WorldWideScience

Sample records for high-quality epidermal rna

  1. Extraction of high-quality epidermal RNA after ammonium thiocyanate-induced dermo-epidermal separation of 4 mm human skin biopsies

    DEFF Research Database (Denmark)

    Clemmensen, Anders; Thomassen, Mads; Clemmensen, Ole

    2009-01-01

    To obtain a separation of the epidermal and dermal compartments to examine compartment specific biological mechanisms in the skin, we incubated 4 mm human skin punch biopsies in ammonium thiocyanate. We wanted to test (i) the histological quality of the dermo-epidermal separation obtained...... by different incubation times; (ii) the amount and quality of extractable epidermal RNA and (iii) its impact on sample RNA expression profiles assessed by large-scale gene expression microarray analysis in both normal and inflamed skin. At 30-min incubation, the split between dermis and epidermis...... and almost completely separated from the dermis of 4 mm skin biopsies by 30 min incubation in 3.8% ammonium thiocyanate combined with curettage of the dermal surface, producing high-quality RNA suitable for transcriptional analysis. Our refined method of dermo-epidermal separation will undoubtedly prove...

  2. High Quality RNA Isolation from Leaf, Shell, Root Tissues and Callus of Hazelnut (Corylus avellana L.

    Directory of Open Access Journals (Sweden)

    Hossein Khosravi

    2017-12-01

    Full Text Available Extraction of high quality RNA is a critical step in molecular genetics studies. Hazelnut is one of the most important nuts plants in the world. The presence of the taxol and other taxanes in hazelnut plant necessitates explaining their biosynthesis pathway and identifying the candidate genes. Therefore, an easy and practical method is necessary for RNA extraction from hazelnuts. Hazelnut has high levels of phenolic compounds. High amounts of polyphenolic and polysaccharide compounds in plants could be causing problems in RNA extraction procedures.  To avoid these problems, a simple and efficient method can be used based on cetyltrimethylammonium bromide (CTAB extraction buffer and lithium chloride for extraction of high quality RNA from different parts of hazelnut plant. Using this method, a high-quality RNA sample (light absorbed in the A260/A280 was 2.04

  3. Isolation of high-quality total RNA from leaves of Myrciaria dubia "CAMU CAMU".

    Science.gov (United States)

    Gómez, Juan Carlos Castro; Reátegui, Alina Del Carmen Egoavil; Flores, Julián Torres; Saavedra, Roberson Ramírez; Ruiz, Marianela Cobos; Correa, Sixto Alfredo Imán

    2013-01-01

    Myrciaria dubia is a main source of vitamin C for people in the Amazon region. Molecular studies of M. dubia require high-quality total RNA from different tissues. So far, no protocols have been reported for total RNA isolation from leaves of this species. The objective of this research was to develop protocols for extracting high-quality total RNA from leaves of M. dubia. Total RNA was purified following two modified protocols developed for leaves of other species (by Zeng and Yang, and by Reid et al.) and one modified protocol developed for fruits of the studied species (by Silva). Quantity and quality of purified total RNA were assessed by spectrophotometric and electrophoretic analysis. Additionally, quality of total RNA was evaluated with reverse-transcription polymerase chain reaction (RT-PCR). With these three modified protocols we were able to isolate high-quality RNA (A260nm/A280nm >1.9 and A260nm/A230nm >2.0). Highest yield was produced with the Zeng and Yang modified protocol (384±46µg ARN/g fresh weight). Furthermore, electrophoretic analysis showed the integrity of isolated RNA and the absence of DNA. Another proof of the high quality of our purified RNA was the successful cDNA synthesis and amplification of a segment of the M. dubia actin 1 gene. We report three modified protocols for isolation total RNA from leaves of M. dubia. The modified protocols are easy, rapid, low in cost, and effective for high-quality and quantity total RNA isolation suitable for cDNA synthesis and polymerase chain reaction.

  4. High-quality total RNA isolation from melon (Cucumis melo L. fruits rich in polysaccharides

    Directory of Open Access Journals (Sweden)

    Gabrielle Silveira de Campos

    2017-08-01

    Full Text Available Melon, a member of the family Cucurbitaceae, is the fourth most important fruit in the world market and, on a volume basis, is Brazil’s main fresh fruit export. Many molecular techniques used to understand the maturation of these fruits require high concentrations of highly purified RNA. However, melons are rich in polyphenolic compounds and polysaccharides, which interfere with RNA extraction. This study aimed to determine the most appropriate method for total RNA extraction from melon fruits. Six extraction buffers were tested: T1 guanidine thiocyanate/phenol/chloroform; T2 sodium azide/?-mercaptoethanol; T3 phenol/guanidine thiocyanate; T4 CTAB/PVP/?-mercaptoethanol; T5 SDS/sodium perchlorate/PVP/?-mercaptoethanol, and T6 sarkosyl/PVP/guanidine thiocyanate, using the AxyPrepTM Multisource Total RNA Miniprep Kit. The best method for extracting RNA from both mature and green fruit was based on the SDS/PVP/?-mercaptoethanol buffer, because it rapidly generated a high quality and quantity of material. In general, higher amounts of RNA were obtained from green than mature fruits, probably due to the lower concentration of polysaccharides and water. The purified material can be used as a template in molecular techniques, such as microarrays, RT-PCR, and in the construction of cDNA and RNA-seq data.

  5. High quality RNA isolation from Aedes aegypti midguts using laser microdissection microscopy

    Directory of Open Access Journals (Sweden)

    Gobert Geoffrey N

    2011-05-01

    Full Text Available Abstract Background Laser microdissection microscopy (LMM has potential as a research tool because it allows precise excision of target tissues or cells from a complex biological specimen, and facilitates tissue-specific sample preparation. However, this method has not been used in mosquito vectors to date. To this end, we have developed an LMM method to isolate midgut RNA using Aedes aegypti. Results Total RNA was isolated from Ae. aegypti midguts that were either fresh-frozen or fixed with histological fixatives. Generally, fresh-frozen tissue sections are a common source of quality LMM-derived RNA; however, our aim was to develop an LMM protocol that could inactivate pathogenic viruses by fixation, while simultaneously preserving RNA from arbovirus-infected mosquitoes. Three groups (10 - 15 mosquitoes per group of female Ae. aegypti at 24 or 48-hours post-blood meal were intrathoracically injected with one of seven common fixatives (Bouin's, Carnoy's, Formoy's, Cal-Rite, 4% formalin, 10% neutral buffered formalin, or zinc formalin to evaluate their effect on RNA quality. Total RNA was isolated from the fixed abdomens using a Trizol® method. The results indicated that RNA from Carnoy's and Bouin's fixative samples was comparable to that of fresh frozen midguts (control in duplicate experiments. When Carnoy's and Bouin's were used to fix the midguts for the LMM procedure, however, Carnoy's-fixed RNA clearly showed much less degradation than Bouin's-fixed RNA. In addition, a sample of 5 randomly chosen transcripts were amplified more efficiently using the Carnoy's treated LMM RNA than Bouin's-fixed RNA in quantitative real-time PCR (qRT-PCR assays, suggesting there were more intact target mRNAs in the Carnoy's fixed RNA. The yields of total RNA ranged from 0.3 to 19.0 ng per ~3.0 × 106 μm2 in the LMM procedure. Conclusions Carnoy's fixative was found to be highly compatible with LMM, producing high quality RNA from Ae. aegypti midguts while

  6. A Rapid and Efficient Method for Purifying High Quality Total RNA from Peaches (Prunus persica for Functional Genomics Analyses

    Directory of Open Access Journals (Sweden)

    LEE MEISEL

    2005-01-01

    Full Text Available Prunus persica has been proposed as a genomic model for deciduous trees and the Rosaceae family. Optimized protocols for RNA isolation are necessary to further advance studies in this model species such that functional genomics analyses may be performed. Here we present an optimized protocol to rapidly and efficiently purify high quality total RNA from peach fruits (Prunus persica. Isolating high-quality RNA from fruit tissue is often difficult due to large quantities of polysaccharides and polyphenolic compounds that accumulate in this tissue and co-purify with the RNA. Here we demonstrate that a modified version of the method used to isolate RNA from pine trees and the woody plant Cinnamomun tenuipilum is ideal for isolating high quality RNA from the fruits of Prunus persica. This RNA may be used for many functional genomic based experiments such as RT-PCR and the construction of large-insert cDNA libraries.

  7. Extraction of High Quality RNA from Cannabis sativa Bast Fibres: A Vademecum for Molecular Biologists

    Directory of Open Access Journals (Sweden)

    Gea Guerriero

    2016-07-01

    Full Text Available In plants there is no universal protocol for RNA extraction, since optimizations are required depending on the species, tissues and developmental stages. Some plants/tissues are rich in secondary metabolites or synthesize thick cell walls, which hinder an efficient RNA extraction. One such example is bast fibres, long extraxylary cells characterized by a thick cellulosic cell wall. Given the economic importance of bast fibres, which are used in the textile sector, as well as in biocomposites as green substitutes of glass fibres, it is desirable to better understand their development from a molecular point of view. This knowledge favours the development of biotechnological strategies aimed at improving specific properties of bast fibres. To be able to perform high-throughput analyses, such as, for instance, transcriptomics of bast fibres, RNA extraction is a crucial and limiting step. We here detail a protocol enabling the rapid extraction of high quality RNA from the bast fibres of textile hemp, Cannabis sativa L., a multi-purpose fibre crop standing in the spotlight of research.

  8. Protocol: A simple phenol-based method for 96-well extraction of high quality RNA from Arabidopsis

    Directory of Open Access Journals (Sweden)

    Coustham Vincent

    2011-03-01

    Full Text Available Abstract Background Many experiments in modern plant molecular biology require the processing of large numbers of samples for a variety of applications from mutant screens to the analysis of natural variants. A severe bottleneck to many such analyses is the acquisition of good yields of high quality RNA suitable for use in sensitive downstream applications such as real time quantitative reverse-transcription-polymerase chain reaction (real time qRT-PCR. Although several commercial kits are available for high-throughput RNA extraction in 96-well format, only one non-kit method has been described in the literature using the commercial reagent TRIZOL. Results We describe an unusual phenomenon when using TRIZOL reagent with young Arabidopsis seedlings. This prompted us to develop a high-throughput RNA extraction protocol (HTP96 adapted from a well established phenol:chloroform-LiCl method (P:C-L that is cheap, reliable and requires no specialist equipment. With this protocol 192 high quality RNA samples can be prepared in 96-well format in three hours (less than 1 minute per sample with less than 1% loss of samples. We demonstrate that the RNA derived from this protocol is of high quality and suitable for use in real time qRT-PCR assays. Conclusion The development of the HTP96 protocol has vastly increased our sample throughput, allowing us to fully exploit the large sample capacity of modern real time qRT-PCR thermocyclers, now commonplace in many labs, and develop an effective high-throughput gene expression platform. We propose that the HTP96 protocol will significantly benefit any plant scientist with the task of obtaining hundreds of high quality RNA extractions.

  9. Isolation of high quality RNA from pistachio (Pistacia vera L.) and other woody plants high in secondary metabolites.

    Science.gov (United States)

    Moazzam Jazi, Maryam; Rajaei, Saideh; Seyedi, Seyed Mahdi

    2015-10-01

    The quality and quantity of RNA are critical for successful downstream transcriptome-based studies such as microarrays and RNA sequencing (RNA-Seq). RNA isolation from woody plants, such as Pistacia vera, with very high amounts of polyphenols and polysaccharides is an enormous challenge. Here, we describe a highly efficient protocol that overcomes the limitations posed by poor quality and low yield of isolated RNA from pistachio and various recalcitrant woody plants. The key factors that resulted in a yield of 150 μg of high quality RNA per 200 mg of plant tissue include the elimination of phenol from the extraction buffer, raising the concentration of β-mercaptoethanol, long time incubation at 65 °C, and nucleic acid precipitation with optimized volume of NaCl and isopropyl alcohol. Also, the A260/A280 and A260/A230 of extracted RNA were about 1.9-2.1and 2.2-2.3, respectively, revealing the high purity. Since the isolated RNA passed highly stringent quality control standards for sensitive reactions, including RNA sequencing and real-time PCR, it can be considered as a reliable and cost-effective method for RNA extraction from woody plants.

  10. Isolation of high-quality total RNA from rumen anaerobic bacteria and fungi, and subsequent detection of glycoside hydrolases.

    Science.gov (United States)

    Wang, Pan; Qi, Meng; Barboza, Perry; Leigh, Mary Beth; Ungerfeld, Emilio; Selinger, L Brent; McAllister, Tim A; Forster, Robert J

    2011-07-01

    The rumen is one of the most powerful fibrolytic fermentation systems known. Gene expression analyses, such as reverse transcription PCR (RT-PCR), microarrays, and metatranscriptomics, are techniques that could significantly expand our understanding of this ecosystem. The ability to isolate and stabilize representative RNA samples is critical to obtaining reliable results with these procedures. In this study, we successfully isolated high-quality total RNA from the solid phase of ruminal contents by using an improved RNA extraction method. This method is based on liquid nitrogen grinding of whole ruminal solids without microbial detachment and acid guanidinium - phenol - chloroform extraction combined with column purification. Yields of total RNA were as high as 150 µg per g of fresh ruminal content. The typical large subunit/small subunit rRNA ratio ranged from 1.8 to 2.0 with an RNA integrity number (Agilent Technologies) greater than 8.5. By eliminating the detachment step, the resulting RNA was more representative of the complete ecosystem. Our improved method removed a major barrier limiting analysis of rumen microbial function from a gene expression perspective. The polyA-tailed eukaryotic mRNAs obtained have successfully been applied to next-generation sequencing, and metatranscriptomic analysis of the solid fraction of rumen contents revealed abundant sequences related to rumen fungi.

  11. Short Communication An efficient method for simultaneous extraction of high-quality RNA and DNA from various plant tissues.

    Science.gov (United States)

    Oliveira, R R; Viana, A J C; Reátegui, A C E; Vincentz, M G A

    2015-12-29

    Determination of gene expression is an important tool to study biological processes and relies on the quality of the extracted RNA. Changes in gene expression profiles may be directly related to mutations in regulatory DNA sequences or alterations in DNA cytosine methylation, which is an epigenetic mark. Correlation of gene expression with DNA sequence or epigenetic mark polymorphism is often desirable; for this, a robust protocol to isolate high-quality RNA and DNA simultaneously from the same sample is required. Although commercial kits and protocols are available, they are mainly optimized for animal tissues and, in general, restricted to RNA or DNA extraction, not both. In the present study, we describe an efficient and accessible method to extract both RNA and DNA simultaneously from the same sample of various plant tissues, using small amounts of starting material. The protocol was efficient in the extraction of high-quality nucleic acids from several Arabidopsis thaliana tissues (e.g., leaf, inflorescence stem, flower, fruit, cotyledon, seedlings, root, and embryo) and from other tissues of non-model plants, such as Avicennia schaueriana (Acanthaceae), Theobroma cacao (Malvaceae), Paspalum notatum (Poaceae), and Sorghum bicolor (Poaceae). The obtained nucleic acids were used as templates for downstream analyses, such as mRNA sequencing, quantitative real time-polymerase chain reaction, bisulfite treatment, and others; the results were comparable to those obtained with commercial kits. We believe that this protocol could be applied to a broad range of plant species, help avoid technical and sampling biases, and facilitate several RNA- and DNA-dependent analyses.

  12. A method for high-quality RNA extraction from tall fescue

    African Journals Online (AJOL)

    Jane

    2011-07-20

    Jul 20, 2011 ... but most of those methods are time-consuming (Li et al.,. 2008). Since RNA ... forage and seed (Wang and Ge, 2004; Huang et al.,. 2008). ..... Malnoy M, Reynoird JP, Mourgues F, Chevreau E, Simoneau P (2001). A method ...

  13. Introduction of a leucine half-zipper engenders multiple high-quality crystals of a recalcitrant tRNA synthetase

    International Nuclear Information System (INIS)

    Guo, Min; Shapiro, Ryan; Schimmel, Paul; Yang, Xiang-Lei

    2010-01-01

    E. coli alanyl-tRNA synthetase is recalcitrant to crystallization. A group of leucine substitutions has transformed the protein. Although Escherichia coli alanyl-tRNA synthetase was among the first tRNA synthetases to be sequenced and extensively studied by functional analysis, it has proved to be recalcitrant to crystallization. This challenge remained even for crystallization of the catalytic fragment. By mutationally introducing three stacked leucines onto the solvent-exposed side of an α-helix, an engineered catalytic fragment of the synthetase was obtained that yielded multiple high-quality crystals and cocrystals with different ligands. The engineered α-helix did not form a leucine zipper that interlocked with the same α-helix from another molecule. Instead, using the created hydrophobic spine, it interacted with other surfaces of the protein as a leucine half-zipper (LHZ) to enhance the crystal lattice interactions. The LHZ made crystal lattice contacts in all crystals of different space groups. These results illustrate the power of introducing an LHZ into helices to facilitate crystallization. The authors propose that the method can be unified with surface-entropy reduction and can be broadly used for protein-surface optimization in crystallization

  14. Evaluations of methods for the isolation of high quality RNA from bovine and cervine hide biopsies for use in gene expression studies

    Science.gov (United States)

    Molecular investigations of the ruminant response to ectoparasites at the parasite-host interface are critically dependent upon the quality of RNA. The complexity of ruminant skin decreases the capacity to obtain high quality RNA from biopsy samples, which directly affects the reliability of data pr...

  15. Extractions of High Quality RNA from the Seeds of Jerusalem Artichoke and Other Plant Species with High Levels of Starch and Lipid.

    Science.gov (United States)

    Mornkham, Tanupat; Wangsomnuk, Preeya Puangsomlee; Fu, Yong-Bi; Wangsomnuk, Pinich; Jogloy, Sanun; Patanothai, Aran

    2013-04-29

    Jerusalem artichoke (Helianthus tuberosus L.) is an important tuber crop. However, Jerusalem artichoke seeds contain high levels of starch and lipid, making the extraction of high-quality RNA extremely difficult and the gene expression analysis challenging. This study was aimed to improve existing methods for extracting total RNA from Jerusalem artichoke dry seeds and to assess the applicability of the improved method in other plant species. Five RNA extraction methods were evaluated on Jerusalem artichoke seeds and two were modified. One modified method with the significant improvement was applied to assay seeds of diverse Jerusalem artichoke accessions, sunflower, rice, maize, peanut and marigold. The effectiveness of the improved method to extract total RNA from seeds was assessed using qPCR analysis of four selected genes. The improved method of Ma and Yang (2011) yielded a maximum RNA solubility and removed most interfering substances. The improved protocol generated 29 to 41 µg RNA/30 mg fresh weight. An A260/A280 ratio of 1.79 to 2.22 showed their RNA purity. Extracted RNA was effective for downstream applications such as first-stranded cDNA synthesis, cDNA cloning and qPCR. The improved method was also effective to extract total RNA from seeds of sunflower, rice, maize and peanut that are rich in polyphenols, lipids and polysaccharides.

  16. Extractions of High Quality RNA from the Seeds of Jerusalem Artichoke and Other Plant Species with High Levels of Starch and Lipid

    Directory of Open Access Journals (Sweden)

    Tanupat Mornkham

    2013-04-01

    Full Text Available Jerusalem artichoke (Helianthus tuberosus L. is an important tuber crop. However, Jerusalem artichoke seeds contain high levels of starch and lipid, making the extraction of high-quality RNA extremely difficult and the gene expression analysis challenging. This study was aimed to improve existing methods for extracting total RNA from Jerusalem artichoke dry seeds and to assess the applicability of the improved method in other plant species. Five RNA extraction methods were evaluated on Jerusalem artichoke seeds and two were modified. One modified method with the significant improvement was applied to assay seeds of diverse Jerusalem artichoke accessions, sunflower, rice, maize, peanut and marigold. The effectiveness of the improved method to extract total RNA from seeds was assessed using qPCR analysis of four selected genes. The improved method of Ma and Yang (2011 yielded a maximum RNA solubility and removed most interfering substances. The improved protocol generated 29 to 41 µg RNA/30 mg fresh weight. An A260/A280 ratio of 1.79 to 2.22 showed their RNA purity. Extracted RNA was effective for downstream applications such as first-stranded cDNA synthesis, cDNA cloning and qPCR. The improved method was also effective to extract total RNA from seeds of sunflower, rice, maize and peanut that are rich in polyphenols, lipids and polysaccharides.

  17. An improved and reproducible protocol for the extraction of high quality fungal RNA from plant biomass substrates

    NARCIS (Netherlands)

    Patyshakuliyeva, Aleksandrina; Mäkelä, Miia R; Sietiö, Outi-Maaria; de Vries, Ronald P; Hildén, Kristiina S; van den Brink, J.

    2014-01-01

    Isolation of high quantity and quality RNA is a crucial step in the detection of meaningful gene expression data. Obtaining intact fungal RNA from complex lignocellulosic substrates is often difficult, producing low integrity RNA which perform poorly in downstream applications. In this study we

  18. Purpura fulminans mimicking toxic epidermal necrolysis - additional value of 16S rRNA sequencing and skin biopsy.

    Science.gov (United States)

    Dautzenberg, K H W; Polderman, F N; van Suylen, R J; Moviat, M A M

    2017-05-01

    Both purpura fulminans and toxic epidermal necrolysis (TEN) are rare and life-threatening disorders with a high mortality. We present a case of suspected rapidly progressive, severe pneumococcal sepsis-induced purpura fulminans complicated by multiple organ failure, severe epidermolysis and cutaneous necrosis. We show the diagnostic challenge to differentiate between purpura fulminans and TEN, as the extensive epidermolysis in purpura fulminans may mimic TEN and we highlight the additional value of repeated skin biopsies and 16S rRNA gene sequencing.

  19. Comparison of Methods for Isolating High Quality DNA and RNA from an Oleaginous Fungus Cunninghamella bainieri Strain 2a1

    Directory of Open Access Journals (Sweden)

    Noor Adila, A. K.

    2007-01-01

    Full Text Available A number of protocols have been reported for efficient fungal DNA and RNA isolation. However, many of these methods are often designed for certain groups or morphological forms of fungi and, in some cases, are species dependent. In this report, we compared four published protocols for DNA isolation from a locally isolated oleaginous fungus, Cunninghamella bainieri strain 2a1. These protocols either involved the use of polyvinyl pyrrolidone (PVP, hexacetyltrimethylammonium bromide (CTAB or without using PVB or CTAB. For RNA isolation, we tested two published protocols, one of which is based on TRI REAGENT (Molecular Research Center, USA and another is simple method employing phenol for RNA extraction and LiCl for precipitation. We found that the protocol involving the use of CTAB produced the highest genomic DNA yield with the best quality compared to other protocols. In the presence of CTAB, unwanted polysaccharides were removed and this method yielded an average amount of 816 ± 12.2 µg DNA/g mycelia with UV absorbance ratios A260/280 and A260/230 of 1.67 ± 0.64 and 1.97 ± 0.23, respectively. The genomic DNA isolated via this protocol is also suitable for PCR amplification and restriction enzyme digestion. As for RNA isolation, the method involving phenol extraction and LiCl precipitation produced the highest yield of RNA with an average amount of 372 ± 6.0 µg RNA/g mycelia. The RNA appears to be relatively pure since it has UV absorbance ratios A260/280 and A260/230 of 1.89 ± 2.00 and 1.99 ± 0.03, respectively. Finally, we have demonstrated that this method could produce RNA of sufficient quality for RT-PCR that amplified a 600 bp fragment of ∆12-fatty acid desaturase gene in C. bainieri.

  20. Quantitation of the mRNA expression of the epidermal growth factor system

    DEFF Research Database (Denmark)

    Sørensen, B S; Tørring, N; Bor, M V

    2000-01-01

    ) and for the quantitation of mRNA for the receptors HER-1 and its preferred dimerization partner, HER-2. The method is based on the generation of specific RNA standards, which are amplified by reverse transcriptase-polymerase chain reaction (RT-PCR) with the sample RNA and a set of calibrators. The resulting calibration...

  1. Comparison of Methods for Isolating High Quality DNA and RNA from an Oleaginous Fungus Cunninghamella bainieri Strain 2a1

    OpenAIRE

    Noor Adila, A. K.; Farah Diba, A. B.; Zamri, Z.; Wan Mohtar, W. Y.; Aidil, A. H.; Mahadi, N. M.; Murad, A. M. A.

    2007-01-01

    A number of protocols have been reported for efficient fungal DNA and RNA isolation. However, many of these methods are often designed for certain groups or morphological forms of fungi and, in some cases, are species dependent. In this report, we compared four published protocols for DNA isolation from a locally isolated oleaginous fungus, Cunninghamella bainieri strain 2a1. These protocols either involved the use of polyvinyl pyrrolidone (PVP), hexacetyltrimethylammonium bromide (CTAB) or w...

  2. An epidermal microRNA regulates neuronal migration through control of the cellular glycosylation state

    DEFF Research Database (Denmark)

    Pedersen, Mikael Egebjerg; Snieckute, Goda; Kagias, Konstantinos

    2013-01-01

    An appropriate balance in glycosylation of proteoglycans is crucial for their ability to regulate animal development. Here, we report that the Caenorhabditis elegans microRNA mir-79, an ortholog of mammalian miR-9, controls sugar-chain homeostasis by targeting two proteins in the proteoglycan bio...... that impinges on a LON-2/glypican pathway and disrupts neuronal migration. Our results identify a regulatory axis controlled by a conserved microRNA that maintains proteoglycan homeostasis in cells....

  3. Combining laser-assisted microdissection (LAM) and RNA-seq allows to perform a comprehensive transcriptomic analysis of epidermal cells of Arabidopsis embryo.

    Science.gov (United States)

    Sakai, Kaori; Taconnat, Ludivine; Borrega, Nero; Yansouni, Jennifer; Brunaud, Véronique; Paysant-Le Roux, Christine; Delannoy, Etienne; Martin Magniette, Marie-Laure; Lepiniec, Loïc; Faure, Jean Denis; Balzergue, Sandrine; Dubreucq, Bertrand

    2018-01-01

    Genome-wide characterization of tissue- or cell-specific gene expression is a recurrent bottleneck in biology. We have developed a sensitive approach based on ultra-low RNA sequencing coupled to laser assisted microdissection for analyzing different tissues of the small Arabidopsis embryo. We first characterized the number of genes detected according to the quantity of tissue yield and total RNA extracted. Our results revealed that as low as 0.02 mm 2 of tissue and 50 pg of total RNA can be used without compromising the number of genes detected. The optimised protocol was used to compare the epidermal versus mesophyll cell transcriptomes of cotyledons at the torpedo-shaped stage of embryo development. The approach was validated by the recovery of well-known epidermal genes such AtML1 or AtPDF2 and genes involved in flavonoid and cuticular waxes pathways. Moreover, the interest and sensitivity of this approach were highlighted by the characterization of several transcription factors preferentially expressed in epidermal cells. This technical advance unlocks some current limitations of transcriptomic analyses and allows to investigate further and efficiently new biological questions for which only a very small amounts of cells need to be isolated. For instance, it paves the way to increasing the spatial accuracy of regulatory networks in developing small embryo of Arabidopsis or other plant tissues.

  4. Retrieval of a million high-quality, full-length microbial 16S and 18S rRNA gene sequences without primer bias

    DEFF Research Database (Denmark)

    Karst, Søren Michael; Dueholm, Morten Simonsen; McIlroy, Simon Jon

    2018-01-01

    Small subunit ribosomal RNA (SSU rRNA) genes, 16S in bacteria and 18S in eukaryotes, have been the standard phylogenetic markers used to characterize microbial diversity and evolution for decades. However, the reference databases of full-length SSU rRNA gene sequences are skewed to well-studied e...

  5. MicroRNA-126 and epidermal growth factor-like domain 7-an angiogenic couple of importance in metastatic colorectal cancer. Results from the Nordic ACT trial.

    Science.gov (United States)

    Hansen, T F; Christensen, R dP; Andersen, R F; Sørensen, F B; Johnsson, A; Jakobsen, A

    2013-09-03

    This study investigated the clinical importance of linked angiogenetic biomarkers to chemotherapy, combined with the anti-vascular endothelial growth factor A (anti-VEGF-A), as a first-line treatment in patients with metastatic colorectal cancer (mCRC). A total of 230 patients from a randomised phase III study were included. The primary microRNA-126 (pri-miRNA-126) A24G single-nucleotide polymorphism and the mature miRNA-126 were analysed by PCR using genomic DNA (full blood) and formalin-fixed paraffin-embedded tissue sections, respectively. The epidermal growth factor-like domain 7 (EGFL7) protein was visualised and quantified using immunohistochemistry. High tumour expression of miRNA-126 was significantly related to a longer progression-free survival. The independent prognostic value of miRNA-126 was confirmed using a Cox regression analysis (hazard ratio=0.49, 95% confidence interval=0.29-0.84, P=0.009). Although not significant, a relationship between EGFL7 expression and response rates is suggested, with EGFL7 expression at the invasive front being lower in responding patients than in the non-responders (P=0.063). The results validate the previous findings on the prognostic value of miRNA-126 in mCRC and may suggest a relationship between treatment efficacy and EGFL7 expression. As miRNA-126 may target VEGF-A as well as EGFL7, the results may provide predictive information in relation to next-generation anti-angiogenetics.

  6. Thousands of primer-free, high-quality, full-length SSU rRNA sequences from all domains of life

    DEFF Research Database (Denmark)

    Karst, Soeren M; Dueholm, Morten S; McIlroy, Simon J

    2016-01-01

    Ribosomal RNA (rRNA) genes are the consensus marker for determination of microbial diversity on the planet, invaluable in studies of evolution and, for the past decade, high-throughput sequencing of variable regions of ribosomal RNA genes has become the backbone of most microbial ecology studies...... (SSU) rRNA genes and synthetic long read sequencing by molecular tagging, to generate primer-free, full-length SSU rRNA gene sequences from all domains of life, with a median raw error rate of 0.17%. We generated thousands of full-length SSU rRNA sequences from five well-studied ecosystems (soil, human...... gut, fresh water, anaerobic digestion, and activated sludge) and obtained sequences covering all domains of life and the majority of all described phyla. Interestingly, 30% of all bacterial operational taxonomic units were novel, compared to the SILVA database (less than 97% similarity...

  7. Targeting the epidermal growth factor receptor in non-small cell lung cancer cells: the effect of combining RNA interference with tyrosine kinase inhibitors or cetuximab

    Directory of Open Access Journals (Sweden)

    Chen Gang

    2012-03-01

    Full Text Available Abstract Background The epidermal growth factor receptor (EGFR is a validated therapeutic target in non-small cell lung cancer (NSCLC. However, current single agent receptor targeting does not achieve a maximal therapeutic effect, and some mutations confer resistance to current available agents. In the current study we have examined, in different NSCLC cell lines, the combined effect of RNA interference targeting the EGFR mRNA, and inactivation of EGFR signaling using different receptor tyrosine kinase inhibitors (TKIs or a monoclonal antibody cetuximab. Methods NSCLC cells (cell lines HCC827, H292, H358, H1650, and H1975 were transfected with EGFR siRNA and/or treated with the TKIs gefitinib, erlotinib, and afatinib, and/or with the monoclonal antibody cetuximab. The reduction of EGFR mRNA expression was measured by real-time quantitative RT-PCR. The down-regulation of EGFR protein expression was measured by western blot, and the proliferation, viability, caspase3/7 activity, and apoptotic morphology were monitored by spectrophotometry, fluorimetry, and fluorescence microscopy. The combined effect of EGFR siRNA and different drugs was evaluated using a combination index. Results EGFR-specific siRNA strongly inhibited EGFR protein expression almost equally in all cell lines and inhibited cell growth and induced cell apoptosis in all NSCLC cell lines studied, albeit with a different magnitude. The effects on growth obtained with siRNA was strikingly different from the effects obtained with TKIs. The effects of siRNA probably correlate with the overall oncogenic significance of the receptor, which is only partly inhibited by the TKIs. The cells which showed weak response to TKIs, such as the H1975 cell line containing the T790M resistance mutation, were found to be responsive to siRNA knockdown of EGFR, as were cell lines with downstream TKI resistance mutations. The cell line HCC827, harboring an exon 19 deletion mutation, was more than 10-fold

  8. Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

    Energy Technology Data Exchange (ETDEWEB)

    Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)

    2014-11-14

    The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

  9. RNA-Seq Analysis of IL-1B and IL-36 Responses in Epidermal Keratinocytes Identifies a Shared MyD88-Dependent Gene Signature.

    Science.gov (United States)

    Swindell, William R; Beamer, Maria A; Sarkar, Mrinal K; Loftus, Shannon; Fullmer, Joseph; Xing, Xianying; Ward, Nicole L; Tsoi, Lam C; Kahlenberg, Michelle J; Liang, Yun; Gudjonsson, Johann E

    2018-01-01

    IL-36 cytokines have recently emerged as mediators of inflammation in autoimmune conditions including psoriasis vulgaris (PsV) and generalized pustular psoriasis (GPP). This study used RNA-seq to profile the transcriptome of primary epidermal keratinocytes (KCs) treated with IL-1B, IL-36A, IL-36B, or IL-36G. We identified some early IL-1B-specific responses (8 h posttreatment), but nearly all late IL-1B responses were replicated by IL-36 cytokines (24 h posttreatment). Type I and II interferon genes exhibited time-dependent response patterns, with early induction (8 h) followed by no response or repression (24 h). Altogether, we identified 225 differentially expressed genes (DEGs) with shared responses to all 4 cytokines at both time points (8 and 24 h). These involved upregulation of ligands ( IL1A, IL1B , and IL36G ) and activating proteases ( CTSS ) but also upregulation of inhibitors such as IL1RN and IL36RN . Shared IL-1B/IL-36 DEGs overlapped significantly with genes altered in PsV and GPP skin lesions, as well as genes near GWAS loci linked to autoimmune and autoinflammatory diseases (e.g., PsV, psoriatic arthritis, inflammatory bowel disease, and primary biliary cholangitis). Inactivation of MyD88 adapter protein using CRISPR/Cas9 completely abolished expression responses of such DEGs to IL-1B and IL-36G stimulation. These results provide a global view of IL-1B and IL-36 expression responses in epidermal KCs with fine-scale characterization of time-dependent and cytokine-specific response patterns. Our findings support an important role for IL-1B and IL-36 in autoimmune or autoinflammatory conditions and show that MyD88 adaptor protein mediates shared IL-1B/IL-36 responses.

  10. RNA-Seq analysis of Gtf2ird1 knockout epidermal tissue provides potential insights into molecular mechanisms underpinning Williams-Beuren syndrome.

    Science.gov (United States)

    Corley, Susan M; Canales, Cesar P; Carmona-Mora, Paulina; Mendoza-Reinosa, Veronica; Beverdam, Annemiek; Hardeman, Edna C; Wilkins, Marc R; Palmer, Stephen J

    2016-06-13

    Williams-Beuren Syndrome (WBS) is a genetic disorder associated with multisystemic abnormalities, including craniofacial dysmorphology and cognitive defects. It is caused by a hemizygous microdeletion involving up to 28 genes in chromosome 7q11.23. Genotype/phenotype analysis of atypical microdeletions implicates two evolutionary-related transcription factors, GTF2I and GTF2IRD1, as prime candidates for the cause of the facial dysmorphology. Using a targeted Gtf2ird1 knockout mouse, we employed massively-parallel sequencing of mRNA (RNA-Seq) to understand changes in the transcriptional landscape associated with inactivation of Gtf2ird1 in lip tissue. We found widespread dysregulation of genes including differential expression of 78 transcription factors or coactivators, several involved in organ development including Hey1, Myf6, Myog, Dlx2, Gli1, Gli2, Lhx2, Pou3f3, Sox2, Foxp3. We also found that the absence of GTF2IRD1 is associated with increased expression of genes involved in cellular proliferation, including growth factors consistent with the observed phenotype of extreme thickening of the epidermis. At the same time, there was a decrease in the expression of genes involved in other signalling mechanisms, including the Wnt pathway, indicating dysregulation in the complex networks necessary for epidermal differentiation and facial skin patterning. Several of the differentially expressed genes have known roles in both tissue development and neurological function, such as the transcription factor Lhx2 which regulates several genes involved in both skin and brain development. Gtf2ird1 inactivation results in widespread gene dysregulation, some of which may be due to the secondary consequences of gene regulatory network disruptions involving several transcription factors and signalling molecules. Genes involved in growth factor signalling and cell cycle progression were identified as particularly important for explaining the skin dysmorphology observed in this

  11. Epidermal growth factor receptor signaling promotes metastatic prostate cancer through microRNA-96-mediated downregulation of the tumor suppressor ETV6.

    Science.gov (United States)

    Tsai, Yuan-Chin; Chen, Wei-Yu; Siu, Man Kit; Tsai, Hong-Yuan; Yin, Juan Juan; Huang, Jiaoti; Liu, Yen-Nien

    2017-01-01

    It has been suggested that ETV6 serves as a tumor suppressor; however, its molecular regulation and cellular functions remain unclear. We used prostate cancer as a model system and demonstrated a molecular mechanism in which ETV6 can be regulated by epidermal growth factor receptor (EGFR) signaling through microRNA-96 (miR-96)-mediated downregulation. In addition, EGFR acts as a transcriptional coactivator that binds to the promoter of primary miR-96 and transcriptionally regulates miR-96 levels. We analyzed two sets of clinical prostate cancer samples, confirmed association patterns that were consistent with the EGFR-miR-96-ETV6 signaling model and demonstrated that the reduced ETV6 levels were associated with malignant prostate cancer. Based on results derived from multiple approaches, we identified the biological functions of ETV6 as a tumor suppressor that inhibits proliferation and metastasis in prostate cancer. We present a molecular mechanism in which EGFR activation leads to the induction of miR-96 expression and suppression of ETV6, which contributes to prostate cancer progression. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  12. Production of high quality brain-derived neurotrophic factor (BDNF) and tropomyosin receptor kinase B (TrkB) RNA from isolated populations of rat spinal cord motor neurons obtained by Laser Capture Microdissection (LCM).

    Science.gov (United States)

    Mehta, Prachi; Premkumar, Brian; Morris, Renée

    2016-08-03

    The mammalian central nervous system (CNS) is composed of multiple cellular elements, making it challenging to segregate one particular cell type to study their gene expression profile. For instance, as motor neurons represent only 5-10% of the total cell population of the spinal cord, meaningful transcriptional analysis on these neurons is almost impossible to achieve from homogenized spinal cord tissue. A major challenge faced by scientists is to obtain good quality RNA from small amounts of starting material. In this paper, we used Laser Capture Microdissection (LCM) techniques to identify and isolate spinal cord motor neurons. The present analysis revealed that perfusion with paraformaldehyde (PFA) does not alter RNA quality. RNA integrity numbers (RINs) of tissue samples from rubrospinal tract (RST)-transected, intact spinal cord or from whole spinal cord homogenate were all above 8, which indicates intact, high-quality RNA. Levels of mRNA for brain-derived neurotrophic factor (BDNF) or for its tropomyosin receptor kinase B (TrkB) were not affected by rubrospinal tract (RST) transection, a surgical procedure that deprive motor neurons from one of their main supraspinal input. The isolation of pure populations of neurons with LCM techniques allows for robust transcriptional characterization that cannot be achieved with spinal cord homogenates. Such preparations of pure population of motor neurons will provide valuable tools to advance our understanding of the molecular mechanisms underlying spinal cord injury and neuromuscular diseases. In the near future, LCM techniques might be instrumental to the success of gene therapy for these debilitating conditions. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  13. RNA.

    Science.gov (United States)

    Darnell, James E., Jr.

    1985-01-01

    Ribonucleic acid (RNA) converts genetic information into protein and usually must be processed to serve its function. RNA types, chemical structure, protein synthesis, translation, manufacture, and processing are discussed. Concludes that the first genes might have been spliced RNA and that humans might be closer than bacteria to primitive…

  14. MicroRNA-126 and epidermal growth factor-like domain 7-an angiogenic couple of importance in metastatic colorectal cancer. Results from the Nordic ACT trial

    DEFF Research Database (Denmark)

    Hansen, T F; Christensen, René dePont; Andersen, R F

    2013-01-01

    Background:This study investigated the clinical importance of linked angiogenetic biomarkers to chemotherapy, combined with the anti-vascular endothelial growth factor A (anti-VEGF-A), as a first-line treatment in patients with metastatic colorectal cancer (mCRC).Methods:A total of 230 patients......-like domain 7 (EGFL7) protein was visualised and quantified using immunohistochemistry.Results:High tumour expression of miRNA-126 was significantly related to a longer progression-free survival. The independent prognostic value of miRNA-126 was confirmed using a Cox regression analysis (hazard ratio=0.49, 95...... on the prognostic value of miRNA-126 in mCRC and may suggest a relationship between treatment efficacy and EGFL7 expression. As miRNA-126 may target VEGF-A as well as EGFL7, the results may provide predictive information in relation to next-generation anti-angiogenetics....

  15. Clinical Usefulness of a One-Tube Nested Reverse Transcription Quantitative Polymerase Chain Reaction Assay for Evaluating Human Epidermal Growth Factor Receptor 2 mRNA Overexpression in Formalin-Fixed and Paraffin-Embedded Breast Cancer Tissue Samples.

    Science.gov (United States)

    Wang, Hye-Young; Ahn, Sungwoo; Park, Sunyoung; Kim, SeungIl; Lee, Hyeyoung

    2017-01-01

    Currently, the two main methods used to analyze human epidermal growth factor receptor 2 (HER2) amplification or overexpression have a limited accuracy and high costs. These limitations can be overcome by the development of complementary quantitative methods. In this study, we analyzed HER2 mRNA expression in clinical formalin-fixed and paraffin-embedded (FFPE) samples using a one-tube nested reverse transcription quantitative polymerase chain reaction (RT-qPCR) assay. We measured expression relative to 3 reference genes and compared the results to those obtained by conventional immunohistochemistry (IHC) and fluorescence in situ hybridization (FISH) assays with 226 FFPE breast cancer tissue samples. The one-tube nested RT-qPCR assay proved to be highly sensitive and specific based on comparisons with IHC (96.9 and 97.7%, respectively) and FISH (92.4 and 92.9%, respectively) obtained with the validation set. Comparisons with clinicopathological data revealed significant associations between HER2 overexpression and TNM stage (p < 0.01), histological type (p < 0.01), ER status (p < 0.001), PR status (p < 0.05), HER2 status (p < 0.001), and molecular subtypes (p < 0.001). Based on these findings, our one-tube nested RT-qPCR assay is a potentially useful and complementary screening tool for the detection of HER2 mRNA overexpression. © 2016 S. Karger AG, Basel.

  16. MicroRNA-126 and epidermal growth factor-like domain 7-an angiogenic couple of importance in metastatic colorectal cancer. Results from the Nordic ACT trial

    DEFF Research Database (Denmark)

    Hansen, T F; Christensen, René dePont; Andersen, R F

    2013-01-01

    Background:This study investigated the clinical importance of linked angiogenetic biomarkers to chemotherapy, combined with the anti-vascular endothelial growth factor A (anti-VEGF-A), as a first-line treatment in patients with metastatic colorectal cancer (mCRC).Methods:A total of 230 patients...... on the prognostic value of miRNA-126 in mCRC and may suggest a relationship between treatment efficacy and EGFL7 expression. As miRNA-126 may target VEGF-A as well as EGFL7, the results may provide predictive information in relation to next-generation anti-angiogenetics....

  17. Epidermal growth factor and insulin-like growth factor I upregulate the expression of the epidermal growth factor system in rat liver

    DEFF Research Database (Denmark)

    Bor, M V; Sørensen, B S; Vinter-Jensen, L

    2000-01-01

    BACKGROUND/AIM: Both epidermal growth factor and insulin-like growth factor I play a role in connection with the liver. In the present study, the possible interaction of these two growth factor systems was studied by investigating the effect of epidermal growth factor or insulin-like growth factor...... I treatment on the expression of the epidermal growth factor receptor, and its activating ligands, transforming growth factor-alpha and epidermal growth factor. METHODS: Fifty-five male rats received no treatment, human recombinant epidermal growth factor or human recombinant insulin-like growth.......8+/-1.6 fmol/mg protein epidermal growth factor and 144+/-22 fmol/mg protein transforming growth factor-alpha. Both epidermal growth factor and insulin-like growth factor I treatment increased the expression of mRNA for transforming growth factor-alpha and epidermal growth factor receptor, as well...

  18. Microneedle fractional radiofrequency increases epidermal hyaluronan and reverses age-related epidermal dysfunction.

    Science.gov (United States)

    Lee, Hee Jung; Seo, Seong Rak; Yoon, Moon Soo; Song, Ji-Ye; Lee, Eun Young; Lee, Sang Eun

    2016-02-01

    Skin aging results in physiological alterations in keratinocyte activities and epidermal function, as well as dermal changes. Yet, the cellular and molecular mechanisms that cause epidermal dysfunction during skin aging are not well understood. Recently, the role of epidermal hyaluronan (HA) as an active regulator of dynamic cellular processes is getting attention and alterations in HA metabolism are thought to be important in age-related epidermal dysfunction. Microneedle fractional radiofrequency (RF) has shown effects for improving cutaneous aging. However, little is known about the effects of fractional RF on the epidermal HA and epidermal function. We investigated the effect of microneedle fractional RF on the expression of epidermal HA in young and aged mice epidermis. We performed fractional RF on the dorsal skin of 30 8-week-old (young) hairless mice and 15 47-week-old (aged) C57BL/6J mice. Skin samples were collected on day 1, 3, and 7. HA content was measured by ELISA. Gene expressions of CD 44, HABP4, and HAS3 were measured using real time RT-PCR. Immunohistochemistry for detection of HA, CD44, PCNA, and filaggrin were performed. HA content and the mRNA levels of HABP4, CD44, and HAS3 were upregulated in the epidermis of both young and aged mice after microneedle fractional RF treatment. The expression was increased from day 1 after treatment and increased expression persisted on day 7. Fractional RF treatment significantly increased PCNA and filaggrin expression only in the aged mice skin. Microneedle fractional RF increased epidermal HA and CD44 expression in both young and aged mice and reversed age-related epidermal dysfunction especially in aged mice, suggesting a new mechanism involved in the skin rejuvenation effect of microneedle fractional RF. © 2015 Wiley Periodicals, Inc.

  19. Fast High-Quality Noise

    DEFF Research Database (Denmark)

    Frisvad, Jeppe Revall; Wyvill, Geoff

    2007-01-01

    At the moment the noise functions available in a graphics programmer's toolbox are either slow to compute or they involve grid-line artifacts making them of lower quality. In this paper we present a real-time noise computation with no grid-line artifacts or other regularity problems. In other words......, we put a new tool in the box that computes fast high-quality noise. In addition to being free of artifacts, the noise we present does not rely on tabulated data (everything is computed on the fly) and it is easy to adjust quality vs. quantity for the noise. The noise is based on point rendering (like...... spot noise), but it extends to more than two dimensions. The fact that it is based on point rendering makes art direction of the noise much easier....

  20. Intra-tumoural vessel area estimated by expression of epidermal growth factor-like domain 7 and microRNA-126 in primary tumours and metastases of patients with colorectal cancer

    DEFF Research Database (Denmark)

    Hansen, T. F.; Nielsen, Boye Schnack; Jakobsen, Anders

    2015-01-01

    Background: Understanding the biological properties of potential drug targets are important. This is especially true for anti-angiogenic therapies in the search for potential biomarkers. The aim of the present descriptive study was to analyse the intra-tumoural expressions of epidermal growth...

  1. Availability of high quality weather data measurements

    DEFF Research Database (Denmark)

    Andersen, Elsa; Johansen, Jakob Berg; Furbo, Simon

    In the period 2016-2017 the project “Availability of high quality weather data measurements” is carried out at Department of Civil Engineering at the Technical University of Denmark. The aim of the project is to establish measured high quality weather data which will be easily available...... for the building energy branch and the solar energy branch in their efforts to achieve energy savings and for researchers and students carrying out projects where measured high quality weather data are needed....

  2. [Progress in epidermal stem cells].

    Science.gov (United States)

    Wang, Li-Juan; Wang, You-Liang; Yang, Xiao

    2010-03-01

    Mammalian skin epidermis contains different epidermal stem cell pools which contribute to the homeostasis and repair of skin epithelium. Epidermal stem cells possess two essential features common to all stem cells: self-renewal and differentiation. Disturbing the balance between self-renewal and differentiation of epidermal stem cell often causes tumors or other skin diseases. Epidermal stem cell niches provide a special microenvironment that maintains a balance of stem cell quiescence and activity. This review primarily concentrates on the following points of the epidermal stem cells: the existing evidences, the self-renewal and differentiation, the division pattern, the signal pathways regulating self-renewal and differentiation, and the microenvironment (niche) and macroenvironment maintaining the homeostasis of stem cells.

  3. Intra-tumoural vessel area estimated by expression of epidermal growth factor-like domain 7 and microRNA-126 in primary tumours and metastases of patients with colorectal cancer

    DEFF Research Database (Denmark)

    Hansen, T. F.; Nielsen, Boye Schnack; Jakobsen, Anders

    2015-01-01

    factor-like domain 7 (EGFL7) and microRNA-126 (miRNA-126) in primary tumours from patients with stage II-IV colorectal cancer (CRC) and in paired samples of primary tumours, regional lymph node metastases and distant metastases. Methods: A total of 126 patients were included. Analyses were performed...

  4. Fabrication of high-quality brazed joints

    International Nuclear Information System (INIS)

    Orlov, A.V.

    1980-01-01

    Problem of ensuring of joint high-quality when brazing different parts in power engineering is considered. To obtain high-quality joints it is necessary to correctly design brazed joint and to choose a gap width, overlap length and fillet radius; to clean up carefully the surfaces to be brazed and fix them properly one relative to another; to apply a solder so as to provide its flowing into the gap and sticking in it; to exactly regulate thermal conditions of brazing. High quality and reliability of brazed joints are ensured by the application of solders based on noble metals, and cheap solders based on nickel, manganese and copper. Joints brazed with nickel base solders may operate at temperatures as high as 888 deg C

  5. Arctigenin induced gallbladder cancer senescence through modulating epidermal growth factor receptor pathway.

    Science.gov (United States)

    Zhang, Mingdi; Cai, Shizhong; Zuo, Bin; Gong, Wei; Tang, Zhaohui; Zhou, Di; Weng, Mingzhe; Qin, Yiyu; Wang, Shouhua; Liu, Jun; Ma, Fei; Quan, Zhiwei

    2017-05-01

    Gallbladder cancer has poor prognosis and limited therapeutic options. Arctigenin, a representative dibenzylbutyrolactone lignan, occurs in a variety of plants. However, the molecular mechanisms involved in the antitumor effect of arctigenin on gallbladder cancer have not been fully elucidated. The expression levels of epidermal growth factor receptor were examined in 100 matched pairs of gallbladder cancer tissues. A positive correlation between high epidermal growth factor receptor expression levels and poor prognosis was observed in gallbladder cancer tissues. Pharmacological inhibition or inhibition via RNA interference of epidermal growth factor receptor induced cellular senescence in gallbladder cancer cells. The antitumor effect of arctigenin on gallbladder cancer cells was primarily achieved by inducing cellular senescence. In gallbladder cancer cells treated with arctigenin, the expression level of epidermal growth factor receptor significantly decreased. The analysis of the activity of the kinases downstream of epidermal growth factor receptor revealed that the RAF-MEK-ERK signaling pathway was significantly inhibited. Furthermore, the cellular senescence induced by arctigenin could be reverted by pcDNA-epidermal growth factor receptor. Arctigenin also potently inhibited the growth of tumor xenografts, which was accompanied by the downregulation of epidermal growth factor receptor and induction of senescence. This study demonstrates arctigenin could induce cellular senescence in gallbladder cancer through the modulation of epidermal growth factor receptor pathway. These data identify epidermal growth factor receptor as a key regulator in arctigenin-induced gallbladder cancer senescence.

  6. Producing high-quality slash pine seeds

    Science.gov (United States)

    James Barnett; Sue Varela

    2003-01-01

    Slash pine is a desirable species. It serves many purposes and is well adapted to poorly drained flatwoods and seasonally flooded areas along the lower Coastal Plain of the Southeastern US. The use of high-quality seeds has been shown to produce uniform seedlings for outplanting, which is key to silvicultural success along the Coastal Plain and elsewhere. We present...

  7. Toxic epidermal necrolysis.

    Science.gov (United States)

    Pereira, Frederick A; Mudgil, Adarsh Vijay; Rosmarin, David M

    2007-02-01

    Toxic epidermal necrolysis (TEN) is an unpredictable, life-threatening drug reaction associated with a 30% mortality. Massive keratinocyte apoptosis is the hallmark of TEN. Cytotoxic T lymphocytes appear to be the main effector cells and there is experimental evidence for involvement of both the Fas-Fas ligand and perforin/granzyme pathways. Optimal treatment for these patients remains to be clarified. Discontinuation of the offending drug and prompt referral to a burn unit are generally agreed upon steps. Beyond that, however, considerable controversy exists. Evidence both pro and con exists for the use of IVIG, systemic corticosteroid, and other measures. There is also evidence suggesting that combination therapies may be of value. All the clinical data, however, is anecdotal or based on observational or retrospective studies. Definitive answers are not yet available. Given the rarity of TEN and the large number of patients required for a study to be statistically meaningful, placebo controlled trials are logistically difficult to accomplish. The absence of an animal model further hampers research into this condition. This article reviews recent data concerning clinical presentation, pathogenesis and treatment of TEN. At the conclusion of this learning activity, participants should have acquired a more comprehensive knowledge of our current understanding of the classification, clinical presentation, etiology, pathophysiology, prognosis, and treatment of TEN.

  8. High-quality compressive ghost imaging

    Science.gov (United States)

    Huang, Heyan; Zhou, Cheng; Tian, Tian; Liu, Dongqi; Song, Lijun

    2018-04-01

    We propose a high-quality compressive ghost imaging method based on projected Landweber regularization and guided filter, which effectively reduce the undersampling noise and improve the resolution. In our scheme, the original object is reconstructed by decomposing of regularization and denoising steps instead of solving a minimization problem in compressive reconstruction process. The simulation and experimental results show that our method can obtain high ghost imaging quality in terms of PSNR and visual observation.

  9. A high-quality genome assembly of quinoa provides insights into the molecular basis of salt bladder-based salinity tolerance and the exceptional nutritional value

    Science.gov (United States)

    Zou, Changsong; Chen, Aojun; Xiao, Lihong; Muller, Heike M; Ache, Peter; Haberer, Georg; Zhang, Meiling; Jia, Wei; Deng, Ping; Huang, Ru; Lang, Daniel; Li, Feng; Zhan, Dongliang; Wu, Xiangyun; Zhang, Hui; Bohm, Jennifer; Liu, Renyi; Shabala, Sergey; Hedrich, Rainer; Zhu, Jian-Kang; Zhang, Heng

    2017-01-01

    Chenopodium quinoa is a halophytic pseudocereal crop that is being cultivated in an ever-growing number of countries. Because quinoa is highly resistant to multiple abiotic stresses and its seed has a better nutritional value than any other major cereals, it is regarded as a future crop to ensure global food security. We generated a high-quality genome draft using an inbred line of the quinoa cultivar Real. The quinoa genome experienced one recent genome duplication about 4.3 million years ago, likely reflecting the genome fusion of two Chenopodium parents, in addition to the γ paleohexaploidization reported for most eudicots. The genome is highly repetitive (64.5% repeat content) and contains 54 438 protein-coding genes and 192 microRNA genes, with more than 99.3% having orthologous genes from glycophylic species. Stress tolerance in quinoa is associated with the expansion of genes involved in ion and nutrient transport, ABA homeostasis and signaling, and enhanced basal-level ABA responses. Epidermal salt bladder cells exhibit similar characteristics as trichomes, with a significantly higher expression of genes related to energy import and ABA biosynthesis compared with the leaf lamina. The quinoa genome sequence provides insights into its exceptional nutritional value and the evolution of halophytes, enabling the identification of genes involved in salinity tolerance, and providing the basis for molecular breeding in quinoa. PMID:28994416

  10. AUTOIMMUNE EPIDERMAL BLISTERING DISEASES

    Directory of Open Access Journals (Sweden)

    Ana Maria Abreu Velez

    2013-11-01

    Full Text Available Autoimmune bullous skin diseases (ABDs are uncommon, potentially fatal diseases of skin and mucous membranes which are associated with deposits of autoantibodies and complement against distinct molecules of the epidermis and dermal/epidermal basement membrane zone (BMZ. These autoantibodies lead to a loss in skin molecular integrity, which manifests clinically as formation of blisters or erosions. In pemphigus vulgaris, loss of adhesion occurs within the epidermis. The pioneering work of Ernst H. Beutner, Ph.D. and Robert E. Jordon, M.D. confirmed the autoimmune nature of these diseases. Walter F. Lever, M.D. contributed significantly to our understanding of the histopathologic features of these diseases. Walter Lever, M.D. and Ken Hashimoto, M.D. contributed electron microscopic studies of these diseases, especially in pemphigus vulgaris and bullous pemphigoid. In bullous pemphigoid (BP, linear IgA bullous dermatosis, epidermolysis bullosa acquisita (EBA and dermatitis herpetiformis (DH, loss of adhesion takes place within or underneath the BMZ. Classic EBA demonstrates extensive skin fragility; DH is commonly associated with gluten-sensitive enteropathy, and manifests clinically with pruritic papulovesicles on the extensor surfaces of the extremities and the lumbosacral area. The clinical spectrum of bullous pemphigoid includes tense blisters, urticarial plaques, and prurigo-like eczematous lesions. Pemphigoid gestationis mostly occurs during the last trimester of pregnancy, and mucous membrane pemphigoid primarily involves the oral mucosa and conjunctivae and leads to scarring. Linear IgA bullous dermatosis manifests with tense blisters in a „cluster of jewels”-like pattern in childhood (chronic bullous disease of childhood and is more clinically heterogeneous in adulthood. Many of the autoantigens in these disorders are known and have been well characterized. ABDs may be influenced by both genetic and exogenous factors. The diagnoses of

  11. High quality transportation fuels from renewable feedstock

    Energy Technology Data Exchange (ETDEWEB)

    Lindfors, Lars Peter

    2010-09-15

    Hydrotreating of vegetable oils is novel process for producing high quality renewable diesel. Hydrotreated vegetable oils (HVO) are paraffinic hydrocarbons. They are free of aromatics, have high cetane numbers and reduce emissions. HVO can be used as component or as such. HVO processes can also be modified to produce jet fuel. GHG savings by HVO use are significant compared to fossil fuels. HVO is already in commercial production. Neste Oil is producing its NExBTL diesel in two plants. Production of renewable fuels will be limited by availability of sustainable feedstock. Therefore R and D efforts are made to expand feedstock base further.

  12. Boiling curve in high quality flow boiling

    International Nuclear Information System (INIS)

    Shiralkar, B.S.; Hein, R.A.; Yadigaroglu, G.

    1980-01-01

    The post dry-out heat transfer regime of the flow boiling curve was investigated experimentally for high pressure water at high qualities. The test section was a short round tube located downstream of a hot patch created by a temperature controlled segment of tubing. Results from the experiment showed that the distance from the dryout point has a significant effect on the downstream temperatures and there was no unique boiling curve. The heat transfer coefficients measured sufficiently downstream of the dryout point could be correlated using the Heineman correlation for superheated steam, indicating that the droplet deposition effects could be neglected in this region

  13. Method for synthesis of high quality graphene

    Science.gov (United States)

    Lanzara, Alessandra [Piedmont, CA; Schmid, Andreas K [Berkeley, CA; Yu, Xiaozhu [Berkeley, CA; Hwang, Choonkyu [Albany, CA; Kohl, Annemarie [Beneditkbeuern, DE; Jozwiak, Chris M [Oakland, CA

    2012-03-27

    A method is described herein for the providing of high quality graphene layers on silicon carbide wafers in a thermal process. With two wafers facing each other in close proximity, in a first vacuum heating stage, while maintained at a vacuum of around 10.sup.-6 Torr, the wafer temperature is raised to about 1500.degree. C., whereby silicon evaporates from the wafer leaving a carbon rich surface, the evaporated silicon trapped in the gap between the wafers, such that the higher vapor pressure of silicon above each of the wafers suppresses further silicon evaporation. As the temperature of the wafers is raised to about 1530.degree. C. or more, the carbon atoms self assemble themselves into graphene.

  14. Breeding and maintaining high-quality insects

    DEFF Research Database (Denmark)

    Jensen, Kim; Kristensen, Torsten Nygård; Heckmann, Lars-Henrik

    2017-01-01

    Insects have a large potential for sustainably enhancing global food and feed production, and commercial insect production is a rising industry of high economic value. Insects suitable for production typically have fast growth, short generation time, efficient nutrient utilization, high...... reproductive potential, and thrive at high density. Insects may cost-efficiently convert agricultural and industrial food by-products into valuable protein once the technology is finetuned. However, since insect mass production is a new industry, the technology needed to efficiently farm these animals is still...... in a starting phase. Here, we discuss the challenges and precautions that need to be considered when breeding and maintaining high-quality insect populations for food and feed. This involves techniques typically used in domestic animal breeding programs including maintaining genetically healthy populations...

  15. High Quality Virtual Reality for Architectural Exhibitions

    DEFF Research Database (Denmark)

    Kreutzberg, Anette

    2016-01-01

    This paper will summarise the findings from creating and implementing a visually high quality Virtual Reality (VR) experiment as part of an international architecture exhibition. It was the aim to represent the architectural spatial qualities as well as the atmosphere created from combining natural...... and artificial lighting in a prominent not yet built project. The outcome is twofold: Findings concerning the integration of VR in an exhibition space and findings concerning the experience of the virtual space itself. In the exhibition, an important aspect was the unmanned exhibition space, requiring the VR...... experience to be self-explanatory. Observations of different visitor reactions to the unmanned VR experience compared with visitor reactions at guided tours with personal instructions are evaluated. Data on perception of realism, spatial quality and light in the VR model were collected with qualitative...

  16. Evolution of dinosaur epidermal structures.

    Science.gov (United States)

    Barrett, Paul M; Evans, David C; Campione, Nicolás E

    2015-06-01

    Spectacularly preserved non-avian dinosaurs with integumentary filaments/feathers have revolutionized dinosaur studies and fostered the suggestion that the dinosaur common ancestor possessed complex integumentary structures homologous to feathers. This hypothesis has major implications for interpreting dinosaur biology, but has not been tested rigorously. Using a comprehensive database of dinosaur skin traces, we apply maximum-likelihood methods to reconstruct the phylogenetic distribution of epidermal structures and interpret their evolutionary history. Most of these analyses find no compelling evidence for the appearance of protofeathers in the dinosaur common ancestor and scales are usually recovered as the plesiomorphic state, but results are sensitive to the outgroup condition in pterosaurs. Rare occurrences of ornithischian filamentous integument might represent independent acquisitions of novel epidermal structures that are not homologous with theropod feathers. © 2015 The Author(s) Published by the Royal Society. All rights reserved.

  17. Biochemistry of epidermal stem cells.

    Science.gov (United States)

    Eckert, Richard L; Adhikary, Gautam; Balasubramanian, Sivaprakasam; Rorke, Ellen A; Vemuri, Mohan C; Boucher, Shayne E; Bickenbach, Jackie R; Kerr, Candace

    2013-02-01

    The epidermis is an important protective barrier that is essential for maintenance of life. Maintaining this barrier requires continuous cell proliferation and differentiation. Moreover, these processes must be balanced to produce a normal epidermis. The stem cells of the epidermis reside in specific locations in the basal epidermis, hair follicle and sebaceous glands and these cells are responsible for replenishment of this tissue. A great deal of effort has gone into identifying protein epitopes that mark stem cells, in identifying stem cell niche locations, and in understanding how stem cell populations are related. We discuss these studies as they apply to understanding normal epidermal homeostasis and skin cancer. An assortment of stem cell markers have been identified that permit assignment of stem cells to specific regions of the epidermis, and progress has been made in understanding the role of these cells in normal epidermal homeostasis and in conditions of tissue stress. A key finding is the multiple stem cell populations exist in epidermis that give rise to different structures, and that multiple stem cell types may contribute to repair in damaged epidermis. Understanding epidermal stem cell biology is likely to lead to important therapies for treating skin diseases and cancer, and will also contribute to our understanding of stem cells in other systems. This article is part of a Special Issue entitled Biochemistry of Stem Cells. Copyright © 2012 Elsevier B.V. All rights reserved.

  18. Biochemistry of epidermal stem cells☆

    Science.gov (United States)

    Eckert, Richard L.; Adhikary, Gautam; Balasubramanian, Sivaprakasam; Rorke, Ellen A.; Vemuri, Mohan C.; Boucher, Shayne E.; Bickenbach, Jackie R.; Kerr, Candace

    2014-01-01

    Background The epidermis is an important protective barrier that is essential for maintenance of life. Maintaining this barrier requires continuous cell proliferation and differentiation. Moreover, these processes must be balanced to produce a normal epidermis. The stem cells of the epidermis reside in specific locations in the basal epidermis, hair follicle and sebaceous glands and these cells are responsible for replenishment of this tissue. Scope of review A great deal of effort has gone into identifying protein epitopes that mark stem cells, in identifying stem cell niche locations, and in understanding how stem cell populations are related. We discuss these studies as they apply to understanding normal epidermal homeostasis and skin cancer. Major conclusions An assortment of stem cell markers have been identified that permit assignment of stem cells to specific regions of the epidermis, and progress has been made in understanding the role of these cells in normal epidermal homeostasis and in conditions of tissue stress. A key finding is the multiple stem cell populations exist in epidermis that give rise to different structures, and that multiple stem cell types may contribute to repair in damaged epidermis. General significance Understanding epidermal stem cell biology is likely to lead to important therapies for treating skin diseases and cancer, and will also contribute to our understanding of stem cells in other systems. This article is part of a Special Issue entitled Biochemistry of Stem Cells. PMID:22820019

  19. Optical studies of high quality synthetic diamond

    International Nuclear Information System (INIS)

    Sharp, S.J.

    1999-01-01

    This thesis is concerned with the study of fundamental and defect induced optical properties of synthetic diamond grown using high pressure, high temperature (HPHT) synthesis or chemical vapour deposition (CVD). The primary technique used for investigation is cathodoluminescence (including imaging and decay-time measurements) in addition to other forms of optical spectroscopy. This thesis is timely in that the crystallinity and purity of synthetic diamond has increased ten fold over the last few years. The diamond exciton emission, which is easily quenched by the presence of defects, is studied in high quality samples in detail. In addition the ability now exists to engineer the isotopic content of synthetic diamond to a high degree of accuracy. The experimental chapters are divided as follows: Chapter 2: High resolution, low temperature spectra reveal a splitting of the free-exciton phonon recombination emission peaks and the bound-exciton zero phonon line. Included are measurements of the variation in intensity and decay-time as a function of temperature. Chapter 3: The shift in energy of the phonon-assisted free-exciton phonon replicas with isotopic content has been measured. The shift is in agreement with the results of interatomic force model for phonon scattering due to isotope disorder. Chapter 4: A study of the shift in energy with isotopic content of the diamond of the GR1 band due to the neutral vacancy has allowed a verification of the theoretical predictions due to the Jahn Teller effect. Chapter 5: The spatial distribution of the free-exciton luminescence is studied in HPHT synthetic and CVD diamond. A variation in intensity with distance from the surface is interpreted as a significant non-radiative loss of excitons to the surface. Chapter 6: The decay-times of all known self-interstitial related centres have been measured in order to calculate the concentration of these centres present in electron irradiated diamond. (author)

  20. High Quality Data for Grid Integration Studies

    Energy Technology Data Exchange (ETDEWEB)

    Clifton, Andrew; Draxl, Caroline; Sengupta, Manajit; Hodge, Bri-Mathias

    2017-01-22

    As variable renewable power penetration levels increase in power systems worldwide, renewable integration studies are crucial to ensure continued economic and reliable operation of the power grid. The existing electric grid infrastructure in the US in particular poses significant limitations on wind power expansion. In this presentation we will shed light on requirements for grid integration studies as far as wind and solar energy are concerned. Because wind and solar plants are strongly impacted by weather, high-resolution and high-quality weather data are required to drive power system simulations. Future data sets will have to push limits of numerical weather prediction to yield these high-resolution data sets, and wind data will have to be time-synchronized with solar data. Current wind and solar integration data sets are presented. The Wind Integration National Dataset (WIND) Toolkit is the largest and most complete grid integration data set publicly available to date. A meteorological data set, wind power production time series, and simulated forecasts created using the Weather Research and Forecasting Model run on a 2-km grid over the continental United States at a 5-min resolution is now publicly available for more than 126,000 land-based and offshore wind power production sites. The National Solar Radiation Database (NSRDB) is a similar high temporal- and spatial resolution database of 18 years of solar resource data for North America and India. The need for high-resolution weather data pushes modeling towards finer scales and closer synchronization. We also present how we anticipate such datasets developing in the future, their benefits, and the challenges with using and disseminating such large amounts of data.

