WorldWideScience

Sample records for high-quality epidermal rna

  1. Extraction of high-quality epidermal RNA after ammonium thiocyanate-induced dermo-epidermal separation of 4 mm human skin biopsies

    DEFF Research Database (Denmark)

    Clemmensen, Anders; Thomassen, Mads; Clemmensen, Ole

    2009-01-01

    To obtain a separation of the epidermal and dermal compartments to examine compartment specific biological mechanisms in the skin, we incubated 4 mm human skin punch biopsies in ammonium thiocyanate. We wanted to test (i) the histological quality of the dermo-epidermal separation obtained...... by different incubation times; (ii) the amount and quality of extractable epidermal RNA and (iii) its impact on sample RNA expression profiles assessed by large-scale gene expression microarray analysis in both normal and inflamed skin. At 30-min incubation, the split between dermis and epidermis...... and almost completely separated from the dermis of 4 mm skin biopsies by 30 min incubation in 3.8% ammonium thiocyanate combined with curettage of the dermal surface, producing high-quality RNA suitable for transcriptional analysis. Our refined method of dermo-epidermal separation will undoubtedly prove...

  2. Isolation of high-quality total RNA from leaves of Myrciaria dubia "CAMU CAMU".

    Science.gov (United States)

    Gómez, Juan Carlos Castro; Reátegui, Alina Del Carmen Egoavil; Flores, Julián Torres; Saavedra, Roberson Ramírez; Ruiz, Marianela Cobos; Correa, Sixto Alfredo Imán

    2013-01-01

    Myrciaria dubia is a main source of vitamin C for people in the Amazon region. Molecular studies of M. dubia require high-quality total RNA from different tissues. So far, no protocols have been reported for total RNA isolation from leaves of this species. The objective of this research was to develop protocols for extracting high-quality total RNA from leaves of M. dubia. Total RNA was purified following two modified protocols developed for leaves of other species (by Zeng and Yang, and by Reid et al.) and one modified protocol developed for fruits of the studied species (by Silva). Quantity and quality of purified total RNA were assessed by spectrophotometric and electrophoretic analysis. Additionally, quality of total RNA was evaluated with reverse-transcription polymerase chain reaction (RT-PCR). With these three modified protocols we were able to isolate high-quality RNA (A260nm/A280nm >1.9 and A260nm/A230nm >2.0). Highest yield was produced with the Zeng and Yang modified protocol (384±46µg ARN/g fresh weight). Furthermore, electrophoretic analysis showed the integrity of isolated RNA and the absence of DNA. Another proof of the high quality of our purified RNA was the successful cDNA synthesis and amplification of a segment of the M. dubia actin 1 gene. We report three modified protocols for isolation total RNA from leaves of M. dubia. The modified protocols are easy, rapid, low in cost, and effective for high-quality and quantity total RNA isolation suitable for cDNA synthesis and polymerase chain reaction.

  3. Isolation of high quality RNA from pistachio (Pistacia vera L.) and other woody plants high in secondary metabolites.

    Science.gov (United States)

    Moazzam Jazi, Maryam; Rajaei, Saideh; Seyedi, Seyed Mahdi

    2015-10-01

    The quality and quantity of RNA are critical for successful downstream transcriptome-based studies such as microarrays and RNA sequencing (RNA-Seq). RNA isolation from woody plants, such as Pistacia vera, with very high amounts of polyphenols and polysaccharides is an enormous challenge. Here, we describe a highly efficient protocol that overcomes the limitations posed by poor quality and low yield of isolated RNA from pistachio and various recalcitrant woody plants. The key factors that resulted in a yield of 150 μg of high quality RNA per 200 mg of plant tissue include the elimination of phenol from the extraction buffer, raising the concentration of β-mercaptoethanol, long time incubation at 65 °C, and nucleic acid precipitation with optimized volume of NaCl and isopropyl alcohol. Also, the A260/A280 and A260/A230 of extracted RNA were about 1.9-2.1and 2.2-2.3, respectively, revealing the high purity. Since the isolated RNA passed highly stringent quality control standards for sensitive reactions, including RNA sequencing and real-time PCR, it can be considered as a reliable and cost-effective method for RNA extraction from woody plants.

  4. High quality RNA isolation from Aedes aegypti midguts using laser microdissection microscopy

    Directory of Open Access Journals (Sweden)

    Gobert Geoffrey N

    2011-05-01

    Full Text Available Abstract Background Laser microdissection microscopy (LMM has potential as a research tool because it allows precise excision of target tissues or cells from a complex biological specimen, and facilitates tissue-specific sample preparation. However, this method has not been used in mosquito vectors to date. To this end, we have developed an LMM method to isolate midgut RNA using Aedes aegypti. Results Total RNA was isolated from Ae. aegypti midguts that were either fresh-frozen or fixed with histological fixatives. Generally, fresh-frozen tissue sections are a common source of quality LMM-derived RNA; however, our aim was to develop an LMM protocol that could inactivate pathogenic viruses by fixation, while simultaneously preserving RNA from arbovirus-infected mosquitoes. Three groups (10 - 15 mosquitoes per group of female Ae. aegypti at 24 or 48-hours post-blood meal were intrathoracically injected with one of seven common fixatives (Bouin's, Carnoy's, Formoy's, Cal-Rite, 4% formalin, 10% neutral buffered formalin, or zinc formalin to evaluate their effect on RNA quality. Total RNA was isolated from the fixed abdomens using a Trizol® method. The results indicated that RNA from Carnoy's and Bouin's fixative samples was comparable to that of fresh frozen midguts (control in duplicate experiments. When Carnoy's and Bouin's were used to fix the midguts for the LMM procedure, however, Carnoy's-fixed RNA clearly showed much less degradation than Bouin's-fixed RNA. In addition, a sample of 5 randomly chosen transcripts were amplified more efficiently using the Carnoy's treated LMM RNA than Bouin's-fixed RNA in quantitative real-time PCR (qRT-PCR assays, suggesting there were more intact target mRNAs in the Carnoy's fixed RNA. The yields of total RNA ranged from 0.3 to 19.0 ng per ~3.0 × 106 μm2 in the LMM procedure. Conclusions Carnoy's fixative was found to be highly compatible with LMM, producing high quality RNA from Ae. aegypti midguts while

  5. Bioengineering a human plasma-based epidermal substitute with efficient grafting capacity and high content in clonogenic cells.

    Science.gov (United States)

    Alexaline, Maia M; Trouillas, Marina; Nivet, Muriel; Bourreau, Emilie; Leclerc, Thomas; Duhamel, Patrick; Martin, Michele T; Doucet, Christelle; Fortunel, Nicolas O; Lataillade, Jean-Jacques

    2015-06-01

    Cultured epithelial autografts (CEAs) produced from a small, healthy skin biopsy represent a lifesaving surgical technique in cases of full-thickness skin burn covering >50% of total body surface area. CEAs also present numerous drawbacks, among them the use of animal proteins and cells, the high fragility of keratinocyte sheets, and the immaturity of the dermal-epidermal junction, leading to heavy cosmetic and functional sequelae. To overcome these weaknesses, we developed a human plasma-based epidermal substitute (hPBES) for epidermal coverage in cases of massive burn, as an alternative to traditional CEA, and set up critical quality controls for preclinical and clinical studies. In this study, phenotypical analyses in conjunction with functional assays (clonal analysis, long-term culture, or in vivo graft) showed that our new substitute fulfills the biological requirements for epidermal regeneration. hPBES keratinocytes showed high potential for cell proliferation and subsequent differentiation similar to healthy skin compared with a well-known reference material, as ascertained by a combination of quality controls. This work highlights the importance of integrating relevant multiparameter quality controls into the bioengineering of new skin substitutes before they reach clinical development. This work involves the development of a new bioengineered epidermal substitute with pertinent functional quality controls. The novelty of this work is based on this quality approach. ©AlphaMed Press.

  6. High Quality RNA Isolation from Leaf, Shell, Root Tissues and Callus of Hazelnut (Corylus avellana L.

    Directory of Open Access Journals (Sweden)

    Hossein Khosravi

    2017-12-01

    Full Text Available Extraction of high quality RNA is a critical step in molecular genetics studies. Hazelnut is one of the most important nuts plants in the world. The presence of the taxol and other taxanes in hazelnut plant necessitates explaining their biosynthesis pathway and identifying the candidate genes. Therefore, an easy and practical method is necessary for RNA extraction from hazelnuts. Hazelnut has high levels of phenolic compounds. High amounts of polyphenolic and polysaccharide compounds in plants could be causing problems in RNA extraction procedures.  To avoid these problems, a simple and efficient method can be used based on cetyltrimethylammonium bromide (CTAB extraction buffer and lithium chloride for extraction of high quality RNA from different parts of hazelnut plant. Using this method, a high-quality RNA sample (light absorbed in the A260/A280 was 2.04

  7. Purpura fulminans mimicking toxic epidermal necrolysis - additional value of 16S rRNA sequencing and skin biopsy.

    Science.gov (United States)

    Dautzenberg, K H W; Polderman, F N; van Suylen, R J; Moviat, M A M

    2017-05-01

    Both purpura fulminans and toxic epidermal necrolysis (TEN) are rare and life-threatening disorders with a high mortality. We present a case of suspected rapidly progressive, severe pneumococcal sepsis-induced purpura fulminans complicated by multiple organ failure, severe epidermolysis and cutaneous necrosis. We show the diagnostic challenge to differentiate between purpura fulminans and TEN, as the extensive epidermolysis in purpura fulminans may mimic TEN and we highlight the additional value of repeated skin biopsies and 16S rRNA gene sequencing.

  8. Protocol: A simple phenol-based method for 96-well extraction of high quality RNA from Arabidopsis

    Directory of Open Access Journals (Sweden)

    Coustham Vincent

    2011-03-01

    Full Text Available Abstract Background Many experiments in modern plant molecular biology require the processing of large numbers of samples for a variety of applications from mutant screens to the analysis of natural variants. A severe bottleneck to many such analyses is the acquisition of good yields of high quality RNA suitable for use in sensitive downstream applications such as real time quantitative reverse-transcription-polymerase chain reaction (real time qRT-PCR. Although several commercial kits are available for high-throughput RNA extraction in 96-well format, only one non-kit method has been described in the literature using the commercial reagent TRIZOL. Results We describe an unusual phenomenon when using TRIZOL reagent with young Arabidopsis seedlings. This prompted us to develop a high-throughput RNA extraction protocol (HTP96 adapted from a well established phenol:chloroform-LiCl method (P:C-L that is cheap, reliable and requires no specialist equipment. With this protocol 192 high quality RNA samples can be prepared in 96-well format in three hours (less than 1 minute per sample with less than 1% loss of samples. We demonstrate that the RNA derived from this protocol is of high quality and suitable for use in real time qRT-PCR assays. Conclusion The development of the HTP96 protocol has vastly increased our sample throughput, allowing us to fully exploit the large sample capacity of modern real time qRT-PCR thermocyclers, now commonplace in many labs, and develop an effective high-throughput gene expression platform. We propose that the HTP96 protocol will significantly benefit any plant scientist with the task of obtaining hundreds of high quality RNA extractions.

  9. A Rapid and Efficient Method for Purifying High Quality Total RNA from Peaches (Prunus persica for Functional Genomics Analyses

    Directory of Open Access Journals (Sweden)

    LEE MEISEL

    2005-01-01

    Full Text Available Prunus persica has been proposed as a genomic model for deciduous trees and the Rosaceae family. Optimized protocols for RNA isolation are necessary to further advance studies in this model species such that functional genomics analyses may be performed. Here we present an optimized protocol to rapidly and efficiently purify high quality total RNA from peach fruits (Prunus persica. Isolating high-quality RNA from fruit tissue is often difficult due to large quantities of polysaccharides and polyphenolic compounds that accumulate in this tissue and co-purify with the RNA. Here we demonstrate that a modified version of the method used to isolate RNA from pine trees and the woody plant Cinnamomun tenuipilum is ideal for isolating high quality RNA from the fruits of Prunus persica. This RNA may be used for many functional genomic based experiments such as RT-PCR and the construction of large-insert cDNA libraries.

  10. Combining laser-assisted microdissection (LAM) and RNA-seq allows to perform a comprehensive transcriptomic analysis of epidermal cells of Arabidopsis embryo.

    Science.gov (United States)

    Sakai, Kaori; Taconnat, Ludivine; Borrega, Nero; Yansouni, Jennifer; Brunaud, Véronique; Paysant-Le Roux, Christine; Delannoy, Etienne; Martin Magniette, Marie-Laure; Lepiniec, Loïc; Faure, Jean Denis; Balzergue, Sandrine; Dubreucq, Bertrand

    2018-01-01

    Genome-wide characterization of tissue- or cell-specific gene expression is a recurrent bottleneck in biology. We have developed a sensitive approach based on ultra-low RNA sequencing coupled to laser assisted microdissection for analyzing different tissues of the small Arabidopsis embryo. We first characterized the number of genes detected according to the quantity of tissue yield and total RNA extracted. Our results revealed that as low as 0.02 mm 2 of tissue and 50 pg of total RNA can be used without compromising the number of genes detected. The optimised protocol was used to compare the epidermal versus mesophyll cell transcriptomes of cotyledons at the torpedo-shaped stage of embryo development. The approach was validated by the recovery of well-known epidermal genes such AtML1 or AtPDF2 and genes involved in flavonoid and cuticular waxes pathways. Moreover, the interest and sensitivity of this approach were highlighted by the characterization of several transcription factors preferentially expressed in epidermal cells. This technical advance unlocks some current limitations of transcriptomic analyses and allows to investigate further and efficiently new biological questions for which only a very small amounts of cells need to be isolated. For instance, it paves the way to increasing the spatial accuracy of regulatory networks in developing small embryo of Arabidopsis or other plant tissues.

  11. Impact of in Vivo Ischemic Time on RNA Quality

    DEFF Research Database (Denmark)

    Olsen, Jesper; Kierkeby, Lene T.; Eiholm, Susanne

    2015-01-01

    immediately following the tumor removal. The time from clamping the main arterial supply to resection and removal of the tumor was used to estimate the in vivo ischemic time. We did not observe a significant difference in RNA quality between normal tissue and tumor tissue. We observed a significant......Considerable effort has been made to improve differentiated diagnostics as well as personalized treatment for colorectal cancer patients. High-quality fresh frozen tissue is often required to investigate relevant molecular signatures in these patients. In RNA expression studies, the “RNA integrity...... number” is widely accepted as a reliable marker of RNA quality. Here, we investigate the feasibility of obtaining high-quality tissue from a colon cancer biobank and the impact of in vivo ischemic time and various technical and clinicopathological factors on RNA quality. Biopsies were obtained...

  12. An improved and reproducible protocol for the extraction of high quality fungal RNA from plant biomass substrates

    NARCIS (Netherlands)

    Patyshakuliyeva, Aleksandrina; Mäkelä, Miia R; Sietiö, Outi-Maaria; de Vries, Ronald P; Hildén, Kristiina S; van den Brink, J.

    2014-01-01

    Isolation of high quantity and quality RNA is a crucial step in the detection of meaningful gene expression data. Obtaining intact fungal RNA from complex lignocellulosic substrates is often difficult, producing low integrity RNA which perform poorly in downstream applications. In this study we

  13. High-quality total RNA isolation from melon (Cucumis melo L. fruits rich in polysaccharides

    Directory of Open Access Journals (Sweden)

    Gabrielle Silveira de Campos

    2017-08-01

    Full Text Available Melon, a member of the family Cucurbitaceae, is the fourth most important fruit in the world market and, on a volume basis, is Brazil’s main fresh fruit export. Many molecular techniques used to understand the maturation of these fruits require high concentrations of highly purified RNA. However, melons are rich in polyphenolic compounds and polysaccharides, which interfere with RNA extraction. This study aimed to determine the most appropriate method for total RNA extraction from melon fruits. Six extraction buffers were tested: T1 guanidine thiocyanate/phenol/chloroform; T2 sodium azide/?-mercaptoethanol; T3 phenol/guanidine thiocyanate; T4 CTAB/PVP/?-mercaptoethanol; T5 SDS/sodium perchlorate/PVP/?-mercaptoethanol, and T6 sarkosyl/PVP/guanidine thiocyanate, using the AxyPrepTM Multisource Total RNA Miniprep Kit. The best method for extracting RNA from both mature and green fruit was based on the SDS/PVP/?-mercaptoethanol buffer, because it rapidly generated a high quality and quantity of material. In general, higher amounts of RNA were obtained from green than mature fruits, probably due to the lower concentration of polysaccharides and water. The purified material can be used as a template in molecular techniques, such as microarrays, RT-PCR, and in the construction of cDNA and RNA-seq data.

  14. Epidermal growth factor and insulin-like growth factor I upregulate the expression of the epidermal growth factor system in rat liver

    DEFF Research Database (Denmark)

    Bor, M V; Sørensen, B S; Vinter-Jensen, L

    2000-01-01

    BACKGROUND/AIM: Both epidermal growth factor and insulin-like growth factor I play a role in connection with the liver. In the present study, the possible interaction of these two growth factor systems was studied by investigating the effect of epidermal growth factor or insulin-like growth factor...... I treatment on the expression of the epidermal growth factor receptor, and its activating ligands, transforming growth factor-alpha and epidermal growth factor. METHODS: Fifty-five male rats received no treatment, human recombinant epidermal growth factor or human recombinant insulin-like growth.......8+/-1.6 fmol/mg protein epidermal growth factor and 144+/-22 fmol/mg protein transforming growth factor-alpha. Both epidermal growth factor and insulin-like growth factor I treatment increased the expression of mRNA for transforming growth factor-alpha and epidermal growth factor receptor, as well...

  15. Microneedle fractional radiofrequency increases epidermal hyaluronan and reverses age-related epidermal dysfunction.

    Science.gov (United States)

    Lee, Hee Jung; Seo, Seong Rak; Yoon, Moon Soo; Song, Ji-Ye; Lee, Eun Young; Lee, Sang Eun

    2016-02-01

    Skin aging results in physiological alterations in keratinocyte activities and epidermal function, as well as dermal changes. Yet, the cellular and molecular mechanisms that cause epidermal dysfunction during skin aging are not well understood. Recently, the role of epidermal hyaluronan (HA) as an active regulator of dynamic cellular processes is getting attention and alterations in HA metabolism are thought to be important in age-related epidermal dysfunction. Microneedle fractional radiofrequency (RF) has shown effects for improving cutaneous aging. However, little is known about the effects of fractional RF on the epidermal HA and epidermal function. We investigated the effect of microneedle fractional RF on the expression of epidermal HA in young and aged mice epidermis. We performed fractional RF on the dorsal skin of 30 8-week-old (young) hairless mice and 15 47-week-old (aged) C57BL/6J mice. Skin samples were collected on day 1, 3, and 7. HA content was measured by ELISA. Gene expressions of CD 44, HABP4, and HAS3 were measured using real time RT-PCR. Immunohistochemistry for detection of HA, CD44, PCNA, and filaggrin were performed. HA content and the mRNA levels of HABP4, CD44, and HAS3 were upregulated in the epidermis of both young and aged mice after microneedle fractional RF treatment. The expression was increased from day 1 after treatment and increased expression persisted on day 7. Fractional RF treatment significantly increased PCNA and filaggrin expression only in the aged mice skin. Microneedle fractional RF increased epidermal HA and CD44 expression in both young and aged mice and reversed age-related epidermal dysfunction especially in aged mice, suggesting a new mechanism involved in the skin rejuvenation effect of microneedle fractional RF. © 2015 Wiley Periodicals, Inc.

  16. Short Communication An efficient method for simultaneous extraction of high-quality RNA and DNA from various plant tissues.

    Science.gov (United States)

    Oliveira, R R; Viana, A J C; Reátegui, A C E; Vincentz, M G A

    2015-12-29

    Determination of gene expression is an important tool to study biological processes and relies on the quality of the extracted RNA. Changes in gene expression profiles may be directly related to mutations in regulatory DNA sequences or alterations in DNA cytosine methylation, which is an epigenetic mark. Correlation of gene expression with DNA sequence or epigenetic mark polymorphism is often desirable; for this, a robust protocol to isolate high-quality RNA and DNA simultaneously from the same sample is required. Although commercial kits and protocols are available, they are mainly optimized for animal tissues and, in general, restricted to RNA or DNA extraction, not both. In the present study, we describe an efficient and accessible method to extract both RNA and DNA simultaneously from the same sample of various plant tissues, using small amounts of starting material. The protocol was efficient in the extraction of high-quality nucleic acids from several Arabidopsis thaliana tissues (e.g., leaf, inflorescence stem, flower, fruit, cotyledon, seedlings, root, and embryo) and from other tissues of non-model plants, such as Avicennia schaueriana (Acanthaceae), Theobroma cacao (Malvaceae), Paspalum notatum (Poaceae), and Sorghum bicolor (Poaceae). The obtained nucleic acids were used as templates for downstream analyses, such as mRNA sequencing, quantitative real time-polymerase chain reaction, bisulfite treatment, and others; the results were comparable to those obtained with commercial kits. We believe that this protocol could be applied to a broad range of plant species, help avoid technical and sampling biases, and facilitate several RNA- and DNA-dependent analyses.

  17. Evaluations of methods for the isolation of high quality RNA from bovine and cervine hide biopsies for use in gene expression studies

    Science.gov (United States)

    Molecular investigations of the ruminant response to ectoparasites at the parasite-host interface are critically dependent upon the quality of RNA. The complexity of ruminant skin decreases the capacity to obtain high quality RNA from biopsy samples, which directly affects the reliability of data pr...

  18. Extraction of High Quality RNA from Cannabis sativa Bast Fibres: A Vademecum for Molecular Biologists

    Directory of Open Access Journals (Sweden)

    Gea Guerriero

    2016-07-01

    Full Text Available In plants there is no universal protocol for RNA extraction, since optimizations are required depending on the species, tissues and developmental stages. Some plants/tissues are rich in secondary metabolites or synthesize thick cell walls, which hinder an efficient RNA extraction. One such example is bast fibres, long extraxylary cells characterized by a thick cellulosic cell wall. Given the economic importance of bast fibres, which are used in the textile sector, as well as in biocomposites as green substitutes of glass fibres, it is desirable to better understand their development from a molecular point of view. This knowledge favours the development of biotechnological strategies aimed at improving specific properties of bast fibres. To be able to perform high-throughput analyses, such as, for instance, transcriptomics of bast fibres, RNA extraction is a crucial and limiting step. We here detail a protocol enabling the rapid extraction of high quality RNA from the bast fibres of textile hemp, Cannabis sativa L., a multi-purpose fibre crop standing in the spotlight of research.

  19. RNA-SeQC: RNA-seq metrics for quality control and process optimization.

    Science.gov (United States)

    DeLuca, David S; Levin, Joshua Z; Sivachenko, Andrey; Fennell, Timothy; Nazaire, Marc-Danie; Williams, Chris; Reich, Michael; Winckler, Wendy; Getz, Gad

    2012-06-01

    RNA-seq, the application of next-generation sequencing to RNA, provides transcriptome-wide characterization of cellular activity. Assessment of sequencing performance and library quality is critical to the interpretation of RNA-seq data, yet few tools exist to address this issue. We introduce RNA-SeQC, a program which provides key measures of data quality. These metrics include yield, alignment and duplication rates; GC bias, rRNA content, regions of alignment (exon, intron and intragenic), continuity of coverage, 3'/5' bias and count of detectable transcripts, among others. The software provides multi-sample evaluation of library construction protocols, input materials and other experimental parameters. The modularity of the software enables pipeline integration and the routine monitoring of key measures of data quality such as the number of alignable reads, duplication rates and rRNA contamination. RNA-SeQC allows investigators to make informed decisions about sample inclusion in downstream analysis. In summary, RNA-SeQC provides quality control measures critical to experiment design, process optimization and downstream computational analysis. See www.genepattern.org to run online, or www.broadinstitute.org/rna-seqc/ for a command line tool.

  20. Evaluating Quality of Aged Archival Formalin-Fixed Paraffin-Embedded Samples for RNA-Sequencing

    Science.gov (United States)

    Archival formalin-fixed paraffin-embedded (FFPE) samples offer a vast, untapped source of genomic data for biomarker discovery. However, the quality of FFPE samples is often highly variable, and conventional methods to assess RNA quality for RNA-sequencing (RNA-seq) are not infor...

  1. Arctigenin induced gallbladder cancer senescence through modulating epidermal growth factor receptor pathway.

    Science.gov (United States)

    Zhang, Mingdi; Cai, Shizhong; Zuo, Bin; Gong, Wei; Tang, Zhaohui; Zhou, Di; Weng, Mingzhe; Qin, Yiyu; Wang, Shouhua; Liu, Jun; Ma, Fei; Quan, Zhiwei

    2017-05-01

    Gallbladder cancer has poor prognosis and limited therapeutic options. Arctigenin, a representative dibenzylbutyrolactone lignan, occurs in a variety of plants. However, the molecular mechanisms involved in the antitumor effect of arctigenin on gallbladder cancer have not been fully elucidated. The expression levels of epidermal growth factor receptor were examined in 100 matched pairs of gallbladder cancer tissues. A positive correlation between high epidermal growth factor receptor expression levels and poor prognosis was observed in gallbladder cancer tissues. Pharmacological inhibition or inhibition via RNA interference of epidermal growth factor receptor induced cellular senescence in gallbladder cancer cells. The antitumor effect of arctigenin on gallbladder cancer cells was primarily achieved by inducing cellular senescence. In gallbladder cancer cells treated with arctigenin, the expression level of epidermal growth factor receptor significantly decreased. The analysis of the activity of the kinases downstream of epidermal growth factor receptor revealed that the RAF-MEK-ERK signaling pathway was significantly inhibited. Furthermore, the cellular senescence induced by arctigenin could be reverted by pcDNA-epidermal growth factor receptor. Arctigenin also potently inhibited the growth of tumor xenografts, which was accompanied by the downregulation of epidermal growth factor receptor and induction of senescence. This study demonstrates arctigenin could induce cellular senescence in gallbladder cancer through the modulation of epidermal growth factor receptor pathway. These data identify epidermal growth factor receptor as a key regulator in arctigenin-induced gallbladder cancer senescence.

  2. Mesoporous silica nanorods toward efficient loading and intracellular delivery of siRNA

    Science.gov (United States)

    Chen, Lijue; She, Xiaodong; Wang, Tao; Shigdar, Sarah; Duan, Wei; Kong, Lingxue

    2018-02-01

    The technology of RNA interference (RNAi) that uses small interfering RNA (siRNA) to silence the gene expression with complementary messenger RNA (mRNA) sequence has great potential for the treatment of cancer in which certain genes were usually found overexpressed. However, the carry and delivery of siRNA to the target site in the human body can be challenging for this technology to be used clinically to silence the cancer-related gene expression. In this work, rod shaped mesoporous silica nanoparticles (MSNs) were developed as siRNA delivery system for specific intracellular delivery. The rod MSNs with an aspect ratio of 1.5 had a high surface area of 934.28 m2/g and achieved a siRNA loading of more than 80 mg/g. With the epidermal growth factor (EGF) grafted on the surface of the MSNs, siRNA can be delivered to the epidermal growth factor receptor (EGFR) overexpressed colorectal cancer cells with high intracellular concentration compared to MSNs without EGF and lead to survivin gene knocking down to less than 30%.

  3. Selection of DNA aptamers against epidermal growth factor receptor with high affinity and specificity

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Deng-Liang [The First Clinical Medical College of Fujian Medical University, Fuzhou (China); Department of Neurosurgery, The First Affiliated Hospital of Fujian Medical University, Fuzhou (China); Song, Yan-Ling; Zhu, Zhi; Li, Xi-Lan; Zou, Yuan [State Key Laboratory for Physical Chemistry of Solid Surfaces, Key Laboratory for Chemical Biology of Fujian Province, Key Laboratory of Analytical Chemistry, and Department of Chemical Biology, College of Chemistry and Chemical Engineering, Xiamen University, Xiamen 361005 (China); Yang, Hai-Tao; Wang, Jiang-Jie [The First Clinical Medical College of Fujian Medical University, Fuzhou (China); Yao, Pei-Sen [Department of Neurosurgery, The First Affiliated Hospital of Fujian Medical University, Fuzhou (China); Pan, Ru-Jun [The First Clinical Medical College of Fujian Medical University, Fuzhou (China); Yang, Chaoyong James, E-mail: cyyang@xmu.edu.cn [State Key Laboratory for Physical Chemistry of Solid Surfaces, Key Laboratory for Chemical Biology of Fujian Province, Key Laboratory of Analytical Chemistry, and Department of Chemical Biology, College of Chemistry and Chemical Engineering, Xiamen University, Xiamen 361005 (China); Kang, De-Zhi, E-mail: kdzy99988@163.com [The First Clinical Medical College of Fujian Medical University, Fuzhou (China); Department of Neurosurgery, The First Affiliated Hospital of Fujian Medical University, Fuzhou (China)

    2014-10-31

    Highlights: • This is the first report of DNA aptamer against EGFR in vitro. • Aptamer can bind targets with high affinity and selectivity. • DNA aptamers are more stable, cheap and efficient than RNA aptamers. • Our selected DNA aptamer against EGFR has high affinity with K{sub d} 56 ± 7.3 nM. • Our selected DNA aptamer against EGFR has high selectivity. - Abstract: Epidermal growth factor receptor (EGFR/HER1/c-ErbB1), is overexpressed in many solid cancers, such as epidermoid carcinomas, malignant gliomas, etc. EGFR plays roles in proliferation, invasion, angiogenesis and metastasis of malignant cancer cells and is the ideal antigen for clinical applications in cancer detection, imaging and therapy. Aptamers, the output of the systematic evolution of ligands by exponential enrichment (SELEX), are DNA/RNA oligonucleotides which can bind protein and other substances with specificity. RNA aptamers are undesirable due to their instability and high cost of production. Conversely, DNA aptamers have aroused researcher’s attention because they are easily synthesized, stable, selective, have high binding affinity and are cost-effective to produce. In this study, we have successfully identified DNA aptamers with high binding affinity and selectivity to EGFR. The aptamer named TuTu22 with K{sub d} 56 ± 7.3 nM was chosen from the identified DNA aptamers for further study. Flow cytometry analysis results indicated that the TuTu22 aptamer was able to specifically recognize a variety of cancer cells expressing EGFR but did not bind to the EGFR-negative cells. With all of the aforementioned advantages, the DNA aptamers reported here against cancer biomarker EGFR will facilitate the development of novel targeted cancer detection, imaging and therapy.

  4. Selection of DNA aptamers against epidermal growth factor receptor with high affinity and specificity

    International Nuclear Information System (INIS)

    Wang, Deng-Liang; Song, Yan-Ling; Zhu, Zhi; Li, Xi-Lan; Zou, Yuan; Yang, Hai-Tao; Wang, Jiang-Jie; Yao, Pei-Sen; Pan, Ru-Jun; Yang, Chaoyong James; Kang, De-Zhi

    2014-01-01

    Highlights: • This is the first report of DNA aptamer against EGFR in vitro. • Aptamer can bind targets with high affinity and selectivity. • DNA aptamers are more stable, cheap and efficient than RNA aptamers. • Our selected DNA aptamer against EGFR has high affinity with K d 56 ± 7.3 nM. • Our selected DNA aptamer against EGFR has high selectivity. - Abstract: Epidermal growth factor receptor (EGFR/HER1/c-ErbB1), is overexpressed in many solid cancers, such as epidermoid carcinomas, malignant gliomas, etc. EGFR plays roles in proliferation, invasion, angiogenesis and metastasis of malignant cancer cells and is the ideal antigen for clinical applications in cancer detection, imaging and therapy. Aptamers, the output of the systematic evolution of ligands by exponential enrichment (SELEX), are DNA/RNA oligonucleotides which can bind protein and other substances with specificity. RNA aptamers are undesirable due to their instability and high cost of production. Conversely, DNA aptamers have aroused researcher’s attention because they are easily synthesized, stable, selective, have high binding affinity and are cost-effective to produce. In this study, we have successfully identified DNA aptamers with high binding affinity and selectivity to EGFR. The aptamer named TuTu22 with K d 56 ± 7.3 nM was chosen from the identified DNA aptamers for further study. Flow cytometry analysis results indicated that the TuTu22 aptamer was able to specifically recognize a variety of cancer cells expressing EGFR but did not bind to the EGFR-negative cells. With all of the aforementioned advantages, the DNA aptamers reported here against cancer biomarker EGFR will facilitate the development of novel targeted cancer detection, imaging and therapy

  5. Sample preservation, transport and processing strategies for honeybee RNA extraction: Influence on RNA yield, quality, target quantification and data normalization.

    Science.gov (United States)

    Forsgren, Eva; Locke, Barbara; Semberg, Emilia; Laugen, Ane T; Miranda, Joachim R de

    2017-08-01

    Viral infections in managed honey bees are numerous, and most of them are caused by viruses with an RNA genome. Since RNA degrades rapidly, appropriate sample management and RNA extraction methods are imperative to get high quality RNA for downstream assays. This study evaluated the effect of various sampling-transport scenarios (combinations of temperature, RNA stabilizers, and duration) of transport on six RNA quality parameters; yield, purity, integrity, cDNA synthesis efficiency, target detection and quantification. The use of water and extraction buffer were also compared for a primary bee tissue homogenate prior to RNA extraction. The strategy least affected by time was preservation of samples at -80°C. All other regimens turned out to be poor alternatives unless the samples were frozen or processed within 24h. Chemical stabilizers have the greatest impact on RNA quality and adding an extra homogenization step (a QIAshredder™ homogenizer) to the extraction protocol significantly improves the RNA yield and chemical purity. This study confirms that RIN values (RNA Integrity Number), should be used cautiously with bee RNA. Using water for the primary homogenate has no negative effect on RNA quality as long as this step is no longer than 15min. Copyright © 2017 Elsevier B.V. All rights reserved.

  6. Selection of DNA aptamers against epidermal growth factor receptor with high affinity and specificity.

    Science.gov (United States)

    Wang, Deng-Liang; Song, Yan-Ling; Zhu, Zhi; Li, Xi-Lan; Zou, Yuan; Yang, Hai-Tao; Wang, Jiang-Jie; Yao, Pei-Sen; Pan, Ru-Jun; Yang, Chaoyong James; Kang, De-Zhi

    2014-10-31

    Epidermal growth factor receptor (EGFR/HER1/c-ErbB1), is overexpressed in many solid cancers, such as epidermoid carcinomas, malignant gliomas, etc. EGFR plays roles in proliferation, invasion, angiogenesis and metastasis of malignant cancer cells and is the ideal antigen for clinical applications in cancer detection, imaging and therapy. Aptamers, the output of the systematic evolution of ligands by exponential enrichment (SELEX), are DNA/RNA oligonucleotides which can bind protein and other substances with specificity. RNA aptamers are undesirable due to their instability and high cost of production. Conversely, DNA aptamers have aroused researcher's attention because they are easily synthesized, stable, selective, have high binding affinity and are cost-effective to produce. In this study, we have successfully identified DNA aptamers with high binding affinity and selectivity to EGFR. The aptamer named TuTu22 with Kd 56±7.3nM was chosen from the identified DNA aptamers for further study. Flow cytometry analysis results indicated that the TuTu22 aptamer was able to specifically recognize a variety of cancer cells expressing EGFR but did not bind to the EGFR-negative cells. With all of the aforementioned advantages, the DNA aptamers reported here against cancer biomarker EGFR will facilitate the development of novel targeted cancer detection, imaging and therapy. Copyright © 2014 Elsevier Inc. All rights reserved.

  7. Extractions of High Quality RNA from the Seeds of Jerusalem Artichoke and Other Plant Species with High Levels of Starch and Lipid

    Directory of Open Access Journals (Sweden)

    Tanupat Mornkham

    2013-04-01

    Full Text Available Jerusalem artichoke (Helianthus tuberosus L. is an important tuber crop. However, Jerusalem artichoke seeds contain high levels of starch and lipid, making the extraction of high-quality RNA extremely difficult and the gene expression analysis challenging. This study was aimed to improve existing methods for extracting total RNA from Jerusalem artichoke dry seeds and to assess the applicability of the improved method in other plant species. Five RNA extraction methods were evaluated on Jerusalem artichoke seeds and two were modified. One modified method with the significant improvement was applied to assay seeds of diverse Jerusalem artichoke accessions, sunflower, rice, maize, peanut and marigold. The effectiveness of the improved method to extract total RNA from seeds was assessed using qPCR analysis of four selected genes. The improved method of Ma and Yang (2011 yielded a maximum RNA solubility and removed most interfering substances. The improved protocol generated 29 to 41 µg RNA/30 mg fresh weight. An A260/A280 ratio of 1.79 to 2.22 showed their RNA purity. Extracted RNA was effective for downstream applications such as first-stranded cDNA synthesis, cDNA cloning and qPCR. The improved method was also effective to extract total RNA from seeds of sunflower, rice, maize and peanut that are rich in polyphenols, lipids and polysaccharides.

  8. Extractions of High Quality RNA from the Seeds of Jerusalem Artichoke and Other Plant Species with High Levels of Starch and Lipid.

    Science.gov (United States)

    Mornkham, Tanupat; Wangsomnuk, Preeya Puangsomlee; Fu, Yong-Bi; Wangsomnuk, Pinich; Jogloy, Sanun; Patanothai, Aran

    2013-04-29

    Jerusalem artichoke (Helianthus tuberosus L.) is an important tuber crop. However, Jerusalem artichoke seeds contain high levels of starch and lipid, making the extraction of high-quality RNA extremely difficult and the gene expression analysis challenging. This study was aimed to improve existing methods for extracting total RNA from Jerusalem artichoke dry seeds and to assess the applicability of the improved method in other plant species. Five RNA extraction methods were evaluated on Jerusalem artichoke seeds and two were modified. One modified method with the significant improvement was applied to assay seeds of diverse Jerusalem artichoke accessions, sunflower, rice, maize, peanut and marigold. The effectiveness of the improved method to extract total RNA from seeds was assessed using qPCR analysis of four selected genes. The improved method of Ma and Yang (2011) yielded a maximum RNA solubility and removed most interfering substances. The improved protocol generated 29 to 41 µg RNA/30 mg fresh weight. An A260/A280 ratio of 1.79 to 2.22 showed their RNA purity. Extracted RNA was effective for downstream applications such as first-stranded cDNA synthesis, cDNA cloning and qPCR. The improved method was also effective to extract total RNA from seeds of sunflower, rice, maize and peanut that are rich in polyphenols, lipids and polysaccharides.

  9. MicroRNA-126 and epidermal growth factor-like domain 7-an angiogenic couple of importance in metastatic colorectal cancer. Results from the Nordic ACT trial.

    Science.gov (United States)

    Hansen, T F; Christensen, R dP; Andersen, R F; Sørensen, F B; Johnsson, A; Jakobsen, A

    2013-09-03

    This study investigated the clinical importance of linked angiogenetic biomarkers to chemotherapy, combined with the anti-vascular endothelial growth factor A (anti-VEGF-A), as a first-line treatment in patients with metastatic colorectal cancer (mCRC). A total of 230 patients from a randomised phase III study were included. The primary microRNA-126 (pri-miRNA-126) A24G single-nucleotide polymorphism and the mature miRNA-126 were analysed by PCR using genomic DNA (full blood) and formalin-fixed paraffin-embedded tissue sections, respectively. The epidermal growth factor-like domain 7 (EGFL7) protein was visualised and quantified using immunohistochemistry. High tumour expression of miRNA-126 was significantly related to a longer progression-free survival. The independent prognostic value of miRNA-126 was confirmed using a Cox regression analysis (hazard ratio=0.49, 95% confidence interval=0.29-0.84, P=0.009). Although not significant, a relationship between EGFL7 expression and response rates is suggested, with EGFL7 expression at the invasive front being lower in responding patients than in the non-responders (P=0.063). The results validate the previous findings on the prognostic value of miRNA-126 in mCRC and may suggest a relationship between treatment efficacy and EGFL7 expression. As miRNA-126 may target VEGF-A as well as EGFL7, the results may provide predictive information in relation to next-generation anti-angiogenetics.

  10. The effects of storage temperature and duration of blood samples on DNA and RNA qualities.

    Science.gov (United States)

    Huang, Lien-Hung; Lin, Pei-Hsien; Tsai, Kuo-Wang; Wang, Liang-Jen; Huang, Ying-Hsien; Kuo, Ho-Chang; Li, Sung-Chou

    2017-01-01

    DNA and RNA samples from blood are the common examination target for non-invasive physical tests and/or biomedical studies. Since high-quality DNA and RNA samples guarantee the correctness of these tests and/or studies, we investigated the effects of storage temperature and storage duration of whole blood on DNA and RNA qualities. Subjects were enrolled to donate blood samples which were stored for different durations and at different temperatures, followed by the examinations on RNA quality, qPCR, DNA quality and DNA methylation. For RNA, we observed obvious quality decline with storage duration longer than 24 hours. Storage at low temperature does not keep RNA samples from degradation. And, storing whole blood samples in freezer dramatically damage RNA. For DNA, quality decline was not observed even with storage duration for 15 days. However, DNA methylation significantly altered with storage duration longer than three days. Storage duration within 24 hours is critical for collecting high-quality RNA samples for next-generation sequencing (NGS) assays (RIN≧8). If microarray assays are expected (RIN≧7), storage duration within 32 hours is acceptable. Although DNA is resistant within 15 days when kept in whole blood, DNA quantity dramatically decreases owing to WBC lysis. In addition, duration for more than three days significantly alter DNA methylation status, globally and locally. Our result provides a reference for dealing with blood samples.

  11. Isolation of high-quality total RNA from rumen anaerobic bacteria and fungi, and subsequent detection of glycoside hydrolases.

    Science.gov (United States)

    Wang, Pan; Qi, Meng; Barboza, Perry; Leigh, Mary Beth; Ungerfeld, Emilio; Selinger, L Brent; McAllister, Tim A; Forster, Robert J

    2011-07-01

    The rumen is one of the most powerful fibrolytic fermentation systems known. Gene expression analyses, such as reverse transcription PCR (RT-PCR), microarrays, and metatranscriptomics, are techniques that could significantly expand our understanding of this ecosystem. The ability to isolate and stabilize representative RNA samples is critical to obtaining reliable results with these procedures. In this study, we successfully isolated high-quality total RNA from the solid phase of ruminal contents by using an improved RNA extraction method. This method is based on liquid nitrogen grinding of whole ruminal solids without microbial detachment and acid guanidinium - phenol - chloroform extraction combined with column purification. Yields of total RNA were as high as 150 µg per g of fresh ruminal content. The typical large subunit/small subunit rRNA ratio ranged from 1.8 to 2.0 with an RNA integrity number (Agilent Technologies) greater than 8.5. By eliminating the detachment step, the resulting RNA was more representative of the complete ecosystem. Our improved method removed a major barrier limiting analysis of rumen microbial function from a gene expression perspective. The polyA-tailed eukaryotic mRNAs obtained have successfully been applied to next-generation sequencing, and metatranscriptomic analysis of the solid fraction of rumen contents revealed abundant sequences related to rumen fungi.

  12. Determining RNA quality for NextGen sequencing: some exceptions to the gold standard rule of 23S to 16S rRNA ratio

    Science.gov (United States)

    Using next-generation-sequencing technology to assess entire transcriptomes requires high quality starting RNA. Currently, RNA quality is routinely judged using automated microfluidic gel electrophoresis platforms and associated algorithms. Here we report that such automated methods generate false-n...

  13. Heparin-binding epidermal growth factor-like growth factor promotes neuroblastoma differentiation.

    Science.gov (United States)

    Gaviglio, Angela L; Knelson, Erik H; Blobe, Gerard C

    2017-05-01

    High-risk neuroblastoma is characterized by undifferentiated neuroblasts and low schwannian stroma content. The tumor stroma contributes to the suppression of tumor growth by releasing soluble factors that promote neuroblast differentiation. Here we identify heparin-binding epidermal growth factor-like growth factor (HBEGF) as a potent prodifferentiating factor in neuroblastoma. HBEGF mRNA expression is decreased in human neuroblastoma tumors compared with benign tumors, with loss correlating with decreased survival. HBEGF protein is expressed only in stromal compartments of human neuroblastoma specimens, with tissue from high-stage disease containing very little stroma or HBEGF expression. In 3 human neuroblastoma cell lines (SK-N-AS, SK-N-BE2, and SH-SY5Y), soluble HBEGF is sufficient to promote neuroblast differentiation and decrease proliferation. Heparan sulfate proteoglycans and heparin derivatives further enhance HBEGF-induced differentiation by forming a complex with the epidermal growth factor receptor, leading to activation of the ERK1/2 and STAT3 pathways and up-regulation of the inhibitor of DNA binding transcription factor. These data support a role for loss of HBEGF in the neuroblastoma tumor microenvironment in neuroblastoma pathogenesis.-Gaviglio, A. L., Knelson, E. H., Blobe, G. C. Heparin-binding epidermal growth factor-like growth factor promotes neuroblastoma differentiation. © FASEB.

  14. Comprehensive processing of high-throughput small RNA sequencing data including quality checking, normalization, and differential expression analysis using the UEA sRNA Workbench.

    Science.gov (United States)

    Beckers, Matthew; Mohorianu, Irina; Stocks, Matthew; Applegate, Christopher; Dalmay, Tamas; Moulton, Vincent

    2017-06-01

    Recently, high-throughput sequencing (HTS) has revealed compelling details about the small RNA (sRNA) population in eukaryotes. These 20 to 25 nt noncoding RNAs can influence gene expression by acting as guides for the sequence-specific regulatory mechanism known as RNA silencing. The increase in sequencing depth and number of samples per project enables a better understanding of the role sRNAs play by facilitating the study of expression patterns. However, the intricacy of the biological hypotheses coupled with a lack of appropriate tools often leads to inadequate mining of the available data and thus, an incomplete description of the biological mechanisms involved. To enable a comprehensive study of differential expression in sRNA data sets, we present a new interactive pipeline that guides researchers through the various stages of data preprocessing and analysis. This includes various tools, some of which we specifically developed for sRNA analysis, for quality checking and normalization of sRNA samples as well as tools for the detection of differentially expressed sRNAs and identification of the resulting expression patterns. The pipeline is available within the UEA sRNA Workbench, a user-friendly software package for the processing of sRNA data sets. We demonstrate the use of the pipeline on a H. sapiens data set; additional examples on a B. terrestris data set and on an A. thaliana data set are described in the Supplemental Information A comparison with existing approaches is also included, which exemplifies some of the issues that need to be addressed for sRNA analysis and how the new pipeline may be used to do this. © 2017 Beckers et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  15. Biobanking of human pancreas cancer tissue: impact of ex-vivo procurement times on RNA quality.

    Science.gov (United States)

    Rudloff, Udo; Bhanot, Umesh; Gerald, William; Klimstra, David S; Jarnagin, William R; Brennan, Murray F; Allen, Peter J

    2010-08-01

    Tissue banking has become a major initiative at many oncology centers. The influence of warm ex-vivo ischemia times, storage times, and biobanking protocols on RNA integrity and subsequent microarray data is not well documented. A prospective institutional review board-approved protocol for the banking of abdominal neoplasms was initiated at Memorial Sloan-Kettering Cancer Center in 2001. Sixty-four representative pancreas cancer specimens snap-frozen at various ex-vivo procurement times (1 h) and banked during three time periods (2001-2004, 2004-2006, 2006-2008) were processed. RNA integrity was determined by microcapillary electrophoresis using the RNA integrity number (RIN) algorithm and by results of laser-capture microdissection (LCM). Overall, 42% of human pancreas cancer specimens banked under a dedicated protocol yielded RNA with a RIN of > or =7. Limited warm ex-vivo ischemia times did not negatively impact RNA quality (percentage of tissue with total RNA with RIN of > or =7 for 60 min, 42%), and long-term storage of banked pancreas cancer biospecimens did not negatively influence RNA quality (total RNA with RIN of > or =7 banked 2001-2004, 44%; 2004-2006, 38%; 2006-2008, 50%). RNA retrieved from pancreatic cancer samples with RIN of > or =7 subject to LCM yielded RNA suitable for further downstream applications. Fresh-frozen pancreas tissue banked within a standardized research protocol yields high-quality RNA in approximately 50% of specimens and can be used for enrichment by LCM. Quality of tissues of the biobank were not adversely impacted by limited variations of warm ischemia times or different storage periods. This study shows the challenges and investments required to initiate and maintain high-quality tissue repositories.

  16. Secreted Frizzled related protein-4 (sFRP4) promotes epidermal differentiation and apoptosis

    International Nuclear Information System (INIS)

    Maganga, Richard; Giles, Natalie; Adcroft, Katharine; Unni, Ambili; Keeney, Diane; Wood, Fiona; Fear, Mark; Dharmarajan, Arunasalam

    2008-01-01

    The skin provides vital protection from infection and dehydration. Maintenance of the skin is through a constant program of proliferation, differentiation and apoptosis of epidermal cells, whereby proliferating cells in the basal layer differentiating to form the keratinized, anucleated stratum corneum. The WNT signalling pathway is known to be important in the skin. WNT signalling has been shown to be important both in epidermal development and in the maintenance and cycling of hair follicles and epidermal stem cells. However, the precise role for this pathway in epidermal differentiation remains unknown. We investigated the role of the WNT signalling inhibitor sFRP4 in epidermal differentiation. sFRP4 is expressed in both normal skin and keratinocytes in culture. Expression of sFRP4 mRNA and protein increases with keratinocyte differentiation and apoptosis, whilst exposure of keratinocytes to exogenous sFRP4 promotes apoptosis and expression of the terminal differentiation marker Involucrin. These data suggest sFRP4 promotes epidermal differentiation.

  17. Real-time three-dimensional imaging of epidermal splitting and removal by high-definition optical coherence tomography.

    Science.gov (United States)

    Boone, Marc; Draye, Jean Pierre; Verween, Gunther; Pirnay, Jean-Paul; Verbeken, Gilbert; De Vos, Daniel; Rose, Thomas; Jennes, Serge; Jemec, Gregor B E; Del Marmol, Véronique

    2014-10-01

    While real-time 3-D evaluation of human skin constructs is needed, only 2-D non-invasive imaging techniques are available. The aim of this paper is to evaluate the potential of high-definition optical coherence tomography (HD-OCT) for real-time 3-D assessment of the epidermal splitting and decellularization. Human skin samples were incubated with four different agents: Dispase II, NaCl 1 M, sodium dodecyl sulphate (SDS) and Triton X-100. Epidermal splitting, dermo-epidermal junction, acellularity and 3-D architecture of dermal matrices were evaluated by High-definition optical coherence tomography before and after incubation. Real-time 3-D HD-OCT assessment was compared with 2-D en face assessment by reflectance confocal microscopy (RCM). (Immuno) histopathology was used as control. HD-OCT imaging allowed real-time 3-D visualization of the impact of selected agents on epidermal splitting, dermo-epidermal junction, dermal architecture, vascular spaces and cellularity. RCM has a better resolution (1 μm) than HD-OCT (3 μm), permitting differentiation of different collagen fibres, but HD-OCT imaging has deeper penetration (570 μm) than RCM imaging (200 μm). Dispase II and NaCl treatments were found to be equally efficient in the removal of the epidermis from human split-thickness skin allografts. However, a different epidermal splitting level at the dermo-epidermal junction could be observed and confirmed by immunolabelling of collagen type IV and type VII. Epidermal splitting occurred at the level of the lamina densa with dispase II and above the lamina densa (in the lamina lucida) with NaCl. The 3-D architecture of dermal papillae and dermis was more affected by Dispase II on HD-OCT which corresponded with histopathologic (orcein staining) fragmentation of elastic fibres. With SDS treatment, the epidermal removal was incomplete as remnants of the epidermal basal cell layer remained attached to the basement membrane on the dermis. With Triton X-100 treatment

  18. Psoriatic T cells reduce epidermal turnover time and affect cell proliferation contributed from differential gene expression.

    Science.gov (United States)

    Li, Junqin; Li, Xinhua; Hou, Ruixia; Liu, Ruifeng; Zhao, Xincheng; Dong, Feng; Wang, Chunfang; Yin, Guohua; Zhang, Kaiming

    2015-09-01

    Psoriasis is mediated primarily by T cells, which reduce epidermal turnover time and affect keratinocyte proliferation. We aimed to identify differentially expressed genes (DEG) in T cells from normal, five pairs of monozygotic twins concordant or discordant for psoriasis, to determine whether these DEG may account for the influence to epidermal turnover time and keratinocyte proliferation. The impact of T cells on keratinocyte proliferation and epidermal turnover time were investigated separately by immunohistochemistry and cultured with (3) H-TdR. mRNA expression patterns were investigated by RNA sequencing and verified by real-time reverse transcription polymerase chain reaction. After co-culture with psoriatic T cells, the expression of Ki-67, c-Myc and p53 increased, while expression of Bcl-2 and epidermal turnover time decreased. There were 14 DEG which were found to participate in the regulation of cell proliferation or differentiation. Psoriatic T cells exhibited the ability to decrease epidermal turnover time and affect keratinocyte proliferation because of the differential expression of PPIL1, HSPH1, SENP3, NUP54, FABP5, PLEKHG3, SLC9A9 and CHCHD4. © 2015 Japanese Dermatological Association.

  19. Characterization of the effect of sample quality on high density oligonucleotide microarray data using progressively degraded rat liver RNA

    Directory of Open Access Journals (Sweden)

    Rosenzweig Barry A

    2007-09-01

    Full Text Available Abstract Background The interpretability of microarray data can be affected by sample quality. To systematically explore how RNA quality affects microarray assay performance, a set of rat liver RNA samples with a progressive change in RNA integrity was generated by thawing frozen tissue or by ex vivo incubation of fresh tissue over a time course. Results Incubation of tissue at 37°C for several hours had little effect on RNA integrity, but did induce changes in the transcript levels of stress response genes and immune cell markers. In contrast, thawing of tissue led to a rapid loss of RNA integrity. Probe sets identified as most sensitive to RNA degradation tended to be located more than 1000 nucleotides upstream of their transcription termini, similar to the positioning of control probe sets used to assess sample quality on Affymetrix GeneChip® arrays. Samples with RNA integrity numbers less than or equal to 7 showed a significant increase in false positives relative to undegraded liver RNA and a reduction in the detection of true positives among probe sets most sensitive to sample integrity for in silico modeled changes of 1.5-, 2-, and 4-fold. Conclusion Although moderate levels of RNA degradation are tolerated by microarrays with 3'-biased probe selection designs, in this study we identify a threshold beyond which decreased specificity and sensitivity can be observed that closely correlates with average target length. These results highlight the value of annotating microarray data with metrics that capture important aspects of sample quality.

  20. The DP-1 transcription factor is required for keratinocyte growth and epidermal stratification.

    Science.gov (United States)

    Chang, Wing Y; Bryce, Dawn M; D'Souza, Sudhir J A; Dagnino, Lina

    2004-12-03

    The epidermis is a stratified epithelium constantly replenished through the ability of keratinocytes in its basal layer to proliferate and self-renew. The epidermis arises from a single-cell layer ectoderm during embryogenesis. Large proliferative capacity is central to ectodermal cell and basal keratinocyte function. DP-1, a heterodimeric partner of E2F transcription factors, is highly expressed in the ectoderm and all epidermal layers during embryogenesis. To investigate the role of DP-1 in epidermal morphogenesis, we inhibited DP-1 activity through exogenous expression of a dominant-negative mutant (dnDP-1). Expression of the dnDP-1 mutant interferes with binding of E2F/DP-1 heterodimers to DNA and inhibits DNA replication, as well as cyclin A mRNA and protein expression. Chromatin immunoprecipitation analysis demonstrated that the cyclin A promoter is predominantly bound in proliferating keratinocytes by complexes containing E2F-3 and E2F-4. Thus, the mechanisms of decreased expression of cyclin A in the presence of dnDP-1 seem to involve inactivation of DP-1 complexes containing E2F-3 and E2F-4. To assess the consequences on epidermal morphogenesis of inhibiting DP-1 activity, we expressed dnDP-1 in rat epithelial keratinocytes in organotypic culture and observed that DP-1 inhibition negatively affected stratification of these cells. Likewise, expression of dnDP-1 in embryonic ectoderm explants produced extensive disorganization of subsequently formed epidermal basal and suprabasal layers, interfering with normal epidermal formation. We conclude that DP-1 activity is required for normal epidermal morphogenesis and ectoderm-to-epidermis transition.

  1. Real-time three-dimensional imaging of epidermal splitting and removal by high-definition optical coherence tomography

    DEFF Research Database (Denmark)

    Boone, Marc; Draye, Jean Pierre; Verween, Gunther

    2014-01-01

    While real-time 3-D evaluation of human skin constructs is needed, only 2-D non-invasive imaging techniques are available. The aim of this paper is to evaluate the potential of high-definition optical coherence tomography (HD-OCT) for real-time 3-D assessment of the epidermal splitting and decell......While real-time 3-D evaluation of human skin constructs is needed, only 2-D non-invasive imaging techniques are available. The aim of this paper is to evaluate the potential of high-definition optical coherence tomography (HD-OCT) for real-time 3-D assessment of the epidermal splitting...... before and after incubation. Real-time 3-D HD-OCT assessment was compared with 2-D en face assessment by reflectance confocal microscopy (RCM). (Immuno) histopathology was used as control. HD-OCT imaging allowed real-time 3-D visualization of the impact of selected agents on epidermal splitting, dermo......-epidermal junction, dermal architecture, vascular spaces and cellularity. RCM has a better resolution (1 μm) than HD-OCT (3 μm), permitting differentiation of different collagen fibres, but HD-OCT imaging has deeper penetration (570 μm) than RCM imaging (200 μm). Dispase II and NaCl treatments were found...

  2. Introduction of a leucine half-zipper engenders multiple high-quality crystals of a recalcitrant tRNA synthetase

    International Nuclear Information System (INIS)

    Guo, Min; Shapiro, Ryan; Schimmel, Paul; Yang, Xiang-Lei

    2010-01-01

    E. coli alanyl-tRNA synthetase is recalcitrant to crystallization. A group of leucine substitutions has transformed the protein. Although Escherichia coli alanyl-tRNA synthetase was among the first tRNA synthetases to be sequenced and extensively studied by functional analysis, it has proved to be recalcitrant to crystallization. This challenge remained even for crystallization of the catalytic fragment. By mutationally introducing three stacked leucines onto the solvent-exposed side of an α-helix, an engineered catalytic fragment of the synthetase was obtained that yielded multiple high-quality crystals and cocrystals with different ligands. The engineered α-helix did not form a leucine zipper that interlocked with the same α-helix from another molecule. Instead, using the created hydrophobic spine, it interacted with other surfaces of the protein as a leucine half-zipper (LHZ) to enhance the crystal lattice interactions. The LHZ made crystal lattice contacts in all crystals of different space groups. These results illustrate the power of introducing an LHZ into helices to facilitate crystallization. The authors propose that the method can be unified with surface-entropy reduction and can be broadly used for protein-surface optimization in crystallization

  3. MicroRNA and gene signature of severe cutaneous drug ...

    African Journals Online (AJOL)

    Purpose: To build a microRNA and gene signature of severe cutaneous adverse drug reactions (SCAR), including Stevens-Johnson syndrome (SJS) and toxic epidermal necrolysis (TEN). Methods: MicroRNA expression profiles were downloaded from miRNA expression profile of patients' skin suffering from TEN using an ...

  4. Epidermal protection with cryogen spray cooling during high fluence pulsed dye laser irradiation: an ex vivo study.

    Science.gov (United States)

    Tunnell, J W; Nelson, J S; Torres, J H; Anvari, B

    2000-01-01

    Higher laser fluences than currently used in therapy (5-10 J/cm(2)) are expected to result in more effective treatment of port wine stain (PWS) birthmarks. However, higher incident fluences increase the risk of epidermal damage caused by absorption of light by melanin. Cryogen spray cooling offers an effective method to reduce epidermal injury during laser irradiation. The objective of this study was to determine whether high laser incident fluences (15-30 J/cm(2)) could be used while still protecting the epidermis in ex vivo human skin samples. Non-PWS skin from a human cadaver was irradiated with a Candela ScleroPlus Laser (lambda = 585 nm; pulse duration = 1.5 msec) by using various incident fluences (8-30 J/cm(2)) without and with cryogen spray cooling (refrigerant R-134a; spurt durations: 40-250 msec). Assessment of epidermal damage was based on histologic analysis. Relatively short spurt durations (40-100 msec) protected the epidermis for laser incident fluences comparable to current therapeutic levels (8-10 J/cm(2)). However, longer spurt durations (100-250 msec) increased the fluence threshold for epidermal damage by a factor of three (up to 30 J/cm(2)) in these ex vivo samples. Results of this ex vivo study show that epidermal protection from high laser incident fluences can be achieved by increasing the cryogen spurt duration immediately before pulsed laser exposure. Copyright 2000 Wiley-Liss, Inc.

  5. Epidermal segmentation in high-definition optical coherence tomography.

    Science.gov (United States)

    Li, Annan; Cheng, Jun; Yow, Ai Ping; Wall, Carolin; Wong, Damon Wing Kee; Tey, Hong Liang; Liu, Jiang

    2015-01-01

    Epidermis segmentation is a crucial step in many dermatological applications. Recently, high-definition optical coherence tomography (HD-OCT) has been developed and applied to imaging subsurface skin tissues. In this paper, a novel epidermis segmentation method using HD-OCT is proposed in which the epidermis is segmented by 3 steps: the weighted least square-based pre-processing, the graph-based skin surface detection and the local integral projection-based dermal-epidermal junction detection respectively. Using a dataset of five 3D volumes, we found that this method correlates well with the conventional method of manually marking out the epidermis. This method can therefore serve to effectively and rapidly delineate the epidermis for study and clinical management of skin diseases.

  6. Engineering of small interfering RNA-loaded lipidoid-poly(DL-lactic-co-glycolic acid) hybrid nanoparticles for highly efficient and safe gene silencing: A quality by design-based approach.

    Science.gov (United States)

    Thanki, Kaushik; Zeng, Xianghui; Justesen, Sarah; Tejlmann, Sarah; Falkenberg, Emily; Van Driessche, Elize; Mørck Nielsen, Hanne; Franzyk, Henrik; Foged, Camilla

    2017-11-01

    Safety and efficacy of therapeutics based on RNA interference, e.g., small interfering RNA (siRNA), are dependent on the optimal engineering of the delivery technology, which is used for intracellular delivery of siRNA to the cytosol of target cells. We investigated the hypothesis that commonly used and poorly tolerated cationic lipids might be replaced with more efficacious and safe lipidoids as the lipid component of siRNA-loaded lipid-polymer hybrid nanoparticles (LPNs) for achieving more efficient gene silencing at lower and safer doses. However, formulation design of such a complex formulation is highly challenging due to a strong interplay between several contributing factors. Hence, critical formulation variables, i.e. the lipidoid content and siRNA:lipidoid ratio, were initially identified, followed by a systematic quality-by-design approach to define the optimal operating space (OOS), eventually resulting in the identification of a robust, highly efficacious and safe formulation. A 17-run design of experiment with an I-optimal approach was performed to systematically assess the effect of selected variables on critical quality attributes (CQAs), i.e. physicochemical properties (hydrodynamic size, zeta potential, siRNA encapsulation/loading) and the biological performance (in vitro gene silencing and cell viability). Model fitting of the obtained data to construct predictive models revealed non-linear relationships for all CQAs, which can be readily overlooked in one-factor-at-a-time optimization approaches. The response surface methodology further enabled the identification of an OOS that met the desired quality target product profile. The optimized lipidoid-modified LPNs revealed more than 50-fold higher in vitro gene silencing at well-tolerated doses and approx. a twofold increase in siRNA loading as compared to reference LPNs modified with the commonly used cationic lipid dioleyltrimethylammonium propane (DOTAP). Thus, lipidoid-modified LPNs show highly

  7. RNA-Seq reveals MicroRNA expression signature and genetic polymorphism associated with growth and muscle quality traits in rainbow trout

    Science.gov (United States)

    The role of microRNA expression and genetic variation in microRNA-binding sites of target genes on growth and muscle quality traits is poorly characterized. We used RNA-Seq approach to investigate their importance on 5 growth and muscle quality traits: whole body weight (WBW), muscle yield, muscle c...

  8. Accurate RNA consensus sequencing for high-fidelity detection of transcriptional mutagenesis-induced epimutations.

    Science.gov (United States)

    Reid-Bayliss, Kate S; Loeb, Lawrence A

    2017-08-29

    Transcriptional mutagenesis (TM) due to misincorporation during RNA transcription can result in mutant RNAs, or epimutations, that generate proteins with altered properties. TM has long been hypothesized to play a role in aging, cancer, and viral and bacterial evolution. However, inadequate methodologies have limited progress in elucidating a causal association. We present a high-throughput, highly accurate RNA sequencing method to measure epimutations with single-molecule sensitivity. Accurate RNA consensus sequencing (ARC-seq) uniquely combines RNA barcoding and generation of multiple cDNA copies per RNA molecule to eliminate errors introduced during cDNA synthesis, PCR, and sequencing. The stringency of ARC-seq can be scaled to accommodate the quality of input RNAs. We apply ARC-seq to directly assess transcriptome-wide epimutations resulting from RNA polymerase mutants and oxidative stress.

  9. Effect of multiple cycles of freeze-thawing on the RNA quality of lung cancer tissues.

    Science.gov (United States)

    Yu, Keke; Xing, Jie; Zhang, Jie; Zhao, Ruiying; Zhang, Ye; Zhao, Lanxiang

    2017-09-01

    RNA degradation is a major problem in tissue banking. We explored the effect of thawing flash-frozen biospecimens on the quality and integrity of RNA for genetic testing as well as for other cancer research studies. The histological quality of the frozen tumor sections was evaluated by using hematoxylin and eosin staining. RNA extraction from 60 lung cancer tissue samples subjected to various freeze/thaw cycles was performed using the RNeasy Plus isolation kit. RNA integrity was assessed by using an Agilent bioanalyzer to obtain RNA integrity numbers (RIN). Furthermore, RNA from different groups was used for fluorescence Reverse transcription-polymerase chain reaction (RT-PCR) analysis of the echinoderm microtubule-associated protein-like 4 and anaplastic lymphoma kinase (EML4-ALK) fusion gene mutation to verify whether it can be used for research or clinical testing. Highly variable RIN values were observed among the samples, which showed no correlation with the number of freeze/thaw cycles conducted. However, after 3 freeze/thaw cycles (each thaw event lasted for 10 min), an increasing number of changes in peak intensity in RINs were observed. After 5 freeze/thaw cycles, RNA integrity decreased to approximately 35%. After 3 freeze/thaw cycles, the RNA could still be used for RT-PCR analysis of EML4-ALK fusion gene mutations; whereas those subjected to 5 freeze/thaw cycles could not. Limited (cycles did not adversely affect the quality of RNA extracted from tumor tissues and subsequent RT-PCR analysis. Our data could be utilized in the establishment of a standardized procedure for tissue biospecimen collection and storage.

  10. On the optimal trimming of high-throughput mRNA sequence data

    Directory of Open Access Journals (Sweden)

    Matthew D MacManes

    2014-01-01

    Full Text Available The widespread and rapid adoption of high-throughput sequencing technologies has afforded researchers the opportunity to gain a deep understanding of genome level processes that underlie evolutionary change, and perhaps more importantly, the links between genotype and phenotype. In particular, researchers interested in functional biology and adaptation have used these technologies to sequence mRNA transcriptomes of specific tissues, which in turn are often compared to other tissues, or other individuals with different phenotypes. While these techniques are extremely powerful, careful attention to data quality is required. In particular, because high-throughput sequencing is more error-prone than traditional Sanger sequencing, quality trimming of sequence reads should be an important step in all data processing pipelines. While several software packages for quality trimming exist, no general guidelines for the specifics of trimming have been developed. Here, using empirically derived sequence data, I provide general recommendations regarding the optimal strength of trimming, specifically in mRNA-Seq studies. Although very aggressive quality trimming is common, this study suggests that a more gentle trimming, specifically of those nucleotides whose Phred score < 2 or < 5, is optimal for most studies across a wide variety of metrics.

  11. Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

    Energy Technology Data Exchange (ETDEWEB)

    Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)

    2014-11-14

    The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

  12. RNA-Seq analysis of Gtf2ird1 knockout epidermal tissue provides potential insights into molecular mechanisms underpinning Williams-Beuren syndrome.

    Science.gov (United States)

    Corley, Susan M; Canales, Cesar P; Carmona-Mora, Paulina; Mendoza-Reinosa, Veronica; Beverdam, Annemiek; Hardeman, Edna C; Wilkins, Marc R; Palmer, Stephen J

    2016-06-13

    Williams-Beuren Syndrome (WBS) is a genetic disorder associated with multisystemic abnormalities, including craniofacial dysmorphology and cognitive defects. It is caused by a hemizygous microdeletion involving up to 28 genes in chromosome 7q11.23. Genotype/phenotype analysis of atypical microdeletions implicates two evolutionary-related transcription factors, GTF2I and GTF2IRD1, as prime candidates for the cause of the facial dysmorphology. Using a targeted Gtf2ird1 knockout mouse, we employed massively-parallel sequencing of mRNA (RNA-Seq) to understand changes in the transcriptional landscape associated with inactivation of Gtf2ird1 in lip tissue. We found widespread dysregulation of genes including differential expression of 78 transcription factors or coactivators, several involved in organ development including Hey1, Myf6, Myog, Dlx2, Gli1, Gli2, Lhx2, Pou3f3, Sox2, Foxp3. We also found that the absence of GTF2IRD1 is associated with increased expression of genes involved in cellular proliferation, including growth factors consistent with the observed phenotype of extreme thickening of the epidermis. At the same time, there was a decrease in the expression of genes involved in other signalling mechanisms, including the Wnt pathway, indicating dysregulation in the complex networks necessary for epidermal differentiation and facial skin patterning. Several of the differentially expressed genes have known roles in both tissue development and neurological function, such as the transcription factor Lhx2 which regulates several genes involved in both skin and brain development. Gtf2ird1 inactivation results in widespread gene dysregulation, some of which may be due to the secondary consequences of gene regulatory network disruptions involving several transcription factors and signalling molecules. Genes involved in growth factor signalling and cell cycle progression were identified as particularly important for explaining the skin dysmorphology observed in this

  13. Evaluation of a new high-dimensional miRNA profiling platform

    Directory of Open Access Journals (Sweden)

    Lamblin Anne-Francoise

    2009-08-01

    Full Text Available Abstract Background MicroRNAs (miRNAs are a class of approximately 22 nucleotide long, widely expressed RNA molecules that play important regulatory roles in eukaryotes. To investigate miRNA function, it is essential that methods to quantify their expression levels be available. Methods We evaluated a new miRNA profiling platform that utilizes Illumina's existing robust DASL chemistry as the basis for the assay. Using total RNA from five colon cancer patients and four cell lines, we evaluated the reproducibility of miRNA expression levels across replicates and with varying amounts of input RNA. The beta test version was comprised of 735 miRNA targets of Illumina's miRNA profiling application. Results Reproducibility between sample replicates within a plate was good (Spearman's correlation 0.91 to 0.98 as was the plate-to-plate reproducibility replicates run on different days (Spearman's correlation 0.84 to 0.98. To determine whether quality data could be obtained from a broad range of input RNA, data obtained from amounts ranging from 25 ng to 800 ng were compared to those obtained at 200 ng. No effect across the range of RNA input was observed. Conclusion These results indicate that very small amounts of starting material are sufficient to allow sensitive miRNA profiling using the Illumina miRNA high-dimensional platform. Nonlinear biases were observed between replicates, indicating the need for abundance-dependent normalization. Overall, the performance characteristics of the Illumina miRNA profiling system were excellent.

  14. Epidermal stem cells: location, potential and contribution to cancer.

    Science.gov (United States)

    Ambler, C A; Määttä, A

    2009-01-01

    Epidermal stem cells have been classically characterized as slow-cycling, long-lived cells that reside in discrete niches in the skin. Gene expression studies of niche-resident cells have revealed a number of stem cell markers and regulators, including the Wnt/beta-catenin, Notch, p63, c-Myc and Hedgehog pathways. A new study challenges the traditional developmental paradigm of slow-cycling stem cells and rapid-cycling transit amplifying cells in some epidermal regions, and there is mounting evidence to suggest that multi-lineage epidermal progenitors can be isolated from highly proliferative, non-niche regions. Whether there is a unique microenvironment surrounding these progenitors remains to be determined. Interestingly, cancer stem cells derived from epidermal tumours exist independent of the classic skin stem cell niche, yet also have stem cell properties, including multi-lineage differentiation. This review summarizes recent studies identifying the location and regulators of mouse and human epidermal stem cells and highlights the strategies used to identify cancer stem cells, including expression of normal epidermal stem cell markers, expression of cancer stem cell markers identified in other epidermal tumours and characterization of side-population tumour cells.

  15. Engineering of small interfering RNA-loaded lipidoid-poly(DL-lactic-co-glycolic acid) hybrid nanoparticles for highly efficient and safe gene silencing: A quality by design-based approach

    DEFF Research Database (Denmark)

    Thanki, Kaushik; Zeng, Xianghui; Justesen, Sarah

    2017-01-01

    used and poorly tolerated cationic lipids might be replaced with more efficacious and safe lipidoids as the lipid component of siRNA-loaded lipid-polymer hybrid nanoparticles (LPNs) for achieving more efficient gene silencing at lower and safer doses. However, formulation design of such a complex...... formulation is highly challenging due to a strong interplay between several contributing factors. Hence, critical formulation variables, i.e. the lipidoid content and siRNA:lipidoid ratio, were initially identified, followed by a systematic quality-by-design approach to define the optimal operating space (OOS......), eventually resulting in the identification of a robust, highly efficacious and safe formulation. A 17-run design of experiment with an I-optimal approach was performed to systematically assess the effect of selected variables on critical quality attributes (CQAs), i.e. physicochemical properties...

  16. [Progress in epidermal stem cells].

    Science.gov (United States)

    Wang, Li-Juan; Wang, You-Liang; Yang, Xiao

    2010-03-01

    Mammalian skin epidermis contains different epidermal stem cell pools which contribute to the homeostasis and repair of skin epithelium. Epidermal stem cells possess two essential features common to all stem cells: self-renewal and differentiation. Disturbing the balance between self-renewal and differentiation of epidermal stem cell often causes tumors or other skin diseases. Epidermal stem cell niches provide a special microenvironment that maintains a balance of stem cell quiescence and activity. This review primarily concentrates on the following points of the epidermal stem cells: the existing evidences, the self-renewal and differentiation, the division pattern, the signal pathways regulating self-renewal and differentiation, and the microenvironment (niche) and macroenvironment maintaining the homeostasis of stem cells.

  17. Comparison of Methods for Isolating High Quality DNA and RNA from an Oleaginous Fungus Cunninghamella bainieri Strain 2a1

    Directory of Open Access Journals (Sweden)

    Noor Adila, A. K.

    2007-01-01

    Full Text Available A number of protocols have been reported for efficient fungal DNA and RNA isolation. However, many of these methods are often designed for certain groups or morphological forms of fungi and, in some cases, are species dependent. In this report, we compared four published protocols for DNA isolation from a locally isolated oleaginous fungus, Cunninghamella bainieri strain 2a1. These protocols either involved the use of polyvinyl pyrrolidone (PVP, hexacetyltrimethylammonium bromide (CTAB or without using PVB or CTAB. For RNA isolation, we tested two published protocols, one of which is based on TRI REAGENT (Molecular Research Center, USA and another is simple method employing phenol for RNA extraction and LiCl for precipitation. We found that the protocol involving the use of CTAB produced the highest genomic DNA yield with the best quality compared to other protocols. In the presence of CTAB, unwanted polysaccharides were removed and this method yielded an average amount of 816 ± 12.2 µg DNA/g mycelia with UV absorbance ratios A260/280 and A260/230 of 1.67 ± 0.64 and 1.97 ± 0.23, respectively. The genomic DNA isolated via this protocol is also suitable for PCR amplification and restriction enzyme digestion. As for RNA isolation, the method involving phenol extraction and LiCl precipitation produced the highest yield of RNA with an average amount of 372 ± 6.0 µg RNA/g mycelia. The RNA appears to be relatively pure since it has UV absorbance ratios A260/280 and A260/230 of 1.89 ± 2.00 and 1.99 ± 0.03, respectively. Finally, we have demonstrated that this method could produce RNA of sufficient quality for RT-PCR that amplified a 600 bp fragment of ∆12-fatty acid desaturase gene in C. bainieri.

  18. Protocol: high throughput silica-based purification of RNA from Arabidopsis seedlings in a 96-well format

    Directory of Open Access Journals (Sweden)

    Salvo-Chirnside Eliane

    2011-12-01

    Full Text Available Abstract The increasing popularity of systems-based approaches to plant research has resulted in a demand for high throughput (HTP methods to be developed. RNA extraction from multiple samples in an experiment is a significant bottleneck in performing systems-level genomic studies. Therefore we have established a high throughput method of RNA extraction from Arabidopsis thaliana to facilitate gene expression studies in this widely used plant model. We present optimised manual and automated protocols for the extraction of total RNA from 9-day-old Arabidopsis seedlings in a 96 well plate format using silica membrane-based methodology. Consistent and reproducible yields of high quality RNA are isolated averaging 8.9 μg total RNA per sample (~20 mg plant tissue. The purified RNA is suitable for subsequent qPCR analysis of the expression of over 500 genes in triplicate from each sample. Using the automated procedure, 192 samples (2 × 96 well plates can easily be fully processed (samples homogenised, RNA purified and quantified in less than half a day. Additionally we demonstrate that plant samples can be stored in RNAlater at -20°C (but not 4°C for 10 months prior to extraction with no significant effect on RNA yield or quality. Additionally, disrupted samples can be stored in the lysis buffer at -20°C for at least 6 months prior to completion of the extraction procedure providing a flexible sampling and storage scheme to facilitate complex time series experiments.

  19. Protocol: high throughput silica-based purification of RNA from Arabidopsis seedlings in a 96-well format.

    Science.gov (United States)

    Salvo-Chirnside, Eliane; Kane, Steven; Kerr, Lorraine E

    2011-12-02

    The increasing popularity of systems-based approaches to plant research has resulted in a demand for high throughput (HTP) methods to be developed. RNA extraction from multiple samples in an experiment is a significant bottleneck in performing systems-level genomic studies. Therefore we have established a high throughput method of RNA extraction from Arabidopsis thaliana to facilitate gene expression studies in this widely used plant model. We present optimised manual and automated protocols for the extraction of total RNA from 9-day-old Arabidopsis seedlings in a 96 well plate format using silica membrane-based methodology. Consistent and reproducible yields of high quality RNA are isolated averaging 8.9 μg total RNA per sample (~20 mg plant tissue). The purified RNA is suitable for subsequent qPCR analysis of the expression of over 500 genes in triplicate from each sample. Using the automated procedure, 192 samples (2 × 96 well plates) can easily be fully processed (samples homogenised, RNA purified and quantified) in less than half a day. Additionally we demonstrate that plant samples can be stored in RNAlater at -20°C (but not 4°C) for 10 months prior to extraction with no significant effect on RNA yield or quality. Additionally, disrupted samples can be stored in the lysis buffer at -20°C for at least 6 months prior to completion of the extraction procedure providing a flexible sampling and storage scheme to facilitate complex time series experiments.

  20. Quantitative PCR--new diagnostic tool for quantifying specific mRNA and DNA molecules

    DEFF Research Database (Denmark)

    Schlemmer, B O; Sorensen, B S; Overgaard, J

    2004-01-01

    of a subset of ligands from the EGF system is increased in bladder cancer. Furthermore, measurement of the mRNA concentration gives important information such as the expression of these ligands correlated to the survival of the patients. In addition to the alterations at the mRNA level, changes also can occur...... at the DNA level in the EGF system. Thus, it has been demonstrated that the number of genes coding for the human epidermal growth factor receptor 2 (HER2) is increased in a number of breast tumors. It is now possible to treat breast cancer patients with a humanized antibody reacting with HER2...... of mRNA or DNA in biological samples. In this study quantitative PCR was used to investigate the role of the EGF (epidermal growth factor) system in cancer both for measurements of mRNA concentrations and for measurements of the number of copies of specific genes. It is shown that the mRNA expression...

  1. The membrane fraction of homogenized rat kidney contains an enzyme that releases epidermal growth factor from the kidney membranes

    DEFF Research Database (Denmark)

    Nexø, Ebba; Poulsen, Steen Seier

    1991-01-01

    shows that the membrane fraction of homogenized rat kidney contains an enzyme that releases immuno and receptor reactive EGF from the kidney membranes when incubated at 37 degrees C. Gel filtration shows that the EGF reactivity released from the membranes is similar to the EGF reactivity in rat urine......High levels of epidermal growth factor (EGF) are excreted in the urine and high levels of mRNA for the EGF-precursor have been demonstrated in the kidney. The EGF-precursor is a membrane bound peptide in the kidney, but little is known about the renal processing of the precursor. The present study...

