High-throughput fragment screening by affinity LC-MS.
Duong-Thi, Minh-Dao; Bergström, Maria; Fex, Tomas; Isaksson, Roland; Ohlson, Sten
2013-02-01
Fragment screening, an emerging approach for hit finding in drug discovery, has recently been proven effective by its first approved drug, vemurafenib, for cancer treatment. Techniques such as nuclear magnetic resonance, surface plasmon resonance, and isothemal titration calorimetry, with their own pros and cons, have been employed for screening fragment libraries. As an alternative approach, screening based on high-performance liquid chromatography separation has been developed. In this work, we present weak affinity LC/MS as a method to screen fragments under high-throughput conditions. Affinity-based capillary columns with immobilized thrombin were used to screen a collection of 590 compounds from a fragment library. The collection was divided into 11 mixtures (each containing 35 to 65 fragments) and screened by MS detection. The primary screening was performed in 3500 fragments per day). Thirty hits were defined, which subsequently entered a secondary screening using an active site-blocked thrombin column for confirmation of specificity. One hit showed selective binding to thrombin with an estimated dissociation constant (K (D)) in the 0.1 mM range. This study shows that affinity LC/MS is characterized by high throughput, ease of operation, and low consumption of target and fragments, and therefore it promises to be a valuable method for fragment screening.
Directory of Open Access Journals (Sweden)
Leterrier Christine
2010-07-01
Full Text Available Abstract Background SNP (Single Nucleotide Polymorphism discovery is now routinely performed using high-throughput sequencing of reduced representation libraries. Our objective was to adapt 454 GS FLX based sequencing methodologies in order to obtain the largest possible dataset from two reduced representations libraries, produced by AFLP (Amplified Fragment Length Polymorphism for genomic DNA, and EST (Expressed Sequence Tag for the transcribed fraction of the genome. Findings The expressed fraction was obtained by preparing cDNA libraries without PCR amplification from quail embryo and brain. To optimize the information content for SNP analyses, libraries were prepared from individuals selected in three quail lines and each individual in the AFLP library was tagged. Sequencing runs produced 399,189 sequence reads from cDNA and 373,484 from genomic fragments, covering close to 250 Mb of sequence in total. Conclusions Both methods used to obtain reduced representations for high-throughput sequencing were successful after several improvements. The protocols may be used for several sequencing applications, such as de novo sequencing, tagged PCR fragments or long fragment sequencing of cDNA.
Molecular markers. Amplified fragment length polymorphism
Directory of Open Access Journals (Sweden)
Pržulj Novo
2005-01-01
Full Text Available Amplified Fragment Length Polymorphism molecular markers (AFLPs has been developed combining procedures of RFLPs and RAPDs molekular markers, i.e. the first step is restriction digestion of the genomic DNA that is followed by selective amplification of the restricted fragments. The advantage of the AFLP technique is that it allows rapid generation of a large number of reproducible markers. The reproducibility of AFLPs markers is assured by the use of restriction site-specific adapters and adapter-specific primers for PCR reaction. Only fragments containing the restriction site sequence plus the additional nucleotides will be amplified and the more selected nucleotides added on the primer sequence the fewer the number of fragments amplified by PCR. The amplified products are normally separated on a sequencing gel and visualized after exposure to X-ray film or by using fluorescent labeled primers. AFLP shave proven to be extremely proficient in revealing diversity at below the species level. A disadvantage of AFLP technique is that AFLPs are essentially a dominant marker system and not able to identify heterozygotes.
DEFF Research Database (Denmark)
Kokotovic, Branko; On, Stephen L.W.
1999-01-01
A method for high-resolution genomic fingerprinting of the enteric pathogens Campylobacter jejuni and Campylobacter coli, based on the determination of amplified fragment length polymorphism, is described. The potential of this method for molecular epidemiological studies of these species...... is evaluated with 50 type, reference, and well-characterised field strains. Amplified fragment length polymorphism fingerprints comprised over 60 bands detected in the size range 35-500 bp. Groups of outbreak strains, replicate subcultures, and 'genetically identical' strains from humans, poultry and cattle......, proved indistinguishable by amplified fragment length polymorphism fingerprinting, but were differentiated fi-om unrelated isolates. Previously unknown relationships between three hippurate-negative C. jejuni strains, and two C. coil var, hyoilei strains, were identified. These relationships corresponded...
Energy Technology Data Exchange (ETDEWEB)
Peter Scott
2006-01-15
This article examines the importance of path dependence effects in impeding the diffusion of high throughput mechanized mining systems in the British coal industry. It demonstrates that the industry had become 'locked in' to low throughput underground haulage technology, on account of institutional interrelatedness between Britain's traditional practice of extensive in-seam mining and its unique system of fragmented, privately owned mineral royalties. Fragmented royalties prevented the concentration of workings and introduction of high throughput main haulage systems that underpinned the rapid productivity growth of European producers. Meanwhile, technical interrelatedness between the haulage systems taking coal to the pit shaft and operations further 'upstream' created bottlenecks which both slowed the overall rate of mechanization and limited the productivity gains from the mechanization that did occur.
Complementary DNA-amplified fragment length polymorphism ...
African Journals Online (AJOL)
Complementary DNA-amplified fragment length polymorphism (AFLP-cDNA) analysis of differential gene expression from the xerophyte Ammopiptanthus mongolicus in response to cold, drought and cold together with drought.
Amplifier channel for a fission fragment semiconductor detector
International Nuclear Information System (INIS)
Tyurin, G.P.
1981-01-01
To compensate the decrease of the transformation coefficient of fission fragment semiconductor detector (SCD) developed is a special amplification channel with controlled transfer coefficient. The block diagram of the channel is presented, the main functional units of which are as follows: preamplifying head with charge-sensitive and timing preamplifiers, linear amplifier and the circuit of spectrum position stabilization, which includes a differential discriminator, integrator and reference signal generator. The amplification channel is made in the CAMAC standard and has the following specifications: dinamical input capacitance of charge-sensitive amplifier c=10000 n PHI, signal amplitude at output of the linear amplifier at energy of fission fragments of 120 MeV has negative polarity and is equal to 5 V. Pulse amplitude change at SCD sensitivity decrease to 50% constitutes not more than 1%. Timing preamplifier has the gain factor at voltage of K=80 at front duration of 3.5 nc. Time resolution of the amplification channel is not worse than 1 nc. Dimensions of preamplifying head are 40x40x15 mm. The amplification channel permitted to use SCD for long-term measurements of fission fragment spectra [ru
Population structure of Salmonella investigated by amplified fragment length polymorphism
DEFF Research Database (Denmark)
Torpdahl, M.; Ahrens, Peter
2004-01-01
Aims: This study was undertaken to investigate the usefulness of amplified fragment length polymorphism (AFLP) in determining the population structure of Salmonella. Methods and Results: A total of 89 strains were subjected to AFLP analysis using the enzymes BglII and BspDI, a combination...... that is novel in Salmonella. Both species S. bongori and S. enterica and all subsp. of S. enterica were represented with emphasis on S. enterica subsp. enterica using a local strain collection and strains from the Salmonella Reference Collection B (SARB). The amplified fragments were used in a band...
Lu, Yuming; Chen, Xi; Wu, Yuxuan; Wang, Yanping; He, Yuqing; Wu, Yan
2013-01-01
A circular plasmid containing a gene coding sequence has been broadly used for studying gene regulation in cells. However, to accommodate a quick screen plasmid construction and preparation can be time consuming. Here we report a PCR amplified dsDNA fragments (PCR-fragments) based transient expression system (PCR-TES) for suiting in the study of gene regulation in plant cells. Instead of transforming plasmids into plant cells, transient expression of PCR-fragments can be applicable. The transformation efficiency and expression property of PCR-fragments are comparable to transformation using plasmids. We analyzed the transformation efficiency in PCR-TES at transcription and protein levels. Our results indicate that the PCR-TES is as versatile as the conventional transformation system using plasmid DNA. Through reconstituting PYR1-mediated ABA signaling pathway in Arabidopsis mesophyll protoplasts, we were not only validating the practicality of PCR-TES but also screening potential candidates of CDPK family members which might be involved in the ABA signaling. Moreover, we determined that phosphorylation of ABF2 by CPK4 could be mediated by ABA-induced PYR1 and ABI1, demonstrating a crucial role of CDPKs in the ABA signaling. In summary, PCR-TES can be applicable to facilitate analyzing gene regulation and for the screen of putative regulatory molecules at the high throughput level in plant cells. PMID:23468926
Directory of Open Access Journals (Sweden)
Yuming Lu
Full Text Available A circular plasmid containing a gene coding sequence has been broadly used for studying gene regulation in cells. However, to accommodate a quick screen plasmid construction and preparation can be time consuming. Here we report a PCR amplified dsDNA fragments (PCR-fragments based transient expression system (PCR-TES for suiting in the study of gene regulation in plant cells. Instead of transforming plasmids into plant cells, transient expression of PCR-fragments can be applicable. The transformation efficiency and expression property of PCR-fragments are comparable to transformation using plasmids. We analyzed the transformation efficiency in PCR-TES at transcription and protein levels. Our results indicate that the PCR-TES is as versatile as the conventional transformation system using plasmid DNA. Through reconstituting PYR1-mediated ABA signaling pathway in Arabidopsis mesophyll protoplasts, we were not only validating the practicality of PCR-TES but also screening potential candidates of CDPK family members which might be involved in the ABA signaling. Moreover, we determined that phosphorylation of ABF2 by CPK4 could be mediated by ABA-induced PYR1 and ABI1, demonstrating a crucial role of CDPKs in the ABA signaling. In summary, PCR-TES can be applicable to facilitate analyzing gene regulation and for the screen of putative regulatory molecules at the high throughput level in plant cells.
DEFF Research Database (Denmark)
Damborg, Peter; Guardabassi, Luca; Pedersen, Karl
2008-01-01
Human (n = 33) and canine (n = 53) Campylobacter upsaliensis isolates from seven countries were genotyped by a new amplified fragment length polymorphism method. We observed 100% typeability and high overall diversity. The majority of human strains (23/33) clustered separately from canine strains...
ALIS-FLP: Amplified ligation selected fragment-length polymorphism method for microbial genotyping
DEFF Research Database (Denmark)
Brillowska-Dabrowska, A.; Wianecka, M.; Dabrowski, Slawomir
2008-01-01
A DNA fingerprinting method known as ALIS-FLP (amplified ligation selected fragment-length polymorphism) has been developed for selective and specific amplification of restriction fragments from TspRI restriction endonuclease digested genomic DNA. The method is similar to AFLP, but differs...
DEFF Research Database (Denmark)
Nag, Sidsel; Dalgaard, Marlene Danner; Kofoed, Poul-Erik
2017-01-01
Genetic polymorphisms in P. falciparum can be used to indicate the parasite's susceptibility to antimalarial drugs as well as its geographical origin. Both of these factors are key to monitoring development and spread of antimalarial drug resistance. In this study, we combine multiplex PCR, custom...... designed dual indexing and Miseq sequencing for high throughput SNP-profiling of 457 malaria infections from Guinea-Bissau, at the cost of 10 USD per sample. By amplifying and sequencing 15 genetic fragments, we cover 20 resistance-conferring SNPs occurring in pfcrt, pfmdr1, pfdhfr, pfdhps, as well...
DEFF Research Database (Denmark)
Møller, Kristian; Jensen, Tim Kåre; Boye, Mette
1999-01-01
Pulsed field gel electrophoresis (PFGE) and amplified fragment length polymorphism (AFLP) were compared for their ability to differentiate between 50 porcine Serpulina pilosicoli isolates. Both techniques were highly sensitive, dividing the isolates into 36 and 38 groups, respectively. Due...
Amplified-fragment length polymorphism fingerprinting of Mycoplasma species
DEFF Research Database (Denmark)
Kokotovic, Branko; Friis, N.F.; Jensen, J.S.
1999-01-01
Amplified-fragment length polymorphism (AFLP) is a whole-genome fingerprinting method based on selective amplification of restriction fragments. The potential of the method for the characterization of mycoplasmas was investigated in a total of 50 strains of human and animal origin, including...... Mycoplasma genitalium (n = 11), Mycoplasma pneumoniae (n = 5), Mycoplasma hominis (n = 5), Mycoplasma hyopneunmoniae (n = 9), Myco plasma flocculare (n = 5), Mycoplasma hyosynoviae (n = 10), and Mycoplasma dispar (n = 5), AFLP templates were prepared by the digestion of mycoplasmal DNA with BglII and Mfe...... to discriminate the analyzed strains at species and intraspecies levels as well, Each of the tested Mycoplasma species developed a banding pattern entirely different from those obtained from other species under analysis, Subtle intraspecies genomic differences were detected among strains of all of the Mycoplasma...
Ruiz-García, Leonor; Cabezas, Jose Antonio; de María, Nuria; Cervera, María-Teresa
2010-01-01
Different molecular techniques have been developed to study either the global level of methylated cytosines or methylation at specific gene sequences. One of them is a modification of the Amplified Fragment Length Polymorphism (AFLP) technique that has been used to study methylation of anonymous CCGG sequences in different fungi, plant and animal species. The main variation of this technique is based on the use of isoschizomers with different methylation sensitivity (such as HpaII and MspI) as a frequent cutter restriction enzyme. For each sample, AFLP analysis is performed using both EcoRI/HpaII and EcoRI/MspI digested samples. Comparative analysis between EcoRI/HpaII and EcoRI/MspI fragment patterns allows the identification of two types of polymorphisms: (1) "Methylation-insensitive polymorphisms" that show common EcoRI/HpaII and EcoRI/MspI patterns but are detected as polymorphic amplified fragments among samples; and (2) "Methylation-sensitive polymorphisms" that are associated with amplified fragments differing in their presence or absence or in their intensity between EcoRI/HpaII and EcoRI/MspI patterns. This chapter describes a detailed protocol of this technique and discusses modifications that can be applied to adjust the technology to different species of interest.
DEFF Research Database (Denmark)
Kokotovic, Branko; Angen, Øystein
2007-01-01
Amplified fragment length polymorphism (AFLP) was evaluated as a method for genotypic characterization and subtyping within the bacterial species Actinobacillus pleuropneumoniae. A total of 155 isolates of A. pleuropneumoniae, representing the serotypic variation described to occur within...
SNP-PHAGE – High throughput SNP discovery pipeline
Directory of Open Access Journals (Sweden)
Cregan Perry B
2006-10-01
Full Text Available Abstract Background Single nucleotide polymorphisms (SNPs as defined here are single base sequence changes or short insertion/deletions between or within individuals of a given species. As a result of their abundance and the availability of high throughput analysis technologies SNP markers have begun to replace other traditional markers such as restriction fragment length polymorphisms (RFLPs, amplified fragment length polymorphisms (AFLPs and simple sequence repeats (SSRs or microsatellite markers for fine mapping and association studies in several species. For SNP discovery from chromatogram data, several bioinformatics programs have to be combined to generate an analysis pipeline. Results have to be stored in a relational database to facilitate interrogation through queries or to generate data for further analyses such as determination of linkage disequilibrium and identification of common haplotypes. Although these tasks are routinely performed by several groups, an integrated open source SNP discovery pipeline that can be easily adapted by new groups interested in SNP marker development is currently unavailable. Results We developed SNP-PHAGE (SNP discovery Pipeline with additional features for identification of common haplotypes within a sequence tagged site (Haplotype Analysis and GenBank (-dbSNP submissions. This tool was applied for analyzing sequence traces from diverse soybean genotypes to discover over 10,000 SNPs. This package was developed on UNIX/Linux platform, written in Perl and uses a MySQL database. Scripts to generate a user-friendly web interface are also provided with common queries for preliminary data analysis. A machine learning tool developed by this group for increasing the efficiency of SNP discovery is integrated as a part of this package as an optional feature. The SNP-PHAGE package is being made available open source at http://bfgl.anri.barc.usda.gov/ML/snp-phage/. Conclusion SNP-PHAGE provides a bioinformatics
[Recent advances of amplified fragment length polymorphism and its applications in forensic botany].
Li, Cheng-Tao; Li, Li
2008-10-01
Amplified fragment length polymorphism (AFLP) is a new molecular marker to detect genomic polymorphism. This new technology has advantages of high resolution, good stability, and reproducibility. Great achievements have been derived in recent years in AFLP related technologies with several AFLP expanded methodologies available. AFLP technology has been widely used in the fields of plant, animal, and microbes. It has become one of the hotspots in Forensic Botany. This review focuses on the recent advances of AFLP and its applications in forensic biology.
Kütahya, Oylum Erkus; Starrenburg, Marjo J. C.; Rademaker, Jan L. W.; Klaassen, Corné H. W.; van Hylckama Vlieg, Johan E. T.; Smid, Eddy J.; Kleerebezem, Michiel
2011-01-01
A high-resolution amplified fragment length polymorphism (AFLP) methodology was developed to achieve the delineation of closely related Lactococcus lactis strains. The differentiation depth of 24 enzyme-primer-nucleotide combinations was experimentally evaluated to maximize the number of polymorphisms. The resolution depth was confirmed by performing diversity analysis on 82 L. lactis strains, including both closely and distantly related strains with dairy and nondairy origins. Strains clustered into two main genomic lineages of L. lactis subsp. lactis and L. lactis subsp. cremoris type-strain-like genotypes and a third novel genomic lineage rooted from the L. lactis subsp. lactis genomic lineage. Cluster differentiation was highly correlated with small-subunit rRNA homology and multilocus sequence analysis (MLSA) studies. Additionally, the selected enzyme-primer combination generated L. lactis subsp. cremoris phenotype-specific fragments irrespective of the genotype. These phenotype-specific markers allowed the differentiation of L. lactis subsp. lactis phenotype from L. lactis subsp. cremoris phenotype strains within the same L. lactis subsp. cremoris type-strain-like genomic lineage, illustrating the potential of AFLP for the generation of phenotype-linked genetic markers. PMID:21666014
Shyamalamma, S; Chandra, S B C; Hegde, M; Naryanswamy, P
2008-07-22
Artocarpus heterophyllus Lam., commonly called jackfruit, is a medium-sized evergreen tree that bears high yields of the largest known edible fruit. Yet, it has been little explored commercially due to wide variation in fruit quality. The genetic diversity and genetic relatedness of 50 jackfruit accessions were studied using amplified fragment length polymorphism markers. Of 16 primer pairs evaluated, eight were selected for screening of genotypes based on the number and quality of polymorphic fragments produced. These primer combinations produced 5976 bands, 1267 (22%) of which were polymorphic. Among the jackfruit accessions, the similarity coefficient ranged from 0.137 to 0.978; the accessions also shared a large number of monomorphic fragments (78%). Cluster analysis and principal component analysis grouped all jackfruit genotypes into three major clusters. Cluster I included the genotypes grown in a jackfruit region of Karnataka, called Tamaka, with very dry conditions; cluster II contained the genotypes collected from locations having medium to heavy rainfall in Karnataka; cluster III grouped the genotypes in distant locations with different environmental conditions. Strong coincidence of these amplified fragment length polymorphism-based groupings with geographical localities as well as morphological characters was observed. We found moderate genetic diversity in these jackfruit accessions. This information should be useful for tree breeding programs, as part of our effort to popularize jackfruit as a commercial crop.
Directory of Open Access Journals (Sweden)
Jiabing Ji
Full Text Available BACKGROUND: Insertion mutant isolation and characterization are extremely valuable for linking genes to physiological function. Once an insertion mutant phenotype is identified, the challenge is to isolate the responsible gene. Multiple strategies have been employed to isolate unknown genomic DNA that flanks mutagenic insertions, however, all these methods suffer from limitations due to inefficient ligation steps, inclusion of restriction sites within the target DNA, and non-specific product generation. These limitations become close to insurmountable when the goal is to identify insertion sites in a high throughput manner. METHODOLOGY/PRINCIPAL FINDINGS: We designed a novel strategy called Restriction Site Extension PCR (RSE-PCR to efficiently conduct large-scale isolation of unknown genomic DNA fragments linked to DNA insertions. The strategy is a modified adaptor-mediated PCR without ligation. An adapter, with complementarity to the 3' overhang of the endonuclease (KpnI, NsiI, PstI, or SacI restricted DNA fragments, extends the 3' end of the DNA fragments in the first cycle of the primary RSE-PCR. During subsequent PCR cycles and a second semi-nested PCR (secondary RSE-PCR, touchdown and two-step PCR are combined to increase the amplification specificity of target fragments. The efficiency and specificity was demonstrated in our characterization of 37 tex mutants of Arabidopsis. All the steps of RSE-PCR can be executed in a 96 well PCR plate. Finally, RSE-PCR serves as a successful alternative to Genome Walker as demonstrated by gene isolation from maize, a plant with a more complex genome than Arabidopsis. CONCLUSIONS/SIGNIFICANCE: RSE-PCR has high potential application in identifying tagged (T-DNA or transposon sequence or walking from known DNA toward unknown regions in large-genome plants, with likely application in other organisms as well.
Machine learning in computational biology to accelerate high-throughput protein expression
DEFF Research Database (Denmark)
Sastry, Anand; Monk, Jonathan M.; Tegel, Hanna
2017-01-01
and machine learning identifies protein properties that hinder the HPA high-throughput antibody production pipeline. We predict protein expression and solubility with accuracies of 70% and 80%, respectively, based on a subset of key properties (aromaticity, hydropathy and isoelectric point). We guide...... the selection of protein fragments based on these characteristics to optimize high-throughput experimentation. Availability and implementation: We present the machine learning workflow as a series of IPython notebooks hosted on GitHub (https://github.com/SBRG/Protein_ML). The workflow can be used as a template...
Machine learning in computational biology to accelerate high-throughput protein expression.
Sastry, Anand; Monk, Jonathan; Tegel, Hanna; Uhlen, Mathias; Palsson, Bernhard O; Rockberg, Johan; Brunk, Elizabeth
2017-08-15
The Human Protein Atlas (HPA) enables the simultaneous characterization of thousands of proteins across various tissues to pinpoint their spatial location in the human body. This has been achieved through transcriptomics and high-throughput immunohistochemistry-based approaches, where over 40 000 unique human protein fragments have been expressed in E. coli. These datasets enable quantitative tracking of entire cellular proteomes and present new avenues for understanding molecular-level properties influencing expression and solubility. Combining computational biology and machine learning identifies protein properties that hinder the HPA high-throughput antibody production pipeline. We predict protein expression and solubility with accuracies of 70% and 80%, respectively, based on a subset of key properties (aromaticity, hydropathy and isoelectric point). We guide the selection of protein fragments based on these characteristics to optimize high-throughput experimentation. We present the machine learning workflow as a series of IPython notebooks hosted on GitHub (https://github.com/SBRG/Protein_ML). The workflow can be used as a template for analysis of further expression and solubility datasets. ebrunk@ucsd.edu or johanr@biotech.kth.se. Supplementary data are available at Bioinformatics online. © The Author (2017). Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com
Fine-scale genotyping methods are necessary in order to identify possible sources of human exposure to opportunistic pathogens belonging to the Mycobacterium avium complex (MAC). In this study, amplified fragment length polymorphism (AFLP) analysis was evaluated for fingerprintin...
DEFF Research Database (Denmark)
On, Stephen L.W.; Atabay, H.I.; Amisu, K.O.
2004-01-01
Aims: To investigate the potential of amplified fragment length polymorphism (AFLP) profiling for genotyping Arcobacter butzleri and to obtain further data on the genetic diversity of this organism. Methods and Results: Seventy-three isolates of Danish, British, Turkish, Swedish, Nigerian and Nor...
DEFF Research Database (Denmark)
Kokotovic, Branko; Bolske, G.; Ahrens, Peter
2000-01-01
The genetic diversity of Mycoplasma capricolum subsp. capripneumoniae strains based on determination of amplified fragment length polymorphisms (AFLP) is described. AFLP fingerprints of 38 strains derived from different countries in Africa and the Middle East consisted of over 100 bands in the size...
Meijer, Adam; Morré, Servaas A.; Van Den Brule, Adriaan J. C.; Savelkoul, Paul H. M.; Ossewaarde, Jacobus M.
1999-01-01
The genomic relatedness of 19 Chlamydia pneumoniae isolates (17 from respiratory origin and 2 from atherosclerotic origin), 21 Chlamydia trachomatis isolates (all serovars from the human biovar, an isolate from the mouse biovar, and a porcine isolate), 6 Chlamydia psittaci isolates (5 avian isolates and 1 feline isolate), and 1 Chlamydia pecorum isolate was studied by analyzing genomic amplified fragment length polymorphism (AFLP) fingerprints. The AFLP procedure was adapted from a previously...
Electrospun amplified fiber optics.
Morello, Giovanni; Camposeo, Andrea; Moffa, Maria; Pisignano, Dario
2015-03-11
All-optical signal processing is the focus of much research aiming to obtain effective alternatives to existing data transmission platforms. Amplification of light in fiber optics, such as in Erbium-doped fiber amplifiers, is especially important for efficient signal transmission. However, the complex fabrication methods involving high-temperature processes performed in a highly pure environment slow the fabrication process and make amplified components expensive with respect to an ideal, high-throughput, room temperature production. Here, we report on near-infrared polymer fiber amplifiers working over a band of ∼20 nm. The fibers are cheap, spun with a process entirely carried out at room temperature, and shown to have amplified spontaneous emission with good gain coefficients and low levels of optical losses (a few cm(-1)). The amplification process is favored by high fiber quality and low self-absorption. The found performance metrics appear to be suitable for short-distance operations, and the large variety of commercially available doping dyes might allow for effective multiwavelength operations by electrospun amplified fiber optics.
International Nuclear Information System (INIS)
Hahn, P.J.; Giddings, L.; Lane, M.J.
1989-01-01
Restriction mapping of relatively large genomes (e.g. human) utilizing randomly generated DNA segments requires high mapping redundancy to successfully organize 'contigs' to represent the entire genome. The number of independent DNA segment maps required is dependent on the average size of a mapping segment; the larger the segment, the fewer required. The authors have developed a strategy for subcloning intact multimegabase subchromosomal fragments as double minute chromosomes. Such fragments could serve as primary mapping elements or as adjunct (linking) fragments to rapidly connect already existent contigs generated using yeast artificial chromosomes or cosmids. They present several lines of evidence supporting the viability of this approach. (1) X-ray treated EMT-6 mouse cells (7.5 Gr.) which are selected over several months with increasing levels of methotrexate (MTX) contain highly amplified circular DNA molecules (double minutes) which include the dihydrofolate reductase (DHFR) gene in a size range between 1,000 and 3,500 kilobases as determined by pulsed-field gel electrophoresis and these acentric chromosomal fragments have been stably maintained in culture for at least a year. (2) Preliminary data based on experiments involving fusion of X-irradiated Chinese Hamster Ovary (CH0 DG44) cells containing randomly inserted cotransfected Neomycin resistance and DHFR genes to mouse EMT-6 cells shows that the linked genes can be readily cotransferred as acentric subchromosomal fragment(s) suitable for gene amplification. (3) The studies of CHO cells with cell fusion transferred X-ray induced chromosomal fragments containing the natural CHO DHFR gene suggest that transferred chromosome fragments undergo gene amplification much more readily than nonfragmented endogenous DHFR genes
Elsheikha, H M; Schott, H C; Mansfield, L S
2006-06-01
Sarcocystis neurona causes serious neurological disease in horses and other vertebrates in the Americas. Based on epidemiological data, this parasite has recently emerged. Here, the genetic diversity of Sarcocystis neurona was evaluated using the amplified fragment length polymorphism (AFLP) method. Fifteen S. neurona taxa from different regions collected over the last 10 years were used; six isolates were from clinically diseased horses, eight isolates were from wild-caught opossums (Didelphis virginiana), and one isolate was from a cowbird (Molothrus ater). Additionally, four outgroup taxa were also fingerprinted. Nine primer pairs were used to generate AFLP patterns, with a total number of amplified fragments ranging from 30 to 60, depending on the isolate and primers tested. Based on the presence/absence of amplified AFLP fragments and pairwise similarity values, all the S. neurona isolates tested were clustered in one monophyletic group. No significant correlation could be found between genomic similarity and host origin of the S. neurona isolates. AFLP revealed significant intraspecific genetic variations, and S. neurona appeared as a highly variable species. Furthermore, linkage disequilibrium analysis suggested that S. neurona populations within Michigan have an intermediate type of population structure that includes characteristics of both clonal and panamictic population structures. AFLP is a reliable molecular technique that has provided one of the most informative approaches to ascertain phylogenetic relationships in S. neurona and its closest relatives, allowing them to be clustered by relative similarity using band matching and unweighted pair group method with arithmetic mean analysis, which may be applicable to other related protozoal species.
DEFF Research Database (Denmark)
Fearnley, C.; On, S.L.W.; Kokotovic, Branko
2005-01-01
An amplified fragment length polymorphism (AFLP) method, developed to genotype Yersinia enterocolitica, has been used to investigate 70 representative strains isolated from humans, pigs, sheep, and cattle in the United Kingdom. AFLP primarily distinguished Y enterocolitica strains according...
Hollox, E J; Atia, T; Cross, G; Parkin, T; Armour, J A L
2002-11-01
Subtelomeric regions of the human genome are gene rich, with a high level of sequence polymorphism. A number of clinical conditions, including learning disability, have been attributed to subtelomeric deletions or duplications, but screening for deletion in these regions using conventional cytogenetic methods and fluorescence in situ hybridisation (FISH) is laborious. Here we report that a new method, multiplex amplifiable probe hybridisation (MAPH), can be used to screen for copy number at subtelomeric regions. We have constructed a set of MAPH probes with each subtelomeric region represented at least once, so that one gel lane can assay copy number at all chromosome ends in one person. Each probe has been sequenced and, where possible, its position relative to the telomere determined by comparison with mapped clones. The sensitivity of the probes has been characterised on a series of cytogenetically verified positive controls and 83 normal controls were used to assess the frequency of polymorphic copy number with no apparent phenotypic effect. We have also used MAPH to test a cohort of 37 people selected from males referred for fragile X syndrome testing and found six changes that were confirmed by dosage PCR. MAPH can be used to screen subtelomeric regions of chromosomes for deletions and duplications before confirmation by FISH or dosage PCR. The high throughput nature of this technique allows it to be used for large scale screening of subtelomeric copy number, before confirmation by FISH. In practice, the availability of a rapid and efficient screen may allow subtelomeric analysis to be applied to a wider selection of patients than is currently possible using FISH alone.
Directory of Open Access Journals (Sweden)
Krystal Cole
Full Text Available High throughput screening technologies such as acoustic droplet ejection (ADE greatly increase the rate at which X-ray diffraction data can be acquired from crystals. One promising high throughput screening application of ADE is to rapidly combine protein crystals with fragment libraries. In this approach, each fragment soaks into a protein crystal either directly on data collection media or on a moving conveyor belt which then delivers the crystals to the X-ray beam. By simultaneously handling multiple crystals combined with fragment specimens, these techniques relax the automounter duty-cycle bottleneck that currently prevents optimal exploitation of third generation synchrotrons. Two factors limit the speed and scope of projects that are suitable for fragment screening using techniques such as ADE. Firstly, in applications where the high throughput screening apparatus is located inside the X-ray station (such as the conveyor belt system described above, the speed of data acquisition is limited by the time required for each fragment to soak into its protein crystal. Secondly, in applications where crystals are combined with fragments directly on data acquisition media (including both of the ADE methods described above, the maximum time that fragments have to soak into crystals is limited by evaporative dehydration of the protein crystals during the fragment soak. Here we demonstrate that both of these problems can be minimized by using small crystals, because the soak time required for a fragment hit to attain high occupancy depends approximately linearly on crystal size.
K.D. Jermstad; A.M. Reem; J.R. Henifin; N.C. Wheeler; D.B Neale
1994-01-01
A total of 225 new genetic loci [151 restriction fragment length polymorphisms (RFLP) and 74 random amplified polymorphic DNAs (RAPD)] in coastal Douglas- fir [Pseudotsuga menziesii (Mirb.) Franco var. menziesii] have been identified using a three-generation outbred pedigree. The Mendelian inheritance of 16 RFLP loci and 29...
HIGH AVERAGE POWER OPTICAL FEL AMPLIFIERS
International Nuclear Information System (INIS)
2005-01-01
Historically, the first demonstration of the optical FEL was in an amplifier configuration at Stanford University [l]. There were other notable instances of amplifying a seed laser, such as the LLNL PALADIN amplifier [2] and the BNL ATF High-Gain Harmonic Generation FEL [3]. However, for the most part FELs are operated as oscillators or self amplified spontaneous emission devices. Yet, in wavelength regimes where a conventional laser seed can be used, the FEL can be used as an amplifier. One promising application is for very high average power generation, for instance FEL's with average power of 100 kW or more. The high electron beam power, high brightness and high efficiency that can be achieved with photoinjectors and superconducting Energy Recovery Linacs (ERL) combine well with the high-gain FEL amplifier to produce unprecedented average power FELs. This combination has a number of advantages. In particular, we show that for a given FEL power, an FEL amplifier can introduce lower energy spread in the beam as compared to a traditional oscillator. This properly gives the ERL based FEL amplifier a great wall-plug to optical power efficiency advantage. The optics for an amplifier is simple and compact. In addition to the general features of the high average power FEL amplifier, we will look at a 100 kW class FEL amplifier is being designed to operate on the 0.5 ampere Energy Recovery Linac which is under construction at Brookhaven National Laboratory's Collider-Accelerator Department
DEFF Research Database (Denmark)
Torpdahl, Mia; Skov, Marianne N.; Sandvang, Dorthe
2005-01-01
subspecies enterica isolates. A total of 25 serotypes were investigated that had been isolated from humans or veterinary sources in Denmark between 1995 and 2001. All isolates were genotyped by multilocus sequence typing (MLST), pulsed-field gel electrophoresis (PFGE) and amplified fragment length...
Targeted DNA Methylation Analysis by High Throughput Sequencing in Porcine Peri-attachment Embryos
MORRILL, Benson H.; COX, Lindsay; WARD, Anika; HEYWOOD, Sierra; PRATHER, Randall S.; ISOM, S. Clay
2013-01-01
Abstract The purpose of this experiment was to implement and evaluate the effectiveness of a next-generation sequencing-based method for DNA methylation analysis in porcine embryonic samples. Fourteen discrete genomic regions were amplified by PCR using bisulfite-converted genomic DNA derived from day 14 in vivo-derived (IVV) and parthenogenetic (PA) porcine embryos as template DNA. Resulting PCR products were subjected to high-throughput sequencing using the Illumina Genome Analyzer IIx plat...
Xian, Zhi-Hong; Cong, Wen-Ming; Zhang, Shu-Hui; Wu, Meng-Chao
2005-01-01
AIM: To study the genetic alterations and their association with clinicopathological characteristics of hepatocellular carcinoma (HCC), and to find the tumor related DNA fragments. METHODS: DNA isolated from tumors and corresponding noncancerous liver tissues of 56 HCC patients was amplified by random amplified polymorphic DNA (RAPD) with 10 random 10-mer arbitrary primers. The RAPD bands showing obvious differences in tumor tissue DNA corresponding to that of normal tissue were separated, purified, cloned and sequenced. DNA sequences were analyzed and compared with GenBank data. RESULTS: A total of 56 cases of HCC were demonstrated to have genetic alterations, which were detected by at least one primer. The detestability of genetic alterations ranged from 20% to 70% in each case, and 17.9% to 50% in each primer. Serum HBV infection, tumor size, histological grade, tumor capsule, as well as tumor intrahepatic metastasis, might be correlated with genetic alterations on certain primers. A band with a higher intensity of 480 bp or so amplified fragments in tumor DNA relative to normal DNA could be seen in 27 of 56 tumor samples using primer 4. Sequence analysis of these fragments showed 91% homology with Homo sapiens double homeobox protein DUX10 gene. CONCLUSION: Genetic alterations are a frequent event in HCC, and tumor related DNA fragments have been found in this study, which may be associated with hepatocarcin-ogenesis. RAPD is an effective method for the identification and analysis of genetic alterations in HCC, and may provide new information for further evaluating the molecular mechanism of hepatocarcinogenesis. PMID:15996039
Federal Laboratory Consortium — Argonne?s high throughput facility provides highly automated and parallel approaches to material and materials chemistry development. The facility allows scientists...
Li, Xiaofei; Wu, Yuhua; Li, Jun; Li, Yunjing; Long, Likun; Li, Feiwu; Wu, Gang
2015-01-05
The rapid increase in the number of genetically modified (GM) varieties has led to a demand for high-throughput methods to detect genetically modified organisms (GMOs). We describe a new dynamic array-based high throughput method to simultaneously detect 48 targets in 48 samples on a Fludigm system. The test targets included species-specific genes, common screening elements, most of the Chinese-approved GM events, and several unapproved events. The 48 TaqMan assays successfully amplified products from both single-event samples and complex samples with a GMO DNA amount of 0.05 ng, and displayed high specificity. To improve the sensitivity of detection, a preamplification step for 48 pooled targets was added to enrich the amount of template before performing dynamic chip assays. This dynamic chip-based method allowed the synchronous high-throughput detection of multiple targets in multiple samples. Thus, it represents an efficient, qualitative method for GMO multi-detection.
High throughput second harmonic imaging for label-free biological applications
Macias Romero, Carlos; Didier, Marie E P; Jourdain, Pascal; Marquet, Pierre; Magistretti, Pierre J.; Tarun, Orly B.; Zubkovs, Vitalijs; Radenovic, Aleksandra; Roke, Sylvie
2014-01-01
Second harmonic generation (SHG) is inherently sensitive to the absence of spatial centrosymmetry, which can render it intrinsically sensitive to interfacial processes, chemical changes and electrochemical responses. Here, we seek to improve the imaging throughput of SHG microscopy by using a wide-field imaging scheme in combination with a medium-range repetition rate amplified near infrared femtosecond laser source and gated detection. The imaging throughput of this configuration is tested by measuring the optical image contrast for different image acquisition times of BaTiO3 nanoparticles in two different wide-field setups and one commercial point-scanning configuration. We find that the second harmonic imaging throughput is improved by 2-3 orders of magnitude compared to point-scan imaging. Capitalizing on this result, we perform low fluence imaging of (parts of) living mammalian neurons in culture.
Scanning fluorescence detector for high-throughput DNA genotyping
Rusch, Terry L.; Petsinger, Jeremy; Christensen, Carl; Vaske, David A.; Brumley, Robert L., Jr.; Luckey, John A.; Weber, James L.
1996-04-01
A new scanning fluorescence detector (SCAFUD) was developed for high-throughput genotyping of short tandem repeat polymorphisms (STRPs). Fluorescent dyes are incorporated into relatively short DNA fragments via polymerase chain reaction (PCR) and are separated by electrophoresis in short, wide polyacrylamide gels (144 lanes with well to read distances of 14 cm). Excitation light from an argon laser with primary lines at 488 and 514 nm is introduced into the gel through a fiber optic cable, dichroic mirror, and 40X microscope objective. Emitted fluorescent light is collected confocally through a second fiber. The confocal head is translated across the bottom of the gel at 0.5 Hz. The detection unit utilizes dichroic mirrors and band pass filters to direct light with 10 - 20 nm bandwidths to four photomultiplier tubes (PMTs). PMT signals are independently amplified with variable gain and then sampled at a rate of 2500 points per scan using a computer based A/D board. LabView software (National Instruments) is used for instrument operation. Currently, three fluorescent dyes (Fam, Hex and Rox) are simultaneously detected with peak detection wavelengths of 543, 567, and 613 nm, respectively. The detection limit for fluorescein-labeled primers is about 100 attomoles. Planned SCAFUD upgrades include rearrangement of laser head geometry, use of additional excitation lasers for simultaneous detection of more dyes, and the use of detector arrays instead of individual PMTs. Extensive software has been written for automatic analysis of SCAFUD images. The software enables background subtraction, band identification, multiple- dye signal resolution, lane finding, band sizing and allele calling. Whole genome screens are currently underway to search for loci influencing such complex diseases as diabetes, asthma, and hypertension. Seven production SCAFUDs are currently in operation. Genotyping output for the coming year is projected to be about one million total genotypes (DNA
Mrzic, Aida; Lermyte, Frederik; Vu, Trung Nghia; Valkenborg, Dirk; Laukens, Kris
2017-09-15
Using mass spectrometry, the analysis of known metabolite structures has become feasible in a systematic high-throughput fashion. Nevertheless, the identification of previously unknown structures remains challenging, partially because many unidentified variants originate from known molecules that underwent unexpected modifications. Here, we present a method for the discovery of unknown metabolite modifications and conjugate metabolite isoforms in a high-throughput fashion. The method is based on user-controlled in-source fragmentation which is used to induce loss of weakly bound modifications. This is followed by the comparison of product ions from in-source fragmentation and collision-induced dissociation (CID). Diagonal MS 2 -MS 3 matching allows the detection of unknown metabolite modifications, as well as substructure similarities. As the method relies heavily on the advantages of in-source fragmentation and its ability to 'magically' elucidate unknown modification, we have named it inSourcerer as a portmanteau of in-source and sorcerer. The method was evaluated using a set of 15 different cytokinin standards. Product ions from in-source fragmentation and CID were compared. Hierarchical clustering revealed that good matches are due to the presence of common substructures. Plant leaf extract, spiked with a mix of all 15 standards, was used to demonstrate the method's ability to detect these standards in a complex mixture, as well as confidently identify compounds already present in the plant material. Here we present a method that incorporates a classic liquid chromatography/mass spectrometry (LC/MS) workflow with fragmentation models and computational algorithms. The assumptions upon which the concept of the method was built were shown to be valid and the method showed that in-source fragmentation can be used to pinpoint structural similarities and indicate the occurrence of a modification. Copyright © 2017 John Wiley & Sons, Ltd.
High-throughput continuous cryopump
International Nuclear Information System (INIS)
Foster, C.A.
1986-01-01
A cryopump with a unique method of regeneration which allows continuous operation at high throughput has been constructed and tested. Deuterium was pumped continuously at a throughput of 30 Torr.L/s at a speed of 2000 L/s and a compression ratio of 200. Argon was pumped at a throughput of 60 Torr.L/s at a speed of 1275 L/s. To produce continuous operation of the pump, a method of regeneration that does not thermally cycle the pump is employed. A small chamber (the ''snail'') passes over the pumping surface and removes the frost from it either by mechanical action with a scraper or by local heating. The material removed is topologically in a secondary vacuum system with low conductance into the primary vacuum; thus, the exhaust can be pumped at pressures up to an effective compression ratio determined by the ratio of the pumping speed to the leakage conductance of the snail. The pump, which is all-metal-sealed and dry and which regenerates every 60 s, would be an ideal system for pumping tritium. Potential fusion applications are for mpmp limiters, for repeating pneumatic pellet injection lines, and for the centrifuge pellet injector spin tank, all of which will require pumping tritium at high throughput. Industrial applications requiring ultraclean pumping of corrosive gases at high throughput, such as the reactive ion etch semiconductor process, may also be feasible
Combining Amplification Typing of L1 Active Subfamilies (ATLAS) with High-Throughput Sequencing.
Rahbari, Raheleh; Badge, Richard M
2016-01-01
With the advent of new generations of high-throughput sequencing technologies, the catalog of human genome variants created by retrotransposon activity is expanding rapidly. However, despite these advances in describing L1 diversity and the fact that L1 must retrotranspose in the germline or prior to germline partitioning to be evolutionarily successful, direct assessment of de novo L1 retrotransposition in the germline or early embryogenesis has not been achieved for endogenous L1 elements. A direct study of de novo L1 retrotransposition into susceptible loci within sperm DNA (Freeman et al., Hum Mutat 32(8):978-988, 2011) suggested that the rate of L1 retrotransposition in the germline is much lower than previously estimated (ATLAS L1 display technique (Badge et al., Am J Hum Genet 72(4):823-838, 2003) to investigate de novo L1 retrotransposition in human genomes. In this chapter, we describe how we combined a high-coverage ATLAS variant with high-throughput sequencing, achieving 11-25× sequence depth per single amplicon, to study L1 retrotransposition in whole genome amplified (WGA) DNAs.
High-throughput characterization methods for lithium batteries
Directory of Open Access Journals (Sweden)
Yingchun Lyu
2017-09-01
Full Text Available The development of high-performance lithium ion batteries requires the discovery of new materials and the optimization of key components. By contrast with traditional one-by-one method, high-throughput method can synthesize and characterize a large number of compositionally varying samples, which is able to accelerate the pace of discovery, development and optimization process of materials. Because of rapid progress in thin film and automatic control technologies, thousands of compounds with different compositions could be synthesized rapidly right now, even in a single experiment. However, the lack of rapid or combinatorial characterization technologies to match with high-throughput synthesis methods, limit the application of high-throughput technology. Here, we review a series of representative high-throughput characterization methods used in lithium batteries, including high-throughput structural and electrochemical characterization methods and rapid measuring technologies based on synchrotron light sources.
Fragment-based drug discovery using rational design.
Jhoti, H
2007-01-01
Fragment-based drug discovery (FBDD) is established as an alternative approach to high-throughput screening for generating novel small molecule drug candidates. In FBDD, relatively small libraries of low molecular weight compounds (or fragments) are screened using sensitive biophysical techniques to detect their binding to the target protein. A lower absolute affinity of binding is expected from fragments, compared to much higher molecular weight hits detected by high-throughput screening, due to their reduced size and complexity. Through the use of iterative cycles of medicinal chemistry, ideally guided by three-dimensional structural data, it is often then relatively straightforward to optimize these weak binding fragment hits into potent and selective lead compounds. As with most other lead discovery methods there are two key components of FBDD; the detection technology and the compound library. In this review I outline the two main approaches used for detecting the binding of low affinity fragments and also some of the key principles that are used to generate a fragment library. In addition, I describe an example of how FBDD has led to the generation of a drug candidate that is now being tested in clinical trials for the treatment of cancer.
Wang, S C; Ding, M M; Wei, X L; Zhang, T; Yao, F
2016-06-01
To recognize the possibility of Y fragment deletion of Amelogenin gene intuitively and simply according to the genotyping graphs. By calculating the ratio of total peak height of genotyping graphs, the statistics of equilibrium distribution between Amelogenin and D3S1358 loci, Amelogenin X-gene and Amelogenin Y-gene, and different alleles of D3S1358 loci from 1 968 individuals was analyzed after amplified by PowerPlex ® 21 detection kit. Sum of peak height of Amelogenin X allele was not less than 60% that of D3S1358 loci alleles in 90.8% female samples, and sum of peak height of Amelogenin X allele was not higher than 70% that of D3S1358 loci alleles in 94.9% male samples. The result of genotyping after amplified by PowerPlex ® 21 detection kit shows that the possibility of Y fragment deletion should be considered when only Amelogenin X-gene of Amelogenin is detected and the peak height of Amelogenin X-gene is not higher than 70% of the total peak height of D3S1358 loci. Copyright© by the Editorial Department of Journal of Forensic Medicine
Energy Technology Data Exchange (ETDEWEB)
Vembris, Aivars, E-mail: aivars.vembris@cfi.lu.lv [Institute of Solid State Physics, University of Latvia, 8 Kengaraga Street, Riga LV-1063 (Latvia); Muzikante, Inta [Institute of Solid State Physics, University of Latvia, 8 Kengaraga Street, Riga LV-1063 (Latvia); Karpicz, Renata; Sliauzys, Gytis [Institute of Physics, Center for Physical Sciences and Technology, A. Gostauto 11, LT-01108 Vilnius (Lithuania); Miasojedovas, Arunas; Jursenas, Saulius [Institute of Applied Research, Vilnius University, Sauletekio 9-III, LT-10222 Vilnius (Lithuania); Gulbinas, Vidmantas [Institute of Physics, Center for Physical Sciences and Technology, A. Gostauto 11, LT-01108 Vilnius (Lithuania)
2012-09-15
Potential of glassy films of newly synthesised low molecular weight organic molecules for light amplification and lasing applications has been investigated by analysing fluorescence, transient differential absorption and amplified spontaneous emission properties. These non-symmetric and symmetric molecules contain styryl-4H-pyran-4-ylidene fragment with three different electron acceptor groups: dicyanomethylene, barbituric acid, indene-1,3-dione. Fluorescence quantum yields of the investigated compounds in solutions are between 0.32 and 0.54, while they drop down by an order of magnitude in thin solid films. Incorporation of bulky side groups reduced excitonic interactions enabling manifestation of amplified spontaneous emission in the neat films of the investigated derivatives. - Highlights: Black-Right-Pointing-Pointer Bulky substituents attached to DCM dye enable formation of neat glassy films. Black-Right-Pointing-Pointer Investigated dyes show amplified spontaneous emission in neat films. Black-Right-Pointing-Pointer Two electron donor groups negatively influence light amplification.
Kobayashi, M.; Retra, K.; Figaroa, F.; Hollander, J.G.; Ab, E.; Heetebrij, R.J.; Irth, H.; Siegal, G.
2010-01-01
Fragment-based drug discovery (FBDD) has become a widely accepted tool that is complementary to high-throughput screening (HTS) in developing small-molecule inhibitors of pharmaceutical targets. Because a fragment campaign can only be as successful as the hit matter found, it is critical that the
Lyons, Eli; Sheridan, Paul; Tremmel, Georg; Miyano, Satoru; Sugano, Sumio
2017-10-24
High-throughput screens allow for the identification of specific biomolecules with characteristics of interest. In barcoded screens, DNA barcodes are linked to target biomolecules in a manner allowing for the target molecules making up a library to be identified by sequencing the DNA barcodes using Next Generation Sequencing. To be useful in experimental settings, the DNA barcodes in a library must satisfy certain constraints related to GC content, homopolymer length, Hamming distance, and blacklisted subsequences. Here we report a novel framework to quickly generate large-scale libraries of DNA barcodes for use in high-throughput screens. We show that our framework dramatically reduces the computation time required to generate large-scale DNA barcode libraries, compared with a naїve approach to DNA barcode library generation. As a proof of concept, we demonstrate that our framework is able to generate a library consisting of one million DNA barcodes for use in a fragment antibody phage display screening experiment. We also report generating a general purpose one billion DNA barcode library, the largest such library yet reported in literature. Our results demonstrate the value of our novel large-scale DNA barcode library generation framework for use in high-throughput screening applications.
Proposed high throughput electrorefining treatment for spent N- Reactor fuel
International Nuclear Information System (INIS)
Gay, E.C.; Miller, W.E.; Laidler, J.J.
1996-01-01
A high-throughput electrorefining process is being adapted to treat spent N-Reactor fuel for ultimate disposal in a geologic repository. Anodic dissolution tests were made with unirradiated N-Reactor fuel to determine the type of fragmentation necessary to provide fuel segments suitable for this process. Based on these tests, a conceptual design was produced of a plant-scale electrorefiner. In this design, the diameter of an electrode assembly is about 1.07 m (42 in.). Three of these assemblies in an electrorefiner would accommodate a 3-metric-ton batch of N-Reactor fuel that would be processed at a rate of 42 kg of uranium per hour
Mondal, Milon; Groothuis, Daphne E.; Hirsch, Anna K. H.
2015-01-01
Fragment-based drug design (FBDD) has emerged as an efficient hit-identification and/or-optimization strategy with a higher hit rate than high-throughput screening (HTS). Whereas fragment linking is more challenging, fragment growing has become the preferred fragment-optimization strategy, requiring
International Nuclear Information System (INIS)
Worley, Bradley; Sisco, Nicholas J.; Powers, Robert
2015-01-01
NMR ligand-affinity screens are vital to drug discovery, are routinely used to screen fragment-based libraries, and used to verify chemical leads from high-throughput assays and virtual screens. NMR ligand-affinity screens are also a highly informative first step towards identifying functional epitopes of unknown proteins, as well as elucidating the biochemical functions of protein–ligand interaction at their binding interfaces. While simple one-dimensional 1 H NMR experiments are capable of indicating binding through a change in ligand line shape, they are plagued by broad, ill-defined background signals from protein 1 H resonances. We present an uncomplicated method for subtraction of protein background in high-throughput ligand-based affinity screens, and show that its performance is maximized when phase-scatter correction is applied prior to subtraction
Pietiainen, Vilja; Saarela, Jani; von Schantz, Carina; Turunen, Laura; Ostling, Paivi; Wennerberg, Krister
2014-05-01
The High Throughput Biomedicine (HTB) unit at the Institute for Molecular Medicine Finland FIMM was established in 2010 to serve as a national and international academic screening unit providing access to state of the art instrumentation for chemical and RNAi-based high throughput screening. The initial focus of the unit was multiwell plate based chemical screening and high content microarray-based siRNA screening. However, over the first four years of operation, the unit has moved to a more flexible service platform where both chemical and siRNA screening is performed at different scales primarily in multiwell plate-based assays with a wide range of readout possibilities with a focus on ultraminiaturization to allow for affordable screening for the academic users. In addition to high throughput screening, the equipment of the unit is also used to support miniaturized, multiplexed and high throughput applications for other types of research such as genomics, sequencing and biobanking operations. Importantly, with the translational research goals at FIMM, an increasing part of the operations at the HTB unit is being focused on high throughput systems biological platforms for functional profiling of patient cells in personalized and precision medicine projects.
Johnsen, G; Kruse, H; Hofshagen, M
2006-12-01
We examined the occurrence and diversity of Campylobacter jejuni on broiler carcasses during slaughter of an infected flock and in the slaughterhouse environment during slaughter and postdisinfection before a new production run. During the slaughter of a known C. jejuni infected broiler flock, samples were taken from broiler carcasses at 7 different stages during the process. Thirty-seven sites in the slaughterhouse environment were sampled both during process and postdisinfection. The samples were analyzed for C. jejuni, and genetic fingerprinting was performed using amplified fragment length polymorphism. All carcass samples were positive. Of the environmental samples collected during slaughter, 89% were positive; 100% of those from the arrival, stunning, scalding, defeathering, and evisceration facilities and 67% of those from the cooling and sorting facilities. Postdisinfection, 41% of the samples were positive; 71% of those from the arrival and stunning area, 60% of those from the scalding and defeathering area, and 20% of those from the evisceration, cooling, and sorting area. The C. jejuni isolates (n = 60) recovered were grouped into 4 different amplified fragment length polymorphism clones with a similarity index of 95% or greater. All isolates obtained from the flock and 94% of the isolates obtained from the environment during slaughtering belonged to clone A, whereas 1 environmental isolate belonged to each of the clones B and C. Isolates from clones A, B, and D were present postdisinfection. Only clone B was detected on flocks slaughtered during the previous week. The high level and continuous presence of Campylobacter in the environment constitutes a risk for transmission to negative carcasses. In Norway, where above 96% of the broiler flocks are Campylobacter-negative, this aspect is of special importance. The ability of Campylobacter to remain in the slaughterhouse environment through washing and disinfection is associated with constructional
DEFF Research Database (Denmark)
Kuehni-Boghenbor, Kathrin; On, Stephen L.W.; Kokotovic, Branko
2006-01-01
In this study, 231 strains of Yersinia enterocolitica, 25 strains of Y. intermedia, and 10 strains of Y. bercovieri from human and porcine sources (including reference strains) were analyzed using amplified fragment length polymorphism (AFLP), a whole-genome fingerprinting method for subtyping...
Giffard, Philip M; Andersson, Patiyan; Wilson, Judith; Buckley, Cameron; Lilliebridge, Rachael; Harris, Tegan M; Kleinecke, Mariana; O'Grady, Kerry-Ann F; Huston, Wilhelmina M; Lambert, Stephen B; Whiley, David M; Holt, Deborah C
2018-01-01
Chlamydia trachomatis infects the urogenital tract (UGT) and eyes. Anatomical tropism is correlated with variation in the major outer membrane protein encoded by ompA. Strains possessing the ocular ompA variants A, B, Ba and C are typically found within the phylogenetically coherent "classical ocular lineage". However, variants B, Ba and C have also been found within three distinct strains in Australia, all associated with ocular disease in children and outside the classical ocular lineage. CtGEM genotyping is a method for detecting and discriminating ocular strains and also the major phylogenetic lineages. The rationale was facilitation of surveillance to inform responses to C. trachomatis detection in UGT specimens from young children. CtGEM typing is based on high resolution melting analysis (HRMA) of two PCR amplified fragments with high combinatorial resolving power, as defined by computerised comparison of 65 whole genomes. One fragment is from the hypothetical gene defined by Jali-1891 in the C. trachomatis B_Jali20 genome, while the other is from ompA. Twenty combinatorial CtGEM types have been shown to exist, and these encompass unique genotypes for all known ocular strains, and also delineate the TI and T2 major phylogenetic lineages, identify LGV strains and provide additional resolution beyond this. CtGEM typing and Sanger sequencing were compared with 42 C. trachomatis positive clinical specimens, and there were no disjunctions. CtGEM typing is a highly efficient method designed and tested using large scale comparative genomics. It divides C. trachomatis into clinically and biologically meaningful groups, and may have broad application in surveillance.
DEFF Research Database (Denmark)
Kokotovic, Branko; Friis, N.F.; Ahrens, Peter
2002-01-01
, were investigated by analysis of amplified fragment length polymorphisms of the Bgl II and Mfe I restriction sites and by pulsed-field gel electrophoresis of a Bss HII digest of chromosomal DNA. Both methods allowed unambiguous differentiation of the analysed strains and showed similar discriminatory...
Directory of Open Access Journals (Sweden)
Karin Regnström
Full Text Available Surface Plasmon Resonance (SPR is rarely used as a primary High-throughput Screening (HTS tool in fragment-based approaches. With SPR instruments becoming increasingly high-throughput it is now possible to use SPR as a primary tool for fragment finding. SPR becomes, therefore, a valuable tool in the screening of difficult targets such as the ubiquitin E3 ligase Parkin. As a prerequisite for the screen, a large number of SPR tests were performed to characterize and validate the active form of Parkin. A set of compounds was designed and used to define optimal SPR assay conditions for this fragment screen. Using these conditions, more than 5000 pre-selected fragments from our in-house library were screened for binding to Parkin. Additionally, all fragments were simultaneously screened for binding to two off target proteins to exclude promiscuous binding compounds. A low hit rate was observed that is in line with hit rates usually obtained by other HTS screening assays. All hits were further tested in dose responses on the target protein by SPR for confirmation before channeling the hits into Nuclear Magnetic Resonance (NMR and other hit-confirmation assays.
Yi, Liuxi; Gao, Fengyun; Siqin, Bateer; Zhou, Yu; Li, Qiang; Zhao, Xiaoqing; Jia, Xiaoyun; Zhang, Hui
2017-01-01
Flax is an important crop for oil and fiber, however, no high-density genetic maps have been reported for this species. Specific length amplified fragment sequencing (SLAF-seq) is a high-resolution strategy for large scale de novo discovery and genotyping of single nucleotide polymorphisms. In this study, SLAF-seq was employed to develop SNP markers in an F2 population to construct a high-density genetic map for flax. In total, 196.29 million paired-end reads were obtained. The average sequencing depth was 25.08 in male parent, 32.17 in the female parent, and 9.64 in each F2 progeny. In total, 389,288 polymorphic SLAFs were detected, from which 260,380 polymorphic SNPs were developed. After filtering, 4,638 SNPs were found suitable for genetic map construction. The final genetic map included 4,145 SNP markers on 15 linkage groups and was 2,632.94 cM in length, with an average distance of 0.64 cM between adjacent markers. To our knowledge, this map is the densest SNP-based genetic map for flax. The SNP markers and genetic map reported in here will serve as a foundation for the fine mapping of quantitative trait loci (QTLs), map-based gene cloning and marker assisted selection (MAS) for flax.
Zhao, Zhenqing; Gu, Honghui; Sheng, Xiaoguang; Yu, Huifang; Wang, Jiansheng; Huang, Long; Wang, Dan
2016-01-01
Molecular markers and genetic maps play an important role in plant genomics and breeding studies. Cauliflower is an important and distinctive vegetable; however, very few molecular resources have been reported for this species. In this study, a novel, specific-locus amplified fragment (SLAF) sequencing strategy was employed for large-scale single nucleotide polymorphism (SNP) discovery and high-density genetic map construction in a double-haploid, segregating population of cauliflower. A total of 12.47 Gb raw data containing 77.92 M pair-end reads were obtained after processing and 6815 polymorphic SLAFs between the two parents were detected. The average sequencing depths reached 52.66-fold for the female parent and 49.35-fold for the male parent. Subsequently, these polymorphic SLAFs were used to genotype the population and further filtered based on several criteria to construct a genetic linkage map of cauliflower. Finally, 1776 high-quality SLAF markers, including 2741 SNPs, constituted the linkage map with average data integrity of 95.68%. The final map spanned a total genetic length of 890.01 cM with an average marker interval of 0.50 cM, and covered 364.9 Mb of the reference genome. The markers and genetic map developed in this study could provide an important foundation not only for comparative genomics studies within Brassica oleracea species but also for quantitative trait loci identification and molecular breeding of cauliflower. PMID:27047515
Kolano, Bozena; Bednara, Edyta; Weiss-Schneeweiss, Hanna
2013-10-01
High heterogeneity was observed among conserved domains of reverse transcriptase ( rt ) isolated from quinoa. Only one Ty1- copia rt was highly amplified. Reverse transcriptase sequences were located predominantly in pericentromeric region of quinoa chromosomes. The heterogeneity, genomic abundance, and chromosomal distribution of reverse transcriptase (rt)-coding fragments of Ty1-copia and Ty3-gypsy long terminal repeat retrotransposons were analyzed in the Chenopodium quinoa genome. Conserved domains of the rt gene were amplified and characterized using degenerate oligonucleotide primer pairs. Sequence analyses indicated that half of Ty1-copia rt (51 %) and 39 % of Ty3-gypsy rt fragments contained intact reading frames. High heterogeneity among rt sequences was observed for both Ty1-copia and Ty3-gypsy rt amplicons, with Ty1-copia more heterogeneous than Ty3-gypsy. Most of the isolated rt fragments were present in quinoa genome in low copy numbers, with only one highly amplified Ty1-copia rt sequence family. The gypsy-like RNase H fragments co-amplified with Ty1-copia-degenerate primers were shown to be highly amplified in the quinoa genome indicating either higher abundance of some gypsy families of which rt domains could not be amplified, or independent evolution of this gypsy-region in quinoa. Both Ty1-copia and Ty3-gypsy retrotransposons were preferentially located in pericentromeric heterochromatin of quinoa chromosomes. Phylogenetic analyses of newly amplified rt fragments together with well-characterized retrotransposon families from other organisms allowed identification of major lineages of retroelements in the genome of quinoa and provided preliminary insight into their evolutionary dynamics.