  1. Secreted Frizzled related protein-4 (sFRP4) promotes epidermal differentiation and apoptosis

    International Nuclear Information System (INIS)

    Maganga, Richard; Giles, Natalie; Adcroft, Katharine; Unni, Ambili; Keeney, Diane; Wood, Fiona; Fear, Mark; Dharmarajan, Arunasalam

    2008-01-01

    The skin provides vital protection from infection and dehydration. Maintenance of the skin is through a constant program of proliferation, differentiation and apoptosis of epidermal cells, whereby proliferating cells in the basal layer differentiating to form the keratinized, anucleated stratum corneum. The WNT signalling pathway is known to be important in the skin. WNT signalling has been shown to be important both in epidermal development and in the maintenance and cycling of hair follicles and epidermal stem cells. However, the precise role for this pathway in epidermal differentiation remains unknown. We investigated the role of the WNT signalling inhibitor sFRP4 in epidermal differentiation. sFRP4 is expressed in both normal skin and keratinocytes in culture. Expression of sFRP4 mRNA and protein increases with keratinocyte differentiation and apoptosis, whilst exposure of keratinocytes to exogenous sFRP4 promotes apoptosis and expression of the terminal differentiation marker Involucrin. These data suggest sFRP4 promotes epidermal differentiation.

  2. Psoriatic T cells reduce epidermal turnover time and affect cell proliferation contributed from differential gene expression.

    Science.gov (United States)

    Li, Junqin; Li, Xinhua; Hou, Ruixia; Liu, Ruifeng; Zhao, Xincheng; Dong, Feng; Wang, Chunfang; Yin, Guohua; Zhang, Kaiming

    2015-09-01

    Psoriasis is mediated primarily by T cells, which reduce epidermal turnover time and affect keratinocyte proliferation. We aimed to identify differentially expressed genes (DEG) in T cells from normal, five pairs of monozygotic twins concordant or discordant for psoriasis, to determine whether these DEG may account for the influence to epidermal turnover time and keratinocyte proliferation. The impact of T cells on keratinocyte proliferation and epidermal turnover time were investigated separately by immunohistochemistry and cultured with (3) H-TdR. mRNA expression patterns were investigated by RNA sequencing and verified by real-time reverse transcription polymerase chain reaction. After co-culture with psoriatic T cells, the expression of Ki-67, c-Myc and p53 increased, while expression of Bcl-2 and epidermal turnover time decreased. There were 14 DEG which were found to participate in the regulation of cell proliferation or differentiation. Psoriatic T cells exhibited the ability to decrease epidermal turnover time and affect keratinocyte proliferation because of the differential expression of PPIL1, HSPH1, SENP3, NUP54, FABP5, PLEKHG3, SLC9A9 and CHCHD4. © 2015 Japanese Dermatological Association.

  3. MicroRNA and gene signature of severe cutaneous drug ...

    African Journals Online (AJOL)

    Purpose: To build a microRNA and gene signature of severe cutaneous adverse drug reactions (SCAR), including Stevens-Johnson syndrome (SJS) and toxic epidermal necrolysis (TEN). Methods: MicroRNA expression profiles were downloaded from miRNA expression profile of patients' skin suffering from TEN using an ...

  4. Toxic epidermal necrolysis successfully treated with etanercept.

    Science.gov (United States)

    Gubinelli, Emanuela; Canzona, Flora; Tonanzi, Tiziano; Raskovic, Desanka; Didona, Biagio

    2009-03-01

    Toxic epidermal necrolysis (TEN) is a rare and acute severe adverse reaction to drugs, characterised by massive apoptosis and widespread epidermal and mucosal detachment. Although no gold standard therapy exists, human i.v. immunoglobulins have recently been described as an effective treatment for this disease. We report a case of phenobarbital-induced TEN in a 59-year-old white woman where the epidermal detachment stopped 48 h after beginning the etanercept treatment with complete healing after 20 days. To the best of our knowledge, this is only the second reported case of TEN successfully treated with etanercept.

  5. An Epidermal Biosensor for Carcinoembryonic Antigen

    National Research Council Canada - National Science Library

    Schwartz, Pauline

    2001-01-01

    ...). An epidermal biosensor is a new approach for the early continuous, in vivo detection of the onset of disease by the using genetically modified skin cells to respond to molecules secreted by tumor cells...

  6. An Epidermal Biosensor for Carcinoembryonic Antigen

    National Research Council Canada - National Science Library

    Schwartz, Pauline

    2003-01-01

    ...) An epidermal biosensor was conceived as a new approach for the early continuous, in vivo detection of the onset of disease by the using genetically modified skin cells to respond to molecules secreted by tumor cells...

  7. Epidermal growth factor in the rat prostate

    DEFF Research Database (Denmark)

    Tørring, Niels; Jørgensen, P E; Poulsen, Steen Seier

    1998-01-01

    Epidermal growth factor (EGF) induces proliferation in prostate epithelial and stromal cells in primary culture. This investigation was set up to characterize the time and spatial expression of EGF in the rat prostate.......Epidermal growth factor (EGF) induces proliferation in prostate epithelial and stromal cells in primary culture. This investigation was set up to characterize the time and spatial expression of EGF in the rat prostate....

  8. Foliar Epidermal Studies of Plants in Euphorbiaceae

    Directory of Open Access Journals (Sweden)

    H. A. Thakur

    2014-03-01

    Full Text Available This paper describes foliar epidermal structure in 17 species belonging to 17 genera of the family Euphoprbiaceae. Anomocytic stomata is predominant, rarely they are anisocytic, paracytic on the same foliar surface with different combinations. Leaves are hypostomatic and rarely amphistomatic. The foliar surface is smooth, rarely striated. The foliar epidermal cell walls are straight or undulate. Distribution of stomata, stomatal index, stomatal frequency, stomatal size and other cell wall contours are described in detail.

  9. Epidermal Inclusion Cysts of The Breast

    Directory of Open Access Journals (Sweden)

    Amir R. Motabar

    2009-02-01

    Full Text Available Epidermal inclusion cysts are uncommon in the breast, but the consequences can besevere when these cysts occur in the breast parenchyma. Here,we report two suchcases. The patient in case 1 was an 37-year-old woman with a 3-cm palpable mass inthe right breast. Mammography revealed a round and smoothly outlined mass, whichindicated a benign tumor, and sonography showed an irregularly shaped and heterogeneoushypoechoic mass, fibroadenoma was suspected on the basis of clinical andimage findings, but excisional biopsy revealed an epidermal inclusion cyst. The patientin case 2 was a 50-year-old woman with a 2.5-cm lesion in the left breast. Mammographyrevealed a round, dense, smoothly outlined mass, and sonography showeda well-defined, central hyperechoic mass. . Breast cancer was suspected on the basisof the sonographic findings and the age of the patient, but the resected specimen revealedan epidermal inclusion cyst. Although epidermal inclusion cysts are benign,occasionally they may play a role in the origin of squamous carcinoma of the breast. .Mammographic and sonographic features of an epidermal cyst may mimic a malignantlesion. Malignant change appears to occur more frequently in epidermal inclusioncysts in the mammary gland, compared to common epidermal inclusion cysts,and this may be associated with origination of mammary epidermal inclusion cystsfrom squamous metaplasia of the mammary duct epithelium.Epidermmoid inclusion cyst of the breast is potentially serious, although such cystsare rare, and differentiation from a malignant or benign breast tumor is required. Excisionis probably the most appropriate treatment, and can eliminate the possible riskof malignant transformation.

  10. Analysis of high-quality modes in open chaotic microcavities

    International Nuclear Information System (INIS)

    Fang, W.; Yamilov, A.; Cao, H.

    2005-01-01

    We present a numerical study of the high-quality modes in two-dimensional dielectric stadium microcavities. Although the classical ray mechanics is fully chaotic in a stadium billiard, all of the high-quality modes show a 'strong scar' around unstable periodic orbits. When the deformation (ratio of the length of the straight segments over the diameter of the half circles) is small, the high-quality modes correspond to whispering-gallery-type trajectories and their quality factors decrease monotonically with increasing deformation. At large deformation, each high-quality mode is associated with multiple unstable periodic orbits. Its quality factor changes nonmonotonically with the deformation, and there exists an optimal deformation for each mode at which its quality factor reaches a local maximum. This unusual behavior is attributed to the interference of waves propagating along different constituent orbits that could minimize light leakage out of the cavity

  11. Innovative and high quality education through Open Education and OER

    OpenAIRE

    Stracke, Christian M.

    2017-01-01

    Online presentation and webinar by Stracke, C. M. (2017, 18 December) on "Innovative and high quality education through Open Education and OER" for the Belt and Road Open Education Learning Week by the Beijing Normal University, China.

  12. Improving high quality, equitable maternal health services in Malawi ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Improving high quality, equitable maternal health services in Malawi (IMCHA) ... In response, the Ministry of Health implemented a Standards-Based Management and Recognition for Reproductive Health initiative to improve ... Total funding.

  13. High Quality Education and Learning for All through Open Education

    NARCIS (Netherlands)

    Stracke, Christian M.

    2016-01-01

    Keynote at the International Lensky Education Forum 2016, Yakutsk, Republic of Sakha, Russian Federation, by Stracke, C. M. (2016, 16 August): "High Quality Education and Learning for All through Open Education"

  14. Extraction of low molecular weight RNA from Citrus trifolita tissues ...

    African Journals Online (AJOL)

    Jane

    2010-12-20

    Dec 20, 2010 ... A critical prerequisite in miRNA studies is acquisition of high quality LMW RNA. LMW RNA is ..... air-dried for a few minutes and then exposed to BIOMAX X-ray film for 48 h using an .... Approaches to microRNA discovery. Nat.

  15. Analysis of E2F factors during epidermal differentiation.

    Science.gov (United States)

    Chang, Wing Y; Dagnino, Lina

    2005-01-01

    The multigene E2F family of transcription factors is central in the control of cell cycle progression. The expression and activity of E2F proteins is tightly regulated transcriptionally and posttranslationally as a function of the proliferation and differentiation status of the cell. In this chapter, we review protocols designed to determine E2F mRNA abundance in tissues by in situ hybridization techniques. The ability to culture primary epidermal keratinocytes and maintain them as either undifferentiated or terminally differentiated cells allows the biochemical and molecular characterization of changes in E2F expression and activity. Thus, we also discuss in detail methods to analyze E2F protein abundance by immunoblot and their ability to bind DNA in cultured cells using electrophoretic mobility shift assays.

  16. The DP-1 transcription factor is required for keratinocyte growth and epidermal stratification.

    Science.gov (United States)

    Chang, Wing Y; Bryce, Dawn M; D'Souza, Sudhir J A; Dagnino, Lina

    2004-12-03

    The epidermis is a stratified epithelium constantly replenished through the ability of keratinocytes in its basal layer to proliferate and self-renew. The epidermis arises from a single-cell layer ectoderm during embryogenesis. Large proliferative capacity is central to ectodermal cell and basal keratinocyte function. DP-1, a heterodimeric partner of E2F transcription factors, is highly expressed in the ectoderm and all epidermal layers during embryogenesis. To investigate the role of DP-1 in epidermal morphogenesis, we inhibited DP-1 activity through exogenous expression of a dominant-negative mutant (dnDP-1). Expression of the dnDP-1 mutant interferes with binding of E2F/DP-1 heterodimers to DNA and inhibits DNA replication, as well as cyclin A mRNA and protein expression. Chromatin immunoprecipitation analysis demonstrated that the cyclin A promoter is predominantly bound in proliferating keratinocytes by complexes containing E2F-3 and E2F-4. Thus, the mechanisms of decreased expression of cyclin A in the presence of dnDP-1 seem to involve inactivation of DP-1 complexes containing E2F-3 and E2F-4. To assess the consequences on epidermal morphogenesis of inhibiting DP-1 activity, we expressed dnDP-1 in rat epithelial keratinocytes in organotypic culture and observed that DP-1 inhibition negatively affected stratification of these cells. Likewise, expression of dnDP-1 in embryonic ectoderm explants produced extensive disorganization of subsequently formed epidermal basal and suprabasal layers, interfering with normal epidermal formation. We conclude that DP-1 activity is required for normal epidermal morphogenesis and ectoderm-to-epidermis transition.

  17. Concrete Waste Recycling Process for High Quality Aggregate

    International Nuclear Information System (INIS)

    Ishikura, Takeshi; Fujii, Shin-ichi

    2008-01-01

    Large amount of concrete waste generates during nuclear power plant (NPP) dismantling. Non-contaminated concrete waste is assumed to be disposed in a landfill site, but that will not be the solution especially in the future, because of decreasing tendency of the site availability and natural resources. Concerning concrete recycling, demand for roadbeds and backfill tends to be less than the amount of dismantled concrete generated in a single rural site, and conventional recycled aggregate is limited of its use to non-structural concrete, because of its inferior quality to ordinary natural aggregate. Therefore, it is vital to develop high quality recycled aggregate for general uses of dismantled concrete. If recycled aggregate is available for high structural concrete, the dismantling concrete is recyclable as aggregate for industry including nuclear field. Authors developed techniques on high quality aggregate reclamation for large amount of concrete generated during NPP decommissioning. Concrete of NPP buildings has good features for recycling aggregate; large quantity of high quality aggregate from same origin, record keeping of the aggregate origin, and little impurities in dismantled concrete such as wood and plastics. The target of recycled aggregate in this development is to meet the quality criteria for NPP concrete as prescribed in JASS 5N 'Specification for Nuclear Power Facility Reinforced Concrete' and JASS 5 'Specification for Reinforced Concrete Work'. The target of recycled aggregate concrete is to be comparable performance with ordinary aggregate concrete. The high quality recycled aggregate production techniques are assumed to apply for recycling for large amount of non-contaminated concrete. These techniques can also be applied for slightly contaminated concrete dismantled from radiological control area (RCA), together with free release survey. In conclusion: a technology on dismantled concrete recycling for high quality aggregate was developed

  18. A high quality Arabidopsis transcriptome for accurate transcript-level analysis of alternative splicing

    KAUST Repository

    Zhang, Runxuan

    2017-04-05

    Alternative splicing generates multiple transcript and protein isoforms from the same gene and thus is important in gene expression regulation. To date, RNA-sequencing (RNA-seq) is the standard method for quantifying changes in alternative splicing on a genome-wide scale. Understanding the current limitations of RNA-seq is crucial for reliable analysis and the lack of high quality, comprehensive transcriptomes for most species, including model organisms such as Arabidopsis, is a major constraint in accurate quantification of transcript isoforms. To address this, we designed a novel pipeline with stringent filters and assembled a comprehensive Reference Transcript Dataset for Arabidopsis (AtRTD2) containing 82,190 non-redundant transcripts from 34 212 genes. Extensive experimental validation showed that AtRTD2 and its modified version, AtRTD2-QUASI, for use in Quantification of Alternatively Spliced Isoforms, outperform other available transcriptomes in RNA-seq analysis. This strategy can be implemented in other species to build a pipeline for transcript-level expression and alternative splicing analyses.

  19. A high quality Arabidopsis transcriptome for accurate transcript-level analysis of alternative splicing

    KAUST Repository

    Zhang, Runxuan; Calixto, Cristiane  P.  G.; Marquez, Yamile; Venhuizen, Peter; Tzioutziou, Nikoleta A.; Guo, Wenbin; Spensley, Mark; Entizne, Juan Carlos; Lewandowska, Dominika; ten  Have, Sara; Frei  dit  Frey, Nicolas; Hirt, Heribert; James, Allan B.; Nimmo, Hugh G.; Barta, Andrea; Kalyna, Maria; Brown, John  W.  S.

    2017-01-01

    Alternative splicing generates multiple transcript and protein isoforms from the same gene and thus is important in gene expression regulation. To date, RNA-sequencing (RNA-seq) is the standard method for quantifying changes in alternative splicing on a genome-wide scale. Understanding the current limitations of RNA-seq is crucial for reliable analysis and the lack of high quality, comprehensive transcriptomes for most species, including model organisms such as Arabidopsis, is a major constraint in accurate quantification of transcript isoforms. To address this, we designed a novel pipeline with stringent filters and assembled a comprehensive Reference Transcript Dataset for Arabidopsis (AtRTD2) containing 82,190 non-redundant transcripts from 34 212 genes. Extensive experimental validation showed that AtRTD2 and its modified version, AtRTD2-QUASI, for use in Quantification of Alternatively Spliced Isoforms, outperform other available transcriptomes in RNA-seq analysis. This strategy can be implemented in other species to build a pipeline for transcript-level expression and alternative splicing analyses.

  20. Learning Disabilities and Achieving High-Quality Education Standards

    Science.gov (United States)

    Gartland, Debi; Strosnider, Roberta

    2017-01-01

    This is an official document of the National Joint Committee on Learning Disabilities (NJCLD), of which Council for Learning Disabilities is a long-standing, active member. With this position paper, NJCLD advocates for the implementation of high-quality education standards (HQES) for students with learning disabilities (LD) and outlines the…

  1. extraction of high quality dna from polysaccharides-secreting ...

    African Journals Online (AJOL)

    cistvr

    A DNA extraction method using CTAB was used for the isolation of genomic DNA from ten. Xanthomonas campestris pathovars, ten isolates of Xanthomonas albilineans and one isolate of. Pseudomonas rubrisubalbicans. High quality DNA was obtained that was ideal for molecular analy- ses. Extracellular polysaccharides ...

  2. Negative Binomial charts for monitoring high-quality processes

    NARCIS (Netherlands)

    Albers, Willem/Wim

    Good control charts for high quality processes are often based on the number of successes between failures. Geometric charts are simplest in this respect, but slow in recognizing moderately increased failure rates p. Improvement can be achieved by waiting until r > 1 failures have occurred, i.e. by

  3. Adoption and impact of high quality bambara flour (HQBF ...

    African Journals Online (AJOL)

    Adoption and impact of high quality bambara flour (HQBF) technology in the ... consumer acceptability/quality of products, credit, availability of raw materials, and ... as a result of 12.5 per cent increase in demand for bambara-based products.

  4. Synthesis and spectroscopic study of high quality alloy Cdx S ...

    Indian Academy of Sciences (India)

    Wintec

    In the present study, we report the synthesis of high quality CdxZn1–xS nanocrystals alloy at. 150°C with .... (XRD) using a Siemens model D 500, powder X-ray ... decays were analysed using IBH DAS6 software. 3. ... This alloying process is.

  5. Isolation of high quality DNA and RNA from cambium of the East ...

    African Journals Online (AJOL)

    STORAGESEVER

    2009-07-06

    Jul 6, 2009 ... bitat modification and unsustainable rates of exploitation. (Joshi and Joshi, 2000; ... actively dividing cells between xylem (wood) and phloem. (bast) tissues ... pellet washed twice with 450 µl of 70% ethanol before air drying.

  6. Co-extraction of high-quality RNA and DNA from rubber tree (Hevea ...

    African Journals Online (AJOL)

    DR TONUKARI NYEROVWO

    2012-05-15

    May 15, 2012 ... method was also evaluated, and the results show that it was suitable for a variety of plants. Key words: Hevea ... Southeast Asia, where it covers more than 90% of the .... After air drying for. 10 min, it was ..... and cost-effective.

  7. EPIDERMAL MORPHOLOGY OF WEST AFRICAN OKRA ...

    African Journals Online (AJOL)

    Administrator

    stem peels were obtained from a slight cut on the tenth internodes. Peels from fruit ... xia l su rfa ce. A b a xia l su rfa ce. Adaxial surface. Abaxial surface. L e n g th. (µ m. ) ..... Variations in epidermal cell shape of both adaxial and abaxial surfaces ...

  8. FOLIAR EPIDERMAL AND PHYTOCHEMICAL STUDIES OF THE ...

    African Journals Online (AJOL)

    Administrator

    alkaloid, saponin, inulin, cellulose, tannin and lignin; Eragrostis tremula tested negative for lignin and positive for cellulose, saponin and alkaloids while Axonopus compressus tested negative for lignin, but positive for alkaloid, saponin, inulin, cellulose and tannin respectively. Leaf epidermal studies help to determine ...

  9. Stevens Johnsons syndrom og toksisk epidermal nekrolyse

    DEFF Research Database (Denmark)

    Kaur-Knudsen, Diljit; Zachariae, Claus; Thomsen, Simon Francis

    2013-01-01

    Stevens-Johnson syndrome and toxic epidermal necrolysis are acute mucocutaneous diseases primarily due to drug intake. The diseases are characterised by the separation of epidermis from dermis which can be life-threatening. Mortality is often caused by sepsis and multiple organ failure. The most...

  10. Response of human epidermal keratinocytes to UV light

    International Nuclear Information System (INIS)

    Kartasova, A.A.

    1987-01-01

    This thesis presents a study on the response of human epidermal keratinocytes to UV light as well as to other agents like 4-NQO and TPA. The effects of ultraviolet (UV) light on the protein synthesis in cultured keratinocytes are presented in ch. III. The next chapter describes the construction of a cDNA library using mRNA isolated from UV irradiated kernatinocytes. This library was differentially screened with cDNA probes synthesized on mRNA from either UV irradiated or nonirradiated cells. Several groups of cDNA clones corresponding to transcripts whose level in the cytoplasm seem to be affected by exposure to UV light have been isolated and characterized by cross-hybridization, sequencing and Northern blot analysis. More detailed analysis of some of the cDNA clones is presented in the two chapters following ch. IV. The complete cDNA sequence of the proteinase inhibitor cystatin A and the modulation of its expression by UV light and the carcinogen 4-nitroquinoline 1-oxide (4-NQO) in keratinocytes are described in ch. V. Two other groups of cDNA clones have been isolated which do not cross-hybridize with each other on Southern blots. However, the primary structures of the proteins deduced from the nucleotide sequences of these two groups of cDNA clones are very similar. 212 refs.; 33 figs.; 2 tabs

  11. Next Generation High Quality Videoconferencing Service for the LHC

    CERN Multimedia

    CERN. Geneva

    2012-01-01

    In recent times, we have witnessed an explosion of video initiatives in the industry worldwide. Several advancements in video technology are currently improving the way we interact and collaborate. These advancements are forcing tendencies and overall experiences: any device in any network can be used to collaborate, in most cases with an overall high quality. To cope with this technology progresses, CERN IT Department has taken the leading role to establish strategies and directions to improve the user experience in remote dispersed meetings and remote collaboration at large in the worldwide LHC communities. Due to the high rate of dispersion in the LHC user communities, these are critically dependent of videoconferencing technology, with a need of robustness and high quality for the best possible user experience. We will present an analysis of the factors that influenced the technical and strategic choices to improve the reliability, efficiency and overall quality of the LHC remote sessions. In particular, ...

  12. Wellbeing Understanding in High Quality Healthcare Informatics and Telepractice.

    Science.gov (United States)

    Fiorini, Rodolfo A; De Giacomo, Piero; L'Abate, Luciano

    2016-01-01

    The proper use of healthcare informatics technology and multidimensional conceptual clarity are fundamental to create and boost outstanding clinical and telepractice results. Avoiding even terminology ambiguities is mandatory for high quality of care service. For instance, well-being or wellbeing is a different way to write the same concept only, or there is a good deal of ambiguity around the meanings of these terms the way they are written. In personal health, healthcare and healthcare informatics, this kind of ambiguity and lack of conceptual clarity has been called out repeatedly over the past 50 years. It is time to get the right, terse scenario. We present a brief review to develop and achieve ultimate wellbeing understanding for practical high quality healthcare informatics and telepractice application. This article presents an innovative point of view on deeper wellbeing understanding towards its increased clinical effective application.

  13. Methods and systems for fabricating high quality superconducting tapes

    Science.gov (United States)

    Majkic, Goran; Selvamanickam, Venkat

    2018-02-13

    An MOCVD system fabricates high quality superconductor tapes with variable thicknesses. The MOCVD system can include a gas flow chamber between two parallel channels in a housing. A substrate tape is heated and then passed through the MOCVD housing such that the gas flow is perpendicular to the tape's surface. Precursors are injected into the gas flow for deposition on the substrate tape. In this way, superconductor tapes can be fabricated with variable thicknesses, uniform precursor deposition, and high critical current densities.

  14. Process to Continuously Melt, Refine and Cast High Quality Steel

    Energy Technology Data Exchange (ETDEWEB)

    None

    2005-09-01

    The purpose of this project is to conduct research and development targeted at designing a revolutionary steelmaking process. This process will deliver high quality steel from scrap to the casting mold in one continuous process and will be safer, more productive, and less capital intensive to build and operate than conventional steelmaking. The new process will produce higher quality steel faster than traditional batch processes while consuming less energy and other resources.

  15. High-quality uniform dry transfer of graphene to polymers.

    Science.gov (United States)

    Lock, Evgeniya H; Baraket, Mira; Laskoski, Matthew; Mulvaney, Shawn P; Lee, Woo K; Sheehan, Paul E; Hines, Daniel R; Robinson, Jeremy T; Tosado, Jacob; Fuhrer, Michael S; Hernández, Sandra C; Walton, Scott G

    2012-01-11

    In this paper we demonstrate high-quality, uniform dry transfer of graphene grown by chemical vapor deposition on copper foil to polystyrene. The dry transfer exploits an azide linker molecule to establish a covalent bond to graphene and to generate greater graphene-polymer adhesion compared to that of the graphene-metal foil. Thus, this transfer approach provides a novel alternative route for graphene transfer, which allows for the metal foils to be reused. © 2011 American Chemical Society

  16. High quality digital holographic reconstruction on analog film

    Science.gov (United States)

    Nelsen, B.; Hartmann, P.

    2017-05-01

    High quality real-time digital holographic reconstruction, i.e. at 30 Hz frame rates, has been at the forefront of research and has been hailed as the holy grail of display systems. While these efforts have produced a fascinating array of computer algorithms and technology, many applications of reconstructing high quality digital holograms do not require such high frame rates. In fact, applications such as 3D holographic lithography even require a stationary mask. Typical devices used for digital hologram reconstruction are based on spatial-light-modulator technology and this technology is great for reconstructing arbitrary holograms on the fly; however, it lacks the high spatial resolution achievable by its analog counterpart, holographic film. Analog holographic film is therefore the method of choice for reconstructing highquality static holograms. The challenge lies in taking a static, high-quality digitally calculated hologram and effectively writing it to holographic film. We have developed a theoretical system based on a tunable phase plate, an intensity adjustable high-coherence laser and a slip-stick based piezo rotation stage to effectively produce a digitally calculated hologram on analog film. The configuration reproduces the individual components, both the amplitude and phase, of the hologram in the Fourier domain. These Fourier components are then individually written on the holographic film after interfering with a reference beam. The system is analogous to writing angularly multiplexed plane waves with individual component phase control.

  17. Long quantum channels for high-quality entanglement transfer

    International Nuclear Information System (INIS)

    Banchi, L; Apollaro, T J G; Cuccoli, A; Verrucchi, P; Vaia, R

    2011-01-01

    High-quality quantum-state and entanglement transfer can be achieved in an unmodulated spin bus operating in the ballistic regime, which occurs when the endpoint qubits A and B are nonperturbatively coupled to the chain by a suitable exchange interaction j 0 . Indeed, the transition amplitude characterizing the transfer quality exhibits a maximum for a finite optimal value j opt 0 (N), where N is the channel length. We show that j opt 0 (N) scales as N -1/6 for large N and that it ensures a high-quality entanglement transfer even in the limit of arbitrarily long channels, almost independently of the channel initialization. For instance, for any chain length the average quantum-state transmission fidelity exceeds 90% and decreases very little in a broad neighbourhood of j opt 0 (N). We emphasize that, taking the reverse point of view, should j 0 be experimentally constrained, high-quality transfer can still be obtained by adjusting the channel length to its optimal value. (paper)

  18. High-quality cardiopulmonary resuscitation: current and future directions.

    Science.gov (United States)

    Abella, Benjamin S

    2016-06-01

    Cardiopulmonary resuscitation (CPR) represents the cornerstone of cardiac arrest resuscitation care. Prompt delivery of high-quality CPR can dramatically improve survival outcomes; however, the definitions of optimal CPR have evolved over several decades. The present review will discuss the metrics of CPR delivery, and the evidence supporting the importance of CPR quality to improve clinical outcomes. The introduction of new technologies to quantify metrics of CPR delivery has yielded important insights into CPR quality. Investigations using CPR recording devices have allowed the assessment of specific CPR performance parameters and their relative importance regarding return of spontaneous circulation and survival to hospital discharge. Additional work has suggested new opportunities to measure physiologic markers during CPR and potentially tailor CPR delivery to patient requirements. Through recent laboratory and clinical investigations, a more evidence-based definition of high-quality CPR continues to emerge. Exciting opportunities now exist to study quantitative metrics of CPR and potentially guide resuscitation care in a goal-directed fashion. Concepts of high-quality CPR have also informed new approaches to training and quality improvement efforts for cardiac arrest care.

  19. Integration study of high quality teaching resources in universities

    Directory of Open Access Journals (Sweden)

    Honglu Liu

    2012-12-01

    Full Text Available Purpose: The development level and quality of education depend on the merits and efficiency in the use of teaching resources, especially in the case of obvious contradiction between the demand and supply of teaching resources. So to integrate teaching resources, improve the efficiency in the use of high quality teaching resources, and take the road of content development to enhance the competitiveness of education has become very important and urgent.Design/methodology/approach: On the basis of analysis on the teaching resources of universities and the problems they faced, this paper introduced the basic concepts of cloud storage, and built the integration architecture of high quality teaching resources in universities based on the cloud storage.Findings and Originality/value: The HDFS-based cloud storage proposed in this paper is a dynamically adjustable and Internet-based storage solution, and the users can access storage targets using the network through a common and easy-to-use protocol and application programming interfaces. This new technology is useful for end users benefits. With the continuous development and improvement of cloud storage, it will necessarily result in more and more applications in the institutions of higher learning and education network.Originality/value: This paper introduced the cloud storage into the integration of high quality teaching resources in universities first and as a new form of service, it can be a good solution.

  20. Epidermal Growth Factor and Intestinal Barrier Function

    Directory of Open Access Journals (Sweden)

    Xiaopeng Tang

    2016-01-01

    Full Text Available Epidermal growth factor (EGF is a 53-amino acid peptide that plays an important role in regulating cell growth, survival, migration, apoptosis, proliferation, and differentiation. In addition, EGF has been established to be an effective intestinal regulator helping to protect intestinal barrier integrity, which was essential for the absorption of nutrients and health in humans and animals. Several researches have demonstrated that EGF via binding to the EGF receptor and subsequent activation of Ras/MAPK, PI3K/AKT, PLC-γ/PKC, and STATS signal pathways regulates intestinal barrier function. In this review, the relationship between epidermal growth factor and intestinal development and intestinal barrier is described, to provide a better understanding of the effects of EGF on intestine development and health.

  1. Epidermal CYP2 family cytochromes P450

    International Nuclear Information System (INIS)

    Du Liping; Hoffman, Susan M.G.; Keeney, Diane S.

    2004-01-01

    Skin is the largest and most accessible drug-metabolizing organ. In mammals, it is the competent barrier that protects against exposure to harmful stimuli in the environment and in the systemic circulation. Skin expresses many cytochromes P450 that have critical roles in exogenous and endogenous substrate metabolism. Here, we review evidence for epidermal expression of genes from the large CYP2 gene family, many of which are expressed preferentially in extrahepatic tissues or specifically in epithelia at the environmental interface. At least 13 CYP2 genes (CYP2A6, 2A7, 2B6, 2C9, 2C18, 2C19, 2D6, 2E1, 2J2, 2R1, 2S1, 2U1, and 2W1) are expressed in skin from at least some human individuals, and the majority of these genes are expressed in epidermis or cultured keratinocytes. Where epidermal expression has been localized in situ by hybridization or immunocytochemistry, CYP2 transcripts and proteins are most often expressed in differentiated keratinocytes comprising the outer (suprabasal) cell layers of the epidermis and skin appendages. The tissue-specific transcriptional regulation of CYP2 genes in the epidermis, and in other epithelia that interface with the environment, suggests important roles for at least some CYP2 gene products in the production and disposition of molecules affecting competency of the epidermal barrier

  2. Epidermal cell death in frogs with chytridiomycosis

    Directory of Open Access Journals (Sweden)

    Laura A. Brannelly

    2017-02-01

    Full Text Available Background Amphibians are declining at an alarming rate, and one of the major causes of decline is the infectious disease chytridiomycosis. Parasitic fungal sporangia occur within epidermal cells causing epidermal disruption, but these changes have not been well characterised. Apoptosis (planned cell death can be a damaging response to the host but may alternatively be a mechanism of pathogen removal for some intracellular infections. Methods In this study we experimentally infected two endangered amphibian species Pseudophryne corroboree and Litoria verreauxii alpina with the causal agent of chytridiomycosis. We quantified cell death in the epidermis through two assays: terminal transferase-mediated dUTP nick end-labelling (TUNEL and caspase 3/7. Results Cell death was positively associated with infection load and morbidity of clinically infected animals. In infected amphibians, TUNEL positive cells were concentrated in epidermal layers, correlating to the localisation of infection within the skin. Caspase activity was stable and low in early infection, where pathogen loads were light but increasing. In animals that recovered from infection, caspase activity gradually returned to normal as the infection cleared. Whereas, in amphibians that did not recover, caspase activity increased dramatically when infection loads peaked. Discussion Increased cell death may be a pathology of the fungal parasite, likely contributing to loss of skin homeostatic functions, but it is also possible that apoptosis suppression may be used initially by the pathogen to help establish infection. Further research should explore the specific mechanisms of cell death and more specifically apoptosis regulation during fungal infection.

  3. Key factors for a high-quality VR experience

    Science.gov (United States)

    Champel, Mary-Luc; Doré, Renaud; Mollet, Nicolas

    2017-09-01

    For many years, Virtual Reality has been presented as a promising technology that could deliver a truly new experience to users. The media and entertainment industry is now investigating the possibility to offer a video-based VR 360 experience. Nevertheless, there is a substantial risk that VR 360 could have the same fate as 3DTV if it cannot offer more than just being the next fad. The present paper aims at presenting the various quality factors required for a high-quality VR experience. More specifically, this paper will focus on the main three VR quality pillars: visual, audio and immersion.

  4. Anti-Stokes Luminescence in High Quality Quantum Wells

    Science.gov (United States)

    Vinattieri, A.; Bogani, F.; Miotto, A.; Ceccherini, S.

    1997-11-01

    We present a detailed investigation of the anti-Stokes (AS) luminescence which originates from exciton recombination when below gap excitation is used, in a set of high quality quantum well structures. We observe strong excitonic resonances in the AS signal as measured from photoluminescence and photoluminescence excitation spectra. We demonstrate that neither the electromagnetic coupling between the wells nor the morphological disorder can explain this up-conversion effect. Time-resolved luminescence data after ps excitation and fs correlation spectroscopy results provide clear evidence of the occurrence of a two-step absorption which is assisted by the exciton population resonantly excited by the first photon.

  5. Methods and systems for fabricating high quality superconducting tapes

    Energy Technology Data Exchange (ETDEWEB)

    Majkic, Goran; Selvamanickam, Venkat

    2018-02-13

    An MOCVD system fabricates high quality superconductor tapes with variable thicknesses. The MOCVD system can include a gas flow chamber between two parallel channels in a housing. A substrate tape is heated and then passed through the MOCVD housing such that the gas flow is perpendicular to the tape's surface. Precursors are injected into the gas flow for deposition on the substrate tape. In this way, superconductor tapes can be fabricated with variable thicknesses, uniform precursor deposition, and high critical current densities.

  6. RNA interference in Lepidoptera

    DEFF Research Database (Denmark)

    Terenius, Ole; Papanicolaou, Alexie; Garbutt, Jennie S.

    2011-01-01

    in RNAi experiments in Lepidoptera are discussed. The review also points to a need to further investigate the mechanism of RNAi in lepidopteran insects and its possible connection to the innate immune response. Our general understanding of RNAi in Lepidoptera will be further aided in the future as our...... experiments have not been collected in such a way that they are possible to analyze. In this review, we have collected detailed data from more than 150 experiments including all to date published and many unpublished experiments. Despite a large variation in the data, trends that are found are that RNAi...... is particularly successful in the family Saturniidae and in genes involved in immunity. On the contrary, gene expression in epidermal tissues seems to be most difficult to silence. In addition, gene silencing by feeding dsRNA requires high concentrations for success. Possible causes for the variability of success...

  7. Optimisation of high-quality total ribonucleic acid isolation from cartilaginous tissues for real-time polymerase chain reaction analysis.

    Science.gov (United States)

    Peeters, M; Huang, C L; Vonk, L A; Lu, Z F; Bank, R A; Helder, M N; Doulabi, B Zandieh

    2016-11-01

    Studies which consider the molecular mechanisms of degeneration and regeneration of cartilaginous tissues are seriously hampered by problematic ribonucleic acid (RNA) isolations due to low cell density and the dense, proteoglycan-rich extracellular matrix of cartilage. Proteoglycans tend to co-purify with RNA, they can absorb the full spectrum of UV light and they are potent inhibitors of polymerase chain reaction (PCR). Therefore, the objective of the present study is to compare and optimise different homogenisation methods and RNA isolation kits for an array of cartilaginous tissues. Tissue samples such as the nucleus pulposus (NP), annulus fibrosus (AF), articular cartilage (AC) and meniscus, were collected from goats and homogenised by either the MagNA Lyser or Freezer Mill. RNA of duplicate samples was subsequently isolated by either TRIzol (benchmark), or the RNeasy Lipid Tissue, RNeasy Fibrous Tissue, or Aurum Total RNA Fatty and Fibrous Tissue kits. RNA yield, purity, and integrity were determined and gene expression levels of type II collagen and aggrecan were measured by real-time PCR. No differences between the two homogenisation methods were found. RNA isolation using the RNeasy Fibrous and Lipid kits resulted in the purest RNA (A260/A280 ratio), whereas TRIzol isolations resulted in RNA that is not as pure, and show a larger difference in gene expression of duplicate samples compared with both RNeasy kits. The Aurum kit showed low reproducibility. For the extraction of high-quality RNA from cartilaginous structures, we suggest homogenisation of the samples by the MagNA Lyser. For AC, NP and AF we recommend the RNeasy Fibrous kit, whereas for the meniscus the RNeasy Lipid kit is advised.Cite this article: M. Peeters, C. L. Huang, L. A. Vonk, Z. F. Lu, R. A. Bank, M. N. Helder, B. Zandieh Doulabi. Optimisation of high-quality total ribonucleic acid isolation from cartilaginous tissues for real-time polymerase chain reaction analysis. Bone Joint Res 2016

  8. Percutaneous vertebroplasty with a high-quality rotational angiographic unit

    Energy Technology Data Exchange (ETDEWEB)

    Pedicelli, Alessandro [Department of Bioimaging and Radiological Sciences, Catholic University of Sacred Heart, Policl. A.Gemelli, l.go Gemelli 1, 00168 Rome (Italy)], E-mail: apedicelli@rm.unicatt.it; Rollo, Massimo [Department of Bioimaging and Radiological Sciences, Catholic University of Sacred Heart, Policl. A.Gemelli, l.go Gemelli 1, 00168 Rome (Italy)], E-mail: mrollo@rm.unicatt.it; Piano, Mariangela [Department of Bioimaging and Radiological Sciences, Catholic University of Sacred Heart, Policl. A.Gemelli, l.go Gemelli 1, 00168 Rome (Italy)], E-mail: mariangela.piano@gmail.com; Re, Thomas J. [Department of Bioimaging and Radiological Sciences, Catholic University of Sacred Heart, Policl. A.Gemelli, l.go Gemelli 1, 00168 Rome (Italy)], E-mail: tomjre@gmail.com; Cipriani, Maria C. [Department of Gerontology, Catholic University of Sacred Heart, Policl. A.Gemelli, l.go Gemelli 1, 00168 Rome (Italy)], E-mail: alexped@yahoo.com; Colosimo, Cesare [Department of Bioimaging and Radiological Sciences, Catholic University of Sacred Heart, Policl. A.Gemelli, l.go Gemelli 1, 00168 Rome (Italy)], E-mail: colosimo@rm.unicatt.it; Bonomo, Lorenzo [Department of Bioimaging and Radiological Sciences, Catholic University of Sacred Heart, Policl. A.Gemelli, l.go Gemelli 1, 00168 Rome (Italy)], E-mail: lbonomo@rm.unicatt.it

    2009-02-15

    We evaluated the reliability of a rotational angiographic unit (RA) with flat-panel detector as a single technique to guide percutaneous vertebroplasty (PVP) and for post-procedure assessment by 2D and 3D reformatted images. Fifty-five consecutive patients (104 vertebral bodies) were treated under RA fluoroscopy. Rotational acquisitions with 2D and 3D reconstruction were obtained in all patients for immediate post-procedure assessment. In complex cases, this technique was also used to evaluate the needle position during the procedure. All patients underwent CT scan after the procedure. RA and CT findings were compared. In all cases, a safe trans-pedicular access and an accurate control of the bone-cement injection were successfully performed with high-quality fluoroscopy, even at the thoracic levels and in case of vertebra plana. 2D and 3D rotational reconstructions permitted CT-like images that clearly showed needle position and were similar to CT findings in depicting intrasomatic implant-distribution. RA detected 40 cement leakages compared to 42 demonstrated by CT and showed overall 95% sensitivity and 100% specificity compared to CT for final post-procedure assessment. Our preliminary results suggest that high-quality RA is reliable and safe as a single technique for PVP guidance, control and post-procedure assessment. It permits fast and cost-effective procedures avoiding multi-modality imaging.

  9. Computer-aided control of high-quality cast iron

    Directory of Open Access Journals (Sweden)

    S. Pietrowski

    2008-04-01

    Full Text Available The study discusses the possibility of control of the high-quality grey cast iron and ductile iron using the author’s genuine computer programs. The programs have been developed with the help of algorithms based on statistical relationships that are said to exist between the characteristic parameters of DTA curves and properties, like Rp0,2, Rm, A5 and HB. It has been proved that the spheroidisation and inoculation treatment of cast iron changes in an important way the characteristic parameters of DTA curves, thus enabling a control of these operations as regards their correctness and effectiveness, along with the related changes in microstructure and mechanical properties of cast iron. Moreover, some examples of statistical relationships existing between the typical properties of ductile iron and its control process were given for cases of the melts consistent and inconsistent with the adopted technology.A test stand for control of the high-quality cast iron and respective melts has been schematically depicted.

  10. High quality electron beams from a laser wakefield accelerator

    Energy Technology Data Exchange (ETDEWEB)

    Wiggins, S M; Issac, R C; Welsh, G H; Brunetti, E; Shanks, R P; Anania, M P; Cipiccia, S; Manahan, G G; Aniculaesei, C; Ersfeld, B; Islam, M R; Burgess, R T L; Vieux, G; Jaroszynski, D A [SUPA, Department of Physics, University of Strathclyde, Glasgow (United Kingdom); Gillespie, W A [SUPA, Division of Electronic Engineering and Physics, University of Dundee, Dundee (United Kingdom); MacLeod, A M [School of Computing and Creative Technologies, University of Abertay Dundee, Dundee (United Kingdom); Van der Geer, S B; De Loos, M J, E-mail: m.wiggins@phys.strath.ac.u [Pulsar Physics, Burghstraat 47, 5614 BC Eindhoven (Netherlands)

    2010-12-15

    High quality electron beams have been produced in a laser-plasma accelerator driven by femtosecond laser pulses with a peak power of 26 TW. Electrons are produced with an energy up to 150 MeV from the 2 mm gas jet accelerator and the measured rms relative energy spread is less than 1%. Shot-to-shot stability in the central energy is 3%. Pepper-pot measurements have shown that the normalized transverse emittance is {approx}1{pi} mm mrad while the beam charge is in the range 2-10 pC. The generation of high quality electron beams is understood from simulations accounting for beam loading of the wakefield accelerating structure. Experiments and self-consistent simulations indicate that the beam peak current is several kiloamperes. Efficient transportation of the beam through an undulator is simulated and progress is being made towards the realization of a compact, high peak brilliance free-electron laser operating in the vacuum ultraviolet and soft x-ray wavelength ranges.

  11. The art of editing RNA structural alignments

    DEFF Research Database (Denmark)

    Andersen, Ebbe Sloth

    2014-01-01

    Manual editing of RNA structural alignments may be considered more art than science, since it still requires an expert biologist to take multiple levels of information into account and be slightly creative when constructing high-quality alignments. Even though the task is rather tedious, it is re......Manual editing of RNA structural alignments may be considered more art than science, since it still requires an expert biologist to take multiple levels of information into account and be slightly creative when constructing high-quality alignments. Even though the task is rather tedious...

  12. RNA Crystallization

    Science.gov (United States)

    Golden, Barbara L.; Kundrot, Craig E.

    2003-01-01

    RNA molecules may be crystallized using variations of the methods developed for protein crystallography. As the technology has become available to syntheisize and purify RNA molecules in the quantities and with the quality that is required for crystallography, the field of RNA structure has exploded. The first consideration when crystallizing an RNA is the sequence, which may be varied in a rational way to enhance crystallizability or prevent formation of alternate structures. Once a sequence has been designed, the RNA may be synthesized chemically by solid-state synthesis, or it may be produced enzymatically using RNA polymerase and an appropriate DNA template. Purification of milligram quantities of RNA can be accomplished by HPLC or gel electrophoresis. As with proteins, crystallization of RNA is usually accomplished by vapor diffusion techniques. There are several considerations that are either unique to RNA crystallization or more important for RNA crystallization. Techniques for design, synthesis, purification, and crystallization of RNAs will be reviewed here.

  13. Epidermal Growth Factor-like Domain 7 Predicts Response to First-Line Chemotherapy and Bevacizumab in Patients with Metastatic Colorectal Cancer

    DEFF Research Database (Denmark)

    Hansen, Torben Frøstrup; Nielsen, Boye Schnack; Sørensen, Flemming Brandt

    2014-01-01

    The number of approved antiangiogenic drugs is constantly growing and emphasizes the need for predictive biomarkers. The aim of this study was to analyze the predictive value of epidermal growth factor-like domain 7 (EGFL7) and microRNA-126 (miR126) to first-line chemotherapy combined with bevaci...

  14. Reptured Epidermal Inclusion Cyst in the Axilla: A Case Report

    International Nuclear Information System (INIS)

    Kim, Kyu Soon; Kim, Hak Hee; Shin, Hee Jeong; Yang, Hye Rin; Sohn, Jeong Hee; Kwon, Gui Young; Gong, Gyung Yub

    2006-01-01

    Epidermal inclusion cysts, the most common type of simple epithelial cyst, are typically well-encapsulated, subepidermal and mobile nodules. They may occur anywhere, but are mostly found on the scalp, face, neck, trunk, and back. Less than 10% of epidermal inclusion cysts occur on the extremities, and even fewer are found on the palms, soles, and breasts. If epidermal inclusion cysts rupture, foreign body reaction, granulomatous reaction or abscess formation could follow. We described here the sonographic findings of ruptured epidermal inclusion cyst of the right axilla in a 33-year-old woman who presented with a palpable axillary mass forming an inflammatory abscess

  15. Culture technique of rabbit primary epidermal keratinocytes

    Directory of Open Access Journals (Sweden)

    Marini M

    2012-10-01

    Full Text Available The epidermis is the protective covering outer layer of the mammalian skin. The epidermal cells are stratified squamous epithelia which undergo continuous differentiation of loss and replacement of cells. Ninety per cent of epidermal cells consist of keratinocytes that are found in the basal layer of the stratified epithelium called epidermis. Keratinocytes are responsible for forming tight junctions with the nerves of the skin as well as in the process of wound healing. This article highlights the method of isolation and culture of rabbit primary epidermal keratinocytes in vitro. Approximately 2cm x 2cm oval shaped line was drawn on the dorsum of the rabbit to mark the surgical area. Then, the skin was carefully excised using a surgical blade and the target skin specimens harvested from the rabbits were placed in transport medium comprising of Dulbecco’s Modified Eagle Medium (DMEM and 1% of antibiotic-antimycotic solution. The specimens were transferred into a petri dish containing 70% ethanol and washed for 5 min followed by a wash in 1 x Dulbecco’s Phosphate Buffered Saline (DBPS. Then, the skin specimens were placed in DMEM and minced into small pieces using a scalpel. The minced pieces were placed in a centrifuge tube containing 0.6% Dispase and 1% antibiotic-antimycotic solution overnight at 4°C in a horizontal orientation. The epidermis layer (whitish, semi-transparent was separated from the dermis (pink, opaque, gooey with the aid of curved forceps by fixing the dermis with one pair of forceps while detaching the epidermis with the second pair. The cells were cultured at a density of 4 x 104 cells/cm2 in culture flask at 37°C and 5% CO2. The cell morphology of the keratinocytes was analyzed using inverted microscope.

  16. Urea uptake enhances barrier function and antimicrobial defense in humans by regulating epidermal gene expression

    Science.gov (United States)

    Grether-Beck, Susanne; Felsner, Ingo; Brenden, Heidi; Kohne, Zippora; Majora, Marc; Marini, Alessandra; Jaenicke, Thomas; Rodriguez-Martin, Marina; Trullas, Carles; Hupe, Melanie; Elias, Peter M.; Krutmann, Jean

    2012-01-01

    Urea is an endogenous metabolite, known to enhance stratum corneum hydration. Yet, topical urea anecdotally also improves permeability barrier function, and it appears to exhibit antimicrobial activity. Hence, we hypothesized that urea is not merely a passive metabolite, but a small-molecule regulator of epidermal structure and function. In 21 human volunteers, topical urea improved barrier function in parallel with enhanced antimicrobial peptide (LL-37 and β-defensin-2) expression. Urea both stimulates expression of, and is transported into keratinocytes by two urea transporters, UT-A1 and UT-A2, and by aquaporin 3, 7 and 9. Inhibitors of these urea transporters block the downstream biological effects of urea, which include increased mRNA and protein levels for: (i) transglutaminase-1, involucrin, loricrin and filaggrin; (ii) epidermal lipid synthetic enzymes, and (iii) cathelicidin/LL-37 and β-defensin-2. Finally, we explored the potential clinical utility of urea, showing that topical urea applications normalized both barrier function and antimicrobial peptide expression in a murine model of atopic dermatitis (AD). Together, these results show that urea is a small-molecule regulator of epidermal permeability barrier function and antimicrobial peptide expression after transporter uptake, followed by gene regulatory activity in normal epidermis, with potential therapeutic applications in diseased skin. PMID:22418868

  17. Heparin-binding epidermal growth factor-like growth factor promotes neuroblastoma differentiation.

    Science.gov (United States)

    Gaviglio, Angela L; Knelson, Erik H; Blobe, Gerard C

    2017-05-01

    High-risk neuroblastoma is characterized by undifferentiated neuroblasts and low schwannian stroma content. The tumor stroma contributes to the suppression of tumor growth by releasing soluble factors that promote neuroblast differentiation. Here we identify heparin-binding epidermal growth factor-like growth factor (HBEGF) as a potent prodifferentiating factor in neuroblastoma. HBEGF mRNA expression is decreased in human neuroblastoma tumors compared with benign tumors, with loss correlating with decreased survival. HBEGF protein is expressed only in stromal compartments of human neuroblastoma specimens, with tissue from high-stage disease containing very little stroma or HBEGF expression. In 3 human neuroblastoma cell lines (SK-N-AS, SK-N-BE2, and SH-SY5Y), soluble HBEGF is sufficient to promote neuroblast differentiation and decrease proliferation. Heparan sulfate proteoglycans and heparin derivatives further enhance HBEGF-induced differentiation by forming a complex with the epidermal growth factor receptor, leading to activation of the ERK1/2 and STAT3 pathways and up-regulation of the inhibitor of DNA binding transcription factor. These data support a role for loss of HBEGF in the neuroblastoma tumor microenvironment in neuroblastoma pathogenesis.-Gaviglio, A. L., Knelson, E. H., Blobe, G. C. Heparin-binding epidermal growth factor-like growth factor promotes neuroblastoma differentiation. © FASEB.

  18. High quality draft genome sequence of the moderately halophilic bacterium Pontibacillus yanchengensis Y32(T) and comparison among Pontibacillus genomes.

    Science.gov (United States)

    Huang, Jing; Qiao, Zi Xu; Tang, Jing Wei; Wang, Gejiao

    2015-01-01

    Pontibacillus yanchengensis Y32(T) is an aerobic, motile, Gram-positive, endospore-forming, and moderately halophilic bacterium isolated from a salt field. In this study, we describe the features of P. yanchengensis strain Y32(T) together with a comparison with other four Pontibacillus genomes. The 4,281,464 bp high-quality-draft genome of strain Y32(T) is arranged into 153 contigs containing 3,965 protein-coding genes and 77 RNA encoding genes. The genome of strain Y32(T) possesses many genes related to its halophilic character, flagellar assembly and chemotaxis to support its survival in a salt-rich environment.

  19. The Epidermal Growth Factor Receptor Is a Regulator of Epidermal Complement Component Expression and Complement Activation

    DEFF Research Database (Denmark)

    Abu-Humaidan, Anas H A; Ananthoju, Nageshwar; Mohanty, Tirthankar

    2014-01-01

    The complement system is activated in response to tissue injury. During wound healing, complement activation seems beneficial in acute wounds but may be detrimental in chronic wounds. We found that the epidermal expression of many complement components was only increased to a minor extent in skin...

  20. High quality diesel fuels by VO-LSGO hydrotreatment

    Energy Technology Data Exchange (ETDEWEB)

    Stanica-Ezeanu, Dorin; Juganaru, Traian [Petroleum and Gas Univ. of Ploiesti (Romania)

    2013-06-01

    The aim of the paper is to obtain a high quality Diesel fuel by hydro-deoxigenation of vegetable oils (VO) mixed with a low sulfur gasoil (LSGO). The process is possible by using a bi-functional catalyst Ni-Mo supported by an activated Al{sub 2}O{sub 3} containing 2% Ultrastable Y-zeolite. The experimental conditions were: T =340 - 380 C, Pressure = 50 bar, LHSV = 1,5 h{sup -1}, H{sub 2}/Feed ratio = 15 mole H{sub 2} /mole liquid feed. The liquid product was separated in two fractions: a light distillate (similar to gasoline) and a heavy distillate (boiling point > 200 C) with very good characteristics for Diesel engines. The reaction chemistry is very complex, but the de-oxygenation process is decisive for the chemical structure of hydrocarbons from final product. Finally, a schema for the reaction mechanism is proposed. (orig.)

  1. Supercapacitors based on high-quality graphene scrolls

    Science.gov (United States)

    Zeng, Fanyan; Kuang, Yafei; Liu, Gaoqin; Liu, Rui; Huang, Zhongyuan; Fu, Chaopeng; Zhou, Haihui

    2012-06-01

    High-quality graphene scrolls (GSS) with a unique scrolled topography are designed using a microexplosion method. Their capacitance properties are investigated by cyclic voltammetry, galvanostatic charge-discharge and electrical impedance spectroscopy. Compared with the specific capacity of 110 F g-1 for graphene sheets, a remarkable capacity of 162.2 F g-1 is obtained at the current density of 1.0 A g-1 in 6 M KOH aqueous solution owing to the unique scrolled structure of GSS. The capacity value is increased by about 50% only because of the topological change of graphene sheets. Meanwhile, GSS exhibit excellent long-term cycling stability along with 96.8% retained after 1000 cycles at 1.0 A g-1. These encouraging results indicate that GSS based on the topological structure of graphene sheets are a kind of promising material for supercapacitors.

  2. High quality flux control system for electron gun evaporation

    International Nuclear Information System (INIS)

    Appelbloom, A.M.; Hadley, P.; van der Marel, D.; Mooij, J.E.

    1991-01-01

    This paper reports on a high quality flux control system for electron gun evaporation developed and tested for the MBE growth of high temperature superconductors. The system can be applied to any electron gun without altering the electron gun itself. Essential elements of the system are a high bandwidth mass spectrometer, control electronics and a high voltage modulator to sweep the electron beam over the melt at high frequencies. the sweep amplitude of the electron beam is used to control the evaporation flux at high frequencies. The feedback loop of the system has a bandwidth of over 100 Hz, which makes it possible to grow superlattices and layered structures in a fast and precisely controlled manner

  3. A roadmap to high quality chemically prepared graphene

    Energy Technology Data Exchange (ETDEWEB)

    Gengler, Regis Y N; Spyrou, Konstantinos; Rudolf, Petra, E-mail: r.gengler@rug.n, E-mail: p.rudolf@rug.n [Zernike Institute for Advanced Materials, University of Groningen, Nijenborgh 4, 9747AG Groningen (Netherlands)

    2010-09-22

    Graphene was discovered half a decade ago and proved the existence of a two-dimensional system which becomes stable as a result of 3D corrugation. It appeared very quickly that this exceptional material had truly outstanding electronic, mechanical, thermal and optical properties. Consequently a broad range of applications appeared, as the graphene science speedily moved forward. Since then, a lot of effort has been devoted not only to the study of graphene but also to its fabrication. Here we review the chemical approaches to graphene production, their advantages as well as their downsides. Our aim is to draw a roadmap of today's most reliable path to high quality graphene via chemical preparation.

  4. Quality management manual for production of high quality cassava flour

    DEFF Research Database (Denmark)

    Dziedzoave, Nanam Tay; Abass, Adebayo Busura; Amoa-Awua, Wisdom K.

    The high quality cassava flour (HQCF) industry has just started to evolve in Africa and elsewhere. The sustainability of the growing industry, the profitability of small- and medium-scale enterprises (SMEs) that are active in the industry and good-health of consumers can best be guaranteed through...... the adoption of proper quality and food safety procedures. Cassava processing enterprises involved in the productionof HQCF must therefore be commited to the quality and food safety of the HQCF. They must have the right technology, appropriate processing machhinery, standard testing instruments...... and the necessary technical expertise. This quality manual was therefore developed to guide small- to medium-scale cassava in the design and implematation of Hazard Analysis Critical Control Point (HACCP) system and Good manufacturing Practices (GMP) plans for HQCF production. It describes the HQCF production...

  5. A roadmap to high quality chemically prepared graphene

    International Nuclear Information System (INIS)

    Gengler, Regis Y N; Spyrou, Konstantinos; Rudolf, Petra

    2010-01-01

    Graphene was discovered half a decade ago and proved the existence of a two-dimensional system which becomes stable as a result of 3D corrugation. It appeared very quickly that this exceptional material had truly outstanding electronic, mechanical, thermal and optical properties. Consequently a broad range of applications appeared, as the graphene science speedily moved forward. Since then, a lot of effort has been devoted not only to the study of graphene but also to its fabrication. Here we review the chemical approaches to graphene production, their advantages as well as their downsides. Our aim is to draw a roadmap of today's most reliable path to high quality graphene via chemical preparation.

  6. CHOREOGRAPHIC METHODS FOR CREATING NOVEL, HIGH QUALITY DANCE

    Directory of Open Access Journals (Sweden)

    David Kirsh

    2016-02-01

    Full Text Available We undertook a detailed ethnographic study of the dance creation process of a noted choreographer and his distinguished troupe. All choreographer dancer interactions were videoed, the choreographer and dancers were interviewed extensively each day, as well as other observations and tests performed. The choreographer used three main methods to produce high quality and novel content: showing, making-on, and tasking. We present, analyze and evaluate these methods, and show how these approaches allow the choreographer to increase the creative output of the dancers and him. His methods, although designed for dance, apply more generally to other creative endeavors, especially where brainstorming is involved, and where the creative process is distributed over many individuals. His approach is also a case study in multi-modal direction, owing to the range of mechanisms he uses to communicate and direct.

  7. Biotransformation of Organic Waste into High Quality Fertilizer

    DEFF Research Database (Denmark)

    Bryndum, Sofie

    Agriculture faces several challenges of future provision of nutrients such as limited P reserves and increasing prices of synthetic fertilizers and recycling of nutrients from organic waste can be an important strategy for the long-term sustainability of the agricultural systems. Organically...... and S, is often low; and (3) the unbalanced composition of nutrients rarely matches crop demands. Therefore the objective of this project was to investigate the potential for (1) recycling nutrients from agro-industrial wastes and (2) compost biotransformation into high-quality organic fertilizers...... other uses into fertilizer use would be unlikely. An estimated ~50 % of the total organic waste pool, primarily consisting of animal manure and waste from the processing of sugar cane, coffee, oil palm and oranges, is currently being re-used as “fertilizers”, meaning it is eventually returned...

  8. Automated Theorem Proving in High-Quality Software Design

    Science.gov (United States)

    Schumann, Johann; Swanson, Keith (Technical Monitor)

    2001-01-01

    The amount and complexity of software developed during the last few years has increased tremendously. In particular, programs are being used more and more in embedded systems (from car-brakes to plant-control). Many of these applications are safety-relevant, i.e. a malfunction of hardware or software can cause severe damage or loss. Tremendous risks are typically present in the area of aviation, (nuclear) power plants or (chemical) plant control. Here, even small problems can lead to thousands of casualties and huge financial losses. Large financial risks also exist when computer systems are used in the area of telecommunication (telephone, electronic commerce) or space exploration. Computer applications in this area are not only subject to safety considerations, but also security issues are important. All these systems must be designed and developed to guarantee high quality with respect to safety and security. Even in an industrial setting which is (or at least should be) aware of the high requirements in Software Engineering, many incidents occur. For example, the Warshaw Airbus crash, was caused by an incomplete requirements specification. Uncontrolled reuse of an Ariane 4 software module was the reason for the Ariane 5 disaster. Some recent incidents in the telecommunication area, like illegal "cloning" of smart-cards of D2GSM handies, or the extraction of (secret) passwords from German T-online users show that also in this area serious flaws can happen. Due to the inherent complexity of computer systems, most authors claim that only a rigorous application of formal methods in all stages of the software life cycle can ensure high quality of the software and lead to real safe and secure systems. In this paper, we will have a look, in how far automated theorem proving can contribute to a more widespread application of formal methods and their tools, and what automated theorem provers (ATPs) must provide in order to be useful.

  9. RNA Origami

    DEFF Research Database (Denmark)

    Sparvath, Steffen Lynge

    introducerede vores gruppe den enkeltstrengede RNA-origami metode, der giver mulighed for cotranscriptional foldning af veldefinerede nanostrukturer, og er en central del af arbejdet præsenteret heri. Denne ph.d.-afhandling udforsker potentielle anvendelser af RNA-origami nanostrukturer, som nanomedicin eller...... biosensorer. Afhandlingen består af en introduktion til RNA-nanoteknologi feltet, en introduktion af enkeltstrenget RNA-origami design, og fire studier, der beskriver design, produktion og karakterisering af både strukturelle og funktionelle RNA-origamier. Flere RNA-origami designs er blevet undersøgt, og...... projekterne, der indgår i denne afhandling, inkluderer de nyeste fremskridt indenfor strukturel RNA-nanoteknologi og udvikling af funktionelle RNA-baserede enheder. Det første studie beskriver konstruktion og karakterisering af en enkeltstrenget 6-helix RNA-origami stuktur, som er den første demonstration af...

  10. Etanercept therapy for toxic epidermal necrolysis.

    Science.gov (United States)

    Paradisi, Andrea; Abeni, Damiano; Bergamo, Fabio; Ricci, Francesco; Didona, Dario; Didona, Biagio

    2014-08-01

    Toxic epidermal necrolysis (TEN) is a severe and potentially lethal drug reaction for which no standard treatment is available. To describe a case series of patients with TEN treated with a single dose of etanercept. We observed 10 consecutive patients with TEN. For each patient, we recorded the presence of comorbidities and all the drugs recently started (ie, in the last month). In all cases, 50 mg of etanercept was administered in a single subcutaneous injection. The clinical severity of disease was computed using the SCORe of Toxic Epidermal Necrosis (SCORTEN) scale. Using the probabilities of death linked to each level of SCORTEN score, we calculated the expected probability of death in our patients. Healing was defined as complete reepithelialization, and a time to healing curve was then obtained using the Kaplan-Meier method. All patients promptly responded to treatment, reaching complete reepithelialization without complications or side effects. The median time to healing was 8.5 days. This is a small, uncontrolled case series. These preliminary results suggest the possibility that tumor necrosis factor-alfa may be an effective target for control of TEN, a dangerous skin condition for which no effective cure has yet been found. Copyright © 2014 American Academy of Dermatology, Inc. Published by Mosby, Inc. All rights reserved.

  11. Post-female-circumcision clitoral epidermal inclusion cyst: a case ...

    African Journals Online (AJOL)

    Keywords: complication, epidermal inclusion cyst, female circumcision. Pediatric Urology Division, Department of Urology, ... transplantation of the epidermis into the subcutaneous tissue with subsequent proliferation of epidermal ... The evolution of the practice of FGM, from being performed by traditional birth attendants to.

  12. 76 FR 45397 - Export Inspection and Weighing Waiver for High Quality Specialty Grain Transported in Containers

    Science.gov (United States)

    2011-07-29

    ...-AB18 Export Inspection and Weighing Waiver for High Quality Specialty Grain Transported in Containers... permanent a waiver due to expire on July 31, 2012, for high quality specialty grain exported in containers... of high quality specialty grain exported in containers are small entities that up until recently...

  13. Herbal medicines that benefit epidermal permeability barrier function

    Directory of Open Access Journals (Sweden)

    Lizhi Hu

    2015-06-01

    Full Text Available Epidermal permeability barrier function plays a critical role in regulating cutaneous functions. Hence, researchers have been searching for effective and affordable regimens to enhance epidermal permeability barrier function. In addition to topical stratum corneum lipids, peroxisome proliferator-activated receptor, and liver X receptor ligands, herbal medicines have been proven to benefit epidermal permeability barrier function in both normal and diseased skin, including atopic dermatitis, glucocorticoid-induced skin damage, and UVB-damaged skin. The potential mechanisms by which herbal medicines improve the permeability barrier include stimulation of epidermal differentiation, lipid production, antimicrobial peptide expression, and antioxidation. Therefore, utilization of herbal medicines could be a valuable alternative approach to enhance epidermal permeability barrier function in order to prevent and/or treat skin disorders associated with permeability barrier abnormalities.

  14. Genetic analysis of Ras genes in epidermal development and tumorigenesis

    Science.gov (United States)

    Drosten, Matthias; Lechuga, Carmen G; Barbacid, Mariano

    2013-01-01

    Proliferation and differentiation of epidermal keratinocytes are tightly controlled to ensure proper development and homeostasis of the epidermis. The Ras family of small GTPases has emerged as a central node in the coordination of cell proliferation in the epidermis. Recent genetic evidence from mouse models has revealed that the intensity of Ras signaling modulates the proliferative capacity of epidermal keratinocytes. Interfering with Ras signaling either by combined elimination of the 3 Ras genes from the basal layer of the epidermis or by overexpression of dominant-negative Ras isoforms caused epidermal thinning due to hypoproliferation of keratinocytes. In contrast, overexpression of oncogenic Ras mutants in different epidermal cell layers led to hyperproliferative phenotypes including the development of papillomas and squamous cell carcinomas. Here, we discuss the value of loss- and gain-of-function studies in mouse models to assess the role of Ras signaling in the control of epidermal proliferation. PMID:24150175

  15. High-Quality Seismic Observations of Sonic Booms

    Science.gov (United States)

    Wurman, Gilead; Haering, Edward A., Jr.; Price, Michael J.