  2. Thousands of primer-free, high-quality, full-length SSU rRNA sequences from all domains of life

    DEFF Research Database (Denmark)

    Karst, Soeren M; Dueholm, Morten S; McIlroy, Simon J

    2016-01-01

    Ribosomal RNA (rRNA) genes are the consensus marker for determination of microbial diversity on the planet, invaluable in studies of evolution and, for the past decade, high-throughput sequencing of variable regions of ribosomal RNA genes has become the backbone of most microbial ecology studies...... (SSU) rRNA genes and synthetic long read sequencing by molecular tagging, to generate primer-free, full-length SSU rRNA gene sequences from all domains of life, with a median raw error rate of 0.17%. We generated thousands of full-length SSU rRNA sequences from five well-studied ecosystems (soil, human...... gut, fresh water, anaerobic digestion, and activated sludge) and obtained sequences covering all domains of life and the majority of all described phyla. Interestingly, 30% of all bacterial operational taxonomic units were novel, compared to the SILVA database (less than 97% similarity...

  3. Polymeric membranes modulate human keratinocyte differentiation in specific epidermal layers.

    Science.gov (United States)

    Salerno, Simona; Morelli, Sabrina; Giordano, Francesca; Gordano, Amalia; Bartolo, Loredana De

    2016-10-01

    In vitro models of human bioengineered skin substitutes are an alternative to animal experimentation for testing the effects and toxicity of drugs, cosmetics and pollutants. For the first time specific and distinct human epidermal strata were engineered by using membranes and keratinocytes. To this purpose, biodegradable membranes of chitosan (CHT), polycaprolactone (PCL) and a polymeric blend of CHT-PCL were prepared by phase-inversion technique and characterized in order to evaluate their morphological, physico-chemical and mechanical properties. The capability of membranes to modulate keratinocyte differentiation inducing specific interactions in epidermal membrane systems was investigated. The overall results demonstrated that the membrane properties strongly influence the cell morpho-functional behaviour of human keratinocytes, modulating their terminal differentiation, with the creation of specific epidermal strata or a fully proliferative epidermal multilayer system. In particular, human keratinocytes adhered on CHT and CHT-PCL membranes, forming the structure of the epidermal top layers, such as the corneum and granulosum strata, characterized by withdrawal or reduction from the cell cycle and cell proliferation. On the PCL membrane, keratinocytes developed an epidermal basal lamina, with high proliferating cells that stratified and migrated over time to form a complete differentiating epidermal multilayer system. Copyright © 2016 Elsevier B.V. All rights reserved.

  4. Gene expression analysis of skin grafts and cultured keratinocytes using synthetic RNA normalization reveals insights into differentiation and growth control.

    Science.gov (United States)

    Katayama, Shintaro; Skoog, Tiina; Jouhilahti, Eeva-Mari; Siitonen, H Annika; Nuutila, Kristo; Tervaniemi, Mari H; Vuola, Jyrki; Johnsson, Anna; Lönnerberg, Peter; Linnarsson, Sten; Elomaa, Outi; Kankuri, Esko; Kere, Juha

    2015-06-25

    Keratinocytes (KCs) are the most frequent cells in the epidermis, and they are often isolated and cultured in vitro to study the molecular biology of the skin. Cultured primary cells and various immortalized cells have been frequently used as skin models but their comparability to intact skin has been questioned. Moreover, when analyzing KC transcriptomes, fluctuation of polyA+ RNA content during the KCs' lifecycle has been omitted. We performed STRT RNA sequencing on 10 ng samples of total RNA from three different sample types: i) epidermal tissue (split-thickness skin grafts), ii) cultured primary KCs, and iii) HaCaT cell line. We observed significant variation in cellular polyA+ RNA content between tissue and cell culture samples of KCs. The use of synthetic RNAs and SAMstrt in normalization enabled comparison of gene expression levels in the highly heterogenous samples and facilitated discovery of differences between the tissue samples and cultured cells. The transcriptome analysis sensitively revealed genes involved in KC differentiation in skin grafts and cell cycle regulation related genes in cultured KCs and emphasized the fluctuation of transcription factors and non-coding RNAs associated to sample types. The epidermal keratinocytes derived from tissue and cell culture samples showed highly different polyA+ RNA contents. The use of SAMstrt and synthetic RNA based normalization allowed the comparison between tissue and cell culture samples and thus proved to be valuable tools for RNA-seq analysis with translational approach. Transciptomics revealed clear difference both between tissue and cell culture samples and between primary KCs and immortalized HaCaT cells.

  5. Quantitation of the mRNA expression of the epidermal growth factor system

    DEFF Research Database (Denmark)

    Sørensen, B S; Tørring, N; Bor, M V

    2000-01-01

    ) and for the quantitation of mRNA for the receptors HER-1 and its preferred dimerization partner, HER-2. The method is based on the generation of specific RNA standards, which are amplified by reverse transcriptase-polymerase chain reaction (RT-PCR) with the sample RNA and a set of calibrators. The resulting calibration...

  6. "Cut-and-paste" manufacture of multiparametric epidermal electronic systems

    Science.gov (United States)

    Lu, Nanshu; Yang, Shixuan; Wang, Pulin

    2016-05-01

    Epidermal electronics is a class of noninvasive and unobstructive skin-mounted, tattoo-like sensors and electronics capable of vital sign monitoring and establishing human-machine interface. The high cost of manpower, materials, vacuum equipment, and photolithographic facilities associated with its manufacture greatly hinders the widespread use of disposable epidermal electronics. Here we report a cost and time effective, completely dry, benchtop "cut-and-paste" method for the freeform and portable manufacture of multiparametric epidermal sensor systems (ESS) within minutes. This versatile method works for all types of thin metal and polymeric sheets and is compatible with any tattoo adhesives or medical tapes. The resulting ESS are multimaterial and multifunctional and have been demonstrated to noninvasively but accurately measure electrophysiological signals, skin temperature, skin hydration, as well as respiratory rate. In addition, planar stretchable coils exploiting double-stranded serpentine design have been successfully applied as wireless, passive epidermal strain sensors.

  7. SPIDIA-RNA: second external quality assessment for the pre-analytical phase of blood samples used for RNA based analyses.

    Directory of Open Access Journals (Sweden)

    Francesca Malentacchi

    Full Text Available One purpose of the EC funded project, SPIDIA, is to develop evidence-based quality guidelines for the pre-analytical handling of blood samples for RNA molecular testing. To this end, two pan-European External Quality Assessments (EQAs were implemented. Here we report the results of the second SPIDIA-RNA EQA. This second study included modifications in the protocol related to the blood collection process, the shipping conditions and pre-analytical specimen handling for participants. Participating laboratories received two identical proficiency blood specimens collected in tubes with or without an RNA stabilizer. For pre-defined specimen storage times and temperatures, laboratories were asked to perform RNA extraction from whole blood according to their usual procedure and to return extracted RNA to the SPIDIA facility for further analysis. These RNA samples were evaluated for purity, yield, integrity, stability, presence of interfering substances, and gene expression levels for the validated markers of RNA stability: FOS, IL1B, IL8, GAPDH, FOSB and TNFRSF10c. Analysis of the gene expression results of FOS, IL8, FOSB, and TNFRSF10c, however, indicated that the levels of these transcripts were significantly affected by blood collection tube type and storage temperature. These results demonstrated that only blood collection tubes containing a cellular RNA stabilizer allowed reliable gene expression analysis within 48 h from blood collection for all the genes investigated. The results of these two EQAs have been proposed for use in the development of a Technical Specification by the European Committee for Standardization.

  8. The Epidermal Growth Factor Receptor Responsive miR-125a Represses Mesenchymal Morphology in Ovarian Cancer Cells

    Directory of Open Access Journals (Sweden)

    Karen D. Cowden Dahl

    2009-11-01

    Full Text Available The epithelial-to-mesenchymal transition (EMT that occurs during embryonic development is recapitulated during tumor metastasis. Important regulators of this process include growth factors, transcription factors, and adhesion molecules. New evidence suggests that microRNA (miRNA activity contributes to metastatic progression and EMT; however, the mechanisms leading to altered miRNA expression during cancer progression remain poorly understood. Importantly, overexpression of the epidermal growth factor receptor (EGFR in ovarian cancer correlates with poor disease outcome and induces EMT in ovarian cancer cells. We report that EGFR signaling leads to transcriptional repression of the miRNA miR-125a through the ETS family transcription factor PEA3. Overexpression of miR-125a induces conversion of highly invasive ovarian cancer cells from a mesenchymal to an epithelial morphology, suggesting miR-125a is a negative regulator of EMT. We identify AT-rich interactive domain 3B (ARID3B as a target of miR-125a and demonstrate that ARID3B is overexpressed in human ovarian cancer. Repression of miR-125a through growth factor signaling represents a novel mechanism for regulating ovarian cancer invasive behavior.

  9. Effect of Postmortem Interval and Years in Storage on RNA Quality of Tissue at a Repository of the NIH NeuroBioBank.

    Science.gov (United States)

    White, Kimberly; Yang, Peixin; Li, Ling; Farshori, Amna; Medina, Alexandre E; Zielke, Horst Ronald

    2018-04-01

    Brain tissue from 1068 donors was analyzed for RNA quality as a function of postmortem interval (PMI) and years in storage. Approximately 83% of the cortical and cerebellar samples had an RNA integrity number (RIN) of 6 or greater, indicating their likely suitability for real-time quantitative polymerase chain reaction research. The average RIN value was independent of the PMI, up to at least 36 hours. The RNA quality for specific donated brains could not be predicted based on the PMI. Individual samples with a low PMI could have a poor RIN value, while a sample with a PMI over 36 hours may have a high RIN value. The RIN values for control brain donors, all of whom died suddenly and unexpectedly, were marginally higher than for individuals with clinical brain disorders. Polymerase chain reaction (PCR) analysis of samples confirmed that RIN values were more critical than PMI for determining suitability of tissue for molecular biological studies and samples should be matched by their RIN values rather than PMI. Importantly, PCR analysis established that tissue stored up to 23 years at -80°C yielded high-quality RNA. These results confirm that postmortem human brain tissue collected by brain and tissue banks over decades can serve as high quality material for the study of human disorders.

  10. Epidermal Inclusion Cysts of The Breast

    Directory of Open Access Journals (Sweden)

    Amir R. Motabar

    2009-02-01

    Full Text Available Epidermal inclusion cysts are uncommon in the breast, but the consequences can besevere when these cysts occur in the breast parenchyma. Here,we report two suchcases. The patient in case 1 was an 37-year-old woman with a 3-cm palpable mass inthe right breast. Mammography revealed a round and smoothly outlined mass, whichindicated a benign tumor, and sonography showed an irregularly shaped and heterogeneoushypoechoic mass, fibroadenoma was suspected on the basis of clinical andimage findings, but excisional biopsy revealed an epidermal inclusion cyst. The patientin case 2 was a 50-year-old woman with a 2.5-cm lesion in the left breast. Mammographyrevealed a round, dense, smoothly outlined mass, and sonography showeda well-defined, central hyperechoic mass. . Breast cancer was suspected on the basisof the sonographic findings and the age of the patient, but the resected specimen revealedan epidermal inclusion cyst. Although epidermal inclusion cysts are benign,occasionally they may play a role in the origin of squamous carcinoma of the breast. .Mammographic and sonographic features of an epidermal cyst may mimic a malignantlesion. Malignant change appears to occur more frequently in epidermal inclusioncysts in the mammary gland, compared to common epidermal inclusion cysts,and this may be associated with origination of mammary epidermal inclusion cystsfrom squamous metaplasia of the mammary duct epithelium.Epidermmoid inclusion cyst of the breast is potentially serious, although such cystsare rare, and differentiation from a malignant or benign breast tumor is required. Excisionis probably the most appropriate treatment, and can eliminate the possible riskof malignant transformation.

  11. Cellular localization of transforming growth factor-alpha mRNA in rat forebrain.

    Science.gov (United States)

    Seroogy, K B; Lundgren, K H; Lee, D C; Guthrie, K M; Gall, C M

    1993-05-01

    The cellular localization of transforming growth factor-alpha (TGF alpha) mRNA in juvenile and adult rat forebrain was examined using in situ hybridization with a 35S-labeled cRNA probe. TGF alpha cRNA-labeled neuronal perikarya were distributed across many forebrain regions including the olfactory bulb, caudate-putamen, nucleus accumbens, olfactory tubercle, ventral pallidum, amygdala, hippocampal stratum granulosum and CA3 stratum pyramidale, and piriform, entorhinal, and retrosplenial cortices. TGF alpha cRNA-hybridizing cells were also localized to several thalamic nuclei and to the suprachiasmatic, dorsomedial, and ventromedial nuclei of the hypothalamus. In addition, labeled cells were present in regions of white matter including the corpus callosum, anterior commissure, internal and external capsules, optic tract, and lateral olfactory tract. Thus, both neurons and glia appear to synthesize TGF alpha in normal brain. Hybridization densities were greater in neuronal fields at 2 weeks of age compared with the adult, suggesting a role for TGF alpha in the development of several forebrain systems. Our results demonstrating the prominent and wide-spread expression of TGF alpha mRNA in forebrain, combined with the extremely low abundance of epidermal growth factor mRNA in brain, support the argument that TGF alpha is the principal endogenous ligand for the epidermal growth factor receptor in normal brain.

  12. High loading efficiency and sustained release of siRNA encapsulated in PLGA nanoparticles: quality by design optimization and characterization.

    Science.gov (United States)

    Cun, Dongmei; Jensen, Ditte Krohn; Maltesen, Morten Jonas; Bunker, Matthew; Whiteside, Paul; Scurr, David; Foged, Camilla; Nielsen, Hanne Mørck

    2011-01-01

    Poly(DL-lactide-co-glycolide acid) (PLGA) is an attractive polymer for delivery of biopharmaceuticals owing to its biocompatibility, biodegradability and outstanding controlled release characteristics. The purpose of this study was to understand and define optimal parameters for preparation of small interfering RNA (siRNA)-loaded PLGA nanoparticles by the double emulsion solvent evaporation method and characterize their properties. The experiments were performed according to a 2(5-1) fractional factorial design based on five independent variables: The volume ratio between the inner water phase and the oil phase, the PLGA concentration, the sonication time, the siRNA load and the amount of acetylated bovine serum albumin (Ac-BSA) in the inner water phase added to stabilize the primary emulsion. The effects on the siRNA encapsulation efficiency and the particle size were investigated. The most important factors for obtaining an encapsulation efficiency as high as 70% were the PLGA concentration and the volume ratio whereas the size was mainly affected by the PLGA concentration. The viscosity of the oil phase was increased at high PLGA concentration, which explains the improved encapsulation by stabilization of the primary emulsion and reduction of siRNA leakage to the outer water phase. Addition of Ac-BSA increased the encapsulation efficiency at low PLGA concentrations. The PLGA matrix protected siRNA against nuclease degradation, provided a burst release of surface-localized siRNA followed by a triphasic sustained release for two months. These results enable careful understanding and definition of optimal process parameters for preparation of PLGA nanoparticles encapsulating high amounts of siRNA with immediate and long-term sustained release properties. Copyright © 2010 Elsevier B.V. All rights reserved.

  13. Automated measurement of epidermal thickness from optical coherence tomography images using line region growing

    Science.gov (United States)

    Delacruz, Jomer; Weissman, Jesse; Gossage, Kirk

    2010-02-01

    Optical Coherence Tomography (OCT) is a non-invasive imaging modality that acquires cross sectional images of tissue in-vivo. It accelerates skin diagnosis by eliminating invasive biopsy and laborious histology in the process. Dermatologists have widely used it for looking at morphology of skin diseases such as psoriasis, dermatitis, basal cell carcinoma etc. Skin scientists have also successfully used it for looking at differences in epidermal thickness and its underlying structure with respect to age, body sites, ethnicity, gender, and other related factors. Similar to other in-vivo imaging systems, OCT images suffer from a high degree of speckle and noise content, which hinders examination of tissue structures. Most of the previous work in OCT segmentation of skin was done manually. This compromised the quality of the results by limiting the analyses to a few frames per area. In this paper, we discuss a region growing method for automatic identification of the upper and lower boundaries of the epidermis in living human skin tissue. This image analysis method utilizes images obtained from a frequency-domain OCT. This system is high-resolution and high-speed, and thus capable of capturing volumetric images of the skin in short time. The three-dimensional (3D) data provides additional information that is used in the segmentation process to help compensate for the inherent noise in the images. This method not only provides a better estimation of the epidermal thickness, but also generates a 3D surface map of the epidermal-dermal junction, from which underlying topography can be visualized and further quantified.

  14. Glucocorticoid receptor, but not mineralocorticoid receptor, mediates cortisol regulation of epidermal ionocyte development and ion transport in zebrafish (danio rerio.

    Directory of Open Access Journals (Sweden)

    Shelly Abad Cruz

    Full Text Available Cortisol is the major endogenous glucocorticoid (GC both in human and fish, mediated by corticosteroid receptors. Due to the absence of aldosterone production in teleost fish, cortisol is also traditionally accepted to function as mineralocorticoid (MC; but whether it acts through the glucocorticoid receptor (GR or the mineralocorticoid receptor (MR remains a subject of debate. Here, we used loss-of-function and rescue assays to determine whether cortisol affects zebrafish epidermal ionocyte development and function via the GR and/or the MR. GR knockdown morphants displayed a significant decrease in the major ionocytes, namely Na(+-K(+-ATPase-rich cells (NaRCs and H(+-ATPase-rich cells (HRCs, as well as other cells, including epidermal stem cells (ESCs, keratinocytes, and mucus cells; conversely, cell numbers were unaffected in MR knockdown morphants. In agreement, GR morphants, but not MR morphants, exhibited decreased NaRC-mediated Ca(2+ uptake and HRC-mediated H(+ secretion. Rescue via GR capped mRNA injection or exogenous cortisol incubation normalized the number of epidermal ionocytes in GR morphants. We also provide evidence for GR localization in epidermal cells. At the transcript level, GR mRNA is ubiquitously expressed in gill sections and present in both NaRCs and HRCs, supporting the knockdown and functional assay results in embryo. Altogether, we have provided solid molecular evidence that GR is indeed present on ionocytes, where it mediates the effects of cortisol on ionocyte development and function. Hence, cortisol-GR axis performs the roles of both GC and MC in zebrafish skin and gills.

  15. Good quality Vitis RNA obtained from an adapted DNA isolation protocol

    Directory of Open Access Journals (Sweden)

    Isabel Baiges

    2003-03-01

    Full Text Available Grapevine is a woody plant, whose high carbohydrate and phenolic compound contents usually interferes with nucleic acid isolation. After we tried several protocols for isolating RNA from the Vitis rootstock Richter- 110 (R-110 with little or no success, we adapted a method reported to be satisfactory for grapevine DNA isolation, to extract RNA. With slight protocol modifications, we succeeded to obtain polysaccharide- and phenolic-free RNA preparations from all vegetative tissues, without excessive sample handling. RNA isolated by the reported method permitted to obtain highly pure mRNA (messenger RNA to construct a cDNA (complementary DNA library and allowed gene transcription analysis by reverse Northern, which guarantees RNA integrity. This method may also be suitable for other plant species with high polysaccharide or phenolic contents.

  16. An improved method for isolation of RNA from bone

    Directory of Open Access Journals (Sweden)

    Carter Lauren E

    2012-01-01

    Full Text Available Abstract Background Bone physiology is increasingly appreciated as an important contributor to metabolic disorders such as type 2 diabetes. However, progress in understanding the role of bone in determining metabolic health is hampered by the well-described difficulty of obtaining high quality RNA from bone for gene expression analysis using the currently available approaches. Results We developed a simple approach to isolate bone RNA that combines pulverizing the bone and the phenol-guanidinium based RNA extraction in a single step while maintaining near-freezing temperatures. This single step method increases the yield of high quality RNA by eight-fold, with RNA integrity numbers ranging from 6.7 to 9.2. Conclusions Our streamlined approach substantially increases the yield of high-quality RNA from bone tissue while facilitating safe and efficient processing of multiple samples using readily available platforms. The RNA obtained from this method is suitable for use in gene expression analysis in real-time quantitative PCR, microarray, and next generation sequencing applications.

  17. Clinical Usefulness of a One-Tube Nested Reverse Transcription Quantitative Polymerase Chain Reaction Assay for Evaluating Human Epidermal Growth Factor Receptor 2 mRNA Overexpression in Formalin-Fixed and Paraffin-Embedded Breast Cancer Tissue Samples.

    Science.gov (United States)

    Wang, Hye-Young; Ahn, Sungwoo; Park, Sunyoung; Kim, SeungIl; Lee, Hyeyoung

    2017-01-01

    Currently, the two main methods used to analyze human epidermal growth factor receptor 2 (HER2) amplification or overexpression have a limited accuracy and high costs. These limitations can be overcome by the development of complementary quantitative methods. In this study, we analyzed HER2 mRNA expression in clinical formalin-fixed and paraffin-embedded (FFPE) samples using a one-tube nested reverse transcription quantitative polymerase chain reaction (RT-qPCR) assay. We measured expression relative to 3 reference genes and compared the results to those obtained by conventional immunohistochemistry (IHC) and fluorescence in situ hybridization (FISH) assays with 226 FFPE breast cancer tissue samples. The one-tube nested RT-qPCR assay proved to be highly sensitive and specific based on comparisons with IHC (96.9 and 97.7%, respectively) and FISH (92.4 and 92.9%, respectively) obtained with the validation set. Comparisons with clinicopathological data revealed significant associations between HER2 overexpression and TNM stage (p < 0.01), histological type (p < 0.01), ER status (p < 0.001), PR status (p < 0.05), HER2 status (p < 0.001), and molecular subtypes (p < 0.001). Based on these findings, our one-tube nested RT-qPCR assay is a potentially useful and complementary screening tool for the detection of HER2 mRNA overexpression. © 2016 S. Karger AG, Basel.

  18. Extracellular Matrix as a Regulator of Epidermal Stem Cell Fate.

    Science.gov (United States)

    Chermnykh, Elina; Kalabusheva, Ekaterina; Vorotelyak, Ekaterina

    2018-03-27

    Epidermal stem cells reside within the specific anatomic location, called niche, which is a microenvironment that interacts with stem cells to regulate their fate. Regulation of many important processes, including maintenance of stem cell quiescence, self-renewal, and homeostasis, as well as the regulation of division and differentiation, are common functions of the stem cell niche. As it was shown in multiple studies, extracellular matrix (ECM) contributes a lot to stem cell niches in various tissues, including that of skin. In epidermis, ECM is represented, primarily, by a highly specialized ECM structure, basement membrane (BM), which separates the epidermal and dermal compartments. Epidermal stem cells contact with BM, but when they lose the contact and migrate to the overlying layers, they undergo terminal differentiation. When considering all of these factors, ECM is of fundamental importance in regulating epidermal stem cells maintenance, proper mobilization, and differentiation. Here, we summarize the remarkable progress that has recently been made in the research of ECM role in regulating epidermal stem cell fate, paying special attention to the hair follicle stem cell niche. We show that the destruction of ECM components impairs epidermal stem cell morphogenesis and homeostasis. A deep understanding of ECM molecular structure as well as the development of in vitro system for stem cell maintaining by ECM proteins may bring us to developing new approaches for regenerative medicine.

  19. UVB-induced epidermal hyperproliferation is modified by a single, topical treatment with a mitosis inhibitory epidermal pentapeptide

    International Nuclear Information System (INIS)

    Olsen, W.M.; Elgjo, K.

    1990-01-01

    A single application of a water-miscible cream base containing the recently identified mitosis inhibitory epidermal pentapeptide pyroGlu-Glu-Asp-Ser-GlyOH (EPP) to hairless mouse skin is followed by a long-lasting period of reduced epidermal cell proliferation. To examine if a similar growth inhibition could be achieved in stimulated and rapidly proliferating epidermis, EPP was applied at two different concentrations, 0.005 or 0.02%, to hairless mouse skin immediately after exposure of the left flank to an erythemic dose of ultraviolet B light (UVB). This dose of UVB alone induces a sustained period of rapid epidermal cell proliferation, starting at about 18 h after the irradiation. Epidermal cell proliferation was followed from 18 to 54 h (0.005% cream) or from 18 to 30 h (0.02% cream) after the treatment by estimating the rate of G2-M cell flux (the mitotic rate) by means of Colcemid, and epidermal DNA synthesis by counting labeled cells after pulse-labeling with 3H-thymidine. The unirradiated side of the mice was used as reference. The results showed that topical treatment with a 0.02% EPP cream partially inhibited UVB-induced epidermal hyperproliferation, while the 0.005% EPP cream inhibited as well as stimulated the UVB-induced hyperproliferation. Thus, EPP is effective even in rapidly proliferating epidermal cell populations, but the outcome is obviously dose-dependent in this test system

  20. RNA-Seq Analysis of IL-1B and IL-36 Responses in Epidermal Keratinocytes Identifies a Shared MyD88-Dependent Gene Signature.

    Science.gov (United States)

    Swindell, William R; Beamer, Maria A; Sarkar, Mrinal K; Loftus, Shannon; Fullmer, Joseph; Xing, Xianying; Ward, Nicole L; Tsoi, Lam C; Kahlenberg, Michelle J; Liang, Yun; Gudjonsson, Johann E

    2018-01-01

    IL-36 cytokines have recently emerged as mediators of inflammation in autoimmune conditions including psoriasis vulgaris (PsV) and generalized pustular psoriasis (GPP). This study used RNA-seq to profile the transcriptome of primary epidermal keratinocytes (KCs) treated with IL-1B, IL-36A, IL-36B, or IL-36G. We identified some early IL-1B-specific responses (8 h posttreatment), but nearly all late IL-1B responses were replicated by IL-36 cytokines (24 h posttreatment). Type I and II interferon genes exhibited time-dependent response patterns, with early induction (8 h) followed by no response or repression (24 h). Altogether, we identified 225 differentially expressed genes (DEGs) with shared responses to all 4 cytokines at both time points (8 and 24 h). These involved upregulation of ligands ( IL1A, IL1B , and IL36G ) and activating proteases ( CTSS ) but also upregulation of inhibitors such as IL1RN and IL36RN . Shared IL-1B/IL-36 DEGs overlapped significantly with genes altered in PsV and GPP skin lesions, as well as genes near GWAS loci linked to autoimmune and autoinflammatory diseases (e.g., PsV, psoriatic arthritis, inflammatory bowel disease, and primary biliary cholangitis). Inactivation of MyD88 adapter protein using CRISPR/Cas9 completely abolished expression responses of such DEGs to IL-1B and IL-36G stimulation. These results provide a global view of IL-1B and IL-36 expression responses in epidermal KCs with fine-scale characterization of time-dependent and cytokine-specific response patterns. Our findings support an important role for IL-1B and IL-36 in autoimmune or autoinflammatory conditions and show that MyD88 adaptor protein mediates shared IL-1B/IL-36 responses.

  1. Epidermal growth factor receptor signaling promotes metastatic prostate cancer through microRNA-96-mediated downregulation of the tumor suppressor ETV6.

    Science.gov (United States)

    Tsai, Yuan-Chin; Chen, Wei-Yu; Siu, Man Kit; Tsai, Hong-Yuan; Yin, Juan Juan; Huang, Jiaoti; Liu, Yen-Nien

    2017-01-01

    It has been suggested that ETV6 serves as a tumor suppressor; however, its molecular regulation and cellular functions remain unclear. We used prostate cancer as a model system and demonstrated a molecular mechanism in which ETV6 can be regulated by epidermal growth factor receptor (EGFR) signaling through microRNA-96 (miR-96)-mediated downregulation. In addition, EGFR acts as a transcriptional coactivator that binds to the promoter of primary miR-96 and transcriptionally regulates miR-96 levels. We analyzed two sets of clinical prostate cancer samples, confirmed association patterns that were consistent with the EGFR-miR-96-ETV6 signaling model and demonstrated that the reduced ETV6 levels were associated with malignant prostate cancer. Based on results derived from multiple approaches, we identified the biological functions of ETV6 as a tumor suppressor that inhibits proliferation and metastasis in prostate cancer. We present a molecular mechanism in which EGFR activation leads to the induction of miR-96 expression and suppression of ETV6, which contributes to prostate cancer progression. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  2. External quality assessment on detection of hepatitis C virus RNA in clinical laboratories of China.

    Science.gov (United States)

    Wang, Lu-nan; Zhang, Rui; Shen, Zi-yu; Chen, Wen-xiang; Li, Jin-ming

    2008-06-05

    As with many studies carried out in European countries, a quality assurance program has been established by the National Center for Clinical Laboratories in China (NCCL). The results showed that the external quality assessment significantly improves laboratory performance for quantitative evaluation of hepatitis C virus (HCV) RNA. Serum panels were delivered twice annually to the clinical laboratories which performed HCV RNA detection in China. Each panel made up of 5 coded samples. All laboratories were requested to carry out the detection within the required time period and report on testing results which contained qualitative and/or quantitative test findings, reagents used and relevant information about apparatus. All the positive samples were calibrated against the first International Standard for HCV RNA in a collaborative study and the range of comparison target value (TG) designated as +/- 0.5 log. The numbers of laboratories reporting on qualitative testing results for the first and second time external quality assessment were 168 and 167 in the year of 2003 and increased to 209 and 233 in 2007; the numbers of laboratories reporting on quantitative testing results were 134 and 147 in 2003 and rose to 340 and 339 in 2007. Deviation between the mean value for quantitative results at home in 2003 and the target value was above 0.5 log, which was comparatively high. By 2007, the target value was close to the national average except for the low concentrated specimens (10(3) IU/ml). The percentage of results within the range of GM +/- 0.5 log(10) varied from 8.2% to 93.5%. Some laboratories had some difficulties in the exact quantification of the lowest (3.00 log IU/ml) as well as of the highest viral levels (6.37 log IU/ml) values, very near to the limits of the dynamic range of the assays. The comparison of these results with the previous study confirms that a regular participation in external quality assessment (EQA) assures the achievement of a high

  3. Oral mucosa: an alternative epidermic cell source to develop autologous dermal-epidermal substitutes from diabetic subjects

    Directory of Open Access Journals (Sweden)

    Daniela GUZMÁN-URIBE

    Full Text Available Abstract Oral mucosa has been highlighted as a suitable source of epidermal cells due to its intrinsic characteristics such as its higher proliferation rate and its obtainability. Diabetic ulcers have a worldwide prevalence that is variable (1%-11%, meanwhile treatment of this has been proven ineffective. Tissue-engineered skin plays an important role in wound care focusing on strategies such autologous dermal-epidermal substitutes. Objective The aim of this study was to obtain autologous dermal-epidermal skin substitutes from oral mucosa from diabetic subjects as a first step towards a possible clinical application for cases of diabetic foot. Material and Methods Oral mucosa was obtained from diabetic and healthy subjects (n=20 per group. Epidermal cells were isolated and cultured using autologous fibrin to develop dermal-epidermal in vitro substitutes by the air-liquid technique with autologous human serum as a supplement media. Substitutes were immunocharacterized with collagen IV and cytokeratin 5-14 as specific markers. A Student´s t- test was performed to assess the differences between both groups. Results It was possible to isolate epidermal cells from the oral mucosa of diabetic and healthy subjects and develop autologous dermal-epidermal skin substitutes using autologous serum as a supplement. Differences in the expression of specific markers were observed and the cytokeratin 5-14 expression was lower in the diabetic substitutes, and the collagen IV expression was higher in the diabetic substitutes when compared with the healthy group, showing a significant difference. Conclusion Cells from oral mucosa could be an alternative and less invasive source for skin substitutes and wound healing. A difference in collagen production of diabetic cells suggests diabetic substitutes could improve diabetic wound healing. More research is needed to determine the crosstalk between components of these skin substitutes and damaged tissues.

  4. Identification of high-confidence RNA regulatory elements by combinatorial classification of RNA-protein binding sites.

    Science.gov (United States)

    Li, Yang Eric; Xiao, Mu; Shi, Binbin; Yang, Yu-Cheng T; Wang, Dong; Wang, Fei; Marcia, Marco; Lu, Zhi John

    2017-09-08

    Crosslinking immunoprecipitation sequencing (CLIP-seq) technologies have enabled researchers to characterize transcriptome-wide binding sites of RNA-binding protein (RBP) with high resolution. We apply a soft-clustering method, RBPgroup, to various CLIP-seq datasets to group together RBPs that specifically bind the same RNA sites. Such combinatorial clustering of RBPs helps interpret CLIP-seq data and suggests functional RNA regulatory elements. Furthermore, we validate two RBP-RBP interactions in cell lines. Our approach links proteins and RNA motifs known to possess similar biochemical and cellular properties and can, when used in conjunction with additional experimental data, identify high-confidence RBP groups and their associated RNA regulatory elements.

  5. A method for high-quality RNA extraction from tall fescue

    African Journals Online (AJOL)

    Jane

    2011-07-20

    Jul 20, 2011 ... but most of those methods are time-consuming (Li et al.,. 2008). Since RNA ... forage and seed (Wang and Ge, 2004; Huang et al.,. 2008). ..... Malnoy M, Reynoird JP, Mourgues F, Chevreau E, Simoneau P (2001). A method ...

  6. COMPARISON OF THE QUALITY OF RNA ISOLATED FROM THE RAINBOW TROUT (Oncorhynchus mykiss TISSUE IN FOUR DIFFERENT WAYS

    Directory of Open Access Journals (Sweden)

    Irena Vardić

    2004-03-01

    Full Text Available Rapid and accurate diagnostic procedures for identification of reared fish diseases are important in order to reduce serious losses in relation of diseases outbrakes. Therefore, molecular biology methods are required for such types of investigations. First level in these experiments are DNA or RNA isolation. Tissue preparation for isolation of RNA, which is used in further RT-PCR (reverse transcription-polymerise chain reaction analysis is the key step on which is the whole process of analysis dependent. Our goal was to compare quality and integrity of RNA isolated from the rainbow trout tissue, which was prepared in four different ways: fresh tissue, frozen tissue, in formalin-fixed, paraffin embedded tissue as well as in methacarn-fixed, paraffin embedded tissue. Isolated RNA was analyzed in gel electrophoresis on non-denaturated, 1% agarose gel. Quality and integrity of RNA was proved by RT-PCR reaction with primers for ß-actin gene. Additional, prepared tissue was tested on presence of two fish viruses: viral haemorrhagic septicaemia (VHS virus and infectious haematopoietic necrosis (IHN virus in RT-PCR reaction with primers specific for these viruses. RNA isolated from fresh and frozen tissue was of high quality, integrity and quantity. RNA isolated from in methacarn-fixed, paraffin embedded tissue was quite disintegrated, but in RT-PCR with primers for ß-actin gave expected products. These products were absent after RT-PCR reaction with in formallin-fixed, paraffin-embedded tissue. That agrees with the facts from the literature about very agressive affect of formalin as a fixative on RNA in tissue. Inspected fish were not infected with VHS and IHN viruses and that was in agreement with results of clinical examination and pathological analysis. According to our knowledge, this is the first successful RNA isolation from in methacarn-fixed, paraffin embedded fish tissue. Isolated RNA can be used for further analysis in RT-PCR reaction. This

  7. Epidermal Growth Factor-like Domain 7 Predicts Response to First-Line Chemotherapy and Bevacizumab in Patients with Metastatic Colorectal Cancer

    DEFF Research Database (Denmark)

    Hansen, Torben Frøstrup; Nielsen, Boye Schnack; Sørensen, Flemming Brandt

    2014-01-01

    The number of approved antiangiogenic drugs is constantly growing and emphasizes the need for predictive biomarkers. The aim of this study was to analyze the predictive value of epidermal growth factor-like domain 7 (EGFL7) and microRNA-126 (miR126) to first-line chemotherapy combined with bevaci...

  8. BioVLAB-MMIA-NGS: microRNA-mRNA integrated analysis using high-throughput sequencing data.

    Science.gov (United States)

    Chae, Heejoon; Rhee, Sungmin; Nephew, Kenneth P; Kim, Sun

    2015-01-15

    It is now well established that microRNAs (miRNAs) play a critical role in regulating gene expression in a sequence-specific manner, and genome-wide efforts are underway to predict known and novel miRNA targets. However, the integrated miRNA-mRNA analysis remains a major computational challenge, requiring powerful informatics systems and bioinformatics expertise. The objective of this study was to modify our widely recognized Web server for the integrated mRNA-miRNA analysis (MMIA) and its subsequent deployment on the Amazon cloud (BioVLAB-MMIA) to be compatible with high-throughput platforms, including next-generation sequencing (NGS) data (e.g. RNA-seq). We developed a new version called the BioVLAB-MMIA-NGS, deployed on both Amazon cloud and on a high-performance publicly available server called MAHA. By using NGS data and integrating various bioinformatics tools and databases, BioVLAB-MMIA-NGS offers several advantages. First, sequencing data is more accurate than array-based methods for determining miRNA expression levels. Second, potential novel miRNAs can be detected by using various computational methods for characterizing miRNAs. Third, because miRNA-mediated gene regulation is due to hybridization of an miRNA to its target mRNA, sequencing data can be used to identify many-to-many relationship between miRNAs and target genes with high accuracy. http://epigenomics.snu.ac.kr/biovlab_mmia_ngs/. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  9. Targeting the epidermal growth factor receptor in non-small cell lung cancer cells: the effect of combining RNA interference with tyrosine kinase inhibitors or cetuximab

    Directory of Open Access Journals (Sweden)

    Chen Gang

    2012-03-01

    Full Text Available Abstract Background The epidermal growth factor receptor (EGFR is a validated therapeutic target in non-small cell lung cancer (NSCLC. However, current single agent receptor targeting does not achieve a maximal therapeutic effect, and some mutations confer resistance to current available agents. In the current study we have examined, in different NSCLC cell lines, the combined effect of RNA interference targeting the EGFR mRNA, and inactivation of EGFR signaling using different receptor tyrosine kinase inhibitors (TKIs or a monoclonal antibody cetuximab. Methods NSCLC cells (cell lines HCC827, H292, H358, H1650, and H1975 were transfected with EGFR siRNA and/or treated with the TKIs gefitinib, erlotinib, and afatinib, and/or with the monoclonal antibody cetuximab. The reduction of EGFR mRNA expression was measured by real-time quantitative RT-PCR. The down-regulation of EGFR protein expression was measured by western blot, and the proliferation, viability, caspase3/7 activity, and apoptotic morphology were monitored by spectrophotometry, fluorimetry, and fluorescence microscopy. The combined effect of EGFR siRNA and different drugs was evaluated using a combination index. Results EGFR-specific siRNA strongly inhibited EGFR protein expression almost equally in all cell lines and inhibited cell growth and induced cell apoptosis in all NSCLC cell lines studied, albeit with a different magnitude. The effects on growth obtained with siRNA was strikingly different from the effects obtained with TKIs. The effects of siRNA probably correlate with the overall oncogenic significance of the receptor, which is only partly inhibited by the TKIs. The cells which showed weak response to TKIs, such as the H1975 cell line containing the T790M resistance mutation, were found to be responsive to siRNA knockdown of EGFR, as were cell lines with downstream TKI resistance mutations. The cell line HCC827, harboring an exon 19 deletion mutation, was more than 10-fold

  10. Production of high quality brain-derived neurotrophic factor (BDNF) and tropomyosin receptor kinase B (TrkB) RNA from isolated populations of rat spinal cord motor neurons obtained by Laser Capture Microdissection (LCM).

    Science.gov (United States)

    Mehta, Prachi; Premkumar, Brian; Morris, Renée

    2016-08-03

    The mammalian central nervous system (CNS) is composed of multiple cellular elements, making it challenging to segregate one particular cell type to study their gene expression profile. For instance, as motor neurons represent only 5-10% of the total cell population of the spinal cord, meaningful transcriptional analysis on these neurons is almost impossible to achieve from homogenized spinal cord tissue. A major challenge faced by scientists is to obtain good quality RNA from small amounts of starting material. In this paper, we used Laser Capture Microdissection (LCM) techniques to identify and isolate spinal cord motor neurons. The present analysis revealed that perfusion with paraformaldehyde (PFA) does not alter RNA quality. RNA integrity numbers (RINs) of tissue samples from rubrospinal tract (RST)-transected, intact spinal cord or from whole spinal cord homogenate were all above 8, which indicates intact, high-quality RNA. Levels of mRNA for brain-derived neurotrophic factor (BDNF) or for its tropomyosin receptor kinase B (TrkB) were not affected by rubrospinal tract (RST) transection, a surgical procedure that deprive motor neurons from one of their main supraspinal input. The isolation of pure populations of neurons with LCM techniques allows for robust transcriptional characterization that cannot be achieved with spinal cord homogenates. Such preparations of pure population of motor neurons will provide valuable tools to advance our understanding of the molecular mechanisms underlying spinal cord injury and neuromuscular diseases. In the near future, LCM techniques might be instrumental to the success of gene therapy for these debilitating conditions. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  11. [ROLE OF microRNA IN SKIN DEVELOPMENT AND WOUND HEALING].

    Science.gov (United States)

    Song, Zhifang; Liu, Dewu

    2014-07-01

    To review the role of microRNA (miRNA) in skin development and wound healing. The recent literature about miRNA in skin development and wound healing was reviewed and analyzed. miRNA extensively involved in the development of the skin, including epidermal cell proliferation, differentiation, aging and hair follicle development; miR-203 known as the "skin-specific miRNA" can directly inhibit the expression of p63 and promote the differentiation of the epidermis. Meanwhile, miRNA also involved in various stages of skin regeneration and wound healing. Abnormal expression of miRNA is closely related with abnormal wound healing. miRNA play an important role in maintaining normal skin physiology and skin regeneration. To explore their roles in the healing of skin wounds and their regulatory mechanism can provide a new target for the treatment, which has a potential value and broad prospects.

  12. Interactions between mRNA export commitment, 3'-end quality control, and nuclear degradation

    DEFF Research Database (Denmark)

    Libri, Domenico; Dower, Ken; Boulay, Jocelyne

    2002-01-01

    Several aspects of eukaryotic mRNA processing are linked to transcription. In Saccharomyces cerevisiae, overexpression of the mRNA export factor Sub2p suppresses the growth defect of hpr1 null cells, yet the protein Hpr1p and the associated THO protein complex are implicated in transcriptional el...... results show that several classes of defective RNPs are subject to a quality control step that impedes release from transcription site foci and suggest that suboptimal messenger ribonucleoprotein assembly leads to RNA degradation by Rrp6p....

  13. Toxic epidermal necrolysis and Stevens-Johnson syndrome

    Directory of Open Access Journals (Sweden)

    French Lars E

    2010-12-01

    Full Text Available Abstract Toxic epidermal necrolysis (TEN and Stevens Johnson Syndrome (SJS are severe adverse cutaneous drug reactions that predominantly involve the skin and mucous membranes. Both are rare, with TEN and SJS affecting approximately 1or 2/1,000,000 annually, and are considered medical emergencies as they are potentially fatal. They are characterized by mucocutaneous tenderness and typically hemorrhagic erosions, erythema and more or less severe epidermal detachment presenting as blisters and areas of denuded skin. Currently, TEN and SJS are considered to be two ends of a spectrum of severe epidermolytic adverse cutaneous drug reactions, differing only by their extent of skin detachment. Drugs are assumed or identified as the main cause of SJS/TEN in most cases, but Mycoplasma pneumoniae and Herpes simplex virus infections are well documented causes alongside rare cases in which the aetiology remains unknown. Several drugs are at "high" risk of inducing TEN/SJS including: Allopurinol, Trimethoprim-sulfamethoxazole and other sulfonamide-antibiotics, aminopenicillins, cephalosporins, quinolones, carbamazepine, phenytoin, phenobarbital and NSAID's of the oxicam-type. Genetic susceptibility to SJS and TEN is likely as exemplified by the strong association observed in Han Chinese between a genetic marker, the human leukocyte antigen HLA-B*1502, and SJS induced by carbamazepine. Diagnosis relies mainly on clinical signs together with the histological analysis of a skin biopsy showing typical full-thickness epidermal necrolysis due to extensive keratinocyte apoptosis. Differential diagnosis includes linear IgA dermatosis and paraneoplastic pemphigus, pemphigus vulgaris and bullous pemphigoid, acute generalized exanthematous pustulosis (AGEP, disseminated fixed bullous drug eruption and staphyloccocal scalded skin syndrome (SSSS. Due to the high risk of mortality, management of patients with SJS/TEN requires rapid diagnosis, evaluation of the prognosis

  14. Herbal medicines that benefit epidermal permeability barrier function

    Directory of Open Access Journals (Sweden)

    Lizhi Hu

    2015-06-01

    Full Text Available Epidermal permeability barrier function plays a critical role in regulating cutaneous functions. Hence, researchers have been searching for effective and affordable regimens to enhance epidermal permeability barrier function. In addition to topical stratum corneum lipids, peroxisome proliferator-activated receptor, and liver X receptor ligands, herbal medicines have been proven to benefit epidermal permeability barrier function in both normal and diseased skin, including atopic dermatitis, glucocorticoid-induced skin damage, and UVB-damaged skin. The potential mechanisms by which herbal medicines improve the permeability barrier include stimulation of epidermal differentiation, lipid production, antimicrobial peptide expression, and antioxidation. Therefore, utilization of herbal medicines could be a valuable alternative approach to enhance epidermal permeability barrier function in order to prevent and/or treat skin disorders associated with permeability barrier abnormalities.

  15. Expression of the epidermal growth factor system in eutopic endometrium from women with endometriosis differs from that in endometrium from healthy women

    DEFF Research Database (Denmark)

    Ejskjaer, Kirsten; Sorensen, Boe Sandahl; Poulsen, Steen Seier

    2008-01-01

    BACKGROUND: The epidermal growth factor (EGF) system comprises four receptors, HER1-4, and several ligands, and is cyclically expressed in endometrium from healthy fertile women. Our aim is to identify differences in expression of the EGF system between endometriotic and normal endometrium. METHODS......: We previously examined the EGF system in endometrial samples from healthy women (n = 14). Here we examine samples from endometrium (n = 23), endometriomas (n = 10) and peritoneal endometriosis (n = 9) from women with endometriosis (n = 23). mRNA expression of receptors and ligands from the EGF system...... was analyzed by real-time PCR, and proteins were localized by immunohistochemistry. RESULTS: Endometrial mRNA for HER1-3 was high compared with our previous findings in healthy endometrium, whereas HER4 and the ligands were unchanged. Endometriomas show lower expression of HER1-3 and no HER4 expression...

  16. Urea uptake enhances barrier function and antimicrobial defense in humans by regulating epidermal gene expression

    Science.gov (United States)

    Grether-Beck, Susanne; Felsner, Ingo; Brenden, Heidi; Kohne, Zippora; Majora, Marc; Marini, Alessandra; Jaenicke, Thomas; Rodriguez-Martin, Marina; Trullas, Carles; Hupe, Melanie; Elias, Peter M.; Krutmann, Jean

    2012-01-01

    Urea is an endogenous metabolite, known to enhance stratum corneum hydration. Yet, topical urea anecdotally also improves permeability barrier function, and it appears to exhibit antimicrobial activity. Hence, we hypothesized that urea is not merely a passive metabolite, but a small-molecule regulator of epidermal structure and function. In 21 human volunteers, topical urea improved barrier function in parallel with enhanced antimicrobial peptide (LL-37 and β-defensin-2) expression. Urea both stimulates expression of, and is transported into keratinocytes by two urea transporters, UT-A1 and UT-A2, and by aquaporin 3, 7 and 9. Inhibitors of these urea transporters block the downstream biological effects of urea, which include increased mRNA and protein levels for: (i) transglutaminase-1, involucrin, loricrin and filaggrin; (ii) epidermal lipid synthetic enzymes, and (iii) cathelicidin/LL-37 and β-defensin-2. Finally, we explored the potential clinical utility of urea, showing that topical urea applications normalized both barrier function and antimicrobial peptide expression in a murine model of atopic dermatitis (AD). Together, these results show that urea is a small-molecule regulator of epidermal permeability barrier function and antimicrobial peptide expression after transporter uptake, followed by gene regulatory activity in normal epidermis, with potential therapeutic applications in diseased skin. PMID:22418868

  17. dsRNA silencing of an R2R3-MYB transcription factor affects flower cell shape in a Dendrobium hybrid.

    Science.gov (United States)

    Lau, Su-Ee; Schwarzacher, Trude; Othman, Rofina Yasmin; Harikrishna, Jennifer Ann

    2015-08-11

    The R2R3-MYB genes regulate pigmentation and morphogenesis of flowers, including flower and cell shape, and therefore have importance in the development of new varieties of orchids. However, new variety development is limited by the long breeding time required in orchids. In this study, we identified a cDNA, DhMYB1, that is expressed during flower development in a hybrid orchid, Dendrobium hybrida (Dendrobium bobby messina X Dendrobium chao phraya) then used the direct application of dsRNA to observe the effect of gene silencing on flower phenotype and floral epidermal cell shape. Flower bud development in the Dendrobium hybrid was characterised into seven stages and the time of meiosis was determined as between stages 3 to 5 when the bud is approximately half of the mature size. Scanning electron microscopy characterisation of adaxial epidermal cells of the flower perianth, showed that the petals and sepals each are divided into two distinct domains based on cell shape and size, while the labellum comprises seven domains. Thirty-two partial cDNA fragments representing R2R3-MYB gene sequences were isolated from D. hybrida. Phylogenetic analysis revealed that nine of the translated sequences were clustered with MYB sequences that are known to be involved in cell shape development and from these, DhMYB1 was selected for full length cDNA cloning and functional study. Direct application of a 430 bp dsRNA from the 3' region of DhMYB1 to emerging orchid flower buds reduced expression of DhMYB1 RNA compared with untreated control. Scanning electron microscopy of adaxial epidermal cells within domain one of the labellum of flowers treated with DhMYB1 dsRNA showed flattened epidermal cells whilst those of control flowers were conical. DhMYB1 is expressed throughout flower bud development and is involved in the development of the conical cell shape of the epidermal cells of the Dendrobium hybrida flower labellum. The direct application of dsRNA changed the phenotype of

  18. RNA interference in Lepidoptera

    DEFF Research Database (Denmark)

    Terenius, Ole; Papanicolaou, Alexie; Garbutt, Jennie S.

    2011-01-01

    in RNAi experiments in Lepidoptera are discussed. The review also points to a need to further investigate the mechanism of RNAi in lepidopteran insects and its possible connection to the innate immune response. Our general understanding of RNAi in Lepidoptera will be further aided in the future as our...... experiments have not been collected in such a way that they are possible to analyze. In this review, we have collected detailed data from more than 150 experiments including all to date published and many unpublished experiments. Despite a large variation in the data, trends that are found are that RNAi...... is particularly successful in the family Saturniidae and in genes involved in immunity. On the contrary, gene expression in epidermal tissues seems to be most difficult to silence. In addition, gene silencing by feeding dsRNA requires high concentrations for success. Possible causes for the variability of success...

  19. [Quantity research on epidermal growth factor in saliva and epidermal growth factor receptor in biopsy samples of recurrent aphthous ulcer patients].

    Science.gov (United States)

    Gu, Yang; Zhang, Gang; Lin, Mei

    2008-02-01

    To examine the change of epidermal growth factor (EGF) concentration in saliva of recurrent aphthous ulcer (RAU) patients during the ulcerous and interval period and epidermal growth factor receptor (EGFR) in ulcer biopsy samples. ECF data of the samples, which were 27 saliva samples from RAU gained not only in the ulcerous period but also in interval period and 33 ones from normal persons, were acquired through enzyme linked immunosorhent assay (ELISA) and EGF standard curve. ECFR-RNA date of RAU biopsies, which were 31 biopsy samples from RAU got during the ulcerous period and 35 ones from normal persons, were surveyed by QF-RT-PCR. All RAU samples were obtained under the same level, which were the whole patients were minor aphthous ulcers and their ulcers occurred not over the first four days. All patients and normal persons were selected seriously under the rule of physical situations without any other diseases and histories of using medicines. The EGF concentration of saliva in RAU group at ulcer occurrence was higher than that in the interval period and the normal control with a significant test (F = 3.24, P ulcer occurrence was higher than the normal control with a significant test (t = 3.15, P ulcer occasion of RAU patients could be related with the decreasing of EGF in saliva during interval period, and that the ulcer sell-cure of RAU patients would be contributed to

  20. Extraordinarily Stretchable All-Carbon Collaborative Nanoarchitectures for Epidermal Sensors

    KAUST Repository

    Cai, Yichen

    2017-06-16

    Multifunctional microelectronic components featuring large stretchability, high sensitivity, high signal-to-noise ratio (SNR), and broad sensing range have attracted a huge surge of interest with the fast developing epidermal electronic systems. Here, the epidermal sensors based on all-carbon collaborative percolation network are demonstrated, which consist 3D graphene foam and carbon nanotubes (CNTs) obtained by two-step chemical vapor deposition processes. The nanoscaled CNT networks largely enhance the stretchability and SNR of the 3D microarchitectural graphene foams, endowing the strain sensor with a gauge factor as high as 35, a wide reliable sensing range up to 85%, and excellent cyclic stability (>5000 cycles). The flexible and reversible strain sensor can be easily mounted on human skin as a wearable electronic device for real-time and high accuracy detecting of electrophysiological stimuli and even for acoustic vibration recognition. The rationally designed all-carbon nanoarchitectures are scalable, low cost, and promising in practical applications requiring extraordinary stretchability and ultrahigh SNRs.

  1. Extraordinarily Stretchable All-Carbon Collaborative Nanoarchitectures for Epidermal Sensors

    KAUST Repository

    Cai, Yichen; Shen, Jie; Dai, Ziyang; Zang, Xiaoxian; Dong, Qiuchun; Guan, Guofeng; Li, Lain-Jong; Huang, Wei; Dong, Xiaochen

    2017-01-01

    Multifunctional microelectronic components featuring large stretchability, high sensitivity, high signal-to-noise ratio (SNR), and broad sensing range have attracted a huge surge of interest with the fast developing epidermal electronic systems. Here, the epidermal sensors based on all-carbon collaborative percolation network are demonstrated, which consist 3D graphene foam and carbon nanotubes (CNTs) obtained by two-step chemical vapor deposition processes. The nanoscaled CNT networks largely enhance the stretchability and SNR of the 3D microarchitectural graphene foams, endowing the strain sensor with a gauge factor as high as 35, a wide reliable sensing range up to 85%, and excellent cyclic stability (>5000 cycles). The flexible and reversible strain sensor can be easily mounted on human skin as a wearable electronic device for real-time and high accuracy detecting of electrophysiological stimuli and even for acoustic vibration recognition. The rationally designed all-carbon nanoarchitectures are scalable, low cost, and promising in practical applications requiring extraordinary stretchability and ultrahigh SNRs.

  2. SPIDIA-RNA: First external quality assessment for the pre-analytical phase of blood samples used for RNA based analyses

    Czech Academy of Sciences Publication Activity Database

    Pazzagli, M.; Malentacchi, F.; Simi, L.; Wyrich, R.; Guenther, K.; Hartmann, C.; Verderio, P.; Pizzamiglio, S.; Ciniselli, C.M.; Tichopád, Aleš; Kubista, Mikael; Gelmini, S.

    2013-01-01

    Roč. 59, č. 1 (2013), s. 20-31 ISSN 1046-2023 Institutional research plan: CEZ:AV0Z50520701 Keywords : Pre-analytical phase * RNA quality * Blood samples Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.221, year: 2013

  3. Enrichment of unlabeled human Langerhans cells from epidermal cell suspensions by discontinuous density gradient centrifugation

    NARCIS (Netherlands)

    Teunissen, M. B.; Wormmeester, J.; Kapsenberg, M. L.; Bos, J. D.

    1988-01-01

    In this report we introduce an alternative procedure for enrichment of human epidermal Langerhans cells (LC) from epidermal cell suspensions of normal skin. By means of discontinuous Ficoll-Metrizoate density gradient centrifugation, a fraction containing high numbers of viable, more than 80% pure

  4. A review of toxic epidermal necrolysis management in Japan

    Directory of Open Access Journals (Sweden)

    Yuri Kinoshita

    2017-01-01

    Full Text Available Toxic epidermal necrolysis (TEN is a severe adverse drug reaction characterized by necrosis of the epidermis. Its incidence is approximately 1 per million a year and average mortality rate is high at 25–50%. TEN has a flu-like prodrome, followed by atypical, targetoid erythematous or purpuric macules on the skin. These macules coalesce to form flaccid blisters that slough off as areas of epidermal necrosis. Drugs such as allopurinol, sulfonamides, and carbamazepine are the most common causes. The human leukocyte antigen (HLA-B*15:02 in Asians being administered carbamazepine and the HLA-B*58:01 antigen in patients of all ethnicities being administered allopurinol are known to be high-risk factors. Rapid diagnosis, discontinuation of the causative drug, and supportive treatment are essential for better prognosis and improvement of sequelae. Till now, systemic corticosteroids and intravenous immunoglobulins have been used as the most common active interventions; however, no gold standard has been established. In Japan, physicians follow a unique diagnostic criteria and treatment guideline to improve the diagnosis rate and streamline treatments. This may be a contributing factor for the lower mortality rate (14.3%. The efficacy of systemic corticosteroids, immunoglobulins, and plasmapheresis may have been beneficial as well. In Japan, TEN is defined as an epidermal detachment of over 10% of the body surface area (BSA, while the globally accepted definition established by Bastuji-Garin describes it as an epidermal detachment of over 30% of the BSA. In Japanese individuals, HLA-A*02:06, HLA-A*02:07, HLA-A*31:01 and HLA-B*51:01 may be linked to higher risks of TEN.

  5. Epidermal growth factor induces HCCR expression via PI3K/Akt/mTOR signaling in PANC-1 pancreatic cancer cells

    International Nuclear Information System (INIS)

    Xu, Zekuan; Zhang, Guoxin; Zhang, Yi; Jiang, Jiakai; Yang, Yang; Shi, Ruihua; Hao, Bo; Zhang, Zhihong; Huang, Zuhu; Kim, Jin W

    2010-01-01

    Human cervical cancer oncoprotein 1 (HCCR-1), reported as a negative regulator of p53, is over-expressed in a variety of human cancers. However, it is yet unknown whether HCCR-1 plays any role in pancreatic cancer development. The aim of this study was to investigate the effect of epidermal growth factor on the expression of HCCR in pancreatic cancer cells, and to explore if PI3K/Akt/mTOR signaling pathway mediated this expression. A polyclonal antibody against HCCR protein was raised by immunizing Balb/c mice with the purified recombinant protein pMBPc-HCCR. Tissue samples were constructed on a tissue chip, and the expression of HCCR was investigated by immunohistochemistry assay and Western blotting. Pancreatic cell line, PANC-1 cells were stably transfected with plasmids containing sense-HCCR-1 fragment and HCCR siRNA fragment. MTT and transwell assay were used to investigate the proliferation and invasion of stable tansfectants. The specific inhibitor of PI3K and mTOR was used to see if PI3K/mTOR signal transduction was involved in the induction of HCCR gene expression. A Luciferase assay was used to see if Akt can enhance the HCCR promoter activity. HCCR was up-regulated in pancreatic tumor tissues (mean Allred score 4.51 ± 1.549 vs. 2.87 ± 2.193, P < 0.01), especially with high expression in poorly differentiated pancreatic cancer. The growth of cells decreased in HCCR-1 siRNA transfected cells compared with vector transfectants. The number of invasion cells was significantly lower in HCCR-1 siRNA transfected cells (24.4 ± 9.9) than that in vector transfectants (49.1 ± 15.4). Treatment of PANC-1 cells with epidermal growth factor increased HCCR protein level in a dose- and time-dependent manner. However, application of LY294002 and rapamycin caused a dramatic reduction of epidermal growth factor-induced HCCR expression. Over-expression of exogenous constitutively active Akt increased the HCCR promoter activity; in contrast, dominant negative Akt decreased

  6. TruSeq Stranded mRNA and Total RNA Sample Preparation Kits

    Science.gov (United States)

    Total RNA-Seq enabled by ribosomal RNA (rRNA) reduction is compatible with formalin-fixed paraffin embedded (FFPE) samples, which contain potentially critical biological information. The family of TruSeq Stranded Total RNA sample preparation kits provides a unique combination of unmatched data quality for both mRNA and whole-transcriptome analyses, robust interrogation of both standard and low-quality samples and workflows compatible with a wide range of study designs.

  7. iMir: an integrated pipeline for high-throughput analysis of small non-coding RNA data obtained by smallRNA-Seq.

    Science.gov (United States)

    Giurato, Giorgio; De Filippo, Maria Rosaria; Rinaldi, Antonio; Hashim, Adnan; Nassa, Giovanni; Ravo, Maria; Rizzo, Francesca; Tarallo, Roberta; Weisz, Alessandro

    2013-12-13

    Qualitative and quantitative analysis of small non-coding RNAs by next generation sequencing (smallRNA-Seq) represents a novel technology increasingly used to investigate with high sensitivity and specificity RNA population comprising microRNAs and other regulatory small transcripts. Analysis of smallRNA-Seq data to gather biologically relevant information, i.e. detection and differential expression analysis of known and novel non-coding RNAs, target prediction, etc., requires implementation of multiple statistical and bioinformatics tools from different sources, each focusing on a specific step of the analysis pipeline. As a consequence, the analytical workflow is slowed down by the need for continuous interventions by the operator, a critical factor when large numbers of datasets need to be analyzed at once. We designed a novel modular pipeline (iMir) for comprehensive analysis of smallRNA-Seq data, comprising specific tools for adapter trimming, quality filtering, differential expression analysis, biological target prediction and other useful options by integrating multiple open source modules and resources in an automated workflow. As statistics is crucial in deep-sequencing data analysis, we devised and integrated in iMir tools based on different statistical approaches to allow the operator to analyze data rigorously. The pipeline created here proved to be efficient and time-saving than currently available methods and, in addition, flexible enough to allow the user to select the preferred combination of analytical steps. We present here the results obtained by applying this pipeline to analyze simultaneously 6 smallRNA-Seq datasets from either exponentially growing or growth-arrested human breast cancer MCF-7 cells, that led to the rapid and accurate identification, quantitation and differential expression analysis of ~450 miRNAs, including several novel miRNAs and isomiRs, as well as identification of the putative mRNA targets of differentially expressed mi

  8. Analysis of E2F factors during epidermal differentiation.

    Science.gov (United States)

    Chang, Wing Y; Dagnino, Lina

    2005-01-01

    The multigene E2F family of transcription factors is central in the control of cell cycle progression. The expression and activity of E2F proteins is tightly regulated transcriptionally and posttranslationally as a function of the proliferation and differentiation status of the cell. In this chapter, we review protocols designed to determine E2F mRNA abundance in tissues by in situ hybridization techniques. The ability to culture primary epidermal keratinocytes and maintain them as either undifferentiated or terminally differentiated cells allows the biochemical and molecular characterization of changes in E2F expression and activity. Thus, we also discuss in detail methods to analyze E2F protein abundance by immunoblot and their ability to bind DNA in cultured cells using electrophoretic mobility shift assays.

  9. Horse hooves and bird feathers: Two model systems for studying the structure and development of highly adapted integumentary accessory organs--the role of the dermo-epidermal interface for the micro-architecture of complex epidermal structures.

    Science.gov (United States)

    Bragulla, Hermann; Hirschberg, Ruth M

    2003-08-15

    Accessory organs of the integument are locally modified parts of the potentially feather-bearing skin in birds (e.g., the rhamphotheca, claws, or scales), and of the potentially hairy skin in mammals (e.g., the rhinarium, nails, claws, or hooves). These special parts of the integument are characterised by a modified structure of their epidermal, dermal and subcutaneous layers. The developmental processes of these various integumentary structures in birds and mammals show both similarities and differences. For example, the development of the specialised epidermal structures of both feathers and the hoof capsule is influenced by the local three-dimensional configuration of the dermis. However, in feathers, in contrast to hooves, the arrangement of the corneous cells is only partially a direct result of the particular arrangement and shape of the dermal surface of the papillary body. Whereas the diameter of the feather papilla, as well as the number, length, and width of dermal ridges on the surface of the feather papilla influence the three-dimensional architecture of the feather rami, there is no apparent direct correlation between the dermo-epidermal interface and the development of the highly ordered architecture of the radii and hamuli in the feather vane. In order to elucidate this morphogenic problem and the problem of locally different processes of keratinisation and cornification, the structure and development of feathers in birds are compared to those of the hoof capsule in horses. The equine hoof is the most complex mammalian integumentary structure, which is determined directly by the dermal surface of the papillary body. Perspectives for further research on the development of modified integumentary structures, such as the role of the dermal microangioarchitecture and the selective adhesion and various differentiation pathways of epidermal cells, are discussed. Copyright 2003 Wiley-Liss, Inc.

  10. EGF receptor targeted lipo-oligocation polyplexes for antitumoral siRNA and miRNA delivery

    Science.gov (United States)

    Müller, Katharina; Klein, Philipp M.; Heissig, Philipp; Roidl, Andreas; Wagner, Ernst

    2016-11-01

    Antitumoral siRNA and miRNA delivery was demonstrated by epidermal growth factor receptor (EGFR) targeted oligoaminoamide polyplexes. For this purpose, the T-shaped lipo-oligomer 454 was used to complex RNA into a core polyplex, which was subsequently functionalized with the targeting peptide ligand GE11 via a polyethylene glycol (PEG) linker. To this end, free cysteines on the surface of 454 polyplex were coupled with a maleimide-PEG-GE11 reagent (Mal-GE11). Resulting particles with sizes of 120-150 nm showed receptor-mediated uptake into EGFR-positive T24 bladder cancer cells, MDA-MB 231 breast cancer cells and Huh7 liver cancer cells. Furthermore, these formulations led to ligand-dependent gene silencing. RNA interference (RNAi) triggered antitumoral effects were observed for two different therapeutic RNAs, a miRNA-200c mimic or EG5 siRNA. Using polyplexes modified with a ratio of 0.8 molar equivalents of Mal-GE11, treatment of T24 or MDA-MB 231 cancer cells with miR-200c led to the expected decreased proliferation and migration, changes in cell cycle and enhanced sensitivity towards doxorubicin. Delivery of EG5 siRNA into Huh7 cells resulted in antitumoral activity with G2/M arrest, triggered by loss of mitotic spindle separation and formation of mono-astral spindles. These findings demonstrate the potential of GE11 ligand-containing RNAi polyplexes for cancer treatment.

  11. Fit for purpose frozen tissue collections by RNA integrity number-based quality control assurance at the Erasmus MC tissue bank.

    Science.gov (United States)

    Kap, Marcel; Oomen, Monique; Arshad, Shazia; de Jong, Bas; Riegman, Peter

    2014-04-01

    About 5000 frozen tissue samples are collected each year by the Erasmus Medical Center tissue bank. Two percent of these samples are randomly selected annually for RNA isolation and RNA Integrity Number (RIN) measurement. A similar quality assessment was conducted during centralization of a 20-year-old tissue collection from the cancer institute, a 15-year-old liver sample archive (-80°C), and a 13-year-old clinical pathology frozen biopsy archive (Liquid Nitrogen). Samples were divided into either high-quality (RIN ≥6.5) or low-quality overall categories, or into four "fit-for-purpose" quality groups: RIN procurement protocols used for these samples needed immediate evaluation. When the distribution of RIN values of the different collections were compared, no significant differences were found, despite differences in average storage time and temperature. According to the principle of "fit-for-purpose" distribution, the vast majority of samples are considered good enough for most downstream techniques. In conclusion, an annual tissue bank quality control procedure provides useful information on tissue sample quality and sheds light on where and if improvements need to be made.

  12. Higher Quality of Molecular Testing, an Unfulfilled Priority: Results from External Quality Assessment for KRAS Mutation Testing in Colorectal Cancer

    NARCIS (Netherlands)

    Tembuyser, L.; Ligtenberg, M.J.L.; Normanno, N.; Delen, S.; Krieken, J.H.J.M. van; Dequeker, E.M.

    2014-01-01

    Precision medicine is now a key element in clinical oncology. RAS mutational status is a crucial predictor of responsiveness to anti-epidermal growth factor receptor agents in metastatic colorectal cancer. In an effort to guarantee high-quality testing services in molecular pathology, the European

  13. Toxic epidermal necrolysis successfully treated with etanercept.

    Science.gov (United States)

    Gubinelli, Emanuela; Canzona, Flora; Tonanzi, Tiziano; Raskovic, Desanka; Didona, Biagio

    2009-03-01

    Toxic epidermal necrolysis (TEN) is a rare and acute severe adverse reaction to drugs, characterised by massive apoptosis and widespread epidermal and mucosal detachment. Although no gold standard therapy exists, human i.v. immunoglobulins have recently been described as an effective treatment for this disease. We report a case of phenobarbital-induced TEN in a 59-year-old white woman where the epidermal detachment stopped 48 h after beginning the etanercept treatment with complete healing after 20 days. To the best of our knowledge, this is only the second reported case of TEN successfully treated with etanercept.

  14. Evolution of the clonogenic potential of human epidermal stem/progenitor cells with age

    Directory of Open Access Journals (Sweden)

    Zobiri O

    2012-02-01

    Full Text Available Olivia Zobiri, Nathalie Deshayes, Michelle Rathman-JosserandDepartment of Biological Research, L'Oréal Advanced Research, Clichy Cedex, FranceAbstract: A number of clinical observations have indicated that the regenerative potential and overall function of the epidermis is modified with age. The epidermis becomes thinner, repairs itself less efficiently after wounding, and presents modified barrier function recovery. In addition, the dermal papillae flatten out with increasing age, suggesting a modification in the interaction between epidermal and dermal compartments. As the epidermal regenerative capacity is dependent upon stem and progenitor cell function, it is naturally of interest to identify and understand age-related changes in these particular keratinocyte populations. Previous studies have indicated that the number of stem cells does not decrease with age in mouse models but little solid evidence is currently available concerning human skin. The objective of this study was to evaluate the clonogenic potential of keratinocyte populations isolated from the epidermis of over 50 human donors ranging from 18 to 71 years old. The data indicate that the number of epidermal cells presenting high regenerative potential does not dramatically decline with age in human skin. The authors believe that changes in the microenvironment controlling epidermal basal cell activity are more likely to explain the differences in epidermal function observed with increasing age.Keywords: skin, epidermal stem cells, aging, colony-forming efficiency test

  15. Guidelines for the management of Stevens-Johnson syndrome/toxic epidermal necrolysis: An Indian perspective.

    Science.gov (United States)

    Gupta, Lalit Kumar; Martin, Abhay Mani; Agarwal, Nidheesh; D'Souza, Paschal; Das, Sudip; Kumar, Rajesh; Pande, Sushil; Das, Nilay Kanti; Kumaresan, Muthuvel; Kumar, Piyush; Garg, Anubhav; Singh, Saurabh

    2016-01-01

    Stevens-Johnson syndrome and toxic epidermal necrolysis are severe, life-threatening mucocutaneous adverse drug reactions with a high morbidity and mortality that require immediate medical care. The various immunomodulatory treatments include systemic corticosteroids, cyclosporine, intravenous immunoglobulin, cyclophosphamide, plasmapheresis and tumor necrosis factor-α inhibitors. The ideal therapy of Stevens-Johnson syndrome/toxic epidermal necrolysis still remains a matter of debate as there are only a limited number of studies of good quality comparing the usefulness of different specific treatments. The aim of this article is to comprehensively review the published medical literature and frame management guidelines suitable in the Indian perspective. The Indian Association of Dermatologists, Venereologists and Leprologists (IADVL) assigned the task of preparing these guidelines to its special interest group on cutaneous adverse drug reactions. The group performed a comprehensive English language literature search for management options in Stevens-Johnson syndrome/toxic epidermal necrolysis across multiple databases (PubMed, EMBASE, MEDLINE and Cochrane) for keywords (alone and in combination) and MeSH items such as "guidelines," "Stevens-Johnson syndrome," "toxic epidermal necrolysis," "corticosteroids," "intravenous immunoglobulin," "cyclosporine" and "management." The available evidence was evaluated using the strength of recommendation taxonomy and graded using a three-point scale. A draft of clinical recommendations was developed on the best available evidence which was also scrutinized and critically evaluated by the IADVL Academy of Dermatology. Based on the inputs received, this final consensus statement was prepared. A total of 104 articles (meta-analyses, prospective and retrospective studies, reviews [including chapters in books], previous guidelines [including Indian guidelines of 2006] and case series) were critically evaluated and the evidence

  16. The art of editing RNA structural alignments

    DEFF Research Database (Denmark)

    Andersen, Ebbe Sloth

    2014-01-01

    Manual editing of RNA structural alignments may be considered more art than science, since it still requires an expert biologist to take multiple levels of information into account and be slightly creative when constructing high-quality alignments. Even though the task is rather tedious, it is re......Manual editing of RNA structural alignments may be considered more art than science, since it still requires an expert biologist to take multiple levels of information into account and be slightly creative when constructing high-quality alignments. Even though the task is rather tedious...

  17. Extraction of low molecular weight RNA from Citrus trifolita tissues ...

    African Journals Online (AJOL)

    Jane

    2010-12-20

    Dec 20, 2010 ... A critical prerequisite in miRNA studies is acquisition of high quality LMW RNA. LMW RNA is ..... air-dried for a few minutes and then exposed to BIOMAX X-ray film for 48 h using an .... Approaches to microRNA discovery. Nat.

  18. eRNA: a graphic user interface-based tool optimized for large data analysis from high-throughput RNA sequencing.

    Science.gov (United States)

    Yuan, Tiezheng; Huang, Xiaoyi; Dittmar, Rachel L; Du, Meijun; Kohli, Manish; Boardman, Lisa; Thibodeau, Stephen N; Wang, Liang

    2014-03-05

    RNA sequencing (RNA-seq) is emerging as a critical approach in biological research. However, its high-throughput advantage is significantly limited by the capacity of bioinformatics tools. The research community urgently needs user-friendly tools to efficiently analyze the complicated data generated by high throughput sequencers. We developed a standalone tool with graphic user interface (GUI)-based analytic modules, known as eRNA. The capacity of performing parallel processing and sample management facilitates large data analyses by maximizing hardware usage and freeing users from tediously handling sequencing data. The module miRNA identification" includes GUIs for raw data reading, adapter removal, sequence alignment, and read counting. The module "mRNA identification" includes GUIs for reference sequences, genome mapping, transcript assembling, and differential expression. The module "Target screening" provides expression profiling analyses and graphic visualization. The module "Self-testing" offers the directory setups, sample management, and a check for third-party package dependency. Integration of other GUIs including Bowtie, miRDeep2, and miRspring extend the program's functionality. eRNA focuses on the common tools required for the mapping and quantification analysis of miRNA-seq and mRNA-seq data. The software package provides an additional choice for scientists who require a user-friendly computing environment and high-throughput capacity for large data analysis. eRNA is available for free download at https://sourceforge.net/projects/erna/?source=directory.

  19. A high-quality genome assembly of quinoa provides insights into the molecular basis of salt bladder-based salinity tolerance and the exceptional nutritional value

    Science.gov (United States)

    Zou, Changsong; Chen, Aojun; Xiao, Lihong; Muller, Heike M; Ache, Peter; Haberer, Georg; Zhang, Meiling; Jia, Wei; Deng, Ping; Huang, Ru; Lang, Daniel; Li, Feng; Zhan, Dongliang; Wu, Xiangyun; Zhang, Hui; Bohm, Jennifer; Liu, Renyi; Shabala, Sergey; Hedrich, Rainer; Zhu, Jian-Kang; Zhang, Heng

    2017-01-01

    Chenopodium quinoa is a halophytic pseudocereal crop that is being cultivated in an ever-growing number of countries. Because quinoa is highly resistant to multiple abiotic stresses and its seed has a better nutritional value than any other major cereals, it is regarded as a future crop to ensure global food security. We generated a high-quality genome draft using an inbred line of the quinoa cultivar Real. The quinoa genome experienced one recent genome duplication about 4.3 million years ago, likely reflecting the genome fusion of two Chenopodium parents, in addition to the γ paleohexaploidization reported for most eudicots. The genome is highly repetitive (64.5% repeat content) and contains 54 438 protein-coding genes and 192 microRNA genes, with more than 99.3% having orthologous genes from glycophylic species. Stress tolerance in quinoa is associated with the expansion of genes involved in ion and nutrient transport, ABA homeostasis and signaling, and enhanced basal-level ABA responses. Epidermal salt bladder cells exhibit similar characteristics as trichomes, with a significantly higher expression of genes related to energy import and ABA biosynthesis compared with the leaf lamina. The quinoa genome sequence provides insights into its exceptional nutritional value and the evolution of halophytes, enabling the identification of genes involved in salinity tolerance, and providing the basis for molecular breeding in quinoa. PMID:28994416

  20. Human blood RNA stabilization in samples collected and transported for a large biobank

    Science.gov (United States)

    2012-01-01

    Background The Norwegian Mother and Child Cohort Study (MoBa) is a nation-wide population-based pregnancy cohort initiated in 1999, comprising more than 108.000 pregnancies recruited between 1999 and 2008. In this study we evaluated the feasibility of integrating RNA analyses into existing MoBa protocols. We compared two different blood RNA collection tube systems – the PAXgene™ Blood RNA system and the Tempus™ Blood RNA system - and assessed the effects of suboptimal blood volumes in collection tubes and of transportation of blood samples by standard mail. Endpoints to characterize the samples were RNA quality and yield, and the RNA transcript stability of selected genes. Findings High-quality RNA could be extracted from blood samples stabilized with both PAXgene and Tempus tubes. The RNA yields obtained from the blood samples collected in Tempus tubes were consistently higher than from PAXgene tubes. Higher RNA yields were obtained from cord blood (3 – 4 times) compared to adult blood with both types of tubes. Transportation of samples by standard mail had moderate effects on RNA quality and RNA transcript stability; the overall RNA quality of the transported samples was high. Some unexplained changes in gene expression were noted, which seemed to correlate with suboptimal blood volumes collected in the tubes. Temperature variations during transportation may also be of some importance. Conclusions Our results strongly suggest that special collection tubes are necessary for RNA stabilization and they should be used for establishing new biobanks. We also show that the 50,000 samples collected in the MoBa biobank provide RNA of high quality and in sufficient amounts to allow gene expression analyses for studying the association of disease with altered patterns of gene expression. PMID:22988904

  1. Commonly Employed African Neonatal Skin Care Products Compromise Epidermal Function in Mice.

    Science.gov (United States)

    Man, Mao-Qiang; Sun, Richard; Man, George; Lee, Dale; Hill, Zelee; Elias, Peter M

    2016-09-01

    Neonatal mortality is much higher in the developing world than in developed countries. Infections are a major cause of neonatal death, particularly in preterm infants, in whom defective epidermal permeability barrier function facilitates transcutaneous pathogen invasion. The objective was to determine whether neonatal skin care products commonly used in Africa benefit or compromise epidermal functions in murine skin. After twice-daily treatment of 6- to 8-week-old hairless mice with each skin care product for 3 days, epidermal permeability barrier function, skin surface pH, stratum corneum hydration, and barrier recovery were measured using a multiprobe adapter system physiology monitor. For products showing some benefits in these initial tests, the epidermal permeability barrier homeostasis was assessed 1 and 5 hours after a single application to acutely disrupted skin. All of the skin care products compromised basal permeability barrier function and barrier repair kinetics. Moreover, after 3 days of treatment, most of the products also reduced stratum corneum hydration while elevating skin surface pH to abnormal levels. Some neonatal skin care products that are widely used in Africa perturb important epidermal functions, including permeability barrier homeostasis in mice. Should these products have similar effects on newborn human skin, they could cause a defective epidermal permeability barrier, which can increase body fluid loss, impair thermoregulation, and contribute to the high rates of neonatal morbidity and mortality seen in Africa. Accordingly, alternative products that enhance permeability barrier function should be identified, particularly for use in preterm infants. © 2016 Wiley Periodicals, Inc.

  2. Spatiotemporal Expression of p63 in Mouse Epidermal Commitment

    Directory of Open Access Journals (Sweden)

    Qian Zhao

    2015-12-01

    Full Text Available The embryonic surface ectoderm is a simple flat epithelium consisting of cells that express the cytokeratins K8/K18. Before stratification, K5/K14 expression substitutes K8/K18 expression, marking the event called epidermal commitment. Previous studies show that the transcription factor p63 plays an essential role in epidermal commitment. However, detailed expression information of p63 during early epidermal development in mice is still unclear. We systematically studied the expression pattern of p63 in mouse epidermal commitment, together with K8 and K5. We show that p63 expression could be detected as early as E8.5 in mouse embryos preceding epidermal commitment. p63 expression first appears near the newly formed somites and the posterior part of the embryo, further expanding to the whole embryonic surface with particular enrichment in the first branchial arches and the limb buds. ΔNp63 is the major class of isoforms expressed in this period. Relative expression intensity of p63 depends on the embryonic position. In summary, there is a sequential and regular expression pattern of K8, p63 and K5 in mouse epidermal commitment. Our study not only contributes to understanding the early events during epidermal development but also provides a basal tool to study the function of p63 in mammals.