High throughput sample processing and automated scoring
Directory of Open Access Journals (Sweden)
Gunnar eBrunborg
2014-10-01
Full Text Available The comet assay is a sensitive and versatile method for assessing DNA damage in cells. In the traditional version of the assay, there are many manual steps involved and few samples can be treated in one experiment. High throughput modifications have been developed during recent years, and they are reviewed and discussed. These modifications include accelerated scoring of comets; other important elements that have been studied and adapted to high throughput are cultivation and manipulation of cells or tissues before and after exposure, and freezing of treated samples until comet analysis and scoring. High throughput methods save time and money but they are useful also for other reasons: large-scale experiments may be performed which are otherwise not practicable (e.g., analysis of many organs from exposed animals, and human biomonitoring studies, and automation gives more uniform sample treatment and less dependence on operator performance. The high throughput modifications now available vary largely in their versatility, capacity, complexity and costs. The bottleneck for further increase of throughput appears to be the scoring.
Zhang, Peng; Zhu, Yuqiang; Wang, Lili; Chen, Liping; Zhou, Shengjun
2015-12-14
Powdery mildew (PM) is the most common fungal disease of cucumber and other cucurbit crops, while breeding the PM-resistant materials is the effective way to defense this disease, and the recent development of modern genetics and genomics make us aware of that studying the resistance genes is the essential way to breed the PM high-resistance plant. With the ever increasing throughput of next-generation sequencing (NGS), the development of specific length amplified fragment sequencing (SLAF-seq) as a high-resolution strategy for large-scale de novo SNP discovery is gradually applied for functional gene mining. Here we combined the bulked segregant analysis (BSA) with SLAF-seq to identify candidate genes associated with PM resistance in cucumber. A segregating population comprising 251 F2 individuals was developed using H136 (female parent) as susceptible parent and BK2 (male parent) as resistance donor. After PMR test, total genomic DNA was prepared from each plant. Systemic genomic analysis of the GC content, repeat sequence, etc. was carried out by prediction software SLAF_Predict to establish condition to ensure the uniformity and density of the molecular markers. After samples were gel purified, SLAFs were generated at Biomarker Technologies Corporation in Beijing. Based on SLAF tags and the PMR test result, the hot region were annotated. A total of 73,100 high-quality SLAF tags with an average depth of 99.11× were sequenced. Among these, 5,355 polymorphic tags were identified with a polymorphism rate of 7.34 %, including 7.09 % SNPs and other polymorphism types. Finally, 140 associated SLAFs were identified, and two main Hot Regions were detected on chromosome 1 and 6, which contained five genes invovled in defense response, toxin metabolism, cell stress response, and injury response in cucumber. Associated markers identified by super-BSA in this study, could not only speed up the study of the PMR genes, but also provide a feasible solution for breeding the
High Throughput Neuro-Imaging Informatics
Directory of Open Access Journals (Sweden)
Michael I Miller
2013-12-01
Full Text Available This paper describes neuroinformatics technologies at 1 mm anatomical scale based on high throughput 3D functional and structural imaging technologies of the human brain. The core is an abstract pipeline for converting functional and structural imagery into their high dimensional neuroinformatic representations index containing O(E3-E4 discriminating dimensions. The pipeline is based on advanced image analysis coupled to digital knowledge representations in the form of dense atlases of the human brain at gross anatomical scale. We demonstrate the integration of these high-dimensional representations with machine learning methods, which have become the mainstay of other fields of science including genomics as well as social networks. Such high throughput facilities have the potential to alter the way medical images are stored and utilized in radiological workflows. The neuroinformatics pipeline is used to examine cross-sectional and personalized analyses of neuropsychiatric illnesses in clinical applications as well as longitudinal studies. We demonstrate the use of high throughput machine learning methods for supporting (i cross-sectional image analysis to evaluate the health status of individual subjects with respect to the population data, (ii integration of image and non-image information for diagnosis and prognosis.
Fragman: an R package for fragment analysis.
Covarrubias-Pazaran, Giovanny; Diaz-Garcia, Luis; Schlautman, Brandon; Salazar, Walter; Zalapa, Juan
2016-04-21
Determination of microsatellite lengths or other DNA fragment types is an important initial component of many genetic studies such as mutation detection, linkage and quantitative trait loci (QTL) mapping, genetic diversity, pedigree analysis, and detection of heterozygosity. A handful of commercial and freely available software programs exist for fragment analysis; however, most of them are platform dependent and lack high-throughput applicability. We present the R package Fragman to serve as a freely available and platform independent resource for automatic scoring of DNA fragment lengths diversity panels and biparental populations. The program analyzes DNA fragment lengths generated in Applied Biosystems® (ABI) either manually or automatically by providing panels or bins. The package contains additional tools for converting the allele calls to GenAlEx, JoinMap® and OneMap software formats mainly used for genetic diversity and generating linkage maps in plant and animal populations. Easy plotting functions and multiplexing friendly capabilities are some of the strengths of this R package. Fragment analysis using a unique set of cranberry (Vaccinium macrocarpon) genotypes based on microsatellite markers is used to highlight the capabilities of Fragman. Fragman is a valuable new tool for genetic analysis. The package produces equivalent results to other popular software for fragment analysis while possessing unique advantages and the possibility of automation for high-throughput experiments by exploiting the power of R.
DEFF Research Database (Denmark)
Kokotovic, Branko; Friis, Niels F.; Nielsen, Elisabeth O.
2002-01-01
Genomic diversity among strains of Mycoplasma hyosynoviae isolated in Denmark was assessed by using amplified fragment length polymorphism (AFLP) analysis. Ninety-six strains, obtained from different specimens and geographical locations during 30 years and the type strain of M. hyosynoviae S16(T......) were concurrently examined for variance in BglII-MfeI and EcoRI-Csp6I-A AFLP markers. A total of 56 different genomic fingerprints having an overall similarity between 77 and 96% were detected. No correlation between AFLP variability and period of isolation or anatomical site of isolation could...
Amplified Fragment Length Polymorphism Diversity in Cephalosporium maydis from Egypt.
Saleh, Amgad A; Zeller, Kurt A; Ismael, Abou-Serie M; Fahmy, Zeinab M; El-Assiuty, Elhamy M; Leslie, John F
2003-07-01
ABSTRACT Cephalosporium maydis, the causal agent of late wilt of maize, was first described in Egypt in the 1960s, where it can cause yield losses of up to 40% in susceptible plantings. We characterized 866 isolates of C. maydis collected from 14 governates in Egypt, 7 in the Nile River Delta and 7 in southern (Middle and Upper) Egypt, with amplified fragment length polymorphism (AFLP) markers. The four AFLP primer-pair combinations generated 68 bands, 25 of which were polymorphic, resulting in 52 clonal haplotypes that clustered the 866 isolates into four phylogenetic lineages. Three lineages were found in both the Nile River Delta and southern Egypt. Lineage IV, the most diverse group (20 haplotypes), was recovered only from governates in the Nile River Delta. In some locations, one lineage dominated (up to 98% of the isolates recovered) and, from some fields, only a single haplotype was recovered. Under field conditions in Egypt, there is no evidence that C. maydis reproduces sexually. The nonuniform geographic distribution of the pathogen lineages within the country could be due to differences in climate or in the farming system, because host material differs in susceptibility and C. maydis lineages differ in pathogenicity.
Analog circuit design designing high performance amplifiers
Feucht, Dennis
2010-01-01
The third volume Designing High Performance Amplifiers applies the concepts from the first two volumes. It is an advanced treatment of amplifier design/analysis emphasizing both wideband and precision amplification.
Class D audio amplifiers for high voltage capacitive transducers
DEFF Research Database (Denmark)
Nielsen, Dennis
of high volume, weight, and cost. High efficient class D amplifiers are now widely available offering power densities, that their linear counterparts can not match. Unlike the technology of audio amplifiers, the loudspeaker is still based on the traditional electrodynamic transducer invented by C.W. Rice......Audio reproduction systems contains two key components, the amplifier and the loudspeaker. In the last 20 – 30 years the technology of audio amplifiers have performed a fundamental shift of paradigm. Class D audio amplifiers have replaced the linear amplifiers, suffering from the well-known issues...... with the low level of acoustical output power and complex amplifier requirements, have limited the commercial success of the technology. Horn or compression drivers are typically favoured, when high acoustic output power is required, this is however at the expense of significant distortion combined...
Chwialkowska, Karolina; Korotko, Urszula; Kosinska, Joanna; Szarejko, Iwona; Kwasniewski, Miroslaw
2017-01-01
Epigenetic mechanisms, including histone modifications and DNA methylation, mutually regulate chromatin structure, maintain genome integrity, and affect gene expression and transposon mobility. Variations in DNA methylation within plant populations, as well as methylation in response to internal and external factors, are of increasing interest, especially in the crop research field. Methylation Sensitive Amplification Polymorphism (MSAP) is one of the most commonly used methods for assessing DNA methylation changes in plants. This method involves gel-based visualization of PCR fragments from selectively amplified DNA that are cleaved using methylation-sensitive restriction enzymes. In this study, we developed and validated a new method based on the conventional MSAP approach called Methylation Sensitive Amplification Polymorphism Sequencing (MSAP-Seq). We improved the MSAP-based approach by replacing the conventional separation of amplicons on polyacrylamide gels with direct, high-throughput sequencing using Next Generation Sequencing (NGS) and automated data analysis. MSAP-Seq allows for global sequence-based identification of changes in DNA methylation. This technique was validated in Hordeum vulgare . However, MSAP-Seq can be straightforwardly implemented in different plant species, including crops with large, complex and highly repetitive genomes. The incorporation of high-throughput sequencing into MSAP-Seq enables parallel and direct analysis of DNA methylation in hundreds of thousands of sites across the genome. MSAP-Seq provides direct genomic localization of changes and enables quantitative evaluation. We have shown that the MSAP-Seq method specifically targets gene-containing regions and that a single analysis can cover three-quarters of all genes in large genomes. Moreover, MSAP-Seq's simplicity, cost effectiveness, and high-multiplexing capability make this method highly affordable. Therefore, MSAP-Seq can be used for DNA methylation analysis in crop
Directory of Open Access Journals (Sweden)
Karolina Chwialkowska
2017-11-01
Full Text Available Epigenetic mechanisms, including histone modifications and DNA methylation, mutually regulate chromatin structure, maintain genome integrity, and affect gene expression and transposon mobility. Variations in DNA methylation within plant populations, as well as methylation in response to internal and external factors, are of increasing interest, especially in the crop research field. Methylation Sensitive Amplification Polymorphism (MSAP is one of the most commonly used methods for assessing DNA methylation changes in plants. This method involves gel-based visualization of PCR fragments from selectively amplified DNA that are cleaved using methylation-sensitive restriction enzymes. In this study, we developed and validated a new method based on the conventional MSAP approach called Methylation Sensitive Amplification Polymorphism Sequencing (MSAP-Seq. We improved the MSAP-based approach by replacing the conventional separation of amplicons on polyacrylamide gels with direct, high-throughput sequencing using Next Generation Sequencing (NGS and automated data analysis. MSAP-Seq allows for global sequence-based identification of changes in DNA methylation. This technique was validated in Hordeum vulgare. However, MSAP-Seq can be straightforwardly implemented in different plant species, including crops with large, complex and highly repetitive genomes. The incorporation of high-throughput sequencing into MSAP-Seq enables parallel and direct analysis of DNA methylation in hundreds of thousands of sites across the genome. MSAP-Seq provides direct genomic localization of changes and enables quantitative evaluation. We have shown that the MSAP-Seq method specifically targets gene-containing regions and that a single analysis can cover three-quarters of all genes in large genomes. Moreover, MSAP-Seq's simplicity, cost effectiveness, and high-multiplexing capability make this method highly affordable. Therefore, MSAP-Seq can be used for DNA methylation
Directory of Open Access Journals (Sweden)
Kotoka Masuyama
Full Text Available Sex determination is important in archeology and anthropology for the study of past societies, cultures, and human activities. Sex determination is also one of the most important components of individual identification in criminal investigations. We developed a new method of sex determination by detecting a single-nucleotide polymorphism in the amelogenin gene using amplified product-length polymorphisms in combination with sex-determining region Y analysis. We particularly focused on the most common types of postmortem DNA damage in ancient and forensic samples: fragmentation and nucleotide modification resulting from deamination. Amplicon size was designed to be less than 60 bp to make the method more useful for analyzing degraded DNA samples. All DNA samples collected from eight Japanese individuals (four male, four female were evaluated correctly using our method. The detection limit for accurate sex determination was determined to be 20 pg of DNA. We compared our new method with commercial short tandem repeat analysis kits using DNA samples artificially fragmented by ultraviolet irradiation. Our novel method was the most robust for highly fragmented DNA samples. To deal with allelic dropout resulting from deamination, we adopted "bidirectional analysis," which analyzed samples from both sense and antisense strands. This new method was applied to 14 Jomon individuals (3500-year-old bone samples whose sex had been identified morphologically. We could correctly identify the sex of 11 out of 14 individuals. These results show that our method is reliable for the sex determination of highly degenerated samples.
Clutterbuck, Abigail L.; Smith, Julia R.; Allaway, David; Harris, Pat; Liddell, Susan; Mobasheri, Ali
2011-01-01
This study employed a targeted high-throughput proteomic approach to identify the major proteins present in the secretome of articular cartilage. Explants from equine metacarpophalangeal joints were incubated alone or with interleukin-1beta (IL-1β, 10 ng/ml), with or without carprofen, a non-steroidal anti-inflammatory drug, for six days. After tryptic digestion of culture medium supernatants, resulting peptides were separated by HPLC and detected in a Bruker amaZon ion trap instrument. The five most abundant peptides in each MS scan were fragmented and the fragmentation patterns compared to mammalian entries in the Swiss-Prot database, using the Mascot search engine. Tryptic peptides originating from aggrecan core protein, cartilage oligomeric matrix protein (COMP), fibronectin, fibromodulin, thrombospondin-1 (TSP-1), clusterin (CLU), cartilage intermediate layer protein-1 (CILP-1), chondroadherin (CHAD) and matrix metalloproteinases MMP-1 and MMP-3 were detected. Quantitative western blotting confirmed the presence of CILP-1, CLU, MMP-1, MMP-3 and TSP-1. Treatment with IL-1β increased MMP-1, MMP-3 and TSP-1 and decreased the CLU precursor but did not affect CILP-1 and CLU levels. Many of the proteins identified have well-established extracellular matrix functions and are involved in early repair/stress responses in cartilage. This high throughput approach may be used to study the changes that occur in the early stages of osteoarthritis. PMID:21354348
Brouat, C; McKey, D; Douzery, E J P
2004-05-01
Comprising four allopatric subspecies that exhibit various grades of ant-plant interactions, from diffuse to obligate and symbiotic associations, the Leonardoxa africana complex (Fabaceae, Caesalpinioideae) provides a good opportunity to investigate the evolutionary history of ant-plant mutualisms. A previous study of the L. africana complex based on chloroplast DNA noncoding sequences revealed a lack of congruence between clades suggested by morphological and plastid characters. In this study, we analysed phylogenetic relationships within the L. africana complex using a Bayesian probability approach on amplified fragment length polymorphism markers. The results reported permit partial validation of the four subspecies of L. africana previously defined by morphological and ecological markers. Incongruences between phylogenies based on chloroplast DNA and amplified fragment length polymorphism markers are discussed in the light of morphological and ecological data, and confronted with hypotheses of convergence, lineage sorting and introgression.
High Throughput Transcriptomics @ USEPA (Toxicology ...
The ideal chemical testing approach will provide complete coverage of all relevant toxicological responses. It should be sensitive and specific It should identify the mechanism/mode-of-action (with dose-dependence). It should identify responses relevant to the species of interest. Responses should ideally be translated into tissue-, organ-, and organism-level effects. It must be economical and scalable. Using a High Throughput Transcriptomics platform within US EPA provides broader coverage of biological activity space and toxicological MOAs and helps fill the toxicological data gap. Slide presentation at the 2016 ToxForum on using High Throughput Transcriptomics at US EPA for broader coverage biological activity space and toxicological MOAs.
Series-Tuned High Efficiency RF-Power Amplifiers
DEFF Research Database (Denmark)
Vidkjær, Jens
2008-01-01
An approach to high efficiency RF-power amplifier design is presented. It addresses simultaneously efficiency optimization and peak voltage limitations when transistors are pushed towards their power limits.......An approach to high efficiency RF-power amplifier design is presented. It addresses simultaneously efficiency optimization and peak voltage limitations when transistors are pushed towards their power limits....
Application of ToxCast High-Throughput Screening and ...
Slide presentation at the SETAC annual meeting on High-Throughput Screening and Modeling Approaches to Identify Steroidogenesis Distruptors Slide presentation at the SETAC annual meeting on High-Throughput Screening and Modeling Approaches to Identify Steroidogenssis Distruptors
A high throughput DNA extraction method with high yield and quality
Directory of Open Access Journals (Sweden)
Xin Zhanguo
2012-07-01
Full Text Available Abstract Background Preparation of large quantity and high quality genomic DNA from a large number of plant samples is a major bottleneck for most genetic and genomic analyses, such as, genetic mapping, TILLING (Targeting Induced Local Lesion IN Genome, and next-generation sequencing directly from sheared genomic DNA. A variety of DNA preparation methods and commercial kits are available. However, they are either low throughput, low yield, or costly. Here, we describe a method for high throughput genomic DNA isolation from sorghum [Sorghum bicolor (L. Moench] leaves and dry seeds with high yield, high quality, and affordable cost. Results We developed a high throughput DNA isolation method by combining a high yield CTAB extraction method with an improved cleanup procedure based on MagAttract kit. The method yielded large quantity and high quality DNA from both lyophilized sorghum leaves and dry seeds. The DNA yield was improved by nearly 30 fold with 4 times less consumption of MagAttract beads. The method can also be used in other plant species, including cotton leaves and pine needles. Conclusion A high throughput system for DNA extraction from sorghum leaves and seeds was developed and validated. The main advantages of the method are low cost, high yield, high quality, and high throughput. One person can process two 96-well plates in a working day at a cost of $0.10 per sample of magnetic beads plus other consumables that other methods will also need.
Chwialkowska, Karolina; Korotko, Urszula; Kosinska, Joanna; Szarejko, Iwona; Kwasniewski, Miroslaw
2017-01-01
Epigenetic mechanisms, including histone modifications and DNA methylation, mutually regulate chromatin structure, maintain genome integrity, and affect gene expression and transposon mobility. Variations in DNA methylation within plant populations, as well as methylation in response to internal and external factors, are of increasing interest, especially in the crop research field. Methylation Sensitive Amplification Polymorphism (MSAP) is one of the most commonly used methods for assessing DNA methylation changes in plants. This method involves gel-based visualization of PCR fragments from selectively amplified DNA that are cleaved using methylation-sensitive restriction enzymes. In this study, we developed and validated a new method based on the conventional MSAP approach called Methylation Sensitive Amplification Polymorphism Sequencing (MSAP-Seq). We improved the MSAP-based approach by replacing the conventional separation of amplicons on polyacrylamide gels with direct, high-throughput sequencing using Next Generation Sequencing (NGS) and automated data analysis. MSAP-Seq allows for global sequence-based identification of changes in DNA methylation. This technique was validated in Hordeum vulgare. However, MSAP-Seq can be straightforwardly implemented in different plant species, including crops with large, complex and highly repetitive genomes. The incorporation of high-throughput sequencing into MSAP-Seq enables parallel and direct analysis of DNA methylation in hundreds of thousands of sites across the genome. MSAP-Seq provides direct genomic localization of changes and enables quantitative evaluation. We have shown that the MSAP-Seq method specifically targets gene-containing regions and that a single analysis can cover three-quarters of all genes in large genomes. Moreover, MSAP-Seq's simplicity, cost effectiveness, and high-multiplexing capability make this method highly affordable. Therefore, MSAP-Seq can be used for DNA methylation analysis in crop
Coppa, Giovanni V; Galeotti, Fabio; Zampini, Lucia; Maccari, Francesca; Galeazzi, Tiziana; Padelia, Lucia; Santoro, Lucia; Gabrielli, Orazio; Volpi, Nicola
2011-04-01
Mucopolysaccharidoses (MPS) diagnosis is often delayed and irreversible organ damage can occur, making possible therapies less effective. This highlights the importance of early and accurate diagnosis. A high-throughput procedure for the simultaneous determination of glucosamine and galactosamine produced from urinary galactosaminoglycans and glucosaminoglycans by capillary electrophoresis (CE) and HPLC has been performed and validated in subjects affected by various MPS including their mild and severe forms, Hurler and Hurler-Scheie, Hunter, Sanfilippo, Morquio, and Maroteaux-Lamy. Contrary to other analytical approaches, the present single analytical procedure, which is able to measure total abnormal amounts of urinary GAGs, high molecular mass, and related fragments, as well as specific hexosamines belonging to a group of GAGs, would be useful for possible application in their early diagnosis. After a rapid urine pretreatment, free hexosamines are generated by acidic hydrolysis, derivatized with 2-aminobenzoic acid and separated by CE/UV in ∼10min and reverse-phase (RP)-HPLC in fluorescence in ∼21min. The total content of hexosamines was found to be indicative of abnormal urinary excretion of GAGs in patients compared to the controls, and the galactosamine/glucosamine ratio was observed to be related to specific MPS syndromes in regard to both their mild and severe forms. As a consequence, important correlations between analytical response and clinical diagnosis and the severity of the disorders were observed. Furthermore, we can assume that the severity of the syndrome may be ascribed to the quantity of total GAGs, as high-molecular-mass polymers and fragments, accumulated in cells and directly excreted in the urine. Finally, due to the high-throughput nature of this approach and to the equipment commonly available in laboratories, this method is suitable for newborn screening in preventive public health programs for early detection of MPS disorders
Geornaras, I; Kunene, N F; von Holy, A; Hastings, J W
1999-09-01
Molecular typing has been used previously to identify and trace dissemination of pathogenic and spoilage bacteria associated with food processing. Amplified fragment length polymorphism (AFLP) is a novel DNA fingerprinting technique which is considered highly reproducible and has high discriminatory power. This technique was used to fingerprint 88 Pseudomonas fluorescens and Pseudomonas putida strains that were previously isolated from plate counts of carcasses at six processing stages and various equipment surfaces and environmental sources of a poultry abattoir. Clustering of the AFLP patterns revealed a high level of diversity among the strains. Six clusters (clusters I through VI) were delineated at an arbitrary Dice coefficient level of 0.65; clusters III (31 strains) and IV (28 strains) were the largest clusters. More than one-half (52.3%) of the strains obtained from carcass samples, which may have represented the resident carcass population, grouped together in cluster III. By contrast, 43.2% of the strains from most of the equipment surfaces and environmental sources grouped together in cluster IV. In most cases, the clusters in which carcass strains from processing stages grouped corresponded to the clusters in which strains from the associated equipment surfaces and/or environmental sources were found. This provided evidence that there was cross-contamination between carcasses and the abattoir environment at the DNA level. The AFLP data also showed that strains were being disseminated from the beginning to the end of the poultry processing operation, since many strains associated with carcasses at the packaging stage were members of the same clusters as strains obtained from carcasses after the defeathering stage.
DEFF Research Database (Denmark)
Engmark, Mikael; Andersen, Mikael Rørdam; Laustsen, Andreas Hougaard
2016-01-01
Snakebite envenoming is a serious condition requiring medical attention and administration of antivenom. Current antivenoms are antibody preparations obtained from the plasma of animals immunised with whole venom(s) and contain antibodies against snake venom toxins, but also against other antigens....... In order to better understand the molecular interactions between antivenom antibodies and epitopes on snake venom toxins, a high-throughput immuno-profiling study on all manually curated toxins from Dendroaspis species and selected African Naja species was performed based on custom-made high......-density peptide microarrays displaying linear toxin fragments. By detection of binding for three different antivenoms and performing an alanine scan, linear elements of epitopes and the positions important for binding were identified. A strong tendency of antivenom antibodies recognizing and binding to epitopes...
Amplified spontaneous emissions in a high-gain laser amplifier
International Nuclear Information System (INIS)
Osada, Hidenori; Gamo, Hideya.
1978-01-01
The gain and line-narrowing of the amplified spontaneous emissions(ASE) in a partially homogeneous high-gain Xe 3.51 μm laser amplifier were studied theoretically and experimentally with emphasis of saturation effect. The unidirectionally travelling ASE was generated by conveniently using optical isolators and used as a broadband radiation source. It has properties of 10 μW/mm 2 in intensity with fluctuation of less than 1% in 5 hours, 43.5 MHz of the linewidth and 1.0 x 10 -3 radians of beam divergence. The measured saturation intensity was 4.85 μW/mm 2 and a small signal gain was 0.1 cm -1 . The theoretical prediction of the line-narrowing shows reasonablly good agreement with the measured one. (author)
Masuyama, Kotoka; Shojo, Hideki; Nakanishi, Hiroaki; Inokuchi, Shota; Adachi, Noboru
2017-01-01
Sex determination is important in archeology and anthropology for the study of past societies, cultures, and human activities. Sex determination is also one of the most important components of individual identification in criminal investigations. We developed a new method of sex determination by detecting a single-nucleotide polymorphism in the amelogenin gene using amplified product-length polymorphisms in combination with sex-determining region Y analysis. We particularly focused on the most common types of postmortem DNA damage in ancient and forensic samples: fragmentation and nucleotide modification resulting from deamination. Amplicon size was designed to be less than 60 bp to make the method more useful for analyzing degraded DNA samples. All DNA samples collected from eight Japanese individuals (four male, four female) were evaluated correctly using our method. The detection limit for accurate sex determination was determined to be 20 pg of DNA. We compared our new method with commercial short tandem repeat analysis kits using DNA samples artificially fragmented by ultraviolet irradiation. Our novel method was the most robust for highly fragmented DNA samples. To deal with allelic dropout resulting from deamination, we adopted “bidirectional analysis,” which analyzed samples from both sense and antisense strands. This new method was applied to 14 Jomon individuals (3500-year-old bone samples) whose sex had been identified morphologically. We could correctly identify the sex of 11 out of 14 individuals. These results show that our method is reliable for the sex determination of highly degenerated samples. PMID:28052096
Elsheikha, H. M.; Schott, H. C.; Mansfield, L. S.
2006-01-01
Sarcocystis neurona causes serious neurological disease in horses and other vertebrates in the Americas. Based on epidemiological data, this parasite has recently emerged. Here, the genetic diversity of Sarcocystis neurona was evaluated using the amplified fragment length polymorphism (AFLP) method. Fifteen S. neurona taxa from different regions collected over the last 10 years were used; six isolates were from clinically diseased horses, eight isolates were from wild-caught opossums (Didelph...
The design of high performance weak current integrated amplifier
International Nuclear Information System (INIS)
Chen Guojie; Cao Hui
2005-01-01
A design method of high performance weak current integrated amplifier using ICL7650 operational amplifier is introduced. The operating principle of circuits and the step of improving amplifier's performance are illustrated. Finally, the experimental results are given. The amplifier has programmable measurement range of 10 -9 -10 -12 A, automatic zero-correction, accurate measurement, and good stability. (authors)
High Throughput PBTK: Open-Source Data and Tools for ...
Presentation on High Throughput PBTK at the PBK Modelling in Risk Assessment meeting in Ispra, Italy Presentation on High Throughput PBTK at the PBK Modelling in Risk Assessment meeting in Ispra, Italy
TARC: Carlo Rubbia's Energy Amplifier
Laurent Guiraud
1997-01-01
Transmutation by Adiabatic Resonance Crossing (TARC) is Carlo Rubbia's energy amplifier. This CERN experiment demonstrated that long-lived fission fragments, such as 99-TC, can be efficiently destroyed.
DEFF Research Database (Denmark)
Fry, N K; Bangsborg, Jette Marie; Bernander, S
2000-01-01
The aims of this work were to assess (i) the intercentre reproducibility and epidemiological concordance of amplified fragment length polymorphism analysis for epidemiological typing of Legionella pneumophila serogroup 1, and (ii) the suitability of the method for standardisation and implementation...... by members of the European Working Group on Legionella Infections. Fifty coded isolates comprising two panels of well-characterised strains, a "reproducibility" panel (n=20) and an "epidemiologically related" panel (n=30), were sent to 13 centres in 12 European countries. Analysis was undertaken in each...... using gel analysis software yielded R=1.00 and E=1.00, with 12, 13 or 14 types. This method can be used as a simple, rapid screening tool for epidemiological typing of isolates of Legionella pneumophila serogroup 1. Results demonstrate that the method can be highly reproducible (R=1...
Varnes, Jeffrey G; Geschwindner, Stefan; Holmquist, Christopher R; Forst, Janet; Wang, Xia; Dekker, Niek; Scott, Clay W; Tian, Gaochao; Wood, Michael W; Albert, Jeffrey S
2016-01-01
Fragment-based drug design (FBDD) relies on direct elaboration of fragment hits and typically requires high resolution structural information to guide optimization. In fragment-assisted drug discovery (FADD), fragments provide information to guide selection and design but do not serve as starting points for elaboration. We describe FADD and high-throughput screening (HTS) campaign strategies conducted in parallel against PDE10A where fragment hit co-crystallography was not available. The fragment screen led to prioritized fragment hits (IC50's ∼500μM), which were used to generate a hypothetical core scaffold. Application of this scaffold as a filter to HTS output afforded a 4μM hit, which, after preparation of a small number of analogs, was elaborated into a 16nM lead. This approach highlights the strength of FADD, as fragment methods were applied despite the absence of co-crystallographical information to efficiently identify a lead compound for further optimization. Copyright © 2015 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Li Kelvin
2012-11-01
Full Text Available Abstract Background In a high-throughput environment, to PCR amplify and sequence a large set of viral isolates from populations that are potentially heterogeneous and continuously evolving, the use of degenerate PCR primers is an important strategy. Degenerate primers allow for the PCR amplification of a wider range of viral isolates with only one set of pre-mixed primers, thus increasing amplification success rates and minimizing the necessity for genome finishing activities. To successfully select a large set of degenerate PCR primers necessary to tile across an entire viral genome and maximize their success, this process is best performed computationally. Results We have developed a fully automated degenerate PCR primer design system that plays a key role in the J. Craig Venter Institute’s (JCVI high-throughput viral sequencing pipeline. A consensus viral genome, or a set of consensus segment sequences in the case of a segmented virus, is specified using IUPAC ambiguity codes in the consensus template sequence to represent the allelic diversity of the target population. PCR primer pairs are then selected computationally to produce a minimal amplicon set capable of tiling across the full length of the specified target region. As part of the tiling process, primer pairs are computationally screened to meet the criteria for successful PCR with one of two described amplification protocols. The actual sequencing success rates for designed primers for measles virus, mumps virus, human parainfluenza virus 1 and 3, human respiratory syncytial virus A and B and human metapneumovirus are described, where >90% of designed primer pairs were able to consistently successfully amplify >75% of the isolates. Conclusions Augmenting our previously developed and published JCVI Primer Design Pipeline, we achieved similarly high sequencing success rates with only minor software modifications. The recommended methodology for the construction of the consensus
High throughput screening method for assessing heterogeneity of microorganisms
Ingham, C.J.; Sprenkels, A.J.; van Hylckama Vlieg, J.E.T.; Bomer, Johan G.; de Vos, W.M.; van den Berg, Albert
2006-01-01
The invention relates to the field of microbiology. Provided is a method which is particularly powerful for High Throughput Screening (HTS) purposes. More specific a high throughput method for determining heterogeneity or interactions of microorganisms is provided.
Avrova, Anna O.; Hyman, Lizbeth J.; Toth, Rachel L.; Toth, Ian K.
2002-01-01
The soft rot bacteria Erwinia carotovora and Erwinia chrysanthemi are important pathogens of potato and other crops. However, the taxonomy of these pathogens, particularly at subspecies level, is unclear. An investigation using amplified fragment length polymorphism (AFLP) fingerprinting was undertaken to determine the taxonomic relationships within this group based on their genetic relatedness. Following cluster analysis on the similarity matrices derived from the AFLP gels, four clusters (c...
A high-power two stage traveling-wave tube amplifier
International Nuclear Information System (INIS)
Shiffler, D.; Nation, J.A.; Schachter, L.; Ivers, J.D.; Kerslick, G.S.
1991-01-01
Results are presented on the development of a two stage high-efficiency, high-power 8.76-GHz traveling-wave tube amplifier. The work presented augments previously reported data on a single stage amplifier and presents new data on the operational characteristics of two identical amplifiers operated in series and separated from each other by a sever. Peak powers of 410 MW have been obtained over the complete pulse duration of the device, with a conversion efficiency from the electron beam to microwave energy of 45%. In all operating conditions the severed amplifier showed a ''sideband''-like structure in the frequency spectrum of the microwave radiation. A similar structure was apparent at output powers in excess of 70 MW in the single stage device. The frequencies of the ''sidebands'' are not symmetric with respect to the center frequency. The maximum, single frequency, average output power was 210 MW corresponding to an amplifier efficiency of 24%. Simulation data is also presented that indicates that the short amplifiers used in this work exhibit significant differences in behavior from conventional low-power amplifiers. These include finite length effects on the gain characteristics, which may account for the observed narrow bandwidth of the amplifiers and for the appearance of the sidebands. It is also found that the bunching length for the beam may be a significant fraction of the total amplifier length
Nemes, Peter; Hoover, William J; Keire, David A
2013-08-06
Sensors with high chemical specificity and enhanced sample throughput are vital to screening food products and medical devices for chemical or biochemical contaminants that may pose a threat to public health. For example, the rapid detection of oversulfated chondroitin sulfate (OSCS) in heparin could prevent reoccurrence of heparin adulteration that caused hundreds of severe adverse events including deaths worldwide in 2007-2008. Here, rapid pyrolysis is integrated with direct analysis in real time (DART) mass spectrometry to rapidly screen major glycosaminoglycans, including heparin, chondroitin sulfate A, dermatan sulfate, and OSCS. The results demonstrate that, compared to traditional liquid chromatography-based analyses, pyrolysis mass spectrometry achieved at least 250-fold higher sample throughput and was compatible with samples volume-limited to about 300 nL. Pyrolysis yielded an abundance of fragment ions (e.g., 150 different m/z species), many of which were specific to the parent compound. Using multivariate and statistical data analysis models, these data enabled facile differentiation of the glycosaminoglycans with high throughput. After method development was completed, authentically contaminated samples obtained during the heparin crisis by the FDA were analyzed in a blinded manner for OSCS contamination. The lower limit of differentiation and detection were 0.1% (w/w) OSCS in heparin and 100 ng/μL (20 ng) OSCS in water, respectively. For quantitative purposes the linear dynamic range spanned approximately 3 orders of magnitude. Moreover, this chemical readout was successfully employed to find clues in the manufacturing history of the heparin samples that can be used for surveillance purposes. The presented technology and data analysis protocols are anticipated to be readily adaptable to other chemical and biochemical agents and volume-limited samples.
High-throughput sample adaptive offset hardware architecture for high-efficiency video coding
Zhou, Wei; Yan, Chang; Zhang, Jingzhi; Zhou, Xin
2018-03-01
A high-throughput hardware architecture for a sample adaptive offset (SAO) filter in the high-efficiency video coding video coding standard is presented. First, an implementation-friendly and simplified bitrate estimation method of rate-distortion cost calculation is proposed to reduce the computational complexity in the mode decision of SAO. Then, a high-throughput VLSI architecture for SAO is presented based on the proposed bitrate estimation method. Furthermore, multiparallel VLSI architecture for in-loop filters, which integrates both deblocking filter and SAO filter, is proposed. Six parallel strategies are applied in the proposed in-loop filters architecture to improve the system throughput and filtering speed. Experimental results show that the proposed in-loop filters architecture can achieve up to 48% higher throughput in comparison with prior work. The proposed architecture can reach a high-operating clock frequency of 297 MHz with TSMC 65-nm library and meet the real-time requirement of the in-loop filters for 8 K × 4 K video format at 132 fps.
Host- and tissue-specific pathogenic traits of Staphylococcus aureus.
W.B. van Leeuwen (Willem); D.C. Melles (Damian); A. Alaidan (Alwaleed); M. Al-Ahdal (Mohammed); H.A.M. Boelens (Hélène); S.V. Snijders (Susan); H.F.L. Wertheim (Heiman); E. van Duijkeren (Engeline); J.K. Peeters (Justine); P.J. van der Spek (Peter); R.F.J. Gorkink (Raymond); G. Simons (Guus); H.A. Verbrugh (Henri); A.F. van Belkum (Alex)
2005-01-01
textabstractComparative genomics were used to assess genetic differences between Staphylococcus aureus strains derived from infected animals versus colonized or infected humans. A total of 77 veterinary isolates were genetically characterized by high-throughput amplified fragment length polymorphism
International Nuclear Information System (INIS)
Fahmy, E.M.; Sobieh, S. E. S.; Ayaad, M. H.; El-Gohary, A. A.; Rownak, A.
2012-12-01
Accurate identifying of the genotypes is considered one of the most important mechanisms used in the recording or the protection of plant varieties. The investigation was conducted at the experimental form belonging to the egyptian Atomic Energy Authority, Inshas. The aim was to evaluate grain quality characteristics and molecular genetic variation using Amplified Fragment Length Polymorphism (AFLP) technique among six rice genotypes, Egyptian Jasmine aromatic rice cultivar and five aromatic rice mutants in (M3 mutagenic generation). Two mutation (Egy22 and Egy24) were selected from irradiated Sakha 102 population with 200 and 400Gy of gamma rays in the M2 generation, respectively, and three mutations ( Egy32, Egy33, and Egy34) were selected from irradiated Sakha 103 population with 200, 300, 400Gy of gamma rays in the M2 generation, respectively. The obtained results showed that the strong aroma was obtained for mutant Egy22 as compared with Egyptian Jasmine rice cultivar (moderate aroma). Seven primer combinations were used through six rice genotypes on the molecular level using AFLP marker. The size of AFLP Fragments Were Ranged from 51- 494bp. The total number of amplified bands was 997 band among them 919 polymorphic bans representing 92.2%. The highest similarity index (89%) was observed between Egyptian Jasmine and Egy32 followed by (82%) observed between Egyptian Jasmine and Egy34. On the other hand, the lowest similarity index was (48%) between Egyptian Jasmine and Egy24. In six rice genotypes, Egy24 produced the highest number of the AFLP makers giving 49 unique markers (23 positive and 26 negative), then Egy22 showed 23 unique markers (27 positive and 6 negative) while Egy33 was characterized by 17 unique markers (12 positive and 5 negative). At last Egyptian Jasmine was discriminated by the lowest number of markets, 10 (6 positive and 4 negative). The study further confirmed that AFLP technique was able to differentiate rice genotypes by a higher number
Fragment informatics and computational fragment-based drug design: an overview and update.
Sheng, Chunquan; Zhang, Wannian
2013-05-01
Fragment-based drug design (FBDD) is a promising approach for the discovery and optimization of lead compounds. Despite its successes, FBDD also faces some internal limitations and challenges. FBDD requires a high quality of target protein and good solubility of fragments. Biophysical techniques for fragment screening necessitate expensive detection equipment and the strategies for evolving fragment hits to leads remain to be improved. Regardless, FBDD is necessary for investigating larger chemical space and can be applied to challenging biological targets. In this scenario, cheminformatics and computational chemistry can be used as alternative approaches that can significantly improve the efficiency and success rate of lead discovery and optimization. Cheminformatics and computational tools assist FBDD in a very flexible manner. Computational FBDD can be used independently or in parallel with experimental FBDD for efficiently generating and optimizing leads. Computational FBDD can also be integrated into each step of experimental FBDD and help to play a synergistic role by maximizing its performance. This review will provide critical analysis of the complementarity between computational and experimental FBDD and highlight recent advances in new algorithms and successful examples of their applications. In particular, fragment-based cheminformatics tools, high-throughput fragment docking, and fragment-based de novo drug design will provide the focus of this review. We will also discuss the advantages and limitations of different methods and the trends in new developments that should inspire future research. © 2012 Wiley Periodicals, Inc.
High Throughput Determinations of Critical Dosing Parameters (IVIVE workshop)
High throughput toxicokinetics (HTTK) is an approach that allows for rapid estimations of TK for hundreds of environmental chemicals. HTTK-based reverse dosimetry (i.e, reverse toxicokinetics or RTK) is used in order to convert high throughput in vitro toxicity screening (HTS) da...
International Nuclear Information System (INIS)
Cuttitta, Christina M.; Ericson, Daniel L.; Scalia, Alexander; Roessler, Christian G.; Teplitsky, Ella; Joshi, Karan; Campos, Olven; Agarwal, Rakhi; Allaire, Marc; Orville, Allen M.; Sweet, Robert M.; Soares, Alexei S.
2015-01-01
An acoustic high-throughput screening method is described for harvesting protein crystals and combining the protein crystals with chemicals such as a fragment library. Acoustic droplet ejection (ADE) is an emerging technology with broad applications in serial crystallography such as growing, improving and manipulating protein crystals. One application of this technology is to gently transfer crystals onto MiTeGen micromeshes with minimal solvent. Once mounted on a micromesh, each crystal can be combined with different chemicals such as crystal-improving additives or a fragment library. Acoustic crystal mounting is fast (2.33 transfers s −1 ) and all transfers occur in a sealed environment that is in vapor equilibrium with the mother liquor. Here, a system is presented to retain crystals near the ejection point and away from the inaccessible dead volume at the bottom of the well by placing the crystals on a concave agarose pedestal (CAP) with the same chemical composition as the crystal mother liquor. The bowl-shaped CAP is impenetrable to crystals. Consequently, gravity will gently move the crystals into the optimal location for acoustic ejection. It is demonstrated that an agarose pedestal of this type is compatible with most commercially available crystallization conditions and that protein crystals are readily transferred from the agarose pedestal onto micromeshes with no loss in diffraction quality. It is also shown that crystals can be grown directly on CAPs, which avoids the need to transfer the crystals from the hanging drop to a CAP. This technology has been used to combine thermolysin and lysozyme crystals with an assortment of anomalously scattering heavy atoms. The results point towards a fast nanolitre method for crystal mounting and high-throughput screening
Honma, K.; Handa, K.; Akinaga, W.; Doi, M.; Matsuzaki, O.
This paper describes the design and the performance of the S-band low noise amplifier and the S-band high power amplifier that have been developed for the Usuda Deep Space Station of the Institute of Space and Astronautical Science (ISAS), Japan. The S-band low noise amplifier consists of a helium gas-cooled parametric amplifier followed by three-stage FET amplifiers and has a noise temperature of 8 K. The high power amplifier is composed of two 28 kW klystrons, capable of transmitting 40 kW continuously when two klystrons are combined. Both subsystems are operating quite satisfactorily in the tracking of Sakigake and Suisei, the Japanese interplanetary probes for Halley's comet exploration, launched by ISAS in 1985.
Library Design-Facilitated High-Throughput Sequencing of Synthetic Peptide Libraries.
Vinogradov, Alexander A; Gates, Zachary P; Zhang, Chi; Quartararo, Anthony J; Halloran, Kathryn H; Pentelute, Bradley L
2017-11-13
A methodology to achieve high-throughput de novo sequencing of synthetic peptide mixtures is reported. The approach leverages shotgun nanoliquid chromatography coupled with tandem mass spectrometry-based de novo sequencing of library mixtures (up to 2000 peptides) as well as automated data analysis protocols to filter away incorrect assignments, noise, and synthetic side-products. For increasing the confidence in the sequencing results, mass spectrometry-friendly library designs were developed that enabled unambiguous decoding of up to 600 peptide sequences per hour while maintaining greater than 85% sequence identification rates in most cases. The reliability of the reported decoding strategy was additionally confirmed by matching fragmentation spectra for select authentic peptides identified from library sequencing samples. The methods reported here are directly applicable to screening techniques that yield mixtures of active compounds, including particle sorting of one-bead one-compound libraries and affinity enrichment of synthetic library mixtures performed in solution.
Applications of ambient mass spectrometry in high-throughput screening.
Li, Li-Ping; Feng, Bao-Sheng; Yang, Jian-Wang; Chang, Cui-Lan; Bai, Yu; Liu, Hu-Wei
2013-06-07
The development of rapid screening and identification techniques is of great importance for drug discovery, doping control, forensic identification, food safety and quality control. Ambient mass spectrometry (AMS) allows rapid and direct analysis of various samples in open air with little sample preparation. Recently, its applications in high-throughput screening have been in rapid progress. During the past decade, various ambient ionization techniques have been developed and applied in high-throughput screening. This review discusses typical applications of AMS, including DESI (desorption electrospray ionization), DART (direct analysis in real time), EESI (extractive electrospray ionization), etc., in high-throughput screening (HTS).
Directory of Open Access Journals (Sweden)
Weiguo Hou
2018-05-01
Full Text Available Myocyanophages, a group of viruses infecting cyanobacteria, are abundant and play important roles in elemental cycling. Here we investigated the particle-associated viral communities retained on 0.2 μm filters and in sediment samples (representing ancient cyanophage communities from four ocean and three lake locations, using high-throughput sequencing and a newly designed primer pair targeting a gene fragment (∼145-bp in length encoding the cyanophage gp23 major capsid protein (MCP. Diverse viral communities were detected in all samples. The fragments of 142-, 145-, and 148-bp in length were most abundant in the amplicons, and most sequences (>92% belonged to cyanophages. Additionally, different sequencing depths resulted in different diversity estimates of the viral community. Operational taxonomic units obtained from deep sequencing of the MCP gene covered the majority of those obtained from shallow sequencing, suggesting that deep sequencing exhibited a more complete picture of cyanophage community than shallow sequencing. Our results also revealed a wide geographic distribution of marine myocyanophages, i.e., higher dissimilarities of the myocyanophage communities corresponded with the larger distances between the sampling sites. Collectively, this study suggests that the newly designed primer pair can be effectively used to study the community and diversity of myocyanophage from different environments, and the high-throughput sequencing represents a good method to understand viral diversity.
High-Throughput Analysis of T-DNA Location and Structure Using Sequence Capture.
Inagaki, Soichi; Henry, Isabelle M; Lieberman, Meric C; Comai, Luca
2015-01-01
Agrobacterium-mediated transformation of plants with T-DNA is used both to introduce transgenes and for mutagenesis. Conventional approaches used to identify the genomic location and the structure of the inserted T-DNA are laborious and high-throughput methods using next-generation sequencing are being developed to address these problems. Here, we present a cost-effective approach that uses sequence capture targeted to the T-DNA borders to select genomic DNA fragments containing T-DNA-genome junctions, followed by Illumina sequencing to determine the location and junction structure of T-DNA insertions. Multiple probes can be mixed so that transgenic lines transformed with different T-DNA types can be processed simultaneously, using a simple, index-based pooling approach. We also developed a simple bioinformatic tool to find sequence read pairs that span the junction between the genome and T-DNA or any foreign DNA. We analyzed 29 transgenic lines of Arabidopsis thaliana, each containing inserts from 4 different T-DNA vectors. We determined the location of T-DNA insertions in 22 lines, 4 of which carried multiple insertion sites. Additionally, our analysis uncovered a high frequency of unconventional and complex T-DNA insertions, highlighting the needs for high-throughput methods for T-DNA localization and structural characterization. Transgene insertion events have to be fully characterized prior to use as commercial products. Our method greatly facilitates the first step of this characterization of transgenic plants by providing an efficient screen for the selection of promising lines.
High energy high repetition-rate thin-disk amplifier for OPCPA pumping
Energy Technology Data Exchange (ETDEWEB)
Schulz, Michael
2013-08-15
The development of a pump laser system for a high power and high repetition rate optical parametric chirped-pulse amplification (OPCPA) is presented in this thesis. The OPCPA system requires pump pulse energies in the range of tens of millijoules at high repetition rates with sub-picosecond pulse durations. This can be achieved to some extend with Innoslab amplifier technology. However, scaling to higher pulse energies at high repetition rates may be problematic. With the thin-disk amplifier presented in this thesis, output energies of 140 mJ at 100 kHz repetition rate could be achieved in burst-mode operation, which is a world record for this type of laser amplifier. Due to its material and spectral properties, ytterbium doped YAG (Yb:YAG) is used as a gain medium for the high power amplifier stages. The low quantum defect and the comparatively large emission bandwidth makes this material the choice for high power operation and sub-picosecond compressed pulse durations. The output beam profile as well as the shape of the output bursts is ideal to pump an OPCPA system. An OPCPA output energy in the millijoule range with repetition rates of 100 kHz to 1 MHz is needed to generate seed pulses for the FEL and for the application as pump-probe laser at the FEL facility. Since the development of this laser system needs to meet requirements set by the Free-Electron Laser in Hamburg (FLASH), the amplifier is conceived for burst-mode operation. The main requirement is a high intra-burst pulse repetition rate of more than 100 kHz and a uniform pulse train (burst) with equal properties for every pulse. The burst-mode is an operation mode where the laser never reaches a lasing equilibrium, which means that the behavior of the amplifier is similar to a switch-on of the laser system for every burst. This makes the development of the amplifier system difficult. Therefore, an analytical model has been developed to study the amplification process during the burst. This includes the
High energy high repetition-rate thin-disk amplifier for OPCPA pumping
International Nuclear Information System (INIS)
Schulz, Michael
2013-08-01
The development of a pump laser system for a high power and high repetition rate optical parametric chirped-pulse amplification (OPCPA) is presented in this thesis. The OPCPA system requires pump pulse energies in the range of tens of millijoules at high repetition rates with sub-picosecond pulse durations. This can be achieved to some extend with Innoslab amplifier technology. However, scaling to higher pulse energies at high repetition rates may be problematic. With the thin-disk amplifier presented in this thesis, output energies of 140 mJ at 100 kHz repetition rate could be achieved in burst-mode operation, which is a world record for this type of laser amplifier. Due to its material and spectral properties, ytterbium doped YAG (Yb:YAG) is used as a gain medium for the high power amplifier stages. The low quantum defect and the comparatively large emission bandwidth makes this material the choice for high power operation and sub-picosecond compressed pulse durations. The output beam profile as well as the shape of the output bursts is ideal to pump an OPCPA system. An OPCPA output energy in the millijoule range with repetition rates of 100 kHz to 1 MHz is needed to generate seed pulses for the FEL and for the application as pump-probe laser at the FEL facility. Since the development of this laser system needs to meet requirements set by the Free-Electron Laser in Hamburg (FLASH), the amplifier is conceived for burst-mode operation. The main requirement is a high intra-burst pulse repetition rate of more than 100 kHz and a uniform pulse train (burst) with equal properties for every pulse. The burst-mode is an operation mode where the laser never reaches a lasing equilibrium, which means that the behavior of the amplifier is similar to a switch-on of the laser system for every burst. This makes the development of the amplifier system difficult. Therefore, an analytical model has been developed to study the amplification process during the burst. This includes the
High-throughput screening (HTS) and modeling of the retinoid ...
Presentation at the Retinoids Review 2nd workshop in Brussels, Belgium on the application of high throughput screening and model to the retinoid system Presentation at the Retinoids Review 2nd workshop in Brussels, Belgium on the application of high throughput screening and model to the retinoid system
Note: A high dynamic range, linear response transimpedance amplifier.
Eckel, S; Sushkov, A O; Lamoreaux, S K
2012-02-01
We have built a high dynamic range (nine decade) transimpedance amplifier with a linear response. The amplifier uses junction-gate field effect transistors (JFETs) to switch between three different resistors in the feedback of a low input bias current operational amplifier. This allows for the creation of multiple outputs, each with a linear response and a different transimpedance gain. The overall bandwidth of the transimpedance amplifier is set by the bandwidth of the most sensitive range. For our application, we demonstrate a three-stage amplifier with transimpedance gains of approximately 10(9)Ω, 3 × 10(7)Ω, and 10(4)Ω with a bandwidth of 100 Hz.
Neumann, Lars; Ritscher, Allegra; Müller, Gerhard; Hafenbradl, Doris
2009-08-01
For the detection of the precise and unambiguous binding of fragments to a specific binding site on the target protein, we have developed a novel reporter displacement binding assay technology. The application of this technology for the fragment screening as well as the fragment evolution process with a specific modelling based design strategy is demonstrated for inhibitors of the protein kinase p38alpha. In a fragment screening approach seed fragments were identified which were then used to build compounds from the deep-pocket towards the hinge binding area of the protein kinase p38alpha based on a modelling approach. BIRB796 was used as a blueprint for the alignment of the fragments. The fragment evolution of these deep-pocket binding fragments towards the fully optimized inhibitor BIRB796 included the modulation of the residence time as well as the affinity. The goal of our study was to evaluate the robustness and efficiency of our novel fragment screening technology at high fragment concentrations, compare the screening data with biochemical activity data and to demonstrate the evolution of the hit fragments with fast kinetics, into slow kinetic inhibitors in an in silico approach.
Gyrocon: a deflection-modulated, high-power microwave amplifier
International Nuclear Information System (INIS)
Tallerico, P.J.
1977-10-01
A large-signal, relativistic theory of the electron-field interaction in a new class of microwave amplifiers is presented and applied to the analysis of a high-power, 450-MHz amplifier for accelerator applications. The analysis indicates that electronic efficiencies in excess of 90 percent are obtainable and that overall efficiencies of 90 percent are possible. The amplifier is unique in several respects; the electron velocity is perpendicular to the circuit energy flow, the device uses a fast-wave circuit, and the electron beam is deflection modulated
High-throughput sequencing of nematode communities from total soil DNA extractions
DEFF Research Database (Denmark)
Sapkota, Rumakanta; Nicolaisen, Mogens
2015-01-01
nematodes without the need for enrichment was developed. Using this strategy on DNA templates from a set of 22 agricultural soils, we obtained 64.4% sequences of nematode origin in total, whereas the remaining sequences were almost entirely from other metazoans. The nematode sequences were derived from...... in previous sequence-based studies are not nematode specific but also amplify other groups of organisms such as fungi and plantae, and thus require a nematode enrichment step that may introduce biases. Results: In this study an amplification strategy which selectively amplifies a fragment of the SSU from...... a broad taxonomic range and most sequences were from nematode taxa that have previously been found to be abundant in soil such as Tylenchida, Rhabditida, Dorylaimida, Triplonchida and Araeolaimida. Conclusions: Our amplification and sequencing strategy for assessing nematode diversity was able to collect...
High-throughput scoring of seed germination
Ligterink, Wilco; Hilhorst, Henk W.M.
2017-01-01
High-throughput analysis of seed germination for phenotyping large genetic populations or mutant collections is very labor intensive and would highly benefit from an automated setup. Although very often used, the total germination percentage after a nominated period of time is not very
Optimization of a high efficiency FEL amplifier
International Nuclear Information System (INIS)
Schneidmiller, E.A.; Yurkov, M.V.
2014-10-01
The problem of an efficiency increase of an FEL amplifier is now of great practical importance. Technique of undulator tapering in the post-saturation regime is used at the existing X-ray FELs LCLS and SACLA, and is planned for use at the European XFEL, Swiss FEL, and PAL XFEL. There are also discussions on the future of high peak and average power FELs for scientific and industrial applications. In this paper we perform detailed analysis of the tapering strategies for high power seeded FEL amplifiers. Application of similarity techniques allows us to derive universal law of the undulator tapering.
Embedded control system for high power RF amplifiers
International Nuclear Information System (INIS)
Sharma, Deepak Kumar; Gupta, Alok Kumar; Jain, Akhilesh; Hannurkar, P.R.
2011-01-01
RF power devices are usually very sensitive to overheat and reflected RF power; hence a protective interlock system is required to be embedded with high power solid state RF amplifiers. The solid state RF amplifiers have salient features of graceful degradation and very low mean time to repair (MTTR). In order to exploit these features in favour of lowest system downtime, a real-time control system is embedded with high power RF amplifiers. The control system is developed with the features of monitoring, measurement and network publishing of various parameters, historical data logging, alarm generation, displaying data to the operator and tripping the system in case of any interlock failure. This paper discusses the design philosophy, features, functions and implementation details of the embedded control system. (author)
A high-power compact regenerative amplifier FEL
International Nuclear Information System (INIS)
Nguyen, D.C.; Sheffield, R.L.; Fortgang, C.M.; Kinross-Wright, J.M.; Ebrahim, N.A.; Goldstein, J.C.
1997-01-01
The Regenerative Amplifier FEL (RAFEL) is a new FEL approach aimed at achieving the highest optical power from a compact rf-linac FEL. The key idea is to feed back a small fraction ( 5 in single pass) wiggler to enable the FEL to reach saturation in a few passes. This paper summarizes the design of a high-power compact regenerative amplifier FEL and describes the first experimental demonstration of the RAFEL concept
Experiences in fragment-based drug discovery.
Murray, Christopher W; Verdonk, Marcel L; Rees, David C
2012-05-01
Fragment-based drug discovery (FBDD) has become established in both industry and academia as an alternative approach to high-throughput screening for the generation of chemical leads for drug targets. In FBDD, specialised detection methods are used to identify small chemical compounds (fragments) that bind to the drug target, and structural biology is usually employed to establish their binding mode and to facilitate their optimisation. In this article, we present three recent and successful case histories in FBDD. We then re-examine the key concepts and challenges of FBDD with particular emphasis on recent literature and our own experience from a substantial number of FBDD applications. Our opinion is that careful application of FBDD is living up to its promise of delivering high quality leads with good physical properties and that in future many drug molecules will be derived from fragment-based approaches. Copyright © 2012 Elsevier Ltd. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Cuttitta, Christina M. [Brookhaven National Laboratory, Upton, NY 11973-5000 (United States); The City University of New York, 2800 Victory Boulevard, Staten Island, NY 10314 (United States); Ericson, Daniel L. [Brookhaven National Laboratory, Upton, NY 11973-5000 (United States); University at Buffalo, SUNY, 12 Capen Hall, Buffalo, NY 14260 (United States); Scalia, Alexander [Brookhaven National Laboratory, Upton, NY 11973-5000 (United States); Binghamton University, 4400 Vestal Parkway East, Binghamton, NY 11973-5000 (United States); Roessler, Christian G. [Brookhaven National Laboratory, Upton, NY 11973-5000 (United States); Teplitsky, Ella [Brookhaven National Laboratory, Upton, NY 11973-5000 (United States); Stony Brook University, Stony Brook, NY 11794-5215 (United States); Joshi, Karan [Brookhaven National Laboratory, Upton, NY 11973-5000 (United States); PEC University of Technology, Chandigarh (India); Campos, Olven [Brookhaven National Laboratory, Upton, NY 11973-5000 (United States); Florida Atlantic University, 777 Glades Road, Boca Raton, FL 33414 (United States); Agarwal, Rakhi; Allaire, Marc [Brookhaven National Laboratory, Upton, NY 11973-5000 (United States); Orville, Allen M. [Brookhaven National Laboratory, Upton, NY 11973-5000 (United States); Brookhaven National Laboratory, Upton, NY 11973-5000 (United States); Sweet, Robert M.; Soares, Alexei S., E-mail: soares@bnl.gov [Brookhaven National Laboratory, Upton, NY 11973-5000 (United States)
2015-01-01
An acoustic high-throughput screening method is described for harvesting protein crystals and combining the protein crystals with chemicals such as a fragment library. Acoustic droplet ejection (ADE) is an emerging technology with broad applications in serial crystallography such as growing, improving and manipulating protein crystals. One application of this technology is to gently transfer crystals onto MiTeGen micromeshes with minimal solvent. Once mounted on a micromesh, each crystal can be combined with different chemicals such as crystal-improving additives or a fragment library. Acoustic crystal mounting is fast (2.33 transfers s{sup −1}) and all transfers occur in a sealed environment that is in vapor equilibrium with the mother liquor. Here, a system is presented to retain crystals near the ejection point and away from the inaccessible dead volume at the bottom of the well by placing the crystals on a concave agarose pedestal (CAP) with the same chemical composition as the crystal mother liquor. The bowl-shaped CAP is impenetrable to crystals. Consequently, gravity will gently move the crystals into the optimal location for acoustic ejection. It is demonstrated that an agarose pedestal of this type is compatible with most commercially available crystallization conditions and that protein crystals are readily transferred from the agarose pedestal onto micromeshes with no loss in diffraction quality. It is also shown that crystals can be grown directly on CAPs, which avoids the need to transfer the crystals from the hanging drop to a CAP. This technology has been used to combine thermolysin and lysozyme crystals with an assortment of anomalously scattering heavy atoms. The results point towards a fast nanolitre method for crystal mounting and high-throughput screening.
Optimization and high-throughput screening of antimicrobial peptides.