    2011-01-01

    The SonicBREWS project (Sonic Boom Resistant Earthquake Warning Systems) is a collaborative effort between Seismic Warning Systems, Inc. and NASA Dryden Flight Research Center. This project aims to evaluate the effects of sonic booms on Earthquake Warning Systems in order to prevent such systems from experiencing false alarms due to sonic booms. The airspace above the Antelope Valley, California includes the High Altitude Supersonic Corridor and the Black Mountain Supersonic Corridor. These corridors are among the few places in the US where supersonic flight is permitted, and sonic booms are commonplace in the Antelope Valley. One result of this project is a rich dataset of high-quality accelerometer records of sonic booms which can shed light on the interaction between these atmospheric phenomena and the solid earth. Nearly 100 sonic booms were recorded with low-noise triaxial MEMS accelerometers recording 1000 samples per second. The sonic booms had peak overpressures ranging up to approximately 10 psf and were recorded in three flight series in 2010 and 2011. Each boom was recorded with up to four accelerometers in various array configurations up to 100 meter baseline lengths, both in the built environment and the free field. All sonic booms were also recorded by nearby microphones. We present the results of the project in terms of the potential for sonic-boom-induced false alarms in Earthquake Warning Systems, and highlight some of the interesting features of the dataset.

  16. Construction of High-Quality Camel Immune Antibody Libraries.

    Science.gov (United States)

    Romão, Ema; Poignavent, Vianney; Vincke, Cécile; Ritzenthaler, Christophe; Muyldermans, Serge; Monsion, Baptiste

    2018-01-01

    Single-domain antibodies libraries of heavy-chain only immunoglobulins from camelids or shark are enriched for high-affinity antigen-specific binders by a short in vivo immunization. Thus, potent binders are readily retrieved from relatively small-sized libraries of 10 7 -10 8 individual transformants, mostly after phage display and panning on a purified target. However, the remaining drawback of this strategy arises from the need to generate a dedicated library, for nearly every envisaged target. Therefore, all the procedures that shorten and facilitate the construction of an immune library of best possible quality are definitely a step forward. In this chapter, we provide the protocol to generate a high-quality immune VHH library using the Golden Gate Cloning strategy employing an adapted phage display vector where a lethal ccdB gene has to be substituted by the VHH gene. With this procedure, the construction of the library can be shortened to less than a week starting from bleeding the animal. Our libraries exceed 10 8 individual transformants and close to 100% of the clones harbor a phage display vector having an insert with the length of a VHH gene. These libraries are also more economic to make than previous standard approaches using classical restriction enzymes and ligations. The quality of the Nanobodies that are retrieved from immune libraries obtained by Golden Gate Cloning is identical to those from immune libraries made according to the classical procedure.

  17. High-quality remote interactive imaging in the operating theatre

    Science.gov (United States)

    Grimstead, Ian J.; Avis, Nick J.; Evans, Peter L.; Bocca, Alan

    2009-02-01

    We present a high-quality display system that enables the remote access within an operating theatre of high-end medical imaging and surgical planning software. Currently, surgeons often use printouts from such software for reference during surgery; our system enables surgeons to access and review patient data in a sterile environment, viewing real-time renderings of MRI & CT data as required. Once calibrated, our system displays shades of grey in Operating Room lighting conditions (removing any gamma correction artefacts). Our system does not require any expensive display hardware, is unobtrusive to the remote workstation and works with any application without requiring additional software licenses. To extend the native 256 levels of grey supported by a standard LCD monitor, we have used the concept of "PseudoGrey" where slightly off-white shades of grey are used to extend the intensity range from 256 to 1,785 shades of grey. Remote access is facilitated by a customized version of UltraVNC, which corrects remote shades of grey for display in the Operating Room. The system is successfully deployed at Morriston Hospital, Swansea, UK, and is in daily use during Maxillofacial surgery. More formal user trials and quantitative assessments are being planned for the future.

  18. Production of high quality water for oil sands application

    Energy Technology Data Exchange (ETDEWEB)

    Beaudette-Hodsman, C.; Macleod, B. [Pall Corp., Mississauga, ON (Canada); Venkatadri, R. [Pall Corp., East Hills, NY (United States)

    2008-10-15

    This paper described a pressurized microfiltration membrane system installed at an oil sands extraction site in Alberta. The system was designed to complement a reverse osmosis (RO) system installed at the site to produce the high quality feed water required by the system's boilers. Groundwater in the region exhibited moderate total suspended solids and high alkalinity and hardness levels, and the RO system required feed water with a silt density index of 3 or less. The conventional pretreatment system used at the site was slowing down production due to the severe fouling of the RO membranes. The new microfiltration system contained an automated PVDF hollow fiber microfiltration membrane system contained in a trailer. Suspended particles and bacteria were captured within the filter, and permeate was sent to the RO unit. Within 6 hours of being installed, the unit was producing water with SDI values in the range of 1.0 to 2.5. It was concluded that the microfiltration system performed reliably regardless of wide variations in feed water quality and flow rates. 3 refs., 1 tab., 8 figs.

  19. CCD Astrophotography High-Quality Imaging from the Suburbs

    CERN Document Server

    Stuart, Adam

    2006-01-01

    This is a reference book for amateur astronomers who have become interested in CCD imaging. Those glorious astronomical images found in astronomy magazines might seem out of reach to newcomers to CCD imaging, but this is not the case. Great pictures are attainable with modest equipment. Adam Stuart’s many beautiful images, reproduced in this book, attest to the quality of – initially – a beginner’s efforts. Chilled-chip astronomical CCD-cameras and software are also wonderful tools for cutting through seemingly impenetrable light-pollution. CCD Astrophotography from the Suburbs describes one man’s successful approach to the problem of getting high-quality astronomical images under some of the most light-polluted conditions. Here is a complete and thoroughly tested program that will help every CCD-beginner to work towards digital imaging of the highest quality. It is equally useful to astronomers who have perfect observing conditions, as to those who have to observe from light-polluted city skies.

  20. Epidermal Growth Factor Receptor in Pancreatic Cancer

    International Nuclear Information System (INIS)

    Oliveira-Cunha, Melissa; Newman, William G.; Siriwardena, Ajith K.

    2011-01-01

    Pancreatic cancer is the fourth leading cause of cancer related death. The difficulty in detecting pancreatic cancer at an early stage, aggressiveness and the lack of effective therapy all contribute to the high mortality. Epidermal growth factor receptor (EGFR) is a transmembrane glycoprotein, which is expressed in normal human tissues. It is a member of the tyrosine kinase family of growth factors receptors and is encoded by proto-oncogenes. Several studies have demonstrated that EGFR is over-expressed in pancreatic cancer. Over-expression correlates with more advanced disease, poor survival and the presence of metastases. Therefore, inhibition of the EGFR signaling pathway is an attractive therapeutic target. Although several combinations of EGFR inhibitors with chemotherapy demonstrate inhibition of tumor-induced angiogenesis, tumor cell apoptosis and regression in xenograft models, these benefits remain to be confirmed. Multimodality treatment incorporating EGFR-inhibition is emerging as a novel strategy in the treatment of pancreatic cancer

  1. [Quantity research on epidermal growth factor in saliva and epidermal growth factor receptor in biopsy samples of recurrent aphthous ulcer patients].

    Science.gov (United States)

    Gu, Yang; Zhang, Gang; Lin, Mei

    2008-02-01

    To examine the change of epidermal growth factor (EGF) concentration in saliva of recurrent aphthous ulcer (RAU) patients during the ulcerous and interval period and epidermal growth factor receptor (EGFR) in ulcer biopsy samples. ECF data of the samples, which were 27 saliva samples from RAU gained not only in the ulcerous period but also in interval period and 33 ones from normal persons, were acquired through enzyme linked immunosorhent assay (ELISA) and EGF standard curve. ECFR-RNA date of RAU biopsies, which were 31 biopsy samples from RAU got during the ulcerous period and 35 ones from normal persons, were surveyed by QF-RT-PCR. All RAU samples were obtained under the same level, which were the whole patients were minor aphthous ulcers and their ulcers occurred not over the first four days. All patients and normal persons were selected seriously under the rule of physical situations without any other diseases and histories of using medicines. The EGF concentration of saliva in RAU group at ulcer occurrence was higher than that in the interval period and the normal control with a significant test (F = 3.24, P ulcer occurrence was higher than the normal control with a significant test (t = 3.15, P ulcer occasion of RAU patients could be related with the decreasing of EGF in saliva during interval period, and that the ulcer sell-cure of RAU patients would be contributed to

  2. Recruiting and retaining high-quality teachers in rural areas.

    Science.gov (United States)

    Monk, David H

    2007-01-01

    In examining recruitment and retention of teachers in rural areas, David Monk begins by noting the numerous possible characteristics of rural communities--small size, sparse settlement, distance from population concentrations, and an economic reliance on agricultural industries that are increasingly using seasonal and immigrant workers to minimize labor costs. Many, though not all, rural areas, he says, are seriously impoverished. Classes in rural schools are relatively small, and teachers tend to report satisfaction with their work environments and relatively few problems with discipline. But teacher turnover is often high, and hiring can be difficult. Monk observes that rural schools have a below-average share of highly trained teachers. Compensation in rural schools tends to be low, perhaps because of a lower fiscal capacity in rural areas, thus complicating efforts to attract and retain teachers. Several student characteristics, including relatively large shares of students with special needs and with limited English skills and lower shares of students attending college, can also make it difficult to recruit and retain high-quality teachers. Other challenges include meeting the needs of highly mobile children of low-income migrant farm workers. With respect to public policy, Monk asserts a need to focus on a subcategory of what might be called hard-to-staff rural schools rather than to develop a blanket set of policies for all rural schools. In particular, he recommends a focus on such indicators as low teacher qualifications, teaching in fields far removed from the area of training, difficulty in hiring, high turnover, a lack of diversity among teachers in the school, and the presence of migrant farm workers' children. Successful efforts to stimulate economic growth in these areas would be highly beneficial. He also calls attention to the potential for modern telecommunication and computing technologies to offset some of the drawbacks associated with teaching

  3. High-quality endoscope reprocessing decreases endoscope contamination.

    Science.gov (United States)

    Decristoforo, P; Kaltseis, J; Fritz, A; Edlinger, M; Posch, W; Wilflingseder, D; Lass-Flörl, C; Orth-Höller, D

    2018-02-24

    Several outbreaks of severe infections due to contamination of gastrointestinal (GI) endoscopes, mainly duodenoscopes, have been described. The rate of microbial endoscope contamination varies dramatically in literature. The aim of this multicentre prospective study was to evaluate the hygiene quality of endoscopes and automated endoscope reprocessors (AERs) in Tyrol/Austria. In 2015 and 2016, a total of 463 GI endoscopes and 105 AERs from 29 endoscopy centres were analysed by a routine (R) and a combined routine and advanced (CRA) sampling procedure and investigated for microbial contamination by culture-based and molecular-based analyses. The contamination rate of GI endoscopes was 1.3%-4.6% according to the national guideline, suggesting that 1.3-4.6 patients out of 100 could have had contacts with hygiene-relevant microorganisms through an endoscopic intervention. Comparison of R and CRA sampling showed 1.8% of R versus 4.6% of CRA failing the acceptance criteria in phase I and 1.3% of R versus 3.0% of CRA samples failing in phase II. The most commonly identified indicator organism was Pseudomonas spp., mainly Pseudomonas oleovorans. None of the tested viruses were detected in 40 samples. While AERs in phase I failed (n = 9, 17.6%) mainly due to technical faults, phase II revealed lapses (n = 6, 11.5%) only on account of microbial contamination of the last rinsing water, mainly with Pseudomonas spp. In the present study the contamination rate of endoscopes was low compared with results from other European countries, possibly due to the high quality of endoscope reprocessing, drying and storage. Copyright © 2018 European Society of Clinical Microbiology and Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

  4. Spatiotemporal Expression of p63 in Mouse Epidermal Commitment

    Directory of Open Access Journals (Sweden)

    Qian Zhao

    2015-12-01

    Full Text Available The embryonic surface ectoderm is a simple flat epithelium consisting of cells that express the cytokeratins K8/K18. Before stratification, K5/K14 expression substitutes K8/K18 expression, marking the event called epidermal commitment. Previous studies show that the transcription factor p63 plays an essential role in epidermal commitment. However, detailed expression information of p63 during early epidermal development in mice is still unclear. We systematically studied the expression pattern of p63 in mouse epidermal commitment, together with K8 and K5. We show that p63 expression could be detected as early as E8.5 in mouse embryos preceding epidermal commitment. p63 expression first appears near the newly formed somites and the posterior part of the embryo, further expanding to the whole embryonic surface with particular enrichment in the first branchial arches and the limb buds. ΔNp63 is the major class of isoforms expressed in this period. Relative expression intensity of p63 depends on the embryonic position. In summary, there is a sequential and regular expression pattern of K8, p63 and K5 in mouse epidermal commitment. Our study not only contributes to understanding the early events during epidermal development but also provides a basal tool to study the function of p63 in mammals.

  5. Polymeric membranes modulate human keratinocyte differentiation in specific epidermal layers.

    Science.gov (United States)

    Salerno, Simona; Morelli, Sabrina; Giordano, Francesca; Gordano, Amalia; Bartolo, Loredana De

    2016-10-01

    In vitro models of human bioengineered skin substitutes are an alternative to animal experimentation for testing the effects and toxicity of drugs, cosmetics and pollutants. For the first time specific and distinct human epidermal strata were engineered by using membranes and keratinocytes. To this purpose, biodegradable membranes of chitosan (CHT), polycaprolactone (PCL) and a polymeric blend of CHT-PCL were prepared by phase-inversion technique and characterized in order to evaluate their morphological, physico-chemical and mechanical properties. The capability of membranes to modulate keratinocyte differentiation inducing specific interactions in epidermal membrane systems was investigated. The overall results demonstrated that the membrane properties strongly influence the cell morpho-functional behaviour of human keratinocytes, modulating their terminal differentiation, with the creation of specific epidermal strata or a fully proliferative epidermal multilayer system. In particular, human keratinocytes adhered on CHT and CHT-PCL membranes, forming the structure of the epidermal top layers, such as the corneum and granulosum strata, characterized by withdrawal or reduction from the cell cycle and cell proliferation. On the PCL membrane, keratinocytes developed an epidermal basal lamina, with high proliferating cells that stratified and migrated over time to form a complete differentiating epidermal multilayer system. Copyright © 2016 Elsevier B.V. All rights reserved.

  6. Epidermal stem cells: location, potential and contribution to cancer.

    Science.gov (United States)

    Ambler, C A; Määttä, A

    2009-01-01

    Epidermal stem cells have been classically characterized as slow-cycling, long-lived cells that reside in discrete niches in the skin. Gene expression studies of niche-resident cells have revealed a number of stem cell markers and regulators, including the Wnt/beta-catenin, Notch, p63, c-Myc and Hedgehog pathways. A new study challenges the traditional developmental paradigm of slow-cycling stem cells and rapid-cycling transit amplifying cells in some epidermal regions, and there is mounting evidence to suggest that multi-lineage epidermal progenitors can be isolated from highly proliferative, non-niche regions. Whether there is a unique microenvironment surrounding these progenitors remains to be determined. Interestingly, cancer stem cells derived from epidermal tumours exist independent of the classic skin stem cell niche, yet also have stem cell properties, including multi-lineage differentiation. This review summarizes recent studies identifying the location and regulators of mouse and human epidermal stem cells and highlights the strategies used to identify cancer stem cells, including expression of normal epidermal stem cell markers, expression of cancer stem cell markers identified in other epidermal tumours and characterization of side-population tumour cells.

  7. UVB-induced epidermal hyperproliferation is modified by a single, topical treatment with a mitosis inhibitory epidermal pentapeptide

    International Nuclear Information System (INIS)

    Olsen, W.M.; Elgjo, K.

    1990-01-01

    A single application of a water-miscible cream base containing the recently identified mitosis inhibitory epidermal pentapeptide pyroGlu-Glu-Asp-Ser-GlyOH (EPP) to hairless mouse skin is followed by a long-lasting period of reduced epidermal cell proliferation. To examine if a similar growth inhibition could be achieved in stimulated and rapidly proliferating epidermis, EPP was applied at two different concentrations, 0.005 or 0.02%, to hairless mouse skin immediately after exposure of the left flank to an erythemic dose of ultraviolet B light (UVB). This dose of UVB alone induces a sustained period of rapid epidermal cell proliferation, starting at about 18 h after the irradiation. Epidermal cell proliferation was followed from 18 to 54 h (0.005% cream) or from 18 to 30 h (0.02% cream) after the treatment by estimating the rate of G2-M cell flux (the mitotic rate) by means of Colcemid, and epidermal DNA synthesis by counting labeled cells after pulse-labeling with 3H-thymidine. The unirradiated side of the mice was used as reference. The results showed that topical treatment with a 0.02% EPP cream partially inhibited UVB-induced epidermal hyperproliferation, while the 0.005% EPP cream inhibited as well as stimulated the UVB-induced hyperproliferation. Thus, EPP is effective even in rapidly proliferating epidermal cell populations, but the outcome is obviously dose-dependent in this test system

  8. New developments in high quality grey cast irons

    Directory of Open Access Journals (Sweden)

    Iulian Riposan

    2014-07-01

    Full Text Available The paper reviews original data obtained by the present authors, revealed in recent separate publications, describing specific procedures for high quality grey irons, and reflecting the forecast needs of the worldwide iron foundry industry. High power, medium frequency coreless induction furnaces are commonly used in electric melting grey iron foundries. This has resulted in low sulphur (1,500 °C, contributing to unfavourable conditions for graphite nucleation. Thin wall castings are increasingly produced by these electric melt shops with a risk of greater eutectic undercooling during solidification. The paper focused on two groups of grey cast irons and their specific problems: carbides and graphite morphology control in lower carbon equivalent high strength irons (CE=3.4%-3.8%, and austenite dendrite promotion in eutectic and slightly hypereutectic irons (CE=4.1%-4.5%, in order to increase their strength characteristics. There are 3 stages and 3 steps involving graphite formation, iron chemistry and iron processing that appear to be important. The concept in the present paper sustains a threestage model for nucleating flake graphite [(Mn,XS type nuclei]. There are three important groups of elements (deoxidizer, Mn/S, and inoculant and three technological stages in electric melting of iron (superheat, pre-conditioning of base iron, final inoculation. Attention is drawn to a control factor (%Mn x (%S ensuring it equals to 0.03 – 0.06, accompanied by 0.005wt.%–0.010wt.% Al and/or Zr content in inoculated irons. It was found that iron powder addition promotes austenite dendrite formation in eutectic and slightly eutectic, acting as reinforcement for the eutectic cells. But, there is an accompanying possible negative influence on the characteristics of the (Mn,XS type graphite nuclei (change the morphology of nuclei from polygonal compact to irregular polygonal, and therefore promote chill tendency in treated irons. A double addition (iron

  9. High quality protein microarray using in situ protein purification

    Directory of Open Access Journals (Sweden)

    Fleischmann Robert D

    2009-08-01

    Full Text Available Abstract Background In the postgenomic era, high throughput protein expression and protein microarray technologies have progressed markedly permitting screening of therapeutic reagents and discovery of novel protein functions. Hexa-histidine is one of the most commonly used fusion tags for protein expression due to its small size and convenient purification via immobilized metal ion affinity chromatography (IMAC. This purification process has been adapted to the protein microarray format, but the quality of in situ His-tagged protein purification on slides has not been systematically evaluated. We established methods to determine the level of purification of such proteins on metal chelate-modified slide surfaces. Optimized in situ purification of His-tagged recombinant proteins has the potential to become the new gold standard for cost-effective generation of high-quality and high-density protein microarrays. Results Two slide surfaces were examined, chelated Cu2+ slides suspended on a polyethylene glycol (PEG coating and chelated Ni2+ slides immobilized on a support without PEG coating. Using PEG-coated chelated Cu2+ slides, consistently higher purities of recombinant proteins were measured. An optimized wash buffer (PBST composed of 10 mM phosphate buffer, 2.7 mM KCl, 140 mM NaCl and 0.05% Tween 20, pH 7.4, further improved protein purity levels. Using Escherichia coli cell lysates expressing 90 recombinant Streptococcus pneumoniae proteins, 73 proteins were successfully immobilized, and 66 proteins were in situ purified with greater than 90% purity. We identified several antigens among the in situ-purified proteins via assays with anti-S. pneumoniae rabbit antibodies and a human patient antiserum, as a demonstration project of large scale microarray-based immunoproteomics profiling. The methodology is compatible with higher throughput formats of in vivo protein expression, eliminates the need for resin-based purification and circumvents

  10. High quality mask storage in an advanced Logic-Fab

    Science.gov (United States)

    Jähnert, Carmen; Fritsche, Silvio

    2012-02-01

    High efficient mask logistics as well as safe and high quality mask storage are essential requirements within an advanced lithography area of a modern logic waferfab. Fast operational availability of the required masks at the exposure tool with excellent mask condition requires a safe mask handling, safeguarding of high mask quality over the whole mask usage time without any quality degradation and an intelligent mask logistics. One big challenge is the prevention of haze on high advanced phase shift masks used in a high volume production line for some thousands of 248nm or 193nm exposures. In 2008 Infineon Dresden qualified a customer specific developed semi-bare mask storage system from DMSDynamic Micro Systems in combination with a high advanced mask handling and an interconnected complex logistic system. This high-capacity mask storage system DMS M1900.22 for more than 3000 masks with fully automated mask and box handling as well as full-blown XCDA purge has been developed and adapted to the Infineon Lithotoollandscape using Nikon and SMIF reticle cases. Advanced features for ESD safety and mask security, mask tracking via RFID and interactions with the exposure tools were developed and implemented. The stocker is remote controlled by the iCADA-RSM system, ordering of the requested mask directly from the affected exposure tool allows fast access. This paper discusses the advantages and challenges for this approach as well as the practical experience gained during the implementation of the new system which improves the fab performance with respect to mask quality, security and throughput. Especially the realization of an extremely low and stable humidity level in addition with a well controlled air flow at each mask surface, preventing masks from haze degradation and particle contamination, turns out to be a notable technical achievement. The longterm stability of haze critical masks has been improved significantly. Relevant environmental parameters like

  11. Fatal toxic epidermal necrolysis associated with minoxidil.

    Science.gov (United States)

    Karaoui, Lamis R; Chahine-Chakhtoura, Corinne

    2009-04-01

    Minoxidil is a direct-acting peripheral vasodilator for the treatment of symptomatic hypertension, or refractory hypertension associated with target organ damage, that is not manageable with a diuretic and two other antihypertensive drugs. The most frequent adverse events associated with minoxidil include hypertrichosis and cardiovascular events related to its powerful antihypertensive effect, and less frequently, rashes, bullous eruptions, and Stevens-Johnson syndrome (SJS). Evidence suggests that SJS and toxic epidermal necrolysis (TEN) are variants of a single disease with common causes and mechanisms, but differing severities. Epidermal detachment is mild in SJS, moderate in overlap SJS-TEN, and severe (> 30% of body surface area) in TEN. We describe a case of minoxidil-associated SJS that evolved into fatal TEN. A 69-year-old African-American woman with a history of chronic kidney disease was admitted to the hospital for a cerebrovascular accident and uncontrolled hypertension. On hospital day 12, oral minoxidil was added to her drug regimen. On day 23, she developed a maculopapular rash on her face that gradually diffused to her chest and back. Vesicles and papular lesions extended to her extremities and mucosal membranes; results of a skin biopsy revealed SJS. A positive Nikolsky's sign (blisters spread on application of pressure) was detected. On days 27-31, diffuse bullae developed with rash exacerbation. Skin detachment exceeded 30% and was consistent with TEN. The patient died on day 39. An evaluation of the causality and time course suggested that minoxidil was the most likely culpable drug, with a Naranjo adverse drug reaction probability scale score indicating that the likelihood of the association was possible (score of 3). The mechanism of this reaction has not been well elucidated. It may be related to an impaired clearance of the minoxidil metabolite, or an immune stimulation resulting in apoptosis and epidermis destruction. To our knowledge, this

  12. Glucocorticoid receptor, but not mineralocorticoid receptor, mediates cortisol regulation of epidermal ionocyte development and ion transport in zebrafish (danio rerio.

    Directory of Open Access Journals (Sweden)

    Shelly Abad Cruz

    Full Text Available Cortisol is the major endogenous glucocorticoid (GC both in human and fish, mediated by corticosteroid receptors. Due to the absence of aldosterone production in teleost fish, cortisol is also traditionally accepted to function as mineralocorticoid (MC; but whether it acts through the glucocorticoid receptor (GR or the mineralocorticoid receptor (MR remains a subject of debate. Here, we used loss-of-function and rescue assays to determine whether cortisol affects zebrafish epidermal ionocyte development and function via the GR and/or the MR. GR knockdown morphants displayed a significant decrease in the major ionocytes, namely Na(+-K(+-ATPase-rich cells (NaRCs and H(+-ATPase-rich cells (HRCs, as well as other cells, including epidermal stem cells (ESCs, keratinocytes, and mucus cells; conversely, cell numbers were unaffected in MR knockdown morphants. In agreement, GR morphants, but not MR morphants, exhibited decreased NaRC-mediated Ca(2+ uptake and HRC-mediated H(+ secretion. Rescue via GR capped mRNA injection or exogenous cortisol incubation normalized the number of epidermal ionocytes in GR morphants. We also provide evidence for GR localization in epidermal cells. At the transcript level, GR mRNA is ubiquitously expressed in gill sections and present in both NaRCs and HRCs, supporting the knockdown and functional assay results in embryo. Altogether, we have provided solid molecular evidence that GR is indeed present on ionocytes, where it mediates the effects of cortisol on ionocyte development and function. Hence, cortisol-GR axis performs the roles of both GC and MC in zebrafish skin and gills.

  13. Stevens-Johnson Syndrome (SJS) and Toxic Epidermal Necrolysis ...

    African Journals Online (AJOL)

    REVIEW. Introduction. Stevens-Johnson syndrome (SJS) and toxic epidermal ... that affect the skin and mucous membranes. ... Open Access article distributed under the terms of the .... pathogenic components are removed from plasma. The.

  14. Epidermal and dermal integumentary structures of ankylosaurian dinosaurs.

    Science.gov (United States)

    Arbour, Victoria M; Burns, Michael E; Bell, Phil R; Currie, Philip J

    2014-01-01

    Ankylosaurian dinosaurs are most notable for their abundant and morphologically diverse osteoderms, which would have given them a spiky appearance in life. Isolated osteoderms are relatively common and provide important information about the structure of the ankylosaur dermis, but fossilized impressions of the soft-tissue epidermis of ankylosaurs are rare. Nevertheless, well-preserved integument exists on several ankylosaur fossils that shows osteoderms were covered by a single epidermal scale, but one or many millimeter-sized ossicles may be present under polygonal, basement epidermal scales. Evidence for the taxonomic utility of ankylosaurid epidermal scale architecture is presented for the first time. This study builds on previous osteological work that argues for a greater diversity of ankylosaurids in the Dinosaur Park Formation of Alberta than has been traditionally recognized and adds to the hypothesis that epidermal skin impressions are taxonomically relevant across diverse dinosaur clades. Copyright © 2013 Wiley Periodicals, Inc.

  15. "Cut-and-paste" manufacture of multiparametric epidermal electronic systems

    Science.gov (United States)

    Lu, Nanshu; Yang, Shixuan; Wang, Pulin

    2016-05-01

    Epidermal electronics is a class of noninvasive and unobstructive skin-mounted, tattoo-like sensors and electronics capable of vital sign monitoring and establishing human-machine interface. The high cost of manpower, materials, vacuum equipment, and photolithographic facilities associated with its manufacture greatly hinders the widespread use of disposable epidermal electronics. Here we report a cost and time effective, completely dry, benchtop "cut-and-paste" method for the freeform and portable manufacture of multiparametric epidermal sensor systems (ESS) within minutes. This versatile method works for all types of thin metal and polymeric sheets and is compatible with any tattoo adhesives or medical tapes. The resulting ESS are multimaterial and multifunctional and have been demonstrated to noninvasively but accurately measure electrophysiological signals, skin temperature, skin hydration, as well as respiratory rate. In addition, planar stretchable coils exploiting double-stranded serpentine design have been successfully applied as wireless, passive epidermal strain sensors.

  16. Predicting human epidermal melanin concentrations for different skin tones

    CSIR Research Space (South Africa)

    Smit, Jacoba E

    2011-07-01

    Full Text Available epidermal melanin concentrations for different skin tones JE Smit 1 , AE Karsten 2 , RW Sparrow 1 1 CSIR Biosciences, Pretoria, South Africa 2 CSIR National Laser Centre, Pretoria, South Africa Author e-mail address: KSmit...

  17. Epidermal Nevus Syndrome Associated with Brain Malformations and Medulloblastoma

    Directory of Open Access Journals (Sweden)

    J Gordon Millichap

    2013-01-01

    Full Text Available Researchers at Juntendo University and Tokyo Women’s Medical University, Japan; and University of California, San Francisco, Ca, report a male infant with epidermal nevus syndrome associated with brainstem and cerebellar malformations and neonatal medulloblastoma.

  18. Comparison of microRNA expression using different preservation methods of matched psoriatic skin samples

    DEFF Research Database (Denmark)

    Løvendorf, Marianne B; Zibert, John R; Hagedorn, Peter H

    2012-01-01

    MicroRNAs are non-coding RNA molecules modulating gene expression post-transcriptionally. Formalin-fixed, paraffin-embedding (FFPE) is a standard preservation method often used in clinical practices, but induces RNA degradation. Extracting high-quality RNA from human skin can be challenging as skin...

  19. Optimal allocation of leaf epidermal area for gas exchange

    OpenAIRE

    de Boer, Hugo J.; Price, Charles A.; Wagner-Cremer, Friederike; Dekker, Stefan C.; Franks, Peter J.; Veneklaas, Erik J.

    2016-01-01

    Summary A long?standing research focus in phytology has been to understand how plants allocate leaf epidermal space to stomata in order to achieve an economic balance between the plant's carbon needs and water use. Here, we present a quantitative theoretical framework to predict allometric relationships between morphological stomatal traits in relation to leaf gas exchange and the required allocation of epidermal area to stomata. Our theoretical framework was derived from first principles of ...

  20. Manufacturing High-Quality Carbon Nanotubes at Lower Cost

    Science.gov (United States)

    Benavides, Jeanette M.; Lidecker, Henning

    2004-01-01

    A modified electric-arc welding process has been developed for manufacturing high-quality batches of carbon nanotubes at relatively low cost. Unlike in some other processes for making carbon nanotubes, metal catalysts are not used and, consequently, it is not necessary to perform extensive cleaning and purification. Also, unlike some other processes, this process is carried out at atmospheric pressure under a hood instead of in a closed, pressurized chamber; as a result, the present process can be implemented more easily. Although the present welding-based process includes an electric arc, it differs from a prior electric-arc nanotube-production process. The welding equipment used in this process includes an AC/DC welding power source with an integral helium-gas delivery system and circulating water for cooling an assembly that holds one of the welding electrodes (in this case, the anode). The cathode is a hollow carbon (optionally, graphite) rod having an outside diameter of 2 in. (approximately equal to 5.1 cm) and an inside diameter of 5/8 in. (approximately equal to 1.6 cm). The cathode is partly immersed in a water bath, such that it protrudes about 2 in. (about 5.1 cm) above the surface of the water. The bottom end of the cathode is held underwater by a clamp, to which is connected the grounding cable of the welding power source. The anode is a carbon rod 1/8 in. (approximately equal to 0.3 cm) in diameter. The assembly that holds the anode includes a thumbknob- driven mechanism for controlling the height of the anode. A small hood is placed over the anode to direct a flow of helium downward from the anode to the cathode during the welding process. A bell-shaped exhaust hood collects the helium and other gases from the process. During the process, as the anode is consumed, the height of the anode is adjusted to maintain an anode-to-cathode gap of 1 mm. The arc-welding process is continued until the upper end of the anode has been lowered to a specified height

  1. Tight junction regulates epidermal calcium ion gradient and differentiation

    International Nuclear Information System (INIS)

    Kurasawa, Masumi; Maeda, Tetsuo; Oba, Ai; Yamamoto, Takuya; Sasaki, Hiroyuki

    2011-01-01

    Research highlights: → We disrupted epidermal tight junction barrier in reconstructed epidermis. → It altered Ca 2+ distribution and consequentially differentiation state as well. → Tight junction should affect epidermal homeostasis by maintaining Ca 2+ gradient. -- Abstract: It is well known that calcium ions (Ca 2+ ) induce keratinocyte differentiation. Ca 2+ distributes to form a vertical gradient that peaks at the stratum granulosum. It is thought that the stratum corneum (SC) forms the Ca 2+ gradient since it is considered the only permeability barrier in the skin. However, the epidermal tight junction (TJ) in the granulosum has recently been suggested to restrict molecular movement to assist the SC as a secondary barrier. The objective of this study was to clarify the contribution of the TJ to Ca 2+ gradient and epidermal differentiation in reconstructed human epidermis. When the epidermal TJ barrier was disrupted by sodium caprate treatment, Ca 2+ flux increased and the gradient changed in ion-capture cytochemistry images. Alterations of ultrastructures and proliferation/differentiation markers revealed that both hyperproliferation and precocious differentiation occurred regionally in the epidermis. These results suggest that the TJ plays a crucial role in maintaining epidermal homeostasis by controlling the Ca 2+ gradient.

  2. Extracellular Matrix as a Regulator of Epidermal Stem Cell Fate.

    Science.gov (United States)

    Chermnykh, Elina; Kalabusheva, Ekaterina; Vorotelyak, Ekaterina

    2018-03-27

    Epidermal stem cells reside within the specific anatomic location, called niche, which is a microenvironment that interacts with stem cells to regulate their fate. Regulation of many important processes, including maintenance of stem cell quiescence, self-renewal, and homeostasis, as well as the regulation of division and differentiation, are common functions of the stem cell niche. As it was shown in multiple studies, extracellular matrix (ECM) contributes a lot to stem cell niches in various tissues, including that of skin. In epidermis, ECM is represented, primarily, by a highly specialized ECM structure, basement membrane (BM), which separates the epidermal and dermal compartments. Epidermal stem cells contact with BM, but when they lose the contact and migrate to the overlying layers, they undergo terminal differentiation. When considering all of these factors, ECM is of fundamental importance in regulating epidermal stem cells maintenance, proper mobilization, and differentiation. Here, we summarize the remarkable progress that has recently been made in the research of ECM role in regulating epidermal stem cell fate, paying special attention to the hair follicle stem cell niche. We show that the destruction of ECM components impairs epidermal stem cell morphogenesis and homeostasis. A deep understanding of ECM molecular structure as well as the development of in vitro system for stem cell maintaining by ECM proteins may bring us to developing new approaches for regenerative medicine.

  3. Simple, rapid and cost-effective method for high quality nucleic acids extraction from different strains of Botryococcus braunii.

    Directory of Open Access Journals (Sweden)

    Byung-Hyuk Kim

    Full Text Available This study deals with an effective nucleic acids extraction method from various strains of Botryococcus braunii which possesses an extensive extracellular matrix. A method combining freeze/thaw and bead-beating with heterogeneous diameter of silica/zirconia beads was optimized to isolate DNA and RNA from microalgae, especially from B. braunii. Eukaryotic Microalgal Nucleic Acids Extraction (EMNE method developed in this study showed at least 300 times higher DNA yield in all strains of B. braunii with high integrity and 50 times reduced working volume compared to commercially available DNA extraction kits. High quality RNA was also extracted using this method and more than two times the yield compared to existing methods. Real-time experiments confirmed the quality and quantity of the input DNA and RNA extracted using EMNE method. The method was also applied to other eukaryotic microalgae, such as diatoms, Chlamydomonas sp., Chlorella sp., and Scenedesmus sp. resulting in higher efficiencies. Cost-effectiveness analysis of DNA extraction by various methods revealed that EMNE method was superior to commercial kits and other reported methods by >15%. This method would immensely contribute to area of microalgal genomics.

  4. Publishing high-quality climate data on the semantic web

    Science.gov (United States)

    Woolf, Andrew; Haller, Armin; Lefort, Laurent; Taylor, Kerry

    2013-04-01

    The effort over more than a decade to establish the semantic web [Berners-Lee et. al., 2001] has received a major boost in recent years through the Open Government movement. Governments around the world are seeking technical solutions to enable more open and transparent access to Public Sector Information (PSI) they hold. Existing technical protocols and data standards tend to be domain specific, and so limit the ability to publish and integrate data across domains (health, environment, statistics, education, etc.). The web provides a domain-neutral platform for information publishing, and has proven itself beyond expectations for publishing and linking human-readable electronic documents. Extending the web pattern to data (often called Web 3.0) offers enormous potential. The semantic web applies the basic web principles to data [Berners-Lee, 2006]: using URIs as identifiers (for data objects and real-world 'things', instead of documents) making the URIs actionable by providing useful information via HTTP using a common exchange standard (serialised RDF for data instead of HTML for documents) establishing typed links between information objects to enable linking and integration Leading examples of 'linked data' for publishing PSI may be found in both the UK (http://data.gov.uk/linked-data) and US (http://www.data.gov/page/semantic-web). The Bureau of Meteorology (BoM) is Australia's national meteorological agency, and has a new mandate to establish a national environmental information infrastructure (under the National Plan for Environmental Information, NPEI [BoM, 2012a]). While the initial approach is based on the existing best practice Spatial Data Infrastructure (SDI) architecture, linked-data is being explored as a technological alternative that shows great promise for the future. We report here the first trial of government linked-data in Australia under data.gov.au. In this initial pilot study, we have taken BoM's new high-quality reference surface

  5. Epidermal Overexpression of Xenobiotic Receptor PXR Impairs the Epidermal Barrier and Triggers Th2 Immune Response.

    Science.gov (United States)

    Elentner, Andreas; Schmuth, Matthias; Yannoutsos, Nikolaos; Eichmann, Thomas O; Gruber, Robert; Radner, Franz P W; Hermann, Martin; Del Frari, Barbara; Dubrac, Sandrine

    2018-01-01

    The skin is in daily contact with environmental pollutants, but the long-term effects of such exposure remain underinvestigated. Many of these toxins bind and activate the pregnane X receptor (PXR), a ligand-activated transcription factor that regulates genes central to xenobiotic metabolism. The objective of this work was to investigate the effect of constitutive activation of PXR in the basal layer of the skin to mimic repeated skin exposure to noxious molecules. We designed a transgenic mouse model that overexpresses the human PXR gene linked to the herpes simplex VP16 domain under the control of the keratin 14 promoter. We show that transgenic mice display increased transepidermal water loss and elevated skin pH, abnormal stratum corneum lipids, focal epidermal hyperplasia, activated keratinocytes expressing more thymic stromal lymphopoietin, a T helper type 2/T helper type 17 skin immune response, and increased serum IgE. Furthermore, the cutaneous barrier dysfunction precedes development of the T helper type 2/T helper type 17 inflammation in transgenic mice, thereby mirroring the time course of atopic dermatitis development in humans. Moreover, further experiments suggest increased PXR signaling in the skin of patients with atopic dermatitis when compared with healthy skin. Thus, PXR activation by environmental pollutants may compromise epidermal barrier function and favor an immune response resembling atopic dermatitis. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  6. Epidermal growth factor and growth in vivo

    International Nuclear Information System (INIS)

    Rhodes, J.A.

    1986-01-01

    Epidermal growth factor (EGF) causes a dose-dependent thickening of the epidermis in suckling mice. The cellular mechanisms underlying this thickening were analyzed by measuring the effect of EGF on the cell-cycle. Neonatal mice were given daily injections of either 2ug EGF/g body weight/day or an equivalent volume of saline, and on the seventh day received a single injection of 3 H-thymidine. At various times the mice were perfused with fixative; 1um sections of skin were stained with a modification of Harris' hematoxylin and were autoradiographed. The sections were analyzed using three methods based on the dependence on time after injection of 3 H-thymidine of: frequency of labelled mitoses, labelling index, and reciprocal grains/nucleus. It was found that EGF caused a two-fold increase in the cell production rate. The effect of exogenous EGF on the morphology of gastric mucosa and incisors of suckling mice was also studied. The gastric mucosa appeared thicker in EGF-treated animals, but the effect was not statistically significant. In contrast to its effect on epidermis and gastric mucosa, EGF caused a significant, dose-dependent decrease in the size of the incisors. Because the mouse submandibular salivary gland is the major source of EGF the effect of sialoadenectomy on female reproductive functions was examined. Ablation of the submandibular gland had no effect on: length of estrus cycle, ability of the female to produce litters, length of the gestation period, litter size, and weight of the litter at birth. There was also no effect on survival of the offspring or on age at which the eyelids separated

  7. Impact of in Vivo Ischemic Time on RNA Quality

    DEFF Research Database (Denmark)

    Olsen, Jesper; Kierkeby, Lene T.; Eiholm, Susanne

    2015-01-01

    immediately following the tumor removal. The time from clamping the main arterial supply to resection and removal of the tumor was used to estimate the in vivo ischemic time. We did not observe a significant difference in RNA quality between normal tissue and tumor tissue. We observed a significant......Considerable effort has been made to improve differentiated diagnostics as well as personalized treatment for colorectal cancer patients. High-quality fresh frozen tissue is often required to investigate relevant molecular signatures in these patients. In RNA expression studies, the “RNA integrity...... number” is widely accepted as a reliable marker of RNA quality. Here, we investigate the feasibility of obtaining high-quality tissue from a colon cancer biobank and the impact of in vivo ischemic time and various technical and clinicopathological factors on RNA quality. Biopsies were obtained...

  8. A Novel Microfluidic Device for Fully Automated Extraction of RNA from Cell Cultures, Phase II

    Data.gov (United States)

    National Aeronautics and Space Administration — Obtaining high quality, intact RNA from cells is an ubiquitous need in the pursuit of space biology. Our overall objective is to develop and commercialize a...

  9. Inequality in Preschool Quality? Community-Level Disparities in Access to High-Quality Learning Environments

    Science.gov (United States)

    Bassok, Daphna; Galdo, Eva

    2016-01-01

    In recent years, unequal access to high-quality preschool has emerged as a growing public policy concern. Because of data limitations, it is notoriously difficult to measure disparities in access to early learning opportunities across communities and particularly challenging to quantify gaps in access to "high-quality" programs. Research…

  10. The membrane fraction of homogenized rat kidney contains an enzyme that releases epidermal growth factor from the kidney membranes

    DEFF Research Database (Denmark)

    Nexø, Ebba; Poulsen, Steen Seier

    1991-01-01

    shows that the membrane fraction of homogenized rat kidney contains an enzyme that releases immuno and receptor reactive EGF from the kidney membranes when incubated at 37 degrees C. Gel filtration shows that the EGF reactivity released from the membranes is similar to the EGF reactivity in rat urine......High levels of epidermal growth factor (EGF) are excreted in the urine and high levels of mRNA for the EGF-precursor have been demonstrated in the kidney. The EGF-precursor is a membrane bound peptide in the kidney, but little is known about the renal processing of the precursor. The present study...

  11. Expression of the epidermal growth factor system in human endometrium during the menstrual cycle

    DEFF Research Database (Denmark)

    Ejskjaer, Kirsten; Sørensen, B S; Poulsen, Steen Seier

    2005-01-01

    The epidermal growth factor (EGF) system is ubiquitous in humans and plays fundamental roles in embryogenesis, development, proliferation and differentiation. As the endometrium of fertile women is characterized by proliferation and differentiation, we hypothesize a role for the EGF system....... Fourteen premenopausal women had endometrial samples removed on day 6 +/- 1 and day 6 +/- 1 and 12 +/- 1 after ovulation during one menstrual cycle. RNA was extracted and analysed by real-time PCR, and immunohistochemistry was performed to localize the components of the EGF system. Human EGF Receptor 1...... (HER1) showed highest expression during the proliferative phase, HER2 and HER4 during the early and HER3 during the late secretory phase. Amphiregulin (AR) and transforming growth factor alpha (TGFalpha) expression is highest in proliferative phase. Heparin binding (HB)-EGF and betacellulin (BCL) show...

  12. Oral mucosa: an alternative epidermic cell source to develop autologous dermal-epidermal substitutes from diabetic subjects

    Directory of Open Access Journals (Sweden)

    Daniela GUZMÁN-URIBE

    Full Text Available Abstract Oral mucosa has been highlighted as a suitable source of epidermal cells due to its intrinsic characteristics such as its higher proliferation rate and its obtainability. Diabetic ulcers have a worldwide prevalence that is variable (1%-11%, meanwhile treatment of this has been proven ineffective. Tissue-engineered skin plays an important role in wound care focusing on strategies such autologous dermal-epidermal substitutes. Objective The aim of this study was to obtain autologous dermal-epidermal skin substitutes from oral mucosa from diabetic subjects as a first step towards a possible clinical application for cases of diabetic foot. Material and Methods Oral mucosa was obtained from diabetic and healthy subjects (n=20 per group. Epidermal cells were isolated and cultured using autologous fibrin to develop dermal-epidermal in vitro substitutes by the air-liquid technique with autologous human serum as a supplement media. Substitutes were immunocharacterized with collagen IV and cytokeratin 5-14 as specific markers. A Student´s t- test was performed to assess the differences between both groups. Results It was possible to isolate epidermal cells from the oral mucosa of diabetic and healthy subjects and develop autologous dermal-epidermal skin substitutes using autologous serum as a supplement. Differences in the expression of specific markers were observed and the cytokeratin 5-14 expression was lower in the diabetic substitutes, and the collagen IV expression was higher in the diabetic substitutes when compared with the healthy group, showing a significant difference. Conclusion Cells from oral mucosa could be an alternative and less invasive source for skin substitutes and wound healing. A difference in collagen production of diabetic cells suggests diabetic substitutes could improve diabetic wound healing. More research is needed to determine the crosstalk between components of these skin substitutes and damaged tissues.

  13. Immune sensitization against epidermal antigens in polymorphous light eruption

    International Nuclear Information System (INIS)

    Gonzalez-Amaro, R.; Baranda, L.; Salazar-Gonzalez, J.F.; Abud-Mendoza, C.; Moncada, B.

    1991-01-01

    To get further insight into the pathogenesis of polymorphous light eruption, we studied nine patients with polymorphous light eruption and six healthy persons. Two skin biopsy specimens were obtained from each person, one from previously ultraviolet light-irradiated skin and another one from unirradiated skin. An epidermal cell suspension, skin homogenate, or both were prepared from each specimen. Autologous cultures were made with peripheral blood mononuclear cells combined with irradiated or unirradiated skin homogenate and peripheral blood mononuclear cells combined with irradiated or unirradiated epidermal cell suspension. Cell proliferation was assessed by 3H-thymidine incorporation assay. The response of peripheral blood mononuclear cells to unirradiated epidermal cells or unirradiated skin homogenate was similar in both patients and controls. However, peripheral blood mononuclear cells from patients with polymorphous light eruption showed a significantly increased proliferative response to both irradiated epidermal cells and irradiated skin homogenate. Our results indicate that ultraviolet light increases the stimulatory capability of polymorphous light eruption epidermal cells in a unidirectional mixed culture with autologous peripheral blood mononuclear cells. This suggests that an immune sensitization against autologous ultraviolet light-modified skin antigens occurs in polymorphous light eruption

  14. Radiotherapy and receptor of epidermal growth factor

    International Nuclear Information System (INIS)

    Deberne, M.

    2009-01-01

    The expression level of the receptor of the epidermal growth factor is in correlation with the tumor cells radiosensitivity. An overexpression of the E.G.F.R. is often present in the bronchi cancer, epidermoid carcinomas of the O.R.L. sphere, esophagus, uterine cervix, and anal duct but also in the rectum cancers and glioblastomas. At the clinical level, the E.G.F.R. expression is in correlation with an unfavourable prognosis after radiotherapy in numerous tumoral localizations. In the rectum cancers it is an independent prognosis factor found in multifactorial analysis: increase of the rate of nodes and local recurrence when the E.G.F.R. is over expressed. In the uterine cervix cancers, the survival is is negatively affected in multifactorial analysis by the E.G.F.R. membranes expression level. At the therapy level, the development of anti E.G.F.R. targeted therapies (tyrosine kinase inhibitors and monoclonal antibodies) opens a new therapy field at radio-sensitivity potentiality. The irradiation makes an activation of the E.G.F.R. way that would be partially responsible of the post irradiation tumoral repopulation. This activation leads the phosphorylation of the PI3 kinase ways and M.A.P. kinase ones, then the Akt protein one that acts an apoptotic modulator part. It has been shown that blocking the E.G.F.R. way acts on three levels: accumulation of ells in phase G1, reduction of the cell repair and increasing of apoptosis. he inhibition of post irradiation action of the E.G.F.R. signal way is a factor explaining the ionizing radiation - anti E.G.F.R. synergy. The preclinical data suggest that the E.G.F.R. blocking by the monoclonal antibodies is more important than the use of tyrosine kinase inhibitors. A first positive randomized study with the cetuximab, published in 2006 in the epidermoid carcinomas of the O.R.L. sphere lead to its authorization on the market with the radiotherapy for this localization. The use of cetuximab in other indication with or in

  15. H{sup +}/peptide transporter (PEPT2) is expressed in human epidermal keratinocytes and is involved in skin oligopeptide transport

    Energy Technology Data Exchange (ETDEWEB)

    Kudo, Michiko; Katayoshi, Takeshi; Kobayashi-Nakamura, Kumiko [DHC Corporation Laboratories, Division 2, 2-42 Hamada, Mihama-ku, Chiba 261-0025 (Japan); Akagawa, Mitsugu [Department of Biological Chemistry, Division of Applied Life Science, Graduate School of Life and Environmental Sciences, Osaka Prefecture University, 1-1 Gakuen-cho, Naka-ku, Sakai 599-8531 (Japan); Tsuji-Naito, Kentaro, E-mail: knaito@dhc.co.jp [DHC Corporation Laboratories, Division 2, 2-42 Hamada, Mihama-ku, Chiba 261-0025 (Japan)

    2016-07-08

    Peptide transporter 2 (PEPT2) is a member of the proton-coupled oligopeptide transporter family, which mediates the cellular uptake of oligopeptides and peptide-like drugs. Although PEPT2 is expressed in many tissues, its expression in epidermal keratinocytes remains unclear. We investigated PEPT2 expression profile and functional activity in keratinocytes. We confirmed PEPT2 mRNA expression in three keratinocyte lines (normal human epidermal keratinocytes (NHEKs), immortalized keratinocytes, and malignant keratinocytes) by reverse transcription-polymerase chain reaction (RT-PCR) and quantitative real-time RT-PCR. In contrast to PEPT1, PEPT2 expression in the three keratinocytes was similar or higher than that in HepG2 cells, used as PEPT2-positive cells. Immunolocalization analysis using human skin showed epidermal PEPT2 localization. We studied keratinocyte transport function by measuring the oligopeptide content using liquid chromatography/tandem mass spectrometry. Glycylsarcosine uptake in NHEKs was pH-dependent, suggesting that keratinocytes could absorb small peptides in the presence of an inward H{sup +} gradient. We also performed a skin-permeability test of several oligopeptides using skin substitute, suggesting that di- and tripeptides pass actively through the epidermis. In conclusion, PEPT2 is expressed in keratinocytes and involved in skin oligopeptide uptake. -- Highlights: •PEPT2 is expressed in keratinocytes, which are more common than other skin cells. •Immunolocalization analysis using human skin revealed epidermal PEPT2 localization. •Keratinocytes could absorb small peptides in the presence of an inward H{sup +} gradient. •Di- and tripeptide pass actively through the epidermis.

  16. An improved method for isolation of RNA from bone

    Directory of Open Access Journals (Sweden)

    Carter Lauren E

    2012-01-01

    Full Text Available Abstract Background Bone physiology is increasingly appreciated as an important contributor to metabolic disorders such as type 2 diabetes. However, progress in understanding the role of bone in determining metabolic health is hampered by the well-described difficulty of obtaining high quality RNA from bone for gene expression analysis using the currently available approaches. Results We developed a simple approach to isolate bone RNA that combines pulverizing the bone and the phenol-guanidinium based RNA extraction in a single step while maintaining near-freezing temperatures. This single step method increases the yield of high quality RNA by eight-fold, with RNA integrity numbers ranging from 6.7 to 9.2. Conclusions Our streamlined approach substantially increases the yield of high-quality RNA from bone tissue while facilitating safe and efficient processing of multiple samples using readily available platforms. The RNA obtained from this method is suitable for use in gene expression analysis in real-time quantitative PCR, microarray, and next generation sequencing applications.

  17. Real-World Solutions for Developing High-Quality PHP Frameworks and Applications

    CERN Document Server

    Bergmann, Sebastian

    2011-01-01

    Learn to develop high-quality applications and frameworks in PHP Packed with in-depth information and step-by-step guidance, this book escorts you through the process of creating, maintaining and extending sustainable software of high quality with PHP. World-renowned PHP experts present real-world case studies for developing high-quality applications and frameworks in PHP that can easily be adapted to changing business requirements. . They offer different approaches to solving  typical development and quality assurance problems that every developer needs to know and master.Details the process

  18. Inhibition of epidermal cell proliferation by borderline rays

    Energy Technology Data Exchange (ETDEWEB)

    Born, W [Freiburg Univ.; Daikeler, G

    1976-08-01

    Treatment of guinea pig flanks with very soft x-rays (borderline rays) directly caused a partial block of epidermal DNA synthesis which had been determined by measuring the /sup 3/H-Tdr incorporation. Higher doses and repeated applications would undoubtedly cause lasting damage to the tissue. The enhanced epidermal DNA synthesis which is sometimes observed should not be misinterpreted as a sign of a directly biopositive utilisation of the quantum energy supplied. Rather, it is a secondary repair process following initial phases of depression. A reparative increase in DNA synthesis may also occur as a primary process if the radiation is almost completely absorbed above the germinative layer.

  19. Epidermal growth factor in mammary glands and milk from rats

    DEFF Research Database (Denmark)

    Thulesen, J; Raaberg, Lasse; Nexø, Ebba

    1993-01-01

    Epidermal growth factor (EGF) is one of the major growth-promoting agents in milk. Using immunohistochemistry we localized EGF in the mammary glands of lactating rats to the luminal border of the secretory cells. Following proteolytic pretreatment of the histological sections, the EGF-immunoreact......Epidermal growth factor (EGF) is one of the major growth-promoting agents in milk. Using immunohistochemistry we localized EGF in the mammary glands of lactating rats to the luminal border of the secretory cells. Following proteolytic pretreatment of the histological sections, the EGF...

  20. RNA oxidation

    DEFF Research Database (Denmark)

    Kjaer, L. K.; Cejvanovic, V.; Henriken, T.

    2015-01-01

    .9 significant hazard ratio for death compared with the quartile with the lowest 8oxoGuo excretion when adjusted for age, sex, BMI, smoker status, s-HbA1c, urine protein excretion and s-cholesterol. We conclude that it is now established that RNA oxidation is an independent risk factor for death in type 2...

  1. Determining RNA quality for NextGen sequencing: some exceptions to the gold standard rule of 23S to 16S rRNA ratio

    Science.gov (United States)

    Using next-generation-sequencing technology to assess entire transcriptomes requires high quality starting RNA. Currently, RNA quality is routinely judged using automated microfluidic gel electrophoresis platforms and associated algorithms. Here we report that such automated methods generate false-n...

  2. Influence of epidermal growth factor on liver regeneration after partial hepatectomy in rats

    DEFF Research Database (Denmark)

    Olsen, Peter Skov; Boesby, S.; Kirkegaard, P.

    2013-01-01

    The role of epidermal growth factor on liver regeneration after partial hepatectomy in rats was investigated. After a 70% hepatectomy in rats, the concentration of epidermal growth factor in portal venous blood was unchanged compared with unoperated controls. However, small amounts of epidermal...... growth factor could be identified in portal venous blood after intestinal instillation of epidermal growth factor. Brunner's glands and the submandibular glands secrete epidermal growth factor. Extirpation of Brunner's glands decreased liver regeneration, whereas removal of the submandibular glands had...... no effect on liver regeneration. Epidermal growth factor antiserum reduced liver regeneration significantly. Oral or s.c. administration of epidermal growth factor had no effect on liver regeneration, whereas epidermal growth factor enhanced the effect of insulin and glucagon on liver regeneration...

  3. Identifying suitable substrates for high-quality graphene-based heterostructures

    Science.gov (United States)

    Banszerus, L.; Janssen, H.; Otto, M.; Epping, A.; Taniguchi, T.; Watanabe, K.; Beschoten, B.; Neumaier, D.; Stampfer, C.

    2017-06-01

    We report on a scanning confocal Raman spectroscopy study investigating the strain-uniformity and the overall strain and doping of high-quality chemical vapour deposited (CVD) graphene-based heterostuctures on a large number of different substrate materials, including hexagonal boron nitride (hBN), transition metal dichalcogenides, silicon, different oxides and nitrides, as well as polymers. By applying a hBN-assisted, contamination free, dry transfer process for CVD graphene, high-quality heterostructures with low doping densities and low strain variations are assembled. The Raman spectra of these pristine heterostructures are sensitive to substrate-induced doping and strain variations and are thus used to probe the suitability of the substrate material for potential high-quality graphene devices. We find that the flatness of the substrate material is a key figure for gaining, or preserving high-quality graphene.

  4. Production of high quality sodium iodide preparations labelled with carrier free iodine-125

    International Nuclear Information System (INIS)

    Abdukayumov, M.N.; Chistyakov, P.G.; Shilin, E.A.

    2001-01-01

    Work is related to the problem of high-quality Sodium Iodide preparation production and to the choice of the peptids iodination methods with the purpose of control test developing to determine the Biological activity of the above mentioned preparation

  5. The Role of Dosimetry in High-Quality EMI Risk Assessment

    National Research Council Canada - National Science Library

    2006-01-01

    The Final Proceedings for The role of EMF dosimetry in high quality risk assessment 13 September 2006 - 15 September 2006 In the last three decades the use of devices that emit electromagnetic fields (EMF...

  6. Universal and rapid salt-extraction of high quality genomic DNA for PCR-based techniques.

    OpenAIRE

    Aljanabi, S M; Martinez, I

    1997-01-01

    A very simple, fast, universally applicable and reproducible method to extract high quality megabase genomic DNA from different organisms is described. We applied the same method to extract high quality complex genomic DNA from different tissues (wheat, barley, potato, beans, pear and almond leaves as well as fungi, insects and shrimps' fresh tissue) without any modification. The method does not require expensive and environmentally hazardous reagents and equipment. It can be performed even i...

  7. [Quality management is associated with high quality services in health care].

    Science.gov (United States)

    Nielsen, Tenna Hassert; Riis, Allan; Mainz, Jan; Jensen, Anne-Louise Degn

    2013-12-09

    In these years, quality management has been the focus in order to meet high quality services for the patients in Danish health care. This article provides information on quality management and quality improvement and it evaluates its effectiveness in achieving better organizational structures, processes and results in Danish health-care organizations. Our findings generally support that quality management is associated with high quality services in health care.

  8. Micromorphology and development of the epicuticular structure on the epidermal cell of ginseng leaves

    Directory of Open Access Journals (Sweden)

    Kyounghwan Lee

    2015-04-01

    Conclusion: The outwardly projected cuticle and epidermal cell wall (i.e., an epicuticular wrinkle acts as a major barrier to block out sunlight in ginseng leaves. The small vesicles in the peripheral region of epidermal cells may suppress the cuticle and parts of epidermal wall, push it upward, and consequently contribute to the formation of the epicuticular structure.

  9. Retrospective Study of Epidermal Parasitic Skin Diseases amongst ...

    African Journals Online (AJOL)

    ADOWIE PERE

    ABSTRACT: A ten year retrospective study (1997-2006) was undertaken to determine the prevalence of. Epidermal Parasitic Skin Diseases (EPSD) among out-patients from the skin diseases hospital in Maiduguri, Borno state. Out of 10,000 out-patients examined during the study period, 3527(35.27%) where infected with ...

  10. An immunologic approach to induction of epidermal growth factor deficiency

    DEFF Research Database (Denmark)

    Raaberg, Lasse; Nexø, Ebba; Poulsen, Steen Seier

    1995-01-01

    Epidermal growth factor (EGF) in pharmacologic doses is able to induce growth and development in the fetus and the newborn. To investigate the opposite situation, the effects of insufficient amounts of EGF during development, we wanted to establish an in vivo model with a state of EGF deficiency....

  11. Clinical Studies on conformal radiotherapy combined with epidermal ...

    African Journals Online (AJOL)

    Purpose: To study the effect of conformal radiotherapy combined with epidermal growth factor receptor-tyrosine kinase inhibitor (EGFR-TKI) in the second-line treatment of non-small cell lung cancer (NSCLC). Methods: A total of 316 patients attending Shanghai Pulmonary Hospital affiliated to Tongji University, were divided ...

  12. Assessment of the Developmental Toxicity of Epidermal Growth ...

    African Journals Online (AJOL)

    Purpose: To determine whether epidermal growth factor (EGF) is involved in reproductive developmental toxicity, using the embryonic stem cell test (EST), as well as ascertain how EGF influences embryonic development. Methods: To predict developmental toxicity on the basis of reducing cell viability and inhibition of ...

  13. Pattern of hormone receptors and human epidermal growth factor ...

    African Journals Online (AJOL)

    Introduction: Breast cancer is the most common cancer among women globally. With immunohistochemistry (IHC), breast cancer is classified into four groups based on IHC profile of estrogen receptor (ER)/progesterone receptor (PR) and human epidermal growth factor receptor 2 (HER2/neu) expression, positive (+) and/or ...

  14. Adding a Piece to the Leaf Epidermal Cell Shape Puzzle.

    Science.gov (United States)

    von Wangenheim, Daniel; Wells, Darren M; Bennett, Malcolm J

    2017-11-06

    The jigsaw puzzle-shaped pavement cells in the leaf epidermis collectively function as a load-bearing tissue that controls organ growth. In this issue of Developmental Cell, Majda et al. (2017) shed light on how the jigsaw shape can arise from localized variations in wall stiffness between adjacent epidermal cells. Copyright © 2017 Elsevier Inc. All rights reserved.

  15. Gastric luminal epidermal growth factor is affected by diet | Iputo ...

    African Journals Online (AJOL)

    Objective. Diet is an area of major interest to those investigating the causes of cancer of the oesophagus in the Transkei. This study looked at the associations between intragastric epidermal growth factor level, diet and intragastric pH. Setting and subjects. A dietary survey was co-ordinated with studies of gastric luminal ...

  16. Epidermal hydration levels in rosacea patients improve after minocycline therapy.

    LENUS (Irish Health Repository)

    Ní Raghallaigh, S

    2013-12-06

    Patients with rosacea frequently report increased skin sensitivity, with features suggestive of an abnormal stratum corneum (SC) permeability barrier. Sebum, pH and hydration levels influence epidermal homeostasis. The correlation of the change in these parameters with clinically effective treatment has not been previously analysed.

  17. Inflammatory linear verrucous epidermal naevus: Report of three ...

    African Journals Online (AJOL)

    Background: Epidermal naevi are congenital harmatomas that arise from embryonal ectodermal cells. The inflammatory linear verrucous variant is rare and presents with disturbing symptoms. In blacks the classical erythema is not common but pruritus and discharge are the commonest features. Methods and results: We ...

  18. Identification of grazed grasses using epidermal characters | R ...

    African Journals Online (AJOL)

    The use of anatomical features of the abaxial epidermis of grasses is discussed for the identification of fragments of epidermis present in samples of rumen. The reliability of this technique, and the variation of the epidermal characters in two widely distributed species of grass, is given. A "Key" to identity certain genera of ...

  19. Improvement of arbutin trans-epidermal delivery using ...

    African Journals Online (AJOL)

    Purpose: To assess the ability of radiofrequency (RF) microporation to promote trans-epidermal delivery of arbutin. Methods: To investigate the enhancing effect of RF microchannels on skin permeation of arbutin, in vitro skin permeability studies were performed with RF microporation-treated Hartley albino guinea pig skin ...

  20. [ROLE OF microRNA IN SKIN DEVELOPMENT AND WOUND HEALING].

    Science.gov (United States)

    Song, Zhifang; Liu, Dewu

    2014-07-01

    To review the role of microRNA (miRNA) in skin development and wound healing. The recent literature about miRNA in skin development and wound healing was reviewed and analyzed. miRNA extensively involved in the development of the skin, including epidermal cell proliferation, differentiation, aging and hair follicle development; miR-203 known as the "skin-specific miRNA" can directly inhibit the expression of p63 and promote the differentiation of the epidermis. Meanwhile, miRNA also involved in various stages of skin regeneration and wound healing. Abnormal expression of miRNA is closely related with abnormal wound healing. miRNA play an important role in maintaining normal skin physiology and skin regeneration. To explore their roles in the healing of skin wounds and their regulatory mechanism can provide a new target for the treatment, which has a potential value and broad prospects.

  1. Selection of DNA aptamers against epidermal growth factor receptor with high affinity and specificity.

    Science.gov (United States)

    Wang, Deng-Liang; Song, Yan-Ling; Zhu, Zhi; Li, Xi-Lan; Zou, Yuan; Yang, Hai-Tao; Wang, Jiang-Jie; Yao, Pei-Sen; Pan, Ru-Jun; Yang, Chaoyong James; Kang, De-Zhi

    2014-10-31

    Epidermal growth factor receptor (EGFR/HER1/c-ErbB1), is overexpressed in many solid cancers, such as epidermoid carcinomas, malignant gliomas, etc. EGFR plays roles in proliferation, invasion, angiogenesis and metastasis of malignant cancer cells and is the ideal antigen for clinical applications in cancer detection, imaging and therapy. Aptamers, the output of the systematic evolution of ligands by exponential enrichment (SELEX), are DNA/RNA oligonucleotides which can bind protein and other substances with specificity. RNA aptamers are undesirable due to their instability and high cost of production. Conversely, DNA aptamers have aroused researcher's attention because they are easily synthesized, stable, selective, have high binding affinity and are cost-effective to produce. In this study, we have successfully identified DNA aptamers with high binding affinity and selectivity to EGFR. The aptamer named TuTu22 with Kd 56±7.3nM was chosen from the identified DNA aptamers for further study. Flow cytometry analysis results indicated that the TuTu22 aptamer was able to specifically recognize a variety of cancer cells expressing EGFR but did not bind to the EGFR-negative cells. With all of the aforementioned advantages, the DNA aptamers reported here against cancer biomarker EGFR will facilitate the development of novel targeted cancer detection, imaging and therapy. Copyright © 2014 Elsevier Inc. All rights reserved.

  2. Rho A Regulates Epidermal Growth Factor-Induced Human Osteosarcoma MG63 Cell Migration

    Directory of Open Access Journals (Sweden)

    Jinyang Wang

    2018-05-01

    Full Text Available Osteosarcoma, the most common primary bone tumor, occurs most frequently in children and adolescents and has a 5-year survival rate, which is unsatisfactory. As epidermal growth factor receptor (EGFR positively correlates with TNM (tumor-node-metastasis stage in osteosarcoma, EGFR may play an important role in its progression. The purpose of this study was to explore potential mechanisms underlying this correlation. We found that EGF promotes MG63 cell migration and invasion as well as stress fiber formation via Rho A activation and that these effects can be reversed by inhibiting Rho A expression. In addition, molecules downstream of Rho A, including ROCK1, LIMK2, and Cofilin, are activated by EGF in MG63 cells, leading to actin stress fiber formation and cell migration. Moreover, inhibition of ROCK1, LIMK2, or Cofilin in MG63 cells using known inhibitors or short hairpin RNA (shRNA prevents actin stress fiber formation and cell migration. Thus, we conclude that Rho A/ROCK1/LIMK2/Cofilin signaling mediates actin microfilament formation in MG63 cells upon EGFR activation. This novel pathway provides a promising target for preventing osteosarcoma progression and for treating this cancer.