  3. High-throughput determination of RNA structure by proximity ligation.

    Science.gov (United States)

    Ramani, Vijay; Qiu, Ruolan; Shendure, Jay

    2015-09-01

    We present an unbiased method to globally resolve RNA structures through pairwise contact measurements between interacting regions. RNA proximity ligation (RPL) uses proximity ligation of native RNA followed by deep sequencing to yield chimeric reads with ligation junctions in the vicinity of structurally proximate bases. We apply RPL in both baker's yeast (Saccharomyces cerevisiae) and human cells and generate contact probability maps for ribosomal and other abundant RNAs, including yeast snoRNAs, the RNA subunit of the signal recognition particle and the yeast U2 spliceosomal RNA homolog. RPL measurements correlate with established secondary structures for these RNA molecules, including stem-loop structures and long-range pseudoknots. We anticipate that RPL will complement the current repertoire of computational and experimental approaches in enabling the high-throughput determination of secondary and tertiary RNA structures.

  4. Tight junction regulates epidermal calcium ion gradient and differentiation

    International Nuclear Information System (INIS)

    Kurasawa, Masumi; Maeda, Tetsuo; Oba, Ai; Yamamoto, Takuya; Sasaki, Hiroyuki

    2011-01-01

    Research highlights: → We disrupted epidermal tight junction barrier in reconstructed epidermis. → It altered Ca 2+ distribution and consequentially differentiation state as well. → Tight junction should affect epidermal homeostasis by maintaining Ca 2+ gradient. -- Abstract: It is well known that calcium ions (Ca 2+ ) induce keratinocyte differentiation. Ca 2+ distributes to form a vertical gradient that peaks at the stratum granulosum. It is thought that the stratum corneum (SC) forms the Ca 2+ gradient since it is considered the only permeability barrier in the skin. However, the epidermal tight junction (TJ) in the granulosum has recently been suggested to restrict molecular movement to assist the SC as a secondary barrier. The objective of this study was to clarify the contribution of the TJ to Ca 2+ gradient and epidermal differentiation in reconstructed human epidermis. When the epidermal TJ barrier was disrupted by sodium caprate treatment, Ca 2+ flux increased and the gradient changed in ion-capture cytochemistry images. Alterations of ultrastructures and proliferation/differentiation markers revealed that both hyperproliferation and precocious differentiation occurred regionally in the epidermis. These results suggest that the TJ plays a crucial role in maintaining epidermal homeostasis by controlling the Ca 2+ gradient.

  5. RNA isolation for transcriptomics of human and mouse small skin biopsies

    Directory of Open Access Journals (Sweden)

    Breit Timo M

    2011-10-01

    Full Text Available Abstract Background Isolation of RNA from skin biopsies presents a challenge, due to the tough nature of skin tissue and a high presence of RNases. As we lacked the dedicated equipment, i.e. homogenizer or bead-beater, needed for the available RNA from skin isolation methods, we adapted and tested our zebrafish single-embryo RNA-isolation protocol for RNA isolation from skin punch biopsies. Findings We tested our new RNA-isolation protocol in two experiments: a large-scale study with 97 human skin samples, and a small study with 16 mouse skin samples. Human skin was sampled with 4.0 mm biopsy punches and for the mouse skin different punch diameter sizes were tested; 1.0, 1.5, 2.0, and 2.5 mm. The average RNA yield in human samples was 1.5 μg with an average RNA quality RIN value of 8.1. For the mouse biopsies, the average RNA yield was 2.4 μg with an average RIN value of 7.5. For 96% of the human biopsies and 100% of the mouse biopsies we obtained enough high-quality RNA. The RNA samples were successfully tested in a transcriptomics analysis using the Affymetrix and Roche NimbleGen platforms. Conclusions Using our new RNA-isolation protocol, we were able to consistently isolate high-quality RNA, which is apt for further transcriptomics analysis. Furthermore, this method is already useable on biopsy material obtained with a punch diameter as small as 1.5 mm.

  6. A technical assessment of the porcine ejaculated spermatozoa for a sperm-specific RNA-seq analysis.

    Science.gov (United States)

    Gòdia, Marta; Mayer, Fabiana Quoos; Nafissi, Julieta; Castelló, Anna; Rodríguez-Gil, Joan Enric; Sánchez, Armand; Clop, Alex

    2018-04-26

    The study of the boar sperm transcriptome by RNA-seq can provide relevant information on sperm quality and fertility and might contribute to animal breeding strategies. However, the analysis of the spermatozoa RNA is challenging as these cells harbor very low amounts of highly fragmented RNA, and the ejaculates also contain other cell types with larger amounts of non-fragmented RNA. Here, we describe a strategy for a successful boar sperm purification, RNA extraction and RNA-seq library preparation. Using these approaches our objectives were: (i) to evaluate the sperm recovery rate (SRR) after boar spermatozoa purification by density centrifugation using the non-porcine-specific commercial reagent BoviPure TM ; (ii) to assess the correlation between SRR and sperm quality characteristics; (iii) to evaluate the relationship between sperm cell RNA load and sperm quality traits and (iv) to compare different library preparation kits for both total RNA-seq (SMARTer Universal Low Input RNA and TruSeq RNA Library Prep kit) and small RNA-seq (NEBNext Small RNA and TailorMix miRNA Sample Prep v2) for high-throughput sequencing. Our results show that pig SRR (~22%) is lower than in other mammalian species and that it is not significantly dependent of the sperm quality parameters analyzed in our study. Moreover, no relationship between the RNA yield per sperm cell and sperm phenotypes was found. We compared a RNA-seq library preparation kit optimized for low amounts of fragmented RNA with a standard kit designed for high amount and quality of input RNA and found that for sperm, a protocol designed to work on low-quality RNA is essential. We also compared two small RNA-seq kits and did not find substantial differences in their performance. We propose the methodological workflow described for the RNA-seq screening of the boar spermatozoa transcriptome. FPKM: fragments per kilobase of transcript per million mapped reads; KRT1: keratin 1; miRNA: micro-RNA; miscRNA: miscellaneous

  7. Human corpus luteum: presence of epidermal growth factor receptors and binding characteristics

    International Nuclear Information System (INIS)

    Ayyagari, R.R.; Khan-Dawood, F.S.

    1987-01-01

    Epidermal growth factor receptors are present in many reproductive tissues but have not been demonstrated in the human corpus luteum. To determine the presence of epidermal growth factor receptors and its binding characteristics, we carried out studies on the plasma cell membrane fraction of seven human corpora lutea (days 16 to 25) of the menstrual cycle. Specific epidermal growth factor receptors were present in human corpus luteum. Insulin, nerve growth factor, and human chorionic gonadotropin did not competitively displace epidermal growth factor binding. The optimal conditions for corpus luteum-epidermal growth factor receptor binding were found to be incubation for 2 hours at 4 degrees C with 500 micrograms plasma membrane protein and 140 femtomol 125 I-epidermal growth factor per incubate. The number (mean +/- SEM) of epidermal growth factor binding sites was 12.34 +/- 2.99 X 10(-19) mol/micrograms protein; the dissociation constant was 2.26 +/- 0.56 X 10(-9) mol/L; the association constant was 0.59 +/- 0.12 X 10(9) L/mol. In two regressing corpora lutea obtained on days 2 and 3 of the menstrual cycle, there was no detectable specific epidermal growth factor receptor binding activity. Similarly no epidermal growth factor receptor binding activity could be detected in ovarian stromal tissue. Our findings demonstrate that specific receptors for epidermal growth factor are present in the human corpus luteum. The physiologic significance of epidermal growth factor receptors in human corpus luteum is unknown, but epidermal growth factor may be involved in intragonadal regulation of luteal function

  8. Response of human epidermal keratinocytes to UV light

    International Nuclear Information System (INIS)

    Kartasova, A.A.

    1987-01-01

    This thesis presents a study on the response of human epidermal keratinocytes to UV light as well as to other agents like 4-NQO and TPA. The effects of ultraviolet (UV) light on the protein synthesis in cultured keratinocytes are presented in ch. III. The next chapter describes the construction of a cDNA library using mRNA isolated from UV irradiated kernatinocytes. This library was differentially screened with cDNA probes synthesized on mRNA from either UV irradiated or nonirradiated cells. Several groups of cDNA clones corresponding to transcripts whose level in the cytoplasm seem to be affected by exposure to UV light have been isolated and characterized by cross-hybridization, sequencing and Northern blot analysis. More detailed analysis of some of the cDNA clones is presented in the two chapters following ch. IV. The complete cDNA sequence of the proteinase inhibitor cystatin A and the modulation of its expression by UV light and the carcinogen 4-nitroquinoline 1-oxide (4-NQO) in keratinocytes are described in ch. V. Two other groups of cDNA clones have been isolated which do not cross-hybridize with each other on Southern blots. However, the primary structures of the proteins deduced from the nucleotide sequences of these two groups of cDNA clones are very similar. 212 refs.; 33 figs.; 2 tabs

  9. A high-throughput method to detect RNA profiling by integration of RT-MLPA with next generation sequencing technology.

    Science.gov (United States)

    Wang, Jing; Yang, Xue; Chen, Haofeng; Wang, Xuewei; Wang, Xiangyu; Fang, Yi; Jia, Zhenyu; Gao, Jidong

    2017-07-11

    RNA in formalin-fixed and paraffin-embedded (FFPE) tissues provides large amount of information indicating disease stages, histological tumor types and grades, as well as clinical outcomes. However, Detection of RNA expression levels in formalin-fixed and paraffin-embedded samples is extremely difficult due to poor RNA quality. Here we developed a high-throughput method, Reverse Transcription-Multiple Ligation-dependent Probe Sequencing (RT-MLPSeq), to determine expression levels of multiple transcripts in FFPE samples. By combining Reverse Transcription-Multiple Ligation-dependent Amplification method and next generation sequencing technology, RT-MLPSeq overcomes the limit of probe length in multiplex ligation-dependent probe amplification assay and thus could detect expression levels of transcripts without quantitative limitations. We proved that different RT-MLPSeq probes targeting on the same transcripts have highly consistent results and the starting RNA/cDNA input could be as little as 1 ng. RT-MLPSeq also presented consistent relative RNA levels of selected 13 genes with reverse transcription quantitative PCR. Finally, we demonstrated the application of the new RT-MLPSeq method by measuring the mRNA expression levels of 21 genes which can be used for accurate calculation of the breast cancer recurrence score - an index that has been widely used for managing breast cancer patients.

  10. Determination of gene expression patterns using high-throughput RNA in situ hybridizaion to whole-mount Drosophila embryos

    Energy Technology Data Exchange (ETDEWEB)

    Weiszmann, R.; Hammonds, A.S.; Celniker, S.E.

    2009-04-09

    We describe a high-throughput protocol for RNA in situ hybridization (ISH) to Drosophila embryos in a 96-well format. cDNA or genomic DNA templates are amplified by PCR and then digoxigenin-labeled ribonucleotides are incorporated into antisense RNA probes by in vitro transcription. The quality of each probe is evaluated before ISH using a RNA probe quantification (dot blot) assay. RNA probes are hybridized to fixed, mixed-staged Drosophila embryos in 96-well plates. The resulting stained embryos can be examined and photographed immediately or stored at 4oC for later analysis. Starting with fixed, staged embryos, the protocol takes 6 d from probe template production through hybridization. Preparation of fixed embryos requires a minimum of 2 weeks to collect embryos representing all stages. The method has been used to determine the expression patterns of over 6,000 genes throughout embryogenesis.

  11. Influence of epidermal growth factor on liver regeneration after partial hepatectomy in rats

    DEFF Research Database (Denmark)

    Olsen, Peter Skov; Boesby, S.; Kirkegaard, P.

    2013-01-01

    The role of epidermal growth factor on liver regeneration after partial hepatectomy in rats was investigated. After a 70% hepatectomy in rats, the concentration of epidermal growth factor in portal venous blood was unchanged compared with unoperated controls. However, small amounts of epidermal...... growth factor could be identified in portal venous blood after intestinal instillation of epidermal growth factor. Brunner's glands and the submandibular glands secrete epidermal growth factor. Extirpation of Brunner's glands decreased liver regeneration, whereas removal of the submandibular glands had...... no effect on liver regeneration. Epidermal growth factor antiserum reduced liver regeneration significantly. Oral or s.c. administration of epidermal growth factor had no effect on liver regeneration, whereas epidermal growth factor enhanced the effect of insulin and glucagon on liver regeneration...

  12. Epidermal growth factor in alkali-burned corneal epithelial wound healing.

    Science.gov (United States)

    Singh, G; Foster, C S

    1987-06-15

    We conducted a double-masked study to evaluate the effect of epidermal growth factor on epithelial wound healing and recurrent erosions in alkali-burned rabbit corneas. Epithelial wounds 10 mm in diameter healed completely under the influence of topical epidermal growth factor, whereas the control corneas did not resurface in the center. On reversal of treatment, the previously nonhealing epithelial defects healed when treated with topical epidermal growth factor eyedrops. Conversely, the epidermal growth factor-treated and resurfaced corneas developed epithelial defects when treatment was discontinued. Histopathologic examination disclosed hyperplastic epithelium growing over the damaged stroma laden with polymorphonuclear leukocytes when treated with epidermal growth factor eyedrops, but it did not adhere to the underlying tissue. Hydropic changes were seen intracellularly as well as between the epithelial cells and the stroma.

  13. Optimization of RNA Extraction from Rat Pancreatic Tissue

    Directory of Open Access Journals (Sweden)

    Sanaz Dastgheib

    2014-05-01

    Full Text Available Background: Optimized RNA extraction from tissues and cell lines consists of four main stages regardless of the method of extraction: 1 homogenizing, 2 effective denaturation of proteins from RNA, 3 inactivation of ribonuclease, and 4 removal of any DNA, protein, and carbohydrate contamination. Isolation of undamaged intact RNA is challenging when the related tissue contains high levels of RNase. Various technical difficulties occur during extraction of RNA from pancreatic tissue due to spontaneous autolysis. Since standard routine protocols yield unacceptable results in pancrease, we have designed a simple method for RNA extraction by comparing different protocols. Methods: We obtained 20-30 mg pancreatic tissues in less than 2 min from 30 rats. Several methods were performed to extract RNA from pancreatic tissue and evaluate its integrity. All methods were performed three times to obtain reproducible results. Results: Immersing pancreatic tissue in RNA-later for 24 h at -80ºC yielded high quality RNA by using the TriPure reagent which was comparable to the commercial RNeasy Micro Kit. The quality of RNA was evaluated by spectrophotometer, electrophoresis and RT-PCR. We separated intact 28S and 18S ribosomal RNA (rRNA when our procedure was compared with the RNeasy Micro Kit. Finally, full length of the actin gene was amplified by RT-PCR. Conclusion: We designed a simple, fast, cost-effective method for complete RNA extraction from the least amount of quantitatively intact pancreatic tissue

  14. Epidermal and dermal integumentary structures of ankylosaurian dinosaurs.

    Science.gov (United States)

    Arbour, Victoria M; Burns, Michael E; Bell, Phil R; Currie, Philip J

    2014-01-01

    Ankylosaurian dinosaurs are most notable for their abundant and morphologically diverse osteoderms, which would have given them a spiky appearance in life. Isolated osteoderms are relatively common and provide important information about the structure of the ankylosaur dermis, but fossilized impressions of the soft-tissue epidermis of ankylosaurs are rare. Nevertheless, well-preserved integument exists on several ankylosaur fossils that shows osteoderms were covered by a single epidermal scale, but one or many millimeter-sized ossicles may be present under polygonal, basement epidermal scales. Evidence for the taxonomic utility of ankylosaurid epidermal scale architecture is presented for the first time. This study builds on previous osteological work that argues for a greater diversity of ankylosaurids in the Dinosaur Park Formation of Alberta than has been traditionally recognized and adds to the hypothesis that epidermal skin impressions are taxonomically relevant across diverse dinosaur clades. Copyright © 2013 Wiley Periodicals, Inc.

  15. 18S Ribosomal RNA Evaluation as Preanalytical Quality Control for Animal DNA

    Directory of Open Access Journals (Sweden)

    Cory Ann Leonard

    2016-01-01

    Full Text Available The 18S ribosomal RNA (rRNA gene is present in all eukaryotic cells. In this study, we evaluated the use of this gene to verify the presence of PCR-amplifiable host (animal DNA as an indicator of sufficient sample quality for quantitative real-time PCR (qPCR analysis. We compared (i samples from various animal species, tissues, and sample types, including swabs; (ii multiple DNA extraction methods; and (iii both fresh and formalin-fixed paraffin-embedded (FFPE samples. Results showed that 18S ribosomal RNA gene amplification was possible from all tissue samples evaluated, including avian, reptile, and FFPE samples and most swab samples. A single swine rectal swab, which showed sufficient DNA quantity and the demonstrated lack of PCR inhibitors, nonetheless was negative by 18S qPCR. Such a sample specifically illustrates the improvement of determination of sample integrity afforded by inclusion of 18S rRNA gene qPCR analysis in addition to spectrophotometric analysis and the use of internal controls for PCR inhibition. Other possible applications for the described 18S rRNA qPCR are preselection of optimal tissue specimens for studies or preliminary screening of archived samples prior to acceptance for biobanking projects.

  16. Maintaining Breast Cancer Specimen Integrity and Individual or Simultaneous Extraction of Quality DNA, RNA, and Proteins from Allprotect-Stabilized and Nonstabilized Tissue Samples

    LENUS (Irish Health Repository)

    Mee, Blanaid C.

    2011-12-29

    The Saint James\\'s Hospital Biobank was established in 2008, to develop a high-quality breast tissue BioResource, as a part of the breast cancer clinical care pathway. The aims of this work were: (1) to ascertain the quality of RNA, DNA, and protein in biobanked carcinomas and normal breast tissues, (2) to assess the efficacy of AllPrep® (Qiagen) in isolating RNA, DNA, and protein simultaneously, (3) to compare AllPrep with RNEasy® and QIAamp® (both Qiagen), and (4) to examine the effectiveness of Allprotect® (Qiagen), a new tissue stabilization medium in preserving DNA, RNA, and proteins. One hundred eleven frozen samples of carcinoma and normal breast tissue were analyzed. Tumor and normal tissue morphology were confirmed by frozen sections. Tissue type, tissue treatment (Allprotect vs. no Allprotect), extraction kit, and nucleic acid quantification were analyzed by utilizing a 4 factorial design (SPSS PASW 18 Statistics Software®). QIAamp (DNA isolation), AllPrep (DNA, RNA, and Protein isolation), and RNeasy (RNA isolation) kits were assessed and compared. Mean DNA yield and A260\\/280 values using QIAamp were 33.2 ng\\/μL and 1.86, respectively, and using AllPrep were 23.2 ng\\/μL and 1.94. Mean RNA yield and RNA Integrity Number (RIN) values with RNeasy were 73.4 ng\\/μL and 8.16, respectively, and with AllPrep were 74.8 ng\\/μL and 7.92. Allprotect-treated tissues produced higher RIN values of borderline significance (P=0.055). No discernible loss of RNA stability was detected after 6 h incubation of stabilized or nonstabilized tissues at room temperature or 4°C or in 9 freeze-thaw cycles. Allprotect requires further detailed evaluation, but we consider AllPrep to be an excellent option for the simultaneous extraction of RNA, DNA, and protein from tumor and normal breast tissues. The essential presampling procedures that maintain the diagnostic integrity of pathology specimens do not appear to compromise the quality of molecular isolates.

  17. Mitochondrial tRNA gene translocations in highly eusocial bees

    Directory of Open Access Journals (Sweden)

    Daniela Silvestre

    2006-01-01

    Full Text Available Mitochondrial gene rearrangement events, especially involving tRNA genes, have been described more frequently as more complete mitochondrial genome sequences are becoming available. In the present work, we analyzed mitochondrial tRNA gene rearrangements between two bee species belonging to the tribes Apini and Meliponini within the "corbiculate Apidae". Eleven tRNA genes are in different genome positions or strands. The molecular events responsible for each translocation are explained. Considering the high number of rearrangements observed, the data presented here contradict the general rule of high gene order conservation among closely related organisms, and also represent a powerful molecular tool to help solve questions about phylogeny and evolution in bees.

  18. Epidermal growth factor in the rat prostate

    DEFF Research Database (Denmark)

    Tørring, Niels; Jørgensen, P E; Poulsen, Steen Seier

    1998-01-01

    Epidermal growth factor (EGF) induces proliferation in prostate epithelial and stromal cells in primary culture. This investigation was set up to characterize the time and spatial expression of EGF in the rat prostate.......Epidermal growth factor (EGF) induces proliferation in prostate epithelial and stromal cells in primary culture. This investigation was set up to characterize the time and spatial expression of EGF in the rat prostate....

  19. Expression of the epidermal growth factor receptor in human small cell lung cancer cell lines

    DEFF Research Database (Denmark)

    Damstrup, L; Rygaard, K; Spang-Thomsen, M

    1992-01-01

    of EGF receptor mRNA in all 10 cell lines that were found to be EGF receptor-positive and in one cell line that was found to be EGF receptor-negative in the radioreceptor assay and affinity labeling. Our results provide, for the first time, evidence that a large proportion of a broad panel of small cell......Epidermal growth factor (EGF) receptor expression was evaluated in a panel of 21 small cell lung cancer cell lines with radioreceptor assay, affinity labeling, and Northern blotting. We found high-affinity receptors to be expressed in 10 cell lines. Scatchard analysis of the binding data...... demonstrated that the cells bound between 3 and 52 fmol/mg protein with a KD ranging from 0.5 x 10(-10) to 2.7 x 10(-10) M. EGF binding to the receptor was confirmed by affinity-labeling EGF to the EGF receptor. The cross-linked complex had a M(r) of 170,000-180,000. Northern blotting showed the expression...

  20. Computational Methods for Quality Check, Preprocessing and Normalization of RNA-Seq Data for Systems Biology and Analysis

    DEFF Research Database (Denmark)

    Mazzoni, Gianluca; Kadarmideen, Haja N.

    2016-01-01

    quality control, trimming and filtering procedures, alignment, postmapping quality control, counting, normalization and differential expression test. For each step, we present the most common tools and we give a complete description of their main characteristics and advantages focusing on the statistics......The use of RNA sequencing (RNA-Seq) technologies is increasing mainly due to the development of new next-generation sequencing machines that have reduced the costs and the time needed for data generation. Nevertheless, microarrays are still the more common choice and one of the reasons...

  1. C/EBPα Short-Activating RNA Suppresses Metastasis of Hepatocellular Carcinoma through Inhibiting EGFR/β-Catenin Signaling Mediated EMT.

    Directory of Open Access Journals (Sweden)

    Hongbo Huan

    Full Text Available Hepatocellular carcinoma is associated with high mortality, and tumor metastasis is an important reason for poor prognosis. However, metastasis has not been effectively prevented in clinical therapy and the mechanisms underlying metastasis have not been fully characterized. CCAAT/enhancer-binding protein-α (C/EBPα is a transcriptional regulator with an essential role in tumor metastasis. We used short-activating RNAs (saRNA to enhance expression of C/EBPα. Intravenous injection of C/EBPα-saRNA in a nude mouse liver orthotopic xenograft tumor model inhibited intrahepatic and distant metastasis. C/EBPα-saRNA-treated mice showed increased serum levels of albumin and decreased alanine aminotransferase (ALT, glutamic-oxalacetic transaminase (AST, indicating a role of C/EBPα in improving liver function. Migration and invasion were inhibited in hepatoma cell lines transfected with C/EBPα-saRNA. We also observed an inhibition of epithelial-mesenchymal transition (EMT and suppression of epidermal growth factor receptor (EGFR, EGFR phosphorylation, and β-catenin in C/EBPa-saRNA-transfected cells. Our results suggested that C/EBPα-saRNA successfully inhibited HCC metastasis by inhibiting EGFR/β-catenin signaling pathway mediated EMT in vitro and in vivo.

  2. Genetic analysis of Ras genes in epidermal development and tumorigenesis

    Science.gov (United States)

    Drosten, Matthias; Lechuga, Carmen G; Barbacid, Mariano

    2013-01-01

    Proliferation and differentiation of epidermal keratinocytes are tightly controlled to ensure proper development and homeostasis of the epidermis. The Ras family of small GTPases has emerged as a central node in the coordination of cell proliferation in the epidermis. Recent genetic evidence from mouse models has revealed that the intensity of Ras signaling modulates the proliferative capacity of epidermal keratinocytes. Interfering with Ras signaling either by combined elimination of the 3 Ras genes from the basal layer of the epidermis or by overexpression of dominant-negative Ras isoforms caused epidermal thinning due to hypoproliferation of keratinocytes. In contrast, overexpression of oncogenic Ras mutants in different epidermal cell layers led to hyperproliferative phenotypes including the development of papillomas and squamous cell carcinomas. Here, we discuss the value of loss- and gain-of-function studies in mouse models to assess the role of Ras signaling in the control of epidermal proliferation. PMID:24150175

  3. Reptured Epidermal Inclusion Cyst in the Axilla: A Case Report

    International Nuclear Information System (INIS)

    Kim, Kyu Soon; Kim, Hak Hee; Shin, Hee Jeong; Yang, Hye Rin; Sohn, Jeong Hee; Kwon, Gui Young; Gong, Gyung Yub

    2006-01-01

    Epidermal inclusion cysts, the most common type of simple epithelial cyst, are typically well-encapsulated, subepidermal and mobile nodules. They may occur anywhere, but are mostly found on the scalp, face, neck, trunk, and back. Less than 10% of epidermal inclusion cysts occur on the extremities, and even fewer are found on the palms, soles, and breasts. If epidermal inclusion cysts rupture, foreign body reaction, granulomatous reaction or abscess formation could follow. We described here the sonographic findings of ruptured epidermal inclusion cyst of the right axilla in a 33-year-old woman who presented with a palpable axillary mass forming an inflammatory abscess

  4. H{sup +}/peptide transporter (PEPT2) is expressed in human epidermal keratinocytes and is involved in skin oligopeptide transport

    Energy Technology Data Exchange (ETDEWEB)

    Kudo, Michiko; Katayoshi, Takeshi; Kobayashi-Nakamura, Kumiko [DHC Corporation Laboratories, Division 2, 2-42 Hamada, Mihama-ku, Chiba 261-0025 (Japan); Akagawa, Mitsugu [Department of Biological Chemistry, Division of Applied Life Science, Graduate School of Life and Environmental Sciences, Osaka Prefecture University, 1-1 Gakuen-cho, Naka-ku, Sakai 599-8531 (Japan); Tsuji-Naito, Kentaro, E-mail: knaito@dhc.co.jp [DHC Corporation Laboratories, Division 2, 2-42 Hamada, Mihama-ku, Chiba 261-0025 (Japan)

    2016-07-08

    Peptide transporter 2 (PEPT2) is a member of the proton-coupled oligopeptide transporter family, which mediates the cellular uptake of oligopeptides and peptide-like drugs. Although PEPT2 is expressed in many tissues, its expression in epidermal keratinocytes remains unclear. We investigated PEPT2 expression profile and functional activity in keratinocytes. We confirmed PEPT2 mRNA expression in three keratinocyte lines (normal human epidermal keratinocytes (NHEKs), immortalized keratinocytes, and malignant keratinocytes) by reverse transcription-polymerase chain reaction (RT-PCR) and quantitative real-time RT-PCR. In contrast to PEPT1, PEPT2 expression in the three keratinocytes was similar or higher than that in HepG2 cells, used as PEPT2-positive cells. Immunolocalization analysis using human skin showed epidermal PEPT2 localization. We studied keratinocyte transport function by measuring the oligopeptide content using liquid chromatography/tandem mass spectrometry. Glycylsarcosine uptake in NHEKs was pH-dependent, suggesting that keratinocytes could absorb small peptides in the presence of an inward H{sup +} gradient. We also performed a skin-permeability test of several oligopeptides using skin substitute, suggesting that di- and tripeptides pass actively through the epidermis. In conclusion, PEPT2 is expressed in keratinocytes and involved in skin oligopeptide uptake. -- Highlights: •PEPT2 is expressed in keratinocytes, which are more common than other skin cells. •Immunolocalization analysis using human skin revealed epidermal PEPT2 localization. •Keratinocytes could absorb small peptides in the presence of an inward H{sup +} gradient. •Di- and tripeptide pass actively through the epidermis.

  5. 99m Tc-anti-epidermal growth factor receptor nanobody for tumor imaging.

    Science.gov (United States)

    Piramoon, Majid; Hosseinimehr, Seyed Jalal; Omidfar, Kobra; Noaparast, Zohreh; Abedi, Seyed Mohammad

    2017-04-01

    Nanobodies are important biomolecules for tumor targeting. In this study, we synthesized and labeled anti-epidermal growth factor receptor (EGFR) nanobody OA-cb6 with 99m Tc(CO) 3 + and evaluated its characteristics for targeting the EGFR in the A431 human epidermal carcinoma cell line. Nanobody radiolabeling was achieved with high yield and radiochemical purity, and the radioconjugate was stable. Biodistribution results in nude mice exhibited a favorable tumor-to-muscle ratio at 4-hr postinjection, and tumor location was visualized at 4 hr after injection of radiolabeled nanobody. Our result showed that the OA-cb6- 99m Tc-tricarbonyl radiolabeled nanobody is a promising radiolabeled biomolecule for tumor imaging in cancers with high EGFR overexpression. © 2016 John Wiley & Sons A/S.

  6. High throughput 16S rRNA gene amplicon sequencing

    DEFF Research Database (Denmark)

    Nierychlo, Marta; Larsen, Poul; Jørgensen, Mads Koustrup

    S rRNA gene amplicon sequencing has been developed over the past few years and is now ready to use for more comprehensive studies related to plant operation and optimization thanks to short analysis time, low cost, high throughput, and high taxonomic resolution. In this study we show how 16S r......RNA gene amplicon sequencing can be used to reveal factors of importance for the operation of full-scale nutrient removal plants related to settling problems and floc properties. Using optimized DNA extraction protocols, indexed primers and our in-house Illumina platform, we prepared multiple samples...... be correlated to the presence of the species that are regarded as “strong” and “weak” floc formers. In conclusion, 16S rRNA gene amplicon sequencing provides a high throughput approach for a rapid and cheap community profiling of activated sludge that in combination with multivariate statistics can be used...

  7. Immune sensitization against epidermal antigens in polymorphous light eruption

    International Nuclear Information System (INIS)

    Gonzalez-Amaro, R.; Baranda, L.; Salazar-Gonzalez, J.F.; Abud-Mendoza, C.; Moncada, B.

    1991-01-01

    To get further insight into the pathogenesis of polymorphous light eruption, we studied nine patients with polymorphous light eruption and six healthy persons. Two skin biopsy specimens were obtained from each person, one from previously ultraviolet light-irradiated skin and another one from unirradiated skin. An epidermal cell suspension, skin homogenate, or both were prepared from each specimen. Autologous cultures were made with peripheral blood mononuclear cells combined with irradiated or unirradiated skin homogenate and peripheral blood mononuclear cells combined with irradiated or unirradiated epidermal cell suspension. Cell proliferation was assessed by 3H-thymidine incorporation assay. The response of peripheral blood mononuclear cells to unirradiated epidermal cells or unirradiated skin homogenate was similar in both patients and controls. However, peripheral blood mononuclear cells from patients with polymorphous light eruption showed a significantly increased proliferative response to both irradiated epidermal cells and irradiated skin homogenate. Our results indicate that ultraviolet light increases the stimulatory capability of polymorphous light eruption epidermal cells in a unidirectional mixed culture with autologous peripheral blood mononuclear cells. This suggests that an immune sensitization against autologous ultraviolet light-modified skin antigens occurs in polymorphous light eruption

  8. Steven johnsons syndrome and toxic epidermal necrolysis: A review

    Directory of Open Access Journals (Sweden)

    Sri ram Anne

    2014-12-01

    Full Text Available Toxic epidermal necrolysis (TEN and Stevens Johnson Syndrome (SJS are severe adverse cutaneous drug reactions that predominantly involve the skin and mucous membranes. They are characterized by mucocutaneous tenderness and typically hemorrhagic erosions, erythema and more or less severe epidermal detachment presenting as blisters and areas of denuded skin. Drugs are assumed or identified as the main cause of SJS/TEN in most cases, but Mycoplasma pneumoniae and Herpes simplex virus infections are well documented causes alongside rare cases in which the etiology remains unknown. Several drugs are at "high" risk of inducing TEN/SJS including: Allopurinol, Trimethoprim-sulfamethoxazole and other sulfonamide-antibiotics, aminopenicillins, cephalosporins, quinolones, carbamazepine, phenytoin, phenobarbital and NSAID's of the oxicam-type. Differential diagnosis includes linear IgA dermatosis and paraneoplastic pemphigus, pemphigus vulgaris and bullous pemphigoid, acute generalized exanthematous pustulosis (AGEP, disseminated fixed bullous drug eruption and staphyloccocal scalded skin syndrome (SSSS. Due to the high risk of mortality, management of patients with SJS/TEN requires rapid diagnosis, identification and interruption of the culprit drug, specialized supportive care ideally in an intensive care unit, and consideration of immunomodulating agents such as high-dose intravenous immunoglobulin therapy.

  9. Gene expression differences between PAXgene and Tempus blood RNA tubes are highly reproducible between independent samples and biobanks.

    Science.gov (United States)

    Skogholt, Anne Heidi; Ryeng, Einar; Erlandsen, Sten Even; Skorpen, Frank; Schønberg, Svanhild A; Sætrom, Pål

    2017-03-23

    Gene expression profiling from blood is sensitive to technology choices. For example, the main blood RNA collection systems-the PAXgene and Tempus tubes-differently influence RNA expression signatures. The aim of this study was to establish a common RNA isolation protocol for these two systems and investigate if it could reduce the differences in gene expression between them. We collected identical blood samples on the PAXgene and Tempus systems and retrieved blood samples from two independent biobanks-NOWAC and HUNT3-which are based on PAXgene and Tempus, respectively. High-quality RNA was extracted from both sampling systems by using their original protocols and our common modified protocol, and were profiled on Illumina microarrays. Regardless of the protocol used, we found most of the measured transcripts to be differently affected by the two sampling systems. However, our modified protocol reduced the number of transcripts that were significantly differentially expressed between PAXgene and Tempus by approximately 50%. Expression differences between PAXgene and Tempus were highly reproducible both between protocols and between different independent sample sets (Pearson correlation 0.563-0.854 across 47323 probes). Moreover, the modified protocol increased the microRNA output of the system with lowest microRNA yield, the PAXgene system. Most transcripts are affected by the choice of sampling system, but these effects are highly reproducible between independent samples. We propose that by running a control experiment with samples on both systems in parallel with biologically relevant samples, researchers may adjust for technical differences between the sampling systems.

  10. An epidermal microRNA regulates neuronal migration through control of the cellular glycosylation state

    DEFF Research Database (Denmark)

    Pedersen, Mikael Egebjerg; Snieckute, Goda; Kagias, Konstantinos

    2013-01-01

    An appropriate balance in glycosylation of proteoglycans is crucial for their ability to regulate animal development. Here, we report that the Caenorhabditis elegans microRNA mir-79, an ortholog of mammalian miR-9, controls sugar-chain homeostasis by targeting two proteins in the proteoglycan bio...... that impinges on a LON-2/glypican pathway and disrupts neuronal migration. Our results identify a regulatory axis controlled by a conserved microRNA that maintains proteoglycan homeostasis in cells....

  11. The epidermal biosynthesis of cholecalciferol (vitamin D3)

    International Nuclear Information System (INIS)

    Beadle, P.C.

    1977-01-01

    An attempt has been made to calculate the rate of ultraviolet absorption by 7-dehydrocholesterol, provitamin D 3 , in the epidermis as a function of latitude, season and skin type, in the hope that it will provide an upper-limit estimate of the epidermal vitamin production. The results indicate that a significant fraction of the total epidermal production may occur in the stratum corneum with figures of 15 and 31% being found for non-pigmented and pigmented epidermises, respectively. Total production in negroid epidermis is predicted to be about 40% of that in the caucasian one and the latitudinal variation is greater than the seasonal variation, in agreement with the behaviour of the available solar ultraviolet. Overall production rates were sufficiently high for it to be unnecessary to invoke an enhanced absorption mechanism for the provitamin, although the results do indicate that there may be a risk of deficient production above about 40 0 N. (author)

  12. Post-female-circumcision clitoral epidermal inclusion cyst: a case ...

    African Journals Online (AJOL)

    Keywords: complication, epidermal inclusion cyst, female circumcision. Pediatric Urology Division, Department of Urology, ... transplantation of the epidermis into the subcutaneous tissue with subsequent proliferation of epidermal ... The evolution of the practice of FGM, from being performed by traditional birth attendants to.

  13. Metabolic epidermal necrosis in two dogs with different underlying diseases.

    Science.gov (United States)

    Bond, R; McNeil, P E; Evans, H; Srebernik, N

    1995-05-06

    Two dogs with metabolic epidermal necrosis had hyperkeratosis of the footpads accompanied by erythematous, erosive and crusting lesions affecting the muzzle, external genitalia, perineum and periocular regions. Histopathological examination of skin biopsies revealed a superficial hydropic dermatitis with marked parakeratosis. Both dogs had high plasma activities of alkaline phosphatase and alanine aminotransferase and high concentrations of glucose, and also a marked hypoaminoacidaemia. Despite these similarities, the cutaneous eruptions were associated with different underlying diseases. One dog had a pancreatic carcinoma which had metastasised widely; the primary tumour and the metastases showed glucagon immunoreactivity on immunocytochemical staining, and the dog's plasma glucagon concentration was markedly greater than that of control dogs. The other dog had diffuse hepatic disease; its plasma glucagon concentration was similar to that of control samples and cirrhosis was identified post mortem. Metabolic epidermal necrosis in dogs is a distinct cutaneous reaction pattern which may be associated with different underlying systemic diseases; however, the pathogenesis of the skin lesions remains unclear.

  14. Cytochrome c oxidase subunit 1-based human RNA quantification to enhance mRNA profiling in forensic biology

    Directory of Open Access Journals (Sweden)

    Dong Zhao

    2017-01-01

    Full Text Available RNA analysis offers many potential applications in forensic science, and molecular identification of body fluids by analysis of cell-specific RNA markers represents a new technique for use in forensic cases. However, due to the nature of forensic materials that often admixed with nonhuman cellular components, human-specific RNA quantification is required for the forensic RNA assays. Quantification assay for human RNA has been developed in the present study with respect to body fluid samples in forensic biology. The quantitative assay is based on real-time reverse transcription-polymerase chain reaction of mitochondrial RNA cytochrome c oxidase subunit I and capable of RNA quantification with high reproducibility and a wide dynamic range. The human RNA quantification improves the quality of mRNA profiling in the identification of body fluids of saliva and semen because the quantification assay can exclude the influence of nonhuman components and reduce the adverse affection from degraded RNA fragments.

  15. GUItars: a GUI tool for analysis of high-throughput RNA interference screening data.

    Directory of Open Access Journals (Sweden)

    Asli N Goktug

    Full Text Available High-throughput RNA interference (RNAi screening has become a widely used approach to elucidating gene functions. However, analysis and annotation of large data sets generated from these screens has been a challenge for researchers without a programming background. Over the years, numerous data analysis methods were produced for plate quality control and hit selection and implemented by a few open-access software packages. Recently, strictly standardized mean difference (SSMD has become a widely used method for RNAi screening analysis mainly due to its better control of false negative and false positive rates and its ability to quantify RNAi effects with a statistical basis. We have developed GUItars to enable researchers without a programming background to use SSMD as both a plate quality and a hit selection metric to analyze large data sets.The software is accompanied by an intuitive graphical user interface for easy and rapid analysis workflow. SSMD analysis methods have been provided to the users along with traditionally-used z-score, normalized percent activity, and t-test methods for hit selection. GUItars is capable of analyzing large-scale data sets from screens with or without replicates. The software is designed to automatically generate and save numerous graphical outputs known to be among the most informative high-throughput data visualization tools capturing plate-wise and screen-wise performances. Graphical outputs are also written in HTML format for easy access, and a comprehensive summary of screening results is written into tab-delimited output files.With GUItars, we demonstrated robust SSMD-based analysis workflow on a 3840-gene small interfering RNA (siRNA library and identified 200 siRNAs that increased and 150 siRNAs that decreased the assay activities with moderate to stronger effects. GUItars enables rapid analysis and illustration of data from large- or small-scale RNAi screens using SSMD and other traditional analysis

  16. Foliar Epidermal Studies of Plants in Euphorbiaceae

    Directory of Open Access Journals (Sweden)

    H. A. Thakur

    2014-03-01

    Full Text Available This paper describes foliar epidermal structure in 17 species belonging to 17 genera of the family Euphoprbiaceae. Anomocytic stomata is predominant, rarely they are anisocytic, paracytic on the same foliar surface with different combinations. Leaves are hypostomatic and rarely amphistomatic. The foliar surface is smooth, rarely striated. The foliar epidermal cell walls are straight or undulate. Distribution of stomata, stomatal index, stomatal frequency, stomatal size and other cell wall contours are described in detail.

  17. Estrogens and growth factors induce the mRNA of the 52K-pro-cathepsin-D secreted by breast cancer cells

    Energy Technology Data Exchange (ETDEWEB)

    Cavailles, V; Augereau, P; Garcia, M; Rochefort, H

    1988-03-25

    The estrogen-induced 52K protein secreted by human breast cancer cells is a lysosomal protease recently identified as a pro-cathepsin D by sequencing several cDNA clones isolated from MCF/sub 7/ cells. Using one of these clones, the authors detected, in MCF/sub 7/ cells a 2.2 kb mRNA whose level was rapidly increased 4- to 10-fold by estradiol, but not by other classes of steroids. Other mitogens, such as epidermal growth factor and insulin, also induced the 2.2 kb mRNA in a dose-dependent manner. Induction with epidermal growth factor was as rapid but was 2- to 3-fold lower than with estradiol. Antiestrogens had no effect on the 52K-cathepsin-D mRNA in MCF/sub 7/ cells, but became estrogen agonists in two antiestrogen-resistant sublines R/sub 27/ and LY2. The use of transcription and translation inhibitors and nuclear run-on experiments indicate that estradiol enhances transcription of the 52K-cathepsin-D gene in MCF/sub 7/ cells.

  18. ABCE1 is a highly conserved RNA silencing suppressor.

    Directory of Open Access Journals (Sweden)

    Kairi Kärblane

    Full Text Available ATP-binding cassette sub-family E member 1 (ABCE1 is a highly conserved protein among eukaryotes and archaea. Recent studies have identified ABCE1 as a ribosome-recycling factor important for translation termination in mammalian cells, yeast and also archaea. Here we report another conserved function of ABCE1. We have previously described AtRLI2, the homolog of ABCE1 in the plant Arabidopsis thaliana, as an endogenous suppressor of RNA silencing. In this study we show that this function is conserved: human ABCE1 is able to suppress RNA silencing in Nicotiana benthamiana plants, in mammalian HEK293 cells and in the worm Caenorhabditis elegans. Using co-immunoprecipitation and mass spectrometry, we found a number of potential ABCE1-interacting proteins that might support its function as an endogenous suppressor of RNA interference. The interactor candidates are associated with epigenetic regulation, transcription, RNA processing and mRNA surveillance. In addition, one of the identified proteins is translin, which together with its binding partner TRAX supports RNA interference.

  19. Conformable liquid metal printed epidermal electronics for smart physiological monitoring and simulation treatment

    Science.gov (United States)

    Wang, Xuelin; Zhang, Yuxin; Guo, Rui; Wang, Hongzhang; Yuan, Bo; Liu, Jing

    2018-03-01

    Conformable epidermal printed electronics enabled from gallium-based liquid metals (LMs), highly conductive and low-melting-point alloys, are proposed as the core to achieving immediate contact between skin surface and electrodes, which can avoid the skin deformation often caused by conventional rigid electrodes. When measuring signals, LMs can eliminate resonance problems with shorter time to reach steady state than Pt and gelled Pt electrodes. By comparing the contact resistance under different working conditions, it is demonstrated that both ex vivo and in vivo LM electrode-skin models have the virtues of direct and immediate contact with skin surface without the deformation encountered with conventional rigid electrodes. In addition, electrocardio electrodes composed of conformable LM printed epidermal electronics are adopted as smart devices to monitor electrocardiogram signals of rabbits. Furthermore, simulation treatment for smart defibrillation offers a feasible way to demonstrate the effect of liquid metal electrodes (LMEs) on the human body with less energy loss. The remarkable features of soft epidermal LMEs such as high conformability, good conductivity, better signal stability, and fine biocompatibility represent a critical step towards accurate medical monitoring and future smart treatments.

  20. An improved method for RNA isolation and cDNA library construction from immature seeds of Jatropha curcas L

    Directory of Open Access Journals (Sweden)

    Kaur Jatinder

    2010-05-01

    Full Text Available Abstract Background RNA quality and quantity is sometimes unsuitable for cDNA library construction, from plant seeds rich in oil, polysaccharides and other secondary metabolites. Seeds of jatropha (Jatropha curcas L. are rich in fatty acids/lipids, storage proteins, polysaccharides, and a number of other secondary metabolites that could either bind and/or co-precipitate with RNA, making it unsuitable for downstream applications. Existing RNA isolation methods and commercial kits often fail to deliver high-quality total RNA from immature jatropha seeds for poly(A+ RNA purification and cDNA synthesis. Findings A protocol has been developed for isolating good quality total RNA from immature jatropha seeds, whereby a combination of the CTAB based RNA extraction method and a silica column of a commercial plant RNA extraction kit is used. The extraction time was reduced from two days to about 3 hours and the RNA was suitable for poly(A+ RNA purification, cDNA synthesis, cDNA library construction, RT-PCR, and Northern hybridization. Based on sequence information from selected clones and amplified PCR product, the cDNA library seems to be a good source of full-length jatropha genes. The method was equally effective for isolating RNA from mustard and rice seeds. Conclusions This is a simple CTAB + silica column method to extract high quality RNA from oil rich immature jatropha seeds that is suitable for several downstream applications. This method takes less time for RNA extraction and is equally effective for other tissues where the quality and quantity of RNA is highly interfered by the presence of fatty acids, polysaccharides and polyphenols.

  1. REDItools: high-throughput RNA editing detection made easy.

    Science.gov (United States)

    Picardi, Ernesto; Pesole, Graziano

    2013-07-15

    The reliable detection of RNA editing sites from massive sequencing data remains challenging and, although several methodologies have been proposed, no computational tools have been released to date. Here, we introduce REDItools a suite of python scripts to perform high-throughput investigation of RNA editing using next-generation sequencing data. REDItools are in python programming language and freely available at http://code.google.com/p/reditools/. ernesto.picardi@uniba.it or graziano.pesole@uniba.it Supplementary data are available at Bioinformatics online.

  2. The Effect of Epidermal Structures on Leaf Spectral Signatures of Ice Plants (Aizoaceae

    Directory of Open Access Journals (Sweden)

    René Hans-Jürgen Heim

    2015-12-01

    Full Text Available Epidermal structures (ES of leaves are known to affect the functional properties and spectral responses. Spectral studies focused mostly on the effect of hairs or wax layers only. We studied a wider range of different ES and their impact on spectral properties. Additionally, we identified spectral regions that allow distinguishing different ES. We used a field spectrometer to measure ex situ leaf spectral responses from 350 nm–2500 nm. A spectral library for 25 species of the succulent family Aizoaceae was assembled. Five functional types were defined based on ES: flat epidermal cell surface, convex to papillary epidermal cell surface, bladder cells, hairs and wax cover. We tested the separability of ES using partial least squares discriminant analysis (PLS-DA based on the spectral data. Subsequently, variable importance (VIP was calculated to identify spectral regions relevant for discriminating our functional types (classes. Classification performance was high, with a kappa value of 0.9 indicating well-separable spectral classes. VIP calculations identified six spectral regions of increased importance for the classification. We confirmed and extended previous findings regarding the visible-near-infrared spectral region. Our experiments also confirmed that epidermal leaf traits can be classified due to clearly distinguishable spectral signatures across species and genera within the Aizoaceae.

  3. Effective Anti-miRNA Oligonucleotides Show High Releasing Rate of MicroRNA from RNA-Induced Silencing Complex.

    Science.gov (United States)

    Ariyoshi, Jumpei; Matsuyama, Yohei; Kobori, Akio; Murakami, Akira; Sugiyama, Hiroshi; Yamayoshi, Asako

    2017-10-01

    MicroRNAs (miRNAs) regulate gene expression by forming RNA-induced silencing complexes (RISCs) and have been considered as promising therapeutic targets. MiRNA is an essential component of RISC for the modulation of gene expression. Therefore, the release of miRNA from RISC is considered as an effective method for the inhibition of miRNA functions. In our previous study, we reported that anti-miRNA oligonucleotides (AMOs), which are composed of the 2'-O-methyl (2'-OMe) RNA, could induce the release of miRNA from RISC. However, the mechanisms underlying the miRNA-releasing effects of chemically modified AMOs, which are conventionally used as anti-cancer drugs, are still unclear. In this study, we investigated the relationship between the miRNA releasing rate from RISC and the inhibitory effect on RISC activity (IC 50 ) using conventional chemically modified AMOs. We demonstrated that the miRNA-releasing effects of AMOs are directly proportional to the IC 50 values, and AMOs, which have an ability to promote the release of miRNA from RISC, can effectively inhibit RISC activity in living cells.

  4. The organization of human epidermis: functional epidermal units and phi proportionality.

    Science.gov (United States)

    Hoath, Steven B; Leahy, D G

    2003-12-01

    The concept that mammalian epidermis is structurally organized into functional epidermal units has been proposed on the basis of stratum corneum (SC) architecture, proliferation kinetics, melanocyte:keratinocyte ratios (1:36), and, more recently, Langerhans cell: epidermal cell ratios (1:53). This article examines the concept of functional epidermal units in human skin in which the maintenance of phi (1.618034) proportionality provides a central organizing principle. The following empirical measurements were used: 75,346 nucleated epidermal cells per mm2, 1394 Langerhans cells per mm2, 1999 melanocytes per mm2, 16 (SC) layers, 900-microm2 corneocyte surface area, 17,778 corneocytes per mm2, 14-d (SC) turnover time, and 93,124 per mm2 total epidermal cells. Given these empirical data: (1) the number of corneocytes is a mean proportional between the sum of the Langerhans cell + melanocyte populations and the number of epidermal cells, 3393/17,778-17,778/93,124; (2) the ratio of nucleated epidermal cells over corneocytes is phi proportional, 75,346/17,778 approximately phi3; (3) assuming similar 14-d turnover times for the (SC) and Malpighian epidermis, the number of corneocytes results from subtraction of a cellular fraction equal to approximately 2/phi2 x the number of living cells, 75,436 - (2/phi2 x 75,346) approximately 17,778; and (4) if total epidermal turnover time equals (SC) turnover time x the ratio of living/dead cells, then compartmental turnover times are unequal (14 d for (SC) to 45.3 d for nucleated epidermis approximately 1/2phi) and cellular replacement rates are 52.9 corneocytes/69.3 keratinocytes per mm2 per h approximately 2/phi2. These empirically derived equivalences provide logicomathematical support for the presence of functional epidermal units in human skin. Validation of a phi proportional unit architecture in human epidermis will be important for tissue engineering of skin and the design of instruments for skin measurement.

  5. SERE: single-parameter quality control and sample comparison for RNA-Seq.

    Science.gov (United States)

    Schulze, Stefan K; Kanwar, Rahul; Gölzenleuchter, Meike; Therneau, Terry M; Beutler, Andreas S

    2012-10-03

    Assessing the reliability of experimental replicates (or global alterations corresponding to different experimental conditions) is a critical step in analyzing RNA-Seq data. Pearson's correlation coefficient r has been widely used in the RNA-Seq field even though its statistical characteristics may be poorly suited to the task. Here we present a single-parameter test procedure for count data, the Simple Error Ratio Estimate (SERE), that can determine whether two RNA-Seq libraries are faithful replicates or globally different. Benchmarking shows that the interpretation of SERE is unambiguous regardless of the total read count or the range of expression differences among bins (exons or genes), a score of 1 indicating faithful replication (i.e., samples are affected only by Poisson variation of individual counts), a score of 0 indicating data duplication, and scores >1 corresponding to true global differences between RNA-Seq libraries. On the contrary the interpretation of Pearson's r is generally ambiguous and highly dependent on sequencing depth and the range of expression levels inherent to the sample (difference between lowest and highest bin count). Cohen's simple Kappa results are also ambiguous and are highly dependent on the choice of bins. For quantifying global sample differences SERE performs similarly to a measure based on the negative binomial distribution yet is simpler to compute. SERE can therefore serve as a straightforward and reliable statistical procedure for the global assessment of pairs or large groups of RNA-Seq datasets by a single statistical parameter.

  6. An improved radiolabelled RNA aptamer molecule for HER2 imaging in cancers.

    Science.gov (United States)

    Varmira, Kambiz; Hosseinimehr, Seyed Jalal; Noaparast, Zohreh; Abedi, Seyed Mohammad

    2014-02-01

    Human epidermal growth factor receptor 2 (HER2) expression has been shown to be increased in several types of human tumours. In this study, for the imaging of HER2-related tumours, a modified RNA aptamer with HER2-specific targeting was labelled with (99m)Tc, by using hydrazino nicotinamide (HYNIC) as the chelator in the presence of tricine or ethylenediamine-N,N'-diacetic acid (EDDA) as the co-ligand. Stability testing of the radiolabelled aptamers in the serum was performed through SDS-PAGE. The aptamer-radionuclide conjugate was evaluated for its cellular HER2-specific binding in ovarian cancer cells (SKOV-3), and its biodistribution properties were assessed in normal and SKOV-3 tumour-bearing mice. In the presence of either tricine or EDDA, the HYNIC-RNA aptamers were labelled with (99m)Tc at a high yield and radiochemical purity. Cellular experiments confirmed the specific binding of the RNA aptamer to the HER2 receptor. In the animal biodistribution study, uptake of the EDDA-co-liganded (99m)Tc-HYNIC-RNA aptamer by the liver and spleen was remarkably lower than that of the aptamer with tricine. Tumours also showed a higher accumulation of radioactivity with the EDDA-co-liganded aptamer complex. This study demonstrated EDDA to be better than tricine for use as a co-ligand with the RNA aptamer, which can be a potential tool for the molecular imaging of HER2-overexpressing cancers.

  7. A high quality Arabidopsis transcriptome for accurate transcript-level analysis of alternative splicing

    KAUST Repository

    Zhang, Runxuan

    2017-04-05

    Alternative splicing generates multiple transcript and protein isoforms from the same gene and thus is important in gene expression regulation. To date, RNA-sequencing (RNA-seq) is the standard method for quantifying changes in alternative splicing on a genome-wide scale. Understanding the current limitations of RNA-seq is crucial for reliable analysis and the lack of high quality, comprehensive transcriptomes for most species, including model organisms such as Arabidopsis, is a major constraint in accurate quantification of transcript isoforms. To address this, we designed a novel pipeline with stringent filters and assembled a comprehensive Reference Transcript Dataset for Arabidopsis (AtRTD2) containing 82,190 non-redundant transcripts from 34 212 genes. Extensive experimental validation showed that AtRTD2 and its modified version, AtRTD2-QUASI, for use in Quantification of Alternatively Spliced Isoforms, outperform other available transcriptomes in RNA-seq analysis. This strategy can be implemented in other species to build a pipeline for transcript-level expression and alternative splicing analyses.

  8. A high quality Arabidopsis transcriptome for accurate transcript-level analysis of alternative splicing

    KAUST Repository

    Zhang, Runxuan; Calixto, Cristiane  P.  G.; Marquez, Yamile; Venhuizen, Peter; Tzioutziou, Nikoleta A.; Guo, Wenbin; Spensley, Mark; Entizne, Juan Carlos; Lewandowska, Dominika; ten  Have, Sara; Frei  dit  Frey, Nicolas; Hirt, Heribert; James, Allan B.; Nimmo, Hugh G.; Barta, Andrea; Kalyna, Maria; Brown, John  W.  S.

    2017-01-01

    Alternative splicing generates multiple transcript and protein isoforms from the same gene and thus is important in gene expression regulation. To date, RNA-sequencing (RNA-seq) is the standard method for quantifying changes in alternative splicing on a genome-wide scale. Understanding the current limitations of RNA-seq is crucial for reliable analysis and the lack of high quality, comprehensive transcriptomes for most species, including model organisms such as Arabidopsis, is a major constraint in accurate quantification of transcript isoforms. To address this, we designed a novel pipeline with stringent filters and assembled a comprehensive Reference Transcript Dataset for Arabidopsis (AtRTD2) containing 82,190 non-redundant transcripts from 34 212 genes. Extensive experimental validation showed that AtRTD2 and its modified version, AtRTD2-QUASI, for use in Quantification of Alternatively Spliced Isoforms, outperform other available transcriptomes in RNA-seq analysis. This strategy can be implemented in other species to build a pipeline for transcript-level expression and alternative splicing analyses.

  9. PANC-1 pancreatic cancer cell growth inhibited by cucurmosin alone and in combination with an epidermal growth factor receptor-targeted drug.

    Science.gov (United States)

    Wang, Congfei; Yang, Aiqin; Zhang, Baoming; Yin, Qiang; Huang, Heguang; Chen, Minghuang; Xie, Jieming

    2014-03-01

    To investigate the inhibition of PANC-1 pancreatic cancer cell growth by cucurmosin (CUS) and its possible mechanism. We observed the inhibition of PANC-1 cell growth by sulforhodamine B and colony-forming experiments in vitro and established nonobese diabetic/severe combined immunodeficiency mouse subcutaneous tumor models in vivo. We used Western blot to analyze protein levels related to apoptosis and epidermal growth factor receptor (EGFR) signaling pathways after drug intervention, whereas the messenger RNA expression of EGFR was analyzed by quantitative real-time polymerase chain reaction. Sulforhodamine B and colony-forming experiments indicated that CUS inhibited PANC-1 cell proliferation in a dose- and time-dependent manner. A stronger inhibitory effect was observed when CUS was combined with gefitinib. The subcutaneous tumor growth was also inhibited. Western blot showed that all the examined proteins decreased, except for 4E-BP1 and the active fragments of caspase 3 and caspase 9 increased. Epidermal growth factor receptor expression did not change significantly in quantitative real-time polymerase chain reaction. Cucurmosin can strongly inhibit the growth of PANC-1 cells in vitro and in vivo. Cucurmosin can down-regulate EGFR protein expression, but not at the messenger RNA level. Cucurmosin can also inhibit the ras/raf and phosphatidylinositol 3-kinase/Akt downstream signaling pathways and enhance the sensitivity of the EGFR-targeted drug gefitinib.

  10. High-throughput screening of effective siRNAs using luciferase-linked chimeric mRNA.

    Directory of Open Access Journals (Sweden)

    Shen Pang

    Full Text Available The use of siRNAs to knock down gene expression can potentially be an approach to treat various diseases. To avoid siRNA toxicity the less transcriptionally active H1 pol III promoter, rather than the U6 promoter, was proposed for siRNA expression. To identify highly efficacious siRNA sequences, extensive screening is required, since current computer programs may not render ideal results. Here, we used CCR5 gene silencing as a model to investigate a rapid and efficient screening approach. We constructed a chimeric luciferase-CCR5 gene for high-throughput screening of siRNA libraries. After screening approximately 900 shRNA clones, 12 siRNA sequences were identified. Sequence analysis demonstrated that most (11 of the 12 sequences of these siRNAs did not match those identified by available siRNA prediction algorithms. Significant inhibition of CCR5 in a T-lymphocyte cell line and primary T cells by these identified siRNAs was confirmed using the siRNA lentiviral vectors to infect these cells. The inhibition of CCR5 expression significantly protected cells from R5 HIV-1JRCSF infection. These results indicated that the high-throughput screening method allows efficient identification of siRNA sequences to inhibit the target genes at low levels of expression.

  11. Extraction of total RNA in the developing chicken forebrain

    Directory of Open Access Journals (Sweden)

    Sayed Rasoul Zaker

    2014-01-01

    Full Text Available Background: Gene expression of Gama-Aminobutyric acid (GABA A receptor subunits may change during development. Procedures in molecular biology are required to understand the gene expression profile GABA A R in chicken. The outcome of the results depends on good-quality high-molecular-weight RNA. Several procedures can be used to isolate RNA from the brain of chicken; however, most of them are time-consuming and require disruption of cells or freeze and thaw in the presence of RNase inhibitors. The aim of this experiment was isolation of RNA from chicken embryonic brain tissues using appropriate RNA extraction kit. Materials and Methods: Fertilized eggs from Ross breed (Gallus gallus were incubated at 38°C and 60% relative humidity in a forced-draft incubator and were turned every 3 h. After 3, 7, 14 and 20 days of incubation, eggs were cooled on ice to induce deep anesthesia. Then whole brains were dissected out. As brains could not be excised in a reproducible way from earlier embryos (embryonic days 4 and 6, whole heads were collected. Chicken embryos between day 7 to 20 and 1 day after birth were decapitated, and their brains removed. Samples were immediately inserted into lysis buffer and stored at −70°C. Total RNA was isolated and a contaminating genomic deoxyribonucleic acid (DNA was digested. RNA quality was checked using gel electrophoresis. Results: We obtained 52 mg/ml to 745 mg/ml with A260/280 1.7-2.2. Only high-quality RNA, with no signs of degradation, was used for further experiments. Conclusion: In conclusion, protocol was found to be suitable for the isolation of total RNA from embryonic chicken cells.

  12. "Cut-and-Paste" Manufacture of Multiparametric Epidermal Sensor Systems.

    Science.gov (United States)

    Yang, Shixuan; Chen, Ying-Chen; Nicolini, Luke; Pasupathy, Praveenkumar; Sacks, Jacob; Su, Becky; Yang, Russell; Sanchez, Daniel; Chang, Yao-Feng; Wang, Pulin; Schnyer, David; Neikirk, Dean; Lu, Nanshu

    2015-11-04

    Multifunctional epidermal sensor systems (ESS) are manufactured with a highly cost and time effective, benchtop, and large-area "cut-and-paste" method. The ESS made out of thin and stretchable metal and conductive polymer ribbons can be noninvasively laminated onto the skin surface to sense electrophysiological signals, skin temperature, skin hydration, and respiratory rate. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  13. Epidermal growth factor receptor expression in urinary bladder cancer

    Directory of Open Access Journals (Sweden)

    Dayalu S.L. Naik

    2011-01-01

    Full Text Available Objective : To evaluate the expression pattern of epidermal growth factor receptor (EGFR in urinary bladder cancer and its association with human epidermal growth factor receptor 2 (HER2, epidermal growth factor (EGF, interleukin-6 (IL-6, and high risk human papilloma virus (HPV types 16 and 18. Materials and Methods : Thirty cases of urothelial carcinoma were analyzed. EGFR, HER2, EGF, and IL-6 expressions in the tissue were evaluated by immunohistochemical staining. For HPV, DNA from tissue samples was extracted and detection of HPV was done by PCR technique. Furthermore, evaluation of different intracellular molecules associated with EGFR signaling pathways was performed by the western blot method using lysates from various cells and tissues. Results : In this study, the frequencies of immunopositivity for EGFR, HER2, EGF, and IL-6 were 23%, 60%, 47%, and 80%, respectively. No cases were positive for HPV-18, whereas HPV-16 was detected in 10% cases. Overall, expression of EGFR did not show any statistically significant association with the studied parameters. However, among male patients, a significant association was found only between EGFR and HER2. Conclusions : Overexpression of EGFR and/or HER2, two important members of the same family of growth factor receptors, was observed in a considerable proportion of cases. Precise knowledge in this subject would be helpful to formulate a rational treatment strategy in patients with urinary bladder cancer.

  14. Nanoparticle orientation to control RNA loading and ligand display on extracellular vesicles for cancer regression

    Science.gov (United States)

    Pi, Fengmei; Binzel, Daniel W.; Lee, Tae Jin; Li, Zhefeng; Sun, Meiyan; Rychahou, Piotr; Li, Hui; Haque, Farzin; Wang, Shaoying; Croce, Carlo M.; Guo, Bin; Evers, B. Mark; Guo, Peixuan

    2018-01-01

    Nanotechnology offers many benefits, and here we report an advantage of applying RNA nanotechnology for directional control. The orientation of arrow-shaped RNA was altered to control ligand display on extracellular vesicle membranes for specific cell targeting, or to regulate intracellular trafficking of small interfering RNA (siRNA) or microRNA (miRNA). Placing membrane-anchoring cholesterol at the tail of the arrow results in display of RNA aptamer or folate on the outer surface of the extracellular vesicle. In contrast, placing the cholesterol at the arrowhead results in partial loading of RNA nanoparticles into the extracellular vesicles. Taking advantage of the RNA ligand for specific targeting and extracellular vesicles for efficient membrane fusion, the resulting ligand-displaying extracellular vesicles were capable of specific delivery of siRNA to cells, and efficiently blocked tumour growth in three cancer models. Extracellular vesicles displaying an aptamer that binds to prostate-specific membrane antigen, and loaded with survivin siRNA, inhibited prostate cancer xenograft. The same extracellular vesicle instead displaying epidermal growth-factor receptor aptamer inhibited orthotopic breast cancer models. Likewise, survivin siRNA-loaded and folate-displaying extracellular vesicles inhibited patient-derived colorectal cancer xenograft.

  15. Biochemistry of epidermal stem cells.

    Science.gov (United States)

    Eckert, Richard L; Adhikary, Gautam; Balasubramanian, Sivaprakasam; Rorke, Ellen A; Vemuri, Mohan C; Boucher, Shayne E; Bickenbach, Jackie R; Kerr, Candace

    2013-02-01

    The epidermis is an important protective barrier that is essential for maintenance of life. Maintaining this barrier requires continuous cell proliferation and differentiation. Moreover, these processes must be balanced to produce a normal epidermis. The stem cells of the epidermis reside in specific locations in the basal epidermis, hair follicle and sebaceous glands and these cells are responsible for replenishment of this tissue. A great deal of effort has gone into identifying protein epitopes that mark stem cells, in identifying stem cell niche locations, and in understanding how stem cell populations are related. We discuss these studies as they apply to understanding normal epidermal homeostasis and skin cancer. An assortment of stem cell markers have been identified that permit assignment of stem cells to specific regions of the epidermis, and progress has been made in understanding the role of these cells in normal epidermal homeostasis and in conditions of tissue stress. A key finding is the multiple stem cell populations exist in epidermis that give rise to different structures, and that multiple stem cell types may contribute to repair in damaged epidermis. Understanding epidermal stem cell biology is likely to lead to important therapies for treating skin diseases and cancer, and will also contribute to our understanding of stem cells in other systems. This article is part of a Special Issue entitled Biochemistry of Stem Cells. Copyright © 2012 Elsevier B.V. All rights reserved.

  16. Biochemistry of epidermal stem cells☆

    Science.gov (United States)

    Eckert, Richard L.; Adhikary, Gautam; Balasubramanian, Sivaprakasam; Rorke, Ellen A.; Vemuri, Mohan C.; Boucher, Shayne E.; Bickenbach, Jackie R.; Kerr, Candace

    2014-01-01

    Background The epidermis is an important protective barrier that is essential for maintenance of life. Maintaining this barrier requires continuous cell proliferation and differentiation. Moreover, these processes must be balanced to produce a normal epidermis. The stem cells of the epidermis reside in specific locations in the basal epidermis, hair follicle and sebaceous glands and these cells are responsible for replenishment of this tissue. Scope of review A great deal of effort has gone into identifying protein epitopes that mark stem cells, in identifying stem cell niche locations, and in understanding how stem cell populations are related. We discuss these studies as they apply to understanding normal epidermal homeostasis and skin cancer. Major conclusions An assortment of stem cell markers have been identified that permit assignment of stem cells to specific regions of the epidermis, and progress has been made in understanding the role of these cells in normal epidermal homeostasis and in conditions of tissue stress. A key finding is the multiple stem cell populations exist in epidermis that give rise to different structures, and that multiple stem cell types may contribute to repair in damaged epidermis. General significance Understanding epidermal stem cell biology is likely to lead to important therapies for treating skin diseases and cancer, and will also contribute to our understanding of stem cells in other systems. This article is part of a Special Issue entitled Biochemistry of Stem Cells. PMID:22820019

  17. Differential amplicons (ΔAmp)-a new molecular method to assess RNA integrity.

    Science.gov (United States)

    Björkman, J; Švec, D; Lott, E; Kubista, M; Sjöback, R

    2016-01-01

    Integrity of the mRNA in clinical samples has major impact on the quality of measured expression levels. This is independent of the measurement technique being next generation sequencing (NGS), Quantitative real-time PCR (qPCR) or microarray profiling. If mRNA is highly degraded or damaged, measured data will be very unreliable and the whole study is likely a waste of time and money. It is therefore common strategy to test the quality of RNA in samples before conducting large and costly studies. Most methods today to assess the quality of RNA are ignorant to the nature of the RNA and, therefore, reflect the integrity of ribosomal RNA, which is the dominant species, rather than of mRNAs, microRNAs and long non-coding RNAs, which usually are the species of interest. Here, we present a novel molecular approach to assess the quality of the targeted RNA species by measuring the differential amplification (ΔAmp) of an Endogenous RNase Resistant (ERR) marker relative to a reference gene, optionally combined with the measurement of two amplicons of different lengths. The combination reveals any mRNA degradation caused by ribonucleases as well as physical, chemical or UV damage. ΔAmp has superior sensitivity to common microfluidic electrophoretic methods, senses the integrity of the actual targeted RNA species, and allows for a smoother and more cost efficient workflow.

  18. Differential amplicons (ΔAmp—a new molecular method to assess RNA integrity

    Directory of Open Access Journals (Sweden)

    J. Björkman

    2016-01-01

    Full Text Available Integrity of the mRNA in clinical samples has major impact on the quality of measured expression levels. This is independent of the measurement technique being next generation sequencing (NGS, Quantitative real-time PCR (qPCR or microarray profiling. If mRNA is highly degraded or damaged, measured data will be very unreliable and the whole study is likely a waste of time and money. It is therefore common strategy to test the quality of RNA in samples before conducting large and costly studies. Most methods today to assess the quality of RNA are ignorant to the nature of the RNA and, therefore, reflect the integrity of ribosomal RNA, which is the dominant species, rather than of mRNAs, microRNAs and long non-coding RNAs, which usually are the species of interest. Here, we present a novel molecular approach to assess the quality of the targeted RNA species by measuring the differential amplification (ΔAmp of an Endogenous RNase Resistant (ERR marker relative to a reference gene, optionally combined with the measurement of two amplicons of different lengths. The combination reveals any mRNA degradation caused by ribonucleases as well as physical, chemical or UV damage. ΔAmp has superior sensitivity to common microfluidic electrophoretic methods, senses the integrity of the actual targeted RNA species, and allows for a smoother and more cost efficient workflow.

  19. Evolution of dinosaur epidermal structures.

    Science.gov (United States)

    Barrett, Paul M; Evans, David C; Campione, Nicolás E

    2015-06-01

    Spectacularly preserved non-avian dinosaurs with integumentary filaments/feathers have revolutionized dinosaur studies and fostered the suggestion that the dinosaur common ancestor possessed complex integumentary structures homologous to feathers. This hypothesis has major implications for interpreting dinosaur biology, but has not been tested rigorously. Using a comprehensive database of dinosaur skin traces, we apply maximum-likelihood methods to reconstruct the phylogenetic distribution of epidermal structures and interpret their evolutionary history. Most of these analyses find no compelling evidence for the appearance of protofeathers in the dinosaur common ancestor and scales are usually recovered as the plesiomorphic state, but results are sensitive to the outgroup condition in pterosaurs. Rare occurrences of ornithischian filamentous integument might represent independent acquisitions of novel epidermal structures that are not homologous with theropod feathers. © 2015 The Author(s) Published by the Royal Society. All rights reserved.

  20. Efficient recovery of whole blood RNA - a comparison of commercial RNA extraction protocols for high-throughput applications in wildlife species

    Directory of Open Access Journals (Sweden)

    Schwochow Doreen

    2012-06-01

    Full Text Available Abstract Background Since the emergence of next generation sequencing platforms, unprecedented opportunities have arisen in the study of natural vertebrate populations. In particular, insights into the genetic and epigenetic mechanisms of adaptation can be revealed through study of the expression profiles of genes. However, as a pre-requisite to expression profiling, care must be taken in RNA preparation as factors like DNA contamination, RNA integrity or transcript abundance can affect downstream applications. Here, we evaluated five commonly used RNA extraction methods using whole blood sampled under varying conditions from 20 wild carnivores. Results Despite the use of minute starting volumes, all methods produced quantifiable RNA extracts (1.4 – 18.4 μg with varying integrity (RIN 4.6 - 7.7, the latter being significantly affected by the storage and extraction method used. We observed a significant overall effect of the extraction method on DNA contamination. One particular extraction method, the LeukoLOCK™ filter system, yielded high RNA integrity along with low DNA contamination and efficient depletion of hemoglobin transcripts highly abundant in whole blood. In a proof of concept sequencing experiment, we found globin RNA transcripts to occupy up to ¼ of all sequencing reads if libraries were not depleted of hemoglobin prior to sequencing. Conclusion By carefully choosing the appropriate RNA extraction method, whole blood can become a valuable source for high-throughput applications like expression arrays or transcriptome sequencing from natural populations. Additionally, candidate genes showing signs of selection could subsequently be genotyped in large population samples using whole blood as a source for RNA without harming individuals from rare or endangered species.

  1. Associations of mRNA:microRNA for the shared downstream molecules of EGFR and alternative tyrosine kinase receptors in Non-Small Cell Lung Cancer

    Directory of Open Access Journals (Sweden)

    Fengfeng Wang

    2016-10-01

    Full Text Available Lung cancer is the top cancer killer worldwide with high mortality rate. Majority belong to non-small cell lung cancers (NSCLCs. The epidermal growth factor receptor (EGFR has been broadly explored as a drug target for therapy. However, the drug responses are not durable due to the acquired resistance. MicroRNAs (miRNAs are small noncoding and endogenous molecules that can inhibit mRNA translation initiation and degrade mRNAs. We wonder if some downstream molecules shared by EGFR and the other tyrosine kinase receptors (TKRs further transduce the signals alternatively, and some miRNAs play the key roles in affecting the expression of these downstream molecules. In this study, we investigated the mRNA:miRNA associations for the direct EGFR downstream molecules in the EGFR signaling pathway shared with the other TKRs, including c-MET (hepatocyte growth factor receptor, Ron (a protein tyrosine kinase related to c-MET, PDGFR (platelet-derived growth factor receptor, and IGF-1R (insulin-like growth factor receptor-1. The multiple linear regression and support vector regression (SVR models were used to discover the statistically significant and the best weighted miRNAs regulating the mRNAs of these downstream molecules. These two models revealed the similar mRNA:miRNA associations. It was found that the miRNAs significantly affecting the mRNA expressions in the multiple regression model were also those with the largest weights in the SVR model. To conclude, we effectively identified a list of meaningful mRNA:miRNA associations: phospholipase C, gamma 1 (PLCG1 with miR-34a, phosphoinositide-3-kinase, regulatory subunit 2 (PIK3R2 with miR-30a-5p, growth factor receptor-bound protein 2 (GRB2 with miR-27a, and Janus kinase 1 (JAK1 with miR-302b and miR-520e. These associations could make great contributions to explore new mechanism in NSCLCs. These candidate miRNAs may be regarded as the potential drug targets for treating NSCLCs with acquired drug

  2. Isolation of Microarray-Grade Total RNA, MicroRNA, and DNA from a Single PAXgene Blood RNA Tube

    DEFF Research Database (Denmark)

    Kruhøffer, Mogens; Andersen, Lars Dyrskjøt; Voss, Thorsten

    2007-01-01

    We have developed a procedure for isolation of microRNA and genomic DNA in addition to total RNA from whole blood stabilized in PAXgene Blood RNA tubes. The procedure is based on automatic extraction on a BioRobot MDx and includes isolation of DNA from a fraction of the stabilized blood...... and recovery of small RNA species that are otherwise lost. The procedure presented here is suitable for large-scale experiments and is amenable to further automation. Procured total RNA and DNA was tested using Affymetrix Expression and single-nucleotide polymorphism GeneChips, respectively, and isolated micro......RNA was tested using spotted locked nucleic acid-based microarrays. We conclude that the yield and quality of total RNA, microRNA, and DNA from a single PAXgene blood RNA tube is sufficient for downstream microarray analysis....

  3. Total rRNA-Seq Analysis Gives Insight into Bacterial, Fungal, Protozoal and Archaeal Communities in the Rumen Using an Optimized RNA Isolation Method

    Directory of Open Access Journals (Sweden)

    Chijioke O. Elekwachi

    2017-09-01

    Full Text Available Advances in high throughput, next generation sequencing technologies have allowed an in-depth examination of biological environments and phenomena, and are particularly useful for culture-independent microbial community studies. Recently the use of RNA for metatranscriptomic studies has been used to elucidate the role of active microbes in the environment. Extraction of RNA of appropriate quality is critical in these experiments and TRIzol reagent is often used for maintaining stability of RNA molecules during extraction. However, for studies using rumen content there is no consensus on (1 the amount of rumen digesta to use or (2 the amount of TRIzol reagent to be used in RNA extraction procedures. This study evaluated the effect of using various quantities of ground rumen digesta and of TRIzol reagent on the yield and quality of extracted RNA. It also investigated the possibility of using lower masses of solid-phase rumen digesta and lower amounts of TRIzol reagent than is used currently, for extraction of RNA for metatranscriptomic studies. We found that high quality RNA could be isolated from 2 g of ground rumen digesta sample, whilst using 0.6 g of ground matter for RNA extraction and using 3 mL (a 5:1 TRIzol : extraction mass ratio of TRIzol reagent. This represents a significant savings in the cost of RNA isolation. These lower masses and volumes were then applied in the RNA-Seq analysis of solid-phase rumen samples obtained from 6 Angus X Hereford beef heifers which had been fed a high forage diet (comprised of barley straw in a forage-to-concentrate ratio of 70:30 for 102 days. A bioinformatics analysis pipeline was developed in-house that generated relative abundance values of archaea, protozoa, fungi and bacteria in the rumen and also allowed the extraction of individual rRNA variable regions that could be analyzed in downstream molecular ecology programs. The average relative abundances of rRNA transcripts of archaea, bacteria

  4. Total rRNA-Seq Analysis Gives Insight into Bacterial, Fungal, Protozoal and Archaeal Communities in the Rumen Using an Optimized RNA Isolation Method.

    Science.gov (United States)

    Elekwachi, Chijioke O; Wang, Zuo; Wu, Xiaofeng; Rabee, Alaa; Forster, Robert J

    2017-01-01

    Advances in high throughput, next generation sequencing technologies have allowed an in-depth examination of biological environments and phenomena, and are particularly useful for culture-independent microbial community studies. Recently the use of RNA for metatranscriptomic studies has been used to elucidate the role of active microbes in the environment. Extraction of RNA of appropriate quality is critical in these experiments and TRIzol reagent is often used for maintaining stability of RNA molecules during extraction. However, for studies using rumen content there is no consensus on (1) the amount of rumen digesta to use or (2) the amount of TRIzol reagent to be used in RNA extraction procedures. This study evaluated the effect of using various quantities of ground rumen digesta and of TRIzol reagent on the yield and quality of extracted RNA. It also investigated the possibility of using lower masses of solid-phase rumen digesta and lower amounts of TRIzol reagent than is used currently, for extraction of RNA for metatranscriptomic studies. We found that high quality RNA could be isolated from 2 g of ground rumen digesta sample, whilst using 0.6 g of ground matter for RNA extraction and using 3 mL (a 5:1 TRIzol : extraction mass ratio) of TRIzol reagent. This represents a significant savings in the cost of RNA isolation. These lower masses and volumes were then applied in the RNA-Seq analysis of solid-phase rumen samples obtained from 6 Angus X Hereford beef heifers which had been fed a high forage diet (comprised of barley straw in a forage-to-concentrate ratio of 70:30) for 102 days. A bioinformatics analysis pipeline was developed in-house that generated relative abundance values of archaea, protozoa, fungi and bacteria in the rumen and also allowed the extraction of individual rRNA variable regions that could be analyzed in downstream molecular ecology programs. The average relative abundances of rRNA transcripts of archaea, bacteria, protozoa and fungi in

  5. High-throughput simultaneous analysis of RNA, protein, and lipid biomarkers in heterogeneous tissue samples.

    Science.gov (United States)

    Reiser, Vladimír; Smith, Ryan C; Xue, Jiyan; Kurtz, Marc M; Liu, Rong; Legrand, Cheryl; He, Xuanmin; Yu, Xiang; Wong, Peggy; Hinchcliffe, John S; Tanen, Michael R; Lazar, Gloria; Zieba, Renata; Ichetovkin, Marina; Chen, Zhu; O'Neill, Edward A; Tanaka, Wesley K; Marton, Matthew J; Liao, Jason; Morris, Mark; Hailman, Eric; Tokiwa, George Y; Plump, Andrew S

    2011-11-01

    With expanding biomarker discovery efforts and increasing costs of drug development, it is critical to maximize the value of mass-limited clinical samples. The main limitation of available methods is the inability to isolate and analyze, from a single sample, molecules requiring incompatible extraction methods. Thus, we developed a novel semiautomated method for tissue processing and tissue milling and division (TMAD). We used a SilverHawk atherectomy catheter to collect atherosclerotic plaques from patients requiring peripheral atherectomy. Tissue preservation by flash freezing was compared with immersion in RNAlater®, and tissue grinding by traditional mortar and pestle was compared with TMAD. Comparators were protein, RNA, and lipid yield and quality. Reproducibility of analyte yield from aliquots of the same tissue sample processed by TMAD was also measured. The quantity and quality of biomarkers extracted from tissue prepared by TMAD was at least as good as that extracted from tissue stored and prepared by traditional means. TMAD enabled parallel analysis of gene expression (quantitative reverse-transcription PCR, microarray), protein composition (ELISA), and lipid content (biochemical assay) from as little as 20 mg of tissue. The mean correlation was r = 0.97 in molecular composition (RNA, protein, or lipid) between aliquots of individual samples generated by TMAD. We also demonstrated that it is feasible to use TMAD in a large-scale clinical study setting. The TMAD methodology described here enables semiautomated, high-throughput sampling of small amounts of heterogeneous tissue specimens by multiple analytical techniques with generally improved quality of recovered biomolecules.

