01-01

    The disaster that happened at the Chernobyl nuclear power station in 1986 caused a sharp rise in radioactive pollution over an extensive area in the region of the Baltic Sea. To estimate the distribution and the concentration of Cs-137 and Sr-90 in Estonian ecosystems, samples of mushrooms, mosses, lichens and the upper horizons of soil were gathered from 63 test sites during 1991. We were particularly interested in the amounts of radionuclides in mushrooms because these are used as food by people. Dangerously high radionuclide concentrations were found in mushrooms gathered in North-East Estonia. Heightened concentrations were registered here and there all over the territory of Estonia, especially in mushrooms gathered in Central and South-Western Estonia. The Cs-137 content in mushrooms depends on its content in other components of the ecosystems, first and foremost on the concentrations of radiocaesium in mosses and litter, which, therefore, can be used as indicators in prognostication the radioactive pollution of mushrooms in a certain region. As Cs-137 migrates between various ecosystem components, it is necessary to check the radioactivity of the forest products used for food for still a number of years to come. The Sr-90 level was low in all the ecosystem components examined. (author). 3 figs., 10 refs

  9. Parasitic macrofungi (Basidiomycetes on fruit shrubs and trees in the Tarnów town (S Poland

    Directory of Open Access Journals (Sweden)

    Marcin Piątek

    2014-08-01

    Full Text Available Results of 6 years of research carried out in the Tarnów town, southern Poland, are presented. Total number of 27 species of Basidiomycetes were recorded on 7 species of fruit shrubs and trees. Some of them were found on hosts new for Poland, on Malus domestica - Abortiporus biennis, Ganoderma australe, Meripilus giganteus, Stereum hirsutum and Volvariella bombycina; on Juglans regia - Ganoderma applanalum and Hineola auricula-judae.

  10. Survey of ectomycorrhizal, litter-degrading, and wood-degrading Basidiomycetes for dye decolorization and ligninolytic enzyme activity.

    Science.gov (United States)

    Casieri, Leonardo; Anastasi, Antonella; Prigione, Valeria; Varese, Giovanna Cristina

    2010-11-01

    Basidiomycetes are essential in forest ecology, being deeply involved in wood and litter decomposition, humification, and mineralization of soil organic matter. The fungal oxidoreductases involved in these processes are today the focus of much attention with a view to their applications. The ecological role and potential biotechnological applications of 300 isolates of Basidiomycetes were assessed, taking into account the degradation of model dyes in different culture conditions and the production of oxidoreductase enzymes. The tested isolates belong to different ecophysiological groups (wood-degrading, litter-degrading, ectomycorrhizal, and coprophilous fungi) and represent a broad systematic and functional biodiversity among Basidiomycetes occurring in deciduous and evergreen forests of northwest Italy (Piedmont Region). The high number of species tested and the use of different culture conditions allowed the investigation of the degradation activity of several novel species, neglected to date. Oxidative enzyme activities varied widely among all ecophysiological groups and laccases were the most commonly detected enzymes. A large number of isolates (86%), belonging to all ecophysiological groups, were found to be active against at least one model dye; the wood-degrading fungi represented the most efficient group. Noteworthily, also some isolates of litter-degrading and ectomycorrhizal fungi achieved good decolorization yield. The 25 best isolates were then tested against nine industrial dyes commonly employed in textile industries. Three isolates of Bjerkandera adusta efficiently decolorized the dyes on all media and can be considered important candidates for application in textile wastewater treatment.

  11. [Knowledge of students of tourism and recreation Academy of Physical Education on wild mushrooms].

    Science.gov (United States)

    Chwaluk, Paweł; Parnicki, Florian

    2011-01-01

    Prophylaxis of acute poisoning with mushrooms is justified because of the relatively high risk of death associated with these intoxications. Mushrooming in Poland has a long tradition and knowledge about mushrooms is usually passed on in families. In recent years the mushrooming becomes an organized form of recreation. Graduates of tourism and recreation should have a minimum of reliable knowledge about mushrooms, to ensure the safety of persons entrusted to their care. The knowledge of wild mushrooms among students of tourism and recreation was tested by means of questionnaire. Mushrooms gathered 108 out of 125 respondents. The primary source of knowledge about mushrooms for 84% of the mushrooms pickers were the parents. Up to 70% of respondents considered at least one of irrational methods useful to distinguish edible mushrooms from the poisonous. Thirteen percent of those polled believed that by simple means mushrooms may be deprived of their toxic properties. Knowledge of the only one deadly poisonous mushrooms growing in Poland was 53%. The tourism and recreation students must pass basic knowledge about mushrooms and identify reliable sources of knowledge in this field.

  12. [Effects of mushroom residue compost on growth and nutrient accumulation of Larix principis-rupprechtii containerized transplants].

    Science.gov (United States)

    Teng, Fei; Liu, Yong; Lou, Jun Shan; Sun, Qiao Yu; Wan, Fang Fang; Yang, Chen; Zhang, Jin

    2016-12-01

    Excessive use of peat may cause some environmental problems. To alleviate the negative effect, an experiment was conducted with the mushroom residue compost to replace peat in Larix principis-rupprechtii containerized transplant production, and the proportion of mushroom residue compost was 0% (T 0 , control), 15% (T 1 ), 18.75% (T 2 ), 25% (T 3 ), 37.50% (T 4 ), 50% (T 5 ), 56.25% (T 6 ) and 60% (T 7 ), respectively. The physical and chemical features of the substrates and its effect on the vegetative growth and nutrient accumulation of L. principis-rupprechtii containerized transplants were studied. The results showed when the proportion of mushroom residue compost in the substrate accounted for 50% or less, there was no significant difference in the transplant height, diameter, and biomass compared with the control, and the nutrient concentration in T 2 , T 4 , T 5 treatments was significantly higher than in T 0 . The pH value was sub-acidic to neutral which was suitable to the transplant growth. When the compost proportion accounted for more than 50%, the pH value was altered to alkali and was not suitable to the transplant growth. When the proportion of mushroom residue compost accounted for 15%, the plant grew best, and the height, diameter, and total biomass got the highest. Therefore, using mushroom residue compost to replace peat in L. principis-rupprechtii containerized transplants cultivation was feasible and the maximum replacement ratio could reach 50%. The high quality transplants could be obtained when the compost replacement ratio was 15%.

  13. The Evaluation of Pediatric Cases with Mushroom Poisoning

    Directory of Open Access Journals (Sweden)

    Selda Hizel

    2007-10-01

    Full Text Available Mushroom poisonings are intoxications with high mortality. Toxic wild mushrooms usually grow up in spring and autmn and the intoxications of these mushrooms occur mostly in these seasons. The symptoms, the initial time of the symptoms, the arrival time to the hospital, the physical examination findings, laboratory datas, treatments that were applied, the time kept in the hospital and the prognoses of the cases with mushroom intoxication diagnosis in the pediatry department were recorded between 1 October and 31 November 2006. During the time described above, a total of 24 cases with mushroom poisoning were determined. 8 of the cases (33.3 % were refered to another hospital, 16 of them (66.7 % were hospitalizated and observed. Gastrointestinal complaints was the symptom determined in every patient at the application time to the hospital whereas only 3 patients (12.5 % had neurologic symptoms. Symptoms occured within 6 hours of consumption of mushrooms in 7 cases (29.2 %. Elevated liver enzymes was determined in 4 patients (16.6 % whereas renal functions were normal in all of the cases. 16 cases who were hospitalizated, completely recovered and were discharged. However, 2 patients (8.3 % who were refered, died. Mushroom poisoning is an important health problem because of its high mortality and the best treatment is to make the public conscious of this problem. Therefore alerting the public, informing them about the symptoms and making them resort to hospitals with the first detected initial symptoms, by improving and strengthening the public education projects will reduce the mortality. [TAF Prev Med Bull. 2007; 6(5: 341-344

  14. The Evaluation of Pediatric Cases with Mushroom Poisoning

    Directory of Open Access Journals (Sweden)

    Selda Hizel

    2007-10-01

    Full Text Available Mushroom poisonings are intoxications with high mortality. Toxic wild mushrooms usually grow up in spring and autmn and the intoxications of these mushrooms occur mostly in these seasons. The symptoms, the initial time of the symptoms, the arrival time to the hospital, the physical examination findings, laboratory datas, treatments that were applied, the time kept in the hospital and the prognoses of the cases with mushroom intoxication diagnosis in the pediatry department were recorded between 1 October and 31 November 2006. During the time described above, a total of 24 cases with mushroom poisoning were determined. 8 of the cases (33.3 % were refered to another hospital, 16 of them (66.7 % were hospitalizated and observed. Gastrointestinal complaints was the symptom determined in every patient at the application time to the hospital whereas only 3 patients (12.5 % had neurologic symptoms. Symptoms occured within 6 hours of consumption of mushrooms in 7 cases (29.2 %. Elevated liver enzymes was determined in 4 patients (16.6 % whereas renal functions were normal in all of the cases. 16 cases who were hospitalizated, completely recovered and were discharged. However, 2 patients (8.3 % who were refered, died. Mushroom poisoning is an important health problem because of its high mortality and the best treatment is to make the public conscious of this problem. Therefore alerting the public, informing them about the symptoms and making them resort to hospitals with the first detected initial symptoms, by improving and strengthening the public education projects will reduce the mortality. [TAF Prev Med Bull 2007; 6(5.000: 341-344

  15. Particularities of Cs-137 accumulation by mushrooms in different zones of radioactive contamination

    International Nuclear Information System (INIS)

    Shatrova, N.E.; Zarubin, O.L.; Koval', G.N.; Shovkun, N.A.; Ogorodnik, A.F.

    1998-01-01

    The cumulation of Cs-137 by the mushrooms of 30 km zone is more intensively, than on the 'southern' trace. The biggest concentrations are discovered in local mushrooms: Suillus luteus (L.) and Paxillus involutus (Batsch:Fr.)

  16. Characterization of aroma-active compounds in raw and cooked pine-mushrooms (Tricholoma matsutake Sing.).

    Science.gov (United States)

    Cho, In Hee; Kim, Se Young; Choi, Hyung-Kyoon; Kim, Young-Suk

    2006-08-23

    The characteristic aroma-active compounds in raw and cooked pine-mushrooms (Tricholoma matsutake Sing.) were investigated by gas chromatography-olfactometry using aroma extract dilution analysis. 1-Octen-3-one (mushroom-like) was the major aroma-active compound in raw pine-mushrooms; this compound had the highest flavor dilution factor, followed by ethyl 2-methylbutyrate (floral and sweet), linalool (citrus-like), methional (boiled potato-like), 3-octanol (mushroom-like and buttery), 1-octen-3-ol (mushroom-like), (E)-2-octen-1-ol (mushroom-like), and 3-octanone (mushroom-like and buttery). By contrast, methional, 2-acetylthiazole (roasted), an unknown compound (chocolate-like), 3-hydroxy-2-butanone (buttery), and phenylacetaldehyde (floral and sweet), which could be formed by diverse thermal reactions during the cooking process, together with C8 compounds, were identified as the major aroma-active compounds in cooked pine-mushrooms.

  17. Shelf-life increase of fresh mushrooms Pleurotus sajor-caju using gamma radiation

    International Nuclear Information System (INIS)

    Moda, Evelise Moncaio

    2008-01-01

    . Values of polyphenoloxidase and peroxidase activities increased in the last day of evaluation in samples irradiated with 250 Gy. This fact may be a result of the water radiolysis process, since mushrooms have high water content. The dose of 125 Gy increased the respiratory rate of the samples until the 5th storage day in comparison to the other treatments, causing reduction in the product shelf-life. The samples irradiated with 250, 500 and 750 Gy had a reduction on the respiratory rate if compared with the control, so contributing to the maintenance of the post harvest quality during the storage. The samples which received 750 Gy obtained the best results in the microbiological analyses, with reduction of total coliform and psychotropic bacteria during the storage period. Sensory analyses showed that the control had higher scores for color, aroma and appearance attributes; they were above the acceptability limit until the last storage day. In general, the irradiated samples were accepted for the evaluated attributes until the 5th storage day; thus, establishing the shelf-life for irradiated mushrooms (author)

  18. 75 FR 3756 - Preserved Mushrooms from Chile, China, India, and Indonesia

    Science.gov (United States)

    2010-01-22

    ...)] Preserved Mushrooms from Chile, China, India, and Indonesia AGENCY: United States International Trade... preserved mushrooms from Chile, China, India, and Indonesia. SUMMARY: The Commission hereby gives notice of... mushrooms from Chile, China, India, and Indonesia would be likely to lead to continuation or recurrence of...

  19. 77 FR 55808 - Certain Preserved Mushrooms From the People's Republic of China: Final Results of Antidumping...

    Science.gov (United States)

    2012-09-11

    ... DEPARTMENT OF COMMERCE International Trade Administration [A-570-851] Certain Preserved Mushrooms... preserved mushrooms from the People's Republic of China (PRC).\\1\\ Based upon our analysis of comments... is listed in the ``Final Results of Review'' section below. \\1\\ See Certain Preserved Mushrooms From...

  20. 76 FR 67146 - Certain Preserved Mushrooms From the People's Republic of China: Final Results of Antidumping...

    Science.gov (United States)

    2011-10-31

    ... DEPARTMENT OF COMMERCE International Trade Administration [A-570-851] Certain Preserved Mushrooms... results of the new shipper reviews (NSRs) of the antidumping duty order on certain preserved mushrooms.... (Hongda) in the Final Results of New Shipper Review of the Antidumping Duty Order on Preserved Mushrooms...

  1. 78 FR 4126 - Certain Preserved Mushrooms From the People's Republic of China: Preliminary Rescission of...

    Science.gov (United States)

    2013-01-18

    ... DEPARTMENT OF COMMERCE International Trade Administration [A-570-851] Certain Preserved Mushrooms... conducting a new shipper review (NSR) of the antidumping duty order on certain preserved mushrooms from the..., respectively. Scope of the Order The products covered by this order are certain preserved mushrooms, whether...

  2. 76 FR 56732 - Certain Preserved Mushrooms From the People's Republic of China: Final Results of Antidumping...

    Science.gov (United States)

    2011-09-14

    ... DEPARTMENT OF COMMERCE International Trade Administration [A-570-851] Certain Preserved Mushrooms... antidumping duty order on certain preserved mushrooms from the People's Republic of China (PRC). See Certain Preserved Mushrooms From the People's Republic of China: Preliminary Results of Antidumping Duty...

  3. 78 FR 18315 - Certain Preserved Mushrooms From the People's Republic of China: Final Rescission of Antidumping...

    Science.gov (United States)

    2013-03-26

    ... DEPARTMENT OF COMMERCE International Trade Administration [A-570-851] Certain Preserved Mushrooms.... (Yinfeng) under the antidumping duty order on certain preserved mushrooms from the People's Republic of... Preserved Mushrooms from the People's Republic of China: Preliminary Rescission of Antidumping Duty New...

  4. 76 FR 16604 - Certain Preserved Mushrooms From the People's Republic of China: Final Results and Final...

    Science.gov (United States)

    2011-03-24

    ... DEPARTMENT OF COMMERCE International Trade Administration [A-570-851] Certain Preserved Mushrooms... (NSRs) of the antidumping duty order on certain preserved mushrooms from the People's Republic of China... Industry Co., Ltd. (Tongfa). See Certain Preserved Mushrooms from the People's Republic of China...

  5. 76 FR 28732 - Certain Preserved Mushrooms From the People's Republic of China: Rescission of Antidumping Duty...

    Science.gov (United States)

    2011-05-18

    ... DEPARTMENT OF COMMERCE International Trade Administration [A-570-851] Certain Preserved Mushrooms... Department) initiated a new shipper review of the antidumping duty order on certain preserved mushrooms from... 31, 2011. See Certain Preserved Mushrooms From the People's Republic of China: Initiation of...

  6. 76 FR 70112 - Certain Preserved Mushrooms From the People's Republic of China: Amended Final Results of...

    Science.gov (United States)

    2011-11-10

    ... DEPARTMENT OF COMMERCE International Trade Administration [A-570-851] Certain Preserved Mushrooms... duty order on certain preserved mushrooms from the People's Republic of China (PRC). See Certain Preserved Mushrooms From the People's Republic of China: Final Results of Antidumping Duty Administrative...

  7. 77 FR 32941 - Certain Preserved Mushrooms From India: Notice of Partial Rescission of Antidumping Duty...

    Science.gov (United States)

    2012-06-04

    ... DEPARTMENT OF COMMERCE International Trade Administration [A-533-813] Certain Preserved Mushrooms... order on certain preserved mushrooms from India with respect to the above-named companies.\\2\\ \\2\\ See... on certain preserved mushrooms from India for the POR. Therefore, in response to the petitioner's...

  8. 75 FR 17376 - Certain Preserved Mushrooms from the People's Republic of China: Amended Final Results Pursuant...

    Science.gov (United States)

    2010-04-06

    ... DEPARTMENT OF COMMERCE International Trade Administration [A-570-851] Certain Preserved Mushrooms... administrative review of the antidumping duty order on certain preserved mushrooms from the PRC for the period... preserved mushrooms from the People's Republic of China (PRC). EFFECTIVE DATE: April 6, 2010. FOR FURTHER...

  9. 78 FR 34037 - Certain Preserved Mushrooms From the People's Republic of China: Final Results of Antidumping...

    Science.gov (United States)

    2013-06-06

    ... DEPARTMENT OF COMMERCE International Trade Administration [A-570-851] Certain Preserved Mushrooms... duty order on certain preserved mushrooms from the People's Republic of China (PRC) covering the period... Review'' section of this notice. \\1\\ See Certain Preserved Mushrooms From the People's Republic of China...

  10. 75 FR 35769 - Certain Preserved Mushrooms from India: Notice of Rescission of Antidumping Duty Administrative...

    Science.gov (United States)

    2010-06-23

    ... DEPARTMENT OF COMMERCE International Trade Administration [A-533-813] Certain Preserved Mushrooms... Request Administrative Review'' of the antidumping duty order on certain preserved mushrooms from India... review of the antidumping duty order on certain preserved mushrooms from India with respect to these...

  11. 76 FR 43261 - Certain Preserved Mushrooms From India: Notice of Rescission of Antidumping Duty Administrative...