  3. Keratins K2 and K10 are essential for the epidermal integrity of plantar skin.

    Science.gov (United States)

    Fischer, Heinz; Langbein, Lutz; Reichelt, Julia; Buchberger, Maria; Tschachler, Erwin; Eckhart, Leopold

    2016-01-01

    K1 and K2 are the main type II keratins in the suprabasal epidermis where each of them heterodimerizes with the type I keratin K10 to form intermediate filaments. In regions of the ears, tail, and soles of the mouse, only K2 is co-expressed with K10, suggesting that these keratins suffice to form a mechanically resilient cytoskeleton. To determine the effects of the suppression of both main keratins, K2 and K10, in the suprabasal plantar epidermis of the mouse. Krt2(-/-) Krt10(-/-) mice were generated by crossing Krt2(-/-) and Krt10(-/-) mice. Epidermal morphology of soles of hind-paws was examined macroscopically and histologically. Immunofluorescence analysis and quantitative PCR analysis were performed to analyze the expression of keratins in sole skin of wildtype and Krt2(-/-) Krt10(-/-) mice. Highly abundant proteins of the sole stratum corneum were determined by electrophoretic and chromatographic separation and subsequent mass spectrometry. K2 and K10 are the most prominent suprabasal keratins in normal mouse soles with the exception of the footpads where K1, K9 and K10 predominate. Mice lacking both K2 and K10 were viable and developed epidermal acanthosis and hyperkeratosis in inter-footpad epidermis of the soles. The expression of keratins K1, K9 and K16 was massively increased at the RNA and protein levels in the soles of Krt2(-/-) Krt10(-/-) mice. This study demonstrates that the loss of the main cytoskeletal components of plantar epidermis, i.e. K2 and K10, can be only partly compensated by the upregulation of other keratins. The thickening of the epidermis in the soles of Krt2(-/-) Krt10(-/-) mice may serve as a model for pathomechanistic aspects of palmoplantar keratoderma. Copyright © 2015. Published by Elsevier Ireland Ltd.

  4. Optimization of RNA Extraction from Rat Pancreatic Tissue

    Directory of Open Access Journals (Sweden)

    Sanaz Dastgheib

    2014-05-01

    Full Text Available Background: Optimized RNA extraction from tissues and cell lines consists of four main stages regardless of the method of extraction: 1 homogenizing, 2 effective denaturation of proteins from RNA, 3 inactivation of ribonuclease, and 4 removal of any DNA, protein, and carbohydrate contamination. Isolation of undamaged intact RNA is challenging when the related tissue contains high levels of RNase. Various technical difficulties occur during extraction of RNA from pancreatic tissue due to spontaneous autolysis. Since standard routine protocols yield unacceptable results in pancrease, we have designed a simple method for RNA extraction by comparing different protocols. Methods: We obtained 20-30 mg pancreatic tissues in less than 2 min from 30 rats. Several methods were performed to extract RNA from pancreatic tissue and evaluate its integrity. All methods were performed three times to obtain reproducible results. Results: Immersing pancreatic tissue in RNA-later for 24 h at -80ºC yielded high quality RNA by using the TriPure reagent which was comparable to the commercial RNeasy Micro Kit. The quality of RNA was evaluated by spectrophotometer, electrophoresis and RT-PCR. We separated intact 28S and 18S ribosomal RNA (rRNA when our procedure was compared with the RNeasy Micro Kit. Finally, full length of the actin gene was amplified by RT-PCR. Conclusion: We designed a simple, fast, cost-effective method for complete RNA extraction from the least amount of quantitatively intact pancreatic tissue

  5. Development of a high-quality cut-off wall using electrophoresis

    International Nuclear Information System (INIS)

    Kawachi, T.; Murahashi, H.

    1991-01-01

    Techniques to build a high-quality cut-off wall have been developed for storage facilities of low-level radioactive waste (LLW) as an emergency measures to prevent leakages. The cut-off wall is highly impermeable, nucleid-adsorptive and have long-term durability. Electrophoresis is used to form impermeable membrane of bentonite as main features of the cut-off wall. First of all, laboratory tests have been conducted to study ways of building barriers on site and to collect data on the barriers properties. Afterwards, on-site construction tests of a high-quality cut-off wall have been carried out. In this paper, we describe the process and results on the studies of the high-quality cut-off wall using electrophoresis

  6. Mesoporous silica nanorods toward efficient loading and intracellular delivery of siRNA

    Science.gov (United States)

    Chen, Lijue; She, Xiaodong; Wang, Tao; Shigdar, Sarah; Duan, Wei; Kong, Lingxue

    2018-02-01

    The technology of RNA interference (RNAi) that uses small interfering RNA (siRNA) to silence the gene expression with complementary messenger RNA (mRNA) sequence has great potential for the treatment of cancer in which certain genes were usually found overexpressed. However, the carry and delivery of siRNA to the target site in the human body can be challenging for this technology to be used clinically to silence the cancer-related gene expression. In this work, rod shaped mesoporous silica nanoparticles (MSNs) were developed as siRNA delivery system for specific intracellular delivery. The rod MSNs with an aspect ratio of 1.5 had a high surface area of 934.28 m2/g and achieved a siRNA loading of more than 80 mg/g. With the epidermal growth factor (EGF) grafted on the surface of the MSNs, siRNA can be delivered to the epidermal growth factor receptor (EGFR) overexpressed colorectal cancer cells with high intracellular concentration compared to MSNs without EGF and lead to survivin gene knocking down to less than 30%.

  7. The epidermal biosynthesis of cholecalciferol (vitamin D3)

    International Nuclear Information System (INIS)

    Beadle, P.C.

    1977-01-01

    An attempt has been made to calculate the rate of ultraviolet absorption by 7-dehydrocholesterol, provitamin D 3 , in the epidermis as a function of latitude, season and skin type, in the hope that it will provide an upper-limit estimate of the epidermal vitamin production. The results indicate that a significant fraction of the total epidermal production may occur in the stratum corneum with figures of 15 and 31% being found for non-pigmented and pigmented epidermises, respectively. Total production in negroid epidermis is predicted to be about 40% of that in the caucasian one and the latitudinal variation is greater than the seasonal variation, in agreement with the behaviour of the available solar ultraviolet. Overall production rates were sufficiently high for it to be unnecessary to invoke an enhanced absorption mechanism for the provitamin, although the results do indicate that there may be a risk of deficient production above about 40 0 N. (author)

  8. Metabolic epidermal necrosis in two dogs with different underlying diseases.

    Science.gov (United States)

    Bond, R; McNeil, P E; Evans, H; Srebernik, N

    1995-05-06

    Two dogs with metabolic epidermal necrosis had hyperkeratosis of the footpads accompanied by erythematous, erosive and crusting lesions affecting the muzzle, external genitalia, perineum and periocular regions. Histopathological examination of skin biopsies revealed a superficial hydropic dermatitis with marked parakeratosis. Both dogs had high plasma activities of alkaline phosphatase and alanine aminotransferase and high concentrations of glucose, and also a marked hypoaminoacidaemia. Despite these similarities, the cutaneous eruptions were associated with different underlying diseases. One dog had a pancreatic carcinoma which had metastasised widely; the primary tumour and the metastases showed glucagon immunoreactivity on immunocytochemical staining, and the dog's plasma glucagon concentration was markedly greater than that of control dogs. The other dog had diffuse hepatic disease; its plasma glucagon concentration was similar to that of control samples and cirrhosis was identified post mortem. Metabolic epidermal necrosis in dogs is a distinct cutaneous reaction pattern which may be associated with different underlying systemic diseases; however, the pathogenesis of the skin lesions remains unclear.

  9. Steroid hormone and epidermal growth factor receptors in meningiomas.

    Science.gov (United States)

    Horsfall, D J; Goldsmith, K G; Ricciardelli, C; Skinner, J M; Tilley, W D; Marshall, V R

    1989-11-01

    A prospective study of steroid hormone and epidermal growth factor receptor expression in 57 meningiomas is presented. Scatchard analysis of radioligand binding identified 20% of meningiomas as expressing classical oestrogen receptors (ER) at levels below that normally accepted for positivity, the remainder being negative. ER could not be visualized in any meningioma using immunocytochemistry. Alternatively, 74% of meningiomas demonstrated the presence of progesterone receptors (PR) by Scatchard analysis, the specificity of which could not be attributed to glucocorticoid or androgen receptors. Confirmation of classical PR presence was determined by immunocytochemical staining. The presence of epidermal growth factor receptor (EGFR) was demonstrated in 100% of meningiomas using immunocytochemical staining. These data are reviewed in the context of previously reported results and are discussed in relation to the potential for medical therapy as an adjunct to surgery.

  10. Immunohistochemical localization of epidermal growth factor in rat and man

    DEFF Research Database (Denmark)

    Poulsen, Steen Seier; Nexø, Ebba

    1986-01-01

    Epidermal growth factor (EGF) is a peptide which stimulates cell mitotic activity and differentiation, has a cytoprotective effect on the gastroduodenal mucosa, and inhibits gastric acid secretion. The immunohistochemical localization of EGF in the Brunner's glands and the submandibular glands is...... antisera against human urinary EGF worked in rat as well as man. EGF was found only in cells with an exocrine function.......Epidermal growth factor (EGF) is a peptide which stimulates cell mitotic activity and differentiation, has a cytoprotective effect on the gastroduodenal mucosa, and inhibits gastric acid secretion. The immunohistochemical localization of EGF in the Brunner's glands and the submandibular glands...... is well documented. The localization of EGF in other tissues is still unclarified. In the present study, the immunohistochemical localization of EGF in tissues from rat, man and a 20 week human fetus were investigated. In man and rat, immunoreaction was found in the submandibular glands, the serous glands...

  11. Stainless steel fabrication for high quality requirements in the nuclear industry

    International Nuclear Information System (INIS)

    Wareing, A.J.

    1990-01-01

    In this paper the author explains the welding procedures and practices adopted within the nuclear industry to achieve the high quality and standards of welds required. The changeover to mechanised welding, orbital TIG welding and synergic MIG welding, has resulted in consistent achievement of high quality standards as well as optimising the productivity. However, the use of mechanised welding machines does require the welder operating them to be fully trained and qualified. The formally organised training courses are described and the cost savings and production rates achieved by utilising the mechanised method are discussed. (author)

  12. Sample preservation, transport and processing strategies for honeybee RNA extraction: Influence on RNA yield, quality, target quantification and data normalization.

    Science.gov (United States)

    Forsgren, Eva; Locke, Barbara; Semberg, Emilia; Laugen, Ane T; Miranda, Joachim R de

    2017-08-01

    Viral infections in managed honey bees are numerous, and most of them are caused by viruses with an RNA genome. Since RNA degrades rapidly, appropriate sample management and RNA extraction methods are imperative to get high quality RNA for downstream assays. This study evaluated the effect of various sampling-transport scenarios (combinations of temperature, RNA stabilizers, and duration) of transport on six RNA quality parameters; yield, purity, integrity, cDNA synthesis efficiency, target detection and quantification. The use of water and extraction buffer were also compared for a primary bee tissue homogenate prior to RNA extraction. The strategy least affected by time was preservation of samples at -80°C. All other regimens turned out to be poor alternatives unless the samples were frozen or processed within 24h. Chemical stabilizers have the greatest impact on RNA quality and adding an extra homogenization step (a QIAshredder™ homogenizer) to the extraction protocol significantly improves the RNA yield and chemical purity. This study confirms that RIN values (RNA Integrity Number), should be used cautiously with bee RNA. Using water for the primary homogenate has no negative effect on RNA quality as long as this step is no longer than 15min. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. Polyethylene Glycol Mediated Colorectal Cancer Chemoprevention: Roles of Epidermal Growth Factor Receptor and Snail

    Science.gov (United States)

    Wali, Ramesh K.; Kunte, Dhananjay P.; Koetsier, Jennifer L.; Bissonnette, Marc; Roy, Hemant K.

    2008-01-01

    Polyethylene glycol (PEG) is a clinically widely used agent with profound chemopreventive properties in experimental colon carcinogenesis. We previously reported that Snail/β-catenin signaling may mediate the suppression of epithelial proliferation by PEG, although the upstream events remain unclear. We report herein the role of epidermal growth factor receptor (EGFR), a known mediator of Snail and overepressed in ~80% of human colorectal cancers (CRC), on PEG-mediated anti-proliferative and hence anti-neoplastic effects in azoxymethane (AOM)-rats and HT-29 colon cancer cells. AOM-rats were randomized to either standard diet or one with 10% PEG 3350 and euthanized 8 weeks later. The colonic samples were subjected to immunohistochemical or Western blot analyses. PEG decreased mucosal EGFR by 60% (pPEG effects were obtained in HT-29 cells. PEG suppressed EGFR protein via lysosmal degradation with no change in mRNA levels. To show that EGFR antagonism per se was responsible for the antiproliferative effect, we inhibited EGFR by either pre-treating cells with gefitinib or stably transfecting with EGFR-shRNA and measured the effect of PEG on proliferation. In either case PEG effect was blunted suggesting a vital role of EGFR. Flow cytometric analysis revealed that EGFR-shRNA cells, besides having reduced membrane EGFR also expressed low Snail levels (40%), corroborating a strong association. Furthermore, in EGFR silenced cells PEG effect on EGFR or Snail was muted, similar to that on proliferation. In conclusion, we show that EGFR is the proximate membrane signaling molecule through which PEG initiates antiproliferative activity with Snail/β-catenin pathway playing the central intermediary function. PMID:18790788

  14. Polyethylene glycol-mediated colorectal cancer chemoprevention: roles of epidermal growth factor receptor and Snail.

    Science.gov (United States)

    Wali, Ramesh K; Kunte, Dhananjay P; Koetsier, Jennifer L; Bissonnette, Marc; Roy, Hemant K

    2008-09-01

    Polyethylene glycol (PEG) is a clinically widely used agent with profound chemopreventive properties in experimental colon carcinogenesis. We reported previously that Snail/beta-catenin signaling may mediate the suppression of epithelial proliferation by PEG, although the upstream events remain unclear. We report herein the role of epidermal growth factor receptor (EGFR), a known mediator of Snail and overexpressed in approximately 80% of human colorectal cancers, on PEG-mediated antiproliferative and hence antineoplastic effects in azoxymethane (AOM) rats and HT-29 colon cancer cells. AOM rats were randomized to either standard diet or one with 10% PEG-3350 and euthanized 8 weeks later. The colonic samples were subjected to immunohistochemical or Western blot analyses. PEG decreased mucosal EGFR by 60% (P PEG effects were obtained in HT-29 cells. PEG suppressed EGFR protein via lysosmal degradation with no change in mRNA levels. To show that EGFR antagonism per se was responsible for the antiproliferative effect, we inhibited EGFR by either pretreating cells with gefitinib or stably transfecting with EGFR-short hairpin RNA and measured the effect of PEG on proliferation. In either case, PEG effect was blunted, suggesting a vital role of EGFR. Flow cytometric analysis revealed that EGFR-short hairpin RNA cells, besides having reduced membrane EGFR, also expressed low Snail levels (40%), corroborating a strong association. Furthermore, in EGFR silenced cells, PEG effect on EGFR or Snail was muted, similar to that on proliferation. In conclusion, we show that EGFR is the proximate membrane signaling molecule through which PEG initiates antiproliferative activity with Snail/beta-catenin pathway playing the central intermediary function.

  15. Selection of DNA aptamers against epidermal growth factor receptor with high affinity and specificity

    International Nuclear Information System (INIS)

    Wang, Deng-Liang; Song, Yan-Ling; Zhu, Zhi; Li, Xi-Lan; Zou, Yuan; Yang, Hai-Tao; Wang, Jiang-Jie; Yao, Pei-Sen; Pan, Ru-Jun; Yang, Chaoyong James; Kang, De-Zhi

    2014-01-01

    Highlights: • This is the first report of DNA aptamer against EGFR in vitro. • Aptamer can bind targets with high affinity and selectivity. • DNA aptamers are more stable, cheap and efficient than RNA aptamers. • Our selected DNA aptamer against EGFR has high affinity with K d 56 ± 7.3 nM. • Our selected DNA aptamer against EGFR has high selectivity. - Abstract: Epidermal growth factor receptor (EGFR/HER1/c-ErbB1), is overexpressed in many solid cancers, such as epidermoid carcinomas, malignant gliomas, etc. EGFR plays roles in proliferation, invasion, angiogenesis and metastasis of malignant cancer cells and is the ideal antigen for clinical applications in cancer detection, imaging and therapy. Aptamers, the output of the systematic evolution of ligands by exponential enrichment (SELEX), are DNA/RNA oligonucleotides which can bind protein and other substances with specificity. RNA aptamers are undesirable due to their instability and high cost of production. Conversely, DNA aptamers have aroused researcher’s attention because they are easily synthesized, stable, selective, have high binding affinity and are cost-effective to produce. In this study, we have successfully identified DNA aptamers with high binding affinity and selectivity to EGFR. The aptamer named TuTu22 with K d 56 ± 7.3 nM was chosen from the identified DNA aptamers for further study. Flow cytometry analysis results indicated that the TuTu22 aptamer was able to specifically recognize a variety of cancer cells expressing EGFR but did not bind to the EGFR-negative cells. With all of the aforementioned advantages, the DNA aptamers reported here against cancer biomarker EGFR will facilitate the development of novel targeted cancer detection, imaging and therapy

  16. Selection of DNA aptamers against epidermal growth factor receptor with high affinity and specificity

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Deng-Liang [The First Clinical Medical College of Fujian Medical University, Fuzhou (China); Department of Neurosurgery, The First Affiliated Hospital of Fujian Medical University, Fuzhou (China); Song, Yan-Ling; Zhu, Zhi; Li, Xi-Lan; Zou, Yuan [State Key Laboratory for Physical Chemistry of Solid Surfaces, Key Laboratory for Chemical Biology of Fujian Province, Key Laboratory of Analytical Chemistry, and Department of Chemical Biology, College of Chemistry and Chemical Engineering, Xiamen University, Xiamen 361005 (China); Yang, Hai-Tao; Wang, Jiang-Jie [The First Clinical Medical College of Fujian Medical University, Fuzhou (China); Yao, Pei-Sen [Department of Neurosurgery, The First Affiliated Hospital of Fujian Medical University, Fuzhou (China); Pan, Ru-Jun [The First Clinical Medical College of Fujian Medical University, Fuzhou (China); Yang, Chaoyong James, E-mail: cyyang@xmu.edu.cn [State Key Laboratory for Physical Chemistry of Solid Surfaces, Key Laboratory for Chemical Biology of Fujian Province, Key Laboratory of Analytical Chemistry, and Department of Chemical Biology, College of Chemistry and Chemical Engineering, Xiamen University, Xiamen 361005 (China); Kang, De-Zhi, E-mail: kdzy99988@163.com [The First Clinical Medical College of Fujian Medical University, Fuzhou (China); Department of Neurosurgery, The First Affiliated Hospital of Fujian Medical University, Fuzhou (China)

    2014-10-31

    Highlights: • This is the first report of DNA aptamer against EGFR in vitro. • Aptamer can bind targets with high affinity and selectivity. • DNA aptamers are more stable, cheap and efficient than RNA aptamers. • Our selected DNA aptamer against EGFR has high affinity with K{sub d} 56 ± 7.3 nM. • Our selected DNA aptamer against EGFR has high selectivity. - Abstract: Epidermal growth factor receptor (EGFR/HER1/c-ErbB1), is overexpressed in many solid cancers, such as epidermoid carcinomas, malignant gliomas, etc. EGFR plays roles in proliferation, invasion, angiogenesis and metastasis of malignant cancer cells and is the ideal antigen for clinical applications in cancer detection, imaging and therapy. Aptamers, the output of the systematic evolution of ligands by exponential enrichment (SELEX), are DNA/RNA oligonucleotides which can bind protein and other substances with specificity. RNA aptamers are undesirable due to their instability and high cost of production. Conversely, DNA aptamers have aroused researcher’s attention because they are easily synthesized, stable, selective, have high binding affinity and are cost-effective to produce. In this study, we have successfully identified DNA aptamers with high binding affinity and selectivity to EGFR. The aptamer named TuTu22 with K{sub d} 56 ± 7.3 nM was chosen from the identified DNA aptamers for further study. Flow cytometry analysis results indicated that the TuTu22 aptamer was able to specifically recognize a variety of cancer cells expressing EGFR but did not bind to the EGFR-negative cells. With all of the aforementioned advantages, the DNA aptamers reported here against cancer biomarker EGFR will facilitate the development of novel targeted cancer detection, imaging and therapy.

  17. Grafting of human epidermal cells, presence and perspectives

    Czech Academy of Sciences Publication Activity Database

    Smetana, Karel; Dvořánková, B.; Labský, Jiří; Vacík, Jiří; Holíková, Z.

    2001-01-01

    Roč. 102, č. 1 (2001), s. 1-6 ISSN 0036-5327 R&D Projects: GA ČR GA203/00/1310; GA AV ČR IBS4050005; GA MZd ND6340; GA MŠk LN00A065; GA AV ČR KSK4055109 Institutional research plan: CEZ:AV0Z4050913 Keywords : cell therapy-keratinocyte-epidermal stem cell * skin defect Subject RIV: CD - Macromolecular Chemistry

  18. Epidermal electronics with advanced capabilities in near-field communication.

    Science.gov (United States)

    Kim, Jeonghyun; Banks, Anthony; Cheng, Huanyu; Xie, Zhaoqian; Xu, Sheng; Jang, Kyung-In; Lee, Jung Woo; Liu, Zhuangjian; Gutruf, Philipp; Huang, Xian; Wei, Pinghung; Liu, Fei; Li, Kan; Dalal, Mitul; Ghaffari, Roozbeh; Feng, Xue; Huang, Yonggang; Gupta, Sanjay; Paik, Ungyu; Rogers, John A

    2015-02-25

    Epidermal electronics with advanced capabilities in near field communications (NFC) are presented. The systems include stretchable coils and thinned NFC chips on thin, low modulus stretchable adhesives, to allow seamless, conformal contact with the skin and simultaneous capabilities for wireless interfaces to any standard, NFC-enabled smartphone, even under extreme deformation and after/during normal daily activities. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  19. Expression and analysis of exogenous proteins in epidermal cells.

    Science.gov (United States)

    Dagnino, Lina; Ho, Ernest; Chang, Wing Y

    2010-01-01

    In this chapter we review protocols for transient transfection of primary keratinocytes. The ability to transfect primary epidermal cells regardless of their differentiation status allows the biochemical and molecular characterization of multiple proteins. We review methods to analyze exogenous protein abundance in transfected keratinocytes by immunoblot and immunoprecipitation. We also present protocols to determine the subcellular distribution of these proteins by indirect immunofluorescence microscopy approaches.

  20. A review of toxic epidermal necrolysis management in Japan

    Directory of Open Access Journals (Sweden)

    Yuri Kinoshita

    2017-01-01

    Full Text Available Toxic epidermal necrolysis (TEN is a severe adverse drug reaction characterized by necrosis of the epidermis. Its incidence is approximately 1 per million a year and average mortality rate is high at 25–50%. TEN has a flu-like prodrome, followed by atypical, targetoid erythematous or purpuric macules on the skin. These macules coalesce to form flaccid blisters that slough off as areas of epidermal necrosis. Drugs such as allopurinol, sulfonamides, and carbamazepine are the most common causes. The human leukocyte antigen (HLA-B*15:02 in Asians being administered carbamazepine and the HLA-B*58:01 antigen in patients of all ethnicities being administered allopurinol are known to be high-risk factors. Rapid diagnosis, discontinuation of the causative drug, and supportive treatment are essential for better prognosis and improvement of sequelae. Till now, systemic corticosteroids and intravenous immunoglobulins have been used as the most common active interventions; however, no gold standard has been established. In Japan, physicians follow a unique diagnostic criteria and treatment guideline to improve the diagnosis rate and streamline treatments. This may be a contributing factor for the lower mortality rate (14.3%. The efficacy of systemic corticosteroids, immunoglobulins, and plasmapheresis may have been beneficial as well. In Japan, TEN is defined as an epidermal detachment of over 10% of the body surface area (BSA, while the globally accepted definition established by Bastuji-Garin describes it as an epidermal detachment of over 30% of the BSA. In Japanese individuals, HLA-A*02:06, HLA-A*02:07, HLA-A*31:01 and HLA-B*51:01 may be linked to higher risks of TEN.

  1. "Cut-and-Paste" Manufacture of Multiparametric Epidermal Sensor Systems.

    Science.gov (United States)

    Yang, Shixuan; Chen, Ying-Chen; Nicolini, Luke; Pasupathy, Praveenkumar; Sacks, Jacob; Su, Becky; Yang, Russell; Sanchez, Daniel; Chang, Yao-Feng; Wang, Pulin; Schnyer, David; Neikirk, Dean; Lu, Nanshu

    2015-11-04

    Multifunctional epidermal sensor systems (ESS) are manufactured with a highly cost and time effective, benchtop, and large-area "cut-and-paste" method. The ESS made out of thin and stretchable metal and conductive polymer ribbons can be noninvasively laminated onto the skin surface to sense electrophysiological signals, skin temperature, skin hydration, and respiratory rate. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. Optimisation of transgene action at the post-transcriptional level: high quality parthenocarpic fruits in industrial tomatoes

    Directory of Open Access Journals (Sweden)

    Defez Roberto

    2002-01-01

    Full Text Available Abstract Background Genetic engineering of parthenocarpy confers to horticultural plants the ability to produce fruits under environmental conditions that curtail fruit productivity and quality. The DefH9-iaaM transgene, whose predicted action is to confer auxin synthesis specifically in the placenta, ovules and derived tissues, has been shown to confer parthenocarpy to several plant species (tobacco, eggplant, tomato and varieties. Results UC82 tomato plants, a typical cultivar used by the processing industry, transgenic for the DefH9-iaaM gene produce parthenocarpic fruits that are malformed. UC82 plants transgenic for the DefH9-RI-iaaM, a DefH9-iaaM derivative gene modified in its 5'ULR by replacing 53 nucleotides immediately upstream of the AUG initiation codon with an 87 nucleotides-long sequence derived from the rolA intron sequence, produce parthenocarpic fruits of high quality. In an in vitro translation system, the iaaM mRNA, modified in its 5'ULR is translated 3–4 times less efficiently than the original transcript. An optimal expressivity of parthenocarpy correlates with a reduced transgene mRNA steady state level in DefH9-RI-iaaM flower buds in comparison to DefH9-iaaM flower buds. Consistent with the known function of the iaaM gene, flower buds transgenic for the DefH9-RI-iaaM gene contain ten times more IAA than control untransformed flower buds, but five times less than DefH9-iaaM flower buds. Conclusions By using an auxin biosynthesis transgene downregulated at the post-transcriptional level, an optimal expressivity of parthenocarpy has been achieved in a genetic background not suitable for the original transgene. Thus, the method allows the generation of a wider range of expressivity of the desired trait in transgenic plants.

  3. The Epidermal Growth Factor Receptor Responsive miR-125a Represses Mesenchymal Morphology in Ovarian Cancer Cells

    Directory of Open Access Journals (Sweden)

    Karen D. Cowden Dahl

    2009-11-01

    Full Text Available The epithelial-to-mesenchymal transition (EMT that occurs during embryonic development is recapitulated during tumor metastasis. Important regulators of this process include growth factors, transcription factors, and adhesion molecules. New evidence suggests that microRNA (miRNA activity contributes to metastatic progression and EMT; however, the mechanisms leading to altered miRNA expression during cancer progression remain poorly understood. Importantly, overexpression of the epidermal growth factor receptor (EGFR in ovarian cancer correlates with poor disease outcome and induces EMT in ovarian cancer cells. We report that EGFR signaling leads to transcriptional repression of the miRNA miR-125a through the ETS family transcription factor PEA3. Overexpression of miR-125a induces conversion of highly invasive ovarian cancer cells from a mesenchymal to an epithelial morphology, suggesting miR-125a is a negative regulator of EMT. We identify AT-rich interactive domain 3B (ARID3B as a target of miR-125a and demonstrate that ARID3B is overexpressed in human ovarian cancer. Repression of miR-125a through growth factor signaling represents a novel mechanism for regulating ovarian cancer invasive behavior.

  4. Epidermal growth in the bottlenose dolphin, Tursiops truncatus

    International Nuclear Information System (INIS)

    Hicks, B.D.; St Aubin, D.J.; Geraci, J.R.; Brown, W.R.

    1985-01-01

    Epidermal growth in two mature female bottlenose dolphins, Tursiops truncatus, was investigated by following the movement of a cohort of tritiated thymidine-labeled epidermal cells for 59 days. The majority of the cells migrated in a cluster which was estimated to reach the skin surface in 73 days. The authors calculate that the outermost cell layer is sloughed 12 times per day. Turnover time and sloughing rate are estimated to be 1.7 times longer and 8.5 times faster than the respective values for epidermal cell kinetics in humans. This apparent inconsistency of slow transit time and rapid sloughing rate is reconciled by the convoluted structure of the stratum germinativum in the dolphin which results in a ratio of germinatival to superficial cells of 876:1. The stratum germinativum of dolphin epidermis appears to lack morphologically distinct, spatially segregated subpopulations of anchoring and stem cells. Dolphin epidermis has a large capacity for cell population, relatively long turnover time, and rapid sloughing rate. The adaptive advantages of these characteristics are discussed

  5. Epidermal growth factor receptor expression in urinary bladder cancer

    Directory of Open Access Journals (Sweden)

    Dayalu S.L. Naik

    2011-01-01

    Full Text Available Objective : To evaluate the expression pattern of epidermal growth factor receptor (EGFR in urinary bladder cancer and its association with human epidermal growth factor receptor 2 (HER2, epidermal growth factor (EGF, interleukin-6 (IL-6, and high risk human papilloma virus (HPV types 16 and 18. Materials and Methods : Thirty cases of urothelial carcinoma were analyzed. EGFR, HER2, EGF, and IL-6 expressions in the tissue were evaluated by immunohistochemical staining. For HPV, DNA from tissue samples was extracted and detection of HPV was done by PCR technique. Furthermore, evaluation of different intracellular molecules associated with EGFR signaling pathways was performed by the western blot method using lysates from various cells and tissues. Results : In this study, the frequencies of immunopositivity for EGFR, HER2, EGF, and IL-6 were 23%, 60%, 47%, and 80%, respectively. No cases were positive for HPV-18, whereas HPV-16 was detected in 10% cases. Overall, expression of EGFR did not show any statistically significant association with the studied parameters. However, among male patients, a significant association was found only between EGFR and HER2. Conclusions : Overexpression of EGFR and/or HER2, two important members of the same family of growth factor receptors, was observed in a considerable proportion of cases. Precise knowledge in this subject would be helpful to formulate a rational treatment strategy in patients with urinary bladder cancer.

  6. Fatty acids are required for epidermal permeability barrier function.

    Science.gov (United States)

    Mao-Qiang, M; Elias, P M; Feingold, K R

    1993-08-01

    The permeability barrier is mediated by a mixture of ceramides, sterols, and free fatty acids arranged as extracellular lamellar bilayers in the stratum corneum. Whereas prior studies have shown that cholesterol and ceramides are required for normal barrier function, definitive evidence for the importance of nonessential fatty acids is not available. To determine whether epidermal fatty acid synthesis also is required for barrier homeostasis, we applied 5-(tetradecyloxy)-2-furancarboxylic acid (TOFA), an inhibitor of acetyl CoA carboxylase, after disruption of the barrier by acetone or tape stripping. TOFA inhibits epidermal fatty acid by approximately 50% and significantly delays barrier recovery. Moreover, coadministration of palmitate with TOFA normalizes barrier recovery, indicating that the delay is due to a deficiency in bulk fatty acids. Furthermore, TOFA treatment also delays the return of lipids to the stratum corneum and results in abnormalities in the structure of lamellar bodies, the organelle which delivers lipid to the stratum corneum. In addition, the organization of secreted lamellar body material into lamellar bilayers within the stratum corneum interstices is disrupted by TOFA treatment. Finally, these abnormalities in lamellar body and stratum corneum membrane structure are corrected by coapplication of palmitate with TOFA. These results demonstrate a requirement for bulk fatty acids in barrier homeostasis. Thus, inhibiting the epidermal synthesis of any of the three key lipids that form the extracellular, lipid-enriched membranes of the stratum corneum results in an impairment in barrier homeostasis.

  7. Epidermal growth in the bottlenose dolphin, Tursiops truncatus

    Energy Technology Data Exchange (ETDEWEB)

    Hicks, B.D.; St. Aubin, D.J.; Geraci, J.R.; Brown, W.R.

    1985-07-01

    Epidermal growth in two mature female bottlenose dolphins, Tursiops truncatus, was investigated by following the movement of a cohort of tritiated thymidine-labeled epidermal cells for 59 days. The majority of the cells migrated in a cluster which was estimated to reach the skin surface in 73 days. The authors calculate that the outermost cell layer is sloughed 12 times per day. Turnover time and sloughing rate are estimated to be 1.7 times longer and 8.5 times faster than the respective values for epidermal cell kinetics in humans. This apparent inconsistency of slow transit time and rapid sloughing rate is reconciled by the convoluted structure of the stratum germinativum in the dolphin which results in a ratio of germinatival to superficial cells of 876:1. The stratum germinativum of dolphin epidermis appears to lack morphologically distinct, spatially segregated subpopulations of anchoring and stem cells. Dolphin epidermis has a large capacity for cell population, relatively long turnover time, and rapid sloughing rate. The adaptive advantages of these characteristics are discussed.

  8. Optimal allocation of leaf epidermal area for gas exchange.

    Science.gov (United States)

    de Boer, Hugo J; Price, Charles A; Wagner-Cremer, Friederike; Dekker, Stefan C; Franks, Peter J; Veneklaas, Erik J

    2016-06-01

    A long-standing research focus in phytology has been to understand how plants allocate leaf epidermal space to stomata in order to achieve an economic balance between the plant's carbon needs and water use. Here, we present a quantitative theoretical framework to predict allometric relationships between morphological stomatal traits in relation to leaf gas exchange and the required allocation of epidermal area to stomata. Our theoretical framework was derived from first principles of diffusion and geometry based on the hypothesis that selection for higher anatomical maximum stomatal conductance (gsmax ) involves a trade-off to minimize the fraction of the epidermis that is allocated to stomata. Predicted allometric relationships between stomatal traits were tested with a comprehensive compilation of published and unpublished data on 1057 species from all major clades. In support of our theoretical framework, stomatal traits of this phylogenetically diverse sample reflect spatially optimal allometry that minimizes investment in the allocation of epidermal area when plants evolve towards higher gsmax . Our results specifically highlight that the stomatal morphology of angiosperms evolved along spatially optimal allometric relationships. We propose that the resulting wide range of viable stomatal trait combinations equips angiosperms with developmental and evolutionary flexibility in leaf gas exchange unrivalled by gymnosperms and pteridophytes. © 2016 The Authors New Phytologist © 2016 New Phytologist Trust.

  9. Producing high-quality negatives from ERTS black-and-white transparancies

    Science.gov (United States)

    Richard J. Myhre

    1973-01-01

    A method has been devised for producing high-quality black-and-white negatives quickly and efficiently from dense transparencies orgininating from Earth Resources Technology Satellite imagery. Transparencies are evaluated on a standard light source to determine exposure and processing information needed for making negatives. A “System ASA Rating” was developed by...

  10. Study on the Introduction of High-Quality Educational Resources for Sino-Foreign Cooperative Education

    Science.gov (United States)

    Jinhui, Lin

    2016-01-01

    In Sino-foreign cooperative education, high-quality introduced educational resources must benefit the growth and development of students, facilitate the school's capacity building and the improvement of overall educational standards, and promote national socioeconomic development. It is necessary to establish and perfect the various working…

  11. High quality ion channels recordings on an injection molded polymer chip

    DEFF Research Database (Denmark)

    Tanzi, Simone

    In this thesis we demonstrate high quality recordings of the ion channel activity across the cell membrane in a biological cell by employing the so called patch clamping technique on an injection molded polymer microfluidic device. Such recordings are traditionally made using glass micropipettes,...

  12. High-quality bulk hybrid perovskite single crystals within minutes by inverse temperature crystallization

    KAUST Repository

    Saidaminov, Makhsud I.; Abdelhady, Ahmed L.; Banavoth, Murali; Alarousu, Erkki; Burlakov, Victor M.; Peng, Wei; Dursun, Ibrahim; Wang, Lingfei; He, Yao; Maculan, Giacomo; Goriely, Alain; Wu, Tao; Mohammed, Omar F.; Bakr, Osman

    2015-01-01

    Single crystals of methylammonium lead trihalide perovskites (MAPbX3; MA=CH3NH3+, X=Br− or I−) have shown remarkably low trap density and charge transport properties; however, growth of such high-quality semiconductors is a time-consuming process

  13. Animated Cell Biology: A Quick and Easy Method for Making Effective, High-Quality Teaching Animations

    Science.gov (United States)

    O'Day, Danton H.

    2006-01-01

    There is accumulating evidence that animations aid learning of dynamic concepts in cell biology. However, existing animation packages are expensive and difficult to learn, and the subsequent production of even short animations can take weeks to months. Here I outline the principles and sequence of steps for producing high-quality PowerPoint…

  14. Emotional Experience, Expression, and Regulation of High-Quality Japanese Elementary School Teachers

    Science.gov (United States)

    Hosotani, Rika; Imai-Matsumura, Kyoko

    2011-01-01

    The present study investigates the emotional experience, expression, and regulation processes of high-quality Japanese elementary school teachers while they interact with children, in terms of teachers' emotional competence. Qualitative analysis of interview data demonstrated that teachers had various emotional experiences including self-elicited…

  15. High quality factor GaAs microcavity with buried bullseye defects

    DEFF Research Database (Denmark)

    Winkler, K.; Gregersen, Niels; Hayrynen, T.

    2018-01-01

    The development of high quality factor solid-state microcavities with low mode volumes has paved the way towards on-chip cavity quantum electrodynamics experiments and the development of high-performance nanophotonic devices. Here, we report on the implementation of a new kind of solid...

  16. 75 FR 41693 - Export Inspection and Weighing Waiver for High Quality Specialty Grains Transported in Containers

    Science.gov (United States)

    2010-07-19

    ... Specialty Grains Transported in Containers AGENCY: Grain Inspection, Packers and Stockyards Administration... rule to potentially make permanent the current waiver for high quality grain exported in containers... exported in containers that was established by a final rule on December 13, 2005 (70 FR 73556). This...

  17. A safe inexpensive method to isolate high quality plant and fungal ...

    African Journals Online (AJOL)

    STORAGESEVER

    2008-08-18

    Aug 18, 2008 ... quality DNA from plant and fungal species. This method uses potassium acetate to remove proteins and polysaccharides in an SDS extraction buffer. Further DNA purification is achieved using a low salt. CTAB treatment. This SDS/CTAB protocol was used to isolate high quality genomic DNA subject to.

  18. Student Writing Accepted as High-Quality Responses to Analytic Text-Based Writing Tasks

    Science.gov (United States)

    Wang, Elaine; Matsumura, Lindsay Clare; Correnti, Richard

    2018-01-01

    Literacy standards increasingly emphasize the importance of analytic text-based writing. Little consensus exists, however, around what high-quality student responses should look like in this genre. In this study, we investigated fifth-grade students' writing in response to analytic text-based writing tasks (15 teachers, 44 writing tasks, 88 pieces…

  19. Toward High Quality Family Day Care for Infants and Toddlers. Final Report.

    Science.gov (United States)

    Rauch, Marian D.; Crowell, Doris C.

    Reported were the results of a project which established a cluster of family day care homes in Hawaii in which caregivers were selected, trained, and provided with supportive services and salaries. The primary objective of the program was to provide a replicable, high quality program for preschool children that would maximize social, emotional,…

  20. Optimization of nitridation conditions for high quality inter-polysilicon dielectric layers

    NARCIS (Netherlands)

    Klootwijk, J.H.; Bergveld, H.J.; van Kranenburg, H.; Woerlee, P.H.; Wallinga, Hans

    1996-01-01

    Nitridation of deposited high temperature oxides (HTO) was studied to form high quality inter-polysilicon dielectric layers for embedded non volatile memories. Good quality dielectric layers were obtained earlier by using an optimized deposition of polysilicon and by performing a post-dielectric

  1. 10 Principles for Building a High-Quality System of Assessments

    Science.gov (United States)

    Jobs for the Future, 2018

    2018-01-01

    Many states and districts are working toward developing and implementing high-quality systems that align assessments with each other, and to college and career readiness, and a comprehensive set of higher-order thinking skills. In order to support states, districts, and communities in this, the following 10 principles as guidance and common…

  2. Access, Participation, and Supports: The Defining Features of High-Quality Inclusion

    Science.gov (United States)

    Buysse, Virginia

    2011-01-01

    This article describes current knowledge about early childhood inclusion, summarizing research and the DEC/NAEYC joint position statement on inclusion. The article also describes effective or promising educational practices that promote access, participation, and supports--the defining features of high-quality inclusion. Future efforts to improve…

  3. Integrated Pathology Informatics Enables High-Quality Personalized and Precision Medicine: Digital Pathology and Beyond.

    Science.gov (United States)

    Volynskaya, Zoya; Chow, Hung; Evans, Andrew; Wolff, Alan; Lagmay-Traya, Cecilia; Asa, Sylvia L

    2018-03-01

    - The critical role of pathology in diagnosis, prognosis, and prediction demands high-quality subspecialty diagnostics that integrates information from multiple laboratories. - To identify key requirements and to establish a systematic approach to providing high-quality pathology in a health care system that is responsible for services across a large geographic area. - This report focuses on the development of a multisite pathology informatics platform to support high-quality surgical pathology and hematopathology using a sophisticated laboratory information system and whole slide imaging for histology and immunohistochemistry, integrated with ancillary tools, including electron microscopy, flow cytometry, cytogenetics, and molecular diagnostics. - These tools enable patients in numerous geographic locations access to a model of subspecialty pathology that allows reporting of every specimen by the right pathologist at the right time. The use of whole slide imaging for multidisciplinary case conferences enables better communication among members of patient care teams. The system encourages data collection using a discrete data synoptic reporting module, has implemented documentation of quality assurance activities, and allows workload measurement, providing examples of additional benefits that can be gained by this electronic approach to pathology. - This approach builds the foundation for accurate big data collection and high-quality personalized and precision medicine.

  4. A Novel Approach to High-Quality Postmortem Tissue Procurement: The GTEx Project

    NARCIS (Netherlands)

    Carithers, Latarsha J.; Ardlie, Kristin; Barcus, Mary; Branton, Philip A.; Britton, Angela; Buia, Stephen A.; Compton, Carolyn C.; Deluca, David S.; Peter-Demchok, Joanne; Gelfand, Ellen T.; Guan, Ping; Korzeniewski, Greg E.; Lockhart, Nicole C.; Rabiner, Chana A.; Rao, Abhi K.; Robinson, Karna L.; Roche, Nancy V.; Sawyer, Sherilyn J.; Segrè, Ayellet V.; Shive, Charles E.; Smith, Anna M.; Sobin, Leslie H.; Undale, Anita H.; Valentino, Kimberly M.; Vaught, Jim; Young, Taylor R.; Moore, Helen M.; Barker, Laura; Basile, Margaret; Battle, Alexis; Boyer, Joy; Bradbury, Debra; Bridge, Jason P.; Brown, Amanda; Burges, Robin; Choi, Christopher; Colantuoni, Deborah; Cox, Nancy; Dermitzakis, Emmanouil T.; Derr, Leslie K.; Dinsmore, Michael J.; Erickson, Kenyon; Fleming, Johnelle; Flutre, Timothée; Foster, Barbara A.; Gamazon, Eric R.; Getz, Gad; Gillard, Bryan M.; Guigo, Roderic; Hambright, Kenneth W.; Hariharan, Pushpa; Hasz, Rick; Im, Hae K.; Jewell, Scott; Karasik, Ellen; Kellis, Manolis; Kheradpour, Pouya; Koester, Susan; Koller, Daphne; Konkashbaev, Anuar; Lappalainen, Tuuli; Little, Roger; Liu, Jun; Lo, Edmund; Lonsdale, John T.; Lu, Chunrong; MacArthur, Daniel G.; Magazine, Harold; Maller, Julian B.; Marcus, Yvonne; Mash, Deborah C.; McCarthy, Mark I.; McLean, Jeffrey; Mestichelli, Bernadette; Miklos, Mark; Monlong, Jean; Mosavel, Magboeba; Moser, Michael T.; Mostafavi, Sara; Nicolae, Dan L.; Pritchard, Jonathan; Qi, Liqun; Ramsey, Kimberly; Rivas, Manuel A.; Robles, Barnaby E.; Rohrer, Daniel C.; Salvatore, Mike; Sammeth, Michael; Seleski, John; Shad, Saboor; Siminoff, Laura A.; Stephens, Matthew; Struewing, Jeff; Sullivan, Timothy; Sullivan, Susan; Syron, John; Tabor, David; Taherian, Mehran; Tejada, Jorge; Temple, Gary F.; Thomas, Jeffrey A.; Thomson, Alexander W.; Tidwell, Denee; Traino, Heather M.; Tu, Zhidong; Valley, Dana R.; Volpi, Simona; Walters, Gary D.; Ward, Lucas D.; Wen, Xiaoquan; Winckler, Wendy; Wu, Shenpei; Zhu, Jun

    2015-01-01

    The Genotype-Tissue Expression (GTEx) project, sponsored by the NIH Common Fund, was established to study the correlation between human genetic variation and tissue-specific gene expression in non-diseased individuals. A significant challenge was the collection of high-quality biospecimens for

  5. High quality data: An evaluation of AIM data quality and data quality procedures

    Science.gov (United States)

    The goal of every monitoring program is to collect high-quality data which can then be used to provide information to decision makers. The Bureau of Land Management (BLM) Assessment, Inventory, and Monitoring (AIM) program is one such data set which provides rangeland status, condition, and trend in...

  6. Timing of high-quality child care and cognitive, language, and preacademic development.

    Science.gov (United States)

    Li, Weilin; Farkas, George; Duncan, Greg J; Burchinal, Margaret R; Vandell, Deborah Lowe

    2013-08-01

    The effects of high- versus low-quality child care during 2 developmental periods (infant-toddlerhood and preschool) were examined using data from the National Institute of Child Health and Human Development Study of Early Child Care. Propensity score matching was used to account for differences in families who used different combinations of child care quality during the 2 developmental periods. Findings indicated that cognitive, language, and preacademic skills prior to school entry were highest among children who experienced high-quality care in both the infant-toddler and preschool periods, somewhat lower among children who experienced high-quality child care during only 1 of these periods, and lowest among children who experienced low-quality care during both periods. Irrespective of the care received during infancy-toddlerhood, high-quality preschool care was related to better language and preacademic outcomes at the end of the preschool period; high-quality infant-toddler care, irrespective of preschool care, was related to better memory skills at the end of the preschool period. (PsycINFO Database Record (c) 2013 APA, all rights reserved).

  7. From journal to headline: the accuracy of climate science news in Danish high quality newspapers

    DEFF Research Database (Denmark)

    Vestergård, Gunver Lystbæk

    2011-01-01

    analysis to examine the accuracy of Danish high quality newspapers in quoting scientific publications from 1997 to 2009. Out of 88 articles, 46 contained inaccuracies though the majority was found to be insignificant and random. The study concludes that Danish broadsheet newspapers are ‘moderately...

  8. Dare to share? How people share high-quality knowledge in online communities

    NARCIS (Netherlands)

    Rotundo, Enrico; Blank, M.; Moser, C.; Leopold, H.

    The Internet has fundamentally changed how work gets done in the 21st century. For example, people increasingly spend time on the Internet where they share and develop knowledge in online communities. Yet, little is known about how high-quality knowledge comes about in these communities. This is

  9. Emblems of Quality in Higher Education. Developing and Sustaining High-Quality Programs.

    Science.gov (United States)

    Haworth, Jennifer Grant; Conrad, Clifton F.

    This book proposes an "engagement" theory of program quality to evaluate and improve higher education programs at all degree levels. Based on interviews with 781 participants in a national study of Masters degree programs, it focuses on the interactive roles of students, faculty, and administrators in developing high-quality programs…

  10. Exome sequencing generates high quality data in non-target regions

    Directory of Open Access Journals (Sweden)

    Guo Yan

    2012-05-01

    Full Text Available Abstract Background Exome sequencing using next-generation sequencing technologies is a cost efficient approach to selectively sequencing coding regions of human genome for detection of disease variants. A significant amount of DNA fragments from the capture process fall outside target regions, and sequence data for positions outside target regions have been mostly ignored after alignment. Result We performed whole exome sequencing on 22 subjects using Agilent SureSelect capture reagent and 6 subjects using Illumina TrueSeq capture reagent. We also downloaded sequencing data for 6 subjects from the 1000 Genomes Project Pilot 3 study. Using these data, we examined the quality of SNPs detected outside target regions by computing consistency rate with genotypes obtained from SNP chips or the Hapmap database, transition-transversion (Ti/Tv ratio, and percentage of SNPs inside dbSNP. For all three platforms, we obtained high-quality SNPs outside target regions, and some far from target regions. In our Agilent SureSelect data, we obtained 84,049 high-quality SNPs outside target regions compared to 65,231 SNPs inside target regions (a 129% increase. For our Illumina TrueSeq data, we obtained 222,171 high-quality SNPs outside target regions compared to 95,818 SNPs inside target regions (a 232% increase. For the data from the 1000 Genomes Project, we obtained 7,139 high-quality SNPs outside target regions compared to 1,548 SNPs inside target regions (a 461% increase. Conclusions These results demonstrate that a significant amount of high quality genotypes outside target regions can be obtained from exome sequencing data. These data should not be ignored in genetic epidemiology studies.

  11. A Narrative Review of High-Quality Literature on the Effects of Resident Duty Hours Reforms.

    Science.gov (United States)

    Lin, Henry; Lin, Emery; Auditore, Stephanie; Fanning, Jon

    2016-01-01

    To summarize current high-quality studies evaluating the effect and efficacy of resident duty hours reforms (DHRs) on patient safety and resident education and well-being. The authors searched PubMed and Medline in August 2012 and again in May 2013 for literature (1987-2013) about the effects of DHRs. They assessed the quality of articles using the Medical Education Research Study Quality Instrument (MERSQI) scoring system. They considered randomized controlled trials (RCTs), partial RCTs, and all studies with a MERSQI score ≥ 14 to be "high-quality" methodology studies. A total of 72 high-quality studies met inclusion criteria. Most studies showed no change or slight improvement in mortality and complication rates after DHRs. Resident well-being was generally improved, but there was a perceived negative impact on education (knowledge acquisition, skills, and cognitive performance) following DHRs. Eleven high-quality studies assessed the impact of DHR interventions; all reported a neutral to positive impact. Seven high-quality studies assessed costs associated with DHRs and demonstrated an increase in hospital costs. The results of most studies that allow enough time for DHR interventions to take effect suggest a benefit to patient safety and resident well-being, but the effect on the quality of training remains unknown. Additional methodologically sound studies on the impact of DHRs are necessary. Priorities for future research include approaches to optimizing education and clinical proficiency and studies on the effect of intervention strategies on both education and patient safety. Such studies will provide additional information to help improve duty hours policies.

  12. Providing high-quality care in primary care settings: how to make trade-offs.

    Science.gov (United States)

    Beaulieu, Marie-Dominique; Geneau, Robert; Del Grande, Claudio; Denis, Jean-Louis; Hudon, Eveline; Haggerty, Jeannie L; Bonin, Lucie; Duplain, Réjean; Goudreau, Johanne; Hogg, William

    2014-05-01

    To gain a deeper understanding of how primary care (PC) practices belonging to different models manage resources to provide high-quality care. Multiple-case study embedded in a cross-sectional study of a random sample of 37 practices. Three regions of Quebec. Health care professionals and staff of 5 PC practices. Five cases showing above-average results on quality-of-care indicators were purposefully selected to contrast on region, practice size, and PC model. Data were collected using an organizational questionnaire; the Team Climate Inventory, which was completed by health care professionals and staff; and 33 individual interviews. Detailed case histories were written and thematic analysis was performed. The core common feature of these practices was their ongoing effort to make trade-offs to deliver services that met their vision of high-quality care. These compromises involved the same 3 areas, but to varying degrees depending on clinic characteristics: developing a shared vision of high-quality care; aligning resource use with that vision; and balancing professional aspirations and population needs. The leadership of the physician lead was crucial. The external environment was perceived as a source of pressure and dilemmas rather than as a source of support in these matters. Irrespective of their models, PC practices' pursuit of high-quality care is based on a vision in which accessibility is a key component, balanced by appropriate management of available resources and of external environment expectations. Current PC reforms often create tensions rather than support PC practices in their pursuit of high-quality care. Copyright© the College of Family Physicians of Canada.

  13. Human corpus luteum: presence of epidermal growth factor receptors and binding characteristics

    International Nuclear Information System (INIS)

    Ayyagari, R.R.; Khan-Dawood, F.S.

    1987-01-01

    Epidermal growth factor receptors are present in many reproductive tissues but have not been demonstrated in the human corpus luteum. To determine the presence of epidermal growth factor receptors and its binding characteristics, we carried out studies on the plasma cell membrane fraction of seven human corpora lutea (days 16 to 25) of the menstrual cycle. Specific epidermal growth factor receptors were present in human corpus luteum. Insulin, nerve growth factor, and human chorionic gonadotropin did not competitively displace epidermal growth factor binding. The optimal conditions for corpus luteum-epidermal growth factor receptor binding were found to be incubation for 2 hours at 4 degrees C with 500 micrograms plasma membrane protein and 140 femtomol 125 I-epidermal growth factor per incubate. The number (mean +/- SEM) of epidermal growth factor binding sites was 12.34 +/- 2.99 X 10(-19) mol/micrograms protein; the dissociation constant was 2.26 +/- 0.56 X 10(-9) mol/L; the association constant was 0.59 +/- 0.12 X 10(9) L/mol. In two regressing corpora lutea obtained on days 2 and 3 of the menstrual cycle, there was no detectable specific epidermal growth factor receptor binding activity. Similarly no epidermal growth factor receptor binding activity could be detected in ovarian stromal tissue. Our findings demonstrate that specific receptors for epidermal growth factor are present in the human corpus luteum. The physiologic significance of epidermal growth factor receptors in human corpus luteum is unknown, but epidermal growth factor may be involved in intragonadal regulation of luteal function

  14. Extracellular RNA Communication (ExRNA)

    Data.gov (United States)

    Federal Laboratory Consortium — Until recently, scientists believed RNA worked mostly inside the cell that produced it. Some types of RNA help translate genes into proteins that are necessary for...

  15. Delivering high quality hip fracture rehabilitation: the perspective of occupational and physical therapy practitioners.

    Science.gov (United States)

    Leland, Natalie E; Lepore, Michael; Wong, Carin; Chang, Sun Hwa; Freeman, Lynn; Crum, Karen; Gillies, Heather; Nash, Paul

    2018-03-01

    The majority of post-acute hip fracture rehabilitation in the US is delivered in skilled nursing facilities (SNFs). Currently, there are limited guidelines that equip occupational and physical therapy practitioners with a summary of what constitutes evidence-based high quality rehabilitation. Thus, this study aimed to identify rehabilitation practitioners' perspectives on the practices that constitute high quality hip fracture rehabilitation. Focus groups were conducted with 99 occupational and physical therapy practitioners working in SNFs in southern California. Purposive sampling of facilities was conducted to capture variation in key characteristics known to impact care delivery for this patient population (e.g., financial resources, staffing, and patient case-mix). Questions aimed to elicit practitioners' perspectives on high quality hip fracture rehabilitation practices. Each session was audio-recorded and transcribed. Data were systematically analyzed using a modified grounded theory approach. Seven themes emerged: objectives of care; first 72 h; positioning, pain, and precautions; use of standardized assessments; episode of care practices; facilitating insight into progress; and interdisciplinary collaboration. Clinical guidelines are critical tools to facilitate clinical decision-making and achieve desired patient outcomes. The findings of this study highlight the practitioners' perspective on what constitutes high quality hip fracture rehabilitation. This work provides critical information to advance the development of stakeholder-driven rehabilitation clinical guidelines. Future research is needed to verify the findings from other stakeholders (e.g., patients), ensure the alignment of our findings with current evidence, and develop measures for evaluating their delivery and relationship to desired outcomes. Implications for Rehabilitation This study highlights occupational and physiotherapy therapy practitioners' perspectives on the cumulative best

  16. Renal content and output of epidermal growth factor in long-term adrenergic agonist-treated rats

    DEFF Research Database (Denmark)

    Thulesen, J; Nexø, Ebba; Poulsen, Steen Seier

    2000-01-01

    This study investigates the renal and urinary levels of epidermal growth factor (EGF) in rats under long-term treatment with alpha- or beta-adrenergic agonists. Urine samples were obtained on days 7, 14 and 21, and renal tissue samples on day 21. EGF was quantified by ELISA and tissue sections were...... material in the distal tubules. Concomitantly, reduced levels of EGF and EGF mRNA were observed, and also the urinary levels of EGF were reduced. Together, these observations indicate alpha-adrenergic treatment to affect the distal tubules. Treatment with the beta-adrenergic agonist did not change...... fractional kidney weight, but initially the urinary excretion of EGF was reduced. The data add further evidence to the suggestion that activity of the sympathetic nervous system influences renal homeostasis of EGF, either directly or indirectly through renal histopathological changes....

  17. Radiologic Findings of Epidermal Cysts in the Trunk

    International Nuclear Information System (INIS)

    Kim, Myung Hyun; Chung, Jae Joon; Park, Kyoung Seuk; Park, Su Mi

    2005-01-01

    To evaluate the ultrasonographic (US) or computer tomography (CT) findings of surgically proven epidermal cysts in the trunk, and to compare the echogenicity of cysts with internal contents. Forty-five patients were retrospectively evaluated. US and CT findings of epidermal cysts were assessed in regard to location, size, shape, number, echogenicity, posterior sound enhancement, internal density, septa, mural nodule and calcification, perilesional infiltration, contrast enhancement, and internal contents. All 45 patients (M:F=29:16; US in 26, CT in 19) had only one cyst, and they were located in the buttocks (n=19), back (n=13), inguinal (n=4), posterior neck (n=3), perineum (n=2), abdominal wall (n=2), presternal (n=1), and axilla (n=1). Of 26 patients who underwent US, there were 8 cases of homogeneously hypoechoic mass (30.8%), 8 of inhomogeneously hypoechoic mass (30.8%), 7 of homogeneously hypoechoic mass with internal hypoechoic lines and echogenic spots (26.9%) and 3 of homogeneously hypoechoic mass with internal echogenic spots (11.5%). Posterior sound enhancement was noted in 21 patients (80.8%). Of 19 patients who underwent CT, there were 14 cases of simple cyst (73.7%) and 5 of abscess-like lesion (26.3%). Overlying skin thickening (n=13), contrast enhancement of cystic wall (n=11), perilesional infiltration (n=7), and internal septa (n=6) were demonstrated. The internal contents of the cysts were keratinous (n=27, 60.0%) or greasy (n=15, 33.3%) material. There was no statistical significance between the echogenicity of the cysts and the internal contents (p > 0.2). Epidermal cysts showed homogeneous or inhomogeneous hypoechoic mass with posterior sound enhancement on US. There was no relationship between the echogenicity of the cysts and the internal contents. In the case of ruptured cyst, an abscess-like lesion with wall enhancement and perilesional infiltration was noted on CT scan

  18. Exudative epidermitis in pigs caused by toxigenic Staphylococcus chromogenes.

    Science.gov (United States)

    Andresen, Lars Ole; Ahrens, Peter; Daugaard, Lise; Bille-Hansen, Vivi

    2005-02-25

    Staphylococcus chromogenes is closely related to Staphylococcus hyicus, which is recognised as the causative agent of exudative epidermitis (EE) in pigs. S. chromogenes is part of the normal skin flora of pigs, cattle and poultry and has so far been considered non-pathogenic to pigs. A strain of S. chromogenes producing exfoliative toxin type B, ExhB, was identified by the use of a multiplex PCR specific for the exfoliative toxins from S. hyicus. The exfoliative toxin from S. chromogenes reacted in immunoblot analysis with polyclonal and monoclonal antibodies specific to ExhB from S. hyicus and had an apparent molecular weight of 30 kDa. Sequencing the gene encoding the exfoliative toxin from S. chromogenes revealed that the molecular weight of the toxin with the signal peptide and the mature toxin was 30,553 and 26,694 Da, respectively. Comparison of the exhB genes from S. chromogenes strain VA654 and S. hyicus strain 1289D-88 showed differences in seven base pairs of the DNA sequences and in two amino acid residues in the deduced amino acid sequences. Pigs were experimentally inoculated with S. chromogenes strain VA654. By clinical observations and histopathological evaluation of the skin alterations, all pigs revealed development of generalized exudative epidermitis. No toxin producing S. hyicus was isolated from the pigs and all ExhB-positive bacterial isolates were identified as S. chromogenes. This confirmed that the disease-causing agent was the inoculated S. chromogenes strain VA654. The results of this study show that S. chromogenes may cause exudative epidermitis in pigs.

  19. Marine Corps Contract Supply Model for High Quality Male Enlistment Contracts at the Recruiting Sub Station Level

    National Research Council Canada - National Science Library

    Welsh, Brian K

    2008-01-01

    .... This research develops contract production models at the Recruiting Sub Station level to estimate the effects of local economic conditions, demographics, and recruiting resources on new high quality...

  20. Expression of paired-like homeodomain transcription factor 2c (PITX2c) in epidermal keratinocytes

    International Nuclear Information System (INIS)

    Shi, Ge; Sohn, Kyung-Cheol; Choi, Tae-Young; Choi, Dae-Kyoung; Lee, Sang-Sin; Ou, Bai-sheng; Kim, Sooil; Lee, Young Ho; Yoon, Tae-Jin; Kim, Seong-Jin; Lee, Young; Seo, Young-Joon; Lee, Jeung-Hoon; Kim, Chang Deok

    2010-01-01

    Paired-like homeodomain transcription factor 2 (PITX2) has been implicated as one of the genes responsible for Rieger syndrome. It has been also shown to play a central role during development. In this study, we investigated the functional role of PITX2 in keratinocyte differentiation. RT-PCR analysis showed that PITX2c isoform was predominantly expressed in a differentiation-dependent manner. Consistent with, immunohistochemical staining showed that PITX2 expression was increased in the upper layer of epidermis. When PITX2c was overexpressed in cultured keratinocytes by a recombinant adenovirus, the differentiation markers such as involucrin and loricrin were significantly increased at both mRNA and protein levels. In addition, PITX2c overexpression led to the decrease of cell growth, concomitantly with the upregulation of cell cycle-related genes p21. To investigate the effect of PITX2c in vivo, we microinjected PITX2c expression vector into zebrafish embryo. Interestingly, overexpression of PITX2c in zebrafish embryo led to the formation of horn-like structure and thickening of epidermis, together with the increase of keratin 8 (K8) expression. These results suggest that PITX2c has a role in proliferation and differentiation of epidermal keratinocytes.

  1. Expression of paired-like homeodomain transcription factor 2c (PITX2c) in epidermal keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Shi, Ge [Department of Dermatology, School of Medicine, Chungnam National University, Daejeon, 301-747 (Korea, Republic of); Research Institute for Medical Sciences, School of Medicine, Chungnam National University, Daejeon, 301-747 (Korea, Republic of); Department of Dermatology, The First Affiliated Hospital, Guangxi Traditional Chinese Medical University, Guangxi, Nanning, 530023 (China); Sohn, Kyung-Cheol; Choi, Tae-Young; Choi, Dae-Kyoung; Lee, Sang-Sin [Department of Dermatology, School of Medicine, Chungnam National University, Daejeon, 301-747 (Korea, Republic of); Research Institute for Medical Sciences, School of Medicine, Chungnam National University, Daejeon, 301-747 (Korea, Republic of); Ou, Bai-sheng [Department of Dermatology, The First Affiliated Hospital, Guangxi Traditional Chinese Medical University, Guangxi, Nanning, 530023 (China); Kim, Sooil; Lee, Young Ho [Department of Anatomy, School of Medicine, Chungnam National University, Daejeon, 301-747 (Korea, Republic of); Yoon, Tae-Jin [Department of Dermatology, School of Medicine, Gyeongsang National University, Jinju, 660-702 (Korea, Republic of); Institute of Health Sciences, School of Medicine, Gyeongsang National University, Jinju, 660-702 (Korea, Republic of); Kim, Seong-Jin [Department of Dermatology, Chonnam National University Medical School, Gwangju, 501-757 (Korea, Republic of); Lee, Young; Seo, Young-Joon; Lee, Jeung-Hoon [Department of Dermatology, School of Medicine, Chungnam National University, Daejeon, 301-747 (Korea, Republic of); Research Institute for Medical Sciences, School of Medicine, Chungnam National University, Daejeon, 301-747 (Korea, Republic of); Kim, Chang Deok, E-mail: cdkimd@cnu.ac.kr [Department of Dermatology, School of Medicine, Chungnam National University, Daejeon, 301-747 (Korea, Republic of); Research Institute for Medical Sciences, School of Medicine, Chungnam National University, Daejeon, 301-747 (Korea, Republic of)

    2010-11-15

    Paired-like homeodomain transcription factor 2 (PITX2) has been implicated as one of the genes responsible for Rieger syndrome. It has been also shown to play a central role during development. In this study, we investigated the functional role of PITX2 in keratinocyte differentiation. RT-PCR analysis showed that PITX2c isoform was predominantly expressed in a differentiation-dependent manner. Consistent with, immunohistochemical staining showed that PITX2 expression was increased in the upper layer of epidermis. When PITX2c was overexpressed in cultured keratinocytes by a recombinant adenovirus, the differentiation markers such as involucrin and loricrin were significantly increased at both mRNA and protein levels. In addition, PITX2c overexpression led to the decrease of cell growth, concomitantly with the upregulation of cell cycle-related genes p21. To investigate the effect of PITX2c in vivo, we microinjected PITX2c expression vector into zebrafish embryo. Interestingly, overexpression of PITX2c in zebrafish embryo led to the formation of horn-like structure and thickening of epidermis, together with the increase of keratin 8 (K8) expression. These results suggest that PITX2c has a role in proliferation and differentiation of epidermal keratinocytes.

  2. Expression of the epidermal growth factor receptor in human small cell lung cancer cell lines

    DEFF Research Database (Denmark)

    Damstrup, L; Rygaard, K; Spang-Thomsen, M

    1992-01-01

    of EGF receptor mRNA in all 10 cell lines that were found to be EGF receptor-positive and in one cell line that was found to be EGF receptor-negative in the radioreceptor assay and affinity labeling. Our results provide, for the first time, evidence that a large proportion of a broad panel of small cell......Epidermal growth factor (EGF) receptor expression was evaluated in a panel of 21 small cell lung cancer cell lines with radioreceptor assay, affinity labeling, and Northern blotting. We found high-affinity receptors to be expressed in 10 cell lines. Scatchard analysis of the binding data...... demonstrated that the cells bound between 3 and 52 fmol/mg protein with a KD ranging from 0.5 x 10(-10) to 2.7 x 10(-10) M. EGF binding to the receptor was confirmed by affinity-labeling EGF to the EGF receptor. The cross-linked complex had a M(r) of 170,000-180,000. Northern blotting showed the expression...