  6. RNA Crystallization

    Science.gov (United States)

    Golden, Barbara L.; Kundrot, Craig E.

    2003-01-01

    RNA molecules may be crystallized using variations of the methods developed for protein crystallography. As the technology has become available to syntheisize and purify RNA molecules in the quantities and with the quality that is required for crystallography, the field of RNA structure has exploded. The first consideration when crystallizing an RNA is the sequence, which may be varied in a rational way to enhance crystallizability or prevent formation of alternate structures. Once a sequence has been designed, the RNA may be synthesized chemically by solid-state synthesis, or it may be produced enzymatically using RNA polymerase and an appropriate DNA template. Purification of milligram quantities of RNA can be accomplished by HPLC or gel electrophoresis. As with proteins, crystallization of RNA is usually accomplished by vapor diffusion techniques. There are several considerations that are either unique to RNA crystallization or more important for RNA crystallization. Techniques for design, synthesis, purification, and crystallization of RNAs will be reviewed here.

  7. Rho A Regulates Epidermal Growth Factor-Induced Human Osteosarcoma MG63 Cell Migration

    Directory of Open Access Journals (Sweden)

    Jinyang Wang

    2018-05-01

    Full Text Available Osteosarcoma, the most common primary bone tumor, occurs most frequently in children and adolescents and has a 5-year survival rate, which is unsatisfactory. As epidermal growth factor receptor (EGFR positively correlates with TNM (tumor-node-metastasis stage in osteosarcoma, EGFR may play an important role in its progression. The purpose of this study was to explore potential mechanisms underlying this correlation. We found that EGF promotes MG63 cell migration and invasion as well as stress fiber formation via Rho A activation and that these effects can be reversed by inhibiting Rho A expression. In addition, molecules downstream of Rho A, including ROCK1, LIMK2, and Cofilin, are activated by EGF in MG63 cells, leading to actin stress fiber formation and cell migration. Moreover, inhibition of ROCK1, LIMK2, or Cofilin in MG63 cells using known inhibitors or short hairpin RNA (shRNA prevents actin stress fiber formation and cell migration. Thus, we conclude that Rho A/ROCK1/LIMK2/Cofilin signaling mediates actin microfilament formation in MG63 cells upon EGFR activation. This novel pathway provides a promising target for preventing osteosarcoma progression and for treating this cancer.

  8. Clinical Translation and Validation of a Predictive Biomarker for Patritumab, an Anti-human Epidermal Growth Factor Receptor 3 (HER3) Monoclonal Antibody, in Patients With Advanced Non-small Cell Lung Cancer.

    Science.gov (United States)

    Mendell, Jeanne; Freeman, Daniel J; Feng, Wenqin; Hettmann, Thore; Schneider, Matthias; Blum, Sabine; Ruhe, Jens; Bange, Johannes; Nakamaru, Kenji; Chen, Shuquan; Tsuchihashi, Zenta; von Pawel, Joachim; Copigneaux, Catherine; Beckman, Robert A

    2015-03-01

    During early clinical development, prospective identification of a predictive biomarker and validation of an assay method may not always be feasible. Dichotomizing a continuous biomarker measure to classify responders also leads to challenges. We present a case study of a prospective-retrospective approach for a continuous biomarker identified after patient enrollment but defined prospectively before the unblinding of data. An analysis of the strengths and weaknesses of this approach and the challenges encountered in its practical application are also provided. HERALD (NCT02134015) was a double-blind, phase 2 study in patients with non-small cell lung cancer (NSCLC) randomized to erlotinib with placebo or with high or low doses of patritumab, a monoclonal antibody targeted against human epidermal growth factor receptor 3 (HER3). While the primary objective was to assess safety and progression-free survival (PFS), a secondary objective was to determine a single predictive biomarker hypothesis to identify subjects most likely to benefit from the addition of patritumab. Although not identified as the primary biomarker in the study protocol, on the basis of preclinical results from 2 independent laboratories, expression levels of the HER3 ligand heregulin (HRG) were prospectively declared the predictive biomarker before data unblinding but after subject enrollment. An assay to measure HRG mRNA was developed and validated. Other biomarkers, such as epidermal growth factor receptor (EGFR) mutation status, were also evaluated in an exploratory fashion. The cutoff value for high vs. low HRG mRNA levels was set at the median delta threshold cycle. A maximum likelihood analysis was performed to evaluate the provisional cutoff. The relationship of HRG values to PFS hazard ratios (HRs) was assessed as a measure of internal validation. Additional NSCLC samples were analyzed to characterize HRG mRNA distribution. The subgroup of patients with high HRG mRNA levels ("HRG-high

  9. Role of submandibular saliva and epidermal growth factor in gastric cytoprotection

    DEFF Research Database (Denmark)

    Poulsen, Steen Seier

    1984-01-01

    without submandibular glands. Exogenous EGF and saliva with a high but still physiological concentration of EGF significantly reduced the median area in the stomach displaying ulcers and ulcerations, whereas saliva without EGF had no effect. Although EGF is a known inhibitor of gastric acid secretion......The role of submandibular epidermal growth factor in protection of the gastric mucosa was investigated in rats. Removal of the submandibular glands and thereby submandibular epidermal growth factor (EGF) caused rats to develop gastric lesions (ulcerations and ulcers) after administration......, the dose used in the present study had no effect on gastric acid secretion in chronic gastric fistula rats; removal of the submandibular glands also did not have any such effect. We conclude that exocrine secretion of submandibular EGF has a cytoprotective function in the stomach, an effect that may...

  10. Oxygen dependency of epidermal growth factor receptor binding and DNA synthesis of rat hepatocytes

    International Nuclear Information System (INIS)

    Hirose, Tetsuro; Terajima, Hiroaki; Yamauchi, Akira

    1997-01-01

    Background/Aims: Changes in oxygen availability modulate replicative responses in several cell types, but the effects on hepatocyte replication remain unclear. We have studied the effects of transient nonlethal hypoxia on epidermal growth factor receptor binding and epidermal growth factor-induced DNA synthesis of rat hepatocytes. Methods: Lactate dehydrogenase activity in culture supernatant, intracellular adenosine triphosphate content, 125 I-epidermal growth factor specific binding, epidermal growth factor receptor protein expression, and 3 H-thymidine incorporation were compared between hepatocytes cultured in hypoxia and normoxia. Results: Hypoxia up to 3 h caused no significant increase in lactate dehydrogenase activity in the culture supernatant, while intracellular adenosine triphosphate content decreased time-dependently and was restored to normoxic levels by reoxygenation (nonlethal hypoxia). Concomitantly, 125 I-epidermal growth factor specific binding to hepatocytes decreased time-dependently (to 54.1% of normoxia) and was restored to control levels by reoxygenation, although 125 I-insulin specific binding was not affected. The decrease in 125 I-epidermal growth factor specific binding was explained by the decrease in the number or available epidermal growth factor receptors (21.37±3.08 to 12.16±1.42 fmol/10 5 cells), while the dissociation constant of the receptor was not affected. The change in the number of available receptors was not considered to be due to receptor degradation-resynthesis, since immuno-detection of the epidermal growth factor receptor revealed that the receptor protein expression did not change during hypoxia and reoxygenation, and since neither actinomycin D nor cycloheximide affected the recovery of 125 I-epidermal growth factor binding by reoxygenation. Inhibition of epidermal growth factor-induced DNA synthesis after hypoxia (to 75.4% of normoxia by 3 h hypoxia) paralleled the decrease in 125 I-epidermal growth factor binding

  11. Identification of a Polyomavirus microRNA Highly Expressed in Tumors

    Science.gov (United States)

    Chen, Chun Jung; Cox, Jennifer E.; Azarm, Kristopher; Wylie, Karen N.; Woolard, Kevin D.; Pesavento, Patricia A.; Sullivan, Christopher S.

    2014-01-01

    Polyomaviruses (PyVs) are associated with tumors including Merkel cell carcinoma (MCC). Several PyVs encode microRNAs (miRNAs) but to date no abundant PyV miRNAs have been reported in tumors. To better understand the function of the Merkel cell PyV (MCPyV) miRNA, we examined phylogenetically-related viruses for miRNA expression. We show that two primate PyVs and the more distantly-related raccoon PyV (RacPyV) encode miRNAs that share genomic position and partial sequence identity with MCPyV miRNAs. Unlike MCPyV miRNA in MCC, RacPyV miRNA is highly abundant in raccoon tumors. RacPyV miRNA negatively regulates reporters of early viral (T antigen) transcripts, yet robust viral miRNA expression is tolerated in tumors. We also identify raccoon miRNAs expressed in RacPyV-associated neuroglial brain tumors, including several likely oncogenic miRNAs (oncomiRs). This work describes the first PyV miRNA abundantly expressed in tumors and is consistent with a possible role for both host and viral miRNAs in RacPyV-associated tumors. PMID:25514573

  12. A rapid silica spin column-based method of RNA extraction from fruit trees for RT-PCR detection of viruses.

    Science.gov (United States)

    Yang, Fan; Wang, Guoping; Xu, Wenxing; Hong, Ni

    2017-09-01

    Efficient recovery of high quality RNA is very important for successful RT-PCR detection of plant RNA viruses. High levels of polyphenols and polysaccharides in plant tissues can irreversibly bind to and/or co-precipitate with RNA, which influences RNA isolation. In this study, a silica spin column-based RNA isolation method was developed by using commercially available silica columns combined with the application of a tissue lysis solution, and binding and washing buffers with high concentration guanidinium thiocyanate (GuSCN, 50% w/v), which helps remove plant proteins, polysaccharides and polyphenolic compounds. The method was successfully used to extract high quality RNA from citrus (Citrus aurantifolia), grapevine (Vitis vinifera), peach (Prunus persica), pear (Pyrus spp.), taro (Colocosia esculenta) and tobacco (Nicotiana benthamiana) samples. The method was comparable to conventional CTAB method in RNA isolation efficiency, but it was more sample-adaptable and cost-effective than commercial kits. High quality RNA isolated using silica spin column-based method was successfully used for the RT-PCR and/or multiplex RT-PCR amplification of woody fruit tree viruses and a viroid. The study provided a useful tool for the detection and characterization of plant viruses. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. Comparison of microRNA expression using different preservation methods of matched psoriatic skin samples

    DEFF Research Database (Denmark)

    Løvendorf, Marianne B; Zibert, John R; Hagedorn, Peter H

    2012-01-01

    MicroRNAs are non-coding RNA molecules modulating gene expression post-transcriptionally. Formalin-fixed, paraffin-embedding (FFPE) is a standard preservation method often used in clinical practices, but induces RNA degradation. Extracting high-quality RNA from human skin can be challenging as skin...

  14. Unravelling the complexity of microRNA-mediated gene regulation in black pepper (Piper nigrum L.) using high-throughput small RNA profiling.

    Science.gov (United States)

    Asha, Srinivasan; Sreekumar, Sweda; Soniya, E V

    2016-01-01

    Analysis of high-throughput small RNA deep sequencing data, in combination with black pepper transcriptome sequences revealed microRNA-mediated gene regulation in black pepper ( Piper nigrum L.). Black pepper is an important spice crop and its berries are used worldwide as a natural food additive that contributes unique flavour to foods. In the present study to characterize microRNAs from black pepper, we generated a small RNA library from black pepper leaf and sequenced it by Illumina high-throughput sequencing technology. MicroRNAs belonging to a total of 303 conserved miRNA families were identified from the sRNAome data. Subsequent analysis from recently sequenced black pepper transcriptome confirmed precursor sequences of 50 conserved miRNAs and four potential novel miRNA candidates. Stem-loop qRT-PCR experiments demonstrated differential expression of eight conserved miRNAs in black pepper. Computational analysis of targets of the miRNAs showed 223 potential black pepper unigene targets that encode diverse transcription factors and enzymes involved in plant development, disease resistance, metabolic and signalling pathways. RLM-RACE experiments further mapped miRNA-mediated cleavage at five of the mRNA targets. In addition, miRNA isoforms corresponding to 18 miRNA families were also identified from black pepper. This study presents the first large-scale identification of microRNAs from black pepper and provides the foundation for the future studies of miRNA-mediated gene regulation of stress responses and diverse metabolic processes in black pepper.

  15. Circulating chromatin-anti-chromatin antibody complexes bind with high affinity to dermo-epidermal structures in murine and human lupus nephritis

    DEFF Research Database (Denmark)

    Fismen, S; Hedberg, A; Fenton, K A

    2009-01-01

    Murine and human lupus nephritis are characterized by glomerular deposits of electron-dense structures (EDS). Dominant components of EDS are chromatin fragments and IgG antibodies. Whether glomerular EDS predispose for similar deposits in skin is unknown. We analysed (i) whether dermo-epidermal i......Murine and human lupus nephritis are characterized by glomerular deposits of electron-dense structures (EDS). Dominant components of EDS are chromatin fragments and IgG antibodies. Whether glomerular EDS predispose for similar deposits in skin is unknown. We analysed (i) whether dermo......-epidermal immune complex deposits have similar molecular composition as glomerular deposits, (ii) whether chromatin fragments bind dermo-epidermal structures, and (iii) whether deposits in nephritic glomeruli predispose for accumulation of similar deposits in skin. Paired skin and kidney biopsies from nephritic...... (NZBxNZW)F1 and MRL-lpr/lpr mice and from five patients with lupus nephritis were analysed by immunofluorescence, immune electron microscopy (IEM) and co-localization TUNEL IEM. Affinity of chromatin fragments for membrane structures was determined by surface plasmon resonance. Results demonstrated (i...

  16. Ventilation-induced increases in EGFR ligand mRNA are not altered by intra-amniotic LPS or ureaplasma in preterm lambs.

    Science.gov (United States)

    Hillman, Noah H; Gisslen, Tate; Polglase, Graeme R; Kallapur, Suhas G; Jobe, Alan H

    2014-01-01

    Chorioamnionitis and mechanical ventilation are associated with bronchopulmonary dysplasia (BPD) in preterm infants. Mechanical ventilation at birth activates both inflammatory and acute phase responses. These responses can be partially modulated by previous exposure to intra-amniotic (IA) LPS or Ureaplasma parvum (UP). Epidermal growth factor receptor (EGFR) ligands participate in lung development, and angiotensin converting enzyme (ACE) 1 and ACE2 contribute to lung inflammation. We asked whether brief mechanical ventilation at birth altered EGFR and ACE pathways and if antenatal exposure to IA LPS or UP could modulate these effects. Ewes were exposed to IA injections of UP, LPS or saline multiple days prior to preterm delivery at 85% gestation. Lambs were either immediately euthanized or mechanically ventilated for 2 to 3 hr. IA UP and LPS cause modest changes in the EGFR ligands amphiregulin (AREG), epiregulin (EREG), heparin binding epidermal growth factor (HB-EGF), and betacellulin (BTC) mRNA expression. Mechanical ventilation greatly increased mRNA expression of AREG, EREG, and HB-EGF, with no additional increases resulting from IA LPS or UP. With ventilation AREG and EREG mRNA localized to cells in terminal airspace. EGFR mRNA also increased with mechanical ventilation. IA UP and LPS decreased ACE1 mRNA and increased ACE2 mRNA, resulting in a 4 fold change in the ACE1/ACE2 ratio. Mechanical ventilation with large tidal volumes increased both ACE1 and ACE2 expression. The alterations seen in ACE with IA exposures and EGFR pathways with mechanical ventilation may contribute to the development of BPD in preterm infants.

  17. Expression and significance of HMGB1, TLR4 and NF-κB p65 in human epidermal tumors

    International Nuclear Information System (INIS)

    Weng, Hui; Deng, Yunhua; Xie, Yuyan; Liu, Hongbo; Gong, Feili

    2013-01-01

    High mobility group protein box 1 (HMGB1) is a DNA binding protein located in nucleus. It is released into extracellular fluid where it acts as a novel proinflammatory cytokine which interacts with Toll like receptor 4 (TLR4) to activate nuclear factor-κB (NF-κB). This sequence of events is involved in tumor growth and progression. However, the effects of HMGB1, TLR4 and NF-κB on epidermal tumors remain unclear. Human epidermal tumor specimens were obtained from 96 patients. Immunohistochemistry was used to detect expression of HMGB1, TLR4 and NF-κB p65 in human epidermal tumor and normal skin specimens. Western blot analysis was used to detect the expression of NF-κB p65 in epithelial cell nuclei in human epidermal tumor and normal tissues. Immunohistochemistry and western blot analysis indicated a progressive but statistically significant increase in p65 expression in epithelial nuclei in benign seborrheic keratosis (SK), precancerous lesions (PCL), low malignancy basal cell carcinoma (BCC) and high malignancy squamous cell carcinoma (SCC) (P <0.01). The level of extracellular HMGB1 in SK was significantly higher than in normal skin (NS) (P <0.01), and was higher than in SCC but without statistical significance. The level of TLR4 on epithelial membranes of SCC cells was significantly higher than in SK, PCL, BCC and NS (P <0.01). There was a significant positive correlation between p65 expression in the epithelial nuclei and TLR4 expression on the epithelial cell membranes (r = 0.3212, P <0.01). These findings indicate that inflammation is intensified in parallel with increasing malignancy. They also indicate that the TLR4 signaling pathway, rather than HMGB1, may be the principal mediator of inflammation in high-grade malignant epidermal tumors. Combined detection of p65 in the epithelial nuclei and TLR4 on the epithelial membranes may assist the accurate diagnosis of malignant epidermal tumors

  18. How the RNA isolation method can affect microRNA microarray results

    DEFF Research Database (Denmark)

    Podolska, Agnieszka; Kaczkowski, Bogumil; Litman, Thomas

    2011-01-01

    RNA microarray analysis on porcine brain tissue. One method is a phenol-guanidine isothiocyanate-based procedure that permits isolation of total RNA. The second method, miRVana™ microRNA isolation, is column based and recovers the small RNA fraction alone. We found that microarray analyses give different results...... that depend on the RNA fraction used, in particular because some microRNAs appear very sensitive to the RNA isolation method. We conclude that precautions need to be taken when comparing microarray studies based on RNA isolated with different methods.......The quality of RNA is crucial in gene expression experiments. RNA degradation interferes in the measurement of gene expression, and in this context, microRNA quantification can lead to an incorrect estimation. In the present study, two different RNA isolation methods were used to perform micro...

  19. Mycobacterial RNA isolation optimized for non-coding RNA: high fidelity isolation of 5S rRNA from Mycobacterium bovis BCG reveals novel post-transcriptional processing and a complete spectrum of modified ribonucleosides.

    Science.gov (United States)

    Hia, Fabian; Chionh, Yok Hian; Pang, Yan Ling Joy; DeMott, Michael S; McBee, Megan E; Dedon, Peter C

    2015-03-11

    A major challenge in the study of mycobacterial RNA biology is the lack of a comprehensive RNA isolation method that overcomes the unusual cell wall to faithfully yield the full spectrum of non-coding RNA (ncRNA) species. Here, we describe a simple and robust procedure optimized for the isolation of total ncRNA, including 5S, 16S and 23S ribosomal RNA (rRNA) and tRNA, from mycobacteria, using Mycobacterium bovis BCG to illustrate the method. Based on a combination of mechanical disruption and liquid and solid-phase technologies, the method produces all major species of ncRNA in high yield and with high integrity, enabling direct chemical and sequence analysis of the ncRNA species. The reproducibility of the method with BCG was evident in bioanalyzer electrophoretic analysis of isolated RNA, which revealed quantitatively significant differences in the ncRNA profiles of exponentially growing and non-replicating hypoxic bacilli. The method also overcame an historical inconsistency in 5S rRNA isolation, with direct sequencing revealing a novel post-transcriptional processing of 5S rRNA to its functional form and with chemical analysis revealing seven post-transcriptional ribonucleoside modifications in the 5S rRNA. This optimized RNA isolation procedure thus provides a means to more rigorously explore the biology of ncRNA species in mycobacteria. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  20. Expressed microRNA associated with high rate of egg production in chicken ovarian follicles.

    Science.gov (United States)

    Wu, N; Gaur, U; Zhu, Q; Chen, B; Xu, Z; Zhao, X; Yang, M; Li, D

    2017-04-01

    MicroRNA (miRNA) is a highly conserved class of small noncoding RNA about 19-24 nucleotides in length that function in a specific manner to post-transcriptionally regulate gene expression in organisms. Tissue miRNA expression studies have discovered a myriad of functions for miRNAs in various aspects, but a role for miRNAs in chicken ovarian tissue at 300 days of age has not hitherto been reported. In this study, we performed the first miRNA analysis of ovarian tissues in chickens with low and high rates of egg production using high-throughput sequencing. By comparing low rate of egg production chickens with high rate of egg production chickens, 17 significantly differentially expressed miRNAs were found (P chickens with high rates of egg production, suggesting that these miRNAs have an important role in ovary development and reproductive management of chicken. Furthermore, we uncovered that a significantly up-regulated miRNA-gga-miR-200a-3p-is ubiquitous in reproduction-regulation-related pathways. This miRNA may play a special central role in the reproductive management of chicken, and needs to be further studied for confirmation. © 2016 Stichting International Foundation for Animal Genetics.

  1. Concise Review: Wnt Signaling Pathways in Skin Development and Epidermal Stem Cells.

    Science.gov (United States)

    Veltri, Anthony; Lang, Christopher; Lien, Wen-Hui

    2018-01-01

    Mammalian skin and its appendages constitute the integumentary system forming a barrier between the organism and its environment. During development, skin epidermal cells divide rapidly and stratify into a multilayered epithelium, as well as invaginate downward in the underlying mesenchyme to form hair follicles (HFs). In postnatal skin, the interfollicular epidermal (IFE) cells continuously proliferate and differentiate while HFs undergo cycles of regeneration. Epidermal regeneration is fueled by epidermal stem cells (SCs) located in the basal layer of the IFE and the outer layer of the bulge in the HF. Epidermal development and SC behavior are mainly regulated by various extrinsic cues, among which Wnt-dependent signaling pathways play crucial roles. This review not only summarizes the current knowledge of Wnt signaling pathways in the regulation of skin development and governance of SCs during tissue homeostasis, but also discusses the potential crosstalk of Wnt signaling with other pathways involved in these processes. Stem Cells 2018;36:22-35. © 2017 AlphaMed Press.

  2. Penile epidermal inclusion cyst: a late complication of penile girth enhancement surgery.

    Science.gov (United States)

    Park, Hyun Jun; Park, Nam Cheol; Park, Sung Woo; Jern, Tae Kyung; Choi, Kyung-Un

    2008-09-01

    Epidermal inclusion cysts are benign lesions that can develop in any part of the body. However, the finding of an epidermal inclusion cyst in the penis is rare. The aim of this article was to present the management of a case of a penile epidermal inclusion cyst that occurred because of late complications of a penile girth enhancement surgery. A 52-year-old man presented with a painless, slowly growing mass in the penis, which was first noted after a penile girth enhancement surgery 20 years ago. A cystic mobile mass about 2 cm in depth was found surrounding the coronal sulcus. Excision of the mass was performed for diagnosis and treatment. There was no communication with the urethra. The pathological diagnosis was an epidermal inclusion cyst of the penis. A penile epidermal inclusion cyst in adult men is rare. It can develop after an inadequate procedure for penile girth enhancement, and should be treated by complete resection.

  3. Optimisation of high-quality total ribonucleic acid isolation from cartilaginous tissues for real-time polymerase chain reaction analysis.

    Science.gov (United States)

    Peeters, M; Huang, C L; Vonk, L A; Lu, Z F; Bank, R A; Helder, M N; Doulabi, B Zandieh

    2016-11-01

    Studies which consider the molecular mechanisms of degeneration and regeneration of cartilaginous tissues are seriously hampered by problematic ribonucleic acid (RNA) isolations due to low cell density and the dense, proteoglycan-rich extracellular matrix of cartilage. Proteoglycans tend to co-purify with RNA, they can absorb the full spectrum of UV light and they are potent inhibitors of polymerase chain reaction (PCR). Therefore, the objective of the present study is to compare and optimise different homogenisation methods and RNA isolation kits for an array of cartilaginous tissues. Tissue samples such as the nucleus pulposus (NP), annulus fibrosus (AF), articular cartilage (AC) and meniscus, were collected from goats and homogenised by either the MagNA Lyser or Freezer Mill. RNA of duplicate samples was subsequently isolated by either TRIzol (benchmark), or the RNeasy Lipid Tissue, RNeasy Fibrous Tissue, or Aurum Total RNA Fatty and Fibrous Tissue kits. RNA yield, purity, and integrity were determined and gene expression levels of type II collagen and aggrecan were measured by real-time PCR. No differences between the two homogenisation methods were found. RNA isolation using the RNeasy Fibrous and Lipid kits resulted in the purest RNA (A260/A280 ratio), whereas TRIzol isolations resulted in RNA that is not as pure, and show a larger difference in gene expression of duplicate samples compared with both RNeasy kits. The Aurum kit showed low reproducibility. For the extraction of high-quality RNA from cartilaginous structures, we suggest homogenisation of the samples by the MagNA Lyser. For AC, NP and AF we recommend the RNeasy Fibrous kit, whereas for the meniscus the RNeasy Lipid kit is advised.Cite this article: M. Peeters, C. L. Huang, L. A. Vonk, Z. F. Lu, R. A. Bank, M. N. Helder, B. Zandieh Doulabi. Optimisation of high-quality total ribonucleic acid isolation from cartilaginous tissues for real-time polymerase chain reaction analysis. Bone Joint Res 2016

  4. IntaRNA 2.0: enhanced and customizable prediction of RNA-RNA interactions.

    Science.gov (United States)

    Mann, Martin; Wright, Patrick R; Backofen, Rolf

    2017-07-03

    The IntaRNA algorithm enables fast and accurate prediction of RNA-RNA hybrids by incorporating seed constraints and interaction site accessibility. Here, we introduce IntaRNAv2, which enables enhanced parameterization as well as fully customizable control over the prediction modes and output formats. Based on up to date benchmark data, the enhanced predictive quality is shown and further improvements due to more restrictive seed constraints are highlighted. The extended web interface provides visualizations of the new minimal energy profiles for RNA-RNA interactions. These allow a detailed investigation of interaction alternatives and can reveal potential interaction site multiplicity. IntaRNAv2 is freely available (source and binary), and distributed via the conda package manager. Furthermore, it has been included into the Galaxy workflow framework and its already established web interface enables ad hoc usage. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  5. Tissue localization of u.v.-B-screening pigments and of chalcone synthase mRNA in needles of Scots pine seedlings

    International Nuclear Information System (INIS)

    Schnitzler, J.P.; Jungblut, T.P.; Heller, W.; Köfferlein, M.; Hutzler, P.; Heinzmann, U.; Schmelzer, E.; Ernst, D.; Langebartels, C.; Sandermann, H. Jr.

    1996-01-01

    Epidermal tissue was isolated from Scots pine (Pinus sylvestris L.) needles by enzymatic digestion in order to study tissue distribution of u.v.-B-screening pigments. Up to 90% of the needle content of a group of diacylated flavonol glycosides that were structurally closely related was found in the epidermal layer. Among these metabolites, 3'',6''-di-para-coumaroyl-isoquercitrin and 3'',6''-di-para-coumaroyl-astragalin were the main u.v.-B-induced compounds in cotyledons and primary needles, respectively. However, catechin and astragalin (kaempferol 3-glucoside), two non-acylated flavonoid metabolites, were only observed in total needle extracts, and at levels independent of u.v.-B treatment. According to this metabolite distribution, the mRNA of chalcone synthase, the key enzyme to flavonoids, was found in epidermal and mesophyll as well as vascular tissues. The major alkaliextractable wall-bound phenolic metabolites, astragalin, 4-coumaric acid, and ferulic acid, a minor component of the cell wall, were also found exclusively in the epidermal layer. These compounds were not stimulated by u.v.-B irradiation within the experimental period. Staining of needle cross sections and epidermal layer preparations with Naturstoffreagenz A confirmed the specific localization of wall-bound astragalin in the outer wall of the epidermal layer. Model calculations of u.v.-B absorptions at 300 nm of soluble and cell-wall-bound metabolites of the epidermal layer revealed an almost complete shielding of the mesophyll tissue from u.v.-B radiation

  6. Keratins K2 and K10 are essential for the epidermal integrity of plantar skin.

    Science.gov (United States)

    Fischer, Heinz; Langbein, Lutz; Reichelt, Julia; Buchberger, Maria; Tschachler, Erwin; Eckhart, Leopold

    2016-01-01

    K1 and K2 are the main type II keratins in the suprabasal epidermis where each of them heterodimerizes with the type I keratin K10 to form intermediate filaments. In regions of the ears, tail, and soles of the mouse, only K2 is co-expressed with K10, suggesting that these keratins suffice to form a mechanically resilient cytoskeleton. To determine the effects of the suppression of both main keratins, K2 and K10, in the suprabasal plantar epidermis of the mouse. Krt2(-/-) Krt10(-/-) mice were generated by crossing Krt2(-/-) and Krt10(-/-) mice. Epidermal morphology of soles of hind-paws was examined macroscopically and histologically. Immunofluorescence analysis and quantitative PCR analysis were performed to analyze the expression of keratins in sole skin of wildtype and Krt2(-/-) Krt10(-/-) mice. Highly abundant proteins of the sole stratum corneum were determined by electrophoretic and chromatographic separation and subsequent mass spectrometry. K2 and K10 are the most prominent suprabasal keratins in normal mouse soles with the exception of the footpads where K1, K9 and K10 predominate. Mice lacking both K2 and K10 were viable and developed epidermal acanthosis and hyperkeratosis in inter-footpad epidermis of the soles. The expression of keratins K1, K9 and K16 was massively increased at the RNA and protein levels in the soles of Krt2(-/-) Krt10(-/-) mice. This study demonstrates that the loss of the main cytoskeletal components of plantar epidermis, i.e. K2 and K10, can be only partly compensated by the upregulation of other keratins. The thickening of the epidermis in the soles of Krt2(-/-) Krt10(-/-) mice may serve as a model for pathomechanistic aspects of palmoplantar keratoderma. Copyright © 2015. Published by Elsevier Ireland Ltd.

  7. Topical Treatment for Stevens - Johnson Syndrome and Toxic Epidermal Necrolysis: A Review

    Directory of Open Access Journals (Sweden)

    Schandra Purnamawati

    2016-08-01

    Full Text Available Background: Stevens - Johnson syndrome (SJS and Toxic Epidermal Necrolysis (TEN are currently regarded to be same disease entity which differs only in the extent and severity of epidermal sloughing. Both are potentially life-threatening mucocutaneous immunologic reaction, which are most frequently induced by drug consumption. The epithelial destruction of skin and mucosal membrane can cause both acute as well as chronic/ long term outcomes in term of  late sequelae during the course of the disease. Sequelae often occur during the late phase of SJS/TEN and become a significant problem due its chronicity and severe degree of impairment, which leads to deterioration of quality of life for the patients. This may prevented or decreased in terms of intensity if the patient’s received prompt and sufficient topical therapy, particularly in managing lesions on the mucosa of the eye, oral, and genital. Objective : This review underlines topical therapies which could be delivered for management of mucocutaneous lesions from SJS/ TEN, aimed to prevent late sequelae due to SJS – TEN in order to improve the life quality of SJS – TEN survivors. Conclusion: SJS/ TEN frequently lead to late sequeale which includes skin, ocular, oral, and genital involvement. These sequelaes are often severe and chonic. Thus, may cause significant decrease in quality of life of SJS/TEN survivors. It is therefore most important to detect them early in order to manage them adequately. To date, we still have an impression that the specific sequelae of SJS – TEN are often late diagnosed and insufficiently treated. Finally, we want to emphasize that for mucosal involvement in particular, such as ocular, genital and oral involvement, a careful topical treatment have to be taken into special consideration in order to prevent severe late sequelae. 

  8. 5S rRNA Promoter for Guide RNA Expression Enabled Highly Efficient CRISPR/Cas9 Genome Editing in Aspergillus niger.

    Science.gov (United States)

    Zheng, Xiaomei; Zheng, Ping; Zhang, Kun; Cairns, Timothy C; Meyer, Vera; Sun, Jibin; Ma, Yanhe

    2018-04-30

    The CRISPR/Cas9 system is a revolutionary genome editing tool. However, in eukaryotes, search and optimization of a suitable promoter for guide RNA expression is a significant technical challenge. Here we used the industrially important fungus, Aspergillus niger, to demonstrate that the 5S rRNA gene, which is both highly conserved and efficiently expressed in eukaryotes, can be used as a guide RNA promoter. The gene editing system was established with 100% rates of precision gene modifications among dozens of transformants using short (40-bp) homologous donor DNA. This system was also applicable for generation of designer chromosomes, as evidenced by deletion of a 48 kb gene cluster required for biosynthesis of the mycotoxin fumonisin B1. Moreover, this system also facilitated simultaneous mutagenesis of multiple genes in A. niger. We anticipate that the use of the 5S rRNA gene as guide RNA promoter can broadly be applied for engineering highly efficient eukaryotic CRISPR/Cas9 toolkits. Additionally, the system reported here will enable development of designer chromosomes in model and industrially important fungi.

  9. Periostin contributes to epidermal hyperplasia in psoriasis common to atopic dermatitis

    Directory of Open Access Journals (Sweden)

    Kazuhiko Arima

    2015-01-01

    Conclusions: Periostin plays an important role during epidermal hyperplasia in IMQ-induced skin inflammation, independently of the IL-23–IL-17/IL-22 axis. Periostin appears to be a mediator for epidermal hyperplasia that is common to AD and psoriasis.

  10. Keratin 17 is overexpressed and predicts poor survival in estrogen receptor-negative/human epidermal growth factor receptor-2-negative breast cancer.

    Science.gov (United States)

    Merkin, Ross D; Vanner, Elizabeth A; Romeiser, Jamie L; Shroyer, A Laurie W; Escobar-Hoyos, Luisa F; Li, Jinyu; Powers, Robert S; Burke, Stephanie; Shroyer, Kenneth R

    2017-04-01

    Clinicopathological features of breast cancer have limited accuracy to predict survival. By immunohistochemistry (IHC), keratin 17 (K17) expression has been correlated with triple-negative status (estrogen receptor [ER]/progesterone receptor/human epidermal growth factor receptor-2 [HER2] negative) and decreased survival, but K17 messenger RNA (mRNA) expression has not been evaluated in breast cancer. K17 is a potential prognostic cancer biomarker, targeting p27, and driving cell cycle progression. This study compared K17 protein and mRNA expression to ER/progesterone receptor/HER2 receptor status and event-free survival. K17 IHC was performed on 164 invasive breast cancers and K17 mRNA was evaluated in 1097 breast cancers. The mRNA status of other keratins (16/14/9) was evaluated in 113 ER - /HER2 - ductal carcinomas. IHC demonstrated intense cytoplasmic and membranous K17 localization in myoepithelial cells of benign ducts and lobules and tumor cells of ductal carcinoma in situ. In ductal carcinomas, K17 protein was detected in most triple-negative tumors (28/34, 82%), some non-triple-negative tumors (52/112, 46%), but never in lobular carcinomas (0/15). In ductal carcinomas, high K17 mRNA was associated with reduced 5-year event-free survival in advanced tumor stage (n = 149, hazard ratio [HR] = 3.68, P = .018), and large (n = 73, HR = 3.95, P = .047), triple-negative (n = 103, HR = 2.73, P = .073), and ER - /HER2 - (n = 113, HR = 2.99, P = .049) tumors. There were significant correlations among keratins 17, 16, 14, and 9 mRNA levels suggesting these keratins (all encoded on chromosome 17) could be coordinately expressed in breast cancer. Thus, K17 is expressed in a subset of triple-negative breast cancers, and is a marker of poor prognosis in patients with advanced stage and ER - /HER2 - breast cancer. Copyright © 2016 Elsevier Inc. All rights reserved.

  11. Evaluating Methods for Isolating Total RNA and Predicting the Success of Sequencing Phylogenetically Diverse Plant Transcriptomes

    Science.gov (United States)

    Bruskiewich, Richard; Burris, Jason N.; Carrigan, Charlotte T.; Chase, Mark W.; Clarke, Neil D.; Covshoff, Sarah; dePamphilis, Claude W.; Edger, Patrick P.; Goh, Falicia; Graham, Sean; Greiner, Stephan; Hibberd, Julian M.; Jordon-Thaden, Ingrid; Kutchan, Toni M.; Leebens-Mack, James; Melkonian, Michael; Miles, Nicholas; Myburg, Henrietta; Patterson, Jordan; Pires, J. Chris; Ralph, Paula; Rolf, Megan; Sage, Rowan F.; Soltis, Douglas; Soltis, Pamela; Stevenson, Dennis; Stewart, C. Neal; Surek, Barbara; Thomsen, Christina J. M.; Villarreal, Juan Carlos; Wu, Xiaolei; Zhang, Yong; Deyholos, Michael K.; Wong, Gane Ka-Shu

    2012-01-01

    Next-generation sequencing plays a central role in the characterization and quantification of transcriptomes. Although numerous metrics are purported to quantify the quality of RNA, there have been no large-scale empirical evaluations of the major determinants of sequencing success. We used a combination of existing and newly developed methods to isolate total RNA from 1115 samples from 695 plant species in 324 families, which represents >900 million years of phylogenetic diversity from green algae through flowering plants, including many plants of economic importance. We then sequenced 629 of these samples on Illumina GAIIx and HiSeq platforms and performed a large comparative analysis to identify predictors of RNA quality and the diversity of putative genes (scaffolds) expressed within samples. Tissue types (e.g., leaf vs. flower) varied in RNA quality, sequencing depth and the number of scaffolds. Tissue age also influenced RNA quality but not the number of scaffolds ≥1000 bp. Overall, 36% of the variation in the number of scaffolds was explained by metrics of RNA integrity (RIN score), RNA purity (OD 260/230), sequencing platform (GAIIx vs HiSeq) and the amount of total RNA used for sequencing. However, our results show that the most commonly used measures of RNA quality (e.g., RIN) are weak predictors of the number of scaffolds because Illumina sequencing is robust to variation in RNA quality. These results provide novel insight into the methods that are most important in isolating high quality RNA for sequencing and assembling plant transcriptomes. The methods and recommendations provided here could increase the efficiency and decrease the cost of RNA sequencing for individual labs and genome centers. PMID:23185583

  12. An Epidermal Biosensor for Carcinoembryonic Antigen

    National Research Council Canada - National Science Library

    Schwartz, Pauline

    2001-01-01

    ...). An epidermal biosensor is a new approach for the early continuous, in vivo detection of the onset of disease by the using genetically modified skin cells to respond to molecules secreted by tumor cells...

  13. Comparison of RNA Extraction Methods for the Identification of Grapevine fan leaf virus

    Directory of Open Access Journals (Sweden)

    Z. Gholampour

    2016-06-01

    Full Text Available Introduction: To now, more than 70 viral diseases have been reported from grapevine. Serological methods are regular diagnostic tools of grapevine viruses, however, their sensitivity has affected by seasonal fluctuations of the virus. Reverse transcription polymerase chain reaction provides significant improvement in detection of grapevine viruses. Extraction of high-quality RNA is essential for the successful application of many molecular techniques, such as RT-PCR. Extraction of high-quality RNA from the leaves of woody plants, such as grapevine, is particularly challenging because of high concentrations of polysaccharides, polyphenols, and other secondary metabolites. Some RNA extraction methods yield pellets that are poorly soluble, indicating the presence of unknown contaminants, whereas others are gelatinous, indicating the presence of polysaccharides. RNA can make complexes with polysaccharides and phenolic compounds render the RNA unusable for applications such as reverse transcription. Grapevine fanleaf virus is a member of the genus Nepovirus in the family Secoviridae. The GFLV genome consists of two positive-sense single stranded RNAs. The genome has a poly (A tail at the 3´ terminus and a covalently linked VPG protein at the 5´ terminus. Several extraction methods had been reported to be used for identification of GFLV in grapevine. Some of them require harmful chemical material; disadvantages of other are high costs. Immunocapture-RT-PCR requires preparation of specific antibody and direct binding RT-PCR (DB-RT-PCR has a high contamination risk. In this study, four RNA extraction protocols were compared with a commercial isolation kit to explore the most efficient RNA isolation method for grapevines. Material and Methods: 40 leaf samples were randomly collected during the growing season of 2011-2012. GFLV was detected in leaf samples by enzyme linked immunosorbent assay (ELISA Using specific antibodies raised against Iranian

  14. Biobanking of Fresh-Frozen Cancer Tissue: RNA Is Stable Independent of Tissue Type with Less Than 1 Hour of Cold Ischemia.

    Science.gov (United States)

    Song, Sang Yong; Jun, Jonghyun; Park, Miyeon; Park, Seo Kyu; Choi, Wonju; Park, Kyunghee; Jang, Kee-Taek; Lee, Myoyong

    2018-02-01

    The effects of preanalytical variables in tissue processing and storage periods on RNA quality of tissues have been well documented in each type of cancer. However, few studies have been performed on a comparative assessment of the impacts across different cancer tissues, even though it is well known that RNase activity is highly variable in various tissue types and RNase-rich tissues have been found to yield low-quality RNA. We investigated the impacts of cold ischemia times and long-term storage on RNA integrity in various types of cancer tissue, which had been fresh-frozen and collected at the Samsung Medical Center Biobank. RNA quality was also evaluated with regard to histopathological variables. We analyzed RNA integrity number (RIN) data, which had been obtained from our quality control (QC) processes over the last 7 years. Approximately 2% of samples were randomly selected and processed to measure RIN quarterly and after 6 years of storage for QC purposes. Fresh-frozen tumor tissues yielded high-quality RNA regardless of tumor type and histopathological features. Up to 1-hour cold ischemia times and up to 6-year storage times did not adversely influence RNA integrity. Only 3 samples showed RIN of <7 out of a total of 396 analyzed tumor tissues. Tissue quality was not adversely affected by long-term storage or limited variations of cold ischemia times. The low-quality samples could be correlated with the structural composition or intratumoral heterogeneity of tissues. The strict application of standardized protocols for tissue collection is the key for high-quality biobanking.

  15. microRNA Biomarker Discovery and High-Throughput DNA Sequencing Are Possible Using Long-term Archived Serum Samples.

    Science.gov (United States)

    Rounge, Trine B; Lauritzen, Marianne; Langseth, Hilde; Enerly, Espen; Lyle, Robert; Gislefoss, Randi E

    2015-09-01

    The impacts of long-term storage and varying preanalytical factors on the quality and quantity of DNA and miRNA from archived serum have not been fully assessed. Preanalytical and analytical variations and degradation may introduce bias in representation of DNA and miRNA and may result in loss or corruption of quantitative data. We have evaluated DNA and miRNA quantity, quality, and variability in samples stored up to 40 years using one of the oldest prospective serum collections in the world, the Janus Serumbank, a biorepository dedicated to cancer research. miRNAs are present and stable in archived serum samples frozen at -25°C for at least 40 years. Long-time storage did not reduce miRNA yields; however, varying preanalytical conditions had a significant effect and should be taken into consideration during project design. Of note, 500 μL serum yielded sufficient miRNA for qPCR and small RNA sequencing and on average 650 unique miRNAs were detected in samples from presumably healthy donors. Of note, 500 μL serum yielded sufficient DNA for whole-genome sequencing and subsequent SNP calling, giving a uniform representation of the genomes. DNA and miRNA are stable during long-term storage, making large prospectively collected serum repositories an invaluable source for miRNA and DNA biomarker discovery. Large-scale biomarker studies with long follow-up time are possible utilizing biorepositories with archived serum and state-of-the-art technology. ©2015 American Association for Cancer Research.

  16. Upregulation of FOXM1 induces genomic instability in human epidermal keratinocytes

    Directory of Open Access Journals (Sweden)

    Philpott Michael P

    2010-02-01

    Full Text Available Abstract Background The human cell cycle transcription factor FOXM1 is known to play a key role in regulating timely mitotic progression and accurate chromosomal segregation during cell division. Deregulation of FOXM1 has been linked to a majority of human cancers. We previously showed that FOXM1 was upregulated in basal cell carcinoma and recently reported that upregulation of FOXM1 precedes malignancy in a number of solid human cancer types including oral, oesophagus, lung, breast, kidney, bladder and uterus. This indicates that upregulation of FOXM1 may be an early molecular signal required for aberrant cell cycle and cancer initiation. Results The present study investigated the putative early mechanism of UVB and FOXM1 in skin cancer initiation. We have demonstrated that UVB dose-dependently increased FOXM1 protein levels through protein stabilisation and accumulation rather than de novo mRNA expression in human epidermal keratinocytes. FOXM1 upregulation in primary human keratinocytes triggered pro-apoptotic/DNA-damage checkpoint response genes such as p21, p38 MAPK, p53 and PARP, however, without causing significant cell cycle arrest or cell death. Using a high-resolution Affymetrix genome-wide single nucleotide polymorphism (SNP mapping technique, we provided the evidence that FOXM1 upregulation in epidermal keratinocytes is sufficient to induce genomic instability, in the form of loss of heterozygosity (LOH and copy number variations (CNV. FOXM1-induced genomic instability was significantly enhanced and accumulated with increasing cell passage and this instability was increased even further upon exposure to UVB resulting in whole chromosomal gain (7p21.3-7q36.3 and segmental LOH (6q25.1-6q25.3. Conclusion We hypothesise that prolonged and repeated UVB exposure selects for skin cells bearing stable FOXM1 protein causes aberrant cell cycle checkpoint thereby allowing ectopic cell cycle entry and subsequent genomic instability. The aberrant

  17. Optimal allocation of leaf epidermal area for gas exchange

    OpenAIRE

    de Boer, Hugo J.; Price, Charles A.; Wagner-Cremer, Friederike; Dekker, Stefan C.; Franks, Peter J.; Veneklaas, Erik J.

    2016-01-01

    Summary A long?standing research focus in phytology has been to understand how plants allocate leaf epidermal space to stomata in order to achieve an economic balance between the plant's carbon needs and water use. Here, we present a quantitative theoretical framework to predict allometric relationships between morphological stomatal traits in relation to leaf gas exchange and the required allocation of epidermal area to stomata. Our theoretical framework was derived from first principles of ...

  18. An Epidermal Biosensor for Carcinoembryonic Antigen

    National Research Council Canada - National Science Library

    Schwartz, Pauline

    2003-01-01

    ...) An epidermal biosensor was conceived as a new approach for the early continuous, in vivo detection of the onset of disease by the using genetically modified skin cells to respond to molecules secreted by tumor cells...

  19. Screening of siRNA nanoparticles for delivery to airway epithelial cells using high-content analysis

    LENUS (Irish Health Repository)

    Hibbitts, Alan

    2011-08-01

    Aims: Delivery of siRNA to the lungs via inhalation offers a unique opportunity to develop a new treatment paradigm for a range of respiratory conditions. However, progress has been greatly hindered by safety and delivery issues. This study developed a high-throughput method for screening novel nanotechnologies for pulmonary siRNA delivery. Methodology: Following physicochemical analysis, the ability of PEI–PEG–siRNA nanoparticles to facilitate siRNA delivery was determined using high-content analysis (HCA) in Calu-3 cells. Results obtained from HCA were validated using confocal microscopy. Finally, cytotoxicity of the PEI–PEG–siRNA particles was analyzed by HCA using the Cellomics® multiparameter cytotoxicity assay. Conclusion: PEI–PEG–siRNA nanoparticles facilitated increased siRNA uptake and luciferase knockdown in Calu-3 cells compared with PEI–siRNA.

  20. Simple, rapid and cost-effective method for high quality nucleic acids extraction from different strains of Botryococcus braunii.

    Directory of Open Access Journals (Sweden)

    Byung-Hyuk Kim

    Full Text Available This study deals with an effective nucleic acids extraction method from various strains of Botryococcus braunii which possesses an extensive extracellular matrix. A method combining freeze/thaw and bead-beating with heterogeneous diameter of silica/zirconia beads was optimized to isolate DNA and RNA from microalgae, especially from B. braunii. Eukaryotic Microalgal Nucleic Acids Extraction (EMNE method developed in this study showed at least 300 times higher DNA yield in all strains of B. braunii with high integrity and 50 times reduced working volume compared to commercially available DNA extraction kits. High quality RNA was also extracted using this method and more than two times the yield compared to existing methods. Real-time experiments confirmed the quality and quantity of the input DNA and RNA extracted using EMNE method. The method was also applied to other eukaryotic microalgae, such as diatoms, Chlamydomonas sp., Chlorella sp., and Scenedesmus sp. resulting in higher efficiencies. Cost-effectiveness analysis of DNA extraction by various methods revealed that EMNE method was superior to commercial kits and other reported methods by >15%. This method would immensely contribute to area of microalgal genomics.

  1. Quality Improvement to Demonstrate the Lack of Reliability of the Human Papillomavirus mRNA Assay to Identify Women With Latent Human Papillomavirus Infections.

    Science.gov (United States)

    Cotton, Sarah; Brown, Robert E; Nugent, Elizabeth K; Robazetti, Sonia C; Berens, Pamela D; Smith, Judith A

    2018-04-01

    To assess the consistency between human papillomavirus (HPV) mRNA testing in women with a history of previous HPV infections diagnosed by HPV DNA assay and the potential effects on follow-up HPV screening. This was a quality improvement study that used data from a pathology laboratory software database reviewed from November 2014 to June 2016 to identify female patients aged 30 years or older with greater than one HPV-positive result, including one or more HPV mRNA assay results and one or more documented HPV DNA assay results for comparison. Previous correlative cytology and colposcopic histopathology were also documented. American College of Obstetricians and Gynecologists' cervical cancer screening guidelines were used to compare potential differences in follow-up recommendations. Four hundred twenty-five charts for female patients 30 years of age or older were identified with one or more prior high-risk HPV infections by DNA assay. There was a 69.3% difference in HPV mRNA results compared with previous HPV DNA-positive results. There was a potential change in follow-up for 71.7% of patients with one prior high-risk-HPV-positive result and 60.0% of patients with two or more prior high-risk HPV-positive results. There were 231 colposcopy reports evaluated in this study. Of these, 62 (26.8%) were abnormal colposcopy reports, including 45 low-grade squamous intraepithelial lesions, 15 high-grade squamous intraepithelial lesions, and two cancers. Twenty-five (40.3%) abnormal colposcopy findings were in patients with a history of at least than two prior HPV DNA-positive results and a report of currently being HPV-negative with the mRNA assay. The HPV mRNA assays are less sensitive for detection of latent HPV infections compared with HPV DNA assays. Based on these data and the potential change in follow-up care, the HPV mRNA assay should not be used for a primary screening tool for cervical cancer. Many pathology laboratories have shifted to using the HPV mRNA assay

  2. Ventilation-induced increases in EGFR ligand mRNA are not altered by intra-amniotic LPS or ureaplasma in preterm lambs.

    Directory of Open Access Journals (Sweden)

    Noah H Hillman

    Full Text Available Chorioamnionitis and mechanical ventilation are associated with bronchopulmonary dysplasia (BPD in preterm infants. Mechanical ventilation at birth activates both inflammatory and acute phase responses. These responses can be partially modulated by previous exposure to intra-amniotic (IA LPS or Ureaplasma parvum (UP. Epidermal growth factor receptor (EGFR ligands participate in lung development, and angiotensin converting enzyme (ACE 1 and ACE2 contribute to lung inflammation. We asked whether brief mechanical ventilation at birth altered EGFR and ACE pathways and if antenatal exposure to IA LPS or UP could modulate these effects. Ewes were exposed to IA injections of UP, LPS or saline multiple days prior to preterm delivery at 85% gestation. Lambs were either immediately euthanized or mechanically ventilated for 2 to 3 hr. IA UP and LPS cause modest changes in the EGFR ligands amphiregulin (AREG, epiregulin (EREG, heparin binding epidermal growth factor (HB-EGF, and betacellulin (BTC mRNA expression. Mechanical ventilation greatly increased mRNA expression of AREG, EREG, and HB-EGF, with no additional increases resulting from IA LPS or UP. With ventilation AREG and EREG mRNA localized to cells in terminal airspace. EGFR mRNA also increased with mechanical ventilation. IA UP and LPS decreased ACE1 mRNA and increased ACE2 mRNA, resulting in a 4 fold change in the ACE1/ACE2 ratio. Mechanical ventilation with large tidal volumes increased both ACE1 and ACE2 expression. The alterations seen in ACE with IA exposures and EGFR pathways with mechanical ventilation may contribute to the development of BPD in preterm infants.

  3. TMEM45A Is Dispensable for Epidermal Morphogenesis, Keratinization and Barrier Formation.

    Directory of Open Access Journals (Sweden)

    Aurélie Hayez

    Full Text Available TMEM45A gene encodes an initially uncharacterized predicted transmembrane protein. We previously showed that this gene is highly expressed in keratinocytes where its expression correlates with keratinization, suggesting a role in normal epidermal physiology. To test this hypothesis, we generated TMEM45A knockout mice and found that these mice develop without any evident phenotype. The morphology of the epidermis assessed by histology and by labelling differentiation markers in immunofluorescence was not altered. Toluidine blue permeability assay showed that the epidermal barrier develops normally during embryonic development. We also showed that depletion of TMEM45A in human keratinocytes does not alter their potential to form in vitro 3D-reconstructed epidermis. Indeed, epidermis with normal morphogenesis were generated from TMEM45A-silenced keratinocytes. Their expression of differentiation markers quantified by RT-qPCR and evidenced by immunofluorescence labelling as well as their barrier function estimated by Lucifer yellow permeability were similar to the control epidermis. In summary, TMEM45A gene expression is dispensable for epidermal morphogenesis, keratinization and barrier formation. If this protein plays a role in the epidermis, its experimental depletion can possibly be compensated by other proteins in the two experimental models analyzed in this study.

  4. Epidermal growth in the bottlenose dolphin, Tursiops truncatus

    International Nuclear Information System (INIS)

    Hicks, B.D.; St Aubin, D.J.; Geraci, J.R.; Brown, W.R.

    1985-01-01

    Epidermal growth in two mature female bottlenose dolphins, Tursiops truncatus, was investigated by following the movement of a cohort of tritiated thymidine-labeled epidermal cells for 59 days. The majority of the cells migrated in a cluster which was estimated to reach the skin surface in 73 days. The authors calculate that the outermost cell layer is sloughed 12 times per day. Turnover time and sloughing rate are estimated to be 1.7 times longer and 8.5 times faster than the respective values for epidermal cell kinetics in humans. This apparent inconsistency of slow transit time and rapid sloughing rate is reconciled by the convoluted structure of the stratum germinativum in the dolphin which results in a ratio of germinatival to superficial cells of 876:1. The stratum germinativum of dolphin epidermis appears to lack morphologically distinct, spatially segregated subpopulations of anchoring and stem cells. Dolphin epidermis has a large capacity for cell population, relatively long turnover time, and rapid sloughing rate. The adaptive advantages of these characteristics are discussed

  5. Epidermal growth in the bottlenose dolphin, Tursiops truncatus

    Energy Technology Data Exchange (ETDEWEB)

    Hicks, B.D.; St. Aubin, D.J.; Geraci, J.R.; Brown, W.R.

    1985-07-01

    Epidermal growth in two mature female bottlenose dolphins, Tursiops truncatus, was investigated by following the movement of a cohort of tritiated thymidine-labeled epidermal cells for 59 days. The majority of the cells migrated in a cluster which was estimated to reach the skin surface in 73 days. The authors calculate that the outermost cell layer is sloughed 12 times per day. Turnover time and sloughing rate are estimated to be 1.7 times longer and 8.5 times faster than the respective values for epidermal cell kinetics in humans. This apparent inconsistency of slow transit time and rapid sloughing rate is reconciled by the convoluted structure of the stratum germinativum in the dolphin which results in a ratio of germinatival to superficial cells of 876:1. The stratum germinativum of dolphin epidermis appears to lack morphologically distinct, spatially segregated subpopulations of anchoring and stem cells. Dolphin epidermis has a large capacity for cell population, relatively long turnover time, and rapid sloughing rate. The adaptive advantages of these characteristics are discussed.

  6. Expression profile of microRNA-146a along HPV-induced multistep carcinogenesis: a study in HPV16 transgenic mice.

    Science.gov (United States)

    Araújo, Rita; Santos, Joana M O; Fernandes, Mara; Dias, Francisca; Sousa, Hugo; Ribeiro, Joana; Bastos, Margarida M S M; Oliveira, Paula A; Carmo, Diogo; Casaca, Fátima; Silva, Sandra; Medeiros, Rui; Gil da Costa, Rui M

    2018-02-01

    Persistent human papillomavirus (HPV) infection is associated with the development of certain types of cancer and the dysregulation of microRNAs has been implicated in HPV-associated carcinogenesis. This is the case of microRNA-146a (miR-146a), which is thought to regulate tumor-associated inflammation. We sought to investigate the expression levels of miR-146a during HPV16-mediated carcinogenesis using skin samples from K14-HPV16 transgenic mice which develop the consecutive phases of the carcinogenesis process. Female transgenic (HPV +/- ) and wild-type (HPV -/- ) mice were sacrificed at 24-26 weeks-old or 28-30 weeks-old. Chest and ear skin samples from HPV +/- and HPV -/- mice were histologically classified and used for microRNA extraction and quantification by qPCR. Chest skin samples from 24 to 26 weeks-old HPV +/- mice presented diffuse epidermal hyperplasia and only 22.5% showed multifocal dysplasia, while at 28-30 weeks-old all (100.0%) HPV +/- animals showed epidermal dysplasia. All HPV +/- ear skin samples showed carcinoma in situ (CIS). MiR-146a expression levels were higher in HPV +/- compared to HPV -/- mice (p = 0.006). There was also an increase in miR-146a expression in dysplastic skin lesions compared with hyperplasic lesions (p = 0.011). Samples showing CIS had a significant decrease in miR-146a expression when compared to samples showing epidermal hyperplasia (p = 0.018) and epidermal dysplasia (p = 0.009). These results suggest that HPV16 induces the overexpression of miR-146a in the initial stages of carcinogenesis (hyperplasia and dysplasia), whereas decreases its expression at later stages (CIS). Taken together, these data implicate and suggest different roles of miR-146a in HPV-mediated carcinogenesis.

  7. High-Level Accumulation of Exogenous Small RNAs Not Affecting Endogenous Small RNA Biogenesis and Function in Plants

    Institute of Scientific and Technical Information of China (English)

    SHEN Wan-xia; Neil A Smith; ZHOU Chang-yong; WANG Ming-bo

    2014-01-01

    RNA silencing is a fundamental plant defence and gene control mechanism in plants that are directed by 20-24 nucleotide (nt) small interfering RNA (siRNA) and microRNA (miRNA). Infection of plants with viral pathogens or transformation of plants with RNA interference (RNAi) constructs is usually associated with high levels of exogenous siRNAs, but it is unclear if these siRNAs interfere with endogenous small RNA pathways and hence affect plant development. Here we provide evidence that viral satellite RNA (satRNA) infection does not affect siRNA and miRNA biogenesis or plant growth despite the extremely high level of satRNA-derived siRNAs. We generated transgenic Nicotiana benthamiana plants that no longer develop the speciifc yellowing symptoms generally associated with infection by Cucumber mosaic virus (CMV) Y-satellite RNA (Y-Sat). We then used these plants to show that CMV Y-Sat infection did not cause any visible phenotypic changes in comparison to uninfected plants, despite the presence of high-level Y-Sat siRNAs. Furthermore, we showed that the accumulation of hairpin RNA (hpRNA)-derived siRNAs or miRNAs, and the level of siRNA-directed transgene silencing, are not signiifcantly affected by CMV Y-Sat infection. Taken together, our results suggest that the high levels of exogenous siRNAs associated with viral infection or RNAi-inducing transgenes do not saturate the endogenous RNA silencing machineries and have no signiifcant impact on normal plant development.

  8. Optimization of laser capture microdissection and RNA amplification for gene expression profiling of prostate cancer

    Directory of Open Access Journals (Sweden)

    Vasmatzis George

    2007-03-01

    Full Text Available Abstract Background To discover prostate cancer biomarkers, we profiled gene expression in benign and malignant cells laser capture microdissected (LCM from prostate tissues and metastatic prostatic adenocarcinomas. Here we present methods developed, optimized, and validated to obtain high quality gene expression data. Results RNase inhibitor was included in solutions used to stain frozen tissue sections for LCM, which improved RNA quality significantly. Quantitative PCR assays, requiring minimal amounts of LCM RNA, were developed to determine RNA quality and concentration. SuperScript II™ reverse transcriptase was replaced with SuperScript III™, and SpeedVac concentration was eliminated to optimize linear amplification. The GeneChip® IVT labeling kit was used rather than the Enzo BioArray™ HighYield™ RNA transcript labeling kit since side-by-side comparisons indicated high-end signal saturation with the latter. We obtained 72 μg of labeled complementary RNA on average after linear amplification of about 2 ng of total RNA. Conclusion Unsupervised clustering placed 5/5 normal and 2/2 benign prostatic hyperplasia cases in one group, 5/7 Gleason pattern 3 cases in another group, and the remaining 2/7 pattern 3 cases in a third group with 8/8 Gleason pattern 5 cases and 3/3 metastatic prostatic adenocarcinomas. Differential expression of alpha-methylacyl coenzyme A racemase (AMACR and hepsin was confirmed using quantitative PCR.

  9. Gloss, colour and grip: multifunctional epidermal cell shapes in bee- and bird-pollinated flowers.

    Science.gov (United States)

    Papiorek, Sarah; Junker, Robert R; Lunau, Klaus

    2014-01-01

    Flowers bear the function of filters supporting the attraction of pollinators as well as the deterrence of floral antagonists. The effect of epidermal cell shape on the visual display and tactile properties of flowers has been evaluated only recently. In this study we quantitatively measured epidermal cell shape, gloss and spectral reflectance of flowers pollinated by either bees or birds testing three hypotheses: The first two hypotheses imply that bee-pollinated flowers might benefit from rough surfaces on visually-active parts produced by conical epidermal cells, as they may enhance the colour signal of flowers as well as the grip on flowers for bees. In contrast, bird-pollinated flowers might benefit from flat surfaces produced by flat epidermal cells, by avoiding frequent visitation from non-pollinating bees due to a reduced colour signal, as birds do not rely on specific colour parameters while foraging. Moreover, flat petal surfaces in bird-pollinated flowers may hamper grip for bees that do not touch anthers and stigmas while consuming nectar and thus, are considered as nectar thieves. Beside this, the third hypothesis implies that those flower parts which are vulnerable to nectar robbing of bee- as well as bird-pollinated flowers benefit from flat epidermal cells, hampering grip for nectar robbing bees. Our comparative data show in fact that conical epidermal cells are restricted to visually-active parts of bee-pollinated flowers, whereas robbing-sensitive parts of bee-pollinated as well as the entire floral surface of bird-pollinated flowers possess on average flat epidermal cells. However, direct correlations between epidermal cell shape and colour parameters have not been found. Our results together with published experimental studies show that epidermal cell shape as a largely neglected flower trait might act as an important feature in pollinator attraction and avoidance of antagonists, and thus may contribute to the partitioning of flower-visitors.

  10. Gloss, colour and grip: multifunctional epidermal cell shapes in bee- and bird-pollinated flowers.

    Directory of Open Access Journals (Sweden)

    Sarah Papiorek

    Full Text Available Flowers bear the function of filters supporting the attraction of pollinators as well as the deterrence of floral antagonists. The effect of epidermal cell shape on the visual display and tactile properties of flowers has been evaluated only recently. In this study we quantitatively measured epidermal cell shape, gloss and spectral reflectance of flowers pollinated by either bees or birds testing three hypotheses: The first two hypotheses imply that bee-pollinated flowers might benefit from rough surfaces on visually-active parts produced by conical epidermal cells, as they may enhance the colour signal of flowers as well as the grip on flowers for bees. In contrast, bird-pollinated flowers might benefit from flat surfaces produced by flat epidermal cells, by avoiding frequent visitation from non-pollinating bees due to a reduced colour signal, as birds do not rely on specific colour parameters while foraging. Moreover, flat petal surfaces in bird-pollinated flowers may hamper grip for bees that do not touch anthers and stigmas while consuming nectar and thus, are considered as nectar thieves. Beside this, the third hypothesis implies that those flower parts which are vulnerable to nectar robbing of bee- as well as bird-pollinated flowers benefit from flat epidermal cells, hampering grip for nectar robbing bees. Our comparative data show in fact that conical epidermal cells are restricted to visually-active parts of bee-pollinated flowers, whereas robbing-sensitive parts of bee-pollinated as well as the entire floral surface of bird-pollinated flowers possess on average flat epidermal cells. However, direct correlations between epidermal cell shape and colour parameters have not been found. Our results together with published experimental studies show that epidermal cell shape as a largely neglected flower trait might act as an important feature in pollinator attraction and avoidance of antagonists, and thus may contribute to the partitioning of

  11. Methylated nucleosides in tRNA and tRNA methyltransferases

    Directory of Open Access Journals (Sweden)

    Hiroyuki eHori

    2014-05-01

    Full Text Available To date, more than 90 modified nucleosides have been found in tRNA and the biosynthetic pathways of the majority of tRNA modifications include a methylation step(s. Recent studies of the biosynthetic pathways have demonstrated that the availability of methyl group donors for the methylation in tRNA is important for correct and efficient protein synthesis. In this review, I focus on the methylated nucleosides and tRNA methyltransferases. The primary functions of tRNA methylations are linked to the different steps of protein synthesis, such as the stabilization of tRNA structure, reinforcement of the codon–anticodon interaction, regulation of wobble base pairing, and prevention of frameshift errors. However, beyond these basic functions, recent studies have demonstrated that tRNA methylations are also involved in the RNA quality control system and regulation of tRNA localization in the cell. In a thermophilic eubacterium, tRNA modifications and the modification enzymes form a network that responses to temperature changes. Furthermore, several modifications are involved in genetic diseases, infections, and the immune response. Moreover, structural, biochemical, and bioinformatics studies of tRNA methyltransferases have been clarifying the details of tRNA methyltransferases and have enabled these enzymes to be classified. In the final section, the evolution of modification enzymes is discussed.

  12. The Accuracy of Seryl-tRNA Synthesis

    Directory of Open Access Journals (Sweden)

    Ita Gruic-Sovulj

    2002-01-01

    Full Text Available The high level of translational fidelity is ensured by various types of quality control mechanisms, which are adapted to prevent or correct naturally occurring mistakes. Accurate aminoacyl-tRNA synthesis is mostly dependent on the specificity of the aminoacyl-tRNA synthetases (aaRS, i.e. their ability to choose among competing structurally similar substrates. Our studies have revealed that accurate seryl-tRNA synthesis in yeast and plants is accomplished via tRNA-assisted optimization of amino acid binding to the active site of seryl-tRNA synthetase (SerRS. Based on our recent kinetic data, a mechanism is proposed by which transient protein : RNA complex activates the cognate amino acid more efficiently and more specifically than the apoenzyme alone. This may proceed via a tRNA induced conformational change in the enzyme’s active site. The influence of tRNASer, on the activation of serine by SerRS variants mutated in the active site, is much less pronounced. Although SerRS misactivates structurally similar threonine in vitro, the formation of such erroneous threonyl-adenylate is reduced in the presence of nonchargeable tRNASer analog. Thus, the sequence-specific tRNA : SerRS interactions enhance the accuracy of amino acid recognition. Another type of quality control mechanism in tRNA serylation is assumed to be based on the complex formation between SerRS and a nonsynthetase protein. Using in vivo interaction screen, yeast peroxin Pex21p was identified as SerRS interacting protein. This was confirmed by an in vitro binding assay. Kinetic experiments performed in the presence of Pex21p revealed that this peroxin acts as an activator of seryl-tRNA synthetase in the aminoacylation reaction.

  13. Skin mucus of Cyprinus carpio inhibits cyprinid herpesvirus 3 binding to epidermal cells

    Directory of Open Access Journals (Sweden)

    Raj Victor

    2011-08-01

    Full Text Available Abstract Cyprinid herpesvirus 3 (CyHV-3 is the aetiological agent of a mortal and highly contagious disease in common and koi carp. The skin is the major portal of entry of CyHV-3 in carp after immersion in water containing the virus. In the present study, we used in vivo bioluminescence imaging to investigate the effect of skin mucus removal and skin epidermis lesion on CyHV-3 entry. Physical treatments inducing removal of the mucus up to complete erosion of the epidermis were applied on a defined area of carp skin just before inoculation by immersion in infectious water. CyHV-3 entry in carp was drastically enhanced on the area of the skin where the mucus was removed with or without associated epidermal lesion. To investigate whether skin mucus inhibits CyHV-3 binding to epidermal cells, tail fins with an intact mucus layer or without mucus were inoculated ex vivo. While electron microscopy examination revealed numerous viral particles bound on the fins inoculated after mucus removal, no particle could be detected after infection of mucus-covered fins. Finally, anti-CyHV-3 neutralising activity of mucus extract was tested in vitro. Incubation of CyHV-3 with mucus extract reduced its infectivity in a dose dependent manner. The present study demonstrates that skin mucus removal and epidermal lesions enhance CyHV-3 entry in carp. It highlights the role of fish skin mucus as an innate immune protection against viral epidermal entry.

  14. Skin mucus of Cyprinus carpio inhibits cyprinid herpesvirus 3 binding to epidermal cells

    Science.gov (United States)

    2011-01-01

    Cyprinid herpesvirus 3 (CyHV-3) is the aetiological agent of a mortal and highly contagious disease in common and koi carp. The skin is the major portal of entry of CyHV-3 in carp after immersion in water containing the virus. In the present study, we used in vivo bioluminescence imaging to investigate the effect of skin mucus removal and skin epidermis lesion on CyHV-3 entry. Physical treatments inducing removal of the mucus up to complete erosion of the epidermis were applied on a defined area of carp skin just before inoculation by immersion in infectious water. CyHV-3 entry in carp was drastically enhanced on the area of the skin where the mucus was removed with or without associated epidermal lesion. To investigate whether skin mucus inhibits CyHV-3 binding to epidermal cells, tail fins with an intact mucus layer or without mucus were inoculated ex vivo. While electron microscopy examination revealed numerous viral particles bound on the fins inoculated after mucus removal, no particle could be detected after infection of mucus-covered fins. Finally, anti-CyHV-3 neutralising activity of mucus extract was tested in vitro. Incubation of CyHV-3 with mucus extract reduced its infectivity in a dose dependent manner. The present study demonstrates that skin mucus removal and epidermal lesions enhance CyHV-3 entry in carp. It highlights the role of fish skin mucus as an innate immune protection against viral epidermal entry. PMID:21816061

  15. Presence of High-Risk HPV mRNA in Relation to Future High-Grade Lesions among High-Risk HPV DNA Positive Women with Minor Cytological Abnormalities.

    Directory of Open Access Journals (Sweden)

    Hanna Johansson

    Full Text Available Continuous expression of E6- and E7-oncogenes of high-risk human papillomavirus (HPV types is necessary for the development and maintenance of the dysplastic phenotype. The aim of the study was to determine the sensitivity and specificity of the APTIMA HPV mRNA assay (Hologic in predicting future development of high-grade cervical intraepithelial neoplasia (CIN among high-risk HPV-DNA-positive women with atypical squamous cells of undetermined significance (ASCUS or low-grade squamous epithelial lesion (LSIL cytology.Archived SurePath cervical samples of women ≥ 35 years of age with high-risk HPV DNA-positive ASCUS (n = 211 or LSIL, (n = 131 were tested for the presence of high-risk HPV E6/E7 mRNA using the APTIMA HPV assay, and the women were monitored for development of histopathologically verified CIN2+.Twenty-nine percent (61/211 of the women in the ASCUS group, and 34.3% (45/131 in the LSIL group developed CIN2+ within 4.5 years of follow-up. The prevalence of HPV mRNA was 90.0% (95% CI 85.9-94.0 among women with ASCUS and 95.4% (95% CI 91.8-99.0 among women with LSIL. The presence of HPV E6/E7 mRNA was associated with future development of CIN2+ among women with ASCUS and LSIL (p=0.02. The mRNA assay demonstrated high sensitivity in predicting future CIN2+ and CIN3 for index ASCUS (96.7%; 95% CI 87.6-99.4 and 100%; 95% CI 82.2-100, respectively and LSIL (97.8%, 95% CI 86.8-99.9 and 100%, 95% CI 79.9-100, respectively. The corresponding specificity was low, 12.7% (95% CI 7.9-19.3 and 5.8% (95% CI 2.2-13.6, for future CIN2+, respectively. The negative predictive value of the HPV mRNA assay for detecting future CIN3 was 100%, since no mRNA-negative woman developed CIN3 (0/27 as compared to 13.6% (43/315 of the mRNA-positive women (p = 0.03.The APTIMA mRNA assay demonstrated high sensitivity but low specificity in predicting future CIN2+ among women with minor cytological abnormalities. The assay had high negative predictive value for future

  16. Presence of High-Risk HPV mRNA in Relation to Future High-Grade Lesions among High-Risk HPV DNA Positive Women with Minor Cytological Abnormalities

    Science.gov (United States)

    Johansson, Hanna; Bjelkenkrantz, Kaj; Darlin, Lotten; Dilllner, Joakim; Forslund, Ola

    2015-01-01

    Objective Continuous expression of E6- and E7-oncogenes of high-risk human papillomavirus (HPV) types is necessary for the development and maintenance of the dysplastic phenotype. The aim of the study was to determine the sensitivity and specificity of the APTIMA HPV mRNA assay (Hologic) in predicting future development of high-grade cervical intraepithelial neoplasia (CIN) among high-risk HPV-DNA-positive women with atypical squamous cells of undetermined significance (ASCUS) or low-grade squamous epithelial lesion (LSIL) cytology. Methods Archived SurePath cervical samples of women ≥ 35 years of age with high-risk HPV DNA-positive ASCUS (n = 211) or LSIL, (n = 131) were tested for the presence of high-risk HPV E6/E7 mRNA using the APTIMA HPV assay, and the women were monitored for development of histopathologically verified CIN2+. Results Twenty-nine percent (61/211) of the women in the ASCUS group, and 34.3% (45/131) in the LSIL group developed CIN2+ within 4.5 years of follow-up. The prevalence of HPV mRNA was 90.0% (95% CI 85.9-94.0) among women with ASCUS and 95.4% (95% CI 91.8-99.0) among women with LSIL. The presence of HPV E6/E7 mRNA was associated with future development of CIN2+ among women with ASCUS and LSIL (p=0.02). The mRNA assay demonstrated high sensitivity in predicting future CIN2+ and CIN3 for index ASCUS (96.7%; 95% CI 87.6-99.4 and 100%; 95% CI 82.2-100, respectively) and LSIL (97.8%, 95% CI 86.8-99.9 and 100%, 95% CI 79.9-100, respectively). The corresponding specificity was low, 12.7% (95% CI 7.9-19.3) and 5.8% (95% CI 2.2-13.6), for future CIN2+, respectively. The negative predictive value of the HPV mRNA assay for detecting future CIN3 was 100%, since no mRNA-negative woman developed CIN3 (0/27) as compared to 13.6% (43/315) of the mRNA-positive women (p = 0.03). Conclusion The APTIMA mRNA assay demonstrated high sensitivity but low specificity in predicting future CIN2+ among women with minor cytological abnormalities. The assay had

  17. Production of high-amylose maize lines using RNA interference in ...

    African Journals Online (AJOL)

    amylose maize lines with a low T-DNA copy number, demonstrating that RNAi is an efficient method for the production of high-amylose maize lines. Key words: Maize, high-amylose, RNA interference, starch branching enzyme gene sbe2a.

  18. Treatment challenges for community oncologists treating postmenopausal women with endocrine-resistant, hormone receptor-positive, human epidermal growth factor receptor 2-negative advanced breast cancer

    International Nuclear Information System (INIS)

    Gradishar, William J

    2016-01-01

    Community-based oncologists are faced with challenges and opportunities when delivering quality patient care, including high patient volumes and diminished resources; however, there may be the potential to deliver increased patient education and subsequently improve outcomes. This review discusses the treatment of postmenopausal women with endocrine-resistant, hormone receptor-positive, human epidermal growth factor receptor 2- negative advanced breast cancer in order to illustrate considerations in the provision of pertinent quality education in the treatment of these patients and the management of therapy-related adverse events. An overview of endocrine-resistant breast cancer and subsequent treatment challenges is also provided. Approved treatment options for endocrine-resistant breast cancer include hormonal therapies and mammalian target of rapamycin inhibitors. Compounds under clinical investigation are also discussed

  19. Micromorphology and development of the epicuticular structure on the epidermal cell of ginseng leaves

    Directory of Open Access Journals (Sweden)

    Kyounghwan Lee

    2015-04-01

    Conclusion: The outwardly projected cuticle and epidermal cell wall (i.e., an epicuticular wrinkle acts as a major barrier to block out sunlight in ginseng leaves. The small vesicles in the peripheral region of epidermal cells may suppress the cuticle and parts of epidermal wall, push it upward, and consequently contribute to the formation of the epicuticular structure.

  20. Possible role of epidermal keratinocytes in the construction of acupuncture meridians.

    Science.gov (United States)

    Denda, Mitsuhiro; Tsutsumi, Moe

    2014-04-01

    Acupuncture meridians consist of a network of acupuncture points on the skin, stimulation of which is well established to have a variety of physiological effects. We have previously demonstrated that epidermal keratinocytes contain multiple sensory systems for temperature, mechanical stimuli, electric potentials and other stimuli. These sensory systems generate changes in the calcium-ion concentration in the epidermis, so epidermal keratinocytes can generate spatially-localized electro-physiological patterns in the skin. We have previously demonstrated signaling between epidermal keratinocytes and peripheral nerve systems. Therefore, stimuli sensed by epidermal keratinocytes might be transferred to the unmyelinated nerve fibers that are known to exist in the epidermis and, thence, to the spinal cord and brain. We propose that epidermal keratinocytes form an information-gathering network in the skin and that this network plays a key role in whole-body homeostasis in response to the changing environment. We also hypothesize that this network corresponds to the acupuncture meridians. As supporting examples, we present some striking calcium propagation patterns observed in cultured human keratinocytes after adenosine-triphosphate (ATP) stimulation. These results support the ideas that keratinocytes can generate spatially-restricted signaling patterns after environmental stimulation and that the cultures might be in-vitro models of meridians as an information-gathering network in skin. Copyright © 2014. Published by Elsevier B.V.