Blondelle, Sylvie E; Lohner, Karl
2010-01-01
While a well-established process for lead compound discovery in for-profit companies, high-throughput screening is becoming more popular in basic and applied research settings in academia. The development of combinatorial libraries combined with easy and less expensive access to new technologies have greatly contributed to the implementation of high-throughput screening in academic laboratories. While such techniques were earlier applied to simple assays involving single targets or based on binding affinity, they have now been extended to more complex systems such as whole cell-based assays. In particular, the urgent need for new antimicrobial compounds that would overcome the rapid rise of drug-resistant microorganisms, where multiple target assays or cell-based assays are often required, has forced scientists to focus onto high-throughput technologies. Based on their existence in natural host defense systems and their different mode of action relative to commercial antibiotics, antimicrobial peptides represent a new hope in discovering novel antibiotics against multi-resistant bacteria. The ease of generating peptide libraries in different formats has allowed a rapid adaptation of high-throughput assays to the search for novel antimicrobial peptides. Similarly, the availability nowadays of high-quantity and high-quality antimicrobial peptide data has permitted the development of predictive algorithms to facilitate the optimization process. This review summarizes the various library formats that lead to de novo antimicrobial peptide sequences as well as the latest structural knowledge and optimization processes aimed at improving the peptides selectivity.
Directory of Open Access Journals (Sweden)
Kamran Honarnejad
Full Text Available Disrupted intracellular calcium homeostasis is believed to occur early in the cascade of events leading to Alzheimer's disease (AD pathology. Particularly familial AD mutations linked to Presenilins result in exaggerated agonist-evoked calcium release from endoplasmic reticulum (ER. Here we report the development of a fully automated high-throughput calcium imaging assay utilizing a genetically-encoded FRET-based calcium indicator at single cell resolution for compound screening. The established high-throughput screening assay offers several advantages over conventional high-throughput calcium imaging technologies. We employed this assay for drug discovery in AD by screening compound libraries consisting of over 20,000 small molecules followed by structure-activity-relationship analysis. This led to the identification of Bepridil, a calcium channel antagonist drug in addition to four further lead structures capable of normalizing the potentiated FAD-PS1-induced calcium release from ER. Interestingly, it has recently been reported that Bepridil can reduce Aβ production by lowering BACE1 activity. Indeed, we also detected lowered Aβ, increased sAPPα and decreased sAPPβ fragment levels upon Bepridil treatment. The latter findings suggest that Bepridil may provide a multifactorial therapeutic modality for AD by simultaneously addressing multiple aspects of the disease.
20180311 - High Throughput Transcriptomics: From screening to pathways (SOT 2018)
The EPA ToxCast effort has screened thousands of chemicals across hundreds of high-throughput in vitro screening assays. The project is now leveraging high-throughput transcriptomic (HTTr) technologies to substantially expand its coverage of biological pathways. The first HTTr sc...
High throughput label-free platform for statistical bio-molecular sensing
DEFF Research Database (Denmark)
Bosco, Filippo; Hwu, En-Te; Chen, Ching-Hsiu
2011-01-01
Sensors are crucial in many daily operations including security, environmental control, human diagnostics and patient monitoring. Screening and online monitoring require reliable and high-throughput sensing. We report on the demonstration of a high-throughput label-free sensor platform utilizing...
Fragger: a protein fragment picker for structural queries.
Berenger, Francois; Simoncini, David; Voet, Arnout; Shrestha, Rojan; Zhang, Kam Y J
2017-01-01
Protein modeling and design activities often require querying the Protein Data Bank (PDB) with a structural fragment, possibly containing gaps. For some applications, it is preferable to work on a specific subset of the PDB or with unpublished structures. These requirements, along with specific user needs, motivated the creation of a new software to manage and query 3D protein fragments. Fragger is a protein fragment picker that allows protein fragment databases to be created and queried. All fragment lengths are supported and any set of PDB files can be used to create a database. Fragger can efficiently search a fragment database with a query fragment and a distance threshold. Matching fragments are ranked by distance to the query. The query fragment can have structural gaps and the allowed amino acid sequences matching a query can be constrained via a regular expression of one-letter amino acid codes. Fragger also incorporates a tool to compute the backbone RMSD of one versus many fragments in high throughput. Fragger should be useful for protein design, loop grafting and related structural bioinformatics tasks.
Li, Chunmei; Yu, Zhilong; Fu, Yusi; Pang, Yuhong; Huang, Yanyi
2017-04-26
We develop a novel single-cell-based platform through digital counting of amplified genomic DNA fragments, named multifraction amplification (mfA), to detect the copy number variations (CNVs) in a single cell. Amplification is required to acquire genomic information from a single cell, while introducing unavoidable bias. Unlike prevalent methods that directly infer CNV profiles from the pattern of sequencing depth, our mfA platform denatures and separates the DNA molecules from a single cell into multiple fractions of a reaction mix before amplification. By examining the sequencing result of each fraction for a specific fragment and applying a segment-merge maximum likelihood algorithm to the calculation of copy number, we digitize the sequencing-depth-based CNV identification and thus provide a method that is less sensitive to the amplification bias. In this paper, we demonstrate a mfA platform through multiple displacement amplification (MDA) chemistry. When performing the mfA platform, the noise of MDA is reduced; therefore, the resolution of single-cell CNV identification can be improved to 100 kb. We can also determine the genomic region free of allelic drop-out with mfA platform, which is impossible for conventional single-cell amplification methods.
High-Throughput Analysis of T-DNA Location and Structure Using Sequence Capture.
Directory of Open Access Journals (Sweden)
Soichi Inagaki
Full Text Available Agrobacterium-mediated transformation of plants with T-DNA is used both to introduce transgenes and for mutagenesis. Conventional approaches used to identify the genomic location and the structure of the inserted T-DNA are laborious and high-throughput methods using next-generation sequencing are being developed to address these problems. Here, we present a cost-effective approach that uses sequence capture targeted to the T-DNA borders to select genomic DNA fragments containing T-DNA-genome junctions, followed by Illumina sequencing to determine the location and junction structure of T-DNA insertions. Multiple probes can be mixed so that transgenic lines transformed with different T-DNA types can be processed simultaneously, using a simple, index-based pooling approach. We also developed a simple bioinformatic tool to find sequence read pairs that span the junction between the genome and T-DNA or any foreign DNA. We analyzed 29 transgenic lines of Arabidopsis thaliana, each containing inserts from 4 different T-DNA vectors. We determined the location of T-DNA insertions in 22 lines, 4 of which carried multiple insertion sites. Additionally, our analysis uncovered a high frequency of unconventional and complex T-DNA insertions, highlighting the needs for high-throughput methods for T-DNA localization and structural characterization. Transgene insertion events have to be fully characterized prior to use as commercial products. Our method greatly facilitates the first step of this characterization of transgenic plants by providing an efficient screen for the selection of promising lines.
Application of amplified fragment length polymorphism (AFLPs) for ...
African Journals Online (AJOL)
Uapaca kirkiana Muell. Årg is a dioecious fruit tree species for priority domestication in Southern Africa. It reaches reproductive maturity in eight to ten years with male plants making up 50% of breeding populations. Early identification of sex of seedlings is a prerequisite for selection and tree improvement. The amplified ...
Developments in SPR Fragment Screening.
Chavanieu, Alain; Pugnière, Martine
2016-01-01
Fragment-based approaches have played an increasing role alongside high-throughput screening in drug discovery for 15 years. The label-free biosensor technology based on surface plasmon resonance (SPR) is now sensitive and informative enough to serve during primary screens and validation steps. In this review, the authors discuss the role of SPR in fragment screening. After a brief description of the underlying principles of the technique and main device developments, they evaluate the advantages and adaptations of SPR for fragment-based drug discovery. SPR can also be applied to challenging targets such as membrane receptors and enzymes. The high-level of immobilization of the protein target and its stability are key points for a relevant screening that can be optimized using oriented immobilized proteins and regenerable sensors. Furthermore, to decrease the rate of false negatives, a selectivity test may be performed in parallel on the main target bearing the binding site mutated or blocked with a low-off-rate ligand. Fragment-based drug design, integrated in a rational workflow led by SPR, will thus have a predominant role for the next wave of drug discovery which could be greatly enhanced by new improvements in SPR devices.
Novel approach of fragment-based lead discovery applied to renin inhibitors.
Tawada, Michiko; Suzuki, Shinkichi; Imaeda, Yasuhiro; Oki, Hideyuki; Snell, Gyorgy; Behnke, Craig A; Kondo, Mitsuyo; Tarui, Naoki; Tanaka, Toshimasa; Kuroita, Takanobu; Tomimoto, Masaki
2016-11-15
A novel approach was conducted for fragment-based lead discovery and applied to renin inhibitors. The biochemical screening of a fragment library against renin provided the hit fragment which showed a characteristic interaction pattern with the target protein. The hit fragment bound only to the S1, S3, and S3 SP (S3 subpocket) sites without any interactions with the catalytic aspartate residues (Asp32 and Asp215 (pepsin numbering)). Prior to making chemical modifications to the hit fragment, we first identified its essential binding sites by utilizing the hit fragment's substructures. Second, we created a new and smaller scaffold, which better occupied the identified essential S3 and S3 SP sites, by utilizing library synthesis with high-throughput chemistry. We then revisited the S1 site and efficiently explored a good building block attaching to the scaffold with library synthesis. In the library syntheses, the binding modes of each pivotal compound were determined and confirmed by X-ray crystallography and the library was strategically designed by structure-based computational approach not only to obtain a more active compound but also to obtain informative Structure Activity Relationship (SAR). As a result, we obtained a lead compound offering synthetic accessibility as well as the improved in vitro ADMET profiles. The fragments and compounds possessing a characteristic interaction pattern provided new structural insights into renin's active site and the potential to create a new generation of renin inhibitors. In addition, we demonstrated our FBDD strategy integrating highly sensitive biochemical assay, X-ray crystallography, and high-throughput synthesis and in silico library design aimed at fragment morphing at the initial stage was effective to elucidate a pocket profile and a promising lead compound. Copyright © 2016 Elsevier Ltd. All rights reserved.
Xu, Chen; Zhang, Nan; Huo, Qianyu; Chen, Minghui; Wang, Rengfeng; Liu, Zhili; Li, Xue; Liu, Yunde; Bao, Huijing
2016-04-15
In this article, we discuss the polymerase chain reaction (PCR)-hybridization assay that we developed for high-throughput simultaneous detection and differentiation of Ureaplasma urealyticum and Ureaplasma parvum using one set of primers and two specific DNA probes based on urease gene nucleotide sequence differences. First, U. urealyticum and U. parvum DNA samples were specifically amplified using one set of biotin-labeled primers. Furthermore, amine-modified DNA probes, which can specifically react with U. urealyticum or U. parvum DNA, were covalently immobilized to a DNA-BIND plate surface. The plate was then incubated with the PCR products to facilitate sequence-specific DNA binding. Horseradish peroxidase-streptavidin conjugation and a colorimetric assay were used. Based on the results, the PCR-hybridization assay we developed can specifically differentiate U. urealyticum and U. parvum with high sensitivity (95%) compared with cultivation (72.5%). Hence, this study demonstrates a new method for high-throughput simultaneous differentiation and detection of U. urealyticum and U. parvum with high sensitivity. Based on these observations, the PCR-hybridization assay developed in this study is ideal for detecting and discriminating U. urealyticum and U. parvum in clinical applications. Copyright © 2016 Elsevier Inc. All rights reserved.
High-throughput sequence alignment using Graphics Processing Units
Directory of Open Access Journals (Sweden)
Trapnell Cole
2007-12-01
Full Text Available Abstract Background The recent availability of new, less expensive high-throughput DNA sequencing technologies has yielded a dramatic increase in the volume of sequence data that must be analyzed. These data are being generated for several purposes, including genotyping, genome resequencing, metagenomics, and de novo genome assembly projects. Sequence alignment programs such as MUMmer have proven essential for analysis of these data, but researchers will need ever faster, high-throughput alignment tools running on inexpensive hardware to keep up with new sequence technologies. Results This paper describes MUMmerGPU, an open-source high-throughput parallel pairwise local sequence alignment program that runs on commodity Graphics Processing Units (GPUs in common workstations. MUMmerGPU uses the new Compute Unified Device Architecture (CUDA from nVidia to align multiple query sequences against a single reference sequence stored as a suffix tree. By processing the queries in parallel on the highly parallel graphics card, MUMmerGPU achieves more than a 10-fold speedup over a serial CPU version of the sequence alignment kernel, and outperforms the exact alignment component of MUMmer on a high end CPU by 3.5-fold in total application time when aligning reads from recent sequencing projects using Solexa/Illumina, 454, and Sanger sequencing technologies. Conclusion MUMmerGPU is a low cost, ultra-fast sequence alignment program designed to handle the increasing volume of data produced by new, high-throughput sequencing technologies. MUMmerGPU demonstrates that even memory-intensive applications can run significantly faster on the relatively low-cost GPU than on the CPU.
Efficiency of random amplified polymorphic DNA (RAPD) and inter ...
African Journals Online (AJOL)
Efficiency of random amplified polymorphic DNA (RAPD) and inter-simple sequence repeats (ISSR) markers for genotype fingerprinting and genetic diversity studies in canola ( ) ... The number of amplified fragments with RAPD primers ranged from 8 to 21, with the size of amplicons ranging from 162 to 3154 bp.
A high performance electrometer amplifier of hybrid design
International Nuclear Information System (INIS)
Rao, N.V.; Nazare, C.K.
1979-01-01
A high performance, reliable, electrometer amplifier of hybrid design for low current measurements in mass spectrometers has been developed. The short term instability with a 5 x 10 11 ohms input resistor is less than 1 x 10sup(-15) Amp. The drift is better than 1 mV/hour. The design steps are illustrated with a typical amplifier performance details. (auth.)
High throughput imaging cytometer with acoustic focussing.
Zmijan, Robert; Jonnalagadda, Umesh S; Carugo, Dario; Kochi, Yu; Lemm, Elizabeth; Packham, Graham; Hill, Martyn; Glynne-Jones, Peter
2015-10-31
We demonstrate an imaging flow cytometer that uses acoustic levitation to assemble cells and other particles into a sheet structure. This technique enables a high resolution, low noise CMOS camera to capture images of thousands of cells with each frame. While ultrasonic focussing has previously been demonstrated for 1D cytometry systems, extending the technology to a planar, much higher throughput format and integrating imaging is non-trivial, and represents a significant jump forward in capability, leading to diagnostic possibilities not achievable with current systems. A galvo mirror is used to track the images of the moving cells permitting exposure times of 10 ms at frame rates of 50 fps with motion blur of only a few pixels. At 80 fps, we demonstrate a throughput of 208 000 beads per second. We investigate the factors affecting motion blur and throughput, and demonstrate the system with fluorescent beads, leukaemia cells and a chondrocyte cell line. Cells require more time to reach the acoustic focus than beads, resulting in lower throughputs; however a longer device would remove this constraint.
High-throughput GPU-based LDPC decoding
Chang, Yang-Lang; Chang, Cheng-Chun; Huang, Min-Yu; Huang, Bormin
2010-08-01
Low-density parity-check (LDPC) code is a linear block code known to approach the Shannon limit via the iterative sum-product algorithm. LDPC codes have been adopted in most current communication systems such as DVB-S2, WiMAX, WI-FI and 10GBASE-T. LDPC for the needs of reliable and flexible communication links for a wide variety of communication standards and configurations have inspired the demand for high-performance and flexibility computing. Accordingly, finding a fast and reconfigurable developing platform for designing the high-throughput LDPC decoder has become important especially for rapidly changing communication standards and configurations. In this paper, a new graphic-processing-unit (GPU) LDPC decoding platform with the asynchronous data transfer is proposed to realize this practical implementation. Experimental results showed that the proposed GPU-based decoder achieved 271x speedup compared to its CPU-based counterpart. It can serve as a high-throughput LDPC decoder.
Evaluating High Throughput Toxicokinetics and Toxicodynamics for IVIVE (WC10)
High-throughput screening (HTS) generates in vitro data for characterizing potential chemical hazard. TK models are needed to allow in vitro to in vivo extrapolation (IVIVE) to real world situations. The U.S. EPA has created a public tool (R package “httk” for high throughput tox...
A versatile and efficient high-throughput cloning tool for structural biology.
Geertsma, Eric R; Dutzler, Raimund
2011-04-19
Methods for the cloning of large numbers of open reading frames into expression vectors are of critical importance for challenging structural biology projects. Here we describe a system termed fragment exchange (FX) cloning that facilitates the high-throughput generation of expression constructs. The method is based on a class IIS restriction enzyme and negative selection markers. FX cloning combines attractive features of established recombination- and ligation-independent cloning methods: It allows the straightforward transfer of an open reading frame into a variety of expression vectors and is highly efficient and very economic in its use. In addition, FX cloning avoids the common but undesirable feature of significantly extending target open reading frames with cloning related sequences, as it leaves a minimal seam of only a single extra amino acid to either side of the protein. The method has proven to be very robust and suitable for all common pro- and eukaryotic expression systems. It considerably speeds up the generation of expression constructs compared to traditional methods and thus facilitates a broader expression screening.
Fearnley, Catherine; On, Stephen L. W.; Kokotovic, Branko; Manning, Georgina; Cheasty, Tom; Newell, Diane G.
2005-01-01
An amplified fragment length polymorphism (AFLP) method, developed to genotype Yersinia enterocolitica, has been used to investigate 70 representative strains isolated from humans, pigs, sheep, and cattle in the United Kingdom. AFLP primarily distinguished Y. enterocolitica strains according to their biotype, with strains dividing into two distinct clusters: cluster A, comprising largely the putatively pathogenic biotypes (BT2 to -4), and cluster B, comprising the putatively nonpathogenic biotype 1A strains and a single BT1B isolate. Within these two clusters, subclusters formed largely on the basis of serotype. However, AFLP profiles also allowed differentiation of strains within these serotype-related subclusters, indicating the high discriminatory power of the technique for Y. enterocolitica. Investigation of the relationship between strain AFLP profile and host confirmed that pigs are, and provides further proof that sheep may be, potential sources of human infection with putatively pathogenic strains. However, the results suggest that some strains causing human disease do not come from veterinary sources identifiable at this time. The distribution of some BT1A isolates within cluster A raises questions about the relationship between virulence potential and biotype. PMID:16151073
Cochems, P; Kirk, A; Zimmermann, S
2014-12-01
Parasitic elements play an important role in the development of every high performance circuit. In the case of high gain, high bandwidth transimpedance amplifiers, the most important parasitic elements are parasitic capacitances at the input and in the feedback path, which significantly influence the stability, the frequency response, and the noise of the amplifier. As these parasitic capacitances range from a few picofarads down to only a few femtofarads, it is nearly impossible to measure them accurately using traditional LCR meters. Unfortunately, they also cannot be easily determined from the transfer function of the transimpedance amplifier, as it contains several overlapping effects and its measurement is only possible when the circuit is already stable. Therefore, we developed an in-circuit measurement method utilizing minimal modifications to the input stage in order to measure its parasitic capacitances directly and with unconditional stability. Furthermore, using the data acquired with this measurement technique, we both proposed a model for the complicated frequency response of high value thick film resistors as they are used in high gain transimpedance amplifiers and optimized our transimpedance amplifier design.
Al-Khalifah, Nasser S; Shanavaskhan, A E
2017-01-01
Ambiguity in the total number of date palm cultivars across the world is pointing toward the necessity for an enumerative study using standard morphological and molecular markers. Among molecular markers, DNA markers are more suitable and ubiquitous to most applications. They are highly polymorphic in nature, frequently occurring in genomes, easy to access, and highly reproducible. Various molecular markers such as restriction fragment length polymorphism (RFLP), amplified fragment length polymorphism (AFLP), simple sequence repeats (SSR), inter-simple sequence repeats (ISSR), and random amplified polymorphic DNA (RAPD) markers have been successfully used as efficient tools for analysis of genetic variation in date palm. This chapter explains a stepwise protocol for extracting total genomic DNA from date palm leaves. A user-friendly protocol for RAPD analysis and a table showing the primers used in different molecular techniques that produce polymorphisms in date palm are also provided.
Li, Gao-De
2015-01-01
It is well known that cyclins are a family of proteins that control cell-cycle progression by activating cyclin-dependent kinase. Based on our experimental results, we propose here a novel hypothesis that certain amplified genomic-DNA fragments (AGFs) may also be required for the cell cycle progression of eukaryotic cells and thus can be named as cell-cycle-associated AGFs (CAGFs). Like fluctuation in cyclin levels during cell cycle progression, these CAGFs are amplified and degraded at diffe...
Biological effectiveness of high-energy protons - Target fragmentation
International Nuclear Information System (INIS)
Cucinotta, F.A.; Katz, R.; Wilson, J.W.; Townsend, L.W.; Shinn, J.; Hajnal, F.
1991-01-01
High-energy protons traversing tissue produce local sources of high-linear-energy-transfer ions through nuclear fragmentation. The contribution of these target fragments to the biological effectiveness of high-energy protons using the cellular track model is examined. The effects of secondary ions are treated in terms of the production collision density using energy-dependent parameters from a high-energy fragmentation model. Calculations for mammalian cell cultures show that at high dose, at which intertrack effects become important, protons deliver damage similar to that produced by gamma rays, and with fragmentation the relative biological effectiveness (RBE) of protons increases moderately from unity. At low dose, where sublethal damage is unimportant, the contribution from target fragments dominates, causing the proton effectiveness to be very different from that of gamma rays with a strongly fluence-dependent RBE. At high energies, the nuclear fragmentation cross sections become independent of energy. This leads to a plateau in the proton single-particle-action cross section, below 1 keV/micron, since the target fragments dominate. 29 refs
Qiu, T; Jiang, L L; Yang, Y F
2016-08-19
The genetic and epigenetic diversity and structure of naturally occurring Phragmites australis populations occupying two different habitats on a small spatial scale in the Songnen Prairie in northeastern China were investigated by assessing amplified fragment length polymorphisms (AFLPs) and methylation-sensitive amplified polymorphisms (MSAPs) through fluorescent capillary detection. The two groups of P. australis were located in a seasonal waterlogged low-lying and alkalized meadow with a pH of 8-8.5 and in an alkaline patch without accumulated rainwater and with a pH greater than 10. These groups showed high levels of genetic diversity at the habitat level based on the percentage of polymorphic bands (90.32, 82.56%), Nei's gene diversity index (0.262, 0.248), and the Shannon diversity index (0.407, 0.383). Although little is known about the between-habitat genetic differentiation of P. australis on a small spatial scale, our results implied significant genetic differentiation between habitats. Extensive epigenetic diversity within habitats, along with clear differentiation, was found. Specifically, the former habitat (Habitat 1, designated H1) harbored higher levels of genetic and epigenetic diversity than the latter (Habitat 2, designated H2), and population-level diversity was also high. This study represents one of few attempts to predict habitat-based genetic differentiation of reeds on a small scale. These assessments of genetic and epigenetic variation are integral aspects of molecular ecological studies on P. australis. Possible causes for within- and between-habitat genetic and epigenetic variations are discussed.
High-throughput optical system for HDES hyperspectral imager
Václavík, Jan; Melich, Radek; Pintr, Pavel; Pleštil, Jan
2015-01-01
Affordable, long-wave infrared hyperspectral imaging calls for use of an uncooled FPA with high-throughput optics. This paper describes the design of the optical part of a stationary hyperspectral imager in a spectral range of 7-14 um with a field of view of 20°×10°. The imager employs a push-broom method made by a scanning mirror. High throughput and a demand for simplicity and rigidity led to a fully refractive design with highly aspheric surfaces and off-axis positioning of the detector array. The design was optimized to exploit the machinability of infrared materials by the SPDT method and a simple assemblage.
Yi, Linglu; Xu, Xueqin; Lin, Xuexia; Li, Haifang; Ma, Yuan; Lin, Jin-Ming
2014-07-07
A novel human papillomavirus (HPV) typing assay for cervical cancer screening and prognosis was developed by the combination of restriction fragment length polymorphism (RFLP) and microchip electrophoresis (MCE) to achieve higher levels of sensitivity and throughput. The detection limit of 2 × 10(2) copies, high sensitivity and typing accuracy on the account of PCR-RFLP-MCE method guarantee the successful diagnosis results of 4-fold higher infection rate over cytologic tests. From clinical samples, eleven kinds of HPV types were identified with a good compatibility degree of over 90%. The described method showed good reliability in clinical samples and provided a promising alternative for pathological studies at the molecular level.
High Performance Computing Modernization Program Kerberos Throughput Test Report
2017-10-26
Naval Research Laboratory Washington, DC 20375-5320 NRL/MR/5524--17-9751 High Performance Computing Modernization Program Kerberos Throughput Test ...NUMBER 5d. PROJECT NUMBER 5e. TASK NUMBER 5f. WORK UNIT NUMBER 2. REPORT TYPE1. REPORT DATE (DD-MM-YYYY) 4. TITLE AND SUBTITLE 6. AUTHOR(S) 8. PERFORMING...PAGE 18. NUMBER OF PAGES 17. LIMITATION OF ABSTRACT High Performance Computing Modernization Program Kerberos Throughput Test Report Daniel G. Gdula* and
High-power piezo drive amplifier for large stack and PFC applications
Clingman, Dan J.; Gamble, Mike
2001-08-01
This paper describes the continuing development of Boeing High Power Piezo Drive Amplifiers. Described is the development and testing of a 1500 Vpp, 8 amp switching amplifier. This amplifier is used to drive a piezo stack driven rotor blade trailing edge flap on a full size helicopter. Also discuss is a switching amplifier designed to drive a Piezo Fiber Composite (PFC) active twist rotor blade. This amplifier was designed to drive the PFC material at 2000 Vpp and 0.5 amps. These amplifiers recycle reactive energy, allowing for a power and weight efficient amplifier design. This work was done in conjunction with the DARPA sponsored Phase II Smart Rotor Blade program and the NASA Langley Research Center sponsored Active Twist Rotor (ATR) blade program.
Yang, J M; Sun, G H; Zheng, X D; Ren, L H; Wang, W J; Li, G R; Sun, B C
2015-12-02
Octopus minor (Sasaki, 1920) is an economically important cephalopod that is found in the northern coastal waters of China. In this study, we investigated genetic differentiation in fishery populations using amplified fragment length polymorphisms (AFLPs). A total of 150 individuals were collected from five locations: Dalian (DL), Yan-tai (YT), Qingdao (QD), Lianyungang (LY), and Zhoushan (ZS), and 243 reproducible bands were amplified using five AFLP primer combinations. The percentage of polymorphic bands ranged from 53.33 to 76.08%. Nei's genetic identity ranged from 0.9139 to 0.9713, and the genetic distance ranged from 0.0291 to 0.0900. A phylogenetic tree was constructed using the unweighted pair group method with arithmetic mean, based on the genetic distance. The DL and YT populations originated from one clade, while the QD, LY, and ZS populations originated from another. The results indicate that the O. minor stock consisted of two genetic populations with an overall significantly analogous FST value (0.1088, P octopus fisheries, so that this marine resource can be conserved for its long-term utilization.
High Efficiency S-Band 20 Watt Amplifier
National Aeronautics and Space Administration — This project includes the design and build of a prototype 20 W, high efficiency, S-Band amplifier. The design will incorporate the latest semiconductor technology,...
High-throughput theoretical design of lithium battery materials
International Nuclear Information System (INIS)
Ling Shi-Gang; Gao Jian; Xiao Rui-Juan; Chen Li-Quan
2016-01-01
The rapid evolution of high-throughput theoretical design schemes to discover new lithium battery materials is reviewed, including high-capacity cathodes, low-strain cathodes, anodes, solid state electrolytes, and electrolyte additives. With the development of efficient theoretical methods and inexpensive computers, high-throughput theoretical calculations have played an increasingly important role in the discovery of new materials. With the help of automatic simulation flow, many types of materials can be screened, optimized and designed from a structural database according to specific search criteria. In advanced cell technology, new materials for next generation lithium batteries are of great significance to achieve performance, and some representative criteria are: higher energy density, better safety, and faster charge/discharge speed. (topical review)
Simulations of High Speed Fragment Trajectories
Yeh, Peter; Attaway, Stephen; Arunajatesan, Srinivasan; Fisher, Travis
2017-11-01
Flying shrapnel from an explosion are capable of traveling at supersonic speeds and distances much farther than expected due to aerodynamic interactions. Predicting the trajectories and stable tumbling modes of arbitrary shaped fragments is a fundamental problem applicable to range safety calculations, damage assessment, and military technology. Traditional approaches rely on characterizing fragment flight using a single drag coefficient, which may be inaccurate for fragments with large aspect ratios. In our work we develop a procedure to simulate trajectories of arbitrary shaped fragments with higher fidelity using high performance computing. We employ a two-step approach in which the force and moment coefficients are first computed as a function of orientation using compressible computational fluid dynamics. The force and moment data are then input into a six-degree-of-freedom rigid body dynamics solver to integrate trajectories in time. Results of these high fidelity simulations allow us to further understand the flight dynamics and tumbling modes of a single fragment. Furthermore, we use these results to determine the validity and uncertainty of inexpensive methods such as the single drag coefficient model.
High-Throughput Block Optical DNA Sequence Identification.
Sagar, Dodderi Manjunatha; Korshoj, Lee Erik; Hanson, Katrina Bethany; Chowdhury, Partha Pratim; Otoupal, Peter Britton; Chatterjee, Anushree; Nagpal, Prashant
2018-01-01
Optical techniques for molecular diagnostics or DNA sequencing generally rely on small molecule fluorescent labels, which utilize light with a wavelength of several hundred nanometers for detection. Developing a label-free optical DNA sequencing technique will require nanoscale focusing of light, a high-throughput and multiplexed identification method, and a data compression technique to rapidly identify sequences and analyze genomic heterogeneity for big datasets. Such a method should identify characteristic molecular vibrations using optical spectroscopy, especially in the "fingerprinting region" from ≈400-1400 cm -1 . Here, surface-enhanced Raman spectroscopy is used to demonstrate label-free identification of DNA nucleobases with multiplexed 3D plasmonic nanofocusing. While nanometer-scale mode volumes prevent identification of single nucleobases within a DNA sequence, the block optical technique can identify A, T, G, and C content in DNA k-mers. The content of each nucleotide in a DNA block can be a unique and high-throughput method for identifying sequences, genes, and other biomarkers as an alternative to single-letter sequencing. Additionally, coupling two complementary vibrational spectroscopy techniques (infrared and Raman) can improve block characterization. These results pave the way for developing a novel, high-throughput block optical sequencing method with lossy genomic data compression using k-mer identification from multiplexed optical data acquisition. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
A Review of High Voltage Drive Amplifiers for Capacitive Actuators
DEFF Research Database (Denmark)
Huang, Lina; Zhang, Zhe; Andersen, Michael A. E.
2012-01-01
This paper gives an overview of the high voltage amplifiers, which are used to drive capacitive actuators. The amplifiers for both piezoelectric and DEAP (dielectric electroactive polymer) actuator are discussed. The suitable topologies for driving capacitive actuators are illustrated in detail...
Theoretical analysis of quantum dot amplifiers with high saturation power and low noise figure
DEFF Research Database (Denmark)
Berg, Tommy Winther; Mørk, Jesper
2002-01-01
Semiconductor quantum dot amplifiers are predicted to exhibit superior characteristics such as high gain, and output power and low noise. The analysis provides criteria and design guidelines for the realization of high quality amplifiers.......Semiconductor quantum dot amplifiers are predicted to exhibit superior characteristics such as high gain, and output power and low noise. The analysis provides criteria and design guidelines for the realization of high quality amplifiers....
High-Throughput Scoring of Seed Germination.
Ligterink, Wilco; Hilhorst, Henk W M
2017-01-01
High-throughput analysis of seed germination for phenotyping large genetic populations or mutant collections is very labor intensive and would highly benefit from an automated setup. Although very often used, the total germination percentage after a nominated period of time is not very informative as it lacks information about start, rate, and uniformity of germination, which are highly indicative of such traits as dormancy, stress tolerance, and seed longevity. The calculation of cumulative germination curves requires information about germination percentage at various time points. We developed the GERMINATOR package: a simple, highly cost-efficient, and flexible procedure for high-throughput automatic scoring and evaluation of germination that can be implemented without the use of complex robotics. The GERMINATOR package contains three modules: (I) design of experimental setup with various options to replicate and randomize samples; (II) automatic scoring of germination based on the color contrast between the protruding radicle and seed coat on a single image; and (III) curve fitting of cumulative germination data and the extraction, recap, and visualization of the various germination parameters. GERMINATOR is a freely available package that allows the monitoring and analysis of several thousands of germination tests, several times a day by a single person.
High throughput salt separation from uranium deposits
Energy Technology Data Exchange (ETDEWEB)
Kwon, S.W.; Park, K.M.; Kim, J.G.; Kim, I.T.; Park, S.B., E-mail: swkwon@kaeri.re.kr [Korea Atomic Energy Research Inst. (Korea, Republic of)
2014-07-01
It is very important to increase the throughput of the salt separation system owing to the high uranium content of spent nuclear fuel and high salt fraction of uranium dendrites in pyroprocessing. Multilayer porous crucible system was proposed to increase a throughput of the salt distiller in this study. An integrated sieve-crucible assembly was also investigated for the practical use of the porous crucible system. The salt evaporation behaviors were compared between the conventional nonporous crucible and the porous crucible. Two step weight reductions took place in the porous crucible, whereas the salt weight reduced only at high temperature by distillation in a nonporous crucible. The first weight reduction in the porous crucible was caused by the liquid salt penetrated out through the perforated crucible during the temperature elevation until the distillation temperature. Multilayer porous crucibles have a benefit to expand the evaporation surface area. (author)
High throughput, low set-up time reconfigurable linear feedback shift registers
Nas, R.J.M.; Berkel, van C.H.
2010-01-01
This paper presents a hardware design for a scalable, high throughput, configurable LFSR. High throughput is achieved by producing L consecutive outputs per clock cycle with a clock cycle period that, for practical cases, increases only logarithmically with the block size L and the length of the
High-throughput epitope identification for snakebite antivenom
DEFF Research Database (Denmark)
Engmark, Mikael; De Masi, Federico; Laustsen, Andreas Hougaard
Insight into the epitopic recognition pattern for polyclonal antivenoms is a strong tool for accurate prediction of antivenom cross-reactivity and provides a basis for design of novel antivenoms. In this work, a high-throughput approach was applied to characterize linear epitopes in 966 individua...... toxins from pit vipers (Crotalidae) using the ICP Crotalidae antivenom. Due to an abundance of snake venom metalloproteinases and phospholipase A2s in the venoms used for production of the investigated antivenom, this study focuses on these toxin families.......Insight into the epitopic recognition pattern for polyclonal antivenoms is a strong tool for accurate prediction of antivenom cross-reactivity and provides a basis for design of novel antivenoms. In this work, a high-throughput approach was applied to characterize linear epitopes in 966 individual...
International Nuclear Information System (INIS)
Park, Daniel Sang-Won; Chen, Pin-Chuan; You, Byoung Hee; Kim, Namwon; Park, Taehyun; Lee, Tae Yoon; Soper, Steven A; Nikitopoulos, Dimitris E; Murphy, Michael C; Datta, Proyag; Desta, Yohannes
2010-01-01
A high throughput, multi-well (96) polymerase chain reaction (PCR) platform, based on a continuous flow (CF) mode of operation, was developed. Each CFPCR device was confined to a footprint of 8 × 8 mm 2 , matching the footprint of a well on a standard micro-titer plate. While several CFPCR devices have been demonstrated, this is the first example of a high-throughput multi-well continuous flow thermal reactor configuration. Verification of the feasibility of the multi-well CFPCR device was carried out at each stage of development from manufacturing to demonstrating sample amplification. The multi-well CFPCR devices were fabricated by micro-replication in polymers, polycarbonate to accommodate the peak temperatures during thermal cycling in this case, using double-sided hot embossing. One side of the substrate contained the thermal reactors and the opposite side was patterned with structures to enhance thermal isolation of the closely packed constant temperature zones. A 99 bp target from a λ-DNA template was successfully amplified in a prototype multi-well CFPCR device with a total reaction time as low as ∼5 min at a flow velocity of 3 mm s −1 (15.3 s cycle −1 ) and a relatively low amplification efficiency compared to a bench-top thermal cycler for a 20-cycle device; reducing the flow velocity to 1 mm s −1 (46.2 s cycle −1 ) gave a seven-fold improvement in amplification efficiency. Amplification efficiencies increased at all flow velocities for 25-cycle devices with the same configuration.
Wu, Bainan; Barile, Elisa; De, Surya K; Wei, Jun; Purves, Angela; Pellecchia, Maurizio
2015-01-01
In recent years the ever so complex field of drug discovery has embraced novel design strategies based on biophysical fragment screening (fragment-based drug design; FBDD) using nuclear magnetic resonance spectroscopy (NMR) and/or structure-guided approaches, most often using X-ray crystallography and computer modeling. Experience from recent years unveiled that these methods are more effective and less prone to artifacts compared to biochemical high-throughput screening (HTS) of large collection of compounds in designing protein inhibitors. Hence these strategies are increasingly becoming the most utilized in the modern pharmaceutical industry. Nonetheless, there is still an impending need to develop innovative and effective strategies to tackle other more challenging targets such as those involving protein-protein interactions (PPIs). While HTS strategies notoriously fail to identify viable hits against such targets, few successful examples of PPIs antagonists derived by FBDD strategies exist. Recently, we reported on a new strategy that combines some of the basic principles of fragment-based screening with combinatorial chemistry and NMR-based screening. The approach, termed HTS by NMR, combines the advantages of combinatorial chemistry and NMR-based screening to rapidly and unambiguously identify bona fide inhibitors of PPIs. This review will reiterate the critical aspects of the approach with examples of possible applications.
Hu, Jiazhi; Meyers, Robin M; Dong, Junchao; Panchakshari, Rohit A; Alt, Frederick W; Frock, Richard L
2016-05-01
Unbiased, high-throughput assays for detecting and quantifying DNA double-stranded breaks (DSBs) across the genome in mammalian cells will facilitate basic studies of the mechanisms that generate and repair endogenous DSBs. They will also enable more applied studies, such as those to evaluate the on- and off-target activities of engineered nucleases. Here we describe a linear amplification-mediated high-throughput genome-wide sequencing (LAM-HTGTS) method for the detection of genome-wide 'prey' DSBs via their translocation in cultured mammalian cells to a fixed 'bait' DSB. Bait-prey junctions are cloned directly from isolated genomic DNA using LAM-PCR and unidirectionally ligated to bridge adapters; subsequent PCR steps amplify the single-stranded DNA junction library in preparation for Illumina Miseq paired-end sequencing. A custom bioinformatics pipeline identifies prey sequences that contribute to junctions and maps them across the genome. LAM-HTGTS differs from related approaches because it detects a wide range of broken end structures with nucleotide-level resolution. Familiarity with nucleic acid methods and next-generation sequencing analysis is necessary for library generation and data interpretation. LAM-HTGTS assays are sensitive, reproducible, relatively inexpensive, scalable and straightforward to implement with a turnaround time of <1 week.
Towards a high throughput droplet-based agglutination assay
Kodzius, Rimantas; Castro, David; Foulds, Ian G.
2013-01-01
This work demonstrates the detection method for a high throughput droplet based agglutination assay system. Using simple hydrodynamic forces to mix and aggregate functionalized microbeads we avoid the need to use magnetic assistance or mixing structures. The concentration of our target molecules was estimated by agglutination strength, obtained through optical image analysis. Agglutination in droplets was performed with flow rates of 150 µl/min and occurred in under a minute, with potential to perform high-throughput measurements. The lowest target concentration detected in droplet microfluidics was 0.17 nM, which is three orders of magnitude more sensitive than a conventional card based agglutination assay.
Towards a high throughput droplet-based agglutination assay
Kodzius, Rimantas
2013-10-22
This work demonstrates the detection method for a high throughput droplet based agglutination assay system. Using simple hydrodynamic forces to mix and aggregate functionalized microbeads we avoid the need to use magnetic assistance or mixing structures. The concentration of our target molecules was estimated by agglutination strength, obtained through optical image analysis. Agglutination in droplets was performed with flow rates of 150 µl/min and occurred in under a minute, with potential to perform high-throughput measurements. The lowest target concentration detected in droplet microfluidics was 0.17 nM, which is three orders of magnitude more sensitive than a conventional card based agglutination assay.
DEFF Research Database (Denmark)
Priemé, Anders; Wolsing, Martin
2004-01-01
Temporal and spatial variation of communities of soil denitrifying bacteria at sites receiving mineral fertilizer (60 and 120 kg N ha-1 year-1) and cattle manure (75 and 150 kg N ha-1 year-1) were explored using terminal restriction fragment length polymorphism (T-RFLP) analyses of PCR amplified...... nitrite reductase (nirK and nirS) gene fragments. The analyses were done three times during the year: in March, July and October. nirK gene fragments could be amplified in all three months, whereas nirS gene fragments could be amplified only in March. Analysis of similarities in T-RFLP patterns revealed...... a significant seasonal shift in the community structure of nirK-containing bacteria. Also, sites treated with mineral fertilizer or cattle manure showed different communities of nirK-containing denitrifying bacteria, since the T-RFLP patterns of soils treated with these fertilizers were significantly different...
Spaargaren, Joke; Stoof, Jeroen; Fennema, Han; Coutinho, Roel; Savelkoul, Paul
2001-01-01
Amplified fragment length polymorphism analysis seems well suited for studying the epidemiology of isolates of Neisseria gonorrhoeae obtained from patients attending the Sexually Transmitted Disease Outpatient Clinic in Amsterdam, The Netherlands. It shows potential to identify the core group of transmitters.
Optimal control of a high-frequency class-D amplifier
DEFF Research Database (Denmark)
Dahl, Nicolai J.; Iversen, Niels Elkjær; Knott, Arnold
2018-01-01
Control loops have been used with switch-mode audio amplifiers to improve the sound quality of the amplifier. Because these amplifiers use a high-frequency modulation, precautions in the controller design must be taken. Further, the quality factor of the output filter can have a great impact...... on the controller's capabilities to suppress noise and track the audio signal. In this paper design methods for modern control are presented. The control method proves to easily overcome the challenge of designing a good performing controller when the output filter has a high quality factor. The results show...... that the controller is able to produce a clear improvement in the Total Harmonic Distortion with up to a 30 times improvement compared to open-loop with a clear reduction in the noise. This places the audio quality on pair with current solutions....
Picosecond mid-infrared amplifier for high average power.
CSIR Research Space (South Africa)
Botha, LR
2007-04-01
Full Text Available High pressure CO2 lasers are good candidates for amplifying picosecond mid infrared pulses. High pressure CO2 lasers are notorious for being unreliable and difficult to operate. In this paper a high pressure CO2 laser is presented based on well...
High sensitivity amplifier/discriminator for PWC's
International Nuclear Information System (INIS)
Hansen, S.
1983-01-01
The facility support group at Fermilab is designing and building a general purpose beam chamber for use in several locations at the laboratory. This pwc has 128 wires per plane spaced 1 mm apart. An initial production of 25 signal planes is anticipated. In proportional chambers, the size of the signal depends exponentially on the charge stored per unit of length along the anode wire. As the wire spacing decreases, the capacitance per unit length decreases, thereby requiring increased applied voltage to restore the necessary charge per unit length. In practical terms, this phenomenon is responsible for difficulties in constructing chambers with less than 2 mm wire spacing. 1 mm chambers, therefore, are frequently operated very near to their breakdown point and/or a high gain gas containing organic compounds such as magic gas is used. This argon/iso-butane mixture has three drawbacks: it is explosive when exposed to the air, it leaves a residue on the wires after extended use and is costly. An amplifier with higher sensitivity would reduce the problems associated with operating chambers with small wire spacings and allow them to be run a safe margin below their breakdown voltage even with an inorganic gas mixture such as argon/CO2, this eliminating the need to use magic gas. Described here is a low cost amplifier with a usable threshold of less than 0.5 μA. Data on the performance of this amplifier/discriminator in operation on a prototype beam chamber are given. This data shows the advantages of the high sensitivity of this design
Cryogenic cooling for high power laser amplifiers
Directory of Open Access Journals (Sweden)
Perin J.P.
2013-11-01
Full Text Available Using DPSSL (Diode Pumped Solid State Lasers as pumping technology, PW-class lasers with enhanced repetition rates are developed. Each of the Yb YAG amplifiers will be diode-pumped at a wavelength of 940 nm. This is a prerequisite for achieving high repetition rates (light amplification duration 1 millisecond and repetition rate 10 Hz. The efficiency of DPSSL is inversely proportional to the temperature, for this reason the slab amplifier have to be cooled at a temperature in the range of 100 K–170 K with a heat flux of 1 MW*m−2. This paper describes the thermo-mechanical analysis for the design of the amplification laser head, presents a preliminary proposal for the required cryogenic cooling system and finally outlines the gain of cryogenic operation for the efficiency of high pulsed laser.
High-throughput screening of small molecule libraries using SAMDI mass spectrometry.
Gurard-Levin, Zachary A; Scholle, Michael D; Eisenberg, Adam H; Mrksich, Milan
2011-07-11
High-throughput screening is a common strategy used to identify compounds that modulate biochemical activities, but many approaches depend on cumbersome fluorescent reporters or antibodies and often produce false-positive hits. The development of "label-free" assays addresses many of these limitations, but current approaches still lack the throughput needed for applications in drug discovery. This paper describes a high-throughput, label-free assay that combines self-assembled monolayers with mass spectrometry, in a technique called SAMDI, as a tool for screening libraries of 100,000 compounds in one day. This method is fast, has high discrimination, and is amenable to a broad range of chemical and biological applications.
Preliminary High-Throughput Metagenome Assembly
Energy Technology Data Exchange (ETDEWEB)
Dusheyko, Serge; Furman, Craig; Pangilinan, Jasmyn; Shapiro, Harris; Tu, Hank
2007-03-26
Metagenome data sets present a qualitatively different assembly problem than traditional single-organism whole-genome shotgun (WGS) assembly. The unique aspects of such projects include the presence of a potentially large number of distinct organisms and their representation in the data set at widely different fractions. In addition, multiple closely related strains could be present, which would be difficult to assemble separately. Failure to take these issues into account can result in poor assemblies that either jumble together different strains or which fail to yield useful results. The DOE Joint Genome Institute has sequenced a number of metagenomic projects and plans to considerably increase this number in the coming year. As a result, the JGI has a need for high-throughput tools and techniques for handling metagenome projects. We present the techniques developed to handle metagenome assemblies in a high-throughput environment. This includes a streamlined assembly wrapper, based on the JGI?s in-house WGS assembler, Jazz. It also includes the selection of sensible defaults targeted for metagenome data sets, as well as quality control automation for cleaning up the raw results. While analysis is ongoing, we will discuss preliminary assessments of the quality of the assembly results (http://fames.jgi-psf.org).
High power pulsed sources based on fiber amplifiers
Canat, Guillaume; Jaouën, Yves; Mollier, Jean-Claude; Bouzinac, Jean-Pierre; Cariou, Jean-Pierre
2017-11-01
Cladding-pumped rare-earth-doped fiber laser technologies are currently among the best sources for high power applications. Theses extremely compact and robust sources appoint them as good candidate for aeronautical and space applications. The double-clad (DC) fiber converts the poor beamquality of high-power large-area pump diodes from the 1st cladding to laser light at another wavelength guided in an active single-mode core. High-power coherent MOPA (Master Oscillator Power Amplifier) sources (several 10W CW or several 100W in pulsed regime) will soon be achieved. Unfortunately it also brings nonlinear effects which quickly impairs output signal distortions. Stimulated Brillouin scattering (SBS) and optical parametric amplification (OPA) have been shown to be strong limitations. Based on amplifier modeling and experiments we discuss the performances of these sources.
High-throughput transformation of Saccharomyces cerevisiae using liquid handling robots.
Directory of Open Access Journals (Sweden)
Guangbo Liu
Full Text Available Saccharomyces cerevisiae (budding yeast is a powerful eukaryotic model organism ideally suited to high-throughput genetic analyses, which time and again has yielded insights that further our understanding of cell biology processes conserved in humans. Lithium Acetate (LiAc transformation of yeast with DNA for the purposes of exogenous protein expression (e.g., plasmids or genome mutation (e.g., gene mutation, deletion, epitope tagging is a useful and long established method. However, a reliable and optimized high throughput transformation protocol that runs almost no risk of human error has not been described in the literature. Here, we describe such a method that is broadly transferable to most liquid handling high-throughput robotic platforms, which are now commonplace in academic and industry settings. Using our optimized method, we are able to comfortably transform approximately 1200 individual strains per day, allowing complete transformation of typical genomic yeast libraries within 6 days. In addition, use of our protocol for gene knockout purposes also provides a potentially quicker, easier and more cost-effective approach to generating collections of double mutants than the popular and elegant synthetic genetic array methodology. In summary, our methodology will be of significant use to anyone interested in high throughput molecular and/or genetic analysis of yeast.
Advances in fragment-based drug discovery platforms.
Orita, Masaya; Warizaya, Masaichi; Amano, Yasushi; Ohno, Kazuki; Niimi, Tatsuya
2009-11-01
Fragment-based drug discovery (FBDD) has been established as a powerful alternative and complement to traditional high-throughput screening techniques for identifying drug leads. At present, this technique is widely used among academic groups as well as small biotech and large pharmaceutical companies. In recent years, > 10 new compounds developed with FBDD have entered clinical development, and more and more attention in the drug discovery field is being focused on this technique. Under the FBDD approach, a fragment library of relatively small compounds (molecular mass = 100 - 300 Da) is screened by various methods and the identified fragment hits which normally weakly bind to the target are used as starting points to generate more potent drug leads. Because FBDD is still a relatively new drug discovery technology, further developments and optimizations in screening platforms and fragment exploitation can be expected. This review summarizes recent advances in FBDD platforms and discusses the factors important for the successful application of this technique. Under the FBDD approach, both identifying the starting fragment hit to be developed and generating the drug lead from that starting fragment hit are important. Integration of various techniques, such as computational technology, X-ray crystallography, NMR, surface plasmon resonance, isothermal titration calorimetry, mass spectrometry and high-concentration screening, must be applied in a situation-appropriate manner.
High efficiency class-I audio power amplifier using a single adaptive supply
International Nuclear Information System (INIS)
Peng Zhenfei; Yang Shanshand; Feng Yong; Hong Zhiliang; Liu Yang
2012-01-01
A high efficiency class-I linear audio power amplifier (PA) with an adaptive supply is presented. Its efficiency is improved by a dynamic supply to reduce the power transistors' voltage drop. A gain compression technique is adopted to make the amplifier accommodate a single positive supply. Circuit complicity and chip area are reduced because no charge pump is necessary for the negative supply. A common shared mode voltage and a symmetric layout pattern are used to minimize the non-linearity. A peak efficiency of 80% is reached at peak output power. The measured THD+N before and after the supply switching point are 0.01% and 0.05%, respectively. The maximum output power is 410 mW for an 8 Ω speaker load. Unlike switching amplifiers, the class-I amplifier operates as a linear amplifier and hence has a low EMI. The advantage of a high efficiency and low EMI makes the class-I amplifier suitable for portable and RF sensitive applications. (semiconductor integrated circuits)
A high-throughput multiplex method adapted for GMO detection.
Chaouachi, Maher; Chupeau, Gaëlle; Berard, Aurélie; McKhann, Heather; Romaniuk, Marcel; Giancola, Sandra; Laval, Valérie; Bertheau, Yves; Brunel, Dominique
2008-12-24
A high-throughput multiplex assay for the detection of genetically modified organisms (GMO) was developed on the basis of the existing SNPlex method designed for SNP genotyping. This SNPlex assay allows the simultaneous detection of up to 48 short DNA sequences (approximately 70 bp; "signature sequences") from taxa endogenous reference genes, from GMO constructions, screening targets, construct-specific, and event-specific targets, and finally from donor organisms. This assay avoids certain shortcomings of multiplex PCR-based methods already in widespread use for GMO detection. The assay demonstrated high specificity and sensitivity. The results suggest that this assay is reliable, flexible, and cost- and time-effective for high-throughput GMO detection.
High-performace cladding-pumped erbium-doped fibre laser and amplifier
International Nuclear Information System (INIS)
Kotov, L V; Likhachev, M E; Bubnov, M M; Medvedkov, O I; Lipatov, D S; Vechkanov, N N; Guryanov, Aleksei N
2012-01-01
We report cladding-pumped erbium-doped fibre laser and amplifier configurations. Through fibre design optimisation, we have achieved a record-high laser slope efficiency, 40 % with respect to absorbed pump power (λ = 976 nm), and an output power of 7.5 W. The erbium-doped fibre amplifier efficiency reaches 32 %.
A High-Voltage Class D Audio Amplifier for Dielectric Elastomer Transducers
DEFF Research Database (Denmark)
Nielsen, Dennis; Knott, Arnold; Andersen, Michael A. E.
2014-01-01
Dielectric Elastomer (DE) transducers have emerged as a very interesting alternative to the traditional electrodynamic transducer. Lightweight, small size and high maneuverability are some of the key features of the DE transducer. An amplifier for the DE transducer suitable for audio applications...... is proposed and analyzed. The amplifier addresses the issue of a high impedance load, ensuring a linear response over the midrange region of the audio bandwidth (100 Hz – 3.5 kHz). THD+N below 0.1% are reported for the ± 300 V prototype amplifier producing a maximum of 125 Var at a peak efficiency of 95 %....
Directory of Open Access Journals (Sweden)
Lieschen De Vos
Full Text Available The Gibberella fujikuroi complex includes many Fusarium species that cause significant losses in yield and quality of agricultural and forestry crops. Due to their economic importance, whole-genome sequence information has rapidly become available for species including Fusarium circinatum, Fusarium fujikuroi and Fusarium verticillioides, each of which represent one of the three main clades known in this complex. However, no previous studies have explored the genomic commonalities and differences among these fungi. In this study, a previously completed genetic linkage map for an interspecific cross between Fusarium temperatum and F. circinatum, together with genomic sequence data, was utilized to consider the level of synteny between the three Fusarium genomes. Regions that are homologous amongst the Fusarium genomes examined were identified using in silico and pyrosequenced amplified fragment length polymorphism (AFLP fragment analyses. Homology was determined using BLAST analysis of the sequences, with 777 homologous regions aligned to F. fujikuroi and F. verticillioides. This also made it possible to assign the linkage groups from the interspecific cross to their corresponding chromosomes in F. verticillioides and F. fujikuroi, as well as to assign two previously unmapped supercontigs of F. verticillioides to probable chromosomal locations. We further found evidence of a reciprocal translocation between the distal ends of chromosome 8 and 11, which apparently originated before the divergence of F. circinatum and F. temperatum. Overall, a remarkable level of macrosynteny was observed among the three Fusarium genomes, when comparing AFLP fragments. This study not only demonstrates how in silico AFLPs can aid in the integration of a genetic linkage map to the physical genome, but it also highlights the benefits of using this tool to study genomic synteny and architecture.
Lyon, Elaine; Laver, Thomas; Yu, Ping; Jama, Mohamed; Young, Keith; Zoccoli, Michael; Marlowe, Natalia
2010-01-01
Population screening has been proposed for Fragile X syndrome to identify premutation carrier females and affected newborns. We developed a PCR-based assay capable of quickly detecting the presence or absence of an expanded FMR1 allele with high sensitivity and specificity. This assay combines a triplet repeat primed PCR with high-throughput automated capillary electrophoresis. We evaluated assay performance using archived samples sent for Fragile X diagnostic testing representing a range of Fragile X CGG-repeat expansions. Two hundred five previously genotyped samples were tested with the new assay. Data were analyzed for the presence of a trinucleotide “ladder” extending beyond 55 repeats, which was set as a cut-off to identify expanded FMR1 alleles. We identified expanded FMR1 alleles in 132 samples (59 premutation, 71 full mutation, 2 mosaics) and normal FMR1 alleles in 73 samples. We found 100% concordance with previous results from PCR and Southern blot analyses. In addition, we show feasibility of using this assay with DNA extracted from dried-blood spots. Using a single PCR combined with high-throughput fragment analysis on the automated capillary electrophoresis instrument, we developed a rapid and reproducible PCR-based laboratory assay that meets many of the requirements for a first-tier test for population screening. PMID:20431035
High Throughput Analysis of Photocatalytic Water Purification
Sobral Romao, J.I.; Baiao Barata, David; Habibovic, Pamela; Mul, Guido; Baltrusaitis, Jonas
2014-01-01
We present a novel high throughput photocatalyst efficiency assessment method based on 96-well microplates and UV-Vis spectroscopy. We demonstrate the reproducibility of the method using methyl orange (MO) decomposition, and compare kinetic data obtained with those provided in the literature for
National Research Council Canada - National Science Library
Boger, Dale L
2005-01-01
.... This entails the high throughput synthesis of DNA binding agents related to distamycin, their screening for binding to androgen response elements using a new high throughput DNA binding screen...
National Research Council Canada - National Science Library
Boger, Dale
2004-01-01
.... This entails the high throughput synthesis of DNA binding agents related to distamycin, their screening for binding to androgen response elements using a new high throughput DNA binding screen...
Proposal for a common nomenclature for fragment ions in mass spectra of lipids
DEFF Research Database (Denmark)
Pauling, Josch K; Hermansson, Martin; Hartler, Jürgen
2017-01-01
Advances in mass spectrometry-based lipidomics have in recent years prompted efforts to standardize the annotation of the vast number of lipid molecules that can be detected in biological systems. These efforts have focused on cataloguing, naming and drawing chemical structures of intact lipid...... molecules, but have provided no guidelines for annotation of lipid fragment ions detected using tandem and multi-stage mass spectrometry, albeit these fragment ions are mandatory for structural elucidation and high confidence lipid identification, especially in high throughput lipidomics workflows. Here we...... propose a nomenclature for the annotation of lipid fragment ions, describe its implementation and present a freely available web application, termed ALEX123 lipid calculator, that can be used to query a comprehensive database featuring curated lipid fragmentation information for more than 430...
A CRISPR CASe for High-Throughput Silencing
Directory of Open Access Journals (Sweden)
Jacob eHeintze
2013-10-01
Full Text Available Manipulation of gene expression on a genome-wide level is one of the most important systematic tools in the post-genome era. Such manipulations have largely been enabled by expression cloning approaches using sequence-verified cDNA libraries, large-scale RNA interference libraries (shRNA or siRNA and zinc finger nuclease technologies. More recently, the CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats and CRISPR-associated (Cas9-mediated gene editing technology has been described that holds great promise for future use of this technology in genomic manipulation. It was suggested that the CRISPR system has the potential to be used in high-throughput, large-scale loss of function screening. Here we discuss some of the challenges in engineering of CRISPR/Cas genomic libraries and some of the aspects that need to be addressed in order to use this technology on a high-throughput scale.
A Low-Noise Transimpedance Amplifier for BLM-Based Ion Channel Recording
Directory of Open Access Journals (Sweden)
Marco Crescentini
2016-05-01
Full Text Available High-throughput screening (HTS using ion channel recording is a powerful drug discovery technique in pharmacology. Ion channel recording with planar bilayer lipid membranes (BLM is scalable and has very high sensitivity. A HTS system based on BLM ion channel recording faces three main challenges: (i design of scalable microfluidic devices; (ii design of compact ultra-low-noise transimpedance amplifiers able to detect currents in the pA range with bandwidth >10 kHz; (iii design of compact, robust and scalable systems that integrate these two elements. This paper presents a low-noise transimpedance amplifier with integrated A/D conversion realized in CMOS 0.35 μm technology. The CMOS amplifier acquires currents in the range ±200 pA and ±20 nA, with 100 kHz bandwidth while dissipating 41 mW. An integrated digital offset compensation loop balances any voltage offsets from Ag/AgCl electrodes. The measured open-input input-referred noise current is as low as 4 fA/√Hz at ±200 pA range. The current amplifier is embedded in an integrated platform, together with a microfluidic device, for current recording from ion channels. Gramicidin-A, α-haemolysin and KcsA potassium channels have been used to prove both the platform and the current-to-digital converter.
A Low-Noise Transimpedance Amplifier for BLM-Based Ion Channel Recording.
Crescentini, Marco; Bennati, Marco; Saha, Shimul Chandra; Ivica, Josip; de Planque, Maurits; Morgan, Hywel; Tartagni, Marco
2016-05-19
High-throughput screening (HTS) using ion channel recording is a powerful drug discovery technique in pharmacology. Ion channel recording with planar bilayer lipid membranes (BLM) is scalable and has very high sensitivity. A HTS system based on BLM ion channel recording faces three main challenges: (i) design of scalable microfluidic devices; (ii) design of compact ultra-low-noise transimpedance amplifiers able to detect currents in the pA range with bandwidth >10 kHz; (iii) design of compact, robust and scalable systems that integrate these two elements. This paper presents a low-noise transimpedance amplifier with integrated A/D conversion realized in CMOS 0.35 μm technology. The CMOS amplifier acquires currents in the range ±200 pA and ±20 nA, with 100 kHz bandwidth while dissipating 41 mW. An integrated digital offset compensation loop balances any voltage offsets from Ag/AgCl electrodes. The measured open-input input-referred noise current is as low as 4 fA/√Hz at ±200 pA range. The current amplifier is embedded in an integrated platform, together with a microfluidic device, for current recording from ion channels. Gramicidin-A, α-haemolysin and KcsA potassium channels have been used to prove both the platform and the current-to-digital converter.