  3. Toxic epidermal necrolysis and Stevens-Johnson syndrome

    Directory of Open Access Journals (Sweden)

    French Lars E

    2010-12-01

    Full Text Available Abstract Toxic epidermal necrolysis (TEN and Stevens Johnson Syndrome (SJS are severe adverse cutaneous drug reactions that predominantly involve the skin and mucous membranes. Both are rare, with TEN and SJS affecting approximately 1or 2/1,000,000 annually, and are considered medical emergencies as they are potentially fatal. They are characterized by mucocutaneous tenderness and typically hemorrhagic erosions, erythema and more or less severe epidermal detachment presenting as blisters and areas of denuded skin. Currently, TEN and SJS are considered to be two ends of a spectrum of severe epidermolytic adverse cutaneous drug reactions, differing only by their extent of skin detachment. Drugs are assumed or identified as the main cause of SJS/TEN in most cases, but Mycoplasma pneumoniae and Herpes simplex virus infections are well documented causes alongside rare cases in which the aetiology remains unknown. Several drugs are at "high" risk of inducing TEN/SJS including: Allopurinol, Trimethoprim-sulfamethoxazole and other sulfonamide-antibiotics, aminopenicillins, cephalosporins, quinolones, carbamazepine, phenytoin, phenobarbital and NSAID's of the oxicam-type. Genetic susceptibility to SJS and TEN is likely as exemplified by the strong association observed in Han Chinese between a genetic marker, the human leukocyte antigen HLA-B*1502, and SJS induced by carbamazepine. Diagnosis relies mainly on clinical signs together with the histological analysis of a skin biopsy showing typical full-thickness epidermal necrolysis due to extensive keratinocyte apoptosis. Differential diagnosis includes linear IgA dermatosis and paraneoplastic pemphigus, pemphigus vulgaris and bullous pemphigoid, acute generalized exanthematous pustulosis (AGEP, disseminated fixed bullous drug eruption and staphyloccocal scalded skin syndrome (SSSS. Due to the high risk of mortality, management of patients with SJS/TEN requires rapid diagnosis, evaluation of the prognosis

  4. Renal origin of rat urinary epidermal growth factor

    DEFF Research Database (Denmark)

    Nexø, Ebba; Poulsen, Steen Seier

    1984-01-01

    The origin of rat urinary epidermal growth factor (EGF) has been investigated. Unilateral nephrectomy decreased the concentration, total output of EGF and EGF/creatinine ratio by approximately 50%, while the output of creatinine was unchanged. Removal of the submandibular glands and duodenal...... Brunner's glands, organs known to produce EGF, had no influence on the output of EGF in urine. Renal clearance of EGF exceeded that of creatinine, and after bilateral nephrectomy or bilateral ligation of the ureters, the concentration of creatinine in serum increased, while the concentration of EGF...

  5. Isolation and In Vitro Characterization of Epidermal Stem Cells

    DEFF Research Database (Denmark)

    Moestrup, Kasper S; Andersen, Marianne Stemann; Jensen, Kim Bak

    2017-01-01

    flow cytometry. Using markers that define the spatial origin of epidermal cells, it is possible to interrogate the specific characteristics of subpopulations of cells based on their in vivo credentials. Here, we describe how to isolate, culture, and characterize keratinocytes from murine back and tail......Colony-forming assays represent prospective methods, where cells isolated from enzymatically dissociated tissues or from tissue cultures are assessed for their proliferative capacity in vitro. Complex tissues such as the epithelial component of the skin (the epidermis) are characterized...

  6. Expression of epidermal growth factor receptors in human endometrial carcinoma

    DEFF Research Database (Denmark)

    Nyholm, H C; Nielsen, Anette Lynge; Ottesen, B

    1993-01-01

    Little data exist on the expression of epidermal growth factor receptors (EGF-Rs) in human endometrial cancer. EGF-R status was studied in 65 patients with endometrial carcinomas and in 26 women with nonmalignant postmenopausal endometria, either inactive/atrophic endometrium or adenomatous...... hyperplasia. EGF-R was identified on frozen tissue sections by means of an indirect immunoperoxidase technique with a monoclonal antibody against the external domain of the EGF-R. Seventy-one percent of the carcinomas expressed positive EGF-R immunoreactivity. In general, staining was most prominent...

  7. Acyl-CoA binding protein and epidermal barrier function

    DEFF Research Database (Denmark)

    Bloksgaard, Maria; Neess, Ditte; Færgeman, Nils J

    2014-01-01

    The acyl-CoA binding protein (ACBP) is a 10kDa intracellular protein expressed in all eukaryotic species and mammalian tissues investigated. It binds acyl-CoA esters with high specificity and affinity and is thought to act as an intracellular transporter of acyl-CoA esters between different...... includes tousled and greasy fur, development of alopecia and scaling of the skin with age. Furthermore, epidermal barrier function is compromised causing a ~50% increase in transepidermal water loss relative to that of wild type mice. Lipidomic analyses indicate that this is due to significantly reduced...

  8. Radiosensitivity of normal human epidermal cells in culture

    International Nuclear Information System (INIS)

    Dover, R.; Potten, C.S.

    1983-01-01

    Using an in vitro culture system the authors have derived #betta#-radiation survival curves over a dose range 0-8 Gy for the clonogenic cells of normal human epidermis. The culture system used allows the epidermal cells to stratify and form a multi-layered sheet of keratinizing cells. The cultures appear to be a very good model for epidermis in vivo. The survival curves show a population which is apparently more sensitive than murine epidermis in vivo. It remains unclear whether this is an intrinsic difference between the species or is a consequence of the in vitro cultivation of the human cells. (author)

  9. Attempt at cloning high-quality goldfish breed 'Ranchu' by fin-cultured cell nuclear transplantation.

    Science.gov (United States)

    Tanaka, Daisuke; Takahashi, Akito; Takai, Akinori; Ohta, Hiromi; Ueno, Koichi

    2012-02-01

    The viability of ornamental fish culture relies on the maintenance of high-quality breeds. To improve the profitability of culture operations we attempted to produce cloned fish from the somatic nucleus of the high-quality Japanese goldfish (Carassius auratus auratus) breed 'Ranchu'. We transplanted the nucleus of a cultured fin-cell from an adult Ranchu into the non-enucleated egg of the original goldfish breed 'Wakin'. Of the 2323 eggs we treated, 802 underwent cleavage, 321 reached the blastula stage, and 51 reached the gastrula stage. Two of the gastrulas developed until the hatching stage. A considerable number of nuclear transplants retained only the donor nucleus. Some of these had only a 2n nucleus derived from the same donor fish. Our results provide insights into the process of somatic cell nuclear transplantation in teleosts, and the cloning of Ranchu.

  10. (-201) β-Gallium oxide substrate for high quality GaN materials

    KAUST Repository

    Roqan, Iman S.

    2015-03-13

    (-201) oriented β-Ga2O3 has the potential to be used as a transparent and conductive substrate for GaN-growth. The key advantages of Ga2O3 are its small lattice mismatches (4.7%), appropriate structural, thermal and electrical properties and a competitive price compared to other substrates. Optical characterization show that GaN layers grown on (-201) oriented β-Ga2O3 are dominated by intense bandedge emission with a high luminescence efficiency. Atomic force microscopy studies show a modest threading dislocation density of ~108 cm-2, while complementary Raman spectroscopy indicates that the GaN epilayer is of high quality with slight compressive strain. Room temperature time-findings suggest that the limitation of the photoluminescence lifetime (~500 ps) is due to nonradiative recombination arising from threading dislocation. Therefore, by optimizing the growth conditions, high quality material with significant optical efficiency can be obtained.

  11. A design technique of low cost but high quality peak stretcher

    Energy Technology Data Exchange (ETDEWEB)

    Lo, H Y; Su, C S; Hsu, J Y; Wang, L

    1981-03-01

    This paper presents the design of low cost but high quality pulse peak stretcher incorporated with a LSI of 12 bit ADC and SKD-85 microcomputer. The conflict between the capacitor high charging speed and longer holding time for realizing a high quality stretcher is discussed and solved. For a lager number of channels available in a dual ramp Wilkinson-type ADC, two-stage stretchers connected in series are designed. The first stage is a fast-discharge to keep the output stretched pulse follow-up the input quickly and the second-stage (main stretcher) is a slow-discharge to keep the transient of the circuit minimum. Both of these two peak stretchers are described and the experiment results are photographically recorded.

  12. High quality atomically thin PtSe2 films grown by molecular beam epitaxy

    Science.gov (United States)

    Yan, Mingzhe; Wang, Eryin; Zhou, Xue; Zhang, Guangqi; Zhang, Hongyun; Zhang, Kenan; Yao, Wei; Lu, Nianpeng; Yang, Shuzhen; Wu, Shilong; Yoshikawa, Tomoki; Miyamoto, Koji; Okuda, Taichi; Wu, Yang; Yu, Pu; Duan, Wenhui; Zhou, Shuyun

    2017-12-01

    Atomically thin PtSe2 films have attracted extensive research interests for potential applications in high-speed electronics, spintronics and photodetectors. Obtaining high quality thin films with large size and controlled thickness is critical. Here we report the first successful epitaxial growth of high quality PtSe2 films by molecular beam epitaxy. Atomically thin films from 1 ML to 22 ML have been grown and characterized by low-energy electron diffraction, Raman spectroscopy and x-ray photoemission spectroscopy. Moreover, a systematic thickness dependent study of the electronic structure is revealed by angle-resolved photoemission spectroscopy (ARPES), and helical spin texture is revealed by spin-ARPES. Our work provides new opportunities for growing large size single crystalline films to investigate the physical properties and potential applications of PtSe2.

  13. Recent developments in high-quality drying of vegetables, fruits, and aquatic products.

    Science.gov (United States)

    Zhang, Min; Chen, Huizhi; Mujumdar, Arun S; Tang, Juming; Miao, Song; Wang, Yuchuan

    2017-04-13

    Fresh foods like vegetables, fruits, and aquatic products have high water activity and they are highly heat-sensitive and easily degradable. Dehydration is one of the most common methods used to improve food shelf-life. However, drying methods used for food dehydration must not only be efficient and economic but also yield high-quality products based on flavor, nutrients, color, rehydration, uniformity, appearance, and texture. This paper reviews some new drying technologies developed for dehydration of vegetables, fruits, and aquatic products. These include: infrared drying, microwave drying, radio frequency drying, electrohydrodynamic drying, etc., as well as hybrid drying methods combining two or more different drying techniques. A comprehensive review of recent developments in high-quality drying of vegetables, fruits and aquatic products is presented and recommendations are made for future research.

  14. Formation of a high quality electron beam using photo cathode RF electron gun

    International Nuclear Information System (INIS)

    Washio, Masakazu

    2000-01-01

    Formation of a high quality electron beam using photo cathode RF electron gun is expected for formation of a next generation high brilliant X-ray beam and a source for electron and positron collider. And, on a field of material science, as is possible to carry out an experiment under ultra short pulse and extremely high precision in time, it collects large expectation. Recently, formation of high quality beam possible to develop for multi directions and to use by everyone in future has been able to realize. Here were explained on electron beam source, principle and component on RF electron gun, working features on RF gun, features and simulation of RF gun under operation, and some views in near future. (G.K.)

  15. Selection of process parameters for producing high quality defatted sesame flour at pilot scale.

    Science.gov (United States)

    Manikantan, M R; Sharma, Rajiv; Yadav, D N; Gupta, R K

    2015-03-01

    The present work was undertaken to study the effect of pearling duration, soaking time, steaming duration and drying temperature on the quality of sesame seeds and mechanically extracted partially defatted sesame cake. On the basis of quality attributes i.e. high protein, low crude fibre, low residual oil and low oxalic acid, the optimum process parameters were selected. The combination of 20 min of pearling duration, 15 min of soaking, 15 min of steaming at 100 kPa pressure and drying at 50 °C yielded high quality partially defatted protein rich sesame flour as compared to untreated defatted sesame flour. The developed high quality partially defatted protein rich sesame flour may be used in various food applications as a vital ingredient to increase the nutritional significance of the prepared foodstuffs.

  16. The Barriers to High-Quality Inpatient Pain Management: A Qualitative Study.

    Science.gov (United States)

    Lin, Richard J; Reid, M Carrington; Liu, Lydia L; Chused, Amy E; Evans, Arthur T

    2015-09-01

    The current literature suggests deficiencies in the quality of acute pain management among general medical inpatients. The aim of this qualitative study is to identify potential barriers to high-quality acute pain management among general medical inpatients at an urban academic medical center during a 2-year period. Data are collected using retrospective chart reviews, survey questionnaires, and semistructured, open-ended interviews of 40 general medical inpatients who have experienced pain during their hospitalization. Our results confirm high prevalence and disabling impacts of pain and significant patient- and provider-related barriers to high-quality acute pain management. We also identify unique system-related barriers such as time delay and pain management culture. Efforts to improve the pain management experience of general medical inpatients will need to address all these barriers. © The Author(s) 2014.

  17. High quality junctions by interpenetration of vapor liquid solid grown nanostructures for microchip integration

    Energy Technology Data Exchange (ETDEWEB)

    Jebril, Seid; Kuhlmann, Hanna; Adelung, Rainer [Funktionale Nanomaterialien, CAU Kiel (Germany); Mueller, Sven [Nanowires and Thin Films, II. Physikalisches Institut, Goettingen (Germany); Ronning, Carsten [Institute for Solid State Physics, Universitaet Jena (Germany); Kienle, Lorenz [Synthese und Realstruktur, CAU Kiel (Germany); Duppel, Viola [MPI fuer Festkoerperforschung, Stuttgart (Germany)

    2009-07-01

    The usability of nanostructures in electrical devices like gas sensors depends critically on the ability to form high quality contacts and junctions. For the fabrication of various nanostructures, vapor-liquid-solid (VLS) growth is a wide spread and very efficient technique. However, forming contacts with the VLS grown structures to utilize them in a device is still tedious, because either the substrate has to be epitaxial to the VLS material or a manual alignment is necessary. Here we demonstrate the contact formation by simply using the ability of individual crystals to interpenetrate each other during the straight forward VLS growth. This allows growing VLS structures directly on two neighboring gold circuit paths of a microchip; bridges over predefined gaps will be formed. Moreover, TEM investigations confirm the high quality of the crystalline junctions that allow demonstrations as UV and hydrogen-sensor. The VLS devices are compared with conventional produced.

  18. Epidermal growth factor receptor inhibition by anti-CD147 therapy in cutaneous squamous cell carcinoma.

    Science.gov (United States)

    Frederick, John W; Sweeny, Larissa; Hartman, Yolanda; Zhou, Tong; Rosenthal, Eben L

    2016-02-01

    Advanced cutaneous squamous cell carcinoma (SCC) is an uncommon and aggressive malignancy. As a result, there is limited understanding of its biology and pathogenesis. CD147 and epidermal growth factor receptor (EGFR) have been identified as oncologically important targets, but their relationship remains undefined in cutaneous SCC. Multiple cutaneous SCC cell lines (Colo-16, SRB-1, and SRB-12), were treated in vitro with a range of chimeric anti-CD147 monoclonal antibody (mAb) (0, 50, 100, and 200 µg/mL) or transfected with a small interfering RNA against CD147 (SiCD147). Cell proliferation, migration (scratch wound healing assay), and protein expression was then assessed. In vivo, Colo-16 flank xenografts were treated anti-CD147 mAb (150 µg i.p. triweekly). After treatment with anti-CD147 (200 µg/mL), there was a significant decrease in proliferation for all cell lines relative to controls (p CD147 (200 µg/mL) resulted in decreased cell migration for all cell lines, with an average of 43% reduction in closure compared to controls (p CD147 antibody therapy and siRNA mediated reduction in CD147 expression were both found to decrease protein expression of EGFR, which correlated with a reduction in downstream total and phosphorylated protein kinase B (pAKT). Tumor growth in vivo was reduced for both the anti-CD147 treatment group and the SiCD147 group relative to controls. Inhibition and downregulation of CD147 in cutaneous SCC resulted in suppression of the malignant phenotype in vitro and in vivo, which may be mediated in part by an alteration in EGFR expression. As a result, CD147 may serve as a potential therapeutic target for advanced cutaneous SCC. © 2014 Wiley Periodicals, Inc.

  19. Production of high-quality polydisperse construction mixes for additive 3D technologies.

    Science.gov (United States)

    Gerasimov, M. D.; Brazhnik, Yu V.; Gorshkov, P. S.; Latyshev, S. S.

    2018-03-01

    The paper describes a new design of a mixer allowing production of high quality polydisperse powders, used in additive 3D technologies. A new principle of dry powder particle mixing is considered, implementing a possibility of a close-to-ideal distribution of such particles in common space. A mathematical model of the mixer is presented, allowing evaluating quality indicators of the produced mixture. Experimental results are shown and rational values of process parameters of the mixer are obtained.

  20. Project outline of high quality electron beam generation at Waseda University

    Energy Technology Data Exchange (ETDEWEB)

    Washio, M.; Hama, Y.; Kashiwagi, S.; Kuroda, R.; Kobuki, T. [Waseda Univ., Advanced Research Institute for Science and Engineering, Shinjuku, Tokyo (Japan); Hirose, T. [Tokyo Metropolitan Univ. (Japan). Dept. of Physics

    2000-03-01

    High quality electron beam generation project has been started at Waseda University under the grant of Ministry of Education, named High-Tech Research Center Project. In the project, we will install a laser photo-cathode RF Gun system with 1.6 accelerating structure cells of s-band and a stabilized RF power source. This RF Gun is expected to produce single electron bunch up to 1 or 2nC with around 10ps pulse duration. (author)

  1. Project outline of high quality electron beam generation at Waseda University

    International Nuclear Information System (INIS)

    Washio, M.; Hama, Y.; Kashiwagi, S.; Kuroda, R.; Kobuki, T.; Hirose, T.

    2000-01-01

    High quality electron beam generation project has been started at Waseda University under the grant of Ministry of Education, named High-Tech Research Center Project. In the project, we will install a laser photo-cathode RF Gun system with 1.6 accelerating structure cells of s-band and a stabilized RF power source. This RF Gun is expected to produce single electron bunch up to 1 or 2nC with around 10ps pulse duration. (author)

  2. Fabrication of high quality GaN nanopillar arrays by dry and wet chemical etching

    OpenAIRE

    Paramanik, Dipak; Motayed, Abhishek; King, Matthew; Ha, Jong-Yoon; Kryluk, Sergi; Davydov, Albert V.; Talin, Alec

    2013-01-01

    We study strain relaxation and surface damage of GaN nanopillar arrays fabricated using inductively coupled plasma (ICP) etching and post etch wet chemical treatment. We controlled the shape and surface damage of such nanopillar structures through selection of etching parameters. We compared different substrate temperatures and different chlorine-based etch chemistries to fabricate high quality GaN nanopillars. Room temperature photoluminescence and Raman scattering measurements were carried ...

  3. Teaching Surgical Procedures with Movies: Tips for High-quality Video Clips

    OpenAIRE

    Jacquemart, Mathieu; Bouletreau, Pierre; Breton, Pierre; Mojallal, Ali; Sigaux, Nicolas

    2016-01-01

    Summary: Video must now be considered as a precious tool for learning surgery. However, the medium does present production challenges, and currently, quality movies are not always accessible. We developed a series of 7 surgical videos and made them available on a publicly accessible internet website. Our videos have been viewed by thousands of people worldwide. High-quality educational movies must respect strategic and technical points to be reliable.

  4. Teaching Surgical Procedures with Movies: Tips for High-quality Video Clips.

    Science.gov (United States)

    Jacquemart, Mathieu; Bouletreau, Pierre; Breton, Pierre; Mojallal, Ali; Sigaux, Nicolas

    2016-09-01

    Video must now be considered as a precious tool for learning surgery. However, the medium does present production challenges, and currently, quality movies are not always accessible. We developed a series of 7 surgical videos and made them available on a publicly accessible internet website. Our videos have been viewed by thousands of people worldwide. High-quality educational movies must respect strategic and technical points to be reliable.

  5. Characteristics of primary care practices associated with high quality of care.

    Science.gov (United States)

    Beaulieu, Marie-Dominique; Haggerty, Jeannie; Tousignant, Pierre; Barnsley, Janet; Hogg, William; Geneau, Robert; Hudon, Éveline; Duplain, Réjean; Denis, Jean-Louis; Bonin, Lucie; Del Grande, Claudio; Dragieva, Natalyia

    2013-09-03

    No primary practice care model has been shown to be superior in achieving high-quality primary care. We aimed to identify the organizational characteristics of primary care practices that provide high-quality primary care. We performed a cross-sectional observational study involving a stratified random sample of 37 primary care practices from 3 regions of Quebec. We recruited 1457 patients who had 1 of 2 chronic care conditions or 1 of 6 episodic care conditions. The main outcome was the overall technical quality score. We measured organizational characteristics by use of a validated questionnaire and the Team Climate Inventory. Statistical analyses were based on multilevel regression modelling. The following characteristics were strongly associated with overall technical quality of care score: physician remuneration method (27.0; 95% confidence interval [CI] 19.0-35.0), extent of sharing of administrative resources (7.6; 95% CI 0.8-14.4), presence of allied health professionals (15.3; 95% CI 5.4-25.2) and/or specialist physicians (19.6; 95% CI 8.3-30.9), the presence of mechanisms for maintaining or evaluating competence (7.7; 95% CI 3.0-12.4) and average organizational access to the practice (4.9; 95% CI 2.6-7.2). The number of physicians (1.2; 95% CI 0.6-1.8) and the average Team Climate Inventory score (1.3; 95% CI 0.1-2.5) were modestly associated with high-quality care. We identified a common set of organizational characteristics associated with high-quality primary care. Many of these characteristics are amenable to change through practice-level organizational changes.

  6. Quantitative Analysis of High-Quality Officer Selection by Commandants Career-Level Education Board

    Science.gov (United States)

    2017-03-01

    impact on the organization and allocate resources to improve the human capital of this select group. From 2011 onward, CCLEB revamped the application...ANALYSIS OF HIGH-QUALITY OFFICER SELECTION BY COMMANDANT’S CAREER - LEVEL EDUCATION BOARD by Clifton N. Rateike March 2017 Thesis Advisor...of Management and Budget, Paperwork Reduction Project (0704-0188) Washington, DC 20503. 1. AGENCY USE ONLY (Leave blank) 2. REPORT DATE March

  7. High-quality AlN films grown on chemical vapor-deposited graphene films

    Directory of Open Access Journals (Sweden)

    Chen Bin-Hao

    2016-01-01

    Full Text Available We report the growth of high-quality AlN films on graphene. The graphene films were synthesized by CVD and then transferred onto silicon substrates. Epitaxial aluminum nitride films were deposited by DC magnetron sputtering on both graphene as an intermediate layer and silicon as a substrate. The structural characteristics of the AlN films and graphene were investigated. Highly c-axis-oriented AlN crystal structures are investigated based on the XRDpatterns observations.

  8. Burnout in boiling heat transfer. Part III. High-quality forced-convection systems

    International Nuclear Information System (INIS)

    Bergles, A.E.

    1979-01-01

    This is the final part of a review of burnout during boiling heat transfer. The status of burnout in high-quality forced-convection systems is reviewed, and recent developments are summarized in detail. A general guide to the considerable literature is given. Parametric effects and correlations for water in circular and noncircular ducts are presented. Other topics discussed include transients, steam-generator applications, correlations for other fluids, fouling, and augmentation

  9. High-quality poly-dispersed mixtures applied in additive 3D technologies.

    Science.gov (United States)

    Gerasimov, M. D.; Brazhnik, Yu V.; Gorshkov, P. S.; Latyshev, S. S.

    2018-03-01

    The paper describes the new mixer design to obtain high-quality poly-dispersed powders applied in additive 3D technologies. It also considers a new mixing principle of dry powder particles ensuring the distribution of such particles in the total volume, which is close to ideal. The paper presents the mathematical model of mixer operation providing for the quality assessment of the ready mixtures. Besides, it demonstrates experimental results and obtained rational values of mixer process parameters.

  10. Generating high-quality single droplets for optical particle characterization with an easy setup

    Science.gov (United States)

    Xu, Jie; Ge, Baozhen; Meng, Rui

    2018-06-01

    The high-performance and micro-sized single droplet is significant for optical particle characterization. We develop a single-droplet generator (SDG) based on a piezoelectric inkjet technique with advantages of low cost and easy setup. By optimizing the pulse parameters, we achieve various size single droplets. Further investigations reveal that SDG generates single droplets of high quality, demonstrating good sphericity, monodispersity and a stable length of several millimeters.

  11. Increased systemic and epidermal levels of IL-17A and IL-1β promotes progression of non-segmental vitiligo.

    Science.gov (United States)

    Bhardwaj, Supriya; Rani, Seema; Srivastava, Niharika; Kumar, Ravinder; Parsad, Davinder

    2017-03-01

    Non-segmental vitiligo (NSV) results from autoimmune destruction of melanocytes. The altered levels of various cytokines have been proposed in the pathogenesis of vitiligo. However, the exact immune mechanisms have not yet been fully elucidated. To investigate the role of epidermal and systemic cytokines in active and stable NSV patients. Serum levels of inflammatory cytokines were checked in 42 active and 30 stable NSV patients with 30 controls. The lesional, perilesional and normal skin sections were subjected to H&E staining. The mRNA expression of inflammatory cytokines and their respective receptors were assessed by quantitative PCR in lesional skin of both active and stable NSV skin. The MITF and IL-17A were immunolocalized in lesional, perilesional and normal skin tissue. Significant increase in the expression of inflammatory cytokines, IL-17A, IL-1β and TGF-β was observed in active patients, whereas no change was observed in stable patients. A marked reduction in epidermal thickness was observed in lesional skin sections. Significant increase in IL-17A and significant decrease in microphthalmia associated transcription factor (MITF) expression was observed in lesional and perilesional skin sections. Moreover, qPCR analysis showed significant alterations in the mRNA levels of IL-17A, IL-1β, IFN-γ, TGF-β and their respective receptors in active and stable vitiligo patient samples. Increased levels of IL-17A and IL-1β cytokines and decreased expression of MITF suggested a possible role of these cytokines in dysregulation of melanocytic activity in the lesional skin and hence might be responsible for the progression of active vitiligo. Copyright © 2016 Elsevier Ltd. All rights reserved.

  12. Fast Batch Production of High-Quality Graphene Films in a Sealed Thermal Molecular Movement System.

    Science.gov (United States)

    Xu, Jianbao; Hu, Junxiong; Li, Qi; Wang, Rubing; Li, Weiwei; Guo, Yufen; Zhu, Yongbo; Liu, Fengkui; Ullah, Zaka; Dong, Guocai; Zeng, Zhongming; Liu, Liwei

    2017-07-01

    Chemical vapor deposition (CVD) growth of high-quality graphene has emerged as the most promising technique in terms of its integrated manufacturing. However, there lacks a controllable growth method for producing high-quality and a large-quantity graphene films, simultaneously, at a fast growth rate, regardless of roll-to-roll (R2R) or batch-to-batch (B2B) methods. Here, a stationary-atmospheric-pressure CVD (SAPCVD) system based on thermal molecular movement, which enables fast B2B growth of continuous and uniform graphene films on tens of stacked Cu(111) foils, with a growth rate of 1.5 µm s -1 , is demonstrated. The monolayer graphene of batch production is found to nucleate from arrays of well-aligned domains, and the films possess few defects and exhibit high carrier mobility up to 6944 cm 2 V -1 s -1 at room temperature. The results indicate that the SAPCVD system combined with single-domain Cu(111) substrates makes it possible to realize fast batch-growth of high-quality graphene films, which opens up enormous opportunities to use this unique 2D material for industrial device applications. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  13. Accelerated probabilistic inference of RNA structure evolution

    Directory of Open Access Journals (Sweden)

    Holmes Ian

    2005-03-01

    Full Text Available Abstract Background Pairwise stochastic context-free grammars (Pair SCFGs are powerful tools for evolutionary analysis of RNA, including simultaneous RNA sequence alignment and secondary structure prediction, but the associated algorithms are intensive in both CPU and memory usage. The same problem is faced by other RNA alignment-and-folding algorithms based on Sankoff's 1985 algorithm. It is therefore desirable to constrain such algorithms, by pre-processing the sequences and using this first pass to limit the range of structures and/or alignments that can be considered. Results We demonstrate how flexible classes of constraint can be imposed, greatly reducing the computational costs while maintaining a high quality of structural homology prediction. Any score-attributed context-free grammar (e.g. energy-based scoring schemes, or conditionally normalized Pair SCFGs is amenable to this treatment. It is now possible to combine independent structural and alignment constraints of unprecedented general flexibility in Pair SCFG alignment algorithms. We outline several applications to the bioinformatics of RNA sequence and structure, including Waterman-Eggert N-best alignments and progressive multiple alignment. We evaluate the performance of the algorithm on test examples from the RFAM database. Conclusion A program, Stemloc, that implements these algorithms for efficient RNA sequence alignment and structure prediction is available under the GNU General Public License.

  14. Oxygen dependency of epidermal growth factor receptor binding and DNA synthesis of rat hepatocytes

    International Nuclear Information System (INIS)

    Hirose, Tetsuro; Terajima, Hiroaki; Yamauchi, Akira

    1997-01-01

    Background/Aims: Changes in oxygen availability modulate replicative responses in several cell types, but the effects on hepatocyte replication remain unclear. We have studied the effects of transient nonlethal hypoxia on epidermal growth factor receptor binding and epidermal growth factor-induced DNA synthesis of rat hepatocytes. Methods: Lactate dehydrogenase activity in culture supernatant, intracellular adenosine triphosphate content, 125 I-epidermal growth factor specific binding, epidermal growth factor receptor protein expression, and 3 H-thymidine incorporation were compared between hepatocytes cultured in hypoxia and normoxia. Results: Hypoxia up to 3 h caused no significant increase in lactate dehydrogenase activity in the culture supernatant, while intracellular adenosine triphosphate content decreased time-dependently and was restored to normoxic levels by reoxygenation (nonlethal hypoxia). Concomitantly, 125 I-epidermal growth factor specific binding to hepatocytes decreased time-dependently (to 54.1% of normoxia) and was restored to control levels by reoxygenation, although 125 I-insulin specific binding was not affected. The decrease in 125 I-epidermal growth factor specific binding was explained by the decrease in the number or available epidermal growth factor receptors (21.37±3.08 to 12.16±1.42 fmol/10 5 cells), while the dissociation constant of the receptor was not affected. The change in the number of available receptors was not considered to be due to receptor degradation-resynthesis, since immuno-detection of the epidermal growth factor receptor revealed that the receptor protein expression did not change during hypoxia and reoxygenation, and since neither actinomycin D nor cycloheximide affected the recovery of 125 I-epidermal growth factor binding by reoxygenation. Inhibition of epidermal growth factor-induced DNA synthesis after hypoxia (to 75.4% of normoxia by 3 h hypoxia) paralleled the decrease in 125 I-epidermal growth factor binding

  15. EGF receptor targeted lipo-oligocation polyplexes for antitumoral siRNA and miRNA delivery

    Science.gov (United States)

    Müller, Katharina; Klein, Philipp M.; Heissig, Philipp; Roidl, Andreas; Wagner, Ernst

    2016-11-01

    Antitumoral siRNA and miRNA delivery was demonstrated by epidermal growth factor receptor (EGFR) targeted oligoaminoamide polyplexes. For this purpose, the T-shaped lipo-oligomer 454 was used to complex RNA into a core polyplex, which was subsequently functionalized with the targeting peptide ligand GE11 via a polyethylene glycol (PEG) linker. To this end, free cysteines on the surface of 454 polyplex were coupled with a maleimide-PEG-GE11 reagent (Mal-GE11). Resulting particles with sizes of 120-150 nm showed receptor-mediated uptake into EGFR-positive T24 bladder cancer cells, MDA-MB 231 breast cancer cells and Huh7 liver cancer cells. Furthermore, these formulations led to ligand-dependent gene silencing. RNA interference (RNAi) triggered antitumoral effects were observed for two different therapeutic RNAs, a miRNA-200c mimic or EG5 siRNA. Using polyplexes modified with a ratio of 0.8 molar equivalents of Mal-GE11, treatment of T24 or MDA-MB 231 cancer cells with miR-200c led to the expected decreased proliferation and migration, changes in cell cycle and enhanced sensitivity towards doxorubicin. Delivery of EG5 siRNA into Huh7 cells resulted in antitumoral activity with G2/M arrest, triggered by loss of mitotic spindle separation and formation of mono-astral spindles. These findings demonstrate the potential of GE11 ligand-containing RNAi polyplexes for cancer treatment.

  16. Nanoparticle orientation to control RNA loading and ligand display on extracellular vesicles for cancer regression

    Science.gov (United States)

    Pi, Fengmei; Binzel, Daniel W.; Lee, Tae Jin; Li, Zhefeng; Sun, Meiyan; Rychahou, Piotr; Li, Hui; Haque, Farzin; Wang, Shaoying; Croce, Carlo M.; Guo, Bin; Evers, B. Mark; Guo, Peixuan

    2018-01-01

    Nanotechnology offers many benefits, and here we report an advantage of applying RNA nanotechnology for directional control. The orientation of arrow-shaped RNA was altered to control ligand display on extracellular vesicle membranes for specific cell targeting, or to regulate intracellular trafficking of small interfering RNA (siRNA) or microRNA (miRNA). Placing membrane-anchoring cholesterol at the tail of the arrow results in display of RNA aptamer or folate on the outer surface of the extracellular vesicle. In contrast, placing the cholesterol at the arrowhead results in partial loading of RNA nanoparticles into the extracellular vesicles. Taking advantage of the RNA ligand for specific targeting and extracellular vesicles for efficient membrane fusion, the resulting ligand-displaying extracellular vesicles were capable of specific delivery of siRNA to cells, and efficiently blocked tumour growth in three cancer models. Extracellular vesicles displaying an aptamer that binds to prostate-specific membrane antigen, and loaded with survivin siRNA, inhibited prostate cancer xenograft. The same extracellular vesicle instead displaying epidermal growth-factor receptor aptamer inhibited orthotopic breast cancer models. Likewise, survivin siRNA-loaded and folate-displaying extracellular vesicles inhibited patient-derived colorectal cancer xenograft.

  17. Epidermolytic hyperkeratosis in inflammatory linear verrucous epidermal nevus

    Directory of Open Access Journals (Sweden)

    Naser Tayyebi Meibodi

    2011-01-01

    Full Text Available Epidermolytic hyperkeratosis presents with perinuclear vacuolization of the keratinocytes in spinous and granular layers, keratinocytes with ill-defined limits, which leads to a reticulate appearance of the epidermis, an increased number of variously shaped and sized basophilic keratohyalin granules and the same sized eosinophilic trichohyalin granules, at any level of epidermis, mainly in the stratum granulosum, and compact hyperkeratosis. This minor reactive pathologic reaction pattern of skin is found in large variety of diseases. This paper is the first case report of such pattern in inflammatory linear verrucous epidermal nevus. Our case is of a 23-year-old man with pruritic verrucous lesions of trunk and extremities initiated since 13 years ago. Physical examination revealed white linear hyperkeratotic lesions, some of them on erythematous background and also classic epidermal nevus. No skeletal, ophthalmic, and nervous system involvement was detected. Microscopic study of pruritic verrucous lesions showed psoriasiform acanthosis, mild papillomatous, hyperkeratosis, and epidermolytic hyperkeratotic changes in hair follicles and acrosyrinx accompanied with moderate perivascular inflammation.

  18. A novel role of RASSF9 in maintaining epidermal homeostasis.

    Directory of Open Access Journals (Sweden)

    Chiou-Mei Lee

    Full Text Available The physiological role of RASSF9, a member of the Ras-association domain family (RASSF, is currently unclear. Here, we report a mouse line in which an Epstein-Barr virus Latent Membrane Protein 1 (LMP1 transgene insertion has created a 7.2-kb chromosomal deletion, which abolished RASSF9 gene expression. The RASSF9-null mice exhibited interesting phenotypes that resembled human ageing, including growth retardation, short lifespan, less subcutaneous adipose layer and alopecia. In the wild-type mice, RASSF9 is predominantly expressed in the epidermal keratinocytes of skin, as determined by quantitative reverse-transcription PCR, immunofluorescence and in situ hybridization. In contrast, RASSF9-/- mice presented a dramatic change in epithelial organization of skin with increased proliferation and aberrant differentiation as detected by bromodeoxyuridine incorporation assays and immunofluorescence analyses. Furthermore, characteristic functions of RASSF9-/- versus wild type (WT mouse primary keratinocytes showed significant proliferation linked to a reduction of p21Cip1 expression under growth or early differentiation conditions. Additionally, in RASSF9-/- keratinocytes there was a drastic down-modulation of terminal differentiation markers, which could be rescued by infection with a recombinant adenovirus, Adv/HA-RASSF9. Our results indicate a novel and significant role of RASSF9 in epidermal homeostasis.

  19. Flexible pH-Sensing Hydrogel Fibers for Epidermal Applications.

    Science.gov (United States)

    Tamayol, Ali; Akbari, Mohsen; Zilberman, Yael; Comotto, Mattia; Lesha, Emal; Serex, Ludovic; Bagherifard, Sara; Chen, Yu; Fu, Guoqing; Ameri, Shideh Kabiri; Ruan, Weitong; Miller, Eric L; Dokmeci, Mehmet R; Sonkusale, Sameer; Khademhosseini, Ali

    2016-03-01

    Epidermal pH is an indication of the skin's physiological condition. For example, pH of wound can be correlated to angiogenesis, protease activity, bacterial infection, etc. Chronic nonhealing wounds are known to have an elevated alkaline environment, while healing process occurs more readily in an acidic environment. Thus, dermal patches capable of continuous pH measurement can be used as point-of-care systems for monitoring skin disorder and the wound healing process. Here, pH-responsive hydrogel fibers are presented that can be used for long-term monitoring of epidermal wound condition. pH-responsive dyes are loaded into mesoporous microparticles and incorporated into hydrogel fibers using a microfluidic spinning system. The fabricated pH-responsive microfibers are flexible and can create conformal contact with skin. The response of pH-sensitive fibers with different compositions and thicknesses are characterized. The suggested technique is scalable and can be used to fabricate hydrogel-based wound dressings with clinically relevant dimensions. Images of the pH-sensing fibers during real-time pH measurement can be captured with a smart phone camera for convenient readout on-site. Through image processing, a quantitative pH map of the hydrogel fibers and the underlying tissue can be extracted. The developed skin dressing can act as a point-of-care device for monitoring the wound healing process. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. Extraordinarily Stretchable All-Carbon Collaborative Nanoarchitectures for Epidermal Sensors

    KAUST Repository

    Cai, Yichen

    2017-06-16

    Multifunctional microelectronic components featuring large stretchability, high sensitivity, high signal-to-noise ratio (SNR), and broad sensing range have attracted a huge surge of interest with the fast developing epidermal electronic systems. Here, the epidermal sensors based on all-carbon collaborative percolation network are demonstrated, which consist 3D graphene foam and carbon nanotubes (CNTs) obtained by two-step chemical vapor deposition processes. The nanoscaled CNT networks largely enhance the stretchability and SNR of the 3D microarchitectural graphene foams, endowing the strain sensor with a gauge factor as high as 35, a wide reliable sensing range up to 85%, and excellent cyclic stability (>5000 cycles). The flexible and reversible strain sensor can be easily mounted on human skin as a wearable electronic device for real-time and high accuracy detecting of electrophysiological stimuli and even for acoustic vibration recognition. The rationally designed all-carbon nanoarchitectures are scalable, low cost, and promising in practical applications requiring extraordinary stretchability and ultrahigh SNRs.

  1. Steven johnsons syndrome and toxic epidermal necrolysis: A review

    Directory of Open Access Journals (Sweden)

    Sri ram Anne

    2014-12-01

    Full Text Available Toxic epidermal necrolysis (TEN and Stevens Johnson Syndrome (SJS are severe adverse cutaneous drug reactions that predominantly involve the skin and mucous membranes. They are characterized by mucocutaneous tenderness and typically hemorrhagic erosions, erythema and more or less severe epidermal detachment presenting as blisters and areas of denuded skin. Drugs are assumed or identified as the main cause of SJS/TEN in most cases, but Mycoplasma pneumoniae and Herpes simplex virus infections are well documented causes alongside rare cases in which the etiology remains unknown. Several drugs are at "high" risk of inducing TEN/SJS including: Allopurinol, Trimethoprim-sulfamethoxazole and other sulfonamide-antibiotics, aminopenicillins, cephalosporins, quinolones, carbamazepine, phenytoin, phenobarbital and NSAID's of the oxicam-type. Differential diagnosis includes linear IgA dermatosis and paraneoplastic pemphigus, pemphigus vulgaris and bullous pemphigoid, acute generalized exanthematous pustulosis (AGEP, disseminated fixed bullous drug eruption and staphyloccocal scalded skin syndrome (SSSS. Due to the high risk of mortality, management of patients with SJS/TEN requires rapid diagnosis, identification and interruption of the culprit drug, specialized supportive care ideally in an intensive care unit, and consideration of immunomodulating agents such as high-dose intravenous immunoglobulin therapy.

  2. Hybrid Enhanced Epidermal SpaceSuit Design Approaches

    Science.gov (United States)

    Jessup, Joseph M.

    A Space suit that does not rely on gas pressurization is a multi-faceted problem that requires major stability controls to be incorporated during design and construction. The concept of Hybrid Epidermal Enhancement space suit integrates evolved human anthropomorphic and physiological adaptations into its functionality, using commercially available bio-medical technologies to address shortcomings of conventional gas pressure suits, and the impracticalities of MCP suits. The prototype HEE Space Suit explored integumentary homeostasis, thermal control and mobility using advanced bio-medical materials technology and construction concepts. The goal was a space suit that functions as an enhanced, multi-functional bio-mimic of the human epidermal layer that works in attunement with the wearer rather than as a separate system. In addressing human physiological requirements for design and construction of the HEE suit, testing regimes were devised and integrated into the prototype which was then subject to a series of detailed tests using both anatomical reproduction methods and human subject.

  3. Extraordinarily Stretchable All-Carbon Collaborative Nanoarchitectures for Epidermal Sensors

    KAUST Repository

    Cai, Yichen; Shen, Jie; Dai, Ziyang; Zang, Xiaoxian; Dong, Qiuchun; Guan, Guofeng; Li, Lain-Jong; Huang, Wei; Dong, Xiaochen

    2017-01-01

    Multifunctional microelectronic components featuring large stretchability, high sensitivity, high signal-to-noise ratio (SNR), and broad sensing range have attracted a huge surge of interest with the fast developing epidermal electronic systems. Here, the epidermal sensors based on all-carbon collaborative percolation network are demonstrated, which consist 3D graphene foam and carbon nanotubes (CNTs) obtained by two-step chemical vapor deposition processes. The nanoscaled CNT networks largely enhance the stretchability and SNR of the 3D microarchitectural graphene foams, endowing the strain sensor with a gauge factor as high as 35, a wide reliable sensing range up to 85%, and excellent cyclic stability (>5000 cycles). The flexible and reversible strain sensor can be easily mounted on human skin as a wearable electronic device for real-time and high accuracy detecting of electrophysiological stimuli and even for acoustic vibration recognition. The rationally designed all-carbon nanoarchitectures are scalable, low cost, and promising in practical applications requiring extraordinary stretchability and ultrahigh SNRs.

  4. Growth of melanocytes in human epidermal cell cultures

    International Nuclear Information System (INIS)

    Staiano-Coico, L.; Hefton, J.M.; Amadeo, C.; Pagan-Charry, I.; Madden, M.R.; Cardon-Cardo, C.

    1990-01-01

    Epidermal cell cultures were grown in keratinocyte-conditioned medium for use as burn wound grafts; the melanocyte composition of the grafts was studied under a variety of conditions. Melanocytes were identified by immunohistochemistry based on a monoclonal antibody (MEL-5) that has previously been shown to react specifically with melanocytes. During the first 7 days of growth in primary culture, the total number of melanocytes in the epidermal cultures decreased to 10% of the number present in normal skin. Beginning on day 2 of culture, bipolar melanocytes were present at a mean cell density of 116 +/- 2/mm2; the keratinocyte to melanocyte ratio was preserved during further primary culture and through three subpassages. Moreover, exposure of cultures to mild UVB irradiation stimulated the melanocytes to proliferate, suggesting that the melanocytes growing in culture maintained their responsiveness to external stimuli. When the sheets of cultured cells were enzymatically detached from the plastic culture flasks before grafting, melanocytes remained in the basal layer of cells as part of the graft applied to the patient

  5. Upregulation of FOXM1 induces genomic instability in human epidermal keratinocytes

    Directory of Open Access Journals (Sweden)

    Philpott Michael P

    2010-02-01

    Full Text Available Abstract Background The human cell cycle transcription factor FOXM1 is known to play a key role in regulating timely mitotic progression and accurate chromosomal segregation during cell division. Deregulation of FOXM1 has been linked to a majority of human cancers. We previously showed that FOXM1 was upregulated in basal cell carcinoma and recently reported that upregulation of FOXM1 precedes malignancy in a number of solid human cancer types including oral, oesophagus, lung, breast, kidney, bladder and uterus. This indicates that upregulation of FOXM1 may be an early molecular signal required for aberrant cell cycle and cancer initiation. Results The present study investigated the putative early mechanism of UVB and FOXM1 in skin cancer initiation. We have demonstrated that UVB dose-dependently increased FOXM1 protein levels through protein stabilisation and accumulation rather than de novo mRNA expression in human epidermal keratinocytes. FOXM1 upregulation in primary human keratinocytes triggered pro-apoptotic/DNA-damage checkpoint response genes such as p21, p38 MAPK, p53 and PARP, however, without causing significant cell cycle arrest or cell death. Using a high-resolution Affymetrix genome-wide single nucleotide polymorphism (SNP mapping technique, we provided the evidence that FOXM1 upregulation in epidermal keratinocytes is sufficient to induce genomic instability, in the form of loss of heterozygosity (LOH and copy number variations (CNV. FOXM1-induced genomic instability was significantly enhanced and accumulated with increasing cell passage and this instability was increased even further upon exposure to UVB resulting in whole chromosomal gain (7p21.3-7q36.3 and segmental LOH (6q25.1-6q25.3. Conclusion We hypothesise that prolonged and repeated UVB exposure selects for skin cells bearing stable FOXM1 protein causes aberrant cell cycle checkpoint thereby allowing ectopic cell cycle entry and subsequent genomic instability. The aberrant

  6. 75 FR 70289 - Certain Coated Paper Suitable For High-Quality Print Graphics Using Sheet-Fed Presses From China...

    Science.gov (United States)

    2010-11-17

    ...)] Certain Coated Paper Suitable For High-Quality Print Graphics Using Sheet-Fed Presses From China and... paper suitable for high-quality print graphics using sheet-fed presses (``certain coated paper'') from... paper industry is materially injured by reason of imports of the subject merchandise from China and...

  7. Identification of SLURP-1 as an epidermal neuromodulator explains the clinical phenotype of Mal de Meleda

    DEFF Research Database (Denmark)

    Chimienti, Fabrice; Hogg, Ronald C; Plantard, Laure

    2003-01-01

    alpha 7 nicotinic acetylcholine receptors that are present in keratinocytes. These results identify SLURP-1 as a secreted epidermal neuromodulator which is likely to be essential for both epidermal homeostasis and inhibition of TNF-alpha release by macrophages during wound healing. This explains both...

  8. Periostin contributes to epidermal hyperplasia in psoriasis common to atopic dermatitis

    Directory of Open Access Journals (Sweden)

    Kazuhiko Arima

    2015-01-01

    Conclusions: Periostin plays an important role during epidermal hyperplasia in IMQ-induced skin inflammation, independently of the IL-23–IL-17/IL-22 axis. Periostin appears to be a mediator for epidermal hyperplasia that is common to AD and psoriasis.

  9. Enrichment of unlabeled human Langerhans cells from epidermal cell suspensions by discontinuous density gradient centrifugation

    NARCIS (Netherlands)

    Teunissen, M. B.; Wormmeester, J.; Kapsenberg, M. L.; Bos, J. D.

    1988-01-01

    In this report we introduce an alternative procedure for enrichment of human epidermal Langerhans cells (LC) from epidermal cell suspensions of normal skin. By means of discontinuous Ficoll-Metrizoate density gradient centrifugation, a fraction containing high numbers of viable, more than 80% pure

  10. Excision of pyrimidine dimers from epidermal DNA and nonsemiconservative epidermal DNA synthesis following ultraviolet irradiation of mouse skin

    International Nuclear Information System (INIS)

    Bowden, G.T.; Trosko, J.E.; Shapas, B.G.; Boutwell, R.K.

    1975-01-01

    Pyrimidine dimer production and excision in epidermal DNA were studied at five different dose levels of ultraviolet light in the skin of intact mice. Dimer production increased with dose up to 50,400 ergs/sq mm. Approximately 30 percent of the thymine-containing dimers were excised by 24 hr after irradiation at three lower dose levels of ultraviolet light. Nonsemiconservative DNA replication in ultraviolet-irradiated mouse skin was shown to continue for at least 18 hr. The rate of nonsemiconservative replication decreased with time, but did so slowly. The initial rates of nonsemiconservative replication increased with ultraviolet light dose levels up to about 4200 ergs/sq mm, after which the initial rates were decreased. Semiconservative epidermal DNA synthesis was shown to be inhibited by hydroxyurea, but hydroxyurea had no effect on ultraviolet light-induced nonsemiconservative DNA replication. The observed pyrimidine dimer excision and nonsemiconservative DNA replication suggest that in the intact mouse the cells of the epidermis are capable of DNA excision repair after ultraviolet irradiation of mouse skin

  11. Epidermal growth factor in alkali-burned corneal epithelial wound healing.

    Science.gov (United States)

    Singh, G; Foster, C S

    1987-06-15

    We conducted a double-masked study to evaluate the effect of epidermal growth factor on epithelial wound healing and recurrent erosions in alkali-burned rabbit corneas. Epithelial wounds 10 mm in diameter healed completely under the influence of topical epidermal growth factor, whereas the control corneas did not resurface in the center. On reversal of treatment, the previously nonhealing epithelial defects healed when treated with topical epidermal growth factor eyedrops. Conversely, the epidermal growth factor-treated and resurfaced corneas developed epithelial defects when treatment was discontinued. Histopathologic examination disclosed hyperplastic epithelium growing over the damaged stroma laden with polymorphonuclear leukocytes when treated with epidermal growth factor eyedrops, but it did not adhere to the underlying tissue. Hydropic changes were seen intracellularly as well as between the epithelial cells and the stroma.

  12. Effects of Wnt3a on proliferation and differentiation of human epidermal stem cells

    International Nuclear Information System (INIS)

    Jia Liwei; Zhou Jiaxi; Peng Sha; Li Juxue; Cao Yujing; Duan Enkui

    2008-01-01

    Epidermal stem cells maintain development and homeostasis of mammalian epidermis throughout life. However, the molecular mechanisms involved in the proliferation and differentiation of epidermal stem cells are far from clear. In this study, we investigated the effects of Wnt3a and Wnt/β-catenin signaling on proliferation and differentiation of human fetal epidermal stem cells. We found both Wnt3a and active β-catenin, two key members of the Wnt/β-catenin signaling, were expressed in human fetal epidermis and epidermal stem cells. In addition, Wnt3a protein can promote proliferation and inhibit differentiation of epidermal stem cells in vitro culture. Our results suggest that Wnt/β-catenin signaling plays important roles in human fetal skin development and homeostasis, which also provide new insights on the molecular mechanisms of oncogenesis in human epidermis

  13. Penile epidermal inclusion cyst: a late complication of penile girth enhancement surgery.

    Science.gov (United States)

    Park, Hyun Jun; Park, Nam Cheol; Park, Sung Woo; Jern, Tae Kyung; Choi, Kyung-Un

    2008-09-01

    Epidermal inclusion cysts are benign lesions that can develop in any part of the body. However, the finding of an epidermal inclusion cyst in the penis is rare. The aim of this article was to present the management of a case of a penile epidermal inclusion cyst that occurred because of late complications of a penile girth enhancement surgery. A 52-year-old man presented with a painless, slowly growing mass in the penis, which was first noted after a penile girth enhancement surgery 20 years ago. A cystic mobile mass about 2 cm in depth was found surrounding the coronal sulcus. Excision of the mass was performed for diagnosis and treatment. There was no communication with the urethra. The pathological diagnosis was an epidermal inclusion cyst of the penis. A penile epidermal inclusion cyst in adult men is rare. It can develop after an inadequate procedure for penile girth enhancement, and should be treated by complete resection.

  14. High quality copy number and genotype data from FFPE samples using Molecular Inversion Probe (MIP) microarrays

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Yuker; Carlton, Victoria E.H.; Karlin-Neumann, George; Sapolsky, Ronald; Zhang, Li; Moorhead, Martin; Wang, Zhigang C.; Richardson, Andrea L.; Warren, Robert; Walther, Axel; Bondy, Melissa; Sahin, Aysegul; Krahe, Ralf; Tuna, Musaffe; Thompson, Patricia A.; Spellman, Paul T.; Gray, Joe W.; Mills, Gordon B.; Faham, Malek

    2009-02-24

    A major challenge facing DNA copy number (CN) studies of tumors is that most banked samples with extensive clinical follow-up information are Formalin-Fixed Paraffin Embedded (FFPE). DNA from FFPE samples generally underperforms or suffers high failure rates compared to fresh frozen samples because of DNA degradation and cross-linking during FFPE fixation and processing. As FFPE protocols may vary widely between labs and samples may be stored for decades at room temperature, an ideal FFPE CN technology should work on diverse sample sets. Molecular Inversion Probe (MIP) technology has been applied successfully to obtain high quality CN and genotype data from cell line and frozen tumor DNA. Since the MIP probes require only a small ({approx}40 bp) target binding site, we reasoned they may be well suited to assess degraded FFPE DNA. We assessed CN with a MIP panel of 50,000 markers in 93 FFPE tumor samples from 7 diverse collections. For 38 FFPE samples from three collections we were also able to asses CN in matched fresh frozen tumor tissue. Using an input of 37 ng genomic DNA, we generated high quality CN data with MIP technology in 88% of FFPE samples from seven diverse collections. When matched fresh frozen tissue was available, the performance of FFPE DNA was comparable to that of DNA obtained from matched frozen tumor (genotype concordance averaged 99.9%), with only a modest loss in performance in FFPE. MIP technology can be used to generate high quality CN and genotype data in FFPE as well as fresh frozen samples.

  15. Epidermal stem cells response to radiative genotoxic stress

    International Nuclear Information System (INIS)

    Marie, Melanie

    2013-01-01

    Human skin is the first organ exposed to various environmental stresses, which requires the development by skin stem cells of specific mechanisms to protect themselves and to ensure tissue homeostasis. As stem cells are responsible for the maintenance of epidermis during individual lifetime, the preservation of genomic integrity in these cells is essential. My PhD aimed at exploring the mechanisms set up by epidermal stem cells in order to protect themselves from two genotoxic stresses, ionizing radiation (Gamma Rays) and ultraviolet radiation (UVB). To begin my PhD, I have taken part of the demonstration of protective mechanisms used by keratinocyte stem cells after ionizing radiation. It has been shown that these cells are able to rapidly repair most types of radiation-induced DNA damage. Furthermore, we demonstrated that this repair is activated by the fibroblast growth factor 2 (FGF2). In order to know if this protective mechanism is also operating in cutaneous carcinoma stem cells, we investigated the response to gamma Rays of carcinoma stem cells isolated from a human carcinoma cell line. As in normal keratinocyte stem cells, we demonstrated that cancer stem cells could rapidly repair radio-induced DNA damage. Furthermore, fibroblast growth factor 2 also mediates this repair, notably thanks to its nuclear isoforms. The second project of my PhD was to study human epidermal stem cells and progenitors responses to UVB radiation. Once cytometry and irradiation conditions were set up, the toxicity of UVB radiation has been evaluate in the primary cell model. We then characterized UVB photons effects on cell viability, proliferation and repair of DNA damage. This study allowed us to bring out that responses of stem cells and their progeny to UVB are different, notably at the level of part of their repair activity of DNA damage. Moreover, progenitors and stem cells transcriptomic responses after UVB irradiation have been study in order to analyze the global

  16. Combinatorics of RNA-RNA interaction

    DEFF Research Database (Denmark)

    Li, Thomas J X; Reidys, Christian

    2012-01-01

    RNA-RNA binding is an important phenomenon observed for many classes of non-coding RNAs and plays a crucial role in a number of regulatory processes. Recently several MFE folding algorithms for predicting the joint structure of two interacting RNA molecules have been proposed. Here joint structure...... means that in a diagram representation the intramolecular bonds of each partner are pseudoknot-free, that the intermolecular binding pairs are noncrossing, and that there is no so-called "zigzag" configuration. This paper presents the combinatorics of RNA interaction structures including...

  17. Induction of PDGF-B in TCA-treated epidermal keratinocytes.

    Science.gov (United States)

    Yonei, Nozomi; Kanazawa, Nobuo; Ohtani, Toshio; Furukawa, Fukumi; Yamamoto, Yuki

    2007-11-01

    Trichloroacetic acid (TCA) is one of the most widely used peeling agents, and induces full necrosis of the whole epidermis, followed by reconstitution of the epidermis and the matrix of the papillary dermis. The cytotoxic effects of TCA, such as suppressing proliferation of keratinocytes and fibroblasts and protein synthesis by fibroblasts, have already been reported. However, the entire biological mechanism responsible for TCA peeling has yet to be determined. Hypothetical activation effects of TCA treatment on epidermal cells to induce production of growth factors and cytokines are examined, and are compared with its cytotoxic effects in terms of time course and applied TCA concentrations. After various periods of incubation with TCA, viability of Pam212 murine keratinocytes was investigated with MTT assay and dye exclusion assay, and production of growth factors and cytokines with reverse transcription-polymerase chain reaction (RT-PCR). Changes in platelet-derived growth factor (PDGF)-B mRNA expression and protein production in the human skin specimens after TCA application were then examined by RT-PCR and immunohistochemistry, respectively. Incubation with TCA showed cytotoxicity and induced death of Pam212 cells, depending on the incubation period and the TCA concentration. In addition, expressions of PDGF-B, tumor growth factor (TGF)-alpha, TGF- beta1 and vascular endothelial growth factor, which are the growth factors reportedly secreted from keratinocytes during wound healing, were all detected in Pam212 cells after short-term treatment with TCA. Expressions of inflammatory cytokines such as interleukin (IL)-1 and IL-10 were also induced. In TCA-treated NIH-3T3 fibroblasts, in contrast, observed was upregulation of only keratinocyte growth factor, which is reportedly secreted from fibroblasts, as well as the similar cytotoxic effect. In human skin, PDGF-B mRNA expression became significantly upregulated after TCA application, and then immediately

  18. Preparation of high-quality iodine-125-labeled pituitary luteinizing hormone for radioimmunoassay

    International Nuclear Information System (INIS)

    Pinto, H.; Wajchenberg, B.L.; Higa, O.Z.; Toledo e Souza, I.T. de; Werner, R.S.; Pieroni, R.R.

    1974-01-01

    High quality pituitary luteinizing hormone labeled with 125 I was obtained after separating out the more heavily iodinated fractions, through starch gel electrophoresis, using the cathodal component (fraction 1) which was further purified on Sephadex G-100, with the obtention of an almost pure 125 I-LH preparation, presenting excellent immunoreactivity and low levels of damage on incubation in plasma. The quality control of the steps of the technique was done with plasma-coated talc (200 mg) which compared favorably, as far indicating undamaged labeled LH, with the more time-consuming chromatoelectrophoresis

  19. Production of high-quality marketing applications: strategies for biotechnology companies working with contract research organizations.

    Science.gov (United States)

    Hecker, Sandra J; Preston, Christopher; Foote, MaryAnn

    2003-01-01

    Many biotechnology and pharmaceutical companies use clinical research organizations (CROs) to assist in the writing and preparation of clinical documents intended for submission to health authorities. Start-up companies often require the expertise of a CRO to prepare their first regulatory documents. Larger or more experienced companies often require CRO staff to assist at times of multiple simultaneous submissions. The timely production of high-quality new drug marketing applications requires close collaborations between the drug company and the CRO. The views of both CRO and industry in ensuring best practices are discussed.

  20. Growth of high quality large area MgB2 thin films by reactive evaporation

    OpenAIRE

    Moeckly, Brian H.; Ruby, Ward S.

    2006-01-01

    We report a new in-situ reactive deposition thin film growth technique for the production of MgB2 thin films which offers several advantages over all existing methods and is the first deposition method to enable the production of high-quality MgB2 films for real-world applications. We have used this growth method, which incorporates a rotating pocket heater, to deposit MgB2 films on a variety of substrates, including single-crystalline, polycrystalline, metallic, and semiconductor materials u...

  1. Joining forces: collaborating internationally to deliver high-quality, online postgraduate education in pain management.

    Science.gov (United States)

    Devonshire, Elizabeth; Siddall, Philip

    2011-01-01

    The effective management of pain is a complex and costly global issue, requiring a range of innovative educational strategies to enable culturally appropriate and high-quality health care provision. In response to this issue, the Pain Management Research Institute at the University of Sydney (Sydney, Australia) has established several strategic alliances with other overseas universities to deliver online postgraduate education in pain management. The present article discusses the rationale for joining forces, and the approach adopted in creating and maintaining these alliances. It also provides insights into the benefits, challenges and opportunities associated with collaborative educational initiatives of this nature, from institutional, academic and student perspectives.

  2. Isolation of high quality graphene from Ru by solution phase intercalation

    Science.gov (United States)

    Koren, E.; Sutter, E.; Bliznakov, S.; Ivars-Barcelo, F.; Sutter, P.

    2013-09-01

    We introduce a method for isolating graphene grown on epitaxial Ru(0001)/α-Al2O3. The strong graphene/Ru(0001) coupling is weakened by electrochemically driven intercalation of hydrogen underpotentially deposited in aqueous KOH solution, which allows the penetration of water molecules at the graphene/Ru(0001) interface. Following these electrochemically driven processes, the graphene can be isolated by electrochemical hydrogen evolution and transferred to arbitrary supports. Raman and transport measurements demonstrate the high quality of the transferred graphene. Our results show that intercalation, typically carried out in vacuum, can be extended to solution environments for graphene processing under ambient conditions.

  3. Experience in melting of high-quality chromium-nickel-molybdenum steel in oxygen converter

    Energy Technology Data Exchange (ETDEWEB)

    Kosoi, L F; Yaburov, S I; Shul' kin, M L; Vedernikov, G G; Bragin, E D; Filork' yan, B K

    1978-10-01

    Technology of melting high-quality medium-carbon constructional chromium-nickel-molybdenum steel has been developed and tested in 130-t converters. The technology envisages metal refinement in a casting laddle using synthetic lime-aluminous slag and argon blowing, as well as liquid ferroallys (master alloys) for steel deoxidation and alloying. Due to a smaller content of sulfur, phosphorus, arsenic and sulphide inclusions, and to a smaller grain size (N 11-12), the steel, produced according to this technology possesses higher plastic properties and impact strength than conventional open-hearth furnace metal after heat treatment for the same strength.

  4. Availability and Price of High Quality Day Care and Female Employment

    DEFF Research Database (Denmark)

    Simonsen, Marianne

    In this paper I analyse to what degree availability and price of high quality publicly subsidised childcare affects female employment for women living in couples following maternity leave. The results show that unrestricted access to day care has a significantly positive effct on female employment.......The price effect is significantly negative: An increase in the price of child care of C=1 will decrease the female employment with 0.08% corresponding to a price elasticity of −0.17. This effect prevails during the first 12 months after childbirth....

  5. Low-cost high-quality crystalline germanium based flexible devices

    KAUST Repository

    Nassar, Joanna M.

    2014-06-16

    High performance flexible electronics promise innovative future technology for various interactive applications for the pursuit of low-cost, light-weight, and multi-functional devices. Thus, here we show a complementary metal oxide semiconductor (CMOS) compatible fabrication of flexible metal-oxide-semiconductor capacitors (MOSCAPs) with high-κ/metal gate stack, using a physical vapor deposition (PVD) cost-effective technique to obtain a high-quality Ge channel. We report outstanding bending radius ~1.25 mm and semi-transparency of 30%.

  6. Facilitating the openEHR approach - organizational structures for defining high-quality archetypes.

    Science.gov (United States)

    Kohl, Christian Dominik; Garde, Sebastian; Knaup, Petra

    2008-01-01

    Using openEHR archetypes to establish an electronic patient record promises rapid development and system interoperability by using or adopting existing archetypes. However, internationally accepted, high quality archetypes which enable a comprehensive semantic interoperability require adequate development and maintenance processes. Therefore, structures have to be created involving different health professions. In the following we present a model which facilitates and governs distributed but cooperative development and adoption of archetypes by different professionals including peer reviews. Our model consists of a hierarchical structure of professional committees and descriptions of the archetype development process considering these different committees.

  7. Assessment of bird populations in a high quality savanna/woodland: a banding approach

    Science.gov (United States)

    Wilmore, Sandra L.; Glowacki, Gary A.; Grundel, Ralph

    2005-01-01

    Between 1999 and 2004, Save the Dunes Conservation Fund's Miller Woods Bird Banding Program monitored migrating and breeding bird populations within a high quality black oak, dry-mesic sand savanna/woodland with ridge and swale topography. The objectives of this program were to collect consistent and reliable demographic and abundance data on the bird populations, to investigate long-term population trends, and to contribute to improved land management decisions at regional and national scales. The technique employed involved capturing birds in mist nets that were deployed for set periods of time at 17 net sites in two banding areas in Miller Woods.

  8. Low-cost high-quality crystalline germanium based flexible devices

    KAUST Repository

    Nassar, Joanna M.; Hussain, Aftab M.; Rojas, Jhonathan Prieto; Hussain, Muhammad Mustafa

    2014-01-01

    High performance flexible electronics promise innovative future technology for various interactive applications for the pursuit of low-cost, light-weight, and multi-functional devices. Thus, here we show a complementary metal oxide semiconductor (CMOS) compatible fabrication of flexible metal-oxide-semiconductor capacitors (MOSCAPs) with high-κ/metal gate stack, using a physical vapor deposition (PVD) cost-effective technique to obtain a high-quality Ge channel. We report outstanding bending radius ~1.25 mm and semi-transparency of 30%.

  9. Fast Synthesis of High Quality Biodiesel from ‘Waste Fish Oil’ by Single Step Transesterification

    Directory of Open Access Journals (Sweden)

    Yogesh C. Sharma

    2014-09-01

    Full Text Available A large volume of fish wastes is produced on a daily basis in the Indian sub-continent. This abundant waste source could serve as an economic feedstock for bioenergy generation. In the present study, oil extracted from discarded fish parts was used for high quality biodiesel production. More specifically, a single step transesterification of ‘waste fishoil’ with methanol using sodium methoxide (CH3ONa as homogeneous catalyst under moderate operational conditions resulted in highly pure biodiesel of > 98% of fatty acid methyl ester (FAME content. Characterization was performed by Fourier Transform-Nuclear Magnetic Resonance (FT-NMR.

  10. HIGH QUALITY FACADE SEGMENTATION BASED ON STRUCTURED RANDOM FOREST, REGION PROPOSAL NETWORK AND RECTANGULAR FITTING

    Directory of Open Access Journals (Sweden)

    K. Rahmani

    2018-05-01

    Full Text Available In this paper we present a pipeline for high quality semantic segmentation of building facades using Structured Random Forest (SRF, Region Proposal Network (RPN based on a Convolutional Neural Network (CNN as well as rectangular fitting optimization. Our main contribution is that we employ features created by the RPN as channels in the SRF.We empirically show that this is very effective especially for doors and windows. Our pipeline is evaluated on two datasets where we outperform current state-of-the-art methods. Additionally, we quantify the contribution of the RPN and the rectangular fitting optimization on the accuracy of the result.