    Science.gov (United States)

    2011-07-20

    ... DEPARTMENT OF COMMERCE International Trade Administration [A-533-813] Certain Preserved Mushrooms... Administrative Review'' of the antidumping duty order on certain preserved mushrooms from India for the period of... order on certain preserved mushrooms from India with respect to the above-named companies. See...

  12. 75 FR 31426 - Certain Preserved Mushrooms from Indonesia: Notice of Rescission of Antidumping Duty...

    Science.gov (United States)

    2010-06-03

    ... DEPARTMENT OF COMMERCE International Trade Administration (A-560-802) Certain Preserved Mushrooms... ``Opportunity to Request Administrative Review'' of the antidumping duty order on certain preserved mushrooms... antidumping duty order on certain preserved mushrooms from Indonesia with respect to these companies. See...

  13. 76 FR 17836 - Certain Preserved Mushrooms From the People's Republic of China: Initiation of Antidumping Duty...

    Science.gov (United States)

    2011-03-31

    ... DEPARTMENT OF COMMERCE International Trade Administration [A-570-851] Certain Preserved Mushrooms... certain preserved mushrooms from the People's Republic of China (PRC). In accordance with section 751(a)(2... antidumping duty order on certain preserved mushrooms from the PRC. See Notice of Amendment of Final...

  14. 75 FR 62108 - Certain Preserved Mushrooms From the People's Republic of China: Notice of Initiation of...

    Science.gov (United States)

    2010-10-07

    ... DEPARTMENT OF COMMERCE International Trade Administration [A-570-851] Certain Preserved Mushrooms... antidumping duty order on certain preserved mushrooms from the People's Republic of China (PRC). See Notice of... Preserved Mushrooms From the People's Republic of China, 64 FR 8308 (February 19, 1999). In accordance with...

  15. 75 FR 16075 - Certain Preserved Mushrooms From the People's Republic of China: Notice of Initiation of...

    Science.gov (United States)

    2010-03-31

    ... DEPARTMENT OF COMMERCE International Trade Administration [A-570-851] Certain Preserved Mushrooms... order on certain preserved mushrooms from the People's Republic of China (PRC). See Notice of Amendment... antidumping duty order on certain preserved mushrooms from the PRC. See Notice of Amendment of Final...

  16. 78 FR 26319 - Certain Preserved Mushrooms From India: Rescission of Antidumping Duty Administrative Review...

    Science.gov (United States)

    2013-05-06

    ... DEPARTMENT OF COMMERCE International Trade Administration [A-533-813] Certain Preserved Mushrooms... Request Administrative Review'' of the antidumping duty order on certain preserved mushrooms from India... administrative review of the antidumping duty order on certain preserved mushrooms from India with respect to the...

  17. Content of radiocesium in mushrooms from some localities in Czech Republic and Slovak Republic

    International Nuclear Information System (INIS)

    Kunova, V; Dvorak, P.; Benova, K.

    2004-01-01

    Interest about content radiocesium remain in mushrooms on actual. Mushrooms are able in bigger rate cumulate 137 Cs. Owing to different natural influence radiocesium all the time discovery, not only in mushrooms, but also in other live organism various kind. In regions, which hit Chernobyl radioactive cloud, we can with distance of several years deal out and funds transcendent permission limits. (authors)

  18. Identification of molecular species of acylglycerols of Philippine wild edible mushroom, Ganoderma lucidum

    Science.gov (United States)

    Wild edible mushrooms are widely consumed in many countries. We successfully cultivated four edible, medicinal Philippine mushrooms in liquid culture. Recently, we identified the molecular species of acylglycerols in the lipid extract of mushroom G. lucidum NRRL66208. One hundred and three molecular...

  19. Long-Term Resistance of Drosophila melanogaster to the Mushroom Toxin Alpha-Amanitin.

    Directory of Open Access Journals (Sweden)

    Chelsea L Mitchell

    Full Text Available Insect resistance to toxins exerts not only a great impact on our economy, but also on the ecology of many species. Resistance to one toxin is often associated with cross-resistance to other, sometimes unrelated, chemicals. In this study, we investigated mushroom toxin resistance in the fruit fly Drosophila melanogaster (Meigen. This fruit fly species does not feed on mushrooms in nature and may thus have evolved cross-resistance to α-amanitin, the principal toxin of deadly poisonous mushrooms, due to previous pesticide exposure. The three Asian D. melanogaster stocks used in this study, Ama-KTT, Ama-MI, and Ama-KLM, acquired α-amanitin resistance at least five decades ago in their natural habitats in Taiwan, India, and Malaysia, respectively. Here we show that all three stocks have not lost the resistance phenotype despite the absence of selective pressure over the past half century. In response to α-amanitin in the larval food, several signs of developmental retardation become apparent in a concentration-dependent manner: higher pre-adult mortality, prolonged larva-to-adult developmental time, decreased adult body size, and reduced adult longevity. In contrast, female fecundity nearly doubles in response to higher α-amanitin concentrations. Our results suggest that α-amanitin resistance has no fitness cost, which could explain why the resistance has persisted in all three stocks over the past five decades. If pesticides caused α-amanitin resistance in D. melanogaster, their use may go far beyond their intended effects and have long-lasting effects on ecosystems.

  20. Long-Term Resistance of Drosophila melanogaster to the Mushroom Toxin Alpha-Amanitin.

    Science.gov (United States)

    Mitchell, Chelsea L; Yeager, Roger D; Johnson, Zachary J; D'Annunzio, Stephanie E; Vogel, Kara R; Werner, Thomas

    2015-01-01

    Insect resistance to toxins exerts not only a great impact on our economy, but also on the ecology of many species. Resistance to one toxin is often associated with cross-resistance to other, sometimes unrelated, chemicals. In this study, we investigated mushroom toxin resistance in the fruit fly Drosophila melanogaster (Meigen). This fruit fly species does not feed on mushrooms in nature and may thus have evolved cross-resistance to α-amanitin, the principal toxin of deadly poisonous mushrooms, due to previous pesticide exposure. The three Asian D. melanogaster stocks used in this study, Ama-KTT, Ama-MI, and Ama-KLM, acquired α-amanitin resistance at least five decades ago in their natural habitats in Taiwan, India, and Malaysia, respectively. Here we show that all three stocks have not lost the resistance phenotype despite the absence of selective pressure over the past half century. In response to α-amanitin in the larval food, several signs of developmental retardation become apparent in a concentration-dependent manner: higher pre-adult mortality, prolonged larva-to-adult developmental time, decreased adult body size, and reduced adult longevity. In contrast, female fecundity nearly doubles in response to higher α-amanitin concentrations. Our results suggest that α-amanitin resistance has no fitness cost, which could explain why the resistance has persisted in all three stocks over the past five decades. If pesticides caused α-amanitin resistance in D. melanogaster, their use may go far beyond their intended effects and have long-lasting effects on ecosystems.

  1. Mushroom speleothems: Stromatolites that formed in the absence of phototrophs

    Science.gov (United States)

    Bontognali, Tomaso; D'Angeli, Ilenia; Tisato, Nicola; Vasconcelos, Crisogono; Bernasconi, Stefano; Gonzales, Esteban; DeWaele, Jo

    2016-04-01

    Unusual speleothems resembling giant mushrooms occur in Santa Catalina Cave, Cuba. Although these mineral buildups are considered a natural heritage, their composition and formation mechanism remain poorly understood. Here we characterize their morphology and mineralogy and present a model for their genesis. We propose that the mushrooms, which are mainly comprised of calcite and aragonite, formed during four different phases within an evolving cave environment. The stipe of the mushroom is an assemblage of three well-known speleothems: a stalagmite surrounded by calcite rafts that were subsequently encrusted by cave clouds (mammilaries). More peculiar is the cap of the mushroom, which is morphologically similar to cerebroid stromatolites and thrombolites of microbial origin occurring in marine environments. Scanning electron microscopy investigations of this last unit revealed the presence of fossilized extracellular polymeric substances (EPS) - the constituents of biofilms and microbial mats. These organic microstructures are mineralized with Ca-carbonate, suggesting that the mushroom cap formed through a microbially-influenced mineralization process. The existence of cerebroid Ca-carbonate buildups forming in dark caves (i.e., in the absence of phototrophs) has interesting implications for the study of fossil microbialites preserved in ancient rocks, which are today considered as one of the earliest evidence for life on Earth.

  2. Utilization following of bioremediation attributes using oyster mushrooms - Pleurotus ostreatus

    International Nuclear Information System (INIS)

    Galanda, D.; Matel, L.

    2007-01-01

    The mushrooms are not only rich food products, but also a specific component of forest biogeocenoses playing an important role in their functioning, including radionuclide migration. The reason why fungi work as such good indicators for radioactivity and pollution in general is connected to their structure. Using absorption to obtain their nutrition, fungi lack water-conducting organs like stems and roots. They absorb moisture and nutrients from the soil background through surface cells. Dissolved or airborne materials, which include pollutants, move freely through the compartments of hyphae. What is more, radiation released during nuclear testing or accidents is absorbed, especially in areas where it rained heavily shortly after the incident. The present work is devoted to an estimation of the transfer coefficient between reared oyster mushrooms and their support die, which was injected with known activity of 241 Am and 242 Pu. After 2 months when we get the reared mushrooms of cane oyster mushrooms were dried and prepared by liquid extraction with Aliquat 336. The samples were measured by alpha-spectrometry. The results of activity 241 Am and 242 Pu in the mushrooms body and residual activity in the support was detected and calculated (authors)

  3. Mushroom speleothems: Stromatolites that formed in the absence of phototrophs

    Directory of Open Access Journals (Sweden)

    Tomaso eBontognali

    2016-04-01

    Full Text Available Unusual speleothems resembling giant mushrooms occur in Santa Catalina Cave, Cuba. Although these mineral buildups are considered a natural heritage, their composition and formation mechanism remain poorly understood. Here we characterize their morphology and mineralogy and present a model for their genesis. We propose that the mushrooms, which are mainly comprised of calcite and aragonite, formed during four different phases within an evolving cave environment. The stipe of the mushroom is an assemblage of three well-known speleothems: a stalagmite surrounded by calcite rafts that were subsequently encrusted by cave clouds (mammilaries. More peculiar is the cap of the mushroom, which is morphologically similar to cerebroid stromatolites and thrombolites of microbial origin occurring in marine environments. Scanning electron microscopy investigations of this last unit revealed the presence of fossilized extracellular polymeric substances (EPS – the constituents of biofilms and microbial mats. These organic microstructures are mineralized with Ca-carbonate, suggesting that the mushroom cap formed through a microbially-influenced mineralization process. The existence of cerebroid Ca-carbonate buildups forming in dark caves (i.e., in the absence of phototrophs has interesting implications for the study of fossil microbialites preserved in ancient rocks, which are today considered as one of the earliest evidence for life on Earth.

  4. Advances in Mushroom Research in the Last Decade

    Directory of Open Access Journals (Sweden)

    Huijuan Pan

    2006-01-01

    Full Text Available There has been a lot of progress in mushroom science and biotechnology in the last decade. The optimization of PFGE separation of fungal chromosomes allowed the study of the molecular karyotype of mushrooms and the assignment of genes to chromosomes. There are 115 genes encoded from different species of mushrooms. Cross breeding continues to be the principal method, but it is accompanied by the analyses of RAPD or RFLPs methods. The genetic makers are used and introduced into commercial large hybrids via introgression breeding. The complex traits such as yield, resistance to disease and quality characteristics, and quantitative traits more than one quantitative trait locus (QTL are found and used in practice. The transformants or transgenic mutant strains were obtained by Agrobacterium system or particle bombardment. At least 651 species representing 182 genera of hetero- and homobasidiomycetes mushrooms were researched containing antitumor or immunostimulating polysaccharides. Ergosterol in the lipid fraction was identified as one of the most active constituents. New sesquiterpenoid hydroquinones, steroids, oxalic acid, triterpenes, water-soluble lignins, sulfated polysaccharides, protein-bound polysaccharides are researched intensively as antimicrobial or antiviral agents. Many small molecular mass compounds exhibit cytotoxic activities, such as illudins, leaianafulvene, triterpenes (ganoderic acids, acetoxyscirpenediol, ergosterol peroxide, sterols. There are many other compounds or activities found in the mushrooms, such as antioxidative, hypoglycemic action, anti-inflammatory effect, hepatoprotective compounds, psychoactive compounds and activities.

  5. Performance of Pleurotus ostreatus mushroom grown on maize stalk residues supplemented with various levels of maize flour and wheat bran

    Directory of Open Access Journals (Sweden)

    Senzosenkosi Surprise MKHIZE

    Full Text Available Abstract Improving the performance of mushroom in terms of high production and fast growth rate is essential in mushroom cultivation. In the present study the performance of Pleurotus ostreatus was evaluated using varying levels of wheat bran (WB and maize flour (MF. The results indicated that Pleurotus ostreatus was highly influenced by different levels of supplementation, with 8% WB, 18% WB and 2% MF having higher contamination rate. The low levels of supplementation gave significantly better mycelial growth rate (MGR and shorter colonisation period as observed that the control had highest MGR whereby 20% MF had lowest MGR. The pinning time (TP was shortest at the first flush with minimum of 3 days (12% MF. The higher levels of supplementation showed maximum biological efficiency (BE such as 14% MF, 12% WB and 14% WB. The yield was also higher at high levels of supplementation such as 20% MF and 8% MF being the exception in the lower levels. Based on the results it was observed that for fast production of oyster mushroom there is no need to supplement the maize stalk substrate but for improved productivity supplements can be added up to certain limits such as 14% MF and 12 WB.

  6. Ligninolytic basidiomycetes as promising organisms for the mycoremediation of PAH-contaminated Environments

    Science.gov (United States)

    Pozdnyakova, N. N.; Balandina, S. A.; Dubrovskaya, E. V.; Golubev, C. N.; Turkovskaya, O. V.

    2018-01-01

    Primary screening of ligninolytic fungi belonging to wood- and soil-inhabiting basidiomycetes revealed their ability to degrade three-ringed PAHs with formation of quinone metabolites at the first stage. The degradative activity was both species and strain specific, and some differences in the “chances” for the formed quinones were found. They were the main end metabolites in the degradation of PAHs by Stropharia rugosoannulata and Agaricus bisporus. During PAH degradation by strains of Trametes versicolor, Pleurotus ostreatus, Schizophyllum commune, and Bjerkandera adusta similar metabolites were detected during the cultivation, but they were utilized further. The results supported the hypothesis that the degree of PAH degradation may depend on the composition of the extracellular ligninolytic complex of the fungi: in the presence of a single ligninolytic enzyme, laccase, the accumulation of quinone metabolites takes place; their further utilization is possible with the participation of ligninolytic peroxidases. The data obtained showed the necessity not only to identify the metabolites formed, but also to study the activity of the basic ligninolytic enzymes. It is important for the correct selection of fungal strains for mycoremediation.

  7. De novo synthesis and decomposition of veratryl alcohol by a lignin-degrading basidiomycete

    Energy Technology Data Exchange (ETDEWEB)

    Lundquist, K; Kirk, T K

    1978-01-01

    In studies of the metabolism of lignin-related aromatics by the ligninolytic basidiomycete Phanerochaete chrysosporium (strain ME-446), a compound was consistently found (TLC) in chloroform extracts of cultures. The substance, identified as veratryl alcohol (1), was first suspected to be a non-metabilizable degradation product of the aromatics studied, which included various guaiacyl- and veratryl-type compounds. Veratryl alcohol itself, in fact, was included in the first experiments. Further investigation with cultures containing /sup 14/C-glucose as growth substrate revealed that 1 is synthesized de novo from glucose. Although the culture medium contained in addition to glucose 0.01 M phthalate or aconitate (buffers), and 0.6 mM L-asparagine (nutrient nitrogen), glucose was the sole source of veratryl alcohol carbon. Introduction of the purified biosynthetic /sup 14/C-veratryl alcohol into fresh cultures resulted in 40% decomposition to /sup 14/CO/sub 2/ in 20 days, showing that the fungus not only makes the compound, it also degrades it. Russell et al. found veratryl alcohol and veratraldehyde in cultures of a ligninolytic fungus (Polystictus versicolor), but considered them to be degradation products of the lignin-related aromatics or wood meal present in the cultures. Reports of synthesis or decomposition of veratryl alcohol by microorganisms were not found.

  8. Proteomics investigation reveals cell death-associated proteins of basidiomycete fungus Trametes versicolor treated with Ferruginol.

    Science.gov (United States)

    Chen, Yu-Han; Yeh, Ting-Feng; Chu, Fang-Hua; Hsu, Fu-Lan; Chang, Shang-Tzen

    2015-01-14

    Ferruginol has antifungal activity against wood-rot fungi (basidiomycetes). However, specific research on the antifungal mechanisms of ferruginol is scarce. Two-dimensional gel electrophoresis and fluorescent image analysis were employed to evaluate the differential protein expression of wood-rot fungus Trametes versicolor treated with or without ferruginol. Results from protein identification of tryptic peptides via liquid chromatography–electrospray ionization tandem mass spectrometry (LC–ESI-MS/MS) analyses revealed 17 protein assignments with differential expression. Downregulation of cytoskeleton β-tubulin 3 indicates that ferruginol has potential to be used as a microtubule-disrupting agent. Downregulation of major facilitator superfamily (MFS)–multiple drug resistance (MDR) transporter and peroxiredoxin TSA1 were observed, suggesting reduction in self-defensive capabilities of T. versicolor. In addition, the proteins involved in polypeptide sorting and DNA repair were also downregulated, while heat shock proteins and autophagy-related protein 7 were upregulated. These observations reveal that such cellular dysfunction and damage caused by ferruginol lead to growth inhibition and autophagic cell death of fungi.