Saieg, Mauro Ajaj; Geddie, William R; Boerner, Scott L; Liu, Ni; Tsao, Ming; Zhang, Tong; Kamel-Reid, Suzanne; da Cunha Santos, Gilda
2012-06-25
Novel high-throughput molecular technologies have made the collection and storage of cells and small tissue specimens a critical issue. The FTA card provides an alternative to cryopreservation for biobanking fresh unfixed cells. The current study compared the quality and integrity of the DNA obtained from 2 types of FTA cards (Classic and Elute) using 2 different extraction protocols ("Classic" and "Elute") and assessed the feasibility of performing multiplex mutational screening using fine-needle aspiration (FNA) biopsy samples. Residual material from 42 FNA biopsies was collected in the cards (21 Classic and 21 Elute cards). DNA was extracted using the Classic protocol for Classic cards and both protocols for Elute cards. Polymerase chain reaction for p53 (1.5 kilobase) and CARD11 (500 base pair) was performed to assess DNA integrity. Successful p53 amplification was achieved in 95.2% of the samples from the Classic cards and in 80.9% of the samples from the Elute cards using the Classic protocol and 28.5% using the Elute protocol (P = .001). All samples (both cards) could be amplified for CARD11. There was no significant difference in the DNA concentration or 260/280 purity ratio when the 2 types of cards were compared. Five samples were also successfully analyzed by multiplex MassARRAY spectrometry, with a mutation in KRAS found in 1 case. High molecular weight DNA was extracted from the cards in sufficient amounts and quality to perform high-throughput multiplex mutation assays. The results of the current study also suggest that FTA Classic cards preserve better DNA integrity for molecular applications compared with the FTA Elute cards. Copyright © 2012 American Cancer Society.
High Energy Single Frequency Resonant Amplifier, Phase I
National Aeronautics and Space Administration — This SBIR phase I project proposes a single frequency high energy resonant amplifier for remote sensing. Current state-of-art technologies can not provide all...
High throughput route selection in multi-rate wireless mesh networks
Institute of Scientific and Technical Information of China (English)
WEI Yi-fei; GUO Xiang-li; SONG Mei; SONG Jun-de
2008-01-01
Most existing Ad-hoc routing protocols use the shortest path algorithm with a hop count metric to select paths. It is appropriate in single-rate wireless networks, but has a tendency to select paths containing long-distance links that have low data rates and reduced reliability in multi-rate networks. This article introduces a high throughput routing algorithm utilizing the multi-rate capability and some mesh characteristics in wireless fidelity (WiFi) mesh networks. It uses the medium access control (MAC) transmission time as the routing metric, which is estimated by the information passed up from the physical layer. When the proposed algorithm is adopted, the Ad-hoc on-demand distance vector (AODV) routing can be improved as high throughput AODV (HT-AODV). Simulation results show that HT-AODV is capable of establishing a route that has high data-rate, short end-to-end delay and great network throughput.
Alginate Immobilization of Metabolic Enzymes (AIME) for High-Throughput Screening Assays (SOT)
Alginate Immobilization of Metabolic Enzymes (AIME) for High-Throughput Screening Assays DE DeGroot, RS Thomas, and SO SimmonsNational Center for Computational Toxicology, US EPA, Research Triangle Park, NC USAThe EPA’s ToxCast program utilizes a wide variety of high-throughput s...
High-throughput phenotyping and genomic selection: the frontiers of crop breeding converge.
Cabrera-Bosquet, Llorenç; Crossa, José; von Zitzewitz, Jarislav; Serret, María Dolors; Araus, José Luis
2012-05-01
Genomic selection (GS) and high-throughput phenotyping have recently been captivating the interest of the crop breeding community from both the public and private sectors world-wide. Both approaches promise to revolutionize the prediction of complex traits, including growth, yield and adaptation to stress. Whereas high-throughput phenotyping may help to improve understanding of crop physiology, most powerful techniques for high-throughput field phenotyping are empirical rather than analytical and comparable to genomic selection. Despite the fact that the two methodological approaches represent the extremes of what is understood as the breeding process (phenotype versus genome), they both consider the targeted traits (e.g. grain yield, growth, phenology, plant adaptation to stress) as a black box instead of dissecting them as a set of secondary traits (i.e. physiological) putatively related to the target trait. Both GS and high-throughput phenotyping have in common their empirical approach enabling breeders to use genome profile or phenotype without understanding the underlying biology. This short review discusses the main aspects of both approaches and focuses on the case of genomic selection of maize flowering traits and near-infrared spectroscopy (NIRS) and plant spectral reflectance as high-throughput field phenotyping methods for complex traits such as crop growth and yield. © 2012 Institute of Botany, Chinese Academy of Sciences.
Reyon, Deepak; Maeder, Morgan L; Khayter, Cyd; Tsai, Shengdar Q; Foley, Jonathan E; Sander, Jeffry D; Joung, J Keith
2013-07-01
Customized DNA-binding domains made using transcription activator-like effector (TALE) repeats are rapidly growing in importance as widely applicable research tools. TALE nucleases (TALENs), composed of an engineered array of TALE repeats fused to the FokI nuclease domain, have been used successfully for directed genome editing in various organisms and cell types. TALE transcription factors (TALE-TFs), consisting of engineered TALE repeat arrays linked to a transcriptional regulatory domain, have been used to up- or downregulate expression of endogenous genes in human cells and plants. This unit describes a detailed protocol for the recently described fast ligation-based automatable solid-phase high-throughput (FLASH) assembly method. FLASH enables automated high-throughput construction of engineered TALE repeats using an automated liquid handling robot or manually using a multichannel pipet. Using the automated approach, a single researcher can construct up to 96 DNA fragments encoding TALE repeat arrays of various lengths in a single day, and then clone these to construct sequence-verified TALEN or TALE-TF expression plasmids in a week or less. Plasmids required for FLASH are available by request from the Joung lab (http://eGenome.org). This unit also describes improvements to the Zinc Finger and TALE Targeter (ZiFiT Targeter) web server (http://ZiFiT.partners.org) that facilitate the design and construction of FLASH TALE repeat arrays in high throughput. © 2013 by John Wiley & Sons, Inc.
High-throughput single nucleotide polymorphism genotyping using nanofluidic Dynamic Arrays
Directory of Open Access Journals (Sweden)
Crenshaw Andrew
2009-01-01
Full Text Available Abstract Background Single nucleotide polymorphisms (SNPs have emerged as the genetic marker of choice for mapping disease loci and candidate gene association studies, because of their high density and relatively even distribution in the human genomes. There is a need for systems allowing medium multiplexing (ten to hundreds of SNPs with high throughput, which can efficiently and cost-effectively generate genotypes for a very large sample set (thousands of individuals. Methods that are flexible, fast, accurate and cost-effective are urgently needed. This is also important for those who work on high throughput genotyping in non-model systems where off-the-shelf assays are not available and a flexible platform is needed. Results We demonstrate the use of a nanofluidic Integrated Fluidic Circuit (IFC - based genotyping system for medium-throughput multiplexing known as the Dynamic Array, by genotyping 994 individual human DNA samples on 47 different SNP assays, using nanoliter volumes of reagents. Call rates of greater than 99.5% and call accuracies of greater than 99.8% were achieved from our study, which demonstrates that this is a formidable genotyping platform. The experimental set up is very simple, with a time-to-result for each sample of about 3 hours. Conclusion Our results demonstrate that the Dynamic Array is an excellent genotyping system for medium-throughput multiplexing (30-300 SNPs, which is simple to use and combines rapid throughput with excellent call rates, high concordance and low cost. The exceptional call rates and call accuracy obtained may be of particular interest to those working on validation and replication of genome- wide- association (GWA studies.
HTTK: R Package for High-Throughput Toxicokinetics
Thousands of chemicals have been profiled by high-throughput screening programs such as ToxCast and Tox21; these chemicals are tested in part because most of them have limited or no data on hazard, exposure, or toxicokinetics. Toxicokinetic models aid in predicting tissue concent...
The rise of fragment-based drug discovery.
Murray, Christopher W; Rees, David C
2009-06-01
The search for new drugs is plagued by high attrition rates at all stages in research and development. Chemists have an opportunity to tackle this problem because attrition can be traced back, in part, to the quality of the chemical leads. Fragment-based drug discovery (FBDD) is a new approach, increasingly used in the pharmaceutical industry, for reducing attrition and providing leads for previously intractable biological targets. FBDD identifies low-molecular-weight ligands (∼150 Da) that bind to biologically important macromolecules. The three-dimensional experimental binding mode of these fragments is determined using X-ray crystallography or NMR spectroscopy, and is used to facilitate their optimization into potent molecules with drug-like properties. Compared with high-throughput-screening, the fragment approach requires fewer compounds to be screened, and, despite the lower initial potency of the screening hits, offers more efficient and fruitful optimization campaigns. Here, we review the rise of FBDD, including its application to discovering clinical candidates against targets for which other chemistry approaches have struggled.
Solid state high power amplifier for driving the SLC injector klystron
International Nuclear Information System (INIS)
Judkins, J.G.; Clendenin, J.E.; Schwarz, H.D.
1985-03-01
The SLC injector klystron rf drive is now provided by a recently developed solid-state amplifier. The high gain of the amplifier permits the use of a fast low-power electronic phase shifter. Thus the SLC computer control system can be used to shift the phase of the high-power rf rapidly during the fill time of the injector accelerator section. These rapid phase shifts are used to introduce a phase-energy relationship in the accelerated electron pulse in conjunction with the operation of the injector bunch compressor. The amplifier, the method of controlling the rf phase, and the operational characteristics of the system are described. 5 refs., 4 figs
Szemiako, Kasjan; Śledzińska, Anna; Krawczyk, Beata
2017-08-01
Candida sp. have been responsible for an increasing number of infections, especially in patients with immunodeficiency. Species-specific differentiation of Candida sp. is difficult in routine diagnosis. This identification can have a highly significant association in therapy and prophylaxis. This work has shown a new application of the terminal restriction fragment length polymorphism (t-RFLP) method in the molecular identification of six species of Candida, which are the most common causes of fungal infections. Specific for fungi homocitrate synthase gene was chosen as a molecular target for amplification. The use of three restriction enzymes, DraI, RsaI, and BglII, for amplicon digestion can generate species-specific fluorescence labeled DNA fragment profiles, which can be used to determine the diagnostic algorithm. The designed method can be a cost-efficient high-throughput molecular technique for the identification of six clinically important Candida species.
A high-throughput, multi-channel photon-counting detector with picosecond timing
Lapington, J S; Miller, G M; Ashton, T J R; Jarron, P; Despeisse, M; Powolny, F; Howorth, J; Milnes, J
2009-01-01
High-throughput photon counting with high time resolution is a niche application area where vacuum tubes can still outperform solid-state devices. Applications in the life sciences utilizing time-resolved spectroscopies, particularly in the growing field of proteomics, will benefit greatly from performance enhancements in event timing and detector throughput. The HiContent project is a collaboration between the University of Leicester Space Research Centre, the Microelectronics Group at CERN, Photek Ltd., and end-users at the Gray Cancer Institute and the University of Manchester. The goal is to develop a detector system specifically designed for optical proteomics, capable of high content (multi-parametric) analysis at high throughput. The HiContent detector system is being developed to exploit this niche market. It combines multi-channel, high time resolution photon counting in a single miniaturized detector system with integrated electronics. The combination of enabling technologies; small pore microchanne...
Space Link Extension Protocol Emulation for High-Throughput, High-Latency Network Connections
Tchorowski, Nicole; Murawski, Robert
2014-01-01
New space missions require higher data rates and new protocols to meet these requirements. These high data rate space communication links push the limitations of not only the space communication links, but of the ground communication networks and protocols which forward user data to remote ground stations (GS) for transmission. The Consultative Committee for Space Data Systems, (CCSDS) Space Link Extension (SLE) standard protocol is one protocol that has been proposed for use by the NASA Space Network (SN) Ground Segment Sustainment (SGSS) program. New protocol implementations must be carefully tested to ensure that they provide the required functionality, especially because of the remote nature of spacecraft. The SLE protocol standard has been tested in the NASA Glenn Research Center's SCENIC Emulation Lab in order to observe its operation under realistic network delay conditions. More specifically, the delay between then NASA Integrated Services Network (NISN) and spacecraft has been emulated. The round trip time (RTT) delay for the continental NISN network has been shown to be up to 120ms; as such the SLE protocol was tested with network delays ranging from 0ms to 200ms. Both a base network condition and an SLE connection were tested with these RTT delays, and the reaction of both network tests to the delay conditions were recorded. Throughput for both of these links was set at 1.2Gbps. The results will show that, in the presence of realistic network delay, the SLE link throughput is significantly reduced while the base network throughput however remained at the 1.2Gbps specification. The decrease in SLE throughput has been attributed to the implementation's use of blocking calls. The decrease in throughput is not acceptable for high data rate links, as the link requires constant data a flow in order for spacecraft and ground radios to stay synchronized, unless significant data is queued a the ground station. In cases where queuing the data is not an option
Green-Frag: Energy-efficient frame fragmentation scheme for wireless sensor networks
Daghistani, Anas; Shihada, Basem
2013-01-01
Frame fragmentation techniques aim to achieve higher throughput by reducing retransmissions. Using experiments on a WSN testbed, we show that frame fragmentation also helps to reduce energy consumption. In this paper we propose Green-Frag, a new
Albrodt, P.; Hanna, M.; Moron, F.; Decker, J.; Winterfeldt, M.; Blume, G.; Erbert, G.; Crump, P.; Georges, P.; Lucas-Leclin, G.
2018-02-01
Improved diode laser beam combining techniques are in strong demand for applications in material processing. Coherent beam combining (CBC) is the only combining approach that has the potential to maintain or even improve all laser properties, and thus has high potential for future systems. As part of our ongoing studies into CBC of diode lasers, we present recent progress in the coherent superposition of high-power single-pass tapered laser amplifiers. The amplifiers are seeded by a DFB laser at λ = 976 nm, where the seed is injected into a laterally single-mode ridge-waveguide input section. The phase pistons on each beam are actively controlled by varying the current in the ridge section of each amplifier, using a sequential hill-climbing algorithm, resulting in a combined beam with power fluctuations of below 1%. The currents into the tapered sections of the amplifiers are separately controlled, and remain constant. In contrast to our previous studies, we favour a limited number of individual high-power amplifiers, in order to preserve a high extracted power per emitter in a simple, low-loss coupling arrangement. Specifically, a multi-arm interferometer architecture with only three devices is used, constructed using 6 mm-long tapered amplifiers, mounted junction up on C-mounts, to allow separate contact to single mode and amplifier sections. A maximum coherently combined power of 12.9 W is demonstrated in a nearly diffraction-limited beam, corresponding to a 65% combining efficiency, with power mainly limited by the intrinsic beam quality of the amplifiers. Further increased combined power is currently sought.
Keeports, David
2006-12-01
By definition, a high fidelity amplifier's instantaneous output voltage is directly proportional to its instantaneous input voltage. While high fidelity is generally valued in the amplification of recorded music, nonlinearity, also known as distortion, is desirable in the amplification of some musical instruments. In particular, guitar amplifiers exploit nonlinearity to increase both the harmonic content and sustain of a guitar's sound. I will discuss how both modifications in sound result from saturation of triode tubes and transistors. Additionally, I will describe the difference in the symmetry of saturation curves for transistors and tubes and the reason why tube guitar amplifiers are generally considered to be superior to solid-state amplifiers. Finally, I will discuss attempts to use solid-state electronics to replicate the sound of tube amplifiers.
High-throughput screening to identify inhibitors of lysine demethylases.
Gale, Molly; Yan, Qin
2015-01-01
Lysine demethylases (KDMs) are epigenetic regulators whose dysfunction is implicated in the pathology of many human diseases including various types of cancer, inflammation and X-linked intellectual disability. Particular demethylases have been identified as promising therapeutic targets, and tremendous efforts are being devoted toward developing suitable small-molecule inhibitors for clinical and research use. Several High-throughput screening strategies have been developed to screen for small-molecule inhibitors of KDMs, each with advantages and disadvantages in terms of time, cost, effort, reliability and sensitivity. In this Special Report, we review and evaluate the High-throughput screening methods utilized for discovery of novel small-molecule KDM inhibitors.
High throughput protein production screening
Beernink, Peter T [Walnut Creek, CA; Coleman, Matthew A [Oakland, CA; Segelke, Brent W [San Ramon, CA
2009-09-08
Methods, compositions, and kits for the cell-free production and analysis of proteins are provided. The invention allows for the production of proteins from prokaryotic sequences or eukaryotic sequences, including human cDNAs using PCR and IVT methods and detecting the proteins through fluorescence or immunoblot techniques. This invention can be used to identify optimized PCR and WT conditions, codon usages and mutations. The methods are readily automated and can be used for high throughput analysis of protein expression levels, interactions, and functional states.
High throughput production of mouse monoclonal antibodies using antigen microarrays
DEFF Research Database (Denmark)
De Masi, Federico; Chiarella, P.; Wilhelm, H.
2005-01-01
Recent advances in proteomics research underscore the increasing need for high-affinity monoclonal antibodies, which are still generated with lengthy, low-throughput antibody production techniques. Here we present a semi-automated, high-throughput method of hybridoma generation and identification....... Monoclonal antibodies were raised to different targets in single batch runs of 6-10 wk using multiplexed immunisations, automated fusion and cell-culture, and a novel antigen-coated microarray-screening assay. In a large-scale experiment, where eight mice were immunized with ten antigens each, we generated...
High throughput electrospinning of high-quality nanofibers via an aluminum disk spinneret
Zheng, Guokuo
In this work, a simple and efficient needleless high throughput electrospinning process using an aluminum disk spinneret with 24 holes is described. Electrospun mats produced by this setup consisted of fine fibers (nano-sized) of the highest quality while the productivity (yield) was many times that obtained from conventional single-needle electrospinning. The goal was to produce scaled-up amounts of the same or better quality nanofibers under variable concentration, voltage, and the working distance than those produced with the single needle lab setting. The fiber mats produced were either polymer or ceramic (such as molybdenum trioxide nanofibers). Through experimentation the optimum process conditions were defined to be: 24 kilovolt, a distance to collector of 15cm. More diluted solutions resulted in smaller diameter fibers. Comparing the morphologies of the nanofibers of MoO3 produced by both the traditional and the high throughput set up it was found that they were very similar. Moreover, the nanofibers production rate is nearly 10 times than that of traditional needle electrospinning. Thus, the high throughput process has the potential to become an industrial nanomanufacturing process and the materials processed by it may be used as filtration devices, in tissue engineering, and as sensors.
International Nuclear Information System (INIS)
Kisselman, Gera; Qiu, Wei; Romanov, Vladimir; Thompson, Christine M.; Lam, Robert; Battaile, Kevin P.; Pai, Emil F.; Chirgadze, Nickolay Y.
2011-01-01
The X-CHIP (X-ray Crystallography High-throughput Integrated Platform) is a novel microchip that has been developed to combine multiple steps of the crystallographic pipeline from crystallization to diffraction data collection on a single device to streamline the entire process. The X-CHIP (X-ray Crystallization High-throughput Integrated Platform) is a novel microchip that has been developed to combine multiple steps of the crystallographic pipeline from crystallization to diffraction data collection on a single device to streamline the entire process. The system has been designed for crystallization condition screening, visual crystal inspection, initial X-ray screening and data collection in a high-throughput fashion. X-ray diffraction data acquisition can be performed directly on-the-chip at room temperature using an in situ approach. The capabilities of the chip eliminate the necessity for manual crystal handling and cryoprotection of crystal samples, while allowing data collection from multiple crystals in the same drop. This technology would be especially beneficial for projects with large volumes of data, such as protein-complex studies and fragment-based screening. The platform employs hydrophilic and hydrophobic concentric ring surfaces on a miniature plate transparent to visible light and X-rays to create a well defined and stable microbatch crystallization environment. The results of crystallization and data-collection experiments demonstrate that high-quality well diffracting crystals can be grown and high-resolution diffraction data sets can be collected using this technology. Furthermore, the quality of a single-wavelength anomalous dispersion data set collected with the X-CHIP at room temperature was sufficient to generate interpretable electron-density maps. This technology is highly resource-efficient owing to the use of nanolitre-scale drop volumes. It does not require any modification for most in-house and synchrotron beamline systems and offers
Energy Technology Data Exchange (ETDEWEB)
Kisselman, Gera; Qiu, Wei; Romanov, Vladimir; Thompson, Christine M.; Lam, Robert [Ontario Cancer Institute, Princess Margaret Hospital, University Health Network, Toronto, Ontario M5G 2C4 (Canada); Battaile, Kevin P. [Argonne National Laboratory, Argonne, Illinois 60439 (United States); Pai, Emil F.; Chirgadze, Nickolay Y., E-mail: nchirgad@uhnresearch.ca [Ontario Cancer Institute, Princess Margaret Hospital, University Health Network, Toronto, Ontario M5G 2C4 (Canada); University of Toronto, Toronto, Ontario M5S 1A8 (Canada)
2011-06-01
The X-CHIP (X-ray Crystallography High-throughput Integrated Platform) is a novel microchip that has been developed to combine multiple steps of the crystallographic pipeline from crystallization to diffraction data collection on a single device to streamline the entire process. The X-CHIP (X-ray Crystallization High-throughput Integrated Platform) is a novel microchip that has been developed to combine multiple steps of the crystallographic pipeline from crystallization to diffraction data collection on a single device to streamline the entire process. The system has been designed for crystallization condition screening, visual crystal inspection, initial X-ray screening and data collection in a high-throughput fashion. X-ray diffraction data acquisition can be performed directly on-the-chip at room temperature using an in situ approach. The capabilities of the chip eliminate the necessity for manual crystal handling and cryoprotection of crystal samples, while allowing data collection from multiple crystals in the same drop. This technology would be especially beneficial for projects with large volumes of data, such as protein-complex studies and fragment-based screening. The platform employs hydrophilic and hydrophobic concentric ring surfaces on a miniature plate transparent to visible light and X-rays to create a well defined and stable microbatch crystallization environment. The results of crystallization and data-collection experiments demonstrate that high-quality well diffracting crystals can be grown and high-resolution diffraction data sets can be collected using this technology. Furthermore, the quality of a single-wavelength anomalous dispersion data set collected with the X-CHIP at room temperature was sufficient to generate interpretable electron-density maps. This technology is highly resource-efficient owing to the use of nanolitre-scale drop volumes. It does not require any modification for most in-house and synchrotron beamline systems and offers
Impact of Nonlinear Power Amplifier on Link Adaptation Algorithm of OFDM Systems
DEFF Research Database (Denmark)
Das, Suvra S.; Tariq, Faisal; Rahman, Muhammad Imadur
2007-01-01
The impact of non linear distortion due to High Power Amplifier (HPA) on the performance of Link Adaptation (LA) - Orthogonal Frequency Division Multiplexing (OFDM) based wireless system is analyzed. The performance of both Forward Error Control Coding (FEC) en-coded and uncoded system is evaluated....... LA maximizes the throughput while maintaining a required Block Error Rate (BLER). It is found that when OFDM signal, which has high PAPR, suffers non linear distortion due to non ideal HPA, the LA fails to meet the target BLER. Detailed analysis of the distortion and effects on LA are presented...
High-throughput screening of saliva for early detection of oral cancer: a pilot study.
Szanto, I; Mark, L; Bona, A; Maasz, G; Sandor, B; Gelencser, G; Turi, Z; Gallyas, F
2012-04-01
The success of tumour therapy depends considerably on early diagnosis. Therefore, we aimed to develop a widely available, cheap, non-invasive, high-throughput method suitable for screening high-risk populations, at least, for early signs of malignant transformation in the oral cavity. First, in order to identify suitable tumour marker candidates, we compared the protein patterns of five selected saliva samples obtained from healthy controls and tumour patients after electrophoretic separation, excised the bands that were consistently up-regulated in the tumour patients only, and performed matrix-assisted laser-desorption ionisation (MALDI)-time of flight (TOF) tandem mass spectrometry (MS/MS) analysis of the proteins in these bands after in-gel tryptic digestion. From the panel of proteins identified, we chose annexin 1 and peroxiredoxin 2 for further studies based on their presence in the saliva of all five oral cancer patients only. Then, we performed a homology search of protein databases using the primary sequence of each in silico tryptic fragment peptide of these two proteins as bait, and selected a unique peptide for each. Finally, we performed targeted MALDI-TOF MS peptide analysis in a blinded fashion on all samples obtained from 20 healthy controls and 22 tumour patients for the presence of these peptides. We found both peptides present in the saliva samples of all cancer patients only. Even though these tumour markers should be validated in a wider population, our results indicate that targeted MALDI-TOF MS analysis of unique peptides of putative saliva protein tumour biomarkers could be the method of choice for cost-efficient, high-throughput screening for the early detection of oral cancer.
Short pulse mid-infrared amplifier for high average power
CSIR Research Space (South Africa)
Botha, LR
2006-09-01
Full Text Available High pressure CO2 lasers are good candidates for amplifying picosecond mid infrared pulses. High pressure CO2 lasers are notorious for being unreliable and difficult to operate. In this paper a high pressure CO2 laser is presented based on well...
Solion ion source for high-efficiency, high-throughput solar cell manufacturing
Energy Technology Data Exchange (ETDEWEB)
Koo, John, E-mail: john-koo@amat.com; Binns, Brant; Miller, Timothy; Krause, Stephen; Skinner, Wesley; Mullin, James [Applied Materials, Inc., Varian Semiconductor Equipment Business Unit, 35 Dory Road, Gloucester, Massachusetts 01930 (United States)
2014-02-15
In this paper, we introduce the Solion ion source for high-throughput solar cell doping. As the source power is increased to enable higher throughput, negative effects degrade the lifetime of the plasma chamber and the extraction electrodes. In order to improve efficiency, we have explored a wide range of electron energies and determined the conditions which best suit production. To extend the lifetime of the source we have developed an in situ cleaning method using only existing hardware. With these combinations, source life-times of >200 h for phosphorous and >100 h for boron ion beams have been achieved while maintaining 1100 cell-per-hour production.
High throughput integrated thermal characterization with non-contact optical calorimetry
Hou, Sichao; Huo, Ruiqing; Su, Ming
2017-10-01
Commonly used thermal analysis tools such as calorimeter and thermal conductivity meter are separated instruments and limited by low throughput, where only one sample is examined each time. This work reports an infrared based optical calorimetry with its theoretical foundation, which is able to provide an integrated solution to characterize thermal properties of materials with high throughput. By taking time domain temperature information of spatially distributed samples, this method allows a single device (infrared camera) to determine the thermal properties of both phase change systems (melting temperature and latent heat of fusion) and non-phase change systems (thermal conductivity and heat capacity). This method further allows these thermal properties of multiple samples to be determined rapidly, remotely, and simultaneously. In this proof-of-concept experiment, the thermal properties of a panel of 16 samples including melting temperatures, latent heats of fusion, heat capacities, and thermal conductivities have been determined in 2 min with high accuracy. Given the high thermal, spatial, and temporal resolutions of the advanced infrared camera, this method has the potential to revolutionize the thermal characterization of materials by providing an integrated solution with high throughput, high sensitivity, and short analysis time.
International Nuclear Information System (INIS)
Zhao, B.; Zheng, X.Z.
2015-01-01
Genetic relationships of nine species of Rhododendron in the Qinling Mountains were evaluated using amplified fragment length polymorphism (AFLP) markers. A total of 440 amplification products were obtained using nine selected AFLP markers, of which 421 (95.40%) showed polymorphism. With these polymorphic products, a dendrogram was constructed using the unweighted pair-group method with arithmetic mean (UPGMA). R. calophytum, R. hypoglaucum and R. clementinae, belonging to Subgen Hymenanthes, gathered together, and the species derived from Subgen Rhododendron and Subgen Tsutsusi formed another two groups. R. tsinlingense, R. purdomii, R. Taibaiense and R. capitatum (Subsect. Lapponica), and R. concinnum (Subsect. Triflora) were clustered as one group, but they belong to difference subsect. and R. purdomii and R. Taibaiense showed the closest genetic distance, but both species differed greatly in morphological characteristics.These results showed that the genetic relationships among nine Rhododendron species, determined by AFLP markers, were partially related to their taxonomic position, geography distribution and morphological classification. The present study will benefit the identification and conservation of Rhododendron, and the development of new Rhododendron cultivar. (author)
Advances in high-power rf amplifiers
International Nuclear Information System (INIS)
Tallerico, P.J.
1979-01-01
Several powerful accelerators and storage rings are being considered that will require tens or even hundreds of megawatts of continuous rf power. The economics of such large machines can be dictated by the cost and efficiency of the rf amplifiers. The overall design and performance of such narrow-band amplifiers, operating in the 50- to 1500-MHz region, are being theoretically studied as a function of frequency to determine the optimum rf amplifier output power, gain, efficiency, and dc power requirements. The state of the art for three types of amplifiers (gridded tubes, klystrons, and gyrocons) is considered and the development work necessary to improve each is discussed. The gyrocon is a new device, hence its various embodiments are discussed in detail. The Soviet designs are reviewed and the gyrocon's strengths and weaknesses are compared to other types of microwave amplifiers. The primary advantages of the gyrocon are the very large amount of power available from a single device and the excellent efficiency and stable operation. The klystron however, has much greater gain and is simpler mechanically. At very low frequencies, the small size of the gridded tube makes it the optimum choice for all but the most powerful systems
Gallium nitride based transistors for high-efficiency microwave switch-mode amplifiers
Energy Technology Data Exchange (ETDEWEB)
Maroldt, Stephan
2012-07-01
Highly-efficient switch-mode power amplifiers form key elements in future fully-digital base stations for mobile communication. This novel digital base station concept reduces system energy consumption, complexity, size and costs, while the flexibility in terms of multi-band operation and signal modulation improves. In this work, innovative core circuits for digital high-efficiency class-D and class-S power amplifiers based on gallium nitride (GaN) technology were developed for the application in digital base stations. A combination of optimized GaN devices and improvements in circuit design allow a highly-efficient switch-mode operation at mobile communication frequencies between 0.45 GHz and 2 GHz. Transistor device modeling for switch-mode operation, the simulation environment, and a broadband measurement system were established for the design and evaluation of digital switchmode power amplifiers. The design of broadband core circuits for switch-mode amplifier concepts was analyzed for dual-stage amplifier circuits, using an initial GaN technology with a gate length of 0.25 {mu}m. A speed-enhanced driver stage improved the circuit switching speed sufficiently above 1 GHz. Speed and efficiency of the amplifier core circuits were studied related to transistor parameters like cut-off frequency or gate capacitance. A reduced gate length was found to improve the switching speed, while a lower on-resistance allows the reduction of the inherent static losses of the GaN-based switches. Apart from this, the restriction of a 50 Ohm environment was found to be a major output power and switching speed limitation, due to a poor switching drive capability of the input capacitance of the GaN circuit. Finally, the optimized transistor and circuit design with an output gate width of 1.2 mm were effectively implemented in the given environment for an operation up to 2 GHz with a high drain efficiency of >65% and a digital output power of 5 W. A maximum output power of 9.7 W and a
Filtering high-throughput protein-protein interaction data using a combination of genomic features
Directory of Open Access Journals (Sweden)
Patil Ashwini
2005-04-01
Full Text Available Abstract Background Protein-protein interaction data used in the creation or prediction of molecular networks is usually obtained from large scale or high-throughput experiments. This experimental data is liable to contain a large number of spurious interactions. Hence, there is a need to validate the interactions and filter out the incorrect data before using them in prediction studies. Results In this study, we use a combination of 3 genomic features – structurally known interacting Pfam domains, Gene Ontology annotations and sequence homology – as a means to assign reliability to the protein-protein interactions in Saccharomyces cerevisiae determined by high-throughput experiments. Using Bayesian network approaches, we show that protein-protein interactions from high-throughput data supported by one or more genomic features have a higher likelihood ratio and hence are more likely to be real interactions. Our method has a high sensitivity (90% and good specificity (63%. We show that 56% of the interactions from high-throughput experiments in Saccharomyces cerevisiae have high reliability. We use the method to estimate the number of true interactions in the high-throughput protein-protein interaction data sets in Caenorhabditis elegans, Drosophila melanogaster and Homo sapiens to be 27%, 18% and 68% respectively. Our results are available for searching and downloading at http://helix.protein.osaka-u.ac.jp/htp/. Conclusion A combination of genomic features that include sequence, structure and annotation information is a good predictor of true interactions in large and noisy high-throughput data sets. The method has a very high sensitivity and good specificity and can be used to assign a likelihood ratio, corresponding to the reliability, to each interaction.
Metagenome Fragment Classification Using -Mer Frequency Profiles
Directory of Open Access Journals (Sweden)
Gail Rosen
2008-01-01
Full Text Available A vast amount of microbial sequencing data is being generated through large-scale projects in ecology, agriculture, and human health. Efficient high-throughput methods are needed to analyze the mass amounts of metagenomic data, all DNA present in an environmental sample. A major obstacle in metagenomics is the inability to obtain accuracy using technology that yields short reads. We construct the unique -mer frequency profiles of 635 microbial genomes publicly available as of February 2008. These profiles are used to train a naive Bayes classifier (NBC that can be used to identify the genome of any fragment. We show that our method is comparable to BLAST for small 25 bp fragments but does not have the ambiguity of BLAST's tied top scores. We demonstrate that this approach is scalable to identify any fragment from hundreds of genomes. It also performs quite well at the strain, species, and genera levels and achieves strain resolution despite classifying ubiquitous genomic fragments (gene and nongene regions. Cross-validation analysis demonstrates that species-accuracy achieves 90% for highly-represented species containing an average of 8 strains. We demonstrate that such a tool can be used on the Sargasso Sea dataset, and our analysis shows that NBC can be further enhanced.
High brightness photonic lantern kW-class amplifier
Montoya, Juan; Hwang, Chris; Aleshire, Chris; Reed, Patricia; Martz, Dale; Riley, Mike; Trainor, Michael; Belley, Catherine; Shaw, Scot; Fan, T. Y.; Ripin, Dan
2018-02-01
Pump-limited kW-class operation in a multimode fiber amplifier using adaptive mode control was achieved. A photonic lantern front end was used to inject an arbitrary superposition of modes on the input to a kW-class fiber amplifier to achieve a nearly diffraction-limited output. We report on the adaptive spatial mode control architecture which allows for compensating transverse-mode disturbances at high power. We also describe the advantages of adaptive spatial mode control for optical phased array systems. In particular, we show that the additional degrees of freedom allow for broader steering and improved atmospheric turbulence compensation relative to piston-only optical phased arrays.
Directory of Open Access Journals (Sweden)
Trout-Yakel Keri M
2010-02-01
Full Text Available Abstract Background A large, multi-province outbreak of listeriosis associated with ready-to-eat meat products contaminated with Listeria monocytogenes serotype 1/2a occurred in Canada in 2008. Subtyping of outbreak-associated isolates using pulsed-field gel electrophoresis (PFGE revealed two similar but distinct AscI PFGE patterns. High-throughput pyrosequencing of two L. monocytogenes isolates was used to rapidly provide the genome sequence of the primary outbreak strain and to investigate the extent of genetic diversity associated with a change of a single restriction enzyme fragment during PFGE. Results The chromosomes were collinear, but differences included 28 single nucleotide polymorphisms (SNPs and three indels, including a 33 kbp prophage that accounted for the observed difference in AscI PFGE patterns. The distribution of these traits was assessed within further clinical, environmental and food isolates associated with the outbreak, and this comparison indicated that three distinct, but highly related strains may have been involved in this nationwide outbreak. Notably, these two isolates were found to harbor a 50 kbp putative mobile genomic island encoding translocation and efflux functions that has not been observed in other Listeria genomes. Conclusions High-throughput genome sequencing provided a more detailed real-time assessment of genetic traits characteristic of the outbreak strains than could be achieved with routine subtyping methods. This study confirms that the latest generation of DNA sequencing technologies can be applied during high priority public health events, and laboratories need to prepare for this inevitability and assess how to properly analyze and interpret whole genome sequences in the context of molecular epidemiology.
Greenough, Lucia; Schermerhorn, Kelly M; Mazzola, Laurie; Bybee, Joanna; Rivizzigno, Danielle; Cantin, Elizabeth; Slatko, Barton E; Gardner, Andrew F
2016-01-29
Detailed biochemical characterization of nucleic acid enzymes is fundamental to understanding nucleic acid metabolism, genome replication and repair. We report the development of a rapid, high-throughput fluorescence capillary gel electrophoresis method as an alternative to traditional polyacrylamide gel electrophoresis to characterize nucleic acid metabolic enzymes. The principles of assay design described here can be applied to nearly any enzyme system that acts on a fluorescently labeled oligonucleotide substrate. Herein, we describe several assays using this core capillary gel electrophoresis methodology to accelerate study of nucleic acid enzymes. First, assays were designed to examine DNA polymerase activities including nucleotide incorporation kinetics, strand displacement synthesis and 3'-5' exonuclease activity. Next, DNA repair activities of DNA ligase, flap endonuclease and RNase H2 were monitored. In addition, a multicolor assay that uses four different fluorescently labeled substrates in a single reaction was implemented to characterize GAN nuclease specificity. Finally, a dual-color fluorescence assay to monitor coupled enzyme reactions during Okazaki fragment maturation is described. These assays serve as a template to guide further technical development for enzyme characterization or nucleoside and non-nucleoside inhibitor screening in a high-throughput manner. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
Kageyama, Shinji; Shinmura, Kazuya; Yamamoto, Hiroko; Goto, Masanori; Suzuki, Koichi; Tanioka, Fumihiko; Tsuneyoshi, Toshihiro; Sugimura, Haruhiko
2008-04-01
The PCR-based DNA fingerprinting method called the methylation-sensitive amplified fragment length polymorphism (MS-AFLP) analysis is used for genome-wide scanning of methylation status. In this study, we developed a method of fluorescence-labeled MS-AFLP (FL-MS-AFLP) analysis by applying a fluorescence-labeled primer and fluorescence-detecting electrophoresis apparatus to the existing method of MS-AFLP analysis. The FL-MS-AFLP analysis enables quantitative evaluation of more than 350 random CpG loci per run. It was shown to allow evaluation of the differences in methylation level of blood DNA of gastric cancer patients and evaluation of hypermethylation and hypomethylation in DNA from gastric cancer tissue in comparison with adjacent non-cancerous tissue.
A broadband high-efficiency Doherty power amplifier using symmetrical devices
Cheng, Zhiqun; Zhang, Ming; Li, Jiangzhou; Liu, Guohua
2018-04-01
This paper proposes a method for broadband and high-efficiency amplification of Doherty power amplifier (DPA) using symmetric devices. In order to achieve the perfect load modulation, the carrier amplifier output circuit total power length is designed to odd multiple of 90°, and the peak amplifier output total power length is designed to even multiple of 180°. The proposed method is demonstrated by designing a broadband high-efficiency DPA using identical 10-W packaged GaN HEMT devices. Measurement results show that over 51% drain efficiency is achieved at 6-dB back-off power, over the frequency band of 1.9–2.4 GHz. Project supported by the National Natural Science Foundation of China (No. 60123456), the Zhejiang Provincial Natural Science Foundation of China (No. LZ16F010001), and the Zhejiang Provincial Public Technology Research Project (No. 2016C31070).
MIPHENO: Data normalization for high throughput metabolic analysis.
High throughput methodologies such as microarrays, mass spectrometry and plate-based small molecule screens are increasingly used to facilitate discoveries from gene function to drug candidate identification. These large-scale experiments are typically carried out over the course...
A high efficiency PWM CMOS class-D audio power amplifier
Energy Technology Data Exchange (ETDEWEB)
Zhu Zhangming; Liu Lianxi; Yang Yintang [Institute of Microelectronics, Xidian University, Xi' an 710071 (China); Lei Han, E-mail: zmyh@263.ne [Xi' an Power-Rail Micro Co., Ltd, Xi' an 710075 (China)
2009-02-15
Based on the difference close-loop feedback technique and the difference pre-amp, a high efficiency PWM CMOS class-D audio power amplifier is proposed. A rail-to-rail PWM comparator with window function has been embedded in the class-D audio power amplifier. Design results based on the CSMC 0.5 mum CMOS process show that the max efficiency is 90%, the PSRR is -75 dB, the power supply voltage range is 2.5-5.5 V, the THD+N in 1 kHz input frequency is less than 0.20%, the quiescent current in no load is 2.8 mA, and the shutdown current is 0.5 muA. The active area of the class-D audio power amplifier is about 1.47 x 1.52 mm{sup 2}. With the good performance, the class-D audio power amplifier can be applied to several audio power systems.
A high efficiency PWM CMOS class-D audio power amplifier
International Nuclear Information System (INIS)
Zhu Zhangming; Liu Lianxi; Yang Yintang; Lei Han
2009-01-01
Based on the difference close-loop feedback technique and the difference pre-amp, a high efficiency PWM CMOS class-D audio power amplifier is proposed. A rail-to-rail PWM comparator with window function has been embedded in the class-D audio power amplifier. Design results based on the CSMC 0.5 μm CMOS process show that the max efficiency is 90%, the PSRR is -75 dB, the power supply voltage range is 2.5-5.5 V, the THD+N in 1 kHz input frequency is less than 0.20%, the quiescent current in no load is 2.8 mA, and the shutdown current is 0.5 μA. The active area of the class-D audio power amplifier is about 1.47 x 1.52 mm 2 . With the good performance, the class-D audio power amplifier can be applied to several audio power systems.
A high efficiency PWM CMOS class-D audio power amplifier
Zhangming, Zhu; Lianxi, Liu; Yintang, Yang; Han, Lei
2009-02-01
Based on the difference close-loop feedback technique and the difference pre-amp, a high efficiency PWM CMOS class-D audio power amplifier is proposed. A rail-to-rail PWM comparator with window function has been embedded in the class-D audio power amplifier. Design results based on the CSMC 0.5 μm CMOS process show that the max efficiency is 90%, the PSRR is -75 dB, the power supply voltage range is 2.5-5.5 V, the THD+N in 1 kHz input frequency is less than 0.20%, the quiescent current in no load is 2.8 mA, and the shutdown current is 0.5 μA. The active area of the class-D audio power amplifier is about 1.47 × 1.52 mm2. With the good performance, the class-D audio power amplifier can be applied to several audio power systems.
García-Pereira, M J; Quesada, H; Caballero, A; Carvajal-Rodríguez, A
2012-05-01
Amplified fragment length polymorphisms (AFLPs) are widely used for phylogenetic inference especially in non-model species. Frequently, trees obtained with other nuclear or mitochondrial markers or with morphological information need additional resolution, increased branch support, or independent data sources (i.e. unlinked loci). In such cases, the use of AFLPs is a quick and cheap option. Computer simulation has shown that dominant AFLP markers lead to less accurate tree topologies than bi-allelic codominant markers such as SNPs, but this difference becomes negligible for shallow trees when using AFLP data sets that include a sufficiently large number of characters. Thus, determining how many AFLP characters are required to recover a given phylogeny is a key issue regarding the appropriateness of AFLPs for phylogenetic reconstruction. Here, we present a user-friendly, java-based graphical interface, AFLPMax, which executes an automatic pipeline of different programs providing the user with the optimal number of AFLP characters needed to recover a given phylogeny with high accuracy and support. Executables for Windows, linux and MacOS X operating systems, source code and user manual are available from: http://webs.uvigo.es/acraaj/AFLPMax.htm. © 2012 Blackwell Publishing Ltd.
High-Throughput Thermodynamic Modeling and Uncertainty Quantification for ICME
Otis, Richard A.; Liu, Zi-Kui
2017-05-01
One foundational component of the integrated computational materials engineering (ICME) and Materials Genome Initiative is the computational thermodynamics based on the calculation of phase diagrams (CALPHAD) method. The CALPHAD method pioneered by Kaufman has enabled the development of thermodynamic, atomic mobility, and molar volume databases of individual phases in the full space of temperature, composition, and sometimes pressure for technologically important multicomponent engineering materials, along with sophisticated computational tools for using the databases. In this article, our recent efforts will be presented in terms of developing new computational tools for high-throughput modeling and uncertainty quantification based on high-throughput, first-principles calculations and the CALPHAD method along with their potential propagations to downstream ICME modeling and simulations.
Controlling high-throughput manufacturing at the nano-scale
Cooper, Khershed P.
2013-09-01
Interest in nano-scale manufacturing research and development is growing. The reason is to accelerate the translation of discoveries and inventions of nanoscience and nanotechnology into products that would benefit industry, economy and society. Ongoing research in nanomanufacturing is focused primarily on developing novel nanofabrication techniques for a variety of applications—materials, energy, electronics, photonics, biomedical, etc. Our goal is to foster the development of high-throughput methods of fabricating nano-enabled products. Large-area parallel processing and highspeed continuous processing are high-throughput means for mass production. An example of large-area processing is step-and-repeat nanoimprinting, by which nanostructures are reproduced again and again over a large area, such as a 12 in wafer. Roll-to-roll processing is an example of continuous processing, by which it is possible to print and imprint multi-level nanostructures and nanodevices on a moving flexible substrate. The big pay-off is high-volume production and low unit cost. However, the anticipated cost benefits can only be realized if the increased production rate is accompanied by high yields of high quality products. To ensure product quality, we need to design and construct manufacturing systems such that the processes can be closely monitored and controlled. One approach is to bring cyber-physical systems (CPS) concepts to nanomanufacturing. CPS involves the control of a physical system such as manufacturing through modeling, computation, communication and control. Such a closely coupled system will involve in-situ metrology and closed-loop control of the physical processes guided by physics-based models and driven by appropriate instrumentation, sensing and actuation. This paper will discuss these ideas in the context of controlling high-throughput manufacturing at the nano-scale.
Göth, Melanie; Badock, Volker; Weiske, Jörg; Pagel, Kevin; Kuropka, Benno
2017-08-08
Fragment-based screening presents a promising alternative to high-throughput screening and has gained great attention in recent years. So far, only a few studies have discussed mass spectrometry as a screening technology for fragments. Herein, we report the application of native electrospray ionization mass spectrometry (MS) for screening defined sets of fragments against four different target proteins. Fragments were selected from a primary screening conducted with a thermal shift assay (TSA) and represented different binding categories. Our data indicated that, beside specific complex formation, many fragments show extensive multiple binding and also charge-state shifts. Both of these factors complicate automated data analysis and decrease the attractiveness of native MS as a primary screening tool for fragments. A comparison of the hits identified by native MS and TSA showed good agreement for two of the proteins. Furthermore, we discuss general challenges, including the determination of an optimal fragment concentration and the question of how to rank fragment hits according to their affinity. In conclusion, we consider native MS to be a highly valuable tool for the validation and deeper investigation of promising fragment hits rather than a method for primary screening. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
High-Throughput Analysis and Automation for Glycomics Studies
Shubhakar, A.; Reiding, K.R.; Gardner, R.A.; Spencer, D.I.R.; Fernandes, D.L.; Wuhrer, M.
2015-01-01
This review covers advances in analytical technologies for high-throughput (HTP) glycomics. Our focus is on structural studies of glycoprotein glycosylation to support biopharmaceutical realization and the discovery of glycan biomarkers for human disease. For biopharmaceuticals, there is increasing
High-Throughput Cloning and Expression Library Creation for Functional Proteomics
Festa, Fernanda; Steel, Jason; Bian, Xiaofang; Labaer, Joshua
2013-01-01
The study of protein function usually requires the use of a cloned version of the gene for protein expression and functional assays. This strategy is particular important when the information available regarding function is limited. The functional characterization of the thousands of newly identified proteins revealed by genomics requires faster methods than traditional single gene experiments, creating the need for fast, flexible and reliable cloning systems. These collections of open reading frame (ORF) clones can be coupled with high-throughput proteomics platforms, such as protein microarrays and cell-based assays, to answer biological questions. In this tutorial we provide the background for DNA cloning, discuss the major high-throughput cloning systems (Gateway® Technology, Flexi® Vector Systems, and Creator™ DNA Cloning System) and compare them side-by-side. We also report an example of high-throughput cloning study and its application in functional proteomics. This Tutorial is part of the International Proteomics Tutorial Programme (IPTP12). Details can be found at http://www.proteomicstutorials.org. PMID:23457047
High-throughput bioinformatics with the Cyrille2 pipeline system
Directory of Open Access Journals (Sweden)
de Groot Joost CW
2008-02-01
Full Text Available Abstract Background Modern omics research involves the application of high-throughput technologies that generate vast volumes of data. These data need to be pre-processed, analyzed and integrated with existing knowledge through the use of diverse sets of software tools, models and databases. The analyses are often interdependent and chained together to form complex workflows or pipelines. Given the volume of the data used and the multitude of computational resources available, specialized pipeline software is required to make high-throughput analysis of large-scale omics datasets feasible. Results We have developed a generic pipeline system called Cyrille2. The system is modular in design and consists of three functionally distinct parts: 1 a web based, graphical user interface (GUI that enables a pipeline operator to manage the system; 2 the Scheduler, which forms the functional core of the system and which tracks what data enters the system and determines what jobs must be scheduled for execution, and; 3 the Executor, which searches for scheduled jobs and executes these on a compute cluster. Conclusion The Cyrille2 system is an extensible, modular system, implementing the stated requirements. Cyrille2 enables easy creation and execution of high throughput, flexible bioinformatics pipelines.
Fragment-based screening by protein crystallography: successes and pitfalls.
Chilingaryan, Zorik; Yin, Zhou; Oakley, Aaron J
2012-10-08
Fragment-based drug discovery (FBDD) concerns the screening of low-molecular weight compounds against macromolecular targets of clinical relevance. These compounds act as starting points for the development of drugs. FBDD has evolved and grown in popularity over the past 15 years. In this paper, the rationale and technology behind the use of X-ray crystallography in fragment based screening (FBS) will be described, including fragment library design and use of synchrotron radiation and robotics for high-throughput X-ray data collection. Some recent uses of crystallography in FBS will be described in detail, including interrogation of the drug targets β-secretase, phenylethanolamine N-methyltransferase, phosphodiesterase 4A and Hsp90. These examples provide illustrations of projects where crystallography is straightforward or difficult, and where other screening methods can help overcome the limitations of crystallography necessitated by diffraction quality.
Fragment-Based Screening by Protein Crystallography: Successes and Pitfalls
Directory of Open Access Journals (Sweden)
Aaron J. Oakley
2012-10-01
Full Text Available Fragment-based drug discovery (FBDD concerns the screening of low-molecular weight compounds against macromolecular targets of clinical relevance. These compounds act as starting points for the development of drugs. FBDD has evolved and grown in popularity over the past 15 years. In this paper, the rationale and technology behind the use of X-ray crystallography in fragment based screening (FBS will be described, including fragment library design and use of synchrotron radiation and robotics for high-throughput X-ray data collection. Some recent uses of crystallography in FBS will be described in detail, including interrogation of the drug targets β-secretase, phenylethanolamine N-methyltransferase, phosphodiesterase 4A and Hsp90. These examples provide illustrations of projects where crystallography is straightforward or difficult, and where other screening methods can help overcome the limitations of crystallography necessitated by diffraction quality.
Ultrafast disk lasers and amplifiers
Sutter, Dirk H.; Kleinbauer, Jochen; Bauer, Dominik; Wolf, Martin; Tan, Chuong; Gebs, Raphael; Budnicki, Aleksander; Wagenblast, Philipp; Weiler, Sascha
2012-03-01
Disk lasers with multi-kW continuous wave (CW) output power are widely used in manufacturing, primarily for cutting and welding applications, notably in the automotive industry. The ytterbium disk technology combines high power (average and/or peak power), excellent beam quality, high efficiency, and high reliability with low investment and operating costs. Fundamental mode picosecond disk lasers are well established in micro machining at high throughput and perfect precision. Following the world's first market introduction of industrial grade 50 W picosecond lasers (TruMicro 5050) at the Photonics West 2008, the second generation of the TruMicro series 5000 now provides twice the average power (100 W at 1030 nm, or 60 W frequency doubled, green output) at a significantly reduced footprint. Mode-locked disk oscillators achieve by far the highest average power of any unamplified lasers, significantly exceeding the 100 W level in laboratory set-ups. With robust long resonators their multi-microjoule pulse energies begin to compete with typical ultrafast amplifiers. In addition, significant interest in disk technology has recently come from the extreme light laser community, aiming for ultra-high peak powers of petawatts and beyond.
Study of a high-order-mode gyrotron traveling-wave amplifier
International Nuclear Information System (INIS)
Chiu, C. C.; Tsai, C. Y.; Kao, S. H.; Chu, K. R.; Barnett, L. R.; Luhmann, N. C. Jr.
2010-01-01
Physics and performance issues of a TE 01 -mode gyrotron traveling-wave amplifier are studied in theory. For a high order mode, absolute instabilities on neighboring modes at the fundamental and higher cyclotron harmonic frequencies impose severe constraints to the device capability. Methods for their stabilization are outlined, on the basis of which the performance characteristics are examined in a multidimensional parameter space under the marginal stability criterion. The results demonstrate the viability of a high-order-mode traveling-wave amplifier and provide a roadmap for design tradeoffs among power, bandwidth, and efficiency. General trends are observed and illustrated with specific examples.
Fragger: a protein fragment picker for structural queries [version 2; referees: 2 approved
Directory of Open Access Journals (Sweden)
Francois Berenger
2018-04-01
Full Text Available Protein modeling and design activities often require querying the Protein Data Bank (PDB with a structural fragment, possibly containing gaps. For some applications, it is preferable to work on a specific subset of the PDB or with unpublished structures. These requirements, along with specific user needs, motivated the creation of a new software to manage and query 3D protein fragments. Fragger is a protein fragment picker that allows protein fragment databases to be created and queried. All fragment lengths are supported and any set of PDB files can be used to create a database. Fragger can efficiently search a fragment database with a query fragment and a distance threshold. Matching fragments are ranked by distance to the query. The query fragment can have structural gaps and the allowed amino acid sequences matching a query can be constrained via a regular expression of one-letter amino acid codes. Fragger also incorporates a tool to compute the backbone RMSD of one versus many fragments in high throughput. Fragger should be useful for protein design, loop grafting and related structural bioinformatics tasks.
High throughput materials research and development for lithium ion batteries
Directory of Open Access Journals (Sweden)
Parker Liu
2017-09-01
Full Text Available Development of next generation batteries requires a breakthrough in materials. Traditional one-by-one method, which is suitable for synthesizing large number of sing-composition material, is time-consuming and costly. High throughput and combinatorial experimentation, is an effective method to synthesize and characterize huge amount of materials over a broader compositional region in a short time, which enables to greatly speed up the discovery and optimization of materials with lower cost. In this work, high throughput and combinatorial materials synthesis technologies for lithium ion battery research are discussed, and our efforts on developing such instrumentations are introduced.
Towards sensitive, high-throughput, biomolecular assays based on fluorescence lifetime
Ioanna Skilitsi, Anastasia; Turko, Timothé; Cianfarani, Damien; Barre, Sophie; Uhring, Wilfried; Hassiepen, Ulrich; Léonard, Jérémie
2017-09-01
Time-resolved fluorescence detection for robust sensing of biomolecular interactions is developed by implementing time-correlated single photon counting in high-throughput conditions. Droplet microfluidics is used as a promising platform for the very fast handling of low-volume samples. We illustrate the potential of this very sensitive and cost-effective technology in the context of an enzymatic activity assay based on fluorescently-labeled biomolecules. Fluorescence lifetime detection by time-correlated single photon counting is shown to enable reliable discrimination between positive and negative control samples at a throughput as high as several hundred samples per second.
A high-efficiency superconductor distributed amplifier
Energy Technology Data Exchange (ETDEWEB)
Herr, Q P, E-mail: quentin.herr@ngc.co [Northrop Grumman Corporation, 7323 Aviation Boulevard, Baltimore, MD 21240 (United States)
2010-02-15
A superconductor output amplifier that converts single-flux-quantum signals to a non-return-to-zero pattern is reported using a twelve-stage distributed amplifier configuration. The output amplitude is measured to be 1.75 mV over a wide bias current range of {+-} 12%. The bit error rate is measured using a Delta-Sigma data pattern to be less than 1 x 10{sup -9} at 10 Gb s{sup -1} per channel. Analysis of the eye diagram suggests that the actual bit error rate may be much lower. The amplifier has power efficiency of 12% neglecting the termination resistor, which may be eliminated from the circuit with a small modification. (rapid communication)
DEFF Research Database (Denmark)
Bohmann, Kristine; Monadjem, Ara; Noer, Christina Lehmkuhl
2011-01-01
Given the diversity of prey consumed by insectivorous bats, it is difficult to discern the composition of their diet using morphological or conventional PCR-based analyses of their faeces. We demonstrate the use of a powerful alternate tool, the use of the Roche FLX sequencing platform to deep......-sequence uniquely 5′ tagged insect-generic barcode cytochrome c oxidase I (COI) fragments, that were PCR amplified from faecal pellets of two free-tailed bat species Chaerephon pumilus and Mops condylurus (family: Molossidae). Although the analyses were challenged by the paucity of southern African insect COI...
High-throughput cloning and expression in recalcitrant bacteria
Geertsma, Eric R.; Poolman, Bert
We developed a generic method for high-throughput cloning in bacteria that are less amenable to conventional DNA manipulations. The method involves ligation-independent cloning in an intermediary Escherichia coli vector, which is rapidly converted via vector-backbone exchange (VBEx) into an
A high-throughput, multi-channel photon-counting detector with picosecond timing
Lapington, J. S.; Fraser, G. W.; Miller, G. M.; Ashton, T. J. R.; Jarron, P.; Despeisse, M.; Powolny, F.; Howorth, J.; Milnes, J.
2009-06-01
High-throughput photon counting with high time resolution is a niche application area where vacuum tubes can still outperform solid-state devices. Applications in the life sciences utilizing time-resolved spectroscopies, particularly in the growing field of proteomics, will benefit greatly from performance enhancements in event timing and detector throughput. The HiContent project is a collaboration between the University of Leicester Space Research Centre, the Microelectronics Group at CERN, Photek Ltd., and end-users at the Gray Cancer Institute and the University of Manchester. The goal is to develop a detector system specifically designed for optical proteomics, capable of high content (multi-parametric) analysis at high throughput. The HiContent detector system is being developed to exploit this niche market. It combines multi-channel, high time resolution photon counting in a single miniaturized detector system with integrated electronics. The combination of enabling technologies; small pore microchannel plate devices with very high time resolution, and high-speed multi-channel ASIC electronics developed for the LHC at CERN, provides the necessary building blocks for a high-throughput detector system with up to 1024 parallel counting channels and 20 ps time resolution. We describe the detector and electronic design, discuss the current status of the HiContent project and present the results from a 64-channel prototype system. In the absence of an operational detector, we present measurements of the electronics performance using a pulse generator to simulate detector events. Event timing results from the NINO high-speed front-end ASIC captured using a fast digital oscilloscope are compared with data taken with the proposed electronic configuration which uses the multi-channel HPTDC timing ASIC.
A high-throughput, multi-channel photon-counting detector with picosecond timing
International Nuclear Information System (INIS)
Lapington, J.S.; Fraser, G.W.; Miller, G.M.; Ashton, T.J.R.; Jarron, P.; Despeisse, M.; Powolny, F.; Howorth, J.; Milnes, J.
2009-01-01
High-throughput photon counting with high time resolution is a niche application area where vacuum tubes can still outperform solid-state devices. Applications in the life sciences utilizing time-resolved spectroscopies, particularly in the growing field of proteomics, will benefit greatly from performance enhancements in event timing and detector throughput. The HiContent project is a collaboration between the University of Leicester Space Research Centre, the Microelectronics Group at CERN, Photek Ltd., and end-users at the Gray Cancer Institute and the University of Manchester. The goal is to develop a detector system specifically designed for optical proteomics, capable of high content (multi-parametric) analysis at high throughput. The HiContent detector system is being developed to exploit this niche market. It combines multi-channel, high time resolution photon counting in a single miniaturized detector system with integrated electronics. The combination of enabling technologies; small pore microchannel plate devices with very high time resolution, and high-speed multi-channel ASIC electronics developed for the LHC at CERN, provides the necessary building blocks for a high-throughput detector system with up to 1024 parallel counting channels and 20 ps time resolution. We describe the detector and electronic design, discuss the current status of the HiContent project and present the results from a 64-channel prototype system. In the absence of an operational detector, we present measurements of the electronics performance using a pulse generator to simulate detector events. Event timing results from the NINO high-speed front-end ASIC captured using a fast digital oscilloscope are compared with data taken with the proposed electronic configuration which uses the multi-channel HPTDC timing ASIC.
Multi-pass amplifier architecture for high power laser systems
Manes, Kenneth R; Spaeth, Mary L; Erlandson, Alvin C
2014-04-01
A main amplifier system includes a first reflector operable to receive input light through a first aperture and direct the input light along an optical path. The input light is characterized by a first polarization. The main amplifier system also includes a first polarizer operable to reflect light characterized by the first polarization state. The main amplifier system further includes a first and second set of amplifier modules. Each of the first and second set of amplifier modules includes an entrance window, a quarter wave plate, a plurality of amplifier slablets arrayed substantially parallel to each other, and an exit window. The main amplifier system additionally includes a set of mirrors operable to reflect light exiting the first set of amplifier modules to enter the second set of amplifier modules and a second polarizer operable to reflect light characterized by a second polarization state.
Fluorescence-based high-throughput screening of dicer cleavage activity.
Podolska, Katerina; Sedlak, David; Bartunek, Petr; Svoboda, Petr
2014-03-01
Production of small RNAs by ribonuclease III Dicer is a key step in microRNA and RNA interference pathways, which employ Dicer-produced small RNAs as sequence-specific silencing guides. Further studies and manipulations of microRNA and RNA interference pathways would benefit from identification of small-molecule modulators. Here, we report a study of a fluorescence-based in vitro Dicer cleavage assay, which was adapted for high-throughput screening. The kinetic assay can be performed under single-turnover conditions (35 nM substrate and 70 nM Dicer) in a small volume (5 µL), which makes it suitable for high-throughput screening in a 1536-well format. As a proof of principle, a small library of bioactive compounds was analyzed, demonstrating potential of the assay.
Repurposing a Benchtop Centrifuge for High-Throughput Single-Molecule Force Spectroscopy.