  1. Effects of Wnt3a on proliferation and differentiation of human epidermal stem cells

    International Nuclear Information System (INIS)

    Jia Liwei; Zhou Jiaxi; Peng Sha; Li Juxue; Cao Yujing; Duan Enkui

    2008-01-01

    Epidermal stem cells maintain development and homeostasis of mammalian epidermis throughout life. However, the molecular mechanisms involved in the proliferation and differentiation of epidermal stem cells are far from clear. In this study, we investigated the effects of Wnt3a and Wnt/β-catenin signaling on proliferation and differentiation of human fetal epidermal stem cells. We found both Wnt3a and active β-catenin, two key members of the Wnt/β-catenin signaling, were expressed in human fetal epidermis and epidermal stem cells. In addition, Wnt3a protein can promote proliferation and inhibit differentiation of epidermal stem cells in vitro culture. Our results suggest that Wnt/β-catenin signaling plays important roles in human fetal skin development and homeostasis, which also provide new insights on the molecular mechanisms of oncogenesis in human epidermis

  2. Increased systemic and epidermal levels of IL-17A and IL-1β promotes progression of non-segmental vitiligo.

    Science.gov (United States)

    Bhardwaj, Supriya; Rani, Seema; Srivastava, Niharika; Kumar, Ravinder; Parsad, Davinder

    2017-03-01

    Non-segmental vitiligo (NSV) results from autoimmune destruction of melanocytes. The altered levels of various cytokines have been proposed in the pathogenesis of vitiligo. However, the exact immune mechanisms have not yet been fully elucidated. To investigate the role of epidermal and systemic cytokines in active and stable NSV patients. Serum levels of inflammatory cytokines were checked in 42 active and 30 stable NSV patients with 30 controls. The lesional, perilesional and normal skin sections were subjected to H&E staining. The mRNA expression of inflammatory cytokines and their respective receptors were assessed by quantitative PCR in lesional skin of both active and stable NSV skin. The MITF and IL-17A were immunolocalized in lesional, perilesional and normal skin tissue. Significant increase in the expression of inflammatory cytokines, IL-17A, IL-1β and TGF-β was observed in active patients, whereas no change was observed in stable patients. A marked reduction in epidermal thickness was observed in lesional skin sections. Significant increase in IL-17A and significant decrease in microphthalmia associated transcription factor (MITF) expression was observed in lesional and perilesional skin sections. Moreover, qPCR analysis showed significant alterations in the mRNA levels of IL-17A, IL-1β, IFN-γ, TGF-β and their respective receptors in active and stable vitiligo patient samples. Increased levels of IL-17A and IL-1β cytokines and decreased expression of MITF suggested a possible role of these cytokines in dysregulation of melanocytic activity in the lesional skin and hence might be responsible for the progression of active vitiligo. Copyright © 2016 Elsevier Ltd. All rights reserved.

  3. The Epidermal Growth Factor Receptor Is a Regulator of Epidermal Complement Component Expression and Complement Activation

    DEFF Research Database (Denmark)

    Abu-Humaidan, Anas H A; Ananthoju, Nageshwar; Mohanty, Tirthankar

    2014-01-01

    The complement system is activated in response to tissue injury. During wound healing, complement activation seems beneficial in acute wounds but may be detrimental in chronic wounds. We found that the epidermal expression of many complement components was only increased to a minor extent in skin...

  4. Notch-deficient skin induces a lethal systemic B-lymphoproliferative disorder by secreting TSLP, a sentinel for epidermal integrity.

    Directory of Open Access Journals (Sweden)

    Shadmehr Demehri

    2008-05-01

    Full Text Available Epidermal keratinocytes form a highly organized stratified epithelium and sustain a competent barrier function together with dermal and hematopoietic cells. The Notch signaling pathway is a critical regulator of epidermal integrity. Here, we show that keratinocyte-specific deletion of total Notch signaling triggered a severe systemic B-lymphoproliferative disorder, causing death. RBP-j is the DNA binding partner of Notch, but both RBP-j-dependent and independent Notch signaling were necessary for proper epidermal differentiation and lipid deposition. Loss of both pathways caused a persistent defect in skin differentiation/barrier formation. In response, high levels of thymic stromal lymphopoietin (TSLP were released into systemic circulation by Notch-deficient keratinocytes that failed to differentiate, starting in utero. Exposure to high TSLP levels during neonatal hematopoiesis resulted in drastic expansion of peripheral pre- and immature B-lymphocytes, causing B-lymphoproliferative disorder associated with major organ infiltration and subsequent death, a previously unappreciated systemic effect of TSLP. These observations demonstrate that local skin perturbations can drive a lethal systemic disease and have important implications for a wide range of humoral and autoimmune diseases with skin manifestations.

  5. [Enhanced lymphocyte proliferation in the presence of epidermal cells of HIV-infected patients in vitro].

    Science.gov (United States)

    Kappus, R P; Berger, S; Thomas, C A; Ottmann, O G; Ganser, A; Stille, W; Shah, P M

    1992-07-01

    Clinical observations show that the HIV infection is often associated with affections of the skin. In order to examine the involvement of the epidermal immune system in the HIV infection, we determined accessory cell function of epidermal cells from HIV-1-infected patients. For this we measured the proliferative response of enriched CD(4+)-T-lymphocytes from HIV-infected patients and noninfected controls to stimulation with anti-CD3 and IL-2 in the presence of epidermal cells; the enhancement of the response is dependent on the presence of functionally intact accessory cells. The capacity of epidermal cells to increase the anti-CD3-stimulated T-cell proliferative response was significantly enhanced in HIV patients (CDC III/IVA) as compared with noninfected donors. It is discussed, whether the increased activity of epidermal cells from HIV-infected patients may be responsible for several of the dermal lesions in the course of an HIV infection as due to an enhanced production and release of epidermal cell-derived cytokines.

  6. Epidermal Growth Factor and Intestinal Barrier Function

    Directory of Open Access Journals (Sweden)

    Xiaopeng Tang

    2016-01-01

    Full Text Available Epidermal growth factor (EGF is a 53-amino acid peptide that plays an important role in regulating cell growth, survival, migration, apoptosis, proliferation, and differentiation. In addition, EGF has been established to be an effective intestinal regulator helping to protect intestinal barrier integrity, which was essential for the absorption of nutrients and health in humans and animals. Several researches have demonstrated that EGF via binding to the EGF receptor and subsequent activation of Ras/MAPK, PI3K/AKT, PLC-γ/PKC, and STATS signal pathways regulates intestinal barrier function. In this review, the relationship between epidermal growth factor and intestinal development and intestinal barrier is described, to provide a better understanding of the effects of EGF on intestine development and health.

  7. Interaction of epidermal growth factor receptors with the cytoskeleton is related to receptor clustering

    NARCIS (Netherlands)

    van Belzen, N.; Spaargaren, M.; Verkleij, A. J.; Boonstra, J.

    1990-01-01

    Recently it has been established that cytoskeleton-associated epidermal growth factor (EGF) receptors are predominantly of the high-affinity class and that EGF induces a recruitment of low-affinity receptors to the cytoskeleton. The nature of this EGF-induced receptor-cytoskeleton interaction,

  8. Evaluation of RNA extraction methods in rice and their application in expression analysis of resistance genes against Magnaporthe oryzae

    Directory of Open Access Journals (Sweden)

    Parisa Azizi

    2017-01-01

    Full Text Available Extraction of RNA of high quality and integrity is essential for gene expression studies and all downstream RNA-based techniques. The leaves of 16 merit Malaysian rice varieties were used to isolate total RNA using five different methods. The quantity, quality and integrity of extracted RNA were confirmed using three different means. The ratios of A260/280 ranged from 2.12 to 2.20. Electrophoresis (1.5% agarose gel was performed, illustrating intact and sharp bands representing the 28S, 18S, 5.8S and 5S ribosomal subunits of RNA, presenting intact RNA. RNA quality was verified using semi-quantitative polymerase chain reaction (sqPCR. The objective of this study was to identify different genes involved in the resistance of rice plants using high-quality RNA extracted 31 h after inoculation of Magnaporthe oryzae pathotype P7.2. The expression levels of eight blast resistance genes, Pikh, Pib, Pita, Pi21, Pi9, Os11gRGA8, OsWRKY22 and OsWRKY45, were evaluated by real-time PCR (RT-PCR. Real-time PCR was performed to identify candidate genes using RNA extracted by the TRIzol method, which showed the highest score compared with other methods in terms of RNA quantity, purity and integrity. In addition, the results of real-time PCR confirmed that the up-regulation of seven blast resistance genes may confer stronger resistance for the MR 276 variety against M. oryzae pathotype P7.2.

  9. Perforator Flaps after Excision of Large Epidermal Cysts in the Buttocks

    Directory of Open Access Journals (Sweden)

    Sang Wha Kim

    2014-03-01

    Full Text Available Background Epidermal cysts are commonly occurring masses usually less than 5 cm in diameter, but in predisposed patients, epidermal cysts can grow relatively large due to chronic infection. Methods From June 2002 to July 2010, 17 patients received 19 regional perforator-based island flaps to cover defects due to the excision of large epidermal cysts (diameter >5 cm in the buttocks. Eight patients had diabetes, and seven had rheumatoid arthritis. The pedicles were not fully isolated to prevent spasms or twisting. Results All the flaps survived completely, except for one case with partial necrosis of the flap, which necessitated another perforator-based island flap for coverage. There were two cases of wound dehiscence, which were re-closed after meticulous debridement. There were no recurrences of the masses during follow-up periods of 8.1 months (range, 6-12 months. Conclusions In patients with large epidermal cysts and underlying medical disorders, regional perforator-based island flaps can be the solution to coverage of the defects after excision.

  10. Analysis of current and alternative phenol based RNA extraction methodologies for cyanobacteria

    Directory of Open Access Journals (Sweden)

    Lindblad Peter

    2009-08-01

    Full Text Available Abstract Background The validity and reproducibility of gene expression studies depend on the quality of extracted RNA and the degree of genomic DNA contamination. Cyanobacteria are gram-negative prokaryotes that synthesize chlorophyll a and carry out photosynthetic water oxidation. These organisms possess an extended array of secondary metabolites that impair cell lysis, presenting particular challenges when it comes to nucleic acid isolation. Therefore, we used the NHM5 strain of Nostoc punctiforme ATCC 29133 to compare and improve existing phenol based chemistry and procedures for RNA extraction. Results With this work we identify and explore strategies for improved and lower cost high quality RNA isolation from cyanobacteria. All the methods studied are suitable for RNA isolation and its use for downstream applications. We analyse different Trizol based protocols, introduce procedural changes and describe an alternative RNA extraction solution. Conclusion It was possible to improve purity of isolated RNA by modifying protocol procedures. Further improvements, both in RNA purity and experimental cost, were achieved by using a new extraction solution, PGTX.

  11. The mRNA and miRNA transcriptomic landscape of Panax ginseng under the high ambient temperature.

    Science.gov (United States)

    Jung, Inuk; Kang, Hyejin; Kim, Jang Uk; Chang, Hyeonsook; Kim, Sun; Jung, Woosuk

    2018-03-19

    Ginseng is a popular traditional herbal medicine in north-eastern Asia. It has been used for human health for over thousands of years. With the rise in global temperature, the production of Korean ginseng (Panax ginseng C.A.Meyer) in Korea have migrated from mid to northern parts of the Korean peninsula to escape from the various higher temperature related stresses. Under the high ambient temperature, vegetative growth was accelerated, which resulted in early flowering. This precocious phase change led to yield loss. Despite of its importance as a traditional medicine, biological mechanisms of ginseng has not been well studied and even the genome sequence of ginseng is yet to be determined due to its complex genome structure. Thus, it is challenging to investigate the molecular biology mechanisms at the transcript level. To investigate how ginseng responds to the high ambient temperature environment, we performed high throughput RNA sequencing and implemented a bioinformatics pipeline for the integrated analysis of small-RNA and mRNA-seq data without a reference genome. By performing reverse transcriptase (RT) PCR and sanger sequencing of transcripts that were assembled using our pipeline, we validated that their sequences were expressed in our samples. Furthermore, to investigate the interaction between genes and non-coding small RNAs and their regulation status under the high ambient temperature, we identified potential gene regulatory miRNAs. As a result, 100,672 contigs with significant expression level were identified and 6 known, 214 conserved and 60 potential novel miRNAs were predicted to be expressed under the high ambient temperature. Collectively, we have found that development, flowering and temperature responsive genes were induced under high ambient temperature, whereas photosynthesis related genes were repressed. Functional miRNAs were down-regulated under the high ambient temperature. Among them are miR156 and miR396 that target flowering (SPL6

  12. Comparison of RNA extraction methods from biofilm samples of Staphylococcus epidermidis

    Directory of Open Access Journals (Sweden)

    França Angela

    2011-12-01

    Full Text Available Abstract Background Microbial biofilms are communities of bacteria adhered to a surface and surrounded by an extracellular polymeric matrix. Biofilms have been associated with increased antibiotic resistance and tolerance to the immune system. Staphylococcus epidermidis is the major bacterial species found in biofilm-related infections on indwelling medical devices. Obtaining high quality mRNA from biofilms is crucial to validate the transcriptional measurements associated with the switching to the biofilm mode of growth. Therefore, we selected three commercially available RNA extraction kits with distinct characteristics, including those using silica membrane or organic extraction methods, and enzymatic or mechanical cell lysis, and evaluated the RNA quality obtained from two distinct S. epidermidis bacterial biofilms. Results RNA extracted using the different kits was evaluated for quantity, purity, integrity, and functionally. All kits were able to extract intact and functional total RNA from the biofilms generated from each S. epidermidis strain. The results demonstrated that the kit based on mechanical lysis and organic extraction (FastRNA® Pro Blue was the only one that was able to isolate pure and large quantities of RNA. Normalized expression of the icaA virulence gene showed that RNA extracted with PureLink™ had a significant lower concentration of icaA mRNA transcripts than the other kits tested. Conclusions When working with complex samples, such as biofilms, that contain a high content extracellular polysaccharide and proteins, special care should be taken when selecting the appropriate RNA extraction system, in order to obtain accurate, reproducible, and biologically significant results. Among the RNA extraction kits tested, FastRNA® Pro Blue was the best option for both S. epidermidis biofilms used.

  13. Expression of the epidermal growth factor system in human endometrium during the menstrual cycle

    DEFF Research Database (Denmark)

    Ejskjaer, Kirsten; Sørensen, B S; Poulsen, Steen Seier

    2005-01-01

    The epidermal growth factor (EGF) system is ubiquitous in humans and plays fundamental roles in embryogenesis, development, proliferation and differentiation. As the endometrium of fertile women is characterized by proliferation and differentiation, we hypothesize a role for the EGF system....... Fourteen premenopausal women had endometrial samples removed on day 6 +/- 1 and day 6 +/- 1 and 12 +/- 1 after ovulation during one menstrual cycle. RNA was extracted and analysed by real-time PCR, and immunohistochemistry was performed to localize the components of the EGF system. Human EGF Receptor 1...... (HER1) showed highest expression during the proliferative phase, HER2 and HER4 during the early and HER3 during the late secretory phase. Amphiregulin (AR) and transforming growth factor alpha (TGFalpha) expression is highest in proliferative phase. Heparin binding (HB)-EGF and betacellulin (BCL) show...

  14. Systemic co-delivery of doxorubicin and siRNA using nanoparticles conjugated with EGFR-specific targeting peptide to enhance chemotherapy in ovarian tumor bearing mice

    Energy Technology Data Exchange (ETDEWEB)

    Liu, C. W.; Lin, W. J., E-mail: wjlin@ntu.edu.tw [National Taiwan University, Graduate Institute of Pharmaceutical Sciences, School of Pharmacy (China)

    2013-10-15

    This aim of this study was to develop peptide-conjugated nanoparticles (NPs) for systemic co-delivery of siRNA and doxorubicin to enhance chemotherapy in epidermal growth factor receptor (EGFR) high-expressed ovarian tumor bearing mice. The active targeting NPs were prepared using heptapeptide-conjugated poly(d,l-lactic-co-glycolic acid)-poly(ethylene glycol). The particle sizes of peptide-free and peptide-conjugated NPs were 159.3 {+-} 32.5 and 184.0 {+-} 52.9 nm, respectively, with zeta potential -21.3 {+-} 3.8 and -15.3 {+-} 2.8 mV. The peptide-conjugated NPs uptake were more efficient in EGFR high-expressed SKOV3 cells than in EGFR low-expressed HepG2 cells due to heptapeptide specificity. The NPs were used to deliver small molecule anticancer drug (e.g., doxorubicin) and large molecule genetic agent (e.g., siRNA). The IC{sub 50} of doxorubicin-loaded peptide-conjugated NPs (0.09 {+-} 0.06 {mu}M) was significantly lower than peptide-free NPs (5.72 {+-} 2.64 {mu}M). The similar result was observed in siRNA-loaded NPs. The peptide-conjugated NPs not only served as a nanocarrier to efficiently deliver doxorubicin and siRNA to EGFR high-expressed ovarian cancer cells but also increased the intracellular accumulation of the therapeutic agents to induce assured anti-tumor growth effect in vivo.

  15. Epidermal inclusion cyst in male breast: mammographic and ultrasonographic findings in three cases

    International Nuclear Information System (INIS)

    Cubells, M.; Gil de Ramales, V.; Bulto, J. A.; Morcillo, E.; Celma, J.

    2000-01-01

    Three cases of histologically diagnosed epidermal inclusion cysts in male breast are presented. This is a very uncommon condition that results from the inclusion of epidermal remnants beneath the skin, which form a keratin-filled cystic cavity. The clinical presentation is that of palpable breast masses showing medium-to-high density in mammography. They are well defined and do not present calcifications. Ultrasound discloses their cystic form, with moderate posterior reinforcement, although they do not appear as anechoic cysts. Characteristically, echoes are detected in the interior that correspond to the degeneration keratin. The differential diagnosis should include cysts complicated by infection or hemorrhage, fibroadenomas with low echogenicity and even tumors of neoplastic origin. Color Doppler ultrasound disclosed the absence of internal vascularisation, a circumstance that indicated the benignity of the lesion. (Author) 9 refs

  16. Evaluation of different pulverisation methods for RNA extraction in squash fruit: lyophilisation, cryogenic mill and mortar grinding.

    Science.gov (United States)

    Román, Belén; González-Verdejo, Clara I; Peña, Francisco; Nadal, Salvador; Gómez, Pedro

    2012-01-01

    Quality and integrity of RNA are critical for transcription studies in plant molecular biology. In squash fruit and other high water content crops, the grinding of tissue with mortar and pestle in liquid nitrogen fails to produce a homogeneous and fine powered sample desirable to ensure a good penetration of the extraction reagent. To develop an improved pulverisation method to facilitate the homogenisation process of squash fruit tissue prior to RNA extraction without reducing quality and yield of the extracted RNA. Three methods of pulverisation, each followed by the same extraction protocol, were compared. The first approach consisted of the lyophilisation of the sample in order to remove the excess of water before grinding, the second one used a cryogenic mill and the control one a mortar grinding of frozen tissue. The quality of the isolated RNA was tested by carrying out a quantitative real time downstream amplification. In the three situations considered, mean values for A(260) /A(280) indicated minimal interference by proteins and RNA quality indicator (RQI) values were considered appropriate for quantitative real-time polymerase chain reaction (qRT-PCR) amplification. Successful qRT-PCR amplifications were obtained with cDNA isolated with the three protocols. Both apparatus can improve and facilitate the grinding step in the RNA extraction process in zucchini, resulting in isolated RNA of high quality and integrity as revealed by qRT-PCR downstream application. This is apparently the first time that a cryogenic mill has been used to prepare fruit samples for RNA extraction, thereby improving the sampling strategy because the fine powder obtained represents a homogeneous mix of the organ tissue. Copyright © 2012 John Wiley & Sons, Ltd.

  17. THE ROLE OF EPIDERMAL BARRIER IMPAIRMENTS IN ATOPIC DERMATITIS: MODERN CONCEPTS OF DISEASE PATHOGENESIS

    Directory of Open Access Journals (Sweden)

    Nikolay N. Murashkin

    2018-01-01

    Full Text Available Atopic dermatitis is a common chronic inflammatory skin disease characterized by a recurring course and progressive decrease in the quality of life. Recent studies in this area demonstrate the multifaceted pathogenesis of atopic dermatitis. Interaction of such factors as epidermal dysfunction, immune system disorders, and the consequences of genetic mutations contributes not only to the development of the disease but also to its progression and chronic course. The article presents various components of the etiopathogenesis of atopic dermatitis, describes the role of lipids, thereby the new therapeutic targets are revealed to specialists.

  18. Inhibition of epidermal cell proliferation by borderline rays

    Energy Technology Data Exchange (ETDEWEB)

    Born, W [Freiburg Univ.; Daikeler, G

    1976-08-01

    Treatment of guinea pig flanks with very soft x-rays (borderline rays) directly caused a partial block of epidermal DNA synthesis which had been determined by measuring the /sup 3/H-Tdr incorporation. Higher doses and repeated applications would undoubtedly cause lasting damage to the tissue. The enhanced epidermal DNA synthesis which is sometimes observed should not be misinterpreted as a sign of a directly biopositive utilisation of the quantum energy supplied. Rather, it is a secondary repair process following initial phases of depression. A reparative increase in DNA synthesis may also occur as a primary process if the radiation is almost completely absorbed above the germinative layer.

  19. MicroRNA-126 and epidermal growth factor-like domain 7-an angiogenic couple of importance in metastatic colorectal cancer. Results from the Nordic ACT trial

    DEFF Research Database (Denmark)

    Hansen, T F; Christensen, René dePont; Andersen, R F

    2013-01-01

    Background:This study investigated the clinical importance of linked angiogenetic biomarkers to chemotherapy, combined with the anti-vascular endothelial growth factor A (anti-VEGF-A), as a first-line treatment in patients with metastatic colorectal cancer (mCRC).Methods:A total of 230 patients......-like domain 7 (EGFL7) protein was visualised and quantified using immunohistochemistry.Results:High tumour expression of miRNA-126 was significantly related to a longer progression-free survival. The independent prognostic value of miRNA-126 was confirmed using a Cox regression analysis (hazard ratio=0.49, 95...... on the prognostic value of miRNA-126 in mCRC and may suggest a relationship between treatment efficacy and EGFL7 expression. As miRNA-126 may target VEGF-A as well as EGFL7, the results may provide predictive information in relation to next-generation anti-angiogenetics....

  20. A validated pipeline for detection of SNVs and short InDels from RNA Sequencing

    Directory of Open Access Journals (Sweden)

    Nitin Mandloi

    2017-12-01

    In this study, we have developed a pipeline to detect germline variants from RNA-seq data. The pipeline steps include: pre-processing, alignment, GATK best practices for RNA-seq and variant filtering. The pre-processing step includes base and adapter trimming and removal of contamination reads from rRNA, tRNA, mitochondrial DNA and repeat regions. The read alignment of the pre-processed reads is performed using STAR/HiSAT. After this we used GATK best practices for the RNA-seq dataset to call germline variants. We benchmarked our pipeline on NA12878 RNA-seq data downloaded from SRA (SRR1258218. After variant calling, the quality passed variants were compared against the gold standard variants provided by GIAB consortium. Of the total ~3.6 million high quality variants reported as gold standard variants for this sample (considering whole genome, our pipeline identified ~58,104 variants to be expressed in RNA-seq. Our pipeline achieved more than 99% of sensitivity in detection of germline variants.

  1. A mRNA-Responsive G-Quadruplex-Based Drug Release System

    Directory of Open Access Journals (Sweden)

    Hidenobu Yaku

    2015-04-01

    Full Text Available G-quadruplex-based drug delivery carriers (GDDCs were designed to capture and release a telomerase inhibitor in response to a target mRNA. Hybridization between a loop on the GDDC structure and the mRNA should cause the G-quadruplex structure of the GDDC to unfold and release the bound inhibitor, anionic copper(II phthalocyanine (CuAPC. As a proof of concept, GDDCs were designed with a 10-30-mer loop, which can hybridize with a target sequence in epidermal growth factor receptor (EGFR mRNA. Structural analysis using circular dichroism (CD spectroscopy showed that the GDDCs form a (3 + 1 type G-quadruplex structure in 100 mM KCl and 10 mM MgCl2 in the absence of the target RNA. Visible absorbance titration experiments showed that the GDDCs bind to CuAPC with Ka values of 1.5 × 105 to 5.9 × 105 M−1 (Kd values of 6.7 to 1.7 μM at 25 °C, depending on the loop length. Fluorescence titration further showed that the G-quadruplex structure unfolds upon binding to the target RNA with Ka values above 1.0 × 108 M−1 (Kd values below 0.01 μM at 25 °C. These results suggest the carrier can sense and bind to the target RNA, which should result in release of the bound drug. Finally, visible absorbance titration experiments demonstrated that the GDDC release CuAPC in response to the target RNA.

  2. Changes in epidermal growth factor receptor expression during chemotherapy in non-small cell lung cancer

    DEFF Research Database (Denmark)

    Jakobsen, Jan Nyrop; Santoni-Rugiu, Eric; Sørensen, Jens Benn

    2014-01-01

    BACKGROUND: Antibodies targeting epidermal growth factor receptor (EGFR), such as cetuximab, may potentially improve outcome in non-small cell lung cancer (NSCLC) patients with high EGFR expression. The EGFR expression may be heterogeneously distributed within tumors, and small biopsies may thus...

  3. Giant epidermal inclusion cyst in the male breast: A case report

    Energy Technology Data Exchange (ETDEWEB)

    KIm, Hyun Jin; Park, Woon Ju; KIm, Sang Wook; Paik, So Ya [Daejin Medical Center Bundang Jesaeng General Hospital, Seongnam (Korea, Republic of)

    2017-03-15

    Giant epidermal inclusion cyst is a rare disease entity, and the occurrence of this cyst in the male breast is extremely rare. We report a case of giant epidermal inclusion cyst in the breast, which presented as a palpable and painful right breast mass in a 63-year-old man. The sonographic and computed tomography (CT) features are described in-depth. Physical examination revealed a firm, well-defined mass in the upper central portion of the right breast. Ultrasonography showed a 5.2 cm sized, oval, circumscribed, and complex cystic and solid mass with posterior acoustic enhancement, and CT showed a well-defined homogeneous low density mass without enhancement in the right breast. Surgical excision was performed, and pathological examination revealed a giant epidermal inclusion cyst.

  4. SINA: accurate high-throughput multiple sequence alignment of ribosomal RNA genes.

    Science.gov (United States)

    Pruesse, Elmar; Peplies, Jörg; Glöckner, Frank Oliver

    2012-07-15

    In the analysis of homologous sequences, computation of multiple sequence alignments (MSAs) has become a bottleneck. This is especially troublesome for marker genes like the ribosomal RNA (rRNA) where already millions of sequences are publicly available and individual studies can easily produce hundreds of thousands of new sequences. Methods have been developed to cope with such numbers, but further improvements are needed to meet accuracy requirements. In this study, we present the SILVA Incremental Aligner (SINA) used to align the rRNA gene databases provided by the SILVA ribosomal RNA project. SINA uses a combination of k-mer searching and partial order alignment (POA) to maintain very high alignment accuracy while satisfying high throughput performance demands. SINA was evaluated in comparison with the commonly used high throughput MSA programs PyNAST and mothur. The three BRAliBase III benchmark MSAs could be reproduced with 99.3, 97.6 and 96.1 accuracy. A larger benchmark MSA comprising 38 772 sequences could be reproduced with 98.9 and 99.3% accuracy using reference MSAs comprising 1000 and 5000 sequences. SINA was able to achieve higher accuracy than PyNAST and mothur in all performed benchmarks. Alignment of up to 500 sequences using the latest SILVA SSU/LSU Ref datasets as reference MSA is offered at http://www.arb-silva.de/aligner. This page also links to Linux binaries, user manual and tutorial. SINA is made available under a personal use license.

  5. Transcriptomic analysis of Petunia hybrida in response to salt stress using high throughput RNA sequencing.

    Directory of Open Access Journals (Sweden)

    Gonzalo H Villarino

    Full Text Available Salinity and drought stress are the primary cause of crop losses worldwide. In sodic saline soils sodium chloride (NaCl disrupts normal plant growth and development. The complex interactions of plant systems with abiotic stress have made RNA sequencing a more holistic and appealing approach to study transcriptome level responses in a single cell and/or tissue. In this work, we determined the Petunia transcriptome response to NaCl stress by sequencing leaf samples and assembling 196 million Illumina reads with Trinity software. Using our reference transcriptome we identified more than 7,000 genes that were differentially expressed within 24 h of acute NaCl stress. The proposed transcriptome can also be used as an excellent tool for biological and bioinformatics in the absence of an available Petunia genome and it is available at the SOL Genomics Network (SGN http://solgenomics.net. Genes related to regulation of reactive oxygen species, transport, and signal transductions as well as novel and undescribed transcripts were among those differentially expressed in response to salt stress. The candidate genes identified in this study can be applied as markers for breeding or to genetically engineer plants to enhance salt tolerance. Gene Ontology analyses indicated that most of the NaCl damage happened at 24 h inducing genotoxicity, affecting transport and organelles due to the high concentration of Na+ ions. Finally, we report a modification to the library preparation protocol whereby cDNA samples were bar-coded with non-HPLC purified primers, without affecting the quality and quantity of the RNA-seq data. The methodological improvement presented here could substantially reduce the cost of sample preparation for future high-throughput RNA sequencing experiments.

  6. Transcriptomic analysis of Petunia hybrida in response to salt stress using high throughput RNA sequencing.

    Science.gov (United States)

    Villarino, Gonzalo H; Bombarely, Aureliano; Giovannoni, James J; Scanlon, Michael J; Mattson, Neil S

    2014-01-01

    Salinity and drought stress are the primary cause of crop losses worldwide. In sodic saline soils sodium chloride (NaCl) disrupts normal plant growth and development. The complex interactions of plant systems with abiotic stress have made RNA sequencing a more holistic and appealing approach to study transcriptome level responses in a single cell and/or tissue. In this work, we determined the Petunia transcriptome response to NaCl stress by sequencing leaf samples and assembling 196 million Illumina reads with Trinity software. Using our reference transcriptome we identified more than 7,000 genes that were differentially expressed within 24 h of acute NaCl stress. The proposed transcriptome can also be used as an excellent tool for biological and bioinformatics in the absence of an available Petunia genome and it is available at the SOL Genomics Network (SGN) http://solgenomics.net. Genes related to regulation of reactive oxygen species, transport, and signal transductions as well as novel and undescribed transcripts were among those differentially expressed in response to salt stress. The candidate genes identified in this study can be applied as markers for breeding or to genetically engineer plants to enhance salt tolerance. Gene Ontology analyses indicated that most of the NaCl damage happened at 24 h inducing genotoxicity, affecting transport and organelles due to the high concentration of Na+ ions. Finally, we report a modification to the library preparation protocol whereby cDNA samples were bar-coded with non-HPLC purified primers, without affecting the quality and quantity of the RNA-seq data. The methodological improvement presented here could substantially reduce the cost of sample preparation for future high-throughput RNA sequencing experiments.

  7. Comparison of blood RNA isolation methods from samples stabilized in Tempus tubes and stored at a large human biobank.

    Science.gov (United States)

    Aarem, Jeanette; Brunborg, Gunnar; Aas, Kaja K; Harbak, Kari; Taipale, Miia M; Magnus, Per; Knudsen, Gun Peggy; Duale, Nur

    2016-09-01

    More than 50,000 adult and cord blood samples were collected in Tempus tubes and stored at the Norwegian Institute of Public Health Biobank for future use. In this study, we systematically evaluated and compared five blood-RNA isolation protocols: three blood-RNA isolation protocols optimized for simultaneous isolation of all blood-RNA species (MagMAX RNA Isolation Kit, both manual and semi-automated protocols; and Norgen Preserved Blood RNA kit I); and two protocols optimized for large RNAs only (Tempus Spin RNA, and Tempus 6-port isolation kit). We estimated the following parameters: RNA quality, RNA yield, processing time, cost per sample, and RNA transcript stability of six selected mRNAs and 13 miRNAs using real-time qPCR. Whole blood samples from adults (n = 59 tubes) and umbilical cord blood (n = 18 tubes) samples collected in Tempus tubes were analyzed. High-quality blood-RNAs with average RIN-values above seven were extracted using all five RNA isolation protocols. The transcript levels of the six selected genes showed minimal variation between the five protocols. Unexplained differences within the transcript levels of the 13 miRNA were observed; however, the 13 miRNAs had similar expression direction and they were within the same order of magnitude. Some differences in the RNA processing time and cost were noted. Sufficient amounts of high-quality RNA were obtained using all five protocols, and the Tempus blood RNA system therefore seems not to be dependent on one specific RNA isolation method.

  8. Epidermal stem cells - role in normal, wounded and pathological psoriatic and cancer skin

    DEFF Research Database (Denmark)

    Kamstrup, M.; Faurschou, A.; Gniadecki, R.

    2008-01-01

    In this review we focus on epidermal stem cells in the normal regeneration of the skin as well as in wounded and psoriatic skin. Furthermore, we discuss current data supporting the idea of cancer stem cells in the pathogenesis of skin carcinoma and malignant melanoma. Epidermal stem cells present...... or transit amplifying cells constitute a primary pathogenetic factor in the epidermal hyperproliferation seen in psoriasis. In cutaneous malignancies mounting evidence supports a stem cell origin in skin carcinoma and malignant melanoma and a possible existence of cancer stem cells Udgivelsesdato: 2008/5...

  9. Modified method for combined DNA and RNA isolation from peanut and other oil seeds.

    Science.gov (United States)

    Dang, Phat M; Chen, Charles Y

    2013-02-01

    Isolation of good quality RNA and DNA from seeds is difficult due to high levels of polysaccharides, polyphenols, and lipids that can degrade or co-precipitate with nucleic acids. Standard RNA extraction methods utilizing guanidinium-phenol-chloroform extraction has not shown to be successful. RNA isolation from plant seeds is a prerequisite for many seed specific gene expression studies and DNA is necessary in marker-assisted selection and other genetic studies. We describe a modified method to isolate both RNA and DNA from the same seed tissue and have been successful with several oil seeds including peanut, soybean, sunflower, canola, and oil radish. An additional LiCl precipitation step was added to isolate both RNA and DNA from the same seed tissues. High quality nucleic acids were observed based on A(260)/A(280) and A(260)/A(230) ratios above 2.0 and distinct bands on gel-electrophoresis. RNA was shown to be suitable for reverse transcriptase polymerase chain reaction based on actin or 60S ribosomal primer amplification and DNA was shown to have a single band on gel-electrophoresis analysis. This result shows that RNA and DNA isolated using this method can be appropriate for molecular studies in peanut and other oil containing seeds.

  10. EPIDERMAL MORPHOLOGY OF WEST AFRICAN OKRA ...

    African Journals Online (AJOL)

    Administrator

    stem peels were obtained from a slight cut on the tenth internodes. Peels from fruit ... xia l su rfa ce. A b a xia l su rfa ce. Adaxial surface. Abaxial surface. L e n g th. (µ m. ) ..... Variations in epidermal cell shape of both adaxial and abaxial surfaces ...

  11. Expression of transforming growth factor alpha and epidermal growth factor receptor in rat lung neoplasms induced by plutonium-239

    International Nuclear Information System (INIS)

    Stegelmeier, B.L.; Gillett, N.A.; Hahn, F.F.; Kelly, G.; Rebar, A.H.

    1994-01-01

    Ninety-two rat lung proliferative lesions and neoplasms induced by inhaled 239 PuO 2 were evaluated for aberrant expression of transforming growth factor alpha (TGF-α) and epidermal growth factor receptor (EGFR). Expression of TGF-α protein, measured by immunohistochemistry, was higher in 94% of the squamous cell carcinomas and 87% of the foci of alveolar epithelial squamous metaplasia than that exhibited by the normal-appearing, adjacent lung parenchyma. In contrast, only 20% of adenocarcinomas and foci of epithelial hyperplasia expressed elevated levels of TGF-α. Many neoplasms expressing TGF-α also expressed excessive levels of EGFR mRNA. Southern and DNA slot blot analyses showed that the elevated EGFR expression was not due to amplification of the EGFR gene. These data suggest that increased amounts of TGF-α were early alterations in the progression of plutonium-induced squamous cell carcinoma, and these increases may occur in parallel with overexpression of the receptor for this growth factor. Together, these alterations create a potential autocrine loop for sustaining clonal expansion of cells initiated by high-LET radiation. 44 refs., 4 figs., 1 tab

  12. Epidermal CYP2 family cytochromes P450

    International Nuclear Information System (INIS)

    Du Liping; Hoffman, Susan M.G.; Keeney, Diane S.

    2004-01-01

    Skin is the largest and most accessible drug-metabolizing organ. In mammals, it is the competent barrier that protects against exposure to harmful stimuli in the environment and in the systemic circulation. Skin expresses many cytochromes P450 that have critical roles in exogenous and endogenous substrate metabolism. Here, we review evidence for epidermal expression of genes from the large CYP2 gene family, many of which are expressed preferentially in extrahepatic tissues or specifically in epithelia at the environmental interface. At least 13 CYP2 genes (CYP2A6, 2A7, 2B6, 2C9, 2C18, 2C19, 2D6, 2E1, 2J2, 2R1, 2S1, 2U1, and 2W1) are expressed in skin from at least some human individuals, and the majority of these genes are expressed in epidermis or cultured keratinocytes. Where epidermal expression has been localized in situ by hybridization or immunocytochemistry, CYP2 transcripts and proteins are most often expressed in differentiated keratinocytes comprising the outer (suprabasal) cell layers of the epidermis and skin appendages. The tissue-specific transcriptional regulation of CYP2 genes in the epidermis, and in other epithelia that interface with the environment, suggests important roles for at least some CYP2 gene products in the production and disposition of molecules affecting competency of the epidermal barrier

  13. Maturational steps of bone marrow-derived dendritic murine epidermal cells. Phenotypic and functional studies on Langerhans cells and Thy-1+ dendritic epidermal cells in the perinatal period.

    Science.gov (United States)

    Elbe, A; Tschachler, E; Steiner, G; Binder, A; Wolff, K; Stingl, G

    1989-10-15

    The adult murine epidermis harbors two separate CD45+ bone marrow (BM)-derived dendritic cell systems, i.e., Ia+, ADPase+, Thy-1-, CD3- Langerhans cells (LC) and Ia-, ADPase-, Thy-1+, CD3+ dendritic epidermal T cells (DETC). To clarify whether the maturation of these cells from their ill-defined precursors is already accomplished before their entry into the epidermis or, alternatively, whether a specific epidermal milieu is required for the expression of their antigenic determinants, we studied the ontogeny of CD45+ epidermal cells (EC). In the fetal life, there exists a considerable number of CD45+, Ia-, ADPase+ dendritic epidermal cells. When cultured, these cells become Ia+ and, in parallel, acquire the potential of stimulating allogeneic T cell proliferation. These results imply that CD45+, Ia-, ADPase+ fetal dendritic epidermal cells are immature LC precursors and suggest that the epidermis plays a decisive role in LC maturation. The day 17 fetal epidermis also contains a small population of CD45+, Thy-1+, ADPase-, CD3- round cells. Over the course of 2 to 3 wk, they are slowly replaced by an ever increasing number of round and, finally, dendritic CD45+, Thy-1+, CD3+ EC. Thus, CD45+, Thy-1+, ADPase-, CD3- fetal EC may either be DETC precursors or, alternatively, may represent a distinctive cell system of unknown maturation potential. According to this latter theory, these cells would be eventually outnumbered by newly immigrating CD45+, Thy-1+, CD3+ T cells--the actual DETC.

  14. High-throughput miRNA profiling of human melanoma blood samples

    Directory of Open Access Journals (Sweden)

    Rass Knuth

    2010-06-01

    Full Text Available Abstract Background MicroRNA (miRNA signatures are not only found in cancer tissue but also in blood of cancer patients. Specifically, miRNA detection in blood offers the prospect of a non-invasive analysis tool. Methods Using a microarray based approach we screened almost 900 human miRNAs to detect miRNAs that are deregulated in their expression in blood cells of melanoma patients. We analyzed 55 blood samples, including 20 samples of healthy individuals, 24 samples of melanoma patients as test set, and 11 samples of melanoma patients as independent validation set. Results A hypothesis test based approch detected 51 differentially regulated miRNAs, including 21 miRNAs that were downregulated in blood cells of melanoma patients and 30 miRNAs that were upregulated in blood cells of melanoma patients as compared to blood cells of healthy controls. The tets set and the independent validation set of the melanoma samples showed a high correlation of fold changes (0.81. Applying hierarchical clustering and principal component analysis we found that blood samples of melanoma patients and healthy individuals can be well differentiated from each other based on miRNA expression analysis. Using a subset of 16 significant deregulated miRNAs, we were able to reach a classification accuracy of 97.4%, a specificity of 95% and a sensitivity of 98.9% by supervised analysis. MiRNA microarray data were validated by qRT-PCR. Conclusions Our study provides strong evidence for miRNA expression signatures of blood cells as useful biomarkers for melanoma.

  15. Physiological epidermal growth factor concentrations activate high affinity receptors to elicit calcium oscillations.

    Directory of Open Access Journals (Sweden)

    Béatrice Marquèze-Pouey

    Full Text Available Signaling mediated by the epidermal growth factor (EGF is crucial in tissue development, homeostasis and tumorigenesis. EGF is mitogenic at picomolar concentrations and is known to bind its receptor on high affinity binding sites depending of the oligomerization state of the receptor (monomer or dimer. In spite of these observations, the cellular response induced by EGF has been mainly characterized for nanomolar concentrations of the growth factor, and a clear definition of the cellular response to circulating (picomolar concentrations is still lacking. We investigated Ca2+ signaling, an early event in EGF responses, in response to picomolar doses in COS-7 cells where the monomer/dimer equilibrium is unaltered by the synthesis of exogenous EGFR. Using the fluo5F Ca2+ indicator, we found that picomolar concentrations of EGF induced in 50% of the cells a robust oscillatory Ca2+ signal quantitatively similar to the Ca2+ signal induced by nanomolar concentrations. However, responses to nanomolar and picomolar concentrations differed in their underlying mechanisms as the picomolar EGF response involved essentially plasma membrane Ca2+ channels that are not activated by internal Ca2+ store depletion, while the nanomolar EGF response involved internal Ca2+ release. Moreover, while the picomolar EGF response was modulated by charybdotoxin-sensitive K+ channels, the nanomolar response was insensitive to the blockade of these ion channels.

  16. Physiological epidermal growth factor concentrations activate high affinity receptors to elicit calcium oscillations.

    Science.gov (United States)

    Marquèze-Pouey, Béatrice; Mailfert, Sébastien; Rouger, Vincent; Goaillard, Jean-Marc; Marguet, Didier

    2014-01-01

    Signaling mediated by the epidermal growth factor (EGF) is crucial in tissue development, homeostasis and tumorigenesis. EGF is mitogenic at picomolar concentrations and is known to bind its receptor on high affinity binding sites depending of the oligomerization state of the receptor (monomer or dimer). In spite of these observations, the cellular response induced by EGF has been mainly characterized for nanomolar concentrations of the growth factor, and a clear definition of the cellular response to circulating (picomolar) concentrations is still lacking. We investigated Ca2+ signaling, an early event in EGF responses, in response to picomolar doses in COS-7 cells where the monomer/dimer equilibrium is unaltered by the synthesis of exogenous EGFR. Using the fluo5F Ca2+ indicator, we found that picomolar concentrations of EGF induced in 50% of the cells a robust oscillatory Ca2+ signal quantitatively similar to the Ca2+ signal induced by nanomolar concentrations. However, responses to nanomolar and picomolar concentrations differed in their underlying mechanisms as the picomolar EGF response involved essentially plasma membrane Ca2+ channels that are not activated by internal Ca2+ store depletion, while the nanomolar EGF response involved internal Ca2+ release. Moreover, while the picomolar EGF response was modulated by charybdotoxin-sensitive K+ channels, the nanomolar response was insensitive to the blockade of these ion channels.

  17. Renal content and output of epidermal growth factor in long-term adrenergic agonist-treated rats

    DEFF Research Database (Denmark)

    Thulesen, J; Nexø, Ebba; Poulsen, Steen Seier

    2000-01-01

    This study investigates the renal and urinary levels of epidermal growth factor (EGF) in rats under long-term treatment with alpha- or beta-adrenergic agonists. Urine samples were obtained on days 7, 14 and 21, and renal tissue samples on day 21. EGF was quantified by ELISA and tissue sections were...... material in the distal tubules. Concomitantly, reduced levels of EGF and EGF mRNA were observed, and also the urinary levels of EGF were reduced. Together, these observations indicate alpha-adrenergic treatment to affect the distal tubules. Treatment with the beta-adrenergic agonist did not change...... fractional kidney weight, but initially the urinary excretion of EGF was reduced. The data add further evidence to the suggestion that activity of the sympathetic nervous system influences renal homeostasis of EGF, either directly or indirectly through renal histopathological changes....

  18. Epigenetic Regulation of Epidermal Stem Cell Biomarkers and Their Role in Wound Healing

    Directory of Open Access Journals (Sweden)

    Sabita N. Saldanha

    2015-12-01

    Full Text Available As an actively renewable tissue, changes in skin architecture are subjected to the regulation of stem cells that maintain the population of cells responsible for the formation of epidermal layers. Stems cells retain their self-renewal property and express biomarkers that are unique to this population. However, differential regulation of the biomarkers can initiate the pathway of terminal cell differentiation. Although, pockets of non-clarity in stem cell maintenance and differentiation in skin still exist, the influence of epigenetics in epidermal stem cell functions and differentiation in skin homeostasis and wound healing is clearly evident. The focus of this review is to discuss the epigenetic regulation of confirmed and probable epidermal stem cell biomarkers in epidermal stratification of normal skin and in diseased states. The role of epigenetics in wound healing, especially in diseased states of diabetes and cancer, will also be conveyed.

  19. Comparison of good- and bad-quality cork: application of high-throughput sequencing of phellogenic tissue.

    Science.gov (United States)

    Teixeira, Rita Teresa; Fortes, Ana Margarida; Pinheiro, Carla; Pereira, Helena

    2014-09-01

    Cork is one of the most valuable non-wood forest products and plays an important role in Mediterranean economies. The production of high-quality cork is dependent on both genome and environment, posing constraints on the industry because an ever-growing amount of bad-quality cork (BQC) development has been observed. In order to identify genes responsible for production of cork of superior quality we performed a comparative analysis using the 454 pyrosequencing approach on phellogenic tissue of good- and bad-quality samples. The transcriptional profiling showed a high number of genes differentially expressed (8.48%) from which 78.8% displayed annotation. Genes more highly represented in BQC are involved in DNA synthesis, RNA processing, proteolysis, and transcription factors related to the abiotic stress response. Putative stomatal/lenticular-associated genes which may be responsible for the disadvantageous higher number of lenticular channels in BQC are also more highly represented. BQC also showed an elevated content of free phenolics. On the other hand, good-quality cork (GQC) can be distinguished by highly expressed genes encoding heat-shock proteins. Together the results provide valuable new information about the molecular events leading to cork formation and provide putative biomarkers associated with cork quality that can be useful in breeding programmes. © The Author 2014. Published by Oxford University Press on behalf of the Society for Experimental Biology. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  20. Using scale and feather traits for module construction provides a functional approach to chicken epidermal development.

    Science.gov (United States)

    Bao, Weier; Greenwold, Matthew J; Sawyer, Roger H

    2017-11-01

    Gene co-expression network analysis has been a research method widely used in systematically exploring gene function and interaction. Using the Weighted Gene Co-expression Network Analysis (WGCNA) approach to construct a gene co-expression network using data from a customized 44K microarray transcriptome of chicken epidermal embryogenesis, we have identified two distinct modules that are highly correlated with scale or feather development traits. Signaling pathways related to feather development were enriched in the traditional KEGG pathway analysis and functional terms relating specifically to embryonic epidermal development were also enriched in the Gene Ontology analysis. Significant enrichment annotations were discovered from customized enrichment tools such as Modular Single-Set Enrichment Test (MSET) and Medical Subject Headings (MeSH). Hub genes in both trait-correlated modules showed strong specific functional enrichment toward epidermal development. Also, regulatory elements, such as transcription factors and miRNAs, were targeted in the significant enrichment result. This work highlights the advantage of this methodology for functional prediction of genes not previously associated with scale- and feather trait-related modules.

  1. Tc-99m-MDP scintigraphy in the evaluation of epidermal nevus syndrome

    International Nuclear Information System (INIS)

    Barbosa, M.N.S.; Cunha, M.O.; Severiche, A.F.A.; Ramos, C.D.; Etchebehere, E.C.S.C.; Belangero, W.; Camargo, E.E.

    1997-01-01

    Full text: Epidermal nevus syndrome has been described as a congenital neurocutaneous disorder in which epidermal nevi are associated with malformations of other organs, commonly the skeleton and central nervous system. Ocular, cardiac, and genitourinary system abnormalities, as well as other skin lesions, may also be seen. A 19 year old patient with epidermal nevus syndrome, presenting congenital facial epidermal nevi and bone deformity of the lower limbs (shortening of the left leg, left thigh varum, bilateral genu valgum, and multiple pathological fractures), as referred to the nuclear medicine laboratory to evaluate involvement of other sites of the skeleton. Whole body bone scintigraphy performed with MDP-Tc-99m showed multiple small focal areas of increased uptake in the skeleton, mainly in the upper and lower limbs, posterior ribs, right acetabulum, right sacroiliac joint, and right greater trochanter, interpreted as pathological fractures at different stages of remodeling. The range of skeletal findings in this condition is quite diverse. Many of these findings can be attributed to local tissue overgrowth with deformities and advanced bone age, associate with pathological fractures

  2. Reliable PCR quantitation of estrogen, progesterone and ERBB2 receptor mRNA from formalin-fixed, paraffin-embedded tissue is independent of prior macro-dissection

    DEFF Research Database (Denmark)

    Tramm, Trine; Hennig, Guido; Kyndi, Marianne

    2013-01-01

    Gene expression analysis on messenger RNA (mRNA) purified from formalin-fixed, paraffin-embedded tissue is increasingly used for research purposes. Tissue heterogeneity may question specificity and interpretation of results from mRNA isolated from a whole slide section, and thresholds for minimal...... tumor content in the paraffin block or macrodissection are used to avoid contamination from non-neoplastic tissue. The aim was to test if mRNA from tissue surrounding breast cancer affected quantification of estrogen receptor α (ESR1), progesterone receptor (PGR) and human epidermal growth factor...... receptor 2 (ERBB2), by comparing gene expression from whole slide and tumor-enriched sections, and correlating gene expression from whole slide sections with corresponding immunohistochemistry. Gene expression, based on mRNA extracted from a training set (36 paraffin blocks) and two validation sets (133...

  3. RNA-Pareto: interactive analysis of Pareto-optimal RNA sequence-structure alignments.

    Science.gov (United States)

    Schnattinger, Thomas; Schöning, Uwe; Marchfelder, Anita; Kestler, Hans A

    2013-12-01

    Incorporating secondary structure information into the alignment process improves the quality of RNA sequence alignments. Instead of using fixed weighting parameters, sequence and structure components can be treated as different objectives and optimized simultaneously. The result is not a single, but a Pareto-set of equally optimal solutions, which all represent different possible weighting parameters. We now provide the interactive graphical software tool RNA-Pareto, which allows a direct inspection of all feasible results to the pairwise RNA sequence-structure alignment problem and greatly facilitates the exploration of the optimal solution set.

  4. Protein profiling of epidermal bladder cells from the halophyte Mesembryanthemum crystallinum.

    Science.gov (United States)

    Barkla, Bronwyn J; Vera-Estrella, Rosario; Pantoja, Omar

    2012-09-01

    Plant epidermal trichomes are as varied in morphology as they are in function. In the halophyte Mesembryanthemum crystallinum, specialized trichomes called epidermal bladder cells (EBC) line the surface of leaves and stems, and increase dramatically in size and volume upon plant salt-treatment. These cells have been proposed to have roles in plant defense and UV protection, but primarily in sodium sequestration and as water reservoirs. To gain further understanding into the roles of EBC, a cell-type-specific proteomics approach was taken in which precision single-cell sampling of cell sap from individual EBC was combined with shotgun peptide sequencing (LC-MS/MS). Identified proteins showed diverse biological functions and cellular locations, with a high representation of proteins involved in H(+)-transport, carbohydrate metabolism, and photosynthesis. The proteome of EBC provides insight into the roles of these cells in ion and water homeostasis and raises the possibility that they are photosynthetically active and functioning in Crassulacean acid metabolism. © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. Ruptured Epidermal Inclusion Cysts in the Subareolar Area: Sonographic Findings in Two Cases

    Energy Technology Data Exchange (ETDEWEB)

    Whang, In Yong; Lee, Jae Hee; Kim, Jeong Soo; Kim, Ki Tae; Shin, Ok Ran [Uijongbu St. Mary' s Hospital, Catholic University College of Medicine, Seoul (Korea, Republic of)

    2007-08-15

    We report here on two cases of ruptured epidermal inclusion cysts in the subareolar area, which is a very unusual location for these cysts and these lesions can be mistaken for breast malignancies. Although the epidermal inclusion cyst is an uncommon finding in the breast, we can easily diagnosis this as a cyst. But when it is presented in an unusual subareolar location and with a ruptured state, it can be mistaken for breast malignancy. We present here two surgically confirmed cases of ruptured epidermal inclusion cyst in a subareolar location, and this has not been previously described in the English medical literature. In our cases, we first considered the possibility of breast malignancy because the masses presented as an irregular mass on the initial sonography, and the patients were over the age 40 and we didn't take the possibility of abscess from ruptured epidermal inclusion cyst into consideration due to its rare occurrence and the unusual lesion location. FNAB and follow up imaging study after medical treatment, or the recurrent feature were the ways to later narrow the differential diagnosis. In conclusion, when a subareolar lesion has findings on sonography that are suspicious of malignancy, the differential diagnosis should include a ruptured epidermal inclusion cyst, with or without evidence of inflammation.

  6. Ruptured Epidermal Inclusion Cysts in the Subareolar Area: Sonographic Findings in Two Cases

    International Nuclear Information System (INIS)

    Whang, In Yong; Lee, Jae Hee; Kim, Jeong Soo; Kim, Ki Tae; Shin, Ok Ran

    2007-01-01

    We report here on two cases of ruptured epidermal inclusion cysts in the subareolar area, which is a very unusual location for these cysts and these lesions can be mistaken for breast malignancies. Although the epidermal inclusion cyst is an uncommon finding in the breast, we can easily diagnosis this as a cyst. But when it is presented in an unusual subareolar location and with a ruptured state, it can be mistaken for breast malignancy. We present here two surgically confirmed cases of ruptured epidermal inclusion cyst in a subareolar location, and this has not been previously described in the English medical literature. In our cases, we first considered the possibility of breast malignancy because the masses presented as an irregular mass on the initial sonography, and the patients were over the age 40 and we didn't take the possibility of abscess from ruptured epidermal inclusion cyst into consideration due to its rare occurrence and the unusual lesion location. FNAB and follow up imaging study after medical treatment, or the recurrent feature were the ways to later narrow the differential diagnosis. In conclusion, when a subareolar lesion has findings on sonography that are suspicious of malignancy, the differential diagnosis should include a ruptured epidermal inclusion cyst, with or without evidence of inflammation

  7. Epidermal growth factor in mammary glands and milk from rats

    DEFF Research Database (Denmark)

    Thulesen, J; Raaberg, Lasse; Nexø, Ebba

    1993-01-01

    Epidermal growth factor (EGF) is one of the major growth-promoting agents in milk. Using immunohistochemistry we localized EGF in the mammary glands of lactating rats to the luminal border of the secretory cells. Following proteolytic pretreatment of the histological sections, the EGF-immunoreact......Epidermal growth factor (EGF) is one of the major growth-promoting agents in milk. Using immunohistochemistry we localized EGF in the mammary glands of lactating rats to the luminal border of the secretory cells. Following proteolytic pretreatment of the histological sections, the EGF...

  8. Retrieval of a million high-quality, full-length microbial 16S and 18S rRNA gene sequences without primer bias

    DEFF Research Database (Denmark)

    Karst, Søren Michael; Dueholm, Morten Simonsen; McIlroy, Simon Jon

    2018-01-01

    Small subunit ribosomal RNA (SSU rRNA) genes, 16S in bacteria and 18S in eukaryotes, have been the standard phylogenetic markers used to characterize microbial diversity and evolution for decades. However, the reference databases of full-length SSU rRNA gene sequences are skewed to well-studied e...

  9. Human epidermal growth factor: molecular forms and application of radioimmunoassay and radioreceptor assay

    International Nuclear Information System (INIS)

    Hirata, Y.; Orth, D.N.

    1981-01-01

    Epidermal growth factor (EGF), a 53 amino acid polypeptide, was first isolated by Cohen. EGF's growth-promoting activity is not limited to epidermal cells, but is expressed on a wide variety of tissues derived from a number of different species. Human EGF (hEGF) was isolated and subsequently purified from human urine. Unexpectedly, a close structural relationship was recognized between mEGF and human β-urogastrone. The authors recently developed both an homologous hEGF radioimmunoassay (RIA) and a radioreceptor assay (RRA) using a human placental membrane fraction. Using these assays, the molecular size of hEGF in human body fluids and tissues was evaluated, and partial characterization of a high molecular weight form of hEGF isolated from human urine was carried out. The concentrations of immunoreactive hEGF were also determined in human tissues and plasma after extraction either with cationic exchange chromatography or with immunoaffinity chromatography. (Auth.)

  10. Stevens-Johnson Syndrome (SJS) and Toxic Epidermal Necrolysis ...

    African Journals Online (AJOL)

    REVIEW. Introduction. Stevens-Johnson syndrome (SJS) and toxic epidermal ... that affect the skin and mucous membranes. ... Open Access article distributed under the terms of the .... pathogenic components are removed from plasma. The.

  11. Epidermal cell death in frogs with chytridiomycosis

    Directory of Open Access Journals (Sweden)

    Laura A. Brannelly

    2017-02-01

    Full Text Available Background Amphibians are declining at an alarming rate, and one of the major causes of decline is the infectious disease chytridiomycosis. Parasitic fungal sporangia occur within epidermal cells causing epidermal disruption, but these changes have not been well characterised. Apoptosis (planned cell death can be a damaging response to the host but may alternatively be a mechanism of pathogen removal for some intracellular infections. Methods In this study we experimentally infected two endangered amphibian species Pseudophryne corroboree and Litoria verreauxii alpina with the causal agent of chytridiomycosis. We quantified cell death in the epidermis through two assays: terminal transferase-mediated dUTP nick end-labelling (TUNEL and caspase 3/7. Results Cell death was positively associated with infection load and morbidity of clinically infected animals. In infected amphibians, TUNEL positive cells were concentrated in epidermal layers, correlating to the localisation of infection within the skin. Caspase activity was stable and low in early infection, where pathogen loads were light but increasing. In animals that recovered from infection, caspase activity gradually returned to normal as the infection cleared. Whereas, in amphibians that did not recover, caspase activity increased dramatically when infection loads peaked. Discussion Increased cell death may be a pathology of the fungal parasite, likely contributing to loss of skin homeostatic functions, but it is also possible that apoptosis suppression may be used initially by the pathogen to help establish infection. Further research should explore the specific mechanisms of cell death and more specifically apoptosis regulation during fungal infection.

  12. RNA surveillance via nonsense-mediated mRNA decay is crucial for longevity in daf-2/insulin/IGF-1 mutant C. elegans.

    Science.gov (United States)

    Son, Heehwa G; Seo, Mihwa; Ham, Seokjin; Hwang, Wooseon; Lee, Dongyeop; An, Seon Woo A; Artan, Murat; Seo, Keunhee; Kaletsky, Rachel; Arey, Rachel N; Ryu, Youngjae; Ha, Chang Man; Kim, Yoon Ki; Murphy, Coleen T; Roh, Tae-Young; Nam, Hong Gil; Lee, Seung-Jae V

    2017-03-09

    Long-lived organisms often feature more stringent protein and DNA quality control. However, whether RNA quality control mechanisms, such as nonsense-mediated mRNA decay (NMD), which degrades both abnormal as well as some normal transcripts, have a role in organismal aging remains unexplored. Here we show that NMD mediates longevity in C. elegans strains with mutations in daf-2/insulin/insulin-like growth factor 1 receptor. We find that daf-2 mutants display enhanced NMD activity and reduced levels of potentially aberrant transcripts. NMD components, including smg-2/UPF1, are required to achieve the longevity of several long-lived mutants, including daf-2 mutant worms. NMD in the nervous system of the animals is particularly important for RNA quality control to promote longevity. Furthermore, we find that downregulation of yars-2/tyrosyl-tRNA synthetase, an NMD target transcript, by daf-2 mutations contributes to longevity. We propose that NMD-mediated RNA surveillance is a crucial quality control process that contributes to longevity conferred by daf-2 mutations.

  13. Epidermal growth factor enemas for induction of remission in left-sided ulcerative colitis

    Directory of Open Access Journals (Sweden)

    Hugo Nodarse-Cuní

    2013-03-01

    Full Text Available Introduction: ulcerative colitis is a little known chronic inflammatory disease in colonic mucosa. The positive effect of epidermal growth factor was shown in a previous report, with enema use for treatment of mild to moderate left-sided manifestation of the disease. This evidence provided the basis for evaluating the efficacy and safety profile of a viscous solution of this product. Methods: thirty-one patients were randomized to three groups for daily medications during 14 days. Twelve received one 10 mg enema of epidermal growth factor dissolved in 100 mL of viscous solution whereas nine were treated with placebo enema; both groups also received 1.2 g of oral mesalamine per day. The other group included ten patients with 3 g / 100 mL of mesalamine enema. Primary end point was clinical responses after two weeks of treatment, defined as a decreased of, at least three points from baseline, the Disease Activity Index and endoscopic or histological evidences of improvement. Results: remission of disease was observed in all patients in the epidermal growth factor group, and six in both, mesalamine enema and placebo group. All the comparisons between groups showed statistically significant superiority for epidermal growth factor, the only product with significant reduction in disease activity index as well as the presence and intensity of digestive symptoms in patients after treatment. None adverse event was reported. Conclusions: the results agree with previous molecular and clinical evidences, indicating that the epidermal growth factor is effective to reduce disease activity and to induce remission. A new study involving more patients should be conducted to confirm the efficacy of the epidermal growth factor enemas.

  14. FOLIAR EPIDERMAL AND PHYTOCHEMICAL STUDIES OF THE ...

    African Journals Online (AJOL)

    Administrator

    alkaloid, saponin, inulin, cellulose, tannin and lignin; Eragrostis tremula tested negative for lignin and positive for cellulose, saponin and alkaloids while Axonopus compressus tested negative for lignin, but positive for alkaloid, saponin, inulin, cellulose and tannin respectively. Leaf epidermal studies help to determine ...

  15. Stevens Johnsons syndrom og toksisk epidermal nekrolyse

    DEFF Research Database (Denmark)

    Kaur-Knudsen, Diljit; Zachariae, Claus; Thomsen, Simon Francis

    2013-01-01

    Stevens-Johnson syndrome and toxic epidermal necrolysis are acute mucocutaneous diseases primarily due to drug intake. The diseases are characterised by the separation of epidermis from dermis which can be life-threatening. Mortality is often caused by sepsis and multiple organ failure. The most...

  16. Structural and biophysical characteristics of human skin in maintaining proper epidermal barrier function

    Directory of Open Access Journals (Sweden)

    Magdalena Boer

    2016-02-01

    Full Text Available The complex structure of human skin and its physicochemical properties turn it into an efficient outermost defence line against exogenous factors, and help maintain homeostasis of the human body. This role is played by the epidermal barrier with its major part – stratum corneum. The condition of the epidermal barrier depends on individual and environmental factors. The most important biophysical parameters characterizing the status of this barrier are the skin pH, epidermal hydration, transepidermal water loss and sebum excretion. The knowledge of biophysical skin processes may be useful for the implementation of prophylactic actions whose aim is to restore the barrier function.

  17. Acyl-CoA binding protein and epidermal barrier function

    DEFF Research Database (Denmark)

    Bloksgaard, Maria; Neess, Ditte; Færgeman, Nils J

    2014-01-01

    The acyl-CoA binding protein (ACBP) is a 10kDa intracellular protein expressed in all eukaryotic species and mammalian tissues investigated. It binds acyl-CoA esters with high specificity and affinity and is thought to act as an intracellular transporter of acyl-CoA esters between different...... includes tousled and greasy fur, development of alopecia and scaling of the skin with age. Furthermore, epidermal barrier function is compromised causing a ~50% increase in transepidermal water loss relative to that of wild type mice. Lipidomic analyses indicate that this is due to significantly reduced...

  18. Comparative profiling of miRNA expression in developing seeds of high linoleic and high oleic safflower (Carthamus tinctorius L. plants

    Directory of Open Access Journals (Sweden)

    Shijiang eCao

    2013-12-01

    Full Text Available Vegetable oils high in oleic acid are considered to be advantageous because of their better nutritional value and potential industrial applications. The oleic acid content in the classic safflower oil is normally 10-15% while a natural mutant (ol accumulates elevated oleic acid up to 70% in seed oil. As a part of our investigation into the molecular features of the high oleic (HO trait in safflower we have profiled the microRNA (miRNA populations in developing safflower seeds expressing the ol allele in comparison to the wild type high linoleic (HL safflower using deep sequencing technology. The small RNA populations of the mid-maturity developing embryos of homozygous ol HO and wild type HL safflower had a very similar size distribution pattern, however, only ~16.5% of the unique small RNAs were overlapping in these two genotypes. From these two small RNA populations we have found 55 known miRNAs and identified two candidate novel miRNA families to be likely unique to the developing safflower seeds. Target genes with conserved as well as novel functions were predicted for the conserved miRNAs. We have also identified 13 miRNAs differentially expressed between the HO and HL safflower genotypes. The results may lay a foundation for unravelling the miRNA-mediated molecular processes that regulate oleic acid accumulation in the HO safflower mutant and developmental processes in safflower embryos in general.

  19. Switching off small RNA regulation with trap-mRNA

    DEFF Research Database (Denmark)

    Overgaard, Martin; Johansen, Jesper; Møller-Jensen, Jakob

    2009-01-01

    to operate at the level of transcription initiation. By employing a highly sensitive genetic screen we uncovered a novel RNA-based regulatory principle in which induction of a trap-mRNA leads to selective degradation of a small regulatory RNA molecule, thereby abolishing the sRNA-based silencing of its...

  20. Protective Effect of HemoHIM on Epidermal Melanocytes in Ultraviolet-B irradiated Mice

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Hae June [Korea Institute of Radiological and Medical Science, Seoul (Korea, Republic of); Kim, Jong Choon; Moon, Chang Jong; Kim, Sung Ho [Chonnam National University, Gwangju (Korea, Republic of); Jung, U Hee; Park, Hae Ran; Jo, Sung Kee [Jeongeup Campus of Korea Atomic Energy Research Institute, Jeongeup (Korea, Republic of); Jang, Jong Sik; Kim, Tae Hwan [Kyungpook National University, Daegu (Korea, Republic of)

    2011-06-15

    We induced the activation of melanocytes in the epidermis of C57BL/6 mice by ultraviolet-B (UV-B) irradiation, and observed the effect of an herbal preparation (HemoHIM, HH) on the formation, and decrease of UV-B-induced epidermal melanocytes. C57BL/6 mice were irradiated by UV-B 80 mJ:cm{sup -2} (0.5 mW:sec{sup -1}) daily for 7 days, and HH was intraperitoneally, orally or topically applied pre- or post-irradiation. For the estimation of change of epidermal melanocytes, light microscopic observation with dihydroxyphenylalanine (DOPA) stain was performed. Split epidermal sheets prepared from the ear of untreated mice exhibited 13∼15 melanocytes:mm{sup -2}, and one week after UV irradiation, the applied areas showed an increased number of strongly DOPA-positive melanocytes with stout dendrites. But intraperitoneal, oral or topical treatment with HH before each irradiation interrupted UV-B-induced pigmentation and resulted in a marked reduction in the number of epidermal melanocytes as compared to the number found in UV-B-irradiated, untreated control skin. The number and size of DOPA-positive epidermal melanocytes were also significantly decreased in intraperitoneally injected or topically applicated group after irradiation with HH at 3rd and 6th weeks after irradiation. The present study suggests the HH as inhibitor of UV-B-induced pigmentation, and depigmenting agent.

  1. Polyethylene Glycol Mediated Colorectal Cancer Chemoprevention: Roles of Epidermal Growth Factor Receptor and Snail

    Science.gov (United States)

    Wali, Ramesh K.; Kunte, Dhananjay P.; Koetsier, Jennifer L.; Bissonnette, Marc; Roy, Hemant K.

    2008-01-01

    Polyethylene glycol (PEG) is a clinically widely used agent with profound chemopreventive properties in experimental colon carcinogenesis. We previously reported that Snail/β-catenin signaling may mediate the suppression of epithelial proliferation by PEG, although the upstream events remain unclear. We report herein the role of epidermal growth factor receptor (EGFR), a known mediator of Snail and overepressed in ~80% of human colorectal cancers (CRC), on PEG-mediated anti-proliferative and hence anti-neoplastic effects in azoxymethane (AOM)-rats and HT-29 colon cancer cells. AOM-rats were randomized to either standard diet or one with 10% PEG 3350 and euthanized 8 weeks later. The colonic samples were subjected to immunohistochemical or Western blot analyses. PEG decreased mucosal EGFR by 60% (pPEG effects were obtained in HT-29 cells. PEG suppressed EGFR protein via lysosmal degradation with no change in mRNA levels. To show that EGFR antagonism per se was responsible for the antiproliferative effect, we inhibited EGFR by either pre-treating cells with gefitinib or stably transfecting with EGFR-shRNA and measured the effect of PEG on proliferation. In either case PEG effect was blunted suggesting a vital role of EGFR. Flow cytometric analysis revealed that EGFR-shRNA cells, besides having reduced membrane EGFR also expressed low Snail levels (40%), corroborating a strong association. Furthermore, in EGFR silenced cells PEG effect on EGFR or Snail was muted, similar to that on proliferation. In conclusion, we show that EGFR is the proximate membrane signaling molecule through which PEG initiates antiproliferative activity with Snail/β-catenin pathway playing the central intermediary function. PMID:18790788

  2. Polyethylene glycol-mediated colorectal cancer chemoprevention: roles of epidermal growth factor receptor and Snail.

    Science.gov (United States)

    Wali, Ramesh K; Kunte, Dhananjay P; Koetsier, Jennifer L; Bissonnette, Marc; Roy, Hemant K

    2008-09-01

    Polyethylene glycol (PEG) is a clinically widely used agent with profound chemopreventive properties in experimental colon carcinogenesis. We reported previously that Snail/beta-catenin signaling may mediate the suppression of epithelial proliferation by PEG, although the upstream events remain unclear. We report herein the role of epidermal growth factor receptor (EGFR), a known mediator of Snail and overexpressed in approximately 80% of human colorectal cancers, on PEG-mediated antiproliferative and hence antineoplastic effects in azoxymethane (AOM) rats and HT-29 colon cancer cells. AOM rats were randomized to either standard diet or one with 10% PEG-3350 and euthanized 8 weeks later. The colonic samples were subjected to immunohistochemical or Western blot analyses. PEG decreased mucosal EGFR by 60% (P PEG effects were obtained in HT-29 cells. PEG suppressed EGFR protein via lysosmal degradation with no change in mRNA levels. To show that EGFR antagonism per se was responsible for the antiproliferative effect, we inhibited EGFR by either pretreating cells with gefitinib or stably transfecting with EGFR-short hairpin RNA and measured the effect of PEG on proliferation. In either case, PEG effect was blunted, suggesting a vital role of EGFR. Flow cytometric analysis revealed that EGFR-short hairpin RNA cells, besides having reduced membrane EGFR, also expressed low Snail levels (40%), corroborating a strong association. Furthermore, in EGFR silenced cells, PEG effect on EGFR or Snail was muted, similar to that on proliferation. In conclusion, we show that EGFR is the proximate membrane signaling molecule through which PEG initiates antiproliferative activity with Snail/beta-catenin pathway playing the central intermediary function.

  3. Multiple roles of integrin-linked kinase in epidermal development, maturation and pigmentation revealed by molecular profiling.

    Directory of Open Access Journals (Sweden)

    David Judah

    Full Text Available Integrin-linked kinase (ILK is an important scaffold protein that mediates a variety of cellular responses to integrin stimulation by extracellular matrix proteins. Mice with epidermis-restricted inactivation of the Ilk gene exhibit pleiotropic phenotypic defects, including impaired hair follicle morphogenesis, reduced epidermal adhesion to the basement membrane, compromised epidermal integrity, as well as wasting and failure to thrive leading to perinatal death. To better understand the underlying molecular mechanisms that cause such a broad range of alterations, we investigated the impact of Ilk gene inactivation on the epidermis transcriptome. Microarray analysis showed over 700 differentially regulated mRNAs encoding proteins involved in multiple aspects of epidermal function, including keratinocyte differentiation and barrier formation, inflammation, regeneration after injury, and fundamental epidermal developmental pathways. These studies also revealed potential effects on genes not previously implicated in ILK functions, including those important for melanocyte and melanoblast development and function, regulation of cytoskeletal dynamics, and homeobox genes. This study shows that ILK is a critical regulator of multiple aspects of epidermal function and homeostasis, and reveals the previously unreported involvement of ILK not only in epidermal differentiation and barrier formation, but also in melanocyte genesis and function.

  4. Multiple roles of integrin-linked kinase in epidermal development, maturation and pigmentation revealed by molecular profiling.

    Science.gov (United States)

    Judah, David; Rudkouskaya, Alena; Wilson, Ryan; Carter, David E; Dagnino, Lina

    2012-01-01

    Integrin-linked kinase (ILK) is an important scaffold protein that mediates a variety of cellular responses to integrin stimulation by extracellular matrix proteins. Mice with epidermis-restricted inactivation of the Ilk gene exhibit pleiotropic phenotypic defects, including impaired hair follicle morphogenesis, reduced epidermal adhesion to the basement membrane, compromised epidermal integrity, as well as wasting and failure to thrive leading to perinatal death. To better understand the underlying molecular mechanisms that cause such a broad range of alterations, we investigated the impact of Ilk gene inactivation on the epidermis transcriptome. Microarray analysis showed over 700 differentially regulated mRNAs encoding proteins involved in multiple aspects of epidermal function, including keratinocyte differentiation and barrier formation, inflammation, regeneration after injury, and fundamental epidermal developmental pathways. These studies also revealed potential effects on genes not previously implicated in ILK functions, including those important for melanocyte and melanoblast development and function, regulation of cytoskeletal dynamics, and homeobox genes. This study shows that ILK is a critical regulator of multiple aspects of epidermal function and homeostasis, and reveals the previously unreported involvement of ILK not only in epidermal differentiation and barrier formation, but also in melanocyte genesis and function.

  5. Standardized method to obtain dermo-epidermal junction samples from bovine hoof

    Directory of Open Access Journals (Sweden)

    H.M.F. Mendes

    2015-04-01

    Full Text Available As afecções podais em bovinos causam importante impacto econômico negativo na bovinocultura. Pesquisas têm sido realizadas com o objetivo de avançar no entendimento dos processos ocorridos na junção derme-epiderme do casco de bovinos com laminite e nos demais tecidos moles durante as lesões infecciosas. Apesar disso, não foram encontrados na literatura consultada estudos que descrevessem um método padronizado para a obtenção de amostras do tecido laminar do casco. Nesse contexto, foi necessário criar e estabelecer um método viável para a colheita de amostras da junção derme-epiderme, de modo a viabilizar o estudo de pós-graduação que originou esta comunicação. O objetivo é relatar um método padronizado, testado e bem-sucedido para obtenção de amostras da junção derme-epiderme do casco de bovinos em suas regiões solear, axial e dorsal. Foram obtidos fragmentos transversais das unhas de vacas abatidas em frigorífico. A espessura desses fragmentos foi de 1,5cm, aproximadamente, e contemplava as regiões solear, axial e dorsal do casco. De forma sistematizada, amostras da junção derme-epiderme de cada uma dessas regiões foram removidas, fixadas em formol, processadas e incluídas em parafina. A análise usando microscopia de luz demonstrou cortes histológicos íntegros e sem artefatos, que permitiram ampla avaliação das estruturas tanto da derme quanto da epiderme. Concluiu-se que o método proposto viabiliza a obtenção de amostras de padrão e qualidade adequados ao estudo do tecido laminar do casco bovino.

  6. Molecular structure and thermodynamic predictions to create highly sensitive microRNA biosensors

    International Nuclear Information System (INIS)

    Larkey, Nicholas E.; Brucks, Corinne N.; Lansing, Shan S.; Le, Sophia D.; Smith, Natasha M.; Tran, Victoria; Zhang, Lulu; Burrows, Sean M.

    2016-01-01

    Many studies have established microRNAs (miRNAs) as post-transcriptional regulators in a variety of intracellular molecular processes. Abnormal changes in miRNA have been associated with several diseases. However, these changes are sometimes subtle and occur at nanomolar levels or lower. Several biosensing hurdles for in situ cellular/tissue analysis of miRNA limit detection of small amounts of miRNA. Of these limitations the most challenging are selectivity and sensor degradation creating high background signals and false signals. Recently we developed a reporter+probe biosensor for let-7a that showed potential to mitigate false signal from sensor degradation. Here we designed reporter+probe biosensors for miR-26a-2-3p and miR-27a-5p to better understand the effect of thermodynamics and molecular structures of the biosensor constituents on the analytical performance. Signal changes from interactions between Cy3 and Cy5 on the reporters were used to understand structural aspects of the reporter designs. Theoretical thermodynamic values, single stranded conformations, hetero- and homodimerization structures, and equilibrium concentrations of the reporters and probes were used to interpret the experimental observations. Studies of the sensitivity and selectivity revealed 5–9 nM detection limits in the presence and absence of interfering off-analyte miRNAs. These studies will aid in determining how to rationally design reporter+probe biosensors to overcome hurdles associated with highly sensitive miRNA biosensing. - Highlights: • Challenges facing highly sensitive miRNA biosensor designs are addressed. • Thermodynamic and molecular structure design metrics for reporter+probe biosensors are proposed. • The influence of ideal and non-ideal reporter hairpin structures on reporter+probe formation and signal change are discussed. • 5–9 nM limits of detection were observed with no interference from off-analytes.

  7. Molecular structure and thermodynamic predictions to create highly sensitive microRNA biosensors

    Energy Technology Data Exchange (ETDEWEB)

    Larkey, Nicholas E.; Brucks, Corinne N.; Lansing, Shan S.; Le, Sophia D.; Smith, Natasha M.; Tran, Victoria; Zhang, Lulu; Burrows, Sean M., E-mail: sean.burrows@oregonstate.edu

    2016-02-25

    Many studies have established microRNAs (miRNAs) as post-transcriptional regulators in a variety of intracellular molecular processes. Abnormal changes in miRNA have been associated with several diseases. However, these changes are sometimes subtle and occur at nanomolar levels or lower. Several biosensing hurdles for in situ cellular/tissue analysis of miRNA limit detection of small amounts of miRNA. Of these limitations the most challenging are selectivity and sensor degradation creating high background signals and false signals. Recently we developed a reporter+probe biosensor for let-7a that showed potential to mitigate false signal from sensor degradation. Here we designed reporter+probe biosensors for miR-26a-2-3p and miR-27a-5p to better understand the effect of thermodynamics and molecular structures of the biosensor constituents on the analytical performance. Signal changes from interactions between Cy3 and Cy5 on the reporters were used to understand structural aspects of the reporter designs. Theoretical thermodynamic values, single stranded conformations, hetero- and homodimerization structures, and equilibrium concentrations of the reporters and probes were used to interpret the experimental observations. Studies of the sensitivity and selectivity revealed 5–9 nM detection limits in the presence and absence of interfering off-analyte miRNAs. These studies will aid in determining how to rationally design reporter+probe biosensors to overcome hurdles associated with highly sensitive miRNA biosensing. - Highlights: • Challenges facing highly sensitive miRNA biosensor designs are addressed. • Thermodynamic and molecular structure design metrics for reporter+probe biosensors are proposed. • The influence of ideal and non-ideal reporter hairpin structures on reporter+probe formation and signal change are discussed. • 5–9 nM limits of detection were observed with no interference from off-analytes.

  8. Improvement of arbutin trans-epidermal delivery using ...

    African Journals Online (AJOL)

    Purpose: To assess the ability of radiofrequency (RF) microporation to promote trans-epidermal delivery of arbutin. Methods: To investigate the enhancing effect of RF microchannels on skin permeation of arbutin, in vitro skin permeability studies were performed with RF microporation-treated Hartley albino guinea pig skin ...

  9. The fission yeast RNA binding protein Mmi1 regulates meiotic genes by controlling intron specific splicing and polyadenylation coupled RNA turnover.

