Hang, I.; Rinttila, T.; Zentek, J.; Kettunen, A.; Alaja, S.; Apajalahti, J.A.; Harmoinen, J.; Vos, de W.M.; Spillmann, T.
2012-01-01
BACKGROUND: Considerable evidence suggests that food impacts both the gastro-intestinal (GI) function and the microbial ecology of the canine GI tract. The aim of this study was to evaluate the influence of high-carbohydrate (HC), high-protein (HP) and dry commercial (DC) diets on the canine colonic
Directory of Open Access Journals (Sweden)
Anna McRee
2014-09-01
Full Text Available Domestic dogs are common amongst communities in sub-Saharan Africa and may serve as important reservoirs for infectious agents that may cause diseases in wildlife. Two agents of concern are canine parvovirus (CPV and canine distemper virus (CDV, which may infect and cause disease in large carnivore species such as African wild dogs and African lions, respectively. The impact of domestic dogs and their diseases on wildlife conservation is increasing in Zimbabwe, necessitating thorough assessment and implementation of control measures. In this study, domestic dogs in north-western Zimbabwe were evaluated for antibodies to CDV, CPV, and canine adenovirus (CAV. These dogs were communal and had no vaccination history. Two hundred and twenty-five blood samples were collected and tested using a commercial enzyme-linked immunosorbent assay (ELISA for antibodies to CPV, CDV, and CAV. Of these dogs, 75 (34% had detectable antibodies to CDV, whilst 191 (84% had antibodies to CPV. Antibodies to canine adenovirus were present in 28 (13% dogs. Canine parvovirus had high prevalence in all six geographic areas tested. These results indicate that CPV is circulating widely amongst domestic dogs in the region. In addition, CDV is present at high levels. Both pathogens can infect wildlife species. Efforts for conservation of large carnivores in Zimbabwe must address the role of domestic dogs in disease transmission.
McRee, Anna; Wilkes, Rebecca P; Dawson, Jessica; Parry, Roger; Foggin, Chris; Adams, Hayley; Odoi, Agricola; Kennedy, Melissa A
2014-09-05
Domestic dogs are common amongst communities in sub-Saharan Africa and may serve as important reservoirs for infectious agents that may cause diseases in wildlife. Two agents of concern are canine parvovirus (CPV) and canine distemper virus (CDV), which may infect and cause disease in large carnivore species such as African wild dogs and African lions, respectively. The impact of domestic dogs and their diseases on wildlife conservation is increasing in Zimbabwe, necessitating thorough assessment and implementation of control measures. In this study, domestic dogs in north-western Zimbabwe were evaluated for antibodies to CDV, CPV, and canine adenovirus (CAV). These dogs were communal and had no vaccination history. Two hundred and twenty-five blood samples were collected and tested using a commercial enzyme-linked immunosorbent assay (ELISA) for antibodies to CPV, CDV, and CAV. Of these dogs, 75 (34%) had detectable antibodies to CDV, whilst 191 (84%) had antibodies to CPV. Antibodies to canine adenovirus were present in 28 (13%) dogs. Canine parvovirus had high prevalence in all six geographic areas tested. These results indicate that CPV is circulating widely amongst domestic dogs in the region. In addition, CDV is present at high levels. Both pathogens can infect wildlife species. Efforts for conservation of large carnivores in Zimbabwe must address the role of domestic dogs in disease transmission.
Tooth fractures in canine clinical practice
International Nuclear Information System (INIS)
Capik, I.; Ledecky, V.; Sevcik, A.
2001-01-01
Tooth fractures constitute a considerable fraction of all tooth diseases. Out of the 5,370 dogs treated during four years, 492 were presented with dental problems and 28.3 % of the latter were treated for tooth fractures. Canines were the most frequently affected teeth (38.8 %), followed by premolars (33.1 %), incisors (25.9 %), and molars (2.2 %), 55.4 % of the patients with canine and incisor fractures being large breed dogs. Fractures of premolars (mostly of 108, 208) were divided evenly irrespective of breed or body size. Nonsurgical endodontic treatment yielded good therapeutic results in most cases, but repeated treatment was necessary in some patients
Directory of Open Access Journals (Sweden)
R Bueno
2005-08-01
Full Text Available The yield as well as phenotypic and functional parameters of canine peripheral blood monocyte-derived macrophages were analyzed. The cells that remained adherent to Teflon after 10 days of culture had high phagocytic activity when inoculated with Leishmania chagasi. Flow cytometric analysis demonstrated that more than 80% of cultured cells were positive for the monocyte/macrophage marker CD14.
Reyes, F D; Arce, C; Moreno, A; Fernández Romero, J M; Luque de Castro, M D
2001-10-31
A method for the determination of monoclonal antibody anti-canine-IgG based on a continuous filtration/dissolution system is presented as prototype for further developments. The basis of the system is the continuous formation of a high-molecular immunocomplex, which is temporally retained on a microfilter located prior to the detector. The immunochemical method consists of the development of a sandwich type heterogeneous non-competitive reaction to yield a high molecular immunocomplex, as a result of the affinity interaction between streptavidin and biotincanine IgG and the immunoreaction between canine IgG and mAb anti-canine IgG, which occurs in solution. Goat anti-mouse IgG labelled with peroxidase is used as tracer. The extension of the immunoreaction is monitored fluorimetrically via the condensation product between 4-hydroxyphenylacetic acid and hydrogen peroxide in the presence of the peroxidase retained on the filter. The method provides a dynamic range from 10(-4) to 500 mug l(-1) with an IC(50) of 0.554 mug 1(-1) (for a biotin-IgG dilution of 1:250, chi(2)=0.6085, r(2)=0.9991, n=14) and a precision, expressed as R.S.D.%, lower than 4.7%. After modifications, the method here proposed can be extended for monitoring analytes of interest in the agrochemical, food and environmental areas, as far as permitted by the availability to produce the corresponding monoclonal antibody.
International Nuclear Information System (INIS)
Kumar, K.S.; Srinivasan, V.; Toles, R.E.; Miner, V.L.; Jackson, W.E.; Seed, T.M.
2002-01-01
There is an urgent need to develop non-toxic radioprotectors. We tested the efficacy of a 3-drug combination (3-DC) of iloprost, misoprostol, and 3D-MPL (3-deacylated monophosphoryl lipid A) and the effects of postirradiation clinical support with high doses of antibiotics and blood transfusion. Canines were given 3-DC or the vehicle and exposed to 3.4 Gy or 4.1 Gy of 60 Co radiation. Canines irradiated at 4.1 Gy were also given clinical support, which consisted of blood transfusion and antibiotics (gentamicin, and cefoxitin or cephalexin). Peripheral blood cell profile and 60-day survival were used as indices of protection. At 3.4 Gy, 3-DC- or vehicle-treated canines without postirradiation clinical support survived only for 10 to 12 days. Fifty percent of the canines treated with 3-DC or vehicle and provided postirradiation clinical support survived 4.1-Gy irradiation. Survival of canines treated with vehicle before irradiation significantly correlated with postirradiation antibiotic treatments, but not with blood transfusion. The recovery profile of peripheral blood cells in 4.1 Gy-irradiated canines treated with vehicle and antibiotics was better than drug-treated canines. These results indicate that therapy with high doses of intramuscular aminoglycoside antibiotic (gentamicin) and an oral cephalosporin (cephalexin) enhanced survival of irradiated canines. Although blood transfusion correlated with survival of 3-DC treated canines, there were no additional survivors with 3-DC treated canines than the controls. (author)
Taguchi, Masayuki; Namikawa, Kazuhiko; Maruo, Takuya; Orito, Kensuke; Lynch, Jonathan; Tsuchiya, Ryo; Sahara, Hiroeki
2012-08-01
Domesticated adult dogs with antibody titer classified as below 'high' to one or more of canine distemper virus (CDV), canine parvovirus type-2 (CPV-2) and canine adenovirus type-1 (CAdV-1) were then given an additional inoculation, and the effectiveness of this booster evaluated 2 months later. Consequently, CDV and CAdV-1 antibody titer experienced a significant increase, but the same effect was not observed in the antibody titer of CPV-2. These findings suggest that with additional inoculation, a booster effect may be expected in increasing antibody titers for CDV and CAdV-1, but it is unlikely to give an increase in CPV-2 antibody titer. © 2012 The Societies and Blackwell Publishing Asia Pty Ltd.
Maeda, Junko; Cartwright, Ian M.; Haskins, Jeremy S.; Fujii, Yoshihiro; Fujisawa, Hiroshi; Hirakawa, Hirokazu; Uesaka, Mitsuru; Kitamura, Hisashi; Fujimori, Akira; Thamm, Douglas H.; Kato, Takamitsu A.
2016-01-01
Heavy ions, characterized by high linear energy transfer (LET) radiation, have advantages compared with low LET protons and photons in their biological effects. The application of heavy ions within veterinary clinics requires additional background information to determine heavy ion efficacy. In the present study, comparison of the cell-killing effects of photons, protons and heavy ions was investigated in canine osteosarcoma (OSA) cells in vitro. A total of four canine OSA cell lines with various radiosensitivities were irradiated with 137Cs gamma-rays, monoenergetic proton beams, 50 keV/µm carbon ion spread out Bragg peak beams and 200 keV/µm iron ion monoenergetic beams. Clonogenic survival was examined using colony-forming as says, and relative biological effectiveness (RBE) values were calculated relative to gamma-rays using the D10 value, which is determined as the dose (Gy) resulting in 10% survival. For proton irradiation, the RBE values for all four cell lines were 1.0–1.1. For all four cell lines, exposure to carbon ions yielded a decreased cell survival compared with gamma-rays, with the RBE values ranging from 1.56–2.10. Iron ions yielded the lowest cell survival among tested radiation types, with RBE values ranging from 3.51–3.69 observed in the three radioresistant cell lines. The radiosensitive cell line investigated demonstrated similar cell survival for carbon and iron ion irradiation. The results of the present study suggest that heavy ions are more effective for killing radioresistant canine OSA cells when compared with gamma-rays and protons. This markedly increased efficiency of cell killing is an attractive reason for utilizing heavy ions for radioresistant canine OSA. PMID:27446477
International Nuclear Information System (INIS)
Kim, Jong-Hyuk; Yu, Chi-Ho; Yhee, Ji-Young; Im, Keum-Soon; Kim, Na-Hyun; Sur, Jung-Hyang
2010-01-01
Human seminoma is classified as classical seminoma (SE) and spermatocytic seminoma (SS). Human SE is known to be more malignant and metastasizing more frequently than SS. Tumor angiogenesis is highly related with tumor progression and metastasis, with microvessel density (MVD) being an important parameter of metastatic potential. Canine seminoma is not yet well-established as SE or SS type including correlation with angiogenesis. We classified canine SE and SS, and then compared them to tumor associated vessels. Twenty-three cases of canine seminomas (2 intratubular, 9 diffuse, and 12 intratubular/diffuse seminomas showing both intratubular and diffuse patterns) were classified as SE or SS by immunohistochemistry (IHC) using monoclonal antibody against PLAP and by PAS stain. The histopathological data were then compared to see if there was a correlation with SE or SS. Angiogenesis of seminomas were evaluated by immunohistochemical assay using polyclonal antibody against Von Willebrand factor (vWF) and by calculating the means of MVD, vessels area and perimeters using computerized image analysis. Statistical Package for Social Sciences (SPSS) program was used for various statistical analyses. The numbers of PLAP+/PAS+ canine SEs were 8/23 (34.8%) and PLAP-/PAS- SSs were 15/23 (61.2%). All SE cases (8/8, 100%) were intratubular/diffuse types. SS types included 2 intratubular (2/15, 13.3%), 9 diffuse (9/15, 60%), and 4 intratubular/diffuse (4/15, 26.7%) types. MVD and vascular parameters in SEs were significantly higher than in SSs, showing the highest value in the intratubular/diffuse type. Seminomas observed with neoplastic cells invasion of vessels presented higher perimeter and area values than seminomas without conformed neoplastic cells invasion. In this study, we demonstrated a positive relationship between canine SE and tumor angiogenesis. Furthermore, we also showed that a tumor cells invasion of vessels were a correlated vascular parameter. Although
Directory of Open Access Journals (Sweden)
Kim Jong-Hyuk
2010-05-01
Full Text Available Abstract Background Human seminoma is classified as classical seminoma (SE and spermatocytic seminoma (SS. Human SE is known to be more malignant and metastasizing more frequently than SS. Tumor angiogenesis is highly related with tumor progression and metastasis, with microvessel density (MVD being an important parameter of metastatic potential. Canine seminoma is not yet well-established as SE or SS type including correlation with angiogenesis. We classified canine SE and SS, and then compared them to tumor associated vessels. Methods Twenty-three cases of canine seminomas (2 intratubular, 9 diffuse, and 12 intratubular/diffuse seminomas showing both intratubular and diffuse patterns were classified as SE or SS by immunohistochemistry (IHC using monoclonal antibody against PLAP and by PAS stain. The histopathological data were then compared to see if there was a correlation with SE or SS. Angiogenesis of seminomas were evaluated by immunohistochemical assay using polyclonal antibody against Von Willebrand factor (vWF and by calculating the means of MVD, vessels area and perimeters using computerized image analysis. Statistical Package for Social Sciences (SPSS program was used for various statistical analyses. Results The numbers of PLAP+/PAS+ canine SEs were 8/23 (34.8% and PLAP-/PAS- SSs were 15/23 (61.2%. All SE cases (8/8, 100% were intratubular/diffuse types. SS types included 2 intratubular (2/15, 13.3%, 9 diffuse (9/15, 60%, and 4 intratubular/diffuse (4/15, 26.7% types. MVD and vascular parameters in SEs were significantly higher than in SSs, showing the highest value in the intratubular/diffuse type. Seminomas observed with neoplastic cells invasion of vessels presented higher perimeter and area values than seminomas without conformed neoplastic cells invasion. Conclusion In this study, we demonstrated a positive relationship between canine SE and tumor angiogenesis. Furthermore, we also showed that a tumor cells invasion of vessels
Bilateral supernumerary primary maxillary canines
Directory of Open Access Journals (Sweden)
Santanu Mukhopadhyay
2018-01-01
Full Text Available Supernumerary teeth are more common in the permanent than in primary dentition. In the primary dentition, the anomaly is most frequently observed in the maxillary lateral incisor region, followed by the maxillary midline where they are termed as mesiodens. Supernumerary teeth in the primary canine region are rare. This paper describes a rare case of nonsyndromic supernumerary primary maxillary canine distributed bilaterally in a 4-year-old boy. Both the supernumeraries resembled size and shape of normal primary canine. The right supplemental canine is high labially placed, whereas the left one is seen normally aligned in the dental arch distal to lateral incisor. One of the most significant sequelae of primary supernumerary teeth is their duplication in the permanent series. Radiographic examination of supernumerary primary canine did not indicate any such anomaly in the permanent dentition. The patient was kept under observation.
Reliability of mandibular canines as indicators for sexual dichotomy.
Hosmani, Jagadish V; Nayak, Ramakant S; Kotrashetti, Vijayalakshmi S; S, Pradeep; Babji, Deepa
2013-02-01
Amongst the various calcified structures in the human body, teeth have gained lot of popularity in estimating the sex of an individual as they are highly resistant to destruction and decomposition. Using permanent mandibular canines many researchers have predicted a high level of accuracy in identifying the sex correctly. The purpose of our study was to gauge the effectiveness of mandibular canines in discerning sex. Fifty dental casts each of males and females were utilized for the study. Mesio-distal dimension and inter-canine distance of mandibular right and left canine was recorded using digital vernier caliper and mandibular canine index was calculated. The mean value of mesio-distal dimensions of right and left mandibular canine was slightly greater in males compared to females. The mandibular canine index was equal in both sexes. Inter-canine distance was marginally higher in males compared to females. Despite of higher values in males none of the parameters were statistically significant. The results herein bolster contemporary studies that mesio-distal dimensions of mandibular canines and mandibular canine index do not reflect sexual dimorphism and that its application should be discontinued in sex prediction among Indian populations. How to cite this article: Hosmani J V, Nayak R S, Kotrashetti V S, Pradeep S, Babji D. Reliability of Mandibular Canines as Indicators for Sexual Dichotomy. J Int Oral Health 2013; 5(1):1-7.
In vitro development of canine somatic cell nuclear transfer embryos in different culture media.
Kim, Dong-Hoon; No, Jin-Gu; Choi, Mi-Kyung; Yeom, Dong-Hyeon; Kim, Dong-Kyo; Yang, Byoung-Chul; Yoo, Jae Gyu; Kim, Min Kyu; Kim, Hong-Tea
2015-01-01
The objective of the present study was to investigate the effects of three different culture media on the development of canine somatic cell nuclear transfer (SCNT) embryos. Canine cloned embryos were cultured in modified synthetic oviductal fluid (mSOF), porcine zygote medium-3 (PZM-3), or G1/G2 sequential media. Our results showed that the G1/G2 media yielded significantly higher morula and blastocyst development in canine SCNT embryos (26.1% and 7.8%, respectively) compared to PZM-3 (8.5% and 0%or mSOF (2.3% and 0%) media. In conclusion, this study suggests that blastocysts can be produced more efficiently using G1/G2 media to culture canine SCNT embryos.
Liu, Dafei; Liu, Fei; Guo, Dongchun; Hu, Xiaoliang; Li, Zhijie; Li, Zhigang; Ma, Jianzhang; Liu, Chunguo
2018-01-23
To rapidly distinguish Canine distemper virus (CDV), canine parvovirus (CPV), and canine kobuvirus (CaKoV) in practice, a one-step multiplex PCR/RT-PCR assay was developed, with detection limits of 10 2.1 TCID 50 for CDV, 10 1.9 TCID 50 for CPV and 10 3 copies for CaKoV. This method did not amplify nonspecific DNA or RNA from other canine viruses. Therefore, the assay provides a sensitive tool for the rapid clinical detection and epidemiological surveillance of CDV, CPV and CaKoV in dogs.
Cyclooxygenase expression in canine platelets and Madin-Darby canine kidney cells.
Kay-Mugford, P A; Benn, S J; LaMarre, J; Conlon, P D
2000-12-01
To examine cyclooxygenase (COX) expression in canine platelets and Madin-Darby canine kidney (MDCK) cells in culture. Canine platelets and MDCK cells. Total RNA was recovered from isolated canine platelets and MDCK cells. Northern blot analysis and reverse transcription-polymerase chain reaction (RT-PCR), using complementary DNA probes and primers designed from the human COX sequences, were used to determine COX-1 and -2 (cyclooxygenase isoforms 1 and 2) messenger RNA (mRNA) expression. Following northern blot analysis, canine platelets were found to express only the 2.8-kb COX-1 transcript; COX-2 was not detected. Canine MDCK cells expressed the 4.5-kb COX-2 transcript, in addition to the 2.8-kb COX-1 transcript. A single DNA band of 270 base pairs was identified following gel electrophoresis of the product obtained from RT-PCR of mRNA from canine platelets. Sequencing revealed that this PCR product was 90% homologous to a portion of the human COX-1 gene (Genbank M59979). Detection of COX-1 by RT-PCR of RNA obtained from canine platelets is a novel finding. The 90% homology of the PCR product with the human sequence suggests strong conservation between the canine and human COX-1 gene. Cloning and sequencing of the canine gene will be required to fully characterize homologous regions. Because of the importance of COX in the inflammatory process and as a potential target of currently available nonsteroidal anti-inflammatory drugs (NSAID), a better understanding of canine COX may improve our ability to use NSAID appropriately, achieve efficacy, and avoid potential adverse drug effects in dogs.
Directory of Open Access Journals (Sweden)
Mostfa Shahabi
2017-09-01
Full Text Available Introduction: Canine impaction is a common occurrence. In this study, we sought to investigate the root anatomy and length of impacted canines and lateral incisor adjacent to impacted maxillary canine. Materials and Methods: In this retrospective study, three-dimensional tomographic imaging was performed on 26 patients with unilateral maxillary canine impaction. In this study, we evaluated root length and anatomy of impacted canines, in terms of resorption intensity and curvature, with Planmeca Romexis Viewer 4.0. Furthermore, crown shape as well as root length and anatomy of the lateral incisors adjacent to impacted canines were investigated and compared with the other side on the dental arch, where canine eruption was normal. Results: Root length of impacted canines was significantly lower than that of normal canines (P=0.011. There were no significant differences between root length of lateral incisors adjacent to impacted canines and root length of lateral incisors adjacent to normal canines (P=0.221. Moreover, the resorption intensity of the adjacent lateral incisors was higher than that of the impacted canines. No significant differences were noted in root resorption intensity between the lateral incisors adjacent to the imacted canines and the lateral incisors adjacent to normal canines (P=0.36. In addition, resorption intensity was significantly higher in impacted canines than in normal canines (P=0.024. Root anatomy of impacted canines was not significantly different from that of normal canines (P=0.055. The crown shape of the lateral incisors adjacent to impacted canines was not significantly different from that of the lateral incisors adjacent to normal canines (P=0.052. Conclusion: Impaction can probably affect root length and canine resorption severity. However, root and crown shape of lateral incisors cannot always be associated with canine impaction.
Chandran, Dev; Shahana, Pallichera Vijayan; Rani, Gudavelli Sudha; Sugumar, Parthasarthy; Shankar, Chinchkar Ramchandra; Srinivasan, Villuppanoor Alwar
2009-12-10
Expression of Physalis mottle tymovirus coat protein in Escherichia coli was earlier shown to self-assemble into empty capsids that were nearly identical to the capsids formed in vivo. Amino acid substitutions were made at the N-terminus of wild-type Physalis mottle virus coat protein with neutralizing epitopes of Canine parvovirus containing the antigenic sites 1-2, 4 and 6-7 and T-cell epitope of the fusion protein of Canine distemper virus in various combinations to yield PhMV1, PhMV2, PhMV3, PhMV4 and PhMV5. These constructs were cloned and expressed in E. coli. The chimeric proteins self-assembled into chimeric tymovirus-like particles (TVLPs) as determined by electron microscopy. The TVLPs were purified by ultracentrifugation and injected into guinea pigs and dogs to determine their immunogenicity. Initial immunogenicity studies in guinea pigs indicated that PhMV3 gave a higher response in comparison to the other TVLPs for both CPV and CDV and hence all further experiments in dogs were done with PhMV3. HI was done against different isolates obtained from various parts of the country. Protective titres indicated the broad spectrum of the vaccine. In conclusion the study indicated that the above chimeric VLP based vaccine could be used in dogs to generate a protective immune response against diseases caused by both Canine parvo and Canine distemper virus.
Khobragade, P.; Jain, A.; Setlur Nagesh, S. V.; Andreana, S.; Dziak, R.; Sunkara, S. K.; Sunkara, S.; Bednarek, D. R.; Rudin, S.; Ionita, C. N.
2015-03-01
High-resolution 3D bone-tissue structure measurements may provide information critical to the understanding of the bone regeneration processes and to the bone strength assessment. Tissue engineering studies rely on such nondestructive measurements to monitor bone graft regeneration area. In this study, we measured bone yield, fractal dimension and trabecular thickness through micro-CT slices for different grafts and controls. Eight canines underwent surgery to remove a bone volume (defect) in the canine's jaw at a total of 44 different locations. We kept 11 defects empty for control and filled the remaining ones with three regenerative materials; NanoGen (NG), a FDA-approved material (n=11), a novel NanoCalcium Sulfate (NCS) material (n=11) and NCS alginate (NCS+alg) material (n=11). After a minimum of four and eight weeks, the canines were sacrificed and the jaw samples were extracted. We used a custombuilt micro-CT system to acquire the data volume and developed software to measure the bone yield, fractal dimension and trabecular thickness. The software used a segmentation algorithm based on histograms derived from volumes of interest indicated by the operator. Using bone yield and fractal dimension as indices we are able to differentiate between the control and regenerative material (p<0.005). Regenerative material NCS showed an average 63.15% bone yield improvement over the control sample, NCS+alg showed 55.55% and NanoGen showed 37.5%. The bone regeneration process and quality of bone were dependent upon the position of defect and time period of healing. This study presents one of the first quantitative comparisons using non-destructive Micro-CT analysis for bone regenerative material in a large animal with a critical defect model. Our results indicate that Micro-CT measurement could be used to monitor invivo bone regeneration studies for greater regenerative process understanding.
Milovancev, Milan; Hilgart-Martiszus, Ian; McNamara, Michael J; Goodall, Cheri P; Seguin, Bernard; Bracha, Shay; Wickramasekara, Samanthi I
2013-06-13
Osteosarcoma (OSA) is the most common primary bone tumor of dogs and carries a poor prognosis despite aggressive treatment. An improved understanding of the biology of OSA is critically needed to allow for development of novel diagnostic, prognostic, and therapeutic tools. The surface-exposed proteome (SEP) of a cancerous cell includes a multifarious array of proteins critical to cellular processes such as proliferation, migration, adhesion, and inter-cellular communication. The specific aim of this study was to define a SEP profile of two validated canine OSA cell lines and a normal canine osteoblast cell line utilizing a biotinylation/streptavidin system to selectively label, purify, and identify surface-exposed proteins by mass spectrometry (MS) analysis. Additionally, we sought to validate a subset of our MS-based observations via quantitative real-time PCR, Western blot and semi-quantitative immunocytochemistry. Our hypothesis was that MS would detect differences in the SEP composition between the OSA and the normal osteoblast cells. Shotgun MS identified 133 putative surface proteins when output from all samples were combined, with good consistency between biological replicates. Eleven of the MS-detected proteins underwent analysis of gene expression by PCR, all of which were actively transcribed, but varied in expression level. Western blot of whole cell lysates from all three cell lines was effective for Thrombospondin-1, CYR61 and CD44, and indicated that all three proteins were present in each cell line. Semi-quantitative immunofluorescence indicated that CD44 was expressed at much higher levels on the surface of the OSA than the normal osteoblast cell lines. The results of the present study identified numerous differences, and similarities, in the SEP of canine OSA cell lines and normal canine osteoblasts. The PCR, Western blot, and immunocytochemistry results, for the subset of proteins evaluated, were generally supportive of the mass spectrometry data
Long-term effectiveness of canine-to-canine bonded flexible spiral wire lingual retainers
Renkema, Anne-Marie; Renkema, Alianne; Bronkhorst, Ewald; Katsaros, Christos
Introduction: The flexible spiral wire (FSW) canine-to-canine lingual retainer bonded to all 6 anterior teeth is a frequently used type of mandibular fixed retainer. This study aimed to assess the long-term effectiveness of FSW canine-to-canine lingual retainers in maintaining the alignment of the
Long-term effectiveness of canine-to-canine bonded flexible spiral wire lingual retainers
Renkema, A.M.; Bronkhorst, E.M.; Katsaros, C.
2011-01-01
INTRODUCTION: The flexible spiral wire (FSW) canine-to-canine lingual retainer bonded to all 6 anterior teeth is a frequently used type of mandibular fixed retainer. This study aimed to assess the long-term effectiveness of FSW canine-to-canine lingual retainers in maintaining the alignment of the
Survivin inhibition via EZN-3042 in canine lymphoma and osteosarcoma.
Shoeneman, J K; Ehrhart, E J; Charles, J B; Thamm, D H
2016-06-01
Canine lymphoma (LSA) and osteosarcoma (OS) have high mortality rates and remain in need of more effective therapeutic approaches. Survivin, an inhibitor of apoptosis (IAP) family member protein that inhibits apoptosis and drives cell proliferation, is commonly elevated in human and canine cancer. Survivin expression is a negative prognostic factor in dogs with LSA and OS, and canine LSA and OS cell lines express high levels of survivin. In this study, we demonstrate that survivin downregulation in canine LSA and OS cells using a clinically applicable locked nucleic acid antisense oligonucleotide (EZN-3042, Enzon Pharmaceuticals, Piscataway Township, NJ, USA) inhibits growth, induces apoptosis and enhances chemosensitivity in vitro, and inhibits survivin transcription and protein production in orthotopic canine OS xenografts. Our findings strongly suggest that survivin-directed therapies might be effective in treatment of canine LSA and OS and support evaluation of EZN-3042 in dogs with cancer. © 2014 John Wiley & Sons Ltd.
Antiviral effect of lithium chloride on infection of cells by canine parvovirus.
Zhou, Pei; Fu, Xinliang; Yan, Zhongshan; Fang, Bo; Huang, San; Fu, Cheng; Hong, Malin; Li, Shoujun
2015-11-01
Canine parvovirus type 2 causes significant viral disease in dogs, with high morbidity, high infectivity, and high mortality. Lithium chloride is a potential antiviral drug for viruses. We determined the antiviral effect of Lithium Chloride on canine parvovirus type 2 in feline kidney cells. The viral DNA and proteins of canine parvovirus were suppressed in a dose-dependent manner by lithium chloride. Further investigation verified that viral entry into cells was inhibited in a dose-dependent manner by lithium chloride. These results indicated that lithium chloride could be a potential antiviral drug for curing dogs with canine parvovirus infection. The specific steps of canine parvovirus entry into cells that are affected by lithium chloride and its antiviral effect in vivo should be explored in future studies.
Expression and function of survivin in canine osteosarcoma.
Shoeneman, Jenette K; Ehrhart, E J; Eickhoff, Jens C; Charles, J B; Powers, Barbara E; Thamm, Douglas H
2012-01-01
Osteosarcoma has a high mortality rate and remains in need of more effective therapeutic approaches. Survivin is an inhibitor of apoptosis family member protein that blocks apoptosis and drives proliferation in human cancer cells where it is commonly elevated. In this study, we illustrate the superiority of a canine osteosarcoma model as a translational tool for evaluating survivin-directed therapies, owing to the striking similarities in gross and microscopic appearance, biologic behavior, gene expression, and signaling pathway alterations. Elevated survivin expression in primary canine osteosarcoma tissue correlated with increased histologic grade and mitotic index and a decreased disease-free interval (DFI). Survivin attenuation in canine osteosarcoma cells inhibited cell-cycle progression, increased apoptosis, mitotic arrest, and chemosensitivity, and cooperated with chemotherapy to significantly improve in vivo tumor control. Our findings illustrate the utility of a canine system to more accurately model human osteosarcoma and strongly suggest that survivin-directed therapies might be highly effective in its treatment. ©2011 AACR.
Mostfa Shahabi; Maryam Omidkhoda; Seyedeh Haniyeh Omidi; Seyed Hosein Hoseini Zarch
2017-01-01
Introduction: Canine impaction is a common occurrence. In this study, we sought to investigate the root anatomy and length of impacted canines and lateral incisor adjacent to impacted maxillary canine. Materials and Methods: In this retrospective study, three-dimensional tomographic imaging was performed on 26 patients with unilateral maxillary canine impaction. In this study, we evaluated root length and anatomy of impacted canines, in terms of resorption intensity and curvature, with Planme...
International Nuclear Information System (INIS)
Meyers, K.M.; Boehme, M.; Inbar, O.
1982-01-01
Endotoxin from Escherichia coli O127:B8, Salmonella abortus-equi and S minnesota induced clumping of some canine platelets (PLT) at a final endotoxin concentration of 1 microgram/ml. Endotoxin-induced clumping of canine PLT was independent of PLT energy-requiring processes, because clumping was observed with canine PLT incubated with 2-deoxy-D-glucose and antimycin A. The PLT responded to adenosine diphosphate before, but not after, incubation with the metabolic inhibitors. Endotoxin induced a slight and inconsistant clumping of bovine and equine PLT at high (mg/ml) endotoxin concentration. High-affinity binding sites could not be demonstrated on canine, bovine, and equine PLT, using 125 I-labeled E coli O127:B8 endotoxin. Nonspecific binding was observed and appeared to be due primarily to an extraneous coat on the PLT surface that was removed by gel filtration. The endotoxin that was bound to PLT did not appear to modify PLT function. An attempt to identify plasma proteins that bound physiologically relevant amounts of endotoxin was not successful. The significance of the endotoxin-induced clumping or lack of it on the pathophysiology of endotoxemia is discussed
Zhang, Kao; Jin, Huijun; Zhong, Fei; Li, Xiujin; Neng, Changai; Chen, Huihui; Li, Wenyan; Wen, Jiexia
2012-11-04
To construct recombinant adenovirus containing canine interferon-gamma (cIFN-gamma) gene and to investigate its antiviral activity against canine parvovirus in Madin-Darby canine kidney cells (MDCK). [Methods] The cIFN-gamma gene was inserted into adenovirus shuttle plasmid to construct pShuttle3-cIFN-gamma expression vector, from which the cIFN-gamma expression cassette was transferred into the adenovirus genomic plasmid pAdeno-X by specific restriction sites to generate recombinant adenovirus genomic plasmid pAd-cIFN-gamma. The pAd-cIFN-gamma plasmid was linearized by digestion and transfected into human embryonic kidney (HEK) 293T cells to generate the replication-defective cIFN-gamma recombinant adenovirus (Ad-cIFN-gamma). To analyze its anti-canine parvovirus activity, the MDCK cells were pre-infected by Ad-cIFN-gamma recombinant adenovirus, and then infected by canine parvovirus. The antiviral activity of the Ad-cIFN-gamma recombinant adenovirus against parvovirus was analyzed. The recombinant adenovirus containing cIFN-gamma gene was constructed by the ligation method. The recombinant adenovirus could mediates recombinant cIFN-gamma secretory expression in MDCK cells. The Ad-cIFN-gamma recombinant adenovirus could significantly inhibit canine parvovirus replication in MDCK cells pre-infected with the recombinant adenovirus. These results indicate that the Ad-cIFN-gamma recombinant adenovirus has the potent antiviral activity against canine parvovirus. The Ad-cIFN-gamma recombinant adenovirus was successfully constructed by the ligation method and possessed a powerful antiviral activity against canine parvovirus.
Energy Technology Data Exchange (ETDEWEB)
Meyers, K.M.; Boehme, M.; Inbar, O.
1982-10-01
Endotoxin from Escherichia coli O127:B8, Salmonella abortus-equi and S minnesota induced clumping of some canine platelets (PLT) at a final endotoxin concentration of 1 microgram/ml. Endotoxin-induced clumping of canine PLT was independent of PLT energy-requiring processes, because clumping was observed with canine PLT incubated with 2-deoxy-D-glucose and antimycin A. The PLT responded to adenosine diphosphate before, but not after, incubation with the metabolic inhibitors. Endotoxin induced a slight and inconsistant clumping of bovine and equine PLT at high (mg/ml) endotoxin concentration. High-affinity binding sites could not be demonstrated on canine, bovine, and equine PLT, using /sup 125/I-labeled E coli O127:B8 endotoxin. Nonspecific binding was observed and appeared to be due primarily to an extraneous coat on the PLT surface that was removed by gel filtration. The endotoxin that was bound to PLT did not appear to modify PLT function. An attempt to identify plasma proteins that bound physiologically relevant amounts of endotoxin was not successful. The significance of the endotoxin-induced clumping or lack of it on the pathophysiology of endotoxemia is discussed.
DEFF Research Database (Denmark)
Hillström, Anna; Hagman, Ragnvi; Tvedten, Harold
2014-01-01
BACKGROUND: Measurement of C-reactive protein (CRP) is used for diagnosing and monitoring systemic inflammatory disease in canine patients. An automated human immunoturbidimetric assay has been validated for measuring canine CRP, but cross-reactivity with canine CRP is unpredictable. OBJECTIVE......: The purpose of the study was to validate a new automated canine-specific immunoturbidimetric CRP method (Gentian cCRP). METHODS: Studies of imprecision, accuracy, prozone effect, interference, limit of quantification, and stability under different storage conditions were performed. The new method was compared...... with a human CRP assay previously validated for canine CRP determination. Samples from 40 healthy dogs were analyzed to establish a reference interval. RESULTS: Total imprecision was
A novel bocavirus in canine liver
Directory of Open Access Journals (Sweden)
Li Linlin
2013-02-01
Full Text Available Abstract Background Bocaviruses are classified as a genus within the Parvoviridae family of single-stranded DNA viruses and are pathogenic in some mammalian species. Two species have been previously reported in dogs, minute virus of canines (MVC, associated with neonatal diseases and fertility disorders; and Canine bocavirus (CBoV, associated with respiratory disease. Findings In this study using deep sequencing of enriched viral particles from the liver of a dog with severe hemorrhagic gastroenteritis, necrotizing vasculitis, granulomatous lymphadenitis and anuric renal failure, we identified and characterized a novel bocavirus we named Canine bocavirus 3 (CnBoV3. The three major ORFs of CnBoV3 (NS1, NP1 and VP1 shared less than 60% aa identity with those of other bocaviruses qualifying it as a novel species based on ICTV criteria. Inverse PCR showed the presence of concatemerized or circular forms of the genome in liver. Conclusions We genetically characterized a bocavirus in a dog liver that is highly distinct from prior canine bocaviruses found in respiratory and fecal samples. Its role in this animal’s complex disease remains to be determined.
Immunopathogenic and Neurological Mechanisms of Canine Distemper Virus
Directory of Open Access Journals (Sweden)
Otávio Valério Carvalho
2012-01-01
Full Text Available Canine distemper is a highly contagious viral disease caused by the canine distemper virus (CDV, which is a member of the Morbillivirus genus, Paramyxoviridae family. Animals that most commonly suffer from this disease belong to the Canidae family; however, the spectrum of natural hosts for CDV also includes several other families of the order Carnivora. The infectious disease presents worldwide distribution and maintains a high incidence and high levels of lethality, despite the availability of effective vaccines, and no specific treatment. CDV infection in dogs is characterized by the presentation of systemic and/or neurological courses, and viral persistence in some organs, including the central nervous system (CNS and lymphoid tissues. An elucidation of the pathogenic mechanisms involved in canine distemper disease will lead to a better understanding of the injuries and clinical manifestations caused by CDV. Ultimately, further insight about this disease will enable the improvement of diagnostic methods as well as therapeutic studies.
Immunopathogenic and Neurological Mechanisms of Canine Distemper Virus
Carvalho, Otávio Valério; Botelho, Clarisse Vieira; Ferreira, Caroline Gracielle Torres; Scherer, Paulo Oldemar; Soares-Martins, Jamária Adriana Pinheiro; Almeida, Márcia Rogéria; Silva Júnior, Abelardo
2012-01-01
Canine distemper is a highly contagious viral disease caused by the canine distemper virus (CDV), which is a member of the Morbillivirus genus, Paramyxoviridae family. Animals that most commonly suffer from this disease belong to the Canidae family; however, the spectrum of natural hosts for CDV also includes several other families of the order Carnivora. The infectious disease presents worldwide distribution and maintains a high incidence and high levels of lethality, despite the availability of effective vaccines, and no specific treatment. CDV infection in dogs is characterized by the presentation of systemic and/or neurological courses, and viral persistence in some organs, including the central nervous system (CNS) and lymphoid tissues. An elucidation of the pathogenic mechanisms involved in canine distemper disease will lead to a better understanding of the injuries and clinical manifestations caused by CDV. Ultimately, further insight about this disease will enable the improvement of diagnostic methods as well as therapeutic studies. PMID:23193403
High yield fabrication of fluorescent nanodiamonds
International Nuclear Information System (INIS)
Boudou, Jean-Paul; Curmi, Patrick A; Jelezko, Fedor; Wrachtrup, Joerg; Balasubramanian, Gopalakrischnan; Reuter, Rolf; Aubert, Pascal; Sennour, Mohamed; Thorel, Alain; Gaffet, Eric
2009-01-01
A new fabrication method to produce homogeneously fluorescent nanodiamonds with high yields is described. The powder obtained by high energy ball milling of fluorescent high pressure, high temperature diamond microcrystals was converted in a pure concentrated aqueous colloidal dispersion of highly crystalline ultrasmall nanoparticles with a mean size less than or equal to 10 nm. The whole fabrication yield of colloidal quasi-spherical nanodiamonds was several orders of magnitude higher than those previously reported starting from microdiamonds. The results open up avenues for the industrial cost-effective production of fluorescent nanodiamonds with well-controlled properties.
High yield fabrication of fluorescent nanodiamonds
Energy Technology Data Exchange (ETDEWEB)
Boudou, Jean-Paul; Curmi, Patrick A [Structure and Activity of Normal and Pathological Biomolecules-INSERM/UEVE U829, Universite d' Evry-Val d' Essonne, Batiment Maupertuis, Rue du pere Andre Jarlan, F-91025 Evry (France); Jelezko, Fedor; Wrachtrup, Joerg; Balasubramanian, Gopalakrischnan; Reuter, Rolf [3.Physikalisches Institut, University of Stuttgart, Pfaffenwaldring 57, D-70550 Stuttgart (Germany); Aubert, Pascal [Nanometric Media Laboratory, Universite d' Evry-Val d' Essonne, Batiment Maupertuis, Rue du pere Andre Jarlan, F-91025 Evry (France); Sennour, Mohamed; Thorel, Alain [Centre des Materiaux, Mines Paris, ParisTech, BP 87, F-91000 Evry (France); Gaffet, Eric [Nanomaterials Research Group-UMR 5060, CNRS, UTBM, Site de Sevenans, F-90010 Belfort (France)], E-mail: jpb.cnrs@free.fr, E-mail: pcurmi@univ-evry.fr, E-mail: f.jelezko@physik.uni-stuttgart.de
2009-06-10
A new fabrication method to produce homogeneously fluorescent nanodiamonds with high yields is described. The powder obtained by high energy ball milling of fluorescent high pressure, high temperature diamond microcrystals was converted in a pure concentrated aqueous colloidal dispersion of highly crystalline ultrasmall nanoparticles with a mean size less than or equal to 10 nm. The whole fabrication yield of colloidal quasi-spherical nanodiamonds was several orders of magnitude higher than those previously reported starting from microdiamonds. The results open up avenues for the industrial cost-effective production of fluorescent nanodiamonds with well-controlled properties.
Directory of Open Access Journals (Sweden)
Sophia Pfahler
Full Text Available A genome-wide association study for canine hip dysplasia (CHD and canine elbow dysplasia (CED using the Illumina canine high density bead chip had been performed for 174 Bernese mountain dogs. General and mixed linear model analysis identified two different regions with single nucleotide polymorphisms (SNPs on dog chromosome (CFA 14 significantly associated with CHD and a further significantly CHD-associated region on CFA37. For CED, four SNPs on CFA11 and 27 were significantly associated. The identified SNPs of four associated regions included nearby candidate genes. These possible positional candidates were the genes PON2 on CFA14 and FN1 on CFA37 for CHD and the genes LMNB1 on CFA11 and WNT10B on CFA27 for CED.
Larson, L J; Schultz, R D
2007-01-01
A group of client-owned dogs and a group of dogs at a commercial kennel were evaluated for duration of antibody responses against canine parvovirus type 2 (CPV-2) and canine adenovirus type 1 (CAV-1) after receiving a combination vaccine containing recombinant canarypox-vectored canine distemper virus (CDV) and modified-live CPV-2, CAV-2, and canine parainfluenza virus, with (C6) or without (C4) two serovars of Leptospira (Recombitek C4 or C6, Merial). Duration of antibody, which correlates with protective immunity, was found to be at least 36 months in both groups. Recombitek combination vaccines can confidently be given every 3 years with assurance of protection in immunocompetent dogs against CPV-2 and CAV-1 as well as CDV. This allows this combination vaccine, like other, similar modified- live virus combination products containing CDV, CAV-2, and CPV-2, to be administered in accordance with the recommendations of the American Animal Hospital Association Canine Vaccine Task Force.
Webb, Craig; Twedt, David C
2003-09-01
Gastritis--inflammation of the stomach--is a frequently cited differential yet rarely characterized diagnosis in cases of canine anorexia and vomiting. Although the list of rule-outs for acute or chronic gastritis is extensive, a review of the veterinary literature reveals fewer than 15 articles that have focused on clinical cases of canine gastritis over the last 25 years. The dog frequently appears in the human literature as an experimentally manipulated model for the study of endoscopic techniques or the effect of medications on gastric mucosa. In the veterinary patient, cases of acute gastritis are rarely pursued with the complete diagnostic armamentarium, and cases of chronic gastritis are rarely found to occur as an entity isolated from the rest of the gastrointestinal tract. This article focuses on those findings most clinically relevant to cases of canine gastritis in veterinary medicine.
Mechanical properties of canine osteosarcoma-affected antebrachia.
Steffey, Michele A; Garcia, Tanya C; Daniel, Leticia; Zwingenberger, Allison L; Stover, Susan M
2017-05-01
To determine the influence of neoplasia on the biomechanical properties of canine antebrachia. Ex vivo biomechanical study. Osteosarcoma (OSA)-affected canine antebrachia (n = 12) and unaffected canine antebrachia (n = 9). Antebrachia were compressed in axial loading until failure. A load-deformation curve was used to acquire the structural mechanical properties of neoplastic and unaffected specimens. Structural properties and properties normalized by body weight (BW) and radius length were compared using analysis of variance (ANOVA). Modes of failure were compared descriptively. Neoplastic antebrachia fractured at, or adjacent to, the OSA in the distal radial diaphysis. Unaffected antebrachia failed via mid-diaphyseal radial fractures with a transverse cranial component and an oblique caudal component. Structural mechanical properties were more variable in neoplastic antebrachia than unaffected antebrachia, which was partially attributable to differences in bone geometry related to dog size. When normalized by dog BW and radial length, strength, stiffness, and energy to yield and failure, were lower in neoplastic antebrachia than in unaffected antebrachia. OSA of the distal radial metaphysis in dogs presented for limb amputation markedly compromises the structural integrity of affected antebrachia. However, biomechanical properties of affected bones was sufficient for weight-bearing, as none of the neoplastic antebrachia fractured before amputation. The behavior of tumor invaded bone under cyclic loading warrants further investigations to evaluate the viability of in situ therapies for bone tumors in dogs. © 2017 The American College of Veterinary Surgeons.
Finite element analysis of rapid canine retraction through reducing resistance and distraction
Directory of Open Access Journals (Sweden)
Junjie XUE
2014-01-01
Full Text Available Objective: The aims of this study were to compare different surgical approaches to rapid canine retraction by designing and selecting the most effective method of reducing resistance by a three-dimensional finite element analysis. Material and Methods: Three-dimensional finite element models of different approaches to rapid canine retraction by reducing resistance and distraction were established, including maxillary teeth, periodontal ligament, and alveolar. The models were designed to dissect the periodontal ligament, root, and alveolar separately. A 1.5 N force vector was loaded bilaterally to the center of the crown between first molar and canine, to retract the canine distally. The value of total deformation was used to assess the initial displacement of the canine and molar at the beginning of force loading. Stress intensity and force distribution were analyzed and evaluated by Ansys 13.0 through comparison of equivalent (von Mises stress and maximum shear stress. Results: The maximum value of total deformation with the three kinds of models occurred in the distal part of the canine crown and gradually reduced from the crown to the apex of the canine; compared with the canines in model 3 and model 1, the canine in model 2 had the maximum value of displacement, up to 1.9812 mm. The lowest equivalent (von Mises stress and the lowest maximum shear stress were concentrated mainly on the distal side of the canine root in model 2. The distribution of equivalent (von Mises stress and maximum shear stress on the PDL of the canine in the three models was highly concentrated on the distal edge of the canine cervix. . Conclusions: Removal of the bone in the pathway of canine retraction results in low stress intensity for canine movement. Periodontal distraction aided by surgical undermining of the interseptal bone would reduce resistance and effectively accelerate the speed of canine retraction.
Varied clinico-radiological presentations of transmigrated canines
Directory of Open Access Journals (Sweden)
Ishita Gupta
2015-01-01
Full Text Available Canine is one of the most commonly impacted teeth in the dental arch. An unerupted permanent canine crossing the midline is called transmigration and is an unusual event. We report nine cases of impacted canine transmigration. Maxillary canine transmigration, bilateral transmigration, and transmigration associated with odontoma are rare presentations. This article discusses the varied clinico-radiologic presentations, etiology, and treatment options of transmigration. It also emphasizes the importance of panoramic radiographs for evaluation of over-retained deciduous canines or missing permanent canines.
A high throughput DNA extraction method with high yield and quality
Directory of Open Access Journals (Sweden)
Xin Zhanguo
2012-07-01
Full Text Available Abstract Background Preparation of large quantity and high quality genomic DNA from a large number of plant samples is a major bottleneck for most genetic and genomic analyses, such as, genetic mapping, TILLING (Targeting Induced Local Lesion IN Genome, and next-generation sequencing directly from sheared genomic DNA. A variety of DNA preparation methods and commercial kits are available. However, they are either low throughput, low yield, or costly. Here, we describe a method for high throughput genomic DNA isolation from sorghum [Sorghum bicolor (L. Moench] leaves and dry seeds with high yield, high quality, and affordable cost. Results We developed a high throughput DNA isolation method by combining a high yield CTAB extraction method with an improved cleanup procedure based on MagAttract kit. The method yielded large quantity and high quality DNA from both lyophilized sorghum leaves and dry seeds. The DNA yield was improved by nearly 30 fold with 4 times less consumption of MagAttract beads. The method can also be used in other plant species, including cotton leaves and pine needles. Conclusion A high throughput system for DNA extraction from sorghum leaves and seeds was developed and validated. The main advantages of the method are low cost, high yield, high quality, and high throughput. One person can process two 96-well plates in a working day at a cost of $0.10 per sample of magnetic beads plus other consumables that other methods will also need.
Energy Technology Data Exchange (ETDEWEB)
Tsuji, Takayuki; Fujimoto, Toshiro (Tokyo Medical and Dental Univ. (Japan). Inst. for Medical and Dental Engineering); Fujii, Masatoshi; Nakano, Toshihiko; Shimooki, Susumu
1991-09-01
Changes of canine brain T{sub 1}s measured in right and left white (W-T{sub 1}) and gray (G-T{sub 1}) matter, thalamus (T-T{sub 1}), and caudate nucleus (C-T{sub 1}) in coronal view with a head coil was studied in anesthesized and automatically ventilated 11 mongrel dogs (9.2{+-}2.2 kg) using 0.1 T MR imager (Mark-J, Siemens-Asahi Meditech) before and every 30 minutes after infusion of distilled water warmed at 37degC into abdominal cavity (192{+-}50 ml/kg) up to 120 minute later. Hemolysis (2{yields}85 mg/dl: before{yields}after 120 min) increased in association with total protein (5.9{yields}8.0 g/dl) while sodium (147{yields}122 mEq/l) and osmolarity (302{yields}263 mOsm/kg) decreased. G-T{sub 1} (388{yields}394 ms) and W-T{sub 1} (287{yields}305 ms) did not change significantly, but T-T{sub 1} prolonged early (331{yields}349 ms) at 60 min (p<0.05) and C-T{sub 1} (356{yields}376 ms) did at 90 min (p<0.05). T-T{sub 1} (363 ms) and C-T{sub 1} (382 ms) elongated from initial each T{sub 1} significantly (p<0.01) 7% and 6% at 120 min, respectively. Basal nuclei, especially thalamus, in canine brain became edematous at the early stage of hyponatremic hypoosmosis induced by peritoneal dialysis with water. (author).
Immunohistochemical Expression of FXR1 in Canine Normal Tissues and Melanomas.
Nordio, Laura; Marques, Andreia T; Lecchi, Cristina; Luciano, Alberto M; Stefanello, Damiano; Giudice, Chiara
2018-04-01
Fragile X mental retardation-related protein 1 (FXR1) is a cytoplasmic RNA-binding protein highly conserved among vertebrates. It has been studied for its role in muscle development, inflammation, and tumorigenesis, being related, for example, to metastasizing behavior in human and canine uveal melanoma. Anti-FXR1 antibodies have never been validated in the canine species. To investigate FXR1 expression in canine melanocytic tumors, the present study tested two commercially available polyclonal anti-human FXR1 antibodies, raised in goat and rabbit, respectively. The cross-reactivity of the anti-FXR1 antibodies was assessed by Western blot analysis, and the protein was localized by IHC in a set of normal canine tissues and in canine melanocytic tumors (10 uveal and 10 oral). Western blot results demonstrated that the antibody raised in rabbit specifically recognized the canine FXR1, while the antibody raised in goat did not cross-react with this canine protein. FXR1 protein was immunodetected using rabbit anti-FXR1 antibody, in canine normal tissues with different levels of intensity and distribution. It was also detected in 10/10 uveal and 9/10 oral melanocytic tumors. The present study validated for the first time the use of anti-FXR1 antibody in dogs and highlighted different FXR1 protein expression in canine melanocytic tumors, the significance of which is undergoing further investigations.
Homologous radioimmunoassay for canine prolactin and its application in various physiological states
International Nuclear Information System (INIS)
Graef, K.-J.; Friedreich, E.; Matthes, S.; Hasan, S.H.
1977-01-01
The purification of canine prolactin and the development of an homologous radioimmunoassay including several physiological studies in the Beagle dog are described. The assay measured immunoreactive canine prolactin with a sensitivity limit of 0.6 ng/ml. Purified canine luteinizing hormone gave no significant inhibition in the assay whereas purified canine growth hormone inhibited the binding of 125 I-labelled canine prolactin to antiserum only at very high dose levels. In Beagle dogs, basal serum prolactin concentrations were in the range 1 to 2 ng/ml in normal male, normal female (metoestrus and anoestrus) and oophorectomized-hysterectomized female dogs. The prolactin concentration in one sample of amniotic fluid was in the same range, while in hypophysectomized make dogs no serum prolactin could be detected by the assay system. Serum prolactin concentrations tended to increase during late pregnancy and parturition, remaining high during the first 9 days of lactation. In consequence, a negative correlation was suggested between serum prolactin and serum progesterone concentrations. (author)
Litster, A L; Pressler, B; Volpe, A; Dubovi, E
2012-08-01
Canine parvovirus (CPV) and canine distemper virus (CDV) are highly infectious and often fatal diseases with worldwide distributions, and are important population management considerations in animal shelters. A point-of-care ELISA test kit is available to detect serum antibodies to CPV and CDV, and presumptively to predict protective status. The aim of this study was to determine the diagnostic accuracy of the test compared to CPV hemagglutination inhibition titers and CDV serum neutralization titers determined by a reference laboratory, using sera collected from dogs housed at animal shelters. The ELISA test was used under both field and laboratory conditions and duplicate specimens were processed using an extra wash step. The test kit yielded accurate results (CPV: sensitivity 92.3%, specificity 93.5%; CDV: sensitivity 75.7%, specificity 91.8%) under field conditions. CDV sensitivity was improved by performing the test under laboratory conditions and using an optical density (OD) meter (laboratory performed 94.0%; OD 88.1%). Point-of-care ELISA testing for serum CPV and CDV antibody titers was demonstrated to be a useful tool for determining antibody status when making decisions regarding the need for CPV and/or CDV vaccination and also in animal shelters for population management. Copyright © 2012 Elsevier Ltd. All rights reserved.
Development of the canine tooth in the beagle
International Nuclear Information System (INIS)
Amimoto, A.; Iwamoto, S.; Hachimura, H.; Miyamoto, T.; Murata, T.; Taura, Y.; Nakama, S.; Hayashi, K.
1993-01-01
The growth of the crown and root in the canine tooth of beagle dogs were observed macroscopically and radiographically, and changes of occlusion with age were investigated. Completion of growth in the crown of the canine tooth was observed in both mandible and maxilla, and its eruption was accompanied by development of the dental root. The permanent canine erupted on the lingual side of deciduous canine in the mandible, and on the mesial side of the deciduous canine in the maxilla. Movement of the permanent canine to normal occlusal position(buccal direction in mandibular canine, and distal direction in maxillary canine)was followed by the loss of the deciduous canine. Coexistence of the permanent and deciduous canines occurred for about 2.4 weeks in the maxilla and about 1.4 weeks in the mandible, on average. Macroscopically, the growth of the permanent canine was completed by 33 weeks of age in the mandible and about 34 weeks of age in the maxilla. The mature root of the permanent canine was recognized radiographically at about 43 weeks of age in the mandible and 47 weeks of age in the maxilla
Ontogeny of canine dimorphism in extant hominoids.
Schwartz, G T; Dean, C
2001-07-01
Many behavioral and ecological factors influence the degree of expression of canine dimorphism for different reasons. Regardless of its socioecological importance, we know virtually nothing about the processes responsible for the development of canine dimorphism. Our aim here is to describe the developmental process(es) regulating canine dimorphism in extant hominoids, using histological markers of tooth growth. Teeth preserve a permanent record of their ontogeny in the form of short- and long-period incremental markings in both enamel and dentine. We selected 52 histological sections of sexed hominoid canine teeth from a total sample of 115, from which we calculated the time and rate of cuspal enamel formation and the rate at which ameloblasts differentiate along the future enamel-dentine junction (EDJ) to the end of crown formation. Thus, we were able to reconstruct longitudinal growth curves for height attainment in male and female hominoid canines. Male hominoids consistently take longer to form canine crowns than do females (although not significantly so for our sample of Homo). Male orangutans and gorillas occasionally take up to twice as long as females to complete enamel formation. The mean ranges of female canine crown formation times are similar in Pan, Gorilla, and Pongo. Interspecific differences between female Pan canine crown heights and those of Gorilla and Pongo, which are taller, result from differences in rates of growth. Differences in canine crown heights between male Pan and the taller, more dimorphic male Gorilla and Pongo canines result both from differences in total time taken to form enamel and from faster rates of growth in Gorilla and Pongo. Although modern human canines do not emerge as significantly dimorphic in this study, it is well-known that sexual dimorphism in canine crown height exists. Larger samples of sexed modern human canines are therefore needed to identify clearly what underlies this. Copyright 2001 Wiley-Liss, Inc.
Genomic instability and telomere fusion of canine osteosarcoma cells.
Directory of Open Access Journals (Sweden)
Junko Maeda
Full Text Available Canine osteosarcoma (OSA is known to present with highly variable and chaotic karyotypes, including hypodiploidy, hyperdiploidy, and increased numbers of metacentric chromosomes. The spectrum of genomic instabilities in canine OSA has significantly augmented the difficulty in clearly defining the biological and clinical significance of the observed cytogenetic abnormalities. In this study, eight canine OSA cell lines were used to investigate telomere fusions by fluorescence in situ hybridization (FISH using a peptide nucleotide acid probe. We characterized each cell line by classical cytogenetic studies and cellular phenotypes including telomere associated factors and then evaluated correlations from this data. All eight canine OSA cell lines displayed increased abnormal metacentric chromosomes and exhibited numerous telomere fusions and interstitial telomeric signals. Also, as evidence of unstable telomeres, colocalization of γ-H2AX and telomere signals in interphase cells was observed. Each cell line was characterized by a combination of data representing cellular doubling time, DNA content, chromosome number, metacentric chromosome frequency, telomere signal level, cellular radiosensitivity, and DNA-PKcs protein expression level. We have also studied primary cultures from 10 spontaneous canine OSAs. Based on the observation of telomere aberrations in those primary cell cultures, we are reasonably certain that our observations in cell lines are not an artifact of prolonged culture. A correlation between telomere fusions and the other characteristics analyzed in our study could not be identified. However, it is important to note that all of the canine OSA samples exhibiting telomere fusion utilized in our study were telomerase positive. Pending further research regarding telomerase negative canine OSA cell lines, our findings may suggest telomere fusions can potentially serve as a novel marker for canine OSA.
Gore, Thomas C; Lakshmanan, Nallakannu; Duncan, Karen L; Coyne, Michael J; Lum, Melissa A; Sterner, Frank J
2005-01-01
A challenge-of-immunity study was conducted to demonstrate immunity in dogs 3 years after their second vaccination with a new multivalent, modified-live vaccine containing canine adenovirus type 2 (CAV-2), canine parvovirus (CPV), and canine distemper virus (CDV). Twenty-three seronegative pups were vaccinated at 7 and 11 weeks of age. Eighteen seronegative pups, randomized into groups of six dogs, served as challenge controls. Dogs were kept in strict isolation for 3 years following the vaccination and then challenged sequentially with virulent canine adenovirus type 1 (CAV-1), CPV, and CDV. For each viral challenge, a separate group of six control dogs was also challenged. Clinical signs of CAV-1, CPV, and CDV infections were prevented in 100% of vaccinated dogs, demonstrating that the multivalent, modified-live test vaccine provided protection against virulent CAV-1, CPV, and CDV challenge in dogs 7 weeks of age or older for a minimum of 3 years following second vaccination.
9 CFR 113.306 - Canine Distemper Vaccine.
2010-01-01
... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Canine Distemper Vaccine. 113.306... Virus Vaccines § 113.306 Canine Distemper Vaccine. Canine Distemper Vaccine shall be prepared from virus... distemper virus, each of five canine distemper susceptible ferrets shall be injected with a sample of the...