  11. ATR-FTIR as a potential tool for controlling high quality vinegar categories

    DEFF Research Database (Denmark)

    Ríos-Reina, Rocío; Callejón, Raquel M.; Oliver-Pozo, Celia

    2017-01-01

    potential as a rapid, cost-effective and non-destructive tool for characterizing different categories of high-quality vinegars. Spectra from 67 wine vinegars belonging to the PDOs “Vinagre de Jerez” and “Vinagre Condado de Huelva”, including their different established categories, were analyzed in the 4000......–600 cm−1 infrared region. Changes associated to categories were observed in the region 1800–900 cm−1. These changes were assigned to certain compounds that increase during aging (e.g. acetic acids, alcohols, esters) or are characteristic of Pedro Ximenez category (e.g. sugars, furfural). Principal...

  12. High-quality fiber fabrication in buffered hydrofluoric acid solution with ultrasonic agitation.

    Science.gov (United States)

    Zhong, Nianbing; Liao, Qiang; Zhu, Xun; Wang, Yongzhong; Chen, Rong

    2013-03-01

    An etching method for preparing high-quality fiber-optic sensors using a buffered etchant with ultrasonic agitation is proposed. The effects of etching conditions on the etch rate and surface morphology of the etched fibers are investigated. The effect of surface roughness is discussed on the fibers' optical properties. Linear etching behavior and a smooth fiber surface can be repeatedly obtained by adjusting the ultrasonic power and etchant pH. The fibers' spectral quality is improved as the ratio of the pit depth to size decreases, and the fibers with smooth surfaces are more sensitive to a bacterial suspension than those with rough surfaces.

  13. THE ACADEMIC PERSONNEL MOTIVATION - A FACTOR FOR HIGH QUALITY EDUCATIONAL PRODUCT

    Directory of Open Access Journals (Sweden)

    Viara Slavianska

    2014-06-01

    Full Text Available The present paper consecutively puts an accent on 1 the quality of higher education as a national priority, 2 the qualification and motivation of the academic staff as factors for offering an educational product of high quality, 3 the strategies, policies and practices for motivating the academic personnel. The necessity of education improvement is adduced, the strategies and politics in the field of academic personnel training are presented, and the possible effects from a wrong approach to employees’ motivation in academic environment are commented.

  14. Low index contrast heterostructure photonic crystal cavities with high quality factors and vertical radiation coupling

    Science.gov (United States)

    Ge, Xiaochen; Minkov, Momchil; Fan, Shanhui; Li, Xiuling; Zhou, Weidong

    2018-04-01

    We report here design and experimental demonstration of heterostructure photonic crystal cavities resonating near the Γ point with simultaneous strong lateral confinement and highly directional vertical radiation patterns. The lateral confinement is provided by a mode gap originating from a gradual modulation of the hole radii. High quality factor resonance is realized with a low index contrast between silicon nitride and quartz. The near surface-normal directional emission is preserved when the size of the core region is scaled down. The influence of the cavity size parameters on the resonant modes is also investigated theoretically and experimentally.

  15. High quality-factor fano metasurface comprising a single resonator unit cell

    Science.gov (United States)

    Sinclair, Michael B.; Warne, Larry K.; Basilio, Lorena I.; Langston, William L.; Campione, Salvatore; Brener, Igal; Liu, Sheng

    2017-06-20

    A new monolithic resonator metasurface design achieves ultra-high Q-factors while using only one resonator per unit cell. The metasurface relies on breaking the symmetry of otherwise highly symmetric resonators to induce intra-resonator mixing of bright and dark modes (rather than inter-resonator couplings), and is scalable from the near-infrared to radio frequencies and can be easily implemented in dielectric materials. The resulting high-quality-factor Fano metasurface can be used in many sensing, spectral filtering, and modulation applications.

  16. A hybrid plasmonic microresonator with high quality factor and small mode volume

    International Nuclear Information System (INIS)

    Lu, Qijing; Chen, Daru; Wu, Genzhu; Peng, Baojin; Xu, Jiancheng

    2012-01-01

    We propose a novel hybrid plasmonic microcavity which is composed of a silver nanoring and a silica toroidal microcavity. The hybrid mode of the proposed hybrid plasmonic microcavity due to the coupling between the surface plasmon polaritons (SPPs) and the dielectric mode is demonstrated with a high quality factor (>1000) and an ultrasmall mode volume (∼0.8 μm 3 ). This microcavity shows great potential in fundamental studies of nonlinear optics and cavity quantum electrodynamics (cQED) and applications in low-threshold plasmonic microlasers. (paper)

  17. Expression of the epidermal growth factor system in eutopic endometrium from women with endometriosis differs from that in endometrium from healthy women

    DEFF Research Database (Denmark)

    Ejskjaer, Kirsten; Sorensen, Boe Sandahl; Poulsen, Steen Seier

    2008-01-01

    BACKGROUND: The epidermal growth factor (EGF) system comprises four receptors, HER1-4, and several ligands, and is cyclically expressed in endometrium from healthy fertile women. Our aim is to identify differences in expression of the EGF system between endometriotic and normal endometrium. METHODS......: We previously examined the EGF system in endometrial samples from healthy women (n = 14). Here we examine samples from endometrium (n = 23), endometriomas (n = 10) and peritoneal endometriosis (n = 9) from women with endometriosis (n = 23). mRNA expression of receptors and ligands from the EGF system...... was analyzed by real-time PCR, and proteins were localized by immunohistochemistry. RESULTS: Endometrial mRNA for HER1-3 was high compared with our previous findings in healthy endometrium, whereas HER4 and the ligands were unchanged. Endometriomas show lower expression of HER1-3 and no HER4 expression...

  18. PANC-1 pancreatic cancer cell growth inhibited by cucurmosin alone and in combination with an epidermal growth factor receptor-targeted drug.

    Science.gov (United States)

    Wang, Congfei; Yang, Aiqin; Zhang, Baoming; Yin, Qiang; Huang, Heguang; Chen, Minghuang; Xie, Jieming

    2014-03-01

    To investigate the inhibition of PANC-1 pancreatic cancer cell growth by cucurmosin (CUS) and its possible mechanism. We observed the inhibition of PANC-1 cell growth by sulforhodamine B and colony-forming experiments in vitro and established nonobese diabetic/severe combined immunodeficiency mouse subcutaneous tumor models in vivo. We used Western blot to analyze protein levels related to apoptosis and epidermal growth factor receptor (EGFR) signaling pathways after drug intervention, whereas the messenger RNA expression of EGFR was analyzed by quantitative real-time polymerase chain reaction. Sulforhodamine B and colony-forming experiments indicated that CUS inhibited PANC-1 cell proliferation in a dose- and time-dependent manner. A stronger inhibitory effect was observed when CUS was combined with gefitinib. The subcutaneous tumor growth was also inhibited. Western blot showed that all the examined proteins decreased, except for 4E-BP1 and the active fragments of caspase 3 and caspase 9 increased. Epidermal growth factor receptor expression did not change significantly in quantitative real-time polymerase chain reaction. Cucurmosin can strongly inhibit the growth of PANC-1 cells in vitro and in vivo. Cucurmosin can down-regulate EGFR protein expression, but not at the messenger RNA level. Cucurmosin can also inhibit the ras/raf and phosphatidylinositol 3-kinase/Akt downstream signaling pathways and enhance the sensitivity of the EGFR-targeted drug gefitinib.

  19. Cellular localization of transforming growth factor-alpha mRNA in rat forebrain.

    Science.gov (United States)

    Seroogy, K B; Lundgren, K H; Lee, D C; Guthrie, K M; Gall, C M

    1993-05-01

    The cellular localization of transforming growth factor-alpha (TGF alpha) mRNA in juvenile and adult rat forebrain was examined using in situ hybridization with a 35S-labeled cRNA probe. TGF alpha cRNA-labeled neuronal perikarya were distributed across many forebrain regions including the olfactory bulb, caudate-putamen, nucleus accumbens, olfactory tubercle, ventral pallidum, amygdala, hippocampal stratum granulosum and CA3 stratum pyramidale, and piriform, entorhinal, and retrosplenial cortices. TGF alpha cRNA-hybridizing cells were also localized to several thalamic nuclei and to the suprachiasmatic, dorsomedial, and ventromedial nuclei of the hypothalamus. In addition, labeled cells were present in regions of white matter including the corpus callosum, anterior commissure, internal and external capsules, optic tract, and lateral olfactory tract. Thus, both neurons and glia appear to synthesize TGF alpha in normal brain. Hybridization densities were greater in neuronal fields at 2 weeks of age compared with the adult, suggesting a role for TGF alpha in the development of several forebrain systems. Our results demonstrating the prominent and wide-spread expression of TGF alpha mRNA in forebrain, combined with the extremely low abundance of epidermal growth factor mRNA in brain, support the argument that TGF alpha is the principal endogenous ligand for the epidermal growth factor receptor in normal brain.

  20. Perforated Sigmoid Diverticulitis in the Presence of Toxic Epidermal Necrolysis

    Directory of Open Access Journals (Sweden)

    P. Heye

    2014-02-01

    Full Text Available Even though the incidence of toxic epidermal necrolysis (TEN is low, it is also associated with a high mortality rate. The condition predominantly affects the skin, but may also affect the gastrointestinal tract, dramatically increasing mortality. We present a case of perforated sigmoid diverticulitis in the presence of TEN. The patient was taking medication, known to be a risk factor, and presented an affected total body surface area and temporal development similar to previously reported cases of TEN. Characteristic abdominal symptoms, however, were missing. Gastrointestinal involvement in TEN appears to be a poor prognostic factor; medical staff must therefore be alert to patients with TEN who complain of abdominal discomfort. The exact pathogenesis, however, remains unclear.

  1. Epidermal Growth Factor Receptor (EGFR) Crosstalks in Liver Cancer

    International Nuclear Information System (INIS)

    Berasain, Carmen; Latasa, María Ujue; Urtasun, Raquel; Goñi, Saioa; Elizalde, María; Garcia-Irigoyen, Oihane; Azcona, María; Prieto, Jesús; Ávila, Matías A.

    2011-01-01

    Hepatocarcinogenesis is a complex multistep process in which many different molecular pathways have been implicated. Hepatocellular carcinoma (HCC) is refractory to conventional chemotherapeutic agents, and the new targeted therapies are meeting with limited success. Interreceptor crosstalk and the positive feedback between different signaling systems are emerging as mechanisms of targeted therapy resistance. The identification of such interactions is therefore of particular relevance to improve therapeutic efficacy. Among the different signaling pathways activated in hepatocarcinogenesis the epidermal growth factor receptor (EGFR) system plays a prominent role, being recognized as a “signaling hub” where different extracellular growth and survival signals converge. EGFR can be transactivated in response to multiple heterologous ligands through the physical interaction with multiple receptors, the activity of intracellular kinases or the shedding of EGFR-ligands. In this article we review the crosstalk between the EGFR and other signaling pathways that could be relevant to liver cancer development and treatment

  2. Epidermal segmentation in high-definition optical coherence tomography.

    Science.gov (United States)

    Li, Annan; Cheng, Jun; Yow, Ai Ping; Wall, Carolin; Wong, Damon Wing Kee; Tey, Hong Liang; Liu, Jiang

    2015-01-01

    Epidermis segmentation is a crucial step in many dermatological applications. Recently, high-definition optical coherence tomography (HD-OCT) has been developed and applied to imaging subsurface skin tissues. In this paper, a novel epidermis segmentation method using HD-OCT is proposed in which the epidermis is segmented by 3 steps: the weighted least square-based pre-processing, the graph-based skin surface detection and the local integral projection-based dermal-epidermal junction detection respectively. Using a dataset of five 3D volumes, we found that this method correlates well with the conventional method of manually marking out the epidermis. This method can therefore serve to effectively and rapidly delineate the epidermis for study and clinical management of skin diseases.

  3. Epidermal growth factor receptor in primary human lung cancer

    International Nuclear Information System (INIS)

    Yu Xueyan; Hu Guoqiang; Tian Keli; Wang Mingyun

    1996-01-01

    Cell membranes were prepared from 12 human lung cancers for the study of the expression of epidermal growth factor receptors (EGFR). EGFR concentration was estimated by ligand binding studies using 125 I-radiolabeled EGF. The dissociation constants of the high affinity sites were identical, 1.48 nmol and 1.1 nmol in cancer and normal lung tissues, the EGFR contents were higher in lung cancer tissues (range: 2.25 to 19.39 pmol·g -1 membrane protein) than that in normal tissues from the same patients (range: 0.72 to 7.43 pmol·g -1 membrane protein). These results suggest that EGF and its receptor may play a role in the regulatory mechanisms in the control of lung cellular growth and tumor promotion

  4. Exudative epidermitis in pigs caused by toxigenic Staphylococcus chromogenes

    DEFF Research Database (Denmark)

    Andresen, Lars Ole; Ahrens, Peter; Daugaard, Lise

    2005-01-01

    Staphylococcus chromogenes is closely related to Staphylococcus hyicus, which is recognised as the causative agent of exudative epidermitis (EE) in pigs. S. chromogenes is part of the normal skin flora of pigs, cattle and poultry and has so far been considered non-pathogenic to pigs. A strain of S....... chromogenes producing exfoliative toxin type B, ExhB, was identified by the use of a multiplex PCR specific for the exfoliative toxins from S. hyicus. The exfoliative toxin from S. chromogenes reacted in immunoblot analysis with polyclonal and monoclonal antibodies specific to ExhB from S. hyicus and had...... an apparent molecular weight of 30 kDa. Sequencing the gene encoding the exfoliative toxin from S. chromogenes revealed that the molecular weight of the toxin with the signal peptide and the mature toxin was 30,553 and 26,694 Da, respectively. Comparison of the exhB genes from S. chromogenes strain VA654...

  5. EPIDERMAL CHARACTERS OF BACCHARIS (ASTERACEAE SPECIES USED IN TRADITIONAL MEDICINE

    Directory of Open Access Journals (Sweden)

    FREIRE SUSANA E.

    2007-06-01

    Full Text Available A morphological study of 38 species of Baccharis used in traditional medicinewas carried out to provide some epidermal characters that will contribute to theknowledge of the genus. The present study revealed: 1 seven different types oftrichomes: conical, aseptate fl agellate, fi liform fl agellate, 1-armed, 2-4-armed,bulbiferous fl agellate, and glandular biseriate; 2 that 28 of the total of 38 specieshave trichomes in tufts; 3 six different types of stomata: anomocytic, anisocytic,cyclocytic, actinocytic, tetracytic, and staurocytic; 4 that some trichome types,such as 2-4-armed (B. dracunculifolia and aseptate fl agellate branched (B. trinervis,show a high diagnostic value; 5 that the stomata types can be used to differentiatespecies with similar trichomes type (e.g. B. trimera and B. articulata.Illustrations of the studied characters are provided.

  6. Epidermal growth factor pathway substrate 15, Eps15

    DEFF Research Database (Denmark)

    Salcini, A E; Chen, H; Iannolo, G

    1999-01-01

    Eps15 was originally identified as a substrate for the kinase activity of the epidermal growth factor receptor (EGFR). Eps15 has a tripartite structure comprising a NH2-terminal portion, which contains three EH domains, a central putative coiled-coil region, and a COOH-terminal domain containing...... multiple copies of the amino acid triplet Aspartate-Proline-Phenylalanine. A pool of Eps15 is localized at clathrin coated pits where it interacts with the clathrin assembly complex AP-2 and a novel AP-2 binding protein, Epsin. Perturbation of Eps15 and Epsin function inhibits receptor-mediated endocytosis...... of EGF and transferrin, demonstrating that both proteins are components of the endocytic machinery. Since the family of EH-containing proteins is implicated in various aspects of intracellular sorting, biomolecular strategies aimed at interfering with these processes can now be envisioned...

  7. Effect of glucocorticoids and gamma radiation on epidermal Langerhans cells

    International Nuclear Information System (INIS)

    Belsito, D.V.; Baer, R.L.; Thorbecke, G.J.; Gigli, I.

    1984-01-01

    The effect of 750 rads of gamma radiation on the rate of return of epidermal Langerhans cells (LC) following suppressive doses of topical glucorticoids was studied in guinea pigs. Gamma radiation alone had no effect on the LC as assessed by staining for cell membrane ATPase activity and Ia antigen. It did, however, delay the expected return of Ia but not ATPase surface markers on the LC after perturbation with glucocorticoids. The delayed return of surface Ia antigen is possibly related to a radiation-induced defect in the production of a required lymphokine and/or in intracellular Ia transport. Although our data do not rule out a cytolytic effect of steroids on the LC, they do strongly suggest that, at least in part, glucocorticoids act on the LC by altering cell surface characteristics

  8. Collagen sheet dressings for cutaneous lesions of toxic epidermal necrolysis

    Directory of Open Access Journals (Sweden)

    S Bhattacharya

    2011-01-01

    Full Text Available Toxic epidermal necrolysis (TEN is associated with a significant mortality of 30-50% and long-term sequelae. Treatment includes early admission to a burn unit, where management with precise fluid, electrolyte, protein, and energy supplementation, moderate mechanical ventilation, and expert wound care can be provided. Specific treatment with immunosuppressive drugs or immunoglobulins did not show an improved outcome in most studies and remains controversial. We have treated the cutaneous lesions of seven patients of TEN with collagen sheet dressings and have found a significant reduction in morbidity. The sheets are a one-time dressing, easy to apply and they reduce fluid loss, prevent infection, reduce pain, avoid repeated dressings and gradually peal off as the underlying lesions heal.

  9. Epidermal differential impedance sensor for conformal skin hydration monitoring.

    Science.gov (United States)

    Huang, Xian; Yeo, Woon-Hong; Liu, Yuhao; Rogers, John A

    2012-12-01

    We present the design and use of an ultrathin, stretchable sensor system capable of conformal lamination onto the skin, for precision measurement and spatial mapping of levels of hydration. This device, which we refer to as a class of 'epidermal electronics' due to its 'skin-like' construction and mode of intimate integration with the body, contains miniaturized arrays of impedance-measurement electrodes arranged in a differential configuration to compensate for common-mode disturbances. Experimental results obtained with different frequencies and sensor geometries demonstrate excellent precision and accuracy, as benchmarked against conventional, commercial devices. The reversible, non-invasive soft contact of this device with the skin makes its operation appealing for applications ranging from skin care, to athletic monitoring to health/wellness assessment.

  10. Toxic epidermal necrolysis associated with deflazacort therapy with nephrotic syndrome

    Directory of Open Access Journals (Sweden)

    Eun Chae Lee

    2014-12-01

    Full Text Available Toxic epidermal necrolysis (TEN is a drug-related fatal disease. Extensive necrosis of the epidermis can lead to serious complications. This report describes two cases of TEN, associated with deflazacort (DFZ, in two boys, aged 4 years and 14 years, with nephrotic syndrome (NS. The 14-year-old male teenager received DFZ following NS relapse. After 17 days, pruritic papules appeared on the lower extremities. Another case involved a 4-year-old boy receiving DFZ and enalapril. After a 41-day DFZ treatment period, erythematous papules appeared on the palms and soles. Within 3 days, both boys developed widespread skin lesions (>50% and were admitted to the intensive care unit for resuscitative and supportive treatment. The patients showed improvement after intravenous immunoglobulin-G therapy. Owing to the rapid, fatal course of TEN, clinicians need to be aware of the adverse effects of this drug when treating cases of NS.

  11. An improved multi-exposure approach for high quality holographic femtosecond laser patterning

    International Nuclear Information System (INIS)

    Zhang, Chenchu; Hu, Yanlei; Li, Jiawen; Lao, Zhaoxin; Ni, Jincheng; Chu, Jiaru; Huang, Wenhao; Wu, Dong

    2014-01-01

    High efficiency two photon polymerization through single exposure via spatial light modulator (SLM) has been used to decrease the fabrication time and rapidly realize various micro/nanostructures, but the surface quality remains a big problem due to the speckle noise of optical intensity distribution at the defocused plane. Here, a multi-exposure approach which used tens of computer generate holograms successively loaded on SLM is presented to significantly improve the optical uniformity without losing efficiency. By applying multi-exposure, we found that the uniformity at the defocused plane was increased from ∼0.02 to ∼0.6 according to our simulation. The fabricated two series of letters “HELLO” and “USTC” under single-and multi-exposure in our experiment also verified that the surface quality was greatly improved. Moreover, by this method, several kinds of beam splitters with high quality, e.g., 2 × 2, 5 × 5 Daman, and complex nonseperate 5 × 5, gratings were fabricated with both of high quality and short time (<1 min, 95% time-saving). This multi-exposure SLM-two-photon polymerization method showed the promising prospect in rapidly fabricating and integrating various binary optical devices and their systems

  12. High-quality GaN nanowires grown on Si and porous silicon by thermal evaporation

    Energy Technology Data Exchange (ETDEWEB)

    Shekari, L., E-mail: lsg09_phy089@student.usm.my [Nano-Optoelectronics Research and Technology Laboratory, School of Physics, Universiti Sains Malaysia, 11800 USM, Penang (Malaysia); Ramizy, A.; Omar, K.; Hassan, H. Abu; Hassan, Z. [Nano-Optoelectronics Research and Technology Laboratory, School of Physics, Universiti Sains Malaysia, 11800 USM, Penang (Malaysia)

    2012-12-15

    Highlights: Black-Right-Pointing-Pointer A new kind of substrate (porous silicon) was used. Black-Right-Pointing-Pointer Also this research introduces an easy and safe method to grow high quality GaN NWs. Black-Right-Pointing-Pointer This is a new growth process to decrease the cost, complexity of growth of GaN NWs. Black-Right-Pointing-Pointer It is a controllable method to synthesize GaN NWs by thermal evaporation. - Abstract: Nanowires (NWs) of GaN thin films were prepared on as-grown Si (1 1 1) and porous silicon (PS) substrates using thermal evaporation method. The film growth produced high-quality wurtzite GaN NWs. The size, morphology, and nanostructures of the crystals were investigated through scanning electron microscopy, high-resolution X-ray diffraction and photoluminescence spectroscopy. The NWs grown on porous silicon were thinner, longer and denser compared with those on as-grown Si. The energy band gap of the NWs grown on PS was larger than that of NWs on as-grown Si. This is due to the greater quantum confinement effects of the crystalline structure of the NWs grown on PS.

  13. Achieving graphical excellence: suggestions and methods for creating high-quality visual displays of experimental data.

    Science.gov (United States)

    Schriger, D L; Cooper, R J

    2001-01-01

    Graphics are an important means of communicating experimental data and results. There is evidence, however, that many of the graphics printed in scientific journals contain errors, redundancies, and lack clarity. Perhaps more important, many graphics fail to portray data at an appropriate level of detail, presenting summary statistics rather than underlying distributions. We seek to aid investigators in the production of high-quality graphics that do their investigations justice by providing the reader with optimum access to the relevant aspects of the data. The depiction of by-subject data, the signification of pairing when present, and the use of symbolic dimensionality (graphing different symbols to identify relevant subgroups) and small multiples (the presentation of an array of similar graphics each depicting one group of subjects) to portray stratification are stressed. Step-by-step instructions for the construction of high-quality graphics are offered. We hope that authors will incorporate these suggestions when developing graphics to accompany their manuscripts and that this process will lead to improvements in the graphical literacy of scientific journals. We also hope that journal editors will keep these principles in mind when refereeing manuscripts submitted for peer review.

  14. The perspective awareness model - Eliciting multiple perspectives to formulate high quality decisions

    International Nuclear Information System (INIS)

    Boucher, Laurel

    2013-01-01

    A great deal of attention is given to the importance of communication in environmental remediation and radioactive waste management. However, very little attention is given to eliciting multiple perspectives so as to formulate high quality decisions. Plans that are based on a limited number of perspectives tend to be narrowly focused whereas those that are based on a wide variety of perspectives tend to be comprehensive, higher quality, and more apt to be put into application. In addition, existing methods of dialogue have built-in limitations in that they typically draw from the predominant thinking patterns which focus in some areas but ignore others. This can result in clarity but a lack of comprehensiveness. This paper presents a Perspective Awareness Model which helps groups such as partnering teams, interagency teams, steering committees, and working groups elicit a wide net of perspectives and viewpoints. The paper begins by describing five factors that makes cooperation among such groups challenging. Next, a Perspective Awareness Model that makes it possible to manage these five factors is presented. The two primary components of this model --- the eight 'Thinking Directions' and the 'Shared Documentation' --- are described in detail. Several examples are given to illustrate how the Perspective Awareness Model can be used to elicit multiple perspectives to formulate high quality decisions in the area of environmental remediation and radioactive waste management. (authors)

  15. High-quality ZnO growth, doping, and polarization effect

    Science.gov (United States)

    Kun, Tang; Shulin, Gu; Jiandong, Ye; Shunming, Zhu; Rong, Zhang; Youdou, Zheng

    2016-03-01

    The authors have reported their recent progress in the research field of ZnO materials as well as the corresponding global advance. Recent results regarding (1) the development of high-quality epitaxy techniques, (2) the defect physics and the Te/N co-doping mechanism for p-type conduction, and (3) the design, realization, and properties of the ZnMgO/ZnO hetero-structures have been shown and discussed. A complete technology of the growth of high-quality ZnO epi-films and nano-crystals has been developed. The co-doping of N plus an iso-valent element to oxygen has been found to be the most hopeful path to overcome the notorious p-type hurdle. High mobility electrons have been observed in low-dimensional structures utilizing the polarization of ZnMgO and ZnO. Very different properties as well as new physics of the electrons in 2DEG and 3DES have been found as compared to the electrons in the bulk. Project supported by the National Natural Science Foundation of China (Nos. 61025020, 61274058, 61322403, 61504057, 61574075), the Natural Science Foundation of Jiangsu Province (Nos. BK2011437, BK20130013, BK20150585), the Priority Academic Program Development of Jiangsu Higher Education Institutions, and the Fundamental Research Funds for the Central Universities.

  16. Development of a biotechnological process for the production of high quality linen fibers.

    Science.gov (United States)

    Valladares Juárez, Ana Gabriela; Rost, Gernot; Heitmann, Uwe; Heger, Egon; Müller, Rudolf

    2011-10-01

    A novel biotechnological process for the production of high-quality flax fibers was developed. In this process, decorticated fibers from green flax were washed with 0.5% soda solution and treated with the pectinolytic strain Geobacillus thermoglucosidasius PB94A. Before drying the fibers, they were treated with the textile softener Adulcinol BUN. If the fibers contained contaminant shives, a bleaching step with hydrogen peroxide was performed before the softener treatment. In experiments where fibers were treated by the new process, and in which the bacterial solutions were reused seven times, the fiber quality was similar in all batches. The resolution of the treated fibers was 2.7 ± 0.4 and the fineness was 11.1 ± 1.1 dtex, while the starting material had a resolution of 7.3 and a fineness of 37 dtex. The new biotechnological treatment eliminates the weather-associated risks of the traditional fiber retting completely and produces consistently high-quality fibers that can be used to produce fine linen yarns.

  17. High quality voice synthesis middle ware; Kohinshitsu onsei gosei middle war

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2000-03-01

    Toshiba Corp. newly developed a natural voice synthesis system, TOS Drive TTS (TOtally speaker Driven Text-To-Speech) system, in which natural high-quality read-aloud is greatly improved, and also developed as its application a voice synthesis middle ware. In the newly developed system, using as a model a narrator's voice recorded preliminarily, a metrical control dictionary is automatically learned that reproduces the characteristics of metrical patters such as intonation or rhythm of a human voice, as is a voice bases dictionary that reproduces the characteristics of a voice quality, enabling natural voice synthesis to be realized that picks up human voice characteristics. The system is high quality and also very compact, while the voice synthesis middle ware utilizing this technology is adaptable to various platforms such as MPU or OS. The system is very suitable for audio response in the ITS field having car navigation systems as the core; besides, expanded application is expected to an audio response system that used to employ a sound recording and reproducing system. (translated by NEDO)

  18. Different paths to high-quality care: three archetypes of top-performing practice sites.

    Science.gov (United States)

    Feifer, Chris; Nemeth, Lynne; Nietert, Paul J; Wessell, Andrea M; Jenkins, Ruth G; Roylance, Loraine; Ornstein, Steven M

    2007-01-01

    Primary care practices use different approaches in their quest for high-quality care. Previous work in the Practice Partner Research Network (PPRNet) found that improved outcomes are associated with strategies to prioritize performance, involve staff, redesign elements of the delivery system, make patients active partners in guideline adherence, and use tools embedded in the electronic medical record. The aim of this study was to examine variations in the adoption of improvements among sites achieving the best outcomes. This study used an observational case study design. A practice-level measure of adherence to clinical guidelines was used to identify the highest performing practices in a network of internal and family medicine practices participating in a national demonstration project. We analyzed qualitative and quantitative information derived from project documents, field notes, and evaluation questionnaires to develop and compare case studies. Nine cases are described. All use many of the same improvement strategies. Differences in the way improvements are organized define 3 distinct archetypes: the Technophiles, the Motivated Team, and the Care Enterprise. There is no single approach that explains the superior performance of high-performing practices, though each has adopted variations of PPRNet's improvement model. Practices will vary in their path to high-quality care. The archetypes could prove to be a useful guide to other practices selecting an overall quality improvement approach.

  19. Angle-resolved reflection spectroscopy of high-quality PMMA opal crystal

    Science.gov (United States)

    Nemtsev, Ivan V.; Tambasov, Igor A.; Ivanenko, Alexander A.; Zyryanov, Victor Ya.

    2018-02-01

    PMMA opal crystal was prepared by a simple hybrid method, which includes sedimentation, meniscus formation and evaporation. We investigated three surfaces of this crystal by angle-resolved reflective light spectroscopy and SEM study. The angle-resolved reflective measurements were carried out in the 400-1100 nm range. We have determined the high-quality ordered surface of the crystal region. Narrow particle size distribution of the surface has been revealed. The average particle diameter obtained with SEM was nearly 361 nm. The most interesting result was that reflectivity of the surface turned out up to 98% at normal light incidence. Using a fit of dependences of the maximum reflectivity wavelength from an angle based on the Bragg-Snell law, the wavelength of maximum 0° reflectivity, the particle diameter and the fill factor have been determined. For the best surface maximum reflectivity wavelength of a 0° angle was estimated to be 869 nm. The particle diameter and fill factor were calculated as 372 nm and 0.8715, respectively. The diameter obtained by fitting is in excellent agreement with the particle diameter obtained with SEM. The reflectivity maximum is assumed to increase significantly when increasing the fill factor. We believe that using our simple approach to manufacture PMMA opal crystals will significantly increase the fabrication of high-quality photonic crystal templates and thin films.

  20. Comparison of reduced sugar high quality chocolates sweetened with stevioside and crude stevia 'green' extract.

    Science.gov (United States)

    Torri, Luisa; Frati, Alessandra; Ninfali, Paolino; Mantegna, Stefano; Cravotto, Giancarlo; Morini, Gabriella

    2017-06-01

    The demand for zero and reduced-sugar food products containing cocoa is expanding continuously. The present study was designed to evaluate the feasibility of producing high-quality chocolate sweetened with a crude extract of Stevia rebaudiana (Bertoni) prepared by a green microwave-assisted water-steam extraction procedure. Seven approximately isosweet chocolate formulations were developed, mixing cocoa paste, sucrose, commercial stevioside, crude green extract and maltitol in different proportions. All samples were analyzed for the determination of polyphenol and flavonoid content, antioxidant activity, and sensory acceptability. The use of a crude stevia extract allowed low-sugar, high-quality chocolates to be obtained that were also acceptable by consumers and had a significant increased antioxidant activity. Moreover, consumers' segmentation revealed a cluster of consumers showing the same overall liking for the sample with 50% sucrose replaced by the stevia crude extract as that obtained with the commercial stevioside and the control sample (without sucrose replacement). The results provide information that can contribute to promoting the development of sweet food products, with advantages in terms of an improved nutritional value (reduced sugar content and increased antioxidant activity) and a reduced impact of the production process on the environment. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.

  1. Effect of osmotic dehydration and vacuum-frying parameters to produce high-quality mango chips.

    Science.gov (United States)

    Nunes, Yolanda; Moreira, Rosana G

    2009-09-01

    Mango (Mangifera indica L.) is a fruit rich in flavor and nutritional values, which is an excellent candidate for producing chips. The objective of this study was to develop high-quality mango chips using vacuum frying. Mango ("Tommy Atkins") slices were pretreated with different maltodextrin concentrations (40, 50, and 65, w/v), osmotic dehydration times (45, 60, and 70 min), and solution temperatures (22 and 40 degrees C). Pretreated slices were vacuum fried at 120, 130, and 138 degrees C and product quality attributes (oil content, texture, color, carotenoid content) determined. The effect of frying temperatures at optimum osmotic dehydration times (65 [w/v] at 40 degrees C) was assessed. All samples were acceptable (scores > 5) to consumer panelists. The best mango chips were those pretreated with 65 (w/v) concentration for 60 min and vacuum fried at 120 degrees C. Mango chips under atmospheric frying had less carotenoid retention (32%) than those under vacuum frying (up to 65%). These results may help further optimize vacuum-frying processing of high-quality fruit-based snacks.

  2. Fabrication of high-quality single-crystal Cu thin films using radio-frequency sputtering.

    Science.gov (United States)

    Lee, Seunghun; Kim, Ji Young; Lee, Tae-Woo; Kim, Won-Kyung; Kim, Bum-Su; Park, Ji Hun; Bae, Jong-Seong; Cho, Yong Chan; Kim, Jungdae; Oh, Min-Wook; Hwang, Cheol Seong; Jeong, Se-Young

    2014-08-29

    Copper (Cu) thin films have been widely used as electrodes and interconnection wires in integrated electronic circuits, and more recently as substrates for the synthesis of graphene. However, the ultra-high vacuum processes required for high-quality Cu film fabrication, such as molecular beam epitaxy (MBE), restricts mass production with low cost. In this work, we demonstrated high-quality Cu thin films using a single-crystal Cu target and radio-frequency (RF) sputtering technique; the resulting film quality was comparable to that produced using MBE, even under unfavorable conditions for pure Cu film growth. The Cu thin film was epitaxially grown on an Al2O3 (sapphire) (0001) substrate, and had high crystalline orientation along the (111) direction. Despite the 10(-3) Pa vacuum conditions, the resulting thin film was oxygen free due to the high chemical stability of the sputtered specimen from a single-crystal target; moreover, the deposited film had >5× higher adhesion force than that produced using a polycrystalline target. This fabrication method enabled Cu films to be obtained using a simple, manufacturing-friendly process on a large-area substrate, making our findings relevant for industrial applications.

  3. Catalytic pyrolysis of microalgae to high-quality liquid bio-fuels

    International Nuclear Information System (INIS)

    Babich, I.V.; Hulst, M. van der; Lefferts, L.; Moulijn, J.A.; O'Connor, P.; Seshan, K.

    2011-01-01

    The pyrolytic conversion of chlorella algae to liquid fuel precursor in presence of a catalyst (Na 2 CO 3 ) has been studied. Thermal decomposition studies of the algae samples were performed using TGA coupled with MS. Liquid oil samples were collected from pyrolysis experiments in a fixed-bed reactor and characterized for water content and heating value. The oil composition was analyzed by GC-MS. Pretreatment of chlorella with Na 2 CO 3 influences the primary conversion of chlorella by shifting the decomposition temperature to a lower value. In the presence of Na 2 CO 3 , gas yield increased and liquid yield decreased when compared with non-catalytic pyrolysis at the same temperatures. However, pyrolysis oil from catalytic runs carries higher heating value and lower acidity. Lower content of acids in the bio-oil, higher aromatics, combined with higher heating value show promise for production of high-quality bio-oil from algae via catalytic pyrolysis, resulting in energy recovery in bio-oil of 40%. -- Highlights: → The pyrolytic catalytic conversion of chlorella algae to liquid fuel precursor. → Na 2 CO 3 as a catalyst for the primary conversion of chlorella. → Pyrolysis oil from catalytic runs carries higher heating value and lower acidity. → High-quality bio-oil from algae via catalytic pyrolysis with energy recovery in bio-oil of 40%.

  4. An improved multi-exposure approach for high quality holographic femtosecond laser patterning

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Chenchu; Hu, Yanlei, E-mail: huyl@ustc.edu.cn, E-mail: jwl@ustc.edu.cn; Li, Jiawen, E-mail: huyl@ustc.edu.cn, E-mail: jwl@ustc.edu.cn; Lao, Zhaoxin; Ni, Jincheng; Chu, Jiaru; Huang, Wenhao; Wu, Dong [Department of Precision Machinery and Precision Instrumentation, University of Science and Technology of China, Hefei 230026 (China)

    2014-12-01

    High efficiency two photon polymerization through single exposure via spatial light modulator (SLM) has been used to decrease the fabrication time and rapidly realize various micro/nanostructures, but the surface quality remains a big problem due to the speckle noise of optical intensity distribution at the defocused plane. Here, a multi-exposure approach which used tens of computer generate holograms successively loaded on SLM is presented to significantly improve the optical uniformity without losing efficiency. By applying multi-exposure, we found that the uniformity at the defocused plane was increased from ∼0.02 to ∼0.6 according to our simulation. The fabricated two series of letters “HELLO” and “USTC” under single-and multi-exposure in our experiment also verified that the surface quality was greatly improved. Moreover, by this method, several kinds of beam splitters with high quality, e.g., 2 × 2, 5 × 5 Daman, and complex nonseperate 5 × 5, gratings were fabricated with both of high quality and short time (<1 min, 95% time-saving). This multi-exposure SLM-two-photon polymerization method showed the promising prospect in rapidly fabricating and integrating various binary optical devices and their systems.

  5. Frequency of chromosomal aneuploidy in high quality embryos from young couples using preimplantation genetic screening

    Directory of Open Access Journals (Sweden)

    Farzaneh Fesahat

    2017-09-01

    Full Text Available Background: Selection of the best embryo for transfer is very important in assisted reproductive technology (ART. Using morphological assessment for this selection demonstrated that the correlation between embryo morphology and implantation potential is relatively weak. On the other hand, aneuploidy is a key genetic factor that can influence human reproductive success in ART. Objective: The aim of this lab trial study was to evaluate the incidence of aneuploidies in five chromosomes in the morphologically high-quality embryos from young patients undergoing ART for sex selection. Materials and Methods: A total of 97 high quality embryos from 23 women at the age of 37or younger years that had previously undergone preimplantation genetic screening for sex selection were included in this study. After washing, the slides of blastomeres from embryos of patients were reanalyzed by fluorescence in-situ hybridization for chromosomes 13, 18 and 21. Results: There was a significant rate of aneuploidy determination in the embryos using preimplantation genetic screening for both sex and three evaluated autosomal chromosomes compared to preimplantation genetic screening for only sex chromosomes (62.9% vs. 24.7%, p=0.000. The most frequent detected chromosomal aneuploidy was trisomy or monosomy of chromosome 13. Conclusion: There is considerable numbers of chromosomal abnormalities in embryos generated in vitro which cause in vitro fertilization failure and it seems that morphological characterization of embryos is not a suitable method for choosing the embryos without these abnormalities

  6. The use of citation indicators to identify and support high-quality research in Poland.

    Science.gov (United States)

    Pilc, Andrzej

    2008-01-01

    In large, mostly English-speaking countries, where the "critical mass" of scientists working in different subfields of science is achieved, the peer review system may be sufficient to assess the quality of scientific research. However, in smaller countries, outside the Anglo-American circle, it is important to introduce different systems to identify research of high quality. In Poland, a parametric system for assessing the quality of research has been introduced. It was largely based on the impact factor of scientific journals. While the use of this indicator to assess research quality is highly questionable, the implementation of the system in the Polish reality is even worse. Therefore it is important to change and improve the system currently used by the Ministry of Science and Higher Education to both evaluate and, more importantly, finance science in Poland. Here, a system based on three factors, i.e. the impact factor, the institutional h-index, and the institutional number of citations, is proposed. The scientific quality of institutions in Division VI: Medical Sciences of the Polish Academy of Sciences were evaluated and the results were compared with the existing system. Moreover, a method to identify high-quality researchers and institutions at the national level based on the quantity of highly cited papers is shown. Additionally, an attempt to identify the highest quality Polish research on an international level is proposed. This is based on the number of individual citations, the individual h-index, the number of publications, and the priority of the discovery.

  7. Identify High-Quality Protein Structural Models by Enhanced K-Means.

    Science.gov (United States)

    Wu, Hongjie; Li, Haiou; Jiang, Min; Chen, Cheng; Lv, Qiang; Wu, Chuang

    2017-01-01

    Background. One critical issue in protein three-dimensional structure prediction using either ab initio or comparative modeling involves identification of high-quality protein structural models from generated decoys. Currently, clustering algorithms are widely used to identify near-native models; however, their performance is dependent upon different conformational decoys, and, for some algorithms, the accuracy declines when the decoy population increases. Results. Here, we proposed two enhanced K -means clustering algorithms capable of robustly identifying high-quality protein structural models. The first one employs the clustering algorithm SPICKER to determine the initial centroids for basic K -means clustering ( SK -means), whereas the other employs squared distance to optimize the initial centroids ( K -means++). Our results showed that SK -means and K -means++ were more robust as compared with SPICKER alone, detecting 33 (59%) and 42 (75%) of 56 targets, respectively, with template modeling scores better than or equal to those of SPICKER. Conclusions. We observed that the classic K -means algorithm showed a similar performance to that of SPICKER, which is a widely used algorithm for protein-structure identification. Both SK -means and K -means++ demonstrated substantial improvements relative to results from SPICKER and classical K -means.

  8. A Systematic Process for Developing High Quality SaaS Cloud Services

    Science.gov (United States)

    La, Hyun Jung; Kim, Soo Dong

    Software-as-a-Service (SaaS) is a type of cloud service which provides software functionality through Internet. Its benefits are well received in academia and industry. To fully utilize the benefits, there should be effective methodologies to support the development of SaaS services which provide high reusability and applicability. Conventional approaches such as object-oriented methods do not effectively support SaaS-specific engineering activities such as modeling common features, variability, and designing quality services. In this paper, we present a systematic process for developing high quality SaaS and highlight the essentiality of commonality and variability (C&V) modeling to maximize the reusability. We first define criteria for designing the process model and provide a theoretical foundation for SaaS; its meta-model and C&V model. We clarify the notion of commonality and variability in SaaS, and propose a SaaS development process which is accompanied with engineering instructions. Using the proposed process, SaaS services with high quality can be effectively developed.

  9. Key elements of high-quality practice organisation in primary health care: a systematic review.

    Science.gov (United States)

    Crossland, Lisa; Janamian, Tina; Jackson, Claire L

    2014-08-04

    To identify elements that are integral to high-quality practice and determine considerations relating to high-quality practice organisation in primary care. A narrative systematic review of published and grey literature. Electronic databases (PubMed, CINAHL, the Cochrane Library, Embase, Emerald Insight, PsycInfo, the Primary Health Care Research and Information Service website, Google Scholar) were searched in November 2013 and used to identify articles published in English from 2002 to 2013. Reference lists of included articles were searched for relevant unpublished articles and reports. Data were configured at the study level to allow for the inclusion of findings from a broad range of study types. Ten elements were most often included in the existing organisational assessment tools. A further three elements were identified from an inductive thematic analysis of descriptive articles, and were noted as important considerations in effective quality improvement in primary care settings. Although there are some validated tools available to primary care that identify and build quality, most are single-strategy approaches developed outside health care settings. There are currently no validated organisational improvement tools, designed specifically for primary health care, which combine all elements of practice improvement and whose use does not require extensive external facilitation.

  10. High-quality PVD graphene growth by fullerene decomposition on Cu foils.

    Science.gov (United States)

    Azpeitia, J; Otero-Irurueta, G; Palacio, I; Martinez, J I; Del Árbol, N Ruiz; Santoro, G; Gutiérrez, A; Aballe, L; Foerster, M; Kalbac, M; Vales, V; Mompeán, F J; García-Hernández, M; Martín-Gago, J A; Munuera, C; López, M F

    2017-08-01

    We present a new protocol to grow large-area, high-quality single-layer graphene on Cu foils at relatively low temperatures. We use C 60 molecules evaporated in ultra high vacuum conditions as carbon source. This clean environment results in a strong reduction of oxygen-containing groups as depicted by X-ray photoelectron spectroscopy (XPS). Unzipping of C 60 is thermally promoted by annealing the substrate at 800ºC during evaporation. The graphene layer extends over areas larger than the Cu crystallite size, although it is changing its orientation with respect to the surface in the wrinkles and grain boundaries, producing a modulated ring in the low energy electron diffraction (LEED) pattern. This protocol is a self-limiting process leading exclusively to one single graphene layer. Raman spectroscopy confirms the high quality of the grown graphene. This layer exhibits an unperturbed Dirac-cone with a clear n-doping of 0.77 eV, which is caused by the interaction between graphene and substrate. Density functional theory (DFT) calculations show that this interaction can be induced by a coupling between graphene and substrate at specific points of the structure leading to a local sp 3 configuration, which also contribute to the D-band in the Raman spectra.

  11. High quality TmIG films with perpendicular magnetic anisotropy grown by sputtering

    Science.gov (United States)

    Wu, C. N.; Tseng, C. C.; Yeh, S. L.; Lin, K. Y.; Cheng, C. K.; Fanchiang, Y. T.; Hong, M.; Kwo, J.

    Ferrimagnetic thulium iron garnet (TmIG) films grown on gadolinium gallium garnet substrates recently showed stress-induced perpendicular magnetic anisotropy (PMA), attractive for realization of quantum anomalous Hall effect (QAHE) of topological insulator (TI) films via the proximity effect. Moreover, current induced magnetization switching of Pt/TmIG has been demonstrated for the development of room temperature (RT) spintronic devices. In this work, high quality TmIG films (about 25nm) were grown by sputtering at RT followed by post-annealing. We showed that the film composition is tunable by varying the growth parameters. The XRD results showed excellent crystallinity of stoichiometric TmIG films with an out-of-plane lattice constant of 1.2322nm, a narrow film rocking curve of 0.017 degree, and a film roughness of 0.2 nm. The stoichiometric films exhibited PMA and the saturation magnetization at RT was 109 emu/cm3 (RT bulk value 110 emu/cm3) with a coercive field of 2.7 Oe. In contrast, TmIG films of Fe deficiency showed in-plane magnetic anisotropy. The high quality sputtered TmIG films will be applied to heterostructures with TIs or metals with strong spin-orbit coupling for novel spintronics.

  12. High-quality collection and disposal of WEEE: Environmental impacts and resultant issues.

    Science.gov (United States)

    Baxter, John; Lyng, Kari-Anne; Askham, Cecilia; Hanssen, Ole Jørgen

    2016-11-01

    Life cycle assessment of the collection, transport and recycling of various types of waste electrical and electronic equipment (WEEE) in Norway shows that small amounts of critical materials (refrigerants, precious/trace metals) are vital for the overall environmental accounts of the value chains. High-quality recycling ensures that materials and energy are effectively recovered from WEEE. This recovery means that responsible waste handling confers net environmental benefits in terms of global warming potential (GWP), for all types of WEEE analysed. For refrigeration equipment, the potential reduction of GWP by high-quality recycling is so large as to be of national significance. For all waste types, the magnitude of the net benefit from recovering materials and energy exceeds the negative consequences of irresponsible disposal. One outcome of this may be widespread misunderstanding of the need for recycling. Furthermore, framing public communication on recycling in terms of avoiding negative consequences, as is essentially universal, may not convey an appropriate message. The issue is particularly important where the consumer regards products as relatively disposable and environmentally benign, and/or where the "null option" of retaining the product at end-of-life is especially prevalent. The paper highlights the implications of all these issues for policy-makers, waste collectors and recyclers, and consumers. Copyright © 2016 Elsevier Ltd. All rights reserved.

  13. High-quality GaN epitaxially grown on Si substrate with serpentine channels

    Science.gov (United States)

    Wei, Tiantian; Zong, Hua; Jiang, Shengxiang; Yang, Yue; Liao, Hui; Xie, Yahong; Wang, Wenjie; Li, Junze; Tang, Jun; Hu, Xiaodong

    2018-06-01

    A novel serpentine-channeled mask was introduced to Si substrate for low-dislocation GaN epitaxial growth and the fully coalesced GaN film on the masked Si substrate was achieved for the first time. Compared with the epitaxial lateral overgrowth (ELOG) growth method, this innovative mask only requires one-step epitaxial growth of GaN which has only one high-dislocation region per mask opening. This new growth method can effectively reduce dislocation density, thus improving the quality of GaN significantly. High-quality GaN with low dislocation density ∼2.4 × 107 cm-2 was obtained, which accounted for about eighty percent of the GaN film in area. This innovative technique is promising for the growth of high-quality GaN templates and the subsequent fabrication of high-performance GaN-based devices like transistors, laser diodes (LDs), and light-emitting diodes (LEDs) on Si substrate.

  14. High-quality genome sequence and description of Bacillus ndiopicus strain FF3T sp. nov.

    Directory of Open Access Journals (Sweden)

    C.I. Lo

    2015-11-01

    Full Text Available Strain FF3T was isolated from the skin-flora of a 39-year-old healthy Senegalese man. Matrix-assisted laser desorption/ionization time-of-flight mass spectrometry did not allow any identification. This strain exhibited a 16S rRNA sequence similarity of 96.8% with Bacillus massiliensis, the phylogenetically closest species with standing nomenclature. Using a polyphasic study made of phenotypic and genomic analyses, strain FF3T was Gram-positive, aeroanaerobic and rod shaped and exhibited a genome of 4 068 720 bp with a G+C content of 37.03% that coded 3982 protein-coding and 67 RNA genes (including four rRNA operons. On the basis of these data, we propose the creation of Bacillus ndiopicus sp. nov.

  15. Nonmuscle Myosin II Is Required for Internalization of the Epidermal Growth Factor Receptor and Modulation of Downstream Signaling*

    Science.gov (United States)

    Kim, Jong Hyun; Wang, Aibing; Conti, Mary Anne; Adelstein, Robert S.

    2012-01-01

    Ligand-induced internalization of the epidermal growth factor receptor (EGFR) is an important process for regulating signal transduction, cellular dynamics, and cell-cell communication. Here, we demonstrate that nonmuscle myosin II (NM II) is required for the internalization of the EGFR and to trigger the EGFR-dependent activation of ERK and AKT. The EGFR was identified as a protein that interacts with NM II by co-immunoprecipitation and mass spectrometry analysis. This interaction requires both the regulatory light chain 20 (RLC20) of NM II and the kinase domain of the EGFR. Two paralogs of NM II, NM II-A, and NM II-B can act to internalize the EGFR, depending on the cell type and paralog content of the cell line. Loss (siRNA) or inhibition (25 μm blebbistatin) of NM II attenuates the internalization of the EGFR and impairs EGFR-dependent activation of ERK and AKT. Both internalization of the EGFR and downstream signaling to ERK and AKT can be partially restored in siRNA-treated cells by introduction of wild type (WT) GFP-NM II, but cannot be restored by motor mutant NM II. Taken together, these results suggest that NM II plays a role in the internalization of the EGFR and EGFR-mediated signaling pathways. PMID:22718763

  16. Cytogenetic evaluation of human glial tumors: correlation of overexpression of epidermal growth factor receptor (EGFB) with abnormalities of chromosome 7

    International Nuclear Information System (INIS)

    Bell, C.W.

    1987-01-01

    Chromosome banding analysis of human glial tumors were performed using G- and Q-banding techniques in an attempt to establish recurring sites of chromosome change. Results revealed a nonrandom karyotypic profile including aneuploidy and considerable variation in chromosome number (range 40 → 200). All tumors examined displayed numerical abnormalities, with the most common numeric change being a gain of chromosome 7. An attempt was then made to correlate the observed chromosome 7 changes with activation of the cellular proto-oncogene c-erb-B, whose produce is the epidermal growth factor receptor (EGFR). Six human glial tumors were analyzed for 125 I-EGF binding, EGFR gene copy number, EGFR gene rearrangement, mRNA expression, and karyotypic profile. Saturation analysis at 4 0 C revealed significant numbers of EGFR's in all 6 tumors. Southern blotting analysis utilizing cDNA probes for the EGFR failed to demonstrate significant amplification or structural rearrangement of the EFGR gene. The results suggest that overexpression of the EGFR may be related to an alternative mechanism, other than gene amplification and elevated mRNA levels, such as the regulation of receptor biosynthesis and degradation. In summary, findings indicate that alterations of chromosome 7 are the most prevalent chromosomal change in human glial tumors, and that these alterations may lead to overexpression of the protooncogene c-erb-B

  17. Gloss, colour and grip: multifunctional epidermal cell shapes in bee- and bird-pollinated flowers.

    Science.gov (United States)

    Papiorek, Sarah; Junker, Robert R; Lunau, Klaus

    2014-01-01

    Flowers bear the function of filters supporting the attraction of pollinators as well as the deterrence of floral antagonists. The effect of epidermal cell shape on the visual display and tactile properties of flowers has been evaluated only recently. In this study we quantitatively measured epidermal cell shape, gloss and spectral reflectance of flowers pollinated by either bees or birds testing three hypotheses: The first two hypotheses imply that bee-pollinated flowers might benefit from rough surfaces on visually-active parts produced by conical epidermal cells, as they may enhance the colour signal of flowers as well as the grip on flowers for bees. In contrast, bird-pollinated flowers might benefit from flat surfaces produced by flat epidermal cells, by avoiding frequent visitation from non-pollinating bees due to a reduced colour signal, as birds do not rely on specific colour parameters while foraging. Moreover, flat petal surfaces in bird-pollinated flowers may hamper grip for bees that do not touch anthers and stigmas while consuming nectar and thus, are considered as nectar thieves. Beside this, the third hypothesis implies that those flower parts which are vulnerable to nectar robbing of bee- as well as bird-pollinated flowers benefit from flat epidermal cells, hampering grip for nectar robbing bees. Our comparative data show in fact that conical epidermal cells are restricted to visually-active parts of bee-pollinated flowers, whereas robbing-sensitive parts of bee-pollinated as well as the entire floral surface of bird-pollinated flowers possess on average flat epidermal cells. However, direct correlations between epidermal cell shape and colour parameters have not been found. Our results together with published experimental studies show that epidermal cell shape as a largely neglected flower trait might act as an important feature in pollinator attraction and avoidance of antagonists, and thus may contribute to the partitioning of flower-visitors.

  18. Gloss, colour and grip: multifunctional epidermal cell shapes in bee- and bird-pollinated flowers.

    Directory of Open Access Journals (Sweden)

    Sarah Papiorek

    Full Text Available Flowers bear the function of filters supporting the attraction of pollinators as well as the deterrence of floral antagonists. The effect of epidermal cell shape on the visual display and tactile properties of flowers has been evaluated only recently. In this study we quantitatively measured epidermal cell shape, gloss and spectral reflectance of flowers pollinated by either bees or birds testing three hypotheses: The first two hypotheses imply that bee-pollinated flowers might benefit from rough surfaces on visually-active parts produced by conical epidermal cells, as they may enhance the colour signal of flowers as well as the grip on flowers for bees. In contrast, bird-pollinated flowers might benefit from flat surfaces produced by flat epidermal cells, by avoiding frequent visitation from non-pollinating bees due to a reduced colour signal, as birds do not rely on specific colour parameters while foraging. Moreover, flat petal surfaces in bird-pollinated flowers may hamper grip for bees that do not touch anthers and stigmas while consuming nectar and thus, are considered as nectar thieves. Beside this, the third hypothesis implies that those flower parts which are vulnerable to nectar robbing of bee- as well as bird-pollinated flowers benefit from flat epidermal cells, hampering grip for nectar robbing bees. Our comparative data show in fact that conical epidermal cells are restricted to visually-active parts of bee-pollinated flowers, whereas robbing-sensitive parts of bee-pollinated as well as the entire floral surface of bird-pollinated flowers possess on average flat epidermal cells. However, direct correlations between epidermal cell shape and colour parameters have not been found. Our results together with published experimental studies show that epidermal cell shape as a largely neglected flower trait might act as an important feature in pollinator attraction and avoidance of antagonists, and thus may contribute to the partitioning of

  19. RNA modifications by oxidation

    DEFF Research Database (Denmark)

    Poulsen, Henrik E; Specht, Elisabeth; Broedbaek, Kasper

    2012-01-01

    to encompass various classes of novel regulatory RNAs, including, e.g., microRNAs. It is well known that DNA is constantly oxidized and repaired by complex genome maintenance mechanisms. Analogously, RNA also undergoes significant oxidation, and there are now convincing data suggesting that oxidation......The past decade has provided exciting insights into a novel class of central (small) RNA molecules intimately involved in gene regulation. Only a small percentage of our DNA is translated into proteins by mRNA, yet 80% or more of the DNA is transcribed into RNA, and this RNA has been found......, and the consequent loss of integrity of RNA, is a mechanism for disease development. Oxidized RNA is found in a large variety of diseases, and interest has been especially devoted to degenerative brain diseases such as Alzheimer disease, in which up to 50-70% of specific mRNA molecules are reported oxidized, whereas...

  20. Human blood RNA stabilization in samples collected and transported for a large biobank

    Science.gov (United States)

    2012-01-01

    Background The Norwegian Mother and Child Cohort Study (MoBa) is a nation-wide population-based pregnancy cohort initiated in 1999, comprising more than 108.000 pregnancies recruited between 1999 and 2008. In this study we evaluated the feasibility of integrating RNA analyses into existing MoBa protocols. We compared two different blood RNA collection tube systems – the PAXgene™ Blood RNA system and the Tempus™ Blood RNA system - and assessed the effects of suboptimal blood volumes in collection tubes and of transportation of blood samples by standard mail. Endpoints to characterize the samples were RNA quality and yield, and the RNA transcript stability of selected genes. Findings High-quality RNA could be extracted from blood samples stabilized with both PAXgene and Tempus tubes. The RNA yields obtained from the blood samples collected in Tempus tubes were consistently higher than from PAXgene tubes. Higher RNA yields were obtained from cord blood (3 – 4 times) compared to adult blood with both types of tubes. Transportation of samples by standard mail had moderate effects on RNA quality and RNA transcript stability; the overall RNA quality of the transported samples was high. Some unexplained changes in gene expression were noted, which seemed to correlate with suboptimal blood volumes collected in the tubes. Temperature variations during transportation may also be of some importance. Conclusions Our results strongly suggest that special collection tubes are necessary for RNA stabilization and they should be used for establishing new biobanks. We also show that the 50,000 samples collected in the MoBa biobank provide RNA of high quality and in sufficient amounts to allow gene expression analyses for studying the association of disease with altered patterns of gene expression. PMID:22988904

  1. Epidermal stem cells - role in normal, wounded and pathological psoriatic and cancer skin

    DEFF Research Database (Denmark)

    Kamstrup, M.; Faurschou, A.; Gniadecki, R.

    2008-01-01

    In this review we focus on epidermal stem cells in the normal regeneration of the skin as well as in wounded and psoriatic skin. Furthermore, we discuss current data supporting the idea of cancer stem cells in the pathogenesis of skin carcinoma and malignant melanoma. Epidermal stem cells present...... or transit amplifying cells constitute a primary pathogenetic factor in the epidermal hyperproliferation seen in psoriasis. In cutaneous malignancies mounting evidence supports a stem cell origin in skin carcinoma and malignant melanoma and a possible existence of cancer stem cells Udgivelsesdato: 2008/5...

  2. Structural and biophysical characteristics of human skin in maintaining proper epidermal barrier function

    Directory of Open Access Journals (Sweden)

    Magdalena Boer

    2016-02-01

    Full Text Available The complex structure of human skin and its physicochemical properties turn it into an efficient outermost defence line against exogenous factors, and help maintain homeostasis of the human body. This role is played by the epidermal barrier with its major part – stratum corneum. The condition of the epidermal barrier depends on individual and environmental factors. The most important biophysical parameters characterizing the status of this barrier are the skin pH, epidermal hydration, transepidermal water loss and sebum excretion. The knowledge of biophysical skin processes may be useful for the implementation of prophylactic actions whose aim is to restore the barrier function.

  3. The expression of proinflammatory genes in epidermal keratinocytes is regulated by hydration status.

    Science.gov (United States)

    Xu, Wei; Jia, Shengxian; Xie, Ping; Zhong, Aimei; Galiano, Robert D; Mustoe, Thomas A; Hong, Seok J

    2014-04-01

    Mucosal wounds heal more rapidly, exhibit less inflammation, and are associated with minimal scarring when compared with equivalent cutaneous wounds. We previously demonstrated that cutaneous epithelium exhibits an exaggerated response to injury compared with mucosal epithelium. We hypothesized that treatment of injured skin with a semiocclusive dressing preserves the hydration of the skin and results in a wound healing phenotype that more closely resembles that of mucosa. Here we explored whether changes in hydration status alter epidermal gene expression patterns in rabbit partial-thickness incisional wounds. Using microarray studies on injured epidermis, we showed that global gene expression patterns in highly occluded versus non-occluded wounds are distinct. Many genes including IL-1β, IL-8, TNF-α (tumor necrosis factor-α), and COX-2 (cyclooxygenase 2) are upregulated in non-occluded wounds compared with highly occluded wounds. In addition, decreased levels of hydration resulted in an increased expression of proinflammatory genes in human ex vivo skin culture (HESC) and stratified keratinocytes. Hierarchical analysis of genes using RNA interference showed that both TNF-α and IL-1β regulate the expression of IL-8 through independent pathways in response to reduced hydration. Furthermore, both gene knockdown and pharmacological inhibition studies showed that COX-2 mediates the TNF-α/IL-8 pathway by increasing the production of prostaglandin E2 (PGE2). IL-8 in turn controls the production of matrix metalloproteinase-9 in keratinocytes. Our data show that hydration status directly affects the expression of inflammatory signaling in the epidermis. The identification of genes involved in the epithelial hydration pathway provides an opportunity to develop strategies to reduce scarring and optimize wound healing.

  4. 3D conditional generative adversarial networks for high-quality PET image estimation at low dose.

    Science.gov (United States)

    Wang, Yan; Yu, Biting; Wang, Lei; Zu, Chen; Lalush, David S; Lin, Weili; Wu, Xi; Zhou, Jiliu; Shen, Dinggang; Zhou, Luping

    2018-07-01

    Positron emission tomography (PET) is a widely used imaging modality, providing insight into both the biochemical and physiological processes of human body. Usually, a full dose radioactive tracer is required to obtain high-quality PET images for clinical needs. This inevitably raises concerns about potential health hazards. On the other hand, dose reduction may cause the increased noise in the reconstructed PET images, which impacts the image quality to a certain extent. In this paper, in order to reduce the radiation exposure while maintaining the high quality of PET images, we propose a novel method based on 3D conditional generative adversarial networks (3D c-GANs) to estimate the high-quality full-dose PET images from low-dose ones. Generative adversarial networks (GANs) include a generator network and a discriminator network which are trained simultaneously with the goal of one beating the other. Similar to GANs, in the proposed 3D c-GANs, we condition the model on an input low-dose PET image and generate a corresponding output full-dose PET image. Specifically, to render the same underlying information between the low-dose and full-dose PET images, a 3D U-net-like deep architecture which can combine hierarchical features by using skip connection is designed as the generator network to synthesize the full-dose image. In order to guarantee the synthesized PET image to be close to the real one, we take into account of the estimation error loss in addition to the discriminator feedback to train the generator network. Furthermore, a concatenated 3D c-GANs based progressive refinement scheme is also proposed to further improve the quality of estimated images. Validation was done on a real human brain dataset including both the normal subjects and the subjects diagnosed as mild cognitive impairment (MCI). Experimental results show that our proposed 3D c-GANs method outperforms the benchmark methods and achieves much better performance than the state

  5. Folate deficiency enhances arsenic effects on expression of genes involved in epidermal differentiation in transgenic K6/ODC mouse skin

    International Nuclear Information System (INIS)

    Nelson, Gail M.; Ahlborn, Gene J.; Delker, Don A.; Kitchin, Kirk T.; O'Brien, Thomas G.; Chen Yan; Kohan, Michael J.; Roop, Barbara C.; Ward, William O.; Allen, James W.

    2007-01-01

    Chronic arsenic exposure in humans is associated with cancers of the skin, lung, bladder and other tissues. There is evidence that folate deficiency may increase susceptibility to arsenic effects, including skin lesions. K6/ODC mice develop skin tumors when exposed to 10 ppm sodium arsenite for 5 months. In the current study, K6/ODC mice maintained on either a folate deficient or folate sufficient diet were exposed to 0, 1, or 10 ppm sodium arsenite in the drinking water for 30 days. Total RNA was isolated from skin samples and gene expression analyzed using Affymetrix Mouse 430 2.0 GeneChips. Data from 24 samples, with 4 mice in each of the 6 treatment groups, were RMA normalized and analyzed by two-way ANOVA using GeneSpring TM . Top gene ontology (GO) categories for genes responding significantly to both arsenic treatment and folate deficiency include nucleotide metabolism and cell organization and biogenesis. For many of these genes, folate deficiency magnifies the response to arsenic treatment. In particular, expression of markers of epidermal differentiation, e.g., loricrin, small proline rich proteins and involucrin, was significantly reduced by arsenic in the folate sufficient animals, and reduced further or at a lower arsenic dose in the folate deficient animals. In addition, expression of a number of epidermal cell growth/proliferation genes and cellular movement genes was altered. These results indicate that arsenic disrupts the normal balance of cell proliferation and differentiation, and that folate deficiency exacerbates these effects, consistent with the view that folate deficiency is a nutritional susceptibility factor for arsenic-induced skin tumorigenesis

  6. Maturational steps of bone marrow-derived dendritic murine epidermal cells. Phenotypic and functional studies on Langerhans cells and Thy-1+ dendritic epidermal cells in the perinatal period.

    Science.gov (United States)

    Elbe, A; Tschachler, E; Steiner, G; Binder, A; Wolff, K; Stingl, G

    1989-10-15

    The adult murine epidermis harbors two separate CD45+ bone marrow (BM)-derived dendritic cell systems, i.e., Ia+, ADPase+, Thy-1-, CD3- Langerhans cells (LC) and Ia-, ADPase-, Thy-1+, CD3+ dendritic epidermal T cells (DETC). To clarify whether the maturation of these cells from their ill-defined precursors is already accomplished before their entry into the epidermis or, alternatively, whether a specific epidermal milieu is required for the expression of their antigenic determinants, we studied the ontogeny of CD45+ epidermal cells (EC). In the fetal life, there exists a considerable number of CD45+, Ia-, ADPase+ dendritic epidermal cells. When cultured, these cells become Ia+ and, in parallel, acquire the potential of stimulating allogeneic T cell proliferation. These results imply that CD45+, Ia-, ADPase+ fetal dendritic epidermal cells are immature LC precursors and suggest that the epidermis plays a decisive role in LC maturation. The day 17 fetal epidermis also contains a small population of CD45+, Thy-1+, ADPase-, CD3- round cells. Over the course of 2 to 3 wk, they are slowly replaced by an ever increasing number of round and, finally, dendritic CD45+, Thy-1+, CD3+ EC. Thus, CD45+, Thy-1+, ADPase-, CD3- fetal EC may either be DETC precursors or, alternatively, may represent a distinctive cell system of unknown maturation potential. According to this latter theory, these cells would be eventually outnumbered by newly immigrating CD45+, Thy-1+, CD3+ T cells--the actual DETC.

  7. Working with RNA

    DEFF Research Database (Denmark)

    Nielsen, Henrik

    2011-01-01

    Working with RNA is not a special discipline in molecular biology. However, RNA is chemically and structurally different from DNA and a few simple work rules have to be implemented to maintain the integrity of the RNA. Alkaline pH, high temperatures, and heavy metal ions should be avoided when po...