Yang, Darren; Wong, Wesley P
2018-01-01
We present high-throughput single-molecule manipulation using a benchtop centrifuge, overcoming limitations common in other single-molecule approaches such as high cost, low throughput, technical difficulty, and strict infrastructure requirements. An inexpensive and compact Centrifuge Force Microscope (CFM) adapted to a commercial centrifuge enables use by nonspecialists, and integration with DNA nanoswitches facilitates both reliable measurements and repeated molecular interrogation. Here, we provide detailed protocols for constructing the CFM, creating DNA nanoswitch samples, and carrying out single-molecule force measurements.
Energy Technology Data Exchange (ETDEWEB)
Weiszmann, R.; Hammonds, A.S.; Celniker, S.E.
2009-04-09
We describe a high-throughput protocol for RNA in situ hybridization (ISH) to Drosophila embryos in a 96-well format. cDNA or genomic DNA templates are amplified by PCR and then digoxigenin-labeled ribonucleotides are incorporated into antisense RNA probes by in vitro transcription. The quality of each probe is evaluated before ISH using a RNA probe quantification (dot blot) assay. RNA probes are hybridized to fixed, mixed-staged Drosophila embryos in 96-well plates. The resulting stained embryos can be examined and photographed immediately or stored at 4oC for later analysis. Starting with fixed, staged embryos, the protocol takes 6 d from probe template production through hybridization. Preparation of fixed embryos requires a minimum of 2 weeks to collect embryos representing all stages. The method has been used to determine the expression patterns of over 6,000 genes throughout embryogenesis.
High efficiency hydrodynamic DNA fragmentation in a bubbling system
Li, Lanhui; Jin, Mingliang; Sun, Chenglong; Wang, Xiaoxue; Xie, Shuting; Zhou, Guofu; Van Den Berg, Albert; Eijkel, Jan C.T.; Shui, Lingling
2017-01-01
DNA fragmentation down to a precise fragment size is important for biomedical applications, disease determination, gene therapy and shotgun sequencing. In this work, a cheap, easy to operate and high efficiency DNA fragmentation method is demonstrated based on hydrodynamic shearing in a bubbling
High power X-band coaxial amplifier experiments
International Nuclear Information System (INIS)
Davis, T.J.; Nation, J.A.
1991-01-01
Studies are continuing on the development of X-band coaxial microwave amplifiers as a source for next generation linear colliders. Coaxial amplifiers employ an annular electron beam propagating between inner and outer drift tube conductors, a configuration which allows large increases in beam current over standard pencil beam amplifiers. Large average diameter systems may still be used without mode competition since TM mode cutoff frequencies are controlled by the separation between conductors. A number of amplifier configurations are being studied, all primed by a driven initial cavity which resonates around 9 GHz. Simple theory of coaxial systems and particle-in-cell simulations are presented, as well as initial experimental results using a 420 keV, 7-8 kA, 9 cm diameter annular beam
Evaluation of Capacity on a High Throughput Vol-oxidizer for Operability
International Nuclear Information System (INIS)
Kim, Young Hwan; Park, Geun Il; Lee, Jung Won; Jung, Jae Hoo; Kim, Ki Ho; Lee, Yong Soon; Lee, Do Youn; Kim, Su Sung
2010-01-01
KAERI is developing a pyro-process. As a piece of process equipment, a high throughput vol-oxidizer which can handle a several tens kg HM/batch was developed to supply U 3 O 8 powders to an electrolytic reduction(ER) reactor. To increase the reduction yield, UO 2 pellets should be converted into uniform powders. In this paper, we aim at the evaluation of a high throughput vol-oxidizer for operability. The evaluation consisted of 3 targets, a mechanical motion test, a heating test and hull separation test. In order to test a high throughput vol-oxidizer, By using a control system, mechanical motion tests of the vol-oxidizer were conducted, and heating rates were analyzed. Also the separation tests of hulls for recovery rate were conducted. The test results of the vol-oxidizer are going to be applied for operability. A study on the characteristics of the volatile gas produced during a vol-oxidation process is not included in this study
Fun with High Throughput Toxicokinetics (CalEPA webinar)
Thousands of chemicals have been profiled by high-throughput screening (HTS) programs such as ToxCast and Tox21. These chemicals are tested in part because there are limited or no data on hazard, exposure, or toxicokinetics (TK). TK models aid in predicting tissue concentrations ...
High Power Narrow Linewidth 1.26 Micron Ho-Doped Fiber Amplifier, Phase II
National Aeronautics and Space Administration — This proposal is for the development of an innovative, high power, and extremely reliable 1.26-micron Ho-doped fluoride fiber amplifier. The proposed fiber amplifier...
High Power Narrow Linewidth 1.26 Micron Ho-Doped Fiber Amplifier, Phase I
National Aeronautics and Space Administration — This proposal is for the development of an innovative, high power, and extremely reliable 1.26-micron Ho-doped fluoride fiber amplifier. The proposed fiber amplifier...
Energy Technology Data Exchange (ETDEWEB)
Fujiwara, Kazuhiro; Tanaka, Shinji; Otsuka, Makiko; Ichimura, Naoya [Lansai Research Institute, Kyoto (Japan); Yonebayashi, Hideharu [Japan National Oil Corp., Chiba (Japan); Hong, Chengxie; Enomoto, Heiji [Tohoku University, Miyagi (Japan)
1999-09-01
Evaluation of effectiveness of restriction fragment length polymorphism (RFLP) analysis of the 16S rRNA gene of microorganisms injected into an oil reservoir, for monitoring their levels over time, was conducted. Two microorganisms, enterobacter cloacae TRC-322 and Bacillus licheniformis TRC-18-2-a, were focused in this paper among the microorganisms selected for injection, and gene fragments of the 16S rRNA gene of these microorganisms were amplified by polymerase chain reaction (PCP), using one set of universal primers. Samples of the reservoir brine and reservoir rock were obtained; the microorganisms inhabiting in the reservoir were isolated from these samples, and the 16S rRNA gene of these microorganisms was amplified, condition remaining the same. RFLP analysis was performed on the 16S rRNA gene of each of these microorganisms, using restriction endonucleases HhaI, MspI, AluI and TaqI as necessary. Comparison of the resultant rRNA gene fragments, demonstrated that closely-related species displaying RFLP profile similar to that of E. cloacae TRC-322 or B. licheniformis TRC-18-2-a were not among the microorganisms isolated from the reservoir. PCR-RFLP analysis of the 16S rRNA gene, using the protocol; presented in this paper, is effective to detect the presence appropriate injecting microorganisms. This method was also effective for studying microorganisms isolated from the reservoir, which have the ability to grow on a molasses. (author)
High throughput experimentation for the discovery of new catalysts
International Nuclear Information System (INIS)
Thomson, S.; Hoffmann, C.; Johann, T.; Wolf, A.; Schmidt, H.-W.; Farrusseng, D.; Schueth, F.
2002-01-01
Full text: The use of combinatorial chemistry to obtain new materials has been developed extensively by the pharmaceutical and biochemical industries, but such approaches have been slow to impact on the field of heterogeneous catalysis. The reasons for this lie in with difficulties associated in the synthesis, characterisation and determination of catalytic properties of such materials. In many synthetic and catalytic reactions, the conditions used are difficult to emulate using High Throughput Experimentation (HTE). Furthermore, the ability to screen these catalysts simultaneously in real time, requires the development and/or modification of characterisation methods. Clearly, there is a need for both high throughput synthesis and screening of new and novel reactions, and we describe several new concepts that help to achieve these goals. Although such problems have impeded the development of combinatorial catalysis, the fact remains that many highly attractive processes still exist for which no suitable catalysts have been developed. The ability to decrease the tiFme needed to evaluate catalyst is therefore essential and this makes the use of high throughput techniques highly desirable. In this presentation we will describe the synthesis, catalytic testing, and novel screening methods developed at the Max Planck Institute. Automated synthesis procedures, performed by the use of a modified Gilson pipette robot, will be described, as will the development of two 16 and 49 sample fixed bed reactors and two 25 and 29 sample three phase reactors for catalytic testing. We will also present new techniques for the characterisation of catalysts and catalytic products using standard IR microscopy and infrared focal plane array detection, respectively
Wang, Youwei; Zhang, Wenqing; Chen, Lidong; Shi, Siqi; Liu, Jianjun
2017-12-01
Li-ion batteries are a key technology for addressing the global challenge of clean renewable energy and environment pollution. Their contemporary applications, for portable electronic devices, electric vehicles, and large-scale power grids, stimulate the development of high-performance battery materials with high energy density, high power, good safety, and long lifetime. High-throughput calculations provide a practical strategy to discover new battery materials and optimize currently known material performances. Most cathode materials screened by the previous high-throughput calculations cannot meet the requirement of practical applications because only capacity, voltage and volume change of bulk were considered. It is important to include more structure-property relationships, such as point defects, surface and interface, doping and metal-mixture and nanosize effects, in high-throughput calculations. In this review, we established quantitative description of structure-property relationships in Li-ion battery materials by the intrinsic bulk parameters, which can be applied in future high-throughput calculations to screen Li-ion battery materials. Based on these parameterized structure-property relationships, a possible high-throughput computational screening flow path is proposed to obtain high-performance battery materials.
Time of flight secondary ion mass spectrometry: A powerful high throughput screening tool
International Nuclear Information System (INIS)
Smentkowski, Vincent S.; Ostrowski, Sara G.
2007-01-01
Combinatorial materials libraries are becoming more complicated; successful screening of these libraries requires the development of new high throughput screening methodologies. Time of flight secondary ion mass spectrometry (ToF-SIMS) is a surface analytical technique that is able to detect and image all elements (including hydrogen which is problematic for many other analysis instruments) and molecular fragments, with high mass resolution, during a single measurement. Commercial ToF-SIMS instruments can image 500 μm areas by rastering the primary ion beam over the region of interest. In this work, we will show that large area analysis can be performed, in one single measurement, by rastering the sample under the ion beam. We show that an entire 70 mm diameter wafer can be imaged in less than 90 min using ToF-SIMS stage (macro)rastering techniques. ToF-SIMS data sets contain a wealth of information since an entire high mass resolution mass spectrum is saved at each pixel in an ion image. Multivariate statistical analysis (MVSA) tools are being used in the ToF-SIMS community to assist with data interpretation; we will demonstrate that MVSA tools provide details that were not obtained using manual (univariate) analysis
High efficiency RF amplifier development over wide dynamic range for accelerator application
Mishra, Jitendra Kumar; Ramarao, B. V.; Pande, Manjiri M.; Joshi, Gopal; Sharma, Archana; Singh, Pitamber
2017-10-01
Superconducting (SC) cavities in an accelerating section are designed to have the same geometrical velocity factor (βg). For these cavities, Radio Frequency (RF) power needed to accelerate charged particles varies with the particle velocity factor (β). RF power requirement from one cavity to other can vary by 2-5 dB within the accelerating section depending on the energy gain in the cavity and beam current. In this paper, we have presented an idea to improve operating efficiency of the SC RF accelerators using envelope tracking technique. A study on envelope tracking technique without feedback is carried out on a 1 kW, 325 MHz, class B (conduction angle of 180 degrees) tuned load power amplifier (PA). We have derived expressions for the efficiency and power output for tuned load amplifier operating on the envelope tracking technique. From the derived expressions, it is observed that under constant load resistance to the device (MOSFET), optimum amplifier efficiency is invariant whereas output power varies with the square of drain bias voltage. Experimental results on 1 kW PA module show that its optimum efficiency is always greater than 62% with variation less than 5% from mean value over 7 dB dynamic range. Low power amplifier modules are the basic building block for the high power amplifiers. Therefore, results for 1 kW PA modules remain valid for the high power solid state amplifiers built using these PA modules. The SC RF accelerators using these constant efficiency power amplifiers can improve overall accelerator efficiency.
Modeling Steroidogenesis Disruption Using High-Throughput ...
Environmental chemicals can elicit endocrine disruption by altering steroid hormone biosynthesis and metabolism (steroidogenesis) causing adverse reproductive and developmental effects. Historically, a lack of assays resulted in few chemicals having been evaluated for effects on steroidogenesis. The steroidogenic pathway is a series of hydroxylation and dehydrogenation steps carried out by CYP450 and hydroxysteroid dehydrogenase enzymes, yet the only enzyme in the pathway for which a high-throughput screening (HTS) assay has been developed is aromatase (CYP19A1), responsible for the aromatization of androgens to estrogens. Recently, the ToxCast HTS program adapted the OECD validated H295R steroidogenesis assay using human adrenocortical carcinoma cells into a high-throughput model to quantitatively assess the concentration-dependent (0.003-100 µM) effects of chemicals on 10 steroid hormones including progestagens, androgens, estrogens and glucocorticoids. These results, in combination with two CYP19A1 inhibition assays, comprise a large dataset amenable to clustering approaches supporting the identification and characterization of putative mechanisms of action (pMOA) for steroidogenesis disruption. In total, 514 chemicals were tested in all CYP19A1 and steroidogenesis assays. 216 chemicals were identified as CYP19A1 inhibitors in at least one CYP19A1 assay. 208 of these chemicals also altered hormone levels in the H295R assay, suggesting 96% sensitivity in the
Durbin, Kenneth R.; Skinner, Owen S.; Fellers, Ryan T.; Kelleher, Neil L.
2015-05-01
Gaseous fragmentation of intact proteins is multifaceted and can be unpredictable by current theories in the field. Contributing to the complexity is the multitude of precursor ion states and fragmentation channels. Terminal fragment ions can be re-fragmented, yielding product ions containing neither terminus, termed internal fragment ions. In an effort to better understand and capitalize upon this fragmentation process, we collisionally dissociated the high (13+), middle (10+), and low (7+) charge states of electrosprayed ubiquitin ions. Both terminal and internal fragmentation processes were quantified through step-wise increases of voltage potential in the collision cell. An isotope fitting algorithm matched observed product ions to theoretical terminal and internal fragment ions. At optimal energies for internal fragmentation of the 10+, nearly 200 internal fragments were observed; on average each of the 76 residues in ubiquitin was covered by 24.1 internal fragments. A pertinent finding was that formation of internal ions occurs at similar energy thresholds as terminal b- and y-ion types in beam-type activation. This large amount of internal fragmentation is frequently overlooked during top-down mass spectrometry. As such, we present several new approaches to visualize internal fragments through modified graphical fragment maps. With the presented advances of internal fragment ion accounting and visualization, the total percentage of matched fragment ions increased from approximately 40% to over 75% in a typical beam-type MS/MS spectrum. These sequence coverage improvements offer greater characterization potential for whole proteins with no needed experimental changes and could be of large benefit for future high-throughput intact protein analysis.
Anisotropy in highly charged ion induced molecule fragmentation
International Nuclear Information System (INIS)
Juhasz, Z.; Sulik, B.; Fremont, F.; Chesnel, J.Y.; Hajaji, A.
2006-01-01
Complete text of publication follows. Studying fragmentation processes of biologically relevant molecules due to highly charged ion impact is important to understand radiation damage in biological tissues. Energy spectra of the charged molecule fragments may reveal the different fragmentation patterns meanwhile the angular distributions of the fragments characterize the dependence of fragmentation probability on the initial orientation of the molecule. The research to explore the angular distribution of the molecule fragments has only recently been started[1]. In 2006 we performed measurements at ARIBE facility at GANIL, Caen (France), in order to investigate orientation effects in molecule fragmentation. Fragmentation of H 2 O, C 6 H 6 and CH 4 , which represent different level of symmetry, have been studied by 60 keV N 6+ ion impact. Energy spectra of the charged fragments at different observation angles have been taken. As our example spectra show the different protonic peaks can be attributed to different fragmentation processes. Significant anisotropy can be seen in the different processes. The strongest evidence for the anisotropy can be seen in the spectra of C 6 H 6 , where the spectra appear isotropic in almost the whole observed energy range except one peak, which has a strong angular dependence and is maximal around 90 deg. (author)
Towards low-delay and high-throughput cognitive radio vehicular networks
Directory of Open Access Journals (Sweden)
Nada Elgaml
2017-12-01
Full Text Available Cognitive Radio Vehicular Ad-hoc Networks (CR-VANETs exploit cognitive radios to allow vehicles to access the unused channels in their radio environment. Thus, CR-VANETs do not only suffer the traditional CR problems, especially spectrum sensing, but also suffer new challenges due to the highly dynamic nature of VANETs. In this paper, we present a low-delay and high-throughput radio environment assessment scheme for CR-VANETs that can be easily incorporated with the IEEE 802.11p standard developed for VANETs. Simulation results show that the proposed scheme significantly reduces the time to get the radio environment map and increases the CR-VANET throughput.
A DNA fingerprinting procedure for ultra high-throughput genetic analysis of insects.
Schlipalius, D I; Waldron, J; Carroll, B J; Collins, P J; Ebert, P R
2001-12-01
Existing procedures for the generation of polymorphic DNA markers are not optimal for insect studies in which the organisms are often tiny and background molecular information is often non-existent. We have used a new high throughput DNA marker generation protocol called randomly amplified DNA fingerprints (RAF) to analyse the genetic variability in three separate strains of the stored grain pest, Rhyzopertha dominica. This protocol is quick, robust and reliable even though it requires minimal sample preparation, minute amounts of DNA and no prior molecular analysis of the organism. Arbitrarily selected oligonucleotide primers routinely produced approximately 50 scoreable polymorphic DNA markers, between individuals of three independent field isolates of R. dominica. Multivariate cluster analysis using forty-nine arbitrarily selected polymorphisms generated from a single primer reliably separated individuals into three clades corresponding to their geographical origin. The resulting clades were quite distinct, with an average genetic difference of 37.5 +/- 6.0% between clades and of 21.0 +/- 7.1% between individuals within clades. As a prelude to future gene mapping efforts, we have also assessed the performance of RAF under conditions commonly used in gene mapping. In this analysis, fingerprints from pooled DNA samples accurately and reproducibly reflected RAF profiles obtained from individual DNA samples that had been combined to create the bulked samples.
Homologous high-throughput expression and purification of highly conserved E coli proteins
Directory of Open Access Journals (Sweden)
Duchmann Rainer
2007-06-01
Full Text Available Abstract Background Genetic factors and a dysregulated immune response towards commensal bacteria contribute to the pathogenesis of Inflammatory Bowel Disease (IBD. Animal models demonstrated that the normal intestinal flora is crucial for the development of intestinal inflammation. However, due to the complexity of the intestinal flora, it has been difficult to design experiments for detection of proinflammatory bacterial antigen(s involved in the pathogenesis of the disease. Several studies indicated a potential association of E. coli with IBD. In addition, T cell clones of IBD patients were shown to cross react towards antigens from different enteric bacterial species and thus likely responded to conserved bacterial antigens. We therefore chose highly conserved E. coli proteins as candidate antigens for abnormal T cell responses in IBD and used high-throughput techniques for cloning, expression and purification under native conditions of a set of 271 conserved E. coli proteins for downstream immunologic studies. Results As a standardized procedure, genes were PCR amplified and cloned into the expression vector pQTEV2 in order to express proteins N-terminally fused to a seven-histidine-tag. Initial small-scale expression and purification under native conditions by metal chelate affinity chromatography indicated that the vast majority of target proteins were purified in high yields. Targets that revealed low yields after purification probably due to weak solubility were shuttled into Gateway (Invitrogen destination vectors in order to enhance solubility by N-terminal fusion of maltose binding protein (MBP, N-utilizing substance A (NusA, or glutathione S-transferase (GST to the target protein. In addition, recombinant proteins were treated with polymyxin B coated magnetic beads in order to remove lipopolysaccharide (LPS. Thus, 73% of the targeted proteins could be expressed and purified in large-scale to give soluble proteins in the range of 500
High throughput 16S rRNA gene amplicon sequencing
DEFF Research Database (Denmark)
Nierychlo, Marta; Larsen, Poul; Jørgensen, Mads Koustrup
S rRNA gene amplicon sequencing has been developed over the past few years and is now ready to use for more comprehensive studies related to plant operation and optimization thanks to short analysis time, low cost, high throughput, and high taxonomic resolution. In this study we show how 16S r......RNA gene amplicon sequencing can be used to reveal factors of importance for the operation of full-scale nutrient removal plants related to settling problems and floc properties. Using optimized DNA extraction protocols, indexed primers and our in-house Illumina platform, we prepared multiple samples...... be correlated to the presence of the species that are regarded as “strong” and “weak” floc formers. In conclusion, 16S rRNA gene amplicon sequencing provides a high throughput approach for a rapid and cheap community profiling of activated sludge that in combination with multivariate statistics can be used...
Reverse Phase Protein Arrays for High-throughput Toxicity Screening
DEFF Research Database (Denmark)
Pedersen, Marlene Lemvig; Block, Ines; List, Markus
High-throughput screening is extensively applied for identification of drug targets and drug discovery and recently it found entry into toxicity testing. Reverse phase protein arrays (RPPAs) are used widespread for quantification of protein markers. We reasoned that RPPAs also can be utilized...... beneficially in automated high-throughput toxicity testing. An advantage of using RPPAs is that, in addition to the baseline toxicity readout, they allow testing of multiple markers of toxicity, such as inflammatory responses, which do not necessarily cumulate in cell death. We used transfection of si......RNAs with known killing effects as a model system to demonstrate that RPPA-based protein quantification can serve as substitute readout of cell viability, hereby reliably reflecting toxicity. In terms of automation, cell exposure, protein harvest, serial dilution and sample reformatting were performed using...
Development of automatic image analysis methods for high-throughput and high-content screening
Di, Zi
2013-01-01
This thesis focuses on the development of image analysis methods for ultra-high content analysis of high-throughput screens where cellular phenotype responses to various genetic or chemical perturbations that are under investigation. Our primary goal is to deliver efficient and robust image analysis
Quantitative in vitro-to-in vivo extrapolation in a high-throughput environment
International Nuclear Information System (INIS)
Wetmore, Barbara A.
2015-01-01
High-throughput in vitro toxicity screening provides an efficient way to identify potential biological targets for environmental and industrial chemicals while conserving limited testing resources. However, reliance on the nominal chemical concentrations in these in vitro assays as an indicator of bioactivity may misrepresent potential in vivo effects of these chemicals due to differences in clearance, protein binding, bioavailability, and other pharmacokinetic factors. Development of high-throughput in vitro hepatic clearance and protein binding assays and refinement of quantitative in vitro-to-in vivo extrapolation (QIVIVE) methods have provided key tools to predict xenobiotic steady state pharmacokinetics. Using a process known as reverse dosimetry, knowledge of the chemical steady state behavior can be incorporated with HTS data to determine the external in vivo oral exposure needed to achieve internal blood concentrations equivalent to those eliciting bioactivity in the assays. These daily oral doses, known as oral equivalents, can be compared to chronic human exposure estimates to assess whether in vitro bioactivity would be expected at the dose-equivalent level of human exposure. This review will describe the use of QIVIVE methods in a high-throughput environment and the promise they hold in shaping chemical testing priorities and, potentially, high-throughput risk assessment strategies
High peak power picosecond hybrid fiber and solid-state amplifier system
International Nuclear Information System (INIS)
Wushouer, X; Yan, P; Yu, H; Liu, Q; Fu, X; Yan, X; Gong, M
2010-01-01
We report the high peak power picosecond hybrid fiber and solid-state laser amplifier system. The passively mode-locked solid-state seed source produced an average power of 1.8 W with pulse width of 14 ps and repetition rate of 86 MHz. It was directly coupled into the first Yb-doped polarized photonic crystal fiber amplifier stage. To avoid the nonlinear effects in fiber, the output power from the first stage was merely amplified to 24 W with the narrow spectra broadening of 0.21 nm. For the improvement of the peak power, the dual-end pumped composite Nd:YVO 4 amplifier system has been chosen at the second stage. To reduce the serious thermal effect, the thermally bonded composite YVO 4 – Nd:YVO 4 – YVO 4 rod crystal was used as the gain medium. The 53 W TEM 00 mode with the peak power of 40 kW, beam quality of M 2 < 1.15, corresponding to the optical-optical efficiency of 42.4% was obtained at the hybrid amplifier laser system. The system allows using a low power seed source and demonstrates an increase in the peak power beyond a fiber master oscillator power amplifier's (MOPA's) limit
Armour, John A L; Palla, Raquel; Zeeuwen, Patrick L J M; den Heijer, Martin; Schalkwijk, Joost; Hollox, Edward J
2007-01-01
Recent work has demonstrated an unexpected prevalence of copy number variation in the human genome, and has highlighted the part this variation may play in predisposition to common phenotypes. Some important genes vary in number over a high range (e.g. DEFB4, which commonly varies between two and seven copies), and have posed formidable technical challenges for accurate copy number typing, so that there are no simple, cheap, high-throughput approaches suitable for large-scale screening. We have developed a simple comparative PCR method based on dispersed repeat sequences, using a single pair of precisely designed primers to amplify products simultaneously from both test and reference loci, which are subsequently distinguished and quantified via internal sequence differences. We have validated the method for the measurement of copy number at DEFB4 by comparison of results from >800 DNA samples with copy number measurements by MAPH/REDVR, MLPA and array-CGH. The new Paralogue Ratio Test (PRT) method can require as little as 10 ng genomic DNA, appears to be comparable in accuracy to the other methods, and for the first time provides a rapid, simple and inexpensive method for copy number analysis, suitable for application to typing thousands of samples in large case-control association studies.
Directory of Open Access Journals (Sweden)
Richard O'Rorke
Full Text Available The Western Australian rock lobster fishery has been both a highly productive and sustainable fishery. However, a recent dramatic and unexplained decline in post-larval recruitment threatens this sustainability. Our lack of knowledge of key processes in lobster larval ecology, such as their position in the food web, limits our ability to determine what underpins this decline. The present study uses a high-throughput amplicon sequencing approach on DNA obtained from the hepatopancreas of larvae to discover significant prey items. Two short regions of the 18S rRNA gene were amplified under the presence of lobster specific PNA to prevent lobster amplification and to improve prey amplification. In the resulting sequences either little prey was recovered, indicating that the larval gut was empty, or there was a high number of reads originating from multiple zooplankton taxa. The most abundant reads included colonial Radiolaria, Thaliacea, Actinopterygii, Hydrozoa and Sagittoidea, which supports the hypothesis that the larvae feed on multiple groups of mostly transparent gelatinous zooplankton. This hypothesis has prevailed as it has been tentatively inferred from the physiology of larvae, captive feeding trials and co-occurrence in situ. However, these prey have not been observed in the larval gut as traditional microscopic techniques cannot discern between transparent and gelatinous prey items in the gut. High-throughput amplicon sequencing of gut DNA has enabled us to classify these otherwise undetectable prey. The dominance of the colonial radiolarians among the gut contents is intriguing in that this group has been historically difficult to quantify in the water column, which may explain why they have not been connected to larval diet previously. Our results indicate that a PCR based technique is a very successful approach to identify the most abundant taxa in the natural diet of lobster larvae.
International Nuclear Information System (INIS)
Xie, M.; Kim, K.J.
1995-01-01
In a high gain free electron laser amplifier based on Self-Amplified Spontaneous Emission (SASE) the spontaneous radiation generated by an electron beam near the undulator entrance is amplified many orders of magnitude along the undulator. The transverse coherence properties of the amplified radiation depends on both the amplification process and the coherence of the seed radiation (the undulator radiation generated in the first gain length or so). The evolution of the transverse coherence in the amplification process is studied based on the solution of the coupled Maxwell-Vlasov equations including higher order transverse modes. The coherence of the seed radiation is determined by the number of coherent modes in the phase space area of the undulator radiation. We discuss the criterion of transverse coherence and identify governing parameters over a broad range of parameters. In particular we re-examine the well known emittance criterion for the undulator radiation, which states that full transverse coherence is guaranteed if the rms emittance is smaller than the wavelength divided by 4π. It is found that this criterion is modified for SASE because of the different optimization conditions required for the electron beam. Our analysis is a generalization of the previous study by Yu and Krinsky for the case of vanishing emittance with parallel electron beam. Understanding the transverse coherence of SASE is important for the X-ray free electron laser projects now under consideration at SLAC and DESY
Quality control methodology for high-throughput protein-protein interaction screening.
Vazquez, Alexei; Rual, Jean-François; Venkatesan, Kavitha
2011-01-01
Protein-protein interactions are key to many aspects of the cell, including its cytoskeletal structure, the signaling processes in which it is involved, or its metabolism. Failure to form protein complexes or signaling cascades may sometimes translate into pathologic conditions such as cancer or neurodegenerative diseases. The set of all protein interactions between the proteins encoded by an organism constitutes its protein interaction network, representing a scaffold for biological function. Knowing the protein interaction network of an organism, combined with other sources of biological information, can unravel fundamental biological circuits and may help better understand the molecular basics of human diseases. The protein interaction network of an organism can be mapped by combining data obtained from both low-throughput screens, i.e., "one gene at a time" experiments and high-throughput screens, i.e., screens designed to interrogate large sets of proteins at once. In either case, quality controls are required to deal with the inherent imperfect nature of experimental assays. In this chapter, we discuss experimental and statistical methodologies to quantify error rates in high-throughput protein-protein interactions screens.
High-throughput screening to enhance oncolytic virus immunotherapy
Directory of Open Access Journals (Sweden)
Allan KJ
2016-04-01
Full Text Available KJ Allan,1,2 David F Stojdl,1–3 SL Swift1 1Children’s Hospital of Eastern Ontario (CHEO Research Institute, 2Department of Biology, Microbiology and Immunology, 3Department of Pediatrics, University of Ottawa, Ottawa, ON, Canada Abstract: High-throughput screens can rapidly scan and capture large amounts of information across multiple biological parameters. Although many screens have been designed to uncover potential new therapeutic targets capable of crippling viruses that cause disease, there have been relatively few directed at improving the efficacy of viruses that are used to treat disease. Oncolytic viruses (OVs are biotherapeutic agents with an inherent specificity for treating malignant disease. Certain OV platforms – including those based on herpes simplex virus, reovirus, and vaccinia virus – have shown success against solid tumors in advanced clinical trials. Yet, many of these OVs have only undergone minimal engineering to solidify tumor specificity, with few extra modifications to manipulate additional factors. Several aspects of the interaction between an OV and a tumor-bearing host have clear value as targets to improve therapeutic outcomes. At the virus level, these include delivery to the tumor, infectivity, productivity, oncolysis, bystander killing, spread, and persistence. At the host level, these include engaging the immune system and manipulating the tumor microenvironment. Here, we review the chemical- and genome-based high-throughput screens that have been performed to manipulate such parameters during OV infection and analyze their impact on therapeutic efficacy. We further explore emerging themes that represent key areas of focus for future research. Keywords: oncolytic, virus, screen, high-throughput, cancer, chemical, genomic, immunotherapy
High throughput electrophysiology: new perspectives for ion channel drug discovery
DEFF Research Database (Denmark)
Willumsen, Niels J; Bech, Morten; Olesen, Søren-Peter
2003-01-01
Proper function of ion channels is crucial for all living cells. Ion channel dysfunction may lead to a number of diseases, so-called channelopathies, and a number of common diseases, including epilepsy, arrhythmia, and type II diabetes, are primarily treated by drugs that modulate ion channels....... A cornerstone in current drug discovery is high throughput screening assays which allow examination of the activity of specific ion channels though only to a limited extent. Conventional patch clamp remains the sole technique with sufficiently high time resolution and sensitivity required for precise and direct...... characterization of ion channel properties. However, patch clamp is a slow, labor-intensive, and thus expensive, technique. New techniques combining the reliability and high information content of patch clamping with the virtues of high throughput philosophy are emerging and predicted to make a number of ion...
Benet, James
1993-01-01
The final report describes the work performed from 9 Jun. 1992 to 31 Jul. 1993 on the NASA Satellite Communications Application Research (SCAR) Phase 2 program, Efficient High Power, Solid State Amplifier for EHF Communications. The purpose of the program was to demonstrate the feasibility of high-efficiency, high-power, EHF solid state amplifiers that are smaller, lighter, more efficient, and less costly than existing traveling wave tube (TWT) amplifiers by combining the output power from up to several hundred solid state amplifiers using a unique orthomode spatial power combiner (OSPC).
Impact of gain saturation on the mode instability threshold in high-power fiber amplifiers
DEFF Research Database (Denmark)
Hansen, Kristian Rymann; Lægsgaard, Jesper
2014-01-01
We present a coupled-mode model of transverse mode instability in high-power fiber amplifiers, which takes the effect of gain saturation into account. The model provides simple semi-analytical formulas for the mode instability threshold, which are valid also for highly saturated amplifiers...
High throughput screening of starch structures using carbohydrate microarrays
DEFF Research Database (Denmark)
Tanackovic, Vanja; Rydahl, Maja Gro; Pedersen, Henriette Lodberg
2016-01-01
In this study we introduce the starch-recognising carbohydrate binding module family 20 (CBM20) from Aspergillus niger for screening biological variations in starch molecular structure using high throughput carbohydrate microarray technology. Defined linear, branched and phosphorylated...
Achieving high data throughput in research networks
International Nuclear Information System (INIS)
Matthews, W.; Cottrell, L.
2001-01-01
After less than a year of operation, the BaBar experiment at SLAC has collected almost 100 million particle collision events in a database approaching 165TB. Around 20 TB of data has been exported via the Internet to the BaBar regional center at IN2P3 in Lyon, France, and around 40TB of simulated data has been imported from the Lawrence Livermore National Laboratory (LLNL). BaBar collaborators plan to double data collection each year and export a third of the data to IN2P3. So within a few years the SLAC OC3 (155 Mbps) connection will be fully utilized by file transfer to France alone. Upgrades to infrastructure is essential and detailed understanding of performance issues and the requirements for reliable high throughput transfers is critical. In this talk results from active and passive monitoring and direct measurements of throughput will be reviewed. Methods for achieving the ambitious requirements will be discussed
Achieving High Data Throughput in Research Networks
International Nuclear Information System (INIS)
Matthews, W
2004-01-01
After less than a year of operation, the BaBar experiment at SLAC has collected almost 100 million particle collision events in a database approaching 165TB. Around 20 TB of data has been exported via the Internet to the BaBar regional center at IN2P3 in Lyon, France, and around 40TB of simulated data has been imported from the Lawrence Livermore National Laboratory (LLNL). BaBar collaborators plan to double data collection each year and export a third of the data to IN2P3. So within a few years the SLAC OC3 (155Mbps) connection will be fully utilized by file transfer to France alone. Upgrades to infrastructure is essential and detailed understanding of performance issues and the requirements for reliable high throughput transfers is critical. In this talk results from active and passive monitoring and direct measurements of throughput will be reviewed. Methods for achieving the ambitious requirements will be discussed
Very fast, high peak-power, planar triode amplifiers for driving optical gates
International Nuclear Information System (INIS)
Howland, M.M.; Davis, S.J.; Gagnon, W.L.
1979-01-01
Recent extensions of the peak power capabilities of planar triodes have made possible the latter's use as very fast pulse amplifiers, to drive optical gates within high-power Nd:glass laser chains. These pulse amplifiers switch voltages in the 20 kV range with rise times of a few nanoseconds, into crystal optical gates that are essentially capacitive loads. This paper describes a simplified procedure for designing these pulse amplifiers. It further outlines the use of bridged-T constant resistance networks to transform load capacitance into pure resistance, independent of frequency
A priori Considerations When Conducting High-Throughput Amplicon-Based Sequence Analysis
Directory of Open Access Journals (Sweden)
Aditi Sengupta
2016-03-01
Full Text Available Amplicon-based sequencing strategies that include 16S rRNA and functional genes, alongside “meta-omics” analyses of communities of microorganisms, have allowed researchers to pose questions and find answers to “who” is present in the environment and “what” they are doing. Next-generation sequencing approaches that aid microbial ecology studies of agricultural systems are fast gaining popularity among agronomy, crop, soil, and environmental science researchers. Given the rapid development of these high-throughput sequencing techniques, researchers with no prior experience will desire information about the best practices that can be used before actually starting high-throughput amplicon-based sequence analyses. We have outlined items that need to be carefully considered in experimental design, sampling, basic bioinformatics, sequencing of mock communities and negative controls, acquisition of metadata, and in standardization of reaction conditions as per experimental requirements. Not all considerations mentioned here may pertain to a particular study. The overall goal is to inform researchers about considerations that must be taken into account when conducting high-throughput microbial DNA sequencing and sequences analysis.
Directory of Open Access Journals (Sweden)
Yanbin Hou
2016-01-01
Full Text Available Compared with conventional Class-A, Class-B, and Class-AB amplifiers, Class-D amplifier, also known as switching amplifier, employs pulse width modulation (PWM technology and solid-state switching devices, capable of achieving much higher efficiency. However, PWM-based switching amplifier is usually designed for low-voltage application, offering a maximum output voltage of several hundred Volts. Therefore, a step-up transformer is indispensably adopted in PWM-based Class-D amplifier to produce high-voltage output. In this paper, a switching amplifier without step-up transformer is developed based on digital pulse step modulation (PSM and hybrid multilevel converter. Under the control of input signal, cascaded power converters with separate DC sources operate in PSM switch mode to directly generate high-voltage and high-power output. The relevant topological structure, operating principle, and design scheme are introduced. Finally, a prototype system is built, which can provide power up to 1400 Watts and peak voltage up to ±1700 Volts. And the performance, including efficiency, linearity, and distortion, is evaluated by experimental tests.
Development of high sensitivity transimpedance amplifier module for self powered neutron detectors
International Nuclear Information System (INIS)
Khan, T.K.; Tamboli, P.K.; Antony, J.; Balasubramanian, R.; Agilandaeswari, K.; Pramanik, M.
2010-01-01
This paper describes design and development of a Transimpedance Amplifier for amplification of very low current from in core Self Powered Neutron Detectors (SPND). Measurement of neutron flux is very important for operation, control and protection of Nuclear Power Plant (NPP). SPND is used to measure Reactor incore flux/power. Based on sensitivity of emitter material used in SPND, pitch length and neutron flux (power level); the current output from SPND varies from few pA to few μA. The described amplifier is suitable to use for this current range. The amplifier provides a very high gain using a resistive T network feedback topology. The amplifier is designed in two stages using ultra low bias current FET OPAMPs. Design of Transimpedance amplifier is carefully done to include ultra low input bias current, low offset voltage and noise. The amplifier has in built test facility for calibration and on line test facility for measurement of insulation resistance (IR). The amplifier module has on board isolated DC-DC converter circuit complying MIL/STD/461C/D which generate isolated +/-15V and +12V supply to provide parameter to parameter ground isolation and independence among each module/signal.The output from the amplifier is 0V to 6V for 0 to 150%FP. The design is simulated in computer and amplifier used at TAPS-3 was modified as per new design and has been tested at TAPS-3 site. The amplifier performed satisfactorily. The results showed that the IR measurement technique adopted in the design can tolerate lower IR of SPND in existing design. (author)
Enzyme free cloning for high throughput gene cloning and expression
de Jong, R.N.; Daniëls, M.; Kaptein, R.; Folkers, G.E.
2006-01-01
Structural and functional genomics initiatives significantly improved cloning methods over the past few years. Although recombinational cloning is highly efficient, its costs urged us to search for an alternative high throughput (HTP) cloning method. We implemented a modified Enzyme Free Cloning
Pan, Hsuan-yu
2010-01-01
This research work aims on exploiting SiGe HBT technologies in high dynamic range wideband RF linear-in- dB envelope detectors and linear amplifiers. First, an improved all-npn broadband highly linear SiGe HBT differential amplifier is presented based on a variation of Caprio's Quad. A broadband linear amplifier with 46dBm OIP₃ at 20MHz, 34dBm OIP₃ at 1GHz, 6dB noise figure and 10.3dBm P₁dB is demonstrated. Second, an improved exact dynamic model of a fast-settling linear-in-dB Automatic Gain...
High-Throughput Analysis of Enzyme Activities
Energy Technology Data Exchange (ETDEWEB)
Lu, Guoxin [Iowa State Univ., Ames, IA (United States)
2007-01-01
High-throughput screening (HTS) techniques have been applied to many research fields nowadays. Robot microarray printing technique and automation microtiter handling technique allows HTS performing in both heterogeneous and homogeneous formats, with minimal sample required for each assay element. In this dissertation, new HTS techniques for enzyme activity analysis were developed. First, patterns of immobilized enzyme on nylon screen were detected by multiplexed capillary system. The imaging resolution is limited by the outer diameter of the capillaries. In order to get finer images, capillaries with smaller outer diameters can be used to form the imaging probe. Application of capillary electrophoresis allows separation of the product from the substrate in the reaction mixture, so that the product doesn't have to have different optical properties with the substrate. UV absorption detection allows almost universal detection for organic molecules. Thus, no modifications of either the substrate or the product molecules are necessary. This technique has the potential to be used in screening of local distribution variations of specific bio-molecules in a tissue or in screening of multiple immobilized catalysts. Another high-throughput screening technique is developed by directly monitoring the light intensity of the immobilized-catalyst surface using a scientific charge-coupled device (CCD). Briefly, the surface of enzyme microarray is focused onto a scientific CCD using an objective lens. By carefully choosing the detection wavelength, generation of product on an enzyme spot can be seen by the CCD. Analyzing the light intensity change over time on an enzyme spot can give information of reaction rate. The same microarray can be used for many times. Thus, high-throughput kinetic studies of hundreds of catalytic reactions are made possible. At last, we studied the fluorescence emission spectra of ADP and obtained the detection limits for ADP under three different
A rapid enzymatic assay for high-throughput screening of adenosine-producing strains
Dong, Huina; Zu, Xin; Zheng, Ping; Zhang, Dawei
2015-01-01
Adenosine is a major local regulator of tissue function and industrially useful as precursor for the production of medicinal nucleoside substances. High-throughput screening of adenosine overproducers is important for industrial microorganism breeding. An enzymatic assay of adenosine was developed by combined adenosine deaminase (ADA) with indophenol method. The ADA catalyzes the cleavage of adenosine to inosine and NH3, the latter can be accurately determined by indophenol method. The assay system was optimized to deliver a good performance and could tolerate the addition of inorganic salts and many nutrition components to the assay mixtures. Adenosine could be accurately determined by this assay using 96-well microplates. Spike and recovery tests showed that this assay can accurately and reproducibly determine increases in adenosine in fermentation broth without any pretreatment to remove proteins and potentially interfering low-molecular-weight molecules. This assay was also applied to high-throughput screening for high adenosine-producing strains. The high selectivity and accuracy of the ADA assay provides rapid and high-throughput analysis of adenosine in large numbers of samples. PMID:25580842
High throughput nonparametric probability density estimation.
Farmer, Jenny; Jacobs, Donald
2018-01-01
In high throughput applications, such as those found in bioinformatics and finance, it is important to determine accurate probability distribution functions despite only minimal information about data characteristics, and without using human subjectivity. Such an automated process for univariate data is implemented to achieve this goal by merging the maximum entropy method with single order statistics and maximum likelihood. The only required properties of the random variables are that they are continuous and that they are, or can be approximated as, independent and identically distributed. A quasi-log-likelihood function based on single order statistics for sampled uniform random data is used to empirically construct a sample size invariant universal scoring function. Then a probability density estimate is determined by iteratively improving trial cumulative distribution functions, where better estimates are quantified by the scoring function that identifies atypical fluctuations. This criterion resists under and over fitting data as an alternative to employing the Bayesian or Akaike information criterion. Multiple estimates for the probability density reflect uncertainties due to statistical fluctuations in random samples. Scaled quantile residual plots are also introduced as an effective diagnostic to visualize the quality of the estimated probability densities. Benchmark tests show that estimates for the probability density function (PDF) converge to the true PDF as sample size increases on particularly difficult test probability densities that include cases with discontinuities, multi-resolution scales, heavy tails, and singularities. These results indicate the method has general applicability for high throughput statistical inference.
Pulse amplifier with high 'common mode rejection'
International Nuclear Information System (INIS)
Ijlst, P.
1987-01-01
The input signal of a pulse amplifier contains large 'common-mode' signals which have to be suppressed. A transformer, especially constructed for this purpose, is described. It has been tried to optimize the signal to noise ratio of the pulse amplifier by means of noise analysis. (Auth.)
Coupling amplified DNA from flow-sorted chromosomes to high-density SNP mapping in barley
Directory of Open Access Journals (Sweden)
Bartoš Jan
2008-06-01
Full Text Available Abstract Background Flow cytometry facilitates sorting of single chromosomes and chromosome arms which can be used for targeted genome analysis. However, the recovery of microgram amounts of DNA needed for some assays requires sorting of millions of chromosomes which is laborious and time consuming. Yet, many genomic applications such as development of genetic maps or physical mapping do not require large DNA fragments. In such cases time-consuming de novo sorting can be minimized by utilizing whole-genome amplification. Results Here we report a protocol optimized in barley including amplification of DNA from only ten thousand chromosomes, which can be isolated in less than one hour. Flow-sorted chromosomes were treated with proteinase K and amplified using Phi29 multiple displacement amplification (MDA. Overnight amplification in a 20-microlitre reaction produced 3.7 – 5.7 micrograms DNA with a majority of products between 5 and 30 kb. To determine the purity of sorted fractions and potential amplification bias we used quantitative PCR for specific genes on each chromosome. To extend the analysis to a whole genome level we performed an oligonucleotide pool assay (OPA for interrogation of 1524 loci, of which 1153 loci had known genetic map positions. Analysis of unamplified genomic DNA of barley cv. Akcent using this OPA resulted in 1426 markers with present calls. Comparison with three replicates of amplified genomic DNA revealed >99% concordance. DNA samples from amplified chromosome 1H and a fraction containing chromosomes 2H – 7H were examined. In addition to loci with known map positions, 349 loci with unknown map positions were included. Based on this analysis 40 new loci were mapped to 1H. Conclusion The results indicate a significant potential of using this approach for physical mapping. Moreover, the study showed that multiple displacement amplification of flow-sorted chromosomes is highly efficient and representative which
High-throughput full-automatic synchrotron-based tomographic microscopy
International Nuclear Information System (INIS)
Mader, Kevin; Marone, Federica; Hintermueller, Christoph; Mikuljan, Gordan; Isenegger, Andreas; Stampanoni, Marco
2011-01-01
At the TOMCAT (TOmographic Microscopy and Coherent rAdiology experimenTs) beamline of the Swiss Light Source with an energy range of 8-45 keV and voxel size from 0.37 (micro)m to 7.4 (micro)m, full tomographic datasets are typically acquired in 5 to 10 min. To exploit the speed of the system and enable high-throughput studies to be performed in a fully automatic manner, a package of automation tools has been developed. The samples are automatically exchanged, aligned, moved to the correct region of interest, and scanned. This task is accomplished through the coordination of Python scripts, a robot-based sample-exchange system, sample positioning motors and a CCD camera. The tools are suited for any samples that can be mounted on a standard SEM stub, and require no specific environmental conditions. Up to 60 samples can be analyzed at a time without user intervention. The throughput of the system is dependent on resolution, energy and sample size, but rates of four samples per hour have been achieved with 0.74 (micro)m voxel size at 17.5 keV. The maximum intervention-free scanning time is theoretically unlimited, and in practice experiments have been running unattended as long as 53 h (the average beam time allocation at TOMCAT is 48 h per user). The system is the first fully automated high-throughput tomography station: mounting samples, finding regions of interest, scanning and reconstructing can be performed without user intervention. The system also includes many features which accelerate and simplify the process of tomographic microscopy.
An 8–18 GHz broadband high power amplifier
International Nuclear Information System (INIS)
Wang Lifa; Yang Ruixia; Li Yanlei; Wu Jingfeng
2011-01-01
An 8–18 GHz broadband high power amplifier (HPA) with a hybrid integrated circuit (HIC) is designed and fabricated. This HPA is achieved with the use of a 4-fingered micro-strip Lange coupler in a GaAs MMIC process. In order to decrease electromagnetic interference, a multilayer AlN material with good heat dissipation is adopted as the carrier of the power amplifier. When the input power is 25 dBm, the saturated power of the continuous wave (CW) outputted by the power amplifier is more than 39 dBm within the frequency range of 8–13 GHz, while it is more than 38.6 dBm within other frequency ranges. We obtain the peak power output, 39.4 dBm, at the frequency of 11.9 GHz. In the whole frequency band, the power-added efficiency is more than 18%. When the input power is 18 dBm, the small signal gain is 15.7 ± 0.7 dB. The dimensions of the HPA are 25 × 15 × 1.5 mm 3 . (semiconductor integrated circuits)
Directory of Open Access Journals (Sweden)
Shota Nakamura
Full Text Available With the severe acute respiratory syndrome epidemic of 2003 and renewed attention on avian influenza viral pandemics, new surveillance systems are needed for the earlier detection of emerging infectious diseases. We applied a "next-generation" parallel sequencing platform for viral detection in nasopharyngeal and fecal samples collected during seasonal influenza virus (Flu infections and norovirus outbreaks from 2005 to 2007 in Osaka, Japan. Random RT-PCR was performed to amplify RNA extracted from 0.1-0.25 ml of nasopharyngeal aspirates (N = 3 and fecal specimens (N = 5, and more than 10 microg of cDNA was synthesized. Unbiased high-throughput sequencing of these 8 samples yielded 15,298-32,335 (average 24,738 reads in a single 7.5 h run. In nasopharyngeal samples, although whole genome analysis was not available because the majority (>90% of reads were host genome-derived, 20-460 Flu-reads were detected, which was sufficient for subtype identification. In fecal samples, bacteria and host cells were removed by centrifugation, resulting in gain of 484-15,260 reads of norovirus sequence (78-98% of the whole genome was covered, except for one specimen that was under-detectable by RT-PCR. These results suggest that our unbiased high-throughput sequencing approach is useful for directly detecting pathogenic viruses without advance genetic information. Although its cost and technological availability make it unlikely that this system will very soon be the diagnostic standard worldwide, this system could be useful for the earlier discovery of novel emerging viruses and bioterrorism, which are difficult to detect with conventional procedures.
Chabbert, Christophe D; Adjalley, Sophie H; Steinmetz, Lars M; Pelechano, Vicent
2018-01-01
Chromatin immunoprecipitation followed by sequencing (ChIP-Seq) or microarray hybridization (ChIP-on-chip) are standard methods for the study of transcription factor binding sites and histone chemical modifications. However, these approaches only allow profiling of a single factor or protein modification at a time.In this chapter, we present Bar-ChIP, a higher throughput version of ChIP-Seq that relies on the direct ligation of molecular barcodes to chromatin fragments. Bar-ChIP enables the concurrent profiling of multiple DNA-protein interactions and is therefore amenable to experimental scale-up, without the need for any robotic instrumentation.
High-throughput characterization for solar fuels materials discovery
Mitrovic, Slobodan; Becerra, Natalie; Cornell, Earl; Guevarra, Dan; Haber, Joel; Jin, Jian; Jones, Ryan; Kan, Kevin; Marcin, Martin; Newhouse, Paul; Soedarmadji, Edwin; Suram, Santosh; Xiang, Chengxiang; Gregoire, John; High-Throughput Experimentation Team
2014-03-01
In this talk I will present the status of the High-Throughput Experimentation (HTE) project of the Joint Center for Artificial Photosynthesis (JCAP). JCAP is an Energy Innovation Hub of the U.S. Department of Energy with a mandate to deliver a solar fuel generator based on an integrated photoelectrochemical cell (PEC). However, efficient and commercially viable catalysts or light absorbers for the PEC do not exist. The mission of HTE is to provide the accelerated discovery through combinatorial synthesis and rapid screening of material properties. The HTE pipeline also features high-throughput material characterization using x-ray diffraction and x-ray photoemission spectroscopy (XPS). In this talk I present the currently operating pipeline and focus on our combinatorial XPS efforts to build the largest free database of spectra from mixed-metal oxides, nitrides, sulfides and alloys. This work was performed at Joint Center for Artificial Photosynthesis, a DOE Energy Innovation Hub, supported through the Office of Science of the U.S. Department of Energy under Award No. DE-SC0004993.
Development of amplifier and shaper for high-rate MWPC
International Nuclear Information System (INIS)
Kamiji, Ichinori; Nanjo, Hajime; Kawasaki, Naoki; Maeda, Yosuke; Naito, Daichi; Seki, Shigeto; Nakagiri, Kota; Sasao, Noboru; Nomura, Tadashi
2015-01-01
A multi-wire proportional chamber (MWPC) will be used as an in-beam charged particle detector for the J-PARC E14 (KOTO) experiment. The maximum counting rate of the MWPC is expected to be up to 1 MHz per channel due to the high neutron and photon flux, expected to be 1 GHz for the 30 x 30 cm"2 area. An amplifier to cope with such high counting-rate is required. We developed a prototype of such amplifier, which has a charge preamplifier with the integration time of 3 ns and a pulse shaping part with three pole-zero cancellation networks. The shaper reduced the characteristic long tail lasting tens of microseconds in the signal of MWPC to 150 ns. Its performance has been tested by using a single-channel MWPC which has almost the same geometrical parameters as the MWPC to be installed in the KOTO experiment. (author)
Fluorescent foci quantitation for high-throughput analysis
Directory of Open Access Journals (Sweden)
Elena Ledesma-Fernández
2015-06-01
Full Text Available A number of cellular proteins localize to discrete foci within cells, for example DNA repair proteins, microtubule organizing centers, P bodies or kinetochores. It is often possible to measure the fluorescence emission from tagged proteins within these foci as a surrogate for the concentration of that specific protein. We wished to develop tools that would allow quantitation of fluorescence foci intensities in high-throughput studies. As proof of principle we have examined the kinetochore, a large multi-subunit complex that is critical for the accurate segregation of chromosomes during cell division. Kinetochore perturbations lead to aneuploidy, which is a hallmark of cancer cells. Hence, understanding kinetochore homeostasis and regulation are important for a global understanding of cell division and genome integrity. The 16 budding yeast kinetochores colocalize within the nucleus to form a single focus. Here we have created a set of freely-available tools to allow high-throughput quantitation of kinetochore foci fluorescence. We use this ‘FociQuant’ tool to compare methods of kinetochore quantitation and we show proof of principle that FociQuant can be used to identify changes in kinetochore protein levels in a mutant that affects kinetochore function. This analysis can be applied to any protein that forms discrete foci in cells.
Experimental and numerical studies of high-velocity impact fragmentation
Energy Technology Data Exchange (ETDEWEB)
Kipp, M.E.; Grady, D.E.; Swegle, J.W.
1993-08-01
Developments are reported in both experimental and numerical capabilities for characterizing the debris spray produced in penetration events. We have performed a series of high-velocity experiments specifically designed to examine the fragmentation of the projectile during impact. High-strength, well-characterized steel spheres (6.35 mm diameter) were launched with a two-stage light-gas gun to velocities in the range of 3 to 5 km/s. Normal impact with PMMA plates, thicknesses of 0.6 to 11 mm, applied impulsive loads of various amplitudes and durations to the steel sphere. Multiple flash radiography diagnostics and recovery techniques were used to assess size, velocity, trajectory and statistics of the impact-induced fragment debris. Damage modes to the primary target plate (plastic) and to a secondary target plate (aluminum) were also evaluated. Dynamic fragmentation theories, based on energy-balance principles, were used to evaluate local material deformation and fracture state information from CTH, a three-dimensional Eulerian solid dynamics shock wave propagation code. The local fragment characterization of the material defines a weighted fragment size distribution, and the sum of these distributions provides a composite particle size distribution for the steel sphere. The calculated axial and radial velocity changes agree well with experimental data, and the calculated fragment sizes are in qualitative agreement with the radiographic data. A secondary effort involved the experimental and computational analyses of normal and oblique copper ball impacts on steel target plates. High-resolution radiography and witness plate diagnostics provided impact motion and statistical fragment size data. CTH simulations were performed to test computational models and numerical methods.
International Nuclear Information System (INIS)
Xu, Shao-Gang; Liao, Ji-Hai; Zhao, Yu-Jun; Yang, Xiao-Bao
2015-01-01
The unique electronic property induced diversified structure of boron (B) cluster has attracted much interest from experimentalists and theorists. B 30–40 were reported to be planar fragments of triangular lattice with proper concentrations of vacancies recently. Here, we have performed high-throughput screening for possible B clusters through the first-principles calculations, including various shapes and distributions of vacancies. As a result, we have determined the structures of B n clusters with n = 30–51 and found a stable planar cluster of B 49 with a double-hexagon vacancy. Considering the 8-electron rule and the electron delocalization, a concise model for the distribution of the 2c–2e and 3c–2e bonds has been proposed to explain the stability of B planar clusters, as well as the reported B cages
High-throughput electrical characterization for robust overlay lithography control
Devender, Devender; Shen, Xumin; Duggan, Mark; Singh, Sunil; Rullan, Jonathan; Choo, Jae; Mehta, Sohan; Tang, Teck Jung; Reidy, Sean; Holt, Jonathan; Kim, Hyung Woo; Fox, Robert; Sohn, D. K.
2017-03-01
Realizing sensitive, high throughput and robust overlay measurement is a challenge in current 14nm and advanced upcoming nodes with transition to 300mm and upcoming 450mm semiconductor manufacturing, where slight deviation in overlay has significant impact on reliability and yield1). Exponentially increasing number of critical masks in multi-patterning lithoetch, litho-etch (LELE) and subsequent LELELE semiconductor processes require even tighter overlay specification2). Here, we discuss limitations of current image- and diffraction- based overlay measurement techniques to meet these stringent processing requirements due to sensitivity, throughput and low contrast3). We demonstrate a new electrical measurement based technique where resistance is measured for a macro with intentional misalignment between two layers. Overlay is quantified by a parabolic fitting model to resistance where minima and inflection points are extracted to characterize overlay control and process window, respectively. Analyses using transmission electron microscopy show good correlation between actual overlay performance and overlay obtained from fitting. Additionally, excellent correlation of overlay from electrical measurements to existing image- and diffraction- based techniques is found. We also discuss challenges of integrating electrical measurement based approach in semiconductor manufacturing from Back End of Line (BEOL) perspective. Our findings open up a new pathway for accessing simultaneous overlay as well as process window and margins from a robust, high throughput and electrical measurement approach.
High-throughput Sequencing Based Immune Repertoire Study during Infectious Disease
Directory of Open Access Journals (Sweden)
Dongni Hou
2016-08-01
Full Text Available The selectivity of the adaptive immune response is based on the enormous diversity of T and B cell antigen-specific receptors. The immune repertoire, the collection of T and B cells with functional diversity in the circulatory system at any given time, is dynamic and reflects the essence of immune selectivity. In this article, we review the recent advances in immune repertoire study of infectious diseases that achieved by traditional techniques and high-throughput sequencing techniques. High-throughput sequencing techniques enable the determination of complementary regions of lymphocyte receptors with unprecedented efficiency and scale. This progress in methodology enhances the understanding of immunologic changes during pathogen challenge, and also provides a basis for further development of novel diagnostic markers, immunotherapies and vaccines.
Hek, A.P. de; Hunneman, P.A.H.; Demmler, M.; Hulsmann, A.
1999-01-01
ln this paper the development and measurement results of a compact broadband 9-Watt high efficient X-band high-power amplifier are discussed. The described amplifier has the following state-of-the art performance: an average ouput power of 9 Watt, a gain of 20 dB and an average Power Added
Subnuclear foci quantification using high-throughput 3D image cytometry
Wadduwage, Dushan N.; Parrish, Marcus; Choi, Heejin; Engelward, Bevin P.; Matsudaira, Paul; So, Peter T. C.
2015-07-01
Ionising radiation causes various types of DNA damages including double strand breaks (DSBs). DSBs are often recognized by DNA repair protein ATM which forms gamma-H2AX foci at the site of the DSBs that can be visualized using immunohistochemistry. However most of such experiments are of low throughput in terms of imaging and image analysis techniques. Most of the studies still use manual counting or classification. Hence they are limited to counting a low number of foci per cell (5 foci per nucleus) as the quantification process is extremely labour intensive. Therefore we have developed a high throughput instrumentation and computational pipeline specialized for gamma-H2AX foci quantification. A population of cells with highly clustered foci inside nuclei were imaged, in 3D with submicron resolution, using an in-house developed high throughput image cytometer. Imaging speeds as high as 800 cells/second in 3D were achieved by using HiLo wide-field depth resolved imaging and a remote z-scanning technique. Then the number of foci per cell nucleus were quantified using a 3D extended maxima transform based algorithm. Our results suggests that while most of the other 2D imaging and manual quantification studies can count only up to about 5 foci per nucleus our method is capable of counting more than 100. Moreover we show that 3D analysis is significantly superior compared to the 2D techniques.
Giant Pulse Phenomena in a High Gain Erbium Doped Fiber Amplifier
Li, Stephen X.; Merritt, Scott; Krainak, Michael A.; Yu, Anthony
2018-01-01
High gain Erbium Doped Fiber Amplifiers (EDFAs) are vulnerable to optical damage when unseeded, e.g. due to nonlinear effects that produce random, spontaneous Q-switched (SQS) pulses with high peak power, i.e. giant pulses. Giant pulses can damage either the components within a high gain EDFA or external components and systems coupled to the EDFA. We explore the conditions under which a reflective, polarization-maintaining (PM), core-pumped high gain EDFA generates giant pulses, provide details on the evolution of normal pulses into giant pulses, and provide results on the transient effects of giant pulses on an amplifier's fused-fiber couplers, an effect which we call Fiber Overload Induced Leakage (FOIL). While FOIL's effect on fused-fiber couplers is temporary, its damage to forward pump lasers in a high gain EDFA can be permanent.