    Directory of Open Access Journals (Sweden)

    Huei-Mei Chen

    Full Text Available The polyA tails of mRNAs are monitored by the exosome as a quality control mechanism. We find that fission yeast, Schizosaccharomyces pombe, adopts this RNA quality control mechanism to regulate a group of 30 or more meiotic genes at the level of both splicing and RNA turnover. In vegetative cells the RNA binding protein Mmi1 binds to the primary transcripts of these genes. We find the novel motif U(U/C/GAAAC highly over-represented in targets of Mmi1. Mmi1 can specifically regulate the splicing of particular introns in a transcript: it inhibits the splicing of introns that are in the vicinity of putative Mmi1 binding sites, while allowing the splicing of other introns that are far from such sites. In addition, binding of Mmi1, particularly near the 3' end, alters 3' processing to promote extremely long polyA tails of up to a kilobase. The hyperadenylated transcripts are then targeted for degradation by the nuclear exonuclease Rrp6. The nuclear polyA binding protein Pab2 assists this hyperadenylation-mediated RNA decay. Rrp6 also targets other hyperadenylated transcripts, which become hyperadenylated in an unknown, but Mmi1-independent way. Thus, hyperadenylation may be a general signal for RNA degradation. In addition, binding of Mmi1 can affect the efficiency of 3' cleavage. Inactivation of Mmi1 in meiosis allows meiotic expression, through splicing and RNA stabilization, of at least 29 target genes, which are apparently constitutively transcribed.

  10. MicroRNA-211 Regulates Oxidative Phosphorylation and Energy Metabolism in Human Vitiligo.

    Science.gov (United States)

    Sahoo, Anupama; Lee, Bongyong; Boniface, Katia; Seneschal, Julien; Sahoo, Sanjaya K; Seki, Tatsuya; Wang, Chunyan; Das, Soumen; Han, Xianlin; Steppie, Michael; Seal, Sudipta; Taieb, Alain; Perera, Ranjan J

    2017-09-01

    Vitiligo is a common chronic skin disorder characterized by loss of epidermal melanocytes and progressive depigmentation. Vitiligo has complex immune, genetic, environmental, and biochemical causes, but the exact molecular mechanisms of vitiligo development and progression, particularly those related to metabolic control, are poorly understood. In this study we characterized the human vitiligo cell line PIG3V and the normal human melanocyte line HEM-l by RNA sequencing, targeted metabolomics, and shotgun lipidomics. Melanocyte-enriched microRNA-211, a known metabolic switch in nonpigmented melanoma cells, was severely down-regulated in vitiligo cell line PIG3V and skin biopsy samples from vitiligo patients, whereas its predicted targets PPARGC1A, RRM2, and TAOK1 were reciprocally up-regulated. microRNA-211 binds to PGC1-α 3' untranslated region locus and represses it. Although mitochondrial numbers were constant, mitochondrial complexes I, II, and IV and respiratory responses were defective in vitiligo cells. Nanoparticle-coated microRNA-211 partially augmented the oxygen consumption rate in PIG3V cells. The lower oxygen consumption rate, changes in lipid and metabolite profiles, and increased reactive oxygen species production observed in vitiligo cells appear to be partly due to abnormal regulation of microRNA-211 and its target genes. These genes represent potential biomarkers and therapeutic targets in human vitiligo. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  11. Evaluation of tools for highly variable gene discovery from single-cell RNA-seq data.

    Science.gov (United States)

    Yip, Shun H; Sham, Pak Chung; Wang, Junwen

    2018-02-21

    Traditional RNA sequencing (RNA-seq) allows the detection of gene expression variations between two or more cell populations through differentially expressed gene (DEG) analysis. However, genes that contribute to cell-to-cell differences are not discoverable with RNA-seq because RNA-seq samples are obtained from a mixture of cells. Single-cell RNA-seq (scRNA-seq) allows the detection of gene expression in each cell. With scRNA-seq, highly variable gene (HVG) discovery allows the detection of genes that contribute strongly to cell-to-cell variation within a homogeneous cell population, such as a population of embryonic stem cells. This analysis is implemented in many software packages. In this study, we compare seven HVG methods from six software packages, including BASiCS, Brennecke, scLVM, scran, scVEGs and Seurat. Our results demonstrate that reproducibility in HVG analysis requires a larger sample size than DEG analysis. Discrepancies between methods and potential issues in these tools are discussed and recommendations are made.

  12. Epidermal characters of Tamarix L. (Tamaricaceae from Northwest China and their taxonomic and palaeogeographic implications

    Directory of Open Access Journals (Sweden)

    Jian-Wei Zhang

    2018-04-01

    Full Text Available The taxonomical position of species of the genus Tamarix (Tamaricaceae has been criticized because of their gross morphological similarities (such as slender, smooth and reddish–brown branches, grey–green foliage and scale leaves, and their systematic relationships remain unclear. In this paper, the leaf epidermal features of 17 species from China are studied based on the micro-morphological characters of the epidermal cells, stomata, salt glands, papillae and epidermal hairs. According to the studies, the leaf epidermal features, together with the character of the flower, are taxonomically clearly distinct. The establishment of Tamarix albiflonum is consolidated. Tamarix korolkowi and Tamarix ramosissima have minimal differences in epidermal characters, and the former is suggested to be a junior synonym. Tamarix ramosissima, Tamarix tarimensis, Tamarix arceuthoides and Tamarix hohenackeri are most similar with respect to their leaf epidermis; considering the common morphological features, habit, distribution and especially the hybridization, it is suggested that these four species are closely genetically related and that the variations among them are probably intraspecific. The new taxonomical evidence indicates the occurrence of 13 species and four variants in China. Presently, Tamarix is a typical plant of arid and semi-arid regions, but its Eocene ancestors lived in warm and humid climates in the coastal areas of the ancient Mediterranean Sea. Thus, the papillae or epidermal hairs, which are outgrowths of the outer epidermal cells facilitating the leaf to respond to water stress and commonly seen in the plants growing in arid or semi-arid areas rather than the plants in warm and humid climates, are of relatively recent origin in Tamarix. The primitive species lack papillae or epidermal hairs, while in evolved species these structures are abundant. Based on the ecological adaptations of the epidermal features, the palaeogeographic

  13. Regulatory mechanisms of RNA function: emerging roles of DNA repair enzymes.

    Science.gov (United States)

    Jobert, Laure; Nilsen, Hilde

    2014-07-01

    The acquisition of an appropriate set of chemical modifications is required in order to establish correct structure of RNA molecules, and essential for their function. Modification of RNA bases affects RNA maturation, RNA processing, RNA quality control, and protein translation. Some RNA modifications are directly involved in the regulation of these processes. RNA epigenetics is emerging as a mechanism to achieve dynamic regulation of RNA function. Other modifications may prevent or be a signal for degradation. All types of RNA species are subject to processing or degradation, and numerous cellular mechanisms are involved. Unexpectedly, several studies during the last decade have established a connection between DNA and RNA surveillance mechanisms in eukaryotes. Several proteins that respond to DNA damage, either to process or to signal the presence of damaged DNA, have been shown to participate in RNA quality control, turnover or processing. Some enzymes that repair DNA damage may also process modified RNA substrates. In this review, we give an overview of the DNA repair proteins that function in RNA metabolism. We also discuss the roles of two base excision repair enzymes, SMUG1 and APE1, in RNA quality control.

  14. Hybrid Enhanced Epidermal SpaceSuit Design Approaches

    Science.gov (United States)

    Jessup, Joseph M.

    A Space suit that does not rely on gas pressurization is a multi-faceted problem that requires major stability controls to be incorporated during design and construction. The concept of Hybrid Epidermal Enhancement space suit integrates evolved human anthropomorphic and physiological adaptations into its functionality, using commercially available bio-medical technologies to address shortcomings of conventional gas pressure suits, and the impracticalities of MCP suits. The prototype HEE Space Suit explored integumentary homeostasis, thermal control and mobility using advanced bio-medical materials technology and construction concepts. The goal was a space suit that functions as an enhanced, multi-functional bio-mimic of the human epidermal layer that works in attunement with the wearer rather than as a separate system. In addressing human physiological requirements for design and construction of the HEE suit, testing regimes were devised and integrated into the prototype which was then subject to a series of detailed tests using both anatomical reproduction methods and human subject.

  15. Grhl3 and Lmo4 play coordinate roles in epidermal migration.

    Science.gov (United States)

    Hislop, Nikki R; Caddy, Jacinta; Ting, Stephen B; Auden, Alana; Vasudevan, Sumitha; King, Sarah L; Lindeman, Geoffrey J; Visvader, Jane E; Cunningham, John M; Jane, Stephen M

    2008-09-01

    In addition to its role in formation of the epidermal barrier, the mammalian transcription factor Grainy head-like 3 (Grhl3) is also essential for neural tube closure and wound repair, processes that are dependent in part on epidermal migration. Here, we demonstrate that the LIM-only domain protein, LMO4 serves as a functional partner of GRHL3 in its established roles, and define a new cooperative role for these factors in another developmental epidermal migration event, eyelid fusion. GRHL3 and LMO4 interact biochemically and genetically, with mutant mice exhibiting fully penetrant exencephaly, thoraco-lumbo-sacral spina bifida, defective skin barrier formation, and a co-incident eyes-open-at-birth (EOB) phenotype, which is not observed in the original individual null lines. The two genes are co-expressed in the surface ectoderm of the migrating eyelid root, and electron microscopy of Grhl3/Lmo4-null eyes reveals a failure in epithelial extension and a lack of peridermal clump formation at the eyelid margins. Accumulation of actin fibers is also absent in the circumference of these eyelids, and ERK1/2 phosphorylation is lost in the epidermis and eyelids of Grhl3(-/-)/Lmo4(-/-) embryos. Keratinocytes from mutant mice fail to "heal" in in vitro scratch assays, consistent with a general epidermal migratory defect that is dependent on ERK activation and actin cable formation.

  16. Reconstruction of ancestral RNA sequences under multiple structural constraints.

    Science.gov (United States)

    Tremblay-Savard, Olivier; Reinharz, Vladimir; Waldispühl, Jérôme

    2016-11-11

    Secondary structures form the scaffold of multiple sequence alignment of non-coding RNA (ncRNA) families. An accurate reconstruction of ancestral ncRNAs must use this structural signal. However, the inference of ancestors of a single ncRNA family with a single consensus structure may bias the results towards sequences with high affinity to this structure, which are far from the true ancestors. In this paper, we introduce achARNement, a maximum parsimony approach that, given two alignments of homologous ncRNA families with consensus secondary structures and a phylogenetic tree, simultaneously calculates ancestral RNA sequences for these two families. We test our methodology on simulated data sets, and show that achARNement outperforms classical maximum parsimony approaches in terms of accuracy, but also reduces by several orders of magnitude the number of candidate sequences. To conclude this study, we apply our algorithms on the Glm clan and the FinP-traJ clan from the Rfam database. Our results show that our methods reconstruct small sets of high-quality candidate ancestors with better agreement to the two target structures than with classical approaches. Our program is freely available at: http://csb.cs.mcgill.ca/acharnement .

  17. In C. elegans, high levels of dsRNA allow RNAi in the absence of RDE-4.

    Science.gov (United States)

    Habig, Jeffrey W; Aruscavage, P Joseph; Bass, Brenda L

    2008-01-01

    C. elegans Dicer requires an accessory double-stranded RNA binding protein, RDE-4, to enact the first step of RNA interference, the cleavage of dsRNA to produce siRNA. While RDE-4 is typically essential for RNAi, we report that in the presence of high concentrations of trigger dsRNA, rde-4 deficient animals are capable of silencing a transgene. By multiple criteria the silencing occurs by the canonical RNAi pathway. For example, silencing is RDE-1 dependent and exhibits a decrease in the targeted mRNA in response to an increase in siRNA. We also find that high concentrations of dsRNA trigger lead to increased accumulation of primary siRNAs, consistent with the existence of a rate-limiting step during the conversion of primary to secondary siRNAs. Our studies also revealed that transgene silencing occurs at low levels in the soma, even in the presence of ADARs, and that at least some siRNAs accumulate in a temperature-dependent manner. We conclude that an RNAi response varies with different conditions, and this may allow an organism to tailor a response to specific environmental signals.

  18. In C. elegans, high levels of dsRNA allow RNAi in the absence of RDE-4.

    Directory of Open Access Journals (Sweden)

    Jeffrey W Habig

    Full Text Available C. elegans Dicer requires an accessory double-stranded RNA binding protein, RDE-4, to enact the first step of RNA interference, the cleavage of dsRNA to produce siRNA. While RDE-4 is typically essential for RNAi, we report that in the presence of high concentrations of trigger dsRNA, rde-4 deficient animals are capable of silencing a transgene. By multiple criteria the silencing occurs by the canonical RNAi pathway. For example, silencing is RDE-1 dependent and exhibits a decrease in the targeted mRNA in response to an increase in siRNA. We also find that high concentrations of dsRNA trigger lead to increased accumulation of primary siRNAs, consistent with the existence of a rate-limiting step during the conversion of primary to secondary siRNAs. Our studies also revealed that transgene silencing occurs at low levels in the soma, even in the presence of ADARs, and that at least some siRNAs accumulate in a temperature-dependent manner. We conclude that an RNAi response varies with different conditions, and this may allow an organism to tailor a response to specific environmental signals.

  19. Amplification and high-level expression of heat shock protein 90 marks aggressive phenotypes of human epidermal growth factor receptor 2 negative breast cancer.

    Science.gov (United States)

    Cheng, Qing; Chang, Jeffrey T; Geradts, Joseph; Neckers, Leonard M; Haystead, Timothy; Spector, Neil L; Lyerly, H Kim

    2012-04-17

    Although human epidermal growth factor receptor 2 (HER2) positive or estrogen receptor (ER) positive breast cancers are treated with clinically validated anti-HER2 or anti-estrogen therapies, intrinsic and acquired resistance to these therapies appears in a substantial proportion of breast cancer patients and new therapies are needed. Identification of additional molecular factors, especially those characterized by aggressive behavior and poor prognosis, could prioritize interventional opportunities to improve the diagnosis and treatment of breast cancer. We compiled a collection of 4,010 breast tumor gene expression data derived from 23 datasets that have been posted on the National Center for Biotechnology Information (NCBI) Gene Expression Omnibus (GEO) database. We performed a genome-scale survival analysis using Cox-regression survival analyses, and validated using Kaplan-Meier Estimates survival and Cox Proportional-Hazards Regression survival analyses. We conducted a genome-scale analysis of chromosome alteration using 481 breast cancer samples obtained from The Cancer Genome Atlas (TCGA), from which combined expression and copy number data were available. We assessed the correlation between somatic copy number alterations and gene expression using analysis of variance (ANOVA). Increased expression of each of the heat shock protein (HSP) 90 isoforms, as well as HSP transcriptional factor 1 (HSF1), was correlated with poor prognosis in different subtypes of breast cancer. High-level expression of HSP90AA1 and HSP90AB1, two cytoplasmic HSP90 isoforms, was driven by chromosome coding region amplifications and were independent factors that led to death from breast cancer among patients with triple-negative (TNBC) and HER2-/ER+ subtypes, respectively. Furthermore, amplification of HSF1 was correlated with higher HSP90AA1 and HSP90AB1 mRNA expression among the breast cancer cells without amplifications of these two genes. A collection of HSP90AA1, HSP90AB1 and HSF

  20. Intra-tumoural vessel area estimated by expression of epidermal growth factor-like domain 7 and microRNA-126 in primary tumours and metastases of patients with colorectal cancer

    DEFF Research Database (Denmark)

    Hansen, T. F.; Nielsen, Boye Schnack; Jakobsen, Anders

    2015-01-01

    Background: Understanding the biological properties of potential drug targets are important. This is especially true for anti-angiogenic therapies in the search for potential biomarkers. The aim of the present descriptive study was to analyse the intra-tumoural expressions of epidermal growth...

  1. High-Salt Intake Suppressed MicroRNA-133a Expression in Dahl SS Rat Myocardium

    Science.gov (United States)

    Guo, Tong-Shuai; Zhang, Jie; Mu, Jian-Jun; Liu, Fu-Qiang; Yuan, Zu-Yi; Ren, Ke-Yu; Wang, Dan

    2014-01-01

    Salt-sensitive individuals show earlier and more serious cardiac damage than nonsalt-sensitive ones. Some studies have suggested that microRNA-133a could reduce cardiac hypertrophy and myocardial fibrosis. The current study aims to investigate the different functions of high-salt intake on salt-sensitive (SS) rats and Sprague-Dawley (SD) rats and the involvement of microRNA-133a in these roles. After high-salt intervention, the left ventricular mass (LVW) and left ventricular mass index (LVMI) of the salt-sensitive high salt (SHS) group were obviously higher than those of the salt-sensitive low salt (SLS) group. However, the difference between the Sprague-Dawley high salt (DHS) group and the Sprague-Dawley low salt (DLS) group was not significant. Compared with SLS group, collagen I and connective tissue growth factor (CTGF) in the heart of SHS group were significantly higher, whereas no statistical difference was observed between the DHS group and the DLS group. Compared with low-salt diet, microRNA-133a in the heart of both strains were significantly decreased, but that in the SHS group decreased more significantly. These results suggest that high salt intervention could down-regulate the expression of myocardial microRNA-133a, which may be one of the mechanisms involved in myocardial fibrosis in salt-sensitive hypertension. PMID:24937684

  2. High-Salt Intake Suppressed MicroRNA-133a Expression in Dahl SS Rat Myocardium

    Directory of Open Access Journals (Sweden)

    Tong-Shuai Guo

    2014-06-01

    Full Text Available Salt-sensitive individuals show earlier and more serious cardiac damage than nonsalt-sensitive ones. Some studies have suggested that microRNA-133a could reduce cardiac hypertrophy and myocardial fibrosis. The current study aims to investigate the different functions of high-salt intake on salt-sensitive (SS rats and Sprague-Dawley (SD rats and the involvement of microRNA-133a in these roles. After high-salt intervention, the left ventricular mass (LVW and left ventricular mass index (LVMI of the salt-sensitive high salt (SHS group were obviously higher than those of the salt-sensitive low salt (SLS group. However, the difference between the Sprague-Dawley high salt (DHS group and the Sprague-Dawley low salt (DLS group was not significant. Compared with SLS group, collagen I and connective tissue growth factor (CTGF in the heart of SHS group were significantly higher, whereas no statistical difference was observed between the DHS group and the DLS group. Compared with low-salt diet, microRNA-133a in the heart of both strains were significantly decreased, but that in the SHS group decreased more significantly. These results suggest that high salt intervention could down-regulate the expression of myocardial microRNA-133a, which may be one of the mechanisms involved in myocardial fibrosis in salt-sensitive hypertension.

  3. The integrated analysis of RNA-seq and microRNA-seq depicts miRNA-mRNA networks involved in Japanese flounder (Paralichthys olivaceus) albinism.

    Science.gov (United States)

    Wang, Na; Wang, Ruoqing; Wang, Renkai; Tian, Yongsheng; Shao, Changwei; Jia, Xiaodong; Chen, Songlin

    2017-01-01

    Albinism, a phenomenon characterized by pigmentation deficiency on the ocular side of Japanese flounder (Paralichthys olivaceus), has caused significant damage. Limited mRNA and microRNA (miRNA) information is available on fish pigmentation deficiency. In this study, a high-throughput sequencing strategy was employed to identify the mRNA and miRNAs involved in P. olivaceus albinism. Based on P. olivaceus genome, RNA-seq identified 21,787 know genes and 711 new genes by transcripts assembly. Of those, 235 genes exhibited significantly different expression pattern (fold change ≥2 or ≤0.5 and q-value≤0.05), including 194 down-regulated genes and 41 up-regulated genes in albino versus normally pigmented individuals. These genes were enriched to 81 GO terms and 9 KEGG pathways (p≤0.05). Among those, the pigmentation related pathways-Melanogenesis and tyrosine metabolism were contained. High-throughput miRNA sequencing identified a total of 475 miRNAs, including 64 novel miRNAs. Furthermore, 33 differentially expressed miRNAs containing 13 up-regulated and 20 down-regulated miRNAs were identified in albino versus normally pigmented individuals (fold change ≥1.5 or ≤0.67 and p≤0.05). The next target prediction discovered a variety of putative target genes, of which, 134 genes including Tyrosinase (TYR), Tyrosinase-related protein 1 (TYRP1), Microphthalmia-associated transcription factor (MITF) were overlapped with differentially expressed genes derived from RNA-seq. These target genes were significantly enriched to 254 GO terms and 103 KEGG pathways (p<0.001). Of those, tyrosine metabolism, lysosomes, phototransduction pathways, etc., attracted considerable attention due to their involvement in regulating skin pigmentation. Expression patterns of differentially expressed mRNA and miRNAs were validated in 10 mRNA and 10 miRNAs by qRT-PCR. With high-throughput mRNA and miRNA sequencing and analysis, a series of interested mRNA and miRNAs involved in fish

  4. Duox, Flotillin-2, and Src42A are required to activate or delimit the spread of the transcriptional response to epidermal wounds in Drosophila.

    Directory of Open Access Journals (Sweden)

    Michelle T Juarez

    2011-12-01

    Full Text Available The epidermis is the largest organ of the body for most animals, and the first line of defense against invading pathogens. A breach in the epidermal cell layer triggers a variety of localized responses that in favorable circumstances result in the repair of the wound. Many cellular and genetic responses must be limited to epidermal cells that are close to wounds, but how this is regulated is still poorly understood. The order and hierarchy of epidermal wound signaling factors are also still obscure. The Drosophila embryonic epidermis provides an excellent system to study genes that regulate wound healing processes. We have developed a variety of fluorescent reporters that provide a visible readout of wound-dependent transcriptional activation near epidermal wound sites. A large screen for mutants that alter the activity of these wound reporters has identified seven new genes required to activate or delimit wound-induced transcriptional responses to a narrow zone of cells surrounding wound sites. Among the genes required to delimit the spread of wound responses are Drosophila Flotillin-2 and Src42A, both of which are transcriptionally activated around wound sites. Flotillin-2 and constitutively active Src42A are also sufficient, when overexpressed at high levels, to inhibit wound-induced transcription in epidermal cells. One gene required to activate epidermal wound reporters encodes Dual oxidase, an enzyme that produces hydrogen peroxide. We also find that four biochemical treatments (a serine protease, a Src kinase inhibitor, methyl-ß-cyclodextrin, and hydrogen peroxide are sufficient to globally activate epidermal wound response genes in Drosophila embryos. We explore the epistatic relationships among the factors that induce or delimit the spread of epidermal wound signals. Our results define new genetic functions that interact to instruct only a limited number of cells around puncture wounds to mount a transcriptional response, mediating

  5. The UEA Small RNA Workbench: A Suite of Computational Tools for Small RNA Analysis.

    Science.gov (United States)

    Mohorianu, Irina; Stocks, Matthew Benedict; Applegate, Christopher Steven; Folkes, Leighton; Moulton, Vincent

    2017-01-01

    RNA silencing (RNA interference, RNAi) is a complex, highly conserved mechanism mediated by short, typically 20-24 nt in length, noncoding RNAs known as small RNAs (sRNAs). They act as guides for the sequence-specific transcriptional and posttranscriptional regulation of target mRNAs and play a key role in the fine-tuning of biological processes such as growth, response to stresses, or defense mechanism.High-throughput sequencing (HTS) technologies are employed to capture the expression levels of sRNA populations. The processing of the resulting big data sets facilitated the computational analysis of the sRNA patterns of variation within biological samples such as time point experiments, tissue series or various treatments. Rapid technological advances enable larger experiments, often with biological replicates leading to a vast amount of raw data. As a result, in this fast-evolving field, the existing methods for sequence characterization and prediction of interaction (regulatory) networks periodically require adapting or in extreme cases, a complete redesign to cope with the data deluge. In addition, the presence of numerous tools focused only on particular steps of HTS analysis hinders the systematic parsing of the results and their interpretation.The UEA small RNA Workbench (v1-4), described in this chapter, provides a user-friendly, modular, interactive analysis in the form of a suite of computational tools designed to process and mine sRNA datasets for interesting characteristics that can be linked back to the observed phenotypes. First, we show how to preprocess the raw sequencing output and prepare it for downstream analysis. Then we review some quality checks that can be used as a first indication of sources of variability between samples. Next we show how the Workbench can provide a comparison of the effects of different normalization approaches on the distributions of expression, enhanced methods for the identification of differentially expressed

  6. High ALK mRNA expression has a negative prognostic significance in rhabdomyosarcoma

    Science.gov (United States)

    Bonvini, P; Zin, A; Alaggio, R; Pawel, B; Bisogno, G; Rosolen, A

    2013-01-01

    Background: Anaplastic lymphoma kinase (ALK) is a receptor tyrosine kinase aberrantly expressed in cancer, but its clinical and functional importance remain controversial. Mutation or amplification of ALK, as well as its expression levels assessed by conventional immunohistochemistry methods, has been linked to prognosis in cancer, although with potential bias because of the semi-quantitative approaches. Herein, we measured ALK mRNA expression in rhabdomyosarcoma (RMS) and determined its clinical impact on patients' stratification and outcome. Methods: Specimens were obtained from RMS patients and cell lines, and ALK expression was analysed by quantitative RT–PCR, western blotting, IHC, and copy number analysis. Results: High ALK mRNA expression was detected in the vast majority of PAX3/7-FOXO1-positive tumours, whereas PAX3/7-FOXO1-negative RMS displayed considerably lower amounts of both mRNA and protein. Notably, ALK mRNA distinguished unfavourable PAX3/7-FOXO1-positive tumours from PAX3/7-FOXO1-negative RMS (Ptumour size (PALK mRNA levels were of prognostic relevance by Cox univariate regression analysis and correlated with increased risk of relapse (P=0.001) and survival (P=0.01), whereas by multivariate analysis elevated ALK mRNA expression resulted a negative prognostic marker when clinical stage was not included. Conclusion: Quantitative assessment of ALK mRNA expression helps to improve risk stratification of RMS patients and identifies tumours with adverse biological characteristics and aggressive behaviour. PMID:24149177

  7. Quantitative Proteomics Reveals the Regulatory Networks of Circular RNA CDR1as in Hepatocellular Carcinoma Cells.

    Science.gov (United States)

    Yang, Xue; Xiong, Qian; Wu, Ying; Li, Siting; Ge, Feng

    2017-10-06

    Circular RNAs (circRNAs), a class of widespread endogenous RNAs, play crucial roles in diverse biological processes and are potential biomarkers in diverse human diseases and cancers. Cerebellar-degeneration-related protein 1 antisense RNA (CDR1as), an oncogenic circRNA, is involved in human tumorigenesis and is dysregulated in hepatocellular carcinoma (HCC). However, the molecular mechanisms underlying CDR1as functions in HCC remain unclear. Here we explored the functions of CDR1as and searched for CDR1as-regulated proteins in HCC cells. A quantitative proteomics strategy was employed to globally identify CDR1as-regulated proteins in HCC cells. In total, we identified 330 differentially expressed proteins (DEPs) upon enhanced CDR1as expression in HepG2 cells, indicating that they could be proteins regulated by CDR1as. Bioinformatic analysis revealed that many DEPs were involved in cell proliferation and the cell cycle. Further functional studies of epidermal growth factor receptor (EGFR) found that CDR1as exerts its effects on cell proliferation at least in part through the regulation of EGFR expression. We further confirmed that CDR1as could inhibit the expression of microRNA-7 (miR-7). EGFR is a validated target of miR-7; therefore, CDR1as may exert its function by regulating EGFR expression via targeting miR-7 in HCC cells. Taken together, we revealed novel functions and underlying mechanisms of CDR1as in HCC cells. This study serves as the first proteome-wide analysis of a circRNA-regulated protein in cells and provides a reliable and highly efficient method for globally identifying circRNA-regulated proteins.

  8. Suppression of the Epidermal Growth Factor-like Domain 7 and Inhibition of Migration and Epithelial-Mesenchymal Transition in Human Pancreatic Cancer PANC-1 Cells.

    Science.gov (United States)

    Wang, Yun-Liang; Dong, Feng-Lin; Yang, Jian; Li, Zhi; Zhi, Qiao-Ming; Zhao, Xin; Yang, Yong; Li, De-Chun; Shen, Xiao-Chun; Zhou, Jin

    2015-01-01

    Epidermal growth factor-like domain multiple 7 (EGFL7), a secreted protein specifically expressed by endothelial cells during embryogenesis, recently was identified as a critical gene in tumor metastasis. Epithelial-mesenchymal transition (EMT) was found to be closely related with tumor progression. Accordingly, it is important to investigate the migration and EMT change after knock-down of EGFL7 gene expression in human pancreatic cancer cells. EGFL7 expression was firstly testified in 4 pancreatic cancer cell lines by real-time polymerase chain reaction (Real-time PCR) and western blot, and the highest expression of EGFL7 was found in PANC-1 cell line. Then, PANC-1 cells transfected with small interference RNA (siRNA) of EGFL7 using plasmid vector were named si-PANC-1, while transfected with negative control plasmid vector were called NC-PANC-1. Transwell assay was used to analyze the migration of PANC-1 cells. Real-time PCR and western blotting were used to detect the expression change of EGFL7 gene, EMT markers like E-Cadherin, N-Cadherin, Vimentin, Fibronectin and transcription factors like snail, slug in PANC-1, NC- PANC-1, and si-PANC-1 cells, respectively. After successful plasmid transfection, EGFL7 gene were dramatically knock-down by RNA interference in si-PANC-1 group. Meanwhile, migration ability decreased significantly, compared with PANC-1 and NC-PANC-1 group. Meanwhile, the expression of epithelial phenotype marker E-Cadherin increased and that of mesenchymal phenotype markers N-Cadherin, Vimentin, Fibronectin dramatically decreased in si-PANC-1 group, indicating a reversion of EMT. Also, transcription factors snail and slug decreased significantly after RNA interference. Current study suggested that highly-expressed EGFL7 promotes migration of PANC-1 cells and acts through transcription factors snail and slug to induce EMT, and further study is needed to confirm this issue.

  9. Excision of pyrimidine dimers from epidermal DNA and nonsemiconservative epidermal DNA synthesis following ultraviolet irradiation of mouse skin

    International Nuclear Information System (INIS)

    Bowden, G.T.; Trosko, J.E.; Shapas, B.G.; Boutwell, R.K.

    1975-01-01

    Pyrimidine dimer production and excision in epidermal DNA were studied at five different dose levels of ultraviolet light in the skin of intact mice. Dimer production increased with dose up to 50,400 ergs/sq mm. Approximately 30 percent of the thymine-containing dimers were excised by 24 hr after irradiation at three lower dose levels of ultraviolet light. Nonsemiconservative DNA replication in ultraviolet-irradiated mouse skin was shown to continue for at least 18 hr. The rate of nonsemiconservative replication decreased with time, but did so slowly. The initial rates of nonsemiconservative replication increased with ultraviolet light dose levels up to about 4200 ergs/sq mm, after which the initial rates were decreased. Semiconservative epidermal DNA synthesis was shown to be inhibited by hydroxyurea, but hydroxyurea had no effect on ultraviolet light-induced nonsemiconservative DNA replication. The observed pyrimidine dimer excision and nonsemiconservative DNA replication suggest that in the intact mouse the cells of the epidermis are capable of DNA excision repair after ultraviolet irradiation of mouse skin

  10. Stevens–Johnson syndrome/toxic epidermal necrolysis caused by cefadroxil in a cat

    Directory of Open Access Journals (Sweden)

    Roberta Sartori

    2016-06-01

    Full Text Available Case summary A 5-year-old, spayed female, indoor-only domestic shorthair cat was referred with an acute history of multifocal cutaneous and mucocutaneous erosive-ulcerative lesions and skin detachment. The lesions occurred on the seventh day of therapy with cefadroxil. Erosive-ulcerative and occasionally crusted lesions were apparent on the medial and lateral canthus of both eyes, ventral neck, abdomen, perivulvar region, periungual skin and medial aspect of the front and hindlimbs. Diffuse and severe exfoliation was present on the dorsum and tail base and in both external ear canals. The cat was also dehydrated, tachycardic and febrile. Histopathological examination revealed extensive epidermal ulceration, interface dermatitis with vacuolar degeneration, apoptosis at multiple epidermal levels and basal, suprabasal and spinous dermoepidermal detachment. The histopathological diagnosis was consistent with Stevens–Johnson syndrome/toxic epidermal necrolysis (SJS/TEN. The recently reported Algorithm of Drug Causality in Epidermal Necrolysis (ALDEN, currently used in human medicine, was applied and a score of +6 was calculated; this supported the view that SJS/TEN in this cat was very likely to be associated with cefadroxil administration. Relevance and novel information This clinical communication reports cefadroxil as a very probable cause of SJS/TEN in a cat; the ALDEN was applied in this case and supported diagnosis.

  11. Epidermal characters of Tamarix L. (Tamaricaceae) from Northwest China and their taxonomic and palaeogeographic implications

    OpenAIRE

    Jian-Wei Zhang; Ashalata D'Rozario; Shi-Min Duan; Xi-Yong Wang; Xiao-Qing Liang; Bo-Rong Pan

    2018-01-01

    The taxonomical position of species of the genus Tamarix (Tamaricaceae) has been criticized because of their gross morphological similarities (such as slender, smooth and reddish–brown branches, grey–green foliage and scale leaves), and their systematic relationships remain unclear. In this paper, the leaf epidermal features of 17 species from China are studied based on the micro-morphological characters of the epidermal cells, stomata, salt glands, papillae and epidermal hairs. According to ...

  12. Bioengineering of cultured epidermis from adult epidermal stem cells using Mebio gel sutable as autologous graft material

    Directory of Open Access Journals (Sweden)

    Lakshmana K Yerneni

    2007-01-01

    Full Text Available Closure of burn wound is the primary requirement in order to reduce morbidity and mortality that are otherwise very high due to non-availability of permanent wound covering materials. Sheets of cultured epidermis grown from autologous epidermal keratinocyte stem cells are accepted world over as one of the best wound covering materials. In a largely populated country like ours where burn casualties occur more frequently due to inadequate safety practices, there is a need for indigenous research inputs to develop such methodologies. The technique to culturing epidermal sheets in vitro involves the basic Reheinwald-Green method with our own beneficial inputs. The technique employs attenuated 3T3 cells as feeders for propagating keratinocyte stem cells that are isolated from the epidermis of an initial skin biopsy of about 5 cm2 from the patient. The cultures are then maintained in Dulbecco's modified Eagle's medium strengthened with Ham's F12 formula, bovine fetal serum and various specific growth-promoting agents and factors in culture flasks under standard culture conditions. The primary cultures thus established would be serially passaged to achieve the required expansion. Our major inputs are into the establishment of (1 an efficient differential trypsinization protocol to isolate large number epidermal keratinocytes from the skin biopsy, (2 a highly specific, unique and foolproof attenuation protocol for 3T3 cells and (3 a specialized and significant decontamination protocol. The fully formed epidermal sheet as verified by immuno-histochemical and light & electron microscopic studies, is lifted on to paraffin gauze by incubating in a neutral protease. The graft is then ready to be transported to the operating theatre for autologous application. We have a capability of growing cultured epidermal sheets sufficient enough to cover 40 per cent burn wound in 28 days. The preliminary small area clinical applications undertaken so far revealed

  13. Intraoperative fluorescence delineation of head and neck cancer with a fluorescent Anti-epidermal growth factor receptor nanobody

    NARCIS (Netherlands)

    Van Driel, P.B.A.A.; Van Der Vorst, J.R.; Verbeek, F.P.R.; Oliveira, S.|info:eu-repo/dai/nl/304841455; Snoeks, T.J.A.; Keereweer, S.; Chan, B.; Boonstra, M.C.; Frangioni, J.V.; Van Bergen En Henegouwen, P.M.P.|info:eu-repo/dai/nl/071919481; Vahrmeijer, A.L.; Lowik, C.W.G.M.

    2014-01-01

    Intraoperative near-infrared (NIR) fluorescence imaging is a technology with high potential to provide the surgeon with real-time visualization of tumors during surgery. Our study explores the feasibility for clinical translation of an epidermal growth factor receptor (EGFR)-targeting nanobody for

  14. Epidermal growth factor receptor: an independent predictor of survival in astrocytic tumors given definitive irradiation

    International Nuclear Information System (INIS)

    An Zhu; Shaeffer, James; Leslie, Susan; Kolm, Paul; El-Mahdi, Anas M.

    1996-01-01

    Purpose: To determine whether the expression of epidermal growth factor receptor (EGFR) protein was predictive of patient survival independently of other prognostic factors in astrocytic tumors. Methods and Materials: Epidermal growth factor receptor protein expression was investigated immunohistochemically in formalin-fixed, paraffin-embedded surgical specimens of 55 glioblastoma multiforme, 14 anaplastic astrocytoma, and 2 astrocytomas given definitive irradiation. We evaluated the relationship of EGFR protein expression and tumor grade, histologic features, age at diagnosis, sex, patient survival, and recurrence-free survival. Results: The percentage of tumor cells which were EGFR positive related to reduced survival by Cox regression analysis in both univariate (p = 0.0424) and multivariate analysis (p = 0.0016). Epidermal growth factor receptor positivity was the only 1 of 11 clinical and histological variables associated with decreased recurrence-free survival by either univariate (p = 0.0353) or multivariate (p = 0.0182) analysis. Epidermal growth factor receptor protein expression was not related to patient age, sex, or histologic features. Conclusion: Epidermal growth factor receptor positivity was a significant and independent prognostic indicator for overall survival and recurrence-free survival for irradiated patients with astrocytic gliomas

  15. MysiRNA-designer: a workflow for efficient siRNA design.

    Directory of Open Access Journals (Sweden)

    Mohamed Mysara

    Full Text Available The design of small interfering RNA (siRNA is a multi factorial problem that has gained the attention of many researchers in the area of therapeutic and functional genomics. MysiRNA score was previously introduced that improves the correlation of siRNA activity prediction considering state of the art algorithms. In this paper, a new program, MysiRNA-Designer, is described which integrates several factors in an automated work-flow considering mRNA transcripts variations, siRNA and mRNA target accessibility, and both near-perfect and partial off-target matches. It also features the MysiRNA score, a highly ranked correlated siRNA efficacy prediction score for ranking the designed siRNAs, in addition to top scoring models Biopredsi, DISR, Thermocomposition21 and i-Score, and integrates them in a unique siRNA score-filtration technique. This multi-score filtration layer filters siRNA that passes the 90% thresholds calculated from experimental dataset features. MysiRNA-Designer takes an accession, finds conserved regions among its transcript space, finds accessible regions within the mRNA, designs all possible siRNAs for these regions, filters them based on multi-scores thresholds, and then performs SNP and off-target filtration. These strict selection criteria were tested against human genes in which at least one active siRNA was designed from 95.7% of total genes. In addition, when tested against an experimental dataset, MysiRNA-Designer was found capable of rejecting 98% of the false positive siRNAs, showing superiority over three state of the art siRNA design programs. MysiRNA is a freely accessible (Microsoft Windows based desktop application that can be used to design siRNA with a high accuracy and specificity. We believe that MysiRNA-Designer has the potential to play an important role in this area.

  16. Small RNA sequencing reveals a comprehensive miRNA signature of BRCA1-associated high-grade serous ovarian cancer

    NARCIS (Netherlands)

    Brouwer, Jan; Kluiver, Joost; de Almeida, Rodrigo C.; Modderman, Rutger; Terpstra, Martijn; Kok, Klaas; Withoff, Sebo; Hollema, Harry; Reitsma, Welmoed; de Bock, Geertruida H.; Mourits, Marian J. E.; van den Berg, Anke

    2016-01-01

    AimsBRCA1 mutation carriers are at increased risk of developing high-grade serous ovarian cancer (HGSOC), a malignancy that originates from fallopian tube epithelium. We aimed to identify differentially expressed known and novel miRNAs in BRCA1-associated HGSOC. Methods Small RNA sequencing was

  17. The interaction between the iron-responsive element binding protein and its cognate RNA is highly dependent upon both RNA sequence and structure.

    Science.gov (United States)

    Jaffrey, S R; Haile, D J; Klausner, R D; Harford, J B

    1993-09-25

    To assess the influence of RNA sequence/structure on the interaction RNAs with the iron-responsive element binding protein (IRE-BP), twenty eight altered RNAs were tested as competitors for an RNA corresponding to the ferritin H chain IRE. All changes in the loop of the predicted IRE hairpin and in the unpaired cytosine residue characteristically found in IRE stems significantly decreased the apparent affinity of the RNA for the IRE-BP. Similarly, alteration in the spacing and/or orientation of the loop and the unpaired cytosine of the stem by either increasing or decreasing the number of base pairs separating them significantly reduced efficacy as a competitor. It is inferred that the IRE-BP forms multiple contacts with its cognate RNA, and that these contacts, acting in concert, provide the basis for the high affinity of this interaction.

  18. Fatal Metastatic Cutaneous Squamous Cell Carcinoma Evolving from a Localized Verrucous Epidermal Nevus

    Directory of Open Access Journals (Sweden)

    Hassan Riad

    2013-10-01

    Full Text Available A malignant transformation is known to occur in many nevi such as a sebaceous nevus or a basal cell nevus, but a verrucous epidermal nevus has only rarely been associated with neoplastic changes. Keratoacanthoma, multifocal papillary apocrine adenoma, multiple malignant eccrine poroma, basal cell carcinoma and cutaneous squamous cell carcinoma (CSCC have all been reported to develop from a verrucous epidermal nevus. CSCC has also been reported to arise from other nevoid lesions like a nevus comedonicus, porokeratosis, a sebaceous nevus, an oral sponge nevus and an ichthyosiform nevus with CHILD syndrome. Here we report a case of progressive poorly differentiated CSCC arising from a localized verrucous epidermal nevus, which caused both spinal cord and brain metastasis.

  19. The expression of proinflammatory genes in epidermal keratinocytes is regulated by hydration status.

    Science.gov (United States)

    Xu, Wei; Jia, Shengxian; Xie, Ping; Zhong, Aimei; Galiano, Robert D; Mustoe, Thomas A; Hong, Seok J

    2014-04-01

    Mucosal wounds heal more rapidly, exhibit less inflammation, and are associated with minimal scarring when compared with equivalent cutaneous wounds. We previously demonstrated that cutaneous epithelium exhibits an exaggerated response to injury compared with mucosal epithelium. We hypothesized that treatment of injured skin with a semiocclusive dressing preserves the hydration of the skin and results in a wound healing phenotype that more closely resembles that of mucosa. Here we explored whether changes in hydration status alter epidermal gene expression patterns in rabbit partial-thickness incisional wounds. Using microarray studies on injured epidermis, we showed that global gene expression patterns in highly occluded versus non-occluded wounds are distinct. Many genes including IL-1β, IL-8, TNF-α (tumor necrosis factor-α), and COX-2 (cyclooxygenase 2) are upregulated in non-occluded wounds compared with highly occluded wounds. In addition, decreased levels of hydration resulted in an increased expression of proinflammatory genes in human ex vivo skin culture (HESC) and stratified keratinocytes. Hierarchical analysis of genes using RNA interference showed that both TNF-α and IL-1β regulate the expression of IL-8 through independent pathways in response to reduced hydration. Furthermore, both gene knockdown and pharmacological inhibition studies showed that COX-2 mediates the TNF-α/IL-8 pathway by increasing the production of prostaglandin E2 (PGE2). IL-8 in turn controls the production of matrix metalloproteinase-9 in keratinocytes. Our data show that hydration status directly affects the expression of inflammatory signaling in the epidermis. The identification of genes involved in the epithelial hydration pathway provides an opportunity to develop strategies to reduce scarring and optimize wound healing.

  20. Fast prediction of RNA-RNA interaction using heuristic algorithm.

    Science.gov (United States)

    Montaseri, Soheila

    2015-01-01

    Interaction between two RNA molecules plays a crucial role in many medical and biological processes such as gene expression regulation. In this process, an RNA molecule prohibits the translation of another RNA molecule by establishing stable interactions with it. Some algorithms have been formed to predict the structure of the RNA-RNA interaction. High computational time is a common challenge in most of the presented algorithms. In this context, a heuristic method is introduced to accurately predict the interaction between two RNAs based on minimum free energy (MFE). This algorithm uses a few dot matrices for finding the secondary structure of each RNA and binding sites between two RNAs. Furthermore, a parallel version of this method is presented. We describe the algorithm's concurrency and parallelism for a multicore chip. The proposed algorithm has been performed on some datasets including CopA-CopT, R1inv-R2inv, Tar-Tar*, DIS-DIS, and IncRNA54-RepZ in Escherichia coli bacteria. The method has high validity and efficiency, and it is run in low computational time in comparison to other approaches.

  1. Low calcium culture condition induces mesenchymal cell-like phenotype in normal human epidermal keratinocytes

    International Nuclear Information System (INIS)

    Takagi, Ryo; Yamato, Masayuki; Murakami, Daisuke; Sugiyama, Hiroaki; Okano, Teruo

    2011-01-01

    Highlights: → Normal human epidermal keratinocytes serially cultured under low calcium concentration were cytokeratin and vimentin double positive cells. → The human keratinocytes expressed some epithelial stem/progenitor cell makers, mesenchymal cell markers, and markers of epithelial-mesenchymal transition. → Mesenchymal cell-like phenotype in the keratinocytes was suppressed under high-calcium condition. -- Abstract: Epithelial-mesenchymal transition (EMT) is an important cellular phenomenon in organ developments, cancer invasions, and wound healing, and many types of transformed cell lines are used for investigating for molecular mechanisms of EMT. However, there are few reports for EMT in normal human epithelial cells, which are non-transformed or non-immortalized cells, in vitro. Therefore, normal human epidermal keratinocytes (NHEK) serially cultured in low-calcium concentration medium (LCM) were used for investigating relations between differentiation and proliferation and mesenchymal-like phenotype in the present study, since long-term cultivation of NHEK is achieved in LCM. Interestingly, NHEK serially cultured in LCM consisted essentially of cytokeratin-vimentin double positive cells (98%), although the NHEK exhibited differentiation under high-calcium culture condition with 3T3 feeder layer. The vimentin expression was suppressed under high-calcium condition. These results may indicate the importance of mesenchymal-like phenotype for serially cultivation of NHEK in vitro.

  2. Highly divergent 16S rRNA sequences in ribosomal operons of Scytonema hyalinum (Cyanobacteria.

    Directory of Open Access Journals (Sweden)

    Jeffrey R Johansen

    Full Text Available A highly divergent 16S rRNA gene was found in one of the five ribosomal operons present in a species complex currently circumscribed as Scytonema hyalinum (Nostocales, Cyanobacteria using clone libraries. If 16S rRNA sequence macroheterogeneity among ribosomal operons due to insertions, deletions or truncation is excluded, the sequence heterogeneity observed in S. hyalinum was the highest observed in any prokaryotic species thus far (7.3-9.0%. The secondary structure of the 16S rRNA molecules encoded by the two divergent operons was nearly identical, indicating possible functionality. The 23S rRNA gene was examined for a few strains in this complex, and it was also found to be highly divergent from the gene in Type 2 operons (8.7%, and likewise had nearly identical secondary structure between the Type 1 and Type 2 operons. Furthermore, the 16S-23S ITS showed marked differences consistent between operons among numerous strains. Both operons have promoter sequences that satisfy consensus requirements for functional prokaryotic transcription initiation. Horizontal gene transfer from another unknown heterocytous cyanobacterium is considered the most likely explanation for the origin of this molecule, but does not explain the ultimate origin of this sequence, which is very divergent from all 16S rRNA sequences found thus far in cyanobacteria. The divergent sequence is highly conserved among numerous strains of S. hyalinum, suggesting adaptive advantage and selective constraint of the divergent sequence.

  3. microRNA profiling in the zoonotic parasite Echinococcus canadensis using a high-throughput approach.

    Science.gov (United States)

    Macchiaroli, Natalia; Cucher, Marcela; Zarowiecki, Magdalena; Maldonado, Lucas; Kamenetzky, Laura; Rosenzvit, Mara Cecilia

    2015-02-06

    microRNAs (miRNAs), a class of small non-coding RNAs, are key regulators of gene expression at post-transcriptional level and play essential roles in fundamental biological processes such as development and metabolism. The particular developmental and metabolic characteristics of cestode parasites highlight the importance of studying miRNA gene regulation in these organisms. Here, we perform a comprehensive analysis of miRNAs in the parasitic cestode Echinococcus canadensis G7, one of the causative agents of the neglected zoonotic disease cystic echinococcosis. Small RNA libraries from protoscoleces and cyst walls of E. canadensis G7 and protoscoleces of E. granulosus sensu stricto G1 were sequenced using Illumina technology. For miRNA prediction, miRDeep2 core algorithm was used. The output list of candidate precursors was manually curated to generate a high confidence set of miRNAs. Differential expression analysis of miRNAs between stages or species was estimated with DESeq. Expression levels of selected miRNAs were validated using poly-A RT-qPCR. In this study we used a high-throughput approach and found transcriptional evidence of 37 miRNAs thus expanding the miRNA repertoire of E. canadensis G7. Differential expression analysis showed highly regulated miRNAs between life cycle stages, suggesting a role in maintaining the features of each developmental stage or in the regulation of developmental timing. In this work we characterize conserved and novel Echinococcus miRNAs which represent 30 unique miRNA families. Here we confirmed the remarkable loss of conserved miRNA families in E. canadensis, reflecting their low morphological complexity and high adaptation to parasitism. We performed the first in-depth study profiling of small RNAs in the zoonotic parasite E. canadensis G7. We found that miRNAs are the preponderant small RNA silencing molecules, suggesting that these small RNAs could be an essential mechanism of gene regulation in this species. We also

  4. Induction of PDGF-B in TCA-treated epidermal keratinocytes.

    Science.gov (United States)

    Yonei, Nozomi; Kanazawa, Nobuo; Ohtani, Toshio; Furukawa, Fukumi; Yamamoto, Yuki

    2007-11-01

    Trichloroacetic acid (TCA) is one of the most widely used peeling agents, and induces full necrosis of the whole epidermis, followed by reconstitution of the epidermis and the matrix of the papillary dermis. The cytotoxic effects of TCA, such as suppressing proliferation of keratinocytes and fibroblasts and protein synthesis by fibroblasts, have already been reported. However, the entire biological mechanism responsible for TCA peeling has yet to be determined. Hypothetical activation effects of TCA treatment on epidermal cells to induce production of growth factors and cytokines are examined, and are compared with its cytotoxic effects in terms of time course and applied TCA concentrations. After various periods of incubation with TCA, viability of Pam212 murine keratinocytes was investigated with MTT assay and dye exclusion assay, and production of growth factors and cytokines with reverse transcription-polymerase chain reaction (RT-PCR). Changes in platelet-derived growth factor (PDGF)-B mRNA expression and protein production in the human skin specimens after TCA application were then examined by RT-PCR and immunohistochemistry, respectively. Incubation with TCA showed cytotoxicity and induced death of Pam212 cells, depending on the incubation period and the TCA concentration. In addition, expressions of PDGF-B, tumor growth factor (TGF)-alpha, TGF- beta1 and vascular endothelial growth factor, which are the growth factors reportedly secreted from keratinocytes during wound healing, were all detected in Pam212 cells after short-term treatment with TCA. Expressions of inflammatory cytokines such as interleukin (IL)-1 and IL-10 were also induced. In TCA-treated NIH-3T3 fibroblasts, in contrast, observed was upregulation of only keratinocyte growth factor, which is reportedly secreted from fibroblasts, as well as the similar cytotoxic effect. In human skin, PDGF-B mRNA expression became significantly upregulated after TCA application, and then immediately

  5. Structure of the gene encoding VGF, a nervous system-specific mRNA that is rapidly and selectively induced by nerve growth factor in PC12 cells.

    Science.gov (United States)

    Salton, S R; Fischberg, D J; Dong, K W

    1991-05-01

    Nerve growth factor (NGF) plays a critical role in the development and survival of neurons in the peripheral nervous system. Following treatment with NGF but not epidermal growth factor, rat pheochromocytoma (PC12) cells undergo neural differentiation. We have cloned a nervous system-specific mRNA, NGF33.1, that is rapidly and relatively selectively induced by treatment of PC12 cells with NGF and basic fibroblast growth factor in comparison with epidermal growth factor. Analysis of the nucleic acid and predicted amino acid sequences of the NGF33.1 cDNA clone suggested that this clone corresponded to the NGF-inducible mRNA called VGF (A. Levi, J. D. Eldridge, and B. M. Paterson, Science 229:393-395, 1985; R. Possenti, J. D. Eldridge, B. M. Paterson, A. Grasso, and A. Levi, EMBO J. 8:2217-2223, 1989). We have used the NGF33.1 cDNA clone to isolate and characterize the VGF gene, and in this paper we report the complete sequence of the VGF gene, including 853 bases of 5' flank revealed TATAA and CCAAT elements, several GC boxes, and a consensus cyclic AMP response element-binding protein binding site. The VGF promoter contains sequences homologous to other NGF-inducible, neuronal promoters. We further show that VGF mRNA is induced in PC12 cells to a greater extent by depolarization and by phorbol-12-myristate-13-acetate treatment than by 8-bromo-cyclic AMP treatment. By Northern (RNA) and RNase protection analysis, VGF mRNA is detectable in embryonic and postnatal central and peripheral nervous tissues but not in a number of nonneural tissues. In the cascade of events which ultimately leads to the neural differentiation of NGF-treated PC12 cells, the VGF gene encodes the most rapidly and selectively regulated, nervous-system specific mRNA yet identified.

  6. Zerodur polishing process for high surface quality and high efficiency

    International Nuclear Information System (INIS)

    Tesar, A.; Fuchs, B.

    1992-08-01

    Zerodur is a glass-ceramic composite importance in applications where temperature instabilities influence optical and mechanical performance, such as in earthbound and spaceborne telescope mirror substrates. Polished Zerodur surfaces of high quality have been required for laser gyro mirrors. Polished surface quality of substrates affects performance of high reflection coatings. Thus, the interest in improving Zerodur polished surface quality has become more general. Beyond eliminating subsurface damage, high quality surfaces are produced by reducing the amount of hydrated material redeposited on the surface during polishing. With the proper control of polishing parameters, such surfaces exhibit roughnesses of < l Angstrom rms. Zerodur polishing was studied to recommend a high surface quality polishing process which could be easily adapted to standard planetary continuous polishing machines and spindles. This summary contains information on a polishing process developed at LLNL which reproducibly provides high quality polished Zerodur surfaces at very high polishing efficiencies

  7. Culture technique of rabbit primary epidermal keratinocytes

    Directory of Open Access Journals (Sweden)

    Marini M

    2012-10-01

    Full Text Available The epidermis is the protective covering outer layer of the mammalian skin. The epidermal cells are stratified squamous epithelia which undergo continuous differentiation of loss and replacement of cells. Ninety per cent of epidermal cells consist of keratinocytes that are found in the basal layer of the stratified epithelium called epidermis. Keratinocytes are responsible for forming tight junctions with the nerves of the skin as well as in the process of wound healing. This article highlights the method of isolation and culture of rabbit primary epidermal keratinocytes in vitro. Approximately 2cm x 2cm oval shaped line was drawn on the dorsum of the rabbit to mark the surgical area. Then, the skin was carefully excised using a surgical blade and the target skin specimens harvested from the rabbits were placed in transport medium comprising of Dulbecco’s Modified Eagle Medium (DMEM and 1% of antibiotic-antimycotic solution. The specimens were transferred into a petri dish containing 70% ethanol and washed for 5 min followed by a wash in 1 x Dulbecco’s Phosphate Buffered Saline (DBPS. Then, the skin specimens were placed in DMEM and minced into small pieces using a scalpel. The minced pieces were placed in a centrifuge tube containing 0.6% Dispase and 1% antibiotic-antimycotic solution overnight at 4°C in a horizontal orientation. The epidermis layer (whitish, semi-transparent was separated from the dermis (pink, opaque, gooey with the aid of curved forceps by fixing the dermis with one pair of forceps while detaching the epidermis with the second pair. The cells were cultured at a density of 4 x 104 cells/cm2 in culture flask at 37°C and 5% CO2. The cell morphology of the keratinocytes was analyzed using inverted microscope.

  8. RNA Sequencing of Formalin-Fixed, Paraffin-Embedded Specimens for Gene Expression Quantification and Data Mining

    Directory of Open Access Journals (Sweden)

    Yan Guo

    2016-01-01

    Full Text Available Background. Proper rRNA depletion is crucial for the successful utilization of FFPE specimens when studying gene expression. We performed a study to evaluate two major rRNA depletion methods: Ribo-Zero and RNase H. RNAs extracted from 4 samples were treated with the two rRNA depletion methods in duplicate and sequenced (N=16. We evaluated their reducibility, ability to detect RNA, and ability to molecularly subtype these triple negative breast cancer specimens. Results. Both rRNA depletion methods produced consistent data between the technical replicates. We found that the RNase H method produced higher quality RNAseq data as compared to the Ribo-Zero method. In addition, we evaluated the RNAseq data generated from the FFPE tissue samples for noncoding RNA, including lncRNA, enhancer/super enhancer RNA, and single nucleotide variation (SNV. We found that the RNase H is more suitable for detecting high-quality, noncoding RNAs as compared to the Ribo-Zero and provided more consistent molecular subtype identification between replicates. Unfortunately, neither method produced reliable SNV data. Conclusions. In conclusion, for FFPE specimens, the RNase H rRNA depletion method performed better than the Ribo-Zero. Neither method generates data sufficient for SNV detection.

  9. [Quality management is associated with high quality services in health care].

    Science.gov (United States)

    Nielsen, Tenna Hassert; Riis, Allan; Mainz, Jan; Jensen, Anne-Louise Degn

    2013-12-09

    In these years, quality management has been the focus in order to meet high quality services for the patients in Danish health care. This article provides information on quality management and quality improvement and it evaluates its effectiveness in achieving better organizational structures, processes and results in Danish health-care organizations. Our findings generally support that quality management is associated with high quality services in health care.

  10. In vitro transformation of primary cultures of neonatal BALB/c mouse epidermal cells with ultraviolet-B radiation

    International Nuclear Information System (INIS)

    Ananthaswamy, H.N.; Kripke, M.L.

    1981-01-01

    Primary epidermal cultures from neonatal BALB/c mice were used to study the carcinogenic effects of ultraviolet radiation in vitro. These cultures were irradiated once through a Falcon plastic dish cover with an FS40 sunlamp [ultraviolet B, lambda approximately 290 to 400 nm] for various lengths of time and maintained for 8 to 12 weeks without subculturing. During this period, most of the cells in the untreated control showed signs of morphological differentiation and eventually died. The cultures irradiated with ultraviolet B radiation also behaved in the same manner except that, in some dishes, small populations of surviving cells began to proliferate and developed into morphologically distinct foci. Seven long-term cell lines were derived from these ultraviolet-irradiated primary epidermal cell cultures. Six of these cell lines produced tumors when injected s.c. into normal and/or immunosuppressed syngeneic recipients. These tumorigenic cell lines lacked definitive characteristics of differentiated epidermal cells, but the cells possessed intermediate junctions, suggesting that they were of epithelial origin. Some of these in vitro-transformed cell lines appeared to be highly antigenic inasmuch as they grew preferentially in immunosuppressed BALB/c mice as compared to their growth in normal syngeneic recipients

  11. Fractional sunburn threshold UVR doses generate equivalent vitamin D and DNA damage in skin types I-VI, but with epidermal DNA damage gradient correlated to skin darkness.

    Science.gov (United States)

    Shih, Barbara B; Farrar, Mark D; Cooke, Marcus S; Osman, Joanne; Langton, Abigail K; Kift, Richard; Webb, Ann R; Berry, Jacqueline L; Watson, Rachel E B; Vail, Andy; de Gruijl, Frank R; Rhodes, Lesley E

    2018-05-03

    Public health guidance recommends limiting sun-exposure to sub-sunburn levels, but it's unknown whether these can gain vitamin D (for musculoskeletal health) whilst avoiding epidermal DNA damage (initiates skin cancer). Well-characterised healthy humans of all skin types (I-VI; lightest to darkest skin) were exposed to a low dose-series of solar simulated UVR of 20-80% their individual sunburn threshold dose (minimal erythemal dose, MED). Significant UVR dose-responses were seen for serum 25(OH)D and whole epidermal CPD, with as little as 0.2 MED concurrently producing 25(OH)D and CPD. Notably, fractional MEDs generated equivalent levels of whole epidermal CPD and 25(OH)D across all skin types. Crucially, we demonstrated an epidermal gradient of CPD formation strongly correlated with skin darkness (r=0.74; Pskin types, ranging from darkest skin, where high CPD levels occurred superficially with none in the germinative basal layer, through to lightest skin where CPD were induced evenly across the epidermal depth. Darker skin people can be encouraged to utilise sub-sunburn UVR-exposure to enhance their vitamin D. In lighter skin people, basal cell damage occurs concurrent with vitamin D synthesis at exquisitely low UVR levels, providing an explanation for their high skin cancer incidence; greater caution is required. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.

  12. Optimal allocation of leaf epidermal area for gas exchange.

    Science.gov (United States)

    de Boer, Hugo J; Price, Charles A; Wagner-Cremer, Friederike; Dekker, Stefan C; Franks, Peter J; Veneklaas, Erik J

    2016-06-01

    A long-standing research focus in phytology has been to understand how plants allocate leaf epidermal space to stomata in order to achieve an economic balance between the plant's carbon needs and water use. Here, we present a quantitative theoretical framework to predict allometric relationships between morphological stomatal traits in relation to leaf gas exchange and the required allocation of epidermal area to stomata. Our theoretical framework was derived from first principles of diffusion and geometry based on the hypothesis that selection for higher anatomical maximum stomatal conductance (gsmax ) involves a trade-off to minimize the fraction of the epidermis that is allocated to stomata. Predicted allometric relationships between stomatal traits were tested with a comprehensive compilation of published and unpublished data on 1057 species from all major clades. In support of our theoretical framework, stomatal traits of this phylogenetically diverse sample reflect spatially optimal allometry that minimizes investment in the allocation of epidermal area when plants evolve towards higher gsmax . Our results specifically highlight that the stomatal morphology of angiosperms evolved along spatially optimal allometric relationships. We propose that the resulting wide range of viable stomatal trait combinations equips angiosperms with developmental and evolutionary flexibility in leaf gas exchange unrivalled by gymnosperms and pteridophytes. © 2016 The Authors New Phytologist © 2016 New Phytologist Trust.

  13. High-throughput sequencing of RNA silencing-associated small RNAs in olive (Olea europaea L..

    Directory of Open Access Journals (Sweden)

    Livia Donaire

    Full Text Available Small RNAs (sRNAs of 20 to 25 nucleotides (nt in length maintain genome integrity and control gene expression in a multitude of developmental and physiological processes. Despite RNA silencing has been primarily studied in model plants, the advent of high-throughput sequencing technologies has enabled profiling of the sRNA component of more than 40 plant species. Here, we used deep sequencing and molecular methods to report the first inventory of sRNAs in olive (Olea europaea L.. sRNA libraries prepared from juvenile and adult shoots revealed that the 24-nt class dominates the sRNA transcriptome and atypically accumulates to levels never seen in other plant species, suggesting an active role of heterochromatin silencing in the maintenance and integrity of its large genome. A total of 18 known miRNA families were identified in the libraries. Also, 5 other sRNAs derived from potential hairpin-like precursors remain as plausible miRNA candidates. RNA blots confirmed miRNA expression and suggested tissue- and/or developmental-specific expression patterns. Target mRNAs of conserved miRNAs were computationally predicted among the olive cDNA collection and experimentally validated through endonucleolytic cleavage assays. Finally, we use expression data to uncover genetic components of the miR156, miR172 and miR390/TAS3-derived trans-acting small interfering RNA (tasiRNA regulatory nodes, suggesting that these interactive networks controlling developmental transitions are fully operational in olive.

  14. Extraction of mRNA from coagulated horse blood and analysis of inflammation-related cytokine responses to coagulation

    DEFF Research Database (Denmark)

    Bovbjerg, Kirsten Katrine Lindegaard; Heegaard, Peter M. H.; Skovgaard, Kerstin

    2010-01-01

    the peripheral blood mononuclear cells present in the blood clot, homogenizing the clot by rotating knife homogenization (GentleMACS, Miltenyi Biotec) in the presence of QIAzol extraction buffer (Qiagen). The RNA extracted yielded high concentrations of total RNA (50-265 ng/μl) and quality measures (RIN=8...

  15. Reconstruction of ancestral RNA sequences under multiple structural constraints

    Directory of Open Access Journals (Sweden)

    Olivier Tremblay-Savard

    2016-11-01

    Full Text Available Abstract Background Secondary structures form the scaffold of multiple sequence alignment of non-coding RNA (ncRNA families. An accurate reconstruction of ancestral ncRNAs must use this structural signal. However, the inference of ancestors of a single ncRNA family with a single consensus structure may bias the results towards sequences with high affinity to this structure, which are far from the true ancestors. Methods In this paper, we introduce achARNement, a maximum parsimony approach that, given two alignments of homologous ncRNA families with consensus secondary structures and a phylogenetic tree, simultaneously calculates ancestral RNA sequences for these two families. Results We test our methodology on simulated data sets, and show that achARNement outperforms classical maximum parsimony approaches in terms of accuracy, but also reduces by several orders of magnitude the number of candidate sequences. To conclude this study, we apply our algorithms on the Glm clan and the FinP-traJ clan from the Rfam database. Conclusions Our results show that our methods reconstruct small sets of high-quality candidate ancestors with better agreement to the two target structures than with classical approaches. Our program is freely available at: http://csb.cs.mcgill.ca/acharnement .

  16. RNA-Sequencing of Drosophila melanogaster Head Tissue on High-Sugar and High-Fat Diets

    Directory of Open Access Journals (Sweden)

    Wayne Hemphill

    2018-01-01

    Full Text Available Obesity has been shown to increase risk for cardiovascular disease and type-2 diabetes. In addition, it has been implicated in aggravation of neurological conditions such as Alzheimer’s. In the model organism Drosophila melanogaster, a physiological state mimicking diet-induced obesity can be induced by subjecting fruit flies to a solid medium disproportionately higher in sugar than protein, or that has been supplemented with a rich source of saturated fat. These flies can exhibit increased circulating glucose levels, increased triglyceride content, insulin-like peptide resistance, and behavior indicative of neurological decline. We subjected flies to variants of the high-sugar diet, high-fat diet, or normal (control diet, followed by a total RNA extraction from fly heads of each diet group for the purpose of Poly-A selected RNA-Sequencing. Our objective was to identify the effects of obesogenic diets on transcriptome patterns, how they differed between obesogenic diets, and identify genes that may relate to pathogenesis accompanying an obesity-like state. Gene ontology analysis indicated an overrepresentation of affected genes associated with immunity, metabolism, and hemocyanin in the high-fat diet group, and CHK, cell cycle activity, and DNA binding and transcription in the high-sugar diet group. Our results also indicate differences in the effects of the high-fat diet and high-sugar diet on expression profiles in head tissue of flies, despite the reportedly similar phenotypic impacts of the diets. The impacted genes, and how they may relate to pathogenesis in the Drosophila obesity-like state, warrant further experimental investigation.

  17. Inflammatory linear verrucous epidermal naevus: Report of three ...

    African Journals Online (AJOL)

    Background: Epidermal naevi are congenital harmatomas that arise from embryonal ectodermal cells. The inflammatory linear verrucous variant is rare and presents with disturbing symptoms. In blacks the classical erythema is not common but pruritus and discharge are the commonest features. Methods and results: We ...

  18. M2 macrophages induce ovarian cancer cell proliferation via a heparin binding epidermal growth factor/matrix metalloproteinase 9 intercellular feedback loop.

    Science.gov (United States)

    Carroll, Molly J; Kapur, Arvinder; Felder, Mildred; Patankar, Manish S; Kreeger, Pamela K

    2016-12-27

    In ovarian cancer, a high ratio of anti-inflammatory M2 to pro-inflammatory M1 macrophages correlates with poor patient prognosis. The mechanisms driving poor tumor outcome as a result of the presence of M2 macrophages in the tumor microenvironment remain unclear and are challenging to study with current techniques. Therefore, in this study we utilized a micro-culture device previously developed by our lab to model concentrated paracrine signaling in order to address our hypothesis that interactions between M2 macrophages and ovarian cancer cells induce tumor cell proliferation. Using the micro-culture device, we determined that co-culture with M2-differentiated primary macrophages or THP-1 increased OVCA433 proliferation by 10-12%. This effect was eliminated with epidermal growth factor receptor (EGFR) or heparin-bound epidermal growth factor (HB-EGF) neutralizing antibodies and HBEGF expression in peripheral blood mononuclear cells from ovarian cancer patients was 9-fold higher than healthy individuals, suggesting a role for HB-EGF in tumor progression. However, addition of HB-EGF at levels secreted by macrophages or macrophage-conditioned media did not induce proliferation to the same extent, indicating a role for other factors in this process. Matrix metalloproteinase-9, MMP-9, which cleaves membrane-bound HB-EGF, was elevated in co-culture and its inhibition decreased proliferation. Utilizing inhibitors and siRNA against MMP9 in each population, we determined that macrophage-secreted MMP-9 released HB-EGF from macrophages, which increased MMP9 in OVCA433, resulting in a positive feedback loop to drive HB-EGF release and increase proliferation in co-culture. Identification of multi-cellular interactions such as this may provide insight into how to most effectively control ovarian cancer progression.

  19. Isotachophoresis for fractionation and recovery of cytoplasmic RNA and nucleus from single cells.

    Science.gov (United States)

    Kuriyama, Kentaro; Shintaku, Hirofumi; Santiago, Juan G

    2015-07-01

    There is a substantial need for simultaneous analyses of RNA and DNA from individual single cells. Such analysis provides unique evidence of cell-to-cell differences and the correlation between gene expression and genomic mutation in highly heterogeneous cell populations. We present a novel microfluidic system that leverages isotachophoresis to fractionate and isolate cytoplasmic RNA and genomic DNA (gDNA) from single cells. The system uniquely enables independent, sequence-specific analyses of these critical markers. Our system uses a microfluidic chip with a simple geometry and four end-channel electrodes, and completes the entire process in RNA output reservoirs, each containing high quality and purity aliquots with no measurable cross-contamination of cytoplasmic RNA versus gDNA. We demonstrate our system with simultaneous, sequence-specific quantitation using off-chip RT-qPCR and qPCR for simultaneous cytoplasmic RNA and gDNA analyses, respectively. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. Etanercept therapy for toxic epidermal necrolysis.

    Science.gov (United States)

    Paradisi, Andrea; Abeni, Damiano; Bergamo, Fabio; Ricci, Francesco; Didona, Dario; Didona, Biagio

    2014-08-01

    Toxic epidermal necrolysis (TEN) is a severe and potentially lethal drug reaction for which no standard treatment is available. To describe a case series of patients with TEN treated with a single dose of etanercept. We observed 10 consecutive patients with TEN. For each patient, we recorded the presence of comorbidities and all the drugs recently started (ie, in the last month). In all cases, 50 mg of etanercept was administered in a single subcutaneous injection. The clinical severity of disease was computed using the SCORe of Toxic Epidermal Necrosis (SCORTEN) scale. Using the probabilities of death linked to each level of SCORTEN score, we calculated the expected probability of death in our patients. Healing was defined as complete reepithelialization, and a time to healing curve was then obtained using the Kaplan-Meier method. All patients promptly responded to treatment, reaching complete reepithelialization without complications or side effects. The median time to healing was 8.5 days. This is a small, uncontrolled case series. These preliminary results suggest the possibility that tumor necrosis factor-alfa may be an effective target for control of TEN, a dangerous skin condition for which no effective cure has yet been found. Copyright © 2014 American Academy of Dermatology, Inc. Published by Mosby, Inc. All rights reserved.

  1. Comparison of 30% salicylic acid with jessner's solution for superficial chemical peeling in epidermal melasma

    International Nuclear Information System (INIS)

    Ejaz, A.; Raza, N.; Iftikhar, N.; Muzzafar, F.

    2008-01-01

    To compare the efficacy and safety of Jessner's solution with 30% salicylic acid as superficial chemical peeling agents in treating epidermal melasma in Asian skin. Sixty consenting patients with epidermal melasma were randomly divided into two groups. Group A was treated with Jessner's solution and Group B with 30% salicylic acid. Baseline Melasma Area Severity Index (MASI) score was noted and peeling started at 2-weekly intervals. Sunscreen in morning and moisturizer at night were prescribed in all patients. MASI score and adverse effects were recorded biweekly. Treatment was stopped at 12 weeks and patients were followed-up at 4 weekly intervals for further 12 weeks. Final MASI score and adverse effects were noted at the end of follow-up period. Mean MASI scores were compared using paired sample t-test and one-way ANOVA. Difference in baseline, treatment end and follow-up end MASI scores was not statistically significant between the two groups (p=0.54, 0.26, and 0.55 respectively). On the other hand, within group analysis of difference between pre and posttreatment MASI score was highly significant in both groups (p < 0.0001). Adverse effects were mild and comparable in both groups. Jessner's solution and 30% salicylic acid are equally effective and safe peeling agents for use in epidermal melasma in Asian skin. (author)

  2. Steroid hormone and epidermal growth factor receptors in meningiomas.

    Science.gov (United States)

    Horsfall, D J; Goldsmith, K G; Ricciardelli, C; Skinner, J M; Tilley, W D; Marshall, V R

    1989-11-01

    A prospective study of steroid hormone and epidermal growth factor receptor expression in 57 meningiomas is presented. Scatchard analysis of radioligand binding identified 20% of meningiomas as expressing classical oestrogen receptors (ER) at levels below that normally accepted for positivity, the remainder being negative. ER could not be visualized in any meningioma using immunocytochemistry. Alternatively, 74% of meningiomas demonstrated the presence of progesterone receptors (PR) by Scatchard analysis, the specificity of which could not be attributed to glucocorticoid or androgen receptors. Confirmation of classical PR presence was determined by immunocytochemical staining. The presence of epidermal growth factor receptor (EGFR) was demonstrated in 100% of meningiomas using immunocytochemical staining. These data are reviewed in the context of previously reported results and are discussed in relation to the potential for medical therapy as an adjunct to surgery.

  3. Assessment of the Developmental Toxicity of Epidermal Growth ...

    African Journals Online (AJOL)

    Purpose: To determine whether epidermal growth factor (EGF) is involved in reproductive developmental toxicity, using the embryonic stem cell test (EST), as well as ascertain how EGF influences embryonic development. Methods: To predict developmental toxicity on the basis of reducing cell viability and inhibition of ...

  4. High-content live cell imaging with RNA probes: advancements in high-throughput antimalarial drug discovery

    Directory of Open Access Journals (Sweden)

    Cervantes Serena

    2009-06-01

    Full Text Available Abstract Background Malaria, a major public health issue in developing nations, is responsible for more than one million deaths a year. The most lethal species, Plasmodium falciparum, causes up to 90% of fatalities. Drug resistant strains to common therapies have emerged worldwide and recent artemisinin-based combination therapy failures hasten the need for new antimalarial drugs. Discovering novel compounds to be used as antimalarials is expedited by the use of a high-throughput screen (HTS to detect parasite growth and proliferation. Fluorescent dyes that bind to DNA have replaced expensive traditional radioisotope incorporation for HTS growth assays, but do not give additional information regarding the parasite stage affected by the drug and a better indication of the drug's mode of action. Live cell imaging with RNA dyes, which correlates with cell growth and proliferation, has been limited by the availability of successful commercial dyes. Results After screening a library of newly synthesized stryrl dyes, we discovered three RNA binding dyes that provide morphological details of live parasites. Utilizing an inverted confocal imaging platform, live cell imaging of parasites increases parasite detection, improves the spatial and temporal resolution of the parasite under drug treatments, and can resolve morphological changes in individual cells. Conclusion This simple one-step technique is suitable for automation in a microplate format for novel antimalarial compound HTS. We have developed a new P. falciparum RNA high-content imaging growth inhibition assay that is robust with time and energy efficiency.

  5. Responses of epidermal cell turgor pressure and photosynthetic activity of leaves of the atmospheric epiphyte Tillandsia usneoides (Bromeliaceae) after exposure to high humidity.

    Science.gov (United States)

    Martin, Craig E; Rux, Guido; Herppich, Werner B

    2013-01-01

    It has been well-established that many epiphytic bromeliads of the atmospheric-type morphology, i.e., with leaf surfaces completely covered by large, overlapping, multicellular trichomes, are capable of absorbing water vapor from the atmosphere when air humidity increases. It is much less clear, however, whether this absorption of water vapor can hydrate the living cells of the leaves and, as a consequence, enhance physiological processes in such cells. The goal of this research was to determine if the absorption of atmospheric water vapor by the atmospheric epiphyte Tillandsia usneoides results in an increase in turgor pressure in leaf epidermal cells that subtend the large trichomes, and, by using chlorophyll fluorescence techniques, to determine if the absorption of atmospheric water vapor by leaves of this epiphyte results in increased photosynthetic activity. Results of measurements on living cells of attached leaves of this epiphytic bromeliad, using a pressure probe and of whole-shoot fluorescence imaging analyses clearly illustrated that the turgor pressure of leaf epidermal cells did not increase, and the photosynthetic activity of leaves did not increase, following exposure of the leaves to high humidity air. These results experimentally demonstrate, for the first time, that the absorption of water vapor following increases in atmospheric humidity in atmospheric epiphytic bromeliads is mostly likely a physical phenomenon resulting from hydration of non-living leaf structures, e.g., trichomes, and has no physiological significance for the plant's living tissues. Copyright © 2012 Elsevier GmbH. All rights reserved.

  6. Epidermal Overexpression of Xenobiotic Receptor PXR Impairs the Epidermal Barrier and Triggers Th2 Immune Response.

    Science.gov (United States)

    Elentner, Andreas; Schmuth, Matthias; Yannoutsos, Nikolaos; Eichmann, Thomas O; Gruber, Robert; Radner, Franz P W; Hermann, Martin; Del Frari, Barbara; Dubrac, Sandrine

    2018-01-01

    The skin is in daily contact with environmental pollutants, but the long-term effects of such exposure remain underinvestigated. Many of these toxins bind and activate the pregnane X receptor (PXR), a ligand-activated transcription factor that regulates genes central to xenobiotic metabolism. The objective of this work was to investigate the effect of constitutive activation of PXR in the basal layer of the skin to mimic repeated skin exposure to noxious molecules. We designed a transgenic mouse model that overexpresses the human PXR gene linked to the herpes simplex VP16 domain under the control of the keratin 14 promoter. We show that transgenic mice display increased transepidermal water loss and elevated skin pH, abnormal stratum corneum lipids, focal epidermal hyperplasia, activated keratinocytes expressing more thymic stromal lymphopoietin, a T helper type 2/T helper type 17 skin immune response, and increased serum IgE. Furthermore, the cutaneous barrier dysfunction precedes development of the T helper type 2/T helper type 17 inflammation in transgenic mice, thereby mirroring the time course of atopic dermatitis development in humans. Moreover, further experiments suggest increased PXR signaling in the skin of patients with atopic dermatitis when compared with healthy skin. Thus, PXR activation by environmental pollutants may compromise epidermal barrier function and favor an immune response resembling atopic dermatitis. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  7. Genetics Home Reference: Stevens-Johnson syndrome/toxic epidermal necrolysis

    Science.gov (United States)

    ... Hung SI. Recent advances in the genetics and immunology of Stevens-Johnson syndrome and toxic epidermal necrosis. ... 2012 May 29. Citation on PubMed or Free article on PubMed Central More from Genetics Home Reference ...

  8. Stable RNA interference of ErbB-2 gene synergistic with epirubicin suppresses breast cancer growth in vitro and in vivo

    International Nuclear Information System (INIS)

    Hu Xiaoqu; Su Fengxi; Qin Li; Jia Weijuan; Gong Chang; Yu Fengyan; Guo Jujiang; Song Erwei

    2006-01-01

    Overexpression of human epidermal growth factor receptor-2 (Her2, ErbB-2) contributes to the progression and metastasis of breast cancer, implying that Her2 gene is a suitable target of RNA interference (RNAi) for breast cancer therapy. Here, we employed plasmid-mediated expression of 2 different Her2-shRNAs (pU6-Her2shRNAs) efficiently silenced the target gene expression on Her2 expressing SKBR-3 breast cancer cells in both mRNA and protein levels. Consequently, pU6-Her2shRNA increased apoptosis and reduced proliferation of SKBR-3 cells assayed by TUNEL and MTT, respectively. In vivo, intra-tumor injection of pU6-Her2shRNA inhibited the growth of SKBR-3 tumors inoculated subcutaneously in nude mice. Furthermore, pU6-Her2shRNA synergized the tumor suppression effect of epirubicin to SKBR-3 cells in vitro and implanted subcutaneously in nude mice. Therefore, we concluded that stable silencing of Her2 gene expression with plasmid expressing shRNA may hold great promise as a novel therapy for Her2 expressing breast cancers alone or in combination with anthracycline chemotherapy

  9. Comparative SEM and LM foliar epidermal and palyno-morphological studies of Amaranthaceae and its taxonomic implications.