  8. High quality draft genome sequence of Janthinobacterium psychrotolerans sp. nov., isolated from a frozen freshwater pond

    DEFF Research Database (Denmark)

    Gong, Xianzhe; Skrivergaard, Stig; Korsgaard, Benjamin

    2017-01-01

    denitrification, and fermentation. The draft genome of strain S3-2T has a size of ~5.8 Mbp and contains 5,297 genes, including 115 RNA genes. Based on the phenotypic properties of the strain, the low in silico DNA-DNA hybridization (DDH) values with related genomes (

  9. Dual-Readout Calorimetry for High-Quality Energy Measurements. Final Report

    International Nuclear Information System (INIS)

    Wigmans, Richard; Nural, Akchurin

    2013-01-01

    This document constitutes the final report on the project Dual-Readout Calorimetry for High-Quality Energy Measurements. The project was carried out by a consortium of US and Italian physicists, led by Dr. Richard Wigmans (Texas tech University). This consortium built several particle detectors and tested these at the European Center for Nuclear Research (CERN) in Geneva, Switzerland. The idea arose to use scintillating crystals as dual-readout calorimeters. Such crystals were of course already known to provide excellent energy resolution for the detection of particles developing electromagnetic (em) showers. The efforts to separate the signals from scintillating crystals into scintillation and Cerenkov components led to four different methods by which this could be accomplished. These methods are based on a) the directionality, b) spectral differences, c) the time structure, and d) the polarization of the signals

  10. Development of nuclear safety class filter elements with long life and high quality

    International Nuclear Information System (INIS)

    Zhang Jinghua

    2009-04-01

    This paper describes the development on nuclear safety class filter elements with long life and high quality used for collecting radioactive contaminants, fragments of resin and impurities in primary systems of NPPs. The filter elements made of glass fibre elements are used for PWR, and of paper elements are used for PHWR. During the research, a series of tests for optimization were performed for selection of filter material and the improvement of binder. The flow rate and comprehensive performance have been measured in simulated conditions. The result shows that the application requirements for operational NPPs can be met, and the reliability and safety of the frame are also be verified. The comprehensive performance of the filter elements is equivalent to that of oversea similar products. The products have been used in NPPs in operation. (authors)

  11. The use of induced mutation combined with crossing in high quality rice breeding

    Energy Technology Data Exchange (ETDEWEB)

    Do Huu At; Bui Huy Thuy; Nguyen Van Bich; Tran Duy Quy [Agricultural Genetics Institute, Division of Genetics and Hybrid Rice Technology, Hanoi (Viet Nam); Nguyen Minh Cong [Hanoi No. 1 Teacher Training Univ., Department of Genetics (Viet Nam)

    2001-03-01

    The high quality rice varieties: Tam thom mutant rice Var., DT17 rice Var, DT21 glutinous rice Var were formed by induced mutation combined with crossing. Tam thom mutant rice Var. lost photosensitivity, could be planted 2 crops/year. DT17 rice Var with high yielding capacity, suitable for growth on lowland in summer crop, is replacing step-by-step Moctuyen rice Var. in North Vietnam. DT21 glutinous rice Var. could be planted 2 crops/year and had short growth duration, average yield was 4.0-4.5 tons/ha. These three ones had good quality, soft and scent cooked rice, suitable for customers and export requirements. Tam thom mutant rice Var. DT17 rice Var., DT21 and glutinous rice Var. were adopted for regional production by Ministry of Agriculture and Rural Development and allowed to be in trial production. (author)

  12. PMG: online generation of high-quality molecular pictures and storyboarded animations

    Science.gov (United States)

    Autin, Ludovic; Tufféry, Pierre

    2007-01-01

    The Protein Movie Generator (PMG) is an online service able to generate high-quality pictures and animations for which one can then define simple storyboards. The PMG can therefore efficiently illustrate concepts such as molecular motion or formation/dissociation of complexes. Emphasis is put on the simplicity of animation generation. Rendering is achieved using Dino coupled to POV-Ray. In order to produce highly informative images, the PMG includes capabilities of using different molecular representations at the same time to highlight particular molecular features. Moreover, sophisticated rendering concepts including scene definition, as well as modeling light and materials are available. The PMG accepts Protein Data Bank (PDB) files as input, which may include series of models or molecular dynamics trajectories and produces images or movies under various formats. PMG can be accessed at http://bioserv.rpbs.jussieu.fr/PMG.html. PMID:17478496

  13. Mechanically stable tuning fork sensor with high quality factor for the atomic force microscope.

    Science.gov (United States)

    Kim, Kwangyoon; Park, Jun-Young; Kim, K B; Lee, Naesung; Seo, Yongho

    2014-01-01

    A quartz tuning fork was used instead of cantilever as a force sensor for the atomic force microscope. A tungsten tip was made by electrochemical etching from a wire of 50 µm diameter. In order to have mechanical stability of the tuning fork, it was attached on an alumina plate. The tungsten tip was attached on the inside end of a prong of a tuning fork. The phase shift was used as a feedback signal to control the distance between the tip and sample, and the amplitude was kept constant using a lock-in amplifier and a homemade automatic gain controller. Due to the mechanical stability, the sensor shows a high quality factor (∼10(3)), and the image quality obtained with this sensor was equivalent to that of the cantilever-based AFM. © 2014 Wiley Periodicals, Inc.

  14. High-quality vertical light emitting diodes fabrication by mechanical lift-off technique

    Science.gov (United States)

    Tu, Po-Min; Hsu, Shih-Chieh; Chang, Chun-Yen

    2011-10-01

    We report the fabrication of mechanical lift-off high quality thin GaN with Hexagonal Inversed Pyramid (HIP) structures for vertical light emitting diodes (V-LEDs). The HIP structures were formed at the GaN/sapphire substrate interface under high temperature during KOH wet etching process. The average threading dislocation density (TDD) was estimated by transmission electron microscopy (TEM) and found the reduction from 2×109 to 1×108 cm-2. Raman spectroscopy analysis revealed that the compressive stress of GaN epilayer was effectively relieved in the thin-GaN LED with HIP structures. Finally, the mechanical lift-off process is claimed to be successful by using the HIP structures as a sacrificial layer during wafer bonding process.

  15. High-quality bulk hybrid perovskite single crystals within minutes by inverse temperature crystallization

    KAUST Repository

    Saidaminov, Makhsud I.

    2015-07-06

    Single crystals of methylammonium lead trihalide perovskites (MAPbX3; MA=CH3NH3+, X=Br− or I−) have shown remarkably low trap density and charge transport properties; however, growth of such high-quality semiconductors is a time-consuming process. Here we present a rapid crystal growth process to obtain MAPbX3 single crystals, an order of magnitude faster than previous reports. The process is based on our observation of the substantial decrease of MAPbX3 solubility, in certain solvents, at elevated temperatures. The crystals can be both size- and shape-controlled by manipulating the different crystallization parameters. Despite the rapidity of the method, the grown crystals exhibit transport properties and trap densities comparable to the highest quality MAPbX3 reported to date. The phenomenon of inverse or retrograde solubility and its correlated inverse temperature crystallization strategy present a major step forward for advancing the field on perovskite crystallization.

  16. The use of induced mutation combined with crossing in high quality rice breeding

    International Nuclear Information System (INIS)

    Do Huu At; Bui Huy Thuy; Nguyen Van Bich; Tran Duy Quy; Nguyen Minh Cong

    2001-01-01

    The high quality rice varieties: Tam thom mutant rice Var., DT17 rice Var, DT21 glutinous rice Var were formed by induced mutation combined with crossing. Tam thom mutant rice Var. lost photosensitivity, could be planted 2 crops/year. DT17 rice Var with high yielding capacity, suitable for growth on lowland in summer crop, is replacing step-by-step Moctuyen rice Var. in North Vietnam. DT21 glutinous rice Var. could be planted 2 crops/year and had short growth duration, average yield was 4.0-4.5 tons/ha. These three ones had good quality, soft and scent cooked rice, suitable for customers and export requirements. Tam thom mutant rice Var. DT17 rice Var., DT21 and glutinous rice Var. were adopted for regional production by Ministry of Agriculture and Rural Development and allowed to be in trial production. (author)

  17. CONSIDERATIONS REGARDING THE 21st CENTURY’s HIGH QUALITY SECURITY CONCEPT

    Directory of Open Access Journals (Sweden)

    Eugen SITEANU

    2017-12-01

    Full Text Available The present paper is devoted to qualitative security which today has to become a topic issue of world security. The opinions regarding the 21st century’s security concept are contradictory since people have different understandings and perceptions of security, respectively insecurity, and do not agree to analyze the security concept as a function of the system. Our take is that implementation of some new security concepts should aim an analysis and understanding of security in an integrating view, in order to make the most comprehensive security environment possible. Therefore, we do believe that it is necessary to define the concept of high quality security, which is translated in our current paper.

  18. Strategies for Promoting High-Quality Care and Personal Resilience in Palliative Care.

    Science.gov (United States)

    Heinze, Katherine E; Holtz, Heidi K; Rushton, Cynda H

    2017-06-01

    Palliative care (PC) clinicians are faced with ever-expanding pressures, which can make it difficult to fulfill their duties to self and others and lead to moral distress. Understanding the pressures that PC clinicians face and the resources that could be employed to ease their moral distress is crucial to maintaining a healthy PC workforce and to providing necessary PC services to patients. In this paper, we discuss recommendations related to two promising pathways for supporting PC clinicians in providing high-quality PC: (1) improving systemic PC delivery and (2) strategies to promote ethical practice environments and individual resilience. Enacting these recommendations holds promise for sustaining higher-quality and accessible PC and a more engaged PC workforce. © 2017 American Medical Association. All Rights Reserved.

  19. A protocol for generating a high-quality genome-scale metabolic reconstruction.

    Science.gov (United States)

    Thiele, Ines; Palsson, Bernhard Ø

    2010-01-01

    Network reconstructions are a common denominator in systems biology. Bottom-up metabolic network reconstructions have been developed over the last 10 years. These reconstructions represent structured knowledge bases that abstract pertinent information on the biochemical transformations taking place within specific target organisms. The conversion of a reconstruction into a mathematical format facilitates a myriad of computational biological studies, including evaluation of network content, hypothesis testing and generation, analysis of phenotypic characteristics and metabolic engineering. To date, genome-scale metabolic reconstructions for more than 30 organisms have been published and this number is expected to increase rapidly. However, these reconstructions differ in quality and coverage that may minimize their predictive potential and use as knowledge bases. Here we present a comprehensive protocol describing each step necessary to build a high-quality genome-scale metabolic reconstruction, as well as the common trials and tribulations. Therefore, this protocol provides a helpful manual for all stages of the reconstruction process.

  20. High Quality Model Predictive Control for Single Phase Grid Connected Photovoltaic Inverters

    DEFF Research Database (Denmark)

    Zangeneh Bighash, Esmaeil; Sadeghzadeh, Seyed Mohammad; Ebrahimzadeh, Esmaeil

    2018-01-01

    Single phase grid-connected inverters with LCL filter are widely used to connect the photovoltaic systems to the utility grid. Among the presented control schemes, predictive control methods are faster and more accurate but are more complex to implement. Recently, the model-predictive control...... algorithm for single-phase inverter has been presented, where the algorithm implementation is straightforward. In the proposed approach, all switching states are tested in each switching period to achieve the control objectives. However, since the number of the switching states in single-phase inverter...... is low, the inverter output current has a high total harmonic distortions. In order to reduce the total harmonic distortions of the injected current, this paper presents a high-quality model-predictive control for one of the newest structure of the grid connected photovoltaic inverter, i.e., HERIC...

  1. Multiview 3D sensing and analysis for high quality point cloud reconstruction

    Science.gov (United States)

    Satnik, Andrej; Izquierdo, Ebroul; Orjesek, Richard

    2018-04-01

    Multiview 3D reconstruction techniques enable digital reconstruction of 3D objects from the real world by fusing different viewpoints of the same object into a single 3D representation. This process is by no means trivial and the acquisition of high quality point cloud representations of dynamic 3D objects is still an open problem. In this paper, an approach for high fidelity 3D point cloud generation using low cost 3D sensing hardware is presented. The proposed approach runs in an efficient low-cost hardware setting based on several Kinect v2 scanners connected to a single PC. It performs autocalibration and runs in real-time exploiting an efficient composition of several filtering methods including Radius Outlier Removal (ROR), Weighted Median filter (WM) and Weighted Inter-Frame Average filtering (WIFA). The performance of the proposed method has been demonstrated through efficient acquisition of dense 3D point clouds of moving objects.

  2. Synthesis and Characterization of Mass Produced High Quality Few Layered Graphene Sheets via a Chemical Method

    KAUST Repository

    Khenfouch, Mohammed

    2014-04-01

    Graphene is a two-dimensional crystal of carbon atoms arranged in a honeycomb lattice. It is a zero band gap semimetal with very unique physical and chemical properties which make it useful for many applications such as ultra-high-speed field-effect transistors, p-n junction diodes, terahertz oscillators, and low-noise electronic, NEMS and sensors. When the high quality mass production of this nanomaterial is still a big challenge, we developed a process which will be an important step to achieve this goal. Atomic Force Microscopy, Scanning Electron Microscopy, Scanning tunneling microscopy, High Resolution Transmission Electron Microscopy, X-Ray Diffraction, Raman spectroscopy, Energy Dispersive X-ray system were investigated to characterize and examine the quality of this product.

  3. Production of High Quality Die Steels from Large ESR Slab Ingots

    Science.gov (United States)

    Geng, Xin; Jiang, Zhou-hua; Li, Hua-bing; Liu, Fu-bin; Li, Xing

    With the rapid development of manufacture industry in China, die steels are in great need of large slab ingot of high quality and large tonnage, such as P20, WSM718R and so on. Solidification structure and size of large slab ingots produced with conventional methods are not satisfied. However, large slab ingots manufactured by ESR process have a good solidification structure and enough section size. In the present research, the new slab ESR process was used to produce the die steels large slab ingots with the maximum size of 980×2000×3200mm. The compact and sound ingot can be manufactured by the slab ESR process. The ultra-heavy plates with the maximum thickness of 410 mm can be obtained after rolling the 49 tons ingots. Due to reducing the cogging and forging process, the ESR for large slab ingots process can increase greatly the yield and production efficiency, and evidently cut off product costs.

  4. Certifying leaders? high-quality management practices and healthy organisations: an ISO-9000 based standardisation approach.

    Science.gov (United States)

    Montano, Diego

    2016-08-05

    The present study proposes a set of quality requirements to management practices by taking into account the empirical evidence on their potential effects on health, the systemic nature of social organisations, and the current conceptualisations of management functions within the framework of comprehensive quality management systems. Systematic reviews and meta-analyses focusing on the associations between leadership and/or supervision and health in occupational settings are evaluated, and the core elements of an ISO 9001 standardisation approach are presented. Six major occupational health requirements to high-quality management practices are identified pertaining to communication processes, organisational justice, role clarity, decision making, social influence processes and management support. It is concluded that the quality of management practices may be improved by developing a quality management system of management practices that ensures not only conformity to product but also to occupational safety and health requirements. Further research may evaluate the practicability of the proposed approach.

  5. Multi-line split DNA synthesis: a novel combinatorial method to make high quality peptide libraries

    Directory of Open Access Journals (Sweden)

    Ueno Shingo

    2004-09-01

    Full Text Available Abstract Background We developed a method to make a various high quality random peptide libraries for evolutionary protein engineering based on a combinatorial DNA synthesis. Results A split synthesis in codon units was performed with mixtures of bases optimally designed by using a Genetic Algorithm program. It required only standard DNA synthetic reagents and standard DNA synthesizers in three lines. This multi-line split DNA synthesis (MLSDS is simply realized by adding a mix-and-split process to normal DNA synthesis protocol. Superiority of MLSDS method over other methods was shown. We demonstrated the synthesis of oligonucleotide libraries with 1016 diversity, and the construction of a library with random sequence coding 120 amino acids containing few stop codons. Conclusions Owing to the flexibility of the MLSDS method, it will be able to design various "rational" libraries by using bioinformatics databases.

  6. High quality factor GaAs microcavity with buried bullseye defects

    Science.gov (United States)

    Winkler, K.; Gregersen, N.; Häyrynen, T.; Bradel, B.; Schade, A.; Emmerling, M.; Kamp, M.; Höfling, S.; Schneider, C.

    2018-05-01

    The development of high quality factor solid-state microcavities with low mode volumes has paved the way towards on-chip cavity quantum electrodynamics experiments and the development of high-performance nanophotonic devices. Here, we report on the implementation of a new kind of solid-state vertical microcavity, which allows for confinement of the electromagnetic field in the lateral direction without deep etching. The confinement originates from a local elongation of the cavity layer imprinted in a shallow etch and epitaxial overgrowth technique. We show that it is possible to improve the quality factor of such microcavities by a specific in-plane bullseye geometry consisting of a set of concentric rings with subwavelength dimensions. This design results in a smooth effective lateral photonic potential and therefore in a reduction of lateral scattering losses, which makes it highly appealing for experiments in the framework of exciton-polariton physics demanding tight spatial confinement.

  7. High-quality single crystal growth and magnetic property of Mn4Ta2O9

    Science.gov (United States)

    Cao, Yiming; Xu, Kun; Yang, Ya; Yang, Wangfan; Zhang, Yuanlei; Kang, Yanru; He, Xijia; Zheng, Anmin; Liu, Mian; Wei, Shengxian; Li, Zhe; Cao, Shixun

    2018-06-01

    A large-size single crystal of Mn4Ta2O9 with ∼3.5 mm in diameter and ∼65 mm in length was successfully grown for the first time by a newly designed one-step method based on the optical floating zone technique. Both the clear Laue spots and sharp XRD Bragg reflections suggest the high quality of the single crystal. In Mn4Ta2O9 single crystal, an antiferromagnetic phase transition was observed below Néel temperature 102 K along c axis, which is similar to the isostructural compound Mn4Nb2O9, but differs from the isostructural Co4Nb2O9. Relative dielectric constant at 30 kOe suggests that no magnetoelectric coupling exists in Mn4Ta2O9.

  8. Hybrid Active-Passive Microwave Photonic Filter with High Quality Factor

    International Nuclear Information System (INIS)

    En-Ming, Xu; Xin-Liang, Zhang; Li-Na, Zhou; Yu, Zhang; De-Xiu, Huang

    2009-01-01

    A hybrid high quality factor (Q-factor) microwave photonic filter with a cascaded active filter and a passive filter is presented and experimentally demonstrated. The active infinite impulse response filter is realized by a recirculating delay line loop with a semiconductor optical amplifier, and a much narrower 3 dB bandwidth of response peaks can be achieved. A passive finite impulse response filter is realized by an unbalance Mach–Zehnder interferometer, and it is cascaded to select the desired filter frequencies and to suppress the intermediate peaks. Compared with the purely active filter scheme, the free spectrum range and the Q-factor of the hybrid structure can be doubled. Stable operation and a high Q-factor of 362 are experimentally demonstrated

  9. Solvent engineering for high-quality perovskite solar cell with an efficiency approaching 20%

    Science.gov (United States)

    Wu, Tongyue; Wu, Jihuai; Tu, Yongguang; He, Xin; Lan, Zhang; Huang, Miaoliang; Lin, Jianming

    2017-10-01

    The perovskite layer is the most crucial factor for the high performance perovskite solar cells. Based on solvent engineering, we develop a ternary-mixed-solvent method for the growth of high-quality [Cs0.05(MA0.17FA0.83)0.95Pb(I0.83Br0.17)3] cation-anion-mixed perovskite films by introducing N-methyl-2-pyrrolidone (NMP) into the precursor mixed solution. By controlling rapid nucleation and retarding crystal growth via intermediate phase PbI2-NMP (Lewis acid-base adduct), a dense, large grain, pinhole-free and long charge carrier lifetime perovskite film is obtained. By optimizing the precursor solvent composition, the perovskite solar cell achieves an impressive power conversion efficiency of 19.61% under one-sun illumination. The research presented here provides a facile, low-cost and highly efficient way for the preparation of perovskite solar cells.

  10. High quality reference genome of drumstick tree (Moringa oleifera Lam.), a potential perennial crop.

    Science.gov (United States)

    Tian, Yang; Zeng, Yan; Zhang, Jing; Yang, ChengGuang; Yan, Liang; Wang, XuanJun; Shi, ChongYing; Xie, Jing; Dai, TianYi; Peng, Lei; Zeng Huan, Yu; Xu, AnNi; Huang, YeWei; Zhang, JiaJin; Ma, Xiao; Dong, Yang; Hao, ShuMei; Sheng, Jun

    2015-07-01

    The drumstick tree (Moringa oleifera Lam.) is a perennial crop that has gained popularity in certain developing countries for its high-nutrition content and adaptability to arid and semi-arid environments. Here we report a high-quality draft genome sequence of M. oleifera. This assembly represents 91.78% of the estimated genome size and contains 19,465 protein-coding genes. Comparative genomic analysis between M. oleifera and related woody plant genomes helps clarify the general evolution of this species, while the identification of several species-specific gene families and positively selected genes in M. oleifera may help identify genes related to M. oleifera's high protein content, fast-growth, heat and stress tolerance. This reference genome greatly extends the basic research on M. oleifera, and may further promote applying genomics to enhanced breeding and improvement of M. oleifera.

  11. Large scale commercial fabrication of high quality graphene-based assays for biomolecule detection

    Science.gov (United States)

    Lerner, Mitchell; Gao, Yingning; Goldsmith, Brett; Barron, Francie

    Large numbers of high quality graphene transistors with mobility approximately 5000 cm2 / V * s were fabricated by chemical vapor deposition and packaged into ceramic carriers with an open cavity design. The ceramic carrier is compatible with standard electronics assembly, enabling the readout of graphene properties on the benchtop without large, expensive probing systems. After chemical functionalization, these sensors demonstrate sensitivity in the pM range and selectivity to many classes of biomolecules as a three terminal liquid-gated field effect transistor. High precision measurements of protein kinetics captured using this technology, commercially known as AGILE R100, are comparable and can exceed the capabilities of state-of-the-art biomolecule characterization tools. Recently published in Sensors and Actuators B

  12. Side-gate modulation effects on high-quality BN-Graphene-BN nanoribbon capacitors

    International Nuclear Information System (INIS)

    Wang, Yang; Chen, Xiaolong; Ye, Weiguang; Wu, Zefei; Han, Yu; Han, Tianyi; He, Yuheng; Cai, Yuan; Wang, Ning

    2014-01-01

    High-quality BN-Graphene-BN nanoribbon capacitors with double side-gates of graphene have been experimentally realized. The double side-gates can effectively modulate the electronic properties of graphene nanoribbon capacitors. By applying anti-symmetric side-gate voltages, we observed significant upward shifting and flattening of the V-shaped capacitance curve near the charge neutrality point. Symmetric side-gate voltages, however, only resulted in tilted upward shifting along the opposite direction of applied gate voltages. These modulation effects followed the behavior of graphene nanoribbons predicted theoretically for metallic side-gate modulation. The negative quantum capacitance phenomenon predicted by numerical simulations for graphene nanoribbons modulated by graphene side-gates was not observed, possibly due to the weakened interactions between the graphene nanoribbon and side-gate electrodes caused by the Ga + beam etching process

  13. THE LEAN SIX SIGMAAPPROACH FOR PROCESS IMPROVEMENT: A CASE STUDY IN A HIGH QUALITY TUSCANY WINERY

    Directory of Open Access Journals (Sweden)

    Riccardo Bettini

    2012-06-01

    Full Text Available This paper describes the application of a Lean Six Sigma (LSS project to a winemaking process in a high-quality, Italian winery. LSS is used to focus on the problem through a quantitative analysis of waste and quality performances. The LSS basic algorithm (called “DMAIC” helps to detect and quantify critical aspects of the process for transferring liquid used in the cellar. The improvement solution is developed and applied through the modification of the cellar system and the process procedure. The results obtained with this solution are shown and discussed in this paper, so too the long term reliability of the improved process analyzed. The results obtained by this case study can help to understand the importance of the LSS method to drive the improvement of agricultural and agrofood productions also in terms of environmental impact which is strongly connected to waste reduction.

  14. Rapid continuous flow synthesis of high-quality silver nanocubes and nanospheres

    KAUST Repository

    Mehenni, Hakim

    2013-01-01

    We report a biphasic-liquid segmented continuous flow method for the synthesis of high-quality plasmonic single crystal silver nanocubes and nanospheres. The nanocubes were synthesized with controllable edge lengths from 20 to 48 nm. Single crystal nanospheres with a mean size of 29 nm were obtained by in-line continuous-flow etching of as-produced 39 nm nanocubes with an aqueous solution of FeNO3. In comparison to batch synthesis, the demonstrated processes represent highly scalable reactions, in terms of both production rate and endurance. The reactions were conducted in a commercially available flow-reactor system that is easily adaptable to industrial-scale production, facilitating widespread utilization of the procedure and the resulting nanoparticles. This journal is © The Royal Society of Chemistry 2013.

  15. A top-down approach to fabrication of high quality vertical heterostructure nanowire arrays.

    Science.gov (United States)

    Wang, Hua; Sun, Minghua; Ding, Kang; Hill, Martin T; Ning, Cun-Zheng

    2011-04-13

    We demonstrate a novel top-down approach for fabricating nanowires with unprecedented complexity and optical quality by taking advantage of a nanoscale self-masking effect. We realized vertical arrays of nanowires of 20-40 nm in diameter with 16 segments of complex longitudinal InGaAsP/InP structures. The unprecedented high quality of etched wires is evidenced by the narrowest photoluminescence linewidth ever produced in similar wavelengths, indistinguishable from that of the corresponding wafer. This top-down, mask-free, large scale approach is compatible with the established device fabrication processes and could serve as an important alternative to the bottom-up approach, significantly expanding ranges and varieties of applications of nanowire technology.

  16. Easy fabrication of high quality nickel mold for deep polymer microfluidic channels

    International Nuclear Information System (INIS)

    Wong, Ten It; Tan, Christina Yuan Ling; Zhou, Xiaodong; Limantoro, Julian; Fong, Kin Phang; Quan, Chenggen; Sun, Ling Ling

    2016-01-01

    Mass fabrication of disposable microfluidic chips with hot embossing is a key technology for microfluidic chip based biosensors. In this work, we develop a new method of fabricating high quality and highly durable nickel molds for hot embossing polymer chips. The process involves the addition of a thick, patterned layer of negative photoresist AZ-125nxT to a 4″ silicon wafer, followed by nickel electroplating and delamination of the nickel mold. Our investigations found that compared to a pillar mask, a hole mask can minimize the diffraction effect in photolithography of a thick photoresist, reduce the adhesion of the AZ-125nxT to the photomask in photolithography, and facilitate clean development of the photoresist patterns. By optimizing the hot embossing and chip bonding parameters, microfluidic chips with deep channels are achieved. (paper)

  17. A Simple and Efficient RNA Extraction Method from Deep-Sea Hydrothermal Vent Chimney Structures.

    Science.gov (United States)

    Muto, Hisashi; Takaki, Yoshihiro; Hirai, Miho; Mino, Sayaka; Sawayama, Shigeki; Takai, Ken; Nakagawa, Satoshi

    2017-12-27

    RNA-based microbiological analyses, e.g., transcriptome and reverse transcription-quantitative PCR, require a relatively large amount of high quality RNA. RNA-based analyses on microbial communities in deep-sea hydrothermal environments often encounter methodological difficulties with RNA extraction due to the presence of unique minerals in and the low biomass of samples. In the present study, we assessed RNA extraction methods for deep-sea vent chimneys that had complex mineral compositions. Mineral-RNA adsorption experiments were conducted using mock chimney minerals and Escherichia coli total RNA solution, and showed that detectable RNA significantly decreased possibly due to adsorption onto minerals. This decrease in RNA was prevented by the addition of sodium tripolyphosphate (STPP), deoxynucleotide triphosphates (dNTPs), salmon sperm DNA, and NaOH. The addition of STPP was also effective for RNA extraction from the mixture of E. coli cells and mock chimney minerals when TRIzol reagent and the RNeasy column were used, but not when the RNeasy PowerSoil total RNA kit was used. A combination of STPP, TRIzol reagent, the RNeasy column, and sonication resulted in the highest RNA yield from a natural chimney. This indirect extraction procedure is simple, rapid, inexpensive, and may be used for large-scale RNA extraction.

  18. High quality transmission Kikuchi diffraction analysis of deformed alloys - Case study

    International Nuclear Information System (INIS)

    Tokarski, Tomasz; Cios, Grzegorz; Kula, Anna; Bała, Piotr

    2016-01-01

    Modern scanning electron microscopes (SEM) equipped with thermally assisted field emission guns (Schottky FEG) are capable of imaging with a resolution in the range of several nanometers or better. Simultaneously, the high electron beam current can be used, which enables fast chemical and crystallographic analysis with a higher resolution than is normally offered by SEM with a tungsten cathode. The current resolution that limits the EDS and EBSD analysis is related to materials' physics, particularly to the electron-specimen interaction volume. The application of thin, electron-transparent specimens, instead of bulk samples, improves the resolution and allows for the detailed analysis of very fine microstructural features. Beside the typical imaging mode, it is possible to use a standard EBSD camera in such a configuration that only transmitted and scattered electrons are detected. This modern approach was successfully applied to various materials giving rise to significant resolution improvement, especially for the light element magnesium based alloys. This paper presents an insight into the application of the transmission Kikuchi diffraction (TKD) technique applied to the most troublesome, heavily-deformed materials. In particular, the values of the highest possible acquisition rates for high resolution and high quality mapping were estimated within typical imaging conditions of stainless steel and magnesium-yttrium alloy. - Highlights: •Monte Carlo simulations were used to simulate EBSD camera intensity for various measuring conditions. •Transmission Kikuchi diffraction parameters were evaluated for highly deformed, light and heavy elements based alloys. •High quality maps with 20 nm spatial resolution were acquired for Mg and Fe based alloys. •High speed TKD measurements were performed at acquisition rates comparable to the reflection EBSD.

  19. The need for high-quality whole-genome sequence databases in microbial forensics.

    Science.gov (United States)

    Sjödin, Andreas; Broman, Tina; Melefors, Öjar; Andersson, Gunnar; Rasmusson, Birgitta; Knutsson, Rickard; Forsman, Mats

    2013-09-01

    Microbial forensics is an important part of a strengthened capability to respond to biocrime and bioterrorism incidents to aid in the complex task of distinguishing between natural outbreaks and deliberate acts. The goal of a microbial forensic investigation is to identify and criminally prosecute those responsible for a biological attack, and it involves a detailed analysis of the weapon--that is, the pathogen. The recent development of next-generation sequencing (NGS) technologies has greatly increased the resolution that can be achieved in microbial forensic analyses. It is now possible to identify, quickly and in an unbiased manner, previously undetectable genome differences between closely related isolates. This development is particularly relevant for the most deadly bacterial diseases that are caused by bacterial lineages with extremely low levels of genetic diversity. Whole-genome analysis of pathogens is envisaged to be increasingly essential for this purpose. In a microbial forensic context, whole-genome sequence analysis is the ultimate method for strain comparisons as it is informative during identification, characterization, and attribution--all 3 major stages of the investigation--and at all levels of microbial strain identity resolution (ie, it resolves the full spectrum from family to isolate). Given these capabilities, one bottleneck in microbial forensics investigations is the availability of high-quality reference databases of bacterial whole-genome sequences. To be of high quality, databases need to be curated and accurate in terms of sequences, metadata, and genetic diversity coverage. The development of whole-genome sequence databases will be instrumental in successfully tracing pathogens in the future.

  20. Prodigious Effects of Concentration Intensification on Nanoparticle Synthesis: A High-Quality, Scalable Approach

    KAUST Repository

    Williamson, Curtis B.

    2015-12-23

    © 2015 American Chemical Society. Realizing the promise of nanoparticle-based technologies demands more efficient, robust synthesis methods (i.e., process intensification) that consistently produce large quantities of high-quality nanoparticles (NPs). We explored NP synthesis via the heat-up method in a regime of previously unexplored high concentrations near the solubility limit of the precursors. We discovered that in this highly concentrated and viscous regime the NP synthesis parameters are less sensitive to experimental variability and thereby provide a robust, scalable, and size-focusing NP synthesis. Specifically, we synthesize high-quality metal sulfide NPs (<7% relative standard deviation for Cu2-xS and CdS), and demonstrate a 10-1000-fold increase in Cu2-xS NP production (>200 g) relative to the current field of large-scale (0.1-5 g yields) and laboratory-scale (<0.1 g) efforts. Compared to conventional synthesis methods (hot injection with dilute precursor concentration) characterized by rapid growth and low yield, our highly concentrated NP system supplies remarkably controlled growth rates and a 10-fold increase in NP volumetric production capacity (86 g/L). The controlled growth, high yield, and robust nature of highly concentrated solutions can facilitate large-scale nanomanufacturing of NPs by relaxing the synthesis requirements to achieve monodisperse products. Mechanistically, our investigation of the thermal and rheological properties and growth rates reveals that this high concentration regime has reduced mass diffusion (a 5-fold increase in solution viscosity), is stable to thermal perturbations (64% increase in heat capacity), and is resistant to Ostwald ripening.

  1. Experience from the 1st year running a massive high quality videoconferencing service for the LHC

    International Nuclear Information System (INIS)

    Fernandes, Joao; Baron, Thomas; Bompastor, Bruno

    2014-01-01

    In the last few years, we have witnessed an explosion of visual collaboration initiatives in the industry. Several advances in video services and also in their underlying infrastructure are currently improving the way people collaborate globally. These advances are creating new usage paradigms: any device in any network can be used to collaborate, in most cases with an overall high quality. To keep apace with this technology progression, the CERN IT Department launched a service based on the Vidyo product. This new service architecture introduces Adaptive Video Layering, which dynamically optimizes the video for each endpoint by leveraging the H.264 Scalable Video Coding (SVC)-based compression technology. It combines intelligent AV routing techniques with the flexibility of H.264 SVC video compression, in order to achieve resilient video collaboration over the Internet, 3G and WiFi. We present an overview of the results that have been achieved after this major change. In particular, the first year of operation of the CERN Vidyo service will be described in terms of performance and scale: The service became part of the daily activity of the LHC collaborations, reaching a monthly usage of more than 3200 meetings with a peak of 750 simultaneous connections. We also present some key features such as the integration with CERN Indico. LHC users can now join a Vidyo meeting either from their personal computer or a CERN videoconference room simply from an Indico event page, with the ease of a single click. The roadmap for future improvements, service extensions and core infrastructure tendencies such as cloud based services and virtualization of system components will also be discussed. Vidyo's strengths allowed us to build a universal service (it is accessible from PCs, but also videoconference rooms, traditional phones, tablets and smartphones), developed with 3 key ideas in mind: ease of use, full integration and high quality.

  2. High quality antireflective ZnS thin films prepared by chemical bath deposition

    International Nuclear Information System (INIS)

    Tec-Yam, S.; Rojas, J.; Rejón, V.; Oliva, A.I.

    2012-01-01

    Zinc sulfide (ZnS) thin films for antireflective applications were deposited on glass substrates by chemical bath deposition (CBD). Chemical analysis of the soluble species permits to predict the optimal pH conditions to obtain high quality ZnS films. For the CBD, the ZnCl 2 , NH 4 NO 3 , and CS(NH 2 ) 2 were fixed components, whereas the KOH concentration was varied from 0.8 to 1.4 M. Groups of samples with deposition times from 60 to 120 min were prepared in a bath with magnetic agitation and heated at 90 °C. ZnS films obtained from optimal KOH concentrations of 0.9 M and 1.0 M exhibited high transparency, homogeneity, adherence, and crystalline. The ZnS films presented a band gap energy of 3.84 eV, an atomic Zn:S stoichiometry ratio of 49:51, a transmittance above 85% in the 300–800 nm wavelength range, and a reflectance below 25% in the UV–Vis range. X-ray diffraction analysis revealed a cubic structure in the (111) orientation for the films. The thickness of the films was tuned between 60 nm and 135 nm by controlling the deposition time and KOH concentration. The incorporation of the CBD-ZnS films into ITO/ZnS/CdS/CdTe and glass/Mo/ZnS heterostructures as antireflective layer confirms their high optical quality. -- Highlights: ► High quality ZnS thin films were prepared by chemical bath deposition (CBD). ► Better CBD-ZnS films were achieved by using 0.9 M-KOH concentration. ► Reduction in the reflectance was obtained for ZnS films used as buffer layers.

  3. Ionocidium ‘Cerrado 101’: intergeneric orchid hybrid with high quality of blooming

    Directory of Open Access Journals (Sweden)

    Jean Carlos Cardoso

    2017-10-01

    Full Text Available Orchids are considered one of the most important potted-flowering in the world. Oncidium genus, as well their hybrids group (OHGs has used for the flower market as pot or cut flower.  However, some horticultural characteristics require improvements, e.g. the production of precocious cultivars, independent-season blooming or easy flowering induction, high quality and durability of flowers and variations in color of flowers, to compete with Phalaenopsis and Dendrobium orchids, as other flower groups. Aiming this purpose there were used hand-crossing pollination between the Oncidium ‘Sweet Sugar’ and Ionopsis utricularioides, a Brazilian wild species, for evaluate the capacity of crossing and to select progenies with interest of use in floriculture as new cultivar. The seeds obtained from this cross were seeded on in vitro conditions, followed by acclimatization and cultivation on greenhouse conditions until de flowering time. One of the plants obtained presented interesting characteristics, as good and rapid vegetative development and high quality of blooming. This hybrid obtained from an intergeneric crossing resulted in a plant with vegetative and flower type characteristics and color similar of Oncidium female parent, but with larger number of ramifications in inflorescence and number of flowers (60% and 219,4%, respectively than Oncidium parent (♀, and with more similarity with Ionopsis (♂. This hybrid cultivar, called Ionocidium ‘Cerrado 101’ is one more option of OHGs in this competitive market and can be used either for pot and also for cut orchid flowers production, main because it longer inflorescence (83 cm.

  4. Blueprint for action: steps toward a high-quality, high-value maternity care system.

    Science.gov (United States)

    Angood, Peter B; Armstrong, Elizabeth Mitchell; Ashton, Diane; Burstin, Helen; Corry, Maureen P; Delbanco, Suzanne F; Fildes, Barbara; Fox, Daniel M; Gluck, Paul A; Gullo, Sue Leavitt; Howes, Joanne; Jolivet, R Rima; Laube, Douglas W; Lynne, Donna; Main, Elliott; Markus, Anne Rossier; Mayberry, Linda; Mitchell, Lynn V; Ness, Debra L; Nuzum, Rachel; Quinlan, Jeffrey D; Sakala, Carol; Salganicoff, Alina

    2010-01-01

    Childbirth Connection hosted a 90th Anniversary national policy symposium, Transforming Maternity Care: A High Value Proposition, on April 3, 2009, in Washington, DC. Over 100 leaders from across the range of stakeholder perspectives were actively engaged in the symposium work to improve the quality and value of U.S. maternity care through broad system improvement. A multi-disciplinary symposium steering committee guided the strategy from its inception and contributed to every phase of the project. The "Blueprint for Action: Steps Toward a High Quality, High Value Maternity Care System", issued by the Transforming Maternity Care Symposium Steering Committee, answers the fundamental question, "Who needs to do what, to, for, and with whom to improve the quality of maternity care over the next five years?" Five stakeholder workgroups collaborated to propose actionable strategies in 11 critical focus areas for moving expeditiously toward the realization of the long term "2020 Vision for a High Quality, High Value Maternity Care System", also published in this issue. Following the symposium these workgroup reports and recommendations were synthesized into the current blueprint. For each critical focus area, the "Blueprint for Action" presents a brief problem statement, a set of system goals for improvement in that area, and major recommendations with proposed action steps to achieve them. This process created a clear sightline to action that if enacted could improve the structure, process, experiences of care, and outcomes of the maternity care system in ways that when anchored in the culture can indeed transform maternity care. Copyright 2010 Jacobs Institute of Women

  5. Alterations in epidermal growth factor receptors 1 and 2 in esophageal squamous cell carcinomas

    International Nuclear Information System (INIS)

    Gonzaga, Isabela Martins; Andreollo, Nelson Adami; Simão, Tatiana Almeida de; Pinto, Luis Felipe Ribeiro; Soares-Lima, Sheila Coelho; Santos, Paulo Thiago Souza de; Blanco, Tania Cristina Moita; Reis, Bruno Souza Bianchi de; Quintella, Danielle Carvalho; Oliveira, Ivanir Martins de; Faria, Paulo Antonio Silvestre de; Kruel, Cleber Dario Pinto

    2012-01-01

    Esophageal squamous cell carcinoma (ESCC) shows a 5-year survival rate below 10%, demonstrating the urgency in improving its treatment. Alterations in epidermal growth factor receptors are closely related to malignancy transformation in a number of tumors and recent successful targeted therapies have been directed to these molecules. Therefore, in this study, we analyzed the expression of EGFR and HER2 and evaluated EGFR mutation profile as well as the presence of mutations in hotspots of KRAS and BRAF in ESCC patients. We performed RT-qPCR, immunohistochemistry and Fluorescent in situ hybridization to determine EGFR and HER2 expression in ESCC patients, and direct sequencing and PCR-RFLP for mutations and polymorphism analysis. Our results showed an increased EGFR mRNA expression in tumors compared to surrounding tissue (p <0.05), with 11% of the cases presenting at least a four-fold difference between tumor and paired adjacent mucosa. EGFR protein overexpression was present only in 4% of the cases. The median expression of HER2 mRNA was not different between tumors and adjacent mucosa. Still, 7% of the tumors presented at least a 25-fold higher expression of this gene when compared to its paired counterpart. Immunohistochemical analysis revealed that 21% of the tumors were positive for HER2 (scores 2+ and 3+), although only 3+ tumors presented amplification of this gene. Mutation analysis for EGFR (exons 18-21), KRAS (codons 12 and 13) and BRAF (V600E) showed no mutations in any of the hotspots of these genes in almost 100 patients analyzed. EGFR presented synonymous polymorphisms at codon 836 (C>T) in 2.1% of the patients, and at codon 787 (G>A) in 79.2% of the cases. This last polymorphism was also evaluated in 304 healthy controls, which presented a similar frequency (73.7%) in comparison with ESCC patients. The absence of mutations of EGFR, KRAS and BRAF as well as the overexpression of EGFR and HER2 in less than 10% of the patients suggest that this

  6. Effects of soap-water wash on human epidermal penetration.

    Science.gov (United States)

    Zhu, Hanjiang; Jung, Eui-Chang; Phuong, Christina; Hui, Xiaoying; Maibach, Howard

    2016-08-01

    Skin decontamination is a primary interventional method used to decrease dermal absorption of hazardous contaminants, including chemical warfare agents, pesticides and industrial pollutants. Soap and water wash, the most common and readily available decontamination system, may enhance percutaneous absorption through the "wash-in effect." To understand better the effect of soap-water wash on percutaneous penetration, and provide insight to improving skin decontamination methods, in vitro human epidermal penetration rates of four C(14) -labeled model chemicals (hydroquinone, clonidine, benzoic acid and paraoxon) were assayed using flow-through diffusion cells. Stratum corneum (SC) absorption rates of these chemicals at various hydration levels (0-295% of the dry SC weights) were determined and compared with the results of the epidermal penetration study to clarify the effect of SC hydration on skin permeability. Results showed accelerated penetration curves of benzoic acid and paraoxon after surface wash at 30 min postdosing. Thirty minutes after washing (60 min postdosing), penetration rates of hydroquinone and benzoic acid decreased due to reduced amounts of chemical on the skin surface and in the SC. At the end of the experiment (90 min postdosing), a soap-water wash resulted in lower hydroquinone penetration, greater paraoxon penetration and similar levels of benzoic acid and clonidine penetration compared to penetration levels in the non-wash groups. The observed wash-in effect agrees with the enhancement effect of SC hydration on the SC chemical absorption rate. These results suggest SC hydration derived from surface wash to be one cause of the wash-in effect. Further, the occurrence of a wash-in effect is dependent on chemical identity and elapsed time between exposure and onset of decontamination. By reducing chemical residue quantity on skin surface and in the SC reservoir, the soap-water wash may decrease the total quantity of chemical absorbed in the

  7. Methods for RNA Analysis

    DEFF Research Database (Denmark)

    Olivarius, Signe

    of the transcriptome, 5’ end capture of RNA is combined with next-generation sequencing for high-throughput quantitative assessment of transcription start sites by two different methods. The methods presented here allow for functional investigation of coding as well as noncoding RNA and contribute to future...... RNAs rely on interactions with proteins, the establishment of protein-binding profiles is essential for the characterization of RNAs. Aiming to facilitate RNA analysis, this thesis introduces proteomics- as well as transcriptomics-based methods for the functional characterization of RNA. First, RNA...

  8. Quantitative PCR--new diagnostic tool for quantifying specific mRNA and DNA molecules

    DEFF Research Database (Denmark)

    Schlemmer, B O; Sorensen, B S; Overgaard, J

    2004-01-01

    of a subset of ligands from the EGF system is increased in bladder cancer. Furthermore, measurement of the mRNA concentration gives important information such as the expression of these ligands correlated to the survival of the patients. In addition to the alterations at the mRNA level, changes also can occur...... at the DNA level in the EGF system. Thus, it has been demonstrated that the number of genes coding for the human epidermal growth factor receptor 2 (HER2) is increased in a number of breast tumors. It is now possible to treat breast cancer patients with a humanized antibody reacting with HER2...... of mRNA or DNA in biological samples. In this study quantitative PCR was used to investigate the role of the EGF (epidermal growth factor) system in cancer both for measurements of mRNA concentrations and for measurements of the number of copies of specific genes. It is shown that the mRNA expression...

  9. Cytoplasmic Z-RNA

    International Nuclear Information System (INIS)

    Zarling, D.A.; Calhoun, C.J.; Hardin, C.C.; Zarling, A.H.

    1987-01-01

    Specific immunochemical probes for Z-RNA were generated and characterized to search for possible Z-RNA-like double helices in cells. Z-RNA was detected in the cytoplasm of fixed protozoan cells by immunofluorescence microscopy using these anti-Z-RNA IgCs. In contrast, autoimmune or experimentally elicited anti-DNA antibodies, specifically reactive with B-DNA or Z-DNA, stained the nuclei. Pre-or nonimmune IgGs did not bind to the cells. RNase A or T1 digestion eliminated anti-Z-RNA IgG binding to cytoplasmic determinants; however, DNase I or mung bean nuclease had no effect. Doxorubicin and ethidium bromide prevented anti-Z-RNA antibody binding; however, actinomycin D, which does not bind double-stranded RNA, did not. Anti-Z-RNA immunofluorescence was specifically blocked in competition assays by synthetic Z-RNA but not Z-DNA, A-RNA, or single-stranded RNAs. Thus, some cytoplasmic sequences in fixed cells exist in the left-handed Z-RNA conformation

  10. Influence of topical human epidermal growth factor on postkeratoplasty re-epithelialisation

    NARCIS (Netherlands)

    M.M. Dellaert; T.A. Casey; S. Wiffen; J. Gordon (Jocelynne); P. Johnson (Jürgen); A.J. Geerards (Annette); W.J. Rijneveld (Wilhelmina); L. Remeijer (Lies); W.H. Beekhuis (Houdijn); P.G.H. Mulder (Paul)

    1997-01-01

    textabstractAIM: To test the efficacy and safety of recombinant human epidermal growth factor (hEGF) on corneal re-epithelialisation following penetrating keratoplasty. METHODS: A prospective, randomised, placebo controlled study was carried out in which patients were

  11. Epidermal response of rainbow trout to Ichthyobodo necator

    DEFF Research Database (Denmark)

    Chettri, Jiwan Kumar; Kuhn, Jesper Andreas; Mohammad, Rezkar Jaafar

    2014-01-01

    Infections with the parasitic flagellate Ichthyobodo necator (Henneguy, 1883) cause severe skin and gill disease in rainbow trout Oncorhynchus mykiss (Walbaum, 1792) juveniles. The epidermal disturbances including hyperplasia and mucous cell exhaustion caused by parasitization are known, but no d...

  12. Epigenetic Regulation of Epidermal Stem Cell Biomarkers and Their Role in Wound Healing

    Directory of Open Access Journals (Sweden)

    Sabita N. Saldanha

    2015-12-01

    Full Text Available As an actively renewable tissue, changes in skin architecture are subjected to the regulation of stem cells that maintain the population of cells responsible for the formation of epidermal layers. Stems cells retain their self-renewal property and express biomarkers that are unique to this population. However, differential regulation of the biomarkers can initiate the pathway of terminal cell differentiation. Although, pockets of non-clarity in stem cell maintenance and differentiation in skin still exist, the influence of epigenetics in epidermal stem cell functions and differentiation in skin homeostasis and wound healing is clearly evident. The focus of this review is to discuss the epigenetic regulation of confirmed and probable epidermal stem cell biomarkers in epidermal stratification of normal skin and in diseased states. The role of epigenetics in wound healing, especially in diseased states of diabetes and cancer, will also be conveyed.

  13. Genetics Home Reference: Stevens-Johnson syndrome/toxic epidermal necrolysis

    Science.gov (United States)

    ... Hung SI. Recent advances in the genetics and immunology of Stevens-Johnson syndrome and toxic epidermal necrosis. ... 2012 May 29. Citation on PubMed or Free article on PubMed Central More from Genetics Home Reference ...

  14. Multistep change in epidermal growth factor receptors during spontaneous neoplastic progression in Chinese hamster embryo fibroblasts

    International Nuclear Information System (INIS)

    Wakshull, E.; Kraemer, P.M.; Wharton, W.

    1985-01-01

    Whole Chinese hamster embryo lineages have been shown to undergo multistep spontaneous neoplastic progression during serial passage in culture. The authors have studied the binding, internalization, and degradation of 125 I-labeled epidermal growth factor at four different stages of transformation. The whole Chinese hamster embryo cells lost cell surface epidermal growth factor receptors gradually during the course of neoplastic progression until only 10% of the receptor number present in the early-passage cells (precrisis) were retained in the late-passage cells (tumorigenic). No differences in internalization rates, chloroquine sensitivity, or ability to degrade hormone between the various passage levels were seen. No evidence for the presence in conditioned medium of transforming growth factors which might mask or down-regulate epidermal growth factor receptor was obtained. These results suggest that a reduction in cell surface epidermal growth factor receptor might be an early event during spontaneous transformation in whole Chinese hamster embryo cells

  15. High Quality Unigenes and Microsatellite Markers from Tissue Specific Transcriptome and Development of a Database in Clusterbean (Cyamopsis tetragonoloba, L. Taub

    Directory of Open Access Journals (Sweden)

    Hukam C. Rawal

    2017-11-01

    Full Text Available Clusterbean (Cyamopsis tetragonoloba L. Taub, is an important industrial, vegetable and forage crop. This crop owes its commercial importance to the presence of guar gum (galactomannans in its endosperm which is used as a lubricant in a range of industries. Despite its relevance to agriculture and industry, genomic resources available in this crop are limited. Therefore, the present study was undertaken to generate RNA-Seq based transcriptome from leaf, shoot, and flower tissues. A total of 145 million high quality Illumina reads were assembled using Trinity into 127,706 transcripts and 48,007 non-redundant high quality (HQ unigenes. We annotated 79% unigenes against Plant Genes from the National Center for Biotechnology Information (NCBI, Swiss-Prot, Pfam, gene ontology (GO and KEGG databases. Among the annotated unigenes, 30,020 were assigned with 116,964 GO terms, 9984 with EC and 6111 with 137 KEGG pathways. At different fragments per kilobase of transcript per millions fragments sequenced (FPKM levels, genes were found expressed higher in flower tissue followed by shoot and leaf. Additionally, we identified 8687 potential simple sequence repeats (SSRs with an average frequency of one SSR per 8.75 kb. A total of 28 amplified SSRs in 21 clusterbean genotypes resulted in polymorphism in 13 markers with average polymorphic information content (PIC of 0.21. We also constructed a database named ‘ClustergeneDB’ for easy retrieval of unigenes and the microsatellite markers. The tissue specific genes identified and the molecular marker resources developed in this study is expected to aid in genetic improvement of clusterbean for its end use.

  16. Use of etanercept to treat toxic epidermal necrolysis in a human immunodeficiency virus-positive patient

    OpenAIRE

    Yung-Yi Lee; Jui-Hung Ko; Chia-Hung Wei; Wen-Hung Chung

    2013-01-01

    Toxic epidermal necrolysis (TEN) is an uncommon and severe cutaneous adverse drug reaction that causes disseminated necrosis of epidermal cells and mucocutaneous detachment. Here, we report the case of a 32-year-old man with human immunodeficiency virus infection who presented with generalized violaceous macules and blister formation 4 days after the administration of mefenamic acid and amoxicillin for a dental procedure. Additional symptoms included oral ulcers and conjunctivitis. Results of...

  17. HLA-B Sequencing in Patients with Stevens-Johnson Syndrome and Toxic Epidermal Necrolysis

    Science.gov (United States)

    2017-03-03

    Stevens -Johnson Syndrome and Toxic Epidermal Necrolysis Brittany L. Lenz, MD, Andrew T. Patterson, MD, Amanda J . Laska, MD, Patrick J . Brown, MD, and...59 MDW/SGVU SUBJECT: Professional Presentation Approval 8 DEC 2016 1. Your paper, entitled HLA-B Sequencing in Patients with Stevens -Johnson...PATIENTS WITH STEVENS -JOHNSON SYNDROME AND TOXIC EPIDERMAL NECROL YSIS 2. FUNDING RECEIVED FOR THIS STUDY? DYES rgj NO FUNDING SOURCE: I I 3. IS THIS

  18. Epidermal growth factor receptor mutation in gastric cancer.

    Science.gov (United States)

    Liu, Zhimin; Liu, Lina; Li, Mei; Wang, Zhaohui; Feng, Lu; Zhang, Qiuping; Cheng, Shihua; Lu, Shen

    2011-04-01

    Epidermal growth factor receptor (EGFR) and Kirsten-RAS (KRAS) mutations have been identified as predictors of response to EGFR tyrosine kinase inhibitors (TKIs) in non-small cell lung cancer. We aimed to screen the mutations of both genes in gastric carcinoma to detect the suitability of EGFR TKIs for patients with gastric carcinoma. We screened EGFR mutation in exons 19-21 and KRAS mutation in exon 2 in 58 gastric adenocarcinomas from China using high resolution melting analysis (HRMA). Positive samples were confirmed by DNA sequencing. Three EGFR missense mutations (5.2%) and 22 single nucleotide polymorphisms (SNP, Q787Q, 37.9%) were identified. To our knowledge, we report for the first time three mutation patterns of EGFR, Y801C, L858R and G863D, in gastric carcinoma. Two samples with EGFR mutation were mucinous adenocarcinoma. These three samples were collected from male patients aged over 75 years old. The frequency of KRAS mutation was 10.3% (6/58). The exclusiveness of EGFR and KRAS mutations was proven for the first time in gastric cancer. Gastric carcinoma of the mucinous adenocarcinoma type collected from older male patients may harbour EGFR mutations. The small subset of gastric adenocarcinoma patients may respond to EGFR TKIs.

  19. Epidermal growth factor and its receptors in human pancreatic carcinoma

    International Nuclear Information System (INIS)

    Chen, Y.F.; Pan, G.Z.; Hou, X.; Liu, T.H.; Chen, J.; Yanaihara, C.; Yanaihara, N.

    1990-01-01

    The role of epidermal growth factor (EGF) in oncogenesis and progression of malignant tumors is a subject of vast interest. In this study, radioimmunoassay and radioreceptor assay of EGF were established. EGF contents in malignant and benign pancreatic tumors, in normal pancreas tissue, and in culture media of a human pancreatic carcinoma cell line were determined. EGF receptor binding studies were performed. It was shown that EGF contents in pancreatic carcinomas were significantly higher than those in normal pancreas or benign pancreatic tumors. EGF was also detected in the culture medium of a pancreatic carcinoma cell line. The binding of 125I-EGF to the pancreatic carcinoma cells was time and temperature dependent, reversible, competitive, and specific. Scatchard analysis showed that the dissociation constant of EGF receptor was 2.1 X 10(-9) M, number of binding sites was 1.3 X 10(5) cell. These results indicate that there is an over-expression of EGF/EGF receptors in pancreatic carcinomas, and that an autocrine regulatory mechanism may exist in the growth-promoting effect of EGF on tumor cells

  20. Roles of p63 in epidermal development and tumorigenesis

    Directory of Open Access Journals (Sweden)

    Jeng-Yuan Yao

    2012-12-01

    Full Text Available pidermis is composed mainly of keratinocytes and is the ma­jor barrier of human body. The development and maintenance of normal epithelial structures and functions require the transcrip­tion factor p63. The p63 gene encodes proteins with structures simi­lar to that of p53, including an N-terminal transacti­vation (TA domain, a DNA-binding domain and a car­boxy-oligomerization domain. TAp63 and ΔNp63 (p63 isoforms without TA domain regulate a wide range of target genes that are important for embryonal development and epithelial integrity. Mutations of p63 gene cause epider­mal abnormalities characterized by ectodermal dysplasia. Recent reports have indicated that p63 plays important role in tumorigenesis as well. However, the relative importance of TAp63 and ΔNp63 in epidermal development and tumorigenesis re­mains mostly unclear and awaits further investigation. In this review, we summarize the current knowledge on the structure and function of p63 and its isoforms.

  1. Shavenbaby couples patterning to epidermal cell shape control.

    Directory of Open Access Journals (Sweden)

    Hélène Chanut-Delalande

    2006-09-01

    Full Text Available It is well established that developmental programs act during embryogenesis to determine animal morphogenesis. How these developmental cues produce specific cell shape during morphogenesis, however, has remained elusive. We addressed this question by studying the morphological differentiation of the Drosophila epidermis, governed by a well-known circuit of regulators leading to a stereotyped pattern of smooth cells and cells forming actin-rich extensions (trichomes. It was shown that the transcription factor Shavenbaby plays a pivotal role in the formation of trichomes and underlies all examined cases of the evolutionary diversification of their pattern. To gain insight into the mechanisms of morphological differentiation, we sought to identify shavenbaby's downstream targets. We show here that Shavenbaby controls epidermal cell shape, through the transcriptional activation of different classes of cellular effectors, directly contributing to the organization of actin filaments, regulation of the extracellular matrix, and modification of the cuticle. Individual inactivation of shavenbaby's targets produces distinct trichome defects and only their simultaneous inactivation prevent trichome formation. Our data show that shavenbaby governs an evolutionarily conserved developmental module consisting of a set of genes collectively responsible for trichome formation, shedding new light on molecular mechanisms acting during morphogenesis and the way they can influence evolution of animal forms.

  2. Retinoic Acid-Induced Epidermal Transdifferentiation in Skin

    Directory of Open Access Journals (Sweden)

    Yoshihiro Akimoto

    2014-06-01

    Full Text Available Retinoids function as important regulatory signaling molecules during development, acting in cellular growth and differentiation both during embryogenesis and in the adult animal. In 1953, Fell and Mellanby first found that excess vitamin A can induce transdifferentiation of chick embryonic epidermis to a mucous epithelium (Fell, H.B.; Mellanby, E. Metaplasia produced in cultures of chick ectoderm by high vitamin A. J. Physiol. 1953, 119, 470–488. However, the molecular mechanism of this transdifferentiation process was unknown for a long time. Recent studies demonstrated that Gbx1, a divergent homeobox gene, is one of the target genes of all-trans retinoic acid (ATRA for this transdifferentiation. Furthermore, it was found that ATRA can induce the epidermal transdifferentiation into a mucosal epithelium in mammalian embryonic skin, as well as in chick embryonic skin. In the mammalian embryonic skin, the co-expression of Tgm2 and Gbx1 in the epidermis and an increase in TGF-β2 expression elicited by ATRA in the dermis are required for the mucosal transdifferentiation, which occurs through epithelial-mesenchymal interaction. Not only does retinoic acid (RA play an important role in mucosal transdifferentiation, periderm desquamation, and barrier formation in the developing mammalian skin, but it is also involved in hair follicle downgrowth and bending by its effect on the Wnt/β-catenin pathway and on members of the Runx, Fox, and Sox transcription factor families.

  3. Intensive Care in a Patient with Toxic Epidermal Necrolysis

    Directory of Open Access Journals (Sweden)

    J. Wallenborn

    2017-01-01

    Full Text Available Toxic epidermal necrolysis (TEN is a serious adverse drug reaction with high lethality, which usually requires intensive-medical care. A 44-year-old man developed generalized exanthema with increasing exfoliation and mucosal involvement after taking allopurinol, ibuprofen, and etoricoxib. The clinical diagnosis of TEN was histologically confirmed. Prednisolone therapy with 3 mg/kg body weight (BW was not able to prevent further progress to finally 80% of the body surface, and infliximab 5 mg/kg BW was given as a single dose. This prevented further progression of the TEN. Despite marked improvement in skin findings, the ICU stay was prolonged by a complex analgosedation, transient kidney failure, volume management, positioning therapy, and vegetatively impeded weaning. Moreover, there was colonization with multiresistant bacteria (MRSA and VRE. Nonetheless, the patient could be restored to health and was released after four weeks. Infliximab seems to be effective in the treatment of TEN, especially in cases of rapid progression. Moreover, patients with TEN are difficult to handle in intensive-medical care, whereby attention should especially be paid to sufficient pain therapy, and the positioning of the patient is a particular challenge.

  4. Homologous radioimmunoassay for human epidermal growth factor (urogastrone)

    International Nuclear Information System (INIS)

    Dailey, G.E.; Kraus, J.W.; Orth, D.N.

    1978-01-01

    Epidermal growth factor (EGF), a polypeptide hormone originally discovered in the mouse submaxillary gland, stimulates growth in a variety of tissues in several species. This hormone has recently been identified in human urine. A homologous RIA for human EGF (RIA-hEGF) has been developed. In general, levels were similar to those recently reported using a heterologous RIA system. Twenty-four-hour urinary excretion of RIA-hEGF by normal adult males and females was 63.0 +- 3.0 and 52.0 +- 3.5 (mean +- SE) μg/total vol, or 29.7 +- 1.1 and 39.8 +- 1.7 μg/g creatinine, respectively. Excretion by females taking oral contraceptives was significantly greater (60.1 +- 2.7 μg/g creatinine; P 0.05). Several of those with very low values had histories of alcohol abuse. Excretion by patients with Cushing's syndrome was normal. Patients with psoriasis or recovering from major burns excreted both abnormally high and abnormally low levels of RIA-hEGF, with no obvious correlation to their clinical condition. There was no apparent diurnal or postprandial variation in urinary RIA-hEGF excretion by normal subjects. An excellent linear correlation was observed between RIA-hEGF and creatinine concentrations in each urine sample for each subject, suggesting that RIA-hEGF concentration in a random urine sample provides a valid index of 24-h RIA-hEGF excretion

  5. Kinetics of growth and differentiation of cultured human epidermal keratinocytes

    International Nuclear Information System (INIS)

    Albers, K.M.

    1985-01-01

    A study was made of the interrelationship between replication and differentiation in cultures of human epidermal keratinocytes. Measures of both parameters were made using newly developed methods to quantify the rate at which keratinocytes replicate and the rate at which they withdraw from the cell cycle. Keratinocyte replication was measured by determining the cell doubling time, labeling index, and cell cycle duration. Cell cycle length was measured using a double label assay that determines the length of time between two successive phases of DNA synthesis. The first DNA synthesis phase was marked by labeling keratinocytes with 14 C-thymidine. At the next round of DNA synthesis, cells were labeled with bromodeoxyuridine, a heavy analog of thymidine. The cell cycle length is given by the time required for the 14 C-labeled DNA to become double labeled. To measure keratinocyte differentiation, the rate at which cells withdraw from the cell cycle was determined. To measure withdrawal, the percentage of cells labeled by a pulse of 14 C-thymidine that failed to undergo a second cycle of DNA synthesis, as measured by bromodeoxyuridine incorporation, was determined. Cells which failed to undergo a second cycle of synthesis were considered to have differentiated and withdrawn from the cell cycle

  6. Intranasal epidermal growth factor treatment rescues neonatal brain injury

    Science.gov (United States)

    Scafidi, Joseph; Hammond, Timothy R.; Scafidi, Susanna; Ritter, Jonathan; Jablonska, Beata; Roncal, Maria; Szigeti-Buck, Klara; Coman, Daniel; Huang, Yuegao; McCarter, Robert J.; Hyder, Fahmeed; Horvath, Tamas L.; Gallo, Vittorio

    2014-02-01

    There are no clinically relevant treatments available that improve function in the growing population of very preterm infants (less than 32 weeks' gestation) with neonatal brain injury. Diffuse white matter injury (DWMI) is a common finding in these children and results in chronic neurodevelopmental impairments. As shown recently, failure in oligodendrocyte progenitor cell maturation contributes to DWMI. We demonstrated previously that the epidermal growth factor receptor (EGFR) has an important role in oligodendrocyte development. Here we examine whether enhanced EGFR signalling stimulates the endogenous response of EGFR-expressing progenitor cells during a critical period after brain injury, and promotes cellular and behavioural recovery in the developing brain. Using an established mouse model of very preterm brain injury, we demonstrate that selective overexpression of human EGFR in oligodendrocyte lineage cells or the administration of intranasal heparin-binding EGF immediately after injury decreases oligodendroglia death, enhances generation of new oligodendrocytes from progenitor cells and promotes functional recovery. Furthermore, these interventions diminish ultrastructural abnormalities and alleviate behavioural deficits on white-matter-specific paradigms. Inhibition of EGFR signalling with a molecularly targeted agent used for cancer therapy demonstrates that EGFR activation is an important contributor to oligodendrocyte regeneration and functional recovery after DWMI. Thus, our study provides direct evidence that targeting EGFR in oligodendrocyte progenitor cells at a specific time after injury is clinically feasible and potentially applicable to the treatment of premature children with white matter injury.

  7. Evolution of the clonogenic potential of human epidermal stem/progenitor cells with age

    Directory of Open Access Journals (Sweden)

    Zobiri O

    2012-02-01

    Full Text Available Olivia Zobiri, Nathalie Deshayes, Michelle Rathman-JosserandDepartment of Biological Research, L'Oréal Advanced Research, Clichy Cedex, FranceAbstract: A number of clinical observations have indicated that the regenerative potential and overall function of the epidermis is modified with age. The epidermis becomes thinner, repairs itself less efficiently after wounding, and presents modified barrier function recovery. In addition, the dermal papillae flatten out with increasing age, suggesting a modification in the interaction between epidermal and dermal compartments. As the epidermal regenerative capacity is dependent upon stem and progenitor cell function, it is naturally of interest to identify and understand age-related changes in these particular keratinocyte populations. Previous studies have indicated that the number of stem cells does not decrease with age in mouse models but little solid evidence is currently available concerning human skin. The objective of this study was to evaluate the clonogenic potential of keratinocyte populations isolated from the epidermis of over 50 human donors ranging from 18 to 71 years old. The data indicate that the number of epidermal cells presenting high regenerative potential does not dramatically decline with age in human skin. The authors believe that changes in the microenvironment controlling epidermal basal cell activity are more likely to explain the differences in epidermal function observed with increasing age.Keywords: skin, epidermal stem cells, aging, colony-forming efficiency test

  8. [Enhanced lymphocyte proliferation in the presence of epidermal cells of HIV-infected patients in vitro].

    Science.gov (United States)

    Kappus, R P; Berger, S; Thomas, C A; Ottmann, O G; Ganser, A; Stille, W; Shah, P M

    1992-07-01

    Clinical observations show that the HIV infection is often associated with affections of the skin. In order to examine the involvement of the epidermal immune system in the HIV infection, we determined accessory cell function of epidermal cells from HIV-1-infected patients. For this we measured the proliferative response of enriched CD(4+)-T-lymphocytes from HIV-infected patients and noninfected controls to stimulation with anti-CD3 and IL-2 in the presence of epidermal cells; the enhancement of the response is dependent on the presence of functionally intact accessory cells. The capacity of epidermal cells to increase the anti-CD3-stimulated T-cell proliferative response was significantly enhanced in HIV patients (CDC III/IVA) as compared with noninfected donors. It is discussed, whether the increased activity of epidermal cells from HIV-infected patients may be responsible for several of the dermal lesions in the course of an HIV infection as due to an enhanced production and release of epidermal cell-derived cytokines.