A high throughput array microscope for the mechanical characterization of biomaterials
Cribb, Jeremy; Osborne, Lukas D.; Hsiao, Joe Ping-Lin; Vicci, Leandra; Meshram, Alok; O'Brien, E. Tim; Spero, Richard Chasen; Taylor, Russell; Superfine, Richard
2015-02-01
In the last decade, the emergence of high throughput screening has enabled the development of novel drug therapies and elucidated many complex cellular processes. Concurrently, the mechanobiology community has developed tools and methods to show that the dysregulation of biophysical properties and the biochemical mechanisms controlling those properties contribute significantly to many human diseases. Despite these advances, a complete understanding of the connection between biomechanics and disease will require advances in instrumentation that enable parallelized, high throughput assays capable of probing complex signaling pathways, studying biology in physiologically relevant conditions, and capturing specimen and mechanical heterogeneity. Traditional biophysical instruments are unable to meet this need. To address the challenge of large-scale, parallelized biophysical measurements, we have developed an automated array high-throughput microscope system that utilizes passive microbead diffusion to characterize mechanical properties of biomaterials. The instrument is capable of acquiring data on twelve-channels simultaneously, where each channel in the system can independently drive two-channel fluorescence imaging at up to 50 frames per second. We employ this system to measure the concentration-dependent apparent viscosity of hyaluronan, an essential polymer found in connective tissue and whose expression has been implicated in cancer progression.
High-throughput bioinformatics with the Cyrille2 pipeline system.
Fiers, M.W.E.J.; Burgt, van der A.; Datema, E.; Groot, de J.C.W.; Ham, van R.C.H.J.
2008-01-01
Background - Modern omics research involves the application of high-throughput technologies that generate vast volumes of data. These data need to be pre-processed, analyzed and integrated with existing knowledge through the use of diverse sets of software tools, models and databases. The analyses
High throughput single-cell and multiple-cell micro-encapsulation.
Lagus, Todd P; Edd, Jon F
2012-06-15
Microfluidic encapsulation methods have been previously utilized to capture cells in picoliter-scale aqueous, monodisperse drops, providing confinement from a bulk fluid environment with applications in high throughput screening, cytometry, and mass spectrometry. We describe a method to not only encapsulate single cells, but to repeatedly capture a set number of cells (here we demonstrate one- and two-cell encapsulation) to study both isolation and the interactions between cells in groups of controlled sizes. By combining drop generation techniques with cell and particle ordering, we demonstrate controlled encapsulation of cell-sized particles for efficient, continuous encapsulation. Using an aqueous particle suspension and immiscible fluorocarbon oil, we generate aqueous drops in oil with a flow focusing nozzle. The aqueous flow rate is sufficiently high to create ordering of particles which reach the nozzle at integer multiple frequencies of the drop generation frequency, encapsulating a controlled number of cells in each drop. For representative results, 9.9 μm polystyrene particles are used as cell surrogates. This study shows a single-particle encapsulation efficiency P(k=1) of 83.7% and a double-particle encapsulation efficiency P(k=2) of 79.5% as compared to their respective Poisson efficiencies of 39.3% and 33.3%, respectively. The effect of consistent cell and particle concentration is demonstrated to be of major importance for efficient encapsulation, and dripping to jetting transitions are also addressed. Continuous media aqueous cell suspensions share a common fluid environment which allows cells to interact in parallel and also homogenizes the effects of specific cells in measurements from the media. High-throughput encapsulation of cells into picoliter-scale drops confines the samples to protect drops from cross-contamination, enable a measure of cellular diversity within samples, prevent dilution of reagents and expressed biomarkers, and amplify
High-throughput preparation and testing of ion-exchanged zeolites
International Nuclear Information System (INIS)
Janssen, K.P.F.; Paul, J.S.; Sels, B.F.; Jacobs, P.A.
2007-01-01
A high-throughput research platform was developed for the preparation and subsequent catalytic liquid-phase screening of ion-exchanged zeolites, for instance with regard to their use as heterogeneous catalysts. In this system aqueous solutions and other liquid as well as solid reagents are employed as starting materials and 24 samples are prepared on a library plate with a 4 x 6 layout. Volumetric dispensing of metal precursor solutions, weighing of zeolite and subsequent mixing/washing cycles of the starting materials and distributing reaction mixtures to the library plate are automatically performed by liquid and solid handlers controlled by a single common and easy-to-use programming software interface. The thus prepared materials are automatically contacted with reagent solutions, heated, stirred and sampled continuously using a modified liquid handling. The high-throughput platform is highly promising in enhancing synthesis of catalysts and their screening. In this paper the preparation of lanthanum-exchanged NaY zeolites (LaNaY) on the platform is reported, along with their use as catalyst for the conversion of renewables
International Nuclear Information System (INIS)
Bagnoud, V.
2004-01-01
We report on a high-energy, high-average-power optical parametric chirped-pulse amplifier developed as the front end for the OMEGA EP laser. The amplifier provides a gain larger than 109 in two stages leading to a total energy of 400 mJ with a pump-to-signal conversion efficiency higher than 25%
Yeow, Jonathan; Joshi, Sanket; Chapman, Robert; Boyer, Cyrille Andre Jean Marie
2018-04-25
Translating controlled/living radical polymerization (CLRP) from batch to the high throughput production of polymer libraries presents several challenges in terms of both polymer synthesis and characterization. Although recently there have been significant advances in the field of low volume, high throughput CLRP, techniques able to simultaneously monitor multiple polymerizations in an "online" manner have not yet been developed. Here, we report our discovery that 5,10,15,20-tetraphenyl-21H,23H-porphine zinc (ZnTPP) is a self-reporting photocatalyst that can mediate PET-RAFT polymerization as well as report on monomer conversion via changes in its fluorescence properties. This enables the use of a microplate reader to conduct high throughput "online" monitoring of PET-RAFT polymerizations performed directly in 384-well, low volume microtiter plates. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Molecular-Simulation-Driven Fragment Screening for the Discovery of New CXCL12 Inhibitors.
Martinez-Rosell, Gerard; Harvey, Matt J; De Fabritiis, Gianni
2018-03-26
Fragment-based drug discovery (FBDD) has become a mainstream approach in drug design because it allows the reduction of the chemical space and screening libraries while identifying fragments with high protein-ligand efficiency interactions that can later be grown into drug-like leads. In this work, we leverage high-throughput molecular dynamics (MD) simulations to screen a library of 129 fragments for a total of 5.85 ms against the CXCL12 monomer, a chemokine involved in inflammation and diseases such as cancer. Our in silico binding assay was able to recover binding poses, affinities, and kinetics for the selected library and was able to predict 8 mM-affinity fragments with ligand efficiencies higher than 0.3. All of the fragment hits present a similar chemical structure, with a hydrophobic core and a positively charged group, and bind to either sY7 or H1S68 pockets, where they share pharmacophoric properties with experimentally resolved natural binders. This work presents a large-scale screening assay using an exclusive combination of thousands of short MD adaptive simulations analyzed with a Markov state model (MSM) framework.
Directory of Open Access Journals (Sweden)
Tri Joko Raharjo
2011-12-01
Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene
High throughput on-chip analysis of high-energy charged particle tracks using lensfree imaging
Energy Technology Data Exchange (ETDEWEB)
Luo, Wei; Shabbir, Faizan; Gong, Chao; Gulec, Cagatay; Pigeon, Jeremy; Shaw, Jessica; Greenbaum, Alon; Tochitsky, Sergei; Joshi, Chandrashekhar [Electrical Engineering Department, University of California, Los Angeles, California 90095 (United States); Ozcan, Aydogan, E-mail: ozcan@ucla.edu [Electrical Engineering Department, University of California, Los Angeles, California 90095 (United States); Bioengineering Department, University of California, Los Angeles, California 90095 (United States); California NanoSystems Institute (CNSI), University of California, Los Angeles, California 90095 (United States)
2015-04-13
We demonstrate a high-throughput charged particle analysis platform, which is based on lensfree on-chip microscopy for rapid ion track analysis using allyl diglycol carbonate, i.e., CR-39 plastic polymer as the sensing medium. By adopting a wide-area opto-electronic image sensor together with a source-shifting based pixel super-resolution technique, a large CR-39 sample volume (i.e., 4 cm × 4 cm × 0.1 cm) can be imaged in less than 1 min using a compact lensfree on-chip microscope, which detects partially coherent in-line holograms of the ion tracks recorded within the CR-39 detector. After the image capture, using highly parallelized reconstruction and ion track analysis algorithms running on graphics processing units, we reconstruct and analyze the entire volume of a CR-39 detector within ∼1.5 min. This significant reduction in the entire imaging and ion track analysis time not only increases our throughput but also allows us to perform time-resolved analysis of the etching process to monitor and optimize the growth of ion tracks during etching. This computational lensfree imaging platform can provide a much higher throughput and more cost-effective alternative to traditional lens-based scanning optical microscopes for ion track analysis using CR-39 and other passive high energy particle detectors.
Fu, Wei; Zhu, Pengyu; Wei, Shuang; Zhixin, Du; Wang, Chenguang; Wu, Xiyang; Li, Feiwu; Zhu, Shuifang
2017-04-01
Among all of the high-throughput detection methods, PCR-based methodologies are regarded as the most cost-efficient and feasible methodologies compared with the next-generation sequencing or ChIP-based methods. However, the PCR-based methods can only achieve multiplex detection up to 15-plex due to limitations imposed by the multiplex primer interactions. The detection throughput cannot meet the demands of high-throughput detection, such as SNP or gene expression analysis. Therefore, in our study, we have developed a new high-throughput PCR-based detection method, multiplex enrichment quantitative PCR (ME-qPCR), which is a combination of qPCR and nested PCR. The GMO content detection results in our study showed that ME-qPCR could achieve high-throughput detection up to 26-plex. Compared to the original qPCR, the Ct values of ME-qPCR were lower for the same group, which showed that ME-qPCR sensitivity is higher than the original qPCR. The absolute limit of detection for ME-qPCR could achieve levels as low as a single copy of the plant genome. Moreover, the specificity results showed that no cross-amplification occurred for irrelevant GMO events. After evaluation of all of the parameters, a practical evaluation was performed with different foods. The more stable amplification results, compared to qPCR, showed that ME-qPCR was suitable for GMO detection in foods. In conclusion, ME-qPCR achieved sensitive, high-throughput GMO detection in complex substrates, such as crops or food samples. In the future, ME-qPCR-based GMO content identification may positively impact SNP analysis or multiplex gene expression of food or agricultural samples. Graphical abstract For the first-step amplification, four primers (A, B, C, and D) have been added into the reaction volume. In this manner, four kinds of amplicons have been generated. All of these four amplicons could be regarded as the target of second-step PCR. For the second-step amplification, three parallels have been taken for
A gas trapping method for high-throughput metabolic experiments.
Krycer, James R; Diskin, Ciana; Nelson, Marin E; Zeng, Xiao-Yi; Fazakerley, Daniel J; James, David E
2018-01-01
Research into cellular metabolism has become more high-throughput, with typical cell-culture experiments being performed in multiwell plates (microplates). This format presents a challenge when trying to collect gaseous products, such as carbon dioxide (CO2), which requires a sealed environment and a vessel separate from the biological sample. To address this limitation, we developed a gas trapping protocol using perforated plastic lids in sealed cell-culture multiwell plates. We used this trap design to measure CO2 production from glucose and fatty acid metabolism, as well as hydrogen sulfide production from cysteine-treated cells. Our data clearly show that this gas trap can be applied to liquid and solid gas-collection media and can be used to study gaseous product generation by both adherent cells and cells in suspension. Since our gas traps can be adapted to multiwell plates of various sizes, they present a convenient, cost-effective solution that can accommodate the trend toward high-throughput measurements in metabolic research.
High-throughput technology for novel SO2 oxidation catalysts
International Nuclear Information System (INIS)
Loskyll, Jonas; Stoewe, Klaus; Maier, Wilhelm F
2011-01-01
We review the state of the art and explain the need for better SO 2 oxidation catalysts for the production of sulfuric acid. A high-throughput technology has been developed for the study of potential catalysts in the oxidation of SO 2 to SO 3 . High-throughput methods are reviewed and the problems encountered with their adaptation to the corrosive conditions of SO 2 oxidation are described. We show that while emissivity-corrected infrared thermography (ecIRT) can be used for primary screening, it is prone to errors because of the large variations in the emissivity of the catalyst surface. UV-visible (UV-Vis) spectrometry was selected instead as a reliable analysis method of monitoring the SO 2 conversion. Installing plain sugar absorbents at reactor outlets proved valuable for the detection and quantitative removal of SO 3 from the product gas before the UV-Vis analysis. We also overview some elements used for prescreening and those remaining after the screening of the first catalyst generations. (topical review)
[Study on sequence characterized amplified region (SCAR) markers of Cornus officinalis].
Chen, Suiqing; Lu, Xiaolei; Wang, Lili
2011-05-01
To establish sequence characterized amplified region markers of Cornus officinalis and provide a scientific basis for molecular identification of C. officinalis. The random primer was screened through RAPD to obtain specific RAPD marker bands. The RAPD marker bands were separated, extracted, cloned and sequenced. Both ends of the sequence of RAPD marker bands were determined. A pair of specific primers was designed for conventional PCR reaction, and SCAR marker was acquired. Four pairs of primers were designed based on the sequence of RAPD marker bands. The DNA of the seven varieties of C. officinalis was amplified by using YST38 and YST43 primer. The results showed that seven varieties of C. officinalis were able to produce a single PCR product. It was an effective way to identify C. officinalis. The varieties with cylindrical and long-pear shape fruits amplified by YST38 showed a specific band, which could be used as the evidence of variety identification. Seven varieties of C. oficinalis were amplified by using primer YST39. But the size of band of the variety with spindly shape fruit (35,0400 bp) was about 300 bp, which was shorter than those of the variety with the other shape fruits of C. officinalis (650-700 bp). The variety with the spindly shape fruit could be identified through this difference. The primer YST92 could produce a fragment from 600-700 bp in the varieties with cylindrical and long-pear shape fruits, a fragment from 200-300 bp in the varieties with oval and short-cylindrical shape fruits and had no fragment in the varieties with long cylindrical, elliptic and short-pear shape fruits, which could be used to select the different shapes of C. officinalis. SCAR mark is established and can be used as the basis for breeding and distinguishing the verieties of C. officinalis.
Green-Frag: Energy-Efficient Frame Fragmentation Scheme for Wireless Sensor Networks
Daghistani, Anas H.
2013-05-15
Power management is an active area of research in wireless sensor networks (WSNs). Efficient power management is necessary because WSNs are battery-operated devices that can be deployed in mission-critical applications. From the communications perspective, one main approach to reduce energy is to maximize throughput so the data can be transmitted in a short amount of time. Frame fragmentation techniques aim to achieve higher throughput by reducing retransmissions. Using experiments on a WSN testbed, we show that frame fragmentation helps to reduce energy consumption. We then study and compare recent frame fragmentation schemes to find the most energy-efficient scheme. Our main contribution is to propose a new frame fragmentation scheme that is optimized to be energy efficient, which is originated from the chosen frame fragmentation scheme. This new energy-efficient frame fragmentation protocol is called (Green-Frag). Green-Frag uses an algorithm that gives sensor nodes the ability to transmit data with optimal transmit power and optimal frame structure based on environmental conditions. Green-Frag takes into consideration the channel conditions, interference patterns and level, as well as the distance between sender and receiver. The thesis discusses various design and implementation considerations for Green-Frag. Also, it shows empirical results of comparing Green-Frag with other frame fragmentation protocols in terms of energy efficiency. Green-Frag performance results shows that it is capable of choosing the best transmit according to the channel conditions. Subsequently, Green-Frag achieves the least energy consumption in all environmental conditions.
High throughput nanoimprint lithography for semiconductor memory applications
Ye, Zhengmao; Zhang, Wei; Khusnatdinov, Niyaz; Stachowiak, Tim; Irving, J. W.; Longsine, Whitney; Traub, Matthew; Fletcher, Brian; Liu, Weijun
2017-03-01
Imprint lithography is a promising technology for replication of nano-scale features. For semiconductor device applications, Canon deposits a low viscosity resist on a field by field basis using jetting technology. A patterned mask is lowered into the resist fluid which then quickly flows into the relief patterns in the mask by capillary action. Following this filling step, the resist is crosslinked under UV radiation, and then the mask is removed, leaving a patterned resist on the substrate. There are two critical components to meeting throughput requirements for imprint lithography. Using a similar approach to what is already done for many deposition and etch processes, imprint stations can be clustered to enhance throughput. The FPA-1200NZ2C is a four station cluster system designed for high volume manufacturing. For a single station, throughput includes overhead, resist dispense, resist fill time (or spread time), exposure and separation. Resist exposure time and mask/wafer separation are well understood processing steps with typical durations on the order of 0.10 to 0.20 seconds. To achieve a total process throughput of 17 wafers per hour (wph) for a single station, it is necessary to complete the fluid fill step in 1.2 seconds. For a throughput of 20 wph, fill time must be reduced to only one 1.1 seconds. There are several parameters that can impact resist filling. Key parameters include resist drop volume (smaller is better), system controls (which address drop spreading after jetting), Design for Imprint or DFI (to accelerate drop spreading) and material engineering (to promote wetting between the resist and underlying adhesion layer). In addition, it is mandatory to maintain fast filling, even for edge field imprinting. In this paper, we address the improvements made in all of these parameters to first enable a 1.20 second filling process for a device like pattern and have demonstrated this capability for both full fields and edge fields. Non
International Nuclear Information System (INIS)
Bidwell, S.W.; Radack, D.J.; Antonsen, T.M. Jr.; Booske, J.H.; Carmel, Y.; Destler, W.W.; Granatstein, V.L.; Levush, B.; Latham, P.E.; Zhang, Z.X.
1990-01-01
A high-average-power FEL amplifier operating at submillimeter frequencies is under development at the University of Maryland. Program goals are to produce a CW, ∼1 MW, FEL amplifier source at frequencies between 280 GHz and 560 GHz. To this end, a high-gain, high-efficiency, tapered FEL amplifier using a sheet electron beam and a short-period (superconducting) wiggler has been chosen. Development of this amplifier is progressing in three stages: (1) beam propagation through a long length (∼1 m) of short period (λ ω = 1 cm) wiggler, (2) demonstration of a proof-of-principle amplifier experiment at 98 GHz, and (3) designs of a superconducting tapered FEL amplifier meeting the ultimate design goal specifications. 17 refs., 1 fig., 1 tab
Stress Recovery Effects of High- and Low-Frequency Amplified Music on Heart Rate Variability.
Nakajima, Yoshie; Tanaka, Naofumi; Mima, Tatsuya; Izumi, Shin-Ichi
Sounds can induce autonomic responses in listeners. However, the modulatory effect of specific frequency components of music is not fully understood. Here, we examined the role of the frequency component of music on autonomic responses. Specifically, we presented music that had been amplified in the high- or low-frequency domains. Twelve healthy women listened to white noise, a stress-inducing noise, and then one of three versions of a piece of music: original, low-, or high-frequency amplified. To measure autonomic response, we calculated the high-frequency normalized unit (HFnu), low-frequency normalized unit, and the LF/HF ratio from the heart rate using electrocardiography. We defined the stress recovery ratio as the value obtained after participants listened to music following scratching noise, normalized by the value obtained after participants listened to white noise after the stress noise, in terms of the HFnu, low-frequency normalized unit, LF/HF ratio, and heart rate. Results indicated that high-frequency amplified music had the highest HFnu of the three versions. The stress recovery ratio of HFnu under the high-frequency amplified stimulus was significantly larger than that under the low-frequency stimulus. Our results suggest that the high-frequency component of music plays a greater role in stress relief than low-frequency components.
Pecunia, Vincenzo; Nikolka, Mark; Sou, Antony; Nasrallah, Iyad; Amin, Atefeh Y; McCulloch, Iain; Sirringhaus, Henning
2017-06-01
Solution-processed semiconductors such as conjugated polymers have great potential in large-area electronics. While extremely appealing due to their low-temperature and high-throughput deposition methods, their integration in high-performance circuits has been difficult. An important remaining challenge is the achievement of low-voltage circuit operation. The present study focuses on state-of-the-art polymer thin-film transistors based on poly(indacenodithiophene-benzothiadiazole) and shows that the general paradigm for low-voltage operation via an enhanced gate-to-channel capacitive coupling is unable to deliver high-performance device behavior. The order-of-magnitude longitudinal-field reduction demanded by low-voltage operation plays a fundamental role, enabling bulk trapping and leading to compromised contact properties. A trap-reduction technique based on small molecule additives, however, is capable of overcoming this effect, allowing low-voltage high-mobility operation. This approach is readily applicable to low-voltage circuit integration, as this work exemplifies by demonstrating high-performance analog differential amplifiers operating at a battery-compatible power supply voltage of 5 V with power dissipation of 11 µW, and attaining a voltage gain above 60 dB at a power supply voltage below 8 V. These findings constitute an important milestone in realizing low-voltage polymer transistors for solution-based analog electronics that meets performance and power-dissipation requirements for a range of battery-powered smart-sensing applications. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
DEFF Research Database (Denmark)
Schückel, Julia; Kracun, Stjepan Kresimir; Willats, William George Tycho
2016-01-01
for this is that advances in genome and transcriptome sequencing, together with associated bioinformatics tools allow for rapid identification of candidate CAZymes, but technology for determining an enzyme's biochemical characteristics has advanced more slowly. To address this technology gap, a novel high-throughput assay...... CPH and ICB substrates are provided in a 96-well high-throughput assay system. The CPH substrates can be made in four different colors, enabling them to be mixed together and thus increasing assay throughput. The protocol describes a 96-well plate assay and illustrates how this assay can be used...... for screening the activities of enzymes, enzyme cocktails, and broths....
DEFF Research Database (Denmark)
Pedersen, Marlene Lemvig; Block, Ines; List, Markus
into automated robotic high-throughput screens, which allows subsequent protein quantification. In this integrated solution, samples are directly forwarded to automated cell lysate preparation and preparation of dilution series, including reformatting to a protein spotter-compatible format after the high......-throughput screening. Tracking of huge sample numbers and data analysis from a high-content screen to RPPAs is accomplished via MIRACLE, a custom made software suite developed by us. To this end, we demonstrate that the RPPAs generated in this manner deliver reliable protein readouts and that GAPDH and TFR levels can...
A mechanism of gene amplification driven by small DNA fragments.
Directory of Open Access Journals (Sweden)
Kuntal Mukherjee
Full Text Available DNA amplification is a molecular process that increases the copy number of a chromosomal tract and often causes elevated expression of the amplified gene(s. Although gene amplification is frequently observed in cancer and other degenerative disorders, the molecular mechanisms involved in the process of DNA copy number increase remain largely unknown. We hypothesized that small DNA fragments could be the trigger of DNA amplification events. Following our findings that small fragments of DNA in the form of DNA oligonucleotides can be highly recombinogenic, we have developed a system in the yeast Saccharomyces cerevisiae to capture events of chromosomal DNA amplification initiated by small DNA fragments. Here we demonstrate that small DNAs can amplify a chromosomal region, generating either tandem duplications or acentric extrachromosomal DNA circles. Small fragment-driven DNA amplification (SFDA occurs with a frequency that increases with the length of homology between the small DNAs and the target chromosomal regions. SFDA events are triggered even by small single-stranded molecules with as little as 20-nt homology with the genomic target. A double-strand break (DSB external to the chromosomal amplicon region stimulates the amplification event up to a factor of 20 and favors formation of extrachromosomal circles. SFDA is dependent on Rad52 and Rad59, partially dependent on Rad1, Rad10, and Pol32, and independent of Rad51, suggesting a single-strand annealing mechanism. Our results reveal a novel molecular model for gene amplification, in which small DNA fragments drive DNA amplification and define the boundaries of the amplicon region. As DNA fragments are frequently found both inside cells and in the extracellular environment, such as the serum of patients with cancer or other degenerative disorders, we propose that SFDA may be a common mechanism for DNA amplification in cancer cells, as well as a more general cause of DNA copy number variation
High-throughput screening of filamentous fungi using nanoliter-range droplet-based microfluidics
Beneyton, Thomas; Wijaya, I. Putu Mahendra; Postros, Prexilia; Najah, Majdi; Leblond, Pascal; Couvent, Angélique; Mayot, Estelle; Griffiths, Andrew D.; Drevelle, Antoine
2016-06-01
Filamentous fungi are an extremely important source of industrial enzymes because of their capacity to secrete large quantities of proteins. Currently, functional screening of fungi is associated with low throughput and high costs, which severely limits the discovery of novel enzymatic activities and better production strains. Here, we describe a nanoliter-range droplet-based microfluidic system specially adapted for the high-throughput sceening (HTS) of large filamentous fungi libraries for secreted enzyme activities. The platform allowed (i) compartmentalization of single spores in ~10 nl droplets, (ii) germination and mycelium growth and (iii) high-throughput sorting of fungi based on enzymatic activity. A 104 clone UV-mutated library of Aspergillus niger was screened based on α-amylase activity in just 90 minutes. Active clones were enriched 196-fold after a single round of microfluidic HTS. The platform is a powerful tool for the development of new production strains with low cost, space and time footprint and should bring enormous benefit for improving the viability of biotechnological processes.
The application of the high throughput sequencing technology in the transposable elements.
Liu, Zhen; Xu, Jian-hong
2015-09-01
High throughput sequencing technology has dramatically improved the efficiency of DNA sequencing, and decreased the costs to a great extent. Meanwhile, this technology usually has advantages of better specificity, higher sensitivity and accuracy. Therefore, it has been applied to the research on genetic variations, transcriptomics and epigenomics. Recently, this technology has been widely employed in the studies of transposable elements and has achieved fruitful results. In this review, we summarize the application of high throughput sequencing technology in the fields of transposable elements, including the estimation of transposon content, preference of target sites and distribution, insertion polymorphism and population frequency, identification of rare copies, transposon horizontal transfers as well as transposon tagging. We also briefly introduce the major common sequencing strategies and algorithms, their advantages and disadvantages, and the corresponding solutions. Finally, we envision the developing trends of high throughput sequencing technology, especially the third generation sequencing technology, and its application in transposon studies in the future, hopefully providing a comprehensive understanding and reference for related scientific researchers.
Development of High Power Amplifiers for Space and Ground-based Applications
DEFF Research Database (Denmark)
Hernández, Carlos Cilla
The power amplifier used in the transmitter of a microwave system is a key issue, and it derermines the system performance, cost, power consumption and reliability to a considerable extent. Traditionally, most of high power amplifiers used in military and commercial applications were tube......, the device was delivering power levels larger than 75 W, PAE >35% and gain oscillating between 7.5 +/- 0.5 dB. Measurements were shifted down in frequency 1 GHz, but simulations predicted maximum power levels similar to the ones measured....
Distributed feedback laser amplifiers combining the functions of amplifiers and channel filters
DEFF Research Database (Denmark)
Wang, Z.; Durhuus, T.; Mikkelsen, Benny
1994-01-01
A dynamic model for distributed feedback amplifiers, including the mode coupled equations and the carrier rate equation, is established. The presented mode coupled equations have taken into account the interaction between fast changing optical signal and the waveguide with corrugations. By showin...... the possibility of amplifying 100 ps pulses without pulse broadening, we anticipate that a distributed feedback amplifier can be used as a combined amplifier and channel filter in high bit rate transmission systems....
High-Throughput Cancer Cell Sphere Formation for 3D Cell Culture.
Chen, Yu-Chih; Yoon, Euisik
2017-01-01
Three-dimensional (3D) cell culture is critical in studying cancer pathology and drug response. Though 3D cancer sphere culture can be performed in low-adherent dishes or well plates, the unregulated cell aggregation may skew the results. On contrary, microfluidic 3D culture can allow precise control of cell microenvironments, and provide higher throughput by orders of magnitude. In this chapter, we will look into engineering innovations in a microfluidic platform for high-throughput cancer cell sphere formation and review the implementation methods in detail.
A high-throughput in vitro ring assay for vasoactivity using magnetic 3D bioprinting
Tseng, Hubert; Gage, Jacob A.; Haisler, William L.; Neeley, Shane K.; Shen, Tsaiwei; Hebel, Chris; Barthlow, Herbert G.; Wagoner, Matthew; Souza, Glauco R.
2016-01-01
Vasoactive liabilities are typically assayed using wire myography, which is limited by its high cost and low throughput. To meet the demand for higher throughput in vitro alternatives, this study introduces a magnetic 3D bioprinting-based vasoactivity assay. The principle behind this assay is the magnetic printing of vascular smooth muscle cells into 3D rings that functionally represent blood vessel segments, whose contraction can be altered by vasodilators and vasoconstrictors. A cost-effective imaging modality employing a mobile device is used to capture contraction with high throughput. The goal of this study was to validate ring contraction as a measure of vasoactivity, using a small panel of known vasoactive drugs. In vitro responses of the rings matched outcomes predicted by in vivo pharmacology, and were supported by immunohistochemistry. Altogether, this ring assay robustly models vasoactivity, which could meet the need for higher throughput in vitro alternatives. PMID:27477945
High-throughput shotgun lipidomics by quadrupole time-of-flight mass spectrometry
DEFF Research Database (Denmark)
Ståhlman, Marcus; Ejsing, Christer S.; Tarasov, Kirill
2009-01-01
Technological advances in mass spectrometry and meticulous method development have produced several shotgun lipidomic approaches capable of characterizing lipid species by direct analysis of total lipid extracts. Shotgun lipidomics by hybrid quadrupole time-of-flight mass spectrometry allows...... the absolute quantification of hundreds of molecular glycerophospholipid species, glycerolipid species, sphingolipid species and sterol lipids. Future applications in clinical cohort studies demand detailed lipid molecule information and the application of high-throughput lipidomics platforms. In this review...... we describe a novel high-throughput shotgun lipidomic platform based on 96-well robot-assisted lipid extraction, automated sample infusion by mircofluidic-based nanoelectrospray ionization, and quantitative multiple precursor ion scanning analysis on a quadrupole time-of-flight mass spectrometer...
A high gain wide dynamic range transimpedance amplifier for optical receivers
International Nuclear Information System (INIS)
Liu Lianxi; Zou Jiao; Liu Shubin; Niu Yue; Zhu Zhangming; Yang Yintang; En Yunfei
2014-01-01
As the front-end preamplifiers in optical receivers, transimpedance amplifiers (TIAs) are commonly required to have a high gain and low input noise to amplify the weak and susceptible input signal. At the same time, the TIAs should possess a wide dynamic range (DR) to prevent the circuit from becoming saturated by high input currents. Based on the above, this paper presents a CMOS transimpedance amplifier with high gain and a wide DR for 2.5 Gbit/s communications. The TIA proposed consists of a three-stage cascade pull push inverter, an automatic gain control circuit, and a shunt transistor controlled by the resistive divider. The inductive-series peaking technique is used to further extend the bandwidth. The TIA proposed displays a maximum transimpedance gain of 88.3 dBΩ with the −3 dB bandwidth of 1.8 GHz, exhibits an input current dynamic range from 100 nA to 10 mA. The output voltage noise is less than 48.23 nV/√Hz within the −3 dB bandwidth. The circuit is fabricated using an SMIC 0.18 μm 1P6M RFCMOS process and dissipates a dc power of 9.4 mW with 1.8 V supply voltage. (semiconductor integrated circuits)
Infra-red thermography for high throughput field phenotyping in Solanum tuberosum.
Directory of Open Access Journals (Sweden)
Ankush Prashar
Full Text Available The rapid development of genomic technology has made high throughput genotyping widely accessible but the associated high throughput phenotyping is now the major limiting factor in genetic analysis of traits. This paper evaluates the use of thermal imaging for the high throughput field phenotyping of Solanum tuberosum for differences in stomatal behaviour. A large multi-replicated trial of a potato mapping population was used to investigate the consistency in genotypic rankings across different trials and across measurements made at different times of day and on different days. The results confirmed a high degree of consistency between the genotypic rankings based on relative canopy temperature on different occasions. Genotype discrimination was enhanced both through normalising data by expressing genotype temperatures as differences from image means and through the enhanced replication obtained by using overlapping images. A Monte Carlo simulation approach was used to confirm the magnitude of genotypic differences that it is possible to discriminate. The results showed a clear negative association between canopy temperature and final tuber yield for this population, when grown under ample moisture supply. We have therefore established infrared thermography as an easy, rapid and non-destructive screening method for evaluating large population trials for genetic analysis. We also envisage this approach as having great potential for evaluating plant response to stress under field conditions.
High-throughput purification of recombinant proteins using self-cleaving intein tags.
Coolbaugh, M J; Shakalli Tang, M J; Wood, D W
2017-01-01
High throughput methods for recombinant protein production using E. coli typically involve the use of affinity tags for simple purification of the protein of interest. One drawback of these techniques is the occasional need for tag removal before study, which can be hard to predict. In this work, we demonstrate two high throughput purification methods for untagged protein targets based on simple and cost-effective self-cleaving intein tags. Two model proteins, E. coli beta-galactosidase (βGal) and superfolder green fluorescent protein (sfGFP), were purified using self-cleaving versions of the conventional chitin-binding domain (CBD) affinity tag and the nonchromatographic elastin-like-polypeptide (ELP) precipitation tag in a 96-well filter plate format. Initial tests with shake flask cultures confirmed that the intein purification scheme could be scaled down, with >90% pure product generated in a single step using both methods. The scheme was then validated in a high throughput expression platform using 24-well plate cultures followed by purification in 96-well plates. For both tags and with both target proteins, the purified product was consistently obtained in a single-step, with low well-to-well and plate-to-plate variability. This simple method thus allows the reproducible production of highly pure untagged recombinant proteins in a convenient microtiter plate format. Copyright © 2016 Elsevier Inc. All rights reserved.
CrossCheck: an open-source web tool for high-throughput screen data analysis.
Najafov, Jamil; Najafov, Ayaz
2017-07-19
Modern high-throughput screening methods allow researchers to generate large datasets that potentially contain important biological information. However, oftentimes, picking relevant hits from such screens and generating testable hypotheses requires training in bioinformatics and the skills to efficiently perform database mining. There are currently no tools available to general public that allow users to cross-reference their screen datasets with published screen datasets. To this end, we developed CrossCheck, an online platform for high-throughput screen data analysis. CrossCheck is a centralized database that allows effortless comparison of the user-entered list of gene symbols with 16,231 published datasets. These datasets include published data from genome-wide RNAi and CRISPR screens, interactome proteomics and phosphoproteomics screens, cancer mutation databases, low-throughput studies of major cell signaling mediators, such as kinases, E3 ubiquitin ligases and phosphatases, and gene ontological information. Moreover, CrossCheck includes a novel database of predicted protein kinase substrates, which was developed using proteome-wide consensus motif searches. CrossCheck dramatically simplifies high-throughput screen data analysis and enables researchers to dig deep into the published literature and streamline data-driven hypothesis generation. CrossCheck is freely accessible as a web-based application at http://proteinguru.com/crosscheck.
Optimizing transformations for automated, high throughput analysis of flow cytometry data.
Finak, Greg; Perez, Juan-Manuel; Weng, Andrew; Gottardo, Raphael
2010-11-04
In a high throughput setting, effective flow cytometry data analysis depends heavily on proper data preprocessing. While usual preprocessing steps of quality assessment, outlier removal, normalization, and gating have received considerable scrutiny from the community, the influence of data transformation on the output of high throughput analysis has been largely overlooked. Flow cytometry measurements can vary over several orders of magnitude, cell populations can have variances that depend on their mean fluorescence intensities, and may exhibit heavily-skewed distributions. Consequently, the choice of data transformation can influence the output of automated gating. An appropriate data transformation aids in data visualization and gating of cell populations across the range of data. Experience shows that the choice of transformation is data specific. Our goal here is to compare the performance of different transformations applied to flow cytometry data in the context of automated gating in a high throughput, fully automated setting. We examine the most common transformations used in flow cytometry, including the generalized hyperbolic arcsine, biexponential, linlog, and generalized Box-Cox, all within the BioConductor flowCore framework that is widely used in high throughput, automated flow cytometry data analysis. All of these transformations have adjustable parameters whose effects upon the data are non-intuitive for most users. By making some modelling assumptions about the transformed data, we develop maximum likelihood criteria to optimize parameter choice for these different transformations. We compare the performance of parameter-optimized and default-parameter (in flowCore) data transformations on real and simulated data by measuring the variation in the locations of cell populations across samples, discovered via automated gating in both the scatter and fluorescence channels. We find that parameter-optimized transformations improve visualization, reduce
Optimizing transformations for automated, high throughput analysis of flow cytometry data
Directory of Open Access Journals (Sweden)
Weng Andrew
2010-11-01
Full Text Available Abstract Background In a high throughput setting, effective flow cytometry data analysis depends heavily on proper data preprocessing. While usual preprocessing steps of quality assessment, outlier removal, normalization, and gating have received considerable scrutiny from the community, the influence of data transformation on the output of high throughput analysis has been largely overlooked. Flow cytometry measurements can vary over several orders of magnitude, cell populations can have variances that depend on their mean fluorescence intensities, and may exhibit heavily-skewed distributions. Consequently, the choice of data transformation can influence the output of automated gating. An appropriate data transformation aids in data visualization and gating of cell populations across the range of data. Experience shows that the choice of transformation is data specific. Our goal here is to compare the performance of different transformations applied to flow cytometry data in the context of automated gating in a high throughput, fully automated setting. We examine the most common transformations used in flow cytometry, including the generalized hyperbolic arcsine, biexponential, linlog, and generalized Box-Cox, all within the BioConductor flowCore framework that is widely used in high throughput, automated flow cytometry data analysis. All of these transformations have adjustable parameters whose effects upon the data are non-intuitive for most users. By making some modelling assumptions about the transformed data, we develop maximum likelihood criteria to optimize parameter choice for these different transformations. Results We compare the performance of parameter-optimized and default-parameter (in flowCore data transformations on real and simulated data by measuring the variation in the locations of cell populations across samples, discovered via automated gating in both the scatter and fluorescence channels. We find that parameter
Directory of Open Access Journals (Sweden)
Atul Asati
Full Text Available Considering importance of ganglioside antibodies as biomarkers in various immune-mediated neuropathies and neurological disorders, we developed a high throughput multiplexing tool for the assessment of gangliosides-specific antibodies based on Biolpex/Luminex platform. In this report, we demonstrate that the ganglioside high throughput multiplexing tool is robust, highly specific and demonstrating ∼100-fold higher concentration sensitivity for IgG detection than ELISA. In addition to the ganglioside-coated array, the high throughput multiplexing tool contains beads coated with influenza hemagglutinins derived from H1N1 A/Brisbane/59/07 and H1N1 A/California/07/09 strains. Influenza beads provided an added advantage of simultaneous detection of ganglioside- and influenza-specific antibodies, a capacity important for the assay of both infectious antigen-specific and autoimmune antibodies following vaccination or disease. Taken together, these results support the potential adoption of the ganglioside high throughput multiplexing tool for measuring ganglioside antibodies in various neuropathic and neurological disorders.
Giannini, F.; Limiti, E.; Orengo, G.; Serino, A.; De Dominicis, M.
2002-01-01
This paper reports a distributed baseband transimpedance amplifier for optical links up to 10 Gb/s. The amplifier operates as a baseband amplifier with a transimpedance gain of 48 dB Ω and a DC-to-9 GHz bandwidth. Some innovative design techniques to improve gain-bandwidth performance at low and high frequency with an available low-cost GaAs MESFET technology have been developed.
Modular high-throughput test stand for versatile screening of thin-film materials libraries
International Nuclear Information System (INIS)
Thienhaus, Sigurd; Hamann, Sven; Ludwig, Alfred
2011-01-01
Versatile high-throughput characterization tools are required for the development of new materials using combinatorial techniques. Here, we describe a modular, high-throughput test stand for the screening of thin-film materials libraries, which can carry out automated electrical, magnetic and magnetoresistance measurements in the temperature range of −40 to 300 °C. As a proof of concept, we measured the temperature-dependent resistance of Fe–Pd–Mn ferromagnetic shape-memory alloy materials libraries, revealing reversible martensitic transformations and the associated transformation temperatures. Magneto-optical screening measurements of a materials library identify ferromagnetic samples, whereas resistivity maps support the discovery of new phases. A distance sensor in the same setup allows stress measurements in materials libraries deposited on cantilever arrays. A combination of these methods offers a fast and reliable high-throughput characterization technology for searching for new materials. Using this approach, a composition region has been identified in the Fe–Pd–Mn system that combines ferromagnetism and martensitic transformation.
Spectrophotometric Enzyme Assays for High-Throughput Screening
Directory of Open Access Journals (Sweden)
Jean-Louis Reymond
2004-01-01
Full Text Available This paper reviews high-throughput screening enzyme assays developed in our laboratory over the last ten years. These enzyme assays were initially developed for the purpose of discovering catalytic antibodies by screening cell culture supernatants, but have proved generally useful for testing enzyme activities. Examples include TLC-based screening using acridone-labeled substrates, fluorogenic assays based on the β-elimination of umbelliferone or nitrophenol, and indirect assays such as the back-titration method with adrenaline and the copper-calcein fluorescence assay for aminoacids.
Watanabe, A.; Furukawa, H.
2018-04-01
The resolution of multichannel Fourier transform (McFT) spectroscopy is insufficient for many applications despite its extreme advantage of high throughput. We propose an improved configuration to realise both performance using a two-dimensional area sensor. For the spectral resolution, we obtained the interferogram of a larger optical path difference by shifting the area sensor without altering any optical components. The non-linear phase error of the interferometer was successfully corrected using a phase-compensation calculation. Warping compensation was also applied to realise a higher throughput to accumulate the signal between vertical pixels. Our approach significantly improved the resolution and signal-to-noise ratio by factors of 1.7 and 34, respectively. This high-resolution and high-sensitivity McFT spectrometer will be useful for detecting weak light signals such as those in non-invasive diagnosis.
International Nuclear Information System (INIS)
Osanyo, A.; Majiwa, P.W.
2006-01-01
Oligonucleotide primers were designed from the conserved nucleotide sequences of 18S ribosomal RNA (18S rRNA) gene of protozoans: Trypanosoma brucei, Leishmania donovani, Triponema aequale and Lagenidium gigantum. The primers were used in polymerace chain reaction (PCR) to generate PCR products of approximately 1 Kb using genomic DNA from T. brucei and the four genotypic groups of T. congolense as template. The five PCR products so produced were digested with several restriction enzymes and hybridized to a DNA probe made from T. brucei PCR product of the same 18S rRNA gene region. Most restriction enzyme digests revealed polymorphism with respect to the location of their recognition sites on the five PCR products. The restriction fragment length polymorphism (RFLP) pattern observed indicate that the 18S rRNA gene sequences of trypanosomes: T. brucei and the four genotypes of T.congolence group are heterogeneous. The results further demonstrate that the region that was amplified can be used in specific identification of trypanosomes species and subspecies.(author)
Mode control in a high gain relativistic klystron amplifier with 3 GW output power
Wu, Yang; Xie, Hong-Quan; Xu, Zhou
2014-01-01
Higher mode excitation is very serious in the relativistic klystron amplifier, especially for the high gain relativistic amplifier working at tens of kilo-amperes. The mechanism of higher mode excitation is explored in the PIC simulation and it is shown that insufficient separation of adjacent cavities is the main cause of higher mode excitation. So RF lossy material mounted on the drift tube wall is adopted to suppress higher mode excitation. A high gain S-band relativistic klystron amplifier is designed for the beam current of 13 kA and the voltage of 1 MV. PIC simulation shows that the output power is 3.2 GW when the input power is only 2.8 kW.
Comparative Study of Si and SiC MOSFETs for High Voltage Class D Audio Amplifiers
DEFF Research Database (Denmark)
Nielsen, Dennis; Knott, Arnold; Andersen, Michael A. E.
2014-01-01
Silicon (Si) Metal-Oxide-Semiconductor Field-Effect Transistors (MOSFETs) are traditional utilised in class D audio amplifiers. It has been proposed to replace the traditional inefficient electrodynamic transducer with the electrostatic transducer. This imposes new high voltage requirements...... on the MOSFETs of class D amplifiers, and significantly reduces the selection of suitable MOSFETs. As a consequence it is investigated, if Silicon-Carbide (SiC) MOSFETs could represent a valid alternative. The theory of pulse timing errors are revisited for the application of high voltage and capactive loaded...... class D amplifiers. It is shown, that SiC MOSFETs can compete with Si MSOFETs in terms of THD. Validation is done using simulations and a 500 V amplifier driving a 100 nF load. THD+N below 0.3 % is reported...
An optical parametric chirped-pulse amplifier for seeding high repetition rate free-electron lasers
International Nuclear Information System (INIS)
Höppner, H; Hage, A; Tanikawa, T; Schulz, M; Faatz, B; Riedel, R; Prandolini, M J; Teubner, U; Tavella, F
2015-01-01
High repetition rate free-electron lasers (FEL), producing highly intense extreme ultraviolet and x-ray pulses, require new high power tunable femtosecond lasers for FEL seeding and FEL pump-probe experiments. A tunable, 112 W (burst mode) optical parametric chirped-pulse amplifier (OPCPA) is demonstrated with center frequencies ranging from 720–900 nm, pulse energies up to 1.12 mJ and a pulse duration of 30 fs at a repetition rate of 100 kHz. Since the power scalability of this OPCPA is limited by the OPCPA-pump amplifier, we also demonstrate a 6.7–13.7 kW (burst mode) thin-disk OPCPA-pump amplifier, increasing the possible OPCPA output power to many hundreds of watts. Furthermore, third and fourth harmonic generation experiments are performed and the results are used to simulate a seeded FEL with high-gain harmonic generation. (paper)
Computational tools for high-throughput discovery in biology
Jones, Neil Christopher
2007-01-01
High throughput data acquisition technology has inarguably transformed the landscape of the life sciences, in part by making possible---and necessary---the computational disciplines of bioinformatics and biomedical informatics. These fields focus primarily on developing tools for analyzing data and generating hypotheses about objects in nature, and it is in this context that we address three pressing problems in the fields of the computational life sciences which each require computing capaci...
Modeling of semiconductor optical amplifiers
DEFF Research Database (Denmark)
Mørk, Jesper; Bischoff, Svend; Berg, Tommy Winther
We discuss the modelling of semiconductor optical amplifiers with emphasis on their high-speed properties. Applications in linear amplification as well as ultrafast optical signal processing are reviewed. Finally, the possible role of quantum-dot based optical amplifiers is discussed.......We discuss the modelling of semiconductor optical amplifiers with emphasis on their high-speed properties. Applications in linear amplification as well as ultrafast optical signal processing are reviewed. Finally, the possible role of quantum-dot based optical amplifiers is discussed....
A pocket device for high-throughput optofluidic holographic microscopy
Mandracchia, B.; Bianco, V.; Wang, Z.; Paturzo, M.; Bramanti, A.; Pioggia, G.; Ferraro, P.
2017-06-01
Here we introduce a compact holographic microscope embedded onboard a Lab-on-a-Chip (LoC) platform. A wavefront division interferometer is realized by writing a polymer grating onto the channel to extract a reference wave from the object wave impinging the LoC. A portion of the beam reaches the samples flowing along the channel path, carrying their information content to the recording device, while one of the diffraction orders from the grating acts as an off-axis reference wave. Polymeric micro-lenses are delivered forward the chip by Pyro-ElectroHydroDynamic (Pyro-EHD) inkjet printing techniques. Thus, all the required optical components are embedded onboard a pocket device, and fast, non-iterative, reconstruction algorithms can be used. We use our device in combination with a novel high-throughput technique, named Space-Time Digital Holography (STDH). STDH exploits the samples motion inside microfluidic channels to obtain a synthetic hologram, mapped in a hybrid space-time domain, and with intrinsic useful features. Indeed, a single Linear Sensor Array (LSA) is sufficient to build up a synthetic representation of the entire experiment (i.e. the STDH) with unlimited Field of View (FoV) along the scanning direction, independently from the magnification factor. The throughput of the imaging system is dramatically increased as STDH provides unlimited FoV, refocusable imaging of samples inside the liquid volume with no need for hologram stitching. To test our embedded STDH microscopy module, we counted, imaged and tracked in 3D with high-throughput red blood cells moving inside the channel volume under non ideal flow conditions.
Complex fragment emission at low and high excitation energy
International Nuclear Information System (INIS)
Moretto, L.G.
1986-08-01
Complex fragment emission has been certified as a compound nucleus process at low energies. An extension of the measurements to heavy ion reactions up to 50 MeV/u shows that most complex fragments are emitted by highly excited compound nuclei formed in incomplete fusion reactions. 12 refs., 26 figs
A comparison of high-throughput techniques for assaying circadian rhythms in plants.
Tindall, Andrew J; Waller, Jade; Greenwood, Mark; Gould, Peter D; Hartwell, James; Hall, Anthony
2015-01-01
Over the last two decades, the development of high-throughput techniques has enabled us to probe the plant circadian clock, a key coordinator of vital biological processes, in ways previously impossible. With the circadian clock increasingly implicated in key fitness and signalling pathways, this has opened up new avenues for understanding plant development and signalling. Our tool-kit has been constantly improving through continual development and novel techniques that increase throughput, reduce costs and allow higher resolution on the cellular and subcellular levels. With circadian assays becoming more accessible and relevant than ever to researchers, in this paper we offer a review of the techniques currently available before considering the horizons in circadian investigation at ever higher throughputs and resolutions.
Development of three channel linear bipolar high voltage amplifier (±2 KV) for electrostatic steerer
International Nuclear Information System (INIS)
Rajesh Kumar; Mukesh Kumar; Suman, S.K.; Safvan, C.P.; Mandal, A.
2011-01-01
Electrostatic steerers and scanners are planned for low energy ion beam facilities at IUAC to steer and scan the ion beam on target. The power supplies for electrostatic steerers are high voltage bipolar DC amplifiers and for scanners are bipolar AC amplifiers. To fulfil the requirements a common unit has been designed and assembled for AC and DC applications. It can be used with electrostatic devices in scanning, steering and sweeping of low energy ion beams at high frequencies to attain uniform implantation. The unit consist of three independent limited bandwidth high voltage, linear bipolar amplifiers (for X-axis, Y-axis and Y1-dog leg plates). The unit has been provided with both local and remote control. (author)
DEFF Research Database (Denmark)
Fry, N K; Bangsborg, Jette Marie; Bergmans, A
2002-01-01
The utility of amplified fragment length polymorphism (AFLP) analysis as a genotyping method for the epidemiological typing of Legionella pneumophila serogroup 1 has been previously demonstrated. This study (i). reports recommendations for the designation of the European Working Group on Legionella...... centres), and 92% (7 centres) to 100% (7 centres). The AFLP method as described is robust and rapid and allows the genotypic comparison of isolates of Legionella pneumophila between different testing centres without the need for exchange of the strains studied....
Madanecki, Piotr; Bałut, Magdalena; Buckley, Patrick G; Ochocka, J Renata; Bartoszewski, Rafał; Crossman, David K; Messiaen, Ludwine M; Piotrowski, Arkadiusz
2018-01-01
High-throughput technologies generate considerable amount of data which often requires bioinformatic expertise to analyze. Here we present High-Throughput Tabular Data Processor (HTDP), a platform independent Java program. HTDP works on any character-delimited column data (e.g. BED, GFF, GTF, PSL, WIG, VCF) from multiple text files and supports merging, filtering and converting of data that is produced in the course of high-throughput experiments. HTDP can also utilize itemized sets of conditions from external files for complex or repetitive filtering/merging tasks. The program is intended to aid global, real-time processing of large data sets using a graphical user interface (GUI). Therefore, no prior expertise in programming, regular expression, or command line usage is required of the user. Additionally, no a priori assumptions are imposed on the internal file composition. We demonstrate the flexibility and potential of HTDP in real-life research tasks including microarray and massively parallel sequencing, i.e. identification of disease predisposing variants in the next generation sequencing data as well as comprehensive concurrent analysis of microarray and sequencing results. We also show the utility of HTDP in technical tasks including data merge, reduction and filtering with external criteria files. HTDP was developed to address functionality that is missing or rudimentary in other GUI software for processing character-delimited column data from high-throughput technologies. Flexibility, in terms of input file handling, provides long term potential functionality in high-throughput analysis pipelines, as the program is not limited by the currently existing applications and data formats. HTDP is available as the Open Source software (https://github.com/pmadanecki/htdp).
The JCSG high-throughput structural biology pipeline
International Nuclear Information System (INIS)
Elsliger, Marc-André; Deacon, Ashley M.; Godzik, Adam; Lesley, Scott A.; Wooley, John; Wüthrich, Kurt; Wilson, Ian A.
2010-01-01
The Joint Center for Structural Genomics high-throughput structural biology pipeline has delivered more than 1000 structures to the community over the past ten years and has made a significant contribution to the overall goal of the NIH Protein Structure Initiative (PSI) of expanding structural coverage of the protein universe. The Joint Center for Structural Genomics high-throughput structural biology pipeline has delivered more than 1000 structures to the community over the past ten years. The JCSG has made a significant contribution to the overall goal of the NIH Protein Structure Initiative (PSI) of expanding structural coverage of the protein universe, as well as making substantial inroads into structural coverage of an entire organism. Targets are processed through an extensive combination of bioinformatics and biophysical analyses to efficiently characterize and optimize each target prior to selection for structure determination. The pipeline uses parallel processing methods at almost every step in the process and can adapt to a wide range of protein targets from bacterial to human. The construction, expansion and optimization of the JCSG gene-to-structure pipeline over the years have resulted in many technological and methodological advances and developments. The vast number of targets and the enormous amounts of associated data processed through the multiple stages of the experimental pipeline required the development of variety of valuable resources that, wherever feasible, have been converted to free-access web-based tools and applications
COMPUTER APPROACHES TO WHEAT HIGH-THROUGHPUT PHENOTYPING
Directory of Open Access Journals (Sweden)
Afonnikov D.
2012-08-01
Full Text Available The growing need for rapid and accurate approaches for large-scale assessment of phenotypic characters in plants becomes more and more obvious in the studies looking into relationships between genotype and phenotype. This need is due to the advent of high throughput methods for analysis of genomes. Nowadays, any genetic experiment involves data on thousands and dozens of thousands of plants. Traditional ways of assessing most phenotypic characteristics (those with reliance on the eye, the touch, the ruler are little effective on samples of such sizes. Modern approaches seek to take advantage of automated phenotyping, which warrants a much more rapid data acquisition, higher accuracy of the assessment of phenotypic features, measurement of new parameters of these features and exclusion of human subjectivity from the process. Additionally, automation allows measurement data to be rapidly loaded into computer databases, which reduces data processing time.In this work, we present the WheatPGE information system designed to solve the problem of integration of genotypic and phenotypic data and parameters of the environment, as well as to analyze the relationships between the genotype and phenotype in wheat. The system is used to consolidate miscellaneous data on a plant for storing and processing various morphological traits and genotypes of wheat plants as well as data on various environmental factors. The system is available at www.wheatdb.org. Its potential in genetic experiments has been demonstrated in high-throughput phenotyping of wheat leaf pubescence.
Musenga, Alessandro; Cowan, David A
2013-05-03
We describe a sensitive, comprehensive and fast screening method based on liquid chromatography-high resolution mass spectrometry for the detection of a large number of analytes in sports samples. UHPLC coupled to high resolution mass spectrometry with polarity switching capability is applied for the rapid screening of a large number of analytes in human urine samples. Full scan data are acquired alternating both positive and negative ionisation. Collision-induced dissociation with positive ionisation is also performed to produce fragment ions to improve selectivity for some analytes. Data are reviewed as extracted ion chromatograms based on narrow mass/charge windows (±5ppm). A simple sample preparation method was developed, using direct enzymatic hydrolysis of glucuronide conjugates, followed by solid phase extraction with mixed mode ion-exchange cartridges. Within a 10min run time (including re-equilibration) the method presented allows for the analysis of a large number of analytes from most of the classes in the World Anti-Doping Agency (WADA) Prohibited List, including anabolic agents, β2-agonists, hormone antagonists and modulators, diuretics, stimulants, narcotics, glucocorticoids and β-blockers, and does so while meeting the WADA sensitivity requirements. The high throughput of the method and the fast sample pre-treatment reduces analysis cost and increases productivity. The method presented has been used for the analysis of over 5000 samples in about one month and proved to be reliable. Copyright © 2013 Elsevier B.V. All rights reserved.
High-throughput selection for cellulase catalysts using chemical complementation.
Peralta-Yahya, Pamela; Carter, Brian T; Lin, Hening; Tao, Haiyan; Cornish, Virginia W
2008-12-24
Efficient enzymatic hydrolysis of lignocellulosic material remains one of the major bottlenecks to cost-effective conversion of biomass to ethanol. Improvement of glycosylhydrolases, however, is limited by existing medium-throughput screening technologies. Here, we report the first high-throughput selection for cellulase catalysts. This selection was developed by adapting chemical complementation to provide a growth assay for bond cleavage reactions. First, a URA3 counter selection was adapted to link chemical dimerizer activated gene transcription to cell death. Next, the URA3 counter selection was shown to detect cellulase activity based on cleavage of a tetrasaccharide chemical dimerizer substrate and decrease in expression of the toxic URA3 reporter. Finally, the utility of the cellulase selection was assessed by isolating cellulases with improved activity from a cellulase library created by family DNA shuffling. This application provides further evidence that chemical complementation can be readily adapted to detect different enzymatic activities for important chemical transformations for which no natural selection exists. Because of the large number of enzyme variants that selections can now test as compared to existing medium-throughput screens for cellulases, this assay has the potential to impact the discovery of improved cellulases and other glycosylhydrolases for biomass conversion from libraries of cellulases created by mutagenesis or obtained from natural biodiversity.
Blood group genotyping: from patient to high-throughput donor screening.
Veldhuisen, B; van der Schoot, C E; de Haas, M
2009-10-01
Blood group antigens, present on the cell membrane of red blood cells and platelets, can be defined either serologically or predicted based on the genotypes of genes encoding for blood group antigens. At present, the molecular basis of many antigens of the 30 blood group systems and 17 human platelet antigens is known. In many laboratories, blood group genotyping assays are routinely used for diagnostics in cases where patient red cells cannot be used for serological typing due to the presence of auto-antibodies or after recent transfusions. In addition, DNA genotyping is used to support (un)-expected serological findings. Fetal genotyping is routinely performed when there is a risk of alloimmune-mediated red cell or platelet destruction. In case of patient blood group antigen typing, it is important that a genotyping result is quickly available to support the selection of donor blood, and high-throughput of the genotyping method is not a prerequisite. In addition, genotyping of blood donors will be extremely useful to obtain donor blood with rare phenotypes, for example lacking a high-frequency antigen, and to obtain a fully typed donor database to be used for a better matching between recipient and donor to prevent adverse transfusion reactions. Serological typing of large cohorts of donors is a labour-intensive and expensive exercise and hampered by the lack of sufficient amounts of approved typing reagents for all blood group systems of interest. Currently, high-throughput genotyping based on DNA micro-arrays is a very feasible method to obtain a large pool of well-typed blood donors. Several systems for high-throughput blood group genotyping are developed and will be discussed in this review.
High-throughput assessment of context-dependent effects of chromatin proteins
Brueckner, L. (Laura); Van Arensbergen, J. (Joris); Akhtar, W. (Waseem); L. Pagie (Ludo); B. van Steensel (Bas)
2016-01-01
textabstractBackground: Chromatin proteins control gene activity in a concerted manner. We developed a high-throughput assay to study the effects of the local chromatin environment on the regulatory activity of a protein of interest. The assay combines a previously reported multiplexing strategy
High-throughput open source computational methods for genetics and genomics
Prins, J.C.P.
2015-01-01
Biology is increasingly data driven by virtue of the development of high-throughput technologies, such as DNA and RNA sequencing. Computational biology and bioinformatics are scientific disciplines that cross-over between the disciplines of biology, informatics and statistics; which is clearly
tcpl: The ToxCast Pipeline for High-Throughput Screening Data
Motivation: The large and diverse high-throughput chemical screening efforts carried out by the US EPAToxCast program requires an efficient, transparent, and reproducible data pipeline.Summary: The tcpl R package and its associated MySQL database provide a generalized platform fo...
Combinatorial chemoenzymatic synthesis and high-throughput screening of sialosides.
Chokhawala, Harshal A; Huang, Shengshu; Lau, Kam; Yu, Hai; Cheng, Jiansong; Thon, Vireak; Hurtado-Ziola, Nancy; Guerrero, Juan A; Varki, Ajit; Chen, Xi
2008-09-19
Although the vital roles of structures containing sialic acid in biomolecular recognition are well documented, limited information is available on how sialic acid structural modifications, sialyl linkages, and the underlying glycan structures affect the binding or the activity of sialic acid-recognizing proteins and related downstream biological processes. A novel combinatorial chemoenzymatic method has been developed for the highly efficient synthesis of biotinylated sialosides containing different sialic acid structures and different underlying glycans in 96-well plates from biotinylated sialyltransferase acceptors and sialic acid precursors. By transferring the reaction mixtures to NeutrAvidin-coated plates and assaying for the yields of enzymatic reactions using lectins recognizing sialyltransferase acceptors but not the sialylated products, the biotinylated sialoside products can be directly used, without purification, for high-throughput screening to quickly identify the ligand specificity of sialic acid-binding proteins. For a proof-of-principle experiment, 72 biotinylated alpha2,6-linked sialosides were synthesized in 96-well plates from 4 biotinylated sialyltransferase acceptors and 18 sialic acid precursors using a one-pot three-enzyme system. High-throughput screening assays performed in NeutrAvidin-coated microtiter plates show that whereas Sambucus nigra Lectin binds to alpha2,6-linked sialosides with high promiscuity, human Siglec-2 (CD22) is highly selective for a number of sialic acid structures and the underlying glycans in its sialoside ligands.