  9. Catalytic Efficiency of Basidiomycete Laccases: Redox Potential versus Substrate-Binding Pocket Structure

    Directory of Open Access Journals (Sweden)

    Olga A. Glazunova

    2018-04-01

    Full Text Available Laccases are copper-containing oxidases that catalyze a one-electron abstraction from various phenolic and non-phenolic compounds with concomitant reduction of molecular oxygen to water. It is well-known that laccases from various sources have different substrate specificities, but it is not completely clear what exactly provides these differences. The purpose of this work was to study the features of the substrate specificity of four laccases from basidiomycete fungi Trametes hirsuta, Coriolopsis caperata, Antrodiella faginea, and Steccherinum murashkinskyi, which have different redox potentials of the T1 copper center and a different structure of substrate-binding pockets. Enzyme activity toward 20 monophenolic substances and 4 phenolic dyes was measured spectrophotometrically. The kinetic parameters of oxidation of four lignans and lignan-like substrates were determined by monitoring of the oxygen consumption. For the oxidation of the high redox potential (>700 mV monophenolic substrates and almost all large substrates, such as phenolic dyes and lignans, the redox potential difference between the enzyme and the substrate (ΔE played the defining role. For the low redox potential monophenolic substrates, ΔE did not directly influence the laccase activity. Also, in the special cases, the structure of the large substrates, such as dyes and lignans, as well as some structural features of the laccases (flexibility of the substrate-binding pocket loops and some amino acid residues in the key positions affected the resulting catalytic efficiency.

  10. Measuring the Electronic Properties of DNA-Specific Schottky Diodes Towards Detecting and Identifying Basidiomycetes DNA

    Science.gov (United States)

    Periasamy, Vengadesh; Rizan, Nastaran; Al-Ta’ii, Hassan Maktuff Jaber; Tan, Yee Shin; Tajuddin, Hairul Annuar; Iwamoto, Mitsumasa

    2016-01-01

    The discovery of semiconducting behavior of deoxyribonucleic acid (DNA) has resulted in a large number of literatures in the study of DNA electronics. Sequence-specific electronic response provides a platform towards understanding charge transfer mechanism and therefore the electronic properties of DNA. It is possible to utilize these characteristic properties to identify/detect DNA. In this current work, we demonstrate a novel method of DNA-based identification of basidiomycetes using current-voltage (I-V) profiles obtained from DNA-specific Schottky barrier diodes. Electronic properties such as ideality factor, barrier height, shunt resistance, series resistance, turn-on voltage, knee-voltage, breakdown voltage and breakdown current were calculated and used to quantify the identification process as compared to morphological and molecular characterization techniques. The use of these techniques is necessary in order to study biodiversity, but sometimes it can be misleading and unreliable and is not sufficiently useful for the identification of fungi genera. Many of these methods have failed when it comes to identification of closely related species of certain genus like Pleurotus. Our electronics profiles, both in the negative and positive bias regions were however found to be highly characteristic according to the base-pair sequences. We believe that this simple, low-cost and practical method could be useful towards identifying and detecting DNA in biotechnology and pathology. PMID:27435636

  11. Studies on the enzymes produced by Basidiomycetes. Part 1. The production of crude enzymes

    Energy Technology Data Exchange (ETDEWEB)

    Hong, J. S.; Kim, D.H.

    1981-01-01

    Cellulase, protease, and xylanase, formation by the basidiomycetes, Pleurotus ostreatus 301 and Lentinus edodes 3-1 in growth on rice straw medium were studied. Cultural conditions adequate for enzyme production and effects of various materials and inorganic salts added to the rice straw media were investigated. Lentinus edodes 3-1 was an excellent producer of cellulase and xylanase, and Pleurotus ostreatus 301 of protease. The optimum conditions for enzyme production were 30 degrees for cellulase production and at 25 degrees for xylanase and protease production, with 75% moisture content and initial pH of 5.0-6.0. The appropriate incubation times for enzyme production were 30 days and 35 days for Pleurotus ostreatus 301 and Lentinus edodes 3-1, respectively. Among the various materials added, defatted soybean, defatted rape seed, or defatted sesame were all effective in enzyme production but reduced mycelial growth. Rice bran was also effective, particularly at a 30% concentration. The addition of inorganic salts enhanced enzyme production. Among inorganic salts, the optimum concentration of CaCO3 was 5%, and that of CaSO4 was 2%.

  12. Demonstration of laccase in the white rot basidiomycete phanerochaete chrysosporium BKM-F1767

    Energy Technology Data Exchange (ETDEWEB)

    Srinivasan, C.; D`Souza, T.M.; Boominathan, K. [Michigan State Univ., East Lansing, MI (United States)

    1995-12-01

    It has been widely reported that the white rot basidiomycete Phanerochaete chrysosporium, unlike most other white rot fungi, does not produce laccase, an enzyme implicated in lignin biodegradation. Our results showed that P. chrysosporium BKM-F1767 produces extracellular laccase in a defined culture medium containing cellulose (10 g/liter) and either 2.4 or 24 mM ammonium tartrate. Laccase activity was demonstrated in the concentrated extracellular culture fluids of this organism as determined by a laccase plate assay as well as a spectrophotometric assay with ABTS [2,2`-azinobis(3-ethylbenzathiazoline-6-sulfonic acid)] as the substrate. Laccase activity was observed even after addition of excess catalase to the extracellular culture fluid to destroy the endogenously produced hydrogen peroxide, indicating that the observed activity is not due to a peroxidase. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis followed by activity staining with ABTS revealed the presence of a laccase band with an estimated M{sub r} of 46,500.

  13. Paleogene radiation of a plant pathogenic mushroom.

    Directory of Open Access Journals (Sweden)

    Martin P A Coetzee

    Full Text Available The global movement and speciation of fungal plant pathogens is important, especially because of the economic losses they cause and the ease with which they are able to spread across large areas. Understanding the biogeography and origin of these plant pathogens can provide insights regarding their dispersal and current day distribution. We tested the hypothesis of a Gondwanan origin of the plant pathogenic mushroom genus Armillaria and the currently accepted premise that vicariance accounts for the extant distribution of the species.The phylogeny of a selection of Armillaria species was reconstructed based on Maximum Parsimony (MP, Maximum Likelihood (ML and Bayesian Inference (BI. A timeline was then placed on the divergence of lineages using a Bayesian relaxed molecular clock approach.Phylogenetic analyses of sequenced data for three combined nuclear regions provided strong support for three major geographically defined clades: Holarctic, South American-Australasian and African. Molecular dating placed the initial radiation of the genus at 54 million years ago within the Early Paleogene, postdating the tectonic break-up of Gondwana.The distribution of extant Armillaria species is the result of ancient long-distance dispersal rather than vicariance due to continental drift. As these finding are contrary to most prior vicariance hypotheses for fungi, our results highlight the important role of long-distance dispersal in the radiation of fungal pathogens from the Southern Hemisphere.

  14. Ganoderma Lucidum (Reishi Mushroom) and cancer.

    Science.gov (United States)

    Unlu, Ahmet; Nayir, Erdinc; Kirca, Onder; Ozdogan, Mustafa

    2016-01-01

    Having a long historical past in traditional Chinese medicine, Ganoderma Lucidum (G. Lucidum) is a type of mushroom believed to extend life and promote health. Due to the increasing consumption pattern, it has been cultivated and marketed intensively since the 1970s. It is claimed to be effective in the prevention and treatment of many diseases, and in addition, it exerts anticancer properties. Almost all the data on the benefits of G. Lucidum are based on laboratory and preclinical studies. The few clinical studies conducted are questionable. Nevertheless, when the findings obtained from laboratory studies are considered, it turns that G. Lucidum is likely to have some benefits for cancer patients. What is important at this point is to determine the components that will provide these benefits, and use them in drug development, after testing their reliability. In conclusion, it would be the right approach to abstain from using and incentivizing this product, until its benefits and harms are set out clearly, by considering its potential side effects.

  15. Mushroom bodies regulate habit formation in Drosophila.

    Science.gov (United States)

    Brembs, Björn

    2009-08-25

    To make good decisions, we evaluate past choices to guide later decisions. In most situations, we have the opportunity to simultaneously learn about both the consequences of our choice (i.e., operantly) and the stimuli associated with correct or incorrect choices (i.e., classically). Interestingly, in many species, including humans, these learning processes occasionally lead to irrational decisions. An extreme case is the habitual drug user consistently administering the drug despite the negative consequences, but we all have experience with our own, less severe habits. The standard animal model employs a combination of operant and classical learning components to bring about habit formation in rodents. After extended training, these animals will press a lever even if the outcome associated with lever-pressing is no longer desired. In this study, experiments with wild-type and transgenic flies revealed that a prominent insect neuropil, the mushroom bodies (MBs), regulates habit formation in flies by inhibiting the operant learning system when a predictive stimulus is present. This inhibition enables generalization of the classical memory and prevents premature habit formation. Extended training in wild-type flies produced a phenocopy of MB-impaired flies, such that generalization was abolished and goal-directed actions were transformed into habitual responses.

  16. Rehydration of freeze-dried and convective dried boletus edulis mushrooms: effect on some quality parameters.

    Science.gov (United States)

    Hernando, I; Sanjuán, N; Pérez-Munuera, I; Mulet, A

    2008-10-01

    Quality of rehydrated products is a key aspect linked to rehydration conditions. To assess the effect of rehydration temperature on some quality parameters, experiments at 20 and 70 degrees C were performed with convective dried and freeze-dried Boletus edulis mushrooms. Rehydration characteristics (through Peleg's parameter, k(1), and equilibrium moisture, W(e)), texture (Kramer), and microstructure (Cryo-Scanning Electron Microscopy) were evaluated. Freeze-dried samples absorbed water more quickly and attained higher W(e) values than convective dried ones. Convective dehydrated samples rehydrated at 20 degrees C showed significantly lower textural values (11.9 +/- 3.3 N/g) than those rehydrated at 70 degrees C (15.7 +/- 1.2 N/g). For the freeze-dried Boletus edulis, the textural values also exhibited significant differences, being 8.2 +/- 1.3 and 10.5 +/- 2.3 N/g for 20 and 70 degrees C, respectively. Freeze-dried samples showed a porous structure that allows rehydration to take place mainly at the extracellular level. This explains the fact that, regardless of temperature, freeze-dried mushrooms absorbed water more quickly and reached higher W(e) values than convective dried ones. Whatever the dehydration technique used, rehydration at 70 degrees C produced a structural damage that hindered water absorption; consequently lower W(e) values and higher textural values were attained than when rehydrating at 20 degrees C.

  17. A Comprehensive Review of Tropical Milky White Mushroom (Calocybe indica P&C).

    Science.gov (United States)

    Subbiah, Krishnamoorthy Akkanna; Balan, Venkatesh

    2015-09-01

    A compressive description of tropical milky white mushroom (Calocybe indica P&C var. APK2) is provided in this review. This mushroom variety was first identified in the eastern Indian state of West Bengal and can be cultivated on a wide variety of substrates, at a high temperature range (30~38℃). However, no commercial cultivation was made until 1998. Krishnamoorthy 1997 rediscovered the fungus from Tamil Nadu, India and standardized the commercial production techniques for the first time in the world. This edible mushroom has a long shelf life (5~7 days) compared to other commercially available counterparts. A comprehensive and critical review on physiological and nutritional requirements viz., pH, temperature, carbon to nitrogen ratio, best carbon source, best nitrogen source, growth period, growth promoters for mycelia biomass production; substrate preparation; spawn inoculation; different supplementation and casing requirements to increase the yield of mushrooms has been outlined. Innovative and inexpensive methods developed to commercially cultivate milky white mushrooms on different lignocellulosic biomass is also described in this review. The composition profiles of milky white mushroom, its mineral contents and non-enzymatic antioxidants are provided in comparison with button mushroom (Agaricus bisporus) and oyster mushroom (Pleurotus ostreatus). Antioxidant assay results using methanol extract of milky white mushroom has been provided along with the information about the compounds that are responsible for flavor profile both in fresh and dry mushrooms. Milky white mushroom extracts are known to have anti-hyperglycemic effect and anti-lipid peroxidation effect. The advantage of growing at elevated temperature creates newer avenues to explore milky white mushroom cultivation economically around the world, especially, in humid tropical and sub-tropical zones. Because of its incomparable productivity and shelf life to any other cultivated mushrooms in the

  18. The Problems Detected in Mushroom Cultivation in Ankara

    Directory of Open Access Journals (Sweden)

    Mürüvvet Ulusoy Deniz

    2016-03-01

    Full Text Available Development of the cultivated mushroom farming which began to be produced in the 1960s in Turkey, has been more faster in the Mediterranean region than other regions. The development of mushroom cultivation has began to seen Marmara and İç Anadolu regions in recent years. The mushroom production which is very important for human health and nutrition, has been changing year to year (sometimes increase, sometimes decrease in the province of Ankara. The first private mushrrom cultivation company had been established in1963. Up to date, the number of private enterprises has changed over the years in Ankara. This study was carried out by doing a survey with an active 12 enterprises which the annual production capacity of 10-600 ton. The enterprises were visited and problems were determined during the cultivation. As a result of the study, It was observed that there are problems in production and marketing phases and with surface soil material

  19. Visualizing mushroom body response to a conditioned odor in honeybees

    Science.gov (United States)

    Faber, Till; Menzel, Randolf

    2001-11-01

    Combining differential conditioning with optophysiological recordings of bee brain activity allows the investigation of learning-related changes in complex neural systems. In this study we focused on the mushroom bodies of the bee brain. Presenting different odors to the animal leads to significant activation of the mushroom body lips. After differential conditioning, the rewarded odor leads to stronger activation than it did before training. Activation by the unrewarded odor remains unchanged. These results resemble findings in the bee's antennal lobes, which are the first olfactory relay station in the insect brain. As an integrative neural network, enhanced activation of the mushroom body lip may carry additional information, i.e., for processing odor concentrations.

  20. Structural Features and Healthy Properties of Polysaccharides Occurring in Mushrooms

    Directory of Open Access Journals (Sweden)

    Eva Guillamón

    2012-12-01

    Full Text Available Polysaccharides from mushrooms have attracted a great deal of attention due to the many healthy benefits they have demonstrated, such as immunomodulation, anticancer activity, prevention and treatment of cardiovascular diseases, antiviral and antimicrobial effects, among others. Isolation and purification of polysaccharides commonly involve several steps, and different techniques are actually available in order to increase extraction yield and purity. Studies have demonstrated that the molecular structure and arrangement significantly influence the biological activity; therefore, there is a wide range of analytical techniques for the elucidation of chemical structures. Different polysaccharides have been isolated from mushrooms, most of them consisting of β-linked glucans, such as lentinan from Lentinus edodes, pleuran from Pleurotus species, schizophyllan from Schizophyllum commune, calocyban from Calocybe indica, or ganoderan and ganopoly from Ganoderma lucidum. This article reviews the main methods of polysaccharide isolation and structural characterization, as well as some of the most important polysaccharides isolated from mushrooms and the healthy benefits they provide.

  1. Extension of mushroom (Agaricus bisporus) shelf life by gamma radiation

    International Nuclear Information System (INIS)

    Lescano, G.

    1994-01-01

    Fresh mushroom sporophores (Agaricus bisporus) were placed in trays and covered with PVC film. Forty-eight of the number of packs were irradiated by a γ-source with a dose of 3 kGy, and the remaining 24 treated as control packs. Both treated and control samples were subsequently stored at 10 ± 2°C and relative humidity of 94 ± 6%. After storage, mushrooms were subjected to quality assessments and taste panel-testing, both raw and when cooked. Irradiated sporophores had an extended shelf-life compared with control samples, with less browning and a delay in cap opening. Desiccation was slowed and stipe elongation reduced so that irradiated mushrooms were still acceptable for consumption 16 days after treatment. Deleterious effects of irradiation at this relatively low level were not observed

  2. Microbial ecology of the Agaricus bisporus mushroom cropping process.

    Science.gov (United States)

    McGee, Conor F

    2018-02-01

    Agaricus bisporus is the most widely cultivated mushroom species in the world. Cultivation is commenced by inoculating beds of semi-pasteurised composted organic substrate with a pure spawn of A. bisporus. The A. bisporus mycelium subsequently colonises the composted substrate by degrading the organic material to release nutrients. A layer of peat, often called "casing soil", is laid upon the surface of the composted substrate to induce the development of the mushroom crop and maintain compost environmental conditions. Extensive research has been conducted investigating the biochemistry and genetics of A. bisporus throughout the cultivation process; however, little is currently known about the wider microbial ecology that co-inhabits the composted substrate and casing layers. The compost and casing microbial communities are known to play important roles in the mushroom production process. Microbial species present in the compost and casing are known for (1) being an important source of nitrogen for the A. bisporus mycelium, (2) releasing sugar residues through the degradation of the wheat straw in the composted substrate, (3) playing a critical role in inducing development of the A. bisporus fruiting bodies and (4) acting as pathogens by parasitising the mushroom mycelium/crop. Despite a long history of research into the mushroom cropping process, an extensive review of the microbial communities present in the compost and casing has not as of yet been undertaken. The aim of this review is to provide a comprehensive summary of the literature investigating the compost and casing microbial communities throughout cultivation of the A. bisporus mushroom crop.

  3. Radical scavenging potential and DNA damage protection of wild edible mushrooms of Kashmir Himalaya

    Directory of Open Access Journals (Sweden)

    Nowsheen Shameem

    2017-10-01

    Full Text Available The edible mushrooms Verpa bohemica and Morchella esculenta are locally used for dietary and antioxidant in tribal areas of Kashmir Himalaya. In the present study, sequences of solvents on the basis of their polarity were used for the extraction from selected mushrooms. The comprehensive antioxidant activity of all edible mushroom extracts was evaluated by seven different methods. V. bohemica exhibited significant inhibitory activity of radicals among all the mushrooms while Morchella extracts protected the DNA damage from OH· radicals. This study provides us the substantiation for the use of these mushrooms as antioxidants besides being already eaten as food.

  4. A ribonuclease from the wild mushroom Boletus griseus.

    Science.gov (United States)

    Wang, Hexiang; Ng, T B

    2006-10-01

    A ribonuclease (RNase) with a molecular mass of 29 kDa and cospecific for poly A and poly U was isolated from fruiting bodies of the mushroom Boletus griseus. Its N-terminal sequence exhibited some similarity to those of RNases from the mushrooms Irpex lacteus and Lentinus edodes. The RNase was adsorbed on diethylaminoethyl-cellulose, Q-Sepharose, and Affi-gel blue gel and was unadsorbed on CM-cellulose. The enzyme exhibited a temperature optimum between 60 and 70 degrees C and a pH optimum at 3.5.