J. Van Heerden; J. Bingham; M. Van Vuuren; R.E.J. Burroughs; E. Stylianides
2002-01-01
Wild dogs Lycaon pictus (n = 8) were vaccinated 4 times against canine distemper (n = 8) (initially with inactivated and subsequently with live attenuated strains of canine distemper) and canine parvovirus infection (n = 8) over a period of 360 days. Four of the wild dogs were also vaccinated 3 times against rabies using a live oral vaccine and 4 with an inactivated parenteral vaccine. Commercially-available canine distemper, canine parvovirus and parenteral rabies vaccines, intended for use ...
Characterization of the canine urinary proteome.
Brandt, Laura E; Ehrhart, E J; Scherman, Hataichanok; Olver, Christine S; Bohn, Andrea A; Prenni, Jessica E
2014-06-01
Urine is an attractive biofluid for biomarker discovery as it is easy and minimally invasive to obtain. While numerous studies have focused on the characterization of human urine, much less research has focused on canine urine. The objectives of this study were to characterize the universal canine urinary proteome (both soluble and exosomal), to determine the overlap between the canine proteome and a representative human urinary proteome study, to generate a resource for future canine studies, and to determine the suitability of the dog as a large animal model for human diseases. The soluble and exosomal fractions of normal canine urine were characterized using liquid chromatography tandem mass spectrometry (LC-MS/MS). Biological Networks Gene Ontology (BiNGO) software was utilized to assign the canine urinary proteome to respective Gene Ontology categories, such as Cellular Component, Molecular Function, and Biological Process. Over 500 proteins were confidently identified in normal canine urine. Gene Ontology analysis revealed that exosomal proteins were largely derived from an intracellular location, while soluble proteins included both extracellular and membrane proteins. Exosome proteins were assigned to metabolic processes and localization, while soluble proteins were primarily annotated to specific localization processes. Several proteins identified in normal canine urine have previously been identified in human urine where these proteins are related to various extrarenal and renal diseases. The results of this study illustrate the potential of the dog as an animal model for human disease states and provide the framework for future studies of canine renal diseases. © 2014 American Society for Veterinary Clinical Pathology and European Society for Veterinary Clinical Pathology.
Canine length in wild male baboons: maturation, aging and social dominance rank.
Directory of Open Access Journals (Sweden)
Jordi Galbany
Full Text Available Canines represent an essential component of the dentition for any heterodont mammal. In primates, like many other mammals, canines are frequently used as weapons. Hence, tooth size and wear may have significant implications for fighting ability, and consequently for social dominance rank, reproductive success, and fitness. We evaluated sources of variance in canine growth and length in a well-studied wild primate population because of the potential importance of canines for male reproductive success in many primates. Specifically, we measured maxillary canine length in 80 wild male baboons (aged 5.04-20.45 years from the Amboseli ecosystem in southern Kenya, and examined its relationship with maturation, age, and social dominance rank. In our analysis of maturation, we compared food-enhanced baboons (those that fed part time at a refuse pit associated with a tourist lodge with wild-feeding males, and found that food-enhanced males achieved long canines earlier than wild-feeding males. Among adult males, canine length decreased with age because of tooth wear. We found some evidence that, after controlling for age, longer canines were associated with higher adult dominance rank (accounting for 9% of the variance in rank, but only among relatively high-ranking males. This result supports the idea that social rank, and thus reproductive success and fitness, may depend in part on fighting ability mediated by canine size.
Mitchell, S A; Zwijnenberg, R J; Huang, J; Hodge, A; Day, M J
2012-12-01
To determine whether client-owned dogs in Australia, last vaccinated with Canvac(®) vaccines containing canine parvovirus-type 2 (CPV-2), canine distemper virus (CDV), canine adenovirus type 2 (CAV-2) ± canine parainfluenza virus (CPiV) at least 18 months ago, were seropositive or responded serologically to revaccination. A total of 235 dogs were recruited from 23 veterinary clinics, representing a variety of breeds, ages and time since last vaccination (TSLV: range 1.5-9 years, mean 2.8 years). Dogs had a blood sample taken and were revaccinated on day 0. A second blood sample was taken 7-14 days later. Blood samples were assessed for antibody titres to CPV-2 (by haemagglutination inhibition) and CDV, CAV type 1 (CAV-1) and CPiV (by virus neutralisation). Dogs with a day 0 titre >10 or a four-fold increase in titre following revaccination were considered to be serological responders. The overall percentage of dogs classified as serological responders was 98.7% for CPV-2, 96.6% for CDV, 99.6% for CAV-1 and 90.3% for CPiV. These results suggest that the duration of serological response induced by modified-live vaccines against CPV-2, CDV, CAV-1 and CPiV, including Canvac(®) vaccines, is beyond 18 months and may extend up to 9 years. Accordingly, these vaccines may be considered for use in extended revaccination interval protocols as recommended by current canine vaccine guidelines. © 2012 The Authors. Australian Veterinary Journal © 2012 Australian Veterinary Association.
Taguchi, Masayuki; Namikawa, Kazuhiko; Maruo, Takuya; Orito, Kensuke; Lynch, Jonathan; Sahara, Hiroeki
2011-09-01
Serum antibody titers for canine parvovirus type-2 (CPV-2), canine distemper virus (CDV) and canine adenovirus type-1 (CAV-1) were investigated in 1031 healthy adult household dogs (2 to 18 years old) given an annual inoculation in the previous 11 to 13 months. The number of dogs retaining significant titers of antibodies against CPV-2, CDV, and CAV-1 were 888 (86%), 744 (72%), and 732 (71%), respectively. There were no differences between males and females in antibody titers against the 3 viruses. Antibody titer for CPV-2 was significantly higher in younger dogs than in older dogs, CDV antibody was significantly higher in older dogs than in younger dogs, and CAV titer was not associated with age.
Canine parvovirus: current perspective.
Nandi, S; Kumar, Manoj
2010-06-01
Canine parvovirus 2 (CPV-2) has been considered to be an important pathogen of domestic and wild canids and has spread worldwide since its emergence in 1978. It has been reported from Asia, Australia, New Zealand, the Americas and Europe. Two distinct parvoviruses are now known to infect dogs-the pathogenic CPV-2 and CPV-1 or the minute virus of canine (MVC). CPV-2, the causative agent of acute hemorrhagic enteritis and myocarditis in dogs, is one of the most important pathogenic viruses with high morbidity (100%) and frequent mortality up to 10% in adult dogs and 91% in pups. The disease condition has been complicated further due to emergence of a number of variants namely CPV-2a, CPV-2b and CPV-2c over the years and involvement of domestic and wild canines. There are a number of different serological and molecular tests available for prompt, specific and accurate diagnosis of the disease. Further, both live attenuated and inactivated vaccines are available to control the disease in animals. Besides, new generation vaccines namely recombinant vaccine, peptide vaccine and DNA vaccine are in different stages of development and offer hope for better management of the disease in canines. However, new generation vaccines have not been issued license to be used in the field condition. Again, the presence of maternal antibodies often interferes with the active immunization with live attenuated vaccine and there always exists a window of susceptibility in spite of following proper immunization regimen. Lastly, judicious use of the vaccines in pet dogs, stray dogs and wild canids keeping in mind the new variants of the CPV-2 along with the proper sanitation and disinfection practices must be implemented for the successful control the disease.
Ultrasonographic evaluation of the canine shoulder.
Long, C D; Nyland, T G
1999-01-01
The aim of this study was to determine the normal ultrasonographic anatomy of the canine shoulder. Fourteen shoulders from 7 clinically normal mid-sized dogs were radiographed and imaged using high frequency ultrasound. Each shoulder was isolated postmortem, and the ultrasonographic and gross anatomy was studied during dissection. The ultrasonographic appearance of the shoulder specimens was similar to that found in the live dogs. Twenty-four shoulders isolated postmortem from 12 variably sized dogs were also used to characterize the normal ultrasound anatomy over a range of sizes. Important anatomic structures that could be consistently evaluated were the biceps tendon and bursa, the bicipital groove surface, the supraspinatous tendon, the infraspinatous tendon, the teres minor tendon, and the caudal aspect of the humeral head. Results of ultrasonographic examination of 4 dogs with shoulder lameness are described to illustrate some applications of canine shoulder ultrasonography in the evaluation of the canine shoulder. In these dogs, ultrasound was a valuable tool to evaluate effusion and synovial proliferation within the bicipital bursa, supraspinatous and biceps tendinitis, biceps tendon strain, and dystrophic calcification.
IQGAP1 is an oncogenic target in canine melanoma.
Directory of Open Access Journals (Sweden)
Becky H Lee
Full Text Available Canine oral mucosal melanoma is an aggressive malignant neoplasm and is characterized by local infiltration and a high metastatic potential. The disease progression is similar to that of human oral melanomas. Whereas human cutaneous melanoma is primarily driven by activating mutations in Braf (60% or Nras (20%, human mucosal melanoma harbors these mutations much less frequently. This makes therapeutic targeting and research modeling of the oral form potentially different from that of the cutaneous form in humans. Similarly, research has found only rare Nras mutations and no activating Braf mutations in canine oral melanomas, but they are still reliant on MAPK signaling. IQGAP1 is a signaling scaffold that regulates oncogenic ERK1/2 MAPK signaling in human Ras- and Raf- driven cancers, including melanomas. To investigate whether IQGAP1 is a potential target in canine melanoma, we examined the expression and localization of IQGAP1 in primary canine melanomas and canine oral melanoma cell lines obtained from the University of California-Davis. Using CRISPR/Cas9 knockout of IQGAP1, we examined effects on downstream ERK1/2 pathway activity and assayed proliferation of cell lines when treated with a peptide that blocks the interaction between IQGAP1 and ERK1/2. We observed that canine IQGAP1 is expressed and localizes to a similar extent in both human and canine melanoma by qPCR, Western blot, and immunofluorescence. Deletion of IQGAP1 reduces MAPK pathway activation in cell lines, similar to effects seen in human BrafV600E cell lines. Additionally, we demonstrated reduced proliferation when these cells are treated with a blocking peptide in vitro.
Prostate histotripsy for BPH: initial canine results
Roberts, William W.; Hall, Timothy L.; Hempel, Christopher R.; Cain, Charles A.
2009-02-01
Histotripsy is an extracorporeal ablative technology that utilizes microsecond pulses of intense ultrasound (< 1% duty cycle) to produce nonthermal, mechanical fractionation of targeted tissue. We have previously demonstrated the feasibility of histotripsy prostate ablation. In this study we sought to assess the chronic tissue response, tolerability and safety of histotripsy in a chronic in vivo canine model. Five acute and thirteen chronic canine subjects were anesthetized and treated with histotripsy targeting the prostate. Pulses consisted of 3 cycle bursts of 750 kHz ultrasound at a repetition rate of 300 Hz delivered transabdominally from a highly focused 15 cm aperture array. Transrectal ultrasound imaging provided accurate targeting and real-time monitoring of histotripsy treatment. Prostates were harvested at 0, 7, 28, or 56 days after treatment. Consistent mechanical tissue fractionation and debulking of prostate tissue was seen acutely and at delayed time points without collateral injury. Urothelialization of the treatment cavity was apparent 28 days after treatment. Canine subjects tolerated histotripsy with minimal hematuria or discomfort. Only mild transient lab abnormalities were noted. Histotripsy is a promising non-invasive therapy for prostate tissue fractionation and debulking that appears safe and well tolerated without systemic side effects in the canine model.
Canine serum protein patterns using high-resolution electrophoresis (HRE).
Abate, O; Zanatta, R; Malisano, T; Dotta, U
2000-03-01
Serum protein values were determined in 26 healthy dogs using agarose gel electrophoresis (SPE), splitting the electrophoretic separation into six regions: albumin, alpha(1), alpha(2), beta(1), beta(2)and gamma globulins. High-resolution electrophoresis (HRE) was used to separate single proteins. Serum proteins from dogs (26 healthy and 20 affected by various diseases) were then characterized by electrophoretic immunofixation (IFE) and Sudan black staining on HRE film. Haemoglobin and normal canine plasma and serum were used to identify haptoglobin and fibrinogen, respectively. In the standard pattern, determined by HRE, the following proteins were identified: albumin, alpha(1)-lipoprotein (alpha(1)-region), haptoglobin and alpha(2)-macroglobulin (alpha(2)-region), beta -lipoprotein and C3 (beta(1)-region), transferrin and IgM (beta(2)-region), IgG (mostly in gamma -region and partly in beta(2)-region). The HRE pattern shown by healthy dogs could be compared with those of dogs affected by various diseases to obtain clinical information. Copyright 2000 Harcourt Publishers Ltd.
Extreme Beta-Cell Deficiency in Pancreata of Dogs with Canine Diabetes.
Directory of Open Access Journals (Sweden)
Emily J Shields
Full Text Available The pathophysiology of canine diabetes remains poorly understood, in part due to enigmatic clinical features and the lack of detailed histopathology studies. Canine diabetes, similar to human type 1 diabetes, is frequently associated with diabetic ketoacidosis at onset or after insulin omission. However, notable differences exist. Whereas human type 1 diabetes often occurs in children, canine diabetes is typically described in middle age to elderly dogs. Many competing theories have been proposed regarding the underlying cause of canine diabetes, from pancreatic atrophy to chronic pancreatitis to autoimmune mediated β-cell destruction. It remains unclear to what extent β-cell loss contributes to canine diabetes, as precise quantifications of islet morphometry have not been performed. We used high-throughput microscopy and automated image processing to characterize islet histology in a large collection of pancreata of diabetic dogs. Diabetic pancreata displayed a profound reduction in β-cells and islet endocrine cells. Unlike humans, canine non-diabetic islets are largely comprised of β-cells. Very few β-cells remained in islets of diabetic dogs, even in pancreata from new onset cases. Similarly, total islet endocrine cell number was sharply reduced in diabetic dogs. No compensatory proliferation or lymphocyte infiltration was detected. The majority of pancreata had no evidence of pancreatitis. Thus, canine diabetes is associated with extreme β-cell deficiency in both new and longstanding disease. The β-cell predominant composition of canine islets and the near-total absence of β-cells in new onset elderly diabetic dogs strongly implies that similar to human type 1 diabetes, β-cell loss underlies the pathophysiology of canine diabetes.
High-yield pulping effluent treatment technologies
International Nuclear Information System (INIS)
Su, W.X.; Hsieh, J.S.
1993-03-01
The objective of this report is to examine the high-yield (mechanical) pulp processes with respect to environmental issues affected by the discharge of their waste streams. Various statistics are given that support the view that high-yield pulping processes will have major growth in the US regions where pulp mills are located, and sites for projects in the development phase are indicated. Conventional and innovative effluent-treatment technologies applicable to these processes are reviewed. The different types of mechanical pulping or high-yield processes are explained, and the chemical additives are discussed. The important relationship between pulp yield and measure of BOD in the effluent is graphically presented. Effluent contaminants are identified, along with other important characteristics of the streams. Current and proposed environmental limitations specifically related to mechanical pulp production are reviewed. Conventional and innovative effluent-treatment technologies are discussed, along with their principle applications, uses, advantages, and disadvantages. Sludge management and disposal techniques become an intimate part of the treatment of waste streams. The conclusion is made that conventional technologies can successfully treat effluent streams under current waste-water discharge limitations, but these systems may not be adequate when stricter standards are imposed. At present, the most important issue in the treatment of pulp-mill waste is the management and disposal of the resultant sludge
Citizen science: a new direction in canine behavior research.
Hecht, Julie; Spicer Rice, Eleanor
2015-01-01
Researchers increasingly rely on members of the public to contribute to scientific projects-from collecting or identifying, to analyzing and disseminating data. The "citizen science" model proves useful to many thematically distinctive fields, like ornithology, astronomy, and phenology. The recent formalization of citizen science projects addresses technical issues related to volunteer participation--like data quality--so that citizen scientists can make longstanding, meaningful contributions to scientific projects. Since the late 1990s, canine science research has relied with greater frequency on the participation of the general public, particularly dog owners. These researchers do not typically consider the methods and technical issues that those conducting citizen science projects embrace and continue to investigate. As more canine science studies rely on public input, an in-depth knowledge of the benefits and challenges of citizen science can help produce relevant, high-quality data while increasing the general public's understanding of canine behavior and cognition as well as the scientific process. We examine the benefits and challenges of current citizen science models in an effort to enhance canine citizen science project preparation, execution, and dissemination. This article is part of a Special Issue entitled: Canine Behavior. Copyright © 2014 Elsevier B.V. All rights reserved.
New and emerging pathogens in canine infectious respiratory disease.
Priestnall, S L; Mitchell, J A; Walker, C A; Erles, K; Brownlie, J
2014-03-01
Canine infectious respiratory disease is a common, worldwide disease syndrome of multifactorial etiology. This review presents a summary of 6 viruses (canine respiratory coronavirus, canine pneumovirus, canine influenza virus, pantropic canine coronavirus, canine bocavirus, and canine hepacivirus) and 2 bacteria (Streptococcus zooepidemicus and Mycoplasma cynos) that have been associated with respiratory disease in dogs. For some pathogens a causal role is clear, whereas for others, ongoing research aims to uncover their pathogenesis and contribution to this complex syndrome. Etiology, clinical disease, pathogenesis, and epidemiology are described for each pathogen, with an emphasis on recent discoveries or novel findings.
Current practices and research updates on diabetes mellitus in canine
Directory of Open Access Journals (Sweden)
Pankaj Kumar
2014-11-01
Full Text Available Diabetes has evidence in ancient literatures, though recently is being considered as one amongst the most emerging disease condition in both human and companion animals. Diabetes mellitus is one of the common endocrinopathy of dog characterized by hyperglycemia, glycosuria and weight loss. Reports suggests high fraction of canine population suffer with diabetes world over. Studies in different veterinary hospitals of United States suggest increase in cases of canine diabetes and decrease in case fatality rate over time. Increase in cases of canine diabetes worldwide is attributed to awareness amongst pet owners, better veterinary health facilities, breed preferences by dog owners, increase dependence on commercial feeds, obesity, etc. Diabetes in most dogs is immune mediated and insulin dependent. Breed predisposition in canine is attributed to dog leukocyte antigen gene pool encoding form major histocompatibility complex-II molecules, however research is still underway. Diagnosis of diabetes still relies on blood sugar evaluation for screening of canine population, though many other diagnostic methods have shown promising benefits including measurement of fructosamine and glycated haemoglobin. Management of diabetes in dog is based on insulin therapy, diet modification and exercise. Use of oral anti-diabetics drugs in canine is limited though experimental studies have shown promising results. Alternative therapies have been explored, but only a few approaches have shown promise for clinical application.
Genetics of Human and Canine Dilated Cardiomyopathy.
Simpson, Siobhan; Edwards, Jennifer; Ferguson-Mignan, Thomas F N; Cobb, Malcolm; Mongan, Nigel P; Rutland, Catrin S
2015-01-01
Cardiovascular disease is a leading cause of death in both humans and dogs. Dilated cardiomyopathy (DCM) accounts for a large number of these cases, reported to be the third most common form of cardiac disease in humans and the second most common in dogs. In human studies of DCM there are more than 50 genetic loci associated with the disease. Despite canine DCM having similar disease progression to human DCM studies into the genetic basis of canine DCM lag far behind those of human DCM. In this review the aetiology, epidemiology, and clinical characteristics of canine DCM are examined, along with highlighting possible different subtypes of canine DCM and their potential relevance to human DCM. Finally the current position of genetic research into canine and human DCM, including the genetic loci, is identified and the reasons many studies may have failed to find a genetic association with canine DCM are reviewed.
9 CFR 113.202 - Canine Hepatitis and Canine Adenovirus Type 2 Vaccine, Killed Virus.
2010-01-01
... Type 2 Vaccine, Killed Virus. 113.202 Section 113.202 Animals and Animal Products ANIMAL AND PLANT HEALTH INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE VIRUSES, SERUMS, TOXINS, AND ANALOGOUS PRODUCTS; ORGANISMS AND VECTORS STANDARD REQUIREMENTS Killed Virus Vaccines § 113.202 Canine Hepatitis and Canine...
Directory of Open Access Journals (Sweden)
J. Van Heerden
2002-07-01
Full Text Available Wild dogs Lycaon pictus (n = 8 were vaccinated 4 times against canine distemper (n = 8 (initially with inactivated and subsequently with live attenuated strains of canine distemper and canine parvovirus infection (n = 8 over a period of 360 days. Four of the wild dogs were also vaccinated 3 times against rabies using a live oral vaccine and 4 with an inactivated parenteral vaccine. Commercially-available canine distemper, canine parvovirus and parenteral rabies vaccines, intended for use in domestic dogs, were used. None of the vaccinated dogs showed any untoward clinical signs. The inactivated canine distemper vaccine did not result in seroconversion whereas the attenuated live vaccine resulted in seroconversion in all wild dogs. Presumably protective concentrations of antibodies to canine distemper virus were present in all wild dogs for at least 451 days. Canine parvovirus haemagglutination inhibition titres were present in all wild dogs prior to the administration of vaccine and protective concentrations persisted for at least 451 days. Vaccination against parvovirus infection resulted in a temporary increase in canine parvovirus haemagglutination inhibition titres in most dogs. Administration of both inactivated parenteral and live oral rabies vaccine initially resulted in seroconversion in 7 of 8 dogs. These titres, however, dropped to very low concentrations within 100 days. Booster administrations resulted in increased antibody concentrations in all dogs. It was concluded that the vaccines were safe to use in healthy subadult wild dogs and that a vaccination protocol in free-ranging wild dogs should at least incorporate booster vaccinations against rabies 3-6 months after the first inoculation.
van Heerden, J; Bingham, J; van Vuuren, M; Burroughs, R E J; Stylianides, E
2002-03-01
Wild dogs Lycaon pictuis (n = 8) were vaccinated 4 times against canine distemper (n = 8) (initially with inactivated and subsequently with live attenuated strains of canine distemper) and canine parvovirus infection (n = 8) over a period of 360 days. Four of the wild dogs were also vaccinated 3 times against rabies using a live oral vaccine and 4 with an inactivated parenteral vaccine. Commercially-available canine distemper, canine parvovirus and parenteral rabies vaccines, intended for use in domestic dogs, were used. None of the vaccinated dogs showed any untoward clinical signs. The inactivated canine distemper vaccine did not result in seroconversion whereas the attenuated live vaccine resulted in seroconversion in all wild dogs. Presumably protective concentrations of antibodies to canine distemper virus were present in all wild dogs for at least 451 days. Canine parvovirus haemagglutination inhibition titres were present in all wild dogs prior to the administration of vaccine and protective concentrations persisted for at least 451 days. Vaccination against parvovirus infection resulted in a temporary increase in canine parvovirus haemagglutination inhibition titres in most dogs. Administration of both inactivated parenteral and live oral rabies vaccine initially resulted in seroconversion in 7 of 8 dogs. These titres, however, dropped to very low concentrations within 100 days. Booster administrations resulted in increased antibody concentrations in all dogs. It was concluded that the vaccines were safe to use in healthy subadult wild dogs and that a vaccination protocol in free-ranging wild dogs should at least incorporate booster vaccinations against rabies 3-6 months after the first inoculation.
9 CFR 113.317 - Parvovirus Vaccine (Canine).
2010-01-01
... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Parvovirus Vaccine (Canine). 113.317... Virus Vaccines § 113.317 Parvovirus Vaccine (Canine). Parvovirus Vaccine recommended for use in dogs... from each dog shall be individually tested for neutralizing antibody against canine parvovirus to...
Angstadt, Andrea Y; Motsinger-Reif, Alison; Thomas, Rachael; Kisseberth, William C; Guillermo Couto, C; Duval, Dawn L; Nielsen, Dahlia M; Modiano, Jaime F; Breen, Matthew
2011-11-01
Osteosarcoma (OS) is the most commonly diagnosed malignant bone tumor in humans and dogs, characterized in both species by extremely complex karyotypes exhibiting high frequencies of genomic imbalance. Evaluation of genomic signatures in human OS using array comparative genomic hybridization (aCGH) has assisted in uncovering genetic mechanisms that result in disease phenotype. Previous low-resolution (10-20 Mb) aCGH analysis of canine OS identified a wide range of recurrent DNA copy number aberrations, indicating extensive genomic instability. In this study, we profiled 123 canine OS tumors by 1 Mb-resolution aCGH to generate a dataset for direct comparison with current data for human OS, concluding that several high frequency aberrations in canine and human OS are orthologous. To ensure complete coverage of gene annotation, we identified the human refseq genes that map to these orthologous aberrant dog regions and found several candidate genes warranting evaluation for OS involvement. Specifically, subsequenct FISH and qRT-PCR analysis of RUNX2, TUSC3, and PTEN indicated that expression levels correlated with genomic copy number status, showcasing RUNX2 as an OS associated gene and TUSC3 as a possible tumor suppressor candidate. Together these data demonstrate the ability of genomic comparative oncology to identify genetic abberations which may be important for OS progression. Large scale screening of genomic imbalance in canine OS further validates the use of the dog as a suitable model for human cancers, supporting the idea that dysregulation discovered in canine cancers will provide an avenue for complementary study in human counterparts. Copyright © 2011 Wiley-Liss, Inc.
Liu, P C; Chen, C A; Chen, C M; Yen, C H; Lee, M H; Chuang, C K; Tu, C F; Su, B L
2016-11-01
The clinical feasibility of passive immunotherapy has not been demonstrated in dogs naturally infected with canine distemper. In this study, porcine anti-canine distemper virus IgG and F(ab') 2 antibody fragments were used to treat infected puppies. A total of 41 naturally infected puppies (age Äsix months) exhibiting severe respiratory signs, but lacking neurological signs, were enrolled in the study. Twenty-five puppies were treated with a combination of IgG or F(ab') 2 antibody fragments (Group 1) and supportive therapy and 16 puppies received routine supportive care only (Group 2). The survival rate of dogs in Group 1 (19/25; 76%) was significantly higher than that in Group 2 (5/16; 31·3%) (Pdistemper virus antibodies improved survival in puppies affected with canine distemper with minimal adverse effects. Therefore, this therapy could be considered for treatment of endangered animal species infected with canine distemper virus. © 2016 British Small Animal Veterinary Association.
Genetics of Human and Canine Dilated Cardiomyopathy
Directory of Open Access Journals (Sweden)
Siobhan Simpson
2015-01-01
Full Text Available Cardiovascular disease is a leading cause of death in both humans and dogs. Dilated cardiomyopathy (DCM accounts for a large number of these cases, reported to be the third most common form of cardiac disease in humans and the second most common in dogs. In human studies of DCM there are more than 50 genetic loci associated with the disease. Despite canine DCM having similar disease progression to human DCM studies into the genetic basis of canine DCM lag far behind those of human DCM. In this review the aetiology, epidemiology, and clinical characteristics of canine DCM are examined, along with highlighting possible different subtypes of canine DCM and their potential relevance to human DCM. Finally the current position of genetic research into canine and human DCM, including the genetic loci, is identified and the reasons many studies may have failed to find a genetic association with canine DCM are reviewed.
Increasing Incidence of Canine Leptospirosis in Switzerland
Directory of Open Access Journals (Sweden)
Andrea Major
2014-07-01
Full Text Available A marked increase in canine leptospirosis was observed in Switzerland over 10 years with a peak incidence of 28.1 diagnosed cases/100,000 dogs/year in the most affected canton. With 95% affected dogs living at altitudes <800 m, the disease presented a seasonal pattern associated with temperature (r2 0.73 and rainfall (r2 0.39, >90% cases being diagnosed between May and October. The increasing yearly incidence however was only weakly correlated with climatic data including number of summer (r2 0.25 or rainy days (r2 0.38. Serovars Australis and Bratislava showed the highest seropositivity rates with 70.5% and 69.1%, respectively. Main clinical manifestations included renal (99.6%, pulmonary (76.7%, hepatic (26.0%, and hemorrhagic syndromes (18.2%, leading to a high mortality rate (43.3%. Similar to the human disease, liver involvement had the strongest association with negative outcome (OR 16.3. Based on these data, canine leptospirosis presents similar features and severity as the human infection for which it therefore can be considered a model. Its re-emergence in a temperate country with very high incidence rates in canines should thus be viewed as a warning and emphasize the need for increased awareness in other species.
Borah, Ballav M; Halter, Timothy J; Xie, Baoquan; Henneman, Zachary J; Siudzinski, Thomas R; Harris, Stephen; Elliott, Matthew; Nancollas, George H
2014-07-01
This work identifies carbonated hydroxyapatite (CAP) as the primary component of canine dental calculus, and corrects the long held belief that canine dental calculus is primarily CaCO3 (calcite). CAP is known to be the principal crystalline component of human dental calculus, suggesting that there are previously unknown similarities in the calcification that occurs in these two unique oral environments. In vitro kinetic experiments mimicking the inorganic components of canine saliva have examined the mechanisms of dental calculus formation. The solutions were prepared so as to mimic the inorganic components of canine saliva; phosphate, carbonate, and magnesium ion concentrations were varied individually to investigate the roll of these ions in controlling the nature of the phases that is nucleated. To date, the inorganic components of the canine oral systems have not been investigated at concentrations that mimic those in vivo. The mineral composition of the synthetic calculi grown under these conditions closely resembled samples excised from canines. This finding adds new information about calculus formation in humans and canines, and their sensitivity to chemicals used to treat these conditions. Copyright © 2014 Elsevier Inc. All rights reserved.
Role of canine circovirus in dogs with acute haemorrhagic diarrhoea.
Anderson, A; Hartmann, K; Leutenegger, C M; Proksch, A L; Mueller, R S; Unterer, S
2017-06-03
Canine circovirus (CanineCV) has been detected in some dogs with severe haemorrhagic diarrhoea, but its pathogenic role is unclear. This study evaluated a suspected association between the presence of CanineCV and acute haemorrhagic diarrhoea syndrome (AHDS) in dogs. The prevalence of CanineCV in dogs with AHDS was compared with that in healthy dogs and those infected with canine parvovirus (CPV). Additionally, time to recovery and mortality rate were compared between CanineCV-positive and CanineCV-negative dogs. Faecal samples of dogs with AHDS (n=55), healthy dogs (n=66) and dogs infected with CPV (n=54) were examined by two real-time TaqMan PCR assays targeting the replicase and capsid genes of CanineCV. CanineCV was detected in faecal samples of two dogs with AHDS, three healthy controls and seven dogs infected with CPV. Among the three groups, there was no significant difference in prevalence of CanineCV. CPV-infected animals that were coinfected with CanineCV had a significantly higher mortality rate compared with those negative for CanineCV. CanineCV does not appear to be the primary causative agent of AHDS in dogs, but might play a role as a negative co-factor in disease outcome in dogs with CPV infection. British Veterinary Association.
Approaches to canine health surveillance.
O'Neill, Dan G; Church, David B; McGreevy, Paul D; Thomson, Peter C; Brodbelt, Dave C
2014-01-01
Effective canine health surveillance systems can be used to monitor disease in the general population, prioritise disorders for strategic control and focus clinical research, and to evaluate the success of these measures. The key attributes for optimal data collection systems that support canine disease surveillance are representativeness of the general population, validity of disorder data and sustainability. Limitations in these areas present as selection bias, misclassification bias and discontinuation of the system respectively. Canine health data sources are reviewed to identify their strengths and weaknesses for supporting effective canine health surveillance. Insurance data benefit from large and well-defined denominator populations but are limited by selection bias relating to the clinical events claimed and animals covered. Veterinary referral clinical data offer good reliability for diagnoses but are limited by referral bias for the disorders and animals included. Primary-care practice data have the advantage of excellent representation of the general dog population and recording at the point of care by veterinary professionals but may encounter misclassification problems and technical difficulties related to management and analysis of large datasets. Questionnaire surveys offer speed and low cost but may suffer from low response rates, poor data validation, recall bias and ill-defined denominator population information. Canine health scheme data benefit from well-characterised disorder and animal data but reflect selection bias during the voluntary submissions process. Formal UK passive surveillance systems are limited by chronic under-reporting and selection bias. It is concluded that active collection systems using secondary health data provide the optimal resource for canine health surveillance.
Gebhard, Christiane; Fuchs-Baumgartinger, Andrea; Razzazi-Fazeli, Ebrahim; Miller, Ingrid; Walter, Ingrid
2016-01-01
Overexpression of matrix metalloproteinases (MMPs) has been associated with increased tumor aggressiveness and metastasis dissemination. We investigated whether the contrasting metastatic behavior of feline and canine osteosarcoma is related to levels and activities of MMP2 and MMP9. Zymography and immunohistochemistry were used to determine expression levels of MMP2 and MMP9 in canine and feline osteosarcoma. Using immunohistochemistry, increased MMP9 levels were identified in most canine osteosarcomas, whereas cat samples more often displayed moderate levels. High levels of pro-MMP9, pro-MMP2, and active MMP2 were detected by gelatin zymography in both species, with significantly higher values for active MMP2 in canine osteosarcoma. These findings indicate that MMP2 is probably involved in canine and feline osteosarcoma and their expression and activity could be associated with the different metastatic behavior of canine and feline osteosarcoma.
Al-Ainawi, Khaled I; Al-Mdalal, Yaser; Hajeer, Mohammad Y
2016-01-01
New studies have been published and aimed to retract canines by means of distraction osteogenesis to reduce treatment time. Although a great care has been given to achieve a bodily movement of the canines, a significant amount of tipping of the canines has been observed. This trial aimed to assess the effect of applying a modified distractor on canine angulation. The sample of the study consisted of 14 canines in seven patients (16-25 years). After the osteotomy procedure, two distractors were applied (one distractor on each side). After 5 days of a latency period, the two distractors were activated at a rate of 1 mm/day. There was a significant difference between the two distractors regarding the time required to retract the canines (p = 0.008) and the observed change in canine angulation following retraction (p = 0.028). The change in the overjet and the mandibular plane angle was statistically insignificant. Eight out of 14 distracted canines reacted positively to the pulp vitality tester after 3 months of completion of distraction. There was no clinical sign of discoloration or pulpal pain in any canine. Within the limits of this study, the modified distractor caused a bodily movement of the canine with a minimal tipping. Further research is required on a long-term basis on a larger group of patients to gain more insight on the observed changes.
PREOVULATORY FOLLICLE DEVELOPMENT IN HIGH YIELDING COWS
Directory of Open Access Journals (Sweden)
Radovan Tomášek
2013-06-01
Full Text Available The aim of the study was to examine the development of preovulatory follicles in pregnant and non-pregnant high yielding cows. The treatment by supergestran and oestrophan was used to synchronize the estrous cycle. Ovaries were monitored by transrectal ultrasonography. The linear increase of preovulatory follicles was observed in pregnant (P < 0,001 and non-pregnant (P < 0,001 cows during 8 days before ovulation. In conclusion, preovulatory follicles in pregnant and non-pregnant high yielding cows developed similarly.
Platelets Inhibit Migration of Canine Osteosarcoma Cells.
Bulla, S C; Badial, P R; Silva, R C; Lunsford, K; Bulla, C
2017-01-01
The interaction between platelets and tumour cells is important for tumour growth and metastasis. Thrombocytopenia or antiplatelet treatment negatively impact on cancer metastasis, demonstrating potentially important roles for platelets in tumour progression. To our knowledge, there is no information regarding the role of platelets in cancer progression in dogs. This study was designed to test whether canine platelets affected the migratory behaviour of three canine osteosarcoma cell lines and to give insights of molecular mechanisms. Intact platelets, platelet lysate and platelet releasate inhibited the migration of canine osteosarcoma cell lines. Addition of blood leucocytes to the platelet samples did not alter the inhibitory effect on migration. Platelet treatment also significantly downregulated the transcriptional levels of SNAI2 and TWIST1 genes. The interaction between canine platelets or molecules released during platelet activation and these tumour cell lines inhibits their migration, which suggests that canine platelets might antagonize metastasis of canine osteosarcoma. This effect is probably due to, at least in part, downregulation of genes related to epithelial-mesenchymal transition. Copyright © 2016. Published by Elsevier Ltd.
High-biomass C4 grasses-Filling the yield gap.
Mullet, John E
2017-08-01
A significant increase in agricultural productivity will be required by 2050 to meet the needs of an expanding and rapidly developing world population, without allocating more land and water resources to agriculture, and despite slowing rates of grain yield improvement. This review examines the proposition that high-biomass C 4 grasses could help fill the yield gap. High-biomass C 4 grasses exhibit high yield due to C 4 photosynthesis, long growth duration, and efficient capture and utilization of light, water, and nutrients. These C 4 grasses exhibit high levels of drought tolerance during their long vegetative growth phase ideal for crops grown in water-limited regions of agricultural production. The stems of some high-biomass C 4 grasses can accumulate high levels of non-structural carbohydrates that could be engineered to enhance biomass yield and utility as feedstocks for animals and biofuels production. The regulatory pathway that delays flowering of high-biomass C 4 grasses in long days has been elucidated enabling production and deployment of hybrids. Crop and landscape-scale modeling predict that utilization of high-biomass C 4 grass crops on land and in regions where water resources limit grain crop yield could increase agricultural productivity. Copyright © 2017 Elsevier B.V. All rights reserved.
Influence of feeding on serum canine pancreatic lipase immunoreactivity concentrations
Directory of Open Access Journals (Sweden)
Steiner JM
2014-10-01
Full Text Available Jörg M Steiner, Craig G Ruaux, David A Williams Gastrointestinal Laboratory, College of Veterinary Medicine and Biomedical Sciences, Texas A&M University, College Station, TX, USA Abstract: Measurement of serum concentration of pancreatic lipase immunoreactivity (PLI has been shown to be highly specific for exocrine pancreatic function and sensitive for the diagnosis of canine pancreatitis. Currently, it is recommended that food be withheld for at least 12 hours before collecting a blood sample for analysis from dogs. However, it is unknown whether feeding has any influence on serum canine PLI concentration. Thus, the goal of this study was to evaluate the influence of feeding on serum canine PLI concentrations in healthy dogs. Food was withheld from eight healthy adult Beagle dogs for at least 17 hours and a baseline serum sample (0 minutes was collected. Dogs were fed and serum samples were collected at 15, 30, 45, 60, 75, 90, 105, 150, 180, 210, 240, 300, 360, 420, and 480 minutes. There was no significant difference in serum canine PLI concentrations at any time after feeding (P=0.131. We conclude that feeding has no significant influence on serum canine PLI concentrations. Keywords: dog, pancreatic function, pancreatitis, biomarker, diagnostic test
9 CFR 113.201 - Canine Distemper Vaccine, Killed Virus.
2010-01-01
... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Canine Distemper Vaccine, Killed Virus... REQUIREMENTS Killed Virus Vaccines § 113.201 Canine Distemper Vaccine, Killed Virus. Canine Distemper Vaccine... canine distemper susceptible dogs (20 vaccinates and 5 controls) shall be used as test animals. Blood...
Wang, Xijun; Feng, Na; Ge, Jinying; Shuai, Lei; Peng, Liyan; Gao, Yuwei; Yang, Songtao; Xia, Xianzhu; Bu, Zhigao
2012-07-20
Effective, safe, and affordable rabies vaccines are still being sought. Attenuated live vaccine has been widely used to protect carnivores from canine distemper. In this study, we generated a recombinant canine distemper virus (CDV) vaccine strain, rCDV-RVG, expressing the rabies virus glycoprotein (RVG) by using reverse genetics. The recombinant virus rCDV-RVG retained growth properties similar to those of vector CDV in Vero cell culture. Animal studies demonstrated that rCDV-RVG was safe in mice and dogs. Mice inoculated intracerebrally or intramuscularly with rCDV-RVG showed no apparent signs of disease and developed a strong rabies virus (RABV) neutralizing antibody response, which completely protected mice from challenge with a lethal dose of street virus. Canine studies showed that vaccination with rCDV-RVG induced strong and long-lasting virus neutralizing antibody responses to RABV and CDV. This is the first study demonstrating that recombinant CDV has the potential to serve as bivalent live vaccine against rabies and canine distemper in animals. Copyright © 2012 Elsevier Ltd. All rights reserved.
Extrusion processing : effects on dry canine diets
Tran, Q.D.
2008-01-01
Keywords: Extrusion, Canine diet, Protein, Lysine, Starch gelatinization, Palatability, Drying.
Extrusion cooking is a useful and economical tool for processing animal feed. This high temperature, short time processing technology causes chemical and physical changes that alter the
Canine distemper outbreak in pet store puppies linked to a high-volume dog breeder.
Schumaker, Brant A; Miller, Myrna M; Grosdidier, Paul; Cavender, Jacqueline L; Montgomery, Donald L; Cornish, Todd E; Farr, Robert M; Driscoll, Michael; Maness, Lori J; Gray, Tangney; Petersen, Dana; Brown, William L; Logan, Jim; O'Toole, Donal
2012-11-01
Canine distemper is uncommon in the pet trade in the United States, in large part due to effective vaccines against Canine distemper virus (CDV). This is a report of CDV affecting 24 young dogs of multiple breeds shortly after sale by 2 pet stores in Wyoming during August-October 2010. Cases were diagnosed over 37 days. Diagnosis was established by a combination of fluorescent antibody staining, reverse transcription polymerase chain reaction, negative stain electron microscopy, and necropsy with histopathology. Viral hemagglutinin gene sequences were analyzed from 2 affected dogs and were identical (GenBank accession no. JF283477). Sequences were distinct from those in a contemporaneous unrelated case of CDV in a Wyoming dog (JF283476) that had no contact with the pet store dogs. The breeding property from which the puppies originated was quarantined by the Kansas Animal Health Department. Puppies intended for sale were tested for CDV. Canine distemper was diagnosed on site in November 2010. At that point 1,466 dogs were euthanized to eliminate dispersal of the disease through commercial channels. The investigation underscores the risks inherent in large-scale dog breeding when vaccination and biosecurity practices are suboptimal.
Military Working Dogs and Canine Ehrlichiosis (Tropical Canine Pancytopenia) in the Vietnam War
1981-06-05
anemia, dermatitis, edema of the limbs and scrotum, and petechial hemorrhages on the penis (116). Hematologic findings included a leucopenia with...idiopathic hemorrhagic disease, and canine hemorrhagic fever (116). Attempts to identity the cause of tropical canine pancytopenia continued in 1969...Following inoculation with infective blood, signs of acute disease appear within 7-10 days and consfst of fever , serous nasal and ocular discharges
Headley, Selwyn Arlington; Alfieri, Amauri Alcindo; Fritzen, Juliana Torres Tomazi; Garcia, João Luis; Weissenböck, Herbert; da Silva, Ana Paula; Bodnar, Livia; Okano, Werner; Alfieri, Alice Fernandes
2013-01-01
The concomitant infections of Canine distemper virus (CDV), Canine adenovirus A types 1 (CAdV-1) and 2 (CAdV-2), Canine parvovirus type 2 (CPV-2), and Toxoplasma gondii are described in a 43-day-old mixed-breed puppy. Clinically, there were convulsions and blindness with spontaneous death; 14 siblings of this puppy, born to a 10-month-old dam, which was seropositive (titer: 1,024) for T. gondii, also died. Necropsy revealed unilateral corneal edema (blue eye), depletion of intestinal lymphoid tissue, non-collapsible lungs, congestion of meningeal vessels, and a pale area in the myocardium. Histopathology demonstrated necrotizing myocarditis associated with intralesional apicomplexan protozoa; necrotizing and chronic hepatitis associated with rare intranuclear inclusion bodies within hepatocytes; necrotizing bronchitis and bronchiolitis; interstitial pneumonia associated with eosinophilic intracytoplasmic inclusion bodies within epithelial cells; atrophy and fusion of intestinal villi with cryptal necrosis; and white matter demyelination of the cerebrum and cerebellum associated with intranuclear inclusion bodies within astrocytes. Polymerase chain reaction (PCR) amplified the partial fragments (bp) of the CDV N gene (290 bp), CPV-2c VP2 capsid protein gene (583 bp), and CAdV-1 (508 bp) and CAdV-2 (1,030 bp) E gene from urine and tissue samples. The PCR assays demonstrated that the apicomplexan protozoa observed within several organs contained DNA specific for T. gondii; genotyping revealed T. gondii type III. The findings support the characterization of concomitant infections of CDV, CAdV-1, CAdV-2, CPV-2, and T. gondii in this puppy. Further, seroreactivity to T. gondii of the dam in association with the systemic disease observed in the puppy described herein is suggestive of congenital toxoplasmosis.
Scerri, Erica Sultana; McDonald, Fraser; Camilleri, Simon
2016-02-01
To compare the developmental dental anomalies associated with maxillary canine-first premolar (MxCP1) transposition and those of palatally displaced canine (PDC) with each other and with the background prevalence in the Maltese population in order to elucidate whether the two conditions have similar or differing genetic backgrounds. Dental records of 477 subjects with PDC, 57 subjects with MxCP1, and a control group of 500 subjects with no history of a PDC or tooth transposition were compared for canine eruption anomalies and hypodontia. A high frequency of bilateral occurrence was present for both canine malpositions and when unilateral, a trend to right-sided occurrence was evident. The occurrence of transpositions in the PDC group and of PDC in the MxCP1 group was higher than expected. The prevalence of incisor hypodontia was significantly higher in subjects with PDC and MxCP1, as compared to the control group. The size of the MxCP1 group is relatively small. The study population is a small isolated Caucasian population and the results may not be applicable to other populations. There is no significant difference between the MxCP1 and PDC groups in the prevalence or distribution of hypodontia and each of these groups exhibits a higher prevalence of the other canine anomaly. These findings support the theory that PDC and MxCP1 form part of a group of interrelated dental anomalies that share a common genetic basis. © The Author 2015. Published by Oxford University Press on behalf of the European Orthodontic Society. All rights reserved. For permissions, please email: journals.permissions@oup.com.
Cellular and Phenotypic Characterization of Canine Osteosarcoma Cell Lines
Directory of Open Access Journals (Sweden)
Marie E. Legare, Jamie Bush, Amanda K. Ashley, Taka Kato, William H. Hanneman
2011-01-01
Full Text Available Canine and human osteosarcoma (OSA have many similarities, with the majority of reported cases occurring in the appendicular skeleton, gender predominance noted, high rate of metastasis at the time of presentation, and a lack of known etiology for this devastating disease. Due to poor understanding of the molecular mechanisms underlying OSA, we have characterized seven different OSA canine cell lines: Abrams, D17, Grey, Hughes, Ingles, Jarques, and Marisco and compared them to U2, a human OSA cell line, for the following parameters: morphology, growth, contact inhibition, migrational tendencies, alkaline phosphatase staining, heterologous tumor growth, double-strand DNA breaks, and oxidative damage. All results demonstrated the positive characteristics of the Abrams cell line for use in future studies of OSA. Of particular interest, the robust growth of a subcutaneous tumor and rapid pulmonary metastasis of the Abrams cell line in an immunocompromised mouse shows incredible potential for the future use of Abrams as a canine OSA model. Further investigations utilizing a canine cell model of OSA, such as Abrams, will be invaluable to understanding the molecular events underlying OSA, pharmaceutical inhibition of metastasis, and eventual prevention of this devastating disease.
Optimisation of a double-centrifugation method for preparation of canine platelet-rich plasma.
Shin, Hyeok-Soo; Woo, Heung-Myong; Kang, Byung-Jae
2017-06-26
Platelet-rich plasma (PRP) has been expected for regenerative medicine because of its growth factors. However, there is considerable variability in the recovery and yield of platelets and the concentration of growth factors in PRP preparations. The aim of this study was to identify optimal relative centrifugal force and spin time for the preparation of PRP from canine blood using a double-centrifugation tube method. Whole blood samples were collected in citrate blood collection tubes from 12 healthy beagles. For the first centrifugation step, 10 different run conditions were compared to determine which condition produced optimal recovery of platelets. Once the optimal condition was identified, platelet-containing plasma prepared using that condition was subjected to a second centrifugation to pellet platelets. For the second centrifugation, 12 different run conditions were compared to identify the centrifugal force and spin time to produce maximal pellet recovery and concentration increase. Growth factor levels were estimated by using ELISA to measure platelet-derived growth factor-BB (PDGF-BB) concentrations in optimised CaCl 2 -activated platelet fractions. The highest platelet recovery rate and yield were obtained by first centrifuging whole blood at 1000 g for 5 min and then centrifuging the recovered platelet-enriched plasma at 1500 g for 15 min. This protocol recovered 80% of platelets from whole blood and increased platelet concentration six-fold and produced the highest concentration of PDGF-BB in activated fractions. We have described an optimised double-centrifugation tube method for the preparation of PRP from canine blood. This optimised method does not require particularly expensive equipment or high technical ability and can readily be carried out in a veterinary clinical setting.
Directory of Open Access Journals (Sweden)
Catherine A. Blunt
2013-05-01
Full Text Available Successful treatment of canine pyoderma has become compromised owing to the development of antimicrobial resistance with accompanying recurrence of infection. Canine skin samples submitted to a veterinary diagnostic laboratory for microbiological culture and sensitivity between January 2007 and June 2010, from which Staphylococcus intermedius was isolated, were selected for this investigation. Antimicrobial resistance of S. intermedius was most prevalent with reference to ampicillin followed by resistance to tetracycline and then potentiated sulphonamides. In general, antimicrobial resistance was low and very few methicillin-resistant isolates were detected. Temporal trends were not noted, except for ampicillin, with isolates becoming more susceptible, and potentiated sulphonamides (co-trimoxazole, with isolates becoming more resistant. In general, both the Kirby–Bauer disc diffusion and broth dilution minimum inhibitory concentration tests yielded similar results for the antimicrobial agents tested. The main difference was evident in the over-estimation of resistance by the Kirby–Bauer test for ampicillin, co-trimoxazole, penicillin and doxycycline. Knowledge of trends in bacterial resistance is important for veterinarians when presented with canine pyoderma. Analysis of antimicrobial susceptibility profiles of S. intermedius isolated from canine pyodermas will guide veterinarians’ use of the most appropriate agent and encourage prudent use of antimicrobials in companion animals.
DEFF Research Database (Denmark)
Damborg, Peter; Guardabassi, Luca; Pedersen, Karl
2008-01-01
Human (n = 33) and canine (n = 53) Campylobacter upsaliensis isolates from seven countries were genotyped by a new amplified fragment length polymorphism method. We observed 100% typeability and high overall diversity. The majority of human strains (23/33) clustered separately from canine strains...
Replicable Expansion and Differentiation of Neural Precursors from Adult Canine Skin
Directory of Open Access Journals (Sweden)
Thomas Duncan
2017-08-01
Full Text Available Repopulation of brain circuits by neural precursors is a potential therapeutic strategy for neurodegenerative disorders; however, choice of cell is critical. Previously, we introduced a two-step culture system that generates a high yield of neural precursors from small samples of adult canine skin. Here, we probe their gene and protein expression profiles in comparison with dermal fibroblasts and brain-derived neural stem cells and characterize their neuronal potential. To date, we have produced >50 skin-derived neural precursor (SKN lines. SKNs can be cultured in a highly replicable fashion and uniformly express a panel of identifying markers. Upon differentiation, they self-upregulate neural specification genes, generating neurons with basic electrophysiological functionality. This unique population of neural precursors, derived from mature skin, overcomes many of the practical issues that have limited clinical translation of alternative cell types. Easily accessible, neuronally committed, and patient specific, SKNs may have potential for the treatment of brain disorders.
Comparison of canine retraction using single and Siamese edgewise brackets: An in vivo study
Directory of Open Access Journals (Sweden)
Zeeshan Iqbal Bhat
2013-01-01
Full Text Available Objectives: The purpose of this study was to check the rate of canine retraction with bodily mechanics using two different pre-adjusted edgewise bracket Systems. Materials and Methods: A split mouth study with twenty patients who were randomly selected and allotted to a single operator. Duration of canine retraction, angulation of canine during its retraction, degree of Rotation, anchorage Loss, distance between canine and premolar at different time intervals were then evaluated, pre- (To, 3 months- (T1 and canine tip touches the second premolar- (T2. Descriptive statistics including mean values and standard deviations were calculated. Paired and unpaired t-test was performed to evaluate the differences between the groups. Results: Rotation and angulation of the canines did not show significant difference in both the systems. There was statistically significant difference (P<0.01 in anchorage loss between single wing and Siamese bracket being 2.65 ±1.41 mm and 1.31 ± 0.93 respectively. There was statistically significant intergroup difference (P<0.01 in canine movement i.e distance between canine and premolar was recorded as 4.72mm (15.06 ± 1.69 to 10.34 ± 1.68mm in single wing bracket and 6.25mm in Siamese (15.52 ± 1.41 to 9.27 ± 1.94. Conclusion: In cases where high anchorage is required and the rate of canine retraction is a concern, Siamese brackets pose a definite advantage over Single wing brackets.
Directory of Open Access Journals (Sweden)
Mehdi Mohebali
2016-10-01
Full Text Available Background: Although many studies had been conducted on various aspects of canine visceral leishmaniasis (CVL in domestic dogs in the endemic areas of Iran, investigations on CVL in wild canines are rare.Methods: This is a cross-sectional study was conducted from December 2012 to 2013 in northeast of Iran where human VL is endemic. Wild canines were trapped around the areas where human VL cases had been previously identified. Wild canines were collected and examined both clinically and serologically using direct agglutination test (DAT. Microscopically examinations were performed in all the seropositive wild canines for the presence of the amastigote form of Leishmania spp. Some Leishmania sp. which had been isolated from the spleens of wild canines, were examined analyzed by conventional PCR and sequencing techniques using α-tubulin and GAPDH genes.Results: Altogether, 84 wild canines including foxes (Vulpes vulpes, n=21, Jackals (Canis aureus, n=60 and wolves (Canis lupus, n=3 were collected. Four foxes and seven jackals showed anti-Leishmania infantum antibodies with titers of 1:320–1:20480 in DAT. Furthermore, one fox and one jackal were parasitologically (microscopy and culture positive and L. infantum was confirmed by sequence analysis.Conclusion: The present study showed that sylvatic cycle of L. infantum had been established in the studied endemic areas of VL in northeastern Iran.
Clinical and Statistical Study on Canine Impaction
Directory of Open Access Journals (Sweden)
Adina-Simona Coșarcă
2013-08-01
Full Text Available Aim: The aim of this study was to perform a clinical and statistical research on permanent impacted canine patients among those with dental impaction referred to and treated at the Oral and Maxillo-Facial Surgery Clinic of Tîrgu Mureș, over a four years period (2009-2012. Materials and methods: The study included 858 patients having dental impaction, and upon clinical records, different parameters, like frequency, gender, age, quadrant involvement, patient residence, associated complications, referring specialist and type of treatment, related to canine impaction, were assessed. Results: The study revealed: about 10% frequency of canine impaction among dental impactions; more frequent in women, in the first quadrant (tooth 13; most cases diagnosed between the age of 10-19 years; patients under 20 were referred by an orthodontist, those over 20 by a dentist; surgical exposure was more often performed than odontectomy. Conclusions: Canine impaction is the second-most frequent dental impaction in dental arch after third molars; it occurs especially in women. Due to its important role, canine recovery within dental arch is a goal to be achieved, whenever possible. Therefore, diagnose and treatment of canine impaction requires an interdisciplinary approach (surgical and orthodontic
Sterenczak, Katharina A; Joetzke, Alexa E; Willenbrock, Saskia; Eberle, Nina; Lange, Sandra; Junghanss, Christian; Nolte, Ingo; Bullerdiek, Jörn; Simon, Daniela; Murua Escobar, Hugo
2010-12-01
Canine lymphoma is a commonly occurring, spontaneously developing neoplasia similar to human non-Hodgkin's lymphoma and, thus, is used as a valuable model for human malignancy. HMGB1 and RAGE are strongly associated with tumour progression and vascularisation. Consequently, deregulated RAGE and HMGB1 may play an important role in the mechanisms involved in lymphoma progression. Expression patterns of HMGB1 and RAGE were analysed in 22 canine lymphoma and three canine non-neoplastic control samples via real time PCR and canine beta-glucuronidase gene (GUSB) as endogenous control. HMGB1 was up-regulated in the neoplastic samples, while RAGE expression remained inconspicuous. This study demonstrated similar mechanisms in lymphoma progression in humans and dogs due to overexpression of HMGB1, which was described in human lymphomas. RAGE remained stable in terms of expression indicating that the extracellular HMGB1-induced effects are regulated by HMGB1 itself.
Podoplanin Expression in Canine Melanoma.
Ogasawara, Satoshi; Honma, Ryusuke; Kaneko, Mika K; Fujii, Yuki; Kagawa, Yumiko; Konnai, Satoru; Kato, Yukinari
2016-12-01
A type I transmembrane protein, podoplanin (PDPN), is expressed in several normal cells such as lymphatic endothelial cells or pulmonary type I alveolar cells. We recently demonstrated that anticanine PDPN monoclonal antibody (mAb), PMab-38, recognizes canine PDPN of squamous cell carcinomas, but does not react with lymphatic endothelial cells. Herein, we investigated whether PMab-38 reacts with canine melanoma. PMab-38 reacted with 90% of melanoma cells (9/10 cases) using immunohistochemistry. Of interest, PMab-38 stained the lymphatic endothelial cells and cancer-associated fibroblasts in melanoma tissues, although it did not stain any lymphatic endothelial cells in normal tissues. PMab-38 could be useful for uncovering the function of PDPN in canine melanomas.
High yielding mutants of blackgram variety 'PH-25'
International Nuclear Information System (INIS)
Misra, R.C.; Mohapatra, B.D.; Panda, B.S.
2001-01-01
Seeds of blackgram (Vigna mungo L.) variety 'PH-5' were treated with chemical mutagens ethyl methanesulfonate (EMS), nitrosoguanidine (NG), maleic hydrazide (MH) and sodium azide (NaN 3 ), each at 3 different concentrations. Thirty six mutant lines developed from mutagenic treatments along with parent varieties were tested in M 4 generation. The mutants showed wide variation in most of the traits and multivariante D 2 analysis showed genetic divergence among themselves. Twenty of the thirty mutants showed genetic divergence from parent. Ten selected high yielding mutants were tested in M 5 . Yield and other productive traits of five high yielding mutants in M 4 and M 5 are presented
Origgi, F C; Plattet, P; Sattler, U; Robert, N; Casaubon, J; Mavrot, F; Pewsner, M; Wu, N; Giovannini, S; Oevermann, A; Stoffel, M H; Gaschen, V; Segner, H; Ryser-Degiorgis, M-P
2012-11-01
An ongoing canine distemper epidemic was first detected in Switzerland in the spring of 2009. Compared to previous local canine distemper outbreaks, it was characterized by unusually high morbidity and mortality, rapid spread over the country, and susceptibility of several wild carnivore species. Here, the authors describe the associated pathologic changes and phylogenetic and biological features of a multiple highly virulent canine distemper virus (CDV) strain detected in and/or isolated from red foxes (Vulpes vulpes), Eurasian badgers (Meles meles), stone (Martes foina) and pine (Martes martes) martens, from a Eurasian lynx (Lynx lynx), and a domestic dog. The main lesions included interstitial to bronchointerstitial pneumonia and meningopolioencephalitis, whereas demyelination--the classic presentation of CDV infection--was observed in few cases only. In the brain lesions, viral inclusions were mainly in the nuclei of the neurons. Some significant differences in brain and lung lesions were observed between foxes and mustelids. Swiss CDV isolates shared together with a Hungarian CDV strain detected in 2004. In vitro analysis of the hemagglutinin protein from one of the Swiss CDV strains revealed functional and structural differences from that of the reference strain A75/17, with the Swiss strain showing increased surface expression and binding efficiency to the signaling lymphocyte activation molecule (SLAM). These features might be part of a novel molecular signature, which might have contributed to an increase in virus pathogenicity, partially explaining the high morbidity and mortality, the rapid spread, and the large host spectrum observed in this outbreak.
Identification of a new genotype of canine distemper virus circulating in America.
Gámiz, César; Martella, Vito; Ulloa, Raúl; Fajardo, Raúl; Quijano-Hernandéz, Israel; Martínez, Simón
2011-08-01
Canine Distemper is a highly contagious viral systemic disease that affects a wide variety of terrestrial carnivores. Canine Distemper virus (CDV) appears genetically heterogeneous, markedly in the hemagglutinin protein (H), showing geographic patterns of diversification that are useful to monitor CDV molecular epidemiology. In Mexico the activity of canine distemper remains high in dogs, likely because vaccine prophylaxis coverage in canine population is under the levels required to control effectively the disease. By phylogenetic analysis based on the nucleoprotein (N) and on the H genes, Mexican CDV strains collected between 2007 and 2010 were distinguished into several genovariants, all which constituted a unique group, clearly distinct from field and vaccine strains circulating worldwide, but resembling a CDV strain, 19876, identified in Missouri, USA, 2004, that was genetically unrelated to other North-American CDV strains. Gathering information on the genetic heterogeneity of CDV on a global scale appears pivotal in order to investigate the origin and modalities of introduction of unusual/novel CDV strains, as well as to understand if vaccine breakthroughs or disease epidemics may be somewhat related to genetic/antigenic or biological differences between field and vaccine strains.