    Science.gov (United States)

    Hussain, Amara Noor; Zafar, Muhammad; Ahmad, Mushtaq; Khan, Raees; Yaseen, Ghulam; Khan, Muhammad Saleem; Nazir, Abdul; Khan, Amir Muhammad; Shaheen, Shabnum

    2018-05-01

    Palynological features as well as comparative foliar epidermal using light and scanning electron microscope (SEM) of 17 species (10genera) of Amaranthaceae have been studied for its taxonomic significance. Different foliar and palynological micro-morphological characters were examined to explain their value in resolving the difficulty in identification. All species were amphistomatic but stomata on abaxial surface were more abundant. Taxonomically significant epidermal character including stomata type, trichomes (unicellular, multicellular, and capitate) and epidermal cells shapes (polygonal and irregular) were also observed. Pollens of this family are Polypantoporate, pores large, spheroidal, mesoporous region is sparsely to scabrate, densely psilate, and spinulose. All these characters can be active at species level for identification purpose. This study indicates that at different taxonomic levels, LM and SEM pollen and epidermal morphology is explanatory and significant to identify species and genera. © 2018 Wiley Periodicals, Inc.

  10. High Efficient Expression, Purification, and Functional Characterization of Native Human Epidermal Growth Factor in Escherichia coli

    Directory of Open Access Journals (Sweden)

    Yi Ma

    2016-01-01

    Full Text Available Human epidermal growth factor (hEGF is a small, mitotic growth polypeptide that promotes the proliferation of various cells and is widely applied in clinical practices. However, high efficient expression of native hEGF in Escherichia coli has not been successful, since three disulfide bonds in monomer hEGF made it unable to fold into correct 3D structure using in vivo system. To tackle this problem, we fused Mxe GyrA intein (Mxe at the C-terminal of hEGF followed by small ubiquitin-related modifier (SUMO and 10x His-tag to construct a chimeric protein hEGF-Mxe-SUMO-H10. The fusion protein was highly expressed at the concentration of 281 mg/L and up to 59.5% of the total cellular soluble proteins. The fusion protein was purified by affinity chromatography and 29.4 mg/L of native hEGF can be released by thiol induced N-terminal cleavage without any proteases. The mitotic activity in Balb/c 3T3 cells is proliferated by commercial and recombinant hEGF measured with methylthiazolyldiphenyl-tetrazolium bromide (MTT assay which indicated that recombinant hEGF protein stimulates the cell proliferation similar to commercial protein. This study significantly improved the yield and reduced the cost of hEGF in the recombinant E. coli system and could be a better strategy to produce native hEGF for pharmaceutical development.

  11. High Efficient Expression, Purification, and Functional Characterization of Native Human Epidermal Growth Factor in Escherichia coli.

    Science.gov (United States)

    Ma, Yi; Yu, Jieying; Lin, Jinglian; Wu, Shaomin; Li, Shan; Wang, Jufang

    2016-01-01

    Human epidermal growth factor (hEGF) is a small, mitotic growth polypeptide that promotes the proliferation of various cells and is widely applied in clinical practices. However, high efficient expression of native hEGF in Escherichia coli has not been successful, since three disulfide bonds in monomer hEGF made it unable to fold into correct 3D structure using in vivo system. To tackle this problem, we fused Mxe GyrA intein (Mxe) at the C-terminal of hEGF followed by small ubiquitin-related modifier (SUMO) and 10x His-tag to construct a chimeric protein hEGF-Mxe-SUMO-H 10 . The fusion protein was highly expressed at the concentration of 281 mg/L and up to 59.5% of the total cellular soluble proteins. The fusion protein was purified by affinity chromatography and 29.4 mg/L of native hEGF can be released by thiol induced N-terminal cleavage without any proteases. The mitotic activity in Balb/c 3T3 cells is proliferated by commercial and recombinant hEGF measured with methylthiazolyldiphenyl-tetrazolium bromide (MTT) assay which indicated that recombinant hEGF protein stimulates the cell proliferation similar to commercial protein. This study significantly improved the yield and reduced the cost of hEGF in the recombinant E. coli system and could be a better strategy to produce native hEGF for pharmaceutical development.

  12. Neutralization of IL-8 prevents the induction of dermatologic adverse events associated with the inhibition of epidermal growth factor receptor

    DEFF Research Database (Denmark)

    Bangsgaard, Nannie; Houtkamp, Mischa; Schuurhuis, Danita H

    2012-01-01

    Epidermal growth factor receptor (EGFR) inhibitors are widely used in the treatment of cancer. EGFR-targeted treatment is known to be associated with a high incidence of dermatological adverse reactions, including papulopustular rash, which can be dose-limiting and may affect compliance to treatm......Epidermal growth factor receptor (EGFR) inhibitors are widely used in the treatment of cancer. EGFR-targeted treatment is known to be associated with a high incidence of dermatological adverse reactions, including papulopustular rash, which can be dose-limiting and may affect compliance......, characterized by acute follicular neutrophil-rich hair follicle inflammation, and thus mimicked adverse events induced by systemic administration of EGFR inhibitors. In this model, we tested the hypothesis that neutrophils, attracted by IL-8, play a central role in the observed rash. Indeed, concomitant local...

  13. Discovering cancer vulnerabilities using high-throughput micro-RNA screening.

    Science.gov (United States)

    Nikolic, Iva; Elsworth, Benjamin; Dodson, Eoin; Wu, Sunny Z; Gould, Cathryn M; Mestdagh, Pieter; Marshall, Glenn M; Horvath, Lisa G; Simpson, Kaylene J; Swarbrick, Alexander

    2017-12-15

    Micro-RNAs (miRNAs) are potent regulators of gene expression and cellular phenotype. Each miRNA has the potential to target hundreds of transcripts within the cell thus controlling fundamental cellular processes such as survival and proliferation. Here, we exploit this important feature of miRNA networks to discover vulnerabilities in cancer phenotype, and map miRNA-target relationships across different cancer types. More specifically, we report the results of a functional genomics screen of 1280 miRNA mimics and inhibitors in eight cancer cell lines, and its presentation in a sophisticated interactive data portal. This resource represents the most comprehensive survey of miRNA function in oncology, incorporating breast cancer, prostate cancer and neuroblastoma. A user-friendly web portal couples this experimental data with multiple tools for miRNA target prediction, pathway enrichment analysis and visualization. In addition, the database integrates publicly available gene expression and perturbation data enabling tailored and context-specific analysis of miRNA function in a particular disease. As a proof-of-principle, we use the database and its innovative features to uncover novel determinants of the neuroblastoma malignant phenotype. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  14. Elevated microRNA-126 is associated with high vascular endothelial growth factor receptor 2 expression levels and high microvessel density in colorectal cancer

    DEFF Research Database (Denmark)

    Hansen, Torben Frøstrup; Andersen, Claus Lindbjerg; Nielsen, Boye Schnack

    2011-01-01

    was to analyse the possible relationship between miRNA-126, VEGFR-2 and angiogenesis in tumour tissue from patients with colorectal cancer (CRC). Tumour tissue was obtained from 81 patients. The miRNA-126 and VEGFR-2 gene expression levels were analysed by PCR and the protein concentrations of VEGFR-2 were...... the median as the cut-off. The median gene expression levels of VEGFR-2 were significantly lower in the tumours expressing low levels of miRNA-126, 0.30 (95% CI, 0.24‑0.36), compared to those expressing high levels of miRNA-126, 0.48 (95% CI, 0.28-0.60), p=0.02. A positive association was observed with VEGFR...... analysed by ELISA. Angiogenesis, visualised by the endothelial cell marker CD105 combined with caldesmon, was assessed by immunohistochemistry and the microvessel density (MVD) technique. In situ hybridisation was performed for miRNA-126. Tumours were classified as low or high miRNA‑126-expressing using...

  15. High-affinity RNA aptamers to C-reactive protein (CRP): newly developed pre-elution methods for aptamer selection

    International Nuclear Information System (INIS)

    Orito, N; Umekage, S; Sakai, E; Tanaka, T; Kikuchi, Y; Sato, K; Kawauchi, S; Tanaka, H

    2012-01-01

    We have developed a modified SELEX (systematic evolution of ligands by exponential enrichment) method to obtain RNA aptamers with high affinity to C-reactive protein (CRP). CRP is a clinical biomarker present in plasma, the level of which increases in response to infections and noninfectious inflammation. The CRP level is also an important prognostic indicator in patients with several syndromes. At present, CRP content in blood is measured immunochemically using antibodies. To develop a more sensitive method using RNA aptamers, we have attempted to obtain high-affinity RNA aptamers to CRP. We succeeded in obtaining an RNA aptamer with high affinity to CRP using a CRP-immobilized Sepharose column and pre-elution procedure. Pre-elution is a method that removes the weak binding portion from a selected RNA population by washing for a short time with buffer containing CRP. By surface plasmon-resonance (SPR) analysis, the affinity constant of this aptamer for CRP was calculated to be K D = 2.25x10 -9 (M). The secondary structure, contact sites with CRP protein, and application of this aptamer will be described.

  16. Fab Chaperone-Assisted RNA Crystallography (Fab CARC).

    Science.gov (United States)

    Sherman, Eileen; Archer, Jennifer; Ye, Jing-Dong

    2016-01-01

    Recent discovery of structured RNAs such as ribozymes and riboswitches shows that there is still much to learn about the structure and function of RNAs. Knowledge learned can be employed in both biochemical research and clinical applications. X-ray crystallography gives unparalleled atomic-level structural detail from which functional inferences can be deduced. However, the difficulty in obtaining high-quality crystals and their phasing information make it a very challenging task. RNA crystallography is particularly arduous due to several factors such as RNA's paucity of surface chemical diversity, lability, repetitive anionic backbone, and flexibility, all of which are counterproductive to crystal packing. Here we describe Fab chaperone assisted RNA crystallography (CARC), a systematic technique to increase RNA crystallography success by facilitating crystal packing as well as expediting phase determination through molecular replacement of conserved Fab domains. Major steps described in this chapter include selection of a synthetic Fab library displayed on M13 phage against a structured RNA crystallization target, ELISA for initial choice of binding Fabs, Fab expression followed by protein A affinity then cation exchange chromatography purification, final choice of Fab by binding specificity and affinity as determined by a dot blot assay, and lastly gel filtration purification of a large quantity of chosen Fabs for crystallization.

  17. HLA-B Sequencing in Patients with Stevens-Johnson Syndrome and Toxic Epidermal Necrolysis

    Science.gov (United States)

    2017-03-03

    Stevens -Johnson Syndrome and Toxic Epidermal Necrolysis Brittany L. Lenz, MD, Andrew T. Patterson, MD, Amanda J . Laska, MD, Patrick J . Brown, MD, and...59 MDW/SGVU SUBJECT: Professional Presentation Approval 8 DEC 2016 1. Your paper, entitled HLA-B Sequencing in Patients with Stevens -Johnson...PATIENTS WITH STEVENS -JOHNSON SYNDROME AND TOXIC EPIDERMAL NECROL YSIS 2. FUNDING RECEIVED FOR THIS STUDY? DYES rgj NO FUNDING SOURCE: I I 3. IS THIS

  18. Clinical Studies on conformal radiotherapy combined with epidermal ...

    African Journals Online (AJOL)

    Purpose: To study the effect of conformal radiotherapy combined with epidermal growth factor receptor-tyrosine kinase inhibitor (EGFR-TKI) in the second-line treatment of non-small cell lung cancer (NSCLC). Methods: A total of 316 patients attending Shanghai Pulmonary Hospital affiliated to Tongji University, were divided ...

  19. Natural RNA circles function as efficient microRNA sponges

    DEFF Research Database (Denmark)

    Hansen, Thomas Birkballe; Jensen, Trine I; Clausen, Bettina Hjelm

    2013-01-01

    MicroRNAs (miRNAs) are important post-transcriptional regulators of gene expression that act by direct base pairing to target sites within untranslated regions of messenger RNAs. Recently, miRNA activity has been shown to be affected by the presence of miRNA sponge transcripts, the so-called comp......MicroRNAs (miRNAs) are important post-transcriptional regulators of gene expression that act by direct base pairing to target sites within untranslated regions of messenger RNAs. Recently, miRNA activity has been shown to be affected by the presence of miRNA sponge transcripts, the so......-called competing endogenous RNA in humans and target mimicry in plants. We previously identified a highly expressed circular RNA (circRNA) in human and mouse brain. Here we show that this circRNA acts as a miR-7 sponge; we term this circular transcript ciRS-7 (circular RNA sponge for miR-7). ciRS-7 contains more...... sponge, suggesting that miRNA sponge effects achieved by circRNA formation are a general phenomenon. This study serves as the first, to our knowledge, functional analysis of a naturally expressed circRNA....

  20. Fatty acids are required for epidermal permeability barrier function.

    Science.gov (United States)

    Mao-Qiang, M; Elias, P M; Feingold, K R

    1993-08-01

    The permeability barrier is mediated by a mixture of ceramides, sterols, and free fatty acids arranged as extracellular lamellar bilayers in the stratum corneum. Whereas prior studies have shown that cholesterol and ceramides are required for normal barrier function, definitive evidence for the importance of nonessential fatty acids is not available. To determine whether epidermal fatty acid synthesis also is required for barrier homeostasis, we applied 5-(tetradecyloxy)-2-furancarboxylic acid (TOFA), an inhibitor of acetyl CoA carboxylase, after disruption of the barrier by acetone or tape stripping. TOFA inhibits epidermal fatty acid by approximately 50% and significantly delays barrier recovery. Moreover, coadministration of palmitate with TOFA normalizes barrier recovery, indicating that the delay is due to a deficiency in bulk fatty acids. Furthermore, TOFA treatment also delays the return of lipids to the stratum corneum and results in abnormalities in the structure of lamellar bodies, the organelle which delivers lipid to the stratum corneum. In addition, the organization of secreted lamellar body material into lamellar bilayers within the stratum corneum interstices is disrupted by TOFA treatment. Finally, these abnormalities in lamellar body and stratum corneum membrane structure are corrected by coapplication of palmitate with TOFA. These results demonstrate a requirement for bulk fatty acids in barrier homeostasis. Thus, inhibiting the epidermal synthesis of any of the three key lipids that form the extracellular, lipid-enriched membranes of the stratum corneum results in an impairment in barrier homeostasis.

  1. Predicting human epidermal melanin concentrations for different skin tones

    CSIR Research Space (South Africa)

    Smit, Jacoba E

    2011-07-01

    Full Text Available epidermal melanin concentrations for different skin tones JE Smit 1 , AE Karsten 2 , RW Sparrow 1 1 CSIR Biosciences, Pretoria, South Africa 2 CSIR National Laser Centre, Pretoria, South Africa Author e-mail address: KSmit...

  2. Epidermal Nevus Syndrome Associated with Brain Malformations and Medulloblastoma

    Directory of Open Access Journals (Sweden)

    J Gordon Millichap

    2013-01-01

    Full Text Available Researchers at Juntendo University and Tokyo Women’s Medical University, Japan; and University of California, San Francisco, Ca, report a male infant with epidermal nevus syndrome associated with brainstem and cerebellar malformations and neonatal medulloblastoma.

  3. Design, Construction, and Validation of Artificial MicroRNA Vectors Using Agrobacterium-Mediated Transient Expression System.

    Science.gov (United States)

    Bhagwat, Basdeo; Chi, Ming; Han, Dianwei; Tang, Haifeng; Tang, Guiliang; Xiang, Yu

    2016-01-01

    Artificial microRNA (amiRNA) technology utilizes microRNA (miRNA) biogenesis pathway to produce artificially selected small RNAs using miRNA gene backbone. It provides a feasible strategy for inducing loss of gene function, and has been applied in functional genomics study, improvement of crop quality and plant virus disease resistance. A big challenge in amiRNA applications is the unpredictability of silencing efficacy of the designed amiRNAs and not all constructed amiRNA candidates would be expressed effectively in plant cells. We and others found that high efficiency and specificity in RNA silencing can be achieved by designing amiRNAs with perfect or almost perfect sequence complementarity to their targets. In addition, we recently demonstrated that Agrobacterium-mediated transient expression system can be used to validate amiRNA constructs, which provides a simple, rapid and effective method to select highly expressible amiRNA candidates for stable genetic transformation. Here, we describe the methods for design of amiRNA candidates with perfect or almost perfect base-pairing to the target gene or gene groups, incorporation of amiRNA candidates in miR168a gene backbone by one step inverse PCR amplification, construction of plant amiRNA expression vectors, and assay of transient expression of amiRNAs in Nicotiana benthamiana through agro-infiltration, small RNA extraction, and amiRNA Northern blot.

  4. Expression profiles of miRNA-122 and its target CAT1 in minipigs (Sus scrofa) fed a high-cholesterol diet

    DEFF Research Database (Denmark)

    Cirera Salicio, Susanna; Birck, Malene Muusfeldt; Busk, Peter Kamp

    2010-01-01

    The Göttingen minipig is an excellent model for studying effects of dietary high-fat intake on obesity. In this study, we analyzed the expression level of microRNA-122 (miRNA-122) and its target mRNA, CAT1, in intact young male minipigs fed either high-cholesterol or standard diet for 11 wk. Mi...... with a decrease in the expression of miRNA-122, confirming the implication of this microRNA in obesity. Gene expression levels of CAT1 did not differ between groups.......RNA-122 and CAT1 are known to be important regulators of lipid metabolism. The weight of the young minipigs was monitored once a week during the feeding period; measurements of total cholesterol, triglycerides, high-density lipoproteins, and low-density lipoproteins were recorded at 4 time points (8, 14...

  5. Nonmuscle Myosin II Is Required for Internalization of the Epidermal Growth Factor Receptor and Modulation of Downstream Signaling*

    Science.gov (United States)

    Kim, Jong Hyun; Wang, Aibing; Conti, Mary Anne; Adelstein, Robert S.

    2012-01-01

    Ligand-induced internalization of the epidermal growth factor receptor (EGFR) is an important process for regulating signal transduction, cellular dynamics, and cell-cell communication. Here, we demonstrate that nonmuscle myosin II (NM II) is required for the internalization of the EGFR and to trigger the EGFR-dependent activation of ERK and AKT. The EGFR was identified as a protein that interacts with NM II by co-immunoprecipitation and mass spectrometry analysis. This interaction requires both the regulatory light chain 20 (RLC20) of NM II and the kinase domain of the EGFR. Two paralogs of NM II, NM II-A, and NM II-B can act to internalize the EGFR, depending on the cell type and paralog content of the cell line. Loss (siRNA) or inhibition (25 μm blebbistatin) of NM II attenuates the internalization of the EGFR and impairs EGFR-dependent activation of ERK and AKT. Both internalization of the EGFR and downstream signaling to ERK and AKT can be partially restored in siRNA-treated cells by introduction of wild type (WT) GFP-NM II, but cannot be restored by motor mutant NM II. Taken together, these results suggest that NM II plays a role in the internalization of the EGFR and EGFR-mediated signaling pathways. PMID:22718763

  6. RNA interference in designing transgenic crops.

    Science.gov (United States)

    Ali, Nusrat; Datta, Swapan K; Datta, Karabi

    2010-01-01

    RNA interference (RNAi) is a sequence specific gene silencing mechanism, triggered by the introduction of dsRNA leading to mRNA degradation. It helps in switching on and off the targeted gene, which might have significant impact in developmental biology. Discovery of RNAi represents one of the most promising and rapidly advancing frontiers in plant functional genomics and in crop improvement by plant metabolic engineering and also plays an important role in reduction of allergenicity by silencing specific plant allergens. In plants the RNAi technology has been employed successfully in improvement of several plant species- by increasing their nutritional value, overall quality and by conferring resistance against pathogens and diseases. The review gives an insight to the perspective use of the technology in designing crops with innovation, to bring improvement to crop productivity and quality.

  7. Diurnal changes in epidermal UV transmittance of plants in naturally high UV environments.

    Science.gov (United States)

    Barnes, Paul W; Flint, Stephan D; Slusser, James R; Gao, Wei; Ryel, Ronald J

    2008-06-01

    Studies were conducted on three herbaceous plant species growing in naturally high solar UV environments in the subalpine of Mauna Kea, Hawaii, USA, to determine if diurnal changes in epidermal UV transmittance (T(UV)) occur in these species, and to test whether manipulation of the solar radiation regime could alter these diurnal patterns. Additional field studies were conducted at Logan, Utah, USA, to determine if solar UV was causing diurnal T(UV) changes and to evaluate the relationship between diurnal changes in T(UV) and UV-absorbing pigments. Under clear skies, T(UV), as measured with a UV-A-pulse amplitude modulation fluorometer for leaves of Verbascum thapsus and Oenothera stricta growing in native soils and Vicia faba growing in pots, was highest at predawn and sunset and lowest at midday. These patterns in T(UV) closely tracked diurnal changes in solar radiation and were the result of correlated changes in fluorescence induced by UV-A and blue radiation but not photochemical efficiency (F(v)/F(m)) or initial fluorescence yield (F(o)). The magnitude of the midday reduction in T(UV) was greater for young leaves than for older leaves of Verbascum. Imposition of artificial shade eliminated the diurnal changes in T(UV) in Verbascum, but reduction in solar UV had no effect on diurnal T(UV) changes in Vicia. In Vicia, the diurnal changes in T(UV) occurred without detectable changes in the concentration of whole-leaf UV-absorbing compounds. Results suggest that plants actively control diurnal changes in UV shielding, and these changes occur in response to signals other than solar UV; however, the underlying mechanisms responsible for rapid changes in T(UV) remain unclear.

  8. Retrospective Study of Epidermal Parasitic Skin Diseases amongst ...

    African Journals Online (AJOL)

    ADOWIE PERE

    ABSTRACT: A ten year retrospective study (1997-2006) was undertaken to determine the prevalence of. Epidermal Parasitic Skin Diseases (EPSD) among out-patients from the skin diseases hospital in Maiduguri, Borno state. Out of 10,000 out-patients examined during the study period, 3527(35.27%) where infected with ...

  9. Development of RNA aptamers as molecular probes for HER2+ breast cancer study using cell-SELEX

    Directory of Open Access Journals (Sweden)

    Seyedeh Alia Moosavian

    2015-06-01

    Full Text Available Objective(s: Development of molecules that specifically recognize cancer cells is one of the major areas in cancer research. Human epidermal growth factor receptor 2 (HER2 is specifically expressed on the surface of breast cancer cells. HER2 is associated with an aggressive phenotype and poor prognosis. In this study we aimed to isolate RNA aptamers that specifically bind to HER2 overexpressing TUBO cell line. Materials and Methods: Panel of aptamers was selected using cell-based systematic evolution of ligands by exponential enrichment (cell-SELEX. Results: Binding studies showed that selected aptamers can identify TUBO cell line with high affinity and selectivity. Our preliminary investigation of the target of aptamers suggested that aptamers bind with HER2 proteins on the surface of TUBO cells. Conclusion: We believe the selected aptamers could be useful ligands for targeted breast cancer therapy.

  10. Simple preparation of plant epidermal tissue for laser microdissection and downstream quantitative proteome and carbohydrate analysis

    Directory of Open Access Journals (Sweden)

    Christian eFalter

    2015-03-01

    Full Text Available The outwardly directed cell wall and associated plasma membrane of epidermal cells represent the first layers of plant defense against intruding pathogens. Cell wall modifications and the formation of defense structures at sites of attempted pathogen penetration are decisive for plant defense. A precise isolation of these stress-induced structures would allow a specific analysis of regulatory mechanism and cell wall adaption. However, methods for large-scale epidermal tissue preparation from the model plant Arabidopsis thaliana, which would allow proteome and cell wall analysis of complete, laser-microdissected epidermal defense structures, have not been provided. We developed the adhesive tape – liquid cover glass technique for simple leaf epidermis preparation from A. thaliana, which is also applicable on grass leaves. This method is compatible with subsequent staining techniques to visualize stress-related cell wall structures, which were precisely isolated from the epidermal tissue layer by laser microdissection coupled to laser pressure catapulting. We successfully demonstrated that these specific epidermal tissue samples could be used for quantitative downstream proteome and cell wall analysis. The development of the adhesive tape – liquid cover glass technique for simple leaf epidermis preparation and the compatibility to laser microdissection and downstream quantitative analysis opens new possibilities in the precise examination of stress- and pathogen-related cell wall structures in epidermal cells. Because the developed tissue processing is also applicable on A. thaliana, well-established, model pathosystems that include the interaction with powdery mildews can be studied to determine principal regulatory mechanisms in plant-microbe interaction with their potential outreach into crop breeding.

  11. TGM5 mutations impact epidermal differentiation in acral peeling skin syndrome.

    Science.gov (United States)

    Pigors, Manuela; Kiritsi, Dimitra; Cobzaru, Cristina; Schwieger-Briel, Agnes; Suárez, Jose; Faletra, Flavio; Aho, Heikki; Mäkelä, Leeni; Kern, Johannes S; Bruckner-Tuderman, Leena; Has, Cristina

    2012-10-01

    Acral peeling skin syndrome (APSS) is an autosomal recessive skin disorder characterized by acral blistering and peeling of the outermost layers of the epidermis. It is caused by mutations in the gene for transglutaminase 5, TGM5. Here, we report on clinical and molecular findings in 11 patients and extend the TGM5 mutation database by four, to our knowledge, previously unreported mutations: p.M1T, p.L41P, p.L214CfsX15, and p.S604IfsX9. The recurrent mutation p.G113C was found in 9 patients, but also in 3 of 100 control individuals in a heterozygous state, indicating that APSS might be more widespread than hitherto expected. Using quantitative real-time PCR, immunoblotting, and immunofluorescence analysis, we demonstrate that expression and distribution of several epidermal differentiation markers and corneodesmosin (CDSN) is altered in APSS keratinocytes and skin. Although the expression of transglutaminases 1 and 3 was not changed, we found an upregulation of keratin 1, keratin 10, involucrin, loricrin, and CDSN, probably as compensatory mechanisms for stabilization of the epidermal barrier. Our results give insights into the consequences of TGM5 mutations on terminal epidermal differentiation.

  12. Autodegradation of 125I-labeled human epidermal cell surface proteins

    International Nuclear Information System (INIS)

    Hashimoto, K.; Singer, K.H.; Lazarus, G.S.

    1982-01-01

    Triton X-100 extracts of cultured human epidermal cells exhibited proteolytic activity as measured by the hydrolysis of [ 3 H]-casein at neutral pH. The majority of endogenous proteolytic activity was inhibited by parahydroxy mercuribenzoate and by mersalyl acid, indicating the enzyme(s) was a thiol class proteinase(s). Crude Triton X-100 extracts were prepared from epidermal cells following labeling of proteins with 125 I. Autodegradation of labeled proteins at 37 degrees C was detected as early as 1 hr and reached a plateau level by 4 hr. Degradation was inhibited by thiol class proteinase inhibitors. Among the detergent-solubilized radiolabeled proteins a polypeptide chain of Mr 155,000 was particularly sensitive to degradation by endogenous thiol proteinase(s)

  13. Epidermal transglutaminase (TGase 3 is required for proper hair development, but not the formation of the epidermal barrier.

    Directory of Open Access Journals (Sweden)

    Susan John

    Full Text Available Transglutaminases (TGase, a family of cross-linking enzymes present in most cell types, are important in events as diverse as cell-signaling and matrix stabilization. Transglutaminase 1 is crucial in developing the epidermal barrier, however the skin also contains other family members, in particular TGase 3. This isoform is highly expressed in the cornified layer, where it is believed to stabilize the epidermis and its reduction is implicated in psoriasis. To understand the importance of TGase 3 in vivo we have generated and analyzed mice lacking this protein. Surprisingly, these animals display no obvious defect in skin development, no overt changes in barrier function or ability to heal wounds. In contrast, hair lacking TGase 3 is thinner, has major alterations in the cuticle cells and hair protein cross-linking is markedly decreased. Apparently, while TGase 3 is of unique functional importance in hair, in the epidermis loss of TGase 3 can be compensated for by other family members.

  14. Preservation of RNA and DNA from mammal samples under field conditions.

    Science.gov (United States)

    Camacho-Sanchez, Miguel; Burraco, Pablo; Gomez-Mestre, Ivan; Leonard, Jennifer A

    2013-07-01

    Ecological and conservation genetics require sampling of organisms in the wild. Appropriate preservation of the collected samples, usually by cryostorage, is key to the quality of the genetic data obtained. Nevertheless, cryopreservation in the field to ensure RNA and DNA stability is not always possible. We compared several nucleic acid preservation solutions appropriate for field sampling and tested them on rat (Rattus rattus) blood, ear and tail tip, liver, brain and muscle. We compared the efficacy of a nucleic acid preservation (NAP) buffer for DNA preservation against 95% ethanol and Longmire buffer, and for RNA preservation against RNAlater (Qiagen) and Longmire buffer, under simulated field conditions. For DNA, the NAP buffer was slightly better than cryopreservation or 95% ethanol, but high molecular weight DNA was preserved in all conditions. The NAP buffer preserved RNA as well as RNAlater. Liver yielded the best RNA and DNA quantity and quality; thus, liver should be the tissue preferentially collected from euthanized animals. We also show that DNA persists in nonpreserved muscle tissue for at least 1 week at ambient temperature, although degradation is noticeable in a matter of hours. When cryopreservation is not possible, the NAP buffer is an economical alternative for RNA preservation at ambient temperature for at least 2 months and DNA preservation for at least 10 months. © 2013 John Wiley & Sons Ltd.

  15. Improving small RNA-seq by using a synthetic spike-in set for size-range quality control together with a set for data normalization.

    Science.gov (United States)

    Locati, Mauro D; Terpstra, Inez; de Leeuw, Wim C; Kuzak, Mateusz; Rauwerda, Han; Ensink, Wim A; van Leeuwen, Selina; Nehrdich, Ulrike; Spaink, Herman P; Jonker, Martijs J; Breit, Timo M; Dekker, Rob J

    2015-08-18

    There is an increasing interest in complementing RNA-seq experiments with small-RNA (sRNA) expression data to obtain a comprehensive view of a transcriptome. Currently, two main experimental challenges concerning sRNA-seq exist: how to check the size distribution of isolated sRNAs, given the sensitive size-selection steps in the protocol; and how to normalize data between samples, given the low complexity of sRNA types. We here present two separate sets of synthetic RNA spike-ins for monitoring size-selection and for performing data normalization in sRNA-seq. The size-range quality control (SRQC) spike-in set, consisting of 11 oligoribonucleotides (10-70 nucleotides), was tested by intentionally altering the size-selection protocol and verified via several comparative experiments. We demonstrate that the SRQC set is useful to reproducibly track down biases in the size-selection in sRNA-seq. The external reference for data-normalization (ERDN) spike-in set, consisting of 19 oligoribonucleotides, was developed for sample-to-sample normalization in differential-expression analysis of sRNA-seq data. Testing and applying the ERDN set showed that it can reproducibly detect differential expression over a dynamic range of 2(18). Hence, biological variation in sRNA composition and content between samples is preserved while technical variation is effectively minimized. Together, both spike-in sets can significantly improve the technical reproducibility of sRNA-seq. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  16. Identification of SLURP-1 as an epidermal neuromodulator explains the clinical phenotype of Mal de Meleda

    DEFF Research Database (Denmark)

    Chimienti, Fabrice; Hogg, Ronald C; Plantard, Laure

    2003-01-01

    alpha 7 nicotinic acetylcholine receptors that are present in keratinocytes. These results identify SLURP-1 as a secreted epidermal neuromodulator which is likely to be essential for both epidermal homeostasis and inhibition of TNF-alpha release by macrophages during wound healing. This explains both...

  17. Interactions of donor sources and media influence the histo-morphological quality of full-thickness skin models.

    Science.gov (United States)

    Lange, Julia; Weil, Frederik; Riegler, Christoph; Groeber, Florian; Rebhan, Silke; Kurdyn, Szymon; Alb, Miriam; Kneitz, Hermann; Gelbrich, Götz; Walles, Heike; Mielke, Stephan

    2016-10-01

    Human artificial skin models are increasingly employed as non-animal test platforms for research and medical purposes. However, the overall histopathological quality of such models may vary significantly. Therefore, the effects of manufacturing protocols and donor sources on the quality of skin models built-up from fibroblasts and keratinocytes derived from juvenile foreskins is studied. Histo-morphological parameters such as epidermal thickness, number of epidermal cell layers, dermal thickness, dermo-epidermal adhesion and absence of cellular nuclei in the corneal layer are obtained and scored accordingly. In total, 144 full-thickness skin models derived from 16 different donors, built-up in triplicates using three different culture conditions were successfully generated. In univariate analysis both media and donor age affected the quality of skin models significantly. Both parameters remained statistically significant in multivariate analyses. Performing general linear model analyses we could show that individual medium-donor-interactions influence the quality. These observations suggest that the optimal choice of media may differ from donor to donor and coincides with findings where significant inter-individual variations of growth rates in keratinocytes and fibroblasts have been described. Thus, the consideration of individual medium-donor-interactions may improve the overall quality of human organ models thereby forming a reproducible test platform for sophisticated clinical research. Copyright © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. Essential function of linoleic acid esterified in acylglucosylceramide and acylceramide in maintaining the epidermal water permeability barrier. Evidence from feeding studies with oleate, linoleate, arachidonate, columbinate and a-linolenate

    DEFF Research Database (Denmark)

    Hansen, Harald S.; Jensen, B.

    1985-01-01

    sphingolipids. These rats showed increased evaporation which was comparable to that of essential fatty acid-deficient rats. We interpret these results as strong evidence for a very specific and essential function of linoleic acid in maintaining the integrity of the epidermal water permeability barrier......Essential fatty acid-deficient rats were supplemented with 300 mg per day of pure fatty acid esters: oleate (O), linoleate (L), arachidonate (A), and columbinate (C) for 10 days. During this period, the rats in groups L, A, and C all showed a decrease in their initially high trans-epidermal water...... loss, a classical essential fatty acid-deficiency symptom, to a level seen in non-deficient rats (group N). The trans-epidermal water loss in rats of group O was unaffected by the supplementation. Fatty acid composition of two epidermal sphingolipids, acylglucosylceramide and acylceramide, from...

  19. Site-Specific Covalent Conjugation of Modified mRNA by tRNA Guanine Transglycosylase.

    Science.gov (United States)

    Ehret, Fabian; Zhou, Cun Yu; Alexander, Seth C; Zhang, Dongyang; Devaraj, Neal K

    2018-03-05

    Modified mRNA (mod-mRNA) has recently been widely studied as the form of RNA useful for therapeutic applications due to its high stability and lowered immune response. Herein, we extend the scope of the recently established RNA-TAG (transglycosylation at guanosine) methodology, a novel approach for genetically encoded site-specific labeling of large mRNA transcripts, by employing mod-mRNA as substrate. As a proof of concept, we covalently attached a fluorescent probe to mCherry encoding mod-mRNA transcripts bearing 5-methylcytidine and/or pseudouridine substitutions with high labeling efficiencies. To provide a versatile labeling methodology with a wide range of possible applications, we employed a two-step strategy for functionalization of the mod-mRNA to highlight the therapeutic potential of this new methodology. We envision that this novel and facile labeling methodology of mod-RNA will have great potential in decorating both coding and noncoding therapeutic RNAs with a variety of diagnostic and functional moieties.

  20. Ultrathin epidermal strain sensor based on an elastomer nanosheet with an inkjet-printed conductive polymer

    Science.gov (United States)

    Tetsu, Yuma; Yamagishi, Kento; Kato, Akira; Matsumoto, Yuya; Tsukune, Mariko; Kobayashi, Yo; Fujie, Masakatsu G.; Takeoka, Shinji; Fujie, Toshinori

    2017-08-01

    To minimize the interference that skin-contact strain sensors cause natural skin deformation, physical conformability to the epidermal structure is critical. Here, we developed an ultrathin strain sensor made from poly(3,4-ethylenedioxythiophene):poly(styrene sulfonate) (PEDOT:PSS) inkjet-printed on a polystyrene-polybutadiene-polystyrene (SBS) nanosheet. The sensor, whose total thickness and gauge factor were ˜1 µm and 0.73 ± 0.10, respectively, deeply conformed to the epidermal structure and successfully detected the small skin strain (˜2%) while interfering minimally with the natural deformation of the skin. Such an epidermal strain sensor will open a new avenue for precisely detecting the motion of human skin and artificial soft-robotic skin.

  1. UVB radiation generates sunburn pain and affects skin by activating epidermal TRPV4 ion channels and triggering endothelin-1 signaling.

    Science.gov (United States)

    Moore, Carlene; Cevikbas, Ferda; Pasolli, H Amalia; Chen, Yong; Kong, Wei; Kempkes, Cordula; Parekh, Puja; Lee, Suk Hee; Kontchou, Nelly-Ange; Yeh, Iwei; Ye, Iwei; Jokerst, Nan Marie; Fuchs, Elaine; Steinhoff, Martin; Liedtke, Wolfgang B

    2013-08-20

    At our body surface, the epidermis absorbs UV radiation. UV overexposure leads to sunburn with tissue injury and pain. To understand how, we focus on TRPV4, a nonselective cation channel highly expressed in epithelial skin cells and known to function in sensory transduction, a property shared with other transient receptor potential channels. We show that following UVB exposure mice with induced Trpv4 deletions, specifically in keratinocytes, are less sensitive to noxious thermal and mechanical stimuli than control animals. Exploring the mechanism, we find that epidermal TRPV4 orchestrates UVB-evoked skin tissue damage and increased expression of the proalgesic/algogenic mediator endothelin-1. In culture, UVB causes a direct, TRPV4-dependent Ca(2+) response in keratinocytes. In mice, topical treatment with a TRPV4-selective inhibitor decreases UVB-evoked pain behavior, epidermal tissue damage, and endothelin-1 expression. In humans, sunburn enhances epidermal expression of TRPV4 and endothelin-1, underscoring the potential of keratinocyte-derived TRPV4 as a therapeutic target for UVB-induced sunburn, in particular pain.

  2. Pigmented epidermal cyst with dense collection of melanin: A rare entity - Report of a case with review of the literature.

    Science.gov (United States)

    Jayalakshmy, P S; Subitha, K; Priya, P V; Johnson, Gerald

    2012-05-01

    Epidermal cyst is a very common benign cystic lesion of the skin. It is usual to find ulceration of the lining epithelium, rupture of the cyst wall with chronic inflammation and foreign body giant cell reaction. But, it is very rare to see an epidermal cyst with marked accumulation of melanin pigment. Only a few cases of pigmented epidermal cyst with dense collection of melanin pigment have been published in the literature. Here, we are reporting a case of ruptured epidermal cyst with keratin granuloma formation and showing dense collection of melanin pigment.

  3. A Novel Microfluidic Device for Fully Automated Extraction of RNA from Cell Cultures, Phase II

    Data.gov (United States)

    National Aeronautics and Space Administration — Obtaining high quality, intact RNA from cells is an ubiquitous need in the pursuit of space biology. Our overall objective is to develop and commercialize a...

  4. Multistep change in epidermal growth factor receptors during spontaneous neoplastic progression in Chinese hamster embryo fibroblasts

    International Nuclear Information System (INIS)

    Wakshull, E.; Kraemer, P.M.; Wharton, W.

    1985-01-01

    Whole Chinese hamster embryo lineages have been shown to undergo multistep spontaneous neoplastic progression during serial passage in culture. The authors have studied the binding, internalization, and degradation of 125 I-labeled epidermal growth factor at four different stages of transformation. The whole Chinese hamster embryo cells lost cell surface epidermal growth factor receptors gradually during the course of neoplastic progression until only 10% of the receptor number present in the early-passage cells (precrisis) were retained in the late-passage cells (tumorigenic). No differences in internalization rates, chloroquine sensitivity, or ability to degrade hormone between the various passage levels were seen. No evidence for the presence in conditioned medium of transforming growth factors which might mask or down-regulate epidermal growth factor receptor was obtained. These results suggest that a reduction in cell surface epidermal growth factor receptor might be an early event during spontaneous transformation in whole Chinese hamster embryo cells

  5. High throughput sequencing of small RNA component of leaves and inflorescence revealed conserved and novel miRNAs as well as phasiRNA loci in chickpea.

    Science.gov (United States)

    Srivastava, Sangeeta; Zheng, Yun; Kudapa, Himabindu; Jagadeeswaran, Guru; Hivrale, Vandana; Varshney, Rajeev K; Sunkar, Ramanjulu

    2015-06-01

    Among legumes, chickpea (Cicer arietinum L.) is the second most important crop after soybean. MicroRNAs (miRNAs) play important roles by regulating target gene expression important for plant development and tolerance to stress conditions. Additionally, recently discovered phased siRNAs (phasiRNAs), a new class of small RNAs, are abundantly produced in legumes. Nevertheless, little is known about these regulatory molecules in chickpea. The small RNA population was sequenced from leaves and flowers of chickpea to identify conserved and novel miRNAs as well as phasiRNAs/phasiRNA loci. Bioinformatics analysis revealed 157 miRNA loci for the 96 highly conserved and known miRNA homologs belonging to 38 miRNA families in chickpea. Furthermore, 20 novel miRNAs belonging to 17 miRNA families were identified. Sequence analysis revealed approximately 60 phasiRNA loci. Potential target genes likely to be regulated by these miRNAs were predicted and some were confirmed by modified 5' RACE assay. Predicted targets are mostly transcription factors that might be important for developmental processes, and others include superoxide dismutases, plantacyanin, laccases and F-box proteins that could participate in stress responses and protein degradation. Overall, this study provides an inventory of miRNA-target gene interactions for chickpea, useful for the comparative analysis of small RNAs among legumes. Copyright © 2015 The Authors. Published by Elsevier Ireland Ltd.. All rights reserved.

  6. The early history of tRNA recognition by aminoacyl-tRNA synthetases

    Indian Academy of Sciences (India)

    Madhu

    2006-10-04

    Oct 4, 2006 ... Discovery of aminoacyl-tRNA synthetases and importance ... The pioneering work of Fritz Lipmann on the high-energy ... the peculiar structural and functional relationships tRNAs ... a bulk of only 20 families of tRNA molecules in contrast ...... balance of tRNA and aminoacyl-tRNA synthetase; Science 242.

  7. Scaffolding proteins in the development and maintenance of the epidermal permeability barrier.

    Science.gov (United States)

    Crawford, Melissa; Dagnino, Lina

    2017-10-02

    The skin of mammals and other terrestrial vertebrates protects the organism against the external environment, preventing heat, water and electrolyte loss, as well as entry of chemicals and pathogens. Impairments in the epidermal permeability barrier function are associated with the genesis and/or progression of a variety of pathological conditions, including genetic inflammatory diseases, microbial and viral infections, and photodamage induced by UV radiation. In mammals, the outside-in epidermal permeability barrier is provided by the joint action of the outermost cornified layer, together with assembled tight junctions in granular keratinocytes found in the layers underneath. Tight junctions serve as both outside-in and inside-out barriers, and impede paracellular movements of ions, water, macromolecules and microorganisms. At the molecular level, tight junctions consist of integral membrane proteins that form an extracellular seal between adjacent cells, and associate with cytoplasmic scaffold proteins that serve as links with the actin cytoskeleton. In this review, we address the roles that scaffold proteins play specifically in the establishment and maintenance of the epidermal permeability barrier, and how various pathologies alter or impair their functions.

  8. Nicotinic acid receptor abnormalities in human skin cancer: implications for a role in epidermal differentiation.

    Directory of Open Access Journals (Sweden)

    Yira Bermudez

    Full Text Available Chronic UV skin exposure leads to epidermal differentiation defects in humans that can be largely restored by pharmacological doses of nicotinic acid. Nicotinic acid has been identified as a ligand for the human G-protein-coupled receptors GPR109A and GPR109B that signal through G(i-mediated inhibition of adenylyl cyclase. We have examined the expression, cellular distribution, and functionality of GPR109A/B in human skin and skin derived epidermal cells.Nicotinic acid increases epidermal differentiation in photodamaged human skin as judged by the terminal differentiation markers caspase 14 and filaggrin. Both GPR109A and GPR109B genes are transcribed in human skin and in epidermal keratinocytes, but expression in dermal fibroblasts is below limits of detection. Receptor transcripts are greatly over-expressed in squamous cell cancers. Receptor protein in normal skin is prominent from the basal through granular layers of the epidermis, with cellular localization more dispersive in the basal layer but predominantly localized at the plasma membrane in more differentiated epidermal layers. In normal human primary and immortalized keratinocytes, nicotinic acid receptors show plasma membrane localization and functional G(i-mediated signaling. In contrast, in a squamous cell carcinoma derived cell line, receptor protein shows a more diffuse cellular localization and the receptors are nearly non-functional.The results of these studies justify future genetic and pharmacological intervention studies to define possible specific role(s of nicotinic acid receptors in human skin homeostasis.

  9. Assessing the in vivo impact of a gel sanitizer on the epidermal "barrier" dynamics

    OpenAIRE

    Henrique Silva; Sara Aguiar Silva; Hugo Ferreira; L. Monteiro Rodrigues

    2015-01-01

    Disease prevention and control depend on hand washing, in particular during epidemic surges (e.g. flu). The use of alcohol-based hand sanitizers is strongly recommended due to its high germicide effectiveness. However, its impact on skin physiology, especially on the barrier function, has not been determined, although most of the formulations include different humectants. This study evaluates the impact of a commercially available formulation on in vivo epidermal barrier dynamics. 13 young ad...

  10. High-Resolution Analysis of Coronavirus Gene Expression by RNA Sequencing and Ribosome Profiling.

    Science.gov (United States)

    Irigoyen, Nerea; Firth, Andrew E; Jones, Joshua D; Chung, Betty Y-W; Siddell, Stuart G; Brierley, Ian

    2016-02-01

    Members of the family Coronaviridae have the largest genomes of all RNA viruses, typically in the region of 30 kilobases. Several coronaviruses, such as Severe acute respiratory syndrome-related coronavirus (SARS-CoV) and Middle East respiratory syndrome-related coronavirus (MERS-CoV), are of medical importance, with high mortality rates and, in the case of SARS-CoV, significant pandemic potential. Other coronaviruses, such as Porcine epidemic diarrhea virus and Avian coronavirus, are important livestock pathogens. Ribosome profiling is a technique which exploits the capacity of the translating ribosome to protect around 30 nucleotides of mRNA from ribonuclease digestion. Ribosome-protected mRNA fragments are purified, subjected to deep sequencing and mapped back to the transcriptome to give a global "snap-shot" of translation. Parallel RNA sequencing allows normalization by transcript abundance. Here we apply ribosome profiling to cells infected with Murine coronavirus, mouse hepatitis virus, strain A59 (MHV-A59), a model coronavirus in the same genus as SARS-CoV and MERS-CoV. The data obtained allowed us to study the kinetics of virus transcription and translation with exquisite precision. We studied the timecourse of positive and negative-sense genomic and subgenomic viral RNA production and the relative translation efficiencies of the different virus ORFs. Virus mRNAs were not found to be translated more efficiently than host mRNAs; rather, virus translation dominates host translation at later time points due to high levels of virus transcripts. Triplet phasing of the profiling data allowed precise determination of translated reading frames and revealed several translated short open reading frames upstream of, or embedded within, known virus protein-coding regions. Ribosome pause sites were identified in the virus replicase polyprotein pp1a ORF and investigated experimentally. Contrary to expectations, ribosomes were not found to pause at the ribosomal

  11. High-Resolution Analysis of Coronavirus Gene Expression by RNA Sequencing and Ribosome Profiling.

    Directory of Open Access Journals (Sweden)

    Nerea Irigoyen

    2016-02-01

    Full Text Available Members of the family Coronaviridae have the largest genomes of all RNA viruses, typically in the region of 30 kilobases. Several coronaviruses, such as Severe acute respiratory syndrome-related coronavirus (SARS-CoV and Middle East respiratory syndrome-related coronavirus (MERS-CoV, are of medical importance, with high mortality rates and, in the case of SARS-CoV, significant pandemic potential. Other coronaviruses, such as Porcine epidemic diarrhea virus and Avian coronavirus, are important livestock pathogens. Ribosome profiling is a technique which exploits the capacity of the translating ribosome to protect around 30 nucleotides of mRNA from ribonuclease digestion. Ribosome-protected mRNA fragments are purified, subjected to deep sequencing and mapped back to the transcriptome to give a global "snap-shot" of translation. Parallel RNA sequencing allows normalization by transcript abundance. Here we apply ribosome profiling to cells infected with Murine coronavirus, mouse hepatitis virus, strain A59 (MHV-A59, a model coronavirus in the same genus as SARS-CoV and MERS-CoV. The data obtained allowed us to study the kinetics of virus transcription and translation with exquisite precision. We studied the timecourse of positive and negative-sense genomic and subgenomic viral RNA production and the relative translation efficiencies of the different virus ORFs. Virus mRNAs were not found to be translated more efficiently than host mRNAs; rather, virus translation dominates host translation at later time points due to high levels of virus transcripts. Triplet phasing of the profiling data allowed precise determination of translated reading frames and revealed several translated short open reading frames upstream of, or embedded within, known virus protein-coding regions. Ribosome pause sites were identified in the virus replicase polyprotein pp1a ORF and investigated experimentally. Contrary to expectations, ribosomes were not found to pause at the

  12. Epidermal growth factor receptor in primary human lung cancer

    International Nuclear Information System (INIS)

    Yu Xueyan; Hu Guoqiang; Tian Keli; Wang Mingyun

    1996-01-01

    Cell membranes were prepared from 12 human lung cancers for the study of the expression of epidermal growth factor receptors (EGFR). EGFR concentration was estimated by ligand binding studies using 125 I-radiolabeled EGF. The dissociation constants of the high affinity sites were identical, 1.48 nmol and 1.1 nmol in cancer and normal lung tissues, the EGFR contents were higher in lung cancer tissues (range: 2.25 to 19.39 pmol·g -1 membrane protein) than that in normal tissues from the same patients (range: 0.72 to 7.43 pmol·g -1 membrane protein). These results suggest that EGF and its receptor may play a role in the regulatory mechanisms in the control of lung cellular growth and tumor promotion

  13. Studies of interactions of porphyrins with transfer RNA by high-resolution NMR

    International Nuclear Information System (INIS)

    Birdsall, W.J.; Lehigh Univ., Bethlehem, PA; Anderson, W.R. Jr; Foster, N.

    1989-01-01

    The interactions of tetra-4N-methulpyridyl porphyrin and its zinc (II), copper (II) and manganese (III) complexes with brewer's yeast type V phenylalanine specific tRNA have been evaluated by high-resolution NMR. Differences in chemical shifts have been noted for thre proton resonances in response to the presence of small quantities of the fre base and the zinc and copper complexes. The protons giving rise to these signals are located on bases T54 and psi55, both of which are involved in the primary intraloop and interloop hydroen bonds that hold the D and TpsiC loops together in the tertiary structure. In addition, broadening of specific resonances due to hydrogen bonding protons in the D stem at low ratios of porphyrin to tRNA indicates that the association of porphyrins increases the rate of imino proton exchange. The titration of the tRNA with the manganese (III) complex did not eveal shifts or spcific broadening comparable to the other porpyrins at low ratios. The changes induced in the NMR spectrum of tNA by porphyrins define their site of interaction with the polynucleotide. This site, at the outside of the elbow-bend in the tRNA 'L', is different from the locus of binding in tRNA for other classical DNA intercalators. Furthermore, a new mode of binding may be involved that is neither intercalative nor simply electrostatic. (author). 36 refs.; 4 figs

  14. Niclosamide inhibits epithelial-mesenchymal transition and tumor growth in lapatinib-resistant human epidermal growth factor receptor 2-positive breast cancer.

    Science.gov (United States)

    Liu, Junjun; Chen, Xiaosong; Ward, Toby; Mao, Yan; Bockhorn, Jessica; Liu, Xiaofei; Wang, Gen; Pegram, Mark; Shen, Kunwei

    2016-02-01

    Acquired resistance to lapatinib, a human epidermal growth factor receptor 2 kinase inhibitor, remains a clinical problem for women with human epidermal growth factor receptor 2-positive advanced breast cancer, as metastasis is commonly observed in these patients. Niclosamide, an anti-helminthic agent, has recently been shown to exhibit cytotoxicity to tumor cells with stem-like characteristics. This study was designed to identify the mechanisms underlying lapatinib resistance and to determine whether niclosamide inhibits lapatinib resistance by reversing epithelial-mesenchymal transition. Here, two human epidermal growth factor receptor 2-positive breast cancer cell lines, SKBR3 and BT474, were exposed to increasing concentrations of lapatinib to establish lapatinib-resistant cultures. Lapatinib-resistant SKBR3 and BT474 cells exhibited up-regulation of the phenotypic epithelial-mesenchymal transition markers Snail, vimentin and α-smooth muscle actin, accompanied by activation of nuclear factor-кB and Src and a concomitant increase in stem cell marker expression (CD44(high)/CD24(low)), compared to naive lapatinib-sensitive SKBR3 and BT474 cells, respectively. Interestingly, niclosamide reversed epithelial-mesenchymal transition, induced apoptosis and inhibited cell growth by perturbing aberrant signaling pathway activation in lapatinib-resistant human epidermal growth factor receptor 2-positive cells. The ability of niclosamide to alleviate stem-like phenotype development and invasion was confirmed. Collectively, our results demonstrate that lapatinib resistance correlates with epithelial-mesenchymal transition and that niclosamide inhibits lapatinib-resistant cell viability and epithelial-mesenchymal transition. These findings suggest a role of niclosamide or derivatives optimized for more favorable bioavailability not only in reversing lapatinib resistance but also in reducing metastatic potential during the treatment of human epidermal growth factor receptor

  15. Radiologic Findings of Epidermal Cysts in the Trunk

    International Nuclear Information System (INIS)

    Kim, Myung Hyun; Chung, Jae Joon; Park, Kyoung Seuk; Park, Su Mi

    2005-01-01

    To evaluate the ultrasonographic (US) or computer tomography (CT) findings of surgically proven epidermal cysts in the trunk, and to compare the echogenicity of cysts with internal contents. Forty-five patients were retrospectively evaluated. US and CT findings of epidermal cysts were assessed in regard to location, size, shape, number, echogenicity, posterior sound enhancement, internal density, septa, mural nodule and calcification, perilesional infiltration, contrast enhancement, and internal contents. All 45 patients (M:F=29:16; US in 26, CT in 19) had only one cyst, and they were located in the buttocks (n=19), back (n=13), inguinal (n=4), posterior neck (n=3), perineum (n=2), abdominal wall (n=2), presternal (n=1), and axilla (n=1). Of 26 patients who underwent US, there were 8 cases of homogeneously hypoechoic mass (30.8%), 8 of inhomogeneously hypoechoic mass (30.8%), 7 of homogeneously hypoechoic mass with internal hypoechoic lines and echogenic spots (26.9%) and 3 of homogeneously hypoechoic mass with internal echogenic spots (11.5%). Posterior sound enhancement was noted in 21 patients (80.8%). Of 19 patients who underwent CT, there were 14 cases of simple cyst (73.7%) and 5 of abscess-like lesion (26.3%). Overlying skin thickening (n=13), contrast enhancement of cystic wall (n=11), perilesional infiltration (n=7), and internal septa (n=6) were demonstrated. The internal contents of the cysts were keratinous (n=27, 60.0%) or greasy (n=15, 33.3%) material. There was no statistical significance between the echogenicity of the cysts and the internal contents (p > 0.2). Epidermal cysts showed homogeneous or inhomogeneous hypoechoic mass with posterior sound enhancement on US. There was no relationship between the echogenicity of the cysts and the internal contents. In the case of ruptured cyst, an abscess-like lesion with wall enhancement and perilesional infiltration was noted on CT scan

  16. Identification of grazed grasses using epidermal characters | R ...

    African Journals Online (AJOL)

    The use of anatomical features of the abaxial epidermis of grasses is discussed for the identification of fragments of epidermis present in samples of rumen. The reliability of this technique, and the variation of the epidermal characters in two widely distributed species of grass, is given. A "Key" to identity certain genera of ...

  17. CoLIde: A bioinformatics tool for CO-expression based small RNA Loci Identification using high-throughput sequencing data

    OpenAIRE

    Mohorianu, Irina; Stocks, Matthew Benedict; Wood, John; Dalmay, Tamas; Moulton, Vincent

    2013-01-01

    Small RNAs (sRNAs) are 20–25 nt non-coding RNAs that act as guides for the highly sequence-specific regulatory mechanism known as RNA silencing. Due to the recent increase in sequencing depth, a highly complex and diverse population of sRNAs in both plants and animals has been revealed. However, the exponential increase in sequencing data has also made the identification of individual sRNA transcripts corresponding to biological units (sRNA loci) more challenging when based exclusively on the...

  18. Exudative epidermitis in pigs caused by toxigenic Staphylococcus chromogenes.

    Science.gov (United States)

    Andresen, Lars Ole; Ahrens, Peter; Daugaard, Lise; Bille-Hansen, Vivi

    2005-02-25

    Staphylococcus chromogenes is closely related to Staphylococcus hyicus, which is recognised as the causative agent of exudative epidermitis (EE) in pigs. S. chromogenes is part of the normal skin flora of pigs, cattle and poultry and has so far been considered non-pathogenic to pigs. A strain of S. chromogenes producing exfoliative toxin type B, ExhB, was identified by the use of a multiplex PCR specific for the exfoliative toxins from S. hyicus. The exfoliative toxin from S. chromogenes reacted in immunoblot analysis with polyclonal and monoclonal antibodies specific to ExhB from S. hyicus and had an apparent molecular weight of 30 kDa. Sequencing the gene encoding the exfoliative toxin from S. chromogenes revealed that the molecular weight of the toxin with the signal peptide and the mature toxin was 30,553 and 26,694 Da, respectively. Comparison of the exhB genes from S. chromogenes strain VA654 and S. hyicus strain 1289D-88 showed differences in seven base pairs of the DNA sequences and in two amino acid residues in the deduced amino acid sequences. Pigs were experimentally inoculated with S. chromogenes strain VA654. By clinical observations and histopathological evaluation of the skin alterations, all pigs revealed development of generalized exudative epidermitis. No toxin producing S. hyicus was isolated from the pigs and all ExhB-positive bacterial isolates were identified as S. chromogenes. This confirmed that the disease-causing agent was the inoculated S. chromogenes strain VA654. The results of this study show that S. chromogenes may cause exudative epidermitis in pigs.

  19. Epidermolytic hyperkeratosis in inflammatory linear verrucous epidermal nevus

    Directory of Open Access Journals (Sweden)

    Naser Tayyebi Meibodi

    2011-01-01

    Full Text Available Epidermolytic hyperkeratosis presents with perinuclear vacuolization of the keratinocytes in spinous and granular layers, keratinocytes with ill-defined limits, which leads to a reticulate appearance of the epidermis, an increased number of variously shaped and sized basophilic keratohyalin granules and the same sized eosinophilic trichohyalin granules, at any level of epidermis, mainly in the stratum granulosum, and compact hyperkeratosis. This minor reactive pathologic reaction pattern of skin is found in large variety of diseases. This paper is the first case report of such pattern in inflammatory linear verrucous epidermal nevus. Our case is of a 23-year-old man with pruritic verrucous lesions of trunk and extremities initiated since 13 years ago. Physical examination revealed white linear hyperkeratotic lesions, some of them on erythematous background and also classic epidermal nevus. No skeletal, ophthalmic, and nervous system involvement was detected. Microscopic study of pruritic verrucous lesions showed psoriasiform acanthosis, mild papillomatous, hyperkeratosis, and epidermolytic hyperkeratotic changes in hair follicles and acrosyrinx accompanied with moderate perivascular inflammation.

  20. Growth of melanocytes in human epidermal cell cultures

    International Nuclear Information System (INIS)

    Staiano-Coico, L.; Hefton, J.M.; Amadeo, C.; Pagan-Charry, I.; Madden, M.R.; Cardon-Cardo, C.

    1990-01-01

    Epidermal cell cultures were grown in keratinocyte-conditioned medium for use as burn wound grafts; the melanocyte composition of the grafts was studied under a variety of conditions. Melanocytes were identified by immunohistochemistry based on a monoclonal antibody (MEL-5) that has previously been shown to react specifically with melanocytes. During the first 7 days of growth in primary culture, the total number of melanocytes in the epidermal cultures decreased to 10% of the number present in normal skin. Beginning on day 2 of culture, bipolar melanocytes were present at a mean cell density of 116 +/- 2/mm2; the keratinocyte to melanocyte ratio was preserved during further primary culture and through three subpassages. Moreover, exposure of cultures to mild UVB irradiation stimulated the melanocytes to proliferate, suggesting that the melanocytes growing in culture maintained their responsiveness to external stimuli. When the sheets of cultured cells were enzymatically detached from the plastic culture flasks before grafting, melanocytes remained in the basal layer of cells as part of the graft applied to the patient

  1. Working with RNA

    DEFF Research Database (Denmark)

    Nielsen, Henrik

    2011-01-01

    Working with RNA is not a special discipline in molecular biology. However, RNA is chemically and structurally different from DNA and a few simple work rules have to be implemented to maintain the integrity of the RNA. Alkaline pH, high temperatures, and heavy metal ions should be avoided when po...

  2. Irradiation of protoporphyric mice induces down-regulation of epidermal eicosanoid metabolism

    International Nuclear Information System (INIS)

    He, D.; Lim, H.W.

    1991-01-01

    This study investigated the effect of radiation on clinical and histologic changes, and on cutaneous eicosanoid metabolism, in Skh:HR-1 hairless albino mice rendered protoporphyric by the administration of collidine. At 0.1-18 h after exposure to 12 kJ/m2 of 396-406 nm irradiation, thicknesses of back skin and ears were measured, and histologic changes were evaluated by using hematoxylin and eosin (H-E) and Giemsa's stains. Activities of eicosanoid-metabolizing enzymes in epidermal and dermal homogenates were assessed by incubating the tissue homogenates with 3H-AA, followed by quantitation of the eicosanoids generated by radio-TLC. In irradiated protoporphyric mice, an increase of back-skin thickness was noted at 0.1 h, reaching a peak at 18 h, whereas maximal increase in ear thickness was observed at 12 h. Histologic changes included dermal edema, increased mast cell degranulation, and mononuclear cells in the dermis. In these irradiated protoporphyric animals, generations of 6 keto-PGF1a, PGF2a, PGE2, PGD2, and HETE by epidermal eicosanoid-metabolizing enzymes were markedly suppressed at all the timepoints studied. Dermal eicosanoid-metabolizing enzymes of irradiated protoporphyric mice generated increased amounts of PGE2 and HETE at 18 h, probably reflecting the presence of dermal cellular infiltrates. The suppression of the activities of epidermal eicosanoid-metabolizing enzymes was prevented by intraperitoneal injection of WR-2721, a sulfhydryl group generator, prior to irradiation, suggesting that the suppression was secondary to photo-oxidative damage of the enzymes during the in vivo phototoxic response. These results suggest that the effect of protoporphyrin and radiation on cutaneous eicosanoid metabolism in this animal model in vivo is that of a down regulation of the activities of epidermal eicosanoid-metabolizing enzymes

  3. High-Throughput Mapping of Single-Neuron Projections by Sequencing of Barcoded RNA.

    Science.gov (United States)

    Kebschull, Justus M; Garcia da Silva, Pedro; Reid, Ashlan P; Peikon, Ian D; Albeanu, Dinu F; Zador, Anthony M

    2016-09-07

    Neurons transmit information to distant brain regions via long-range axonal projections. In the mouse, area-to-area connections have only been systematically mapped using bulk labeling techniques, which obscure the diverse projections of intermingled single neurons. Here we describe MAPseq (Multiplexed Analysis of Projections by Sequencing), a technique that can map the projections of thousands or even millions of single neurons by labeling large sets of neurons with random RNA sequences ("barcodes"). Axons are filled with barcode mRNA, each putative projection area is dissected, and the barcode mRNA is extracted and sequenced. Applying MAPseq to the locus coeruleus (LC), we find that individual LC neurons have preferred cortical targets. By recasting neuroanatomy, which is traditionally viewed as a problem of microscopy, as a problem of sequencing, MAPseq harnesses advances in sequencing technology to permit high-throughput interrogation of brain circuits. Copyright © 2016 Elsevier Inc. All rights reserved.

  4. External Quality Assessment for the Detection of Measles Virus by Reverse Transcription-PCR Using Armored RNA.

    Directory of Open Access Journals (Sweden)

    Dong Zhang

    Full Text Available In recent years, nucleic acid tests for detection of measles virus RNA have been widely applied in laboratories belonging to the measles surveillance system of China. An external quality assessment program was established by the National Center for Clinical Laboratories to evaluate the performance of nucleic acid tests for measles virus. The external quality assessment panel, which consisted of 10 specimens, was prepared using armored RNAs, complex of noninfectious MS2 bacteriophage coat proteins encapsulated RNA of measles virus, as measles virus surrogate controls. Conserved sequences amplified from a circulating measles virus strain or from a vaccine strain were encapsulated into these armored RNAs. Forty-one participating laboratories from 15 provinces, municipalities, or autonomous regions that currently conduct molecular detection of measles virus enrolled in the external quality assessment program, including 40 measles surveillance system laboratories and one diagnostic reagent manufacturer. Forty laboratories used commercial reverse transcription-quantitative PCR kits, with only one laboratory applying a conventional PCR method developed in-house. The results indicated that most of the participants (38/41, 92.7% were able to accurately detect the panel with 100% sensitivity and 100% specificity. Although a wide range of commercially available kits for nucleic acid extraction and reverse transcription polymerase chain reaction were used by the participants, only two false-negative results and one false-positive result were generated; these were generated by three separate laboratories. Both false-negative results were obtained with tests performed on specimens with the lowest concentration (1.2 × 104 genomic equivalents/mL. In addition, all 18 participants from Beijing achieved 100% sensitivity and 100% specificity. Overall, we conclude that the majority of the laboratories evaluated have reliable diagnostic capacities for the detection

  5. Protocol: high throughput silica-based purification of RNA from Arabidopsis seedlings in a 96-well format

    OpenAIRE

    Salvo-Chirnside, Eliane; Kane, Steven; Kerr, Lorraine E

    2011-01-01

    Abstract The increasing popularity of systems-based approaches to plant research has resulted in a demand for high throughput (HTP) methods to be developed. RNA extraction from multiple samples in an experiment is a significant bottleneck in performing systems-level genomic studies. Therefore we have established a high throughput method of RNA extraction from Arabidopsis thaliana to facilitate gene expression studies in this widely used plant model. We present optimised manual and automated p...

  6. Epidermal Growth Factor Receptor in Pancreatic Cancer

    International Nuclear Information System (INIS)

    Oliveira-Cunha, Melissa; Newman, William G.; Siriwardena, Ajith K.

    2011-01-01

    Pancreatic cancer is the fourth leading cause of cancer related death. The difficulty in detecting pancreatic cancer at an early stage, aggressiveness and the lack of effective therapy all contribute to the high mortality. Epidermal growth factor receptor (EGFR) is a transmembrane glycoprotein, which is expressed in normal human tissues. It is a member of the tyrosine kinase family of growth factors receptors and is encoded by proto-oncogenes. Several studies have demonstrated that EGFR is over-expressed in pancreatic cancer. Over-expression correlates with more advanced disease, poor survival and the presence of metastases. Therefore, inhibition of the EGFR signaling pathway is an attractive therapeutic target. Although several combinations of EGFR inhibitors with chemotherapy demonstrate inhibition of tumor-induced angiogenesis, tumor cell apoptosis and regression in xenograft models, these benefits remain to be confirmed. Multimodality treatment incorporating EGFR-inhibition is emerging as a novel strategy in the treatment of pancreatic cancer

  7. Accelerated probabilistic inference of RNA structure evolution

    Directory of Open Access Journals (Sweden)

    Holmes Ian

    2005-03-01

    Full Text Available Abstract Background Pairwise stochastic context-free grammars (Pair SCFGs are powerful tools for evolutionary analysis of RNA, including simultaneous RNA sequence alignment and secondary structure prediction, but the associated algorithms are intensive in both CPU and memory usage. The same problem is faced by other RNA alignment-and-folding algorithms based on Sankoff's 1985 algorithm. It is therefore desirable to constrain such algorithms, by pre-processing the sequences and using this first pass to limit the range of structures and/or alignments that can be considered. Results We demonstrate how flexible classes of constraint can be imposed, greatly reducing the computational costs while maintaining a high quality of structural homology prediction. Any score-attributed context-free grammar (e.g. energy-based scoring schemes, or conditionally normalized Pair SCFGs is amenable to this treatment. It is now possible to combine independent structural and alignment constraints of unprecedented general flexibility in Pair SCFG alignment algorithms. We outline several applications to the bioinformatics of RNA sequence and structure, including Waterman-Eggert N-best alignments and progressive multiple alignment. We evaluate the performance of the algorithm on test examples from the RFAM database. Conclusion A program, Stemloc, that implements these algorithms for efficient RNA sequence alignment and structure prediction is available under the GNU General Public License.

  8. Epidermal growth factor and active caspase-3 expression in the levator ani muscle of dogs with and without perineal hernia.

    Science.gov (United States)

    Pérez-Gutiérrez, J F; Argüelles, J C; Iglesias-Núñez, M; Oliveira, K S; De La Muela, M Sánchez

    2011-07-01

    To perform a histological and immunohistochemical study of epidermal growth factor, transforming growth factor-alpha and their receptor, as well as the apoptotic signal active caspase-3 in the levator ani muscle of dogs with and without perineal hernia. Biopsy specimens of the levator ani muscle were obtained from 25 dogs with perineal hernia and 4 non-affected dogs and were processed for Masson and immunohistochemical staining. The affected dogs exhibited myopathological features, internalised nuclei, destruction and abnormal size of muscle fibres, which were replaced by collagen. The immunohistochemical study revealed active caspase-3, epidermal growth factor, transforming growth factor-alpha and epidermal growth factor receptor in the levator ani. Compared to the healthy muscle, transforming growth factor-alpha staining intensity was lower in the affected muscle, whereas epidermal growth factor receptor and active caspase-3 staining were higher. Pelvic diaphragm muscle weakening is the leading cause of perineal hernia in the dog. Survival and death signals expressed in these muscles may contribute to the pathogenesis of this disease. This study reports epidermal growth factor, transforming growth factor-alpha and epidermal growth factor receptor immunohistochemical expression in the skeletal muscle and suggests that perineal hernia in the dog is accompanied by levator ani muscle atrophy, increased expression of epidermal growth factor receptor, caspase-3 activation, and decreased expression of transforming growth factor-alpha. © 2011 British Small Animal Veterinary Association.

  9. Immunological quality and performance of tumor vessel-targeting CAR-T cells prepared by mRNA-EP for clinical research.

    Science.gov (United States)

    Inoo, Kanako; Inagaki, Ryo; Fujiwara, Kento; Sasawatari, Shigemi; Kamigaki, Takashi; Nakagawa, Shinsaku; Okada, Naoki

    2016-01-01

    We previously reported that tumor vessel-redirected T cells, which were genetically engineered with chimeric antigen receptor (CAR) specific for vascular endothelial growth factor receptor 2 (VEGFR2), demonstrated significant antitumor effects in various murine solid tumor models. In the present study, we prepared anti-VEGFR2 CAR-T cells by CAR-coding mRNA electroporation (mRNA-EP) and analyzed their immunological characteristics and functions for use in clinical research. The expression of anti-VEGFR2 CAR on murine and human T cells was detected with approximately 100% efficiency for a few days, after peaking 6-12 hours after mRNA-EP. Triple transfer of murine anti-VEGFR2 CAR-T cells into B16BL6 tumor-bearing mice demonstrated an antitumor effect comparable to that for the single transfer of CAR-T cells engineered with retroviral vector. The mRNA-EP did not cause any damage or defects to human T-cell characteristics, as determined by viability, growth, and phenotypic parameters. Additionally, two kinds of human anti-VEGFR2 CAR-T cells, which expressed different CAR construction, differentiated to effector phase with cytokine secretion and cytotoxic activity in antigen-specific manner. These results indicate that our anti-VEGFR2 CAR-T cells prepared by mRNA-EP have the potential in terms of quality and performance to offer the prospect of safety and efficacy in clinical research as cellular medicine.

  10. Immunological quality and performance of tumor vessel-targeting CAR-T cells prepared by mRNA-EP for clinical research

    Directory of Open Access Journals (Sweden)

    Kanako Inoo

    2016-01-01

    Full Text Available We previously reported that tumor vessel-redirected T cells, which were genetically engineered with chimeric antigen receptor (CAR specific for vascular endothelial growth factor receptor 2 (VEGFR2, demonstrated significant antitumor effects in various murine solid tumor models. In the present study, we prepared anti-VEGFR2 CAR-T cells by CAR-coding mRNA electroporation (mRNA-EP and analyzed their immunological characteristics and functions for use in clinical research. The expression of anti-VEGFR2 CAR on murine and human T cells was detected with approximately 100% efficiency for a few days, after peaking 6–12 hours after mRNA-EP. Triple transfer of murine anti-VEGFR2 CAR-T cells into B16BL6 tumor-bearing mice demonstrated an antitumor effect comparable to that for the single transfer of CAR-T cells engineered with retroviral vector. The mRNA-EP did not cause any damage or defects to human T-cell characteristics, as determined by viability, growth, and phenotypic parameters. Additionally, two kinds of human anti-VEGFR2 CAR-T cells, which expressed different CAR construction, differentiated to effector phase with cytokine secretion and cytotoxic activity in antigen-specific manner. These results indicate that our anti-VEGFR2 CAR-T cells prepared by mRNA-EP have the potential in terms of quality and performance to offer the prospect of safety and efficacy in clinical research as cellular medicine.

  11. Morphometric analysis of epidermal differentiation in primary roots of Zea mays

    Science.gov (United States)

    Moore, R.; Smith, H. S.

    1990-01-01

    Epidermal differentiation in primary roots of Zea mays was divided into six cell types based on cellular shape and cytoplasmic appearance. These six cell types are: 1) apical protoderm, located at the tip of the root pole and characterized by periclinally flattened cells; 2) cuboidal protoderm, located approximately 230 microns from the root pole and characterized by cuboidal cells; 3) tabular epidermis, located approximately 450 microns from the root pole and characterized by anticlinally flattened cells; 4) cuboidal epidermis, located approximately 900 microns from the root pole and characterized by cuboidal cells having numerous small vacuoles; 5) vacuolate cuboidal epidermis, located approximately 1,500 microns from the root pole and characterized by cuboidal cells containing several large vacuoles; and 6) columnar epidermis, located approximately 2,200 microns from the root pole (i.e., at the beginning of the zone of elongation) and characterized by elongated cells. We also used stereology to quantify the cellular changes associated with epidermal differentiation. The quiescent center and the apical protoderm have significantly different ultrastructures. The relative volume of dictyosomes increases dramatically during the early stages of epidermal differentiation. This increase correlates inversely with the amount of coverage provided by the root cap and mucilage.

  12. Identification and comparative analysis of the epidermal differentiation complex in snakes

    Science.gov (United States)

    Brigit Holthaus, Karin; Mlitz, Veronika; Strasser, Bettina; Tschachler, Erwin; Alibardi, Lorenzo; Eckhart, Leopold

    2017-01-01

    The epidermis of snakes efficiently protects against dehydration and mechanical stress. However, only few proteins of the epidermal barrier to the environment have so far been identified in snakes. Here, we determined the organization of the Epidermal Differentiation Complex (EDC), a cluster of genes encoding protein constituents of cornified epidermal structures, in snakes and compared it to the EDCs of other squamates and non-squamate reptiles. The EDC of snakes displays shared synteny with that of the green anole lizard, including the presence of a cluster of corneous beta-protein (CBP)/beta-keratin genes. We found that a unique CBP comprising 4 putative beta-sheets and multiple cysteine-rich EDC proteins are conserved in all snakes and other squamates investigated. Comparative genomics of squamates suggests that the evolution of snakes was associated with a gene duplication generating two isoforms of the S100 fused-type protein, scaffoldin, the origin of distinct snake-specific EDC genes, and the loss of other genes that were present in the EDC of the last common ancestor of snakes and lizards. Taken together, our results provide new insights into the evolution of the skin in squamates and a basis for the characterization of the molecular composition of the epidermis in snakes. PMID:28345630

  13. Fragment-based modelling of single stranded RNA bound to RNA recognition motif containing proteins

    Science.gov (United States)

    de Beauchene, Isaure Chauvot; de Vries, Sjoerd J.; Zacharias, Martin

    2016-01-01

    Abstract Protein-RNA complexes are important for many biological processes. However, structural modeling of such complexes is hampered by the high flexibility of RNA. Particularly challenging is the docking of single-stranded RNA (ssRNA). We have developed a fragment-based approach to model the structure of ssRNA bound to a protein, based on only the protein structure, the RNA sequence and conserved contacts. The conformational diversity of each RNA fragment is sampled by an exhaustive library of trinucleotides extracted from all known experimental protein–RNA complexes. The method was applied to ssRNA with up to 12 nucleotides which bind to dimers of the RNA recognition motifs (RRMs), a highly abundant eukaryotic RNA-binding domain. The fragment based docking allows a precise de novo atomic modeling of protein-bound ssRNA chains. On a benchmark of seven experimental ssRNA–RRM complexes, near-native models (with a mean heavy-atom deviation of <3 Å from experiment) were generated for six out of seven bound RNA chains, and even more precise models (deviation < 2 Å) were obtained for five out of seven cases, a significant improvement compared to the state of the art. The method is not restricted to RRMs but was also successfully applied to Pumilio RNA binding proteins. PMID:27131381

  14. Hollow silicon microneedle array based trans-epidermal antiemetic patch for efficient management of chemotherapy induced nausea and vomiting

    Science.gov (United States)

    Kharbikar, Bhushan N.; Kumar S., Harish; Kr., Sindhu; Srivastava, Rohit

    2015-12-01

    Chemotherapy Induced Nausea and Vomiting (CINV) is a serious health concern in the treatment of cancer patients. Conventional routes for administering anti-emetics (i.e. oral and parenteral) have several drawbacks such as painful injections, poor patient compliance, dependence on skilled personnel, non-affordability to majority of population (parenteral), lack of programmability and suboptimal bioavailability (oral). Hence, we have developed a trans-epidermal antiemetic drug delivery patch using out-of-plane hollow silicon microneedle array. Microneedles are pointed micron-scale structures that pierce the epidermal layer of skin to reach dermal blood vessels and can directly release the drug in their vicinity. They are painless by virtue of avoiding significant contact with dermal sensory nerve endings. This alternate approach gives same pharmacodynamic effects as par- enteral route at a sparse drug-dose requirement, hence negligible side-effects and improved patient compliance. Microneedle design attributes were derived by systematic study of human skin anatomy, natural micron-size structures like wasp-sting and cactus-spine and multi-physics simulations. We used deep reactive ion etching with Bosch process and optimized recipe of gases to fabricate high-aspect-ratio hollow silicon microneedle array. Finally, microneedle array and polydimethylsiloxane drug reservoir were assembled to make finished anti-emetic patch. We assessed microneedles mechanical stability, physico-chemical properties and performed in-vitro, ex- vivo and in-vivo studies. These studies established functional efficacy of the device in trans-epidermal delivery of anti-emetics, its programmability, ease of use and biosafety. Thus, out-of-plane hollow silicon microneedle array trans-epidermal antiemetic patch is a promising strategy for painless and effective management of CINV at low cost in mainstream healthcare.

  15. Human eccrine sweat gland cells turn into melanin-uptaking keratinocytes in dermo-epidermal skin substitutes.

    Science.gov (United States)

    Böttcher-Haberzeth, Sophie; Biedermann, Thomas; Pontiggia, Luca; Braziulis, Erik; Schiestl, Clemens; Hendriks, Bart; Eichhoff, Ossia M; Widmer, Daniel S; Meuli-Simmen, Claudia; Meuli, Martin; Reichmann, Ernst

    2013-02-01

    Recently, Biedermann et al. (2010) have demonstrated that human eccrine sweat gland cells can develop a multilayered epidermis. The question still remains whether these cells can fulfill exclusive and very specific functional properties of epidermal keratinocytes, such as the incorporation of melanin, a feature absent in sweat gland cells. We added human melanocytes to eccrine sweat gland cells to let them develop into an epidermal analog in vivo. The interaction between melanocytes and sweat gland-derived keratinocytes was investigated. The following results were gained: (1) macroscopically, a pigmentation of the substitutes was seen 2-3 weeks after transplantation; (2) we confirmed the development of a multilayered, stratified epidermis with melanocytes distributed evenly throughout the basal layer; (3) melanocytic dendrites projected to suprabasal layers; and (4) melanin was observed to be integrated into former eccrine sweat gland cells. These skin substitutes were similar or equal to skin substitutes cultured from human epidermal keratinocytes. The only differences observed were a delay in pigmentation and less melanin uptake. These data suggest that eccrine sweat gland cells can form a functional epidermal melanin unit, thereby providing striking evidence that they can assume one of the most characteristic keratinocyte properties.

  16. Pattern of hormone receptors and human epidermal growth factor ...

    African Journals Online (AJOL)

    Introduction: Breast cancer is the most common cancer among women globally. With immunohistochemistry (IHC), breast cancer is classified into four groups based on IHC profile of estrogen receptor (ER)/progesterone receptor (PR) and human epidermal growth factor receptor 2 (HER2/neu) expression, positive (+) and/or ...