A high-throughput surface plasmon resonance biosensor based on differential interferometric imaging
International Nuclear Information System (INIS)
Wang, Daqian; Ding, Lili; Zhang, Wei; Zhang, Enyao; Yu, Xinglong; Luo, Zhaofeng; Ou, Huichao
2012-01-01
A new high-throughput surface plasmon resonance (SPR) biosensor based on differential interferometric imaging is reported. The two SPR interferograms of the sensing surface are imaged on two CCD cameras. The phase difference between the two interferograms is 180°. The refractive index related factor (RIRF) of the sensing surface is calculated from the two simultaneously acquired interferograms. The simulation results indicate that the RIRF exhibits a linear relationship with the refractive index of the sensing surface and is unaffected by the noise, drift and intensity distribution of the light source. The affinity and kinetic information can be extracted in real time from continuously acquired RIRF distributions. The results of refractometry experiments show that the dynamic detection range of SPR differential interferometric imaging system can be over 0.015 refractive index unit (RIU). High refractive index resolution is down to 0.45 RU (1 RU = 1 × 10 −6 RIU). Imaging and protein microarray experiments demonstrate the ability of high-throughput detection. The aptamer experiments demonstrate that the SPR sensor based on differential interferometric imaging has a great capability to be implemented for high-throughput aptamer kinetic evaluation. These results suggest that this biosensor has the potential to be utilized in proteomics and drug discovery after further improvement. (paper)
Fragment screening of cyclin G-associated kinase by weak affinity chromatography.
Meiby, Elinor; Knapp, Stefan; Elkins, Jonathan M; Ohlson, Sten
2012-11-01
Fragment-based drug discovery (FBDD) has become a new strategy for drug discovery where lead compounds are evolved from small molecules. These fragments form low affinity interactions (dissociation constant (K(D)) = mM - μM) with protein targets, which require fragment screening methods of sufficient sensitivity. Weak affinity chromatography (WAC) is a promising new technology for fragment screening based on selective retention of fragments by a drug target. Kinases are a major pharmaceutical target, and FBDD has been successfully applied to several of these targets. In this work, we have demonstrated the potential to use WAC in combination with mass spectrometry (MS) detection for fragment screening of a kinase target-cyclin G-associated kinase (GAK). One hundred seventy fragments were selected for WAC screening by virtual screening of a commercial fragment library against the ATP-binding site of five different proteins. GAK protein was immobilized on a capillary HPLC column, and compound binding was characterized by frontal affinity chromatography. Compounds were screened in sets of 13 or 14, in combination with MS detection for enhanced throughput. Seventy-eight fragments (46 %) with K(D) < 200 μM were detected, including a few highly efficient GAK binders (K(D) of 2 μM; ligand efficiency = 0.51). Of special interest is that chiral screening by WAC may be possible, as two stereoisomeric fragments, which both contained one chiral center, demonstrated twin peaks. This ability, in combination with the robustness, sensitivity, and simplicity of WAC makes it a new method for fragment screening of considerable potential.
40 CFR Table 3 to Subpart Eeee of... - Operating Limits-High Throughput Transfer Racks
2010-07-01
... 40 Protection of Environment 12 2010-07-01 2010-07-01 true Operating Limits-High Throughput Transfer Racks 3 Table 3 to Subpart EEEE of Part 63 Protection of Environment ENVIRONMENTAL PROTECTION... Throughput Transfer Racks As stated in § 63.2346(e), you must comply with the operating limits for existing...
NASA developments in solid state power amplifiers
Leonard, Regis F.
1990-01-01
Over the last ten years, NASA has undertaken an extensive program aimed at development of solid state power amplifiers for space applications. Historically, the program may be divided into three phases. The first efforts were carried out in support of the advanced communications technology satellite (ACTS) program, which is developing an experimental version of a Ka-band commercial communications system. These first amplifiers attempted to use hybrid technology. The second phase was still targeted at ACTS frequencies, but concentrated on monolithic implementations, while the current, third phase, is a monolithic effort that focusses on frequencies appropriate for other NASA programs and stresses amplifier efficiency. The topics covered include: (1) 20 GHz hybrid amplifiers; (2) 20 GHz monolithic MESFET power amplifiers; (3) Texas Instruments' (TI) 20 GHz variable power amplifier; (4) TI 20 GHz high power amplifier; (5) high efficiency monolithic power amplifiers; (6) GHz high efficiency variable power amplifier; (7) TI 32 GHz monolithic power amplifier performance; (8) design goals for Hughes' 32 GHz variable power amplifier; and (9) performance goals for Hughes' pseudomorphic 60 GHz power amplifier.
Management of High-Throughput DNA Sequencing Projects: Alpheus.
Miller, Neil A; Kingsmore, Stephen F; Farmer, Andrew; Langley, Raymond J; Mudge, Joann; Crow, John A; Gonzalez, Alvaro J; Schilkey, Faye D; Kim, Ryan J; van Velkinburgh, Jennifer; May, Gregory D; Black, C Forrest; Myers, M Kathy; Utsey, John P; Frost, Nicholas S; Sugarbaker, David J; Bueno, Raphael; Gullans, Stephen R; Baxter, Susan M; Day, Steve W; Retzel, Ernest F
2008-12-26
High-throughput DNA sequencing has enabled systems biology to begin to address areas in health, agricultural and basic biological research. Concomitant with the opportunities is an absolute necessity to manage significant volumes of high-dimensional and inter-related data and analysis. Alpheus is an analysis pipeline, database and visualization software for use with massively parallel DNA sequencing technologies that feature multi-gigabase throughput characterized by relatively short reads, such as Illumina-Solexa (sequencing-by-synthesis), Roche-454 (pyrosequencing) and Applied Biosystem's SOLiD (sequencing-by-ligation). Alpheus enables alignment to reference sequence(s), detection of variants and enumeration of sequence abundance, including expression levels in transcriptome sequence. Alpheus is able to detect several types of variants, including non-synonymous and synonymous single nucleotide polymorphisms (SNPs), insertions/deletions (indels), premature stop codons, and splice isoforms. Variant detection is aided by the ability to filter variant calls based on consistency, expected allele frequency, sequence quality, coverage, and variant type in order to minimize false positives while maximizing the identification of true positives. Alpheus also enables comparisons of genes with variants between cases and controls or bulk segregant pools. Sequence-based differential expression comparisons can be developed, with data export to SAS JMP Genomics for statistical analysis.
High-throughput screening with micro-x-ray fluorescence
International Nuclear Information System (INIS)
Havrilla, George J.; Miller, Thomasin C.
2005-01-01
Micro-x-ray fluorescence (MXRF) is a useful characterization tool for high-throughput screening of combinatorial libraries. Due to the increasing threat of use of chemical warfare (CW) agents both in military actions and against civilians by terrorist extremists, there is a strong push to improve existing methods and develop means for the detection of a broad spectrum of CW agents in a minimal amount of time to increase national security. This paper describes a combinatorial high-throughput screening technique for CW receptor discovery to aid in sensor development. MXRF can screen materials for elemental composition at the mesoscale level (tens to hundreds of micrometers). The key aspect of this work is the use of commercial MXRF instrumentation coupled with the inherent heteroatom elements within the target molecules of the combinatorial reaction to provide rapid and specific identification of lead species. The method is demonstrated by screening an 11-mer oligopeptide library for selective binding of the degradation products of the nerve agent VX. The identified oligopeptides can be used as selective molecular receptors for sensor development. The MXRF screening method is nondestructive, requires minimal sample preparation or special tags for analysis, and the screening time depends on the desired sensitivity
Mok, Aaron T. Y.; Lee, Kelvin C. M.; Wong, Kenneth K. Y.; Tsia, Kevin K.
2018-02-01
Biophysical properties of cells could complement and correlate biochemical markers to characterize a multitude of cellular states. Changes in cell size, dry mass and subcellular morphology, for instance, are relevant to cell-cycle progression which is prevalently evaluated by DNA-targeted fluorescence measurements. Quantitative-phase microscopy (QPM) is among the effective biophysical phenotyping tools that can quantify cell sizes and sub-cellular dry mass density distribution of single cells at high spatial resolution. However, limited camera frame rate and thus imaging throughput makes QPM incompatible with high-throughput flow cytometry - a gold standard in multiparametric cell-based assay. Here we present a high-throughput approach for label-free analysis of cell cycle based on quantitative-phase time-stretch imaging flow cytometry at a throughput of > 10,000 cells/s. Our time-stretch QPM system enables sub-cellular resolution even at high speed, allowing us to extract a multitude (at least 24) of single-cell biophysical phenotypes (from both amplitude and phase images). Those phenotypes can be combined to track cell-cycle progression based on a t-distributed stochastic neighbor embedding (t-SNE) algorithm. Using multivariate analysis of variance (MANOVA) discriminant analysis, cell-cycle phases can also be predicted label-free with high accuracy at >90% in G1 and G2 phase, and >80% in S phase. We anticipate that high throughput label-free cell cycle characterization could open new approaches for large-scale single-cell analysis, bringing new mechanistic insights into complex biological processes including diseases pathogenesis.
High Throughput Plasma Water Treatment
Mujovic, Selman; Foster, John
2016-10-01
The troublesome emergence of new classes of micro-pollutants, such as pharmaceuticals and endocrine disruptors, poses challenges for conventional water treatment systems. In an effort to address these contaminants and to support water reuse in drought stricken regions, new technologies must be introduced. The interaction of water with plasma rapidly mineralizes organics by inducing advanced oxidation in addition to other chemical, physical and radiative processes. The primary barrier to the implementation of plasma-based water treatment is process volume scale up. In this work, we investigate a potentially scalable, high throughput plasma water reactor that utilizes a packed bed dielectric barrier-like geometry to maximize the plasma-water interface. Here, the water serves as the dielectric medium. High-speed imaging and emission spectroscopy are used to characterize the reactor discharges. Changes in methylene blue concentration and basic water parameters are mapped as a function of plasma treatment time. Experimental results are compared to electrostatic and plasma chemistry computations, which will provide insight into the reactor's operation so that efficiency can be assessed. Supported by NSF (CBET 1336375).
High Efficiency Hydrodynamic DNA Fragmentation in a Bubbling System.
Li, Lanhui; Jin, Mingliang; Sun, Chenglong; Wang, Xiaoxue; Xie, Shuting; Zhou, Guofu; van den Berg, Albert; Eijkel, Jan C T; Shui, Lingling
2017-01-18
DNA fragmentation down to a precise fragment size is important for biomedical applications, disease determination, gene therapy and shotgun sequencing. In this work, a cheap, easy to operate and high efficiency DNA fragmentation method is demonstrated based on hydrodynamic shearing in a bubbling system. We expect that hydrodynamic forces generated during the bubbling process shear the DNA molecules, extending and breaking them at the points where shearing forces are larger than the strength of the phosphate backbone. Factors of applied pressure, bubbling time and temperature have been investigated. Genomic DNA could be fragmented down to controllable 1-10 Kbp fragment lengths with a yield of 75.30-91.60%. We demonstrate that the ends of the genomic DNAs generated from hydrodynamic shearing can be ligated by T4 ligase and the fragmented DNAs can be used as templates for polymerase chain reaction. Therefore, in the bubbling system, DNAs could be hydrodynamically sheared to achieve smaller pieces in dsDNAs available for further processes. It could potentially serve as a DNA sample pretreatment technique in the future.
High-Throughput Next-Generation Sequencing of Polioviruses
Montmayeur, Anna M.; Schmidt, Alexander; Zhao, Kun; Magaña, Laura; Iber, Jane; Castro, Christina J.; Chen, Qi; Henderson, Elizabeth; Ramos, Edward; Shaw, Jing; Tatusov, Roman L.; Dybdahl-Sissoko, Naomi; Endegue-Zanga, Marie Claire; Adeniji, Johnson A.; Oberste, M. Steven; Burns, Cara C.
2016-01-01
ABSTRACT The poliovirus (PV) is currently targeted for worldwide eradication and containment. Sanger-based sequencing of the viral protein 1 (VP1) capsid region is currently the standard method for PV surveillance. However, the whole-genome sequence is sometimes needed for higher resolution global surveillance. In this study, we optimized whole-genome sequencing protocols for poliovirus isolates and FTA cards using next-generation sequencing (NGS), aiming for high sequence coverage, efficiency, and throughput. We found that DNase treatment of poliovirus RNA followed by random reverse transcription (RT), amplification, and the use of the Nextera XT DNA library preparation kit produced significantly better results than other preparations. The average viral reads per total reads, a measurement of efficiency, was as high as 84.2% ± 15.6%. PV genomes covering >99 to 100% of the reference length were obtained and validated with Sanger sequencing. A total of 52 PV genomes were generated, multiplexing as many as 64 samples in a single Illumina MiSeq run. This high-throughput, sequence-independent NGS approach facilitated the detection of a diverse range of PVs, especially for those in vaccine-derived polioviruses (VDPV), circulating VDPV, or immunodeficiency-related VDPV. In contrast to results from previous studies on other viruses, our results showed that filtration and nuclease treatment did not discernibly increase the sequencing efficiency of PV isolates. However, DNase treatment after nucleic acid extraction to remove host DNA significantly improved the sequencing results. This NGS method has been successfully implemented to generate PV genomes for molecular epidemiology of the most recent PV isolates. Additionally, the ability to obtain full PV genomes from FTA cards will aid in facilitating global poliovirus surveillance. PMID:27927929
Design Methodology of High Power Distributed Amplifier Employing Broadband Impedance Transformer
DEFF Research Database (Denmark)
Narendra, Kumar; Zhurbenko, Vitaliy; Collantes, Juan Mari
2009-01-01
A novel topology of a high power distributed amplifier (DA) in combination with a broadband impedance transformer is presented. The advantages of the proposed topology are explored analytically and verified by a full-wave 3D simulations. Stability of the high power DA is verified with the pole...
Development of a high power millimeter wave free-electron laser amplifier
International Nuclear Information System (INIS)
Bidwell, S.W.; Zhang, Z.X.; Antonsen, T.M. Jr.; Destler, W.W.; Granatstein, V.L.; Levush, B.; Rodgers, J.; Freund, H.P.
1992-01-01
Progress on the development of a high-average-power millimeter wave free-electron laser amplifier is reported. Successful sheet electron beam propagation has been observed through a 54 cm long wiggler magnet. One hundred percent transport efficiency is reported with a 15 A, 0.1 cm x 2.0 cm, sheet electron beam through B w = 5.1 kG, λ w = 0.96 cm, planar electromagnet wiggler. Preliminary success with a novel, yet simple, method of side focusing using offset poles is reported. Status of development on a 94 GHz, 180 kW, pulsed amplifier is discussed with results from numerical simulation
Virtual high screening throughput and design of 14α-lanosterol ...
African Journals Online (AJOL)
STORAGESEVER
2009-07-06
Jul 6, 2009 ... Virtual high screening throughput and design of. 14α-lanosterol demethylase inhibitors against. Mycobacterium tuberculosis. Hildebert B. Maurice1*, Esther Tuarira1 and Kennedy Mwambete2. 1School of Pharmaceutical Sciences, Institute of Allied Health Sciences, Muhimbili University of Health and.
Directory of Open Access Journals (Sweden)
Dongfang Li
2015-10-01
Full Text Available Random number generators (RNG play an important role in many sensor network systems and applications, such as those requiring secure and robust communications. In this paper, we develop a high-security and high-throughput hardware true random number generator, called PUFKEY, which consists of two kinds of physical unclonable function (PUF elements. Combined with a conditioning algorithm, true random seeds are extracted from the noise on the start-up pattern of SRAM memories. These true random seeds contain full entropy. Then, the true random seeds are used as the input for a non-deterministic hardware RNG to generate a stream of true random bits with a throughput as high as 803 Mbps. The experimental results show that the bitstream generated by the proposed PUFKEY can pass all standard national institute of standards and technology (NIST randomness tests and is resilient to a wide range of security attacks.
Li, Dongfang; Lu, Zhaojun; Zou, Xuecheng; Liu, Zhenglin
2015-10-16
Random number generators (RNG) play an important role in many sensor network systems and applications, such as those requiring secure and robust communications. In this paper, we develop a high-security and high-throughput hardware true random number generator, called PUFKEY, which consists of two kinds of physical unclonable function (PUF) elements. Combined with a conditioning algorithm, true random seeds are extracted from the noise on the start-up pattern of SRAM memories. These true random seeds contain full entropy. Then, the true random seeds are used as the input for a non-deterministic hardware RNG to generate a stream of true random bits with a throughput as high as 803 Mbps. The experimental results show that the bitstream generated by the proposed PUFKEY can pass all standard national institute of standards and technology (NIST) randomness tests and is resilient to a wide range of security attacks.
High-energy nuclear reaction mechanisms - fission, fragmentation and spallation
International Nuclear Information System (INIS)
Kaufman, S.B.
1987-01-01
Measurements of the correlations in kinetic energy, mass, charge, and angle of coincident fragments formed in high-energy nuclear reactions have helped to characterize the processes of fission, fragmentation and spallation. For example, fission or fission-like two-body breakup mechanisms result in a strong angular correlation between two heavy fragments; in addition, the momentum transfer in the reaction can be deduced from the correlation. Another example is the multiplicity of light charged particles associated with a given heavy fragment, which is a measure of the violence of the collision, thus distinguishing between central and peripheral collisions. A summary of what has been learned about these processes from such studies will be given, along with some suggestions for further experiments
Quark and gluon fragmentation in high energy e+e- annihilation
International Nuclear Information System (INIS)
Saxon, D.H.
1986-07-01
The paper on quark and gluon fragmentation in high energy e + e - annihilation is based on lectures given at the International School of High Energy Physics, Yugoslavia, 1986. Fragmentation Models, charged particle multiplicity, Bose-Einstein correlations, single particle inclusive distributions, hadrons in jets, leading particle effects, baryon production, comparison of quark and gluon jets, and the string effect, are all discussed. (UK)
An energy efficient hybrid interference-resilient frame fragmentation for wireless sensor networks
Meer, Ammar M.; Daghistani, Anas; Shihada, Basem
2015-01-01
Frame fragmentation into small blocks with dedicated error detection codes per block can reduce the unnecessary retransmission of the correctly received blocks. However, the optimal block size varies based on the wireless channel conditions. Further, blocks within a single frame may have different optimal sizes based on variations in interference patterns. This paper proposes a hybrid interference-resilient frame fragmentation (Hi-Frag) link-layer scheme for wireless sensor networks. It effectively addresses the challenges associated with dynamic partitioning of blocks while accounting for the observed error patterns. Hi-Frag is the first work to introduce an adaptive frame fragmentation scheme with hybrid block sizing, implemented and evaluated on a real WSN testbed. Hi-Frag shows substantial enhancements over fixed-size partial packet recovery protocols, achieving up to 2.5× improvement in throughput when the channel condition is noisy, while reducing network delays by up to 14% of the observed delay. On average, Hi-Frag shows 35% gain in throughput compared to static fragmentation approaches across all channel conditions used in our experiments. Also, Hi-Frag lowers the energy consumed per useful bit by 66% on average compared to conventional protocols, which increases the energy efficiency.
An energy efficient hybrid interference-resilient frame fragmentation for wireless sensor networks
Meer, Ammar M.
2015-08-30
Frame fragmentation into small blocks with dedicated error detection codes per block can reduce the unnecessary retransmission of the correctly received blocks. However, the optimal block size varies based on the wireless channel conditions. Further, blocks within a single frame may have different optimal sizes based on variations in interference patterns. This paper proposes a hybrid interference-resilient frame fragmentation (Hi-Frag) link-layer scheme for wireless sensor networks. It effectively addresses the challenges associated with dynamic partitioning of blocks while accounting for the observed error patterns. Hi-Frag is the first work to introduce an adaptive frame fragmentation scheme with hybrid block sizing, implemented and evaluated on a real WSN testbed. Hi-Frag shows substantial enhancements over fixed-size partial packet recovery protocols, achieving up to 2.5× improvement in throughput when the channel condition is noisy, while reducing network delays by up to 14% of the observed delay. On average, Hi-Frag shows 35% gain in throughput compared to static fragmentation approaches across all channel conditions used in our experiments. Also, Hi-Frag lowers the energy consumed per useful bit by 66% on average compared to conventional protocols, which increases the energy efficiency.
Millimeter-wave power amplifiers
du Preez, Jaco
2017-01-01
This book provides a detailed review of millimeter-wave power amplifiers, discussing design issues and performance limitations commonly encountered in light of the latest research. Power amplifiers, which are able to provide high levels of output power and linearity while being easily integrated with surrounding circuitry, are a crucial component in wireless microwave systems. The book is divided into three parts, the first of which introduces readers to mm-wave wireless systems and power amplifiers. In turn, the second focuses on design principles and EDA concepts, while the third discusses future trends in power amplifier research. The book provides essential information on mm-wave power amplifier theory, as well as the implementation options and technologies involved in their effective design, equipping researchers, circuit designers and practicing engineers to design, model, analyze, test and implement high-performance, spectrally clean and energy-efficient mm-wave systems.
Breen, Lucas; Cao, Lulu; Eom, Kirsten; Srajer Gajdosik, Martina; Camara, Lila; Giacometti, Jasminka; Dupuy, Damian E; Josic, Djuro
2012-05-01
Fast, cost-effective and reproducible isolation of IgM from plasma is invaluable to the study of IgM and subsequent understanding of the human immune system. Additionally, vast amounts of information regarding human physiology and disease can be derived from analysis of the low abundance proteome of the plasma. In this study, methods were optimized for both the high-throughput isolation of IgM from human plasma, and the high-throughput isolation and fractionation of low abundance plasma proteins. To optimize the chromatographic isolation of IgM from human plasma, many variables were examined including chromatography resin, mobile phases, and order of chromatographic separations. Purification of IgM was achieved most successfully through isolation of immunoglobulin from human plasma using Protein A chromatography with a specific resin followed by subsequent fractionation using QA strong anion exchange chromatography. Through these optimization experiments, an additional method was established to prepare plasma for analysis of low abundance proteins. This method involved chromatographic depletion of high-abundance plasma proteins and reduction of plasma proteome complexity through further chromatographic fractionation. Purification of IgM was achieved with high purity as confirmed by SDS-PAGE and IgM-specific immunoblot. Isolation and fractionation of low abundance protein was also performed successfully, as confirmed by SDS-PAGE and mass spectrometry analysis followed by label-free quantitative spectral analysis. The level of purity of the isolated IgM allows for further IgM-specific analysis of plasma samples. The developed fractionation scheme can be used for high throughput screening of human plasma in order to identify low and high abundance proteins as potential prognostic and diagnostic disease biomarkers.
Power Amplifiers in CMOS Technology: A contribution to power amplifier theory and techniques
Acar, M.
2011-01-01
In order to meet the demands from the market on cheaper, miniaturized mobile communications devices realization of RF power amplifiers in the mainstream CMOS technology is essential. In general, CMOS Power Amplifiers (PAs) require high voltage to decrease the matching network losses and for high
Wide bandwidth transimpedance amplifier for extremely high sensitivity continuous measurements.
Ferrari, Giorgio; Sampietro, Marco
2007-09-01
This article presents a wide bandwidth transimpedance amplifier based on the series of an integrator and a differentiator stage, having an additional feedback loop to discharge the standing current from the device under test (DUT) to ensure an unlimited measuring time opportunity when compared to switched discharge configurations while maintaining a large signal amplification over the full bandwidth. The amplifier shows a flat response from 0.6 Hz to 1.4 MHz, the capability to operate with leakage currents from the DUT as high as tens of nanoamperes, and rail-to-rail dynamic range for sinusoidal current signals independent of the DUT leakage current. Also available is a monitor output of the stationary current to track experimental slow drifts. The circuit is ideal for noise spectral and impedance measurements of nanodevices and biomolecules when in the presence of a physiological medium and in all cases where high sensitivity current measurements are requested such as in scanning probe microscopy systems.
Directory of Open Access Journals (Sweden)
Irena Trbojević-Akmačić
2016-06-01
Full Text Available Changes in protein glycosylation are related to different diseases and have a potential as diagnostic and prognostic disease biomarkers. Transferrin (Tf glycosylation changes are common marker for congenital disorders of glycosylation. However, biological interindividual variability of Tf N-glycosylation and genes involved in glycosylation regulation are not known. Therefore, high-throughput Tf isolation method and large scale glycosylation studies are needed in order to address these questions. Due to their unique chromatographic properties, the use of chromatographic monoliths enables very fast analysis cycle, thus significantly increasing sample preparation throughput. Here, we are describing characterization of novel immunoaffinity-based monolithic columns in a 96-well plate format for specific high-throughput purification of human Tf from blood plasma. We optimized the isolation and glycan preparation procedure for subsequent ultra performance liquid chromatography (UPLC analysis of Tf N-glycosylation and managed to increase the sensitivity for approximately three times compared to initial experimental conditions, with very good reproducibility. This work is licensed under a Creative Commons Attribution 4.0 International License.
High rate amplifier-digitizer system for liquid argon calorimeters
International Nuclear Information System (INIS)
Droege, T.F.; Lobkowicz, F.; Fukushima, Y.
1978-01-01
A low-cost charge amplifier for a liquid argon photon detector and a new method for pulse height analysis are described. This scheme is suitable for high-energy photon detection with high counting rate. Samples of preamplifer output are taken just before and just after the arrival of the charge from the detector. The difference of these samples provides a stable pedestal and rejects low frequency noise. Short two-pulse resolving time (approximately equal to 200ns) is achieved. 6 refs
Amplification of deoxyribonucleic acid (DNA) fragment using two ...
African Journals Online (AJOL)
user
2011-04-11
Apr 11, 2011 ... polymerases on this method, whether different lengths of. DNA fragments could be amplified by two-step PCR and the difference of DNA product quality produced by the two methods. MATERIALS AND METHODS. PCR template and reagents. Enterobacteria phage lambda DNA (GenBank no: V00636) ...
Several fluidic tuned AC Amplifiers were designed and tested. Interstage tuning and feedback designs are considered. Good results were obtained...corresponding Q’s as high as 12. Element designs and test results of one, two, and three stage amplifiers are presented. AC Modulated Carrier Systems
High-throughput verification of transcriptional starting sites by Deep-RACE
DEFF Research Database (Denmark)
Olivarius, Signe; Plessy, Charles; Carninci, Piero
2009-01-01
We present a high-throughput method for investigating the transcriptional starting sites of genes of interest, which we named Deep-RACE (Deep–rapid amplification of cDNA ends). Taking advantage of the latest sequencing technology, it allows the parallel analysis of multiple genes and is free...
International Nuclear Information System (INIS)
Ramakumar, Adarsh
2016-01-01
Nuclear or radiation mass casualties require individual, rapid, and accurate dose-based triage of exposed subjects for cytokine therapy and supportive care, to save life. Radiation mass casualties will demand high-throughput individual diagnostic dose assessment for medical management of exposed subjects. Cytogenetic techniques are widely used for triage and definitive radiation biodosimetry. Prototype platform to demonstrate high-throughput microfluidic micro incubation to support the logistics of sample in miniaturized incubators from the site of accident to analytical labs has been developed. Efforts have been made, both at the level of developing concepts and advanced system for higher throughput in processing the samples and also implementing better and efficient methods of logistics leading to performance of lab-on-chip analyses. Automated high-throughput platform with automated feature extraction, storage, cross platform data linkage, cross platform validation and inclusion of multi-parametric biomarker approaches will provide the first generation high-throughput platform systems for effective medical management, particularly during radiation mass casualty events
Yennawar, Neela H; Fecko, Julia A; Showalter, Scott A; Bevilacqua, Philip C
2016-01-01
Many labs have conventional calorimeters where denaturation and binding experiments are setup and run one at a time. While these systems are highly informative to biopolymer folding and ligand interaction, they require considerable manual intervention for cleaning and setup. As such, the throughput for such setups is limited typically to a few runs a day. With a large number of experimental parameters to explore including different buffers, macromolecule concentrations, temperatures, ligands, mutants, controls, replicates, and instrument tests, the need for high-throughput automated calorimeters is on the rise. Lower sample volume requirements and reduced user intervention time compared to the manual instruments have improved turnover of calorimetry experiments in a high-throughput format where 25 or more runs can be conducted per day. The cost and efforts to maintain high-throughput equipment typically demands that these instruments be housed in a multiuser core facility. We describe here the steps taken to successfully start and run an automated biological calorimetry facility at Pennsylvania State University. Scientists from various departments at Penn State including Chemistry, Biochemistry and Molecular Biology, Bioengineering, Biology, Food Science, and Chemical Engineering are benefiting from this core facility. Samples studied include proteins, nucleic acids, sugars, lipids, synthetic polymers, small molecules, natural products, and virus capsids. This facility has led to higher throughput of data, which has been leveraged into grant support, attracting new faculty hire and has led to some exciting publications. © 2016 Elsevier Inc. All rights reserved.
Crystal Symmetry Algorithms in a High-Throughput Framework for Materials
Taylor, Richard
The high-throughput framework AFLOW that has been developed and used successfully over the last decade is improved to include fully-integrated software for crystallographic symmetry characterization. The standards used in the symmetry algorithms conform with the conventions and prescriptions given in the International Tables of Crystallography (ITC). A standard cell choice with standard origin is selected, and the space group, point group, Bravais lattice, crystal system, lattice system, and representative symmetry operations are determined. Following the conventions of the ITC, the Wyckoff sites are also determined and their labels and site symmetry are provided. The symmetry code makes no assumptions on the input cell orientation, origin, or reduction and has been integrated in the AFLOW high-throughput framework for materials discovery by adding to the existing code base and making use of existing classes and functions. The software is written in object-oriented C++ for flexibility and reuse. A performance analysis and examination of the algorithms scaling with cell size and symmetry is also reported.
Development of Control Applications for High-Throughput Protein Crystallography Experiments
International Nuclear Information System (INIS)
Gaponov, Yurii A.; Matsugaki, Naohiro; Honda, Nobuo; Sasajima, Kumiko; Igarashi, Noriyuki; Hiraki, Masahiko; Yamada, Yusuke; Wakatsuki, Soichi
2007-01-01
An integrated client-server control system (PCCS) with a unified relational database (PCDB) has been developed for high-throughput protein crystallography experiments on synchrotron beamlines. The major steps in protein crystallographic experiments (purification, crystallization, crystal harvesting, data collection, and data processing) are integrated into the software. All information necessary for performing protein crystallography experiments is stored in the PCDB database (except raw X-ray diffraction data, which is stored in the Network File Server). To allow all members of a protein crystallography group to participate in experiments, the system was developed as a multi-user system with secure network access based on TCP/IP secure UNIX sockets. Secure remote access to the system is possible from any operating system with X-terminal and SSH/X11 (Secure Shell with graphical user interface) support. Currently, the system covers the high-throughput X-ray data collection stages and is being commissioned at BL5A and NW12A (PF, PF-AR, KEK, Tsukuba, Japan)
The design of a linear L-band high power amplifier for mobile communication satellites
Whittaker, N.; Brassard, G.; Li, E.; Goux, P.
1990-01-01
A linear L-band solid state high power amplifier designed for the space segment of the Mobile Satellite (MSAT) mobile communication system is described. The amplifier is capable of producing 35 watts of RF power with multitone signal at an efficiency of 25 percent and with intermodulation products better than 16 dB below carrier.
Mode control in a high-gain relativistic klystron amplifier
Li, Zheng-Hong; Zhang, Hong; Ju, Bing-Quan; Su, Chang; Wu, Yang
2010-05-01
Middle cavities between the input and output cavity can be used to decrease the required input RF power for the relativistic klystron amplifier. Meanwhile higher modes, which affect the working mode, are also easy to excite in a device with more middle cavities. In order for the positive feedback process for higher modes to be excited, a special measure is taken to increase the threshold current for such modes. Higher modes' excitation will be avoided when the threshold current is significantly larger than the beam current. So a high-gain S-band relativistic klystron amplifier is designed for the beam of current 5 kA and beam voltage 600 kV. Particle in cell simulations show that the gain is 1.6 × 105 with the input RF power of 6.8 kW, and that the output RF power reaches 1.1 GW.
An Ecometric Study of Recent Microfossils using High-throughput Imaging
Elder, L. E.; Hull, P. M.; Hsiang, A. Y.; Kahanamoku, S.
2016-02-01
The era of Big Data has ushered in the potential to collect population level information in a manageable time frame. Taxon-free morphological trait analysis, referred to as ecometrics, can be used to examine and compare ecological dynamics between communities with entirely different species compositions. Until recently population level studies of morphology were difficult because of the time intensive task of collecting measurements. To overcome this, we implemented advances in imaging technology and created software to automate measurements. This high-throughput set of methods collects assemblage-scale data, with methods tuned to foraminiferal samples (e.g., light objects on a dark background). Methods include serial focused dark-field microscopy, custom software (Automorph) to batch process images, extract 2D and 3D shape parameters and frames, and implement landmark-free geometric morphometric analyses. Informatics pipelines were created to store, catalog and share images through the Yale Peabody Museum(YPM; peabody.yale.edu). We openly share software and images to enhance future data discovery. In less than a year we have generated over 25TB of high resolution semi 3D images for this initial study. Here, we take the first step towards developing ecometric approaches for open ocean microfossil communities with a calibration study of community shape in recent sediments. We will present an overview of the `shape' of modern planktonic foraminiferal communities from 25 Atlantic core top samples (23 sites in the North and Equatorial Atlantic; 2 sites in the South Atlantic). In total, more than 100,000 microfossils and fragments were imaged from these sites' sediment cores, an unprecedented morphometric sample set. Correlates of community shape, including diversity, temperature, and latitude, will be discussed. These methods have also been applied to images of limpets and fish teeth to date, and have the potential to be used on modern taxa to extract meaningful
Thermo-optical effects in high-power Ytterbium-doped fiber amplifiers
DEFF Research Database (Denmark)
Hansen, Kristian Rymann; Alkeskjold, Thomas Tanggaard; Broeng, Jes
2011-01-01
We investigate the effect of temperature gradients in high-power Yb-doped fiber amplifiers by a numerical beam propagation model, which takes thermal effects into account in a self-consistent way. The thermally induced change in the refractive index of the fiber leads to a thermal lensing effect...
Fluorescence-based high-throughput screening of dicer cleavage activity
Czech Academy of Sciences Publication Activity Database
Podolská, Kateřina; Sedlák, David; Bartůněk, Petr; Svoboda, Petr
2014-01-01
Roč. 19, č. 3 (2014), s. 417-426 ISSN 1087-0571 R&D Projects: GA ČR GA13-29531S; GA MŠk(CZ) LC06077; GA MŠk LM2011022 Grant - others:EMBO(DE) 1483 Institutional support: RVO:68378050 Keywords : Dicer * siRNA * high-throughput screening Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.423, year: 2014
MMIC for High-Efficiency Ka-BAnd GaN Power Amplifiers (2007043), Phase I
National Aeronautics and Space Administration — This proposal addresses the need for high-efficiency, high-output power amplifiers operating in the Ka-band frequencies. For space communications, the power...
A high efficiency Ku-band radial line relativistic klystron amplifier
Energy Technology Data Exchange (ETDEWEB)
Dang, Fangchao; Zhang, Xiaoping, E-mail: zhangxiaoping@nudt.edu.cn; Zhong, Huihuang; Zhang, Jun; Ju, Jinchuan [College of Optoelectronic Science and Engineering, National University of Defense Technology, Changsha 410073 (China)
2016-07-15
To achieve the gigawatt-level microwave amplification output at Ku-band, a radial-line relativistic klystron amplifier is proposed and investigated in this paper. Different from the annular electron beam in conventional axial relativistic klystron amplifiers, a radial-radiated electron beam is employed in this proposed klystron. Owing to its radially spreading speciality, the electron density and space charge effect are markedly weakened during the propagation in the radial line drift tube. Additionally, the power capacity, especially in the output cavity, is enhanced significantly because of its large volume, which is profitable for the long pulse operation. Particle-in-cell simulation results demonstrate that a high power microwave with the power of 3 GW and the frequency of 14.25 GHz is generated with a 500 kV, 12 kA electron beam excitation and the 30 kW radio-frequency signal injection. The power conversion efficiency is 50%, and the gain is about 50 dB. Meanwhile, there is insignificant electron beam self-excitation in the proposed structure by the adoption of two transverse electromagnetic reflectors. The relative phase difference between the injected signals and output microwaves keeps stable after the amplifier saturates.
High throughput electrophysiology: new perspectives for ion channel drug discovery
DEFF Research Database (Denmark)
Willumsen, Niels J; Bech, Morten; Olesen, Søren-Peter
2003-01-01
. A cornerstone in current drug discovery is high throughput screening assays which allow examination of the activity of specific ion channels though only to a limited extent. Conventional patch clamp remains the sole technique with sufficiently high time resolution and sensitivity required for precise and direct....... The introduction of new powerful HTS electrophysiological techniques is predicted to cause a revolution in ion channel drug discovery....
Novel high-throughput cell-based hybridoma screening methodology using the Celigo Image Cytometer.
Zhang, Haohai; Chan, Leo Li-Ying; Rice, William; Kassam, Nasim; Longhi, Maria Serena; Zhao, Haitao; Robson, Simon C; Gao, Wenda; Wu, Yan
2017-08-01
Hybridoma screening is a critical step for antibody discovery, which necessitates prompt identification of potential clones from hundreds to thousands of hybridoma cultures against the desired immunogen. Technical issues associated with ELISA- and flow cytometry-based screening limit accuracy and diminish high-throughput capability, increasing time and cost. Conventional ELISA screening with coated antigen is also impractical for difficult-to-express hydrophobic membrane antigens or multi-chain protein complexes. Here, we demonstrate novel high-throughput screening methodology employing the Celigo Image Cytometer, which avoids nonspecific signals by contrasting antibody binding signals directly on living cells, with and without recombinant antigen expression. The image cytometry-based high-throughput screening method was optimized by detecting the binding of hybridoma supernatants to the recombinant antigen CD39 expressed on Chinese hamster ovary (CHO) cells. Next, the sensitivity of the image cytometer was demonstrated by serial dilution of purified CD39 antibody. Celigo was used to measure antibody affinities of commercial and in-house antibodies to membrane-bound CD39. This cell-based screening procedure can be completely accomplished within one day, significantly improving throughput and efficiency of hybridoma screening. Furthermore, measuring direct antibody binding to living cells eliminated both false positive and false negative hits. The image cytometry method was highly sensitive and versatile, and could detect positive antibody in supernatants at concentrations as low as ~5ng/mL, with concurrent K d binding affinity coefficient determination. We propose that this screening method will greatly facilitate antibody discovery and screening technologies. Copyright © 2017 Elsevier B.V. All rights reserved.
Kuptsov, G. V.; Petrov, V. V.; Petrov, V. A.; Laptev, A. V.; Kirpichnikov, A. V.; Pestryakov, E. V.
2018-04-01
The source of instabilities in the multidisk diode-pumped high power Yb:YAG laser amplifier with cryogenic closed-loop cooling in the laser amplification channel of the high-intensity laser system with 1 kHz repetition rate was determined. Dissected copper mounts were designed and used to suppress instabilities and to achieve repeatability of the system. The equilibrium temperature dependency of the active elements on average power was measured. The seed laser for the multidisk amplifier was numerically simulated and designed to allow one to increase pulses output energy after the amplifier up to 500 mJ.
In silico fragment-based drug design.
Konteatis, Zenon D
2010-11-01
In silico fragment-based drug design (FBDD) is a relatively new approach inspired by the success of the biophysical fragment-based drug discovery field. Here, we review the progress made by this approach in the last decade and showcase how it complements and expands the capabilities of biophysical FBDD and structure-based drug design to generate diverse, efficient drug candidates. Advancements in several areas of research that have enabled the development of in silico FBDD and some applications in drug discovery projects are reviewed. The reader is introduced to various computational methods that are used for in silico FBDD, the fragment library composition for this technique, special applications used to identify binding sites on the surface of proteins and how to assess the druggability of these sites. In addition, the reader will gain insight into the proper application of this approach from examples of successful programs. In silico FBDD captures a much larger chemical space than high-throughput screening and biophysical FBDD increasing the probability of developing more diverse, patentable and efficient molecules that can become oral drugs. The application of in silico FBDD holds great promise for historically challenging targets such as protein-protein interactions. Future advances in force fields, scoring functions and automated methods for determining synthetic accessibility will all aid in delivering more successes with in silico FBDD.
Production of light fragments in hA collisions at high energies
International Nuclear Information System (INIS)
Braun, M.A.; Vechernin, V.V.
1988-12-01
Production of fast relativistic light fragments in hA collisions at high energies is considered. Direct coalescence of produced nucleons into fragments is shown to be the main mechanism for fragment production. The influence of the nuclear field is small and is not described by the well-known Butler-Pearson formulas. The coalescence coefficient strongly depends on the angle and on the behaviour of the fragment wave function at small internucleon distances. (author). 14 refs, 7 figs
De Barba, M; Miquel, C; Lobréaux, S; Quenette, P Y; Swenson, J E; Taberlet, P
2017-05-01
Microsatellite markers have played a major role in ecological, evolutionary and conservation research during the past 20 years. However, technical constrains related to the use of capillary electrophoresis and a recent technological revolution that has impacted other marker types have brought to question the continued use of microsatellites for certain applications. We present a study for improving microsatellite genotyping in ecology using high-throughput sequencing (HTS). This approach entails selection of short markers suitable for HTS, sequencing PCR-amplified microsatellites on an Illumina platform and bioinformatic treatment of the sequence data to obtain multilocus genotypes. It takes advantage of the fact that HTS gives direct access to microsatellite sequences, allowing unambiguous allele identification and enabling automation of the genotyping process through bioinformatics. In addition, the massive parallel sequencing abilities expand the information content of single experimental runs far beyond capillary electrophoresis. We illustrated the method by genotyping brown bear samples amplified with a multiplex PCR of 13 new microsatellite markers and a sex marker. HTS of microsatellites provided accurate individual identification and parentage assignment and resulted in a significant improvement of genotyping success (84%) of faecal degraded DNA and costs reduction compared to capillary electrophoresis. The HTS approach holds vast potential for improving success, accuracy, efficiency and standardization of microsatellite genotyping in ecological and conservation applications, especially those that rely on profiling of low-quantity/quality DNA and on the construction of genetic databases. We discuss and give perspectives for the implementation of the method in the light of the challenges encountered in wildlife studies. © 2016 John Wiley & Sons Ltd.
Ka-Band AlGaN/GaN HEMT high power and driver amplifier MMICs
Heijningen, M. van; Vliet, F.E. van; Quay, R.; Raay, F. van; Kiefer, R.; Mueller, S.; Krausse, D.; Seelmann-Eggebert, M.; Mikulla, M.; Schlechtweg, M.
2005-01-01
In this paper the MMIC technology, design and characterization of a high power amplifier and driver amplifier MMIC at 30 GHz in AlGaN/GaN HEMT technology are presented. The MMICs are designed using CPW technology on a 390 μm thick SiC substrate. The measured small-signal gain of the driver is 14 dB
e-Drug3D: 3D structure collections dedicated to drug repurposing and fragment-based drug design.
Pihan, Emilie; Colliandre, Lionel; Guichou, Jean-François; Douguet, Dominique
2012-06-01
In the drug discovery field, new uses for old drugs, selective optimization of side activities and fragment-based drug design (FBDD) have proved to be successful alternatives to high-throughput screening. e-Drug3D is a database of 3D chemical structures of drugs that provides several collections of ready-to-screen SD files of drugs and commercial drug fragments. They are natural inputs in studies dedicated to drug repurposing and FBDD. e-Drug3D collections are freely available at http://chemoinfo.ipmc.cnrs.fr/e-drug3d.html either for download or for direct in silico web-based screenings.
High throughput diffractive multi-beam femtosecond laser processing using a spatial light modulator
Energy Technology Data Exchange (ETDEWEB)
Kuang Zheng [Laser Group, Department of Engineering, University of Liverpool Brownlow Street, Liverpool L69 3GQ (United Kingdom)], E-mail: z.kuang@liv.ac.uk; Perrie, Walter [Laser Group, Department of Engineering, University of Liverpool Brownlow Street, Liverpool L69 3GQ (United Kingdom); Leach, Jonathan [Department of Physics and Astronomy, University of Glasgow, Glasgow G12 8QQ (United Kingdom); Sharp, Martin; Edwardson, Stuart P. [Laser Group, Department of Engineering, University of Liverpool Brownlow Street, Liverpool L69 3GQ (United Kingdom); Padgett, Miles [Department of Physics and Astronomy, University of Glasgow, Glasgow G12 8QQ (United Kingdom); Dearden, Geoff; Watkins, Ken G. [Laser Group, Department of Engineering, University of Liverpool Brownlow Street, Liverpool L69 3GQ (United Kingdom)
2008-12-30
High throughput femtosecond laser processing is demonstrated by creating multiple beams using a spatial light modulator (SLM). The diffractive multi-beam patterns are modulated in real time by computer generated holograms (CGHs), which can be calculated by appropriate algorithms. An interactive LabVIEW program is adopted to generate the relevant CGHs. Optical efficiency at this stage is shown to be {approx}50% into first order beams and real time processing has been carried out at 50 Hz refresh rate. Results obtained demonstrate high precision surface micro-structuring on silicon and Ti6Al4V with throughput gain >1 order of magnitude.
Fragment screening for drug leads by weak affinity chromatography (WAC-MS).
Ohlson, Sten; Duong-Thi, Minh-Dao
2018-02-23
Fragment-based drug discovery is an important tool for design of small molecule hit-to-lead compounds against various biological targets. Several approved drugs have been derived from an initial fragment screen and many such candidates are in various stages of clinical trials. Finding fragment hits, that are suitable for optimisation by medicinal chemists, is still a challenge as the binding between the small fragment and its target is weak in the range of mM to µM of K d and irrelevant non-specific interactions are abundant in this area of transient interactions. Fortunately, there are methods that can study weak interactions quite efficiently of which NMR, surface plasmon resonance (SPR) and X-ray crystallography are the most prominent. Now, a new technology based on zonal affinity chromatography, weak affinity chromatography (WAC), has been introduced which has remedied many of the problems with other technologies. By combining WAC with mass spectrometry (WAC-MS), it is a powerful tool to identify binders quantitatively in terms of affinity and kinetics either from fragment libraries or from complex mixtures of biological extracts. As WAC-MS can be multiplexed by analysing mixtures of fragments (20-100 fragments) in one sample, this approach yields high throughput, where a whole library of e.g. >2000 fragments can be analysed quantitatively within a day. WAC-MS is easy to perform, where the robustness and quality of HPLC is fully utilized. This review will highlight the rationale behind the application of WAC-MS for fragment screening in drug discovery. Copyright © 2018 Elsevier Inc. All rights reserved.
Toward reliable and repeatable automated STEM-EDS metrology with high throughput
Zhong, Zhenxin; Donald, Jason; Dutrow, Gavin; Roller, Justin; Ugurlu, Ozan; Verheijen, Martin; Bidiuk, Oleksii
2018-03-01
New materials and designs in complex 3D architectures in logic and memory devices have raised complexity in S/TEM metrology. In this paper, we report about a newly developed, automated, scanning transmission electron microscopy (STEM) based, energy dispersive X-ray spectroscopy (STEM-EDS) metrology method that addresses these challenges. Different methodologies toward repeatable and efficient, automated STEM-EDS metrology with high throughput are presented: we introduce the best known auto-EDS acquisition and quantification methods for robust and reliable metrology and present how electron exposure dose impacts the EDS metrology reproducibility, either due to poor signalto-noise ratio (SNR) at low dose or due to sample modifications at high dose conditions. Finally, we discuss the limitations of the STEM-EDS metrology technique and propose strategies to optimize the process both in terms of throughput and metrology reliability.
Modeling Disordered Materials with a High Throughput ab-initio Approach
2015-11-13
Modeling Disordered Materials with a High Throughput ab - initio Approach Kesong Yang,1 Corey Oses,2 and Stefano Curtarolo3, 4 1Department of...J. Furthmüller, Efficient iterative schemes for ab initio total-energy calculations using a plane-wave basis set, Phys. Rev. B 54, 11169–11186 (1996
A high-throughput pipeline for the design of real-time PCR signatures
Directory of Open Access Journals (Sweden)
Reifman Jaques
2010-06-01
Full Text Available Abstract Background Pathogen diagnostic assays based on polymerase chain reaction (PCR technology provide high sensitivity and specificity. However, the design of these diagnostic assays is computationally intensive, requiring high-throughput methods to identify unique PCR signatures in the presence of an ever increasing availability of sequenced genomes. Results We present the Tool for PCR Signature Identification (TOPSI, a high-performance computing pipeline for the design of PCR-based pathogen diagnostic assays. The TOPSI pipeline efficiently designs PCR signatures common to multiple bacterial genomes by obtaining the shared regions through pairwise alignments between the input genomes. TOPSI successfully designed PCR signatures common to 18 Staphylococcus aureus genomes in less than 14 hours using 98 cores on a high-performance computing system. Conclusions TOPSI is a computationally efficient, fully integrated tool for high-throughput design of PCR signatures common to multiple bacterial genomes. TOPSI is freely available for download at http://www.bhsai.org/downloads/topsi.tar.gz.
DEFF Research Database (Denmark)
Adams, Jonathan D; Ebbesen, Christian L.; Barnkob, Rune
2012-01-01
-slide format using low-cost, rapid-prototyping techniques. This high-throughput acoustophoresis chip (HTAC) utilizes a temperature-stabilized, standing ultrasonic wave, which imposes differential acoustic radiation forces that can separate particles according to size, density and compressibility. The device...
A Functional High-Throughput Assay of Myelination in Vitro
2014-07-01
Human induced pluripotent stem cells, hydrogels, 3D culture, electrophysiology, high-throughput assay 16. SECURITY CLASSIFICATION OF: 17...image the 3D rat dorsal root ganglion ( DRG ) cultures with sufficiently low background as to detect electrically-evoked depolarization events, as...of voltage-sensitive dyes. 8 We have made substantial progress in Task 4.1. We have fabricated neural fiber tracts from DRG explants and
Directory of Open Access Journals (Sweden)
Daniel W. H. Robarts
2014-07-01
Full Text Available In the past few decades, many investigations in the field of plant biology have employed selectively neutral, multilocus, dominant markers such as inter-simple sequence repeat (ISSR, random-amplified polymorphic DNA (RAPD, and amplified fragment length polymorphism (AFLP to address hypotheses at lower taxonomic levels. More recently, sequence-related amplified polymorphism (SRAP markers have been developed, which are used to amplify coding regions of DNA with primers targeting open reading frames. These markers have proven to be robust and highly variable, on par with AFLP, and are attained through a significantly less technically demanding process. SRAP markers have been used primarily for agronomic and horticultural purposes, developing quantitative trait loci in advanced hybrids and assessing genetic diversity of large germplasm collections. Here, we suggest that SRAP markers should be employed for research addressing hypotheses in plant systematics, biogeography, conservation, ecology, and beyond. We provide an overview of the SRAP literature to date, review descriptive statistics of SRAP markers in a subset of 171 publications, and present relevant case studies to demonstrate the applicability of SRAP markers to the diverse field of plant biology. Results of these selected works indicate that SRAP markers have the potential to enhance the current suite of molecular tools in a diversity of fields by providing an easy-to-use. highly variable marker with inherent biological significance.
High-Performance BiCMOS Transimpedance Amplifiers for Fiber-Optic Receivers
Directory of Open Access Journals (Sweden)
F. Touati
2007-12-01
Full Text Available High gain, wide bandwidth, low noise, and low-power transimpedance amplifiers based on new BiCMOS common- base topologies have been designed for fiber-optic receivers. In particular a design approach, hereafter called "A more- FET approach", added a new dimension to effectively optimize performance tradeoffs inherent in such circuits. Using conventional silicon 0.8 μm process parameters, simulated performance features of a total-FET transimpedance amplifier operating at 7.2 GHz, which is close to the technology fT of 12 GHz, are presented. The results are superior to those of similar recent designs and comparable to IC designs using GaAs technology. A detailed analysis of the design architecture, including a discussion on the effects of moving toward more FET-based designs is presented.
High-throughput anisotropic plasma etching of polyimide for MEMS
International Nuclear Information System (INIS)
Bliznetsov, Vladimir; Manickam, Anbumalar; Ranganathan, Nagarajan; Chen, Junwei
2011-01-01
This note describes a new high-throughput process of polyimide etching for the fabrication of MEMS devices with an organic sacrificial layer approach. Using dual frequency superimposed capacitively coupled plasma we achieved a vertical profile of polyimide with an etching rate as high as 3.5 µm min −1 . After the fabrication of vertical structures in a polyimide material, additional steps were performed to fabricate structural elements of MEMS by deposition of a SiO 2 layer and performing release etching of polyimide. (technical note)
REDItools: high-throughput RNA editing detection made easy.
Picardi, Ernesto; Pesole, Graziano
2013-07-15
The reliable detection of RNA editing sites from massive sequencing data remains challenging and, although several methodologies have been proposed, no computational tools have been released to date. Here, we introduce REDItools a suite of python scripts to perform high-throughput investigation of RNA editing using next-generation sequencing data. REDItools are in python programming language and freely available at http://code.google.com/p/reditools/. ernesto.picardi@uniba.it or graziano.pesole@uniba.it Supplementary data are available at Bioinformatics online.
Applications of high-throughput clonogenic survival assays in high-LET particle microbeams
Directory of Open Access Journals (Sweden)
Antonios eGeorgantzoglou
2016-01-01
Full Text Available Charged particle therapy is increasingly becoming a valuable tool in cancer treatment, mainly due to the favorable interaction of particle radiation with matter. Its application is still limited due, in part, to lack of data regarding the radiosensitivity of certain cell lines to this radiation type, especially to high-LET particles. From the earliest days of radiation biology, the clonogenic survival assay has been used to provide radiation response data. This method produces reliable data but it is not optimized for high-throughput microbeam studies with high-LET radiation where high levels of cell killing lead to a very low probability of maintaining cells’ clonogenic potential. A new method, therefore, is proposed in this paper, which could potentially allow these experiments to be conducted in a high-throughput fashion. Cells are seeded in special polypropylene dishes and bright-field illumination provides cell visualization. Digital images are obtained and cell detection is applied based on corner detection, generating individual cell targets as x-y points. These points in the dish are then irradiated individually by a micron field size high-LET microbeam. Post-irradiation, time-lapse imaging follows cells’ response. All irradiated cells are tracked by linking trajectories in all time-frames, based on finding their nearest position. Cell divisions are detected based on cell appearance and individual cell temporary corner density. The number of divisions anticipated is low due to the high probability of cell killing from high-LET irradiation. Survival curves are produced based on cell’s capacity to divide at least 4-5 times. The process is repeated for a range of doses of radiation. Validation shows the efficiency of the proposed cell detection and tracking method in finding cell divisions.
Applications of High-Throughput Clonogenic Survival Assays in High-LET Particle Microbeams.
Georgantzoglou, Antonios; Merchant, Michael J; Jeynes, Jonathan C G; Mayhead, Natalie; Punia, Natasha; Butler, Rachel E; Jena, Rajesh
2015-01-01
Charged particle therapy is increasingly becoming a valuable tool in cancer treatment, mainly due to the favorable interaction of particle radiation with matter. Its application is still limited due, in part, to lack of data regarding the radiosensitivity of certain cell lines to this radiation type, especially to high-linear energy transfer (LET) particles. From the earliest days of radiation biology, the clonogenic survival assay has been used to provide radiation response data. This method produces reliable data but it is not optimized for high-throughput microbeam studies with high-LET radiation where high levels of cell killing lead to a very low probability of maintaining cells' clonogenic potential. A new method, therefore, is proposed in this paper, which could potentially allow these experiments to be conducted in a high-throughput fashion. Cells are seeded in special polypropylene dishes and bright-field illumination provides cell visualization. Digital images are obtained and cell detection is applied based on corner detection, generating individual cell targets as x-y points. These points in the dish are then irradiated individually by a micron field size high-LET microbeam. Post-irradiation, time-lapse imaging follows cells' response. All irradiated cells are tracked by linking trajectories in all time-frames, based on finding their nearest position. Cell divisions are detected based on cell appearance and individual cell temporary corner density. The number of divisions anticipated is low due to the high probability of cell killing from high-LET irradiation. Survival curves are produced based on cell's capacity to divide at least four to five times. The process is repeated for a range of doses of radiation. Validation shows the efficiency of the proposed cell detection and tracking method in finding cell divisions.
Energy Technology Data Exchange (ETDEWEB)
Wen, Xianfei; Yang, Haori
2015-06-01
A major challenge in utilizing spectroscopy techniques for nuclear safeguards is to perform high-resolution measurements at an ultra-high throughput rate. Traditionally, piled-up pulses are rejected to ensure good energy resolution. To improve throughput rate, high-pass filters are normally implemented to shorten pulses. However, this reduces signal-to-noise ratio and causes degradation in energy resolution. In this work, a pulse pile-up recovery algorithm based on template-matching was proved to be an effective approach to achieve high-throughput gamma ray spectroscopy. First, a discussion of the algorithm was given in detail. Second, the algorithm was then successfully utilized to process simulated piled-up pulses from a scintillator detector. Third, the algorithm was implemented to analyze high rate data from a NaI detector, a silicon drift detector and a HPGe detector. The promising results demonstrated the capability of this algorithm to achieve high-throughput rate without significant sacrifice in energy resolution. The performance of the template-matching algorithm was also compared with traditional shaping methods. - Highlights: • A detailed discussion on the template-matching algorithm was given. • The algorithm was tested on data from a NaI and a Si detector. • The algorithm was successfully implemented on high rate data from a HPGe detector. • The performance of the algorithm was compared with traditional shaping methods. • The advantage of the algorithm in active interrogation was discussed.
International Nuclear Information System (INIS)
Heusinkveld, Harm J.; Westerink, Remco H.S.
2011-01-01
Calcium plays a crucial role in virtually all cellular processes, including neurotransmission. The intracellular Ca 2+ concentration ([Ca 2+ ] i ) is therefore an important readout in neurotoxicological and neuropharmacological studies. Consequently, there is an increasing demand for high-throughput measurements of [Ca 2+ ] i , e.g. using multi-well microplate readers, in hazard characterization, human risk assessment and drug development. However, changes in [Ca 2+ ] i are highly dynamic, thereby creating challenges for high-throughput measurements. Nonetheless, several protocols are now available for real-time kinetic measurement of [Ca 2+ ] i in plate reader systems, though the results of such plate reader-based measurements have been questioned. In view of the increasing use of plate reader systems for measurements of [Ca 2+ ] i a careful evaluation of current technologies is warranted. We therefore performed an extensive set of experiments, using two cell lines (PC12 and B35) and two fluorescent calcium-sensitive dyes (Fluo-4 and Fura-2), for comparison of a linear plate reader system with single cell fluorescence microscopy. Our data demonstrate that the use of plate reader systems for high-throughput real-time kinetic measurements of [Ca 2+ ] i is associated with many pitfalls and limitations, including erroneous sustained increases in fluorescence, limited sensitivity and lack of single cell resolution. Additionally, our data demonstrate that probenecid, which is often used to prevent dye leakage, effectively inhibits the depolarization-evoked increase in [Ca 2+ ] i . Overall, the data indicate that the use of current plate reader-based strategies for high-throughput real-time kinetic measurements of [Ca 2+ ] i is associated with caveats and limitations that require further investigation. - Research highlights: → The use of plate readers for high-throughput screening of intracellular Ca 2+ is associated with many pitfalls and limitations. → Single cell
Filter Paper-based Nucleic Acid Storage in High-throughput Solid Tumor Genotyping.
Stachler, Matthew; Jia, Yonghui; Sharaf, Nematullah; Wade, Jacqueline; Longtine, Janina; Garcia, Elizabeth; Sholl, Lynette M
2015-01-01
Molecular testing of tumors from formalin-fixed paraffin-embedded (FFPE) tissue blocks is central to clinical practice; however, it requires histology support and increases test turnaround time. Prospective fresh frozen tissue collection requires special handling, additional storage space, and may not be feasible for small specimens. Filter paper-based collection of tumor DNA reduces the need for histology support, requires little storage space, and preserves high-quality nucleic acid. We investigated the performance of tumor smears on filter paper in solid tumor genotyping, as compared with paired FFPE samples. Whatman FTA Micro Card (FTA preps) smears were prepared from 21 fresh tumor samples. A corresponding cytology smear was used to assess tumor cellularity and necrosis. DNA was isolated from FTA preps and FFPE core samples using automated methods and quantified using SYBR green dsDNA detection. Samples were genotyped for 471 mutations on a mass spectrophotometry-based platform (Sequenom). DNA concentrations from FTA preps and FFPE correlated for untreated carcinomas but not for mesenchymal tumors (Spearman σ=0.39 and σ=-0.1, respectively). Average DNA concentrations were lower from FTA preps as compared with FFPE, but DNA quality was higher with less fragmentation. Seventy-six percent of FTA preps and 86% of FFPE samples generated adequate DNA for genotyping. FTA preps tended to perform poorly for collection of DNA from pretreated carcinomas and mesenchymal neoplasms. Of the 16 paired DNA samples that were genotyped, 15 (94%) gave entirely concordant results. Filter paper-based sample preservation is a feasible alternative to FFPE for use in automated, high-throughput genotyping of carcinomas.
Parratt, Kirsten; Jeong, Jenny; Qiu, Peng; Roy, Krishnendu
2017-08-08
Studying cell behavior within 3D material niches is key to understanding cell biology in health and diseases, and developing biomaterials for regenerative medicine applications. Current approaches to studying these cell-material niches have low throughput and can only analyze a few replicates per experiment resulting in reduced measurement assurance and analytical power. Here, we report 3D material cytometry (3DMaC), a novel high-throughput method based on microfabricated, shape-specific 3D cell-material niches and imaging cytometry. 3DMaC achieves rapid and highly multiplexed analyses of very high replicate numbers ("n" of 10 4 -10 6 ) of 3D biomaterial constructs. 3DMaC overcomes current limitations of low "n", low-throughput, and "noisy" assays, to provide rapid and simultaneous analyses of potentially hundreds of parameters in 3D biomaterial cultures. The method is demonstrated here for a set of 85 000 events containing twelve distinct cell-biomaterial micro-niches along with robust, customized computational methods for high-throughput analytics with potentially unprecedented statistical power.