Comazzi, S; Avery, P R; Garden, O A; Riondato, F; Rütgen, B; Vernau, W
2017-09-01
Flow cytometry (FC) is assuming increasing importance in diagnosis in veterinary oncology. The European Canine Lymphoma Network (ECLN) is an international cooperation of different institutions working on canine lymphoma diagnosis and therapy. The ECLN panel of experts on FC has defined the issue of reporting FC on canine lymphoma and leukemia as their first hot topic, since a standardized report that includes all the important information is still lacking in veterinary medicine. The flow cytometry panel of the ECLN started a consensus initiative using the Delphi approach. Clinicians were considered the main target of FC reports. A panel of experts in FC was interrogated about the important information needed from a report. Using the feedback from clinicians and subsequent discussion, a list of information to be included in the report was made, with four different levels of recommendation. The final report should include both a quantitative part and a qualitative or descriptive part with interpretation of the salient results. Other items discussed included the necessity of reporting data regarding the quality of samples, use of absolute numbers of positive cells, cutoff values, the intensity of fluorescence, and possible aberrant patterns of antigen expression useful from a clinical point of view. The consensus initiative is a first step toward standardization of diagnostic approach to canine hematopoietic neoplasms among different institutions and countries. This harmonization will improve communication and patient care and also facilitate the multicenter studies necessary to further our knowledge of canine hematopoietic neoplasms. © 2016 International Clinical Cytometry Society. © 2016 International Clinical Cytometry Society.
Benetka, V; Leschnik, M; Affenzeller, N; Möstl, K
2011-04-09
Austrian field cases of canine distemper (14 dogs, one badger [Meles meles] and one stone marten [Martes foina]) from 2002 to 2007 were investigated and the case histories were summarised briefly. Phylogenetic analysis of fusion (F) and haemagglutinin (H) gene sequences revealed different canine distemper virus (CDV) lineages circulating in Austria. The majority of CDV strains detected from 2002 to 2004 were well embedded in the European lineage. One Austrian canine sample detected in 2003, with a high similarity to Hungarian sequences from 2005 to 2006, could be assigned to the Arctic group (phocine distemper virus type 2-like). The two canine sequences from 2007 formed a clearly distinct group flanked by sequences detected previously in China and the USA on an intermediate position between the European wildlife and the Asia-1 cluster. The Austrian wildlife strains (2006 and 2007) could be assigned to the European wildlife group and were most closely related to, yet clearly different from, the 2007 canine samples. To elucidate the epidemiological role of Austrian wildlife in the transmission of the disease to dogs and vice versa, H protein residues related to receptor and host specificity (residues 530 and 549) were analysed. All samples showed the amino acids expected for their host of origin, with the exception of a canine sequence from 2007, which had an intermediate position between wildlife and canine viral strains. In the period investigated, canine strains circulating in Austria could be assigned to four different lineages reflecting both a high diversity and probably different origins of virus introduction to Austria in different years.
Vaccines for canine leishmaniasis
Directory of Open Access Journals (Sweden)
Clarisa B. Palatnik-De-Sousa
2012-04-01
Full Text Available Leishmaniasis is the third most important vector-borne disease worldwide. Visceral leishmaniasis (VL is a severe and frequently lethal protozoan disease of increasing incidence and severity due to infected human and dog migration, new geographical distribution of the insect due to global-warming, co-infection with immunosuppressive diseases and poverty. The disease is an anthroponosis in India and Central Africa and a canid zoonosis (ZVL in the Americas, the Middle East, Central Asia, China and the Mediterranean. The ZVL epidemic has been controlled by one or more measures including the culling of infected dogs, treatment of human cases and insecticidal treatment of homes and dogs. However, the use of vaccines is considered the most cost-effective control tool for human and canine disease. Since the severity of the disease is related to the generation of T-cell immunosuppression, effective vaccines should be capable of sustaining or enhancing the T-cell immunity. In this review we summarize the clinical and parasitological characteristics of ZVL with special focus on the cellular and humoral canine immune response and review state-of-the-art vaccine development against human and canine visceral leishmaniasis. Experimental vaccination against leishmaniasis has evolved from the practice of leishmanization with living parasites to vaccination with crude lysates, native parasite extracts to recombinant and DNA vaccination. Although more than 30 defined vaccines have been studied in laboratory models no human formulation has been licensed so far; however three second-generation canine vaccines have already been registered. As expected for a zoonotic disease, the recent preventive vaccination of dogs in Brazil has led to a reduction in the incidence of canine and human disease. The recent identification of several Leishmania proteins with T-cell epitopes anticipates development of a multiprotein vaccine that will be capable of protecting both humans
Frequency of cardiac arrhythmias in high and low- yielding dairy cows
Directory of Open Access Journals (Sweden)
Afshin Jafari Dehkordi
2014-06-01
Full Text Available Electrocardiography (ECG may be used to recognize cardiac disorders. Levels of milk production may change the serum electrolytes which its imbalance has a role in cardiac arrhythmia. Fifty high yielding and fifty low yielding Holstein dairy cows were used in this study. Electrocardiography was recorded by base-apex lead and blood samples were collected from jugular vein for measurement of serum elements such as sodium, potassium, calcium, phosphorous, iron and magnesium. Cardiac dysrhythmias were detected more frequent in low yielding Holstein cows (62.00% compared to high yielding Holstein cows (46.00%. The cardiac dysrhythmias that were observed in low yielding Holstein cows included sinus arrhythmia (34.70%, wandering pacemaker (22.45 %, bradycardia (18.37%, tachycardia (10.20%, atrial premature beat (2.04%, sinoatrial block (2.04%, atrial fibrillation (8.16% and atrial tachycardia (2.04%. The cardiac dysrhythmias were observed in high yielding Holstein cows including, sinus arrhythmia (86.95% and wandering pacemaker (13.05%. Also, notched P wave was observed to be 30% and 14% in high- and low- yielding Holstein cows respectively. The serum calcium concentration of low yielding Holstein cows was significantly lower than that of high yielding Holstein cows. There was not any detectable significant difference in other serum elements between high- and low- yielding Holstein cows. Based on the result of present study, could be concluded that low serum concentration of calcium results to more frequent dysrhythmias in low yielding Holstein cows.
Canine adenovirus type 1 in a fennec fox (Vulpes zerda).
Choi, Jeong-Won; Lee, Hyun-Kyoung; Kim, Seong-Hee; Kim, Yeon-Hee; Lee, Kyoung-Ki; Lee, Myoung-Heon; Oem, Jae-Ku
2014-12-01
A 10-mo-old female fennec fox (Vulpes zerda) with drooling suddenly died and was examined postmortem. Histologic examination of different tissue samples was performed. Vacuolar degeneration and diffuse fatty change were observed in the liver. Several diagnostic methods were used to screen for canine parvovirus, canine distemper virus, canine influenza virus, canine coronavirus, canine parainfluenza virus, and canine adenovirus (CAdV). Only CAdV type 1 (CAdV-1) was detected in several organs (liver, lung, brain, kidney, spleen, and heart), and other viruses were not found. CAdV-1 was confirmed by virus isolation and nucleotide sequencing.
Development of high yielding mutants in lentil
International Nuclear Information System (INIS)
Rajput, M.A.; Sarwar, G.; Siddiqui, K.A.
2001-01-01
Full text: Lentil (Lens culinaris Medik.) locally known as Masoor, is the second most important rabi pulse crop, after chickpea, in Pakistan. It is cultivated on an area of over 63,400 ha, which constitutes about 4.83% of the total area under pulses. The annual production of the crop is 28,200 tones with an average yield of 445 kg/ha. Yield at the national level is very low, about one-half of the world's yield, which is mainly due to non-availability of high yield potential genotypes. Keeping in view the importance of mutants in developing a large number of new varieties, an induced mutations programme was initiated at AEARC, Tandojam during 1987-88, to develop high yielding varieties in lentil. For this, seeds of two lentil varieties, 'Masoor-85' and 'ICARDA-8' had been irradiated with gamma-rays ranging from 100-600 Gy in NIAB, Faisalabad during 1990. Selections were made in M2 on the basis of earliness, plant height, branches/plant and 100 grain weight. After confirming these mutants in M3 they were promoted in station yield trials and studied continuously for three consecutive years (1993- 1995). Overall results revealed that these mutants have consistent improvement of earliness in flowering and maturity. Plant height also increased in all mutant lines except AEL 23/40/91 where reduction in this attribute was observed as compared to parent variety. Mutant lines AEL 49/20/91 and AEL 13/30/91 showed improvement in 100 grain weight. The improvement of some agronomic characters enhanced the yield of mutant lines in comparison to parent varieties (Masoor-85 and ICARDA-8). The diversity in yield over the respective parents was computed from 6.94 to 60.12%. From these encouraging results it is hoped that mutant lines like AEL 12/30/91 and AEL 49/20/91 may serve as potential lentil genotypes in future. (author)
Noguchi, S; Mori, T; Hoshino, Y; Yamada, N; Maruo, K; Akao, Y
2013-06-01
Malignant melanoma (MM) is one of the most aggressive cancers in dogs and in humans. However, the molecular mechanisms of its development and progression remain unclear. Presently, we examined the expression profile of microRNAs (miRs) in canine oral MM tissues and paired normal oral mucosa tissues by using the microRNA-microarray assay and quantitative RT-PCR. Importantly, a decreased expression of miR-203 was significantly associated with a shorter survival time. Also, miR-203 and -205 were markedly down-regulated in canine and human MM cell lines tested. Furthermore, the ectopic expression of miR-205 had a significant inhibitory effect on the cell growth of canine and human melanoma cells tested by targeting erbb3. Our data suggest that miR-203 is a new prognostic factor in canine oral MMs and that miR-205 functions as a tumour suppressor by targeting erbb3 in both canine and human MM cells. © 2011 John Wiley & Sons Ltd.
Enzyme-linked immunosorbent Assay for detecting of antibody to canine distemper virus
Directory of Open Access Journals (Sweden)
Sudarisman
2006-03-01
Full Text Available Serum neutralisation test (SNT has been established for evaluating canine distemper vaccination, but until now SNT was rarely used due to the need for continuous tissue culture facilities and requires 3 days to perform. For detecting antibody to canine distemper virus, an enzyme-linked immunosorbent assay (ELISA is relatively simple and rapid seroassay. ELISA for canine immunoglobulin (Ig G antibodies to canine distemper virus (CDV was developed by using Onderstepoort strain of canine distemper virus as coating antigen. Rabbit anti canine IgG labelled with horse radish peroxidase was used as the conjugate, while phenylenediamine dihydrochloride (OPD was used as the substrate. The ELISA results were then compared with the results of the SNT, using the sera of 312 random-source dogs from West Java. The two test-results had a high degree of correlation. Very few discrepancies occurred and most of these were at the lower limits of each test. When the sera were tested at 1 : 100 dilutions, there was a 95.5% agreement between the ELISA and SNT. Their sensitivity and spesificity were 83.9 and 98.4%. Titrated SNT and ELISA also were performed on sera from 7 dogs whose lifetime medical histories were known. The antibodies were inclining up after two months of post vaccination, where the titre was not in zero/lower position at the day of vaccination. However, antibody zero or low position were found at 28 days post vaccination. All of the results indicated that ELISA can be used for evaluating antibody to canine distemper virus response, replacing the SNT.
Directory of Open Access Journals (Sweden)
Hang Ingrid
2012-06-01
Full Text Available Abstract Background Considerable evidence suggests that food impacts both the gastro-intestinal (GI function and the microbial ecology of the canine GI tract. The aim of this study was to evaluate the influence of high-carbohydrate (HC, high-protein (HP and dry commercial (DC diets on the canine colonic microbiota in Beagle dogs. Diets were allocated according to the Graeco-Latin square design. For this purpose, microbial DNA was isolated from faecal samples and separated by density gradient centrifugation, resulting in specific profiling based on the guanine-cytosine content (%G + C. In addition, 16 S rRNA gene amplicons were obtained from the most abundant %G + C peaks and analysed by sequence analysis, producing a total of 720 non-redundant sequences (240 sequences per diet. Results The DC diet sample showed high abundance of representatives of the orders Clostridiales, Lactobacillales, Coriobacteriales and Bacteroidales. Sequence diversity was highest for DC diet samples and included representatives of the orders Lactobacillales and Bacteroidales, which were not detected in samples from the HP and HC diets. These latter two diets also had reduced levels of representatives of the family Lachnospiraceae, specifically Clostridial cluster XIVa. The HC diet favoured representatives of the order Erysipelotrichales, more specifically the Clostridial cluster XVIII, while the HP diet favoured representatives of the order Fusobacteriales. Conclusions This study detected Coriobacteriales in dog faeces, possibly due to the non-selective nature of the %G + C profiling method used in combination with sequencing. Moreover, our work demonstrates that the effect of diet on faecal microbiota can be explained based on the metabolic properties of the detected microbial taxa.
Epidemiology of canine gastrointestinal helminths in sub-Saharan Africa
Directory of Open Access Journals (Sweden)
Nozyechi Ngulube Chidumayo
2018-02-01
Full Text Available Abstract Background Dogs have a close association with humans providing companionship, security and a source of dietary protein. However, dogs are also potential carriers of zoonotic pathogens. Dogs, therefore, pose a public health risk and a good understanding of canine diseases is important for planning and implementing control measures. The aim of this study was to characterise canine helminthiasis in sub-Saharan Africa using a systematic approach. Methods Pubmed and Google Scholar were searched for relevant primary studies published from 2000. Forty-one eligible studies were included in the meta-analysis. Pooled prevalences were estimated using the quality effects model. Results and conclusions Twenty-six genera of enteric helminths were reported and the pooled estimate of canine helminthiasis was 71% (95% CI: 63–79%. Species of Ancylostoma and Toxocara, causative agents of larva migrans in humans, were the most frequently reported helminths with pooled estimated prevalences of 41% (95% CI: 32–50% and 22% (95% CI: 16–29%, respectively. Dipylidium caninum and Taenia spp. were the most frequently reported cestodes with pooled estimated prevalences of 20% (95% CI: 12–29% and 9% (95% CI: 5–15%, respectively. Trematodes were rarely reported. There was a high level of heterogeneity in most pooled estimates (I2 ˃ 80%. The results of this study show that canine helminthiasis is highly prevalent in sub-Saharan Africa and there is need for regular deworming programmes to improve the health status of the dogs and minimise the potential health risk to humans.
Castanheira, Pedro; Duarte, Ana; Gil, Solange; Cartaxeiro, Clara; Malta, Manuel; Vieira, Sara; Tavares, Luis
2014-04-23
Infections caused by canine parvovirus, canine distemper virus and canine coronavirus are an important cause of mortality and morbidity in dogs worldwide. Prior to this study, no information was available concerning the incidence and prevalence of these viruses in Cape Verde archipelago. To provide information regarding the health status of the canine population in Vila do Maio, Maio Island, Cape Verde, 53 rectal swabs were collected from 53 stray dogs during 2010 and 93 rectal swabs and 88 blood samples were collected from 125 stray dogs in 2011. All rectal swabs (2010 n = 53; 2011 n = 93) were analysed for the presence of canine parvovirus, canine distemper virus and canine coronavirus nucleic acids by quantitative PCR methods. Specific antibodies against canine distemper virus and canine parvovirus were also assessed (2011 n = 88).From the 2010 sampling, 43.3% (23/53) were positive for canine parvovirus DNA, 11.3% (6/53) for canine distemper virus RNA and 1.9% (1/53) for canine coronavirus RNA. In 2011, the prevalence values for canine parvovirus and canine coronavirus were quite similar to those from the previous year, respectively 44.1% (41/93), and 1.1% (1/93), but canine distemper virus was not detected in any of the samples analysed (0%, 0/93). Antibodies against canine parvovirus were detected in 71.6% (63/88) blood samples and the seroprevalence found for canine distemper virus was 51.1% (45/88). This study discloses the data obtained in a molecular and serological epidemiological surveillance carried out in urban populations of stray and domestic animals. Virus transmission and spreading occurs easily in large dog populations leading to high mortality rates particularly in unvaccinated susceptible animals. In addition, these animals can act as disease reservoirs for wild animal populations by occasional contact. Identification of susceptible wildlife of Maio Island is of upmost importance to evaluate the risk of pathogen spill over from
DEFF Research Database (Denmark)
Martella, V.; Cirone, F.; Elia, G.
2006-01-01
Canine distemper virus (CDV) is a highly contagious viral pathogen causing lethal disease in dogs and other mammalians. A high degree of genetic variation is found between recent CDV strains and the old CDV isolates used in the vaccines and such genetic variation is regarded as a possible cause....... These results suggest that at least three different CDV lineages are present in Italy. Keywords: Canine distemper virus; Dogs; Lineages; H gene...
Racette, Molly; Al saleh, Habib; Waller, Kenneth R; Bleedorn, Jason A; McCabe, Ronald P; Vanderby, Ray; Markel, Mark D; Brounts, Sabrina H; Block, Walter F; Muir, Peter
2016-03-01
Estimation of cranial cruciate ligament (CrCL) structural properties in client-owned dogs with incipient cruciate rupture would be advantageous. The objective of this study was to determine whether magnetic resonance imaging (MRI) measurement of normal CrCL volume in an ex-vivo canine model predicts structural properties. Stifles from eight dogs underwent 3.0 Tesla 3D MRI. CrCL volume and normalized median grayscale values were determined using 3D Fast Spin Echo (FSE) Cube and Vastly under-sampled Isotropic PRojection (VIPR)-alternative repetition time (aTR) sequences. Stifles were then mechanically tested. After joint laxity testing, CrCL structural properties were determined, including displacement at yield, yield load, load to failure, and stiffness. Yield load and load to failure (R(2)=0.56, P 0.57, P <0.005). In conclusion, 3D MRI offers a predictive method for estimating canine CrCL structural properties. 3D MRI may be useful for monitoring CrCL properties in clinical trials. Copyright © 2016 Elsevier Ltd. All rights reserved.
Willow yield is highly dependent on clone and site
DEFF Research Database (Denmark)
Ugilt Larsen, Søren; Jørgensen, Uffe; Lærke, Poul Erik
2014-01-01
Use of high-yielding genotypes is one of the means to achieve high yield and profitability in willow (Salix spp.) short rotation coppice. This study investigated the performance of eight willow clones (Inger, Klara, Linnea, Resolution, Stina, Terra Nova, Tora, Tordis) on five Danish sites......, differing considerably in soil type, climatic conditions and management. Compared to the best clone, the yield was up to 36 % lower for other clones across sites and up to 51 % lower within sites. Tordis was superior to other clones with dry matter yields between 5.2 and 10.2 Mg ha−1 year−1 during the first...... 3-year harvest rotation, and it consistently ranked as the highest yielding clone on four of the five sites and not significantly lower than the highest yielding clone on the fifth site. The ranking of the other clones was more dependent on site with significant interaction between clone and site...
Effects of aurothiomalate treatment on canine osteosarcoma in a murine xenograft model.
Scharf, Valery F; Farese, James P; Siemann, Dietmar W; Abbott, Jeffrey R; Kiupel, Matti; Salute, Marc E; Milner, Rowan J
2014-03-01
Osteosarcoma is a highly fatal cancer, with most patients ultimately succumbing to metastatic disease. The purpose of this study was to evaluate the effects of the antirheumatoid drug aurothiomalate on canine and human osteosarcoma cells and on canine osteosarcoma growth and metastasis in a mouse xenograft model. We hypothesized that aurothiomalate would decrease osteosarcoma cell survival, tumor cellular proliferation, tumor growth, and metastasis. After performing clonogenic assays, aurothiomalate or a placebo was administered to 54 mice inoculated with canine osteosarcoma. Survival, tumor growth, embolization, metastasis, histopathology, cell proliferation marker Ki67, and apoptosis marker caspase-3 were compared between groups. Statistical analysis was carried out using the Kaplan-Meier method with the log-rank test and one-way analysis of variance with the Tukey's test or Dunn's method. Aurothiomalate caused dose-dependent inhibition of osteosarcoma cell survival (Posteosarcoma cell survival and reduced tumor cell proliferation, growth, embolization, and pulmonary metastasis. Given aurothiomalate's established utility in canine and human medicine, our results suggest that this compound may hold promise as an adjunctive therapy for osteosarcoma. Further translational research is warranted to better characterize the dose response of canine and human osteosarcoma to aurothiomalate.
The anti-canine distemper virus activities of ex vivo-expanded canine natural killer cells.
Park, Ji-Yun; Shin, Dong-Jun; Lee, Soo-Hyeon; Lee, Je-Jung; Suh, Guk-Hyun; Cho, Duck; Kim, Sang-Ki
2015-04-17
Natural killer (NK) cells play critical roles in induction of antiviral effects against various viruses of humans and animals. However, few data on NK cell activities during canine distemper virus (CDV) infections are available. Recently, we established a culture system allowing activation and expansion of canine non-B, non-T, large granular NK lymphocytes from PBMCs of normal dogs. In the present study, we explored the ability of such expanded NK cells to inhibit CDV infection in vitro. Cultured CD3-CD5-CD21- NK cells produced large amounts of IFN-γ, exhibited highly upregulated expression of mRNAs encoding NK-cell-associated receptors, and demonstrated strong natural killing activity against canine tumor cells. Although the expanded NK cells were dose-dependently cytotoxic to both normal and CDV-infected Vero cells, CDV infection rendered Vero cells more susceptible to NK cells. Pretreatment with anti-CDV serum from hyperimmunized dogs enhanced the antibody-dependent cellular cytotoxicity (ADCC) of NK cells against CDV-infected Vero cells. The culture supernatants of NK cells, added before or after infection, dose-dependently inhibited both CDV replication and development of CDV-induced cytopathic effects (CPEs) in Vero cells. Anti-IFN-γ antibody neutralized the inhibitory effects of NK cell culture supernatants on CDV replication and CPE induction in Vero cells. Such results emphasize the potential significance of NK cells in controlling CDV infection, and indicate that NK cells may play roles both during CDV infection and in combating such infections, under certain conditions. Copyright © 2015 Elsevier B.V. All rights reserved.
Dimethylformamide as a cryoprotectant for canine semen diluted and frozen in ACP-106C.
Mota Filho, A C; Teles, C H A; Jucá, R P; Cardoso, J F S; Uchoa, D C; Campello, C C; Silva, A R; Silva, L D M
2011-10-15
The objective was to assess the effect of adding various concentrations of dimethylformamide on characteristics of canine semen diluted in powdered coconut water (ACP-106C; ACP Biotecnologia, Fortaleza, CE, Brazil) and frozen at -196°C. Fifteen ejaculates were collected by manual stimulation from five adult Boxer dogs. The sperm-rich fraction was diluted in ACP-106C (ACP Biotecnologia) containing 10% egg yolk and divided into four aliquots. The cryoprotectants used for each aliquot were 6% glycerol (control group; CG) or 2%, 4%, or 6% dimethylformamide (DF2, DF4, and DF6, respectively). After thawing, total motility (mean ± SEM) for CG (58.4 ± 24.6) was higher (P Biotecnologia) and 10% egg yolk as a diluent, yielded unsatisfactory in vitro results for freezing canine semen. Copyright © 2011 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Ana Gracanin
Full Text Available Pet dogs very frequently develop spontaneous mammary tumors and have been suggested as a good model organism for breast cancer research. In order to obtain an insight into underlying signaling mechanisms during canine mammary tumorigenesis, in this study we assessed the incidence and the mechanism of canonical Wnt activation in a panel of 12 canine mammary tumor cell lines. We show that a subset of canine mammary cell lines exhibit a moderate canonical Wnt activity that is dependent on Wnt ligands, similar to what has been described in human breast cancer cell lines. In addition, three of the tested canine mammary cell lines have a high canonical Wnt activity that is not responsive to inhibitors of Wnt ligand secretion. Tumor cell lines with highly active canonical Wnt signaling often carry mutations in key members of the Wnt signaling cascade. These cell lines, however, carry no mutations in the coding regions of intracellular Wnt pathway components (APC, β-catenin, GSK3β, CK1α and Axin1 and have a functional β-catenin destruction complex. Interestingly, however, the cell lines with high canonical Wnt activity specifically overexpress LEF1 mRNA and the knock-down of LEF1 significantly inhibits TCF-reporter activity. In addition, LEF1 is overexpressed in a subset of canine mammary carcinomas, implicating LEF1 in ligand-independent activation of canonical Wnt signaling in canine mammary tumors. We conclude that canonical Wnt activation may be a frequent event in canine mammary tumors both through Wnt ligand-dependent and novel ligand-independent mechanisms.
Directory of Open Access Journals (Sweden)
Deli Liu
2015-06-01
Full Text Available Spontaneous canine head and neck squamous cell carcinoma (HNSCC represents an excellent model of human HNSCC but is greatly understudied. To better understand and utilize this valuable resource, we performed a pilot study that represents its first genome-wide characterization by investigating 12 canine HNSCC cases, of which 9 are oral, via high density array comparative genomic hybridization and RNA-seq. The analyses reveal that these canine cancers recapitulate many molecular features of human HNSCC. These include analogous genomic copy number abnormality landscapes and sequence mutation patterns, recurrent alteration of known HNSCC genes and pathways (e.g., cell cycle, PI3K/AKT signaling, and comparably extensive heterogeneity. Amplification or overexpression of protein kinase genes, matrix metalloproteinase genes, and epithelial-mesenchymal transition genes TWIST1 and SNAI1 are also prominent in these canine tumors. This pilot study, along with a rapidly growing body of literature on canine cancer, reemphasizes the potential value of spontaneous canine cancers in HNSCC basic and translational research.
Surgical Procedures and Clinical Considerations for Impacted Canines: A Literature Review
Directory of Open Access Journals (Sweden)
Parviz Torkzaban
2016-09-01
Full Text Available Impaction of canine teeth is a clinical problem whose treatment usually requires an interdisciplinary approach. After the maxillary third molar, the maxillary canine is the second-most commonly impacted tooth, with an incidence of 1% - 2.5%. Maxillary canines are more common in females than males. This study reviews the surgical treatments and orthodontic considerations for impacted canines exposure reported in previous studies. The clinician should be aware of variations in the surgical management of labially and palatally impacted canines, as well as the most common methods of canine in orthodontic application, and the implications of canine extraction. The different factors that affect these decisions are discussed.
9 CFR 113.214 - Parvovirus Vaccine, Killed Virus (Canine).
2010-01-01
... REQUIREMENTS Killed Virus Vaccines § 113.214 Parvovirus Vaccine, Killed Virus (Canine). Parvovirus Vaccine... antibody against canine parvovirus to determine susceptibility. A constant virus-varying serum... vaccinates and the controls shall be challenged with virulent canine parvovirus furnished or approved by...
Orthodontic Traction of Impacted Canine Using Cantilever
Directory of Open Access Journals (Sweden)
Cláudia Nakandakari
2016-01-01
Full Text Available The impaction of the maxillary canines causes relevant aesthetic and functional problems. The multidisciplinary approach to the proper planning and execution of orthodontic traction of the element in question is essential. Many strategies are cited in the literature; among them is the good biomechanical control in order to avoid possible side effects. The aim of this paper is to present a case report in which a superior canine impacted by palatine was pulled out with the aid of the cantilever on the Segmented Arch Technique (SAT concept. A 14.7-year-old female patient appeared at clinic complaining about the absence of the upper right permanent canine. The proposed treatment prioritized the traction of the upper right canine without changing the occlusion and aesthetics. For this, it only installed the upper fixed appliance (Roth with slot 0.018, opting for SAT in order to minimize unwanted side effects. The use of cantilever to the traction of the upper right canine has enabled an efficient and predictable outcome, because it is of statically determined mechanics.
Transmigration of mandibular canine – case report
International Nuclear Information System (INIS)
Gruszka, Katarzyna; Różyło, T. Katarzyna; Różyło-Kalinowska, Ingrid; Denkiewicz, Katarzyna; Masłowska, Klaudia
2014-01-01
Transmigration is a phenomenon of movement of an unerupted tooth in the bone across the midline. This anomaly is not often found. Transmigration is more prevalent in females than in males, and more often encountered in the mandible than maxilla, it affects mostly canines. The aim of this study was to present a case report of a mandibular canine transmigration in a patient aged 12. Intraoral examination determined hypodontia of right second premolar and delayed eruption of left second premolar in maxilla, as well as persistent deciduous teeth: right second molar, left canine and second molar. The patient was referred for a Cone-Beam CT examination, which allowed precise visualization of the transmigrating canine as well as ruled out resorption of roots of mandibular incisors. The treatment with a maxillary fixed orthodontic appliance was finished after obtaining a satisfactory result. Proper alignment of the incisors in the anterior-posterior plane and correct midline position were accepted by the patient. Transmigrating canine after consultation with the surgeon was designed to further radiological observation
European surveillance of emerging pathogens associated with canine infectious respiratory disease.
Mitchell, Judy A; Cardwell, Jacqueline M; Leach, Heather; Walker, Caray A; Le Poder, Sophie; Decaro, Nicola; Rusvai, Miklos; Egberink, Herman; Rottier, Peter; Fernandez, Mireia; Fragkiadaki, Eirini; Shields, Shelly; Brownlie, Joe
2017-12-01
Canine infectious respiratory disease (CIRD) is a major cause of morbidity in dogs worldwide, and is associated with a number of new and emerging pathogens. In a large multi-centre European study the prevalences of four key emerging CIRD pathogens; canine respiratory coronavirus (CRCoV), canine pneumovirus (CnPnV), influenza A, and Mycoplasma cynos (M. cynos); were estimated, and risk factors for exposure, infection and clinical disease were investigated. CIRD affected 66% (381/572) of the dogs studied, including both pet and kennelled dogs. Disease occurrence and severity were significantly reduced in dogs vaccinated against classic CIRD agents, canine distemper virus (CDV), canine adenovirus 2 (CAV-2) and canine parainfluenza virus (CPIV), but substantial proportions (65.7%; 201/306) of vaccinated dogs remained affected. CRCoV and CnPnV were highly prevalent across the different dog populations, with overall seropositivity and detection rates of 47% and 7.7% for CRCoV, and 41.7% and 23.4% for CnPnV, respectively, and their presence was associated with increased occurrence and severity of clinical disease. Antibodies to CRCoV had a protective effect against CRCoV infection and more severe clinical signs of CIRD but antibodies to CnPnV did not. Involvement of M. cynos and influenza A in CIRD was less apparent. Despite 45% of dogs being seropositive for M. cynos, only 0.9% were PCR positive for M. cynos. Only 2.7% of dogs were seropositive for Influenza A, and none were positive by PCR. Copyright © 2017 Elsevier B.V. All rights reserved.
Canine Parvovirus: Current Perspective
Nandi, S.; Kumar, Manoj
2010-01-01
Canine parvovirus 2 (CPV-2) has been considered to be an important pathogen of domestic and wild canids and has spread worldwide since its emergence in 1978. It has been reported from Asia, Australia, New Zealand, the Americas and Europe. Two distinct parvoviruses are now known to infect dogs—the pathogenic CPV-2 and CPV-1 or the minute virus of canine (MVC). CPV-2, the causative agent of acute hemorrhagic enteritis and myocarditis in dogs, is one of the most important pathogenic viruses with...
Approaches to achieve high grain yield and high resource use efficiency in rice
Directory of Open Access Journals (Sweden)
Jianchang YANG
2015-06-01
Full Text Available This article discusses approaches to simultaneously increase grain yield and resource use efficiency in rice. Breeding nitrogen efficient cultivars without sacrificing rice yield potential, improving grain fill in later-flowering inferior spikelets and enhancing harvest index are three important approaches to achieving the dual goal of high grain yield and high resource use efficiency. Deeper root distribution and higher leaf photosynthetic N use efficiency at lower N rates could be used as selection criteria to develop N-efficient cultivars. Enhancing sink activity through increasing sugar-spikelet ratio at the heading time and enhancing the conversion efficiency from sucrose to starch though increasing the ratio of abscisic acid to ethylene in grains during grain fill could effectively improve grain fill in inferior spikelets. Several practices, such as post-anthesis controlled soil drying, an alternate wetting and moderate soil drying regime during the whole growing season, and non-flooded straw mulching cultivation, could substantially increase grain yield and water use efficiency, mainly via enhanced remobilization of stored carbon from vegetative tissues to grains and improved harvest index. Further research is needed to understand synergistic interaction between water and N on crop and soil and the mechanism underlying high resource use efficiency in high-yielding rice.
Evaluation of P16 expression in canine appendicular osteosarcoma.
Murphy, B G; Mok, M Y; York, D; Rebhun, R; Woolard, K D; Hillman, C; Dickinson, P; Skorupski, K
2017-06-20
Osteosarcoma (OSA) is a common malignant bone tumor of large breed dogs that occurs at predictable anatomic sites. At the time of initial diagnosis, most affected dogs have occult pulmonary metastases. Even with aggressive surgical treatment combined with chemotherapy, the majority of dogs diagnosed with OSA live less than 1 year from the time of diagnosis. The ability to identify canine OSA cases most responsive to treatment is needed. In humans, OSA is also an aggressive tumor that is histologically and molecularly similar to canine OSA. The expression of the tumor suppressor gene product P16 by human OSA tissue has been linked to a favorable response to chemotherapy. We identified an antibody that binds canine P16 and developed a canine OSA tissue microarray in order to test the hypothesis that P16 expression by canine OSA tissue is predictive of clinical outcome following amputation and chemotherapy. Although statistical significance was not reached, a trend was identified between the lack of canine OSA P16 expression and a shorter disease free interval. The identification of a molecular marker for canine OSA is an important goal and the results reported here justify a larger study.
Cone beam computed tomography findings of impacted upper canines
Energy Technology Data Exchange (ETDEWEB)
Da Silva Santos, Ludmilla Mota [Dept. of Endodontics, Aracatuba Dental School, Paulista State University, Aracatuba(Brazil); Bastos, Luana Costa; Da Silva, Silvio Jose Albergaria; Campos, Paulo Sergio Flores [School of Dentistry, Federal University of Bahia, Salvador (Brazil); Oliveira Santos, Christiano [Dept. of Stomatology, Oral Public Health, and Forensic Dentistry, School of Dentistry, University of Sao Paulo, Ribeirao Preto (Brazil); Neves, Frederico Sampaio [Dept. of Oral Diagnosis, Piracicaba Dental School, State University of Campinas, Piracicaba (Brazil)
2014-12-15
To describe the features of impacted upper canines and their relationship with adjacent structures through three-dimensional cone-beam computed tomography (CBCT) images. Using the CBCT scans of 79 upper impacted canines, we evaluated the following parameters: gender, unilateral/bilateral occurrence, location, presence and degree of root resorption of adjacent teeth (mild, moderate, or severe), root dilaceration, dental follicle width, and presence of other associated local conditions. Most of the impacted canines were observed in females (56 cases), unilaterally (51 cases), and at a palatine location (53 cases). Root resorption in adjacent teeth and root dilaceration were observed in 55 and 47 impacted canines, respectively. In most of the cases, the width of the dental follicle of the canine was normal; it was abnormally wide in 20 cases. A statistically significant association was observed for all variables, except for root dilaceration (p=0.115) and the side of impaction (p=0.260). Root resorption of adjacent teeth was present in most cases of canine impaction, mostly affecting adjacent lateral incisors to a mild degree. A wide dental follicle of impacted canines was not associated with a higher incidence of external root resorption of adjacent teeth.
Cone beam computed tomography findings of impacted upper canines
International Nuclear Information System (INIS)
Da Silva Santos, Ludmilla Mota; Bastos, Luana Costa; Da Silva, Silvio Jose Albergaria; Campos, Paulo Sergio Flores; Oliveira Santos, Christiano; Neves, Frederico Sampaio
2014-01-01
To describe the features of impacted upper canines and their relationship with adjacent structures through three-dimensional cone-beam computed tomography (CBCT) images. Using the CBCT scans of 79 upper impacted canines, we evaluated the following parameters: gender, unilateral/bilateral occurrence, location, presence and degree of root resorption of adjacent teeth (mild, moderate, or severe), root dilaceration, dental follicle width, and presence of other associated local conditions. Most of the impacted canines were observed in females (56 cases), unilaterally (51 cases), and at a palatine location (53 cases). Root resorption in adjacent teeth and root dilaceration were observed in 55 and 47 impacted canines, respectively. In most of the cases, the width of the dental follicle of the canine was normal; it was abnormally wide in 20 cases. A statistically significant association was observed for all variables, except for root dilaceration (p=0.115) and the side of impaction (p=0.260). Root resorption of adjacent teeth was present in most cases of canine impaction, mostly affecting adjacent lateral incisors to a mild degree. A wide dental follicle of impacted canines was not associated with a higher incidence of external root resorption of adjacent teeth.
International Nuclear Information System (INIS)
Rohaya Megat Abdul Wahab; Albira Sintian; Zaidah Zainal Arifin; Zaidah Zainal Ariffin; Shahrul Hisham Zainal Ariffin
2015-01-01
Alkaline phosphatase (ALP), tartrate-resistant acid phosphatase (TRAP) and aspartate aminotransferase (AST) activities were studied as bio markers of canine movement. Root resorption was also evaluated in canines subjected to the orthodontic forces. Nineteen subjects randomly received 100 and 150 g force using self-ligating brackets (SLB) either on the right or left site of maxillary arch. Gingival crevicular fluid samples were collected at distal sites of canines for five consecutive weeks. The activities of ALP, TRAP and AST were assayed and measured spectrophotometrically. Canine movement was measured for five consecutive weeks while root resorption was monitored at baseline, week 0 and week 5 using periapical radiographs. In 100 g group, TRAP activity significantly increased in week 3-5 when compared to TRAP baseline activity. However, ALP and AST activities slightly increased. In 150 g group, ALP and TRAP activities slightly increased when compared with their baseline activities. However, AST significantly increased in week 5. Canine movement and root resorption were not significantly different (p<0.05) in both groups. A force of 100 and 150 g slightly increased the bone modeling process and resulted in similar canine movement and root resorption. Therefore, 100 g force could be an optimum force for canine retraction and is preferable (compared with 150 g force) in canine retraction using SLB. (author)
Two interceptive approaches to palatally displaced canines: a prospective longitudinal study.
Leonardi, Maria; Armi, Pamela; Franchi, Lorenzo; Baccetti, Tiziano
2004-10-01
This study evaluated the effectiveness of two interceptive approaches to palatally displaced canines (PDCs), ie, extraction of the deciduous canines alone and in association with the use of a cervical pull headgear. The prospective longitudinal design of the investigation included 46 subjects with PDC (62 maxillary canines) who were randomly assigned to one of three groups (1) a group that underwent the extraction of the deciduous canine only, (2) a group that received in addition the use of a cervical pull headgear, and (3) an untreated control group. Panoramic radiographs were evaluated at initial observation (T1) and after an average period of 18 months (T2). Cervical vertebral maturation was assessed on lateral cephalograms at T1. Successful or unsuccessful canine eruption was assessed 48 months after T1. The between-group statistical comparisons were performed on the T1-T2 changes in the diagnostic parameters on panoramic radiographs, the prevalence rates of successful canine eruption, and the amount of time for canine eruption. The removal of the deciduous canine as an isolated measure to intercept palatal displacement of maxillary canines showed a prevalence rate of 50% success, which was not significantly greater than the success rate in untreated controls. The use of a headgear in addition to the extraction of the deciduous canine induced successful eruption in 80% of the cases, with a significant improvement in the measures for intraosseous canine position. There was no significant difference between the two interceptive approaches in the time required for canine eruption.
Skeletal maturity assessment using mandibular canine calcification stages
Directory of Open Access Journals (Sweden)
Vildana Džemidžić
2016-11-01
Full Text Available Objective. The aims of this study were: to investigate the relationship between mandibular canine calcification stages and skeletal maturity; and to evaluate whether the mandibular canine calcification stages may be used as a reliable diagnostic tool for skeletal maturity assessment. Materials and methods. This study included 151 subjects: 81 females and 70 males, with ages ranging from 9 to 16 years (mean age: 12.29±1.86 years. The inclusion criteria for subjects were as follows: age between 9 and 16 years; good general health without any hormonal, nutritional, growth or dental development problems. Subjects who were undergoing or had previously received orthodontic treatment were not included in this study. The calcification stages of the left permanent mandibular canine were assessed according to the method of Demirjian, on panoramic radiographs. Assessment of skeletal maturity was carried out using the cervical vertebral maturation index (CVMI, as proposed by the Hassel-Farman method, on lateral cephalograms. The correlation between the calcification stages of mandibular canine and skeletal maturity was estimated separately for male and female subjects. Results. Correlation coefficients between calcification stages of mandibular canine and skeletal maturity were 0.895 for male and 0.701 for female subjects. Conclusions. A significant correlation was found between the calcification stages of the mandibular canine and skeletal maturity. The calcification stages of the mandibular canine show a satisfactory diagnostic performance only for assessment of pre-pubertal growth phase.
A new method for rapid Canine retraction
Directory of Open Access Journals (Sweden)
"Khavari A
2001-06-01
Full Text Available Distraction osteogenesis method (Do in bone lengthening and rapid midpalatal expansion have shown the great ability of osteognic tissues for rapid bone formation under distraction force and special protocol with optimum rate of one millimeter per day. Periodontal membrane of teeth (PDM is the extension of periostium in the alveolar socked. Orthodontic force distracts PDM fibers in the tension side and then bone formation will begin.Objects: Rapid retraction of canine tooth into extraction space of first premolar by DO protocol in order to show the ability of the PDM in rapid bone formation. The other objective was reducing total orthodontic treatment time of extraction cases.Patients and Methods: Tweleve maxillary canines in six patients were retracted rapidly in three weeks by a custom-made tooth-born appliance. Radiographic records were taken to evaluate the effects of heavy applied force on canine and anchorage teeth.Results: Average retraction was 7.05 mm in three weeks (2.35 mm/week. Canines rotated distal- in by mean 3.5 degrees.Anchorage loss was from 0 to 0.8 mm with average of 0.3 mm.Root resorption of canines was negligible, and was not significant clinically. Periodontium was normal after rapid retraction. No hazard for pulp vitality was observed.Discussion: PDM responded well to heavy distraction force by Do protocol. Rapid canine retraction seems to be a safe method and can considerabely reduce orthodontic time.
Headley,Selwyn Arlington; Saito,Taís Berelli
2003-01-01
Simultaneous infection of canine distemper virus and canine parvovirus associated with distemper myocardial degeneration and necrosis is described in a pup. The dog demonstrated myoclonus, nystagmus, enamel hypoplasia, abdominal pustules, and bilateral corneal ulceration clinically. Demyelinating encephalitis, myocardial degeneration and necrosis with mineralization, and necrosis, hemorrhage and fusion of intestinal villi were observed. The lesions observed in this dog are characteristic of a...
Directory of Open Access Journals (Sweden)
Pires Maria A
2007-08-01
Full Text Available Abstract Background Cutaneous mast cell tumours are one of the most common neoplasms in dogs and show a highly variable biologic behaviour. Several prognosis tools have been proposed for canine mast cell tumours, including histological grading and cell proliferation markers. CD117 is a receptor tyrosine kinase thought to play a key role in human and canine mast cell neoplasms. Normal (membrane-associated and aberrant (cytoplasmic, focal or diffuse CD117 immunoexpression patterns have been identified in canine mast cell tumours. Cytoplasmic CD117 expression has been found to correlate with higher histological grade and with a worsened post-surgical prognosis. This study addresses the role of CD117 in canine mast cell tumours by studying the correlations between CD117 immunoexpression patterns, two proliferation markers (Ki67 and AgNORs histological grade, and several other pathological variables. Results Highly significant (p Conclusion These findings highlight the key role of CD117 in the biopathology of canine MCTs and confirm the relationship between aberrant CD117 expression and increased cell proliferation and higher histological grade. Further studies are needed to unravel the cellular mechanisms underlying focal and diffuse cytoplasmic CD117 staining patterns, and their respective biopathologic relevance.
Novel canine circovirus strains from Thailand: Evidence for genetic recombination.
Piewbang, Chutchai; Jo, Wendy K; Puff, Christina; van der Vries, Erhard; Kesdangsakonwut, Sawang; Rungsipipat, Anudep; Kruppa, Jochen; Jung, Klaus; Baumgärtner, Wolfgang; Techangamsuwan, Somporn; Ludlow, Martin; Osterhaus, Albert D M E
2018-05-14
Canine circoviruses (CanineCV's), belonging to the genus Circovirus of the Circoviridae family, were detected by next generation sequencing in samples from Thai dogs with respiratory symptoms. Genetic characterization and phylogenetic analysis of nearly complete CanineCV genomes suggested that natural recombination had occurred among different lineages of CanineCV's. Similarity plot and bootscaning analyses indicated that American and Chinese viruses had served as major and minor parental viruses, respectively. Positions of recombination breakpoints were estimated using maximum-likelihood frameworks with statistical significant testing. The putative recombination event was located in the Replicase gene, intersecting with open reading frame-3. Analysis of nucleotide changes confirmed the origin of the recombination event. This is the first description of naturally occurring recombinant CanineCV's that have resulted in the circulation of newly emerging CanineCV lineages.
Wright, N; Jackson, F R; Niezgoda, M; Ellison, J A; Rupprecht, C E; Nel, L H
2013-08-28
Rabies in dogs can be controlled through mass vaccination. Oral vaccination of domestic dogs would be useful in the developing world, where greater vaccination coverage is needed especially in inaccessible areas or places with large numbers of free-roaming dogs. From this perspective, recent research has focused on development of new recombinant vaccines that can be administered orally in a bait to be used as adjunct for parenteral vaccination. One such candidate, a recombinant canine adenovirus type 2 vaccine expressing the rabies virus glycoprotein (CAV2-RG), is considered a promising option for dogs, given host specificity and safety. To assess the potential use of this vaccine in domestic dog populations, we investigated the prevalence of antibodies against canine adenovirus type 2 in South African dogs. Blood was collected from 241 dogs from the Gauteng and KwaZulu-Natal provinces. Sampled dogs had not previously been vaccinated against canine adenovirus type 1 (CAV1) or canine adenovirus type 2 (CAV2). Animals from both provinces had a high percentage of seropositivity (45% and 62%), suggesting that CAV2 circulates extensively among domestic dog populations in South Africa. Given this finding, we evaluated the effect of pre-existing CAV-specific antibodies on the efficacy of the CAV2-RG vaccine delivered via the oral route in dogs. Purpose-bred Beagle dogs, which received prior vaccination against canine parvovirus, canine distemper virus and CAV, were immunized by oral administration of CAV2-RG. After rabies virus (RABV) infection all animals, except one vaccinated dog, developed rabies. This study demonstrated that pre-existing antibodies against CAV, such as naturally occurs in South African dogs, inhibits the development of neutralizing antibodies against RABV when immunized with a CAV-based rabies recombinant vaccine. Copyright © 2013 Elsevier Ltd. All rights reserved.
Podoplanin Expression in Canine Melanoma
Ogasawara, Satoshi; Honma, Ryusuke; Kaneko, Mika K.; Fujii, Yuki; Kagawa, Yumiko; Konnai, Satoru; Kato, Yukinari
2016-01-01
A type I transmembrane protein, podoplanin (PDPN), is expressed in several normal cells such as lymphatic endothelial cells or pulmonary type I alveolar cells. We recently demonstrated that anticanine PDPN monoclonal antibody (mAb), PMab-38, recognizes canine PDPN of squamous cell carcinomas, but does not react with lymphatic endothelial cells. Herein, we investigated whether PMab-38 reacts with canine melanoma. PMab-38 reacted with 90% of melanoma cells (9/10 cases) using immunohistochemistr...
Canine scent detection of canine cancer: a feasibility study
Directory of Open Access Journals (Sweden)
Dorman DC
2017-10-01
Full Text Available David C Dorman,1 Melanie L Foster,2 Katherine E Fernhoff,1 Paul R Hess2 1Department of Molecular and Biomedical Sciences, 2Department of Clinical Sciences, College of Veterinary Medicine, North Carolina State University, Raleigh, NC, USA Abstract: The scent detection prowess of dogs has prompted interest in their ability to detect cancer. The purpose of this study was to determine whether dogs could use olfactory cues to discriminate urine samples collected from dogs that did or did not have urinary tract transitional cell carcinoma (TCC, at a rate greater than chance. Dogs with previous scent training (n=4 were initially trained to distinguish between a single control and a single TCC-positive urine sample. All dogs acquired this task (mean =15±7.9 sessions; 20 trials/session. The next training phase used four additional control urine samples (n=5 while maintaining the one original TCC-positive urine sample. All dogs quickly acquired this task (mean =5.3±1.5 sessions. The last training phase used multiple control (n=4 and TCC-positive (n=6 urine samples to promote categorical training by the dogs. Only one dog was able to correctly distinguish multiple combinations of TCC-positive and control urine samples suggesting that it mastered categorical learning. The final study phase evaluated whether this dog would generalize this behavior to novel urine samples. However, during double-blind tests using two novel TCC-positive and six novel TCC-negative urine samples, this dog did not indicate canine TCC-positive cancer samples more frequently than expected by chance. Our study illustrates the need to consider canine olfactory memory and the use of double-blind methods to avoid erroneous conclusions regarding the ability of dogs to alert on specimens from canine cancer patients. Our results also suggest that sample storage, confounding odors, and other factors need to be considered in the design of future studies that evaluate the detection of
Wen, Jiexia; Pan, Sumin; Liang, Shuang; Zhong, Zhenyu; He, Ying; Lin, Hongyu; Li, Wenyan; Wang, Liyue; Li, Xiujin; Zhong, Fei
2013-01-01
Canine parvovirus (CPV) disease is an acute, highly infectious disease threatening the dog-raising industry. So far there are no effective therapeutic strategies to control this disease. Although the canine transferrin receptor (TfR) was identified as a receptor for CPV infection, whether extracellular domain of TfR (called soluble TfR (sTfR)) possesses anti-CPV activities remains elusive. Here, we used the recombinant sTfR prepared from HEK293T cells with codon-optimized gene structure to investigate its anti-CPV activity both in vitro and in vivo. Our results indicated that codon optimization could significantly improve sTfR expression in HEK293T cells. The prepared recombinant sTfR possessed a binding activity to both CPV and CPV VP2 capsid proteins and significantly inhibited CPV infection of cultured feline F81 cells and decreased the mortality of CPV-infected dogs, which indicates that the sTfR has the anti-CPV activity both in vitro and in vivo. PMID:24089666
Directory of Open Access Journals (Sweden)
Jiexia Wen
2013-01-01
Full Text Available Canine parvovirus (CPV disease is an acute, highly infectious disease threatening the dog-raising industry. So far there are no effective therapeutic strategies to control this disease. Although the canine transferrin receptor (TfR was identified as a receptor for CPV infection, whether extracellular domain of TfR (called soluble TfR (sTfR possesses anti-CPV activities remains elusive. Here, we used the recombinant sTfR prepared from HEK293T cells with codon-optimized gene structure to investigate its anti-CPV activity both in vitro and in vivo. Our results indicated that codon optimization could significantly improve sTfR expression in HEK293T cells. The prepared recombinant sTfR possessed a binding activity to both CPV and CPV VP2 capsid proteins and significantly inhibited CPV infection of cultured feline F81 cells and decreased the mortality of CPV-infected dogs, which indicates that the sTfR has the anti-CPV activity both in vitro and in vivo.
Bergman, J G H E; Muniz, M; Sutton, D; Fensome, R; Ling, F; Paul, G
2006-11-25
The results of vaccinating two groups of puppies with commercial vaccines, both of which claimed to provide adequate protection with a final vaccination at 10 weeks of age, were compared. Groups of 19 and 20 puppies with similar titres of maternally derived antibodies against canine parvovirus (cpv), canine distemper virus (cdv) and canine adenovirus type 2 (cav-2) at four weeks of age were vaccinated at six and 10 weeks of age and their responses to each vaccination were measured by comparing the titres against cpv, cdv and cav-2 in the serum samples taken immediately before the vaccination and four weeks later. After the vaccination at six weeks of age, all 19 of the puppies in group 1 had responded to cpv and cdv, and 14 had responded to cav-2; in group 2, 17 of the 20 had responded to cpv, 19 to cdv and 15 to cav-2. In both groups the puppies that did not respond to the first vaccination had responded serologically to cpv, cdv and cav-2 at 10 weeks of age.
International Nuclear Information System (INIS)
Hassan, S.; Javed, M.A.; Khan, A.J.; Tariq, M.
1997-01-01
Pure seeds of a blight susceptible but high yielding chickpea variety 6153 were irradiated at 20 Kr(0.2 kGy) dose of gamma radiation and the mutant line CMN-446-4 was selected in M3 generation on the basis of high yield and disease resistance. After confirmation of its resistance to blight in M4 and M5, the mutant line CMN-446-4 along with other promising chickpea mutants were evaluated in various yield trials at different locations. The mutant line CMN-446-4 was got evaluated in chickpea national uniform yield trial conducted over two locations in the country during 1993-94. The mutant line, on average, ranked 3rd by producing significantly higher yield of 1528 kg/ha as compared to the two checked varieties Punjab-91 and Paidar-91 which yielded 1316 and 1391 kg/ha respectively. The mutant CMN-446-4 has significantly greater percentage of protein content (25.22%) compared to its parental variety having (20.12%). (author)
[Study on High-yield Cultivation Measures for Arctii Fructus].
Liu, Shi-yong; Jiang, Xiao-bo; Wang, Tao; Sun, Ji-ye; Hu, Shang-qin; Zhang, Li
2015-02-01
To find out the high yield cultivation measures for Arctii Fructus. Completely randomized block experiment design method was used in the field planting, to analyze the effect of different cultivation way on agronomic characters, phenological phase,quality and quantity of Arctii Fructus. Arctium lappa planted on August 28 had the best results of plant height, thousand seeds weight and yield. The highest yield of Arctii Fructus was got at the density of 1,482 plants/667 m2. Arctiin content was in an increase trend with the planting time delay and planting density increasing. The plant height, thousand seeds weight, yield and arctiin content by split application of fertilizer were significantly higher than that by one-time fertilization. Compared with open field Arctium lappa, plant height, yield, arctiin content and relative water content of plastic film mulching Arctium lappa was higher by 7.74%, 10.87%, 6.38% and 24.20%, respectively. In the topping Arctium lappa, the yield was increased by 11.09%, with 39. 89% less branching number. Early planting time and topping shortened the growth cycle of Arctium lappa plant. The high-yield cultivation measures of Arctii Fructus are: around August 28 to sowing, planting density of 1 482 plants/667 m2, split application of fertilizer for four times, covering film on surface of the soil and topping in bolting.
Abdelmagid, Omar Y; Larson, Laurie; Payne, Laurie; Tubbs, Anna; Wasmoen, Terri; Schultz, Ronald
2004-01-01
The results of this study confirmed that dogs vaccinated subcutaneously with a commercially available multivalent vaccine containing modified-live canine distemper virus, canine adenovirus type 2, canine parvovirus type 2b, and canine parainfluenza virus antigens were protected against sequential experimental challenge 55 to 57 months after initial vaccination given at 7 to 8 weeks of age. All 10 vaccinates were protected against clinical diseases and mortality following parvovirus and infectious canine hepatitis experimental infections. All vaccinates were protected against mortality and 90% against clinical disease following distemper challenge. These data support at least a 4-year duration of immunity for these three "core" fractions in the combination vaccine.
A rare case of canine anomaly - a possible algorithm for treating it.
Vaida, Ligia; Todor, Bianca Ioana; Corega, Claudia; Băciuţ, Mihaela; Băciuţ, Grigore
2014-01-01
Canine transmigration is a very rare dental anomaly in which an unerupted mandibular canine migrates, crossing the mandibular midline. This unusual condition is most often diagnosed by chance during a routine X-ray examination. The most common clinical signs announcing the presence of this anomaly are over-retention of the deciduous canine and the absence of permanent canine from the dental arch after its physiological period of eruption. In this paper, we present a clinical case, 10-year-old boy, who was diagnosed with mandibular right canine transmigration at three years after the start of orthodontic treatment, during which we were expecting the eruption of mandibular canines. The orthopantomograph revealed the mandibular right canine to be in a horizontal position under the apices of the incisors - type 2 transmigration pattern classified by Mupparapu (2002). Based on cone-beam computer tomography examination, we recommended a surgical exposure of the canine and orthodontic alignment. Due to the risk of root resorption of the mandibular right lateral incisor during orthodontic movement phase of canine transmigrated to the dental arch, we decided to align the mandibular right canine in a transposition, between the two mandibular right incisors. Then we resorted to adapting the mandibular right lateral incisor coronary morphology to simulate a canine and also to reshaping the canine coronary morphology to resemble a lateral incisor. This therapeutic approach allowed us to restore morphologically and functionally the mandibular dento-alveolar arch, preserving the entire dental system.
Development and Characterization of Canine Distemper Virus Monoclonal Antibodies.
Liu, Yuxiu; Hao, Liying; Li, Xiangdong; Wang, Linxiao; Zhang, Jianpo; Deng, Junhua; Tian, Kegong
2017-06-01
Five canine distemper virus monoclonal antibodies were developed by immunizing BALB/c mice with a traditional vaccine strain Snyder Hill. Among these monoclonal antibodies, four antibodies recognized both field and vaccine strains of canine distemper virus without neutralizing ability. One monoclonal antibody, 1A4, against hemagglutinin protein of canine distemper virus was found to react only with vaccine strain virus but not field isolates, and showed neutralizing activity to vaccine strain virus. These monoclonal antibodies could be very useful tools in the study of the pathogenesis of canine distemper virus and the development of diagnostic reagents.
Surgical considerations and management of bilateral labially impacted canines
Directory of Open Access Journals (Sweden)
Yu-Shan Huang
2016-06-01
Full Text Available Canines are among the most commonly impacted teeth. When a canine is positioned labially, the untoward soft-tissue responses following surgical exposure may cause unfavorable esthetic outcomes. Therefore, decision making as to the choice of a proper surgical technique to uncover labially impacted teeth is critical. This case presentation describes two different surgical approaches for two maxillary impacted canines in a 12-year-old girl. A sequential approach included a first stage of surgical exposure using apically positioned flaps and orthodontic extrusion of both impacted teeth. A successive laterally positioned flap was used for the left maxillary canine to achieve a harmonious soft-tissue contour. In this case, close monitoring and cooperation during the various treatment phases led to proper canine positioning and a successful esthetic result, with good periodontal health and functional occlusion.
Directory of Open Access Journals (Sweden)
Doo-Hyung Lee
Full Text Available Halyomorpha halys is an invasive species from Asia causing major economic losses in agricultural production in the mid-Atlantic region of the United States. Unlike other crop pests, H. halys is also well-known for nuisance problems in urban, suburban, and rural areas, as massive numbers of adults often invade human-made structures to overwinter inside protected environments. Research efforts have focused on populations in human-made structures while overwintering ecology of H. halys in natural landscapes is virtually unknown. We explored forested landscapes in the mid-Atlantic region to locate and characterize natural overwintering structures used by H. halys. We also evaluated the use of detector canines to locate overwintering H. halys to enhance the accuracy and efficiency of surveys. From these studies, we indentified shared characteristics of overwintering sites used by H. halys in natural landscapes. Overwintering H. halys were recovered from dry crevices in dead, standing trees with thick bark, particularly oak (Quercus spp. and locust (Robinia spp.; these characteristics were shared by 11.8% of all dead trees in surveyed landscapes. For trees with favorable characteristics, we sampled ∼20% of the total above-ground tree area and recovered 5.9 adults per tree from the trees with H. halys present. Two detector canines were successfully trained to recognize and detect the odor of adult H. halys yielding >84% accuracy in laboratory and semi-field trials. Detector canines also found overwintering H. halys under field conditions. In particular, overwintering H. halys were recovered only from dead trees that yielded positive indications from the canines and shared key tree characteristics established by human surveyors. The identified characteristics of natural overwintering sites of H. halys will serve as baseline information to establish crop economic risk levels posed by overwintering populations, and accordingly develop sustainable
Immunohistochemical Characterization of Canine Lymphomas
Directory of Open Access Journals (Sweden)
Roxana CORA
2017-11-01
Full Text Available Lymphomas occur by clonal expansion of lymphoid cells and have distinctive morphological and immunophenotypic features. Determination of canine lymphoma immunophenotype is useful for accurate prognosis and further therapy. In the suggested study, we performed an immunohistochemical evaluation of some cases with canine lymphoma diagnosed in the Department of Pathology (Faculty of Veterinary Medicine, Cluj-Napoca, Romania, in order to characterize them. The investigation included 39 dogs diagnosed with different anatomical forms of lymphoma, following necropsy analysis or assessment of biopsies. The diagnosis of lymphoma was confirmed by necropsy and histopathology (Hematoxylin-eosin stain examinations. The collected specimens were analyzed by immunohistochemistry technique (automatic method using the following antibodies: CD3, CD20, CD21 and CD79a. The analyzed neoplasms were characterized as follows: about 64.10% of cases were diagnosed as B-cell lymphomas, 33.34% of cases as T-cell lymphomas, whereas 2.56% of cases were null cell type lymphomas (neither B nor T. Most of multicentric (80%, mediastinal (60% and primary central nervous system lymphomas (100% had B immunophenotype, while the majority of cutaneous (80% and digestive (100% lymphomas had T immunophenotype. Immunohistochemical description of canine lymphomas can deliver some major details concerning their behavior and malignancy. Additionally, vital prognosis and efficacy of some therapeutic protocols are relying on the immunohistochemical features of canine lymphoma.