  5. Mushroom poisoning in children: liver MDCT findings in three cases

    International Nuclear Information System (INIS)

    Cakir, Banu; Kirbas, Ismail; Cevik, Belma; Teksam, Mehmet; Coskun, Mehmet

    2007-01-01

    Wild mushroom poisoning occurs quite frequently in Turkey, usually during late summer and autumn when climatic conditions favour fungal growth. We report the MDCT findings of the liver in three children after mushroom poisoning. In all three patients, precontrast MDCT findings showed diffuse reduction of hepatic attenuation compared with the spleen. Contrast-enhanced MDCT images showed homogeneous contrast enhancement of the liver. All three patients recovered after medical treatment. A follow-up precontrast MDCT examination was performed in one patient in whom the density of the liver parenchyma had returned to normal. (orig.)

  6. Investigation on Possibility of Transferring OysterMushroom (Pleurotusostreatus Manganese Peroxidase Gene (mnp to the White Button Mushroom (Agaricusbisporus

    Directory of Open Access Journals (Sweden)

    Mojgan Parvandi

    2017-12-01

    Full Text Available Introduction: The white button mushroom does not produce remarkable yield in the third flash. Nutritional deficiency and the inability of this mushroom to efficient use of compost are mentioned as its reasons. Basically, compost includes two major food components, lignocellulose and microbial biomass. But this microbial biomass provides just 10% of button mushroom food needs. According to research studies, differentenzymes in both white button mushroom and oyster mushroom are responsible for decomposition of lignin compounds in compost media, from begin of mycelium grows to the end of fruiting. Lacasse, manganese peroxidase, lignin peroxidase, glyoxal oxidase enzymes contribute to degradation of lignin compounds in degradation mushroom has proven by researchers however itis dependent on mushroom types. Manganese peroxidase enzyme (EC. 1.11.1.13 is an extracellular parser lignin enzyme that has a central peroxidase core. Manganese peroxidase enzyme oxidizesMn2+ to Mn3+ and then Mn3+ oxidizes phenolic structure to fonoxile radical. Produced Mn3+ is very active and makes complex by chelating organic acids that is produced by mushrooms such as oxalate or malate. Mn3+ ions become stable by helping of these chelates and it can penetrate through materials such as wood. On the other hand, in recent years, plant biotechnology provides new solutions for old problems such as use of microorganisms, particularly using bacteria for gene transfer and improvement of superlatives. For a sample of this method, Agrobacterium-mediated transformation system can be noted. In addition, the use of suitable promoters for heterologous genes expression in suitable hosts is an important strategy in functional biotechnology that has been raised in edible mushroom genetic engineering. The lack of efficient and sufficient use of compost, low power of white button mushroom in competition with other rivals, lack of yield per area unit due to production costs, pests and diseases

  7. Chemical constituents and antioxidant activity of the Arctic mushroom Lycoperdon molle Pers

    Directory of Open Access Journals (Sweden)

    Purnima Singh

    2012-03-01

    Full Text Available The biochemical adaptations of fungi to the harsh conditions of the Arctic may mean that these organisms have properties useful to people. Using samples of the puffball mushroom Lycoperdon molle Pers. (Basidiomycota, Fungi collected at Ny-Ålesund, Svalbard, we examined the in vitro antioxidant potential of this species by investigating its free-radical scavenging (FRS activity, inhibition of lipid peroxidation (ILP and Trolox equivalent antioxidant capacity (TEAC. The FRS activity of the samples in various organic solvents, including methanol, ethanol, acetone and dimethyl sulfoxide (DMSO, were found to be in the range of 44.00–89.60%, while ILP activities ranged from 32.00 to 54.41%. The methanol extract showed the highest levels of FRS (89.60% and ILP (54.41% compared to standard antioxidants butylated hydroxyanisol and butylated hydroxytoluene (BHT. The TEAC value was also found to be higher compared to the standard water soluble vitamin E analogue Trolox (3.9 mM. Antimicrobial screening of Lycoperdon molle extracts was negative to the tested microorganisms. Using electrospray ionization mass spectrometry (ESI-MS, we determined that the samples contained compounds such as phosphoethanolamine, monomethyl arsenic acid, phosphatidyl glycerol, phosphoionositol, phosphoserine and lysophosphatidyl choline. We found that Lycoperdon molle showed strong antioxidant abilities compared to the standards, suggesting that this and perhaps other Arctic mushrooms could be valuable sources of natural antioxidants for the pharmaceutical industry. To our knowledge, this is the first report of the antioxidant activity in any Arctic mushroom.

  8. Radioactivity of vegetables and mushrooms in Finland after the Chernobyl accident in 1986

    International Nuclear Information System (INIS)

    Rantavaara, Aino.

    1987-06-01

    The Finnish Centre for Radiation and Nuclear Safety determined gamma-emitting radionuclides in vegetables, fruit and mushrooms in the growing season of 1986. About 780 samples of the most common species were collected during six months in locations which represent different fallout areas of radioactivity. The samples were analysed for the gamma-emitting substances by semiconductor-spectrometry. 89 Sr and 90 Sr were determined radiochemically in a limited number of vegetable and berry samples. Early in May 1986, 131 I and other short-lived radionuclides were dominating. Later in the sampling season, the most important substances detected were 134 Cs and 137 Cs. The lowest concentrations of 137 Cs were measured in leafy and fruit vegetables, root crops and potatoes, 0.3 - 8 Bq kg -1 on an average, depending on the species. In garden berries the nationwide mean 137 Cs concentrations were 10 - 30 Bq kg -1 and in wild berries 80 - 120 Bq kg -1 . The average concentrations of 137 Cs in different types of mushrooms varied from 220 to 1100 Bq kg -1 . The contents of 90 Sr in vegetables and berries were about the same or slightly higher than in the previous years. The daily intake of 137 Cs via the products studied was estimated using nationwide production-weighted mean contents of 137 Cs in different species and data on the average consumption of foodstuffs. Fruit and vegetables of the season 1986 contributed 3.4 Bq d -1 to the dietary intake and mushrooms about 1 Bq d -1 . The effects of processing on vegetables and fruits were not taken into account in the intake calculations. The dietary intake of radionuclides other than 134 Cs and 137 Cs via the produce of season 1986 was very small

  9. First report of phytochelatins in a mushroom: induction of phytochelatins by metal exposure in Boletus edulis.

    Science.gov (United States)

    Collin-Hansen, Christian; Pedersen, Sindre A; Andersen, Rolf A; Steinnes, Eiliv

    2007-01-01

    Some species of macromycetes (mushrooms) consistently are found to contain high concentrations of toxic metals such as cadmium (Cd) and mercury (Hg), and consumption of wild-growing mushrooms is acknowledged as a significant source for Cd and Hg in humans. Yet little is known about the speciation of Cd and Hg in mushroom tissues. Here we present the first evidence of peptides of the phytochelatin family being responsible for binding a large fraction of Cd in caps of the macromycete Boletus edulis exposed to excess metals. Concentrations of Cd, Zn, Cu and Hg, as well as cytosolic Cd-binding capacity (CCBC), glutathione (GSH) and free proline (Pro) were quantified in fruiting bodies of B. edulis differentially exposed to a wide range of metals. Metal distribution among cytosolic compounds were investigated by size exclusion chromatography (SEC), followed by metal determinations with atomic absorption chromatography (AAS) and HR-ICP-MS. Cd-binding compounds in SEC elutates were investigated further by high performance liquid chromatography-mass spectrometry (HPLC-MS). CCBC was >90 times higher in the exposed group relative to the reference group (Mann-Whitney's P < 0.001), whereas concentrations of free Pro were almost identical for the two groups. For the whole study selection, CCBC correlated positively with metal exposure (Spearman's P < 0.001 for all four metals), suggesting dose-dependent induction of Cd-binding compounds by exposure to these metals, possibly as a defense mechanism. The presence of phytochelatins (PCs), a family of cystein-rich oligopeptides, was confirmed in Cd-containing SEC fractions by HPLC-MS. The appearance of more complex PCs was coupled to declining concentrations of GSH. To our knowledge this is the first report demonstrating the presence of PCs in a macromycete.

  10. [Nutrient transfer and growth of Pinus greggii Engelm. inoculated with edible ectomycorrhizal mushrooms in two substrates].

    Science.gov (United States)

    Rentería-Chávez, María C; Pérez-Moreno, Jesús; Cetina-Alcalá, Víctor M; Ferrera-Cerrato, Ronald; Xoconostle-Cázares, Beatriz

    An ectomycorrhiza is a mutualistic symbiosis of paramount importance in forestry and tree production. One of the selection criteria of ectomycorrhizal fungi that has currently gained importance is their edibility due to the economic, ecological and cultural relevance of edible ectomycorrhizal mushrooms as a non-timber forest product. The effect of the inoculation with three edible ectomycorrhizal mushrooms: Laccaria laccata, Laccaria bicolor y Hebeloma leucosarx, which are widely sold in Mexico, on the growth and nutrient contents of Pinus greggii grown in an experimental substrate and a commercial substrate enriched with a slow-release fertilizer, was evaluated. Two years after sowing, differences in terms of shoot and root biomass and macro and micronutrient contents between inoculated and non-inoculated plants, were recorded independently of the fungal species and the substrate. Despite the fact that plants grown in the commercial substrate had higher growth and nutrient contents, their ectomycorrhizal colonization percentages were smaller than those of the plants grown in the experimental substrate. The differences in the nutrient transfer to the inoculated plant shoots among the evaluated fungal species were recorded. Ca mobilization by L. laccata, Na by L. bicolor and Mn by H. leucosarx were observed in the plants growing in the experimental substrate. It has been demonstrated that the selection of substrates constitutes an important factor in the production of ectomycorrhizal plants and that the three evaluated species of edible ectomycorrhizal mushrooms have an enormous potential in the controlled mycorrhization of P. greggii. Copyright © 2017 Asociación Argentina de Microbiología. Publicado por Elsevier España, S.L.U. All rights reserved.

  11. Levels of platinum group elements and rare-earth elements in wild mushroom species growing in Poland.

    Science.gov (United States)

    Mleczek, Mirosław; Niedzielski, Przemysław; Kalač, Pavel; Siwulski, Marek; Rzymski, Piotr; Gąsecka, Monika

    2016-01-01

    Due to limited data-describing abilities of mushrooms to accumulate platinum group elements (PGEs) and rare-earth elements (REEs), the aim of this study was to determine, by inductively coupled plasma optical emission spectrometry followed by microwave-assisted sample digestion by nitric acid, the content of these elements in 20 mushroom species (10 above ground and 10 growing on wood), mostly edible, collected near a busy trunk road. The highest content of PGEs in above-ground mushroom species was observed in Lepista gilva and Suillus bovinus fruit bodies (0.38 ± 0.05 and 0.37 ± 0.03 mg kg(-1) DW, respectively), while in mushrooms growing on wood, the highest content was observed in Pleurotus ostreatus (0.35 ± 0.04 mg kg(-1) DW). The mean content of PGEs for both these groups was 0.23 ± 0.08 and 0.26 ± 0.07 mg kg(-1) DW, respectively. The highest content of REEs in Suillus luteus and Tricholoma equestra was 5.03 ± 0.50 and 2.18 ± 0.56 mg kg(-1) DW, respectively, but within mushrooms growing on wood in Ganoderma applanatum fruiting bodies it was 4.19 ± 0.78 mg kg(-1) DW. Mean contents of REEs were 1.39 ± 1.21 and 1.61 ± 0.97 mg kg(-1) DW in above-ground species and species growing on wood, respectively. Generally, the group of mushroom species growing on wood was capable of slightly higher accumulation of both REEs and PGEs. No limits have been established for both the groups until now.

  12. Extensive sampling of basidiomycete genomes demonstrates inadequacy of the white rot/ brown rot paradigm for wood decay fungi

    Energy Technology Data Exchange (ETDEWEB)

    Riley, Robert; Salamov, Asaf; Brown, Daren W.; Nagy, Laszlo G.; Floudas, Dimitris; Held, Benjamin; Levasseur, Anthony; Lombard, Vincent; Morin, Emmanuelle; Otillar, Robert; Lindquist, Erika; Sun, Hui; LaButti, Kurt; Schmutz, Jeremy; Jabbour, Dina; Luo, Hong; Baker, Scott E.; Pisabarro, Antonio; Walton, Jonathan D.; Blanchette, Robert; Henrissat, Bernard; Martin, Francis; Cullen, Dan; Hibbett, David; Grigoriev, Igor V.

    2014-03-14

    Basidiomycota (basidiomycetes) make up 32percent of the described fungi and include most wood decaying species, as well as pathogens and mutualistic symbionts. Wood-decaying basidiomycetes have typically been classified as either white rot or brown rot, based on the ability (in white rot only) to degrade lignin along with cellulose and hemicellulose. Prior genomic comparisons suggested that the two decay modes can be distinguished based on the presence or absence of ligninolytic class II peroxidases (PODs), as well as the abundance of enzymes acting directly on crystalline cellulose (reduced in brown rot). To assess the generality of the white rot/brown rot classification paradigm we compared the genomes of 33 basidiomycetes, including four newly sequenced wood decayers, and performed phylogenetically-informed Principal Components Analysis (PCA) of a broad range of gene families encoding plant biomass-degrading enzymes. The newly sequenced Botryobasidium botryosum and Jaapia argillacea genomes lack PODs, but possess diverse enzymes acting on crystalline cellulose, and they group close to the model white rot species Phanerochaete chrysosporium in the PCA. Furthermore, laboratory assays showed that both B. botryosum and J. argillacea can degrade all polymeric components of woody plant cell walls, a characteristic of white rot. We also found expansions in reducing polyketide synthase genes specific to the brown rot fungi. Our results suggest a continuum rather than a dichotomy between the white rot and brown rot modes of wood decay. A more nuanced categorization of rot types is needed, based on an improved understanding of the genomics and biochemistry of wood decay.

  13. Bioaccumulation of 137Cs in wild mushrooms collected in Poland and Slovakia

    International Nuclear Information System (INIS)

    Bazala, M.A.; Bystrzejewska-Piotrowska, G.; Cipakova, A.

    2005-01-01

    Activities of caesium in the mushrooms collected at different localities in Poland and Slovakia have been compared. Discrimination factor, defined as [(Bq·kg - 1137 Cs in caps)/(Bq·kg -1 40 K in caps)]/[(Bq·kg -1 137 Cs in stipes)/(Bq·kg - 14 0K in stipes)], was used to explain mechanisms of uptake and transport of radiocaesium in fungi. The collected specimens were divided into caps and stipes. Activities of 137 Cs and 40 K were measured using a multichannel gamma spectrophotometer with HPGe(Li) detector. The highest accumulation of 137 Cs was found in the samples of Xerocomus badius, Suillus luteus and Tricholoma equestre (2.7, 1.9 and 1.2 kBq·kg -1 , respectively). T. equestre and S. luteus proved to hyperaccumulate caesium since 137 Cs levels in the caps were two orders of magnitude higher than in the soil while only one order higher in the case of X. badius. Transport of 137 Cs from stipe to cap in fruitbody is directly related to K concentration with lack of similar dependence in the case of transport from soil to cap. There is no dependence between activity of 137 Cs in the analyzed fruitbodies and its activity in the soil, which makes mushrooms controversial bioindicators of 137 Cs-polluted soils. (author)

  14. Bioprospecting of powdered pineapple rind as an organic supplement of composted sawdust for Pleurotus ostreatus mushroom cultivation.

    Science.gov (United States)

    Narh Mensah, Deborah L; Addo, Peter; Dzomeku, Matilda; Obodai, Mary

    2018-03-01

    Pineapple rind is a by-product of the pineapple processing industry and contains nutrients and other compounds which must be utilized as a bioresource for socio-economic benefits while preventing the potential problems of improper agroindustrial biomass disposal methods. Pleurotus ostreatus is an edible oyster mushroom with medicinal properties and can be cultivated on various agroindustrial biomass, including sawdust containing supplements. Pineapple rind was powdered and used as a supplement of composted sawdust at 2%, 5%, 10%, 12%, 15%, and 20% (w/w) on dry weight basis. A control treatment consisted of composted sawdust supplemented with rice bran at 12% (the most utilized composition in Ghana). P. ostreatus strain EM-1 was cultivated on these treatments. Factors investigated included the spawn run period, yield, fruiting body weight and size, biological efficiency, and nutritional composition (proximate composition and Copper, Zinc and Lead content) of fruiting bodies harvested from selected high-yielding treatments and the control treatment. Full colonization of all treatments occurred by the 34th day of incubation. Enhanced yield, fruiting body weight and size, and biological efficiency were generally recorded with supplementation at lower concentrations (2% and 5%) compared to treatments supplemented at higher concentrations. There was also a supplement concentration-dependent alteration of the nutritional composition of the mushroom. Powdered pineapple rind can be utilized as an organic supplement at relatively low concentrations in composted sawdust for P. ostreatus strain EM-1 cultivation. The use of lower concentrations of powdered pineapple rind in composted sawdust is advantageous as relatively less input will be required to produce higher P. ostreatus strain EM-1 yields. Utilization of pineapple rind for mushroom cultivation will extend the pineapple plant value chain, intensify mushroom production in a sustainable way, and minimize agricultural

  15. Growth and yield performance of Pleurotus ostreatus (Jacq. Fr.) Kumm (oyster mushroom) on different substrates.

    Science.gov (United States)

    Girmay, Zenebe; Gorems, Weldesemayat; Birhanu, Getachew; Zewdie, Solomon

    2016-12-01

    Mushroom cultivation is reported as an economically viable bio-technology process for conversion of various lignocellulosic wastes. Given the lack of technology know-how on the cultivation of mushroom, this study was conducted in Wondo Genet College of Forestry and Natural Resource, with the aim to assess the suitability of selected substrates (agricultural and/or forest wastes) for oyster mushroom cultivation. Accordingly, four substrates (cotton seed, paper waste, wheat straw, and sawdust) were tested for their efficacy in oyster mushroom production. Pure culture of oyster mushroom was obtained from Mycology laboratory, Department of Plant Biology and Biodiversity Management, Addis Ababa University. The pure culture was inoculated on potato dextrose agar for spawn preparation. Then, the spawn containing sorghum was inoculated with the fungal culture for the formation of fruiting bodies on the agricultural wastes. The oyster mushroom cultivation was undertaken under aseptic conditions, and the growth and development of mushroom were monitored daily. Results of the study revealed that oyster mushroom can grow on cotton seed, paper waste, sawdust and wheat straw, with varying growth performances. The highest biological and economic yield, as well as the highest percentage of biological efficiency of oyster mushroom was obtained from cotton seed, while the least was from sawdust. The study recommends cotton seed, followed by paper waste as suitable substrates for the cultivation of oyster mushroom. It also suggests that there is a need for further investigation on various aspects of oyster mushroom cultivation in Ethiopia to promote the industry.