A robust robotic high-throughput antibody purification platform.
Schmidt, Peter M; Abdo, Michael; Butcher, Rebecca E; Yap, Min-Yin; Scotney, Pierre D; Ramunno, Melanie L; Martin-Roussety, Genevieve; Owczarek, Catherine; Hardy, Matthew P; Chen, Chao-Guang; Fabri, Louis J
2016-07-15
Monoclonal antibodies (mAbs) have become the fastest growing segment in the drug market with annual sales of more than 40 billion US$ in 2013. The selection of lead candidate molecules involves the generation of large repertoires of antibodies from which to choose a final therapeutic candidate. Improvements in the ability to rapidly produce and purify many antibodies in sufficient quantities reduces the lead time for selection which ultimately impacts on the speed with which an antibody may transition through the research stage and into product development. Miniaturization and automation of chromatography using micro columns (RoboColumns(®) from Atoll GmbH) coupled to an automated liquid handling instrument (ALH; Freedom EVO(®) from Tecan) has been a successful approach to establish high throughput process development platforms. Recent advances in transient gene expression (TGE) using the high-titre Expi293F™ system have enabled recombinant mAb titres of greater than 500mg/L. These relatively high protein titres reduce the volume required to generate several milligrams of individual antibodies for initial biochemical and biological downstream assays, making TGE in the Expi293F™ system ideally suited to high throughput chromatography on an ALH. The present publication describes a novel platform for purifying Expi293F™-expressed recombinant mAbs directly from cell-free culture supernatant on a Perkin Elmer JANUS-VariSpan ALH equipped with a plate shuttle device. The purification platform allows automated 2-step purification (Protein A-desalting/size exclusion chromatography) of several hundred mAbs per week. The new robotic method can purify mAbs with high recovery (>90%) at sub-milligram level with yields of up to 2mg from 4mL of cell-free culture supernatant. Copyright © 2016 Elsevier B.V. All rights reserved.
Nie, H-T; Li, Q; Kong, L-F
2014-06-01
Recombination analysis in gynogenetic diploids is a powerful tool for assessing the degree of inbreeding, investigating crossover events and understanding chiasma interference during meiosis. To estimate the marker-centromere recombination rate, the inheritance pattern of 654 amplified fragment length polymorphism (AFLP) markers was examined in the 72-h veliger larvae of two meiogynogenetic diploid families in the Pacific abalone (Haliotis discus hannai). The second-division segregation frequency (y) of the AFLP loci ranged from 0.00 to 0.96, with 23.9% of loci showing y-values higher than 0.67, evidencing the existence of interference. The average recombination frequency across the 654 AFLP loci was 0.45, allowing estimation of the fixation index of 0.55, indicating that meiotic gynogenesis could provide an effective means of rapid inbreeding in the Pacific abalone. The AFLP loci have a small proportion (4.4%) of y-values greater than 0.90, suggesting that a relatively low or intermediate degree of chiasma interference occurred in the abalone chromosomes. The information obtained in this study will enhance our understanding of the abalone genome and will be useful for genetic studies in the species. © 2014 Stichting International Foundation for Animal Genetics.
Reverse Phase Protein Arrays for High-Throughput Protein Measurements in Mammospheres
DEFF Research Database (Denmark)
Pedersen, Marlene Lemvig; Block, Ines; List, Markus
Protein Array (RPPA)-based readout format integrated into robotic siRNA screening. This technique would allow post-screening high-throughput quantification of protein changes. Recently, breast cancer stem cells (BCSCs) have attracted much attention, as a tumor- and metastasis-driving subpopulation...
High Throughput WAN Data Transfer with Hadoop-based Storage
Amin, A.; Bockelman, B.; Letts, J.; Levshina, T.; Martin, T.; Pi, H.; Sfiligoi, I.; Thomas, M.; Wüerthwein, F.
2011-12-01
Hadoop distributed file system (HDFS) is becoming more popular in recent years as a key building block of integrated grid storage solution in the field of scientific computing. Wide Area Network (WAN) data transfer is one of the important data operations for large high energy physics experiments to manage, share and process datasets of PetaBytes scale in a highly distributed grid computing environment. In this paper, we present the experience of high throughput WAN data transfer with HDFS-based Storage Element. Two protocols, GridFTP and fast data transfer (FDT), are used to characterize the network performance of WAN data transfer.
High Throughput WAN Data Transfer with Hadoop-based Storage
International Nuclear Information System (INIS)
Amin, A; Thomas, M; Bockelman, B; Letts, J; Martin, T; Pi, H; Sfiligoi, I; Wüerthwein, F; Levshina, T
2011-01-01
Hadoop distributed file system (HDFS) is becoming more popular in recent years as a key building block of integrated grid storage solution in the field of scientific computing. Wide Area Network (WAN) data transfer is one of the important data operations for large high energy physics experiments to manage, share and process datasets of PetaBytes scale in a highly distributed grid computing environment. In this paper, we present the experience of high throughput WAN data transfer with HDFS-based Storage Element. Two protocols, GridFTP and fast data transfer (FDT), are used to characterize the network performance of WAN data transfer.
Radar Waveform Pulse Analysis Measurement System for High-Power GaN Amplifiers
Thrivikraman, Tushar; Perkovic-Martin, Dragana; Jenabi, Masud; Hoffman, James
2012-01-01
This work presents a measurement system to characterize the pulsed response of high-power GaN amplifiers for use in space-based SAR platforms that require very strict amplitude and phase stability. The measurement system is able to record and analyze data on three different time scales: fast, slow, and long, which allows for greater detail of the mechanisms that impact amplitude and phase stability. The system is fully automated through MATLAB, which offers both instrument control capability and in-situ data processing. To validate this system, a high-power GaN HEMT amplifier operated in saturation was characterized. The fast time results show that variations to the amplitude and phase are correlated to DC supply transients, while long time characteristics are correlated to temperature changes.
A Primer on High-Throughput Computing for Genomic Selection
Directory of Open Access Journals (Sweden)
Xiao-Lin eWu
2011-02-01
Full Text Available High-throughput computing (HTC uses computer clusters to solve advanced computational problems, with the goal of accomplishing high throughput over relatively long periods of time. In genomic selection, for example, a set of markers covering the entire genome is used to train a model based on known data, and the resulting model is used to predict the genetic merit of selection candidates. Sophisticated models are very computationally demanding and, with several traits to be evaluated sequentially, computing time is long and output is low. In this paper, we present scenarios and basic principles of how HTC can be used in genomic selection, implemented using various techniques from simple batch processing to pipelining in distributed computer clusters. Various scripting languages, such as shell scripting, Perl and R, are also very useful to devise pipelines. By pipelining, we can reduce total computing time and consequently increase throughput. In comparison to the traditional data processing pipeline residing on the central processors, performing general purpose computation on a graphics processing unit (GPU provide a new-generation approach to massive parallel computing in genomic selection. While the concept of HTC may still be new to many researchers in animal breeding, plant breeding, and genetics, HTC infrastructures have already been built in many institutions, such as the University of Wisconsin – Madison, which can be leveraged for genomic selection, in terms of central processing unit (CPU capacity, network connectivity, storage availability, and middleware connectivity. Exploring existing HTC infrastructures as well as general purpose computing environments will further expand our capability to meet increasing computing demands posed by unprecedented genomic data that we have today. We anticipate that HTC will impact genomic selection via better statistical models, faster solutions, and more competitive products (e.g., from design of
Amplifier for nuclear spectrometry
International Nuclear Information System (INIS)
Suarez Canner, E.
1996-01-01
The spectroscopy amplifier model AE-020 is designed to adjust suitable the pulses coming from nuclear radiation detectors. Due to is capacity and specifications, the amplifier can be used together with high and medium resolution spectroscopy system
Chen, Hui; Jiang, Wen
2014-01-01
The oral microbiome is one of most diversity habitat in the human body and they are closely related with oral health and disease. As the technique developing,, high throughput sequencing has become a popular approach applied for oral microbial analysis. Oral bacterial profiles have been studied to explore the relationship between microbial diversity and oral diseases such as caries and periodontal disease. This review describes the application of high-throughput sequencing for characterizati...
Efficient production of antibody Fab fragment by transient gene expression in insect cells.
Mori, Keita; Hamada, Hirotsugu; Ogawa, Takafumi; Ohmuro-Matsuyama, Yuki; Katsuda, Tomohisa; Yamaji, Hideki
2017-08-01
Transient gene expression allows a rapid production of diverse recombinant proteins in early-stage preclinical and clinical developments of biologics. Insect cells have proven to be an excellent platform for the production of functional recombinant proteins. In the present study, the production of an antibody Fab fragment by transient gene expression in lepidopteran insect cells was investigated. The DNA fragments encoding heavy-chain (Hc; Fd fragment) and light-chain (Lc) genes of an Fab fragment were individually cloned into the plasmid vector pIHAneo, which contained the Bombyx mori actin promoter downstream of the B. mori nucleopolyhedrovirus (BmNPV) IE-1 transactivator and the BmNPV HR3 enhancer for high-level expression. Trichoplusia ni BTI-TN-5B1-4 (High Five) cells were co-transfected with the resultant plasmid vectors using linear polyethyleneimine. When the transfection efficiency was evaluated, a plasmid vector encoding an enhanced green fluorescent protein (EGFP) gene was also co-transfected. Transfection and culture conditions were optimized based on both the flow cytometry of the EGFP expression in transfected cells and the yield of the secreted Fab fragments determined by enzyme-linked immunosorbent assay (ELISA). Under optimal conditions, a yield of approximately 120 mg/L of Fab fragments was achieved in 5 days in a shake-flask culture. Transient gene expression in insect cells may offer a promising approach to the high-throughput production of recombinant proteins. Copyright © 2017 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.
Fragment assignment in the cloud with eXpress-D
2013-01-01
Background Probabilistic assignment of ambiguously mapped fragments produced by high-throughput sequencing experiments has been demonstrated to greatly improve accuracy in the analysis of RNA-Seq and ChIP-Seq, and is an essential step in many other sequence census experiments. A maximum likelihood method using the expectation-maximization (EM) algorithm for optimization is commonly used to solve this problem. However, batch EM-based approaches do not scale well with the size of sequencing datasets, which have been increasing dramatically over the past few years. Thus, current approaches to fragment assignment rely on heuristics or approximations for tractability. Results We present an implementation of a distributed EM solution to the fragment assignment problem using Spark, a data analytics framework that can scale by leveraging compute clusters within datacenters–“the cloud”. We demonstrate that our implementation easily scales to billions of sequenced fragments, while providing the exact maximum likelihood assignment of ambiguous fragments. The accuracy of the method is shown to be an improvement over the most widely used tools available and can be run in a constant amount of time when cluster resources are scaled linearly with the amount of input data. Conclusions The cloud offers one solution for the difficulties faced in the analysis of massive high-thoughput sequencing data, which continue to grow rapidly. Researchers in bioinformatics must follow developments in distributed systems–such as new frameworks like Spark–for ways to port existing methods to the cloud and help them scale to the datasets of the future. Our software, eXpress-D, is freely available at: http://github.com/adarob/express-d. PMID:24314033
PCR cycles above routine numbers do not compromise high-throughput DNA barcoding results.
Vierna, J; Doña, J; Vizcaíno, A; Serrano, D; Jovani, R
2017-10-01
High-throughput DNA barcoding has become essential in ecology and evolution, but some technical questions still remain. Increasing the number of PCR cycles above the routine 20-30 cycles is a common practice when working with old-type specimens, which provide little amounts of DNA, or when facing annealing issues with the primers. However, increasing the number of cycles can raise the number of artificial mutations due to polymerase errors. In this work, we sequenced 20 COI libraries in the Illumina MiSeq platform. Libraries were prepared with 40, 45, 50, 55, and 60 PCR cycles from four individuals belonging to four species of four genera of cephalopods. We found no relationship between the number of PCR cycles and the number of mutations despite using a nonproofreading polymerase. Moreover, even when using a high number of PCR cycles, the resulting number of mutations was low enough not to be an issue in the context of high-throughput DNA barcoding (but may still remain an issue in DNA metabarcoding due to chimera formation). We conclude that the common practice of increasing the number of PCR cycles should not negatively impact the outcome of a high-throughput DNA barcoding study in terms of the occurrence of point mutations.
A high throughput mechanical screening device for cartilage tissue engineering.
Mohanraj, Bhavana; Hou, Chieh; Meloni, Gregory R; Cosgrove, Brian D; Dodge, George R; Mauck, Robert L
2014-06-27
Articular cartilage enables efficient and near-frictionless load transmission, but suffers from poor inherent healing capacity. As such, cartilage tissue engineering strategies have focused on mimicking both compositional and mechanical properties of native tissue in order to provide effective repair materials for the treatment of damaged or degenerated joint surfaces. However, given the large number design parameters available (e.g. cell sources, scaffold designs, and growth factors), it is difficult to conduct combinatorial experiments of engineered cartilage. This is particularly exacerbated when mechanical properties are a primary outcome, given the long time required for testing of individual samples. High throughput screening is utilized widely in the pharmaceutical industry to rapidly and cost-effectively assess the effects of thousands of compounds for therapeutic discovery. Here we adapted this approach to develop a high throughput mechanical screening (HTMS) system capable of measuring the mechanical properties of up to 48 materials simultaneously. The HTMS device was validated by testing various biomaterials and engineered cartilage constructs and by comparing the HTMS results to those derived from conventional single sample compression tests. Further evaluation showed that the HTMS system was capable of distinguishing and identifying 'hits', or factors that influence the degree of tissue maturation. Future iterations of this device will focus on reducing data variability, increasing force sensitivity and range, as well as scaling-up to even larger (96-well) formats. This HTMS device provides a novel tool for cartilage tissue engineering, freeing experimental design from the limitations of mechanical testing throughput. © 2013 Published by Elsevier Ltd.
Recent advances in quantitative high throughput and high content data analysis.
Moutsatsos, Ioannis K; Parker, Christian N
2016-01-01
High throughput screening has become a basic technique with which to explore biological systems. Advances in technology, including increased screening capacity, as well as methods that generate multiparametric readouts, are driving the need for improvements in the analysis of data sets derived from such screens. This article covers the recent advances in the analysis of high throughput screening data sets from arrayed samples, as well as the recent advances in the analysis of cell-by-cell data sets derived from image or flow cytometry application. Screening multiple genomic reagents targeting any given gene creates additional challenges and so methods that prioritize individual gene targets have been developed. The article reviews many of the open source data analysis methods that are now available and which are helping to define a consensus on the best practices to use when analyzing screening data. As data sets become larger, and more complex, the need for easily accessible data analysis tools will continue to grow. The presentation of such complex data sets, to facilitate quality control monitoring and interpretation of the results will require the development of novel visualizations. In addition, advanced statistical and machine learning algorithms that can help identify patterns, correlations and the best features in massive data sets will be required. The ease of use for these tools will be important, as they will need to be used iteratively by laboratory scientists to improve the outcomes of complex analyses.
Importance of riparian remnants for frog species diversity in a highly fragmented rainforest.
Rodríguez-Mendoza, Clara; Pineda, Eduardo
2010-12-23
Tropical forests undergo continuous transformation to other land uses, resulting in landscapes typified by forest fragments surrounded by anthropogenic habitats. Small forest fragments, specifically strip-shaped remnants flanking streams (referred to as riparian remnants), can be particularly important for the maintenance and conservation of biodiversity within highly fragmented forests. We compared frog species diversity between riparian remnants, other forest fragments and cattle pastures in a tropical landscape in Los Tuxtlas, Mexico. We found similar species richness in the three habitats studied and a similar assemblage structure between riparian remnants and forest fragments, although species composition differed by 50 per cent. Frog abundance was halved in riparian remnants compared with forest fragments, but was twice that found in pastures. Our results suggest that riparian remnants play an important role in maintaining a portion of frog species diversity in a highly fragmented forest, particularly during environmentally stressful (hot and dry) periods. In this regard, however, the role of riparian remnants is complementary, rather than substitutive, with respect to the function of other forest fragments within the fragmented forest.
A continuous high-throughput bioparticle sorter based on 3D traveling-wave dielectrophoresis.
Cheng, I-Fang; Froude, Victoria E; Zhu, Yingxi; Chang, Hsueh-Chia; Chang, Hsien-Chang
2009-11-21
We present a high throughput (maximum flow rate approximately 10 microl/min or linear velocity approximately 3 mm/s) continuous bio-particle sorter based on 3D traveling-wave dielectrophoresis (twDEP) at an optimum AC frequency of 500 kHz. The high throughput sorting is achieved with a sustained twDEP particle force normal to the continuous through-flow, which is applied over the entire chip by a single 3D electrode array. The design allows continuous fractionation of micron-sized particles into different downstream sub-channels based on differences in their twDEP mobility on both sides of the cross-over. Conventional DEP is integrated upstream to focus the particles into a single levitated queue to allow twDEP sorting by mobility difference and to minimize sedimentation and field-induced lysis. The 3D electrode array design minimizes the offsetting effect of nDEP (negative DEP with particle force towards regions with weak fields) on twDEP such that both forces increase monotonically with voltage to further increase the throughput. Effective focusing and separation of red blood cells from debris-filled heterogeneous samples are demonstrated, as well as size-based separation of poly-dispersed liposome suspensions into two distinct bands at 2.3 to 4.6 microm and 1.5 to 2.7 microm, at the highest throughput recorded in hand-held chips of 6 microl/min.
Lin, Chia-Wei; Chung, Chien-Hung; Chen, Jo-Chu; Yeh, Shy-Dong; Ku, Hsin-Mei
2013-01-01
A better understanding of virus resistance mechanisms can offer more effective strategies to control virus diseases. Papaya ringspot virus (PRSV), Potyviridae, causes severe economical losses in papaya and cucurbit production worldwide. However, no resistance gene against PRSV has been identified to date. This study aimed to identify candidate PRSV resistance genes using cDNA-AFLP analysis and offered an open architecture and transcriptomic method to study those transcripts differentially expressed after virus inoculation. The whole genome expression profile of Cucumis metuliferus inoculated with PRSV was generated using cDNA-amplified fragment length polymorphism (cDNA-AFLP) method. Transcript derived fragments (TDFs) identified from the resistant line PI 292190 may represent genes involved in the mechanism of PRSV resistance. C. metuliferus susceptible Acc. 2459 and resistant PI 292190 lines were inoculated with PRSV and subsequently total RNA was isolated for cDNA-AFLP analysis. More than 400 TDFs were expressed specifically in resistant line PI 292190. A total of 116 TDFs were cloned and their expression patterns and putative functions in the PRSV-resistance mechanism were further characterized. Subsequently, 28 out of 116 candidates which showed two-fold higher expression levels in resistant PI 292190 than those in susceptible Acc. 2459 after virus inoculation were selected from the reverse northern blot and bioinformatic analysis. Furthermore, the time point expression profiles of these candidates by northern blot analysis suggested that they might play roles in resistance against PRSV and could potentially provide valuable information for controlling PRSV disease in the future. PMID:23874746
International Nuclear Information System (INIS)
Hodzic, Jasmina; Dingjan, Ilse; Maas, Mariëlle JP; Meulen-Muileman, Ida H van der; Menezes, Renee X de; Heukelom, Stan; Verheij, Marcel; Gerritsen, Winald R; Geldof, Albert A; Triest, Baukelien van; Beusechem, Victor W van
2015-01-01
Radiotherapy is one of the mainstays in the treatment for cancer, but its success can be limited due to inherent or acquired resistance. Mechanisms underlying radioresistance in various cancers are poorly understood and available radiosensitizers have shown only modest clinical benefit. There is thus a need to identify new targets and drugs for more effective sensitization of cancer cells to irradiation. Compound and RNA interference high-throughput screening technologies allow comprehensive enterprises to identify new agents and targets for radiosensitization. However, the gold standard assay to investigate radiosensitivity of cancer cells in vitro, the colony formation assay (CFA), is unsuitable for high-throughput screening. We developed a new high-throughput screening method for determining radiation susceptibility. Fast and uniform irradiation of batches up to 30 microplates was achieved using a Perspex container and a clinically employed linear accelerator. The readout was done by automated counting of fluorescently stained nuclei using the Acumen eX3 laser scanning cytometer. Assay performance was compared to that of the CFA and the CellTiter-Blue homogeneous uniform-well cell viability assay. The assay was validated in a whole-genome siRNA library screening setting using PC-3 prostate cancer cells. On 4 different cancer cell lines, the automated cell counting assay produced radiation dose response curves that followed a linear-quadratic equation and that exhibited a better correlation to the results of the CFA than did the cell viability assay. Moreover, the cell counting assay could be used to detect radiosensitization by silencing DNA-PKcs or by adding caffeine. In a high-throughput screening setting, using 4 Gy irradiated and control PC-3 cells, the effects of DNA-PKcs siRNA and non-targeting control siRNA could be clearly discriminated. We developed a simple assay for radiation susceptibility that can be used for high-throughput screening. This will aid
High-throughput sockets over RDMA for the Intel Xeon Phi coprocessor
Santogidis, Aram
2017-01-01
In this paper we describe the design, implementation and performance of Trans4SCIF, a user-level socket-like transport library for the Intel Xeon Phi coprocessor. Trans4SCIF library is primarily intended for high-throughput applications. It uses RDMA transfers over the native SCIF support, in a way that is transparent for the application, which has the illusion of using conventional stream sockets. We also discuss the integration of Trans4SCIF with the ZeroMQ messaging library, used extensively by several applications running at CERN. We show that this can lead to a substantial, up to 3x, increase of application throughput compared to the default TCP/IP transport option.
Patterning cell using Si-stencil for high-throughput assay
Wu, Jinbo
2011-01-01
In this communication, we report a newly developed cell pattering methodology by a silicon-based stencil, which exhibited advantages such as easy handling, reusability, hydrophilic surface and mature fabrication technologies. Cell arrays obtained by this method were used to investigate cell growth under a temperature gradient, which demonstrated the possibility of studying cell behavior in a high-throughput assay. This journal is © The Royal Society of Chemistry 2011.
High-throughput diagnosis of potato cyst nematodes in soil samples.
Reid, Alex; Evans, Fiona; Mulholland, Vincent; Cole, Yvonne; Pickup, Jon
2015-01-01
Potato cyst nematode (PCN) is a damaging soilborne pest of potatoes which can cause major crop losses. In 2010, a new European Union directive (2007/33/EC) on the control of PCN came into force. Under the new directive, seed potatoes can only be planted on land which has been found to be free from PCN infestation following an official soil test. A major consequence of the new directive was the introduction of a new harmonized soil sampling rate resulting in a threefold increase in the number of samples requiring testing. To manage this increase with the same staffing resources, we have replaced the traditional diagnostic methods. A system has been developed for the processing of soil samples, extraction of DNA from float material, and detection of PCN by high-throughput real-time PCR. Approximately 17,000 samples are analyzed each year using this method. This chapter describes the high-throughput processes for the production of float material from soil samples, DNA extraction from the entire float, and subsequent detection and identification of PCN within these samples.
A multilayer microdevice for cell-based high-throughput drug screening
International Nuclear Information System (INIS)
Liu, Chong; Wang, Lei; Li, Jingmin; Ding, Xiping; Chunyu, Li; Xu, Zheng; Wang, Qi
2012-01-01
A multilayer polydimethylsiloxane microdevice for cell-based high-throughput drug screening is described in this paper. This established microdevice was based on a modularization method and it integrated a drug/medium concentration gradient generator (CGG), pneumatic microvalves and a cell culture microchamber array. The CGG was able to generate five steps of linear concentrations with the same outlet flow rate. The medium/drug flowed through CGG and then into the pear-shaped cell culture microchambers vertically. This vertical perfusion mode was used to reduce the impact of the shear stress on the physiology of cells induced by the fluid flow in the microchambers. Pear-shaped microchambers with two arrays of miropillars at each outlet were adopted in this microdevice, which were beneficial to cell distribution. The chemotherapeutics Cisplatin (DDP)-induced Cisplatin-resistant cell line A549/DDP apoptotic experiments were performed well on this platform. The results showed that this novel microdevice could not only provide well-defined and stable conditions for cell culture, but was also useful for cell-based high-throughput drug screening with less reagents and time consumption. (paper)
A High-throughput Selection for Cellulase Catalysts Using Chemical Complementation
Peralta-Yahya, Pamela; Carter, Brian T.; Lin, Hening; Tao, Haiyan; Cornish, Virginia W.
2010-01-01
Efficient enzymatic hydrolysis of lignocellulosic material remains one of the major bottlenecks to cost-effective conversion of biomass to ethanol. Improvement of glycosylhydrolases however is limited by existing medium-throughput screening technologies. Here, we report the first high-throughput selection for cellulase catalysts. This selection was developed by adapting chemical complementation to provide a growth assay for bond cleavage reactions. First, a URA3 counter selection was adapted to link chemical dimerizer activated gene transcription to cell death. Next, the URA3 counter selection was shown to detect cellulase activity based on cleavage of a tetrasaccharide chemical dimerizer substrate and decrease in expression of the toxic URA3 reporter. Finally, the utility of the cellulase selection was assessed by isolating cellulases with improved activity from a cellulase library created by family DNA shuffling. This application provides further evidence that chemical complementation can be readily adapted to detect different enzymatic activities for important chemical transformations for which no natural selection exists. Due to the large number of enzyme variants selections can test compared to existing medium-throughput screens for cellulases, this assay has the potential to impact the discovery of improved cellulases and other glycosylhydrolases for biomass conversion from libraries of cellulases created by mutagenesis or obtained from natural biodiversity. PMID:19053460
An Automated High Throughput Proteolysis and Desalting Platform for Quantitative Proteomic Analysis
Directory of Open Access Journals (Sweden)
Albert-Baskar Arul
2013-06-01
Full Text Available Proteomics for biomarker validation needs high throughput instrumentation to analyze huge set of clinical samples for quantitative and reproducible analysis at a minimum time without manual experimental errors. Sample preparation, a vital step in proteomics plays a major role in identification and quantification of proteins from biological samples. Tryptic digestion a major check point in sample preparation for mass spectrometry based proteomics needs to be more accurate with rapid processing time. The present study focuses on establishing a high throughput automated online system for proteolytic digestion and desalting of proteins from biological samples quantitatively and qualitatively in a reproducible manner. The present study compares online protein digestion and desalting of BSA with conventional off-line (in-solution method and validated for real time sample for reproducibility. Proteins were identified using SEQUEST data base search engine and the data were quantified using IDEALQ software. The present study shows that the online system capable of handling high throughput samples in 96 well formats carries out protein digestion and peptide desalting efficiently in a reproducible and quantitative manner. Label free quantification showed clear increase of peptide quantities with increase in concentration with much linearity compared to off line method. Hence we would like to suggest that inclusion of this online system in proteomic pipeline will be effective in quantification of proteins in comparative proteomics were the quantification is really very crucial.
Performance Evaluation of IEEE 802.11ah Networks With High-Throughput Bidirectional Traffic.
Šljivo, Amina; Kerkhove, Dwight; Tian, Le; Famaey, Jeroen; Munteanu, Adrian; Moerman, Ingrid; Hoebeke, Jeroen; De Poorter, Eli
2018-01-23
So far, existing sub-GHz wireless communication technologies focused on low-bandwidth, long-range communication with large numbers of constrained devices. Although these characteristics are fine for many Internet of Things (IoT) applications, more demanding application requirements could not be met and legacy Internet technologies such as Transmission Control Protocol/Internet Protocol (TCP/IP) could not be used. This has changed with the advent of the new IEEE 802.11ah Wi-Fi standard, which is much more suitable for reliable bidirectional communication and high-throughput applications over a wide area (up to 1 km). The standard offers great possibilities for network performance optimization through a number of physical- and link-layer configurable features. However, given that the optimal configuration parameters depend on traffic patterns, the standard does not dictate how to determine them. Such a large number of configuration options can lead to sub-optimal or even incorrect configurations. Therefore, we investigated how two key mechanisms, Restricted Access Window (RAW) grouping and Traffic Indication Map (TIM) segmentation, influence scalability, throughput, latency and energy efficiency in the presence of bidirectional TCP/IP traffic. We considered both high-throughput video streaming traffic and large-scale reliable sensing traffic and investigated TCP behavior in both scenarios when the link layer introduces long delays. This article presents the relations between attainable throughput per station and attainable number of stations, as well as the influence of RAW, TIM and TCP parameters on both. We found that up to 20 continuously streaming IP-cameras can be reliably connected via IEEE 802.11ah with a maximum average data rate of 160 kbps, whereas 10 IP-cameras can achieve average data rates of up to 255 kbps over 200 m. Up to 6960 stations transmitting every 60 s can be connected over 1 km with no lost packets. The presented results enable the fine tuning
DEFF Research Database (Denmark)
Raijada, Dhara; Cornett, Claus; Rantanen, Jukka
2013-01-01
The present study puts forward a miniaturized high-throughput platform to understand influence of excipient selection and processing on the stability of a given drug compound. Four model drugs (sodium naproxen, theophylline, amlodipine besylate and nitrofurantoin) and ten different excipients were...... for chemical degradation. The proposed high-throughput platform can be used during early drug development to simulate typical processing induced stress in a small scale and to understand possible phase transformation behaviour and influence of excipients on this....
International Nuclear Information System (INIS)
Haemori, M.; Edura, T.; Tsutsui, K.; Itaka, K.; Wada, Y.; Koinuma, H.
2006-01-01
We have fabricated a combinatorial nm-planar electrode array by using photolithography and chemical mechanical polishing processes for high throughput electrical evaluation of organic devices. Sub-nm precision was achieved with respect to the average level difference between each pair of electrodes and a dielectric layer. The insulating property between the electrodes is high enough to measure I-V characteristics of organic semiconductors. Bottom-contact field-effect-transistors (FETs) of pentacene were fabricated on this electrode array by use of molecular beam epitaxy. It was demonstrated that the array could be used as a pre-patterned device substrate for high throughput screening of the electrical properties of organic semiconductors
Avrova, Anna O; Hyman, Lizbeth J; Toth, Rachel L; Toth, Ian K
2002-04-01
The soft rot bacteria Erwinia carotovora and Erwinia chrysanthemi are important pathogens of potato and other crops. However, the taxonomy of these pathogens, particularly at subspecies level, is unclear. An investigation using amplified fragment length polymorphism (AFLP) fingerprinting was undertaken to determine the taxonomic relationships within this group based on their genetic relatedness. Following cluster analysis on the similarity matrices derived from the AFLP gels, four clusters (clusters 1 to 4) resulted. Cluster 1 contained Erwinia carotovora subsp. carotovora (subclusters 1a and 1b) and Erwinia carotovora subsp. odorifera (subcluster 1c) strains, while cluster 2 contained Erwinia carotovora subsp. atroseptica (subcluster 2a) and Erwinia carotovora subsp. betavasculorum (subcluster 2b) strains. Clusters 3 and 4 contained Erwinia carotovora subsp. wasabiae and E. chrysanthemi strains, respectively. While E. carotovora subsp. carotovora and E. chrysanthemi showed a high level of molecular diversity (23 to 38% mean similarity), E. carotovora subsp. odorifera, E. carotovora subsp. betavasculorum, E. carotovora subsp. atroseptica, and E. carotovora subsp. wasabiae showed considerably less (56 to 76% mean similarity), which may reflect their limited geographical distributions and/or host ranges. The species- and subspecies-specific banding profiles generated from the AFLPs allowed rapid identification of unknown isolates and the potential for future development of diagnostics. AFLP fingerprinting was also found to be more differentiating than other techniques for typing the soft rot erwinias and was applicable to all strain types, including different serogroups.
2010-07-01
... 40 Protection of Environment 12 2010-07-01 2010-07-01 true Continuous Compliance With Operating Limits-High Throughput Transfer Racks 9 Table 9 to Subpart EEEE of Part 63 Protection of Environment...—Continuous Compliance With Operating Limits—High Throughput Transfer Racks As stated in §§ 63.2378(a) and (b...
Cosson, Steffen; Danial, Maarten; Saint-Amans, Julien Rosselgong; Cooper-White, Justin J
2017-04-01
Advanced polymerization methodologies, such as reversible addition-fragmentation transfer (RAFT), allow unprecedented control over star polymer composition, topology, and functionality. However, using RAFT to produce high throughput (HTP) combinatorial star polymer libraries remains, to date, impracticable due to several technical limitations. Herein, the methodology "rapid one-pot sequential aqueous RAFT" or "rosa-RAFT," in which well-defined homo-, copolymer, and mikto-arm star polymers can be prepared in very low to medium reaction volumes (50 µL to 2 mL) via an "arm-first" approach in air within minutes, is reported. Due to the high conversion of a variety of acrylamide/acrylate monomers achieved during each successive short reaction step (each taking 3 min), the requirement for intermediary purification is avoided, drastically facilitating and accelerating the star synthesis process. The presented methodology enables RAFT to be applied to HTP polymeric bio/nanomaterials discovery pipelines, in which hundreds of complex polymeric formulations can be rapidly produced, screened, and scaled up for assessment in a wide range of applications. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
High-Performance Operational and Instrumentation Amplifiers
Shahi, B.
2015-01-01
This thesis describes techniques to reduce the offset error in precision instrumentation and operational amplifiers. The offset error which is considered a major error source associated with gain blocks, together with other errors are reviewed. Conventional and newer approaches to remove offset and
Directory of Open Access Journals (Sweden)
Gavin C. Bowick
2011-05-01
Full Text Available The continuing use of high-throughput assays to investigate cellular responses to infection is providing a large repository of information. Due to the large number of differentially expressed transcripts, often running into the thousands, the majority of these data have not been thoroughly investigated. Advances in techniques for the downstream analysis of high-throughput datasets are providing additional methods for the generation of additional hypotheses for further investigation. The large number of experimental observations, combined with databases that correlate particular genes and proteins with canonical pathways, functions and diseases, allows for the bioinformatic exploration of functional networks that may be implicated in replication or pathogenesis. Herein, we provide an example of how analysis of published high-throughput datasets of cellular responses to hemorrhagic fever virus infection can generate additional functional data. We describe enrichment of genes involved in metabolism, post-translational modification and cardiac damage; potential roles for specific transcription factors and a conserved involvement of a pathway based around cyclooxygenase-2. We believe that these types of analyses can provide virologists with additional hypotheses for continued investigation.
A Fully Automated High-Throughput Zebrafish Behavioral Ototoxicity Assay.
Todd, Douglas W; Philip, Rohit C; Niihori, Maki; Ringle, Ryan A; Coyle, Kelsey R; Zehri, Sobia F; Zabala, Leanne; Mudery, Jordan A; Francis, Ross H; Rodriguez, Jeffrey J; Jacob, Abraham
2017-08-01
Zebrafish animal models lend themselves to behavioral assays that can facilitate rapid screening of ototoxic, otoprotective, and otoregenerative drugs. Structurally similar to human inner ear hair cells, the mechanosensory hair cells on their lateral line allow the zebrafish to sense water flow and orient head-to-current in a behavior called rheotaxis. This rheotaxis behavior deteriorates in a dose-dependent manner with increased exposure to the ototoxin cisplatin, thereby establishing itself as an excellent biomarker for anatomic damage to lateral line hair cells. Building on work by our group and others, we have built a new, fully automated high-throughput behavioral assay system that uses automated image analysis techniques to quantify rheotaxis behavior. This novel system consists of a custom-designed swimming apparatus and imaging system consisting of network-controlled Raspberry Pi microcomputers capturing infrared video. Automated analysis techniques detect individual zebrafish, compute their orientation, and quantify the rheotaxis behavior of a zebrafish test population, producing a powerful, high-throughput behavioral assay. Using our fully automated biological assay to test a standardized ototoxic dose of cisplatin against varying doses of compounds that protect or regenerate hair cells may facilitate rapid translation of candidate drugs into preclinical mammalian models of hearing loss.
Yang, Wanneng; Guo, Zilong; Huang, Chenglong; Duan, Lingfeng; Chen, Guoxing; Jiang, Ni; Fang, Wei; Feng, Hui; Xie, Weibo; Lian, Xingming; Wang, Gongwei; Luo, Qingming; Zhang, Qifa; Liu, Qian; Xiong, Lizhong
2014-01-01
Even as the study of plant genomics rapidly develops through the use of high-throughput sequencing techniques, traditional plant phenotyping lags far behind. Here we develop a high-throughput rice phenotyping facility (HRPF) to monitor 13 traditional agronomic traits and 2 newly defined traits during the rice growth period. Using genome-wide association studies (GWAS) of the 15 traits, we identify 141 associated loci, 25 of which contain known genes such as the Green Revolution semi-dwarf gene, SD1. Based on a performance evaluation of the HRPF and GWAS results, we demonstrate that high-throughput phenotyping has the potential to replace traditional phenotyping techniques and can provide valuable gene identification information. The combination of the multifunctional phenotyping tools HRPF and GWAS provides deep insights into the genetic architecture of important traits. PMID:25295980
Fragment-based approaches to anti-HIV drug discovery: state of the art and future opportunities.
Huang, Boshi; Kang, Dongwei; Zhan, Peng; Liu, Xinyong
2015-12-01
The search for additional drugs to treat HIV infection is a continuing effort due to the emergence and spread of HIV strains resistant to nearly all current drugs. The recent literature reveals that fragment-based drug design/discovery (FBDD) has become an effective alternative to conventional high-throughput screening strategies for drug discovery. In this critical review, the authors describe the state of the art in FBDD strategies for the discovery of anti-HIV drug-like compounds. The article focuses on fragment screening techniques, direct fragment-based design and early hit-to-lead progress. Rapid progress in biophysical detection and in silico techniques has greatly aided the application of FBDD to discover candidate agents directed at a variety of anti-HIV targets. Growing evidence suggests that structural insights on key proteins in the HIV life cycle can be applied in the early phase of drug discovery campaigns, providing valuable information on the binding modes and efficiently prompting fragment hit-to-lead progression. The combination of structural insights with improved methodologies for FBDD, including the privileged fragment-based reconstruction approach, fragment hybridization based on crystallographic overlays, fragment growth exploiting dynamic combinatorial chemistry, and high-speed fragment assembly via diversity-oriented synthesis followed by in situ screening, offers the possibility of more efficient and rapid discovery of novel drugs for HIV-1 prevention or treatment. Though the use of FBDD in anti-HIV drug discovery is still in its infancy, it is anticipated that anti-HIV agents developed via fragment-based strategies will be introduced into the clinic in the future.
Robarts, Daniel W. H.; Wolfe, Andrea D.
2014-01-01
In the past few decades, many investigations in the field of plant biology have employed selectively neutral, multilocus, dominant markers such as inter-simple sequence repeat (ISSR), random-amplified polymorphic DNA (RAPD), and amplified fragment length polymorphism (AFLP) to address hypotheses at lower taxonomic levels. More recently, sequence-related amplified polymorphism (SRAP) markers have been developed, which are used to amplify coding regions of DNA with primers targeting open reading frames. These markers have proven to be robust and highly variable, on par with AFLP, and are attained through a significantly less technically demanding process. SRAP markers have been used primarily for agronomic and horticultural purposes, developing quantitative trait loci in advanced hybrids and assessing genetic diversity of large germplasm collections. Here, we suggest that SRAP markers should be employed for research addressing hypotheses in plant systematics, biogeography, conservation, ecology, and beyond. We provide an overview of the SRAP literature to date, review descriptive statistics of SRAP markers in a subset of 171 publications, and present relevant case studies to demonstrate the applicability of SRAP markers to the diverse field of plant biology. Results of these selected works indicate that SRAP markers have the potential to enhance the current suite of molecular tools in a diversity of fields by providing an easy-to-use, highly variable marker with inherent biological significance. PMID:25202637
Robarts, Daniel W H; Wolfe, Andrea D
2014-07-01
In the past few decades, many investigations in the field of plant biology have employed selectively neutral, multilocus, dominant markers such as inter-simple sequence repeat (ISSR), random-amplified polymorphic DNA (RAPD), and amplified fragment length polymorphism (AFLP) to address hypotheses at lower taxonomic levels. More recently, sequence-related amplified polymorphism (SRAP) markers have been developed, which are used to amplify coding regions of DNA with primers targeting open reading frames. These markers have proven to be robust and highly variable, on par with AFLP, and are attained through a significantly less technically demanding process. SRAP markers have been used primarily for agronomic and horticultural purposes, developing quantitative trait loci in advanced hybrids and assessing genetic diversity of large germplasm collections. Here, we suggest that SRAP markers should be employed for research addressing hypotheses in plant systematics, biogeography, conservation, ecology, and beyond. We provide an overview of the SRAP literature to date, review descriptive statistics of SRAP markers in a subset of 171 publications, and present relevant case studies to demonstrate the applicability of SRAP markers to the diverse field of plant biology. Results of these selected works indicate that SRAP markers have the potential to enhance the current suite of molecular tools in a diversity of fields by providing an easy-to-use, highly variable marker with inherent biological significance.
Radially resolved simulation of a high-gain free electron laser amplifier
International Nuclear Information System (INIS)
Fawley, W.M.; Prosnitz, D.; Doss, S.; Gelinas, R.
1983-01-01
The results of a two-dimensional simulation of a high-gain free electron laser (FEL) amplifier is presented. The simulation solves the inhomogeneous paraxial wave equation. The source term is radially resolved and is obtained by tracking the interaction of the laser field with localized macroparticles
Benet, James
1994-01-01
This document is an addendum to the NASA Satellite Communications Application Research (SCAR) Phase 2 Final Report, 'Efficient High Power, Solid State Amplifier for EHF Communications.' This report describes the work performed from 1 August 1993 to 11 March 1994, under contract number NASW-4513. During this reporting period an array of transistor amplifiers was repaired by replacing all MMIC amplifier chips. The amplifier array was then tested using three different feedhorn configurations. Descriptions, procedures, and results of this testing are presented in this report, and conclusions are drawn based on the test results obtained.
Ethoscopes: An open platform for high-throughput ethomics.
Directory of Open Access Journals (Sweden)
Quentin Geissmann
2017-10-01
Full Text Available Here, we present the use of ethoscopes, which are machines for high-throughput analysis of behavior in Drosophila and other animals. Ethoscopes provide a software and hardware solution that is reproducible and easily scalable. They perform, in real-time, tracking and profiling of behavior by using a supervised machine learning algorithm, are able to deliver behaviorally triggered stimuli to flies in a feedback-loop mode, and are highly customizable and open source. Ethoscopes can be built easily by using 3D printing technology and rely on Raspberry Pi microcomputers and Arduino boards to provide affordable and flexible hardware. All software and construction specifications are available at http://lab.gilest.ro/ethoscope.
Energy Technology Data Exchange (ETDEWEB)
Wall, Andrew J. [National Energy Technology Lab. (NETL), Pittsburgh, PA, (United States); Capo, Rosemary C. [Univ. of Pittsburgh, PA (United States); Stewart, Brian W. [Univ. of Pittsburgh, PA (United States); Phan, Thai T. [Univ. of Pittsburgh, PA (United States); Jain, Jinesh C. [National Energy Technology Lab. (NETL), Pittsburgh, PA, (United States); Hakala, Alexandra [National Energy Technology Lab. (NETL), Pittsburgh, PA, (United States); Guthrie, George D. [National Energy Technology Lab. (NETL), Pittsburgh, PA, (United States)
2016-09-22
This technical report presents the details of the Sr column configuration and the high-throughput Sr separation protocol. Data showing the performance of the method as well as the best practices for optimizing Sr isotope analysis by MC-ICP-MS is presented. Lastly, this report offers tools for data handling and data reduction of Sr isotope results from the Thermo Scientific Neptune software to assist in data quality assurance, which help avoid issues of data glut associated with high sample throughput rapid analysis.
Energy Technology Data Exchange (ETDEWEB)
Hakala, Jacqueline Alexandra [National Energy Technology Lab. (NETL), Morgantown, WV (United States)
2016-11-22
This technical report presents the details of the Sr column configuration and the high-throughput Sr separation protocol. Data showing the performance of the method as well as the best practices for optimizing Sr isotope analysis by MC-ICP-MS is presented. Lastly, this report offers tools for data handling and data reduction of Sr isotope results from the Thermo Scientific Neptune software to assist in data quality assurance, which help avoid issues of data glut associated with high sample throughput rapid analysis.
Correction of Microplate Data from High-Throughput Screening.
Wang, Yuhong; Huang, Ruili
2016-01-01
High-throughput screening (HTS) makes it possible to collect cellular response data from a large number of cell lines and small molecules in a timely and cost-effective manner. The errors and noises in the microplate-formatted data from HTS have unique characteristics, and they can be generally grouped into three categories: run-wise (temporal, multiple plates), plate-wise (background pattern, single plate), and well-wise (single well). In this chapter, we describe a systematic solution for identifying and correcting such errors and noises, mainly basing on pattern recognition and digital signal processing technologies.
High-Throughput Network Communication with NetIO
Schumacher, J\\"orn; The ATLAS collaboration; Vandelli, Wainer
2016-01-01
HPC network technologies like Infiniband, TrueScale or OmniPath provide low-latency and high-throughput communication between hosts, which makes them attractive options for data-acquisition systems in large-scale high-energy physics experiments. Like HPC networks, DAQ networks are local and include a well specified number of systems. Unfortunately traditional network communication APIs for HPC clusters like MPI or PGAS target exclusively the HPC community and are not suited well for DAQ applications. It is possible to build distributed DAQ applications using low-level system APIs like Infiniband Verbs (and this has been done), but it requires a non negligible effort and expert knowledge. On the other hand, message services like 0MQ have gained popularity in the HEP community. Such APIs allow to build distributed applications with a high-level approach and provide good performance. Unfortunately their usage usually limits developers to TCP/IP-based networks. While it is possible to operate a TCP/IP stack on to...
High-Throughput Printing Process for Flexible Electronics
Hyun, Woo Jin
Printed electronics is an emerging field for manufacturing electronic devices with low cost and minimal material waste for a variety of applications including displays, distributed sensing, smart packaging, and energy management. Moreover, its compatibility with roll-to-roll production formats and flexible substrates is desirable for continuous, high-throughput production of flexible electronics. Despite the promise, however, the roll-to-roll production of printed electronics is quite challenging due to web movement hindering accurate ink registration and high-fidelity printing. In this talk, I will present a promising strategy for roll-to-roll production using a novel printing process that we term SCALE (Self-aligned Capillarity-Assisted Lithography for Electronics). By utilizing capillarity of liquid inks on nano/micro-structured substrates, the SCALE process facilitates high-resolution and self-aligned patterning of electrically functional inks with greatly improved printing tolerance. I will show the fabrication of key building blocks (e.g. transistor, resistor, capacitor) for electronic circuits using the SCALE process on plastics.
Energy Technology Data Exchange (ETDEWEB)
Elkin, Christopher; Kapur, Hitesh; Smith, Troy; Humphries, David; Pollard, Martin; Hammon, Nancy; Hawkins, Trevor
2001-09-15
We have developed an automated purification method for terminator sequencing products based on a magnetic bead technology. This 384-well protocol generates labeled DNA fragments that are essentially free of contaminates for less than $0.005 per reaction. In comparison to laborious ethanol precipitation protocols, this method increases the phred20 read length by forty bases with various DNA templates such as PCR fragments, Plasmids, Cosmids and RCA products. Our method eliminates centrifugation and is compatible with both the MegaBACE 1000 and ABIPrism 3700 capillary instruments. As of September 2001, this method has produced over 1.6 million samples with 93 percent averaging 620 phred20 bases as part of Joint Genome Institutes Production Process.
High-throughput screening of tick-borne pathogens in Europe
DEFF Research Database (Denmark)
Michelet, Lorraine; Delannoy, Sabine; Devillers, Elodie
2014-01-01
was conducted on 7050 Ixodes ricinus nymphs collected from France, Denmark, and the Netherlands using a powerful new high-throughput approach. This advanced methodology permitted the simultaneous detection of 25 bacterial, and 12 parasitic species (including; Borrelia, Anaplasma, Ehrlichia, Rickettsia......, Bartonella, Candidatus Neoehrlichia, Coxiella, Francisella, Babesia, and Theileria genus) across 94 samples. We successfully determined the prevalence of expected (Borrelia burgdorferi sensu lato, Anaplasma phagocytophilum, Rickettsia helvetica, Candidatus Neoehrlichia mikurensis, Babesia divergens, Babesia...
High Throughput Single-cell and Multiple-cell Micro-encapsulation
Lagus, Todd P.; Edd, Jon F.
2012-01-01
Microfluidic encapsulation methods have been previously utilized to capture cells in picoliter-scale aqueous, monodisperse drops, providing confinement from a bulk fluid environment with applications in high throughput screening, cytometry, and mass spectrometry. We describe a method to not only encapsulate single cells, but to repeatedly capture a set number of cells (here we demonstrate one- and two-cell encapsulation) to study both isolation and the interactions between cells in groups of ...
2017-10-01
greater gas polarizations and production amounts/ throughputs- benefiting in particular from the advent of com- pact, high-power, relatively low- cost ...Award Number: W81XWH-15-1-0271 TITLE: Low- Cost , High-Throughput 3-D Pulmonary Imager Using Hyperpolarized Contrast Agents and Low-Field MRI...DISTRIBUTION STATEMENT: Approved for Public Release; Distribution Unlimited The views, opinions and/or findings contained in this report are those of the
High throughput octal alpha/gamma spectrometer for low level bioassay estimations
International Nuclear Information System (INIS)
Bhasin, B.D.; Shirke, S.H.; Suri, M.M.; Vaidya, P.P.; Ghodgaonkar, M.D.
1995-01-01
The present paper describes the development of a high throughput octal alpha spectrometry system specially developed for the estimation of low levels of actinides in bioassay and environmental samples. The system processes simultaneously the outputs coming from eight independent detectors. It can be configured to simultaneously record low level alpha and gamma spectra. The high throughput is achieved by using a prioritised multiplexer router. The prioritised multiplexing and routing coupled with fast 8K ADC (conversion time 20 μsec) allow simultaneous acquisition of multiple spectra without any significant loss in counts. The dual (8K, 24bit) port memory facilitates easy online viewing of spectrum buildup. A menu driven user friendly software makes the operating system convenient to use. A specially developed software provides built-in routines for processing the spectra and estimating the isotopic activity. The interactive mode of software provides easy identification of isotopes compatible with the separation chemistry of different actinides. (author). 6 refs., 2 figs
Design of a High-Throughput Biological Crystallography Beamline for Superconducting Wiggler
International Nuclear Information System (INIS)
Tseng, P.C.; Chang, C.H.; Fung, H.S.; Ma, C.I.; Huang, L.J.; Jean, Y.C.; Song, Y.F.; Huang, Y.S.; Tsang, K.L.; Chen, C.T.
2004-01-01
We are constructing a high-throughput biological crystallography beamline BL13B, which utilizes the radiation generated from a 3.2 Tesla, 32-pole superconducting multipole wiggler, for multi-wavelength anomalous diffraction (MAD), single-wavelength anomalous diffraction (SAD), and other related experiments. This beamline is a standard double crystal monochromator (DCM) x-ray beamline equipped with a collimating mirror (CM) and a focusing mirror (FM). Both the CM and FM are one meter long and made of Si substrate, and the CM is side-cooled by water. Based on detailed thermal analysis, liquid nitrogen (LN2) cooling for both crystals of the DCM has been adopted to optimize the energy resolution and photon beam throughput. This beamline will deliver, through a 100 μm diameter pinhole, photon flux of greater than 1011 photons/sec in the energy range from 6.5 keV to 19 keV, which is comparable to existing protein crystallography beamlines from bending magnet source at high energy storage rings
Validation of the high-throughput marker technology DArT using the model plant Arabidopsis thaliana.
Wittenberg, Alexander H J; van der Lee, Theo; Cayla, Cyril; Kilian, Andrzej; Visser, Richard G F; Schouten, Henk J
2005-08-01
Diversity Arrays Technology (DArT) is a microarray-based DNA marker technique for genome-wide discovery and genotyping of genetic variation. DArT allows simultaneous scoring of hundreds of restriction site based polymorphisms between genotypes and does not require DNA sequence information or site-specific oligonucleotides. This paper demonstrates the potential of DArT for genetic mapping by validating the quality and molecular basis of the markers, using the model plant Arabidopsis thaliana. Restriction fragments from a genomic representation of the ecotype Landsberg erecta (Ler) were amplified by PCR, individualized by cloning and spotted onto glass slides. The arrays were then hybridized with labeled genomic representations of the ecotypes Columbia (Col) and Ler and of individuals from an F(2) population obtained from a Col x Ler cross. The scoring of markers with specialized software was highly reproducible and 107 markers could unambiguously be ordered on a genetic linkage map. The marker order on the genetic linkage map coincided with the order on the DNA sequence map. Sequencing of the Ler markers and alignment with the available Col genome sequence confirmed that the polymorphism in DArT markers is largely a result of restriction site polymorphisms.
An S-band high gain relativistic klystron amplifier with high phase stability
Energy Technology Data Exchange (ETDEWEB)
Wu, Y. [Institute of Applied Electronics, China Academy of Engineering Physics, Mianyang 621900 (China); Science and Technology on High Power Microwave Laboratory, Mianyang 621900 (China); Li, Z. H.; Xu, Z.; Ma, Q. S. [Institute of Applied Electronics, China Academy of Engineering Physics, Mianyang 621900 (China); Xie, H. Q. [College of Science, Southwestern University of Science and Technology, Mianyang 621010 (China)
2014-11-15
For the purpose of coherent high power microwave combining, an S-band high gain relativistic klystron amplifier with high phase stability is presented and studied. By the aid of 3D particle-in-cell code and circuit simulation software, the mechanism of parasitic oscillation in the device is investigated. And the RF lossy material is adopted in the simulation and experiment to suppress the oscillation. The experimental results show that with an input RF power of 10 kW, a microwave pulse with power of 1.8 GW is generated with a gain of 52.6 dB. And the relative phase difference fluctuation between output microwave and input RF signal is less than ±10° in 90 ns.
High-Efficiency, Ka-Band Solid-State Power Amplifier Utilizing GaN Technology, Phase II
National Aeronautics and Space Administration — QuinStar Technology proposes to develop a high-efficiency, solid-state power amplifier (SSPA), operating at Ka-band frequencies, for high data rate, long range space...
DEFF Research Database (Denmark)
Rottwitt, Karsten
2017-01-01
The chapter provides a discussion of optical fiber amplifiers and through three sections provides a detailed treatment of three types of optical fiber amplifiers, erbium doped fiber amplifiers (EDFA), Raman amplifiers, and parametric amplifiers. Each section comprises the fundamentals including...... the basic physics and relevant in-depth theoretical modeling, amplifiers characteristics and performance data as a function of specific operation parameters. Typical applications in fiber optic communication systems and the improvement achievable through the use of fiber amplifiers are illustrated....
High-throughput investigation of polymerization kinetics by online monitoring of GPC and GC
Hoogenboom, R.; Fijten, M.W.M.; Abeln, C.H.; Schubert, U.S.
2004-01-01
Gel permeation chromatography (GPC) and gas chromatography (GC) were successfully introduced into a high-throughput workflow. The feasibility and limitations of online GPC with a high-speed column was evaluated by measuring polystyrene standards and comparison of the results with regular offline GPC
ToxCast Workflow: High-throughput screening assay data processing, analysis and management (SOT)
US EPA’s ToxCast program is generating data in high-throughput screening (HTS) and high-content screening (HCS) assays for thousands of environmental chemicals, for use in developing predictive toxicity models. Currently the ToxCast screening program includes over 1800 unique c...
Computational and statistical methods for high-throughput mass spectrometry-based PTM analysis
DEFF Research Database (Denmark)
Schwämmle, Veit; Vaudel, Marc
2017-01-01
Cell signaling and functions heavily rely on post-translational modifications (PTMs) of proteins. Their high-throughput characterization is thus of utmost interest for multiple biological and medical investigations. In combination with efficient enrichment methods, peptide mass spectrometry analy...
Applications of high-throughput sequencing to chromatin structure and function in mammals
Dunham, Ian
2009-01-01
High-throughput DNA sequencing approaches have enabled direct interrogation of chromatin samples from mammalian cells. We are beginning to develop a genome-wide description of nuclear function during development, but further data collection, refinement, and integration are needed.
Directory of Open Access Journals (Sweden)
Emma Suryati
2013-03-01
Full Text Available Infeksi penyakit ice-ice pada Kappaphycus alvarezii seringkali menyebabkan penurunan produksi yang sangat signifikan. K. alvarezii merupakan alga merah penghasil karaginan yang memiliki nilai ekonomi tinggi dan banyak dimanfaatkan dalam berbagai industri, seperti farmasi, makanan, stabilizer, dan kosmetik. Perbaikan genetik sangat diperlukan untuk meningkatkan produksi. Penelitian ini bertujuan untuk mengetahui karakteristik kemiripan genetik K. alvarezii sehat dan terinfeksi penyakit dari Balai Penelitian dan Pengembangan Budidaya Air Payau (BPPBAP, Maros dengan metode Amplified Fragment Length Polymorphism (AFLP. Pada penelitian ini juga dianalisis K. alvarezii asal Bone (BNE, Gorontalo (GRL, Tambalang (TMB, dan Kendari (KND sebagai kontrol rumput laut sehat. Metode AFLP menggunakan enzim restriksi Psti dan Mset, preamplifikasi dan amplifikasi selektif diawali dengan isolsi DNA, uji genimoc DNA, restriksi dan ligasi. Hasil yang diperoleh menunjukkan penggunaan marker AFLP dengan primer forward P11 dan primer reverse M48, M49 dan M50 terhadap K. alvarezii yang berasal dari Takalar (TKL, dan Mataram (MTR, tanpa infeksi (sehat dan terinfeksi penyakit Takalar ice (TKL+, Mataram ice (MTR+, serta K. alvarezii kontrol (BNE, (GRL, (TMB, dan (KND menghasilkan 519 fragmen dalam 122 lokus dengan ukuran 50 - ~370 pb. Kemiripan genetik K. alvarezii yang terinfeksi penyakit ice-ice lebih rendah jika dibandingkan dengan yang sehat. Kemiripan genetik K. alvarezii dari Takalar sehat (TKL dan terinfeksi ice-ice (TKL+ adalah 0,8176 dan MTR-MTR+ adalah 0,8033.
2017-10-01
low- cost and high-throughput was a key element proposed for this project, which we believe will be of significant benefit to the patients suffering...Award Number: W81XWH-15-1-0272 TITLE: Low- Cost , High-Throughput 3-D Pulmonary Imager Using Hyperpolarized Contrast Agents and Low-Field MRI...STATEMENT: Approved for Public Release; Distribution Unlimited The views, opinions and/or findings contained in this report are those of the author(s
Salvo-Chirnside, Eliane; Kane, Steven; Kerr, Lorraine E
2011-01-01
Abstract The increasing popularity of systems-based approaches to plant research has resulted in a demand for high throughput (HTP) methods to be developed. RNA extraction from multiple samples in an experiment is a significant bottleneck in performing systems-level genomic studies. Therefore we have established a high throughput method of RNA extraction from Arabidopsis thaliana to facilitate gene expression studies in this widely used plant model. We present optimised manual and automated p...
From Classical to High Throughput Screening Methods for Feruloyl Esterases: A Review.
Ramírez-Velasco, Lorena; Armendáriz-Ruiz, Mariana; Rodríguez-González, Jorge Alberto; Müller-Santos, Marcelo; Asaff-Torres, Ali; Mateos-Díaz, Juan Carlos
2016-01-01
Feruloyl esterases (FAEs) are a diverse group of hydrolases widely distributed in plants and microorganisms which catalyzes the cleavage and formation of ester bonds between plant cell wall polysaccharides and phenolic acids. FAEs have gained importance in biofuel, medicine and food industries due to their capability of acting on a large range of substrates for cleaving ester bonds and synthesizing highadded value molecules through esterification and transesterification reactions. During the past two decades extensive studies have been carried out on the production, characterization and classification of FAEs, however only a few reports of suitable High Throughput Screening assays for this kind of enzymes have been reported. This review is focused on a concise but complete revision of classical to High Throughput Screening methods for FAEs, highlighting its advantages and disadvantages, and finally suggesting future perspectives for this important research field.
AELAS: Automatic ELAStic property derivations via high-throughput first-principles computation
Zhang, S. H.; Zhang, R. F.
2017-11-01
The elastic properties are fundamental and important for crystalline materials as they relate to other mechanical properties, various thermodynamic qualities as well as some critical physical properties. However, a complete set of experimentally determined elastic properties is only available for a small subset of known materials, and an automatic scheme for the derivations of elastic properties that is adapted to high-throughput computation is much demanding. In this paper, we present the AELAS code, an automated program for calculating second-order elastic constants of both two-dimensional and three-dimensional single crystal materials with any symmetry, which is designed mainly for high-throughput first-principles computation. Other derivations of general elastic properties such as Young's, bulk and shear moduli as well as Poisson's ratio of polycrystal materials, Pugh ratio, Cauchy pressure, elastic anisotropy and elastic stability criterion, are also implemented in this code. The implementation of the code has been critically validated by a lot of evaluations and tests on a broad class of materials including two-dimensional and three-dimensional materials, providing its efficiency and capability for high-throughput screening of specific materials with targeted mechanical properties. Program Files doi:http://dx.doi.org/10.17632/f8fwg4j9tw.1 Licensing provisions: BSD 3-Clause Programming language: Fortran Nature of problem: To automate the calculations of second-order elastic constants and the derivations of other elastic properties for two-dimensional and three-dimensional materials with any symmetry via high-throughput first-principles computation. Solution method: The space-group number is firstly determined by the SPGLIB code [1] and the structure is then redefined to unit cell with IEEE-format [2]. Secondly, based on the determined space group number, a set of distortion modes is automatically specified and the distorted structure files are generated