Stem Cell-Associated Marker Expression in Canine Hair Follicles.
Gerhards, Nora M; Sayar, Beyza S; Origgi, Francesco C; Galichet, Arnaud; Müller, Eliane J; Welle, Monika M; Wiener, Dominique J
2016-03-01
Functional hair follicle (HF) stem cells (SCs) are crucial to maintain the constant recurring growth of hair. In mice and humans, SC subpopulations with different biomarker expression profiles have been identified in discrete anatomic compartments of the HF. The rare studies investigating canine HF SCs have shown similarities in biomarker expression profiles to that of mouse and human SCs. The aim of our study was to broaden the current repertoire of SC-associated markers and their expression patterns in the dog. We combined analyses on the expression levels of CD34, K15, Sox9, CD200, Nestin, LGR5 and LGR6 in canine skin using RT-qPCR, the corresponding proteins in dog skin lysates, and their expression patterns in canine HFs using immunohistochemistry. Using validated antibodies, we were able to define the location of CD34, Sox9, Keratin15, LGR5 and Nestin in canine HFs and confirm that all tested biomarkers are expressed in canine skin. Our results show similarities between the expression profile of canine, human and mouse HF SC markers. This repertoire of biomarkers will allow us to conduct functional studies and investigate alterations in the canine SC compartment of different diseases, like alopecia or skin cancer with the possibility to extend relevant findings to human patients. © 2016 The Histochemical Society.
Chlamydia in canine or feline coronary arteriosclerotic lesions
Directory of Open Access Journals (Sweden)
Grabarevic Zeljko
2011-09-01
Full Text Available Abstract Background There are numerous reports linking Chlamydia infection to human coronary atherosclerosis. However, there is a lack of data regarding this correlation in dogs and cats, and there are no reports investigating coronary arteriosclerosis and Chlamydia in these species. The aim of the present study was to examine whether there is a correlation between canine and feline spontaneous atherosclerosis or arteriosclerosis and the presence of Chlamydia. Archived histopathological samples of dogs (n = 16 and cats (n = 13 with findings of atherosclerosis or arteriosclerosis in heart tissue were examined for the presence of Chlamydiaceae using real-time PCR, ArrayTube Microarray and immunohistochemistry. Additionally, arteriosclerotic lesions of all cases were histologically classified and graded. Results Both canine atherosclerotic cases, and all 14 canine arteriosclerotic cases were negative for Chlamydia. Only one of the 13 arteriosclerotic feline cases was positive for Chlamydia by real-time PCR, revealing C. abortus by ArrayTube Microarray. To our knowledge, this is the first description of C. abortus in a cat. Overall, the type and grade of canine and feline arteriosclerotic lesions revealed similarities, and were predominantly moderate and hyperplastic. Conclusions These findings suggest that there is no obvious correlation between canine and feline coronary arteriosclerosis and the presence of Chlamydia. In order to draw final conclusions about the correlation between Chlamydia and canine atherosclerosis, examination of more samples is required.
Chlamydia in canine or feline coronary arteriosclerotic lesions.
Sostaric-Zuckermann, Ivan C; Borel, Nicole; Kaiser, Carmen; Grabarevic, Zeljko; Pospischil, Andreas
2011-09-09
There are numerous reports linking Chlamydia infection to human coronary atherosclerosis. However, there is a lack of data regarding this correlation in dogs and cats, and there are no reports investigating coronary arteriosclerosis and Chlamydia in these species. The aim of the present study was to examine whether there is a correlation between canine and feline spontaneous atherosclerosis or arteriosclerosis and the presence of Chlamydia. Archived histopathological samples of dogs (n = 16) and cats (n = 13) with findings of atherosclerosis or arteriosclerosis in heart tissue were examined for the presence of Chlamydiaceae using real-time PCR, ArrayTube Microarray and immunohistochemistry. Additionally, arteriosclerotic lesions of all cases were histologically classified and graded. Both canine atherosclerotic cases, and all 14 canine arteriosclerotic cases were negative for Chlamydia. Only one of the 13 arteriosclerotic feline cases was positive for Chlamydia by real-time PCR, revealing C. abortus by ArrayTube Microarray. To our knowledge, this is the first description of C. abortus in a cat. Overall, the type and grade of canine and feline arteriosclerotic lesions revealed similarities, and were predominantly moderate and hyperplastic. These findings suggest that there is no obvious correlation between canine and feline coronary arteriosclerosis and the presence of Chlamydia. In order to draw final conclusions about the correlation between Chlamydia and canine atherosclerosis, examination of more samples is required.
A Case of Maxillary Protrusion with Congenitally Missing Canine Teeth in the Mandible
松井, 啓至; 酒徳, 明彦
1996-01-01
A patient that had a maxillary protrusion with congenitally missing canine teeth in the mandible was successfully treated with the extraction of the maxillary first premolars. The patient's cooperation in wearing headgear appliance was highly favorable. Her profile changes were pronounced and esthetically pleasing. A review of her post-treatment records revealed an excellent esthetic and occlusal result even though the first premolars were aligned instead of the canine teeth in the mandible. ...
A compendium of canine normal tissue gene expression.
Directory of Open Access Journals (Sweden)
Joseph Briggs
Full Text Available BACKGROUND: Our understanding of disease is increasingly informed by changes in gene expression between normal and abnormal tissues. The release of the canine genome sequence in 2005 provided an opportunity to better understand human health and disease using the dog as clinically relevant model. Accordingly, we now present the first genome-wide, canine normal tissue gene expression compendium with corresponding human cross-species analysis. METHODOLOGY/PRINCIPAL FINDINGS: The Affymetrix platform was utilized to catalogue gene expression signatures of 10 normal canine tissues including: liver, kidney, heart, lung, cerebrum, lymph node, spleen, jejunum, pancreas and skeletal muscle. The quality of the database was assessed in several ways. Organ defining gene sets were identified for each tissue and functional enrichment analysis revealed themes consistent with known physio-anatomic functions for each organ. In addition, a comparison of orthologous gene expression between matched canine and human normal tissues uncovered remarkable similarity. To demonstrate the utility of this dataset, novel canine gene annotations were established based on comparative analysis of dog and human tissue selective gene expression and manual curation of canine probeset mapping. Public access, using infrastructure identical to that currently in use for human normal tissues, has been established and allows for additional comparisons across species. CONCLUSIONS/SIGNIFICANCE: These data advance our understanding of the canine genome through a comprehensive analysis of gene expression in a diverse set of tissues, contributing to improved functional annotation that has been lacking. Importantly, it will be used to inform future studies of disease in the dog as a model for human translational research and provides a novel resource to the community at large.
Molecular characterization of the canine HMGB1.
Murua Escobar, H; Meyer, B; Richter, A; Becker, K; Flohr, A M; Bullerdiek, J; Nolte, I
2003-01-01
Due to the close similarities of numerous canine diseases to their human counterparts, the dog could join the mouse as the species of choice to unravel the genetic background of complex diseases as e.g. cancer and metabolic diseases. Accordingly, the role of the dog as a model for therapeutic approaches is strongly increasing. However, prerequisite for such studies is the characterization of the corresponding canine genes. Recently, the human high mobility group protein B1 (HMGB1) has attracted considerable interest of oncologists because of what is called its "double life". Besides its function as an architectural transcription factor HMGB1 can also be secreted by certain cells and then acts as a ligand for the receptor for advanced glycation end products (RAGE). The binding of HMGB1 to RAGE can activate key cell signaling pathways, such as p38(MAPK), JNK, and p42/p44(MAPK) emphasizing the important role of HMGB1 in inflammation and tumor metastasis. These results make HMGB1 a very interesting target for therapeutic studies done in model organisms like the dog. In this study we characterized the molecular structure of the canine HMGB1 gene on genomic and cDNA levels, its predicted protein, the gene locus and a basic expression pattern. Copyright 2003 S. Karger AG, Basel
Canine urothelial carcinoma: genomically aberrant and comparatively relevant.
Shapiro, S G; Raghunath, S; Williams, C; Motsinger-Reif, A A; Cullen, J M; Liu, T; Albertson, D; Ruvolo, M; Bergstrom Lucas, A; Jin, J; Knapp, D W; Schiffman, J D; Breen, M
2015-06-01
Urothelial carcinoma (UC), also referred to as transitional cell carcinoma (TCC), is the most common bladder malignancy in both human and canine populations. In human UC, numerous studies have demonstrated the prevalence of chromosomal imbalances. Although the histopathology of the disease is similar in both species, studies evaluating the genomic profile of canine UC are lacking, limiting the discovery of key comparative molecular markers associated with driving UC pathogenesis. In the present study, we evaluated 31 primary canine UC biopsies by oligonucleotide array comparative genomic hybridization (oaCGH). Results highlighted the presence of three highly recurrent numerical aberrations: gain of dog chromosome (CFA) 13 and 36 and loss of CFA 19. Regional gains of CFA 13 and 36 were present in 97 % and 84 % of cases, respectively, and losses on CFA 19 were present in 77 % of cases. Fluorescence in situ hybridization (FISH), using targeted bacterial artificial chromosome (BAC) clones and custom Agilent SureFISH probes, was performed to detect and quantify these regions in paraffin-embedded biopsy sections and urine-derived urothelial cells. The data indicate that these three aberrations are potentially diagnostic of UC. Comparison of our canine oaCGH data with that of 285 human cases identified a series of shared copy number aberrations. Using an informatics approach to interrogate the frequency of copy number aberrations across both species, we identified those that had the highest joint probability of association with UC. The most significant joint region contained the gene PABPC1, which should be considered further for its role in UC progression. In addition, cross-species filtering of genome-wide copy number data highlighted several genes as high-profile candidates for further analysis, including CDKN2A, S100A8/9, and LRP1B. We propose that these common aberrations are indicative of an evolutionarily conserved mechanism of pathogenesis and harbor genes
BMI1 is expressed in canine osteosarcoma and contributes to cell growth and chemotherapy resistance.
Shahi, Mehdi Hayat; York, Daniel; Gandour-Edwards, Regina; Withers, Sita S; Holt, Roseline; Rebhun, Robert B
2015-01-01
BMI1, a stem cell factor and member of the polycomb group of genes, has been shown to contribute to growth and chemoresistance of several human malignancies including primary osteosarcoma (OSA). Naturally occurring OSA in the dog represents a large animal model of human OSA, however the potential role of BMI1 in canine primary and metastatic OSA has not been examined. Immunohistochemical staining of canine primary and metastatic OSA tumors revealed strong nuclear expression of BMI1. An identical staining pattern was found in both primary and metastatic human OSA tissues. Canine OSA cell lines (Abrams, Moresco, and D17) expressed high levels of BMI1 compared with canine osteoblasts and knockdown or inhibition of BMI1 by siRNA or by small molecule BMI1-inhibitor PTC-209 demonstrated a role for BMI1 in canine OSA cell growth and resistance to carboplatin and doxorubicin chemotherapy. These findings suggest that inhibition of BMI1 in primary or metastatic OSA may improve response to chemotherapy and that the dog may serve as a large animal model to evaluate such therapy.
Canine index – A tool for sex determination
Directory of Open Access Journals (Sweden)
Shankar M. Bakkannavar
2015-12-01
Full Text Available Teeth are most useful tools in victim identification in the living as well as the dead in the field of forensic investigations. Their ability to survive in situations like mass disasters makes them constructive devices. Many authors have measured crowns of teeth in both males and females and found certain variations. Canines, reported to survive in air crash and hurricane disasters, are perhaps the most stable teeth in the oral cavity because of the labiolingual thickness of the crown and the root anchorage in the alveolar process of jaws. Measurement of mesiodistal width of the mandibular canines and inter-canine distance of the mandible provides good evidence of sex identification due to dimorphism. This study was undertaken to evaluate the effectiveness of canine index (CI in the determination of sex.
Serosurvey for canine distemper virus exposure in dogs in communal lands in Zimbabwe
Directory of Open Access Journals (Sweden)
P.J. Kelly
2005-06-01
Full Text Available Sera from 173 apparently healthy, unvaccinated dogs from 4 widely separated communal lands in Zimbabwe were tested by ELISA for antibodies against canine distemper virus. Overall, 82 % were positive with high prevalences found in each communal land. The highest seroprevalence was in dogs between 1 and 2 years of age (91 %; 49/54. These results show dogs in the communal lands of Zimbabwe are commonly exposed to canine distemper virus and that a substantial number survive infection. The role that the virus might play in the high mortality rate of the dog population on communal land warrants further investigation.
Apoptotic intrinsic pathway proteins predict survival in canine cutaneous mast cell tumours.
Barra, C N; Macedo, B M; Cadrobbi, K G; Pulz, L H; Huete, G C; Kleeb, S R; Xavier, J G; Catão-Dias, J L; Nishiya, A T; Fukumasu, H; Strefezzi, R F
2018-03-01
Mast cell tumours (MCTs) are the most frequent canine round cell neoplasms and show variable biological behaviours with high metastatic and recurrence rates. The disease is treated surgically and wide margins are recommended. Adjuvant chemotherapy and radiotherapy used in this disease cause DNA damage in neoplastic cells, which is aimed to induce apoptotic cell death. Resisting cell death is a hallmark of cancer, which contributes to the development and progression of tumours. The aim of this study was to investigate the expression of the proteins involved in the apoptotic intrinsic pathway and to evaluate their potential use as prognostic markers for canine cutaneous MCTs. Immunohistochemistry for BAX, BCL2, APAF1, Caspase-9, and Caspase-3 was performed in 50 canine cases of MCTs. High BAX expression was associated with higher mortality rate and shorter survival. BCL2 and APAF1 expressions offered additional prognostic information to the histopathological grading systems. The present results indicate that variations in the expression of apoptotic proteins are related to malignancy of cutaneous MCTs in dogs. © 2017 John Wiley & Sons Ltd.
Nonsurgical, nonextraction management of impacted maxillary canine
Directory of Open Access Journals (Sweden)
Jasneet Singh
2018-01-01
Full Text Available NS, a 12 year 2 months old female patient, presented with the chief complaint of irregular teeth. Diagnosis revealed skeletal Class II jaw base relation, with average (toward vertical growth pattern, dentoalveolar angles Class I molar relationship with severe crowding in upper and moderate crowding in the lower arch, normally positioned maxillary incisors but proclined lower incisors, “V” shape constricted maxillary arch with first premolar in crossbite, overretained deciduous molar and a high placed buccoversion canine in the first quadrant and an impacted canine in the second quadrant, constricted mandibular arch with first premolar blocked out in the third quadrant. Treatment with a nonsurgical, nonextraction treatment plan by expansion of the upper arch and taking advantage of natural eruptive forces of the tooth was planned. The final outcome solved the patient's complaints and achieved an esthetically pleasing and functionally adequate occlusal result.
Directory of Open Access Journals (Sweden)
Xinyu Wang
Full Text Available To trace the evolution of canine coronavirus (CCoV, 201 stool samples from diarrheic dogs in northeast China were subjected to reverse transcription-polymerase chain reactions (RT-PCRs targeting the partial M and S genes of CCoV, followed by an epidemiological analysis. M gene RT-PCRs showed that 28.36% (57/201 of the samples were positive for CCoV; of the 57 positive samples, CCoV-I and CCoV-II accounted for 15.79% (9/57 and 84.21% (48/57, respectively. A sequence comparison of the partial M gene revealed nucleotide homologies of 88.4%-100% among the 57 CCoV strains, and 88.7%-96.2% identity between the 57 CCoV strains and the Chinese reference strain HF3. The CCoV-I and CCoV-II strains exhibited genetic diversity when compared with reference strains from China and other countries. The 57 CCoV strains exhibited high co-infection rates with canine kobuvirus (CaKV (33.33% and canine parvovirus-2 (CPV-2 (31.58%. The CCoV prevalence in diarrheic dogs differed significantly with immunization status, regions, seasons, and ages. Moreover, 28 S genes were amplified from the 57 CCoV-positive samples, including 26 CCoV-IIa strains, one CCoV-IIb strain, and one CCoV-I strain. A sequence comparison of the partial S gene revealed 86.3%-100% nucleotide identity among the 26 CCoV-IIa strains, and 89.6%-92.2% identity between the 26 CCoV-IIa strains and the Chinese reference strain V1. The 26 CCoV-IIa strains showed genetic diversity when compared with reference strains from China and other countries. Our data provide evidence that CCoV-I, CCoV-IIa, and CCoV-IIb strains co-circulate in the diarrhoetic dogs in northeast China, high co-infection rates with CaKV and CPV-2 were observed, and the CCoV-II strains exhibited high prevalence and genetic diversity.
Expert Opinion to Identify High-Risk Entry Routes of Canine Rabies into Papua New Guinea.
Brookes, V J; Ward, M P
2017-03-01
The proximity of Papua New Guinea (PNG) to canine rabies-endemic countries in South-East Asia presents a risk of incursion of this disease into PNG and the rest of the Oceanic region. The objective of this study was to identify the highest risk routes for entry of dogs - associated with movement of people - into PNG from canine rabies-endemic countries. A structured, in-country expert-elicitation workshop was used, and 20 entry routes were identified. The highest risk routes were three land routes from Papua, Indonesia (hunters, traditional border crossers and unregulated, unchecked 'shopper-crossers') and two sea routes (fishing and logging). These results will be used to direct more detailed risk assessments to develop surveillance strategies and incursion response plans. © 2016 Blackwell Verlag GmbH.
Rate of retraction of anterior teeth after canine distraction
Directory of Open Access Journals (Sweden)
Litesh Singla
2017-01-01
Full Text Available Background and Objectives: Orthodontists have always strived to develop a new technique to reduce the treatment time with minimal patient cooperation. Canine distraction was introduced as an alternative technique for canine retraction in a minimum possible period of 3 weeks, thus avoiding taxing the anchorage by molars since the canines are retracted within the lag phase of molars. It has been proved by numerous studies that the bone mesial to canine after rapid canine distraction through the extraction socket is a new and immature. The objectives of this study were to evaluate the rate of retraction of anterior teeth, the time taken, and anchorage loss during the retraction of anterior teeth into this newly organized bone. Methods: Six orthodontic patients who required first premolar extractions were selected. Undermining of the interseptal bone distal to the canine was done, and canines were retracted into the extraction space of the first premolar, using a custom-made tooth borne intraoral distraction screw, following which the incisors were retracted into the newly formed bone using closing loops. The patients were called at weekly intervals to measure the amount of space left between canine and lateral incisor, and the rate of retraction was calculated after space was closed. Results: The present study showed that the rate of retraction of mandibular and maxillary teeth was 0.74 ± 0.39 mm and 0.73 ± 0.15 mm/week, respectively. The anchorage loss was found to be 1.83 ± 0.29 mm and 2.08 ± 0.38 mm in mandibular and maxillary arches, respectively. The time taken to retract the incisors was found to be 40.3 ± 1.5 and 41.7 ± 0.6 days for mandibular and maxillary arches, respectively. Interpretation and Conclusion: Retraction of incisors is faster in both maxillary and mandibular arches when the incisors are retracted immediately into the immature bone created after canine distraction.
Directory of Open Access Journals (Sweden)
D S Kothavade
2012-01-01
Full Text Available Aim : The purpose of the present study was to establish the relationship between the eruption of permanent maxillary canines and cervical vertebral maturation stages (CVMs to assess an alternative method for determining time of canine eruption in the late mixed dentition. Materials and Methods : One hundred and twenty subjects with erupting permanent maxillary canines were observed both intraorally and radiographically with orthopantamograms. Lateral cephalograms were recorded to divide subjects according to CVM stage into prepeak (CS1 and CS2, peak (CS3 and CS4 and postpeak (CS5 and CS6 groups of puberty. Statistical Analysis : The differences between the prevalence rates of canine eruption in different groups of puberty were estimated using ′z test′. Results : Prepeak group comprised of forty six subjects, peak group sixty eight subjects and postpeak group six subjects. The differences in prevalence rates between peak and prepeak and between peak and postpeak groups were noticed highly significant (p<0.001, while prevalence rates between peak and postpeak was found less significant ( p0 <0.01. Conclusion : Eruption of the permanent maxillary canine can occur at any CVM stage till end of the puberty or after puberty (CS1-CS6. Thus, an absence of maxillary canine during or after postpeak stage of puberty (CS5 or CS6 suggests delayed eruption and canine impaction.
Neutron emission and fragment yield in high-energy fission
International Nuclear Information System (INIS)
Grudzevich, O. T.; Klinov, D. A.
2013-01-01
The KRIS special library of spectra and emission probabilities in the decays of 1500 nuclei excited up to energies between 150 and 250 MeV was developed for correctly taking into account the decay of highly excited nuclei appearing as fission fragments. The emission of neutrons, protons, and photons was taken into account. Neutron emission fromprimary fragments was found to have a substantial effect on the formation of yields of postneutron nuclei. The library was tested by comparing the calculated and measured yields of products originating from the fission of nuclei that was induced by high-energy protons. The method for calculating these yields was tested on the basis of experimental data on the thermal-neutroninduced fission of 235 U nuclei
Canine tooth size and fitness in male mandrills (Mandrillus sphinx).
Leigh, Steven R; Setchell, Joanna M; Charpentier, Marie; Knapp, Leslie A; Wickings, E Jean
2008-07-01
Sexual selection theory explains the evolution of exaggerated male morphologies and weaponry, but the fitness consequences of developmental and age-related changes in these features remain poorly understood. This long-term study of mandrill monkeys (Mandrillus sphinx) demonstrates how age-related changes in canine tooth weaponry and adult canine size correlate closely with male lifetime reproductive success. Combining long-term demographic and morphometric data reveals that male fitness covaries simply and directly with canine ontogeny, adult maximum size, and wear. However, fitness is largely independent of other somatometrics. Male mandrills sire offspring almost exclusively when their canines exceed approximately 30 mm, or two-thirds of average adult value (45 mm). Moreover, sires have larger canines than nonsires. The tooth diminishes through wear as animals age, corresponding with, and perhaps influencing, reproductive senescence. These factors combine to constrain male reproductive opportunities to a brief timespan, defined by the period of maximum canine length. Sexually-selected weaponry, especially when it is nonrenewable like the primate canine tooth, is intimately tied to the male life course. Our analyses of this extremely dimorphic species indicate that sexual selection is closely intertwined with growth, development, and aging, pointing to new directions for sexual selection theory. Moreover, the primate canine tooth has potential as a simple mammalian system for testing genetically-based models of aging. Finally, the tooth may record details of life histories in fossil primates, especially when sexual selection has played a role in the evolution of dimorphism.
Transmigration of Mandibular Canine: Report of Four Cases and Review of Literature
Directory of Open Access Journals (Sweden)
Gaurav Sharma
2011-01-01
Full Text Available Transmigration of canine is a rare phenomenon. The prevalence of transmigration of mandibular canine has been found to be only 0.14%–0.31%. The treatment of impacted transmigrated canine is very complicated if it is diagnosed at a later stage. We report 4 cases of transmigration of mandibular canine and review the literature regarding the etiology and treatment. Panoramic radiograph should be taken during the mixed dentition period if the mandibular canine has not erupted from more than one year from its normal chronological age of eruption as intraoral periapical radiograph examination will not always detect an impacted or transmigrated canine.
Asymmetry in development (mineralisation of permanent mandibular canine roots
Directory of Open Access Journals (Sweden)
Burić Mirjana V.
2012-01-01
Full Text Available Introduction. The development of the teeth is closely associated with the proper and unobstructed physical and psychological development of the child. Aim. To determine the existence of asymmetry in the development of the roots of the lower permanent canine teeth in different age groups of children of both sexes. Material and methods. The study was conducted on 523 ortopantomograms (253 boys and 270 girls of orthodontic patients aged 6 to 14 years of the Dental Clinic in Niš. We analyzed the development of asymmetry in the lower permanent canine root, using the method of Gleiser and Hunt, or the modification by Tijanić (1981. Results. It was found that asymmetry in the development of the root in both sexes of the lower canine teeth was present in 20 patients (3.82%, 10 boys (3.95% and 10 girls (3.70%. The difference is in the range of one stage. Asymmetric development of the roots of the lower incisors in girls and boys usually present in the 7th and 8th stages (60% in girls and in 50% in boys. In 90% of girls in developing asymmetry the root of the lower canine is present in a single stage, and in 10% of girls it presents within three stages. Asymmetric development of the root of the lower canine is the most common in the 7th and 8th stages of development (55%. Conclusion. Asymmetric root development of permanent lower canines was found in 3.82% of patients. More than half of respondents (55% had asymmetrical canine root development stage in half and three quarters of the total root length. The results of this study indicate that the canine is the tooth with very little variations in its development.
Dimopoulou, Maria; Kirpensteijn, Jolle; Moens, Hester; Kik, Marja
2008-07-01
To investigate the histologic characteristics of feline osteosarcoma (OS) and compare the histologic data with phenotypically comparable canine OS. The effects of histologic and clinical variables on survival statistics were evaluated. Retrospective study. Cats (n=62) and dogs (22). Medical records of 62 cats with OS were reviewed for clinically relevant data. Clinical outcome was obtained by telephone interview. Histologic characteristics of OS were classified using a standardized grading system. Histologic characteristics in 22 feline skeletal OS were compared with 22 canine skeletal OS of identical location and subtype. Prognostic variables for clinical outcome were determined using multivariate analysis. Feline OS was characterized by moderate to abundant cellular pleomorphism, low mitotic index, small to moderate amounts of matrix, high cellularity, and a moderate amount of necrosis. There was no significant difference between histologic variables in feline and canine OS. Histologic grade, surgery, and mitotic index significantly influenced clinical outcome as determined by multivariate analysis. Tumor invasion into vessels was not identified as a significant prognosticator. Feline and canine skeletal OS have similar histologic but different prognostic characteristics. Prognosis for cats with OS is related to histologic grade and mitotic index of the tumor.
International Nuclear Information System (INIS)
Seed, T.M.; Kaspar, L.V.; Domann, F.; Niiro, G.K.; LeBuis, D.A.
1988-01-01
We report here our initial observations on the growth and morphology, and developmental radiosensitivity of giant, multinucleated, osteoclast-like cells (MN-OS) generated through in vitro cultivation of hematopoietic progenitor-enriched canine bone marrow samples. Maximum cell densities of 5.5 x 10(3) to 6.5 x 10(3) MN-OS per cm2 of growth area were achieved following 10 to 14 days of culture at 37 degrees C. Acute gamma irradiation of the initial marrow inocula resulted in significant, dose-dependent perturbations of MN-OS formation, growth, and development. Attempts to estimate radiosensitivity of MN-OS progenitors from canine marrow yielded a range of Do values from a low of 212 cGy measured at six days of culture to higher values of 405 to 542 cGy following 10 to 22 days of culture. At the intermediate times of culture (10 to 14 days), the radiation-induced responses were clearly biphasic, reflecting either (a) the presence of multiple subpopulations of MN-OS progenitors with varying degrees of radiosensitivity or (b) the inherent biphasic nature of MN-OS development involving early progenitor cell proliferation followed by maturation and subsequent fusion. Morphologically, MN-OS generated from irradiated marrow inocula appeared only marginally altered, with alterations expressed largely in a biphasic, dose-dependent fashion in terms of smaller cell size, reduced number of nuclei, increased expression of both surface microprojections, and a unique set of crystalloid cytoplasmic inclusions. Functionally, MN-OS appeared to be impaired by irradiation of marrow progenitors, as evidenced by failure to initiate resorptive attachments to devitalized bone spicules in vitro
Orthodontic management of buccally erupted ectopic canine with two case reports
Directory of Open Access Journals (Sweden)
Avesh Sachan
2012-01-01
Full Text Available Ectopic canine teeth develop displaced from their normal position. Any permanent tooth can be ectopic, and the cause may be both genetic and environmental. Orthodontic treatment is justified because ectopic canine teeth can migrate in the jaw bone and may damage the adjacent teeth roots and bone. Orthodontic treatment is also justifiable for aesthetic reasons. Diagnosis and treatment of ectopically erupting permanent maxillary canines requires timely management by the orthodontist. Internal or external root resorption of teeth adjacent to the ectopic canine is the most common sequel. Malocclusion with severe crowding is difficult to treat without extraction. Non-extraction treatment of ectopic canines can compromise the patient′s profile. This article represents two cases of extraction treatment approach for buccally displaced or ectopic canine in a patient with severe crowding in the mandibular arch.
Retrospective radiation dosimetry using electron paramagnetic resonance in canine dental enamel
International Nuclear Information System (INIS)
Khan, Rao F.H.; Pekar, J.; Rink, W.J.; Boreham, D.R.
2005-01-01
Electron paramagnetic resonance (EPR) biodosimetry of human tooth enamel has been widely used for measuring radiation doses in various scenarios. We have now developed EPR dosimetry in tooth enamel extracted from canines. Molars and incisors from canines were cleaned by processing in supersaturated aqueous potassium hydroxide solution. The dosimetric signal in canine tooth enamel was found to increase linearly as a function of laboratory added dose from 0.44±0.02 to 4.42±0.22 Gy. The gamma radiation sensitivity of the canine molar enamel was found to be comparable to that of human tooth enamel. The dosimetric signal in canine enamel has been found to be stable up to at least 6 weeks after in vitro irradiation. A dosimetric signal variation of 10-25% was observed for canines ranging from in age 3 years to 16 year old
Consequences of crown shortening canine teeth in Greenland sled dogs
DEFF Research Database (Denmark)
Kortegaard, H E; Anthony Knudsen, T; Dahl, S
2015-01-01
OBJECTIVES: To evaluate the consequences of crown shortening, focusing on the prevalence of pulp exposure and periapical pathology in Greenland sled dogs that had had their canine crowns shortened at an early age. METHODS: Five cadaver heads and 54 sled dogs underwent an oral examination for dental...... fractures and pulp exposure of canines. All canines were radiographed and evaluated for periapical pathology. RESULTS: The prevalence of canine pulp exposure in 12 (5 heads and 7 dogs) crown shortened dogs was 91 · 7%, and 21 · 3% in 47 not-crown shortened dogs. A significant (P pulp...... exposure of the canines in the crown shortened group compared to the not-crown shortened group was seen with a relative risk of 4 · 3 on a dog basis and a relative risk of 12 · 2 on a tooth basis. In dogs with pulp exposure of canines (n = 51) the prevalence of periapical pathology was 82 · 4%, but only 0...
Dental anomalies associated with buccally- and palatally-impacted maxillary canines.
Sajnani, Anand K; King, Nigel M
2014-08-01
The aim of the present study was to determine the association of both buccally- and palatally-impacted canines with other dental anomalies. This retrospective study was conducted on a population of 533 southern Chinese children and adolescents who had impacted maxillary canines that had been treated in the Paediatric Dentistry and Orthodontics Clinic, Prince Philip Dental Hospital, The University of Hong Kong, Hong Kong. Descriptions of the impacted canine and other associated anomalies were obtained from the case notes and radiographs. Clinical photographs and study casts were used, where available. A total of 253 (47.5%) patients with impacted maxillary canines were diagnosed with other dental anomalies. Microdontia was the most frequently-occurring anomaly reported in these patients, with the maxillary lateral incisor the most commonly affected tooth. Other odontogenic anomalies that were associated with both buccally- and palatally-impacted canines included hypodontia, supernumerary teeth, transposition of other teeth, enamel hypoplasia, other impacted teeth, and dens invaginatus. Both buccally- and palatally-impacted canines were found to be associated with other odontogenic anomalies. © 2013 Wiley Publishing Asia Pty Ltd.
SURVEILLANCE FOR ANTIBODIES AGAINST SIX CANINE VIRUSES IN WILD RACCOONS (PROCYON LOTOR) IN JAPAN.
Aoki, Emiko; Soma, Takehisa; Yokoyama, Mayumi; Matsubayashi, Makoto; Sasai, Kazumi
2017-10-01
Raccoons (Procyon lotor) are found worldwide. They are frequently seen in crowded inner cities as well as in forests or wooded areas, often living in proximity to humans and their pets. We examined sera from 100 wild raccoons in Japan for antibodies to six canine viruses with veterinary significance to assess their potential as reservoirs. We also aimed to understand the distribution of potentially infected wildlife. We found that 7% of samples were seropositive for canine distemper virus (CDV), 10% for canine parvovirus type 2, 2% for canine adenovirus type 1, 6% for canine adenovirus type 2, and 7% for canine coronavirus. No samples were found to be seropositive for canine parainfluenza virus. Seropositivity rates for canine distemper virus and canine parvovirus type 2 were significantly different between areas, and younger raccoons (Canis lupus familiaris), our results suggest that they can act as reservoirs for some of these important canine viruses and might be involved in viral transmission. Further study should include isolation and analysis of canine viruses in wild raccoons from a wider area.
Overexpression of vimentin in canine prostatic carcinoma
DEFF Research Database (Denmark)
Rodrigues, M M P; Rema, A; Gärtner, F
2011-01-01
Canine prostatic tumours exhibit similarities to those of man and may represent a useful model system to explore the mechanisms of cancer progression. Tumour progression to malignancy requires a change from an epithelial phenotype to a fibroblastic or mesenchymal phenotype. Vimentin expression...... is associated with the invasive phenotype of human prostate cancer cells. The aim of the present study was to characterize immunohistochemically the expression of vimentin by canine prostatic carcinomas. Primary carcinomas and metastatic tumour foci both showed vimentin expression. This finding suggests...... that the acquisition of the epithelial-mesenchymal transition phenotype in canine prostatic carcinoma may be characterized by the presence of mesenchymal intermediate filament (vimentin) that could lead to a higher likelihood of metastasis....
Vaccines for Canine Leishmaniasis
Directory of Open Access Journals (Sweden)
Faeze Foroughi-Parvar
2014-01-01
Full Text Available Leishmania infantum is the obligatory intracellular parasite of mammalian macrophages and causes zoonotic visceral leishmaniasis (ZVL. The presence of infected dogs as the main reservoir host of ZVL is regarded as the most important potential risk for human infection. Thus the prevention of canine visceral leishmaniasis (CVL is essential to stop the current increase of the Mediterranean visceral leishmaniasis. Recently considerable advances in achieving protective immunization of dogs and several important attempts for achieving an effective vaccine against CVL lead to attracting the scientists trust in its important role for eradication of ZVL. This paper highlights the recent advances in vaccination against canine visceral leishmaniasis from 2007 until now.
Thiruvenkatachari, Badri; Javidi, Hanieh; Griffiths, Sarah Elizabeth; Shah, Anwar A; Sandler, Jonathan
2017-10-01
Maxillary canines are generally considered important both cosmetically and functionally. Most claims on the importance of maxillary canines, however, have been based on expert opinions and clinician-based studies. There are no scientific studies in the literature reporting on their cosmetic importance or how laypeople perceive a smile treated by maxillary canine extractions. Our objective was to investigate whether there is any difference in the perceptions of patients' smiles treated by extracting either maxillary canines or first premolars, as judged by orthodontists, dentists, and laypeople. This retrospective study included 24 participants who had unilateral or bilateral extraction of maxillary permanent canines and fixed appliances in the maxillary and mandibular arches to comprehensively correct the malocclusion, selected from orthodontic patients treated at Chesterfield Royal Hospital NHS trust in the United Kingdom over the last 20 years. The control group of patients had extraction of maxillary first premolars followed by fixed appliances and finished to an extremely high standard judged by the requirement that they had been submitted for the Membership in Orthodontics examination. The finished Peer Assessment Rating scores for this group were less than 5. The end-of-treatment frontal extraoral smiling and frontal intraoral views were presented for both groups. The photographs were blinded for extraction choice and standardized for size and brightness using computer software (Adobe Photoshop CC version 14.0; Adobe Systems, San Jose, Calif). The work file was converted to an editable pdf file and e-mailed to the assessors. The assessor panel consisted of 30 members (10 orthodontists, 10 dentists, and 10 laypeople), who were purposely selected. The measures were rated on a 10-point Likert scale. The attractiveness ratings were not statistically significantly different between the canine extraction and premolar extraction groups, with a mean difference of 0
Upper canine inclination influences the aesthetics of a smile.
Bothung, C; Fischer, K; Schiffer, H; Springer, I; Wolfart, S
2015-02-01
This current study investigated which angle of canine inclination (angle between canine tooth axis (CA-line) and the line between the lateral canthus and the ipsilateral labial angle (EM-line)) is perceived to be most attractive in a smile. The second objective was to determine whether laymen and dental experts share the same opinion. A Q-sort assessment was performed with 48 posed smile photographs to obtain two models of neutral facial attractiveness. Two sets of images (1 male model set, 1 female model set), each containing seven images with incrementally altered canine and posterior teeth inclinations, were generated. The images were ranked for attractiveness by three groups (61 laymen, 59 orthodontists, 60 dentists). The images with 0° inclination, that is CA-line (maxillary canine axis) parallel to EM-line (the line formed by the lateral canthus and the ipsilateral corner of the mouth) (male model set: 54·4%; female model set: 38·9%), or -5° (inward) inclination (male model set: 20%; female model set: 29·4%) were perceived to be most attractive within each set. Images showing inward canine inclinations were regarded to be more attractive than those with outward inclinations. Dental experts and laymen were in accordance with the aesthetics. Smiles were perceived to be most attractive when the upper canine tooth axis was parallel to the EM-line. In reconstructive or orthodontic therapy, it is thus important to incline canines more inwardly than outwardly. © 2014 John Wiley & Sons Ltd.
Treatment modalities of palatal impacted canines
Dimova, Cena; Papakoca, Kiro; Ristoska, Sonja; Kovacevska, Ivona
2012-01-01
Introduction: The orthodontic treatment of impacted maxillary canine remains a challenge to today’s clinicians. The treatment of this clinical entity usually involves surgical exposure of the impacted tooth, followed by orthodontic traction to guide and align it into the dental arch. The impacted palatal canine requires a combination of both treatment modalities: orthodontic management and oral surgical treatment. Two types of approach are commonly used: simple exposure, or exposure with brac...
Oz, A Z; Ciger, S
2018-03-01
The aim of the present study was to evaluate the changes of incisor root resorption associated with impacted maxillary canines and health of periodontal tissues around maxillary canines erupted with orthodontic treatment. Twenty patients with a unilateral palatally impacted maxillary canine were included in the study. Cone-beam computed tomography images taken before and after orthodontic treatment were compared with the contralateral canines serving as control teeth. Root resorption was present in 10% of central and 40% of lateral incisors before treatment. After treatment, the incidence of resorption decreased. The thickness of the buccal bone surrounding the impacted canines was similar to that surrounding the contralateral canines, except in the apical area. Periodontal pocket depth and alveolar bone loss were greater for the impacted canine teeth than for the contralateral canines. Incisor root resorption associated with impacted canine teeth showed signs of repair after orthodontic treatment. Slight differences related to periodontal health were found between the previously impacted teeth and contralateral canine teeth.
Directory of Open Access Journals (Sweden)
Yang Qiang
2014-01-01
Full Text Available This study was aimed to develop an ECM-derived biphasic scaffold and to investigate its regeneration potential loaded with BM-MSCs in repair of large, high-load-bearing osteochondral defects of the canine femoral head. The scaffolds were fabricated using cartilage and bone ECM as a cartilage and bone layer, respectively. Osteochondral constructs were fabricated using induced BM-MSCs and the scaffold. Osteochondral defects (11 mm diameter × 10 mm depth were created on femoral heads of canine and treated with the constructs. The repaired tissue was evaluated for gross morphology, radiography, histological, biomechanics at 3 and 6 months after implantation. Radiography revealed that femoral heads slightly collapsed at 3 months and severely collapsed at 6 months. Histology revealed that some defects in femoral heads were repaired, but with fibrous tissue or fibrocartilage, and femoral heads with different degrees of collapse. The bone volume fraction was lower for subchondral bone than normal femoral bone at 3 and 6 months. Rigidity was lower in repaired subchondral bone than normal femoral bone at 6 months. The ECM-derived, biphasic scaffold combined with induced BM-MSCs did not successfully repair large, high-load-bearing osteochondral defects of the canine femoral head. However, the experience can help improve the technique of scaffold fabrication and vascularization.
Comprehensive characterization of commercially available canine training aids.
Tipple, Christopher A; Caldwell, Patricia T; Kile, Brian M; Beussman, Douglas J; Rushing, Blake; Mitchell, Natalie J; Whitchurch, Christian J; Grime, Martin; Stockham, Rex; Eckenrode, Brian A
2014-09-01
Effective and reliable training aids for victim recovery canine teams is essential for law enforcement and investigative purposes. Without adequate training aids, the rate of recovery for sub surface or surface human remains deposition using canine teams may be adversely affected and result in confusing information. The composition of three commercially available canine training aids that purportedly generate volatile components responsible for the odor of human decomposition is relatively simple and not closely related to those compounds experimentally determined to be present at the site of surface or sub-surface human remains. In this study, these different commercial formulations were chemically characterized using six different sampling approaches, including two applications of direct liquid injection, solid-phase microextraction (SPME), purge and trap, ambient preconcentration/thermal desorption, and cryogenic preconcentration/thermal desorption. Direct liquid injections resulted in the fewest number of detected compounds, while a cryogen based thermal desorption method detected the greatest number of compounds in each formulation. Based solely upon the direct liquid injection analysis, Pseudo™ Scent I was composed of approximately 29±4% and 71±5% of 2-pyrrolidinone and 4-aminobutanoic acid, respectively. This same analysis showed that Pseudo™ Scent II was composed of approximately 11±1, 11±1, 24±5, and 54±7% of putrescine, cadaverine, 2-pyrrolidinone, and 4-aminobutanoic acid, respectively. Headspace analysis was conducted to more closely simulate the process whereby a canine's nose would capture a volatiles profile. More compounds were detected using the headspace sampling method; however, the vast majority was not consistent with current data on human decomposition. Additionally, the three formulations were tested in outdoor and indoor scenarios by a double-blinded canine team, using a certified and specifically trained victim recovery canine
In-vitro antiviral efficacy of ribavirin and interferon-alpha against canine distemper virus.
Carvalho, Otávio V; Saraiva, Giuliana L; Ferreira, Caroline G T; Felix, Daniele M; Fietto, Juliana L R; Bressan, Gustavo C; Almeida, Márcia R; Silva Júnior, Abelardo
2014-10-01
Canine distemper is a highly contagious disease with high incidence and lethality in the canine population. The objective of this study was to evaluate the efficacy of antiviral action with ribavirin (RBV), interferon-alpha (IFNα), and combinations of RBV and IFNα against canine distemper virus (CDV). Vero cells inoculated with CDV were treated with RBV, IFNα, and combinations of these drugs. The efficacy to inhibit viral replication was evaluated by adding the compounds at different times to determine which step of the viral replicative process was affected. Both drugs were effective against CDV in vitro. The IFNα was the most active compound, with an average IC50 (50% inhibitory concentration) value lower than the IC50 of the RBV. Ribavirin (RBV) was more selective than IFNα, however, and neither drug showed extracellular antiviral activity. The combination of RBV and IFNα exhibited antiviral activity for the intra- and extracellular stages of the replicative cycle of CDV, although the intracellular viral inhibition was higher. Both RBV and IFNα showed high antiviral efficacy against CDV, and furthermore, RBV + IFNα combinations have shown greater interference range in viral infectivity. These compounds could potentially be used to treat clinical disease associated with CDV infection.
Optimization of Dithionite Bleaching of High Yield Bagasse Pulp
International Nuclear Information System (INIS)
Mohamed, E.
2005-01-01
High yield bagasse pulp was prepared by soaking bagasse in 10 % cold sodium hydroxide for 24 hours and then refluxing for two hours at 95 degree C. Optimization of dithionite bleaching was attained by investigation of different parameters as consistency, temperature, time and ph. Effect of additives as chelating agent (EDTA) or stabilizing of bleaching solution (Zn compound and hexamethylene tetramine) was considered. The effect of air content was also studied. One and two stages bleaching of the pulp were investigated by using sodium dithionite (D) as a sole bleaching agent or after application of one stage bleaching by hydrogen peroxide to attain high brightness for high yield pulp
Rika-Heke, Tamara; Kelman, Mark; Ward, Michael P
2015-07-01
The aim of this study was to describe the association between climate, weather and the occurrence of canine tick paralysis, feline tick paralysis and canine parvovirus in Australia. The Southern Oscillation Index (SOI) and monthly average rainfall (mm) data were used as indices for climate and weather, respectively. Case data were extracted from a voluntary national companion animal disease surveillance resource. Climate and weather data were obtained from the Australian Government Bureau of Meteorology. During the 4-year study period (January 2010-December 2013), a total of 4742 canine parvovirus cases and 8417 tick paralysis cases were reported. No significant (P ≥ 0.05) correlations were found between the SOI and parvovirus, canine tick paralysis or feline tick paralysis. A significant (P parvovirus occurrence and rainfall in the same month (0.28), and significant negative cross-correlations (-0.26 to -0.36) between parvovirus occurrence and rainfall 4-6 months previously. Significant (P canine tick paralysis occurrence and rainfall 1-3 months previously, and significant positive cross-correlations (0.29-0.47) between canine tick paralysis occurrence and rainfall 7-10 months previously. Significant positive cross-correlations (0.37-0.68) were found between cases of feline tick paralysis and rainfall 6-10 months previously. These findings may offer a useful tool for the management and prevention of tick paralysis and canine parvovirus, by providing an evidence base supporting the recommendations of veterinarians to clients thus reducing the impact of these diseases. Copyright © 2015 Elsevier Ltd. All rights reserved.
BMI1 is expressed in canine osteosarcoma and contributes to cell growth and chemotherapy resistance.
Directory of Open Access Journals (Sweden)
Mehdi Hayat Shahi
Full Text Available BMI1, a stem cell factor and member of the polycomb group of genes, has been shown to contribute to growth and chemoresistance of several human malignancies including primary osteosarcoma (OSA. Naturally occurring OSA in the dog represents a large animal model of human OSA, however the potential role of BMI1 in canine primary and metastatic OSA has not been examined. Immunohistochemical staining of canine primary and metastatic OSA tumors revealed strong nuclear expression of BMI1. An identical staining pattern was found in both primary and metastatic human OSA tissues. Canine OSA cell lines (Abrams, Moresco, and D17 expressed high levels of BMI1 compared with canine osteoblasts and knockdown or inhibition of BMI1 by siRNA or by small molecule BMI1-inhibitor PTC-209 demonstrated a role for BMI1 in canine OSA cell growth and resistance to carboplatin and doxorubicin chemotherapy. These findings suggest that inhibition of BMI1 in primary or metastatic OSA may improve response to chemotherapy and that the dog may serve as a large animal model to evaluate such therapy.
High-resolution mapping of yield curve shape and evolution for high porosity sandstones
Bedford, J. D.; Faulkner, D.; Wheeler, J.; Leclere, H.
2017-12-01
The onset of permanent inelastic deformation for porous rock is typically defined by a yield curve plotted in P-Q space, where P is the effective mean stress and Q is the differential stress. Sandstones usually have broadly elliptical shaped yield curves, with the low pressure side of the ellipse associated with localized brittle faulting (dilation) and the high pressure side with distributed ductile deformation (compaction). However recent works have shown that these curves might not be perfectly elliptical and that significant evolution in shape occurs with continued deformation. We therefore use a novel stress-probing methodology to map in high-resolution the yield curve shape for Boise and Idaho Gray sandstones (36-38% porosity) and also investigate curve evolution with increasing deformation. The data reveal yield curves with a much flatter geometry than previously recorded for porous sandstone and that the compactive side of the curve is partly comprised of a near vertical limb. The yield curve evolution is found to be strongly dependent on the nature of inelastic strain. Samples that were compacted under a deviatoric load, with a component of inelastic shear strain, were found to have yield curves with peaks that are approximately 50% higher than similar porosity samples that were hydrostatically compacted (i.e. purely volumetric strain). The difference in yield curve evolution along the different loading paths is attributed to mechanical anisotropy that develops during deviatoric loading by the closure of preferentially orientated fractures. Increased shear strain also leads to the formation of a plateau at the peak of the yield curve as samples deform along the deviatoric loading path. These results have important implications for understanding how the strength of porous rock evolves along different stress paths, including during fluid extraction from hydrocarbon reservoirs where the stress state is rarely isotropic.
BACTERIAL PROFILE OF NECROTIC PULPS IN CHEETAH (ACINONYX JUBATUS) CANINE TEETH.
Almansa Ruiz, José C; Bosman, Anna-Mari; Steenkamp, Gerhard
2016-03-01
The role of microbes and their antimicrobial susceptibilities in both acute and chronic infections of the dental pulp in humans has been well studied. Presently, no data are available on endodontic pathogens in cheetahs (Acinonyx jubatus). The aim of this study was to isolate and identify the bacteria found in the canine teeth of cheetahs, where the pulp was necrotic and exposed due to a complicated crown fracture. Thirty-six microbiologic samples were taken from root canals (RCs) of the canine teeth of 19 cheetahs: one pulp sample was taken from 10 cheetahs, four samples from 2 cheetahs, two samples from 3 cheetahs, and three samples from 4 cheetahs. Exposed pulps were cultured for aerobic and anaerobic bacteria; an additional screening with a 16S rRNA-specific polymerase chain reaction (PCR) was used for the last six samples. Antimicrobial susceptibility of isolates was determined by use of the Kirby-Bauer diffusion test. In total, 59 cultivable isolates belonging to 19 microbial species and 13 genera were recovered from the 36 RCs sampled. Only two samples yielded no cultivable bacteria. Thirty-two (54.49%) of the cultivable isolates were Gram positive and 27 (45.71%) were Gram negative. The maximum number of isolates cultivated from an individual RC was six. Facultative anaerobes (62.72%) were the most common bacteria of the RCs that yielded cultivable bacteria. Of the isolates, 28.81% were aerobic and 8.47% were strict anaerobes. The antimicrobials that showed the greatest efficacy in vitro against the different bacteria isolates were amikacin and gentamicin. The more common bacterial species isolated by PCR were anaerobes (60.8%), facultative anaerobes (30.2%), and aerobes (8.6%).
Povey, C.
1982-01-01
A parvovirus of canine origin, cultured in a feline kidney cell line, was inactivated with formalin. Three pilot serials were produced and three forms of finished vaccine (nonadjuvanted, single adjuvanted and double adjuvanted) were tested in vaccination and challenge trials. A comparison was also made with two inactivated feline panleukopenia virus vaccines, one of which has official approval for use in dogs. The inactivated canine vaccine in nonadjuvanted, adjuvanted or double adjuvanted fo...
Nayak, Reshma; Nayak, Us Krishna; Hegde, Gautam
2010-01-01
Orthodontic diagnosis and treatment planning for growing children must involve growth prediction, especially in the treatment of skeletal problems. Studies have shown that a strong association exists between skeletal maturity and dental calcification stages. The present study was therefore taken up to provide a simple and practical method for assessing skeletal maturity using a dental periapical film and standard dental X-ray machine, to compare the developmental stages of the mandibular canine with that of developmental stages of modified MP3 and to find out if any correlation exists, to determine if the developmental stages of the mandibular canine alone can be used as a reliable indicator for assessment of skeletal maturity. A total of 160 periapical radiographs (80 males and 80 females), of the mandibular right canine and the MP3 region was taken and assessed according to the Dermirjian's stages of dental calcification and the modified MP3 stages. The correlation between the developmental stages of MP3 and the mandibular right canine in male and female groups, is of high statistical significance (p = 0.001). The correlation coefficient between MP3 stages and developmental stages of mandibular canine and chronological age in male and females was found to be not significant. The correlation between the mandibular canine calcification stages and MP3 stages was found to be significant. The developmental stages of the mandibular canine could be used very reliably as a sole indicator for assessment of skeletal maturity.
Morello, Emanuela; Martano, Marina; Buracco, Paolo
2011-09-01
Osteosarcoma (OSA) is the most common primary bone tumour in dogs. The appendicular locations are most frequently involved and large to giant breed dogs are commonly affected, with a median age of 7-8 years. OSA is a locally invasive neoplasm with a high rate of metastasis, mostly to the lungs. Due to similarities in biology and treatment of OSA in dogs and humans, canine OSA represents a valid and important tumour model. Differences between canine and human OSAs include the age of occurrence (OSA is most commonly an adolescent disease in humans), localisation (the stifle is the most common site of localisation in humans) and limited use of neoadjuvant chemotherapy in canine OSA. Copyright © 2010 Elsevier Ltd. All rights reserved.
Evaluation of post-vaccination immunity to canine distemper and ...
African Journals Online (AJOL)
SERVER
2007-08-20
Aug 20, 2007 ... Key words: Immunoblot ELISA, post-vaccination immunity, canine distemper, parvoviruses. INTRODUCTION. Canine ..... NGOs and other government agencies to fund and intensify ... Vaccination Programs for Dogs. In: recent ...
Killey, R; Mynors, C; Pearce, R; Nell, A; Prentis, A; Day, M J
2018-01-01
To determine the utility of an in-practice test kit to detect protective serum antibody against canine distemper virus, canine adenovirus and canine parvovirus type 2 in a sample of the UK dog population. Serum samples from 486 dogs, last vaccinated between less than 1 month and 124 months previously, were tested with the VacciCheck™ test kit for protective antibodies against distemper, adenovirus and parvovirus type 2. A high proportion of the dogs tested (93·6%) had protective antibody against all three of the core vaccine antigens: 95·7% of the dogs were seropositive against canine distemper virus, 97·3% against canine adenovirus and 98·5% against canine parvovirus type 2. The small number of dogs that were seronegative for one or more of the antigens (n = 31) may have had waning of previous serum antibody or may have been rare genetic non-responders to that specific antigen. UK veterinarians can be reassured that triennial revaccination of adult dogs with core vaccines provides long-lived protective immunity. In-practice serological test kits are a valuable tool for informing decision-making about canine core revaccination. © 2017 British Small Animal Veterinary Association.
Automation of gender determination in human canines using artificial intelligence
Directory of Open Access Journals (Sweden)
F. Fidya
2017-09-01
Full Text Available Background: Gender determination is an important aspect of the identification process. The tooth represents a part of the human body that indicates the nature of sexual dimorphism. Artificial intelligence enables computers to perform to the same standard the same tasks as those carried out by humans. Several methods of classification exist within an artificial intelligence approach to identifying sexual dimorphism in canines. Purpose: This study aimed to quantify the respective accuracy of the Naive Bayes, decision tree, and multi-layer perceptron (MLP methods in identifying sexual dimorphism in canines. Methods: A sample of results derived from 100 measurements of the diameter of mesiodistal, buccolingual, and diagonal upper and lower canine jaw models of both genders were entered into an application computer program that implements the algorithm (MLP. The analytical process was conducted by the program to obtain a classification model with testing being subsequently carried out in order to obtain 50 new measurement results, 25 each for males and females. A comparative analysis was conducted on the program-generated information. Results: The accuracy rate of the Naive Bayes method was 82%, while that of the decision tree and MLP amounted to 84%. The MLP method had an absolute error value lower than that of its decision tree counterpart. Conclusion: The use of artificial intelligence methods produced a highly accurate identification process relating to the gender determination of canine teeth. The most appropriate method was the MLP with an accuracy rate of 84%.
Canine as a biomedical research model: immunological, hematological, and oncological aspects
International Nuclear Information System (INIS)
Shifrine, M.; Wilson, F.D.
1980-01-01
The canine has been used as a biomedical research model in radiation studies by a number of laboratories supported primarily by the US Department of Energy and its predecessors. These studies were unique in that they covered the life spans of the canines and permitted the collection of data from birth to death under controlled conditions. Since these were multiparametric studies, an extensive data base has been established, not the least of which are normative values covering all biologic systems, including immunohematology. The canine model has also been extensively used by other groups, such as transplantation biologists. The virtues of the canine as a model in these and many other endeavors are becoming increasingly more apparent with the passing of time. One of the primary goals of this volume was to compile the knowledge and experience of researchers using the canine model and to focus their expertise on furthering the use of the canine for studies in immunology, hematology, and oncology. We have attempted to present some of the contemporary, diverse uses of the canine in biomedical research, emphasizing immunologic endpoints, and also to present in detail some of the latest technology used in such studies
High yielding rice mutants for West Bengal
International Nuclear Information System (INIS)
Debnath, A.R.; Sen, S.
1980-01-01
Four high yielding mutants with specific genetic corrections of the simply inherited characters were developed from IR-8 through X-irradiation. Recurrent selections of the promising isolates were made under diverse agro-climatic conditions in Winter and Summer seasons of West Bengal. The isolates CNM 6 and CNM 25 belonging to early maturity group and CNM 20 and CNM 31, to mid-early maturity group were finally selected at X 5 generation on the basis of their resistance qualities, maturity period and grain yield. They were evaluated upto X 10 qeneration at multi-locations as Pre-release and Minikit Varieties at State level. They were also placed at the National Screening Nursery (NSN) for screening against multiple diseases and pests at the National level. CNM 6 is reported to be promising in IRTP nurseries. It is reported that CNM 25 (IET 5646) ranked 2nd on the basis of average grain yield, CNM 20 (IET 5937) and CNM 31 (IET 5936) were resistant to diseases and with yield comparable to Jaya. These four productive mutants of superior types are widely accepted. CNM 6 is recommended for cultivation in Bankura and Birbhum districts and CNM 25 and CNM 31 in the different agro-climatic zones of West Bengal. (author)
Canine parvovirus in asymptomatic feline carriers.
Clegg, S R; Coyne, K P; Dawson, S; Spibey, N; Gaskell, R M; Radford, A D
2012-05-25
Canine parvovirus (CPV) and feline panleukopaenia virus (FPLV) are two closely related viruses, which are known to cause severe disease in younger unvaccinated animals. As well as causing disease in their respective hosts, CPV has recently acquired the feline host range, allowing it to infect both cats and dogs. As well as causing disease in dogs, there is evidence that under some circumstances CPV may also cause disease in cats. This study has investigated the prevalence of parvoviruses in the faeces of clinically healthy cats and dogs in two rescue shelters. Canine parvovirus was demonstrated in 32.5% (13/50) of faecal samples in a cross sectional study of 50 cats from a feline only shelter, and 33.9% (61/180) of faecal samples in a longitudinal study of 74 cats at a mixed canine and feline shelter. Virus was isolated in cell cultures of both canine and feline origin from all PCR-positive samples suggesting they contained viable, infectious virus. In contrast to the high CPV prevalence in cats, no FPLV was found, and none of 122 faecal samples from dogs, or 160 samples collected from the kennel environment, tested positive for parvovirus by PCR. Sequence analysis of major capsid VP2 gene from all positive samples, as well as the non-structural gene from 18 randomly selected positive samples, showed that all positive cats were shedding CPV2a or 2b, rather than FPLV. Longitudinally sampling in one shelter showed that all cats appeared to shed the same virus sequence type at each date they were positive (up to six weeks), despite a lack of clinical signs. Fifty percent of the sequences obtained here were shown to be similar to those recently obtained in a study of sick dogs in the UK (Clegg et al., 2011). These results suggest that in some circumstances, clinically normal cats may be able to shed CPV for prolonged periods of time, and raises the possibility that such cats may be important reservoirs for the maintenance of infection in both the cat and the dog
Bagshaw, Clarence; Isdell, Allen E; Thiruvaiyaru, Dharma S; Brisbin, I Lehr; Sanchez, Susan
2014-06-01
More than thirty years have passed since canine parvovirus (CPV) emerged as a significant pathogen and it continues to pose a severe threat to world canine populations. Published information suggests that flies (Diptera) may play a role in spreading this virus; however, they have not been studied extensively and the degree of their involvement is not known. This investigation was directed toward evaluating the vector capacity of such flies and determining their potential role in the transmission and ecology of CPV. Molecular diagnostic methods were used in this cross-sectional study to detect the presence of CPV in flies trapped at thirty-eight canine facilities. The flies involved were identified as belonging to the house fly (Mucidae), flesh fly (Sarcophagidae) and blow/bottle fly (Calliphoridae) families. A primary surveillance location (PSL) was established at a canine facility in south-central South Carolina, USA, to identify fly-virus interaction within the canine facility environment. Flies trapped at this location were pooled monthly and assayed for CPV using polymerase chain reaction (PCR) methods. These insects were found to be positive for CPV every month from February through the end of November 2011. Fly vector behavior and seasonality were documented and potential environmental risk factors were evaluated. Statistical analyses were conducted to compare the mean numbers of each of the three fly families captured, and after determining fly CPV status (positive or negative), it was determined whether there were significant relationships between numbers of flies captured, seasonal numbers of CPV cases, temperature and rainfall. Flies were also sampled at thirty-seven additional canine facility surveillance locations (ASL) and at four non-canine animal industry locations serving as negative field controls. Canine facility risk factors were identified and evaluated. Statistical analyses were conducted on the number of CPV cases reported within the past year
Feeding ecology and morphology of the upper canines in bears (carnivora: Ursidae).