  17. Perforated Sigmoid Diverticulitis in the Presence of Toxic Epidermal Necrolysis

    Directory of Open Access Journals (Sweden)

    P. Heye

    2014-02-01

    Full Text Available Even though the incidence of toxic epidermal necrolysis (TEN is low, it is also associated with a high mortality rate. The condition predominantly affects the skin, but may also affect the gastrointestinal tract, dramatically increasing mortality. We present a case of perforated sigmoid diverticulitis in the presence of TEN. The patient was taking medication, known to be a risk factor, and presented an affected total body surface area and temporal development similar to previously reported cases of TEN. Characteristic abdominal symptoms, however, were missing. Gastrointestinal involvement in TEN appears to be a poor prognostic factor; medical staff must therefore be alert to patients with TEN who complain of abdominal discomfort. The exact pathogenesis, however, remains unclear.

  18. R2R - software to speed the depiction of aesthetic consensus RNA secondary structures

    Directory of Open Access Journals (Sweden)

    Weinberg Zasha

    2011-01-01

    Full Text Available Abstract Background With continuing identification of novel structured noncoding RNAs, there is an increasing need to create schematic diagrams showing the consensus features of these molecules. RNA structural diagrams are typically made either with general-purpose drawing programs like Adobe Illustrator, or with automated or interactive programs specific to RNA. Unfortunately, the use of applications like Illustrator is extremely time consuming, while existing RNA-specific programs produce figures that are useful, but usually not of the same aesthetic quality as those produced at great cost in Illustrator. Additionally, most existing RNA-specific applications are designed for drawing single RNA molecules, not consensus diagrams. Results We created R2R, a computer program that facilitates the generation of aesthetic and readable drawings of RNA consensus diagrams in a fraction of the time required with general-purpose drawing programs. Since the inference of a consensus RNA structure typically requires a multiple-sequence alignment, the R2R user annotates the alignment with commands directing the layout and annotation of the RNA. R2R creates SVG or PDF output that can be imported into Adobe Illustrator, Inkscape or CorelDRAW. R2R can be used to create consensus sequence and secondary structure models for novel RNA structures or to revise models when new representatives for known RNA classes become available. Although R2R does not currently have a graphical user interface, it has proven useful in our efforts to create 100 schematic models of distinct noncoding RNA classes. Conclusions R2R makes it possible to obtain high-quality drawings of the consensus sequence and structural models of many diverse RNA structures with a more practical amount of effort. R2R software is available at http://breaker.research.yale.edu/R2R and as an Additional file.

  19. R2R - software to speed the depiction of aesthetic consensus RNA secondary structures

    Science.gov (United States)

    2011-01-01

    Background With continuing identification of novel structured noncoding RNAs, there is an increasing need to create schematic diagrams showing the consensus features of these molecules. RNA structural diagrams are typically made either with general-purpose drawing programs like Adobe Illustrator, or with automated or interactive programs specific to RNA. Unfortunately, the use of applications like Illustrator is extremely time consuming, while existing RNA-specific programs produce figures that are useful, but usually not of the same aesthetic quality as those produced at great cost in Illustrator. Additionally, most existing RNA-specific applications are designed for drawing single RNA molecules, not consensus diagrams. Results We created R2R, a computer program that facilitates the generation of aesthetic and readable drawings of RNA consensus diagrams in a fraction of the time required with general-purpose drawing programs. Since the inference of a consensus RNA structure typically requires a multiple-sequence alignment, the R2R user annotates the alignment with commands directing the layout and annotation of the RNA. R2R creates SVG or PDF output that can be imported into Adobe Illustrator, Inkscape or CorelDRAW. R2R can be used to create consensus sequence and secondary structure models for novel RNA structures or to revise models when new representatives for known RNA classes become available. Although R2R does not currently have a graphical user interface, it has proven useful in our efforts to create 100 schematic models of distinct noncoding RNA classes. Conclusions R2R makes it possible to obtain high-quality drawings of the consensus sequence and structural models of many diverse RNA structures with a more practical amount of effort. R2R software is available at http://breaker.research.yale.edu/R2R and as an Additional file. PMID:21205310

  20. R2R--software to speed the depiction of aesthetic consensus RNA secondary structures.

    Science.gov (United States)

    Weinberg, Zasha; Breaker, Ronald R

    2011-01-04

    With continuing identification of novel structured noncoding RNAs, there is an increasing need to create schematic diagrams showing the consensus features of these molecules. RNA structural diagrams are typically made either with general-purpose drawing programs like Adobe Illustrator, or with automated or interactive programs specific to RNA. Unfortunately, the use of applications like Illustrator is extremely time consuming, while existing RNA-specific programs produce figures that are useful, but usually not of the same aesthetic quality as those produced at great cost in Illustrator. Additionally, most existing RNA-specific applications are designed for drawing single RNA molecules, not consensus diagrams. We created R2R, a computer program that facilitates the generation of aesthetic and readable drawings of RNA consensus diagrams in a fraction of the time required with general-purpose drawing programs. Since the inference of a consensus RNA structure typically requires a multiple-sequence alignment, the R2R user annotates the alignment with commands directing the layout and annotation of the RNA. R2R creates SVG or PDF output that can be imported into Adobe Illustrator, Inkscape or CorelDRAW. R2R can be used to create consensus sequence and secondary structure models for novel RNA structures or to revise models when new representatives for known RNA classes become available. Although R2R does not currently have a graphical user interface, it has proven useful in our efforts to create 100 schematic models of distinct noncoding RNA classes. R2R makes it possible to obtain high-quality drawings of the consensus sequence and structural models of many diverse RNA structures with a more practical amount of effort. R2R software is available at http://breaker.research.yale.edu/R2R and as an Additional file.

  1. Técnica para o estudo da anatomia da epiderme foliar de batata A technique for the anatomical study of potato leaf epidermis

    Directory of Open Access Journals (Sweden)

    Fernanda Bastos Segatto

    2004-10-01

    main leaflets from the medium portion of potato plants. An adequate study of all evaluated clones was only possible with the epidermal fingerprint technique. The epidermal fingerprint on glass slides is a fast preparing, low cost and easy implementation technique, which enables to evaluate a high number of potato plants in a short period of time.

  2. High-Throughput Sequencing Based Methods of RNA Structure Investigation

    DEFF Research Database (Denmark)

    Kielpinski, Lukasz Jan

    In this thesis we describe the development of four related methods for RNA structure probing that utilize massive parallel sequencing. Using them, we were able to gather structural data for multiple, long molecules simultaneously. First, we have established an easy to follow experimental...... and computational protocol for detecting the reverse transcription termination sites (RTTS-Seq). This protocol was subsequently applied to hydroxyl radical footprinting of three dimensional RNA structures to give a probing signal that correlates well with the RNA backbone solvent accessibility. Moreover, we applied...

  3. Clinical implementation of RNA signatures for pharmacogenomic decision-making

    Directory of Open Access Journals (Sweden)

    Tang W

    2011-09-01

    Full Text Available Weihua Tang1, Zhiyuan Hu2, Hind Muallem1, Margaret L Gulley1,21Department of Pathology and Laboratory Medicine, 2Lineberger Comprehensive Cancer Center, University of North Carolina at Chapel Hill, North Carolina, NC, USAAbstract: RNA profiling is increasingly used to predict drug response, dose, or toxicity based on analysis of drug pharmacokinetic or pharmacodynamic pathways. Before implementing multiplexed RNA arrays in clinical practice, validation studies are carried out to demonstrate sufficient evidence of analytic and clinical performance, and to establish an assay protocol with quality assurance measures. Pathologists assure quality by selecting input tissue and by interpreting results in the context of the input tissue as well as the technologies that were used and the clinical setting in which the test was ordered. A strength of RNA profiling is the array-based measurement of tens to thousands of RNAs at once, including redundant tests for critical analytes or pathways to promote confidence in test results. Instrument and reagent manufacturers are crucial for supplying reliable components of the test system. Strategies for quality assurance include careful attention to RNA preservation and quality checks at pertinent steps in the assay protocol, beginning with specimen collection and proceeding through the various phases of transport, processing, storage, analysis, interpretation, and reporting. Specimen quality is checked by probing housekeeping transcripts, while spiked and exogenous controls serve as a check on analytic performance of the test system. Software is required to manipulate abundant array data and present it for interpretation by a laboratory physician who reports results in a manner facilitating therapeutic decision-making. Maintenance of the assay requires periodic documentation of personnel competency and laboratory proficiency. These strategies are shepherding genomic arrays into clinical settings to provide added

  4. RNA-Seq as an Emerging Tool for Marine Dinoflagellate Transcriptome Analysis: Process and Challenges

    Directory of Open Access Journals (Sweden)

    Muhamad Afiq Akbar

    2018-01-01

    Full Text Available Dinoflagellates are the large group of marine phytoplankton with primary studies interest regarding their symbiosis with coral reef and the abilities to form harmful algae blooms (HABs. Toxin produced by dinoflagellates during events of HABs cause severe negative impact both in the economy and health sector. However, attempts to understand the dinoflagellates genomic features are hindered by their complex genome organization. Transcriptomics have been employed to understand dinoflagellates genome structure, profile genes and gene expression. RNA-seq is one of the latest methods for transcriptomics study. This method is capable of profiling the dinoflagellates transcriptomes and has several advantages, including highly sensitive, cost effective and deeper sequence coverage. Thus, in this review paper, the current workflow of dinoflagellates RNA-seq starts with the extraction of high quality RNA and is followed by cDNA sequencing using the next-generation sequencing platform, dinoflagellates transcriptome assembly and computational analysis will be discussed. Certain consideration needs will be highlighted such as difficulty in dinoflagellates sequence annotation, post-transcriptional activity and the effect of RNA pooling when using RNA-seq.

  5. A path-based measurement for human miRNA functional similarities using miRNA-disease associations

    Science.gov (United States)

    Ding, Pingjian; Luo, Jiawei; Xiao, Qiu; Chen, Xiangtao

    2016-09-01

    Compared with the sequence and expression similarity, miRNA functional similarity is so important for biology researches and many applications such as miRNA clustering, miRNA function prediction, miRNA synergism identification and disease miRNA prioritization. However, the existing methods always utilized the predicted miRNA target which has high false positive and false negative to calculate the miRNA functional similarity. Meanwhile, it is difficult to achieve high reliability of miRNA functional similarity with miRNA-disease associations. Therefore, it is increasingly needed to improve the measurement of miRNA functional similarity. In this study, we develop a novel path-based calculation method of miRNA functional similarity based on miRNA-disease associations, called MFSP. Compared with other methods, our method obtains higher average functional similarity of intra-family and intra-cluster selected groups. Meanwhile, the lower average functional similarity of inter-family and inter-cluster miRNA pair is obtained. In addition, the smaller p-value is achieved, while applying Wilcoxon rank-sum test and Kruskal-Wallis test to different miRNA groups. The relationship between miRNA functional similarity and other information sources is exhibited. Furthermore, the constructed miRNA functional network based on MFSP is a scale-free and small-world network. Moreover, the higher AUC for miRNA-disease prediction indicates the ability of MFSP uncovering miRNA functional similarity.

  6. Combined Stimulation with the Tumor Necrosis Factor α and the Epidermal Growth Factor Promotes the Proliferation of Hepatocytes in Rat Liver Cultured Slices

    Directory of Open Access Journals (Sweden)

    Francis Finot

    2012-01-01

    Full Text Available The culture liver slices are mainly used to investigate drug metabolism and xenobiotic-mediated liver injuries while apoptosis and proliferation remain unexplored in this culture model. Here, we show a transient increase in LDH release and caspase activities indicating an ischemic injury during the slicing procedure. Then, caspase activities decrease and remain low in cultured slices demonstrating a low level of apoptosis. The slicing procedure is also associated with the G0/G1 transition of hepatocytes demonstrated by the activation of stress and proliferation signalling pathways including the ERK1/2 and JNK1/2/3 MAPKinases and the transient upregulation of c-fos. The cells further progress up to mid-G1 phase as indicated by the sequential induction of c-myc and p53 mRNA levels after the slicing procedure and at 24 h of culture, respectively. The stimulation by epidermal growth factor induces the ERK1/2 phosphorylation but fails to activate expression of late G1 and S phase markers such as cyclin D1 and Cdk1 indicating that hepatocytes are arrested in mid-G1 phase of the cell cycle. However, we found that combined stimulation by the proinflammatory cytokine tumor necrosis factor α and the epidermal growth factor promotes the commitment to DNA replication as observed in vivo during the liver regeneration.

  7. Comparative evaluation of total RNA extraction methods in Theobroma cacao using shoot apical meristems.

    Science.gov (United States)

    Silva, D V; Branco, S M J; Holanda, I S A; Royaert, S; Motamayor, J C; Marelli, J P; Corrêa, R X

    2016-03-04

    Theobroma cacao is a species of great economic importance with its beans used for chocolate production. The tree has been a target of various molecular studies. It contains many polyphenols, which complicate the extraction of nucleic acids with the extraction protocols requiring a large amount of plant material. These issues, therefore, necessitate the optimization of the protocols. The aim of the present study was to evaluate different methods for extraction of total RNA from shoot apical meristems of T. cacao 'CCN 51' and to assess the influence of storage conditions for the meristems on the extraction. The study also aimed to identify the most efficient protocol for RNA extraction using a small amount of plant material. Four different protocols were evaluated for RNA extraction using one shoot apical meristem per sample. Among these protocols, one that was more efficient was then tested to extract RNA using four different numbers of shoot apical meristems, subjected to three different storage conditions. The best protocol was tested for cDNA amplification using reverse transcription-polymerase chain reaction; the cDNA quality was determined to be satisfactory for molecular analyses. The study revealed that with the best RNA extraction protocol, one shoot apical meristem was sufficient for extraction of high-quality total RNA. The results obtained might enable advances in genetic analyses and molecular studies using reduced amount of plant material.

  8. High-quality compressive ghost imaging

    Science.gov (United States)

    Huang, Heyan; Zhou, Cheng; Tian, Tian; Liu, Dongqi; Song, Lijun

    2018-04-01

    We propose a high-quality compressive ghost imaging method based on projected Landweber regularization and guided filter, which effectively reduce the undersampling noise and improve the resolution. In our scheme, the original object is reconstructed by decomposing of regularization and denoising steps instead of solving a minimization problem in compressive reconstruction process. The simulation and experimental results show that our method can obtain high ghost imaging quality in terms of PSNR and visual observation.

  9. Role of RNase MRP in viral RNA degradation and RNA recombination.

    Science.gov (United States)

    Jaag, Hannah M; Lu, Qiasheng; Schmitt, Mark E; Nagy, Peter D

    2011-01-01

    RNA degradation, together with RNA synthesis, controls the steady-state level of viral RNAs in infected cells. The endoribonucleolytic cleavage of viral RNA is important not only for viral RNA degradation but for RNA recombination as well, due to the participation of some RNA degradation products in the RNA recombination process. To identify host endoribonucleases involved in degradation of Tomato bushy stunt virus (TBSV) in a Saccharomyces cerevisiae model host, we tested eight known endoribonucleases. Here we report that downregulation of SNM1, encoding a component of the RNase MRP, and a temperature-sensitive mutation in the NME1 gene, coding for the RNA component of RNase MRP, lead to reduced production of the endoribonucleolytically cleaved TBSV RNA in yeast. We also show that the highly purified yeast RNase MRP cleaves the TBSV RNA in vitro, resulting in TBSV RNA degradation products similar in size to those observed in yeast cells. Knocking down the NME1 homolog in Nicotiana benthamiana also led to decreased production of the cleaved TBSV RNA, suggesting that in plants, RNase MRP is involved in TBSV RNA degradation. Altogether, this work suggests a role for the host endoribonuclease RNase MRP in viral RNA degradation and recombination.

  10. Use of etanercept to treat toxic epidermal necrolysis in a human immunodeficiency virus-positive patient

    OpenAIRE

    Yung-Yi Lee; Jui-Hung Ko; Chia-Hung Wei; Wen-Hung Chung

    2013-01-01

    Toxic epidermal necrolysis (TEN) is an uncommon and severe cutaneous adverse drug reaction that causes disseminated necrosis of epidermal cells and mucocutaneous detachment. Here, we report the case of a 32-year-old man with human immunodeficiency virus infection who presented with generalized violaceous macules and blister formation 4 days after the administration of mefenamic acid and amoxicillin for a dental procedure. Additional symptoms included oral ulcers and conjunctivitis. Results of...

  11. The RNA synthesis machinery of negative-stranded RNA viruses

    International Nuclear Information System (INIS)

    Ortín, Juan; Martín-Benito, Jaime

    2015-01-01

    The group of Negative-Stranded RNA Viruses (NSVs) includes many human pathogens, like the influenza, measles, mumps, respiratory syncytial or Ebola viruses, which produce frequent epidemics of disease and occasional, high mortality outbreaks by transmission from animal reservoirs. The genome of NSVs consists of one to several single-stranded, negative-polarity RNA molecules that are always assembled into mega Dalton-sized complexes by association to many nucleoprotein monomers. These RNA-protein complexes or ribonucleoproteins function as templates for transcription and replication by action of the viral RNA polymerase and accessory proteins. Here we review our knowledge on these large RNA-synthesis machines, including the structure of their components, the interactions among them and their enzymatic activities, and we discuss models showing how they perform the virus transcription and replication programmes. - Highlights: • Overall organisation of NSV RNA synthesis machines. • Structure and function of the ribonucleoprotein components: Atomic structure of the RNA polymerase complex. • Commonalities and differences between segmented- and non-segmented NSVs. • Transcription versus replication programmes

  12. The RNA synthesis machinery of negative-stranded RNA viruses

    Energy Technology Data Exchange (ETDEWEB)

    Ortín, Juan, E-mail: jortin@cnb.csic.es [Department of Molecular and Cellular Biology, Centro Nacional de Biotecnología (CSIC) and CIBER de Enfermedades Respiratorias (ISCIII), Madrid (Spain); Martín-Benito, Jaime, E-mail: jmartinb@cnb.csic.es [Department of Macromolecular Structures, Centro Nacional de Biotecnología (CSIC), Madrid (Spain)

    2015-05-15

    The group of Negative-Stranded RNA Viruses (NSVs) includes many human pathogens, like the influenza, measles, mumps, respiratory syncytial or Ebola viruses, which produce frequent epidemics of disease and occasional, high mortality outbreaks by transmission from animal reservoirs. The genome of NSVs consists of one to several single-stranded, negative-polarity RNA molecules that are always assembled into mega Dalton-sized complexes by association to many nucleoprotein monomers. These RNA-protein complexes or ribonucleoproteins function as templates for transcription and replication by action of the viral RNA polymerase and accessory proteins. Here we review our knowledge on these large RNA-synthesis machines, including the structure of their components, the interactions among them and their enzymatic activities, and we discuss models showing how they perform the virus transcription and replication programmes. - Highlights: • Overall organisation of NSV RNA synthesis machines. • Structure and function of the ribonucleoprotein components: Atomic structure of the RNA polymerase complex. • Commonalities and differences between segmented- and non-segmented NSVs. • Transcription versus replication programmes.

  13. Epidermal response of rainbow trout to Ichthyobodo necator

    DEFF Research Database (Denmark)

    Chettri, Jiwan Kumar; Kuhn, Jesper Andreas; Mohammad, Rezkar Jaafar

    2014-01-01

    Infections with the parasitic flagellate Ichthyobodo necator (Henneguy, 1883) cause severe skin and gill disease in rainbow trout Oncorhynchus mykiss (Walbaum, 1792) juveniles. The epidermal disturbances including hyperplasia and mucous cell exhaustion caused by parasitization are known, but no d...

  14. Beta1 integrin-mediated adhesion signalling is essential for epidermal progenitor cell expansion

    DEFF Research Database (Denmark)

    Piwko-Czuchra, Aleksandra; Koegel, Heidi; Meyer, Hannelore

    2009-01-01

    BACKGROUND: There is a major discrepancy between the in vitro and in vivo results regarding the role of beta1 integrins in the maintenance of epidermal stem/progenitor cells. Studies of mice with skin-specific ablation of beta1 integrins suggested that epidermis can form and be maintained in thei...... of increased keratinocyte proliferation such as wound healing. CONCLUSIONS/SIGNIFICANCE: These data demonstrate that expression of beta1 integrins is critically important for the expansion of epidermal progenitor cells to maintain epidermal homeostasis....... that developed similar, but less severe defects than mice with beta1-deficient keratinocytes. Surprisingly we found that upon aging these abnormalities attenuated due to a rapid expansion of cells, which escaped or compensated for the down-regulation of beta1 integrin expression. A similar phenomenon...... was observed in aged mice with a complete, skin-specific ablation of the beta1 integrin gene, where cells that escaped Cre-mediated recombination repopulated the mutant skin in a very short time period. The expansion of beta1 integrin expressing keratinocytes was even further accelerated in situations...

  15. RNA quality control in yeast - what is good and what is bad?

    DEFF Research Database (Denmark)

    Andersen, Kasper Røjkjær; Brodersen, Ditlev Egeskov

    positions in the tRNA molecules [2]. We believe that in such cases, the tRNAs are recognized by a common structural alteration that causes part of the molecule to unfold and thereby mark the tRNA as defect. We therefore want to isolate and crystallize the RNA binding proteins Air1p or Air2p in complex...... with aberrant tRNA analogous to gain knowledge of how the cell determines which RNAs are good and bad and use this as a model system for how the cell in general recognizes aberrant RNAs. So far, Air1p and Air2p have been cloned from different yeast organisms and the first expression tests of the proteins have...

  16. Compromised epidermal barrier stimulates Harderian gland activity and hypertrophy in ACBP-/- mice

    DEFF Research Database (Denmark)

    Sørensen, Signe Bek; Neess, Ditte; Dixen, Karen

    2015-01-01

    of the eye lid. We show that disruption of the Acbp gene leads to a significant enlargement of this gland with hypertrophy of the acinar cells and increased de novo synthesis of monoalkyl diacylglycerol, the main lipid species produced by the gland. Mice with conditional targeting of the Acbp gene......Acyl-CoA binding protein (ACBP) is a small, ubiquitously expressed intracellular protein that binds C14-C22 acyl-CoA esters with very high affinity and specificity. We have recently shown that targeted disruption of the Acbp gene leads to a compromised epidermal barrier and that this causes delayed...

  17. Long Noncoding RNA-1604 Orchestrates Neural Differentiation through the miR-200c/ZEB Axis.

    Science.gov (United States)

    Weng, Rong; Lu, Chenqi; Liu, Xiaoqin; Li, Guoping; Lan, Yuanyuan; Qiao, Jing; Bai, Mingliang; Wang, Zhaojie; Guo, Xudong; Ye, Dan; Jiapaer, Zeyidan; Yang, Yiwei; Xia, Chenliang; Wang, Guiying; Kang, Jiuhong

    2018-03-01

    Clarifying the regulatory mechanisms of embryonic stem cell (ESC) neural differentiation is helpful not only for understanding neural development but also for obtaining high-quality neural progenitor cells required by stem cell therapy of neurodegenerative diseases. Here, we found that long noncoding RNA 1604 (lncRNA-1604) was highly expressed in cytoplasm during neural differentiation, and knockdown of lncRNA-1604 significantly repressed neural differentiation of mouse ESCs both in vitro and in vivo. Bioinformatics prediction and mechanistic analysis revealed that lncRNA-1604 functioned as a novel competing endogenous RNA of miR-200c and regulated the core transcription factors ZEB1 and ZEB2 during neural differentiation. Furthermore, we also demonstrated the critical role of miR-200c and ZEB1/2 in mouse neural differentiation. Either introduction of miR-200c sponge or overexpression of ZEB1/2 significantly reversed the lncRNA-1604 knockdown-induced repression of mouse ESC neural differentiation. Collectively, these findings not only identified a previously unknown role of lncRNA-1604 and ZEB1/2 but also elucidated a new regulatory lncRNA-1604/miR-200c/ZEB axis in neural differentiation. Stem Cells 2018;36:325-336. © 2017 AlphaMed Press.

  18. Identification and validation of cetuximab resistance associated long noncoding RNA biomarkers in metastatic colorectal cancer.

    Science.gov (United States)

    Peng, Ke; Liu, Ruiqi; Yu, Yiyi; Liang, Li; Yu, Shan; Xu, Xiaojing; Liu, Tianshu

    2018-01-01

    Cetuximab is one of the most widely used epidermal growth factor receptor (EGFR) inhibitors to treat patients with metastatic colorectal cancer (mCRC) harboring wild-type of RAS/RAF status. However, primary and acquired resistance to cetuximab is often found during target therapy. To gain insights into the functions of long non-coding RNA (lncRNA) in cetuximab resistance, we used a lncRNA-mining approach to distinguish lncRNA specific probes in Affymetrix HG-U133A 2.0 arrays. Then we performed lncRNA expression profiling in a cetuximab treated mCRC cohort from Gene Expression Ominus (GEO). The potential lncRNAs were further validated in acquired cetuximab resistant cell lines and clinical samples of our hospital. The functions and associated pathways of the prognostic lncRNA were predicted by GO and KEGG analyses. 249 lncRNA-specific probe sets (corresponding to 212 lncRNAs) were represented in Affymetrix HG-U133A 2.0 arrays. We found that 9 lncRNAs were differentially expressed between disease control group (DCG) and non-responders, and 5 of these 9 lncRNAs were significantly related with the progression-free survival (PFS) of the patients. Among those 5 lncRNAs, POU5F1P4 was also down-regulated in acquired cetuximab resistant cells, as well as in cetuximab resistant patients. Downregulation of POU5F1P4 decreased the sensitivity of colorectal cancer cells to cetuximab. Our findings indicate the potential roles of lncRNAs in cetuximab resistance, and may provide the useful information for discovery of new biomarkers and therapeutic targets. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  19. Preparation of Total RNA from Fission Yeast.

    Science.gov (United States)

    Bähler, Jürg; Wise, Jo Ann

    2017-04-03

    Treatment with hot phenol breaks open fission yeast cells and begins to strip away bound proteins from RNA. Deproteinization is completed by multiple extractions with chloroform/isoamyl alcohol and separation of the aqueous and organic phases using MaXtract gel, an inert material that acts as a physical barrier between the phases. The final step is concentration of the RNA by ethanol precipitation. The protocol can be used to prepare RNA from several cultures grown in parallel, but it is important not to process too many samples at once because delays can be detrimental to RNA quality. A reasonable number of samples to process at once would be three to four for microarray or RNA sequencing analyses and six for preliminary investigations of mutants implicated in RNA metabolism. © 2017 Cold Spring Harbor Laboratory Press.

  20. A Simple and Efficient RNA Extraction Method from Deep-Sea Hydrothermal Vent Chimney Structures.

    Science.gov (United States)

    Muto, Hisashi; Takaki, Yoshihiro; Hirai, Miho; Mino, Sayaka; Sawayama, Shigeki; Takai, Ken; Nakagawa, Satoshi

    2017-12-27

    RNA-based microbiological analyses, e.g., transcriptome and reverse transcription-quantitative PCR, require a relatively large amount of high quality RNA. RNA-based analyses on microbial communities in deep-sea hydrothermal environments often encounter methodological difficulties with RNA extraction due to the presence of unique minerals in and the low biomass of samples. In the present study, we assessed RNA extraction methods for deep-sea vent chimneys that had complex mineral compositions. Mineral-RNA adsorption experiments were conducted using mock chimney minerals and Escherichia coli total RNA solution, and showed that detectable RNA significantly decreased possibly due to adsorption onto minerals. This decrease in RNA was prevented by the addition of sodium tripolyphosphate (STPP), deoxynucleotide triphosphates (dNTPs), salmon sperm DNA, and NaOH. The addition of STPP was also effective for RNA extraction from the mixture of E. coli cells and mock chimney minerals when TRIzol reagent and the RNeasy column were used, but not when the RNeasy PowerSoil total RNA kit was used. A combination of STPP, TRIzol reagent, the RNeasy column, and sonication resulted in the highest RNA yield from a natural chimney. This indirect extraction procedure is simple, rapid, inexpensive, and may be used for large-scale RNA extraction.

  1. Sequence-based heuristics for faster annotation of non-coding RNA families.

    Science.gov (United States)

    Weinberg, Zasha; Ruzzo, Walter L

    2006-01-01

    Non-coding RNAs (ncRNAs) are functional RNA molecules that do not code for proteins. Covariance Models (CMs) are a useful statistical tool to find new members of an ncRNA gene family in a large genome database, using both sequence and, importantly, RNA secondary structure information. Unfortunately, CM searches are extremely slow. Previously, we created rigorous filters, which provably sacrifice none of a CM's accuracy, while making searches significantly faster for virtually all ncRNA families. However, these rigorous filters make searches slower than heuristics could be. In this paper we introduce profile HMM-based heuristic filters. We show that their accuracy is usually superior to heuristics based on BLAST. Moreover, we compared our heuristics with those used in tRNAscan-SE, whose heuristics incorporate a significant amount of work specific to tRNAs, where our heuristics are generic to any ncRNA. Performance was roughly comparable, so we expect that our heuristics provide a high-quality solution that--unlike family-specific solutions--can scale to hundreds of ncRNA families. The source code is available under GNU Public License at the supplementary web site.

  2. Coordinated action of histone modification and microRNA regulations in human genome.

    Science.gov (United States)

    Wang, Xuan; Zheng, Guantao; Dong, Dong

    2015-10-10

    Both histone modifications and microRNAs (miRNAs) play pivotal role in gene expression regulation. Although numerous studies have been devoted to explore the gene regulation by miRNA and epigenetic regulations, their coordinated actions have not been comprehensively examined. In this work, we systematically investigated the combinatorial relationship between miRNA and epigenetic regulation by taking advantage of recently published whole genome-wide histone modification data and high quality miRNA targeting data. The results showed that miRNA targets have distinct histone modification patterns compared with non-targets in their promoter regions. Based on this finding, we proposed a machine learning approach to fit predictive models on the task to discern whether a gene is targeted by a specific miRNA. We found a considerable advantage in both sensitivity and specificity in diverse human cell lines. Finally, we found that our predicted miRNA targets are consistently annotated with Gene Ontology terms. Our work is the first genome-wide investigation of the coordinated action of miRNA and histone modification regulations, which provide a guide to deeply understand the complexity of transcriptional regulation. Copyright © 2015 Elsevier B.V. All rights reserved.

  3. Cervi cornus Colla (deer antler glue) induce epidermal differentiation in the reconstruction of skin equivalents.

    Science.gov (United States)

    Choi, H-R; Nam, K-M; Kim, D-S; Huh, C-H; Na, J-I; Park, K-C

    2013-06-01

    In the reconstruction of skin equivalents (SEs), keratinocyte differentiation is important because epidermal differentiation is closely related with barrier function. The aim of this study was to investigate the effects of Cervi cornus Colla (CCC) on the stem cell activity and epidermal differentiation in the reconstruction of skin equivalent. Four different models were constructed according to different composition of dermal substitute. Results showed similar morphologic findings when hyaluronic acid (HA) and/or CCC was added. But, immunohistochemical staining showed that p63 was significantly increased by addition of HA and/or CCC. Increased staining of integrin α6 and β1 was variably observed when HA and/or CCC was added to make dermal substitute. These finding showed that addition of HA and/or CCC may affect the stem cell activity in the reconstruction of skin. Furthermore, filaggrin expression was much increased when CCC was added. It showed that epidermal differentiation was significantly improved by addition of CCC. In conclusion, simultaneous presence of HA and CCC contributed to the stem cell activity and epidermal differentiation in the reconstruction of SE. Legislation in the EU prohibits marketing cosmetics and personal care products that contain constituents that have been examined through animal experiments. To avoid these limitations, SEs can be used for testing the safety or the efficacy of cosmetic ingredients. Therefore, our results showed that combined use of HA and CCC can be helpful for the reconstruction of SE with good stem cell activity and epidermal differentiation. © 2013 Society of Cosmetic Scientists and the Société Française de Cosmétologie.

  4. The iris signal: blue periphery, tan collaret and freckles pattern - strong indicators for epidermal skin cancer in South-Eastern Europe.

    Science.gov (United States)

    Grigore, M; Furtunescu, F; Minca, D; Costache, M; Garbe, C; Simionescu, O

    2018-03-10

    Eye and skin share the embryological origin. Both are established risk factors in epidermal skin cancer. There are few reports using iris colour classification scales, most of them analyse colour in general or are too complex to use in daily practice. To investigate which iris colour pattern is associated with epidermal skin cancer in a S-E European Caucasian population. A case-control study was conducted on 480 patients: 229 skin cancers patients and 251 controls (dermatological patients free of skin cancers) admitted in two medical clinics of Dermatology in Bucharest, between October 2011 and May 2014. High-resolution iris photographs were taken for each patient. Three parameters of the iris were analysed individually and in association patterns for each patient: periphery, collaret and freckles. The most frequent iris colour pattern associated with epidermal skin cancer was blue periphery with light brown collaret and freckles present. In terms of individual parameters, the strongest indicators for skin cancer patients were blue periphery and blue collaret. The results of this study sustain the hypothesis that blue periphery with light brown collaret and freckles iris pattern is a reliable phenotypic marker for epidermal skin cancer. The results of this study differ from previous reports in which skin cancer risk was associated with a homogeneous blue iris. We account these differences in the characteristics of the recruited patients (S-E European, skin type II and III). The assessment of iris colour patterns is an easy and inexpensive detection tool in skin cancer risk assessment. © 2018 European Academy of Dermatology and Venereology.

  5. Bacteriological examination of inflamed epidermal cysts: a survey between 2008 and 2009 at a hospital in southern Taiwan

    Directory of Open Access Journals (Sweden)

    Yen-Hsi Liu

    2010-09-01

    Conclusions: Both aerobic and anaerobic microorganisms were present in the inflamed epidermal cysts, although the anaerobic bacteria, specifically, Propionibacterium spp and Peptostreptococcus spp, were isolated slightly more frequently. Antibiotics directed against anaerobes may be considered in the treatment regimen for inflamed epidermal cysts.

  6. Novel targeted approaches to treating biliary tract cancer: the dual epidermal growth factor receptor and ErbB-2 tyrosine kinase inhibitor NVP-AEE788 is more efficient than the epidermal growth factor receptor inhibitors gefitinib and erlotinib.

    Science.gov (United States)

    Wiedmann, Marcus; Feisthammel, Jürgen; Blüthner, Thilo; Tannapfel, Andrea; Kamenz, Thomas; Kluge, Annett; Mössner, Joachim; Caca, Karel

    2006-08-01

    Aberrant activation of the epidermal growth factor receptor is frequently observed in neoplasia, notably in tumors of epithelial origin. Attempts to treat such tumors with epidermal growth factor receptor antagonists resulted in remarkable success in recent studies. Little is known, however, about the efficacy of this therapy in biliary tract cancer. Protein expression of epidermal growth factor receptor, ErbB-2, and vascular endothelial growth factor receptor-2 was assessed in seven human biliary tract cancer cell lines by immunoblotting. In addition, histological sections from 19 patients with extrahepatic cholangiocarcinoma were analyzed for epidermal growth factor receptor, ErbB-2 and vascular endothelial growth factor receptor-2 expression by immunohistochemistry. Moreover, we sequenced the cDNA products representing the entire epidermal growth factor receptor coding region of the seven cell lines, and searched for genomic epidermal growth factor receptor amplifications and polysomy by fluorescence in-situ hybridization. Cell growth inhibition by gefitinib erlotinib and NVP-AEE788 was studied in vitro by automated cell counting. In addition, the anti-tumoral effect of erlotinib and NVP-AEE788 was studied in a chimeric mouse model. The anti-tumoral drug mechanism in this model was assessed by MIB-1 antibody staining, terminal deoxynucleotidyl transfer-mediated dUTP nick end-labelling assay, von Willebrand factor staining, and immunoblotting for p-p42/44 (p-Erk1/2, p-MAPK) and p-AKT. Immunoblotting revealed expression of epidermal growth factor receptor, ErbB-2, and vascular endothelial growth factor receptor-2 in all biliary tract cancer cell lines. EGFR was detectable in six of 19 (32%) extrahepatic human cholangiocarcinoma tissue samples, ErbB-2 in 16 of 19 (84%), and vascular endothelial growth factor receptor-2 in nine of 19 (47%). Neither epidermal growth factor receptor mutations nor amplifications or polysomy were found in the seven biliary tract cancer

  7. Frozen allogeneic human epidermal cultured sheets for the cure of complicated leg ulcers.

    Science.gov (United States)

    Bolívar-Flores, Y J; Kuri-Harcuch, W

    1999-08-01

    Skin ulcers due to venous stasis or diabetes are common among the elderly and are difficult to treat. Repeated applications of cell-based products have been reported to result in cure or improvement of leg ulcers of small size in a fraction of patients. To examine the effects of frozen human allogeneic epidermal cultures for the treatment of acute and chronic ulcers. We treated a series of 10 consecutive patients with leg ulcers of different etiology and duration with frozen human allogeneic epidermal cultures stored frozen and thawed for 5-10 minutes at room temperature before application. Three patients had ulcers with exposed Achilles or extensor tendon. The ulcers treated were as large as 160 cm2 in area and of up to 20-years' duration. After preliminary preparation of the wounds by debridement to remove necrotic tissue and application of silver sulfadiazine to control infection, thawed cultures were applied biweekly from 2 to 15 times depending on the size and complexity of the ulcer. All ulcers healed, including those with tendon exposure. After the first few applications, granulation tissue formed in the ulcer bed and on exposed tendons, and epidermal healing took place through proliferation and migration of cells from the margins of the wound. The time required for complete healing ranged from 1 to 31 weeks after the first application. The use of frozen human allogeneic epidermal cultures is a safe and effective treatment for venous or diabetic ulcers, even those with tendon exposure. It seems possible that any leg ulcer will be amenable to successful treatment by this method.

  8. The relationship between quantitative human epidermal growth factor receptor 2 gene expression by the 21-gene reverse transcriptase polymerase chain reaction assay and adjuvant trastuzumab benefit in Alliance N9831.

    Science.gov (United States)

    Perez, Edith A; Baehner, Frederick L; Butler, Steven M; Thompson, E Aubrey; Dueck, Amylou C; Jamshidian, Farid; Cherbavaz, Diana; Yoshizawa, Carl; Shak, Steven; Kaufman, Peter A; Davidson, Nancy E; Gralow, Julie; Asmann, Yan W; Ballman, Karla V

    2015-10-01

    The N9831 trial demonstrated the efficacy of adjuvant trastuzumab for patients with human epidermal growth factor receptor 2 (HER2) locally positive tumors by protein or gene analysis. We used the 21-gene assay to examine the association of quantitative HER2 messenger RNA (mRNA) gene expression and benefit from trastuzumab. N9831 tested the addition of trastuzumab to chemotherapy in stage I-III HER2-positive breast cancer. For two of the arms of the trial, doxorubicin and cyclophosphamide followed by paclitaxel (AC-T) and doxorubicin and cyclophosphamide followed by paclitaxel and trastuzumab concurrent chemotherapy-trastuzumab (AC-TH), recurrence score (RS) and HER2 mRNA expression were determined by the 21-gene assay (Oncotype DX®) (negative 10 % positive cells = positive), 91 % for RT-PCR versus central fluorescence in situ hybridization (FISH) (≥2.0 = positive) and 94 % for central IHC versus central FISH. In the primary analysis, the association of HER2 expression by 21-gene assay with trastuzumab benefit was marginally nonsignificant (nonlinear p = 0.057). In hormone receptor-positive patients (local IHC) the association was significant (p = 0.002). The association was nonlinear with the greatest estimated benefit at lower and higher HER2 expression levels. Concordance among HER2 assessments by central IHC, FISH, and RT-PCR were similar and high. Association of HER2 mRNA expression with trastuzumab benefit as measured by time to distant recurrence was nonsignificant. A consistent benefit of trastuzumab irrespective of mHER2 levels was observed in patients with either IHC-positive or FISH-positive tumors. Trend for benefit was observed also for the small groups of patients with negative results by any or all of the central assays. Clinicaltrials.gov NCT00005970 . Registered 5 July 2000.

  9. Retinoic acid modulation of ultraviolet light-induced epidermal ornithine decarboxylase activity

    International Nuclear Information System (INIS)

    Lowe, N.J.; Breeding, J.

    1982-01-01

    Irradiation of skin with ultraviolet light of sunburn range (UVB) leads to a large and rapid induction of the polyamine biosynthetic enzyme ornithine decarboxylase in the epidermis. Induction of epidermal ornithine decarboxylase also occurs following application of the tumor promoting agent 12-0-tetradecanoylphorbol-13 acetate and topical retinoic acid is able to block both this ornithine decarboxylase induction and skin tumor promotion. In the studies described below, topical application of retinoic acid to hairless mouse skin leads to a significant inhibition of UVB-induced epidermal ornithine decarboxylase activity. The degree of this inhibition was dependent on the dose, timing, and frequency of the application of retinoic acid. To show significant inhibition of UVB-induced ornithine decarboxylase the retinoic acid had to be applied within 5 hr of UVB irradiation. If retinoic acid treatment was delayed beyond 7 hr following UVB, then no inhibition of UVB-induced ornithine decarboxylase was observed. The quantities of retinoic acid used (1.7 nmol and 3.4 nmol) have been shown effective at inhibiting 12-0-tetradecanoyl phorbol-13 acetate induced ornithine decarboxylase. The results show that these concentrations of topical retinoic acid applied either before or immediately following UVB irradiation reduces the UVB induction of epidermal ornithine decarboxylase. The effect of retinoic acid in these regimens on UVB-induced skin carcinogenesis is currently under study

  10. Fabrication of high-quality brazed joints

    International Nuclear Information System (INIS)

    Orlov, A.V.

    1980-01-01

    Problem of ensuring of joint high-quality when brazing different parts in power engineering is considered. To obtain high-quality joints it is necessary to correctly design brazed joint and to choose a gap width, overlap length and fillet radius; to clean up carefully the surfaces to be brazed and fix them properly one relative to another; to apply a solder so as to provide its flowing into the gap and sticking in it; to exactly regulate thermal conditions of brazing. High quality and reliability of brazed joints are ensured by the application of solders based on noble metals, and cheap solders based on nickel, manganese and copper. Joints brazed with nickel base solders may operate at temperatures as high as 888 deg C

  11. Ensemble-based prediction of RNA secondary structures.

    Science.gov (United States)

    Aghaeepour, Nima; Hoos, Holger H

    2013-04-24

    Accurate structure prediction methods play an important role for the understanding of RNA function. Energy-based, pseudoknot-free secondary structure prediction is one of the most widely used and versatile approaches, and improved methods for this task have received much attention over the past five years. Despite the impressive progress that as been achieved in this area, existing evaluations of the prediction accuracy achieved by various algorithms do not provide a comprehensive, statistically sound assessment. Furthermore, while there is increasing evidence that no prediction algorithm consistently outperforms all others, no work has been done to exploit the complementary strengths of multiple approaches. In this work, we present two contributions to the area of RNA secondary structure prediction. Firstly, we use state-of-the-art, resampling-based statistical methods together with a previously published and increasingly widely used dataset of high-quality RNA structures to conduct a comprehensive evaluation of existing RNA secondary structure prediction procedures. The results from this evaluation clarify the performance relationship between ten well-known existing energy-based pseudoknot-free RNA secondary structure prediction methods and clearly demonstrate the progress that has been achieved in recent years. Secondly, we introduce AveRNA, a generic and powerful method for combining a set of existing secondary structure prediction procedures into an ensemble-based method that achieves significantly higher prediction accuracies than obtained from any of its component procedures. Our new, ensemble-based method, AveRNA, improves the state of the art for energy-based, pseudoknot-free RNA secondary structure prediction by exploiting the complementary strengths of multiple existing prediction procedures, as demonstrated using a state-of-the-art statistical resampling approach. In addition, AveRNA allows an intuitive and effective control of the trade-off between

  12. Feasibility of RNA and DNA Extraction from Fresh Pipelle and Archival Endometrial Tissues for Use in Gene Expression and SNP Arrays

    Directory of Open Access Journals (Sweden)

    Heather D. Kissel

    2013-01-01

    Full Text Available Identifying molecular markers of endometrial hyperplasia (neoplasia progression is critical to cancer prevention. To assess RNA and DNA quantity and quality from routinely collected endometrial samples and evaluate the performance of RNA- and DNA-based arrays across endometrial tissue types, we collected fresh frozen (FF Pipelle, FF curettage, and formalin-fixed paraffin-embedded (FFPE hysterectomy specimens (benign indications from eight women. Additionally, neoplastic and uninvolved tissues from 24 FFPE archival hysterectomy specimens with endometrial hyperplasias and carcinomas were assessed. RNA was extracted from 15 of 16 FF and 51 of 51 FFPE samples, with yields >1.2 μg for 13/15 (87% FF and 50/51 (98% FFPE samples. Extracted RNA was of high quality; all samples performed successfully on the Illumina whole-genome cDNA-mediated annealing, selection, extension, and ligation (WG-DASL array and performance did not vary by tissue type. While DNA quantity from FFPE samples was excellent, quality was not sufficient for successful performance on the Affymetrix SNP Array 6.0. In conclusion, FF Pipelle samples, which are minimally invasive, yielded excellent quantity and quality of RNA for gene expression arrays (similar to FF curettage and should be considered for use in genomic studies. FFPE-derived DNA should be evaluated on new rapidly evolving sequencing platforms.

  13. Effect of halophilic conditions in stabilisation of RNA structure and function at high temperature under radiations.

    Science.gov (United States)

    Maurel, M.-C.

    We have already shown the structural integrity of tRNA at high temperature - 82C for 30h - in high salt concentrations (Tehei et al, 2002). Stability were also performed by measuring the residual specific tRNA charge capacity after heat treatment for 30 h at 82C. RNA molecules are selected (in vitro selection) at high temperature at high salt concentration. We are undergoing studies of such molecules submitted to several stressful conditions, in particular high radiations. These studies provide support for the importance of salt to protect macromolecules against severe cosmic conditions. These could be useful for searching traces of life in planetary objects and space exploration. References : ElAmri, C., Baron, M-H., Maurel, M.-C. ``Adenine adsorption onto and release from meteorite specimens assessed by Surface Enhanced Raman Spectroscopy ''. Journal of Raman Spectroscopy (2004) in press. Meli, M., Vergne, J. and Maurel, M-C. "In vitro selection of adenine-dependent hairpin ribozymes" J. Biol. Chem., (2003), 278, 11, 9835-9842. ElAmri, C., Baron, M-H., Maurel, M.-C. ``Adenine in mineral samples : development of a methodology based on Surface Enhanced Raman Spectroscopy (SERS) for picomole detections ''. Spectrochimica Acta, A, 59, 2645-2654. Tehei, M., Franzetti, B., Maurel, M-C., Vergne, J., Hountondji, C. , Zaccai, G. ``Salt and the Search for Traces of Life '', Extremophiles, (2002), 6 : 427-430. Meli, M., Vergne, J., Décout, J.L., and Maurel, M-C. ``Adenine-Aptamer Complexes. A bipartite RNA site which binds the adenine nucleic base '', J. Biol. Chem., (2002), 277, 3, 2104-2111.

  14. Unprecedented high-resolution view of bacterial operon architecture revealed by RNA sequencing.

    Science.gov (United States)

    Conway, Tyrrell; Creecy, James P; Maddox, Scott M; Grissom, Joe E; Conkle, Trevor L; Shadid, Tyler M; Teramoto, Jun; San Miguel, Phillip; Shimada, Tomohiro; Ishihama, Akira; Mori, Hirotada; Wanner, Barry L

    2014-07-08

    We analyzed the transcriptome of Escherichia coli K-12 by strand-specific RNA sequencing at single-nucleotide resolution during steady-state (logarithmic-phase) growth and upon entry into stationary phase in glucose minimal medium. To generate high-resolution transcriptome maps, we developed an organizational schema which showed that in practice only three features are required to define operon architecture: the promoter, terminator, and deep RNA sequence read coverage. We precisely annotated 2,122 promoters and 1,774 terminators, defining 1,510 operons with an average of 1.98 genes per operon. Our analyses revealed an unprecedented view of E. coli operon architecture. A large proportion (36%) of operons are complex with internal promoters or terminators that generate multiple transcription units. For 43% of operons, we observed differential expression of polycistronic genes, despite being in the same operons, indicating that E. coli operon architecture allows fine-tuning of gene expression. We found that 276 of 370 convergent operons terminate inefficiently, generating complementary 3' transcript ends which overlap on average by 286 nucleotides, and 136 of 388 divergent operons have promoters arranged such that their 5' ends overlap on average by 168 nucleotides. We found 89 antisense transcripts of 397-nucleotide average length, 7 unannotated transcripts within intergenic regions, and 18 sense transcripts that completely overlap operons on the opposite strand. Of 519 overlapping transcripts, 75% correspond to sequences that are highly conserved in E. coli (>50 genomes). Our data extend recent studies showing unexpected transcriptome complexity in several bacteria and suggest that antisense RNA regulation is widespread. Importance: We precisely mapped the 5' and 3' ends of RNA transcripts across the E. coli K-12 genome by using a single-nucleotide analytical approach. Our resulting high-resolution transcriptome maps show that ca. one-third of E. coli operons are

  15. Grafting of human epidermal cells, presence and perspectives

    Czech Academy of Sciences Publication Activity Database

    Smetana, Karel; Dvořánková, B.; Labský, Jiří; Vacík, Jiří; Holíková, Z.

    2001-01-01

    Roč. 102, č. 1 (2001), s. 1-6 ISSN 0036-5327 R&D Projects: GA ČR GA203/00/1310; GA AV ČR IBS4050005; GA MZd ND6340; GA MŠk LN00A065; GA AV ČR KSK4055109 Institutional research plan: CEZ:AV0Z4050913 Keywords : cell therapy-keratinocyte-epidermal stem cell * skin defect Subject RIV: CD - Macromolecular Chemistry

  16. Optimization of phenol extraction procedures for preparation of RNA from mammalian lymphoid organs

    Energy Technology Data Exchange (ETDEWEB)

    Griffin, G.D.; Sellin, H.G.; Novelli, G.D.

    1978-07-01

    Methods have been developed to optimize the extraction of RNA from mammalian lymphoid organs (spleen) with respect to both quantity and quality of RNA and with minimal DNA contamination. Nuclease inhibitors, including diethyl pyrocarbonate, polyvinyl sulfate, and bentonite were used in the initial disruption of the tissue, which was accomplished by blender, Dounce homogenizer, or preparation of a cell suspension. Seven buffer systems, varying with respect to pH, detergent, and NaCl concentration, were used in the initial extraction with phenol, and the temperature of extraction was also varied. Protocols involving the selective use of naphthalene 1.5-disulfonic acid and sodium dodecyl sulfate were developed to provide an initial RNA extract with minimal DNA content. Dounce homogenization, followed by separate treatment of nuclear and cytosol fractions, was found to be the most effective technique, both in terms of RNA yield (averaging 76%) and the quality of RNA recovered (as judged by gel electrophoresis). RNA from blender preparations contained larger amounts of DNA and RNA yield was decreased to 54%. RNA extracted from spleen cell suspensions was of poor quality and gave very poor yield (27%).

  17. Assessing the in vivo impact of a gel sanitizer on the epidermal "barrier" dynamics

    Directory of Open Access Journals (Sweden)

    Henrique Silva

    2015-03-01

    Full Text Available Disease prevention and control depend on hand washing, in particular during epidemic surges (e.g. flu. The use of alcohol-based hand sanitizers is strongly recommended due to its high germicide effectiveness. However, its impact on skin physiology, especially on the barrier function, has not been determined, although most of the formulations include different humectants. This study evaluates the impact of a commercially available formulation on in vivo epidermal barrier dynamics. 13 young adult subjects (21.6 ± 2.6 years old were selected after informed consent. Subjects were asked to apply a commercially available alcohol gel sanitizer to one hand for 15 days. TEWL absolute values were measured on days 1, 8 and 15 and a plastic occlusion stress test (POST applied. Evaporation half-life (t1/2 evap and dynamic water mass (DWM values increased significantly on day 15 on the treated hand compared to the control hand suggesting that, in the present experimental conditions, the regular use of an alcohol-based gel sanitizer does changes the epidermal barrier. This study also confirms the usefulness of this kinetic model to detect subtle changes on in vivo TEWL dynamics.

  18. IntaRNA 2.0: enhanced and customizable prediction of RNA–RNA interactions

    Science.gov (United States)

    Mann, Martin; Wright, Patrick R.

    2017-01-01

    Abstract The IntaRNA algorithm enables fast and accurate prediction of RNA–RNA hybrids by incorporating seed constraints and interaction site accessibility. Here, we introduce IntaRNAv2, which enables enhanced parameterization as well as fully customizable control over the prediction modes and output formats. Based on up to date benchmark data, the enhanced predictive quality is shown and further improvements due to more restrictive seed constraints are highlighted. The extended web interface provides visualizations of the new minimal energy profiles for RNA–RNA interactions. These allow a detailed investigation of interaction alternatives and can reveal potential interaction site multiplicity. IntaRNAv2 is freely available (source and binary), and distributed via the conda package manager. Furthermore, it has been included into the Galaxy workflow framework and its already established web interface enables ad hoc usage. PMID:28472523

  19. How to measure RNA expression in rare senescent cells expressing any specific protein such as p16Ink4a.

    Science.gov (United States)

    Jeyapalan, Jessie C; Sedivy, John M

    2013-02-01

    Here we describe a carefully optimized method for the preparation of high quality RNA by flow sorting of formaldehyde fixed senescent cells immunostained for any intracellular antigen. Replicative cellular senescence is a phenomenon of irreversible growth arrest triggered by the accumulation of a discrete number of cell divisions. The underlying cause of senescence due to replicative exhaustion is telomere shortening. We document here a spontaneous and apparently stochastic process that continuously generates senescent cells in cultures fully immortalized with telomerase. In the course of studying this phenomenon we developed a preparative fluorescence activated flow sorting method based on immunofluorescent staining of intracellular antigens that can also deliver RNA suitable for quantitative analysis of global gene expression. The protocols were developed using normal human diploid fibroblasts (HDF) and up to 5x107 cells could be conveniently processed in a single experiment. The methodology is based on formaldehyde crosslinking of cells, followed by permeabilization, antibody staining, flow sorting, reversal of the crosslinks, and recovery of the RNA. We explored key parameters such as crosslink reversal that affect the fragmentation of RNA. The recovered RNA is of high quality for downstream molecular applications based on short range sequence analysis, such qPCR, hybridization microarrays, and next generation sequencing. The RNA was analyzed by Affymetrix Gene Chip expression profiling and compared to RNA prepared by the direct lysis of cells. The correlation between the data sets was very high, indicating that the procedure does not introduce systematic changes in the mRNA transcriptome. The methods presented in this communication should be of interest to many investigators working in diverse model systems.

  20. Topical Application of Glycolipids from Isochrysis galbana Prevents Epidermal Hyperplasia in Mice

    Directory of Open Access Journals (Sweden)

    Azahara Rodríguez-Luna

    2017-12-01

    Full Text Available Chronic inflammatory skin diseases such as psoriasis have a significant impact on society. Currently, the major topical treatments have many side effects, making their continued use in patients difficult. Microalgae have emerged as a source of bio-active molecules such as glycolipids with potent anti-inflammatory properties. We aimed to investigate the effects of a glycolipid (MGMG-A and a glycolipid fraction (MGDG obtained from the microalga Isochrysis galbana on a TPA-induced epidermal hyperplasia murine model. In a first set of experiments, we examined the preventive effects of MGMG-A and MGDG dissolved in acetone on TPA-induced hyperplasia model in mice. In a second step, we performed an in vivo permeability study by using rhodamine-containing cream, ointment, or gel to determinate the formulation that preserves the skin architecture and reaches deeper. The selected formulation was assayed to ensure the stability and enhanced permeation properties of the samples in an ex vivo experiment. Finally, MGDG-containing cream was assessed in the hyperplasia murine model. The results showed that pre-treatment with acetone-dissolved glycolipids reduced skin edema, epidermal thickness, and pro-inflammatory cytokine production (TNF-α, IL-1β, IL-6, IL-17 in epidermal tissue. The in vivo and ex vivo permeation studies showed that the cream formulation had the best permeability profile. In the same way, MGDG-cream formulation showed better permeation than acetone-dissolved preparation. MGDG-cream application attenuated TPA-induced skin edema, improved histopathological features, and showed a reduction of the inflammatory cell infiltrate. In addition, this formulation inhibited epidermal expression of COX-2 in a similar way to dexamethasone. Our results suggest that an MGDG-containing cream could be an emerging therapeutic strategy for the treatment of inflammatory skin pathologies such as psoriasis.

  1. Comparing the normalization methods for the differential analysis of Illumina high-throughput RNA-Seq data.

    Science.gov (United States)

    Li, Peipei; Piao, Yongjun; Shon, Ho Sun; Ryu, Keun Ho

    2015-10-28

    Recently, rapid improvements in technology and decrease in sequencing costs have made RNA-Seq a widely used technique to quantify gene expression levels. Various normalization approaches have been proposed, owing to the importance of normalization in the analysis of RNA-Seq data. A comparison of recently proposed normalization methods is required to generate suitable guidelines for the selection of the most appropriate approach for future experiments. In this paper, we compared eight non-abundance (RC, UQ, Med, TMM, DESeq, Q, RPKM, and ERPKM) and two abundance estimation normalization methods (RSEM and Sailfish). The experiments were based on real Illumina high-throughput RNA-Seq of 35- and 76-nucleotide sequences produced in the MAQC project and simulation reads. Reads were mapped with human genome obtained from UCSC Genome Browser Database. For precise evaluation, we investigated Spearman correlation between the normalization results from RNA-Seq and MAQC qRT-PCR values for 996 genes. Based on this work, we showed that out of the eight non-abundance estimation normalization methods, RC, UQ, Med, TMM, DESeq, and Q gave similar normalization results for all data sets. For RNA-Seq of a 35-nucleotide sequence, RPKM showed the highest correlation results, but for RNA-Seq of a 76-nucleotide sequence, least correlation was observed than the other methods. ERPKM did not improve results than RPKM. Between two abundance estimation normalization methods, for RNA-Seq of a 35-nucleotide sequence, higher correlation was obtained with Sailfish than that with RSEM, which was better than without using abundance estimation methods. However, for RNA-Seq of a 76-nucleotide sequence, the results achieved by RSEM were similar to without applying abundance estimation methods, and were much better than with Sailfish. Furthermore, we found that adding a poly-A tail increased alignment numbers, but did not improve normalization results. Spearman correlation analysis revealed that RC, UQ

  2. Mammalian tissues defective in nonsense-mediated mRNA decay display highly aberrant splicing patterns

    DEFF Research Database (Denmark)

    Weischenfeldt, Joachim Lütken; Waage, Johannes Eichler; Tian, Geng

    2012-01-01

    ABSTRACT: BACKGROUND: Nonsense-mediated mRNA decay (NMD) affects the outcome of alternative splicing by degrading mRNA isoforms with premature termination codons. Splicing regulators constitute important NMD targets; however, the extent to which loss of NMD causes extensive deregulation...... of alternative splicing has not previously been assayed in a global, unbiased manner. Here, we combine mouse genetics and RNA-seq to provide the first in vivo analysis of the global impact of NMD on splicing patterns in two primary mouse tissues ablated for the NMD factor UPF2. RESULTS: We developed...... importance, the latter events are associated with high intronic conservation. CONCLUSIONS: Our data demonstrate that NMD regulates alternative splicing outcomes through an intricate web of splicing regulators and that its loss leads to the deregulation of a panoply of splicing events, providing novel...

  3. Dynamic thermal effects of epidermal melanin and plasmonic nanoparticles during photoacoustic breast imaging

    Science.gov (United States)

    Ghassemi, Pejhman; Wang, Quanzeng; Pfefer, T. Joshua

    2016-03-01

    Photoacoustic Tomography (PAT) employs high-power near-infrared (near-IR) laser pulses to generate structural and functional information on tissue chromophores up to several centimeters below the surface. Such insights may facilitate detection of breast cancer - the most common cancer in women. PAT mammography has been the subject of extensive research, including techniques based on exogenous agents for PAT contrast enhancement and molecular specificity. However, photothermal safety risks of PAT due to strong chromophores such as epidermal melanin and plasmonic nanoparticles have not been rigorously studied. We have used computational and experimental approaches to elucidate highly dynamic optical-thermal processes during PAT. A Monte Carlo model was used to simulate light propagation at 800 and 1064 nm in a multi-layer breast tissue geometry with different epidermal pigmentation levels and a tumorsimulating inclusion incorporating nanoparticles. Energy deposition results were then used in a bioheat transfer model to simulate temperature transients. Experimental measurements involved multi-layer hydrogel phantoms with inclusions incorporating gold nanoparticles. Phantom optical properties were measured using the inverse adding-doubling technique. Thermal imaging was performed as phantoms were irradiated with 5 ns near-IR pulses. Scenarios using 10 Hz laser irradiation of breast tissue containing various nanoparticle concentrations were implemented experimentally and computationally. Laser exposure levels were based on ANSI/IEC limits. Surface temperature measurements were compared to corresponding simulation data. In general, the effect of highly pigmented skin on temperature rise was significant, whereas unexpectedly small levels of temperature rise during nanoparticle irradiation were attributed to rapid photodegradation. Results provide key initial insights into light-tissue interactions impacting the safety and effectiveness of PAT.

  4. High-throughput SHAPE analysis reveals structures in HIV-1 genomic RNA strongly conserved across distinct biological states.

    Directory of Open Access Journals (Sweden)

    Kevin A Wilkinson

    2008-04-01

    Full Text Available Replication and pathogenesis of the human immunodeficiency virus (HIV is tightly linked to the structure of its RNA genome, but genome structure in infectious virions is poorly understood. We invent high-throughput SHAPE (selective 2'-hydroxyl acylation analyzed by primer extension technology, which uses many of the same tools as DNA sequencing, to quantify RNA backbone flexibility at single-nucleotide resolution and from which robust structural information can be immediately derived. We analyze the structure of HIV-1 genomic RNA in four biologically instructive states, including the authentic viral genome inside native particles. Remarkably, given the large number of plausible local structures, the first 10% of the HIV-1 genome exists in a single, predominant conformation in all four states. We also discover that noncoding regions functioning in a regulatory role have significantly lower (p-value < 0.0001 SHAPE reactivities, and hence more structure, than do viral coding regions that function as the template for protein synthesis. By directly monitoring protein binding inside virions, we identify the RNA recognition motif for the viral nucleocapsid protein. Seven structurally homologous binding sites occur in a well-defined domain in the genome, consistent with a role in directing specific packaging of genomic RNA into nascent virions. In addition, we identify two distinct motifs that are targets for the duplex destabilizing activity of this same protein. The nucleocapsid protein destabilizes local HIV-1 RNA structure in ways likely to facilitate initial movement both of the retroviral reverse transcriptase from its tRNA primer and of the ribosome in coding regions. Each of the three nucleocapsid interaction motifs falls in a specific genome domain, indicating that local protein interactions can be organized by the long-range architecture of an RNA. High-throughput SHAPE reveals a comprehensive view of HIV-1 RNA genome structure, and further

  5. Tumores dermóides e epidermóides intra-espinhas

    Directory of Open Access Journals (Sweden)

    Oscar Fontenelle Filho

    1971-03-01

    Full Text Available São relatados dois casos de tumores epidermóides e um de tumor dermóide, todos intrarraquianos. Este último era de localização epidural ao nível da coluna torácica (caso 3; os dois tumores epidermóides situavam-se na coluna tóraco-lombar (caso 1 e lombar (caso 2, respectivamente, sendo o primeiro intramedular e o segundo intradural. Em dois casos (casos 2 e 3 os tumores associavam-se a fístula dérmica congênita. Um paciente (caso 3 foi operado aos dois meses de idade; a descoberta do tumor deveu-se à realização da raquimanometria que revelou bloqueio, apesar do paciente não apresentar qualquer sinal neurológico de compressão medular. Os autores são de opinião que, em presença de fístula dérmica congênita ao nível da coluna vertebral, principalmente quando localizada acima do segmento lombosacro, deve-se sempre suspeitar da possibilidade do tumor epidermóide ou dermóide intrarraquiano, mesmo na ausência de sinais neurológicos. A combinação de sintomas neurológicos de longa duração, a evidência radiológica de erosão e alargamento do canal raquiano e a história de fístula dérmica congênita proporcionaram o diagnóstico pré-operatório correto no caso 2.

  6. Neonatal hyperthyroidism impairs epinephrine-provoked secretion of nerve growth factor and epidermal growth factor in mouse saliva.

    Science.gov (United States)

    Lakshmanan, J; Landel, C P

    1986-07-01

    We examined long-term effects of neonatal hyperthyroidism on salivary secretions of nerve growth factor and epidermal growth factor in male and female mice at the age of 31 days. Hyperthyroidism was induced by thyroxine (T4) injections (0.4 microgram/g body weight/day) during days 0-6. Littermate control mice were treated with vehicle. T4 treatment did not alter the amounts of protein secreted into saliva but hormone administration induced alteration in the types of protein secreted. T4 treatment decreased the contents of both nerve growth factor and epidermal growth factor secreted into the saliva. A Sephadex G-200 column chromatographic profile revealed the presence of two distinct nerve growth factor immunoreactive peaks, while epidermal growth factor immunoreactivity predominantly eluted as a single low molecular weight form. T4 treatment did not alter the molecular nature of their secretion, but the treatment decreased their contents. These results indicate an impairment in salivary secretion of nerve growth factor and epidermal growth factor long after T4 treatment has been discontinued.

  7. MicroRNA-target binding structures mimic microRNA duplex structures in humans.

    Directory of Open Access Journals (Sweden)

    Xi Chen

    Full Text Available Traditionally, researchers match a microRNA guide strand to mRNA sequences using sequence comparisons to predict its potential target genes. However, many of the predictions can be false positives due to limitations in sequence comparison alone. In this work, we consider the association of two related RNA structures that share a common guide strand: the microRNA duplex and the microRNA-target binding structure. We have analyzed thousands of such structure pairs and found many of them share high structural similarity. Therefore, we conclude that when predicting microRNA target genes, considering just the microRNA guide strand matches to gene sequences may not be sufficient--the microRNA duplex structure formed by the guide strand and its companion passenger strand must also be considered. We have developed software to translate RNA binding structure into encoded representations, and we have also created novel automatic comparison methods utilizing such encoded representations to determine RNA structure similarity. Our software and methods can be utilized in the other RNA secondary structure comparisons as well.

  8. Epidermal hydration levels in rosacea patients improve after minocycline therapy.

    LENUS (Irish Health Repository)

    Ní Raghallaigh, S

    2013-12-06

    Patients with rosacea frequently report increased skin sensitivity, with features suggestive of an abnormal stratum corneum (SC) permeability barrier. Sebum, pH and hydration levels influence epidermal homeostasis. The correlation of the change in these parameters with clinically effective treatment has not been previously analysed.

  9. Epidermal Langerhans' cell induction of immunity against an ultraviolet-induced skin tumour

    International Nuclear Information System (INIS)

    Cavanagh, L.L.; Sluyter, R.; Henderson, K.G.; Barnetson, R.St.C.; Halliday, G.M.

    1996-01-01

    Lanerghans' cells (LC) have been shown experimentally to induce immune response against many antigens; however, their role in the initiation of anti-tumour immunity has received little attention. This study examined the ability of murine epidermal LC to induce immunity to an ultraviolet radiation (UV)-induced skin tumour. Freshly prepared epidermal cells (EC) were cultured for 2 or 20 hr with granulocyte-macrophage colony-stimulating factor (GM-CSF), pulsed with an extract of the UV-13-1 tumour, then used to immunize naive syngeneic mice. Delayed type hypersensitivity (DTH) was elicited 10 days after immunization by injection of UV-13-1 tumour cells into the ear pinna, and measured 24 hr later. EC cultured with GM-CSF for 2 hr induced anti-tumour DTH, as did EC cultured for 20 hr without GM-CSF. Conversely, EC cultured for 2 hr without GM-CSF, or EC cultured for 20 hr with GM-CSF were unable to induce a DTH. Induction of immunity required active presentation of tumour antigens by Ia + EC and was tumour specific. Thus Ia + epidermal cells are capable of inducing anti-tumour immunity to UV-induced skin tumours, but only when they contact antigen in particular states of maturation. (author)

  10. Reduced epidermal thickness, nerve degeneration and increased pain-related behavior in rats with diabetes type 1 and 2.

    Science.gov (United States)

    Boric, Matija; Skopljanac, Ivan; Ferhatovic, Lejla; Jelicic Kadic, Antonia; Banozic, Adriana; Puljak, Livia

    2013-11-01

    To examine the mechanisms contributing to pain genesis in diabetic neuropathy, we investigated epidermal thickness and number of intraepidermal nerve fibers in rat foot pad of the animal model of diabetes type 1 and type 2 in relation to pain-related behavior. Male Sprague-Dawley rats were used. Diabetes type 1 was induced with intraperitoneal injection of streptozotocin (STZ) and diabetes type 2 was induced with a combination of STZ and high-fat diet. Control group for diabetes type 1 was fed with regular laboratory chow, while control group for diabetes type 2 received high-fat diet. Body weights and blood glucose levels were monitored to confirm induction of diabetes. Pain-related behavior was analyzed using thermal (hot, cold) and mechanical stimuli (von Frey fibers, number of hyperalgesic responses). Two months after induction of diabetes, glabrous skin samples from plantar surface of the both hind paws were collected. Epidermal thickness was evaluated with hematoxylin and eosin staining. Intraepidermal nerve fibers quantification was performed after staining skin with polyclonal antiserum against protein gene product 9.5. We found that induction of diabetes type 1 and type 2 causes significant epidermal thinning and loss of intraepidermal nerve fibers in a rat model, and both changes were more pronounced in diabetes type 1 model. Significant increase of pain-related behavior two months after induction of diabetes was observed only in a model of diabetes type 1. In conclusion, animal models of diabetes type 1 and diabetes type 2 could be used in pharmacological studies, where cutaneous changes could be used as outcome measures for predegenerative markers of neuropathies. Copyright © 2013 Elsevier B.V. All rights reserved.

  11. Improved measurements of RNA structure conservation with generalized centroid estimators

    Directory of Open Access Journals (Sweden)

    Yohei eOkada

    2011-08-01

    Full Text Available Identification of non-protein-coding RNAs (ncRNAs in genomes is acrucial task for not only molecular cell biology but alsobioinformatics. Secondary structures of ncRNAs are employed as a keyfeature of ncRNA analysis since biological functions of ncRNAs aredeeply related to their secondary structures. Although the minimumfree energy (MFE structure of an RNA sequence is regarded as the moststable structure, MFE alone could not be an appropriate measure foridentifying ncRNAs since the free energy is heavily biased by thenucleotide composition. Therefore, instead of MFE itself, severalalternative measures for identifying ncRNAs have been proposed such asthe structure conservation index (SCI and the base pair distance(BPD, both of which employ MFE structures. However, thesemeasurements are unfortunately not suitable for identifying ncRNAs insome cases including the genome-wide search and incur high falsediscovery rate. In this study, we propose improved measurements basedon SCI and BPD, applying generalized centroid estimators toincorporate the robustness against low quality multiple alignments.Our experiments show that our proposed methods achieve higher accuracythan the original SCI and BPD for not only human-curated structuralalignments but also low quality alignments produced by CLUSTALW. Furthermore, the centroid-based SCI on CLUSTAL W alignments is moreaccurate than or comparable with that of the original SCI onstructural alignments generated with RAF, a high quality structuralaligner, for which two-fold expensive computational time is requiredon average. We conclude that our methods are more suitable forgenome-wide alignments which are of low quality from the point of viewon secondary structures than the original SCI and BPD.

  12. Adenylylation of small RNA sequencing adapters using the TS2126 RNA ligase I.

    Science.gov (United States)

    Lama, Lodoe; Ryan, Kevin

    2016-01-01

    Many high-throughput small RNA next-generation sequencing protocols use 5' preadenylylated DNA oligonucleotide adapters during cDNA library preparation. Preadenylylation of the DNA adapter's 5' end frees from ATP-dependence the ligation of the adapter to RNA collections, thereby avoiding ATP-dependent side reactions. However, preadenylylation of the DNA adapters can be costly and difficult. The currently available method for chemical adenylylation of DNA adapters is inefficient and uses techniques not typically practiced in laboratories profiling cellular RNA expression. An alternative enzymatic method using a commercial RNA ligase was recently introduced, but this enzyme works best as a stoichiometric adenylylating reagent rather than a catalyst and can therefore prove costly when several variant adapters are needed or during scale-up or high-throughput adenylylation procedures. Here, we describe a simple, scalable, and highly efficient method for the 5' adenylylation of DNA oligonucleotides using the thermostable RNA ligase 1 from bacteriophage TS2126. Adapters with 3' blocking groups are adenylylated at >95% yield at catalytic enzyme-to-adapter ratios and need not be gel purified before ligation to RNA acceptors. Experimental conditions are also reported that enable DNA adapters with free 3' ends to be 5' adenylylated at >90% efficiency. © 2015 Lama and Ryan; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  13. Carbon isotope ratios of epidermal and mesophyll tissues from leaves of C3 and CAM plants

    International Nuclear Information System (INIS)

    Nishida, K.; Roksandic, Z.; Osmond, B.

    1981-01-01

    The δ 13 C values for epidermal and mesophyll tissues of two C 3 plants, Commelina communis and Tulipa gesneriana, and a CAM plant, Kalanchoē daigremontiana, were measured. The values for the tissues of both C 3 plants were similar. In young leaves of Kalanchoē, the epidermis and the mesophyll showed S 13 C values which were nearly identical, and similar to those found in C 3 plants. However, markedly more negative values for epidermal compared to mesophyll tissue, were obtained in the mature Kalanchoē leaf. This is consistent with the facts that the epidermis in a CAM leaf is formed when leaves engage in C 3 photosynthesis and that subsequent dark CO 2 fixation in guard cells or mesophyll cells makes only a small contribution to total epidermal carbon

  14. Clinical characteristics and epidermal barrier function of papulopustular rosacea: A comparison study with acne vulgaris.

    Science.gov (United States)

    Zhou, Maosong; Xie, Hongfu; Cheng, Lin; Li, Ji

    2016-01-01

    To evaluate the clinical characteristics and epidermal barrier function of papulopustular rosacea by comparing with acne vulgaris. Four hundred and sixty-three papulopustular rosacea patients and four hundred and twelve acne vulgaris patients were selected for the study in Xiangya Hospital of Central South University from March 2015 to May 2016. They were analyzed for major facial lesions, self-conscious symptoms and epidermal barrier function. Erythema, burning, dryness and itching presented in papulopustular rosacea patients were significantly higher than that in acne vulgaris patients ( P acne vulgaris patients ( P acne vulgaris patients ( P acne vulgaris patients in comparison with that of healthy subjects ( P >0.05, P acne vulgaris patients and healthy subjects ( P acne vulgaris patients than that of healthy subjects ( P acne vulgaris. The epidermal barrier function was damaged in papulopustular rosacea patients while not impaired in that of acne vulgaris patients.

  15. Conformational Selection and Induced Fit for RNA Polymerase and RNA/DNA Hybrid Backtracked Recognition

    Directory of Open Access Journals (Sweden)

    Haifeng eChen

    2015-11-01

    Full Text Available RNA polymerase catalyzes transcription with a high fidelity. If DNA/RNA mismatch or DNA damage occurs downstream, a backtracked RNA polymerase can proofread this situation. However, the backtracked mechanism is still poorly understood. Here we have performed multiple explicit-solvent molecular dynamics (MD simulations on bound and apo DNA/RNA hybrid to study backtracked recognition. MD simulations at room temperature suggest that specific electrostatic interactions play key roles in the backtracked recognition between the polymerase and DNA/RNA hybrid. Kinetics analysis at high temperature shows that bound and apo DNA/RNA hybrid unfold via a two-state process. Both kinetics and free energy landscape analyses indicate that bound DNA/RNA hybrid folds in the order of DNA/RNA contracting, the tertiary folding and polymerase binding. The predicted Φ-values suggest that C7, G9, dC12, dC15 and dT16 are key bases for the backtracked recognition of DNA/RNA hybrid. The average RMSD values between the bound structures and the corresponding apo ones and Kolmogorov-Smirnov (KS P test analyses indicate that the recognition between DNA/RNA hybrid and polymerase might follow an induced fit mechanism for DNA/RNA hybrid and conformation selection for polymerase. Furthermore, this method could be used to relative studies of specific recognition between nucleic acid and protein.

  16. Methods for RNA Analysis

    DEFF Research Database (Denmark)

    Olivarius, Signe

    of the transcriptome, 5’ end capture of RNA is combined with next-generation sequencing for high-throughput quantitative assessment of transcription start sites by two different methods. The methods presented here allow for functional investigation of coding as well as noncoding RNA and contribute to future...... RNAs rely on interactions with proteins, the establishment of protein-binding profiles is essential for the characterization of RNAs. Aiming to facilitate RNA analysis, this thesis introduces proteomics- as well as transcriptomics-based methods for the functional characterization of RNA. First, RNA...

  17. Aminoacyl-tRNA quality control is required for efficient activation of the TOR pathway regulator Gln3p.

    Science.gov (United States)

    Mohler, Kyle; Mann, Rebecca; Kyle, Amanda; Reynolds, Noah; Ibba, Michael

    2017-09-14

    The aminoacylation status of the cellular tRNA pool regulates both general amino acid control (GAAC) and target of rapamycin (TOR) stress response pathways in yeast. Consequently, fidelity of translation at the level of aminoacyl-tRNA synthesis plays a central role in determining accuracy and sensitivity of stress responses. To investigate effects of translational quality control (QC) on cell physiology under stress conditions, phenotypic microarray analyses were used to identify changes in QC deficient cells. Nitrogen source growth assays showed QC deficient yeast grew differently compared to WT. The QC deficient strain was more tolerant to caffeine treatment than wild type through altered interactions with the TOR and GAAC pathways. Increased caffeine tolerance of the QC deficient strain was consistent with the observation that the activity of Gln3p, a transcription factor controlled by the TOR pathway, is decreased in the QC deficient strain compared to WT. GCN4 translation, which is typically repressed in the absence of nutritional stress, was enhanced in the QC deficient strain through TOR inhibition. QC did not impact cell cycle regulation; however, the chronological lifespan of QC deficient yeast strains decreased compared to wild type, likely due to translational errors and alteration of the TOR-associated regulon. These findings support the idea that changes in translational fidelity provide a mechanism of cellular adaptation by modulating TOR activity. This, in turn, supports a central role for aminoacyl-tRNA synthesis QC in the integrated stress response by maintaining the proper aa-tRNA pools necessary to coordinate the GAAC and TOR.

  18. Influence of topical human epidermal growth factor on postkeratoplasty re-epithelialisation

    NARCIS (Netherlands)

    M.M. Dellaert; T.A. Casey; S. Wiffen; J. Gordon (Jocelynne); P. Johnson (Jürgen); A.J. Geerards (Annette); W.J. Rijneveld (Wilhelmina); L. Remeijer (Lies); W.H. Beekhuis (Houdijn); P.G.H. Mulder (Paul)

    1997-01-01

    textabstractAIM: To test the efficacy and safety of recombinant human epidermal growth factor (hEGF) on corneal re-epithelialisation following penetrating keratoplasty. METHODS: A prospective, randomised, placebo controlled study was carried out in which patients were

  19. Availability of high quality weather data measurements

    DEFF Research Database (Denmark)

    Andersen, Elsa; Johansen, Jakob Berg; Furbo, Simon

    In the period 2016-2017 the project “Availability of high quality weather data measurements” is carried out at Department of Civil Engineering at the Technical University of Denmark. The aim of the project is to establish measured high quality weather data which will be easily available...... for the building energy branch and the solar energy branch in their efforts to achieve energy savings and for researchers and students carrying out projects where measured high quality weather data are needed....

  20. The immigration delay disease: adermatoglyphia-inherited absence of epidermal ridges.

    Science.gov (United States)

    Burger, Bettina; Fuchs, Dana; Sprecher, Eli; Itin, Peter

    2011-05-01

    In the digital age, personal identification by fingerprints (epidermal ridges) has become more frequent and is often required for biometric passports. The more fingerprints are analyzed, the more variants in their formation are documented. Individuals completely missing fingerprints as an isolated finding are extremely rare. Only 4 kindreds have been described to date, with additional clinical features in most cases. We describe a female patient with missing epidermal ridges on the fingers, palms, toes, and soles as an isolated feature. Absent fingerprints, or adermatoglyphia, were inherited over 4 generations of her family in an autosomal dominant fashion. We present the clinical features of the index patient, and compare the case with previous reports in the literature. Because of problems in personal identification, this embryologic malformation caused the patient significant difficulties when traveling to other countries, which is why we name it the immigration delay disease. Copyright © 2009 American Academy of Dermatology, Inc. Published by Mosby, Inc. All rights reserved.