  16. Metabolites from nematophagous fungi and nematicidal natural products from fungi as alternatives for biological control. Part II: metabolites from nematophagous basidiomycetes and non-nematophagous fungi.

    Science.gov (United States)

    Degenkolb, Thomas; Vilcinskas, Andreas

    2016-05-01

    In this second section of a two-part mini-review article, we introduce 101 further nematicidal and non-nematicidal secondary metabolites biosynthesized by nematophagous basidiomycetes or non-nematophagous ascomycetes and basidiomycetes. Several of these compounds have promising nematicidal activity and deserve further and more detailed analysis. Thermolides A and B, omphalotins, ophiobolins, bursaphelocides A and B, illinitone A, pseudohalonectrins A and B, dichomitin B, and caryopsomycins A-C are excellent candidates or lead compounds for the development of biocontrol strategies for phytopathogenic nematodes. Paraherquamides, clonostachydiol, and nafuredins offer promising leads for the development of formulations against the intestinal nematodes of ruminants.

  17. Lead accumulation in the straw mushroom, Volvariella volvacea, from lead contaminated rice straw and stubble.

    Science.gov (United States)

    Kumhomkul, Thapakorn; Panich-pat, Thanawan

    2013-08-01

    Straw mushrooms were grown on lead contaminated rice straw and stubble. Study materials were dried, acid digested, and analyzed for lead using flame atomic absorption spectrophotometry. The results showed the highest lead concentration in substrate was 445.350 mg kg⁻¹ in Treatment 3 (T3) and the lowest was BD (below detection) in Treatment 1 (T1). The maximum lead content in straw mushrooms was 5.072 mg kg⁻¹ dw in pileus of T3 and the minimum lead content in straw mushrooms was BD in egg and mature (stalk and pileus) stage of T1. The lead concentration in straw mushrooms was affected by the age of the mycelium and the morphology of mushrooms. Mushrooms' lead uptake produced the highest accumulation in the cell wall. Some lead concentrations in straw mushrooms exceeded the EU standard (>3 mg kg⁻¹ dw).

  18. Evaluation of Mycelium Growth Rate and Yield of White Button Mushroom Isolates (Agaricus bisporus in Iran

    Directory of Open Access Journals (Sweden)

    Mohammad Javad Ahmadi Lahijani

    2017-10-01

    using LSD test at 5% significance level. Results and discussion: There were significant differences among isolates based on mycelium growth rate and yield. In PDA medium, 2200 isolate showed the fastest mycelium growth rate with 1.9 mm.day-1 and final colony diameter of 8.1 cm. were This isolate also showed the fastest mycelium growth rate on CYM medium and covering the spawn and compost media surfaces, and produced the highest yield along with A15a isolate (A15a and 2200 with 22.1 and 19.4 kg.m-2, respectively. Magnum d with mycelium growth rate of 0.7 mm.day-1 and final colony diameter of 3.1 cm showed the slowest mycelium growth rate. On average, 75% of isolates were grouped in slow mycelium growth rate class and 25% were placed in fast mycelium growth rate class. Isolates A15a, 2200, A15, M7219 and F64d showed fast mycelium growth rate. All of the isolates showed filamentous mycelium growth type and no abnormal mycelium growth type was observed. Isolate A15a with 50% coverage of compost surface during the first 5 days and 90% during the 15 days showed the fastest mycelium growth rate on this medium, followed by isolates F64d, 2200 and A15a. Normal mycelium growth rate on compost medium varied from 6-8 to sometimes 10-12 mm.day-1 (Farsi and Pooyanfar, 2011. There was a high positive correlation between mycelium growth rate and the yield component, so that isolates with faster mycelium growth rate produced higher yield. Farsi and Gordan, (2001 also reported significant positive correlation between filamentous mycelium type and yield, so that isolates with filamentous mycelium growth type and high mycelium growth rate produced higher yield. Faster mycelium growth rate is considered as a desire characteristic in mushroom cultivation due to the reduction of contamination risk of other micro-organisms (Oie, 2003. Conclusion: There was a high significant difference among white button mushroom isolates in terms of mycelium growth rate and yield. Isolates with faster

  19. Studies on the transfer of Cs, Sr, Co, Mn and Zn from soil to plants and from medium to mushrooms by using radiotracer

    International Nuclear Information System (INIS)

    Ban-nai, Tadaaki; Muramatsu, Yasuyuki; Yoshida, Satoshi; Yanagisawa, Kei

    1996-01-01

    Radiotracer experiments were carried out to study radionuclide uptake by plants and mushrooms. Transfer factors of radionuclides from soil to leaf vegetables (cabbage, Chinese cabbage, komatsuna, spinach and lettuce) have been determined by radiotracers. The transfer factors of radioactive Cs, Sr, Mn, Co and Zn for edible parts of vegetables were 0.11, 0.24, 0.61, 0.05 and 0.52, respectively. The transfer factors of Mn, Co and Zn for spinach were higher than those for the other vegetables. The transfer factors of Cs for different organs of the leaf vegetables were rather homogeneous. The transfer factors of Sr and Mn were higher for older (outer) leaves than younger (inner) ones. In contrast to Sr and Mn, transfer factors of Zn for younger leaves were higher than those for older ones. In order to study radionuclide uptake by mushrooms, cultivation experiments in flasks were carried out using radiotracers, 137 Cs, 85 Sr, 60 Co, 54 Mn and 65 Zn. Four mushroom species Hebeloma vinosophyllum, Flammulina velutipes, Agrocybe cylindracea and Coprinus phlyctidosporus were used. In addition, Medicago sativa was also tested. Mushrooms tended to accumulate Cs, although there was a large difference between mushroom species. The concentration ratio had the highest value of 21 for Cs in vinosophyllum. The value was much higher than that in the plant sample. The present findings agreed with our previous observations in which Hebeloma species collected in forests contained large amount of 137 Cs. The effects of stable elements in the medium on the accumulations were investigated. The concentration ratios of Cs, Sr and Co were not influenced highly by coexisting stable elements in the medium. However, the ratio of Mn decreased as the amount of coexisting stable elements in the medium was increased. (J.P.N.)

  20. Steroid Hydroxylation by Basidiomycete Peroxygenases: a Combined Experimental and Computational Study

    Science.gov (United States)

    Babot, Esteban D.; del Río, José C.; Cañellas, Marina; Sancho, Ferran; Lucas, Fátima; Guallar, Víctor; Kalum, Lisbeth; Lund, Henrik; Gröbe, Glenn; Scheibner, Katrin; Ullrich, René; Hofrichter, Martin; Martínez, Angel T.

    2015-01-01

    The goal of this study is the selective oxyfunctionalization of steroids under mild and environmentally friendly conditions using fungal enzymes. With this purpose, peroxygenases from three basidiomycete species were tested for the hydroxylation of a variety of steroidal compounds, using H2O2 as the only cosubstrate. Two of them are wild-type enzymes from Agrocybe aegerita and Marasmius rotula, and the third one is a recombinant enzyme from Coprinopsis cinerea. The enzymatic reactions on free and esterified sterols, steroid hydrocarbons, and ketones were monitored by gas chromatography, and the products were identified by mass spectrometry. Hydroxylation at the side chain over the steroidal rings was preferred, with the 25-hydroxyderivatives predominating. Interestingly, antiviral and other biological activities of 25-hydroxycholesterol have been reported recently (M. Blanc et al., Immunity 38:106–118, 2013, http://dx.doi.org/10.1016/j.immuni.2012.11.004). However, hydroxylation in the ring moiety and terminal hydroxylation at the side chain also was observed in some steroids, the former favored by the absence of oxygenated groups at C-3 and by the presence of conjugated double bonds in the rings. To understand the yield and selectivity differences between the different steroids, a computational study was performed using Protein Energy Landscape Exploration (PELE) software for dynamic ligand diffusion. These simulations showed that the active-site geometry and hydrophobicity favors the entrance of the steroid side chain, while the entrance of the ring is energetically penalized. Also, a direct correlation between the conversion rate and the side chain entrance ratio could be established that explains the various reaction yields observed. PMID:25862224

  1. Microbiological and physicochemical analysis of pumpkin juice fermentation by the basidiomycetous fungus Ganoderma lucidum.

    Science.gov (United States)

    Zhao, Jing; Liu, Wei; Chen, Dong; Zhou, Chunli; Song, Yi; Zhang, Yuyu; Ni, Yuanying; Li, Quanhong

    2015-02-01

    A new protocol for processing of pumpkin juice was set up which included fermentation by the basidiomycete Ganoderma lucidum at 28 °C for 7 d. The growth curve of G. lucidum in pumpkin juice was successfully (R(2)  = 0.99) fitted by a 4-parameter logistic model and the ideal highest biomass was estimated to be 4.79 g/L. G. lucidum was found to have a significant acidification effect on pumpkin juice. The lowest pH (4.05 ± 0.05) and highest total titratable acidity (14.31 ± 0.16 mL 0.1 M NaOH/100 mL) were found on the 4th day during fermentation. Sugars in pumpkin juice fermented with G. lucidum showed a significant decrease, especially glucose and fructose. On the contrary, the release of exo-polysaccharides and free amino acids greatly enriched the pumpkin juice. The variation of color index and viscosity also mirrored the above behavior. Based on headspace solid phase microextraction and gas chromatography-mass spectrometry, 68 volatile compounds were identified, including 17 esters, 14 alcohols, 13 phenyl compounds, 11 aldehydes, 8 ketones, 3 acids, 1 furan, and 1 benzothiazole. The pumpkin juices fermented for different days were markedly differentiated with principal component analysis and the fermentation process was tentatively divided into 3 periods: the booming (from the 1st to 4th day), steady (from the 5th to 6th day), and decline (the 7th day) period. © 2014 Institute of Food Technologists®

  2. Identification of some ectomycorrhizal basidiomycetes by PCR amplification of their gpd (glyceraldehyde-3-phosphate dehydrogenase) genes.

    Science.gov (United States)

    Kreuzinger, N; Podeu, R; Gruber, F; Göbl, F; Kubicek, C P

    1996-01-01

    Degenerated oligonucleotide primers designed to flank an approximately 1.2-kb fragment of the gene encoding glyceraldehyde-3-phosphate dehydrogenase (gpd) from ascomycetes and basidiomycetes were used to amplify the corresponding gpd fragments from several species of the ectomycorrhizal fungal taxa Boletus, Amanita, and Lactarius. Those from B. edulis, A. muscaria, and L. deterrimus were cloned and sequenced. The respective nucleotide sequences of these gene fragments showed a moderate degree of similarity (72 to 76%) in the protein-encoding regions and only a low degree of similarity in the introns (56 to 66%). Introns, where present, occurred at conserved positions, but the respective positions and numbers of introns in a given taxon varied. The amplified fragment from a given taxon could be distinguished from that of others by both restriction nuclease cleavage analysis and Southern hybridization. A procedure for labeling DNA probes with fluorescein-12-dUTP by PCR was developed. These probes were used in a nonradioactive hybridization assay, with which the gene could be detected in 2 ng of chromosomal DNA of L. deterrimus on slot blots. Taxon-specific amplification was achieved by the design of specific oligonucleotide primers. The application of the gpd gene for the identification of mycorrhizal fungi under field conditions was demonstrated, with Picea abies (spruce) mycorrhizal roots harvested from a northern alpine forest area as well as from a plant-breeding nursery. The interference by inhibitory substances, which sometimes occurred in the DNA extracted from the root-fungus mixture, could be overcome by using very diluted concentrations of template DNA for a first round of PCR amplification followed by a second round with nested oligonucleotide primers. We conclude that gpd can be used to detect ectomycorrhizal fungi during symbiotic interaction. PMID:8795234

  3. Removal and mineralization of polycyclic aromatic hydrocarbons by litter-decomposing basidiomycetous fungi

    Energy Technology Data Exchange (ETDEWEB)

    Steffen, K T; Hatakka, A [Dept. of Applied Chemistry and Microbiology, Univ. of Helsinki (Finland); Hofrichter, M [Unit of Environmental Biotechnology, International Graduate School Zittau, Zittau (Germany)

    2003-07-01

    Nine strains of litter-decomposing fungi, representing eight species of agaric basidiomycetes, were tested for their ability to remove a mixture of three polycyclic aromatic hydrocarbons (PAHs) (total 60 mg l{sup -1}) comprising anthracene, pyrene and benzo(a)pyrene (BaP) in liquid culture. All strains were able to convert this mixture to some extent, but considerable differences in degradative activity were observed depending on the species, the Mn(II) concentration, and the particular PAH. Stropharia rugosoannulata was the most efficient degrader, removing or transforming BaP almost completely and about 95% of anthracene and 85% of pyrene, in cultures supplemented with 200 {mu}M Mn(II), within 6 weeks. In contrast less than 40, 18, and 50% BaP, anthracene and pyrene, respectively, were degraded in the absence of supplemental Mn(II). In the case of Stropharia coronilla, the presence of Mn(II) led to a 20-fold increase of anthracene conversion. The effect of manganese could be attributed to the stimulation of manganese peroxidase (MnP). The maximum activity of MnP increased in S. rugosoannulata cultures from 10 U l{sup -1} in the absence of Mn(II) to 320 U l{sup -1} in Mn(II)-supplemented cultures. The latter degraded about 6% of a {sup 14}C-labeled BaP into {sup 14}CO{sub 2} whereas only 0.7% was mineralized in the absence of Mn(II). In solid-state straw cultures, S. rugosoannulata, S. coronilla and Agrocybe praecox mineralized between 4 and 6% of {sup 14}C-labeled BaP within 12 weeks. (orig.)

  4. Removal and mineralization of polycyclic aromatic hydrocarbons by litter-decomposing basidiomycetous fungi.

    Science.gov (United States)

    Steffen, K T; Hatakka, A; Hofrichter, M

    2002-10-01

    Nine strains of litter-decomposing fungi, representing eight species of agaric basidiomycetes, were tested for their ability to remove a mixture of three polycyclic aromatic hydrocarbons (PAHs) (total 60 mg l(-1)) comprising anthracene, pyrene and benzo(a)pyrene (BaP) in liquid culture. All strains were able to convert this mixture to some extent, but considerable differences in degradative activity were observed depending on the species, the Mn(II) concentration, and the particular PAH. Stropharia rugosoannulata was the most efficient degrader, removing or transforming BaP almost completely and about 95% of anthracene and 85% of pyrene, in cultures supplemented with 200 micro M Mn(II), within 6 weeks. In contrast less than 40, 18, and 50% BaP, anthracene and pyrene, respectively, were degraded in the absence of supplemental Mn(II). In the case of Stropharia coronilla, the presence of Mn(II) led to a 20-fold increase of anthracene conversion. The effect of manganese could be attributed to the stimulation of manganese peroxidase (MnP). The maximum activity of MnP increased in S. rugosoannulata cultures from 10 U l(-1) in the absence of Mn(II) to 320 U l(-1) in Mn(II)-supplemented cultures. The latter degraded about 6% of a (14)C-labeled BaP into (14)CO(2) whereas only 0.7% was mineralized in the absence of Mn(II). In solid-state straw cultures, S. rugosoannulata, S. coronilla and Agrocybe praecox mineralized between 4 and 6% of (14)C-labeled BaP within 12 weeks.

  5. Biomass measurement by flow cytometry during solid-state fermentation of basidiomycetes.

    Science.gov (United States)

    Steudler, Susanne; Böhmer, Ulrike; Weber, Jost; Bley, Thomas

    2015-02-01

    Solid-state fermentation (SSF) is a robust process that is well suited to the on-site cultivation of basidiomycetes that produce enzymes for the treatment of lignocellulosics. Reliable methods for biomass quantification are essential for the analysis of fungal growth kinetics. However, direct biomass determination is not possible during SSF because the fungi grow into the substrate and use it as a nutrient source. This necessitates the use of indirect methods that are either very laborious and time consuming or can only provide biomass measurements during certain growth periods. Here, we describe the development and optimization of a new rapid method for fungal biomass determination during SSF that is based on counting fungal nuclei by flow cytometry. Fungal biomass was grown on an organic substrate and its concentration was measured by isolating the nuclei from the fungal hyphae after cell disruption, staining them with SYTOX(®) Green, and then counting them using a flow cytometer. A calibration curve relating the dry biomass of the samples to their concentrations of nuclei was established. Multiple buffers and disruption methods were tested. The results obtained were compared with values determined using the method of ergosterol determination, a classical technique for fungal biomass measurement during SSF. Our new approach can be used to measure fungal biomass on a range of different scales, from 15 mL cultures to a laboratory reactor with a working volume of 10 L (developed by the Research Center for Medical Technology and Biotechnology (fzmb GmbH)). © 2014 International Society for Advancement of Cytometry. © 2014 International Society for Advancement of Cytometry.

  6. Application of solid waste from anaerobic digestion of poultry litter in Agrocybe aegerita cultivation: mushroom production, lignocellulolytic enzymes activity and substrate utilization.

    Science.gov (United States)

    Isikhuemhen, Omoanghe S; Mikiashvili, Nona A; Kelkar, Vinaya

    2009-06-01

    The degradation and utilization of solid waste (SW) from anaerobic digestion of poultry litter by Agrocybe aegerita was evaluated through mushroom production, loss of organic matter (LOM), lignocellulolytic enzymes activity, lignocellulose degradation and mushroom nutrients content. Among the substrate combinations (SCs) tested, substrates composed of 10-20% SW, 70-80% wheat straw and 10% millet was found to produce the highest mushroom yield (770.5 and 642.9 g per 1.5 kg of substrate). LOM in all SCs tested varied between 8.8 and 48.2%. A. aegerita appears to degrade macromolecule components (0.6-21.8% lignin, 33.1-55.2% cellulose and 14-53.9% hemicellulose) during cultivation on the different SCs. Among the seven extracellular enzymes monitored, laccase, peroxidase and CMCase activities were higher before fruiting; while xylanase showed higher activities after fruiting. A source of carbohydrates (e.g., millet) in the substrate is needed in order to obtain yield and biological efficiency comparable to other commercially cultivated exotic mushrooms.