Christiansen, Per
2008-07-01
The morphology and mechanical strength of the upper canines in all eight extant species of ursids is analyzed, and the findings are discussed in relation to feeding ecology. Ursids have proportionally smaller canines than other large carnivores with a specialized feeding ecology, such as large felids, and the upper canine morphology is both canid-like and felid-like. The giant panda is the most divergent species, and its short, blunt, and cone-like canines appear well adapted for tearing into bamboo. The almost equally herbivorous spectacled bear has a less derived canine morphology. The large canines of the sun bear are divergent from other ursine ursids, and may be an adaptation for tearing open tree trunks in search of insects. Discriminant Analysis is successful in separating ursid species on the basis of canine morphology, but the canines of ursine ursids, and also of the spectacled bear, show greater resemblance among the species than the marked differences in feeding ecology would suggest. This could be in part due to a short evolutionary history, and in part due to canines not having been subjected to much evolutionary selection as has been the case among other large carnivores, such as large felids. Ursids are probably evolutionarily and ecologically successful due to physical size and strength rather than a derived craniodental anatomy. Copyright 2008 Wiley-Liss, Inc.
Taguchi, Masayuki; Namikawa, Kazuhiko; Maruo, Takuya; Saito, Miyoko; Lynch, Jonathan; Sahara, Hiroeki
2012-10-01
The objective of this study was to determine whether post-vaccination antibody titers vary according to body weight in adult dogs. Antibody titers against canine parvovirus type 2 (CPV-2), canine distemper virus (CDV), and canine adenovirus type 1 (CAdV-1) were measured for 978 domestic adult dogs from 2 to 6 y of age. The dogs had been vaccinated approximately 12 mo earlier with a commercial combination vaccine. The dogs were divided into groups according to their weight. It was found that mean antibody titers in all weight groups were sufficient to prevent infection. Intergroup comparison, however, revealed that CPV-2 antibody titers were significantly higher in the Super Light ( 20 kg) groups and were also significantly higher in the Light (5 to 9.9 kg) group than in the Heavy group. Antibody titers against CDV were significantly higher in the Super Light, Light, and Medium groups than in the Heavy group. There were no significant differences among the groups for the CAdV-1 antibody titers.
American Canine Hepatozoonosis
Ewing, S. A.; Panciera, R. J.
2003-01-01
American canine hepatozoonosis (ACH) is a tick-borne disease that is spreading in the southeastern and south-central United States. Characterized by marked leukocytosis and periosteal bone proliferation, ACH is very debilitating and often fatal. Dogs acquire infection by ingesting nymphal or adult Gulf Coast ticks (Amblyomma maculatum) that, in a previous life stage, ingested the parasite in a blood meal taken from some vertebrate intermediate host. ACH is caused by the apicomplexan Hepatozoon americanum and has been differentiated from Old World canine hepatozoonosis caused by H. canis. Unlike H. canis, which is transmitted by the ubiquitous brown dog tick (Rhipicephalus sanguineus), H. americanum is essentially an accidental parasite of dogs, for which Gulf Coast ticks are not favored hosts. The geographic portrait of the disease parallels the known distribution of the Gulf Coast tick, which has expanded in recent years. Thus, the endemic cycle of H. americanum involves A. maculatum as definitive host and some vertebrate intermediate host(s) yet to be identified. Although coyotes (Canis latrans) are known to be infected, it is not known how important this host is in maintaining the endemic cycle. This review covers the biology of the parasite and of the tick that transmits it and contrasts ACH with classical canine hepatozoonosis. Clinical aspects of the disease are discussed, including diagnosis and treatment, and puzzling epidemiologic issues are examined. Brief consideration is given to the potential for ACH to be used as a model for study of angiogenesis and of hypertrophic osteoarthropathy. PMID:14557294
High ethanol yields using Aspergillus oryzae koji and corn media
Energy Technology Data Exchange (ETDEWEB)
Ziffer, J.; Iosif, M.C.
1982-01-01
High ethanol and stillage solids were achieved using whole corn mashes. Ethanol yields of 14% (98.5% of theory) and stillage levels of approximately 23% were obtained in 74-90 hours using mild acid pretreatment with A. oryzae wheat bran koji saccharification. High ethanol yields were also obtained with bacterial amylase, instead of the acid treatment, when the sterilization step was omitted. The implications of ethanol fermentation process modifications are explored.
uPAR EXPRESSION IN CANINE NORMAL PROSTATE AND WITH PROLIFERATIVE DISORDERS
Directory of Open Access Journals (Sweden)
Mariana Rodrigues Faleiro
2013-06-01
Full Text Available Prostatic lesions such as prostatic intraepithelial neoplasia (PIN and proliferative inflammatory atrophy (PIA are studied in human and canine species due to their malignance potential. The plasminogen activator (PA system has been suggested to play a central role in cell adhesion, angiogenesis, inflammation, and tumor invasion. The urokinase-type plasminogen activator receptor (uPAR is a component of the PA, with a range of expression in tumor and stromal cells. In this study, uPAR expression in both canine normal prostates and with proliferative disorders (benign prostatic hyperplasia-BPH, proliferative inflammatory atrophy-PIA, prostatic intraepithelial neoplasia-PIN, and carcinoma-PC was evaluated by immunohistochemistry in a tissue microarray (TMA slide to establish the role of this enzyme in extracellular matrix (ECM remodeling and in the processes of tissue invasion. A total of 298 cores and 355 diagnoses were obtained, with 36 (10.1% normal prostates, 46 (13.0% with BPH, 128 (36.1% with PIA, 74 (20.8% with PIN and 71 (20.0% with PC. There is variation in the expression of uPAR in canine prostate according to the lesion, with lower expression in normal tissue and with BPH, and higher expression in tissue with PIA, PIN and PC. The high expression of uPAR in inflammatory and neoplastic microenvironment indicates increased proteolytic activity in canine prostates with PIA, PIN, and PC.
National clinical guidelines for management of the palatally ectopic maxillary canine.
Husain, J; Burden, D; McSherry, P; Morris, D; Allen, M
2012-08-01
This review summarises updated clinical guidelines produced by the Clinical Standards Committee of the Faculty of Dental Surgery, Royal College of Surgeons of England (FDSRCS). This guideline on the management of the palatally ectopic maxillary canine illustrates the information contained in the recently updated online version. The timely recognition of ectopic canines is important for the overall management of the dentition. This review illustrates five management strategies for ectopic permanent canines: interceptive treatment by extraction of the deciduous canine, surgical exposure and orthodontic alignment, surgical removal of the palatally ectopic permanent canine, auto-transplantation and no active treatment/leave and observe. The current available evidence for each of these management options has been evaluated and awarded a grade used by the Scottish Intercollegiate Guidelines Network.
Orthodontic-surgical treatment of four impacted canines in an adult patient: A case report.
Pavlović, Jasna; Tabaković, Saša Z; Simić, Sanja; Vujačić, Amila; Vukićević, Vladanka
2016-07-01
Full impaction of canines, in both jaws, is a rare phenomenon. It is usually coupled with the persistence of deciduous canines, or any other irregularity in the dental arch. Panoramic radiograph of a 24-year-old female patient showed bilateral canine impaction in both jaws. Due to vestibular, apical and medial position of canines in the upper jaw, the surgical approach implied the apically positioned flap technique. The position of impacted mandibular canines was vertical with more coronal position relative to the upper canines, thus requiring a closed eruption technique. Inadequate position of impacted canines in the bone fully justifies the use of orthodontic-surgical treatment.
Chon, E.; Thompson, V.; Schmid, S.; Stein, T. J.
2012-01-01
Summary Canine malignant melanoma is a highly aggressive tumour associated with a poor overall survival rate due to both local disease recurrence and its highly metastatic nature. Similar to advanced melanoma in man, canine oral melanoma is poorly responsive to conventional anti-cancer therapies. The lack of sustainable disease control warrants investigation of novel therapies, preferably targeting features specific to the tumour and different from normal cells. The Wnt signalling pathway is known to contribute to melanocytic lineage development in vertebrates and perturbation of the Wnt/β-catenin pathway has been implicated in numerous cancer types. Alterations of the Wnt/β-catenin pathway are suggested to occur in a subset of human melanomas, although the precise role of the Wnt/β-catenin pathway in melanoma is yet to be defined. This study investigates the activation status of the canonical Wnt/β-catenin pathway in canine malignant melanoma and its potential as a therapeutic target for treating this disease. The data indicate canonical Wnt/β-catenin pathway activation is a rare event in canine oral malignant melanoma tissue and canine malignant melanoma cell lines. PMID:22901430
Severe canine distemper outbreak in unvaccinated dogs in Mozambique
Directory of Open Access Journals (Sweden)
Julieta Zacarias
2016-07-01
Full Text Available Although significant animal suffering caused by preventable diseases is frequently seen in developing countries, reports of this are scarce. This report describes avoidable animal suffering owing to a suspected canine distemper (CD outbreak in unvaccinated dogs owned by low-income families in Mozambique that killed approximately 200 animals. Affected dogs exhibited clinical signs, and gross and microscopic lesions compatible with CD. Immunohistochemical staining confirmed the presence of canine distemper virus (CDV in the kidney of one dog from the cohort. This brief communication again illustrates that large outbreaks of CDV in unvaccinated dogs occur and that large-scale avoidable suffering and threats to the health of dogs and wild canines continue. Mass vaccination supported by government and non-government organisations is recommended. Keywords: Canine distemper; dogs; outbreak; animal welfare; Mozambique
Management of an Unusual Ectopic Eruption of Maxillary Canine.
Aileni, Kaladhar Reddy; Rachala, Madhukar Reddy; Prathima, Chintakunta Reddy; Naveen, Pitalla Kumar; Soujanya, Donthula
2017-05-01
Transposition of teeth is a rare condition, with a prevalence of 0.3-0.4% in general population. They are more commonly observed in females, and may occur unilaterally/bilaterally with greater frequency of left side occurrence in unilateral transposition cases. A 17-year-old female patient reported with the chief complaint of unaesthetic smile. On clinical examination the patient was diagnosed with Angle's class I malocclusion with an ectopically erupted maxillary left canine labial to the left central incisor with retained deciduous canine. The treatment plan decided was to extract the retained deciduous canine, level and align the ectopic canine using an R-loop. The treatment for the patient was finished in 14 months and was retained using a fixed lingual retainer in the upper and lower arches.
Yield-determining factors in high-solids enzymatic hydrolysis of lignocellulose
Directory of Open Access Journals (Sweden)
Felby Claus
2009-06-01
Full Text Available Abstract Background Working at high solids (substrate concentrations is advantageous in enzymatic conversion of lignocellulosic biomass as it increases product concentrations and plant productivity while lowering energy and water input. However, for a number of lignocellulosic substrates it has been shown that at increasing substrate concentration, the corresponding yield decreases in a fashion which can not be explained by current models and knowledge of enzyme-substrate interactions. This decrease in yield is undesirable as it offsets the advantages of working at high solids levels. The cause of the 'solids effect' has so far remained unknown. Results The decreasing conversion at increasing solids concentrations was found to be a generic or intrinsic effect, describing a linear correlation from 5 to 30% initial total solids content (w/w. Insufficient mixing has previously been shown not to be involved in the effect. Hydrolysis experiments with filter paper showed that neither lignin content nor hemicellulose-derived inhibitors appear to be responsible for the decrease in yields. Product inhibition by glucose and in particular cellobiose (and ethanol in simultaneous saccharification and fermentation at the increased concentrations at high solids loading plays a role but could not completely account for the decreasing conversion. Adsorption of cellulases was found to decrease at increasing solids concentrations. There was a strong correlation between the decreasing adsorption and conversion, indicating that the inhibition of cellulase adsorption to cellulose is causing the decrease in yield. Conclusion Inhibition of enzyme adsorption by hydrolysis products appear to be the main cause of the decreasing yields at increasing substrate concentrations in the enzymatic decomposition of cellulosic biomass. In order to facilitate high conversions at high solids concentrations, understanding of the mechanisms involved in high-solids product inhibition
Cardiac involvement in canine babesiosis : review article
Directory of Open Access Journals (Sweden)
R.G. Lobetti
2005-06-01
Full Text Available Cardiac dysfunction in canine babesiosis has traditionally been regarded as a rare complication, with the majority of lesions reported as incidental findings at post-mortem examination. Recent studies have, however, demonstrated cardiac lesions in canine babesiosis. Cardiac troponins, especially troponin I, are sensitive markers of myocardial injury in canine babesiosis, and the magnitude of elevation of plasma troponin I concentrations appears to be proportional to the severity of the disease. ECG changes in babesiosis are similar to the pattern described for myocarditis and myocardial ischaemia and together with histopathological findings indicate that the heart suffers from the same pathological processes described in other organs in canine babesiosis, namely inflammation and hypoxia. The clinical application of the ECG appears to be limited and thus cardiovascular assessment should be based on functional monitoring rather than an ECG tracing. On cardiac histopathology from dogs that succumbed to babesiosis, haemorrhage, necrosis, inflammation and fibrin microthrombi in the myocardium were documented, all of which would have resulted in ECG changes and elevations in cardiac troponin. Myocardial damage causes left ventricular failure, which will result in hypotension and an expansion of the plasma volume due to homeostatic mechanisms.
The Ondersteport Canine distemper virus strain and measles ...
African Journals Online (AJOL)
Three groups of dogs aged three months each were used in an experiment to assess efficacy of imported Canine distemper vaccine (Ondersteport strain) and measles vaccine in protecting Nigerian dogs against local isolates of Canine distemper virus. Each group consisted of four randomly selected puppies. One group ...
Management of an impacted and transposed maxillary canine
Directory of Open Access Journals (Sweden)
Deepti A
2010-03-01
Full Text Available Maxillary canine-lateral incisor transposition is a relatively rare anomaly, with both dental and facial esthetic implications. This is a case report of a maxillary canine-lateral incisor transposition that was successfully treated by surgical-orthodontic treatment followed by esthetic reshaping of the involved teeth.
Canine and incisor microwear in pitheciids and Ateles reflects documented patterns of tooth use.
Delezene, Lucas K; Teaford, Mark F; Ungar, Peter S
2016-09-01
Platyrrhine species differ in the extent to and the manner in which they use their incisors and canines during food ingestion. For example, Ateles uses its anterior teeth to process mechanically nondemanding soft fruits, while the sclerocarp-harvesting pitheciids rely extensively on these teeth to acquire and process more demanding foods. Pitheciids themselves vary in anterior tooth use, with the pitheciines (Cacajao, Chiropotes, and Pithecia) noted to use their robust canines in a variety of ways to predate seeds, while Callicebus, which rarely predates seeds, uses its incisors and exceptionally short canines to scrape tough mesocarp from fruits. To investigate the relationship between tooth use and dental wear, microwear textures were investigated for the anterior teeth of these five genera of platyrrhine primates. Using a white light confocal microscope, 12 microwear texture attributes that reflect feature size, anisotropy, density, and complexity were recorded from high-resolution epoxy casts of the incisors and canines of adult wild-collected Brazilian specimens of Ateles, Callicebus, Cacajao, Chiropotes, and Pithecia. Pitheciine canines tend to have deep microwear features and complex, anisotropic microwear textures, while Ateles anterior teeth tend to have very small features, low feature density, and less complex and anisotropic surfaces. Callicebus incisor and canine microwear is generally intermediate in size and complexity between those extremes. These findings align with expectations from reported field observations of tooth use and illustrate the potential for using microwear texture analysis to infer patterns of anterior tooth use in extinct primates. Am J Phys Anthropol 161:6-25, 2016. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.
Expression of monocarboxylate transporter 1 in oral and ocular canine melanocytic tumors.
Shimoyama, Y; Akihara, Y; Kirat, D; Iwano, H; Hirayama, K; Kagawa, Y; Ohmachi, T; Matsuda, K; Okamoto, M; Kadosawa, T; Yokota, H; Taniyama, H
2007-07-01
Solid tumors are composed of a heterogeneous population of cells surviving in various concentrations of oxygen. In a hypoxic environment, tumor cells generally up-regulate glycolysis and, therefore, generate more lactate that must be expelled from the cell through proton transporters to prevent intracellular acidosis. Monocarboxylate transporter 1 (MCT1) is a major proton transporter in mammalian cells that transports monocarboxylates, such as lactate and pyruvate, together with a proton across the plasma membrane. Melanocytic neoplasia occurs frequently in dogs, but the prognosis is highly site-dependent. In this study, 50 oral canine melanomas, which were subdivided into 3 histologic subtypes, and 17 ocular canine melanocytic neoplasms (14 melanocytomas and 3 melanomas) were used to examine and compare MCT1 expression. Immunohistochemistry using a polyclonal chicken anti-rat MCT1 antibody showed that most oral melanoma exhibited cell membrane staining, although there were no significant differences observed among the 3 histologic subtypes. In contrast, the majority of ocular melanocytic tumors were not immunoreactive. Additionally, we documented the presence of a 45-kDa band in cell membrane protein Western blots, and sequencing of a reverse transcriptase polymerase chain reaction band of expected size confirmed its identity as a partial canine MCT1 transcript in 3 oral tumors. Increased MCT1 expression in oral melanomas compared with ocular melanocytic tumors may reflect the very different biology between these tumors in dogs. These results are the first to document canine MCT1 expression in canine tumors and suggest that increased MCT1 expression may provide a potential therapeutic target for oral melanoma.
Li, Li; Zhang, Xi-Zhou; Li, Tinx-Xuan; Yu, Hai-Ying; Ji, Lin; Chen, Guang-Deng
2014-07-01
A total of twenty seven middle maturing rice varieties as parent materials were divided into four types based on P use efficiency for grain yield in 2011 by field experiment with normal phosphorus (P) application. The rice variety with high yield and high P efficiency was identified by pot experiment with normal and low P applications, and the contribution rates of various P efficiencies to yield were investigated in 2012. There were significant genotype differences in yield and P efficiency of the test materials. GRLu17/AiTTP//Lu17_2 (QR20) was identified as a variety with high yield and high P efficiency, and its yields at the low and normal rates of P application were 1.96 and 1.92 times of that of Yuxiang B, respectively. The contribution rate of P accumulation to yield was greater than that of P grain production efficiency and P harvest index across field and pot experiments. The contribution rates of P accumulation and P grain production efficiency to yield were not significantly different under the normal P condition, whereas obvious differences were observed under the low P condition (66.5% and 26.6%). The minimal contribution to yield was P harvest index (11.8%). Under the normal P condition, the contribution rates of P accumulation to yield and P harvest index were the highest at the jointing-heading stage, which were 93.4% and 85.7%, respectively. In addition, the contribution rate of P accumulation to grain production efficiency was 41.8%. Under the low P condition, the maximal contribution rates of P accumulation to yield and grain production efficiency were observed at the tillering-jointing stage, which were 56.9% and 20.1% respectively. Furthermore, the contribution rate of P accumulation to P harvest index was 16.0%. The yield, P accumulation, and P harvest index of QR20 significantly increased under the normal P condition by 20.6%, 18.1% and 18.2% respectively compared with that in the low P condition. The rank of the contribution rates of P
Radioimmunoassay of canine growth hormone
International Nuclear Information System (INIS)
Eigenmann, J.E.; Eigenmann, R.Y.
1981-01-01
A sensitive radioimmunoassay (RIA) for canine growth hormone (GH) was developed. Antibodies were elicited in rhesus monkeys. One antiserum exhibited a working titer at a dilution of 1:500 000. Radioiodination was performed enzymatically employing lactoperoxidase. Logit-log transformation and least squares fitting resulted in straight line fitting of the standard curve between 0.39 and 50 ng/ml. Formation of large-molecular [ 125 I]GH during storage caused diminished assay sensitivity. Therefore [ 125 I]GH was re-purified by gel chromatography. Using this procedure, high and reproducible assay sensitivity was obtained. Tracer preparations were used for as long as 3 months after iodination. Diluted plasma from normal and acromegalic dogs resulted in a dose-response curve parallel to the standard curve. Canine prolactin exhibited a cross-reactivity of 2%. The within-assay coefficient of variation (CV) was 3.8 and the between-assay CV was 7.2%. Mean plasma GH concentration in normal dogs was 1.92 +- 0.14 ng/ml (mean +- SEM.) GH levels in acromegalic dogs were appreciably higher. Insulin-induced hypoglycaemia, arginine and ornithine administration resulted in inconsistent and sluggish GH increment. A better response was obtained by injecting a low dose of clonidine. Clonidine administration to hypopituitary dogs resulted in absent or poor GH increment. (author)
Aspects and clinical procedures of eruptive changes of permanent upper canines
Directory of Open Access Journals (Sweden)
Sheila Marcia Francisco
2012-04-01
Full Text Available INTRODUCTION: Even though the upper canine is the tooth that presents most eruption anomalies, after the third molars, canine retention prevalence in the population is quite low. Local, physiologic and pathologic factors can provide difficulties for the tooth eruptive process. The correct diagnosis in trying to prevent upper canine retention with ectopic eruption is fundamental to choose the ideal treatment, which can be performed by various methods. OBJECTIVE: The present paper has the purpose of approaching aspects related to impacted upper permanent canines by a literature review, including localization and treatment conducts.
A randomized clinical study of two interceptive approaches to palatally displaced canines.
Baccetti, Tiziano; Leonardi, Maria; Armi, Pamela
2008-08-01
This study evaluated the effectiveness of two interceptive approaches to palatally displaced canines (PDC), i.e. extraction of the primary canines alone or in association with the use of a cervical-pull headgear. The randomized prospective design comprised 75 subjects with PDC (92 maxillary canines) who were randomly assigned to three groups: extraction of the primary canine only (EG), extraction of the primary canine and cervical-pull headgear (EHG), and an untreated control group (CG). Panoramic radiographs were evaluated at the time of initial observation (T1) and after an average period of 18 months (T2). At T2, an evaluation of the success of canine eruption was undertaken. Between-group statistical comparisons, Kruskal-Wallis test with Bonferroni correction, were performed on the T1-T2 changes of the diagnostic parameters on panoramic radiographs and the prevalence rates of success in canine eruption. A superimposition study on lateral cephalograms at T1 and T2 was carried out to evaluate the changes in the sagittal position of the upper molars in the three groups. The removal of the primary canine as an isolated measure to intercept palatal displacement of maxillary canines showed a success rate of 65.2 per cent, which was significantly greater than that in the untreated controls (36 per cent). The additional use of a headgear resulted in successful eruption in 87.5 per cent of the subjects, with a significant improvement in the measurements for intraosseous canine position. The cephalometric superimposition study showed a significant mesial movement of the upper first molars in the CG and EG when compared with the EHG.
Li, Jonathan Y; Middleton, Dana M; Chen, Steven; White, Leonard; Ellinwood, N Matthew; Dickson, Patricia; Vite, Charles; Bradbury, Allison; Provenzale, James M
2017-08-01
Purpose We describe a novel technique for measuring diffusion tensor imaging metrics in the canine brain. We hypothesized that a standard method for region of interest placement could be developed that is highly reproducible, with less than 10% difference in measurements between raters. Methods Two sets of canine brains (three seven-week-old full-brains and two 17-week-old single hemispheres) were scanned ex-vivo on a 7T small-animal magnetic resonance imaging system. Strict region of interest placement criteria were developed and then used by two raters to independently measure diffusion tensor imaging metrics within four different white-matter regions within each specimen. Average values of fractional anisotropy, radial diffusivity, and the three eigenvalues (λ1, λ2, and λ3) within each region in each specimen overall and within each individual image slice were compared between raters by calculating the percentage difference between raters for each metric. Results The mean percentage difference between raters for all diffusion tensor imaging metrics when pooled by each region and specimen was 1.44% (range: 0.01-5.17%). The mean percentage difference between raters for all diffusion tensor imaging metrics when compared by individual image slice was 2.23% (range: 0.75-4.58%) per hemisphere. Conclusion Our results indicate that the technique described is highly reproducible, even when applied to canine specimens of differing age, morphology, and image resolution. We propose this technique for future studies of diffusion tensor imaging analysis in canine brains and for cross-sectional and longitudinal studies of canine brain models of human central nervous system disease.
Rahman, Md Mahfujur; Hamid, Sharifah Bee Abd; Basirun, Wan Jefrey; Bhassu, Subha; Rashid, Nur Raifana Abdul; Mustafa, Shuhaimi; Mohd Desa, Mohd Nasir; Ali, Md Eaqub
2016-01-01
This paper describes a short-amplicon-based TaqMan probe quantitative real-time PCR (qPCR) assay for the quantitative detection of canine meat in chicken nuggets, which are very popular across the world, including Malaysia. The assay targeted a 100-bp fragment of canine cytb gene using a canine-specific primer and TaqMan probe. Specificity against 10 different animals and plants species demonstrated threshold cycles (Ct) of 16.13 ± 0.12 to 16.25 ± 0.23 for canine DNA and negative results for the others in a 40-cycle reaction. The assay was tested for the quantification of up to 0.01% canine meat in deliberately spiked chicken nuggets with 99.7% PCR efficiency and 0.995 correlation coefficient. The analysis of the actual and qPCR predicted values showed a high recovery rate (from 87% ± 28% to 112% ± 19%) with a linear regression close to unity (R(2) = 0.999). Finally, samples of three halal-branded commercial chicken nuggets collected from different Malaysian outlets were screened for canine meat, but no contamination was demonstrated.
Executive Summary High-Yield Scenario Workshop Series Report
Energy Technology Data Exchange (ETDEWEB)
Leslie Park Ovard; Thomas H. Ulrich; David J. Muth Jr.; J. Richard Hess; Steven Thomas; Bryce Stokes
2009-12-01
To get a collective sense of the impact of research and development (R&D) on biomass resource availability, and to determine the feasibility that yields higher than baseline assumptions used for past assessments could be achieved to support U.S. energy independence, an alternate “High-Yield Scenario” (HYS) concept was presented to industry experts at a series of workshops held in December 2009. The workshops explored future production of corn/agricultural crop residues, herbaceous energy crops (HECs), and woody energy crops (WECs). This executive summary reports the findings of that workshop.
Amorim, Irina; Freitas, Daniela P; Magalhães, Ana; Faria, Fátima; Lopes, Célia; Faustino, Augusto M; Smet, Annemieke; Haesebrouck, Freddy; Reis, Celso A; Gärtner, Fátima
2014-08-01
The gastric mucosa of dogs is often colonized by non-Helicobacter pylori helicobacters (NHPH), while H. pylori is the predominant gastric Helicobacter species in humans. The colonization of the human gastric mucosa by H. pylori is highly dependent on the recognition of host glycan receptors. Our goal was to define the canine gastric mucosa glycophenotype and to evaluate the capacity of different gastric Helicobacter species to adhere to the canine gastric mucosa. The glycosylation profile in body and antral compartments of the canine gastric mucosa, with focus on the expression of histo-blood group antigens was evaluated. The in vitro binding capacity of FITC-labeled H. pylori and NHPH to the canine gastric mucosa was assessed in cases representative of the canine glycosylation pattern. The canine gastric mucosa lacks expression of type 1 Lewis antigens and presents a broad expression of type 2 structures and A antigen, both in the surface and glandular epithelium. Regarding the canine antral mucosa, H. heilmannii s.s. presented the highest adhesion score whereas in the body region the SabA-positive H. pylori strain was the strain that adhered more. The canine gastric mucosa showed a glycosylation profile different from the human gastric mucosa suggesting that alternative glycan receptors may be involved in Helicobacter spp. binding. Helicobacter pylori and NHPH strains differ in their ability to adhere to canine gastric mucosa. Among the NHPH, H. heilmannii s.s. presented the highest adhesion capacity in agreement with its reported colonization of the canine stomach. © 2014 John Wiley & Sons Ltd.
Selection of common bean lines with high grain yield and high grain calcium and iron concentrations
Directory of Open Access Journals (Sweden)
Nerinéia Dalfollo Ribeiro
2014-02-01
Full Text Available Genetic improvement of common bean nutritional quality has advantages in marketing and can contribute to society as a food source. The objective of this study was to evaluate the genetic variability for grain yield, calcium and iron concentrations in grains of inbred common bean lines obtained by different breeding methods. For this, 136 F7 inbred lines were obtained using the Pedigree method and 136 F7 inbred lines were obtained using the Single-Seed Descent (SSD method. The lines showed genetic variability for grain yield, and concentrations of calcium and iron independently of the method of advancing segregating populations. The Pedigree method allows obtaining a greater number of lines with high grain yield. Selection using the SSD method allows the identification of a larger number of lines with high concentrations of calcium and iron in grains. Weak negative correlations were found between grain yield and calcium concentration (r = -0.0994 and grain yield and iron concentration (r = -0.3926. Several lines show genetic superiority for grain yield and concentrations of calcium and iron in grains and their selection can result in new common bean cultivars with high nutritional quality.
Morphology of palatally impacted canines: A case-controlled cone-beam volumetric tomography study.
Hettiarachchi, Pilana Vithanage Kalani Shihanika; Olive, Richard John; Monsour, Paul
2017-02-01
The aim of this study was to investigate the relationships between an apical curvature or a hook and the crown/root ratio in subjects with and without palatally impacted maxillary canines. An experimental group of 44 patients (17 boys, 27 girls; mean age, 13.6 years) with 59 palatally impacted maxillary canines was selected from the records of patients referred to a radiology practice for cone-beam imaging. If a patient had bilateral palatally impacted canines, 1 canine was randomly selected for analysis. The palatally impacted canine group was matched for age and sex with 49 normal subjects (25 boys, 24 girls; mean age, 13.2 years) with 98 canines. Cone-beam DICOM files were imported into In Vivo imaging software (version 5.3; Anatomage, San Jose, Calif) for analysis. The angulations and linear variables of the maxillary canines were measured by using the software measurement tools. Chi-square and independent t tests were used to test for differences between the groups. The presence of a hook at the apical third and other root curvature were significantly different between the 2 groups (P <0.001 and P <0.05, respectively). Of the 44 palatally impacted canines, 16 (36.4%) had an apical hook and only 1 canine in the control group had an apical hook (1.0%). The mean root length of the palatally impacted canines was 2.66 mm shorter (P <0.001), and the mean crown/root ratio was significantly greater for the palatally impacted canines compared with the nonimpacted group (P <0.001). Palatally impacted canines have a greater tendency to develop apical hooks and are less likely to develop other root curvatures than are nonimpacted canines. Also, they have shorter roots resulting in larger crown/root ratios compared with the control group. Copyright © 2017 American Association of Orthodontists. Published by Elsevier Inc. All rights reserved.
Canine detection of free-ranging brown treesnakes on Guam
Savidge, J.A.; Stanford, J.W.; Reed, R.N.; Haddock, G.R.; Adams, A.A.Y.
2011-01-01
We investigated canine teams (dogs and their handlers) on Guam as a potential tool for finding invasive brown treesnakes (Boiga irregularis) in the wild. Canine teams searched a 40 ?? 40 m forested area for a snake that had consumed a dead mouse containing a radio-transmitter. To avoid tainting the target or target area with human scent, no snake was handled or closely approached prior to searches. Trials were conducted during the morning when these nocturnal snakes were usually hidden in refugia. A radiotracker knew the snake's location, but dog handlers and search navigators did not. Of 85 trials conducted over four months, the two canine teams had an average success rate of 35% of correctly defining an area ??? 5 ?? 5 m that contained the transmittered snake; the team with more experience prior to the trials had a success rate of 44% compared with 26% for the less experienced team. Canine teams also found 11 shed skins from wild snakes. Although dogs alerted outside the vicinity of transmittered snakes, only one wild, non-transmittered snake was found during the trials, possibly reflecting the difficulty humans have in locating non-transmittered brown treesnakes in refugia. We evaluated success at finding snakes as a function of canine team, number of prior trials (i.e. experience gained during the trials), recent canine success at finding a target snake, various environmental conditions, snake perch height, and snake characteristics (snout-vent length and sex). Success rate increased over the course of the trials. Canine team success also increased with increasing average humidity and decreased with increasing average wind speed. Our results suggest dogs could be useful at detecting brown treesnakes in refugia, particularly when compared to daytime visual searches by humans, but techniques are needed to help humans find and extract snakes once a dog has alerted. ?? New Zealand Ecological Society.
Cryopreservation of microencapsulated canine sperm.
Shah, Shambhu; Otsuki, Tsubasa; Fujimura, Chika; Yamamoto, Naoki; Yamashita, Yasuhisa; Higaki, Shogo; Hishinuma, Mitsugu
2011-03-01
The objective was to develop a method for cryopreserving microencapsulated canine sperm. Pooled ejaculates from three beagle dogs were extended in egg yolk tris extender and encapsulated using alginate and poly-L-lysine at room temperature. The microcapsules were cooled at 4 °C, immersed in pre-cooled extender (equivalent in volume to the microcapsules) to reach final concentration of 7% (v/v) glycerol and 0.75% (v/v) Equex STM paste, and equilibrated for 5, 30 and 60 min at 4 °C. Thereafter, microcapsules were loaded into 0.5 mL plastic straws and frozen in liquid nitrogen. In Experiment 1, characteristics of microencapsulated canine sperm were evaluated after glycerol addition at 4 °C. Glycerol exposure for 5, 30 and 60 min did not significantly affect progressive motility, viability, or acrosomal integrity of microencapsulated sperm compared with pre-cooled unencapsulated sperm (control). In Experiment 2, characteristics of frozen-thawed canine microencapsulated sperm were evaluated at 0, 3, 6, and 9 h of culture at 38.5 °C. Pre-freeze glycerol exposure for 5, 30, and 60 min at 4 °C did not influence post-thaw quality in unencapsulated sperm. Post-thaw motility and acrosomal integrity of microencapsulated sperm decreased more than those of unencapsulated sperm (P < 0.05) following glycerol exposure for 5 min. However, motility, viability and acrosomal integrity of microencapsulated sperm after 30 and 60 min glycerol exposure were higher than unencapsulated sperm cultured for 6 or 9 h (P < 0.05). In conclusion, since microencapsulated canine sperm were successfully cryopreserved, this could be a viable alternative to convention sperm cryopreservation in this species. Copyright © 2011 Elsevier Inc. All rights reserved.
Added-values of high spatiotemporal remote sensing data in crop yield estimation
Gao, F.; Anderson, M. C.
2017-12-01
Timely and accurate estimation of crop yield before harvest is critical for food market and administrative planning. Remote sensing derived parameters have been used for estimating crop yield by using either empirical or crop growth models. The uses of remote sensing vegetation index (VI) in crop yield modeling have been typically evaluated at regional and country scales using coarse spatial resolution (a few hundred to kilo-meters) data or assessed over a small region at field level using moderate resolution spatial resolution data (10-100m). Both data sources have shown great potential in capturing spatial and temporal variability in crop yield. However, the added value of data with both high spatial and temporal resolution data has not been evaluated due to the lack of such data source with routine, global coverage. In recent years, more moderate resolution data have become freely available and data fusion approaches that combine data acquired from different spatial and temporal resolutions have been developed. These make the monitoring crop condition and estimating crop yield at field scale become possible. Here we investigate the added value of the high spatial and temporal VI for describing variability of crop yield. The explanatory ability of crop yield based on high spatial and temporal resolution remote sensing data was evaluated in a rain-fed agricultural area in the U.S. Corn Belt. Results show that the fused Landsat-MODIS (high spatial and temporal) VI explains yield variability better than single data source (Landsat or MODIS alone), with EVI2 performing slightly better than NDVI. The maximum VI describes yield variability better than cumulative VI. Even though VI is effective in explaining yield variability within season, the inter-annual variability is more complex and need additional information (e.g. weather, water use and management). Our findings augment the importance of high spatiotemporal remote sensing data and supports new moderate
Low cost, high yield IFE reactors: Revisiting Velikhov's vaporizing blankets
International Nuclear Information System (INIS)
Logan, B.G.
1992-01-01
The performance (efficiency and cost) of IFE reactors using MHD conversion is explored for target blanket shells of various materials vaporized and ionized by high fusion yields (5 to 500 GJ). A magnetized, prestressed reactor chamber concept is modeled together with previously developed models for the Compact Fusion Advanced Rankine II (CFARII) MHD Balance-of-Plant (BoP). Using conservative 1-D neutronics models, high fusion yields (20 to 80 GJ) are found necessary to heat Flibe, lithium, and lead-lithium blankets to MHD plasma temperatures, at initial solid thicknesses sufficient to capture most of the fusion yield. Advanced drivers/targets would need to be developed to achieve a ''Bang per Buck'' figure-of-merit approx-gt 20 to 40 joules yield per driver $ for this scheme to be competitive with these blanket materials. Alternatively, more realistic neutronics models and better materials such as lithium hydride may lower the minimum required yields substantially. The very low CFARII BoP costs (contributing only 3 mills/kWehr to CoE) allows this type of reactor, given sufficient advances that non-driver costs dominate, to ultimately produce electricity at a much lower cost than any current nuclear plant
Lakshmanan, Nallakannu; Gore, Thomas C; Duncan, Karen L; Coyne, Michael J; Lum, Melissa A; Sterner, Frank J
2006-01-01
Thirty-two seronegative pups were vaccinated at 8 weeks of age with modified-live canine distemper virus (CDV), canine adenovirus type-2 (CAV-2), and canine parvovirus (CPV) vaccine and at 12 weeks with a modified-live CDV, CAV-2, CPV, and killed rabies virus vaccine. An additional 31 seronegative pups served as age-matched, nonvaccinated controls. All test dogs were strictly isolated for 3 years after receiving the second vaccination and then were challenged with virulent rabies virus. Clinical signs of rabies were prevented in 28 (88%) of the 32 vaccinated dogs. In contrast, 97% (30 of 31) of the control dogs died of rabies infection. These study results indicated that no immunogenic interference occurred between the modified-live vaccine components and the killed rabies virus component. Furthermore, these results indicated that the rabies component in the test vaccine provided protection against virulent rabies challenge in dogs 12 weeks of age or older for a minimum of 3 years following vaccination.
Wang, Jianchang; Wang, Jinfeng; Li, Ruiwen; Liu, Libing; Yuan, Wanzhe
2017-08-15
Canine distemper, caused by Canine distemper virus (CDV), is a highly contagious and fatal systemic disease in free-living and captive carnivores worldwide. Recombinase polymerase amplification (RPA), as an isothermal gene amplification technique, has been explored for the molecular detection of diverse pathogens. A real-time reverse transcription RPA (RT-RPA) assay for the detection of canine distemper virus (CDV) using primers and exo probe targeting the CDV nucleocapsid protein gene was developed. A series of other viruses were tested by the RT-RPA.Thirty-two field samples were further tested by RT-RPA, and the resuts were compared with those obtained by the real-time RT-PCR. The RT-RPA assay was performed successfully at 40 °C, and the results were obtained within 3 min-12 min. The assay could detect CDV, but did not show cross-detection of canine parvovirus-2 (CPV-2), canine coronavirus (CCoV), canine parainfluenza virus (CPIV), pseudorabies virus (PRV) or Newcastle disease virus (NDV), demonstrating high specificity. The analytical sensitivity of RT-RPA was 31.8 copies in vitro transcribed CDV RNA, which is 10 times lower than the real-time RT-PCR. The assay performance was validated by testing 32 field samples and compared to real-time RT-PCR. The results indicated an excellent correlation between RT-RPA and a reference real-time RT-PCR method. Both assays provided the same results, and R 2 value of the positive results was 0.947. The results demonstrated that the RT-RPA assay offers an alternative tool for simple, rapid, and reliable detection of CDV both in the laboratory and point-of-care facility, especially in the resource-limited settings.
Management of impacted all canines with surgical exposure and alignment by orthodontic treatment
Directory of Open Access Journals (Sweden)
Radha Katiyar
2013-01-01
Full Text Available Canine impaction is a dental problem very often encountered in orthodontic practice. After the third molar, the canine is the most frequently impacted tooth. Bringing the impacted canine into a normal position is important for functional occlusion and the final esthetics of the orthodontic treatment. This article illustrates a peculiar case, in which all four permanent canines maintained their unerupted status at age of 16 years. All four impacted canines were surgically exposed, attachment bonded, traction given with K-9 spring and ideally positioned with fixed orthodontic mechanotherapy.
International Nuclear Information System (INIS)
Konzak, C.F.; Rubenthaler, G.L.
1984-01-01
Preliminary data offer promise that advances have been made in breeding hard red spring wheat selections with a yielding capacity about equal to current cultivars and with an increased capacity for producing high protein grain. The most promising new selections are derivatives of Magnif 41M1, CI17689, a semi-dwarf mutant of an Argentinian high protein cultivar. Rapid changes in disease and pest problems also required immediate attention and a reorientation of breeding materials and goals. Selection procedures suggested as promising include early generation (F 2 and F 3 ) screening for disease resistance and agronomic type, with screening for protein content delayed until F 4 or F 5 . Cultural conditions conducive for expressing the highest yield capacity are proposed as optimum for identifying those selections also able to produce high protein grain. A goal of routine production of 14.5% (or higher) protein grain is considered necessary and achievable under fertility management conditions required for maximum yield expression of agronomically competitive cultivars. Agronomically improved sources of high protein genes, an increasing number of induced high protein mutants, and numerous high protein crossbred derivatives of T. dicoccoides and Aegilops species have recently become available. These new or improved germplasm sources as well as a considerable reserve of yet untapped germplasm variability in other accessions of wild T. dicoccoides offer increased optimism that further, rapid advances in the breeding of adapted high yielding, high protein wheats are achievable. Improved breeding schemes, using induced male sterility mutants either to aid in crossing or to develop male sterile facilitated recurrent selection (MSFRS) populations, should contribute towards an earlier achievement of the desired goal while providing the basis for buffering against rapid changes in disease and pest problems
Detection of a group 2 coronavirus in dogs with canine infectious respiratory disease
International Nuclear Information System (INIS)
Erles, Kerstin; Toomey, Crista; Brooks, Harriet W.; Brownlie, Joe
2003-01-01
An investigation into the causes of canine infectious respiratory disease was carried out in a large rehoming kennel. Tissue samples taken from the respiratory tract of diseased dogs were tested for the presence of coronaviruses using RT-PCR with conserved primers for the polymerase gene. Sequence analysis of four positive samples showed the presence of a coronavirus with high similarity to both bovine and human coronavirus (strain OC43) in their polymerase and spike genes, whereas there was a low similarity to comparable genes in the enteric canine coronavirus. This canine respiratory coronavirus (CRCV) was detected by RT-PCR in 32/119 tracheal and 20/119 lung samples, with the highest prevalence being detected in dogs with mild clinical symptoms. Serological analysis showed that the presence of antibodies against CRCV on the day of entry into the kennel decreased the risk of developing respiratory disease
FLT3 mutations in canine acute lymphocytic leukemia
International Nuclear Information System (INIS)
Suter, Steven E; Small, George W; Seiser, Eric L; Thomas, Rachael; Breen, Matthew; Richards, Kristy L
2011-01-01
FMS-like tyrosine kinase 3 (FLT3) is a commonly mutated protein in a variety of human acute leukemias. Mutations leading to constitutively active FLT3, including internal tandem duplications of the juxtamembrane domain (ITD), result in continuous cellular proliferation, resistance to apoptotic cell death, and a poorer prognosis. A better understanding of the molecular consequences of FLT3 activation would allow improved therapeutic strategies in these patients. Canine lymphoproliferative diseases, including lymphoma and acute leukemias, share evolutionarily conserved chromosomal aberrations and exhibit conserved mutations within key oncogenes when compared to their human counterparts. A small percentage of canine acute lymphocytic leukemias (ALL) also exhibit FLT3 ITD mutations. We molecularly characterized FLT3 mutations in two dogs and one cell line, by DNA sequencing, gene expression analysis via quantitative real-time PCR, and sensitivity to the FLT3 inhibitor lestaurtinib via in vitro proliferation assays. FLT 3 and downstream mediators of FLT3 activation were assessed by Western blotting. The canine B-cell leukemia cell line, GL-1, and neoplastic cells from 2/7 dogs diagnosed cytologically with ALL were found to have FLT3 ITD mutations and FLT3 mRNA up-regulation. Lestaurtinib, a small molecule FLT3 inhibitor, significantly inhibited the growth of GL-1 cells, while not affecting the growth of two other canine lymphoid cell lines without the FLT3 mutation. Finally, western blots were used to confirm the conserved downstream mediators of FLT3 activating mutations. These results show that ALL and FLT3 biology is conserved between canine and human patients, supporting the notion that canine ALL, in conjunction with the GL-1 cell line, will be useful in the development of a relevant large animal model to aid in the study of human FLT3 mutant leukemias
Vaccine-induced canine distemper in a lesser panda.
Bush, M; Montali, R J; Brownstein, D; James, A E; Appel, M J
1976-11-01
A fatal disease occurred in a lesser panda (Ailurus fulgens) 2 weeks after vaccination with modified live distemper vaccine. The disease clinically resembled canine distemper. Pathologically there was giant cell pneumonia, with canine distemper viral inclusion bodies in pulmonary and digestive tract epithelium. Viral isolates were indicative of an attenuated strain rather than virulent types.
Alpha-1-antitrypsin studies: canine serum and canine surfactant protein
International Nuclear Information System (INIS)
Tuttle, W.C.; Slauson, D.O.; Dahlstrom, M.; Gorman, C.
1974-01-01
Canine serum alpha-1-antitrypsin was isolated by gel filtration and affinity chromatography and characterized by polyacrylamide gel electrophoresis and immunoelectrophoresis. Measurement of the trypsin inhibitory capacity of the separated protein indicated a ninefold concentration of functional trypsin inhibitor during the isolation procedure. Electrophoresis demonstrated the presence of a single protein with alpha-globulin mobility and a molecular weight near that of human alpha-1-antitrypsin. The trypsin inhibitory capacity of pulmonary surfactant protein from five Beagle dogs was measured, related to total surfactant protein concentration, and compared with similar measurements on whole serum from the same animals. Results indicated a variable concentration of trypsin inhibitor in the canine pulmonary surfactant protein. However, the concentration in the surfactant protein was always significantly higher than that in the corresponding serum sample. Preliminary experiments designed to separate the trypsin inhibitory fraction(s) from the other surfactant proteins by gel filtration chromatography indicated that the trypsin inhibitor was probably a single protein with a molecular weight near that of alpha-1-antitrypsin. (U.S.)
Canine hip dysplasia: significance of early bony spurring
International Nuclear Information System (INIS)
Morgan, J.P.
1987-01-01
It is the purpose of this study to call attention to new bone production that often occurs early in the sequence of pathological changes associated with canine hip dysplasia. New bone production extending to bony remodeling, as well as femoral head subluxation, both occur in the sequence of pathologic changes associated with canine hip dysplasia. Subluxation is considered primary, while osteoarthrosis is a secondary feature, and both are used in the diagnosis of canine hip dysplasia. This report concerns the significance of the presence of a solitary bony osteophyte, or spur, that is frequently evident on the caudal aspect of the femoral neck as viewed on the conventional ventrodorsal projection. This report utilizes findings from pelvic radiographs of 605 dogs (five breeds). There was a greater frequency (54%)of this bony change in cases diagnosed radiographically as dysplastic than in cases diagnosed as normal(15%).Thus, it is suggested that this minimal radiographic change can be used as an indicator of early canine hip dysplasia, especially in the absence of subluxation of the femoral head
Radiographic assessment of dental anomalies in patients with ectopic maxillary canines
DEFF Research Database (Denmark)
Sørensen, Helle Budtz; Artmann, Lone; Larsen, Helle Juul
2008-01-01
dental deviations in cases with either palatal or labial ectopic canines. Design. Panoramic and intra-oral radiographs from 50 patients with palatally located (38 females and 12 males) and 19 patients with labially located ectopic canines (11 females and 8 males), aged 10 years, 2 months-18 years, 1...... month, were analysed. Dental deviations registered were crown and root malformations, agenesis, and eruption deviations. Registrations were performed in the maxillary incisor field and in the dentition in general. Results. The study documented that palatally as well as labially located ectopic canines...... can occur in dentitions without other dental deviations. Dental deviations occurred in approximately two-thirds of all cases, more often in females and in cases with palatally located canines. More than half of the females with palatally located canines had deviations in the maxillary incisors...
Canine Babesiosis in China Caused by Babesia gibsoni: A Molecular Approach.
Directory of Open Access Journals (Sweden)
Da-Wei Yao
2014-06-01
Full Text Available To provide a point of reference to study the epidemiology and clinical expression of canine babesiosis in China.A total of 30 dogs infected with canine babesiosis were evaluated by mean of clinical history, physical examination, hematological, restriction fragment length polymorphism of PCR products (PCR-RFLP and sequencing analysis.The most prevalent clinical abnormalities were lethargy (100%, anorexia (100%, pale or icteric mucous membranes (80%, fever (70% and dark urine (70%. Hematology parameters revealed that anemia and thrombocytopenia were the major abnormalities in blood of dogs infected with canine babesia. The results of PCR-RFLP and sequencing analysis indicated that B. gibsoni was the main species responsible for canine babesiosis cases at the time of the study in Nanjing, China.The results provide valuable information for better understanding of the epidemiology of canine babesiosis in China.
The expression and serological reactivity of recombinant canine herpesvirus 1 glycoprotein D
Directory of Open Access Journals (Sweden)
Markéta Vaňková
2016-01-01
Full Text Available The aim of this work was to express recombinant glycoprotein D of canine herpesvirus 1 in bacterial cells and to evaluate its diagnostic sensitivity and specificity when compared to traditional serological methods. The gene fragment coding glycoprotein D of canine herpesvirus 1 was amplified by polymerase chain reaction, cloned into plasmid vector and expressed in Escherichia coli cells. Recombinant protein was then purified and used as an antigen in immunoblot for a detection of canine herpesvirus 1 specific antibodies. Antibody testing was performed on the panel of 100 canine sera by immunoblot with recombinant glycoprotein D as antigen and compared with indirect immunofluorescence assay. Serum samples were collected from 83 dogs with no history of canine herpesvirus 1 or reproductive disorders, and from 17 dogs from breeding kennels with a history of canine herpesvirus 1 related reproductive disorders. Sensitivity of glycoprotein D based immunoblot was 89.2% and specificity was 93%. Kappa value was calculated to be 0.8 between immunoblot and indirect immunofluorescence assay. Antibodies against canine herpesvirus 1 infection were detected in 33% of samples by immunoblot assay. Our study confirms that recombinant glycoprotein D expressed in bacterial cells could be used as a suitable and sensitive antigen for immunological tests and that herpesvirus infection seems to be common among the canine population in the Czech Republic.
Orthodontic-surgical treatment of bilateral maxillary canine impaction
Directory of Open Access Journals (Sweden)
Sumitra
2012-01-01
Full Text Available A 13-year-old female patient reported with the chief complaint of irregular front teeth. She had a skeletal Class III and Angle′s Class I malocclusion with hyperdivergent growth pattern and bilateral impaction of maxillary canines. Surgical exposure of the impacted teeth and orthodontic alignment was planned. The surgical exposure was done by a minimally invasive modified window technique. Orthodontic treatment of impacted canines without causing significant morbidity to the adjacent teeth and periodontium is a challenge. The bilaterally impacted maxillary canines were successfully aligned and leveled. The depth of the gingival sulcus and clinical crown heights of disimpacted teeth were normal post-treatment and after 1 year of retention.
Remote detection of explosives using trained canines
International Nuclear Information System (INIS)
Smith, J.C.
1983-03-01
Use of dogs is a search method which combines high probability of detection, speed of search, and low cost. It was concluded that the canine could be used for explosive screening of personnel, but that it was imperative that the dog be in a position remote from employees and employee traffic. A study was made of the design of booths and air flow for this purpose. Results of tests and conclusions are given and discussed
Difficulties in estimating the human burden of canine rabies.
Taylor, Louise H; Hampson, Katie; Fahrion, Anna; Abela-Ridder, Bernadette; Nel, Louis H
2017-01-01
Current passive surveillance data for canine rabies, particularly for the regions where the burden is highest, are inadequate for appropriate decision making on control efforts. Poor enforcement of existing legislation and poor implementation of international guidance reduce the effectiveness of surveillance systems, but another set of problems relates to the fact that canine rabies is an untreatable condition which affects very poor sectors of society. This results in an unknown, but potentially large proportion of rabies victims dying outside the health system, deaths that are unlikely to be recorded by surveillance systems based on health center records. This article critically evaluates the potential sources of information on the number of human deaths attributable to canine rabies, and how we might improve the estimates required to move towards the goal of global canine rabies elimination. Copyright © 2015 The Authors. Published by Elsevier B.V. All rights reserved.
Expression of Bcl-2 in canine osteosarcoma
Piro, F.; Leonardi, L.
2015-01-01
Osteosarcoma (OS) is the most common primary malignancy of bone. It is responsible for 80-85% of the primary bone tumors affecting dogs and it is characterized by aggressive and invasive behavior, with a high metastatic potential. Several studies on cancer and related tumorigenesis, show an involvement of the mechanisms of programmed cell death and cell survival. Many signals seem to be involved in the related mechanism of autophagy and in particular, our interest is focused on the expression of a family of Bcl-2 that seems to be involved either in the control of biomolecular mechanisms like autophagy and apoptosis. In this study we investigated the expression of Bcl-2 in different cases of spontaneous canine osteosarcoma and the related preliminary results are described. We found Bcl-2 activity was increased in OS tissue compared to normal bone tissue. These results suggested that Bcl-2 activity may play an important role in the formation of OS and as a diagnostic for neoplastic activity. However, further research is needed to confirm the role of Bcl-2 activity in OS in canines. PMID:26623359
An Update on Therapeutic Management of Canine Demodicosis
Directory of Open Access Journals (Sweden)
S. K. Singh
2011-02-01
Full Text Available Canine demodicosis is a common noncontagious parasitic dermatosis caused by different spp of Demodex mites including Demodex canis, Demodex injai and D. cornei. Generalized demodicosis can be one of the most frustrating skin diseases, one will ever treat. Conventional and newer miticidal therapies are available to veterinarian to treat this frustrating skin disease. All recognized Demodex mites in dogs appear to respond similarly to mite targeted therapy. Treatment for canine demodicosis includes amitraz, ivermectin, milbemicin oxime, moxidectin, and doramectin. The use of any glucocorticoid-containing products is contraindicated and could favour disease generalization. Conventional treatments will often appear to work however, but it relies heavily on a highly toxic method of treatment. Using natural remedies for mange, on the other hand, can enhance the dog’s immune system, so that the body can fight off the mange mite infection by itself. [Veterinary World 2011; 4(1.000: 41-44
Lotspeich, Erica; Kitts, Kelley; Goodpaster, John
2012-07-10
It is a common misconception that the amount of explosive is the chief contributor to the quantity of vapor that is available to trained canines. In fact, this quantity (known as odor availability) depends not only on the amount of explosive material, but also the container volume, explosive vapor pressure and temperature. In order to better understand odor availability, headspace experiments were conducted and the results were compared to theory. The vapor-phase concentrations of three liquid explosives (nitromethane, nitroethane and nitropropane) were predicted using the Ideal Gas Law for containers of various volumes that are in use for canine testing. These predictions were verified through experiments that varied the amount of sample, the container size, and the temperature. These results demonstrated that the amount of sample that is needed to saturate different sized containers is small, predictable and agrees well with theory. In general, and as expected, once the headspace of a container is saturated, any subsequent increase in sample volume will not result in the release of more vapors. The ability of canines to recognize and alert to differing amounts of nitromethane has also been studied. In particular, it was found that the response of trained canines is independent of the amount of nitromethane present, provided it is a sufficient quantity to saturate the container in which it is held. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.
International Nuclear Information System (INIS)
Rubin, B.; Topper, J. L.; Farnell, C. C.; Yalin, A. P.
2009-01-01
We present a quartz crystal microbalance-based system for high sensitivity differential sputter yield measurements of different target materials due to ion bombardment. The differential sputter yields can be integrated to find total yields. Possible ion beam conditions include ion energies in the range of 30-350 eV and incidence angles of 0 deg. - 70 deg. from normal. A four-grid ion optics system is used to achieve a collimated ion beam at low energy (<100 eV) and a two-grid ion optics is used for higher energies (up to 750 eV). A complementary weight loss approach is also used to measure total sputter yields. Validation experiments are presented that confirm high sensitivity and accuracy of sputter yield measurements.
High lysine and high yielding mutants in wheat (Triticum aestivum) L
International Nuclear Information System (INIS)
Mohammad, T.; Mahmood, F.; Ahmad, A.; Sattar, A.; Khan, I.
1988-01-01
The dry seeds of the variety Lu-26 were irradiated with 20 krad of gamma rays. In M 2 about 300 mutant plants were selected for short stature, rust resistance and other desirable traits. As a result of further selection, in M 6 , eight superior lines were finally identified. The agronomic characteristics of these mutants, the parent variety (Lu-26) and a standard check variety (Pak-81) are shown. The selected mutants and commercially grown cultivars (Lu-26 and Pak-81) were studied for total protein content and amino acid pattern. The mutants WM-89-1, WM-6-17 and WM-81-2 showing high yield also contained comparatively high amounts of methionine and lysine. The lysine contents were 565, 410, and 370 mg/100g in the mutants WM-89-1, WM-6-17 and WM-81-2, respectively against a range value of 210-370 mg/100g in other mutants and 250-320 in the commercial cultivars. The mutant WM-81-2 was comparable to WM-56-1-5 in lysine content. The results of these experiments show a possibility of developing varieties having high yield and high amounts of essential amino acids such as lysine and methionine
Intranasal vaccine trial for canine infectious tracheobronchitis (kennel cough).
Glickman, L T; Appel, M J
1981-08-01
Two field trials were conducted during periods of endemic (summer) and epizootic (winter) canine infectious tracheobronchitis activity to evaluate the efficacy of three intranasal vaccines in a closed commercial beagle breeding kennel. A trivalent vaccine containing Bordetella bronchiseptica, canine parainfluenza, and canine adenovirus-2 was administered at 3 weeks of age. The vaccine was 71.2% and 81.8% effective in decreasing the incidence of coughing during the winter and summer trials, respectively. The number of deaths was lower in each of the vaccine groups than in the placebo groups. No adverse reactions were observed with any of the intranasal vaccines.
Cloning and characterization of the canine receptor for advanced glycation end products.
Murua Escobar, Hugo; Soller, Jan T; Sterenczak, Katharina A; Sperveslage, Jan D; Schlueter, Claudia; Burchardt, Birgit; Eberle, Nina; Fork, Melanie; Nimzyk, Rolf; Winkler, Susanne; Nolte, Ingo; Bullerdiek, Jörn
2006-03-15
Metastasis is one of the major problems when dealing with malignant neoplasias. Accordingly, the finding of molecular targets, which can be addressed to reduce tumour metastasising, will have significant impact on the development of new therapeutic approaches. Recently, the receptor for advanced glycation end products (RAGE)-high mobility group B1 (HMGB1) protein complex has been shown to have significant influence on invasiveness, growth and motility of tumour cells, which are essential characteristics required for metastatic behaviour. A set of in vitro and in vivo approaches showed that blocking of this complex resulted in drastic suppression of tumour cell growth. Due to the similarities of human and canine cancer the dog has joined the common rodent animal model for therapeutic and preclinical studies. However, complete characterisation of the protein complex is a precondition to a therapeutic approach based on the blocking of the RAGE-HMGB1 complex to spontaneously occurring tumours in dogs. We recently characterised the canine HMGB1 gene and protein completely. Here we present the complete characterisation of the canine RAGE gene including its 1384 bp mRNA, the 1215 bp protein coding sequence, the 2835 bp genomic structure, chromosomal localisation, gene expression pattern, and its 404 amino acid protein. Furthermore we compared the CDS of six different canine breeds and screened them for single nucleotide polymorphisms.
Eruption of the maxillary canines in relation to skeletal maturity.