  9. Commonly Employed African Neonatal Skin Care Products Compromise Epidermal Function in Mice.

    Science.gov (United States)

    Man, Mao-Qiang; Sun, Richard; Man, George; Lee, Dale; Hill, Zelee; Elias, Peter M

    2016-09-01

    Neonatal mortality is much higher in the developing world than in developed countries. Infections are a major cause of neonatal death, particularly in preterm infants, in whom defective epidermal permeability barrier function facilitates transcutaneous pathogen invasion. The objective was to determine whether neonatal skin care products commonly used in Africa benefit or compromise epidermal functions in murine skin. After twice-daily treatment of 6- to 8-week-old hairless mice with each skin care product for 3 days, epidermal permeability barrier function, skin surface pH, stratum corneum hydration, and barrier recovery were measured using a multiprobe adapter system physiology monitor. For products showing some benefits in these initial tests, the epidermal permeability barrier homeostasis was assessed 1 and 5 hours after a single application to acutely disrupted skin. All of the skin care products compromised basal permeability barrier function and barrier repair kinetics. Moreover, after 3 days of treatment, most of the products also reduced stratum corneum hydration while elevating skin surface pH to abnormal levels. Some neonatal skin care products that are widely used in Africa perturb important epidermal functions, including permeability barrier homeostasis in mice. Should these products have similar effects on newborn human skin, they could cause a defective epidermal permeability barrier, which can increase body fluid loss, impair thermoregulation, and contribute to the high rates of neonatal morbidity and mortality seen in Africa. Accordingly, alternative products that enhance permeability barrier function should be identified, particularly for use in preterm infants. © 2016 Wiley Periodicals, Inc.

  10. The effects of storage temperature and duration of blood samples on DNA and RNA qualities.

    Science.gov (United States)

    Huang, Lien-Hung; Lin, Pei-Hsien; Tsai, Kuo-Wang; Wang, Liang-Jen; Huang, Ying-Hsien; Kuo, Ho-Chang; Li, Sung-Chou

    2017-01-01

    DNA and RNA samples from blood are the common examination target for non-invasive physical tests and/or biomedical studies. Since high-quality DNA and RNA samples guarantee the correctness of these tests and/or studies, we investigated the effects of storage temperature and storage duration of whole blood on DNA and RNA qualities. Subjects were enrolled to donate blood samples which were stored for different durations and at different temperatures, followed by the examinations on RNA quality, qPCR, DNA quality and DNA methylation. For RNA, we observed obvious quality decline with storage duration longer than 24 hours. Storage at low temperature does not keep RNA samples from degradation. And, storing whole blood samples in freezer dramatically damage RNA. For DNA, quality decline was not observed even with storage duration for 15 days. However, DNA methylation significantly altered with storage duration longer than three days. Storage duration within 24 hours is critical for collecting high-quality RNA samples for next-generation sequencing (NGS) assays (RIN≧8). If microarray assays are expected (RIN≧7), storage duration within 32 hours is acceptable. Although DNA is resistant within 15 days when kept in whole blood, DNA quantity dramatically decreases owing to WBC lysis. In addition, duration for more than three days significantly alter DNA methylation status, globally and locally. Our result provides a reference for dealing with blood samples.

  11. High quality uniform YBCO film growth by the metalorganic deposition using trifluoroacetates

    Energy Technology Data Exchange (ETDEWEB)

    Wang, S.S., E-mail: wangssh@tsinghua.edu.cn [Key Laboratory of Micro-nano Measurement, Manipulation and Physics (Beihang University), Ministry of Education, Beijing 100191 (China); Beijing Dingchen Superconducting Technology Co., Ltd., Beijing 100084 (China); Zhang, Z.L. [Key Laboratory of Micro-nano Measurement, Manipulation and Physics (Beihang University), Ministry of Education, Beijing 100191 (China); Wang, L. [Applied superconductivity research center, Department of Physics, Tsinghua University, Beijing 100084 (China); Gao, L.K.; Liu, J. [Beijing Dingchen Superconducting Technology Co., Ltd., Beijing 100084 (China)

    2017-03-15

    Highlights: • High quality double-sided YBCO films are fabricated on LaAlO3 substrates by TFA-MOD method with diameters up to 2 in. • Large area YBCO films were very uniform in microstructure and thickness distribution, an average inductive Jc in excess of 6 MA/cm{sup 2} and low R{sub s} (10 GHz) of 0.3 mΩ at 77 K were obtained. • It will greatly promoted the research and applications of large-area YBCO films by chemical solution method. - Abstract: A need exists for the large-area superconducting YBa{sub 2}Cu{sub 3}O{sub 7-x} (YBCO) films with high critical current density for microwave communication and/or electric power applications. Trifluoroacetic metalorganic (TFA-MOD) method is a promising low cost technique for large-scale production of YBCO films, because it does not need high vacuum device and is easily applicable to substrates of various shape and size. In this paper, double-sided YBCO films with maximum 2 in diameter were prepared on LaAlO{sub 3} substrates by TFA-MOD method. Inductive critical current densitiy J{sub c}, microwave surface resistance R{sub s}, as well as the microstructure were characterized. A newly homemade furnace system was used to epitaxially grown YBCO films, which can improve the uniformity of YBCO film significantly by gas supply and temperature distribution proper design. Results showed that the large area YBCO films were very uniform in microstructure and thickness distribution, an average inductive J{sub c} in excess of 6 MA/cm{sup 2} with uniform distribution, and low R{sub s} (10 GHz) below 0.3 mΩ at 77 K were obtained. Andthe film filter may be prepared to work at temperatures lower than 74 K. These results are very close to the highest value of YBCO films made by conventional vacuum method, so we show a very promising route for large-scale production of high quality large-area YBCO superconducting films at a lower cost.

  12. Achieving Ohmic Contact for High-quality MoS2 Devices on Hexagonal Boron Nitride

    Science.gov (United States)

    Cui, Xu

    highly stable device performance, even at elevated temperatures. Both optical and electrical characterization confirms our high quality devices, including an ultra-clean interface, a record-high Hall mobility reaching 34,000 cm. 2/Vs, and first observation of Shubnikov–de Haas oscillations. The development of Ohmic contact and fabrication of high quality devices are critical to MoS2 application and studying its intrinsic properties. Therefore, the progress made in this work will facilitate efforts to study novel physical phenomena of MoS2 that were not accessible before.

  13. High-quality draft genome sequence of Ensifer meliloti Mlalz-1, a microsymbiont of Medicago laciniata (L.) miller collected in Lanzarote, Canary Islands, Spain.

    Science.gov (United States)

    Osman, Wan Adnawani Meor; van Berkum, Peter; León-Barrios, Milagros; Velázquez, Encarna; Elia, Patrick; Tian, Rui; Ardley, Julie; Gollagher, Margaret; Seshadri, Rekha; Reddy, T B K; Ivanova, Natalia; Woyke, Tanja; Pati, Amrita; Markowitz, Victor; Baeshen, Mohamed N; Baeshen, Naseebh Nabeeh; Kyrpides, Nikos; Reeve, Wayne

    2017-01-01

    10.1601/nm.1335 Mlalz-1 (INSDC = ATZD00000000) is an aerobic, motile, Gram-negative, non-spore-forming rod that was isolated from an effective nitrogen-fixing nodule of Medicago laciniata (L.) Miller from a soil sample collected near the town of Guatiza on the island of Lanzarote, the Canary Islands, Spain. This strain nodulates and forms an effective symbiosis with the highly specific host M. laciniata . This rhizobial genome was sequenced as part of the DOE Joint Genome Institute 2010 Genomic Encyclopedia for Bacteria and Archaea-Root Nodule Bacteria (GEBA-RNB) sequencing project. Here the features of 10.1601/nm.1335 Mlalz-1 are described, together with high-quality permanent draft genome sequence information and annotation. The 6,664,116 bp high-quality draft genome is arranged in 99 scaffolds of 100 contigs, containing 6314 protein-coding genes and 74 RNA-only encoding genes. Strain Mlalz-1 is closely related to 10.1601/nm.1335 10.1601/strainfinder?urlappend=%3Fid%3DIAM+12611 T , 10.1601/nm.1334 A 321 T and 10.1601/nm.17831 10.1601/strainfinder?urlappend=%3Fid%3DORS+1407 T , based on 16S rRNA gene sequences. gANI values of ≥98.1% support the classification of strain Mlalz-1 as 10.1601/nm.1335. Nodulation of M. laciniata requires a specific nodC allele, and the nodC gene of strain Mlalz-1 shares ≥98% sequence identity with nodC of M. laciniata -nodulating 10.1601/nm.1328 strains, but ≤93% with nodC of 10.1601/nm.1328 strains that nodulate other Medicago species. Strain Mlalz-1 is unique among sequenced 10.1601/nm.1335 strains in possessing genes encoding components of a T2SS and in having two versions of the adaptive acid tolerance response lpiA-acvB operon. In 10.1601/nm.1334 strain 10.1601/strainfinder?urlappend=%3Fid%3DWSM+419, lpiA is essential for enhancing survival in lethal acid conditions. The second copy of the lpiA-acvB operon of strain Mlalz-1 has highest sequence identity (> 96%) with that of 10.1601/nm.1334 strains, which suggests genetic

  14. Epidermal growth factor induces HCCR expression via PI3K/Akt/mTOR signaling in PANC-1 pancreatic cancer cells

    International Nuclear Information System (INIS)

    Xu, Zekuan; Zhang, Guoxin; Zhang, Yi; Jiang, Jiakai; Yang, Yang; Shi, Ruihua; Hao, Bo; Zhang, Zhihong; Huang, Zuhu; Kim, Jin W

    2010-01-01

    Human cervical cancer oncoprotein 1 (HCCR-1), reported as a negative regulator of p53, is over-expressed in a variety of human cancers. However, it is yet unknown whether HCCR-1 plays any role in pancreatic cancer development. The aim of this study was to investigate the effect of epidermal growth factor on the expression of HCCR in pancreatic cancer cells, and to explore if PI3K/Akt/mTOR signaling pathway mediated this expression. A polyclonal antibody against HCCR protein was raised by immunizing Balb/c mice with the purified recombinant protein pMBPc-HCCR. Tissue samples were constructed on a tissue chip, and the expression of HCCR was investigated by immunohistochemistry assay and Western blotting. Pancreatic cell line, PANC-1 cells were stably transfected with plasmids containing sense-HCCR-1 fragment and HCCR siRNA fragment. MTT and transwell assay were used to investigate the proliferation and invasion of stable tansfectants. The specific inhibitor of PI3K and mTOR was used to see if PI3K/mTOR signal transduction was involved in the induction of HCCR gene expression. A Luciferase assay was used to see if Akt can enhance the HCCR promoter activity. HCCR was up-regulated in pancreatic tumor tissues (mean Allred score 4.51 ± 1.549 vs. 2.87 ± 2.193, P < 0.01), especially with high expression in poorly differentiated pancreatic cancer. The growth of cells decreased in HCCR-1 siRNA transfected cells compared with vector transfectants. The number of invasion cells was significantly lower in HCCR-1 siRNA transfected cells (24.4 ± 9.9) than that in vector transfectants (49.1 ± 15.4). Treatment of PANC-1 cells with epidermal growth factor increased HCCR protein level in a dose- and time-dependent manner. However, application of LY294002 and rapamycin caused a dramatic reduction of epidermal growth factor-induced HCCR expression. Over-expression of exogenous constitutively active Akt increased the HCCR promoter activity; in contrast, dominant negative Akt decreased

  15. Epidermal transglutaminase (TGase 3 is required for proper hair development, but not the formation of the epidermal barrier.

    Directory of Open Access Journals (Sweden)

    Susan John

    Full Text Available Transglutaminases (TGase, a family of cross-linking enzymes present in most cell types, are important in events as diverse as cell-signaling and matrix stabilization. Transglutaminase 1 is crucial in developing the epidermal barrier, however the skin also contains other family members, in particular TGase 3. This isoform is highly expressed in the cornified layer, where it is believed to stabilize the epidermis and its reduction is implicated in psoriasis. To understand the importance of TGase 3 in vivo we have generated and analyzed mice lacking this protein. Surprisingly, these animals display no obvious defect in skin development, no overt changes in barrier function or ability to heal wounds. In contrast, hair lacking TGase 3 is thinner, has major alterations in the cuticle cells and hair protein cross-linking is markedly decreased. Apparently, while TGase 3 is of unique functional importance in hair, in the epidermis loss of TGase 3 can be compensated for by other family members.

  16. RNA isolation for transcriptomics of human and mouse small skin biopsies

    Directory of Open Access Journals (Sweden)

    Breit Timo M

    2011-10-01

    Full Text Available Abstract Background Isolation of RNA from skin biopsies presents a challenge, due to the tough nature of skin tissue and a high presence of RNases. As we lacked the dedicated equipment, i.e. homogenizer or bead-beater, needed for the available RNA from skin isolation methods, we adapted and tested our zebrafish single-embryo RNA-isolation protocol for RNA isolation from skin punch biopsies. Findings We tested our new RNA-isolation protocol in two experiments: a large-scale study with 97 human skin samples, and a small study with 16 mouse skin samples. Human skin was sampled with 4.0 mm biopsy punches and for the mouse skin different punch diameter sizes were tested; 1.0, 1.5, 2.0, and 2.5 mm. The average RNA yield in human samples was 1.5 μg with an average RNA quality RIN value of 8.1. For the mouse biopsies, the average RNA yield was 2.4 μg with an average RIN value of 7.5. For 96% of the human biopsies and 100% of the mouse biopsies we obtained enough high-quality RNA. The RNA samples were successfully tested in a transcriptomics analysis using the Affymetrix and Roche NimbleGen platforms. Conclusions Using our new RNA-isolation protocol, we were able to consistently isolate high-quality RNA, which is apt for further transcriptomics analysis. Furthermore, this method is already useable on biopsy material obtained with a punch diameter as small as 1.5 mm.

  17. A resonant magnetic field microsensor with high quality factor at atmospheric pressure

    International Nuclear Information System (INIS)

    Herrera-May, A L; García-Ramírez, P J; Martínez-Castillo, J; Sauceda-Carvajal, A; García-González, L; Aguilera-Cortés, L A; Figueras-Costa, E

    2009-01-01

    A resonant magnetic field microsensor with a high quality factor at atmospheric pressure has been designed, fabricated and tested. This microsensor does not require vacuum packaging to operate efficiently and presents a compact and simple geometrical configuration of silicon. This geometry permits us to decrease the size of the structure and facilities its fabrication and operation. It is constructed of a seesaw plate (400 × 150 × 15 µm 3 ), two torsional beams (60 × 40 × 15 µm 3 ), four flexural beams (130 × 12 × 15 µm 3 ) and a Wheatstone bridge with four p-type piezoresistors. The resonant device exploits the Lorentz force principle and operates at its first resonant frequency (136.52 kHz). A sinusoidal excitation current of 22.0 mA with a frequency of 136.52 kHz and magnetic fields from 1 to 400 G are considered. The mechanical response of the microsensor is modeled with the finite element method (FEM). The structure of the microsensor registered a maximum von Mises stress of 53.8 MPa between the flexural and the torsional beams. Additionally, a maximum deflection (372.5 nm) is obtained at the extreme end of the plate. The proposed microsensor has the maximum magnetic sensitivity of 40.3 µV G −1 (magnetic fields −1/2 , theoretical resolution of 1.43 mG Hz −1/2 and power consumption less than 10.0 mW

  18. High-quality EuO thin films the easy way via topotactic transformation

    Science.gov (United States)

    Mairoser, Thomas; Mundy, Julia A.; Melville, Alexander; Hodash, Daniel; Cueva, Paul; Held, Rainer; Glavic, Artur; Schubert, Jürgen; Muller, David A.; Schlom, Darrell G.; Schmehl, Andreas

    2015-07-01

    Epitaxy is widely employed to create highly oriented crystalline films. A less appreciated, but nonetheless powerful means of creating such films is via topotactic transformation, in which a chemical reaction transforms a single crystal of one phase into a single crystal of a different phase, which inherits its orientation from the original crystal. Topotactic reactions may be applied to epitactic films to substitute, add or remove ions to yield epitactic films of different phases. Here we exploit a topotactic reduction reaction to provide a non-ultra-high vacuum (UHV) means of growing highly oriented single crystalline thin films of the easily over-oxidized half-metallic semiconductor europium monoxide (EuO) with a perfection rivalling that of the best films of the same material grown by molecular-beam epitaxy or UHV pulsed-laser deposition. As the technique only requires high-vacuum deposition equipment, it has the potential to drastically improve the accessibility of high-quality single crystalline films of EuO as well as other difficult-to-synthesize compounds.

  19. High-Quality Ultra-Compact Grid Layout of Grouped Networks.

    Science.gov (United States)

    Yoghourdjian, Vahan; Dwyer, Tim; Gange, Graeme; Kieffer, Steve; Klein, Karsten; Marriott, Kim

    2016-01-01

    Prior research into network layout has focused on fast heuristic techniques for layout of large networks, or complex multi-stage pipelines for higher quality layout of small graphs. Improvements to these pipeline techniques, especially for orthogonal-style layout, are difficult and practical results have been slight in recent years. Yet, as discussed in this paper, there remain significant issues in the quality of the layouts produced by these techniques, even for quite small networks. This is especially true when layout with additional grouping constraints is required. The first contribution of this paper is to investigate an ultra-compact, grid-like network layout aesthetic that is motivated by the grid arrangements that are used almost universally by designers in typographical layout. Since the time when these heuristic and pipeline-based graph-layout methods were conceived, generic technologies (MIP, CP and SAT) for solving combinatorial and mixed-integer optimization problems have improved massively. The second contribution of this paper is to reassess whether these techniques can be used for high-quality layout of small graphs. While they are fast enough for graphs of up to 50 nodes we found these methods do not scale up. Our third contribution is a large-neighborhood search meta-heuristic approach that is scalable to larger networks.

  20. Design of high quality doped CeO2 solid electrolytes with nanohetero structure

    International Nuclear Information System (INIS)

    Mori, T.; Ou, D.R.; Ye, F.; Drennan, J.

    2006-01-01

    Doped cerium (CeO 2 ) compounds are fluorite related oxides which show oxide ionic conductivity higher than yttria-stabilized zirconia in oxidizing atmosphere. As a consequence of this, a considerable interest has been shown in application of these materials for low (400-650 o C) temperature operation of solid oxide fuel cells (SOFCs). In this paper, our experimental data about the influence of microstructure at the atomic level on electrochemical properties were reviewed in order to develop high quality doped CeO 2 electrolytes in fuel cell applications. Using this data in the present paper, our original idea for a design of nanodomain structure in doped CeO 2 electrolytes was suggested. The nanosized powders and dense sintered bodies of M doped CeO 2 (M:Sm,Gd,La,Y,Yb, and Dy) compounds were fabricated. Also nanostructural features in these specimens were introduced for conclusion of relationship between electrolytic properties and domain structure in doped CeO 2 . It is essential that the electrolytic properties in doped CeO 2 solid electrolytes reflect in changes of microstructure even down to the atomic scale. Accordingly, a combined approach of nanostructure fabrication, electrical measurement and structure characterization was required to develop superior quality doped CeO 2 electrolytes in the fuel cells. (author)

  1. Efficient Simplification Methods for Generating High Quality LODs of 3D Meshes

    Institute of Scientific and Technical Information of China (English)

    Muhammad Hussain

    2009-01-01

    Two simplification algorithms are proposed for automatic decimation of polygonal models, and for generating their LODs. Each algorithm orders vertices according to their priority values and then removes them iteratively. For setting the priority value of each vertex, exploiting normal field of its one-ring neighborhood, we introduce a new measure of geometric fidelity that reflects well the local geometric features of the vertex. After a vertex is selected, using other measures of geometric distortion that are based on normal field deviation and distance measure, it is decided which of the edges incident on the vertex is to be collapsed for removing it. The collapsed edge is substituted with a new vertex whose position is found by minimizing the local quadric error measure. A comparison with the state-of-the-art algorithms reveals that the proposed algorithms are simple to implement, are computationally more efficient, generate LODs with better quality, and preserve salient features even after drastic simplification. The methods are useful for applications such as 3D computer games, virtual reality, where focus is on fast running time, reduced memory overhead, and high quality LODs.

  2. Chemical and biological studies on producing high quality biscuits with irradiated tomato wastes

    International Nuclear Information System (INIS)

    Nassef, A.E.

    2005-01-01

    The present investigation has been carried out to produce high quality biscuits for treatment of some special diseases. In this study, the total tomato processing wastes were used as new source of protein in which the most predominate elements were found to be phosphorus, potassium and magnesium. Phenyl alanine was found to be the first limiting amino acid, while lysine was the second limiting amino acid. It was found to contain about 30.66% fiber and 28.1% protein. The total tomato processing wastes remain unutilized and they not only add to the disposal problem, but also aggravate environmental pollution. Tomato wastes were irradiated in two doses (1.5 and 2.5 KGy) for preservation. Biscuits were made with supplementation of 5, 10 and 15% tomato wastes. All samples of biscuits were examined for chemical composition and organoleptic evaluation. Biological assay was carried out on rats fed biscuits containing 15% irradiated and non-irradiated tomato wastes. The weight gain, serum cholesterol and triglycerides were determined. Internal organs were also followed. The results obtained showed that 15% tomato wastes biscuit had the highest content of lysine, isoleucine and fiber (6.36, 2.72 and 24.80, respectively) and also scored a good grade. Weight gain, cholesterol and triglycerides were reduced comparable to control and there was no effect of irradiation on the rats internal organs

  3. Comparative study of active plasma lenses in high-quality electron accelerator transport lines

    Science.gov (United States)

    van Tilborg, J.; Barber, S. K.; Benedetti, C.; Schroeder, C. B.; Isono, F.; Tsai, H.-E.; Geddes, C. G. R.; Leemans, W. P.

    2018-05-01

    Electrically discharged active plasma lenses (APLs) are actively pursued in compact high-brightness plasma-based accelerators due to their high-gradient, tunable, and radially symmetric focusing properties. In this manuscript, the APL is experimentally compared with a conventional quadrupole triplet, highlighting the favorable reduction in the energy dependence (chromaticity) in the transport line. Through transport simulations, it is explored how the non-uniform radial discharge current distribution leads to beam-integrated emittance degradation and a charge density reduction at focus. However, positioning an aperture at the APL entrance will significantly reduce emittance degradation without additional loss of charge in the high-quality core of the beam. An analytical model is presented that estimates the emittance degradation from a short beam driving a longitudinally varying wakefield in the APL. Optimizing laser plasma accelerator operation is discussed where emittance degradation from the non-uniform discharge current (favoring small beams inside the APL) and wakefield effects (favoring larger beam sizes) is minimized.

  4. Approach for growth of high-quality and large protein crystals

    Energy Technology Data Exchange (ETDEWEB)

    Matsumura, Hiroyoshi, E-mail: matsumura@chem.eng.osaka-u.ac.jp [Graduate School of Engineering, Osaka University, Suita, Osaka 565-0871 (Japan); JST (Japan); SOSHO Inc., Osaka 541-0053 (Japan); Sugiyama, Shigeru; Hirose, Mika; Kakinouchi, Keisuke; Maruyama, Mihoko; Murai, Ryota [Graduate School of Engineering, Osaka University, Suita, Osaka 565-0871 (Japan); JST (Japan); Adachi, Hiroaki; Takano, Kazufumi [Graduate School of Engineering, Osaka University, Suita, Osaka 565-0871 (Japan); JST (Japan); SOSHO Inc., Osaka 541-0053 (Japan); Murakami, Satoshi [JST (Japan); SOSHO Inc., Osaka 541-0053 (Japan); Graduate School of Bioscience and Biotechnology, Tokyo Institute of Technology, Nagatsuta, Midori-ku, Yokohama 226-8501 (Japan); Mori, Yusuke; Inoue, Tsuyoshi [Graduate School of Engineering, Osaka University, Suita, Osaka 565-0871 (Japan); JST (Japan); SOSHO Inc., Osaka 541-0053 (Japan)

    2011-01-01

    Three crystallization methods, including crystallization in the presence of a semi-solid agarose gel, top-seeded solution growth (TSSG) and a large-scale hanging-drop method, have previously been presented. In this study, crystallization has been further evaluated in the presence of a semi-solid agarose gel by crystallizing additional proteins. A novel crystallization method combining TSSG and the large-scale hanging-drop method has also been developed. Three crystallization methods for growing large high-quality protein crystals, i.e. crystallization in the presence of a semi-solid agarose gel, top-seeded solution growth (TSSG) and a large-scale hanging-drop method, have previously been presented. In this study the effectiveness of crystallization in the presence of a semi-solid agarose gel has been further evaluated by crystallizing additional proteins in the presence of 2.0% (w/v) agarose gel, resulting in complete gelification with high mechanical strength. In TSSG the seed crystals are hung by a seed holder protruding from the top of the growth vessel to prevent polycrystallization. In the large-scale hanging-drop method, a cut pipette tip was used to maintain large-scale droplets consisting of protein–precipitant solution. Here a novel crystallization method that combines TSSG and the large-scale hanging-drop method is reported. A large and single crystal of lysozyme was obtained by this method.

  5. High Yield Chemical Vapor Deposition Growth of High Quality Large-Area AB Stacked Bilayer Graphene

    Science.gov (United States)

    Liu, Lixin; Zhou, Hailong; Cheng, Rui; Yu, Woo Jong; Liu, Yuan; Chen, Yu; Shaw, Jonathan; Zhong, Xing; Huang, Yu; Duan, Xiangfeng

    2012-01-01

    Bernal stacked (AB stacked) bilayer graphene is of significant interest for functional electronic and photonic devices due to the feasibility to continuously tune its band gap with a vertical electrical field. Mechanical exfoliation can be used to produce AB stacked bilayer graphene flakes but typically with the sizes limited to a few micrometers. Chemical vapor deposition (CVD) has been recently explored for the synthesis of bilayer graphene but usually with limited coverage and a mixture of AB and randomly stacked structures. Herein we report a rational approach to produce large-area high quality AB stacked bilayer graphene. We show that the self-limiting effect of graphene growth on Cu foil can be broken by using a high H2/CH4 ratio in a low pressure CVD process to enable the continued growth of bilayer graphene. A high temperature and low pressure nucleation step is found to be critical for the formation of bilayer graphene nuclei with high AB stacking ratio. A rational design of a two-step CVD process is developed for the growth of bilayer graphene with high AB stacking ratio (up to 90 %) and high coverage (up to 99 %). The electrical transport studies demonstrated that devices made of the as-grown bilayer graphene exhibit typical characteristics of AB stacked bilayer graphene with the highest carrier mobility exceeding 4,000 cm2/V·s at room temperature, comparable to that of the exfoliated bilayer graphene. PMID:22906199

  6. Criteria to Extract High-Quality Protein Data Bank Subsets for Structure Users.

    Science.gov (United States)

    Carugo, Oliviero; Djinović-Carugo, Kristina

    2016-01-01

    It is often necessary to build subsets of the Protein Data Bank to extract structural trends and average values. For this purpose it is mandatory that the subsets are non-redundant and of high quality. The first problem can be solved relatively easily at the sequence level or at the structural level. The second, on the contrary, needs special attention. It is not sufficient, in fact, to consider the crystallographic resolution and other feature must be taken into account: the absence of strings of residues from the electron density maps and from the files deposited in the Protein Data Bank; the B-factor values; the appropriate validation of the structural models; the quality of the electron density maps, which is not uniform; and the temperature of the diffraction experiments. More stringent criteria produce smaller subsets, which can be enlarged with more tolerant selection criteria. The incessant growth of the Protein Data Bank and especially of the number of high-resolution structures is allowing the use of more stringent selection criteria, with a consequent improvement of the quality of the subsets of the Protein Data Bank.

  7. Teolenn: an efficient and customizable workflow to design high-quality probes for microarray experiments

    Science.gov (United States)

    Jourdren, Laurent; Duclos, Aurélie; Brion, Christian; Portnoy, Thomas; Mathis, Hugues; Margeot, Antoine; Le Crom, Stéphane

    2010-01-01

    Despite the development of new high-throughput sequencing techniques, microarrays are still attractive tools to study small genome organisms, thanks to sample multiplexing and high-feature densities. However, the oligonucleotide design remains a delicate step for most users. A vast array of software is available to deal with this problem, but each program is developed with its own strategy, which makes the choice of the best solution difficult. Here we describe Teolenn, a universal probe design workflow developed with a flexible and customizable module organization allowing fixed or variable length oligonucleotide generation. In addition, our software is able to supply quality scores for each of the designed probes. In order to assess the relevance of these scores, we performed a real hybridization using a tiling array designed against the Trichoderma reesei fungus genome. We show that our scoring pipeline correlates with signal quality for 97.2% of all the designed probes, allowing for a posteriori comparisons between quality scores and signal intensities. This result is useful in discarding any bad scoring probes during the design step in order to get high-quality microarrays. Teolenn is available at http://transcriptome.ens.fr/teolenn/. PMID:20176570

  8. A High-Quality Reference Genome for the Invasive Mosquitofish Gambusia affinis Using a Chicago Library.

    Science.gov (United States)

    Hoffberg, Sandra L; Troendle, Nicholas J; Glenn, Travis C; Mahmud, Ousman; Louha, Swarnali; Chalopin, Domitille; Bennetzen, Jeffrey L; Mauricio, Rodney

    2018-04-27

    The western mosquitofish, Gambusia affinis, is a freshwater poecilid fish native to the southeastern United States but with a global distribution due to widespread human introduction. Gambusia affinis has been used as a model species for a broad range of evolutionary and ecological studies. We sequenced the genome of a male G. affinis to facilitate genetic studies in diverse fields including invasion biology and comparative genetics. We generated Illumina short read data from paired-end libraries and in vitro proximity-ligation libraries. We obtained 54.9× coverage, N50 contig length of 17.6 kb, and N50 scaffold length of 6.65 Mb. Compared to two other species in the Poeciliidae family, G. affinis has slightly fewer genes that have shorter total, exon, and intron length on average. Using a set of universal single-copy orthologs in fish genomes, we found 95.5% of these genes were complete in the G. affinis assembly. The number of transposable elements in the G. affinis assembly is similar to those of closely related species. The high-quality genome sequence and annotations we report will be valuable resources for scientists to map the genetic architecture of traits of interest in this species. Copyright © 2018, G3: Genes, Genomes, Genetics.

  9. A High-Quality Reference Genome for the Invasive Mosquitofish Gambusia affinis Using a Chicago Library

    Directory of Open Access Journals (Sweden)

    Sandra L. Hoffberg

    2018-06-01

    Full Text Available The western mosquitofish, Gambusia affinis, is a freshwater poecilid fish native to the southeastern United States but with a global distribution due to widespread human introduction. Gambusia affinis has been used as a model species for a broad range of evolutionary and ecological studies. We sequenced the genome of a male G. affinis to facilitate genetic studies in diverse fields including invasion biology and comparative genetics. We generated Illumina short read data from paired-end libraries and in vitro proximity-ligation libraries. We obtained 54.9× coverage, N50 contig length of 17.6 kb, and N50 scaffold length of 6.65 Mb. Compared to two other species in the Poeciliidae family, G. affinis has slightly fewer genes that have shorter total, exon, and intron length on average. Using a set of universal single-copy orthologs in fish genomes, we found 95.5% of these genes were complete in the G. affinis assembly. The number of transposable elements in the G. affinis assembly is similar to those of closely related species. The high-quality genome sequence and annotations we report will be valuable resources for scientists to map the genetic architecture of traits of interest in this species.

  10. Genetic and geochemical signatures to prevent frauds and counterfeit of high-quality asparagus and pistachio.

    Science.gov (United States)

    Zannella, Carmela; Carucci, Francesca; Aversano, Riccardo; Prohaska, Thomas; Vingiani, Simona; Carputo, Domenico; Adamo, Paola

    2017-12-15

    A fingerprinting strategy based on genetic (simple sequence repeat) and geochemical (multielement and 87 Sr/ 86 Sr ratio) analysis was tested to prove the geographical origin of high-quality Italian products "White Asparagus from Bassano del Grappa" and "Green Pistachio from Bronte". Genetic analysis generated many polymorphic alleles and different specific amplified fragments in both agriproducts. In addition, a core set of markers was defined. According to variability within production soils and products, potential candidate elements linking asparagus (Zn, P, Cr, Mg, B, K) and pistachio (Mn, P, Cr, Mg, Ti, B, K, Sc, S) to the production areas were identified. The Sr isotopic signature was an excellent marker when Italian asparagus was compared with literature data for Hungarian and Peruvian asparagus. This work reinforces the use of Sr isotope composition in the soil bioavailable fraction, as assessed by 1mol/L NH 4 NO 3 , to distinguish white asparagus and pistachio originating from different geographical areas. Copyright © 2017 Elsevier Ltd. All rights reserved.

  11. HIGH QUALITY ENVIRONMENTAL PRINCIPLES APPLIED TO THE ARCHITECTONIC DESIGN SELECTION PROCEDURE: THE NUTRE LAB CASE

    Directory of Open Access Journals (Sweden)

    Claudia Barroso Krause

    2012-06-01

    Full Text Available The need to produce more sustainable buildings has been influencing the design decisions all over the world. That’s why it is imperative, in Brazil, the development of strategies and method to aid the decision making during the design process, focused on high quality environmental. This paper presents a decision support tool based on the principles of sustainable construction developed by the Project, Architecture and Sustainability Research Group (GPAS of Federal University of Rio de Janeiro – Brazil. The methodology has been developed for the selection of a preliminary design of a laboratory to be built at Rio Technology Park at the University campus. The support provided by GPAS occurred in three stages: the elaboration of the Reference Guide for the competitors, the development of a methodology to evaluate the proposed solutions (based on environmental performance criteria and the assistance of the members of jury in the trial phase. The theoretical framework was based upon the concepts of the bioclimatic architecture, the procedures specified by the certification HQE® (Haute Qualité Environnementale and the method suggested by the ADDENDA® architecture office. The success of this experience points out the possibility to future application in similar cases.

  12. Surface states in the photoionization of high-quality CdSe core/shell nanocrystals.

    Science.gov (United States)

    Li, Shu; Steigerwald, Michael L; Brus, Louis E

    2009-05-26

    We use electric force microscopy (EFM) to study single nanocrystal photoionization in two classes of high-quality nanocrystals whose exciton luminescence quantum yields approach unity in solution. The CdSe/CdS/ZnS core/shell nanocrystals do not photoionize, while the CdSe/CdS nanocrystals do show substantial photoionization. This verifies the theoretical prediction that the ZnS shell confines the excited electron within the nanocrystal. Despite the high luminescence quantum yield, photoionization varies substantially among the CdSe/CdS nanocrystals. We have studied the nanocrystal photoionization with both UV (396 nm) and green (532 nm) light, and we have found that the magnitude of the charge due to photoionization per absorbed photon is greater for UV excitation than for green excitation. A fraction of the photoionization occurs directly via a "hot electron" process, using trap states that are either on the particle surface, within the ligand sphere, or within the silicon oxide layer. This must occur without relaxation to the thermalized, lowest-energy, emitting exciton. We discuss the occurrence of hot carrier processes that are common to photoionization, luminescence blinking, and the fast transient optical absorption that is associated with multiple exciton generation MEG studies.

  13. High quality long-wavelength lasers grown by atmospheric organometallic vapor phase epitaxy using tertiarybutylarsine

    International Nuclear Information System (INIS)

    Miller, B.I.; Young, M.G.; Oron, M.; Koren, U.; Kisker, D.

    1990-01-01

    High quality long-wavelength InGaAsP/InP lasers were grown by atmospheric organometallic vapor phase epitaxy using tertiarybutylarsine (TBA) as a substitute for AsH 3 . Electrical and photoluminescence measurements on InGaAs and InGaAsP showed that TBA-grown material was at least as good as AsH 3 material in terms of suitability for lasers. From two wafers grown by TBA, current thresholds I th as low as 11 mA were obtained for a 2-μm-wide semi-insulating blocking planar buried heterostructure laser lasing near 1.3 μm wavelength. The differential quantum efficiencies η D were as high as 21%/facet with a low internal loss α=21 cm -1 . In addition I th as low as 18 mA and η D as high as 18% have been obtained for multiplequantum well lasers at 1.54 μm wavelength. These results show that TBA might be used to replace AsH 3 without compromising on laser performance

  14. Life Cycle Analysis of High Quality Recycled Aggregate Produced byHeating and Rubbing Method

    Science.gov (United States)

    Shima, Hirokazu; Matsuhashi, Ryuji; Yoshida, Yoshikuni; Tateyashiki, Hisashi

    Most of demolished concrete is recycled as road subbase, but its generation is expected to increase rapidly and exceed the demand of road subbase in a near future. To promote the recycling of concrete, the technology to produce high quality recycled aggregate by the heating and rubbing method has been developed. In this method, demolished concrete is heated up to about 300°C in a heater to make cement paste brittle with its dehydration. The heated concrete is then rubbed in two mills to recover the recycled aggregate, while the paste is removed from the surface of aggregate and collected as cement fine powder. In this method, much energy is consumed to heat and rub concrete; however, the cement fine powder is utilized for a soil stabilizer and cement raw materials, so that the environmental load is reduced in cement manufacturing. The life cycle analysis of the recycled aggregate is carried out to evaluate this technology. As a result, the life cycle CO2 is a negative value because the deduction of CO2 emission in cement manufacturing by the powder is much large. This technology is proved to be very effective to reduce CO2.

  15. High-quality substrate for fluorescence enhancement using agarose-coated silica opal film.

    Science.gov (United States)

    Xu, Ming; Li, Juan; Sun, Liguo; Zhao, Yuanjin; Xie, Zhuoying; Lv, Linli; Zhao, Xiangwei; Xiao, Pengfeng; Hu, Jing; Lv, Mei; Gu, Zhongze

    2010-08-01

    To improve the sensitivity of fluorescence detection in biochip, a new kind of substrates was developed by agarose coating on silica opal film. In this study, silica opal film was fabricated on glass substrate using the vertical deposition technique. It can provide stronger fluorescence signals and thus improve the detection sensitivity. After coating with agarose, the hybrid film could provide a 3D support for immobilizing sample. Comparing with agarose-coated glass substrate, the agarose-coated opal substrates could selectively enhance particular fluorescence signals with high sensitivity when the stop band of the silica opal film in the agarose-coated opal substrate overlapped the fluorescence emission wavelength. A DNA hybridization experiment demonstrated that fluorescence intensity of special type of agarose-coated opal substrates was about four times that of agarose-coated glass substrate. These results indicate that the optimized agarose-coated opal substrate can be used for improving the sensitivity of fluorescence detection with high quality and selectivity.

  16. Deoxy-liquefaction of three different species of macroalgae to high-quality liquid oil.

    Science.gov (United States)

    Li, Jinhua; Wang, Guoming; Chen, Ming; Li, Jiedong; Yang, Yaoyao; Zhu, Qiuyan; Jiang, Xiaohuan; Wang, Zonghua; Liu, Haichao

    2014-10-01

    Three species of macroalgae (Ulva lactuca, Laminaria japonica and Gelidium amansii) were converted into liquid oils via deoxy-liquefaction. The elemental analysis, FTIR and GC-MS results showed that the three liquid oils were all mainly composed of aromatics, phenols, alkanes and alkenes, other oxygen-containing compounds, and some nitrogen-containing compounds though there were some differences in terms of their types or contents due to the different constituents in the macroalgae feedstocks. The oxygen content was only 5.15-7.30% and the H/C molar ratio was up to 1.57-1.73. Accordingly, the HHV of the three oils were 42.50, 41.76 and 40.00 MJ/kg, respectively. The results suggested that U. lactuca, L. japonica and G. amansii have potential as biomass feedstock for fuel and chemicals and that deoxy-liquefaction technique may be an effective way to convert macroalgae into high-quality liquid oil. Copyright © 2014 Elsevier Ltd. All rights reserved.

  17. Practical considerations for obtaining high quality quantitative computed tomography data of the skeletal system.

    Science.gov (United States)

    Troy, Karen L; Edwards, W Brent

    2018-05-01

    Quantitative CT (QCT) analysis involves the calculation of specific parameters such as bone volume and density from CT image data, and can be a powerful tool for understanding bone quality and quantity. However, without careful attention to detail during all steps of the acquisition and analysis process, data can be of poor- to unusable-quality. Good quality QCT for research requires meticulous attention to detail and standardization of all aspects of data collection and analysis to a degree that is uncommon in a clinical setting. Here, we review the literature to summarize practical and technical considerations for obtaining high quality QCT data, and provide examples of how each recommendation affects calculated variables. We also provide an overview of the QCT analysis technique to illustrate additional opportunities to improve data reproducibility and reliability. Key recommendations include: standardizing the scanner and data acquisition settings, minimizing image artifacts, selecting an appropriate reconstruction algorithm, and maximizing repeatability and objectivity during QCT analysis. The goal of the recommendations is to reduce potential sources of error throughout the analysis, from scan acquisition to the interpretation of results. Copyright © 2018 Elsevier Inc. All rights reserved.

  18. Synthesis of high-quality diesel with furfural and 2-methylfuran from hemicellulose.

    Science.gov (United States)

    Li, Guangyi; Li, Ning; Wang, Zhiqiang; Li, Changzhi; Wang, Aiqin; Wang, Xiaodong; Cong, Yu; Zhang, Tao

    2012-10-01

    Hydroxyalkylation-alkylation (HAA) coupled with hydrodeoxygenation is a promising route for the synthesis of renewable high-quality diesel or jet fuel. In this work, a series of solid-acid catalysts were firstly used for HAA between lignocellulose-derived furan and carbonyl compounds. Among the investigated catalysts, Nafion-212 resin demonstrated the highest activity and stability. Owing to the high activity of the reactants and the advantage in industrial integration, the HAA of 2-methylfuran (2-MF) and furfural can be considered as a prospective route in future applications. Catalyst loading, reaction temperature, and time had evident effects on the HAA of 2-MF and furfural over Nafion-212 resin. Finally, the HAA product of 2-MF and furfural was hydrogenated over a Pd/C catalyst and hydrodeoxygenated over Pt-loaded solid-acid catalysts. Pt/zirconium phosphate (Pt/ZrP) was found to be the best catalyst for hydrodeoxygenation. Over the 4 % Pt/ZrP catalyst, a 94 % carbon yield of diesel and 75 % carbon yield of C15 hydrocarbons (with 6-butylundecane as the major component) was achieved. Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  19. High-quality Thermodynamic Data on the Stability Changes of Proteins Upon Single-site Mutations

    Energy Technology Data Exchange (ETDEWEB)

    Pucci, Fabrizio, E-mail: fapucci@ulb.ac.be; Bourgeas, Raphaël, E-mail: rbourgeas@ulb.ac.be; Rooman, Marianne, E-mail: mrooman@ulb.ac.be [Department of BioModeling, BioInformatics and BioProcesses, Université Libre de Bruxelles, CP 165/61, Roosevelt Avenue 50, 1050 Brussels, Belgium and Interuniversity Institute of Bioinformatics in Brussels, CP 263, Triumph Bld, 1050 Brussels (Belgium)

    2016-06-15

    We have set up and manually curated a dataset containing experimental information on the impact of amino acid substitutions in a protein on its thermal stability. It consists of a repository of experimentally measured melting temperatures (T{sub m}) and their changes upon point mutations (ΔT{sub m}) for proteins having a well-resolved x-ray structure. This high-quality dataset is designed for being used for the training or benchmarking of in silico thermal stability prediction methods. It also reports other experimentally measured thermodynamic quantities when available, i.e., the folding enthalpy (ΔH) and heat capacity (ΔC{sub P}) of the wild type proteins and their changes upon mutations (ΔΔH and ΔΔC{sub P}), as well as the change in folding free energy (ΔΔG) at a reference temperature. These data are analyzed in view of improving our insights into the correlation between thermal and thermodynamic stabilities, the asymmetry between the number of stabilizing and destabilizing mutations, and the difference in stabilization potential of thermostable versus mesostable proteins.

  20. Extraction of high quality DNA from seized Moroccan cannabis resin (Hashish.

    Directory of Open Access Journals (Sweden)

    Moulay Abdelaziz El Alaoui

    Full Text Available The extraction and purification of nucleic acids is the first step in most molecular biology analysis techniques. The objective of this work is to obtain highly purified nucleic acids derived from Cannabis sativa resin seizure in order to conduct a DNA typing method for the individualization of cannabis resin samples. To obtain highly purified nucleic acids from cannabis resin (Hashish free from contaminants that cause inhibition of PCR reaction, we have tested two protocols: the CTAB protocol of Wagner and a CTAB protocol described by Somma (2004 adapted for difficult matrix. We obtained high quality genomic DNA from 8 cannabis resin seizures using the adapted protocol. DNA extracted by the Wagner CTAB protocol failed to give polymerase chain reaction (PCR amplification of tetrahydrocannabinolic acid (THCA synthase coding gene. However, the extracted DNA by the second protocol permits amplification of THCA synthase coding gene using different sets of primers as assessed by PCR. We describe here for the first time the possibility of DNA extraction from (Hashish resin derived from Cannabis sativa. This allows the use of DNA molecular tests under special forensic circumstances.

  1. The Fast Tracker Real Time Processor: high quality real-time tracking at ATLAS

    CERN Document Server

    Stabile, A; The ATLAS collaboration

    2011-01-01

    As the LHC luminosity is ramped up to the design level of 1x1034 cm−2 s−1 and beyond, the high rates, multiplicities, and energies of particles seen by the detectors will pose a unique challenge. Only a tiny fraction of the produced collisions can be stored on tape and immense real-time data reduction is needed. An effective trigger system must maintain high trigger efficiencies for the most important physics and at the same time suppress the enormous QCD backgrounds. This requires massive computing power to minimize the online execution time of complex algorithms. A multi-level trigger is an effective solution for an otherwise impossible problem. The Fast Tracker (FTK)[1], [2] is a proposed upgrade to the current ATLAS trigger system that will operate at full Level-1 output rates and provide high quality tracks reconstructed over the entire detector by the start of processing in Level-2. FTK is a dedicated Super Computer based on a mixture of advanced technologies. The architecture broadly employs powerf...

  2. High-quality LaVO3 films as solar energy conversion material

    International Nuclear Information System (INIS)

    Zhang, Hai-Tian; Brahlek, Matthew; Ji, Xiaoyu; Lei, Shiming; Lapano, Jason

    2017-01-01

    Mott insulating oxides and their heterostructures have recently been identified as potential photovoltaic materials with favorable absorption properties and an intrinsic built-in electric field that can efficiently separate excited electron hole pairs. At the same time, they are predicted to overcome the Shockley-Queisser limit due to strong electron electron interaction present. Despite these premises a high concentration of defects commonly observed in Mott insulating films acting as recombination centers can derogate the photovoltaic conversion efficiency. With use of the self-regulated growth kinetics in hybrid molecular beam epitaxy, this obstacle can be overcome. High-quality, stoichiometric LaVO 3 films were grown with defect densities of in-gap states up to 2 orders of magnitude lower compared to the films in the literature, and a factor of 3 lower than LaVO 3 bulk single crystals. Photoconductivity measurements revealed a significant photoresponsivity increase as high as tenfold of stoichiometric LaVO 3 films compared to their nonstoichiometric counterparts. Furthermore, this work marks a critical step toward the realization of high-performance Mott insulator solar cells beyond conventional semiconductors.

  3. FlexSAR, a high quality, flexible, cost effective, prototype SAR system

    Science.gov (United States)

    Jensen, Mark; Knight, Chad; Haslem, Brent

    2016-05-01

    The FlexSAR radar system was designed to be a high quality, low-cost, flexible research prototype instrument. Radar researchers and practitioners often desire the ability to prototype new or advanced configurations, yet the ability to enhance or upgrade existing radar systems can be cost prohibitive. FlexSAR answers the need for a flexible radar system that can be extended easily, with minimal cost and time expenditures. The design approach focuses on reducing the resources required for developing and validating new advanced radar modalities. Such an approach fosters innovation and provides risk reduction since actual radar data can be collected in the appropriate mode, processed, and analyzed early in the development process. This allows for an accurate, detailed understanding of the corresponding trade space. This paper is a follow-on to last years paper and discusses the advancements that have been made to the FlexSAR system. The overall system architecture is discussed and presented along with several examples illustrating the system utility.

  4. Controllable Edge Oxidation and Bubbling Exfoliation Enable the Fabrication of High Quality Water Dispersible Graphene.

    Science.gov (United States)

    Tian, Suyun; Sun, Jing; Yang, Siwei; He, Peng; Wang, Gang; Di, Zengfeng; Ding, Guqiao; Xie, Xiaoming; Jiang, Mianheng

    2016-09-26

    Despite significant progresses made on mass production of chemically exfoliated graphene, the quality, cost and environmental friendliness remain major challenges for its market penetration. Here, we present a fast and green exfoliation strategy for large scale production of high quality water dispersible few layer graphene through a controllable edge oxidation and localized gas bubbling process. Mild edge oxidation guarantees that the pristine sp 2 lattice is largely intact and the edges are functionalized with hydrophilic groups, giving rise to high conductivity and good water dispersibility at the same time. The aqueous concentration can be as high as 5.0 mg mL -1 , which is an order of magnitude higher than previously reports. The water soluble graphene can be directly spray-coated on various substrates, and the back-gated field effect transistor give hole and electron mobility of ~496 and ~676 cm 2 V -1 s -1 , respectively. These results achieved are expected to expedite various applications of graphene.

  5. Use of artificial intelligence in the production of high quality minced meat

    Science.gov (United States)

    Kapovsky, B. R.; Pchelkina, V. A.; Plyasheshnik, P. I.; Dydykin, A. S.; Lazarev, A. A.

    2017-09-01

    A design for an automatic line for minced meat production according to new production technology based on an innovative meat milling method is proposed. This method allows the necessary degree of raw material comminution at the stage of raw material preparation to be obtained, which leads to production intensification due to the traditional meat mass comminution equipment being unnecessary. To ensure consistent quality of the product obtained, the use of on-line automatic control of the technological process for minced meat production is envisaged. This system has been developed using artificial intelligence methods and technologies. The system is trainable during the operation process, adapts to changes in processed raw material characteristics and to external impacts that affect the system operation, and manufactures meat shavings with minimal dispersion of the typical particle size. The control system includes equipment for express analysis of the chemical composition of the minced meat and its temperature after comminution. In this case, the minced meat production process can be controlled strictly as a function of time, which excludes subjective factors for assessing the degree of finished product readiness. This will allow finished meat products with consistent, targeted high quality to be produced.

  6. Failure of anthropometry as a facial identification technique using high-quality photographs.

    Science.gov (United States)

    Kleinberg, Krista F; Vanezis, Peter; Burton, A Mike

    2007-07-01

    Anthropometry can be used in certain circumstances to facilitate comparison of a photograph of a suspect with that of the potential offender from surveillance footage. Experimental research was conducted to determine whether anthropometry has a place in forensic practice in confirming the identity of a suspect from a surveillance video. We examined an existing database of photographic lineups, where one video image was compared against 10 photographs, which has previously been used in psychological research. Target (1) and test (10) photos were of high quality, although taken with a different camera. The anthropometric landmarks of right and left ectocanthions, nasion, and stomion were chosen, and proportions and angle values between these landmarks were measured to compare target with test photos. Results indicate that these measurements failed to accurately identify targets. There was also no indication that any of the landmarks made a better comparison than another. It was concluded that, for these landmarks, this method does not generate the consistent results necessary for use as evidence in a court of law.

  7. High quality TbMnO3 films deposited on YAlO3

    International Nuclear Information System (INIS)

    Glavic, Artur; Voigt, Joerg; Persson, Joerg; Su, Yixi; Schubert, Juergen; Groot, Joost de; Zande, Willi; Brueckel, Thomas

    2011-01-01

    Research highlights: → We found a good substrate and suitable deposition parameters to create untwinned, epitaxial thin films of TbMnO 3 . → Laboratory experiments prove the crystalline quality of the films. → We were able to measure the micro magnetic structure in the films by polarized neutron diffraction (to our knowledge the first neutron investigations on TbMnO 3 thin films). - Abstract: High quality thin films of TbMnO 3 were grown by pulsed laser deposition on orthorhombicYAlO 3 (1 0 0). The interface and surface roughness of a 55 nm thick film were probed by X-ray reflectometry and atomic force microscopy, yielding a roughness of 1 nm. X-ray diffraction revealed untwinned films and a small mosaic spread of 0.04 o and 0.2 o for out-of-plane and in-plane reflections, respectively. This high degree of epitaxy was also confirmed by Rutherford backscattering spectrometry. Using polarized neutron diffraction we could identify a magnetic structure with the propagation vector (0 0.27 0), identical to the bulk magnetic structure of TbMnO 3 .

  8. The production of the heavy pig for high quality processed products

    Directory of Open Access Journals (Sweden)

    Paolo Bosi

    2010-01-01

    Full Text Available The review discusses the topics presented below, with experimental data and more evidence for some aspects which areproblematic for the pig producer. To obtain high quality processed pig products, heavy pig production in Italy is subjectedto rules fixed by several Consortia, on the basis of the experience of producers and the results from scientific research.Slaughter animals of at least 9 months of age and 160 kg live weight are required to provide heavy cuts with excellentmeat. Breeds are limited to Italian Large White and Landrace, selected for specific parameters such as loss at 1st saltingof the ham, and their crosses. Crosses with Duroc and hybrids can be used if obtained from selection and crossingschemes that fit the objectives of Italian selection. Backfat thickness must be “sufficient” to obtain retailed fresh hamswith fat cover ranging from 20 to 30 mm, depending on ham weight, and the content of linoleic acid in ham fat covercannot exceed 15%. Fat quantity and quality in feeds should be carefully controlled to satisfy the quality of fat in theham. The feeding level is also relevant, due to the imposed minimum age at slaughter. Feed restriction is a necessarypractice to respect the rules for ham production. For castrate males of medium genetic value, the restriction shouldreduce fat deposition, but the diet composition can be adapted to maintain the maximum growth of protein. For strainswith high lean deposition potential and particularly for gilts, protein deposition should also be limited to maintain a sufficientfat cover of ham.

  9. DEVELOPMENT OF ACID-SOIL TOLERANT CORN (Zea mays L. WITH HIGH-QUALITY PROTEIN

    Directory of Open Access Journals (Sweden)

    E.S. Halimi

    2011-06-01

    Full Text Available Corn is an important food crop in Indonesia. Plant expansion has been hampered by soil-acidity problem and the protein content of many corn varieties was low. This research initiates development of soil-acid-tolerant corn with high-quality-protein content. Research was done on 12 factorial treatments and 3 replications as blocks in RCBD. The first factor was corn populations: Toray-1(G1, Toray-2(G2, GS-5(G3 and GS-10(G4. The second factor was fertilizations: P1(69 kg N+36 kg P2O5+15 kg K2O per ha; P2(115 kg N+54 kg P2O5+30 kg K2O per ha; and P3(161 kg N+72 kg P2O5+45 kg K2O per ha. The observed variables consisted of several agronomic traits, including the protein content. Results indicated that the corn populations, in general, showed good agronomic traits. The differences were mostly between populations, not between fertilizations, and no interaction was observed. The yield potential ranged from 4.25 to 6.47 ton dry seeds per ha. The protein content of seed resulted from cross ranged from 9.84% to 11.30%, as compared to the parents of 9.11% and 12.62%. This research concludes that genetic factors play an important role as confirmed by heritability estimate (h2=0.75.

  10. Sensory analysis and consumer acceptance of 140 high-quality extra virgin olive oils.

    Science.gov (United States)

    Valli, Enrico; Bendini, Alessandra; Popp, Martin; Bongartz, Annette

    2014-08-01

    Sensory analysis is a crucial tool for evaluating the quality of extra virgin olive oils. One aim of such an investigation is to verify if the sensory attributes themselves - which are strictly related to volatile and phenolic compounds - may permit the discrimination of high-quality products obtained by olives of different cultivars and/or grown in various regions. Moreover, a crucial topic is to investigate the interdependency between relevant parameters determining consumer acceptance and objective sensory characteristics evaluated by the panel test. By statistically analysing the sensory results, a grouping - but not discriminatory - effect was shown for some cultivars and some producing areas. The preference map shows that the most appreciated samples by consumers were situated in the direction of the 'ripe fruity' and 'sweet' axis and opposite to the 'bitter' and 'other attributes' (pungent, green fruity, freshly cut grass, green tomato, harmony, persistency) axis. Extra virgin olive oils produced from olives of the same cultivars and grown in the same areas shared similar sensorial attributes. Some differences in terms of expectation and interpretation of sensory characteristics of extra virgin olive oils might be present for consumers and panellists: most of the consumers appear unfamiliar with positive sensorial attributes, such as bitterness and pungency. © 2013 Society of Chemical Industry.

  11. Application of high quality antiproton beam to study charmonium and exotics above DD-bar threshold

    International Nuclear Information System (INIS)

    Barabanov, M.Y.; Vodopyanov, A.S.

    2014-01-01

    The spectroscopy of charmonium and exotic states with hidden charm is discussed. It is a good testing tool for theories of strong interactions including QCD in both perturbative and non-perturbative regime, lattice QCD, potential models and phenomenological models. An elaborated analysis of charmonium and charmed hybrid spectrum is given, and attempts to interpret recent experimental data in the above DD-bar threshold region are considered. Experiments using antiproton beam take advantage of the intensive production of particle-antiparticle pairs in antiproton-proton annihilations. Experimental data from different collaboration are analyzed with special attention given to new states with hidden charm that were discovered recently. Some of these states can be interpreted as higher-laying S, P and D wave charmonium states. But much more data on different decay modes are needed before firmer conclusions can be made. These data can be derived directly from the experiments using high quality antiproton beam with momentum up to 15 GeV/c. (authors)

  12. Cooking and the human commitment to a high-quality diet.

    Science.gov (United States)

    Carmody, R N; Wrangham, R W

    2009-01-01

    For our body size, humans exhibit higher energy use yet reduced structures for mastication and digestion of food compared to chimpanzees, our closest living relatives. This suite of features suggests that humans are adapted to a high-quality diet. Although increased consumption of meat during human evolution certainly contributed to dietary quality, meat-eating alone appears to be insufficient to support the evolution of these traits, because modern humans fare poorly on raw diets that include meat. Here, we suggest that cooking confers physical and chemical benefits to food that are consistent with observed human dietary adaptations. We review evidence showing that cooking facilitates mastication, increases digestibility, and otherwise improves the net energy value of plant and animal foods regularly consumed by humans. We also address the likelihood that cooking was adopted more than 250,000 years ago (kya), a period that we believe is sufficient in length for the proposed adaptations to have occurred. Additional experimental work is needed to help discriminate the relative contributions of cooking, meat eating, and other innovations such as nonthermal food processing in supporting the human transition toward dietary quality.

  13. Theoretical-Experimental study on the electroslag remelting technology of high quality steels

    International Nuclear Information System (INIS)

    Robles P, E.F.

    1993-01-01

    This is a theoretical-experimental laboratory study on the Electroslag Remelting Technology (ESRT) of high quality steels. The objective of this study was to analyze the problems that this technology entails and thus facilitate its industrial application in Mexico. The study was carried out using a 1 Kg. capacity furnace, the behavior of different fluxes on the remelting of 1018 AISI carbon steel was established and a slag 70F/15/15 was selected for the remelting of H-13 AISI hot work tool steel. From the experimental results it was possible to establish a flux manufacture route, the electrode conditioning necessary for the experiments, and the critical points of the process. It was demonstrated that the crucible and electrode advance system are the more critical points in the furnace manufacture, that the start up is fundamental for the remelting continuity and that the CaF 2 base slags are more recommendable for special steels refining. It has been proven that it is possible to experiment with little laboratory electroslag furnaces. (Author)

  14. High quality human immunoglobulin G purified from Cohn fractions by liquid chromatography

    Directory of Open Access Journals (Sweden)

    K. Tanaka

    2000-01-01

    Full Text Available In order to obtain intravenous immunoglobulin G (iv IgG of high quality from F-I+II+III or F-II+III pastes prepared by the Cohn method, we developed a chromatography process using ion exchange gels, Q-Sepharose FF and CM-Sepharose FF, and Sephacryl S-300 gel filtration. Viral inactivation was performed by incubating the preparation with pepsin at pH 4.0 at 35oC for 18 h. The characteristics of 28 batches produced by us were: yield 4.3 ± 0.2 g/l plasma, i.e., a recovery of 39.1 ± 1.8%; IgG subclasses distribution: IgG1 = 58.4%, IgG2 = 34.8%, IgG3 = 4.5% and IgG4 = 2.3%; IgG size distribution was 98.4% monomers, 1.2% dimers and 0.4% polymers and protein aggregates; anticomplement activity was less than 0.5 CH50/mg IgG, and prekallikrein activator activity (PKA was less than 5 IU/ml. These characteristics satisfied the requirements of the European Pharmacopoea edition, and the regulations of the Brazilian Health Ministry (M.S. Portaria No. 2, 30/10/1998.

  15. High-quality electron beam generation in a proton-driven hollow plasma wakefield accelerator

    Science.gov (United States)

    Li, Y.; Xia, G.; Lotov, K. V.; Sosedkin, A. P.; Hanahoe, K.; Mete-Apsimon, O.

    2017-10-01

    Simulations of proton-driven plasma wakefield accelerators have demonstrated substantially higher accelerating gradients compared to conventional accelerators and the viability of accelerating electrons to the energy frontier in a single plasma stage. However, due to the strong intrinsic transverse fields varying both radially and in time, the witness beam quality is still far from suitable for practical application in future colliders. Here we demonstrate the efficient acceleration of electrons in proton-driven wakefields in a hollow plasma channel. In this regime, the witness bunch is positioned in the region with a strong accelerating field, free from plasma electrons and ions. We show that the electron beam carrying the charge of about 10% of 1 TeV proton driver charge can be accelerated to 0.6 TeV with a preserved normalized emittance in a single channel of 700 m. This high-quality and high-charge beam may pave the way for the development of future plasma-based energy frontier colliders.

  16. Controllable Edge Oxidation and Bubbling Exfoliation Enable the Fabrication of High Quality Water Dispersible Graphene

    Science.gov (United States)

    Tian, Suyun; Sun, Jing; Yang, Siwei; He, Peng; Wang, Gang; di, Zengfeng; Ding, Guqiao; Xie, Xiaoming; Jiang, Mianheng

    2016-09-01

    Despite significant progresses made on mass production of chemically exfoliated graphene, the quality, cost and environmental friendliness remain major challenges for its market penetration. Here, we present a fast and green exfoliation strategy for large scale production of high quality water dispersible few layer graphene through a controllable edge oxidation and localized gas bubbling process. Mild edge oxidation guarantees that the pristine sp2 lattice is largely intact and the edges are functionalized with hydrophilic groups, giving rise to high conductivity and good water dispersibility at the same time. The aqueous concentration can be as high as 5.0 mg mL-1, which is an order of magnitude higher than previously reports. The water soluble graphene can be directly spray-coated on various substrates, and the back-gated field effect transistor give hole and electron mobility of ~496 and ~676 cm2 V-1 s-1, respectively. These results achieved are expected to expedite various applications of graphene.

  17. CESAME: Providing High Quality Professional Development in Science and Mathematics for K-12 Teachers

    Science.gov (United States)

    Hickman, Paul

    2002-04-01

    It is appropriate that after almost half a century of Science and Mathematics education reform we take a look back and a peek forward to understand the present state of this wonderfully complex system. Each of the components of this system including teaching, professional development, assessment, content and the district K-12 curriculum all need to work together if we hope to provide quality science, mathematics and technology education for ALL students. How do the state and national standards drive the system? How do state policies on student testing and teacher licensure come into play? How do we improve the preparation, retention and job satisfaction of our K-12 teachers? What initiatives have made or are making a difference? What else needs to be done? What can the physics community do to support local efforts? This job is too big for any single organization or individual but we each can contribute to the effort. Our Center at Northeastern University, with support from the National Science Foundation, has a sharply defined focus: to get high quality, research-based instructional materials into the hands of K-12 classroom teachers and provide the support they need to use the materials effectively in their classrooms.

  18. Formation of high-quality self-assembled monolayers of conjugated dithiols on gold: base matters.

    Science.gov (United States)

    Valkenier, Hennie; Huisman, Everardus H; van Hal, Paul A; de Leeuw, Dago M; Chiechi, Ryan C; Hummelen, Jan C

    2011-04-06

    This Article reports a systematic study on the formation of self-assembled monolayers (SAMs) of conjugated molecules for molecular electronic (ME) devices. We monitored the deprotection reaction of acetyl protected dithiols of oligophenylene ethynylenes (OPEs) in solution using two different bases and studied the quality of the resulting SAMs on gold. We found that the optimal conditions to reproducibly form dense, high-quality monolayers are 9-15% triethylamine (Et(3)N) in THF. The deprotection base tetrabutylammonium hydroxide (Bu(4)NOH) leads to less dense SAMs and the incorporation of Bu(4)N into the monolayer. Furthermore, our results show the importance of the equilibrium concentrations of (di)thiolate in solution on the quality of the SAM. To demonstrate the relevance of these results for molecular electronics applications, large-area molecular junctions were fabricated using no base, Et(3)N, and Bu(4)NOH. The magnitude of the current-densities in these devices is highly dependent on the base. A value of β=0.15 Å(-1) for the exponential decay of the current-density of OPEs of varying length formed using Et(3)N was obtained. © 2011 American Chemical Society

  19. The high quality of safety culture is absolutely necessary for the nuclear industry development

    International Nuclear Information System (INIS)

    Amiruddin, A.

    1998-01-01

    Batan as a facilitator in achieving the nuclear programme, has to start to introduce the nuclear science and technology to the publics and announces the nuclear activities results. By this mean time, most of people is still quite sure considering that the use of fossil fuel is better than that of nuclear fuel, even though there will be no other choice ultimately to use nuclear energy. This contradiction appears due to three reasons i.e., public's unbelieveness crisis dealt with less of knowledge of public about nuclear sciences and technology, their confident of nuclear-danger risks and the broadly miss-information sprout by the opposition. The main challenge created from the crisis of the safety culture of human activities. Some points to anticipated those situation are to establish infrastructure, maintain co-operation, links and coordination within points in the infrastructure, also to create the working culture system based on professional development and high quality safety management, and to increase publics information by a birds point approach through regional, cultural, social and political communication. Publics knowledge and understanding will bring about their supports and acceptances to the nuclear programme and its development (Nuclear Power Plant as a particular)

  20. Fabricating High-Quality 3D-Printed Alloys for Dental Applications

    Directory of Open Access Journals (Sweden)

    Min-Ho Hong

    2017-07-01

    Full Text Available Metal additive manufacturing (AM, especially selective laser melting (SLM, has been receiving particular attention because metallic functional structures with complicated configurations can be effectively fabricated using the technique. However, there still exist some future challenges for the fabrication of high-quality SLM products for dental applications. First, the surface quality of SLM products should be further improved by standardizing the laser process parameters or by appropriately post-treating the surface. Second, it should be guaranteed that dental SLM restorations have good dimensional accuracy and, in particular, a good marginal fit. Third, a definitive standard regarding building and scanning strategies, which affect the anisotropy, should be established to optimize the mechanical properties and fatigue resistance of SLM dental structures. Fourth, the SLM substructure’s bonding and support to veneering ceramic should be further studied to facilitate the use of esthetic dental restorations. Finally, the biocompatibility of SLM dental alloys should be carefully examined and improved to minimize the potential release of toxic metal ions from the alloys. Future research of SLM should focus on solving the above challenges, as well as on fabricating dental structures with “controlled” porosity.