  7. Structure and Biochemestry of Laccases from the Lignin-Degrading Basidiomycete, Ganoderma lucidum

    Energy Technology Data Exchange (ETDEWEB)

    C.A.Reddy, PI

    2005-06-30

    and ligated G.lucidum DNA was done using ABI Geneamp XL PCR kit in Ribocycler. The 5 conserved copper binding region of laccase was used for designing forward primer (5TCGACAATTCTTTCCTGTACG3) and reverse primer (5 TGGAGATGGG ACACT GGCTTATC 3). The PCR profile was 95 C for 3min, 94 C for 1min, 57 C for 30 sec and 68 C for 5min. for 30 cycles, and the final extension was at 72 C for 10min. The resulting {approx}2.7 Kb inverse PCR fragment was cloned into ZERO TOPOII blunt ligation vector (INVITROGEN) and screened on Kanamycin plates. Selected putative clones containing inserts were digested with a battery of restriction enzymes and analyzed on 1% agarose gels. Restriction digestion of these clones with BamHI, PstI, SalI, PvuII, EcoRI, and XhoI revealed 8 distinct patterns suggesting gene diversity. Two clones were sequenced using overlapping primers on ABI system. The sequences were aligned using Bioedit program. The aa sequences of the clones were deduced by Genewise2 program using Aspergillus as the reference organism. Eukaryotic gene regulatory sequences were identified using GeneWise2 Program. Laccase sequence alignments and similarity indexes were calculated using ClustalW and BioEdit programs. Blast analysis of two distinct BamHI clones, lac1 and lac4, showed that the proteins encoded by these clones are fungal laccase sequences. The coding sequence of lac1gene is interrupted by 6 introns ranging in size from 37-55 nt and encodes a mature protein consisting of 456 aa (Mr: 50,160), preceded by a putative 37-aa signal sequence. This predicted Mr is in agreement with the range of Mrs previously reported by us for the laccases of G. lucidum. The deduced aa sequence of LAC1 showed relatively high degree of homology with laccases of other basidiomycetes. It showed 96% homology to full-length LAC4 protein and 47-53% similarity to unpublished partial laccase sequences of other G. lucidum strains. Among the other basidiomycete laccases, LAC1 showed the highest similarity

  8. Knowledge and use of edible mushrooms in two municipalities of the Sierra Tarahumara, Chihuahua, Mexico.

    Science.gov (United States)

    Quiñónez-Martínez, Miroslava; Ruan-Soto, Felipe; Aguilar-Moreno, Ivonne Estela; Garza-Ocañas, Fortunato; Lebgue-Keleng, Toutcha; Lavín-Murcio, Pablo Antonio; Enríquez-Anchondo, Irma Delia

    2014-09-17

    The Sierra Madre Occidental of Chihuahua in Northern Mexico is inhabited by indigenous Raramuris, mestizos, and other ethnic groups. The territory consists of canyons and ravines with pine, oak and pine-oak forests in the higher plateaus. A great diversity of potentially edible mushrooms is found in forests of the Municipalities of Bocoyna and Urique. Their residents are the only consumers of wild mushrooms in the Northern Mexico; they have a long tradition of collecting and eating these during the "rainy season." However, despite the wide diversity of edible mushrooms that grow in these areas, residents have a selective preference. This paper aims to record evidence of the knowledge and use of wild potentially edible mushroom species by inhabitants of towns in the Sierra Tarahumara of Chihuahua, Mexico. Using a semi-structured technique, we surveyed 197 habitants from seven locations in Urique, Bocoyna, and the Cusarare area from 2010 to 2012. Known fungi, local nomenclature, species consumed, preparation methods, appreciation of taste, forms of preservation, criteria for differentiating toxic and edible fungi, other uses, economic aspects, and traditional teaching were recorded. To identify the recognized species, photographic stimuli of 22 local edible species and two toxic species were used. The respondents reported preference for five species: Amanita rubescens, Agaricus campestris, Ustilago maydis, Hypomyces lactifluorum, and the Amanita caesarea complex. No apparent differences were found between ethnic groups in terms of preference, although mestizos used other species in Bocoyna (Boletus edulis and B. pinophilus). Some different uses of fungi are recognized by respondents, i.e. home decorations, medicine, as food in breeding rams, etc. The studied population shows a great appreciation towards five species, mainly the A. caesarea complex, and an apparent lack of knowledge of nearly 20 species which are used as food in other areas of Mexico. There are no

  9. Mushrooms and the radioactivity coming from Tchernobyl fallout

    International Nuclear Information System (INIS)

    2001-01-01

    In France, since the accident of Tchernobyl in 1986, the radiation regular monitoring of the food and the environment shows that the mushrooms present cesium 137 content levels upper than all the other agricultural products. This paper presents and explains the today and future situation

  10. Culinary-medicinal mushrooms: must action be taken?

    NARCIS (Netherlands)

    Griensven, van L.J.L.D.

    2009-01-01

    In the Western world, the mushroom industry suffers from overproduction. Expectations are stronger than reality, and as a result, production is too high and prices are too low. Because bulk production has taken the lead, which not only happens in the West, overproduction occurs regularly. Low

  11. Analysis of Edible Mushroom Marketing in Three Villages in Central ...

    African Journals Online (AJOL)

    This study examined the marketing of edible mushroom in three villages (Alesi, Ekukunela ... The socio-economic characteristics of sellers, profit margin and marketing ... One hundred and twenty respondents were interviewed at three different markets in three selected ... The concentration of sellers is low while entry is free.

  12. Fungal and mycotoxin assessment of dried edible mushroom in Nigeria

    DEFF Research Database (Denmark)

    Ezekiel, C.N.; Sulyok, M.; Frisvad, Jens Christian

    2013-01-01

    In order to determine whether dried mushrooms are a foodstuff that may be less susceptible to infection by toxigenic molds and consequently to mycotoxin contamination, 34 dried market samples were analyzed. Fungal population was determined in the samples by conventional mycological techniques...

  13. Effects of Porosity and Thermal Treatment on Hydration of Mushrooms

    NARCIS (Netherlands)

    Paudel, Ekaraj; Boom, R.M.; Sman, van der R.G.M.

    2016-01-01

    In this study, hydration of mushroom as a porous food material has been studied considering their biphasic character. It consists of a solid phase that consists of intertwined hyphae and having cell walls with a swellable polymeric matrix and a pore phase made up by the space in between the

  14. Effects of spent mushroom compost on quality and productivity of ...

    African Journals Online (AJOL)

    SMC), which is a waste product of mushroom processing through a year, on greenhouse cucumber growth as an organic matter source for the soil. The effects of SMC on several yield related characteristics, such as total yield, fruit width, fruit ...

  15. Performance of oyster mushroom (Pleurotus ostreatus) in different ...

    African Journals Online (AJOL)

    USER

    2012-05-08

    May 8, 2012 ... These mixtures were compressed by pressing down with bottle in transparent poly bags ... The bags were then opened after two weeks and left open for mushroom ..... results of this work are within the range they reported.The.

  16. The Mushroom Curriculum: Using Natural History to Teach Psychology.

    Science.gov (United States)

    Sommer, Robert

    1989-01-01

    Describes the development and content of a freshman seminar titled "The Psychology of Mushrooms," which teaches psychology as natural history. This approach allowed the course to proceed from concrete experience to general principals of perception, learning, social, and abnormal psychology. (Author/LS)

  17. Evaluating the production of Ganoderma mushroom on corn cobs ...

    African Journals Online (AJOL)

    The corn cobs and saw dust (control) were sterilized, inoculated under aseptic conditions in clear plastic bags and incubated at room temperature. Fruit bodies were observed within 30 to 50 days, results considerably shorter compared to when using saw dust, which can take up to four months before mushrooms are ...

  18. Evaluation on the effects of P. ostreatus spent mushroom compost ...

    African Journals Online (AJOL)

    Realization in minimizing production cost for in vitro culture had brought to a study on application of P. ostreatus spent mushroom compost (SMC). Sterile nodal explants was inoculated on different treatments with 15 replicates each. Treatments were MS medium supplemented with different concentrations of SMC (1 and 2 ...

  19. Mushrooms as Efficient Solar Steam-Generation Devices.

    Science.gov (United States)

    Xu, Ning; Hu, Xiaozhen; Xu, Weichao; Li, Xiuqiang; Zhou, Lin; Zhu, Shining; Zhu, Jia

    2017-07-01

    Solar steam generation is emerging as a promising technology, for its potential in harvesting solar energy for various applications such as desalination and sterilization. Recent studies have reported a variety of artificial structures that are designed and fabricated to improve energy conversion efficiencies by enhancing solar absorption, heat localization, water supply, and vapor transportation. Mushrooms, as a kind of living organism, are surprisingly found to be efficient solar steam-generation devices for the first time. Natural and carbonized mushrooms can achieve ≈62% and ≈78% conversion efficiencies under 1 sun illumination, respectively. It is found that this capability of high solar steam generation is attributed to the unique natural structure of mushroom, umbrella-shaped black pileus, porous context, and fibrous stipe with a small cross section. These features not only provide efficient light absorption, water supply, and vapor escape, but also suppress three components of heat losses at the same time. These findings not only reveal the hidden talent of mushrooms as low-cost materials for solar steam generation, but also provide inspiration for the future development of high-performance solar thermal conversion devices. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. Pro- and antioxidative properties of medicinal mushroom extracts

    NARCIS (Netherlands)

    Song, W.; Griensven, van L.J.L.D.

    2008-01-01

    Hot water extracts of 2 groups of medicinal mushrooms have been tested from the genera Agaricus, Antrodia, Auricularia, Coprinus, Cordyceps, Hericium, Grifola, Ganoderma, Lentinus, Phellinus, and Trametes for ROS-generating activity in human cells and for DPPH-TEAC antioxidant activity. Group 1

  1. Cultivation of Schizophyllum commune mushroom on different wood substrates

    Directory of Open Access Journals (Sweden)

    P.N. Dasanayaka

    2017-07-01

    Full Text Available Schizophyllum commune is an edible mushroom grown on wood under natural conditions. Present study focused on cultivation of S.commune on different wood substrates since it is not commercially cultivated. A pure culture of S. commune was obtained by growing a tissue of the mushroom on Potato Dextrose Agar (PDA medium. Spawns were produced by growing the mycelium on paddy grains. Mushroom was cultivated on sawdust of seven different wood substrates. The maximum yield was observed in sawdust of jackfruit (Artocarpusheterophyllus followed by sawdust of rambutan (Nepheliumlappaceum and country almond (Terminaliacatappa. A significant difference was not observed when mango (Mangiferaindica elephant apple (Dilleniaindica, tulip wood tree (Harpulliaarborea and thungfaa (Alstoniamacrophylla sawdust used as substrate. The lowest yield was observed in thungfaa (Alstoniamacrophylla sawdust. Effect of some additives on the yield was studied and significant difference in yield was observed when rice bran and used-tea leaves used as additives. Effect of rice bran on yield was studied using different ratios of sawdust to rice bran and the highest was observed in 2:1 ratio of sawdust to rice bran. The best incubating temperature for mycelial growth on the substrate was 350C. The composition of the mushroom on a dry weight basis was; 71.4% moisture, 23.35% crude protein and 6% ash. Tested wood species are promising substrates for cultivation of S.communeas cottage industry.

  2. Cultivation and bromatological analysis of the medicinal mushroom ...

    African Journals Online (AJOL)

    User

    2015-02-04

    Feb 4, 2015 ... African Journal of Biotechnology. Full Length Research Paper ... Both treatments were carried out in 10 repetitions, totaling 200 packages. ... The mushrooms showed high levels of ethereal extract, fibers and ... Nowadays, they have a guaranteed market in many ... Residues processing ..... Effect of different.

  3. Mushroom production in the faculty of agriculture teaching and ...

    African Journals Online (AJOL)

    The study was carried out in the Teaching and Research of the Faculty of Agriculture, University of Port Harcourt, Nigeria. The main objective was to conduct an economic assessment of mushroom production in the farm. The study utilized secondary data generated from the farm record of the farm. Gross margin model was ...

  4. Harm potential of magic mushroom use: A review

    NARCIS (Netherlands)

    van Amsterdam, Jan; Opperhuizen, Antoon; van den Brink, Wim

    2011-01-01

    In 2007, the Minister of Health of the Netherlands requested the CAM (Coordination point Assessment and Monitoring new drugs) to assess the overall risk of magic mushrooms. The present paper is an updated redraft of the review, written to support the assessment by CAM experts. It summarizes the

  5. Cultivation of mushroom ( Pleurotus ostreatus ) using corn cobs and ...

    African Journals Online (AJOL)

    An investigation was carried out on the cultivation of mushroom (Pleurotus ostreatus) using corn cobs and saw dust as the main substrates. Lignocellulosic wastes such as corn cobs and saw dust were packaged inside heat – resistant polythene bags and pasteurized before being seeded with 7.5% w/w millet spawn of ...

  6. Effect of mushroom ( Pleurotus tuber-regium ) inoculums on crude ...

    African Journals Online (AJOL)

    Pollution of soils by crude oil in Niger-Delta of Nigeria has brought untold hardship to the inhabitants of the region. This study was carried out in 2010/2011 and 2011/2012 to determine the effect of Pleurotus tuber-regium (mushroom) inoculums on crude oil polluted soil on stover and grain yields and as well as cob length ...

  7. Nigerian Mushrooms: Underutilized Non-Wood Forest Resources ...

    African Journals Online (AJOL)

    MICHAEL

    1 University of Benin, Faculty of Life Sciences, Department of Plant Biology and Biotechnology, P.M.B 1154, ... representation of Nigerian mushroom's diversity, .... Farm wastes: .... animals. Recently, Ganoderma species have been successfully tested in poultry farming for the ... capacity of birds in Nigeria (Ogbe et al., 2008).

  8. New Germplasms of the Culinary-Medicinal Button Mushroom, Agaricus bisporus (Agaricomycetes): Two Wild Strains from the Tibetan Plateau (China).

    Science.gov (United States)

    Li, Bin-Bin; Jiang, Si-Ping; Xu, Ai-Guo; Dorji, Phurbu; Wang, Wen-Jing; Wang, Xiao-Liang; Wei, Tie-Zheng; Zhang, Zu-Tang; Yao, Yi-Jian

    2017-01-01

    Agaricus bisporus is one of the most important commercially cultivated culinary-medicinal mushrooms worldwide. In China, most of the cultivated strains of the fungus were introduced from other countries and cultivated in the eastern provinces. In this study, 2 wild strains of A. bisporus, 2091 and 2094, isolated from fresh specimens collected from the Tibetan Plateau, were domesticated and cultivated alongside a commercial hybrid strain, As2796, in Lhasa, China, for comparison in order to provide new germplasms for cultivation. Basic characteristics, mushroom yield, dry weight, polysaccharide contents, and antioxidant activities of the tested strains were analyzed. Compared with strain As2796, the 2 wild strains displayed good values for mycelial growth, time to fruiting, mushroom yield, dry weight, and polysaccharide contents, and their basidiomata had distinct morphological characteristics (e.g., brown or pale brown caps with some white scales). In addition, the antioxidant activities (reducing power and DPPH radical scavenging effect) of strain 2094 were significantly higher than those of the other 2 strains. Domestication of the 2 wild strains would add more genetic variation into the germplasm of A. bisporus for cultivation, especially in China, and might help to address the problem inherent to the nearly monoculture crop lacking genetic diversity in China.

  9. Differential response of oyster shell powder on enzyme profile and nutritional value of oyster mushroom Pleurotus florida PF05.

    Science.gov (United States)

    Naraian, Ram; Narayan, Om Prakash; Srivastava, Jatin

    2014-01-01

    Oyster mushroom Pleurotus florida was cultivated on different combinations of wheat straw (WS) as basal substrate and oyster shell powder (OSP) supplement. The OSP supplementation considerably responded to different cultivation phases. The mycelium grew fast and showed rapid growth rate (8.91 mmd(-1)) in WS + OSP (97 + 3) combination while WS + OSP (92 + 8) showed maximum laccase (3.133 U/g) and Mn peroxidase (MnP) activities (0.091 U/g). The climax level of laccase (5.433 U/g) and MnP (0.097 U/g) was recorded during fruit body initiation in WS + OSP (97 + 3) and WS + OSP (98 + 2) combinations, respectively. The WS + OSP (97 + 3) combination represented the best condition for mushroom cultivation and produced the highest biological efficiency (147%). In addition, protein and lipid contents in fruit bodies were slightly improved in response to OSP. The carbohydrate was significantly increased by raising concentration of OSP. The highest values of protein, carbohydrate, and lipid noted were 31.3 μg/g, 0.0639 (g/g), and 0.373 (g/g) correspondingly. Conclusively it was evident that lower concentrations of OSP acted positively and relatively to higher concentrations and improved nutritional content which may suitably be used to enhance both yield and nutritional values of mushroom.

  10. Formulation and nutritional evaluation of a healthy vegetable soup powder supplemented with soy flour, mushroom, and moringa leaf.

    Science.gov (United States)

    Farzana, Tasnim; Mohajan, Suman; Saha, Trissa; Hossain, Md Nur; Haque, Md Zahurul

    2017-07-01

    The research study was conducted to develop a healthy vegetables soup powder supplemented with soy flour, mushroom, moringa leaf and compare its nutritional facts with locally available soup powders. Proximate analysis and sensory evaluation were done by standard method. In this study, moisture, ash, protein, fat, fiber, carbohydrate, and energy content were ranged from 2.83% to 5.46%, 9.39% to 16.48%, 6.92% to 16.05%, 4.22% to 6.39%, 0.22% to 1.61%, 58.81% to 75.41%, and 337.42 to 386.72 kcal/100 g, respectively. Highest content of vitamin D, minerals, protein, and fiber and lowest content of moisture, fat, and carbohydrate were found in the presently developed soy-mushroom-moringa soup powder compare to locally available soup powders. Vitamin C was also found significantly higher than locally available soup powders S1, S2, and S3. Heavy metals were not found in any of the soup powders. On the sensory and microbiological point of view, the presently developed soup powder was found highly acceptable up to 6 months. So, the developed soy-mushroom-moringa soup powder is nutritionally superior to locally available soup powders and sufficient to meet day-to-day nutritional requirements as a supplement.