Baccetti, Tiziano; Franchi, Lorenzo; De Lisa, Simona; Giuntini, Veronica
2008-05-01
Our aim in this study was to assess the relationship between the eruption of the permanent maxillary canines and skeletal maturity in subjects with different skeletal relationships in the sagittal and vertical planes. A sample of 152 subjects (63 boys, 89 girls) with erupting permanent maxillary canines was analyzed. On the lateral cephalograms, the stage of cervical vertebral maturation was assessed. Then the subjects were divided into prepeak (before the pubertal growth spurt, cervical stage [CS]1 and CS2), peak (during the pubertal growth spurt, CS3 and CS4), and postpeak (after the pubertal growth spurt, CS5 and CS6) groups. Skeletal relationships in the sagittal and vertical planes were evaluated, and relationships to timing of canine eruption were tested statistically. The prepeak group comprised 86 subjects, the peak group 66 subjects, and the postpeak group 0 subjects. The differences in prevalence rates between either the prepeak or peak groups and the postpeak group were statistically significant (P < 0.001). The prevalence rate for hyperdivergent subjects showing eruption of the permanent maxillary canine in the prepeak group (37.2%) was significantly higher than in the reference orthodontic population (21%). The eruption of the permanent maxillary canine can occur at any stage in skeletal maturation before the end the pubertal growth spurt (CS1-CS4), with hyperdivergent subjects more frequently having prepubertal canine eruption.
Energy Technology Data Exchange (ETDEWEB)
Boretti, Felicitos; Reusch, C.E. [Klinik fuer Kleintiermedizin, Vetsuisse Fakultaet Zuerich, Univ. Zuerich (Switzerland)
2010-03-15
Hypothyroidism is one of the most common endocrinopathies in dogs. Clinical symptoms and hematological and biochemical parameters lead to a first suspicion. To confirm diagnosis can be challenging, however. Determination of total serum T4 concentration is accepted as the primary screening test for the disease, and low serum T4 concentrations are intuitively suggestive of hypothyroidism. However it is well known that low T4 concentrations are frequently encountered in euthyroid dogs with various nonthyroidal diseases and in dogs receiving certain pharmacologic agents. Since assessment of endogenous TSH (canine TSH) using current canine TSH assays shows normal values in a high percentage of hypothyroid dogs (up to 40%), its diagnostic value is only limited. The TSH-stimulation test can still be recognized as the gold standard for the diagnosis of hypothyroidism in dogs. Determination of circulating T4 concentration before and 6 hours after the administration of exogenous TSH (recombinant human TSH, Thyrogen {sup registered}) provides an assessment of the functional reserve capacity of the thyroid gland with minimal change in post-TSH T4 concentration, compared with the basal concentration, expected in dogs with hypothyroidism. Also this test can be influenced by nonthyroidal illness and by medications known to affect thyroid function. This suppressing influence seems to be less pronounced using a higher dose of TSH. Therefore, to improve the discriminatory power of the TSH stimulation test to differentiate between euthyroid-sick and primary hypothyroidism, the higher dose should be used in cases in which testing cannot be delayed. More recently, ultrasonography and scintigraphy have been used for the diagnosis of primary hypothyroidism. Using ultrasonography, a sensitivity of 98% was reported if size and echogenicity of the gland were combined. However, specificity was as low as 77%. and care must be taken when measuring the gland because of a relatively high
Shahi, Mehdi Hayat; Holt, Roseline; Rebhun, Robert B
2014-01-01
The Hedgehog-GLI signaling pathway is active in a variety of human malignancies and is known to contribute to the growth and survival of human osteosarcoma cells. In this study, we examined the expression and regulation of GLI transcription factors in multiple canine osteosarcoma cell lines and analyzed the effects of inhibiting GLI with GANT61, a GLI-specific inhibitor. Compared with normal canine osteoblasts, real-time PCR showed that GLI1 and GLI2 were highly expressed in two out of three cell lines and correlated with downstream target gene expression of PTCH1and PAX6. Treatment of canine osteosarcoma cells with GANT61 resulted in decreased expression of GLI1, GLI2, PTCH1, and PAX6. Furthermore, GANT61 inhibited proliferation and colony formation in all three canine osteosarcoma cell lines. The finding that GLI signaling activity is present and active in canine osteosarcoma cells suggests that spontaneously arising osteosarcoma in dogs might serve as a good model for future preclinical testing of GLI inhibitors.
Directory of Open Access Journals (Sweden)
Mehdi Hayat Shahi
Full Text Available The Hedgehog-GLI signaling pathway is active in a variety of human malignancies and is known to contribute to the growth and survival of human osteosarcoma cells. In this study, we examined the expression and regulation of GLI transcription factors in multiple canine osteosarcoma cell lines and analyzed the effects of inhibiting GLI with GANT61, a GLI-specific inhibitor. Compared with normal canine osteoblasts, real-time PCR showed that GLI1 and GLI2 were highly expressed in two out of three cell lines and correlated with downstream target gene expression of PTCH1and PAX6. Treatment of canine osteosarcoma cells with GANT61 resulted in decreased expression of GLI1, GLI2, PTCH1, and PAX6. Furthermore, GANT61 inhibited proliferation and colony formation in all three canine osteosarcoma cell lines. The finding that GLI signaling activity is present and active in canine osteosarcoma cells suggests that spontaneously arising osteosarcoma in dogs might serve as a good model for future preclinical testing of GLI inhibitors.
Interleukin-8 promotes canine hemangiosarcoma growth by regulating the tumor microenvironment
Energy Technology Data Exchange (ETDEWEB)
Kim, Jong-Hyuk, E-mail: jhkim@umn.edu [Department of Veterinary Clinical Science, College of Veterinary Medicine, University of Minnesota, St. Paul, MN (United States); Masonic Cancer Center, University of Minnesota, Minneapolis, MN (United States); Frantz, Aric M.; Anderson, Katie L.; Graef, Ashley J.; Scott, Milcah C. [Department of Veterinary Clinical Science, College of Veterinary Medicine, University of Minnesota, St. Paul, MN (United States); Robinson, Sally [Department of Veterinary and Biomedical Sciences, College of Veterinary Medicine, University of Minnesota, St. Paul, MN (United States); Sharkey, Leslie C. [Department of Veterinary Clinical Science, College of Veterinary Medicine, University of Minnesota, St. Paul, MN (United States); Masonic Cancer Center, University of Minnesota, Minneapolis, MN (United States); O' Brien, Timothy D. [Department of Veterinary Clinical Science, College of Veterinary Medicine, University of Minnesota, St. Paul, MN (United States); Department of Veterinary Population Medicine, College of Veterinary Medicine, University of Minnesota, St. Paul, MN (United States); Dickerson, Erin B. [Department of Veterinary Clinical Science, College of Veterinary Medicine, University of Minnesota, St. Paul, MN (United States); Masonic Cancer Center, University of Minnesota, Minneapolis, MN (United States); Modiano, Jaime F., E-mail: modiano@umn.edu [Department of Veterinary Clinical Science, College of Veterinary Medicine, University of Minnesota, St. Paul, MN (United States); Masonic Cancer Center, University of Minnesota, Minneapolis, MN (United States)
2014-04-15
Interleukin-8 (IL-8) gene expression is highly up-regulated in canine hemangiosarcoma (HSA); however, its role in the pathogenesis of this disease is unknown. We investigated the expression of IL-8 in canine HSA tissues and cell lines, as well and the effects of IL-8 on canine HSA in vitro, and in vivo using a mouse xenograft model for the latter. Constitutive expression of IL-8 mRNA, IL-8 protein, and IL-8 receptor were variable among different tumor samples and cell lines, but they showed stable steady states in each cell line. Upon the addition of IL-8, HSA cells showed transient intracellular calcium fluxes, suggesting that their IL-8 receptors are functional and that IL-8 binding activates relevant signaling pathways. Yet, neither addition of exogenous IL-8 nor blockade of endogenous IL-8 by neutralizing anti-IL-8 antibody (α-IL-8 Ab) affected HSA cell proliferation or survival in vitro. To assess potential effects of IL-8 in other tumor constituents, we stratified HSA cell lines and whole tumor samples into “IL-8 high” and “IL-8 low” groups. Genome-wide gene expression profiling showed that samples in the “IL-8 high” tumor group were enriched for genes associated with a “reactive microenvironment,” including activation of coagulation, inflammation, and fibrosis networks. Based on these findings, we hypothesized that the effects of IL-8 on these tumors were mostly indirect, regulating interactions with the microenvironment. This hypothesis was supported by in vivo xenograft experiments where survival and engraftment of tumor cells was inhibited by administration of neutralizing α-IL-8 Ab. Together, our results suggest that IL-8 contributes to establishing a permissive microenvironment during the early stages of tumorigenesis in HSA. - Highlights: • IL-8 is expressed in canine hemangiosarcoma tumor samples and cell lines. • IL-8 transduces a relevant biological signal in canine hemangiosarcoma cells. • IL-8 gene signature is associated
Interleukin-8 promotes canine hemangiosarcoma growth by regulating the tumor microenvironment
International Nuclear Information System (INIS)
Kim, Jong-Hyuk; Frantz, Aric M.; Anderson, Katie L.; Graef, Ashley J.; Scott, Milcah C.; Robinson, Sally; Sharkey, Leslie C.; O'Brien, Timothy D.; Dickerson, Erin B.; Modiano, Jaime F.
2014-01-01
Interleukin-8 (IL-8) gene expression is highly up-regulated in canine hemangiosarcoma (HSA); however, its role in the pathogenesis of this disease is unknown. We investigated the expression of IL-8 in canine HSA tissues and cell lines, as well and the effects of IL-8 on canine HSA in vitro, and in vivo using a mouse xenograft model for the latter. Constitutive expression of IL-8 mRNA, IL-8 protein, and IL-8 receptor were variable among different tumor samples and cell lines, but they showed stable steady states in each cell line. Upon the addition of IL-8, HSA cells showed transient intracellular calcium fluxes, suggesting that their IL-8 receptors are functional and that IL-8 binding activates relevant signaling pathways. Yet, neither addition of exogenous IL-8 nor blockade of endogenous IL-8 by neutralizing anti-IL-8 antibody (α-IL-8 Ab) affected HSA cell proliferation or survival in vitro. To assess potential effects of IL-8 in other tumor constituents, we stratified HSA cell lines and whole tumor samples into “IL-8 high” and “IL-8 low” groups. Genome-wide gene expression profiling showed that samples in the “IL-8 high” tumor group were enriched for genes associated with a “reactive microenvironment,” including activation of coagulation, inflammation, and fibrosis networks. Based on these findings, we hypothesized that the effects of IL-8 on these tumors were mostly indirect, regulating interactions with the microenvironment. This hypothesis was supported by in vivo xenograft experiments where survival and engraftment of tumor cells was inhibited by administration of neutralizing α-IL-8 Ab. Together, our results suggest that IL-8 contributes to establishing a permissive microenvironment during the early stages of tumorigenesis in HSA. - Highlights: • IL-8 is expressed in canine hemangiosarcoma tumor samples and cell lines. • IL-8 transduces a relevant biological signal in canine hemangiosarcoma cells. • IL-8 gene signature is associated
Directory of Open Access Journals (Sweden)
Ryan M Wallace
2015-11-01
Full Text Available The Republic of Haiti is one of only several countries in the Western Hemisphere in which canine rabies is still endemic. Estimation methods have predicted that 130 human deaths occur per year, yet existing surveillance mechanisms have detected few of these rabies cases. Likewise, canine rabies surveillance capacity has had only limited capacity, detecting only two rabid dogs per year, on average. In 2013, Haiti initiated a community-based animal rabies surveillance program comprised of two components: active community bite investigation and passive animal rabies investigation. From January 2013 -December 2014, 778 rabies suspect animals were reported for investigation. Rabies was laboratory-confirmed in 70 animals (9% and an additional 36 cases were identified based on clinical diagnosis (5%, representing an 18-fold increase in reporting of rabid animals compared to the three years before the program was implemented. Dogs were the most frequent rabid animal (90%. Testing and observation ruled out rabies in 61% of animals investigated. A total of 639 bite victims were reported to the program and an additional 364 bite victims who had not sought medical care were identified during the course of investigations. Only 31% of people with likely rabies exposures had initiated rabies post-exposure prophylaxis prior to the investigation. Rabies is a neglected disease in-part due to a lack of surveillance and understanding about the burden. The surveillance methods employed by this program established a much higher burden of canine rabies in Haiti than previously recognized. The active, community-based bite investigations identified numerous additional rabies exposures and bite victims were referred for appropriate medical care, averting potential human rabies deaths. The use of community-based rabies surveillance programs such as HARSP should be considered in canine rabies endemic countries.
Dehghani, Mahdieh; Shadkam, Elaheh; Ahrari, Farzaneh; Dehghani, Mahboobe
2018-04-01
Age estimation in adults is an important issue in forensic science. This study aimed to estimate the chronological age of Iranians by means of pulp/tooth area ratio (AR) of canines in digital panoramic radiographs. The sample consisted of panoramic radiographs of 271 male and female subjects aged 16-64 years. The pulp/tooth area ratio (AR) of upper and lower canines was calculated by AutoCAD software. Data were subjected to correlation and regression analysis. There was a significant and inverse correlation between age and pulp/tooth area ratio of upper and lower canines (r=-0.794 for upper canine and r=-0.282 for lower canine; p-value<0.001). Linear regression equations were derived separately for upper, lower and both canines. The mean difference between actual and estimated age using upper canine was 6.07±1.7. The results showed that the pulp/tooth area ratios of canines are a reliable method for age estimation in Iranians. The pulp/tooth area ratio of upper canine was better correlated with chronological age than that of lower canine. Copyright © 2018 Elsevier B.V. All rights reserved.
Comparison of three methods for recovery of Brucella canis DNA from canine blood samples.
Batinga, Maria Cryskely A; Dos Santos, Jaíne C; Lima, Julia T R; Bigotto, Maria Fernanda D; Muner, Kerstin; Faita, Thalita; Soares, Rodrigo M; da Silva, David A V; Oliveira, Trícia M F S; Ferreira, Helena L; Diniz, Jaqueline A; Keid, Lara B
2017-12-01
Brucella canis, a gram-negative, facultative intracellular and zoonotic bacterium causes canine brucellosis. Direct methods are the most appropriate for the detection of canine brucellosis and bacterial isolation from blood samples has been employed as gold-standard method. However, due to the delay in obtaining results and the biological risk of the bacterial culturing, the polymerase chain reaction (PCR) has been successfully used as an alternative method for the diagnosis of the infection. Sample preparation is a key step for successful PCR and protocols that provide high DNA yield and purity are recommended to ensure high diagnostic sensitivity. The objective of this study was to evaluate the performance of PCR for the diagnosis of B. canis infection in 36 dogs by testing DNA of whole blood obtained through different extraction and purification protocols. Methods 1 and 2 were based on a commercial kit, using protocols recommended for DNA purification of whole blood and tissue samples, respectively. Method 3 was an in-house method based on enzymatic lysis and purification using organic solvents. The results of the PCR on samples obtained through three different DNA extraction protocols were compared to the blood culture. Of the 36 dogs, 13 (36.1%) were positive by blood culturing, while nine (25.0%), 14 (38.8%), and 15 (41.6%) were positive by PCR after DNA extraction using methods 1, 2 and 3, respectively. PCR performed on DNA purified by Method 2 was as efficient as blood culturing and PCR performed on DNA purified with in-house method, but had the advantage of being less laborious and, therefore, a suitable alternative for the direct B. canis detection in dogs. Copyright © 2017. Published by Elsevier B.V.
Jenkins, Eileen K.; DeChant, Mallory T.; Perry, Erin B.
2018-01-01
The impact of health, management, and microbiota on olfactory function in canines has not been examined in review. The most important characteristic of the detection canine is its sense of smell. Olfactory receptors are primarily located on the ethmoturbinates of the nasal cavity. The vomeronasal organ is an additional site of odor detection that detects chemical signals that stimulate behavioral and/or physiological changes. Recent advances in the genetics of olfaction suggest that genetic changes, along with the unique anatomy and airflow of the canine nose, are responsible for the macrosmia of the species. Inflammation, alterations in blood flow and hydration, and systemic diseases alter olfaction and may impact working efficiency of detection canines. The scientific literature contains abundant information on the potential impact of pharmaceuticals on olfaction in humans, but only steroids, antibiotics, and anesthetic agents have been studied in the canine. Physical stressors including exercise, lack of conditioning, and high ambient temperature impact olfaction directly or indirectly in the canine. Dietary fat content, amount of food per meal, and timing of meals have been demonstrated to impact olfaction in mice and dogs. Gastrointestinal (GI) microbiota likely impacts olfaction via bidirectional communication between the GI tract and brain, and the microbiota is impacted by exercise, diet, and stress. The objective of this literature review is to discuss the specific effects of health, management, and microbiota shifts on olfactory performance in working canines. PMID:29651421
Directory of Open Access Journals (Sweden)
Eileen K. Jenkins
2018-03-01
Full Text Available The impact of health, management, and microbiota on olfactory function in canines has not been examined in review. The most important characteristic of the detection canine is its sense of smell. Olfactory receptors are primarily located on the ethmoturbinates of the nasal cavity. The vomeronasal organ is an additional site of odor detection that detects chemical signals that stimulate behavioral and/or physiological changes. Recent advances in the genetics of olfaction suggest that genetic changes, along with the unique anatomy and airflow of the canine nose, are responsible for the macrosmia of the species. Inflammation, alterations in blood flow and hydration, and systemic diseases alter olfaction and may impact working efficiency of detection canines. The scientific literature contains abundant information on the potential impact of pharmaceuticals on olfaction in humans, but only steroids, antibiotics, and anesthetic agents have been studied in the canine. Physical stressors including exercise, lack of conditioning, and high ambient temperature impact olfaction directly or indirectly in the canine. Dietary fat content, amount of food per meal, and timing of meals have been demonstrated to impact olfaction in mice and dogs. Gastrointestinal (GI microbiota likely impacts olfaction via bidirectional communication between the GI tract and brain, and the microbiota is impacted by exercise, diet, and stress. The objective of this literature review is to discuss the specific effects of health, management, and microbiota shifts on olfactory performance in working canines.
Jenkins, Eileen K; DeChant, Mallory T; Perry, Erin B
2018-01-01
The impact of health, management, and microbiota on olfactory function in canines has not been examined in review. The most important characteristic of the detection canine is its sense of smell. Olfactory receptors are primarily located on the ethmoturbinates of the nasal cavity. The vomeronasal organ is an additional site of odor detection that detects chemical signals that stimulate behavioral and/or physiological changes. Recent advances in the genetics of olfaction suggest that genetic changes, along with the unique anatomy and airflow of the canine nose, are responsible for the macrosmia of the species. Inflammation, alterations in blood flow and hydration, and systemic diseases alter olfaction and may impact working efficiency of detection canines. The scientific literature contains abundant information on the potential impact of pharmaceuticals on olfaction in humans, but only steroids, antibiotics, and anesthetic agents have been studied in the canine. Physical stressors including exercise, lack of conditioning, and high ambient temperature impact olfaction directly or indirectly in the canine. Dietary fat content, amount of food per meal, and timing of meals have been demonstrated to impact olfaction in mice and dogs. Gastrointestinal (GI) microbiota likely impacts olfaction via bidirectional communication between the GI tract and brain, and the microbiota is impacted by exercise, diet, and stress. The objective of this literature review is to discuss the specific effects of health, management, and microbiota shifts on olfactory performance in working canines.
The Comparative Diagnostic Features of Canine and Human Lymphoma
Directory of Open Access Journals (Sweden)
Davis M. Seelig
2016-06-01
Full Text Available The non-Hodgkin lymphomas (NHLs are a heterogeneous family of lymphoid malignancies that are among the most common neoplasms of both dogs and humans. Owing to shared molecular, signaling, incidence, and pathologic features, there is a strong framework supporting the utilization of canine lymphoma as a comparative, large animal model of human NHL. In alignment with the biologic similarities, the current approach towards the diagnosis and classification of canine lymphoma is based upon the human World Health Organization guidelines. While this approach has contributed to an increasing appreciation of the potential biological scope of canine lymphoma, it has also become apparent that the most appropriate diagnostic philosophy must be multimodal, namely by requiring knowledge of microscopic, immunophenotypic, and clinical features before establishing a final disease diagnosis. This review seeks to illustrate the comparative similarities and differences in the diagnosis of canine lymphoma through the presentation of the microscopic and immunophenotypic features of its most common forms.
The Comparative Diagnostic Features of Canine and Human Lymphoma.
Seelig, Davis M; Avery, Anne C; Ehrhart, E J; Linden, Michael A
2016-06-01
The non-Hodgkin lymphomas (NHLs) are a heterogeneous family of lymphoid malignancies that are among the most common neoplasms of both dogs and humans. Owing to shared molecular, signaling, incidence, and pathologic features, there is a strong framework supporting the utilization of canine lymphoma as a comparative, large animal model of human NHL. In alignment with the biologic similarities, the current approach towards the diagnosis and classification of canine lymphoma is based upon the human World Health Organization guidelines. While this approach has contributed to an increasing appreciation of the potential biological scope of canine lymphoma, it has also become apparent that the most appropriate diagnostic philosophy must be multimodal, namely by requiring knowledge of microscopic, immunophenotypic, and clinical features before establishing a final disease diagnosis. This review seeks to illustrate the comparative similarities and differences in the diagnosis of canine lymphoma through the presentation of the microscopic and immunophenotypic features of its most common forms.
Directory of Open Access Journals (Sweden)
Shalini Gupta
2014-01-01
Full Text Available Aim: To investigate whether sexual dimorphism can be established by odontometric study of permanent maxillary canine teeth as well as inter-canine width in north Indian population. Study Design: The study was carried out at department of oral and maxillofacial pathology, King George′s Medical University, Lucknow, India on students and patients reporting at OPD. Out of total 180 subjects examined 90 subjects were female and 90 were male. Impressions of the upper arch were made using alginate and casts poured in dental stone. The mesiodistal diameter (MD of the crown of permanent maxillary canine both on right and left sides and inter-canine width were measured. From these measurements, maxillary canine index was calculated. The percentage of sexual dimorphism (SD was assessed for all the parameters. Results: In the present study, the MD of maxillary canine for both right (P = 0.001 and left side (P = 0.005 was significantly higher among male subjects than females, Similar observation was found for inter-canine width too (P = 0.0001. However, the maxillary canine index for right and left was almost similar (P > 0.05 for both male and female subjects. The SD in right and left MDs of maxillary canine was 4.2% and 3.6% respectively. For, inter-canine width it was maximum (13.7%. However, SD in right and left canine index showed negative values (−2.1% and -0.9% respectively. Conclusion: There was SD in MD and inter-canine width of permanent maxillary canine teeth. SD was more on right permanent maxillary canine teeth than left permanent maxillary canine.
[Nonsurgical endodontic treatment of an invaginated canine].
Fernández Guerrero, F; Miñana Laliga, R; Bullon Fernandez, P
1989-01-01
We present a case of a maxillary canine with a dens invaginatus treated successfully. The patient had pain, swelling and a sinus tract coming from the inmature apex of the canine. The canals were enlarged and cleaned and the main canal was filled with Calcium Hydroxide to allow the root development. Seven months later, the patient was asymptomatic and the tooth was obturated with guttapercha. One year later it was confirm the success in the treatment.
Canine babesiosis: from molecular taxonomy to control
Directory of Open Access Journals (Sweden)
Irwin Peter J
2009-03-01
Full Text Available Abstract Canine babesiosis is a clinically significant emerging vector-borne disease caused by protozoan haemoparasites. This review article considers recent literature pertaining to the taxonomic classification of Babesia and Theileria species affecting dogs and the geographical distribution of these parasites. The diagnosis of canine babesiosis by traditional, molecular and serological methods is reviewed, together with recent advances in our understanding of the pathophysiology of piroplasmosis, and of the treatment and prevention of this disease.
Directory of Open Access Journals (Sweden)
Weigeng Shao
2017-11-01
Full Text Available Giant panda is the world-class precious endangered species, facing the canine distemper and other important infectious diseases on its wild and captive population of a serious threat. In this study, we used MaxEnt model and combined with ArcGIS analysis to predict the potential risk of canine distemper to giant panda habitat in Sichuan, Gansu and Shaanxi Provinces, China. The results showed that 35.05% and 19.47% of the distribution areas of the giant pandas were in the high risk and medium risk of canine distemper, respectively. The canine distemper pose a great risk to the healthy survival of giant pandas in China. In future, epidemic prevention, vaccine development and application of wild animals should be enhanced so as to effectively protect the giant panda.
Genetic characterization of canine influenza A virus (H3N2) in Thailand.
Bunpapong, Napawan; Nonthabenjawan, Nutthawan; Chaiwong, Supassama; Tangwangvivat, Ratanaporn; Boonyapisitsopa, Supanat; Jairak, Waleemas; Tuanudom, Ranida; Prakairungnamthip, Duangduean; Suradhat, Sanipa; Thanawongnuwech, Roongroje; Amonsin, Alongkorn
2014-02-01
In January 2012, several clinical cases of dogs with flu-like symptoms, including coughing, sneezing, nasal discharge, and fever, were reported in a small-animal hospital located in Bangkok, Thailand. One influenza A virus was identified and characterized as an avian-like influenza virus H3N2. The virus was named A/canine/Thailand/CU-DC5299/12. A phylogenetic analysis indicated that the canine virus belonged to an avian Eurasian lineage and was genetically related to the canine influenza viruses H3N2 from China and Korea. This canine virus displays a unique genetic signature with two amino acid insertions in the NA protein, which is similar to the canine influenza viruses from eastern China (Zhejiang and Jiangsu). This study constitutes the first report of H3N2 canine influenza virus infection in a small-animal hospital in Thailand.
Genetic variant of canine distemper virus from clinical cases in ...
African Journals Online (AJOL)
Canine distemper virus (CDV) is a highly contagious viral pathogen of worldwide distribution that can cause lethal disease in domestic dogs and other members of the family Canidae. Genetic diversity is found among reference strains and isolates of CDV, mainly in the haemagglutinin (H) protein, and this may be ...
Glucosamine and chondroitin use in canines for osteoarthritis: A ...
African Journals Online (AJOL)
Osteoarthritis is a slowly progressive and debilitating disease that affects canines of all breeds. Pain and decreased mobility resulting from osteoarthritis often have a negative impact on the affected canine's quality of life, level of comfort, daily functioning, activity, behaviour, and client-pet companionship. Despite limited and ...
Leishmania (infantum) chagasi in canine urinary sediment
Mendonça, Ivete Lopes de; Batista, Joilson Ferreira; Alves, Leucio Camara
2015-01-01
Canine visceral leishmaniasis (CVL) is difficult to diagnosis, mainly due to the presence of asymptomatic animals, the diversity of clinical symptoms and the difficulty in obtaining diagnostic evidence of high sensitivity and specificity. The purpose of this study was to diagnose CVL in urinary sediment of 70 dogs of different breeds, sexes and ages from the veterinary hospital of the Federal University of Piauí and Zoonosis Control Center of Teresina, Brazil. The serological tests were TR DP...
Scharf, Valery F; Farese, James P; Coomer, Alastair R; Milner, Rowan J; Taylor, David P; Salute, Marc E; Chang, Myron N; Neal, Dan; Siemann, Dietmar W
2013-05-01
Objective-To investigate the effects of bevacizumab, a human monoclonal antibody against vascular endothelial growth factor, on the angiogenesis and growth of canine osteosarcoma cells xenografted in mice. Animals-27 athymic nude mice. Procedures-To each mouse, highly metastasizing parent osteosarcoma cells of canine origin were injected into the left gastrocnemius muscle. Each mouse was then randomly allocated to 1 of 3 treatment groups: high-dose bevacizumab (4 mg/kg, IP), low-dose bevacizumab (2 mg/kg, IP), or control (no treatment). Tumor growth (the number of days required for the tumor to grow from 8 to 13 mm), vasculature, histomorphology, necrosis, and pulmonary metastasis were evaluated. Results-Mice in the high-dose bevacizumab group had significantly delayed tumor growth (mean ± SD, 13.4 ± 3.8 days; range, 9 to 21 days), compared with that for mice in the low-dose bevacizumab group (mean ± SD, 9.4 ± 1.5 days; range, 7 to 11 days) or control group (mean ± SD, 7. 2 ± 1.5 days; range, 4 to 9 days). Mice in the low-dose bevacizumab group also had significantly delayed tumor growth, compared with that for mice in the control group. Conclusions and Clinical Relevance-Results indicated that bevacizumab inhibited growth of canine osteosarcoma cells xenografted in mice, which suggested that vascular endothelial growth factor inhibitors may be clinically useful for the treatment of osteosarcoma in dogs. Impact for Human Medicine-Canine osteosarcoma is used as a research model for human osteosarcoma; therefore, bevacizumab may be clinically beneficial for the treatment of osteosarcoma in humans.
A case of unusual root morphology: Maxillary canine with two roots
Directory of Open Access Journals (Sweden)
Nagesh Bolla
2009-01-01
Full Text Available The case describes a 3 months follow-up of the treatment of a maxillary canine with two roots. Clinical examination revealed a maxillary canine with a large carious lesion and an exaggerated response to cold thermal tests. Radiographic examination revealed a large distal carious lesion that appeared to invade the pulp chamber. The radiograph also revealed what appeared to be an extra root in this permanent maxillary canine.
Hegde, Gautham; Hegde, Nanditha; Kumar, Anil; Keshavaraj
2014-07-01
Orthodontic diagnosis and treatment planning for growing children must involve growth prediction, especially in the treatment of skeletal problems. Studies have shown that a strong association exists between skeletal maturity and dental calcification stages. The present study was therefore taken up to provide a simple and practical method for assessing skeletal maturity using a dental periapical film and standard dental X-ray machine, to compare the developmental stages of the mandibular canine with that of developmental stages of modified MP3 and to find out if any correlation exists, to determine if the developmental stages of the mandibular canine alone can be used as a reliable indicator for assessment of skeletal maturity. A total of 160 periapical radiographs, of the mandibular right canine and the MP3 region was taken and assessed according to the Dermirjian's stages of dental calcification and the modified MP3 stages. The correlation coefficient between MP3 stages and developmental stages of mandibular canine was found to be significant in both male and female groups. When the canine calcification stages were compared with the MP3 stages it was found that with the exception of the D stage of canine calcification the remaining stages showed a very high correlation with the modified MP3 stages. The correlation between the mandibular canine calcification stages, and the MP3 stages was found to be significant. The canine calcification could be used as a sole indicator for assessment of skeletal maturity.
Directory of Open Access Journals (Sweden)
PAN Li-yuan
2016-11-01
Full Text Available Taoyuan, Yunnan Province is a special eco-site which keeps the highest yield records of rice cultivation in small planting areas. Soil microbial species and functional diversity were evaluated using cultivation method and BIOLOG ecoplates. The results showed that the microbial community of the high yield region was more abundant, and the total microbial population was 2 times of the control, furthermore, the areas belonged to the healthy "bacteria" soil, which was showed as bacteria > actinomycetes > fungi. Bacteria were the dominant populations in the rhizosphere of high yielding rice field, and the yield formation of rice was not correlated with the depth of soil layers. In order to obtain more species diversity information, Shannon diversity index H, Shannon evenness index E and Simpson index D were analyzed, and the results showed that microbial community diversity and evenness were not the main differences between the high and general yield areas. Then, the functional diversity of soil microbial community was investigated through the average well color development(AWCD and diversity index analyses. The results of AWCD analysis indicated that the metabolic activity of soil microbial community in high yield paddy soils were stronger than the control. Moreover, the difference range from large to small showed as tillering stage > harvest period > seedling period > rotation period, the stronger the rice growth, the greater the difference between the high yield region and the control. At tillering stage and harvest stage, due to the vigorous plant growth, the root exudates were rich, and the microbial communities of high yield paddy soils showed a strong metabolic activity and strong ability to use carbon sources. The results of Shannon, Simpson and McIntosh indices analysis indicated that common microbial species was not a key factor affecting the yield of rice. Tillering stage was a key period for the growth of high yield rice, and many
Why is Southern African canine babesiosis so virulent? An evolutionary perspective
Directory of Open Access Journals (Sweden)
Penzhorn Barend L
2011-04-01
Full Text Available Abstract Canine babesiosis is a common, highly virulent disease in Southern Africa with even pups and juveniles being severely affected. This contrasts with bovine babesiosis, for example, where host, parasite and vector co-evolved and young animals develop immunity after infection without showing clinical signs. Babesia rossi, the main causative organism of canine babesiosis in sub-Saharan Africa, was first described from a side-striped jackal (Canis adustus in Kenya. Although data are meagre, there is evidence that indigenous African canids, such as jackals and wild dogs (Lycaon pictus, can harbour the parasite without showing untoward effects. Dogs are not indigenous to Africa. The vast majority of dogs presented at veterinary facilities in South Africa represent recently introduced European, Asian or American breeds. The contention is that B. rossi is a new challenge to which these dogs have not adapted. With intensive treatment of clinical cases, natural selection is effectively negated and the status quo will probably be maintained indefinitely. It is postulated that Babesia vogeli, which frequently results in unapparent infections or mild manifestations in dogs, represents or is closely related to the ancestral form of the canine parasite, possibly originating from wolves (Canis lupus.
Mast cells in Canine parvovirus-2-associated enteritis with crypt abscess.
Woldemeskel, M W; Saliki, J T; Blas-Machado, U; Whittington, L
2013-11-01
The role of mast cells (MCs) in allergic reactions and parasitic infections is well established. Their involvement in host immune response against bacterial and viral infections is reported. In this study, investigation is made to determine if MCs are associated with Canine parvovirus-2 (CPV-2)-induced enteritis with crypt abscess (ECA). Mast cell count (MCC) was made on toluidine blue-stained intestinal sections from a total of 34 dogs. These included 16 dogs exhibiting ECA positive for CPV-2 and negative for Canine distemper virus and Canine coronavirus by immunohistochemistry and fluorescent antibody test, 12 dogs with inflammatory bowel disease (IBD), and 6 non-ECA/non-IBD (control) dogs. The average total MCC per high-power field in ECA (40.8 ± 2.2) and IBD (24.7 ± 2.1) was significantly higher (P .05), MCC was also higher in ECA than in IBD. The present study for the first time has documented significantly increased MCs in CPV-2-associated ECA as was previously reported for IBD, showing that MCs may also play an important role in CPV-2-associated ECA. Further studies involving more CPV-infected dogs are recommended to substantiate the findings.
Purification and partial characterization of canine S100A12.
Heilmann, Romy M; Suchodolski, Jan S; Steiner, Jörg M
2010-12-01
Canine S100A12 (cS100A12) is a calcium-binding protein of the S100 superfamily of EF-hand proteins, and its expression is restricted to neutrophils and monocytes. Interaction of S100A12 with the receptor for advanced glycation end products (RAGE) has been suggested to play a central role in inflammation. Moreover, S100A12 has been shown to represent a sensitive and specific marker for gastrointestinal inflammation in humans. Only human, porcine, bovine, and rabbit S100A12 have been purified to date, and an immunoassay for the quantification of S100A12 is available only for humans. Therefore, the aim of this study was to develop a protocol for the purification of S100A12 and to partially characterize this protein in the dog (Canis lupus familiaris) as a prelude to the development of an immunologic method for its detection and quantification in canine serum and fecal specimens. Leukocytes were isolated from canine whole blood by dextran sedimentation, and canine S100A12 was extracted from the cytosol fraction of these cells. Further purification of cS100A12 comprised of ammonium sulfate precipitation, hydrophobic interaction chromatography, and strong cation- and anion-exchange column chromatography. Canine S100A12 was successfully purified from canine whole blood. The relative molecular mass of the protein was estimated at 10,379.5 and isoelectric focusing revealed an isoelectric point of 6.0. The approximate specific absorbance of cS100A12 at 280 nm was determined to be 1.78 for a 1 mg/ml solution. The N-terminal AA sequence of the first 15 residues of cS100A12 was Thr-Lys-Leu-Glu-Asp-His-X-Glu-Gly-Ile-Val-Asp-Val-Phe-His, and revealed 100% identity with the predicted protein sequence available through the canine genome project. Sequence homology for the 14 N-terminal residues identified for cS100A12 with those of feline, bovine, porcine, and human S100A12 was 78.6%. We conclude that canine S100A12 can be successfully purified from canine whole blood using the
Krause-Parello, Cheryl A; Sarni, Sarah; Padden, Eleni
2016-12-01
Veterans with post-traumatic stress disorder (PTSD) are a vulnerable population at high risk for depression, isolation, and suicide. A substantial body of anecdotal evidence exists supporting the use of canines as an effective adjunct treatment for this population. However, a comprehensive review of its use based on scientific literature has thus far not been conducted. A narrative literature review was conducted to examine the current state of the science on canine assistance for veterans diagnosed with PTSD in order to synthesize current empirical knowledge on the subject. Articles were retrieved among the small body of recent literature using computerized database searches. Inclusion criteria included peer-reviewed journal publications published through October 1st, 2015. Only originally published articles that examined the outcomes of canine assistance on veterans with PTSD were examined. Additionally, each included article was specific to veterans, dogs, and, PTSD in combination rather than article that discuss the concepts separately. Exclusion criteria included symposia and conference material, dissertations, media articles, and no mention of canines as a treatment modality. 563 articles were retrieved; 6 met the criteria. When evaluating data, information and themes were extracted into an Excel table; this table was employed in the synthesis of information into manuscript form. The following themes were explored within the selected publications: What is Canine Assistance; Why Use Canine Assistance for PTSD in Veterans; Concerns; and Future Directions. The literature endorsed canine assistance for PTSD in veterans as a promising modality. Authors also raised concerns about lack of protocols, cost and availability barriers, and animal welfare calling for additional, rigorous research to advance its use as a treatment for veterans with PTSD. PTSD continues to pose significant psychological, health, and welfare challenges to veterans and the multi
Guarnieri, R; Cavallini, C; Vernucci, R; Vichi, M; Leonardi, R; Barbato, E
2016-11-01
The prevalence of impacted maxillary canine is reported to be between 1% and 3%. The lack of monitoring and the delay in the treatment of the impacted canine can cause different complications such as: displacement of adjacent teeth, loss of vitality of neighbouring teeth, shortening of the dental arch, follicular cysts, canine ankylosis, recurrent infections, recurrent pain, internal resorption of the canine and the adjacent teeth, external resorption of the canine and the adjacent teeth, combination of these factors. An appropriate diagnosis, accurate predictive analysis and early intervention are likely to prevent such undesirable effects. The objective is to evaluate, by means of a retrospective observational study, the possibility of carrying out a predictive analysis of root resorption adjacent to the impacted canines by means of orthopantomographs, so as to limit the prescription of additional 3D radiography. 120 subjects with unilateral or bilateral maxillary impacted canine were examined and 50 patients with 69 impacted maxillary canine (22 male, 28 female; mean age: 11.7 years) satisfied the inclusion criteria of the study. These patients were subjected to a basic clinical and radiographic investigation (orthopantomographs and computerized tomography). All panoramic films were viewed under standardized conditions for the evaluation of two main variables: maxillary canine angulations (a, b, g angles) and the overlapping between the impacted teeth and the lateral incisor (Analysis of Lindauer). Binary logistic regression was used to estimate the likelihood of resorbed lateral incisors depending on sector location and angle measurements. Results indicated that b angle has the greatest influence on the prediction of root resorption (predictive value of b angle = 76%). If β angle <18° and Lindauer = I, the probability of resorption is 0.06. Evaluation of b angle and superimposition lateral incisor/impacted canine analysed on orthopantomographs could be one of
Carter, Elizabeth K.; Melkonian, Jeff; Riha, Susan J.; Shaw, Stephen B.
2016-09-01
Several recent studies have indicated that high air temperatures are limiting maize (Zea mays L.) yields in the US Corn Belt and project significant yield losses with expected increases in growing season temperatures. Further work has suggested that high air temperatures are indicative of high evaporative demand, and that decreases in maize yields which correlate to high temperatures and vapor pressure deficits (VPD) likely reflect underlying soil moisture limitations. It remains unclear whether direct high temperature impacts on yields, independent of moisture stress, can be observed under current temperature regimes. Given that projected high temperature and moisture may not co-vary the same way as they have historically, quantitative analyzes of direct temperature impacts are critical for accurate yield projections and targeted mitigation strategies under shifting temperature regimes. To evaluate yield response to above optimum temperatures independent of soil moisture stress, we analyzed climate impacts on irrigated maize yields obtained from the National Corn Growers Association (NCGA) corn yield contests for Nebraska, Kansas and Missouri. In irrigated maize, we found no evidence of a direct negative impact on yield by daytime air temperature, calculated canopy temperature, or VPD when analyzed seasonally. Solar radiation was the primary yield-limiting climate variable. Our analyses suggested that elevated night temperature impacted yield by increasing rates of phenological development. High temperatures during grain-fill significantly interacted with yields, but this effect was often beneficial and included evidence of acquired thermo-tolerance. Furthermore, genetics and management—information uniquely available in the NCGA contest data—explained more yield variability than climate, and significantly modified crop response to climate. Thermo-acclimation, improved genetics and changes to management practices have the potential to partially or completely
Efficient adenovector CD40 ligand immunotherapy of canine malignant melanoma.
von Euler, Henrik; Sadeghi, Arian; Carlsson, Björn; Rivera, Patricio; Loskog, Angelica; Segall, Thomas; Korsgren, Olle; Tötterman, Thomas H
2008-05-01
Cutaneous canine melanomas are usually benign in contrast to human malignant melanoma. However, the canine oropharyngeal, uveal, and mucocutaneous neoplasms are aggressive and have metastatic potential. Surgery and to a lesser extent radiotherapy and chemotherapy are widely adopted treatments but are seldom curative in advanced stages. The similarities between human and canine melanoma make spontaneous canine melanoma an excellent disease model for exploring novel therapies. Herein, we report the first 2 adenovector CD40L immunogene (AdCD40L) treatments of aggressive canine malignant melanoma. Case no. 1 was an advanced stage III oral melanoma that was cured from malignant melanoma with 2 intratumor AdCD40L injections before cytoreductive surgery. After treatment, the tumor tissue was infiltrated with T lymphocytes and B lymphocytes suggesting immune activation. This dog survived 401 days after the first round of gene therapy and was free of melanoma at autopsy. Case no. 2 had a conjunctival malignant melanoma with a rapid progression. This case was treated with 6 AdCD40L injections over 60 days. One hundred and twenty days after start of gene therapy and 60 days after the last injection, the tumor had regressed dramatically, and the dog had a minimal tumor mass and no signs of progression or metastasis. Our results indicate that AdCD40L immunogene therapy is beneficial in canine malignant melanoma and could be considered for human malignant melanoma as well.
High-yield oil palm expansion spares land at the expense of forests in the Peruvian Amazon
International Nuclear Information System (INIS)
Gutiérrez-Vélez, Víctor H; DeFries, Ruth; Uriarte, María; Lim, Yili; Pinedo-Vásquez, Miguel; Padoch, Christine; Baethgen, Walter; Fernandes, Katia
2011-01-01
High-yield agriculture potentially reduces pressure on forests by requiring less land to increase production. Using satellite and field data, we assessed the area deforested by industrial-scale high-yield oil palm expansion in the Peruvian Amazon from 2000 to 2010, finding that 72% of new plantations expanded into forested areas. In a focus area in the Ucayali region, we assessed deforestation for high- and smallholder low-yield oil palm plantations. Low-yield plantations accounted for most expansion overall (80%), but only 30% of their expansion involved forest conversion, contrasting with 75% for high-yield expansion. High-yield expansion minimized the total area required to achieve production but counter-intuitively at higher expense to forests than low-yield plantations. The results show that high-yield agriculture is an important but insufficient strategy to reduce pressure on forests. We suggest that high-yield agriculture can be effective in sparing forests only if coupled with incentives for agricultural expansion into already cleared lands.
Orthodontic Traction of Impacted Canine Using Cantilever
Nakandakari, Cláudia; Gonçalves, João Roberto; Cassano, Daniel Serra; Raveli, Taísa Boamorte; Bianchi, Jonas; Raveli, Dirceu Barnabé
2016-01-01
The impaction of the maxillary canines causes relevant aesthetic and functional problems. The multidisciplinary approach to the proper planning and execution of orthodontic traction of the element in question is essential. Many strategies are cited in the literature; among them is the good biomechanical control in order to avoid possible side effects. The aim of this paper is to present a case report in which a superior canine impacted by palatine was pulled out with the aid of the cantilever...
Detection of canine pneumovirus in dogs with canine infectious respiratory disease.
Mitchell, Judy A; Cardwell, Jacqueline M; Renshaw, Randall W; Dubovi, Edward J; Brownlie, Joe
2013-12-01
Canine pneumovirus (CnPnV) was recently identified during a retrospective survey of kenneled dogs in the United States. In this study, archived samples from pet and kenneled dogs in the United Kingdom were screened for CnPnV to explore the relationship between exposure to CnPnV and the development of canine infectious respiratory disease (CIRD). Within the pet dog population, CnPnV-seropositive dogs were detected throughout the United Kingdom and Republic of Ireland, with an overall estimated seroprevalence of 50% (n = 314/625 dogs). In the kennel population, there was a significant increase in seroprevalence, from 26% (n = 56/215 dogs) on the day of entry to 93.5% (n = 201/215 dogs) after 21 days (P respiratory disease than those that did not seroconvert (P respiratory disease than immunologically naive dogs (P respiratory signs and histopathological changes and in dogs housed for 8 to 14 days, which coincided with a significant increase in the risk of developing respiratory disease compared to the risk of those housed 1 to 7 days (P disease prevention strategy.
Yield strength of molybdenum, tantalum and tungsten at high strain rates and very high temperatures
International Nuclear Information System (INIS)
Škoro, G.P.; Bennett, J.R.J.; Edgecock, T.R.; Booth, C.N.
2012-01-01
Highlights: ► New experimental data on the yield strength of molybdenum, tantalum and tungsten. ► High strain rate effects at record high temperatures (up to 2700 K). ► Test of the consistency of the Zerilli–Armstrong model at very high temperatures. - Abstract: Recently reported results of the high strain rate, high temperature measurements of the yield strength of tantalum and tungsten have been analyzed along with new experimental results on the yield strength of molybdenum. Thin wires are subjected to high stress by passing a short, fast, high current pulse through a thin wire; the amplitude of the current governs the stress and the repetition rate of the pulses determines the temperature of the wire. The highest temperatures reached in the experiments were 2100 °C (for molybdenum), 2250 °C (for tantalum) and 2450 °C (for tungsten). The strain-rates in the tests were in the range from 500 to 1500 s −1 . The parameters for the constitutive equation developed by Zerilli and Armstrong have been determined from the experimental data and the results have been compared with the data obtained at lower temperatures. An exceptionally good fit is obtained for the deformation of tungsten.
Directory of Open Access Journals (Sweden)
Patil Sandeep S
2012-01-01
Full Text Available Abstract Oncolytic viruses refer to those that are able to eliminate malignancies by direct targeting and lysis of cancer cells, leaving non-cancerous tissues unharmed. Several oncolytic viruses including adenovirus strains, canine distemper virus and vaccinia virus strains have been used for canine cancer therapy in preclinical studies. However, in contrast to human studies, clinical trials with oncolytic viruses for canine cancer patients have not been reported. An 'ideal' virus has yet to be identified. This review is focused on the prospective use of oncolytic viruses in the treatment of canine tumors - a knowledge that will undoubtedly contribute to the development of oncolytic viral agents for canine cancer therapy in the future.
High-yield criteria for panoramic radiography. Final report
International Nuclear Information System (INIS)
White, S.C.; Forsythe, A.B.
1982-06-01
Panoramic radiographs should be obtained when the examination offers the prospect of providing information that will assist in patient care. The purpose of this study was to determine whether high-yield criteria could be developed for the use of panoramic radiographs in the treatment planning of patients seeking dental care. Clinicians were asked what signs or symptoms caused them to order a panoramic radiograph upon patient admission into the UCLA Dental Clinic. At the time the patient was radiographed, a variety of demographic and clinical measures were recorded. The most important high-yield criterion for the panoramic examination is whether the radiograph is ordered for 'general screening examination' (a negative predictor) and whether the radiograph was ordered for any specific examination (a positive predictor). The use of these (or any other) decision rules required clinical judgment of the costs (social and economic) of a missed positive finding relative to that of an unproductive examination
Wilmes, Benedict; Drescher, Dieter
2009-05-01
In the course of a clinical pilot study we tested the vertical periodontal ligament (V-PDL) distraction as a means of aligning ankylosed upper canines. The objective of this study was to analyze the appropriateness und effectiveness of this method. The ankylosed upper canines of five female patients aged between 16 und 19 years were surgically exposed, luxated, and after a latency period of 5 to 7 days, distracted at a rate of 0.5 mm per day. The installed distractors were borne by the periodontal-mucosa, the periodontal-mucosa and the bone, or by the bone exclusively. We evaluated the distraction distance and time and degree of hard and soft tissue generation present in the region surrounding the distracted teeth. All canines were aligned after a mean distraction period of 43.2 days (+/- 3.6 days). The mean distraction distance was 10.8 mm. Three canines had defects at the cemento-enamel junction, and one canine had to be extracted due to a large defect at the root. Vertical PDL distraction is a minimally-invasive therapy to align ankylosed impacted canines. Even if the long-term prognosis of distracted canines with defects is uncertain, the patient benefits from the vertical PDL distraction because both hard and soft tissues are generated in the vicinity of the distracted canine.
High-Yield Synthesis of Zinc Oxide Nanoparticles from Bicontinuous Microemulsions
Directory of Open Access Journals (Sweden)
S. López-Cuenca
2011-01-01
Full Text Available The high-yield synthesis of zinc oxide (ZnO primary nanoparticles with high purity and with diameters between 6 and 22 nm using bicontinuous microemulsions is reported in this work. The ZnO nanoparticles were made by hydrolysis of Zn(NO32 with NaOH aqueous solution and precipitation, followed by calcination of the precipitate. Higher yields and productivities of ZnO nanoparticles were obtained compared to values produced with w/o micremulsions reported in the literature. Particles were characterized by transmission electronic microscopy (TEM, X-ray diffraction, and atomic absorption spectroscopy.
A high yielding, better quality chickpea mutant variety 'NIFA-95'
International Nuclear Information System (INIS)
Hassan, S.; Javed, M.A.; Khattak, S.U.K.; Iqbal, M.M.
2001-01-01
Chickpea or gram (Cicer arietinum L.) is an important legume crop of Pakistan, grown on over one million hectares annually. The national average yield of the crop is very low (0.5 t/ha) and thus the country had to spent about 2 billion rupees ($ 50 million) on import of pulses. The main causes of low yield are non-availability of genetic sources for resistance to various diseases especially gram blight Ascochyta rabiei (Pass.) Lab., insect pest (Pod borer) and non-adoption of proper production technology by the farmers. This calls for earnest efforts of breeders to evolve high yielding and disease resistant varieties of chickpea for provision of quality seeds to the farming community to increase production of this important crop. Seeds of a highly blight susceptible variety '6153' were irradiated at 200 Gy dose of gamma radiation in 1985 and the promising mutant line CMN-446-4 was selected in M3 generation on the basis of disease resistance, greater number of pods and better plant type. After confirmation of its resistance to blight in M 4 and M 5 , the mutant line was evaluated in various trials at different locations. In the advanced and zonal yield trials during 1993-95, the line CMN-446-4 produced the highest grain yield of 2,600 kg/ha as compared to the rest of the mutants and varieties. The line was also evaluated in the chickpea national uniform yield trial, conducted on over 11 locations in the country during 1993-94. In this trial, the mutant line ranked 3rd by producing an average yield of 1,528 kg/ha as compared to the two check varieties 'Punjab-91' (1,316 kg/ha) and 'Paidar-91' (1,391 kg/ha). The mutant line CMN-446-4 is moderately resistant to gram blight, highly resistant to stored pest (pulse beetle), contains 25.3% more protein as compared to the parental variety 6153 and is also better in nitrogen fixing capacity.The proposal for release of the mutant line CMN-446-4 as a new variety under the name 'NIFA-95' for general cultivation in the rainfed
Setting the Record Straight on "High-Yield" Strategies
Marzano, Robert J.
2009-01-01
Widely credited with proposing nine "high-yield" instructional strategies, author Robert J. Marzano sets the record straight about the broader number of strategies identified by the research. He provides a list of 41 strategies and suggests more nuanced ways of using, observing, and evaluating them. (Contains 1 figure.)
Directory of Open Access Journals (Sweden)
Hiroki Yamazaki
Full Text Available Canine histiocytic sarcoma (CHS is an aggressive malignant neoplasm that originates from histiocytic lineage cells, including dendritic cells and macrophages, and is characterized by progressive local infiltration and a very high metastatic potential. Survivin is as an apoptotic inhibitory factor that has major functions in cell proliferation, including inhibition of apoptosis and regulation of cell division, and is expressed in most types of human and canine malignant neoplasms, including melanoma and osteosarcoma. To investigate whether survivin was expressed at high levels in CHS and whether its expression was correlated with the aggressive biological behavior of CHS, we assessed relation between survivin expression and CHS progression, as well as the effects of survivin inhibition on the biological activities of CHS cells. We comparatively analyzed the expression of 6 selected anti-apoptotic genes, including survivin, in specimens from 30 dogs with histiocytic sarcoma and performed annexin V staining to evaluate apoptosis, methylthiazole tetrazolium assays to assess cell viability and chemosensitivity, and latex bead assays to measure changes in phagocytic activities in 4 CHS cell lines and normal canine fibroblasts transfected with survivin siRNA. Survivin gene expression levels in 30 specimens were significantly higher than those of the other 6 genes. After transfection with survivin siRNA, apoptosis, cell growth inhibition, enhanced chemosensitivity, and weakened phagocytic activities were observed in all CHS cell lines. In contrast, normal canine fibroblasts were not significantly affected by survivin knockdown. These results suggested that survivin expression may mediate the aggressive biological activities of CHS and that survivin may be an effective therapeutic target for the treatment of CHS.
Methods for high yield production of terpenes
Energy Technology Data Exchange (ETDEWEB)
Kutchan, Toni; Higashi, Yasuhiro; Feng, Xiaohong
2017-01-03
Provided are enhanced high yield production systems for producing terpenes in plants via the expression of fusion proteins comprising various combinations of geranyl diphosphate synthase large and small subunits and limonene synthases. Also provided are engineered oilseed plants that accumulate monoterpene and sesquiterpene hydrocarbons in their seeds, as well as methods for producing such plants, providing a system for rapidly engineering oilseed crop production platforms for terpene-based biofuels.
Genetics of Human and Canine Dilated Cardiomyopathy
Siobhan Simpson; Jennifer Edwards; Thomas F. N. Ferguson-Mignan; Malcolm Cobb; Nigel P. Mongan; Catrin S. Rutland
2015-01-01
Cardiovascular disease is a leading cause of death in both humans and dogs. Dilated cardiomyopathy (DCM) accounts for a large number of these cases, reported to be the third most common form of cardiac disease in humans and the second most common in dogs. In human studies of DCM there are more than 50 genetic loci associated with the disease. Despite canine DCM having similar disease progression to human DCM studies into the genetic basis of canine DCM lag far behind those of human DCM. In th...
Directory of Open Access Journals (Sweden)
Nathaniel B Lyman
Full Text Available Future increases in global surface temperature threaten those worldwide who depend on rice production for their livelihoods and food security. Past analyses of high-temperature stress on rice production have focused on paddy yield and have failed to account for the detrimental impact of high temperatures on milling quality outcomes, which ultimately determine edible (marketable rice yield and market value. Using genotype specific rice yield and milling quality data on six common rice varieties from Arkansas, USA, combined with on-site, half-hourly and daily temperature observations, we show a nonlinear effect of high-temperature stress exposure on yield and milling quality. A 1 °C increase in average growing season temperature reduces paddy yield by 6.2%, total milled rice yield by 7.1% to 8.0%, head rice yield by 9.0% to 13.8%, and total milling revenue by 8.1% to 11.0%, across genotypes. Our results indicate that failure to account for changes in milling quality leads to understatement of the impacts of high temperatures on rice production outcomes. These dramatic losses result from reduced paddy yield and increased percentages of chalky and broken kernels, which together decrease the quantity and market value of milled rice. Recently published estimates show paddy yield reductions of up to 10% across the major rice-producing regions of South and Southeast Asia due to rising temperatures. The results of our study suggest that the often-cited 10% figure underestimates the economic implications of climate change for rice producers, thus potentially threatening future food security for global rice producers and consumers.
Orthodontic treatment of a complete transposed impacted maxillary canine
Directory of Open Access Journals (Sweden)
Pi-Huei Liu
2015-03-01
Full Text Available Tooth transposition is a positional interchange of two adjacent teeth. Transposition most often occurs at maxillary canine. Moving transposed teeth to their normal positions is challenging because this requires bodily movement and translation of one tooth to pass another. This procedure may cause damage to the teeth or supporting structures. We report a case of complete transposition of maxillary canine and lateral incisor. Transposed teeth were successfully moved orthodontically to their normal positions. Multiple mechanics were meticulously applied to achieve complete correction of the tooth positions and to minimize root resorption and/or periodontal defects of canine and lateral incisors. Factors concerning treatment planning for transposed teeth are discussed.
Biogas production from high-yielding energy crops in boreal conditions
Energy Technology Data Exchange (ETDEWEB)
Seppala, M.
2013-11-01
In this thesis, the methane production potential of traditional and novel energy crops was evaluated in boreal conditions. The highest methane yield per hectare was achieved with maize (4 000-9 200 m{sup 3}CH{sub 4} ha{sup -1} a{sup -1}) and the second highest with brown knapweed (2 700-6 100 m{sup 3}CH{sub 4} ha{sup -1} a{sup -1}). Recently, the most feasible energy crop, grass, produced 1 200-3 600 m{sup 3}CH{sub 4} ha{sup -1} a{sup -1}. The specific methane yields of traditional and novel energy crops varied from 170-500 l kg{sup -1} volatile solid (VS). The highest specific methane yields were obtained with maize, while the novel energy crops were at a lower range. The specific methane yields decreased in the later harvest time with maize and brown knapweed, and the specific methane yield of the grasses decreased from the 1st to 2nd harvests. Maize and brown knapweed produced the highest total solid (TS) yields per hectare 13-23 tTS ha{sup -1}, which were high when compared with the TS yields of grasses (6-13 tTS ha{sup -1}). The feasibility of maize and brown knapweed in co-digestion with liquid cow manure, in continuously stirred tank reactors (CSTR), was evaluated. According to the CSTR runs, maize and brown knapweed are suitable feeds and have stable processes, producing the highest methane yields (organic loading rate 2 kgVS m{sup -3}d{sup -1}), with maize at 259 l kgVS{sup -1} and brown knapweed at 254 l kgVS{sup -1}. The energy balance (input/output) of the cultivation of the grasses, maize and brown knapweed was calculated in boreal conditions, and it was better when the digestate was used as a fertilizer (1.8-4.8 %) than using chemical fertilizers (3.7-16.2 %), whose production is the most energy demanding process in cultivation. In conclusion, the methane production of maize, grasses and novel energy crops can produce high methane yields and are suitable feeds for anaerobic digestion. The cultivation managements of maize and novel energy crops for
Directory of Open Access Journals (Sweden)
Gautham Hegde
2014-01-01
Full Text Available Objective: Orthodontic diagnosis and treatment planning for growing children must involve growth prediction, especially in the treatment of skeletal problems. Studies have shown that a strong association exists between skeletal maturity and dental calcification stages. The present study was therefore taken up to provide a simple and practical method for assessing skeletal maturity using a dental periapical film and standard dental X-ray machine, to compare the developmental stages of the mandibular canine with that of developmental stages of modified MP3 and to find out if any correlation exists, to determine if the developmental stages of the mandibular canine alone can be used as a reliable indicator for assessment of skeletal maturity. Materials and Methods: A total of 160 periapical radiographs, of the mandibular right canine and the MP3 region was taken and assessed according to the Dermirjian′s stages of dental calcification and the modified MP3 stages. Results and Discussion: The correlation coefficient between MP3 stages and developmental stages of mandibular canine was found to be significant in both male and female groups. When the canine calcification stages were compared with the MP3 stages it was found that with the exception of the D stage of canine calcification the remaining stages showed a very high correlation with the modified MP3 stages. Conclusion: The correlation between the mandibular canine calcification stages, and the MP3 stages was found to be significant. The canine calcification could be used as a sole indicator for assessment of skeletal maturity.
Rapid and sensitive detection of canine parvovirus type 2 by recombinase polymerase amplification.
Wang, Jianchang; Liu, Libing; Li, Ruiwen; Wang, Jinfeng; Fu, Qi; Yuan, Wanzhe
2016-04-01
A novel recombinase polymerase amplification (RPA)-based method for detection of canine parvovirus type 2 (CPV-2) was developed. Sensitivity analysis showed that the detection limit of RPA was 10 copies of CPV-2 genomic DNA. RPA amplified both CPV-2a and -2b DNA but did not amplify the template of other important dog viruses (CCoV, PRV or CDV), demonstrating high specificity. The method was further validated with 57 canine fecal samples. An outstanding advantage of RPA is that it is an isothermal reaction and can be performed in a water bath, making RPA a potential alternative method for CPV-2 detection in resource-limited settings.
Expression of Bcl-2 in canine osteosarcoma
Directory of Open Access Journals (Sweden)
F. Piro
2015-03-01
Full Text Available Osteosarcoma (OS is the most common primary malignancy of bone. It is responsible for 80-85% of the primary bone tumors affecting dogs and it is characterized by aggressive and invasive behavior, with a high metastatic potential. Several studies on cancer and related tumorigenesis, show an involvement of the mechanisms of programmed cell death and cell survival. Many signals seem to be involved in the related mechanism of autophagy and in particular, our interest is focused on the expression of a family of Bcl-2 that seems to be involved either in the control of biomolecular mechanisms like autophagy and apoptosis. In this study we investigated the expression of Bcl-2 in different cases of spontaneous canine osteosarcoma and the related preliminary results are described. We found Bcl-2 activity was increased in OS tissue compared to normal bone tissue. These results suggested that Bcl-2 activity may play an important role in the formation of OS and as a diagnostic for neoplastic activity. However, further research is needed to confirm the role of Bcl-2 activity in OS in canines.
Canine faecal contamination and parasitic risk in the city of Naples (southern Italy
Directory of Open Access Journals (Sweden)
Veneziano Vincenzo
2006-09-01
Full Text Available Abstract Background Dogs are associated with more than 60 zoonotic diseases among which, parasitosis and, in particular, helminthosis, can pose serious public-health concerns worldwide. Many canine gastrointestinal parasites eliminate their dispersion elements (eggs, larvae, oocysts by the faecal route. The quantity of canine faeces deposited on public and private property in cities worldwide is both a perennial nuisance and an important health issue. Public sites such as playgrounds, parks, gardens, public squares and sandpits may be an important source of human infection. The aim of this study was to evaluate the extent of both canine faecal contamination in the city of Naples (southern Italy, and presence of canine parasitic elements, with particular regard to those which are potential agents of zoonosis. A regular grid of sub-areas (1 km × 700 m was overlaid on the city map using a Geographical Information System (GIS. In each sub-area the straightest 1 km transect was drawn and digitalized on-screen in the GIS. Between February and May 2005 canine faeces were counted along the 1 km transects in 143 sub-areas, and 415 canine faecal samples were collected and submitted to coprological examinations. Negative binomial regression models and Gaussian random effects models were used to analyze the association between faeces count and human population density taking into account for extraPoisson variability. Logistic regression model was used to evaluate the association between positivity to parasitic elements and number of canine faeces. Results Out of the 143 studied sub-areas, 141 (98.6% contained canine faeces. There was a strong spatial gradient with 48% of the total variability accounted by between neighbourhood variability; a positive association between the number of faeces and the human population density was found. Seventy (over 415, 16.9% canine faecal samples were positive for parasitic elements. There was no association between
Current state of knowledge: the canine gastrointestinal microbiome.
Hooda, Seema; Minamoto, Yasushi; Suchodolski, Jan S; Swanson, Kelly S
2012-06-01
Gastrointestinal (GI) microbes have important roles in the nutritional, immunological, and physiologic processes of the host. Traditional cultivation techniques have revealed bacterial density ranges from 10(4) to 10(5) colony forming units (CFU)/g in the stomach, from 10(5) to 10(7) CFU/g in the small intestine, and from 10(9) to 10(11) CFU/g in the colon of healthy dogs. As a small number of bacterial species can be grown and studied in culture, however, progress was limited until the recent emergence of DNA-based techniques. In recent years, DNA sequencing technology and bioinformatics have allowed for better phylogenetic and functional/metabolic characterization of the canine gut microbiome. Predominant phyla include Firmicutes, Bacteroidetes, Fusobacteria, Proteobacteria, and Actinobacteria. Studies using 16S ribosomal RNA (rRNA) gene pyrosequencing have demonstrated spatial differences along the GI tract and among microbes adhered to the GI mucosa compared to those in intestinal contents or feces. Similar to humans, GI microbiome dysbiosis is common in canine GI diseases such as chronic diarrhea and inflammatory bowel diseases. DNA-based assays have also identified key pathogens contributing to such conditions, including various Clostridium, Campylobacter, Salmonella, and Escherichia spp. Moreover, nutritionists have applied DNA-based techniques to study the effects of dietary interventions such as dietary fiber, prebiotics, and probiotics on the canine GI microbiome and associated health indices. Despite recent advances in the field, the canine GI microbiome is far from being fully characterized and a deeper characterization of the phylogenetic and functional/metabolic capacity of the GI microbiome in health and disease is needed. This paper provides an overview of recent studies performed to characterize the canine GI microbiome.
Directory of Open Access Journals (Sweden)
Herbert Sousa Soares
2014-12-01
Full Text Available Blood samples were collected from 99 domestic dogs from the urban and rural areas of the Lábrea municipality, state of Amazonas, Brazil. Canine serum samples were tested by immunofluorescence assay against Rickettsia spp., which revealed that only 3.0% (1/33 and 7.6% (5/66 of the dogs from urban and rural areas, respectively, reacted positively to at least one Rickettsia species. DNA was extracted from canine blood and tested by a battery of PCR assays targeting protozoa of the genera Babesia and Hepatozoon, and bacteria of the genera Rickettsia and Ehrlichia and family Anaplasmataceae. All samples were negative in the PCR assays targeting the genera Babesia, Hepatozoon, Ehrlichia and Rickettsia. For Anaplasmataceae, 3% (1/33 and 39.4% (26/66 of the urban and rural dogs, respectively, yielded amplicons that generated DNA sequences 100% identical to the corresponding sequence of Wolbachia endosymbiont of Dirofilaria immitis. Because of these results, all canine DNA samples were further tested in a PCR assay targeting filarial nematodes, which was positive for 18.2% (6/33 and 57.6% (38/66 urban and rural dogs, respectively. Filarial-PCR products generated DNA sequences 100% identical to D. immitis. While tick-borne infections were rare in Lábrea, D. immitis infection rates were among the highest reported in South America.
Decaro, Nicola; Mari, Viviana; Larocca, Vittorio; Losurdo, Michele; Lanave, Gianvito; Lucente, Maria Stella; Corrente, Marialaura; Catella, Cristiana; Bo, Stefano; Elia, Gabriella; Torre, Giorgio; Grandolfo, Erika; Martella, Vito; Buonavoglia, Canio
2016-08-30
A molecular survey for traditional and emerging pathogens associated with canine infectious respiratory disease (CIRD) was conducted in Italy between 2011 and 2013 on a total of 138 dogs, including 78 early acute clinically ill CIRD animals, 22 non-clinical but exposed to clinically ill CIRD dogs and 38 CIRD convalescent dogs. The results showed that canine parainfluenza virus (CPIV) was the most commonly detected CIRD pathogen, followed by canine respiratory coronavirus (CRCoV), Bordetella bronchiseptica, Mycoplasma cynos, Mycoplasma canis and canine pneumovirus (CnPnV). Some classical CIRD agents, such as canine adenoviruses, canine distemper virus and canid herpesvirus 1, were not detected at all, as were not other emerging respiratory viruses (canine influenza virus, canine hepacivirus) and bacteria (Streptococcus equi subsp. zooepidemicus). Most severe forms of respiratory disease were observed in the presence of CPIV, CRCoV and M. cynos alone or in combination with other pathogens, whereas single CnPnV or M. canis infections were detected in dogs with no or very mild respiratory signs. Interestingly, only the association of M. cynos (alone or in combination with either CRCoV or M. canis) with severe clinical forms was statistically significant. The study, while confirming CPIV as the main responsible for CIRD occurrence, highlights the increasing role of recently discovered viruses, such as CRCoV and CnPnV, for which effective vaccines are not available in the market. Copyright © 2016 Elsevier B.V. All rights reserved.
Prevalence and risk factors for canine obesity surveyed in veterinary practices in Beijing, China.
Mao, Junfu; Xia, Zhaofei; Chen, Jiangnan; Yu, Jinhai
2013-11-01
An epidemiological survey of canine obesity was carried out in Beijing, China. Cases (n=2391, 7 districts) were collected at 14 animal hospitals between April 2008 and April 2011. The body condition score (scales of 1-5) was used to assess obesity of the dogs (Burkholder and Toll, 2000; Laflamme, 1997). Obesity rates were analyzed with respect to breed, age, sex, neutering, food control, feeding frequency, reproduction status, food type, nutritional supplements, living environment, feeding time, number of pets per household, feeding purpose, activity control, exercise duration, exercise status and exercise type. The overall canine obesity rate was 44.4% in this survey. The risk factors for dog obesity were food type (non-commercial food, OR=1.377, pobesity was high in pugs (70.7%), Cocker Spaniel (69.4%), Pekingese (51.9%), Pomeranian (54.6%) and Golden Retriever (51.9%). This is the first report of the epidemiology of canine obesity in China. Copyright © 2013 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Laura Nordio
2017-05-01
Full Text Available FXR1 (Fragile X mental retardation-related protein 1 is a cytoplasmic RNA binding protein, which genetic expression has been related to metastatic potential in human melanoma. The aims of the present study were: the validation of two commercially available clones of polyclonal anti-human FXR1 antibody in dogs; their application to investigate FXR1 expression in a group of canine oral melanomas. Anti-FXR1 antibody was not previously validated in the canine species. Two different commercially available polyclonal anti-FXR1 antibodies (respectively made in goat and in rabbit were used. FXR1 protein in canine serum was identified by western blot after SDS-PAGE, using human serum as control. FXR1 immunohistochemical expression was tested in a series of normal tissues, that are expected to express FXR1, and in 31 cases of oral melanomas. The final immunohistochemical protocol used heat-induced unmasking and overnight incubation. FXR1 protein bands in canine serum were detected by tested antibodies, in a more specific way by the rabbit antibody. FXR1 immunohistochemical staining was positive in all tested organs, with different levels of expression. FXR1 was also expressed in 31/31 tested melanomas, with variable intensity and percentage of positive cells (Figure 1. Equal results were achieved with the two antibodies in 8 cases of melanoma, whereas there were variable differences in 22, and one case stained only with goat antibody. The rabbit antibody gave less background staining. This study validated anti-FXR1 antibodies for use in the canine species. This protein was expressed in various normal tissues, as well as in the tested neoplasms. Significance of different level of expression is undergoing evaluation with further studies.
Models of experimental saccular aneurysms of carotid arteries in canine
International Nuclear Information System (INIS)
Zhang Haixia; Cheng Yingsheng; Li Minghua
2006-01-01
Objective: To study the availability by making experimental saccular aneurysm models of carotid arteries in canine similar to human intracranial aneurysms. Methods: Twenty healthy canines with experimental saccular side-wall aneurysms of carotid arteries were created successfully by surgery. Results: Forty experimental saccular side-wall aneurysms of carotid arteries were created successfully with 36 aneurysms and parent arteries maintaining patency with each other and four spontaneously occluded confirmed by angiography. Model successful rate reached 90%. Conclusions: Experimental saccular side-wall aneurysms of carotid arteries in canines were one of best models created for simulating human intracranial aneurysms. (authors)
Testosterone biotransformation by the isolated perfused canine pancreas
International Nuclear Information System (INIS)
Fernandez-del Castillo, C.; Diaz-Sanchez, V.; Varela-Fascinetto, G.; Altamirano, A.; Odor-Morales, A.; Lopez-Medrano, R.M.; Robles-Diaz, G.
1991-01-01
There is strong evidence indicating that the pancreas is under the influence of sex steroid hormones, and that it may even participate in their biosynthesis and metabolism. In the present study, [3H]testosterone was perfused into the isolated canine pancreas, and measured in the effluent with several of its metabolites (5 alpha-dihydrotestosterone, androstenedione, and estradiol). Results show that testosterone is readily transformed by the canine pancreas. The main product found in the effluent is androstenedione. The testis and spleen were also perfused with [3H]testosterone and used as controls. In both cases, this hormone appeared mostly unchanged in the effluent as compared to the pancreatic perfusion (p less than 0.0001). From our data, we conclude that the canine pancreas has the capacity to transform sex steroid hormones, and could be considered an extragonadal site of sex steroid biosynthesis
Testosterone biotransformation by the isolated perfused canine pancreas
Energy Technology Data Exchange (ETDEWEB)
Fernandez-del Castillo, C.; Diaz-Sanchez, V.; Varela-Fascinetto, G.; Altamirano, A.; Odor-Morales, A.; Lopez-Medrano, R.M.; Robles-Diaz, G. (Instituto Nacional de la Nutricion Salvador Zubiran, Mexico City (Mexico))
1991-01-01
There is strong evidence indicating that the pancreas is under the influence of sex steroid hormones, and that it may even participate in their biosynthesis and metabolism. In the present study, (3H)testosterone was perfused into the isolated canine pancreas, and measured in the effluent with several of its metabolites (5 alpha-dihydrotestosterone, androstenedione, and estradiol). Results show that testosterone is readily transformed by the canine pancreas. The main product found in the effluent is androstenedione. The testis and spleen were also perfused with (3H)testosterone and used as controls. In both cases, this hormone appeared mostly unchanged in the effluent as compared to the pancreatic perfusion (p less than 0.0001). From our data, we conclude that the canine pancreas has the capacity to transform sex steroid hormones, and could be considered an extragonadal site of sex steroid biosynthesis.
Molecular characterization of canine parvovirus in Vientiane, Laos.
Vannamahaxay, Soulasack; Vongkhamchanh, Souliya; Intanon, Montira; Tangtrongsup, Sahatchai; Tiwananthagorn, Saruda; Pringproa, Kidsadagon; Chuammitri, Phongsakorn
2017-05-01
The global emergence of canine parvovirus type 2c (CPV-2c) has been well documented. In the present study, 139 rectal swab samples collected from diarrheic dogs living in Vientiane, Laos, in 2016 were tested for the presence of the canine parvovirus (CPV) VP2 gene by PCR. The results showed that 82.73% (115/139) of dogs were CPV positive by PCR. The partial VP2 gene was sequenced in 94 of the positive samples; 91 samples belonged to CPV-2c (426Glu) subtype, while 3 samples belonged to the CPV-2a (426Asn) subtype. Notably, phylogenetic analysis of amino acid sequences revealed a close relationship between Laotian isolates and novel Chinese CPV-2c isolates. In Laotian CPV isolates, aligned protein sequences indicated a high rate of residue substitutions at positions 305, 324, 345, 370, 375, and 426 in the GH loop. The mutation at residue 370 (Q370R), a single mutation, was characterized as a unique mutant residue specific to the Laotian CPV-2c variant.
Alkaline phosphatase activity in gingival crevicular fluid during canine retraction.
Batra, P; Kharbanda, Op; Duggal, R; Singh, N; Parkash, H
2006-02-01
The aim of the study was to investigate alkaline phosphatase activity in the gingival crevicular fluid (GCF) during orthodontic tooth movement in humans. Postgraduate orthodontic clinic. Ten female patients requiring all first premolar extractions were selected and treated with standard edgewise mechanotherapy. Canine retraction was done using 100 g sentalloy springs. Maxillary canine on one side acted as experimental site while the contralateral canine acted as control. Gingival crevicular fluid was collected from mesial and distal of canines before initiation of canine retraction (baseline), immediately after initiation of retraction, and on 1st, 7th, 14th and 21st day and the alkaline phosphatase activity was estimated. The results show significant (p < 0.05) changes in alkaline phosphatase activity on the 7th, 14th and 21st day on both mesial and distal aspects of the compared experimental and control sides. The peak in enzyme activity occurred on the 14th day of initiation of retraction followed by a significant fall in activity especially on the mesial aspect. The study showed that alkaline phosphatase activity could be successfully estimated in the GCF using calorimetric estimation assay kits. The enzyme activity showed variation according to the amount of tooth movement.
A modified live canine parvovirus vaccine. II. Immune response.
Carmichael, L E; Joubert, J C; Pollock, R V
1983-01-01
The safety and efficacy of an attenuated canine parvovirus (A-CPV) vaccine was evaluated in both experimental and in field dogs. After parenteral vaccination, seronegative dogs developed hemagglutination-inhibition (HI) antibody titers as early as postvaccination (PV) day 2. Maximal titers occurred within 1 week. Immunity was associated with the persistence of HI antibody titers (titers greater than 80) that endured at least 2 years. Immune dogs challenged with virulent CPV did not shed virus in their feces. The A-CPV vaccine did not cause illness alone or in combination with living canine distemper (CD) and canine adenovirus type-2 (CAV-2) vaccines, nor did it interfere with the immune response to the other viruses. A high rate (greater than 98%) of immunity was engendered in seronegative pups. In contrast, maternal antibody interfered with the active immune response to the A-CPV. More than 95% of the dogs with HI titers less than 10 responded to the vaccine, but only 50% responded when titers were approximately 20. No animal with a titer greater than 80 at the time of vaccination became actively immunized. Susceptibility to virulent CPV during that period when maternal antibody no longer protects against infection, but still prevents active immunization, is the principal cause of vaccinal failure in breeding kennels where CPV is present. Reduction, but not complete elimination, of CPV disease in large breeding kennels occurred within 1-2 months of instituting an A-CPV vaccination program.
Orthodontic-surgical treatment of bilateral maxillary canine impaction
Sumitra
2012-01-01
A 13-year-old female patient reported with the chief complaint of irregular front teeth. She had a skeletal Class III and Angle's Class I malocclusion with hyperdivergent growth pattern and bilateral impaction of maxillary canines. Surgical exposure of the impacted teeth and orthodontic alignment was planned. The surgical exposure was done by a minimally invasive modified window technique. Orthodontic treatment of impacted canines without causing significant morbidity to the adjacent teeth an...
Povey, C.
1982-01-01
A parvovirus of canine origin, cultured in a feline kidney cell line, was inactivated with formalin. Three pilot serials were produced and three forms of finished vaccine (nonadjuvanted, single adjuvanted and double adjuvanted) were tested in vaccination and challenge trials. A comparison was also made with two inactivated feline panleukopenia virus vaccines, one of which has official approval for use in dogs. The inactivated canine vaccine in nonadjuvanted, adjuvanted or double adjuvanted form was immunogenic in 20 of 20 vaccinated dogs. The double adjuvanted vaccine is selected as the one of choice on the basis of best and most persistent seriological response. PMID:7039811
MiR-34a regulates the invasive capacity of canine osteosarcoma cell lines.
Lopez, Cecilia M; Yu, Peter Y; Zhang, Xiaoli; Yilmaz, Ayse Selen; London, Cheryl A; Fenger, Joelle M
2018-01-01
Osteosarcoma (OSA) is the most common bone tumor in children and dogs; however, no substantial improvement in clinical outcome has occurred in either species over the past 30 years. MicroRNAs (miRNAs) are small non-coding RNAs that regulate gene expression and play a fundamental role in cancer. The purpose of this study was to investigate the potential contribution of miR-34a loss to the biology of canine OSA, a well-established spontaneous model of the human disease. RT-qPCR demonstrated that miR-34a expression levels were significantly reduced in primary canine OSA tumors and canine OSA cell lines as compared to normal canine osteoblasts. In canine OSA cell lines stably transduced with empty vector or pre-miR-34a lentiviral constructs, overexpression of miR-34a inhibited cellular invasion and migration but had no effect on cell proliferation or cell cycle distribution. Transcriptional profiling of canine OSA8 cells possessing enforced miR-34a expression demonstrated dysregulation of numerous genes, including significant down-regulation of multiple putative targets of miR-34a. Moreover, gene ontology analysis of down-regulated miR-34a target genes showed enrichment of several biological processes related to cell invasion and motility. Lastly, we validated changes in miR-34a putative target gene expression, including decreased expression of KLF4, SEM3A, and VEGFA transcripts in canine OSA cells overexpressing miR-34a and identified KLF4 and VEGFA as direct target genes of miR-34a. Concordant with these data, primary canine OSA tumor tissues demonstrated increased expression levels of putative miR-34a target genes. These data demonstrate that miR-34a contributes to invasion and migration in canine OSA cells and suggest that loss of miR-34a may promote a pattern of gene expression contributing to the metastatic phenotype in canine OSA.
MiR-34a regulates the invasive capacity of canine osteosarcoma cell lines.
Directory of Open Access Journals (Sweden)
Cecilia M Lopez
Full Text Available Osteosarcoma (OSA is the most common bone tumor in children and dogs; however, no substantial improvement in clinical outcome has occurred in either species over the past 30 years. MicroRNAs (miRNAs are small non-coding RNAs that regulate gene expression and play a fundamental role in cancer. The purpose of this study was to investigate the potential contribution of miR-34a loss to the biology of canine OSA, a well-established spontaneous model of the human disease.RT-qPCR demonstrated that miR-34a expression levels were significantly reduced in primary canine OSA tumors and canine OSA cell lines as compared to normal canine osteoblasts. In canine OSA cell lines stably transduced with empty vector or pre-miR-34a lentiviral constructs, overexpression of miR-34a inhibited cellular invasion and migration but had no effect on cell proliferation or cell cycle distribution. Transcriptional profiling of canine OSA8 cells possessing enforced miR-34a expression demonstrated dysregulation of numerous genes, including significant down-regulation of multiple putative targets of miR-34a. Moreover, gene ontology analysis of down-regulated miR-34a target genes showed enrichment of several biological processes related to cell invasion and motility. Lastly, we validated changes in miR-34a putative target gene expression, including decreased expression of KLF4, SEM3A, and VEGFA transcripts in canine OSA cells overexpressing miR-34a and identified KLF4 and VEGFA as direct target genes of miR-34a. Concordant with these data, primary canine OSA tumor tissues demonstrated increased expression levels of putative miR-34a target genes.These data demonstrate that miR-34a contributes to invasion and migration in canine OSA cells and suggest that loss of miR-34a may promote a pattern of gene expression contributing to the metastatic phenotype in canine OSA.
Heat shock protein expression in canine malignant mammary tumours
International Nuclear Information System (INIS)
Romanucci, Mariarita; Marinelli, Alessia; Sarli, Giuseppe; Salda, Leonardo Della
2006-01-01
Abnormal levels of Heat Shock Proteins (HSPs) have been observed in many human neoplasms including breast cancer and it has been demonstrated that they have both prognostic and therapeutic implications. In this study, we evaluated immunohistochemical expression of HSPs in normal and neoplastic canine mammary glands and confronted these results with overall survival (OS), in order to understand the role of HSPs in carcinogenesis and to establish their potential prognostic and/or therapeutic value. Immunohistochemical expression of Hsp27, Hsp72, Hsp73 and Hsp90 was evaluated in 3 normal canine mammary glands and 30 malignant mammary tumours (10 in situ carcinomas, 10 invasive carcinomas limited to local structures without identifiable invasion of blood or lymphatic vessels, 10 carcinomas with invasion of blood or lymphatic vessels and/or metastases to regional lymph nodes). A semi-quantitative method was used for the analysis of the results. Widespread constitutive expression of Hsp73 and Hsp90 was detected in normal tissue, Hsp72 appeared to be focally distributed and Hsp27 showed a negative to rare weak immunostaining. In mammary tumours, a significant increase in Hsp27 (P < 0.01), Hsp72 (P < 0.05) and Hsp90 (P < 0.01) expression was observed as well as a significant reduction in Hsp73 (P < 0.01) immunoreactivity compared to normal mammary gland tissue. Hsp27 demonstrated a strong positivity in infiltrating tumour cells and metaplastic squamous elements of invasive groups. High Hsp27 expression also appeared to be significantly correlated to a shorter OS (P = 0.00087). Intense immunolabelling of Hsp72 and Hsp73 was frequently detected in infiltrative or inflammatory tumour areas. Hsp90 expression was high in all tumours and, like Hsp73, it also showed an intense positivity in lymphatic emboli. These results suggest that Hsp27, Hsp72 and Hsp90 are involved in canine mammary gland carcinogenesis. In addition, Hsp27 appears to be implicated in tumour invasiveness and
Gonsalves, Mishka N; Jankovits, Daniel A; Huber, Michael L; Strom, Adam M; Garcia, Tanya C; Stover, Susan M
2016-09-20
To compare the biomechanical properties of simulated humeral condylar fractures reduced with one of two screw fixation methods: 3.0 mm headless compression screw (HCS) or 3.5 mm cortical bone screw (CBS) placed in lag fashion. Bilateral humeri were collected from nine canine cadavers. Standardized osteotomies were stabilized with 3.0 mm HCS in one limb and 3.5 mm CBS in the contralateral limb. Condylar fragments were loaded to walk, trot, and failure loads while measuring construct properties and condylar fragment motion. The 3.5 mm CBS-stabilized constructs were 36% stiffer than 3.0 mm HCS-stabilized constructs, but differences were not apparent in quality of fracture reduction nor in yield loads, which exceeded expected physiological loads during rehabilitation. Small residual fragment displacements were not different between CBS and HCS screws. Small fragment rotation was not significantly different between screws, but was weakly correlated with moment arm length (R² = 0.25). A CBS screw placed in lag fashion provides stiffer fixation than an HCS screw, although both screws provide similar anatomical reduction and yield strength to condylar fracture fixation in adult canine humeri.
Extraction of Unerupted Maxillary Canine Teeth in a Maned Wolf (Chrysocyon brachyurus
Directory of Open Access Journals (Sweden)
Lourdes M. B. Pessoa
2016-01-01
Full Text Available The purpose of this case report is to describe the diagnosis and treatment of unerupted canine teeth in a maned wolf. After physical examination, complete blood count, and serum biochemical profile, the animal underwent general anesthesia and head radiography was performed to confirm the diagnosis. The treatment consisted of the extraction of both maxillary canine teeth and clinical and radiographic follow-up of the right mandibular canine tooth.
Extraction of Unerupted Maxillary Canine Teeth in a Maned Wolf (Chrysocyon brachyurus)
Pessoa, Lourdes M. B.; Roza, Marcello; Farias, Anderson; Jesus, Pedro Henrique de; Campbell, Rita de Cassia; Pinho, Mariângela Pereira de
2016-01-01
The purpose of this case report is to describe the diagnosis and treatment of unerupted canine teeth in a maned wolf. After physical examination, complete blood count, and serum biochemical profile, the animal underwent general anesthesia and head radiography was performed to confirm the diagnosis. The treatment consisted of the extraction of both maxillary canine teeth and clinical and radiographic follow-up of the right mandibular canine tooth.
Factors affecting the optimal performance of a high-yield pulping operation
Energy Technology Data Exchange (ETDEWEB)
Broderick, G [Noranda Technology Centre, Pointe-Claire, PQ (Canada); Paris, J [Ecole Polytechnique, Montreal, PQ (Canada); Valada, J L [Quebec Univ., Trois-Rivieres, PQ (Canada)
1995-06-01
Strategies for operating a chemical-mechanical pulp mill were investigated from data based on process models from some one hundred pilot scale pulping runs. Optimal values for 55 process and pulp quality variables have been calculated by applying a genetic algorithm search to a fuzzy model of the overall system. Best pulp quality was achieved and maintained when the chemical pretreatment was conducted at moderately low temperatures using a high SO{sub 2} concentration, which produced high sulphonation and high yield at the same time. By characterizing the quality of the pulp at the fibre level, optimization results were said to be more easily transferable to other high yield pulping systems. 19 refs., 6 tabs.
PMab-38 Recognizes Canine Podoplanin of Squamous Cell Carcinomas.
Kaneko, Mika K; Honma, Ryusuke; Ogasawara, Satoshi; Fujii, Yuki; Nakamura, Takuro; Saidoh, Noriko; Takagi, Michiaki; Kagawa, Yumiko; Konnai, Satoru; Kato, Yukinari
2016-10-01
Podoplanin, a type I transmembrane protein, is expressed in lymphatic endothelial cells. Although we previously developed an anticanine podoplanin monoclonal antibody (mAb), PMab-38, immunohistochemistry (IHC) showed that it did not react with canine lymphatic endothelial cells. Here, we determined whether PMab-38 recognizes canine podoplanin of squamous cell carcinomas (SCCs) and clarified its epitope. In IHC, PMab-38 reacted with 83% of SCCs (15/18 cases). Flow cytometry showed that the epitope of PMab-38 was different from that of the platelet aggregation-stimulating domain of the N-terminus, which was detected by almost all antipodoplanin mAbs such as D2-40 or NZ-1. PMab-38 is expected to be useful for investigating the function of podoplanin in canine tumors.
Severe canine distemper outbreak in unvaccinated dogs in Mozambique.
Zacarias, Julieta; Dimande, Alberto; Achá, Sara; Dias, Paula T; Leonel, Elisa M; Messa, Aurora; Macucule, Baltazar; Júnior, José L; Bila, Custódio G
2016-07-15
Although significant animal suffering caused by preventable diseases is frequently seen in developing countries, reports of this are scarce. This report describes avoidable animal suffering owing to a suspected canine distemper (CD) outbreak in unvaccinated dogs owned by low-income families in Mozambique that killed approximately 200 animals. Affected dogs exhibited clinical signs, and gross and microscopic lesions compatible with CD. Immunohistochemical staining confirmed the presence of canine distemper virus (CDV) in the kidney of one dog from the cohort. This brief communication again illustrates that large outbreaks of CDV in unvaccinated dogs occur and that large-scale avoidable suffering and threats to the health of dogs and wild canines continue. Mass vaccination supported by government and non-government organisations is recommended.
Directory of Open Access Journals (Sweden)
A.F. Miresmaeili
2012-10-01
Full Text Available Introduction & Objective: Maxillary canines are esthetically and functionally important, but patients with impacted maxillary canines are perceived to be more difficult and time-consuming to treat than the average orthodontic patient. The aim of this study was to define orthodontic Treatment Difficulty Index (TDI of impacted maxillary canine with CBCT according to experts' opinions.Materials & Methods: In this cross sectional study, nine variables in CBCT of thirty six consecutive patients with 50 impacted maxillary canines were measured using Dolphin 3D. The related 3D and 2D pictures and the measured data were uploaded on a website. Ten orthodontists were asked to judge the difficulty of bringing the impacted canine to occlusal plane from 1 to 10 (1 = easy, 10 = extremely difficult.Then, they were also asked to evaluate the effect of each variable on treatment from 1 to 5 (1= very low, 5= very high. Random effect linear regression was used in exploration stage and then simple linear regression was used for the application of the model.Results: The patients mean age was 19.08 ± 5.8 years. Mean clinical experience of examiners was 22.7 ±12.02 years. Three variables were deleted at exploration stage and two other in model application stage. Vertical distance to the occlusal plane (P=0.000, overlap in frontal view (P=0.000, angulations of the canine to the occlusal plan (P=0.029, dilacerations (P=0.000, and rotation (P=0.029 had a significant relationship with TDI.Conclusion: Treatment difficulty of impacted maxillary canines could be predicted quantitatively by measuring variables in CBCT.(Sci J Hamadan Univ Med Sci 2012;19(3:30-35
Canine tumor cross-species genomics uncovers targets linked to osteosarcoma progression
2009-01-01
Background Pulmonary metastasis continues to be the most common cause of death in osteosarcoma. Indeed, the 5-year survival for newly diagnosed osteosarcoma patients has not significantly changed in over 20 years. Further understanding of the mechanisms of metastasis and resistance for this aggressive pediatric cancer is necessary. Pet dogs naturally develop osteosarcoma providing a novel opportunity to model metastasis development and progression. Given the accelerated biology of canine osteosarcoma, we hypothesized that a direct comparison of canine and pediatric osteosarcoma expression profiles may help identify novel metastasis-associated tumor targets that have been missed through the study of the human cancer alone. Results Using parallel oligonucleotide array platforms, shared orthologues between species were identified and normalized. The osteosarcoma expression signatures could not distinguish the canine and human diseases by hierarchical clustering. Cross-species target mining identified two genes, interleukin-8 (IL-8) and solute carrier family 1 (glial high affinity glutamate transporter), member 3 (SLC1A3), which were uniformly expressed in dog but not in all pediatric osteosarcoma patient samples. Expression of these genes in an independent population of pediatric osteosarcoma patients was associated with poor outcome (p = 0.020 and p = 0.026, respectively). Validation of IL-8 and SLC1A3 protein expression in pediatric osteosarcoma tissues further supported the potential value of these novel targets. Ongoing evaluation will validate the biological significance of these targets and their associated pathways. Conclusions Collectively, these data support the strong similarities between human and canine osteosarcoma and underline the opportunities provided by a comparative oncology approach as a means to improve our understanding of cancer biology and therapies. PMID:20028558
Canine tumor cross-species genomics uncovers targets linked to osteosarcoma progression
Directory of Open Access Journals (Sweden)
Triche Timothy
2009-12-01
Full Text Available Abstract Background Pulmonary metastasis continues to be the most common cause of death in osteosarcoma. Indeed, the 5-year survival for newly diagnosed osteosarcoma patients has not significantly changed in over 20 years. Further understanding of the mechanisms of metastasis and resistance for this aggressive pediatric cancer is necessary. Pet dogs naturally develop osteosarcoma providing a novel opportunity to model metastasis development and progression. Given the accelerated biology of canine osteosarcoma, we hypothesized that a direct comparison of canine and pediatric osteosarcoma expression profiles may help identify novel metastasis-associated tumor targets that have been missed through the study of the human cancer alone. Results Using parallel oligonucleotide array platforms, shared orthologues between species were identified and normalized. The osteosarcoma expression signatures could not distinguish the canine and human diseases by hierarchical clustering. Cross-species target mining identified two genes, interleukin-8 (IL-8 and solute carrier family 1 (glial high affinity glutamate transporter, member 3 (SLC1A3, which were uniformly expressed in dog but not in all pediatric osteosarcoma patient samples. Expression of these genes in an independent population of pediatric osteosarcoma patients was associated with poor outcome (p = 0.020 and p = 0.026, respectively. Validation of IL-8 and SLC1A3 protein expression in pediatric osteosarcoma tissues further supported the potential value of these novel targets. Ongoing evaluation will validate the biological significance of these targets and their associated pathways. Conclusions Collectively, these data support the strong similarities between human and canine osteosarcoma and underline the opportunities provided by a comparative oncology approach as a means to improve our understanding of cancer biology and therapies.
Association of canine juvenile generalized demodicosis with the dog leukocyte antigen system.
It, V; Barrientos, L; López Gappa, J; Posik, D; Díaz, S; Golijow, C; Giovambattista, G
2010-07-01
Demodectic mange is a well-known parasitic skin disease characterized by the presence of a larger than normal number of Demodex mites (Demodex canis) in the skin of dogs. Recent research has suggested that major histocompatibility complex (MHC) class II expression is higher in the skin of dogs suffering from demodicosis than in normal ones. We have investigated whether canine Dog Leukocyte Antigen (DLA) class II alleles are associated with canine juvenile generalized demodicosis (JGD). In the present study, the analysis of microsatellite markers (FH2202, FH2975 and FH2054) linked to DLA was made in Boxer, Argentinean Mastiff and mixed breed dogs. DNA samples from 56 dogs affected with the disease and 60 breed-matched controls collected in Argentina were analysed. A highly significant association, in some of the analysed markers, in all breeds with the presence of demodicosis was observed with P or =5. The results of this study suggest that an underlying DLA association exists with demodicosis in dogs and that this may represent an important immunological risk factor in the aetiology of this condition. This information could be used in the future to develop diagnostic tests to prevent canine JGD.
Homologous recombination is a force in the evolution of canine distemper virus.
Yuan, Chaowen; Liu, Wenxin; Wang, Yingbo; Hou, Jinlong; Zhang, Liguo; Wang, Guoqing
2017-01-01
Canine distemper virus (CDV) is the causative agent of canine distemper (CD) that is a highly contagious, lethal, multisystemic viral disease of receptive carnivores. The prevalence of CDV is a major concern in susceptible animals. Presently, it is unclear whether intragenic recombination can contribute to gene mutations and segment reassortment in the virus. In this study, 25 full-length CDV genome sequences were subjected to phylogenetic and recombinational analyses. The results of phylogenetic analysis, intragenic recombination, and nucleotide selection pressure indicated that mutation and recombination occurred in the six individual genes segment (H, F, P, N, L, M) of the CDV genome. The analysis also revealed pronounced genetic diversity in the CDV genome according to the geographically distinct lineages (genotypes), namely Asia-1, Asia-2, Asia-3, Europe, America-1, and America-2. The six recombination events were detected using SimPlot and RDP programs. The analysis of selection pressure demonstrated that a majority of the nucleotides in the CDV individual gene were under negative selection. Collectively, these data suggested that homologous recombination acts as a key force driving the genetic diversity and evolution of canine distemper virus.
The detection and differentiation of canine respiratory pathogens using oligonucleotide microarrays.
Wang, Lih-Chiann; Kuo, Ya-Ting; Chueh, Ling-Ling; Huang, Dean; Lin, Jiunn-Horng
2017-05-01
Canine respiratory diseases are commonly seen in dogs along with co-infections with multiple respiratory pathogens, including viruses and bacteria. Virus infections in even vaccinated dogs were also reported. The clinical signs caused by different respiratory etiological agents are similar, which makes differential diagnosis imperative. An oligonucleotide microarray system was developed in this study. The wild type and vaccine strains of canine distemper virus (CDV), influenza virus, canine herpesvirus (CHV), Bordetella bronchiseptica and Mycoplasma cynos were detected and differentiated simultaneously on a microarray chip. The detection limit is 10, 10, 100, 50 and 50 copy numbers for CDV, influenza virus, CHV, B. bronchiseptica and M. cynos, respectively. The clinical test results of nasal swab samples showed that the microarray had remarkably better efficacy than the multiplex PCR-agarose gel method. The positive detection rate of microarray and agarose gel was 59.0% (n=33) and 41.1% (n=23) among the 56 samples, respectively. CDV vaccine strain and pathogen co-infections were further demonstrated by the microarray but not by the multiplex PCR-agarose gel. The oligonucleotide microarray provides a highly efficient diagnosis alternative that could be applied to clinical usage, greatly assisting in disease therapy and control. Copyright © 2017 Elsevier B.V. All rights reserved.
Genetic diversity of canine olfactory receptors
Directory of Open Access Journals (Sweden)
Hitte Christophe
2009-01-01
Full Text Available Abstract Background Evolution has resulted in large repertoires of olfactory receptor (OR genes, forming the largest gene families in mammalian genomes. Knowledge of the genetic diversity of olfactory receptors is essential if we are to understand the differences in olfactory sensory capability between individuals. Canine breeds constitute an attractive model system for such investigations. Results We sequenced 109 OR genes considered representative of the whole OR canine repertoire, which consists of more than 800 genes, in a cohort of 48 dogs of six different breeds. SNP frequency showed the overall level of polymorphism to be high. However, the distribution of SNP was highly heterogeneous among OR genes. More than 50% of OR genes were found to harbour a large number of SNP, whereas the rest were devoid of SNP or only slightly polymorphic. Heterogeneity was also observed across breeds, with 25% of the SNP breed-specific. Linkage disequilibrium within OR genes and OR clusters suggested a gene conversion process, consistent with a mean level of polymorphism higher than that observed for introns and intergenic sequences. A large proportion (47% of SNP induced amino-acid changes and the Ka/Ks ratio calculated for all alleles with a complete ORF indicated a low selective constraint with respect to the high level of redundancy of the olfactory combinatory code and an ongoing pseudogenisation process, which affects dog breeds differently. Conclusion Our demonstration of a high overall level of polymorphism, likely to modify the ligand-binding capacity of receptors distributed differently within the six breeds tested, is the first step towards understanding why Labrador Retrievers and German Shepherd Dogs have a much greater potential for use as sniffer dogs than Pekingese dogs or Greyhounds. Furthermore, the heterogeneity in OR polymorphism observed raises questions as to why, in a context in which most OR genes are highly polymorphic, a subset of
[Biological characteristics of a chimeric rabies virus expressing canine parvovirus VP2 protein].
Niu, Xue-Feng; Liu, Xiao-Hui; Sun, Zhao-Jin; Shi, He-He; Chen, Jing; Jiang, Bido; Sun, Jing-Chen; Guo, Xiao-Feng
2009-09-01
To obtain a bivalence vaccine against canine rabies virus and canine parvovirus, a chimeric rabies virus expressing canine parvovirus VP2 protein was generated by the technique of reverse genetics. It was shown that the chimeric virus designated as HEP-Flury (VP2) grew well on BHK-21 cells and the VP2 gene could still be stably expressed after ten passages on BHK-21 cells. Experiments on the mice immunized with the chimeric virus HEP-Flury (VP2) demonstrated that specific antibodies against rabies virus and canine parvovirus were induced in immunized mice after vaccination with the live chimeric virus.
Cellular endocytic compartment localization of expressed canine CD1 molecules
DEFF Research Database (Denmark)
Schjærff, Mette; Keller, Stefan M.; Affolter, Verena K.
2016-01-01
CD1 molecules are glycoproteins present primarily on dendritic cells (DCs), which recognize and presenta variety of foreign- and self-lipid antigens to T-cells. Humans have five different CD1 isoforms that sur-vey distinct cellular compartments allowing for recognition of a large repertoire...... onlya diminished GFP expression. In conclusion, canine CD1 transfectants show distinct localization patternsthat are similar to human CD1 proteins with the exception of the canine CD1d isoform, which most likelyis non-functional. These findings imply that canine CD1 localization overall resembles human...... CD1 traf-ficking patterns. This knowledge is important for the understanding of lipid antigen-receptor immunityin the dog....
Canine Gouging: A Taboo Resurfacing in Migrant Urban Population.
Noman, Anila Virani; Wong, Ferranti; Pawar, Ravikiran Ramakrishna
2015-01-01
Cosmopolitan cities have become a pool of migrants from different parts of the world, who carry their cultural beliefs and superstitions with them around the globe. Canine gouging is a kind of infant oral mutilation (IOM) which is widely practiced among rural population of Africa where the primary tooth bud of the deciduous canine is enucleated. The belief is that the life threatening illnesses in children like vomiting, diarrhoea, and fevers are caused by worms which infest on tooth buds. This case report is of a 15-year-old Somalian born boy, who presented at the dental institute with intermittent pain in his lower right permanent canine which was associated with a discharging intra oral buccal sinus. The tooth was endodontically treated and then restored with composite. General dental practitioners need to be vigilant when encountered with tooth presenting unusual morphology, unilateral missing tooth, and shift in the midline due to early loss of deciduous/permanent canines. Identification of any such dental mutilation practice will need further counselling of the individual and family members. It is the duty of every dental professional to educate and safeguard the oral and dental health of general public.
Orthodontic management of bilaterally impacted mandibular canines in a growing patient
Directory of Open Access Journals (Sweden)
Rajaganesh J Gautam
2016-01-01
Full Text Available KK, an 11.9-year-old male patient, presented with the chief complaint of forwardly placed upper front teeth. Diagnosis revealed a Class II subdivision right malocclusion on an underlying Class I skeletal base with a horizontal growth pattern, bimaxillary proclination, crowding in the lower arch, over retained deciduous canines in the upper right and lower quadrants, an unerupted maxillary right permanent canine, and bilaterally impacted mandibular permanent canines, an increased overjet, and a deep overbite. He had a mild convex profile, a toothy smile with a nonconsonant smile arc and mildly protrusive lips. Treatment with a nonextraction treatment plan, which included surgical uncovering and orthodontic eruptive guidance of the impacted mandibular canines, with multibracket metallic fixed appliances, solved the patient′s complaints and achieved an esthetically pleasing and functionally adequate occlusal result.
Comparison of canine parvovirus with mink enteritis virus by restriction site mapping.
McMaster, G K; Tratschin, J D; Siegl, G
1981-01-01
The genomes of canine parvovirus and mink enteritis virus were compared by restriction enzyme analysis of their replicative-form DNAs. Of 79 mapped sites, 68, or 86%, were found to be common for both types of DNA, indicating that canine parvovirus and mink enteritis virus are closely related viruses. Whether they evolved from a common precursor or whether canine parvovirus is derived from mink enteritis virus, however, cannot be deduced from our present data.
Comparison of biomolecule desorption yields for low and high energy primary ions
International Nuclear Information System (INIS)
Kamensky, I.; Hakansson, P.; Sundqvist, B.; McNeal, C.J.; MacFarlane, R.
1982-01-01
Ion induced desorption yields of molecular ions from samples of cesium iodide, glycylglycine, ergosterol, bleomycin and a trinucleoside diphosphate have been studied using primary beams of 54 MeV 63 Cu 9+ and 3 keV 133 Cs + . Mass analysis was performed with a time-of-flight technique. Each sample was studied with the same spectrometer for both low and high energy primary ions and without opening of the vacuum chamber in between the measurements. The results show that fast heavy ions give larger yields for all samples studied and that the yield ratios for high to low energy desorption increase with the mass of the sample molecule. (orig.)
Comparative photoelastic study of dental and skeletal anchorages in the canine retraction
Directory of Open Access Journals (Sweden)
Cristiane Aparecida de Assis Claro
2014-01-01
Full Text Available OBJECTIVE: To compare dental and skeletal anchorages in mandibular canine retraction by means of a stress distribution analysis. METHODS: A photoelastic model was produced from second molar to canine, without the first premolar, and mandibular canine retraction was simulated by a rubber band tied to two types of anchorage: dental anchorage, in the first molar attached to adjacent teeth, and skeletal anchorage with a hook simulating the mini-implant. The forces were applied 10 times and observed in a circular polariscope. The stresses located in the mandibular canine were recorded in 7 regions. The Mann-Whitney test was employed to compare the stress in each region and between both anchorage systems. The stresses in the mandibular canine periradicular regions were compared by the Kruskal-Wallis test. RESULTS: Stresses were similar in the cervical region and the middle third. In the apical third, the stresses associated with skeletal anchorage were higher than the stresses associated with dental anchorage. The results of the Kruskal-Wallis test showed that the highest stresses were identified in the cervical-distal, apical-distal, and apex regions with the use of dental anchorage, and in the apical-distal, apical-mesial, cervical-distal, and apex regions with the use of skeletal anchorage. CONCLUSIONS: The use of skeletal anchorage in canine retraction caused greater stress in the apical third than the use of dental anchorage, which indicates an intrusive component resulting from the direction of the force due to the position of the mini-implant and the bracket hook of the canine.
Direct magnetic resonance arthrography of the canine elbow
Directory of Open Access Journals (Sweden)
Yauheni Zhalniarovich
2017-01-01
Full Text Available This study compares the effects of four dilutions of the gadolinium-containing contrast media (1:100; 1:400; 1:800; 1:1,200 administered to the elbow on the quality of magnetic resonance images. All the examined dilutions had a positive effect on image quality, and 1:800 was regarded as the optimal dilution of gadolinium for viewing the elbow because it imparted good contrast to the joint cavity without obliterating the contours of articular surfaces. Transverse, sagittal, and dorsal low-field magnetic resonance images were obtained in 24 canine cadaver front limbs. The musculus biceps brachii, m. triceps brachii, m. extensor carpi radialis, m. flexor carpi ulnaris, the articular surfaces, the medial coronoid process and the anconeal process of the ulna were well visualized by High Resolution Gradient Echo, XBONE T2 and Spin Echo T1 sequences in the sagittal plane. The biceps brachii, pronator teres, flexor carpi radialis, extensor digitorum communis, extensor carpi radialis, deltoid muscle and the articular surface of the medial condyle of the humerus were very well visualized by 3D SST1 and XBONE T2 sequences in the transverse plane. The triceps brachii muscle, extensor digitorum lateralis muscle, superficial digital flexor, deep digital flexor and the medial condyle of the humerus were very well visualized by the Spin Echo T1 sequence in the dorsal plane. This article describes for the first time the use of the gadolinium contrast agent administered to the canine elbow joint during magnetic resonance modality. Magnetic resonance arthrography can be a helpful visualization technique in treating canine soft tissue elbow injury.
Grimaldi, Gabriel; Teva, Antonio; Santos, Claudiney B.; Ferreira, Adelson L.; Falqueto, Aloísio
2012-01-01
To assess the effect of the rapid removal of potentially infectious dogs on the prevalence and incidence of canine infections, a prospective study was undertaken in an area endemic for Leishmania infantum. We used serological testing based on the rapid DPP rK28 fusion protein chromatographic immunoassay for this dog screening-and-culling intervention trial. The outcome was evaluated by measuring seropositivity and sero-conversion/-reversion rates for canine infection. Our estimates indicated ...
Sajnani, Anand K
2015-02-01
The position of the permanent maxillary canine at the angle of the mouth is strategically significant in maintaining the harmony and symmetry of the occlusal relationship. However, the maxillary canine is the second most frequently impacted tooth, with prevalence reported to be between 1% and 2%. Moreover, treatment of this condition is often complex and involves substantial time and financial cost. Hence, it is only prudent to monitor the eruption and identify the etiological factors that lead to impaction of the maxillary canine. Numerous researchers have tried to identify specific and nonspecific etiological factors responsible for displacement of canines. The purpose of this review was to track the development processes of maxillary canines and determine the hindrances that affect the eruption at different ages. Awareness of the eruption process and etiology of noneruption will help to reduce the incidence of impacted canines by allowing for early recognition and interceptive treatment. © 2013 Wiley Publishing Asia Pty Ltd.
Tumor microvessel density–associated mast cells in canine nodal lymphoma
Mann, Elizabeth; Whittington, Lisa
2014-01-01
Objective: Mast cells are associated in angiogenesis in various human and animal neoplasms. However, association of mast cells with tumor microvessel density in canine lymphoma was not previously documented. The objective of the study is to determine if mast cells are increased in canine nodal lymphomas and to evaluate their correlation with tumor microvessel density and grading of lymphomas. Methods: Nodal lymphomas from 33 dogs were studied and compared with nonneoplastic lymph nodes from 6 dogs as control. Mast cell count was made on Toluidine blue stained sections. Immunohistochemistry using antibody against Factor VIII was employed to visualize and determine microvessel density. Results: The mast cell count in lymphoma (2.95 ± 2.4) was significantly higher (p < 0.05) than that in the control (0.83 ± 0.3) and was positively correlated with tumor microvessel density (r = 0.44, p = 0.009). Significant difference was not observed in mast cell count and tumor microvessel density among different gradings of lymphomas. Conclusions: Mast cells are associated with tumor microvessel density in canine nodal lymphoma with no significant difference among gradings of lymphomas. Mast cells may play an important role in development of canine nodal lymphomas. Further detailed investigation on the role of mast cells as important part of tumor microenvironment in canine nodal lymphomas is recommended. PMID:26770752
Tumor microvessel density–associated mast cells in canine nodal lymphoma
Directory of Open Access Journals (Sweden)
Moges Woldemeskel
2014-11-01
Full Text Available Objective: Mast cells are associated in angiogenesis in various human and animal neoplasms. However, association of mast cells with tumor microvessel density in canine lymphoma was not previously documented. The objective of the study is to determine if mast cells are increased in canine nodal lymphomas and to evaluate their correlation with tumor microvessel density and grading of lymphomas. Methods: Nodal lymphomas from 33 dogs were studied and compared with nonneoplastic lymph nodes from 6 dogs as control. Mast cell count was made on Toluidine blue stained sections. Immunohistochemistry using antibody against Factor VIII was employed to visualize and determine microvessel density. Results: The mast cell count in lymphoma (2.95 ± 2.4 was significantly higher (p < 0.05 than that in the control (0.83 ± 0.3 and was positively correlated with tumor microvessel density (r = 0.44, p = 0.009. Significant difference was not observed in mast cell count and tumor microvessel density among different gradings of lymphomas. Conclusions: Mast cells are associated with tumor microvessel density in canine nodal lymphoma with no significant difference among gradings of lymphomas. Mast cells may play an important role in development of canine nodal lymphomas. Further detailed investigation on the role of mast cells as important part of tumor microenvironment in canine nodal lymphomas is recommended.
How far is the root apex of a unilateral impacted canine from the root apices' arch form?
Kim, Sung-Hun; Kim, You-Min; Oh, Sewoong; Kim, Seong-Sik; Park, Soo-Byung; Son, Woo-Sung; Kim, Yong-Il
2017-02-01
The purpose of this study was to determine the arch form of the root apices of normally erupting teeth and then determine the differences in the location of the apex of impacted canines relative to normally erupting canines. In addition, we sought to determine whether the labiopalatal position of the impacted canines influences the position of the apices. The study included 21 patients with unerupted canines that subsequently had a normal eruption, 21 patients with palatally impacted canines, 27 patients with labially impacted canines, and 17 patients with midalveolus impacted canines. Images were obtained using cone beam computed tomography, and the x, y, and z coordinates of the root apices were determined using Ondemand3D software (Cybermed Co., Seoul, Korea). Two-dimensional coordinates were converted from acquired 3-dimensional coordinates via projection on a palatal plane, and the Procrustes method was used to process the converted 2-dimensional coordinates and to draw the arch forms of the root apices. Finally, we measured the extent of root apex deviation from the arch forms of the root apices. Normally erupting canines showed that even though calcifications may be immature, their positions were aligned with a normal arch form. The root apices of the impacted canines were an average of 6.572 mm away from the root apices' arch form, whereas those of the contralateral nonimpacted canines were an average distance of 2.221 mm away, a statistically significant difference. The palatally impacted canines' root apices distribution tended toward the first premolar root apices. Incompletely calcified, unerupted teeth with a subsequent normal eruption showed a normal arch form of the root apices. The root apices of impacted canines were farther from the arch forms than were the nonimpacted canines. Also, the root apices of impacted canines in the palatal area showed distributions different from those of the other impacted canine groups. Copyright © 2017 American
Directory of Open Access Journals (Sweden)
Danielle N C C Costa
Full Text Available BACKGROUND: Visceral leishmaniasis belongs to the list of neglected tropical diseases and is considered a public health problem worldwide. Spatial correlation between the occurrence of the disease in humans and high rates of canine infection suggests that in the presence of the vector, canine visceral leishmaniasis is the key factor for triggering transmission to humans. Despite the control strategies implemented, such as the sacrifice of infected dogs being put down, the incidence of American visceral leishmaniasis remains high in many Latin American countries. METHODOLOGY/PRINCIPAL FINDINGS: Mathematical models were developed to describe the transmission dynamics of canine leishmaniasis and its control by culling. Using these models, imperfect control scenarios were implemented to verify the possible factors which alter the effectiveness of controlling this disease in practice. CONCLUSIONS/SIGNIFICANCE: A long-term continuous program targeting both asymptomatic and symptomatic dogs should be effective in controlling canine leishmaniasis in areas of low to moderate transmission (R0 up to 1.4. However, the indiscriminate sacrifice of asymptomatic dogs with positive diagnosis may jeopardize the effectiveness of the control program, if tests with low specificity are used, increasing the chance of generating outrage in the population, and leading to lower adherence to the program. Therefore, culling must be planned accurately and implemented responsibly and never as a mechanical measure in large scale. In areas with higher transmission, culling alone is not an effective control strategy.
Wang, Shujuan; Xing, Xiaolong; Li, Jian; Jing, Xinli
2018-01-01
The objective of the current work is to synthesize novel boron-containing polymers with excellent thermal resistance, and reveal the structure and the reason for the high char yield. Thus, poly (dihydroxybiphenyl borate) (PDDB) with a more rigid molecular chain, was successfully synthesized using 4,4‧-dihydroxybiphenyl and boric acid. Structural characterizations of the prepared PDDB were performed via NMR, FTIR, XPS, and XRD analyses. The results reveal that PDDB consists of aromatic, Phsbnd Osbnd B and Bsbnd Osbnd B structures as well as a small number of boron hydroxyl and phenolic hydroxyl groups. PDDB shows good solubility in strong polar solvents, which is of great importance for the modification of thermosetting resins. TGA combined with DSC were employed to evaluate the thermal properties of PDDB, and increases in the glass transition temperature (Tg) and char yield were observed with increased boron content. Tg and char yield of PDDB (800 °C, nitrogen atmosphere) reached up to 219 °C and 66.5%, respectively. PDDB was extensively characterized during pyrolysis to reveal the high char yield of PDDB. As briefly discussed, the boron oxide and boron carbide that formed during pyrolysis play a crucial role in the high char yield of PDDB, which reduces the release of volatile carbon dioxide and carbon. This research suggests that PDDB has great potential as a novel modified agent for the improvement of the comprehensive performance of thermosetting resins to broaden their applicability in the field of advanced composites.
In vivo electrical conductivity imaging of a canine brain using a 3 T MREIT system
International Nuclear Information System (INIS)
Kim, Hyung Joong; Oh, Tong In; Kim, Young Tae; Lee, Byung Il; Woo, Eung Je; Lee, Soo Yeol; Seo, Jin Keun; Kwon, Ohin; Park, Chunjae; Kang, Byeong Teck; Park, Hee Myung
2008-01-01
Magnetic resonance electrical impedance tomography (MREIT) aims at producing high-resolution cross-sectional conductivity images of an electrically conducting object such as the human body. Following numerous phantom imaging experiments, the most recent study demonstrated successful conductivity image reconstructions of postmortem canine brains using a 3 T MREIT system with 40 mA imaging currents. Here, we report the results of in vivo animal imaging experiments using 5 mA imaging currents. To investigate any change of electrical conductivity due to brain ischemia, canine brains having a regional ischemic model were scanned along with separate scans of canine brains having no disease model. Reconstructed multi-slice conductivity images of in vivo canine brains with a pixel size of 1.4 mm showed a clear contrast between white and gray matter and also between normal and ischemic regions. We found that the conductivity value of an ischemic region decreased by about 10–14%. In a postmortem brain, conductivity values of white and gray matter decreased by about 4–8% compared to those in a live brain. Accumulating more experience of in vivo animal imaging experiments, we plan to move to human experiments. One of the important goals of our future work is the reduction of the imaging current to a level that a human subject can tolerate. The ability to acquire high-resolution conductivity images will find numerous clinical applications not supported by other medical imaging modalities. Potential applications in biology, chemistry and material science are also expected
Churchill, A E
1987-04-04
Canine parvovirus isolated from a case of haemorrhagic enteritis in a breeding kennel in England was passaged and cloned in cultured feline and canine cells. No significant evidence of pathogenicity was found during six serial passages of the modified virus back through young dogs. The attenuated virus was excreted by inoculated animals and spread rapidly to uninoculated animals held in contact. When high titre attenuated virus was given to the six-week-old offspring of a seropositive dam a prompt seroconversion was observed. When the attenuated virus was used as an experimental vaccine in 108 pups in an infected breeding colony a highly significant improvement was obtained in the accumulated morbidity and mortality compared with a parallel group vaccinated with modified live feline panleucopenia virus.
Chromosomal mapping of canine-derived BAC clones to the red fox and American mink genomes.
Kukekova, Anna V; Vorobieva, Nadegda V; Beklemisheva, Violetta R; Johnson, Jennifer L; Temnykh, Svetlana V; Yudkin, Dmitry V; Trut, Lyudmila N; Andre, Catherine; Galibert, Francis; Aguirre, Gustavo D; Acland, Gregory M; Graphodatsky, Alexander S
2009-01-01
High-quality sequencing of the dog (Canis lupus familiaris) genome has enabled enormous progress in genetic mapping of canine phenotypic variation. The red fox (Vulpes vulpes), another canid species, also exhibits a wide range of variation in coat color, morphology, and behavior. Although the fox genome has not yet been sequenced, canine genomic resources have been used to construct a meiotic linkage map of the red fox genome and begin genetic mapping in foxes. However, a more detailed gene-specific comparative map between the dog and fox genomes is required to establish gene order within homologous regions of dog and fox chromosomes and to refine breakpoints between homologous chromosomes of the 2 species. In the current study, we tested whether canine-derived gene-containing bacterial artificial chromosome (BAC) clones can be routinely used to build a gene-specific map of the red fox genome. Forty canine BAC clones were mapped to the red fox genome by fluorescence in situ hybridization (FISH). Each clone was uniquely assigned to a single fox chromosome, and the locations of 38 clones agreed with cytogenetic predictions. These results clearly demonstrate the utility of FISH mapping for construction of a whole-genome gene-specific map of the red fox. The further possibility of using canine BAC clones to map genes in the American mink (Mustela vison) genome was also explored. Much lower success was obtained for this more distantly related farm-bred species, although a few BAC clones were mapped to the predicted chromosomal locations.
Automated tru-cut imaging-guided core needle biopsy of canine ...
African Journals Online (AJOL)
The purpose of this study was to evaluate the diagnostic value of imaging-guided core needle biopsy for canine orbital mass diagnosis. A second excisional biopsy obtained during surgery or necropsy was used as the reference standard. A prospective feasibility study was conducted in 23 canine orbital masses at a single ...