  11. The influence of a whole food vegan diet with Nori algae and wild mushrooms on selected blood parameters.

    Science.gov (United States)

    Schwarz, Joachim; Dschietzig, Thomas; Schwarz, Jens; Dura, Andreas; Nelle, Esther; Watanabe, Fumio; Wintgens, Karl Florian; Reich, Michael; Armbruster, Franz Paul

    2014-01-01

    Vegan and vegetarian diets could overcome many diseases of civilization. This study examines whether a whole food vegan diet with Nori algae and wild mushrooms can provide a sufficient quantity of critical nutrients. Five blood samples (Baseline to Time 5) were taken over eight months from 75 subjects (10 vegans without B12 supplementation who consumed Nori algae and wild mushrooms, 20 vegans with supplementation, 40 vegetarians, 5 meat-eaters). Blood was analyzed for blood cell counts, total vitamin B12, holotranscobalamin, homocysteine, methylmalonic acid, vitamin B6, folic acid, ferritin, TSH, zinc, creatinine, vitamin D2 and D3. In the vegan group without supplementation, all means were within the tolerance (holotranscobalamin, homocystein) or normal, except for elevated methylmalonic acid and diminished vitamin D. This group developed significantly higher vitamin D2 levels. The vegan group with B12 supplementation and the vegetarian group showed normal values for all parameters. Vegans following a whole food diet had a borderline supply of vitamin B12. Folic acid, vitamin B6, TSH, iron metabolism, and the blood count were in the normal range. Vegans taking dietary supplements demonstrated satisfactory overall results. An ingestion of sundried mushrooms can contribute to the supply of vitamin D.

  12. Screening of antagonistic bacteria against the green mold disease (Trichoderma harzianum Rifai of Grey Oyster Mushroom (Pleurotus pulmonarius (Fr. Quel.

    Directory of Open Access Journals (Sweden)

    Nualsri, C.

    2005-01-01

    Full Text Available A total of 174 strains of bacteria antagonistic against the green mold (Trichoderma harzianum, isolated from cultivating bags and fruiting bodies of the mushrooms, were screened for effects on mushroom mycelia and ability to control the green mold disease. Twenty-eight of them promoted the primodia formation of the Pleurotus pulmonarius mycelia on agar plates. Twenty-two isolates were selected and further tested in a mushroom house. Cell suspension of each isolate was prepared and sprayed onto the spawn surface of P. pulmonarius. Fifteen isolates shortened the times required from watering to 2nd and 3rd flushing and increased yield of the basidiocarps by 1.1-34.3% over 30 days. Six isolates of bacteria which showed an inhibitory effect against T. harzianum, enhanced primordia formation and increased yield of P. pulmonarius were selected and used for control testing in a cultivation house. The suspension of each isolate was sprayed onto the spawn surface immediately after exposure to the air in the mushroom house, followed by spore suspension of T. harzianum two days later. The number of infected bags was counted at 30 days after inoculation and the cumulative yield was compared after 60 days. The results showed that bacteria isolate B012-022 was highly effective in suppressing the green mold disease.Only 6.7% of the cultivating bags were found to be infected by T. harzianum when bacteria isolate B012-022 was applied. Cumulative yield obtained from 900 g of 94% sawdust + 5% rice bran + 1% Ca(OH2 was 300.0 g/bag after 60 days, 71.1% higher than the bags infected by the green mold and without bacterial spraying. Identification of the six bacterial isolates showed all to be Bacillus spp.

  13. Mushroom drying with solar assisted heat pump system

    International Nuclear Information System (INIS)

    Şevik, Seyfi; Aktaş, Mustafa; Doğan, Hikmet; Koçak, Saim

    2013-01-01

    Highlights: • Experimental investigation of a simple and cost effective solar assisted heat pump system. • Developing of a computer program for a drying system with different scenarios by using PLC. • Obtained less energy input with high coefficients of performance of system and more quality products. • Determination of mushroom drying properties such as moisture content, moisture ratio and drying ratio. - Abstract: In this study, a simple and cost effective solar assisted heat pump system (SAHP) with flat plate collectors and a water source heat pump has been proposed. Mushroom drying was examined experimentally in the drying system. Solar energy (SE) system and heat pump (HP) system can be used separately or together. A computer program has been developed for the system. Drying air temperature, relative humidity, weight of product values, etc. were monitored and controlled with different scenarios by using PLC. This system is cheap, good quality and sustainable and it is modeled for good quality product and increased efficiency. Thus, products could be dried with less energy input and more controlled conditions. Mushrooms were dried at 45 °C and 55 °C drying air temperature and 310 kg/h mass flow rate. Mushrooms were dried from initial moisture content 13.24 g water/g dry matter (dry basis) to final moisture content 0.07 g water/g dry matter (dry basis). Mushrooms were dried by using HP system, SE system and SAHP system respectively at 250–220 min, at 270–165 min and at 230–190 min. The coefficients of performance of system (COP) are calculated in a range from 2.1 to 3.1 with respect to the results of experiments. The energy utilization ratios (EURs) were found to vary between 0.42 and 0.66. Specific moisture extraction rate (SMER) values were found to vary between 0.26 and 0.92 kg/kW h

  14. Mercury in certain boletus mushrooms from Poland and Belarus.

    Science.gov (United States)

    Falandysz, Jerzy; Krasińska, Grażyna; Pankavec, Sviatlana; Nnorom, Innocent C

    2014-01-01

    This paper reports the results of the study of Hg contents of four species of Boletus mushroom (Boletus reticulatus Schaeff. 1763, B. pinophilus Pilát & Dermek 1973, B. impolitus Fr. 1838 and B. luridus Schaeff. 1774) and the surface soils (0-10 cm layer, ∼100 g) samples beneath the mushrooms from ten forested areas in Poland and Belarus by cold-vapour atomic absorption spectroscopy. The ability of the species to bioconcentrate Hg was calculated (as the BCF) while Hg intakes from consumption of these mushroom species were also estimated. The median Hg content of the caps of the species varied between 0.38 and 4.7 mg kg(-1) dm; in stipes between 0.13 and 2.5 mg kg(-1) dm and in the mean Hg contents of soils varied from 0.020 ± 0.01 mg kg(-1) dm to 0.17 ± 0.10 mg kg(-1) dm which is considered as "background" Hg level. The median Hg content of caps of B. reticulatus and B. pinophilus were up to 4.7 and 3.6 mg kg(-1) dm, respectively, and they very efficiently bioaccumulate Hg with median BCF values of up to 130 for caps and 58 for stipes. The caps and stipes of these mushrooms if eaten will expose consumer to elevated dose of total Hg estimated at 1.4 mg for caps of Boletus reticulatus from the Kacze Łęgi site, which is a nature reserve area. Nevertheless, the occasional consumption of the valued B. reticulatus and B. pinophilus mushrooms maybe safe.

  15. Cloning and heterologous expression of two aryl-aldehyde dehydrogenases from the white-rot basidiomycete Phanerochaete chrysosporium

    Energy Technology Data Exchange (ETDEWEB)

    Nakamura, Tomofumi [Faculty of Agriculture, Kyushu University, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581 (Japan); Fukuoka Institute of Health and Environmental Sciences, 39 Mukaizano, Dazaifu-shi, Fukuoka 818-0135 (Japan); Ichinose, Hirofumi [Faculty of Agriculture, Kyushu University, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581 (Japan); Wariishi, Hiroyuki, E-mail: hirowari@agr.kyushu-u.ac.jp [Faculty of Agriculture, Kyushu University, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581 (Japan); Bio-Architecture Center, Kyushu University, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581 (Japan); Innovation Center for Medical Redox Navigation, Kyushu University, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581 (Japan)

    2010-04-09

    We identified two aryl-aldehyde dehydrogenase proteins (PcALDH1 and PcALDH2) from the white-rot basidiomycete Phanerochaete chrysosporium. Both PcALDHs were translationally up-regulated in response to exogenous addition of vanillin, one of the key aromatic compounds in the pathway of lignin degradation by basidiomycetes. To clarify the catalytic functions of PcALDHs, we isolated full-length cDNAs encoding these proteins and heterologously expressed the recombinant enzymes using a pET/Escherichia coli system. The open reading frames of both PcALDH1 and PcALDH2 consisted of 1503 nucleotides. The deduced amino acid sequences of both proteins showed high homologies with aryl-aldehyde dehydrogenases from other organisms and contained ten conserved domains of ALDHs. Moreover, a novel glycine-rich motif 'GxGxxxG' was located at the NAD{sup +}-binding site. The recombinant PcALDHs catalyzed dehydrogenation reactions of several aryl-aldehyde compounds, including vanillin, to their corresponding aromatic acids. These results strongly suggested that PcALDHs metabolize aryl-aldehyde compounds generated during fungal degradation of lignin and various aromatic xenobiotics.

  16. Mineralisation of 14C-labelled synthetic lignin and ligninolytic enzyme activities of litter-decomposing basidiomycetous fungi.

    Science.gov (United States)

    Steffen, K T; Hofrichter, M; Hatakka, A

    2000-12-01

    Within a screening program, 27 soil litter-decomposing basidiomycetes were tested for ligninolytic enzyme activities using agar-media containing 2,2'-azinobis(3-ethylbenzthiazoline-6-sulphonate), a humic acid or Mn2+ ions as indicator substrates. Most active species were found within the family Strophariaceae (Agrocybe praecox, Stropharia coronilla, S. rugosoannulata) and used for mineralisation experiments with a 14C-ring-labelled synthetic lignin (14C-DHP). The fungi mineralised around 25% of the lignin to 14CO2 within 12 weeks of incubation in a straw environment; about 20% of the lignin was converted to water-soluble fragments. Mn-peroxidase was found to be the predominant ligninolytic enzyme of all three fungi in liquid culture and its production was strongly enhanced in the presence of Mn2+ ions. The results of this study demonstrate that certain ubiquitous litter-decomposing basidiomycetes possess ligninolytic activities similar to the wood-decaying white-rot fungi, the most efficient lignin degraders in nature.

  17. Implementation of Optical Meanders in the Temperature Measurement of the Extermination of Basidiomycete Serpula Lacrymans Using Microwave Heating

    Directory of Open Access Journals (Sweden)

    Andrej Liner

    2013-01-01

    Full Text Available The dry rot basidiomycete Serpula lacrymans is the most common and destructive wood decay fungus, which attacks and damages houses and other wooden construction worldwide [1], [2]. Effective chemicals have been developed for remediation and treatment of dry rot outbreaks and for wood preservation against dry rot, but in most cases, control is most economically achieved by environmental management to avoid creating favourable growth conditions for the fungus [3]. Thermal treatment using microwaves represents one of possible approaches in fungal growth control and refurbishment of damaged wooden constructions. One of the possibilities, how to monitor this whole process seems to be the use of Optical fiber DTS (Distribution Temperature Systems. The Optical fiber DTS are unique distributed temperature systems using optical fiber as a sensor. Due to the electromagnetic resistance is this system suitable for the monitoring of these processes. This article deals with application of optical meanders in the temperature measurement during the extermination of basidiomycete Serpula lacrymans using microwave heating. Because of the adverse effect of microwave radiation on all other types of temperature sensors.

  18. Cloning and heterologous expression of two aryl-aldehyde dehydrogenases from the white-rot basidiomycete Phanerochaete chrysosporium

    International Nuclear Information System (INIS)

    Nakamura, Tomofumi; Ichinose, Hirofumi; Wariishi, Hiroyuki

    2010-01-01

    We identified two aryl-aldehyde dehydrogenase proteins (PcALDH1 and PcALDH2) from the white-rot basidiomycete Phanerochaete chrysosporium. Both PcALDHs were translationally up-regulated in response to exogenous addition of vanillin, one of the key aromatic compounds in the pathway of lignin degradation by basidiomycetes. To clarify the catalytic functions of PcALDHs, we isolated full-length cDNAs encoding these proteins and heterologously expressed the recombinant enzymes using a pET/Escherichia coli system. The open reading frames of both PcALDH1 and PcALDH2 consisted of 1503 nucleotides. The deduced amino acid sequences of both proteins showed high homologies with aryl-aldehyde dehydrogenases from other organisms and contained ten conserved domains of ALDHs. Moreover, a novel glycine-rich motif 'GxGxxxG' was located at the NAD + -binding site. The recombinant PcALDHs catalyzed dehydrogenation reactions of several aryl-aldehyde compounds, including vanillin, to their corresponding aromatic acids. These results strongly suggested that PcALDHs metabolize aryl-aldehyde compounds generated during fungal degradation of lignin and various aromatic xenobiotics.

  19. Biological effects and ISSR analysis of 60Co γ-irradiation on edible mushroom mycelia

    International Nuclear Information System (INIS)

    Cai Weiming; Feng Weilin; Jin Qunli; Fan Lijun; Wu Yongzhi

    2009-01-01

    Mycelia of Agaricus bitorquis, Flammulina velutipes and Pleurotus eryngii were irradiated by 60 Co γ-rays at the dose of 0, 200, 500 and 800 Gy. The results showed that irradiation inhibited their mycelia growth positively. Of the three edible mushroom, Agaricus bitorquis was the most sensitive one to irradiation, its mycelia died at the dose of 800 Gy. Germination rate, growth rate and vigor of all mycelia irradiated with un-lethal doses increased along with the times of transfer of culture. Electrical conductivity (EC) analysis showed that irradiation increased EC of leaching solution of mycelia positively. The EC of leaching solution of mycelia of Flammulina velutipes and Pleurotus eryngii irradiated with 500 Gy, Agaricus bitorquis irradiated with 200 Gy, were significantly higher than CK. ISSR analysis revealed that 60 Co γ irradiation effect on DNA variation of Agaricus bitorquis, Flammulina velutipes and pleurotus eryngii mycelia in varying degrees. Number of polymorphic bands changed after irradiation. Flawing bands and increasing bands were observed in amplified bands of 14 selected ISSR primers. The ISSR variation rates of Agaricus bitorquis for 200 Gy and 599 Gy treatments were 33.3% and 50.5%; the ISSR variation rates of Flammulina velutipes for 200 Gy, 500 Gy and 800 Gy treatments were 2.3%, 2.3% and 3.1%, that of Pleurotus eryngii were 8.6%, 13.4% and 20.0%. It is possible to use 60 Co γ irradiation as a mutagen to screen new mushroom varieties. (authors)

  20. Ultrasonically extracted β-d-glucan from artificially cultivated mushroom, characteristic properties and antioxidant activity.

    Science.gov (United States)

    Alzorqi, Ibrahim; Sudheer, Surya; Lu, Ting-Jang; Manickam, Sivakumar

    2017-03-01

    Ganoderma mushroom cultivated recently in Malaysia to produce chemically different nutritional fibers has attracted the attention of the local market. The extraction methods, molecular weight and degree of branching of (1-3; 1-6)-β-d-glucan polysaccharides is of prime importance to determine its antioxidant bioactivity. Therefore three extraction methods i.e. hot water extraction (HWE), soxhlet extraction (SE) and ultrasound assisted extraction (US) were employed to study the total content of (1-3; 1-6)-β-d-glucans, degree of branching, structural characteristics, monosaccharides composition, as well as the total yield of polysaccharides that could be obtained from the artificially cultivated Ganoderma. The physical characteristics by HPAEC-PAD, HPGPC and FTIR, as well as the antioxidant in vitro assays of DPPH scavenging activity and ferric reducing power (FRAP) indicated that (1-3; 1-6)-β-d-glucans of Malaysian mushroom have better antioxidant activity, higher molecular weight and optimal degree of branching when extracted by US in comparison with conventional methods. Copyright © 2016 Elsevier B.V. All rights reserved.

  1. Radiosensitivity study and radiation effects on morphology characterization of grey oyster mushroom Pleurotus sajor-caju

    Energy Technology Data Exchange (ETDEWEB)

    Rashid, Rosnani Abdul; Awang, Mat Rasol; Mohamad, Azhar; Mutaat, Hassan Hamdani; Maskom, Mohd Meswan [Bioprocess Group, Agrotechnology and Biosciences Division, Malaysian Nuclear Agency, Bangi 43600, Selangor (Malaysia); Daud, Fauzi; Senafi, Sahidan [School of Bioscience and Biotechnology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, Bangi 43600, Selangor (Malaysia)

    2014-09-03

    Radiosensitive dosage and morphology characterization of irradiated grey oyster mushroom Pleurotus sajor-caju by gamma rays was investigated due to effects of irradiation. In order to establish the effect, mycelium of P. sajor-caju was irradiated by gamma rays at dose 0.1 to 8.0 kGy with dose rate 0.227 Gy sec{sup −1}. The irradiation of mycelia was carried out at the radiation facility in Malaysian Nuclear Agency. The radiosensitivity study was performed by evaluating the percentage of survival irradiated mycelia. The lethal dose of the mycelium P. sajor-caju was determined at 4.0 kGy and LD{sub 50} to be equal at 2.2 kGy. The radiation effects on morphology were evaluated based on growth rate of irradiated mycelia, mycelia types, colonization period on substrate, morphology of fruit bodies and yields. The results shown growth rate of irradiated mycelium was slightly lower than the control and decreased as the dose increased. Irradiation was found can induced the primordia formation on PDA and the BE of irradiated seed is higher than to control. The irradiation is proven to be useful for generating new varieties of mushroom with commercial value to the industry.

  2. A Study on Recycling of Spent Mushroom Substrate to Prepare Chars and Activated Carbon

    Directory of Open Access Journals (Sweden)

    Yuhui Ma

    2014-05-01

    Full Text Available Chars were obtained from spent mushroom substrate (SMS via pyrolysis. It was found that as the pyrolysis temperature increased from 400 to 700 °C, the char yield decreased from 45.10 to 33.79 wt.% and the higher heating value increased from 17.32 to 22.72 MJ/kg. The largest BET surface area (13 m2/g was created at 500 °C. Hydrogen atoms were continuously lost during pyrolysis, whereas oxygen atoms were difficult to eliminate. Whewellite, calcite, lime, and quartz were the minerals in the chars, and their forms and crystallinity changed with changing pyrolysis temperature. Activated carbon with a BET surface area of 1023 m2/g and a total pore volume of 0.595 cm3/g was obtained from the char prepared at 500 °C. Its characteristics were studied by N2-adsorption, Fourier transform infrared spectroscopy (FTIR, and X-ray diffraction (XRD. The pyrolysis and KOH-activation processes were investigated by thermogravimetric analysis (TGA. The results showed that the pyrolysis of SMS occurred primarily between 217 and 375 °C and that the energies needed for the pyrolysis reactions were relatively low due to the prior mushroom cultivation. Furthermore, lignin was incompletely decomposed in the char prepared at 500 °C, and KOH suppressed tar evolution and reduced the energy needed to decompose the residual lignin during activation.

  3. Screening of Lignocellulose-Degrading Superior Mushroom Strains and Determination of Their CMCase and Laccase Activity

    Directory of Open Access Journals (Sweden)

    Li Fen

    2014-01-01

    Full Text Available In order to screen lignocellulose-degrading superior mushroom strains ten strains of mushrooms (Lentinus edodes939, Pholiota nameko, Lentinus edodes868, Coprinus comatus, Macrolepiota procera, Auricularia auricula, Hericium erinaceus, Grifola frondosa, Pleurotus nebrodensis, and Shiraia bambusicola were inoculated onto carboxymethylcellulose agar-Congo red plates to evaluate their ability to produce carbomethyl cellulase (CMCase. The results showed that the ratio of transparent circle to mycelium circle of Hericium erinaceus was 8.16 (P<0.01 higher than other strains. The filter paper culture screening test showed that Hericium erinaceus and Macrolepiota procera grew well and showed extreme decomposition of the filter paper. When cultivated in guaiacol culture medium to detect their abilities to secrete laccase, Hericium erinaceus showed the highest ability with the largest reddish brown circles of 4.330 cm. CMCase activity determination indicated that Coprinus comatus and Hericium erinaceus had the ability to produce CMCase with 33.92 U/L on the 9th day and 22.58 U/L on the 10th day, respectively, while Coprinus comatus and Pleurotus nebrodensis had the ability to produce laccase with 496.67 U/L and 489.17 U/L on the 16th day and 18th day. Based on the results, Coprinus comatus might be the most promising lignocellulose-degrading strain to produce both CMCase and laccase at high levels.

  4. Structure, organization, and transcriptional regulation of a family of copper radical oxidase genes in the lignin-degrading basidiomycete Phanerochaete chrysosporium

    Science.gov (United States)

    Amber Vanden Wymelenberg; Grzegorz Sabat; Michael Mozuch; Philip J. Kersten; Dan Cullen; Robert A. Blanchette

    2006-01-01

    The white rot basidiomycete Phanerochaete chrysosporium produces an array of nonspecific extracellular enzymes thought to be involved in lignin degradation, including lignin peroxidases, manganese peroxidases, and the H2O2-generating copper radical oxidase, glyoxal oxidase (GLX). Preliminary analysis of the P. chrysosporium draft genome had identified six sequences...

  5. Effect of long-term preservation of basidiomycetes on perlite in liquid nitrogen on their growth, morphological, enzymatic and genetic Characteristics

    Czech Academy of Sciences Publication Activity Database

    Homolka, Ladislav; Lisá, Ludmila; Eichlerová, Ivana; Valášková, Vendula; Baldrian, Petr

    2010-01-01

    Roč. 114, 11-12 (2010), s. 929-935 ISSN 1878-6146 R&D Projects: GA MŠk LC06066 Institutional research plan: CEZ:AV0Z50200510 Keywords : Basidiomycetes * Cryopreservation * Enzymes Subject RIV: EE - Microbiology, Virology

  6. Application of Tragacanth gum impregnated with Satureja khuzistanica essential oil as a natural coating for enhancement of postharvest quality and shelf life of button mushroom (Agaricus bisporus).

    Science.gov (United States)

    Nasiri, M; Barzegar, M; Sahari, M A; Niakousari, M

    2018-01-01

    The effect of Tragacanth gum (TG) coating incorporated with 100, 500 and 1000ppm Satureja khuzistanica essential oil (SEO) on the postharvest quality and shelf life of button mushroom (Agaricus bisporus) stored at 4±1°C for 16days was investigated. Weight loss, firmness, browning index (BI), total phenolics, ascorbic acid, microbial and sensory quality were measured. The results indicated that treatment with TG containing SEO (TGSEO) maintained 92.4% tissue firmness, and reduced microorganism counts, such as yeasts and molds and Pseudomonas, compared to uncoated samples. Furthermore, mushrooms treated with TGSEO coating exhibited up to 57.1% decreased in BI, significantly higher levels of total phenolics (85.6%) and ascorbic acid accumulation (71.8%) than control and its efficiency was better than that TG coating alone. Sensory evaluation demonstrated the capability of TGSEO coating for preserving the quality of mushroom during the storage. The results obtained endorse that application of TGSEO coating might be a simple and effective technique for prolonging their postharvest shelf life of mushroom by up to 16days. Copyright © 2017 Elsevier B.V. All rights reserved.

  7. Mushroom poisoning in Ireland: the collaboration between the National Poisons Information Centre and expert mycologists.

    LENUS (Irish Health Repository)

    Cassidy, Nicola

    2012-02-01

    BACKGROUND: Occasionally, mycologist assistance is requested to reliably identify mushroom species in symptomatic cases where there is a concern that a toxic species is involved. The aim of this study was to describe the epidemiology of mushroom poisoning in Ireland, to describe the working arrangement between the National Poisons Information Centre (NPIC) and professional mycologists and to present a case series detailing the circumstances when mycologists were consulted. METHODS: Computerised records from 1 January 2004 to 31 December 2009 were retrospectively reviewed and data on patient demographics, circumstances, and mushroom species collated. In 1999, the NPIC established a national registry of volunteer professional mycologists who are available 24 h\\/day for mushroom identification. The NPIC staff liaises directly with the mycologist and arranges transport of mushroom material. Digital photographic images are requested if there is likely to be a delay in arranging transportation of mushroom material, and the images are subsequently emailed to a mycologist. Five cases of suspected mushroom poisoning were chosen to demonstrate the inter-professional collaboration between the NPIC and mycologists. RESULTS: From 2004 to 2009, the NPIC was consulted about 70 cases of suspected mushroom exposures. Forty-five children ingested unknown mushrooms, 12 adults and 2 children ingested hallucinogenic mushrooms and 11 adults ingested wild toxic mushrooms that were incorrectly identified or confused with edible species. The mycologists were consulted 10 times since 1999. In this series, Amanita species were identified in two cases. In three cases, the species identified were Clitocybe nebularis, Coprinus comatus and Panaeolina foenisecii, respectively, and serious poisoning was excluded. Incorrect mushroom identification by a health care professional using the Internet occurred in two cases. The mycologists assisted Poisons Information Centres in Northern Ireland and the

  8. Mushroom poisoning in Ireland: The collaboration between the National Poisons Information Centre and expert mycologists.

    LENUS (Irish Health Repository)

    Cassidy, Nicola

    2011-03-01

    Background. Occasionally, mycologist assistance is requested to reliably identify mushroom species in symptomatic cases where there is a concern that a toxic species is involved. The aim of this study was to describe the epidemiology of mushroom poisoning in Ireland, to describe the working arrangement between the National Poisons Information Centre (NPIC) and professional mycologists and to present a case series detailing the circumstances when mycologists were consulted. Methods. Computerised records from 1 January 2004 to 31 December 2009 were retrospectively reviewed and data on patient demographics, circumstances, and mushroom species collated. In 1999, the NPIC established a national registry of volunteer professional mycologists who are available 24 h\\/day for mushroom identification. The NPIC staff liaises directly with the mycologist and arranges transport of mushroom material. Digital photographic images are requested if there is likely to be a delay in arranging transportation of mushroom material, and the images are subsequently emailed to a mycologist. Five cases of suspected mushroom poisoning were chosen to demonstrate the inter-professional collaboration between the NPIC and mycologists. Results. From 2004 to 2009, the NPIC was consulted about 70 cases of suspected mushroom exposures. Forty-five children ingested unknown mushrooms, 12 adults and 2 children ingested hallucinogenic mushrooms and 11 adults ingested wild toxic mushrooms that were incorrectly identified or confused with edible species. The mycologists were consulted 10 times since 1999. In this series, Amanita species were identified in two cases. In three cases, the species identified were Clitocybe nebularis, Coprinus comatus and Panaeolina foenisecii, respectively, and serious poisoning was excluded. Incorrect mushroom identification by a health care professional using the Internet occurred in two cases. The mycologists assisted Poisons Information Centres in Northern Ireland

  9. Use of modified atmosphere packaging to preserve mushroom quality during storage.

    Science.gov (United States)

    Palacios, Irene; Moro, Carlos; Lozano, Miguel; D'Arrigo, Matilde; Guillamón, Eva; García-Lafuente, Ana; Villares, Ana

    2011-09-01

    Mushrooms have attracted much attention due to their excellent nutritional and sensory properties. However, they are highly perishable and rapidly lose their organoleptic characteristics. Many methods have been employed for mushroom storage, such as packaging, blanching, canning, or freeze drying. Among them, modified atmosphere packaging (MAP) has been widely employed for preserving fresh mushrooms. MAP provides an affordable packaging system that partly avoids enzymatic browning, fermentation and other biochemical processes by maintaining a controlled gas atmosphere. Several factors, including optimum CO2 and O2 partial pressures, permeability, package material, thickness, or product weight, must be considered in order to design a suitable modified atmosphere package for mushrooms. Thus, different strategies are available to preserve mushroom quality after harvest. The article presents some promising patents on use of modified atmosphere packaging to preserve mushroom quality during storage.

  10. Wild mushrooms in Ethiopia: A review and synthesis for future perspective

    International Nuclear Information System (INIS)

    Dejene, T.; Oria-de-Rueda, J.A.; Martín-Pinto, P.

    2017-01-01

    Aim of study: To review and provide all-purpose information about wild mushrooms in Ethiopia and to create awareness for conservation and use of mycological resources. Area of study: We focused mainly on Ethiopia, where information about wild mushrooms is scanty and their status is unknown under the rampant degradation of the habitats. Main results: We reviewed all relevant references related to wild mushrooms and their ecological niches, cultural practices and species used for cultivation as well as the anthropogenic factors affecting the conservation of fungal diversity. Research highlights: This review summarizes issues related to the diversity of wild mushrooms, the main ecological niches and their associated fungal species, and mushroom cultivation practices in Ethiopia. Moreover, threats and the need for future conservation of wild mushrooms in the country are also reported. This review paper can serve as base line information and indicator for further mycological studies in Ethiopia as well as in other developing countries with similar scenarios.

  11. Wild mushrooms in Ethiopia: A review and synthesis for future perspective

    Energy Technology Data Exchange (ETDEWEB)

    Dejene, T.; Oria-de-Rueda, J.A.; Martín-Pinto, P.

    2017-11-01

    Aim of study: To review and provide all-purpose information about wild mushrooms in Ethiopia and to create awareness for conservation and use of mycological resources. Area of study: We focused mainly on Ethiopia, where information about wild mushrooms is scanty and their status is unknown under the rampant degradation of the habitats. Main results: We reviewed all relevant references related to wild mushrooms and their ecological niches, cultural practices and species used for cultivation as well as the anthropogenic factors affecting the conservation of fungal diversity. Research highlights: This review summarizes issues related to the diversity of wild mushrooms, the main ecological niches and their associated fungal species, and mushroom cultivation practices in Ethiopia. Moreover, threats and the need for future conservation of wild mushrooms in the country are also reported. This review paper can serve as base line information and indicator for further mycological studies in Ethiopia as well as in other developing countries with similar scenarios.

  12. Segmentation of Mushroom and Cap width Measurement using Modified K-Means Clustering Algorithm

    Directory of Open Access Journals (Sweden)

    Eser Sert

    2014-01-01

    Full Text Available Mushroom is one of the commonly consumed foods. Image processing is one of the effective way for examination of visual features and detecting the size of a mushroom. We developed software for segmentation of a mushroom in a picture and also to measure the cap width of the mushroom. K-Means clustering method is used for the process. K-Means is one of the most successful clustering methods. In our study we customized the algorithm to get the best result and tested the algorithm. In the system, at first mushroom picture is filtered, histograms are balanced and after that segmentation is performed. Results provided that customized algorithm performed better segmentation than classical K-Means algorithm. Tests performed on the designed software showed that segmentation on complex background pictures is performed with high accuracy, and 20 mushrooms caps are measured with 2.281 % relative error.

  13. Wild mushrooms in Ethiopia: A review and synthesis for future perspective

    Directory of Open Access Journals (Sweden)

    Tatek Dejene

    2017-05-01

    Full Text Available Aim of study: To review and provide all-purpose information about wild mushrooms in Ethiopia and to create awareness for conservation and use of mycological resources. Area of study: We focused mainly on Ethiopia, where information about wild mushrooms is scanty and their status is unknown under the rampant degradation of the habitats. Main results: We reviewed all relevant references related to wild mushrooms and their ecological niches, cultural practices and species used for cultivation as well as the anthropogenic factors affecting the conservation of fungal diversity. Research highlights: This review summarizes issues related to the diversity of wild mushrooms, the main ecological niches and their associated fungal species, and mushroom cultivation practices in Ethiopia. Moreover, threats and the need for future conservation of wild mushrooms in the country are also reported. This review paper can serve as base line information and indicator for further mycological studies in Ethiopia as well as in other developing countries with similar scenarios.

  14. Gamma irradiation protects oleic acid from oxidation: an experiment in Lactarius deliciosus wild mushroom

    OpenAIRE

    Fernandes, Ângela; Oliveira, M.B.P.P.; Antonio, Amilcar L.; Martins, Anabela; Ferreira, Isabel C.F.R.

    2012-01-01

    The short shelf-life of mushrooms is an obstacle to the distribution and marketing of the fresh product. Thus, prolonging postharvest storage, while preserving their quality, would benefit the mushroom industry as well as consumers [1]. There has been extensive research on finding the most appropriate technology for mushrooms preservation and a particular interest arises for wild species. Treatment by irradiation emerges as a possible conservation technique that has been tested successfully i...

  15. Determination of cesium and selenium in cultivated mushrooms using radionuclide X-ray fluorescence technique

    International Nuclear Information System (INIS)

    Racz, L.; Bumbalova, A.; Harangozo, M.; Toelgyessy, J.; Tomecek, O.

    2000-01-01

    Cesium and selenium intake of cultivated mushrooms (Agaricus bisporus), with these elements previously added to culture medium, has been examined from the viewpoint of health- and environmental protection. The process of measuring has been carried out by the radionuclide X-ray fluorescence technique. Treatments of the elementary substance with Se salt appears to influence the Se content of the mushrooms to a significant extent. Cs intake is of considerable importance, as this element is accumulated by mushrooms. (author)

  16. The pathogenic fungi in mushroom cultivation of Agaricus bisporus (Lange.) Imbach.

    OpenAIRE

    Agata Tekiela

    2012-01-01

    The research was conducted in a mushroom growing facility located near Rzeszów, consisting of three production cycles. The number and composition of microorganisms which accompany the mushroom cultivation depended on the healthiness of: the compost, casing and spawn of Agaricus bisporus. The presence of pathogenic fungi in the cultivation halls at the beginning of the production cycle is a serious threat to the cultivation of common mushroom because their rapid development shortens the span o...

  17. Growth and yield performance of Pleurotus ostreatus (Jacq. Fr.) Kumm (oyster mushroom) on different substrates

    OpenAIRE

    Girmay, Zenebe; Gorems, Weldesemayat; Birhanu, Getachew; Zewdie, Solomon

    2016-01-01

    Mushroom cultivation is reported as an economically viable bio-technology process for conversion of various lignocellulosic wastes. Given the lack of technology know-how on the cultivation of mushroom, this study was conducted in Wondo Genet College of Forestry and Natural Resource, with the aim to assess the suitability of selected substrates (agricultural and/or forest wastes) for oyster mushroom cultivation. Accordingly, four substrates (cotton seed, paper waste, wheat straw, and sawdust) ...

  18. Contents of trace elements in meadow mushrooms as results of PIXE, NAA and AAS measurements

    International Nuclear Information System (INIS)

    Urban, J.; Sieniawski, J.

    1992-01-01

    Contents of heavy elements in mushrooms from the Dresden area and from some parts of Poland, by use of three methods of measurement (PIXE, AAS and NAA) were determined, with the special interest focused on wild growing and cultivated meadow mushrooms. The ability for accumulation of Se, Cu, Ag and Cu was established. In some wild growing mushrooms the values of Cd, Hg, As and Pb exceeded allowed limits for human nutrition. (author). 16 refs, 1 fig., 5 tabs

  19. Nicotine in dried boletus mushrooms - Causes for contamination must be determined

    OpenAIRE

    German Federal Institute for Risk Assessment

    2009-01-01

    Recently, nicotine has been detected in samples of dried boletus mushrooms. In large doses, nicotine is a strong neurotoxin and natural component of the tobacco plant. Yet food supply plants such as potatoes, tomatoes, aubergines and cauliflower also contain very small amounts of the substance. The cause of nicotine contamination in dried boletus mushrooms has thus far not been determined since nicotine has not been established as a naturally occurring component in mushrooms. Whether the nico...

  20. Identification and Control of Cladobotryum spp., Causal Agents of Cobeweb Disease of Cultivated Mushroom

    OpenAIRE

    Ivana Potočnik

    2009-01-01

    Cladobotryum spp. are causal agents of cobweb disease, one of the most serious diseases of cultivated mushroom (Agaricus bisporus (Lange) Imbach) in Serbia and worldwide, which affects product quality and yield. The disease symptoms are: cottony fluffy white or yellowish to pink colonies on mushroom casing, rapid colonization of casing surface, covering of host basidiomata by mycelia, and their decay. Prochloraz-Mn has been officially recommended for mushroom cultivation in EU countries. Howe...