Wu, Lisa Y; Johnson, Jacqueline M; Simmons, Jessica K; Mendes, Desiree E; Geruntho, Jonathan J; Liu, Tiancheng; Dirksen, Wessel P; Rosol, Thomas J; Davis, William C; Berkman, Clifford E
2014-05-01
Prostate-specific membrane antigen (PSMA) remains an important target for diagnostic and therapeutic application for human prostate cancer. Model cell lines have been recently developed to study canine prostate cancer but their PSMA expression and enzymatic activity have not been elucidated. The present study was focused on determining PSMA expression in these model canine cell lines and the use of fluorescent small-molecule enzyme inhibitors to detect canine PSMA expression by flow cytometry. Western blot and RT-PCR were used to determine the transcriptional and translational expression of PSMA on the canine cell lines Leo and Ace-1. An endpoint HPLC-based assay was used to monitor the enzymatic activity of canine PSMA and the potency of enzyme inhibitors. Flow cytometry was used to detect the PSMA expressed on Leo and Ace-1 cells using a fluorescently tagged PSMA enzyme inhibitor. Canine PSMA expression on the Leo cell line was confirmed by Western blot and RT-PCR, the enzyme activity, and flow cytometry. Kinetic parameters Km and Vmax of PSMA enzymatic activity for the synthetic substrate (PABGγG) were determined to be 393 nM and 220 pmol min(-1) mg protein(-1) , respectively. The inhibitor core 1 and fluorescent inhibitor 2 were found to be potent reversible inhibitors (IC50 = 13.2 and 1.6 nM, respectively) of PSMA expressed on the Leo cell line. Fluorescent labeling of Leo cells demonstrated that the fluorescent PSMA inhibitor 2 can be used for the detection of PSMA-positive canine prostate tumor cells. Expression of PSMA on Ace-1 was low and not detectable by flow cytometry. The results described herein have demonstrated that PSMA is expressed on canine prostate tumor cells and exhibits similar enzymatic characteristics as human PSMA. The findings show that the small molecule enzyme inhibitors currently being studied for use in diagnosis and therapy of human prostate cancer can also be extended to include canine prostate cancer. Importantly
Evaluation of the kinase domain of c-KIT in canine cutaneous mast cell tumors
International Nuclear Information System (INIS)
Webster, Joshua D; Kiupel, Matti; Yuzbasiyan-Gurkan, Vilma
2006-01-01
Mutations in the c-KIT proto-oncogene have been implicated in the progression of several neoplastic diseases, including gastrointestinal stromal tumors and mastocytosis in humans, and cutaneous mast cell tumors (MCTs) in canines. Mutations in human mastocytosis patients primarily occur in c-KIT exon 17, which encodes a portion of its kinase domain. In contrast, deletions and internal tandem duplication (ITD) mutations are found in the juxtamembrane domain of c-KIT in approximately 15% of canine MCTs. In addition, ITD c-KIT mutations are significantly associated with aberrant KIT protein localization in canine MCTs. However, some canine MCTs have aberrant KIT localization but lack ITD c-KIT mutations, suggesting that other mutations or other factors may be responsible for aberrant KIT localization in these tumors. In order to characterize the prevalence of mutations in the phospho-transferase portion of c-KIT's kinase domain in canine MCTs exons 16–20 of 33 canine MCTs from 33 dogs were amplified and sequenced. Additionally, in order to determine if mutations in c-KIT exon 17 are responsible for aberrant KIT localization in MCTs that lack juxtamembrane domain c-KIT mutations, c-KIT exon 17 was amplified and sequenced from 18 canine MCTs that showed an aberrant KIT localization pattern but did not have ITD c-KIT mutations. No mutations or polymorphisms were identified in exons 16–20 of any of the MCTs examined. In conclusion, mutations in the phospho-transferase portion of c-KIT's kinase domain do not play an important role in the progression of canine cutaneous MCTs, or in the aberrant localization of KIT in canine MCTs
Open versus closed surgical exposure of canine teeth that are displaced in the roof of the mouth.
Parkin, Nicola; Benson, Philip E; Thind, Bikram; Shah, Anwar; Khalil, Ismail; Ghafoor, Saiba
2017-08-21
databases. We included randomised and quasi-randomised controlled trials assessing young people receiving surgical treatment to correct upper PDCs. There was no restriction on age, presenting malocclusion or type of active orthodontic treatment undertaken. We included unilaterally and bilaterally displaced canines. Two review authors independently screened the results of the electronic searches, extracted data and assessed the risk of bias in the included studies. We attempted to contact study authors for missing data or clarification where feasible. We followed statistical guidelines from the Cochrane Handbook for Systematic Reviews of Interventions for data synthesis. We included three studies, involving 146 participants. Two studies were assessed as being at high risk of bias.The main finding of the review was that the two techniques may be equally successful at exposing PDCs (risk ratio (RR) 0.99, 95% confidence interval (CI) 0.93 to 1.06; three studies, 141 participants analysed, low-quality evidence).One surgical failure was due to detachment of the gold chain (closed group). One study reported on complications following surgery and found two in the closed group: a post-operative infection requiring antibiotics and pain during alignment of the canine as the gold chain penetrated through the gum tissue of the palate.We were unable to pool data for dental aesthetics, patient-reported pain and discomfort, periodontal health and treatment time; however, individual studies did not find any differences between the surgical techniques (low- to very low-quality evidence). Currently, the evidence suggests that neither the open or closed surgical technique for exposing palatally displaced maxillary canine teeth is superior for any of the outcomes included in this review; however, we considered the evidence to be low quality, with two of the three included studies being at high risk of bias. This suggests the need for more high-quality studies. Three ongoing clinical trials have
DEFF Research Database (Denmark)
Kaewsakhorn, T.; Kisseberth, W.C.; Capen, C.C.
2005-01-01
Background: Transitional cell carcinoma (TCC) in dogs is associated with high morbidity and mortality. Calcitriol and its analog seocalcitol, combined with medium-chain triglyceride (MCT), have potential for the treatment of this disease. Materials and Methods: TCC cells were treated with calcitr...... inhibited TCC cell growth via induction of cell cycle arrest and MCT enhanced this effect. Therefore, calcitriol and seocalcitol with MCT may have therapeutic potential for canine bladder cancer....... with calcitriol or seocalcitol, alone or combined with MCT. Cell growth, cell cycle kinetics, vitamin D receptor (VDR) localization and expression, and Bcl-2 expression were measured. Results: Canine TCC expresses high levels of nuclear VDR. Furthermore, calcitriol and seocalcitol significantly inhibited cell...
Feline and canine coronaviruses: common genetic and pathobiological features.
Le Poder, Sophie
2011-01-01
A new human coronavirus responsible for severe acute respiratory syndrome (SARS) was identified in 2003, which raised concern about coronaviruses as agents of serious infectious disease. Nevertheless, coronaviruses have been known for about 50 years to be major agents of respiratory, enteric, or systemic infections of domestic and companion animals. Feline and canine coronaviruses are widespread among dog and cat populations, sometimes leading to the fatal diseases known as feline infectious peritonitis (FIP) and pantropic canine coronavirus infection in cats and dogs, respectively. In this paper, different aspects of the genetics, host cell tropism, and pathogenesis of the feline and canine coronaviruses (FCoV and CCoV) will be discussed, with a view to illustrating how study of FCoVs and CCoVs can improve our general understanding of the pathobiology of coronaviruses.
High green fodder yielding new grass varieties
C. Babu, K. Iyanar and A. Kalamani
2014-01-01
Two high biomass yielding forage grass varieties one each in Cumbu Napier hybrid and Guinea grass have been evolved at the Department of Forage Crops, Centre for Plant Breeding and Genetics, Tamil Nadu Agricultural University, Coimbatore and identified for release at national (All India) level as Cumbu Napier hybrid grass CO (BN) 5 and Guinea grass CO (GG) 3 during 2012 and 2013 respectively. Cumbu Napier hybrid grass CO (BN) 5 secured first rank at all national level with reference to green ...
Detection of canine cytokine gene expression by reverse transcription-polymerase chain reaction.
Pinelli, E; van der Kaaij, S Y; Slappendel, R; Fragio, C; Ruitenberg, E J; Bernadina, W; Rutten, V P
1999-08-02
Further characterization of the canine immune system will greatly benefit from the availability of tools to detect canine cytokines. Our interest concerns the study on the role of cytokines in canine visceral leishmaniasis. For this purpose, we have designed specific primers using previously published sequences for the detection of canine IL-2, IFN-gamma and IL10 mRNA by reverse transcription-polymerase chain reaction (RT-PCR). For IL-4, we have cloned and sequenced this cytokine gene, and developed canine-specific primers. To control for sample-to-sample variation in the quantity of mRNA and variation in the RT and PCR reactions, the mRNA levels of glyceraldehyde-3-phosphate dehydrogenase (G3PDH), a housekeeping gene, were determined in parallel. Primers to amplify G3PDH were designed from consensus sequences obtained from the Genbank database. The mRNA levels of the cytokines mentioned here were detected from ConA-stimulated peripheral mononuclear cells derived from Leishmania-infected dogs. A different pattern of cytokine production among infected animals was found.
Canine distemper viral infection threatens the giant panda population in China
Jin, Yipeng; Zhang, Xinke; Ma, Yisheng; Qiao, Yanchao; Liu, Xiaobin; Zhao, Kaihui; Zhang, Chenglin; Lin, Degui; Fu, Xuelian; Xu, Xinrong; Wang, Yiwei; Wang, Huanan
2017-01-01
We evaluated exposure to canine distemper virus (CDV) in eight wild giant pandas (Ailuropoda melanoleuca) and 125 unvaccinated domestic dogs living in and around Foping National Nature Reserve (FNNR), China. Seventy-two percent of unvaccinated domestic dogs (mixed breed) had neutralizing antibodies for CDV due to exposure to the disease. The eight wild giant pandas were naïve to CDV and carried no positive antibody titer. RT-PCR assays for hemagglutinin (H) gene confirmed the presence of CDV in 31 clinically ill dogs from several areas near FNNR. Genomic sequence analysis showed that the 21 canine CDV were highly homologous to each other and belonged to the Asian-1 genotype. They showed high homology with the GP01 strain sequenced from a fatally infected giant panda, suggesting cross-species infection. Observational and GPS tracking data revealed home range overlap in pandas and dogs around FNNR. This study shows that CDV is endemic in domestic dogs near FNNR and that cross-species CDV infection threatens the wild giant panda population. PMID:29371956
Canine distemper viral infection threatens the giant panda population in China.
Jin, Yipeng; Zhang, Xinke; Ma, Yisheng; Qiao, Yanchao; Liu, Xiaobin; Zhao, Kaihui; Zhang, Chenglin; Lin, Degui; Fu, Xuelian; Xu, Xinrong; Wang, Yiwei; Wang, Huanan
2017-12-26
We evaluated exposure to canine distemper virus (CDV) in eight wild giant pandas ( Ailuropoda melanoleuca ) and 125 unvaccinated domestic dogs living in and around Foping National Nature Reserve (FNNR), China. Seventy-two percent of unvaccinated domestic dogs (mixed breed) had neutralizing antibodies for CDV due to exposure to the disease. The eight wild giant pandas were naïve to CDV and carried no positive antibody titer. RT-PCR assays for hemagglutinin ( H ) gene confirmed the presence of CDV in 31 clinically ill dogs from several areas near FNNR. Genomic sequence analysis showed that the 21 canine CDV were highly homologous to each other and belonged to the Asian-1 genotype. They showed high homology with the GP01 strain sequenced from a fatally infected giant panda, suggesting cross-species infection. Observational and GPS tracking data revealed home range overlap in pandas and dogs around FNNR. This study shows that CDV is endemic in domestic dogs near FNNR and that cross-species CDV infection threatens the wild giant panda population.
Gupta, Vikas; Chakravarti, Soumendu; Chander, Vishal; Majumder, Saurabh; Bhat, Shabir Ahmad; Gupta, Vivek Kumar; Nandi, Sukdeb
2017-07-01
Canine parvovirus-2 (CPV-2), which is ubiquitously distributed worldwide, causes severe and often fatal gastroenteritis in dogs. Accurate, differential and rapid diagnosis of canine parvoviral enteritis remains a challenge for clinicians. A recently developed isothermal amplification technique, polymerase spiral reaction (PSR), was optimized for the first time for a viral pathogen with reference recombinant plasmid standards from different CPV-2 antigenic variants (CPV-2, CPV-2a, CPV-2b and CPV-2c) and subsequently validated using clinical samples. Addition of chromogenic substrate SYBR Green I after the completion of the reaction resulted in bright green fluorescence in positive samples, while negative samples and a no-template control remained orange. These results were further substantiated through visualization of a laddering pattern of the PSR-amplified product in an agarose gel in positive cases and the absence of this pattern in no-template control and negative samples. The PSR assay was found to be highly specific, as it did not react with other putative canine pathogens (canine adenovirus 1 and canine distemper virus). The sensitivity of the newly developed PSR technique was compared with that of conventional PCR, real-time PCR and LAMP, using a serial tenfold dilution of canine parvovirus DNA. The detection limit of PSR was found to be at the femtogram level, which is comparable with that of real-time PCR and LAMP, which are ten times more sensitive than conventional PCR. The assay was validated using 90 clinical samples, of which 54 were found positive, while only 45 samples were positive in conventional PCR. This novel assay, which is fully compliant with the 'ASSURED' concept for disease diagnosis, provides a simple, rapid, specific, sensitive and cost-effective method for diagnosis of canine parvoviral enteritis in veterinary clinics.
Interspecies dynamics among bacteria associated with canine periodontal disease.
Sanguansermsri, P; Nobbs, A H; Jenkinson, H F; Surarit, R
2018-02-01
The etiology and pathogenic mechanisms associated with canine periodontal disease are less well understood than the disease in humans. In this study we have reconstructed defined consortia biofilms in vitro of microorganisms identified as prevalent in a same-breed cohort of dogs with or without periodontal disease. Frederiksenia canicola and Neisseria canis were selected as potential early colonizers of salivary pellicle, and Fusobacterium nucleatum and Porphyromonas gulae were included as high incidence canine oral bacteria. N. canis formed a biofilm substratum under aerobic conditions, but was unable to tolerate anaerobic conditions. Fr. canicola exhibited synergistic biofilm growth with Po. gulae under anaerobic conditions, but displayed an antagonistic relationship with Fu. nucleatum. However, strong co-adhesion between Fu. nucleatum and Po. gulae was able to overcome the inhibitory effects of Fr. canicola to facilitate three-species biofilm formation. Parvimonas micra, an anaerobic, asaccharolytic Gram-positive coccus found only under disease conditions in vivo, was able to form biofilms in conjunction with Fr. canicola and Po. gulae. Furthermore, the specific proteolytic activities of biofilms containing Fr. canicola and Po. gulae or Fu. nucleatum and Po. gulae were increased several-fold upon the addition of Pa. micra. This suggests that anaerobic cocci such as Pa. micra might provide a catalyst for progressive tissue destruction, inflammation and alveolar bone loss in canine periodontal disease, in keeping with the keystone-pathogen hypothesis. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Canine Leishmaniosis: tools for diagnosis in veterinary practice in Colombia
Directory of Open Access Journals (Sweden)
Víctor Acero P
2015-09-01
Full Text Available The objective of this article is to perform a critical analysis and guide veterinarians in the management of canine Leishmaniosis. A systematic literature review was performed between 2005 and 2014 including scientific papers which take into account experiences and reports of: pathogenesis, diagnosis, clinical presentation, treatment, vaccination, prevention and control strategies. We discuss the different aspects of VL management and aspects that should be taken into account depending on the country, after a patient is suspected or confirmed as positive, including the possibility of euthanasia. We describe the different clinical manifestations of the disease, diagnosis, signs and treatment of canine leishmaniosis. Canine leishmaniosis is present in different parts of the country, therefore it must be considered as a possible differential diagnosis in the veterinary clinic, in patients with dermatological and systemic signs that are compatible with various diseases. In Colombia, the patients diagnosed with cutaneous leishmaniasis could be treated and have a favorable prognosis, whereas in canines with diagnosis of visceral leishmaniasis euthanasia should be considered because of the public health implications.
Compensatory canine angulation in angle Class II and III patients
Directory of Open Access Journals (Sweden)
Mauro Carlos Agner Busato
2009-09-01
Full Text Available The aim of this study was to evaluate the occurence of compensation in mesiodistal axial inclinations of canines in skeletal malocclusions patients. The sample consisted of 25 Angle Class II, division 1 malocclusion (group 1 and 19 Angle Class III malocclusion patients (group 2. After measurement of dental angulations through a method that associates plaster model photography and AutoCad software, comparisons between the groups were performed by T-test for independent samples. Results showed that there was no statistically significant difference (p < 0.05 between groups, when maxillary canine angulations were compared. Regarding the mandibular canines, there was a statistically significant difference in dental angulation, expressed by 3.2° for group 1 and 0.15° for group 2. An upright position tendency for mandibular canines was observed in the Angle Class III sample. This configures a pattern of compensatory coronary positioning, since the angulation of these teeth makes them occupy less space in the dental arch and consequently mandibular incisors can be in a more retracted position in the sagittal plane.
Directory of Open Access Journals (Sweden)
Rao Nagesha AS
2009-09-01
Full Text Available Abstract Background Gene expression profiling of spontaneous tumors in the dog offers a unique translational opportunity to identify prognostic biomarkers and signaling pathways that are common to both canine and human. Osteosarcoma (OS accounts for approximately 80% of all malignant bone tumors in the dog. Canine OS are highly comparable with their human counterpart with respect to histology, high metastatic rate and poor long-term survival. This study investigates the prognostic gene profile among thirty-two primary canine OS using canine specific cDNA microarrays representing 20,313 genes to identify genes and cellular signaling pathways associated with survival. This, the first report of its kind in dogs with OS, also demonstrates the advantages of cross-species comparison with human OS. Results The 32 tumors were classified into two prognostic groups based on survival time (ST. They were defined as short survivors (dogs with poor prognosis: surviving fewer than 6 months and long survivors (dogs with better prognosis: surviving 6 months or longer. Fifty-one transcripts were found to be differentially expressed, with common upregulation of these genes in the short survivors. The overexpressed genes in short survivors are associated with possible roles in proliferation, drug resistance or metastasis. Several deregulated pathways identified in the present study, including Wnt signaling, Integrin signaling and Chemokine/cytokine signaling are comparable to the pathway analysis conducted on human OS gene profiles, emphasizing the value of the dog as an excellent model for humans. Conclusion A molecular-based method for discrimination of outcome for short and long survivors is useful for future prognostic stratification at initial diagnosis, where genes and pathways associated with cell cycle/proliferation, drug resistance and metastasis could be potential targets for diagnosis and therapy. The similarities between human and canine OS makes the
High-yield production of canine parvovirus virus-like particles in a baculovirus expression system.
Jin, Hongli; Xia, Xiaohong; Liu, Bing; Fu, Yu; Chen, Xianping; Wang, Huihui; Xia, Zhenqiang
2016-03-01
An optimized VP2 gene from the current prevalent CPV strain (new CPV-2a) in China was expressed in a baculovirus expression system. It was found that the VP2 proteins assembled into virus-like particles (VLPs) with antigenic properties similar to those of natural CPV and with an especially high hemagglutination (HA) titer (1:2(20)). Dogs intramuscularly or orally immunized with VLPs produced antibodies against CPV with >1:80 hemagglutination inhibition (HI) units for at least 3 months. The CPV VLPs could be considered for use as a vaccine against CPV or as a platform for research on chimeric VLP vaccines against other diseases.
Derman, Serap; Mustafaeva, Zeynep Akdeste; Abamor, Emrah Sefik; Bagirova, Melahat; Allahverdiyev, Adil
2015-10-20
Canine parvovirus 2 (CPV-2) remains a significant worldwide canine pathogen and the most common cause of viral enteritis in dogs. The 1 L15 and 7 L15 peptides overlap each other with QPDGGQPAV residues (7-15 of VP2 capsid protein of CPV) is shown to produce high immune response. PLGA nanoparticles were demonstrated to have special properties such as; controlled antigen release, protection from degradation, elimination of booster-dose and enhancing the cellular uptake by antigen presenting cells. Nevertheless, there is no study available in literature, about developing vaccine based on PLGA nanoparticles with adjuvant properties against CPV. Thus, the aim of the present study was to synthesize and characterize high immunogenic W-1 L19 peptide (from the VP2 capsid protein of CPV) loaded PLGA nanoparticle and to evaluate their in vitro immunogenic activity. PLGA nanoparticles were produced with 5.26 ± 0.05 % loading capacity and high encapsulation efficiency with 81.2 ± 3.1 %. Additionally, it was evaluated that free NPs and W-1 L19 peptide encapsulated PLGA nanoparticles have Z-ave of 183.9 ± 12.1 nm, 221.7 ± 15.8 nm and polydispersity index of 0.107 ± 0.08, 0.135 ± 0.12 respectively. It was determined that peptide loaded PLGA nanoparticles were successfully phagocytized by macrophage cells and increased NO production at 2-folds (*P vaccine candidate against Canine Parvovirus. Studies targeting PLGA nanoparticles based delivery system must be maintained in near future in order to develop new and more effective nano-vaccine formulations.
Gossellin, J; Wren, J A; Sunderland, S J
2007-08-01
Canine patients are generally regarded as being clinically obese when their body weight is at least 15% above ideal. The incidence of obesity in dogs is thought to be in the range of 20-40% of the general population and, since obesity is known to predispose or exacerbate a range of serious medical conditions, its importance cannot be overstated. Management of obesity through dietary restriction and increased exercise is often difficult to achieve and dependent upon owner compliance. Until recently there has been no authorized therapeutic medication available for weight reduction in dogs, and drugs used in people have proved unsuitable. However, with the development of microsomal triglyceride transfer protein inhibitors for canine use, such as dirlotapide, the veterinarian has a novel method with which to augment traditional weight control programmes. This approach has the additional advantage that weight loss is achieved without dietary restriction or change in exercise regimen, providing encouragement for the owner to comply with subsequent dietary and exercise recommendations, thereby increasing the likelihood for long-term success.
Peracute Infectious Canine Hepatitis
Directory of Open Access Journals (Sweden)
A. H. Cheema*, I. Ahmed, G. Mustafa and A. Aslam
2012-05-01
Full Text Available Peracute infectious canine hepatitis (ICH was diagnosed in two young male dogs out of 56 dead canines presented for necropsy examination during the period of April 2009 to June 2010. These dogs were purebred, one- month old Alsatian and 5-month old Labrador. None of the dogs had received any vaccination or deworming treatment; both had died after illness lasting for six hours and twenty four hours respectively. The dogs had shown signs of depression, anorexia and fever. At necropsy, lymph nodes were swollen, edematous and congested; livers were enlarged, bright red and mottled with numerous small white foci. Petechial hemorrhages were seen in the mucosa. Excessive serosanguinous fluid was present in the abdominal cavities. Histologically, the most significant lesion was necrohemorrhagic hepatitis with single cell necrosis of hepatocytes, lacunose dilation of sinusoids filled with blood and numerous large, solid intranuclear inclusion bodies (IIBs in the hepatocytes and macrophages. Both eosinophilic and basophilic (amphophilic inclusions were seen. It has been observed that ICH is re-emerging in some endemic countries. Pet dogs should be regularly protected by effective vaccination.
Radioresistant canine hematopoietic cells
International Nuclear Information System (INIS)
Kawakami, T.G.; Shimizu, J.; Rosenblatt, L.S.; Goldman, M.
1987-01-01
Survival of dogs that are continuously exposed to a moderate dose-rate of gamma radiation (10 cGy/day) is dependent on the age of the dog at the time of exposure. Most dogs exposed postpartum to gamma radiation suffered from suppressed hematopoiesis and died of aplasia. On the other hand, none of the in utero-exposed dogs suffered from suppressed hematopoiesis and most became long-term survivors, tolerating 10-fold greater total dose, but dying of myeloproliferative disease (MPD). Using acute gamma irradiation of hematopoietic cells and colony forming unit cell assay (CFU), they observed that a canine hematopoietic cell line established from a myeloid leukemic dog that was a long-term survivor of continuous irradiation was approximately 4-fold more radioresistant than a hematopoietic cell line established from a dog with nonradiation-induced myeloid leukemia or hematopoietic cells from normal canine bone marrow. In utero dogs that are long-term survivors of continuous irradiation have radioresistant hematopoietic cells, and radioresistance that is a constitutive property of the cells
Berger, C; Berger, B; Parson, W
2012-01-01
In recent years, evidence from domestic dogs has increasingly been analyzed by forensic DNA testing. Especially, canine hairs have proved most suitable and practical due to the high rate of hair transfer occurring between dogs and humans. Starting with the description of a contamination-free sample handling procedure, we give a detailed workflow for sequencing hypervariable segments (HVS) of the mtDNA control region from canine evidence. After the hair material is lysed and the DNA extracted by Phenol/Chloroform, the amplification and sequencing strategy comprises the HVS I and II of the canine control region and is optimized for DNA of medium-to-low quality and quantity. The sequencing procedure is based on the Sanger Big-dye deoxy-terminator method and the separation of the sequencing reaction products is performed on a conventional multicolor fluorescence detection capillary electrophoresis platform. Finally, software-aided base calling and sequence interpretation are addressed exemplarily.
Surgical innovations in canine gonadectomy
Van Goethem, Bart
2016-01-01
In this thesis some recent technological developments in human surgery are evaluated for their potential use in veterinary medicine by introducing them as surgical innovations for canine gonadectomy. Barbed sutures achieve wound apposition without surgical knot tying and thus avoid knot-associated
Mid-Season High-Resolution Satellite Imagery for Forecasting Site-Specific Corn Yield
Directory of Open Access Journals (Sweden)
Nahuel R. Peralta
2016-10-01
Full Text Available A timely and accurate crop yield forecast is crucial to make better decisions on crop management, marketing, and storage by assessing ahead and implementing based on expected crop performance. The objective of this study was to investigate the potential of high-resolution satellite imagery data collected at mid-growing season for identification of within-field variability and to forecast corn yield at different sites within a field. A test was conducted on yield monitor data and RapidEye satellite imagery obtained for 22 cornfields located in five different counties (Clay, Dickinson, Rice, Saline, and Washington of Kansas (total of 457 ha. Three basic tests were conducted on the data: (1 spatial dependence on each of the yield and vegetation indices (VIs using Moran’s I test; (2 model selection for the relationship between imagery data and actual yield using ordinary least square regression (OLS and spatial econometric (SPL models; and (3 model validation for yield forecasting purposes. Spatial autocorrelation analysis (Moran’s I test for both yield and VIs (red edge NDVI = NDVIre, normalized difference vegetation index = NDVIr, SRre = red-edge simple ratio, near infrared = NIR and green-NDVI = NDVIG was tested positive and statistically significant for most of the fields (p < 0.05, except for one. Inclusion of spatial adjustment to model improved the model fit on most fields as compared to OLS models, with the spatial adjustment coefficient significant for half of the fields studied. When selected models were used for prediction to validate dataset, a striking similarity (RMSE = 0.02 was obtained between predicted and observed yield within a field. Yield maps could assist implementing more effective site-specific management tools and could be utilized as a proxy of yield monitor data. In summary, high-resolution satellite imagery data can be reasonably used to forecast yield via utilization of models that include spatial adjustment to
A homologous radioimmunoassay for canine prolactin: plasma levels huring the reproductive cycle
International Nuclear Information System (INIS)
Coster, R. De; Beerens, D.; Mey, J. De; Beckers, J.-F.
1983-01-01
A method is described for the purification of canine prolactin, involving preparative isoelectrofocusing. Canine prolactin has a molecular weight of 23 000 daltons, an isoelectric point of 5.7 and exhibits a high degree of homogeneity in polyacrylamide gels stained by means of a silver method. A specific, homologous radioimmunoassay is described using the Bolton-Hunter method for preparation of the labelled ligand, with a sensitivity of 0.1 ng/tube. Basal plasma prolactin levels of 2-4 ng/ml obtained through the oestrous cycle remained fairly constant but a rise of 9 ng/ml was found at the end of dioestrus in non-pregnant bitches. Level also rose 30 days after mating to reach a peak of about 50 ng/ml near parturition and during early lactation. (author)
Stahl, Franka; Grabowski, Rosemarie
2003-05-01
The relationship between maxillary canine displacement and the simultaneous occurrence of "genetically determined predisposition to disturbed development of the dentition" as defined by Hoffmeister was investigated in 675 patients. Panoramic radiographs taken of each patient during the first and the second mixed dentition periods were evaluated. Canine inclination and the distance between the tip of the canine and a line connecting the cusps of the molars were computed in five different age groups according to Dausch-Neumann. Statistical analysis revealed 34 patients with "potential canine displacement", who exhibited further symptoms of "genetically determined predisposition to disturbed development of the dentition" significantly more frequently than the total group. The symptoms concerned were agenesia, displaced tooth buds, rotated or tilted incisors, aplasia and microdontia of lateral incisors. Careful follow-ups in patients with a predisposition to disturbed dental development enables risks to be anticipated and canine displacement to be detected at an early stage.
Expression of nociceptive ligands in canine osteosarcoma.
Shor, S; Fadl-Alla, B A; Pondenis, H C; Zhang, X; Wycislo, K L; Lezmi, S; Fan, T M
2015-01-01
Canine osteosarcoma (OS) is associated with localized pain as a result of tissue injury from tumor infiltration and peritumoral inflammation. Malignant bone pain is caused by stimulation of peripheral pain receptors, termed nociceptors, which reside in the localized tumor microenvironment, including the periosteal and intramedullary bone cavities. Several nociceptive ligands have been determined to participate directly or indirectly in generating bone pain associated with diverse skeletal abnormalities. Canine OS cells actively produce nociceptive ligands with the capacity to directly or indirectly activate peripheral pain receptors residing in the bone tumor microenvironment. Ten dogs with appendicular OS. Expression of nerve growth factor, endothelin-1, and microsomal prostaglandin E synthase-1 was characterized in OS cell lines and naturally occurring OS samples. In 10 dogs with OS, circulating concentrations of nociceptive ligands were quantified and correlated with subjective pain scores and tumor volume in patients treated with standardized palliative therapies. Canine OS cells express and secrete nerve growth factor, endothelin-1, and prostaglandin E2. Naturally occurring OS samples uniformly express nociceptive ligands. In a subset of OS-bearing dogs, circulating nociceptive ligand concentrations were detectable but failed to correlate with pain status. Localized foci of nerve terminal proliferation were identified in a minority of primary bone tumor samples. Canine OS cells express nociceptive ligands, potentially permitting active participation of OS cells in the generation of malignant bone pain. Specific inhibitors of nociceptive ligand signaling pathways might improve pain control in dogs with OS. Copyright © 2015 The Authors. Journal of Veterinary Internal Medicine published by Wiley Periodicals, Inc. on behalf of American College of Veterinary Internal Medicine.
DEFF Research Database (Denmark)
Nielsen, Line; Søgaard, Mette; Jensen, Trine Hammer
2009-01-01
The mechanisms behind the in vivo virulence of immunosuppressive wild-type Morbillivirus infections are still not fully understood. To investigate lymphotropism and host responses we have selected the natural host model of canine distemper virus (CDV) infection in mink. This model displays...
Feline and Canine Coronaviruses: Common Genetic and Pathobiological Features
Directory of Open Access Journals (Sweden)
Sophie Le Poder
2011-01-01
Full Text Available A new human coronavirus responsible for severe acute respiratory syndrome (SARS was identified in 2003, which raised concern about coronaviruses as agents of serious infectious disease. Nevertheless, coronaviruses have been known for about 50 years to be major agents of respiratory, enteric, or systemic infections of domestic and companion animals. Feline and canine coronaviruses are widespread among dog and cat populations, sometimes leading to the fatal diseases known as feline infectious peritonitis (FIP and pantropic canine coronavirus infection in cats and dogs, respectively. In this paper, different aspects of the genetics, host cell tropism, and pathogenesis of the feline and canine coronaviruses (FCoV and CCoV will be discussed, with a view to illustrating how study of FCoVs and CCoVs can improve our general understanding of the pathobiology of coronaviruses.
Evolution of canine parvovirus--a need for new vaccines?
Truyen, Uwe
2006-10-05
Canine parvovirus (CPV) is a new virus, which is continuing to evolve, giving rise to new antigenic types and virus mutants that spread through the dog population. The most successful mutants, from an evolutionary perspective, appear to be selected by improved binding to the CPV receptor, the canine transferrin receptor, and by an extended host range, which for the newer antigenic types now includes both the dog and the cat. The new viruses also show antigenic differences that can be defined by binding of certain monoclonal antibodies; they also differ in their reactivity in virus neutralisation tests, using immune sera raised against the various antigenic types. These differences may influence the susceptibility of young animals to infection at the time when the level of maternally derived antibody decreases to the minimum protective titre. This minimum protective titre may vary depending on the infecting virus type. There is, however, a high degree of cross-protection between the virus types and the true relevance of the differences in neutralisation titer is currently not known.
THE REDUCED CANINE PANCREAS TO STUDY THE EFFECTS OF INTRAOPERATIVE RADIOTHERAPY
HEIJMANS, HJ; MEHTA, D; KLEIBEUKER, JH; SLUITER, WJ; HOEKSTRA, HJ
1993-01-01
A canine model is described to study the tolerance of the pancreas to intra-operative radiotherapy (IORT). The canine pancreas is a horseshoe-shaped organ. To create a homogeneous delivery of IORT to the whole pancreas surgical manipulation is necessary which may induce pancreatitis. A resection of
Laparoscopic radical prostatectomy in the canine model.
Price, D T; Chari, R S; Neighbors, J D; Eubanks, S; Schuessler, W W; Preminger, G M
1996-12-01
The purpose of this study was to determine the feasibility of performing laparoscopic radical prostatectomy in a canine model. Laparoscopic radical prostatectomy was performed on six adult male canines. A new endoscopic needle driver was used to construct a secure vesicourethral anastomosis. Average operative time required to complete the procedure was 304 min (range 270-345 min). Dissection of the prostate gland took an average of 67 min (range 35-90 min), and construction of the vesicourethral anastomosis took 154 min (rage 80-240 min). There were no intraoperative complications and only one postoperative complication (anastomotic leak). Five of the six animals recovered uneventfully from the procedure, and their foley catheters were removed 10-14 days postoperatively after a retrograde cystourethrogram demonstrated an intact vesicourethral anastomosis. Four (80%) of the surviving animals were clinically continent within 10 days after catheter removal. Post mortem examination confirmed that the vesicourethral anastomosis was intact with no evidence of urine extravasation. These data demonstrate the feasibility of laparoscopic radical prostatectomy in a canine model, and suggest that additional work with this technique should be continued to develop its potential clinical application.
Carbon isotope discrimination as a selection tool for high water use efficiency and high crop yields
International Nuclear Information System (INIS)
Kumarasinghe, K.S.; Kirda, C.; Bowen, G.D.; Zapata, F.; Awonaike, K.O.; Holmgren, E.; Arslan, A.; De Bisbal, E.C.; Mohamed, A.R.A.G.; Montenegro, A.
1996-01-01
Results of back-up research conducted at the FAO/IAEA Agriculture and Biotechnology Laboratory in support of the FAO/IAEA Co-ordinated Research Programme on the Use of Isotope Studies on Increasing and Stabilizing Plant Productivity in Low Phosphate and Semi-arid and Sub-humid Soils of the Tropics and Sub-tropics, are presented here. Neutron probe measurements confirmed the earlier reports of a strong correlation of Δ with grain yield and water use efficiency of wheat. High soil gypsum content and soil salinity, a wide spread problem in soils of arid and semi-arid climatic zones, do not interfere with the association of Δ with crop yields, provided plants are grown in similar soil water status and soil fertility level. Results of a glasshouse experiment using selected cowpea genotypes showed that Δ values measured at flowering stage positively correlated with total dry matter production and percent N 2 derived from atmosphere (%Ndfa), contributing to an earlier report from the laboratory that it may be possible to use Δ values for screening of leguminous crops for high N 2 fixation potential. 13 C isotope discrimination in the leaves of Gliricidia sepium was measured to examine if the technique could be extended to studies with trees. Results of a glasshouse experiment with 18 provenances of Gliricidia sepium showed highly significant correlations of Δ with total dry matter production, water use efficiency and total N accumulated through biological nitrogen fixation. Although the correlation of Δ with water use efficiency and dry matter yield are relatively clear and better understood, the correlation with nitrogen fixation still needs a closer examination under different environmental conditions and with different species. While 13 C isotope discrimination may be a valuable tool for identifying annual crops with high water use efficiency and high yield potential, it may be more attractive for tree species considering the long growth periods taken for trees
Successful Treatment of Canine Sporotrichosis with Terbinafine: Case Reports and Literature Review.
Viana, Paula Gonçalves; Figueiredo, Anna Barreto Fernandes; Gremião, Isabella Dib Ferreira; de Miranda, Luisa Helena Monteiro; da Silva Antonio, Isabela Maria; Boechat, Jéssica Sepulveda; de Sá Machado, Ana Caroline; de Oliveira, Manoel Marques Evangelista; Pereira, Sandro Antonio
2018-04-01
Sporotrichosis occurs worldwide, and the metropolitan region of Rio de Janeiro, Brazil, is a main endemic area, with a large number of human and animal cases in the last 19 years. This mycosis is more frequently described in cats rather than in dogs. There are a limited number of oral antifungal agents for the treatment of sporotrichosis in animals. In this context, the effectiveness of terbinafine in the treatment of sporotrichosis in humans, as well as the promising results of in vitro susceptibility tests, inspired us to use this drug in the therapy of this mycosis in dogs. We reported for the first time the use of terbinafine in the treatment of two dogs with sporotrichosis caused by Sporothrix brasiliensis. Moreover, we provided an overview of therapeutic features of canine sporotrichosis cases reported since the 1960s. One of the dogs presented the fixed cutaneous form of the disease, while the other patient presented hyperemia of the nasal mucosa and respiratory signs only. Terbinafine showed high antifungal activity in vitro against the canine Sporothrix isolates. The dogs were successfully treated with terbinafine, with remission of all clinical signs initially presented. The current reports indicate that this drug can emerge as a therapeutic option for canine sporotrichosis.
The effects of piroxicam and deracoxib on canine mammary tumour cell line.
Ustün Alkan, Fulya; Ustüner, Oya; Bakırel, Tülay; Cınar, Suzan; Erten, Gaye; Deniz, Günnur
2012-01-01
Cyclooxygenase (COX) inhibitors, already widely used for the treatment of pain and inflammation, are considered as promising compounds for the prevention and treatment of neoplasia. The aim of our study was to determine the direct antiproliferative effects of nonsteroidal anti-inflammatory drugs (NSAIDs), piroxicam and deracoxib, at a variety of concentrations as both single and combined treatments on canine mammary carcinoma cell line CMT-U27 and to understand the mechanisms of cell death. MTT assay was performed to determine cell viability, and flow cytometric analyses were performed to evaluate apoptosis and cell cycle alterations. Significant decrease in cell viability was observed at high concentrations of piroxicam and deracoxib in both single and combined treatments after 72 h incubation. Combined treatment produced a significantly greater inhibition than that caused by either agent alone. Also apoptotic cell number was increased by both drugs at the cytotoxic concentrations. However, concomitant treatment of cells with piroxicam and deracoxib resulted in significant induction of apoptosis at lower concentrations and accumulation of cells in the G₀/G₁ phase. Significant cytotoxic effects exhibited by the combination of piroxicam and deracoxib against canine mammary carcinoma cells in vitro suggest an attractive approach for the treatment of canine mammary carcinoma.
The Effects of Piroxicam and Deracoxib on Canine Mammary Tumour Cell Line
Directory of Open Access Journals (Sweden)
Fulya Üstün Alkan
2012-01-01
Full Text Available Cyclooxygenase (COX inhibitors, already widely used for the treatment of pain and inflammation, are considered as promising compounds for the prevention and treatment of neoplasia. The aim of our study was to determine the direct antiproliferative effects of nonsteroidal anti-inflammatory drugs (NSAIDs, piroxicam and deracoxib, at a variety of concentrations as both single and combined treatments on canine mammary carcinoma cell line CMT-U27 and to understand the mechanisms of cell death. MTT assay was performed to determine cell viability, and flow cytometric analyses were performed to evaluate apoptosis and cell cycle alterations. Significant decrease in cell viability was observed at high concentrations of piroxicam and deracoxib in both single and combined treatments after 72 h incubation. Combined treatment produced a significantly greater inhibition than that caused by either agent alone. Also apoptotic cell number was increased by both drugs at the cytotoxic concentrations. However, concomitant treatment of cells with piroxicam and deracoxib resulted in significant induction of apoptosis at lower concentrations and accumulation of cells in the G0/G1 phase. Significant cytotoxic effects exhibited by the combination of piroxicam and deracoxib against canine mammary carcinoma cells in vitro suggest an attractive approach for the treatment of canine mammary carcinoma.
High yield neutron generators using the DD reaction
Energy Technology Data Exchange (ETDEWEB)
Vainionpaa, J. H.; Harris, J. L.; Piestrup, M. A.; Gary, C. K.; Williams, D. L.; Apodaca, M. D.; Cremer, J. T. [Adelphi technology, 2003 E. Bayshore Rd. 94061, Redwood City, CA (United States); Ji, Qing; Ludewigt, B. A. [Lawrence Berkeley National Lab, 1 Cyclotron Road, Berkeley, CA 94720 (United States); Jones, G. [G and J Enterprise, 1258 Quary Ln, Suite F, Pleasanton California 94566 (United States)
2013-04-19
A product line of high yield neutron generators has been developed at Adelphi technology inc. The generators use the D-D fusion reaction and are driven by an ion beam supplied by a microwave ion source. Yields of up to 5 Multiplication-Sign 10{sup 9} n/s have been achieved, which are comparable to those obtained using the more efficient D-T reaction. The microwave-driven plasma uses the electron cyclotron resonance (ECR) to produce a high plasma density for high current and high atomic ion species. These generators have an actively pumped vacuum system that allows operation at reduced pressure in the target chamber, increasing the overall system reliability. Since no radioactive tritium is used, the generators can be easily serviced, and components can be easily replaced, providing essentially an unlimited lifetime. Fast neutron source size can be adjusted by selecting the aperture and target geometries according to customer specifications. Pulsed and continuous operation has been demonstrated. Minimum pulse lengths of 50 {mu}s have been achieved. Since the generators are easily serviceable, they offer a long lifetime neutron generator for laboratories and commercial systems requiring continuous operation. Several of the generators have been enclosed in radiation shielding/moderator structures designed for customer specifications. These generators have been proven to be useful for prompt gamma neutron activation analysis (PGNAA), neutron activation analysis (NAA) and fast neutron radiography. Thus these generators make excellent fast, epithermal and thermal neutron sources for laboratories and industrial applications that require neutrons with safe operation, small footprint, low cost and small regulatory burden.
Cavalli, Alessandra; Desario, Costantina; Kusi, Ilir; Mari, Viviana; Lorusso, Eleonora; Cirone, Francesco; Kumbe, Ilirjan; Colaianni, Maria Loredana; Buonavoglia, Domenico; Decaro, Nicola
2014-07-01
An epidemiological survey for Canine parvovirus 2 (CPV-2) and Canine coronavirus (CCoV) was conducted in Albania. A total of 57 fecal samples were collected from diarrheic dogs in the District of Tirana during 2011-2013. The molecular assays detected 53 and 31 CPV- and CCoV-positive specimens, respectively, with mixed CPV-CCoV infections diagnosed in 28 dogs. The most frequently detected CPV type was 2a, whereas IIa was the predominant CCoV subtype. A better comprehension of the CPV-CCoV epidemiology in eastern European countries will help to assess the most appropriate vaccination strategies to prevent disease due to infections with these widespread agents of acute gastroenteritis in the dog.
Optimization of components in high-yield synthesis of block copolymer-mediated gold nanoparticles
International Nuclear Information System (INIS)
Ray, Debes; Aswal, Vinod Kumar
2012-01-01
The optimization to achieve stable and high-yield gold nanoparticles in block copolymer-mediated synthesis has been examined. Gold nanoparticles are synthesized using block copolymer P85 in gold salt HAuCl 4 ·3H 2 O solution. This method usually has a very limited yield which does not simply increase with the increase in the gold salt concentration. We show that the yield can be enhanced by increasing the block copolymer concentration but is limited to the factor by which the concentration is increased. On the other hand, the presence of an additional reductant (trisodium citrate) in 1:1 molar ratio with gold salt enhances the yield by manyfold. In this case (with additional reductant), the stable and high-yield nanoparticles having size about 14 nm can be synthesized at very low block copolymer concentrations. These nanoparticles thus can be efficiently used for their application such as for adsorption of proteins.
CANINE DISTEMPER IN A VACCINATED SNOW LEOPARD ( PANTHERA UNCIA).
Chinnadurai, Sathya K; Kinsel, Michael J; Adkesson, Michael J; Terio, Karen
2017-12-01
A 6-yr-old male snow leopard ( Panthera uncia) presented with acute seizures, hyperthermia, and tachypnea. Because of a diagnosis of anuric renal failure, the animal was euthanized. On histopathologic examination, numerous intralesional intracytoplasmic and intranuclear inclusions were found in the lungs, lymph nodes, and stomach. Positive immunohistochemical staining for canine distemper virus (CDV) was found in the lungs and, to a lesser extent, in the lymph nodes and brain. Molecular testing yielded a CDV H gene sequence that was closely related to CDV isolates concurrently found in wild raccoons from adjacent forested areas. The leopard had been vaccinated once against CDV with the use of a recombinant canarypox-vectored live vaccine during a routine wellness examination 12 wk prior to death. Serial serum neutralization titers performed on banked serum collected between vaccination and death showed poor serologic response to the vaccine. This case demonstrates a probable failure of protection against naturally occurring CDV.
Intra- and interspecies gene expression models for predicting drug response in canine osteosarcoma.
Fowles, Jared S; Brown, Kristen C; Hess, Ann M; Duval, Dawn L; Gustafson, Daniel L
2016-02-19
Genomics-based predictors of drug response have the potential to improve outcomes associated with cancer therapy. Osteosarcoma (OS), the most common primary bone cancer in dogs, is commonly treated with adjuvant doxorubicin or carboplatin following amputation of the affected limb. We evaluated the use of gene-expression based models built in an intra- or interspecies manner to predict chemosensitivity and treatment outcome in canine OS. Models were built and evaluated using microarray gene expression and drug sensitivity data from human and canine cancer cell lines, and canine OS tumor datasets. The "COXEN" method was utilized to filter gene signatures between human and dog datasets based on strong co-expression patterns. Models were built using linear discriminant analysis via the misclassification penalized posterior algorithm. The best doxorubicin model involved genes identified in human lines that were co-expressed and trained on canine OS tumor data, which accurately predicted clinical outcome in 73 % of dogs (p = 0.0262, binomial). The best carboplatin model utilized canine lines for gene identification and model training, with canine OS tumor data for co-expression. Dogs whose treatment matched our predictions had significantly better clinical outcomes than those that didn't (p = 0.0006, Log Rank), and this predictor significantly associated with longer disease free intervals in a Cox multivariate analysis (hazard ratio = 0.3102, p = 0.0124). Our data show that intra- and interspecies gene expression models can successfully predict response in canine OS, which may improve outcome in dogs and serve as pre-clinical validation for similar methods in human cancer research.
Functional Characterization of Canine Interferon-Lambda
Fan, Wenhui; Xu, Lei; Ren, Liqian; Qu, Hongren; Li, Jing; Liang, Jingjing; Liu, Wenjun
2014-01-01
In this study, we provide the first comprehensive annotation of canine interferon-λ (CaIFN-λ, type III IFN). Phylogenetic analysis based on genomic sequences indicated that CaIFN-λ is located in the same branch with Swine IFN-λ1 (SwIFN-λ), Bat IFN-λ1 (BaIFN-λ), and human IFN-λ1 (HuIFN-λ1). CaIFN-λ was cloned, expressed in Escherichia coli, and purified to further investigate the biological activity in vitro. The recombinant CaIFN-λ (rCaIFN-λ) displayed potent antiviral activity on both homologous and heterologous animal cells in terms of inhibiting the replication of the New Jersey serotype of vesicular stomatitis virus (VSV), canine parvovirus, and influenza virus A/WSN/33 (H1N1), respectively. In addition, we also found that rCaIFN-λ exhibits a significant antiproliferative response against A72 canine tumor cells and MDCK cells in a dose-dependent manner. Furthermore, CaIFN-λ activated the JAK-STAT signaling pathway. To evaluate the expression of CaIFN-λ induced by virus and the expression of IFN-stimulated genes (ISGs) induced by rCaIFN-λ in the MDCK cells, we measured the relative mRNA level of CaIFN-λ and ISGs (ISG15, Mx1, and 2′5′-OAS) by quantitative real-time PCR and found that the mRNA level of CaIFN-λ and the ISGs significantly increased after treating the MDCK cells with viruses and rCaIFN-λ protein, respectively. Finally, to evaluate the binding activity of rCaIFN-λ to its receptor, we expressed the extracellular domain of the canine IFN-λ receptor 1 (CaIFN-λR1-EC) and determined the binding activity via ELISA. Our results demonstrated that rCaIFN-λ bound tightly to recombinant CaIFN-λR1-EC (rCaIFN-λR1-EC). PMID:24950142
High-resolution, regional-scale crop yield simulations for the Southwestern United States
Stack, D. H.; Kafatos, M.; Medvigy, D.; El-Askary, H. M.; Hatzopoulos, N.; Kim, J.; Kim, S.; Prasad, A. K.; Tremback, C.; Walko, R. L.; Asrar, G. R.
2012-12-01
Over the past few decades, there have been many process-based crop models developed with the goal of better understanding the impacts of climate, soils, and management decisions on crop yields. These models simulate the growth and development of crops in response to environmental drivers. Traditionally, process-based crop models have been run at the individual farm level for yield optimization and management scenario testing. Few previous studies have used these models over broader geographic regions, largely due to the lack of gridded high-resolution meteorological and soil datasets required as inputs for these data intensive process-based models. In particular, assessment of regional-scale yield variability due to climate change requires high-resolution, regional-scale, climate projections, and such projections have been unavailable until recently. The goal of this study was to create a framework for extending the Agricultural Production Systems sIMulator (APSIM) crop model for use at regional scales and analyze spatial and temporal yield changes in the Southwestern United States (CA, AZ, and NV). Using the scripting language Python, an automated pipeline was developed to link Regional Climate Model (RCM) output with the APSIM crop model, thus creating a one-way nested modeling framework. This framework was used to combine climate, soil, land use, and agricultural management datasets in order to better understand the relationship between climate variability and crop yield at the regional-scale. Three different RCMs were used to drive APSIM: OLAM, RAMS, and WRF. Preliminary results suggest that, depending on the model inputs, there is some variability between simulated RCM driven maize yields and historical yields obtained from the United States Department of Agriculture (USDA). Furthermore, these simulations showed strong non-linear correlations between yield and meteorological drivers, with critical threshold values for some of the inputs (e.g. minimum and
A novel method for objective vision testing in canine models of inherited retinal disease.
Gearhart, Patricia M; Gearhart, Chris C; Petersen-Jones, Simon M
2008-08-01
The use of canine models of retinal disease in the development of therapeutic strategies for inherited retinal disorders is a growing area of research. To evaluate accurately the success of potential vision-enhancing treatments, reliable methods for objectively assessing visual function in canine models is necessary. A simple vision-testing device was constructed that consisted of a junction box with four exit tunnels. Dogs were placed in the junction box and given one vision-based choice for exit. The first-choice tunnel and time to exit were recorded and analyzed. Two canine models of retinal disease with distinct molecular defects, a null mutation in the gene encoding the alpha subunit of rod cyclic GMP phosphodiesterase (PDE6A), and a null mutation in the gene encoding a retinal pigment epithelium-specific protein (RPE65) were tested and compared to those in unaffected dogs. With the use of bright light versus dim red light, the test differentiated between unaffected dogs and dogs affected with either mutation with a high degree of certainty. The white-light intensity series showed a significantly different performance between the unaffected and affected dogs. A significant difference in performance was detected between the dogs with each mutation. The results indicate that this novel canine vision-testing method is an accurate and sensitive means of distinguishing between unaffected dogs and dogs affected with two different forms of inherited retinal disease and should be useful as a means of assessing response to therapy in future studies.
Maxillary canine impactions related to impacted central incisors: two case reports.
Bayram, Mehmet; Ozer, Mete; Sener, Ismail
2007-09-01
The purpose of this case report is to describe the combined surgical and orthodontic treatment of two cases with an impacted maxillary central incisor and canine in the same quadrant and to discuss the causal relationship between them. The most common causes of canine impactions are usually the result of one or more factors such as a long path of eruption, tooth size-arch length discrepancies, abnormal position of the tooth bud, prolonged retention or early loss of the deciduous canine, trauma, the presence of an alveolar cleft, ankylosis, cystic or neoplastic formation, dilaceration of the root, supernumerary teeth, and odontomas. Although impaction of the maxillary central incisor is almost as prevalent as impacted canines its etiology is different. The principal factors involved in causing the anomaly are supernumerary teeth, odontomas, and trauma. Case #1: A 10.5-year-old girl in the early mixed dentition stage presented with a chief complaint of the appearance of her anterior teeth. She had a Class I skeletal pattern and a history of trauma to the maxillary central incisors at age five with premature exfoliation. Radiographs revealed an impacted upper right central incisor in the region of the nasal floor, delayed eruption of the maxillary permanent central incisor, and the adjacent lateral incisor was inclined toward the edentulous space. Treatment was done in two stages consisting of surgical exposure and traction of the impacted central incisor and fixed orthodontic treatment. Case #2: An 11.5-year-old girl presented for orthodontic treatment with the chief complaint of an unerupted tooth and the appearance of her upper anterior teeth. She was in the late mixed dentition period with a Class III skeletal pattern along with an anterior cross-bite with some maxillary transverse deficiency. The maxillary right canine and central incisor were absent, but the maxillary right deciduous canine was still present. Treatment included arch expansion followed by
Canine distemper virus DNA vaccination of mink can overcome interference by maternal antibodies
DEFF Research Database (Denmark)
Jensen, Trine Hammer; Nielsen, Line; Aasted, Bent
2015-01-01
Canine distemper virus (CDV) is highly contagious and can cause severe disease against which conventional live vaccines are ineffective in the presence of maternal antibodies. Vaccination in the presences of maternal antibodies was challenged by vaccination of 5 days old and 3 weeks old mink kits...
Ultra-broadband nonlinear saturable absorption of high-yield MoS2 nanosheets
Wei, Rongfei; Zhang, Hang; Hu, Zhongliang; Qiao, Tian; He, Xin; Guo, Qiangbing; Tian, Xiangling; Chen, Zhi; Qiu, Jianrong
2016-07-01
High-yield MoS2 nanosheets with strong nonlinear optical (NLO) responses in a broad near-infrared range were synthesized by a facile hydrothermal method. The observation of saturable absorption, which was excited by the light with photon energy smaller than the gap energy of MoS2, can be attributed to the enhancement of the hybridization between the Mo d-orbital and S p-orbital by the oxygen incorporation into MoS2. High-yield MoS2 nanosheets with high modulation depth and large saturable intensity generated a stable, passively Q-switched fiber laser pulse at 1.56 μm. The high output power of 1.08 mW can be attained under a very low pump power of 30.87 mW. Compared to recently reported passively Q-switched fiber lasers utilizing exfoliated MoS2 nanosheets, the efficiency of the laser for our passive Q-switching operation is larger and reaches 3.50%. This research may extend the understanding on the NLO properties of MoS2 and indicate the feasibility of the high-yield MoS2 nanosheets to passively Q-switched fiber laser effectively at low pump strengths.
Orthodontic treatment of a stubborn palatally ectopic canine: a case report.
Al-Musfir, Tumadher M; Morris, David O
2014-03-01
This is a case report that highlights a different treatment approach in dealing with palatally ectopic canines. The modified transpalatal arch with an 'active' arm was used to align a palatally ectopic canine with 'push' mechanics after the initial use of more conventional 'pull' mechanics (piggy-back archwire technique) had failed.
Successful experimental challenge of dogs with canine parvovirus-2.
Carman, S; Povey, C
1982-01-01
Withholding food from dogs for 24 hours prior to, and for 48 hours following oral challenge with a gut mucosal homogenate of canine parvovirus-2, was a successful means of reproducing gastroenteric signs of canine parvovirus-2 infection. Twenty-one of 24 dogs, which had previously received various vaccine preparations of mink enteritis virus or were unvaccinated, and which were starved at challenge, developed soft or liquid feces with large or without large clots of mucus. Altered feces were ...
Energy Technology Data Exchange (ETDEWEB)
Kettle, Peter-Raymond, E-mail: peter-raymond.kettle@psi.ch [Paul Scherrer Institut PSI, Laboratory for Particle Physics (Switzerland)
2013-03-15
The muon as a laboratory for studying charged lepton-flavour violation (cLFV) has proven to be one of the most sensitive areas to probe for 'New Physics', due to the muon's copious production rate and relatively long lifetime. The search at the intensity frontier with precision-type experiments is complementary to the search for new particles at the high-energy frontier of TeV colliders. Of the three 'golden' muon channels: {mu} {yields} e{gamma}, {mu} {yields} 3e and {mu} {yields} econversion, an overview of the status of the coincidence experiments MEG, together with the latest results, which constitute the most stringent limit to date on this decay and the recently initiated Mu3e experiment, will be given.
Zhai, Lin; Qiu, Lan-Yan; Zu, Yuan; Yan, Yan; Ren, Xiao-Zhuan; Zhao, Jun-Feng; Liu, Yu-Jiang; Liu, Ji-Bin; Qian, Lin-Xue
2015-04-21
To explore the feasibility of non-invasive quantitative estimation of portal venous pressure by contrast-enhanced ultrasound (CEUS) in a canine model. Liver fibrosis was established in adult canines (Beagles; n = 14) by subcutaneous injection of carbon tetrachloride (CCl4). CEUS parameters, including the area under the time-intensity curve and intensity at portal/arterial phases (Qp/Qa and Ip/Ia, respectively), were used to quantitatively assess the blood flow ratio of the portal vein/hepatic artery at multiple time points. The free portal venous pressures (FPP) were measured by a multi-channel baroreceptor using a percutaneous approach at baseline and 8, 16, and 24 wk after CCl4 injections in each canine. Liver biopsies were obtained at the end of 8, 16, and 24 wk from each animal, and the stage of the fibrosis was assessed according to the Metavir scoring system. A Pearson correlation test was performed to compare the FPP with Qp/Qa and Ip/Ia. Pathologic examination of 42 biopsies from the 14 canines at weeks 8, 16, and 24 revealed that liver fibrosis was induced by CCl4 and represented various stages of liver fibrosis, including F0 (n = 3), F1 (n = 12), F2 (n = 14), F3 (n = 11), and F4 (n = 2). There were significant differences in the measurements of Qp/Qa (19.85 ± 3.30 vs 10.43 ± 1.21, 9.63 ± 1.03, and 8.77 ± 0.96) and Ip/Ia (1.77 ± 0.37 vs 1.03 ± 0.12, 0.83 ± 0.10, and 0.69 ± 0.13) between control and canine fibrosis at 8, 16, and 24 wk, respectively (all P fibrosis model. Prediction of elevated FPP based on Qp/Qa and Ip/Ia was highly sensitive, as assessed by the area under the receiver operating curve (0.866 and 0.895, respectively). CEUS is a potential method to accurately, but non-invasively, estimate portal venous pressure through measurement of Qp/Qa and Ip/Ia parameters.
Adina Coșarcă; Mariana Păcurar; Cecilia Petrovan; Alina Ormenișan
2014-01-01
Aim: The aim of this study was to compare the periodontal status of impacted canines after 5 years following completion of the combined surgical and orthodontic treatment. Materials and methods: We examined 20 labially impacted canines and 20 palatally impacted canines at 5 years after the end of treatment. We assessed the periodontal status of these teeth. Results: Different outcomes were found regarding the probing depth and the amount of keratinized gingiva in the two mentioned groups of t...
Sandwich-dot enzyme-linked immunosorbent assay for the detection of canine distemper virus
Li, Zhi; Zhang, Yanlong; Wang, Huiguo; Jin, Jinhua; Li, Wenzhe
2013-01-01
A sandwich-dot enzyme-linked immunosorbent assay (dot ELISA) was developed for the detection of canine distemper virus (CDV). In 56 dogs suspected to have CD the rates of detection of CDV antigen in samples of blood lymphocytes and palpebral conjunctiva by dot ELISA and ELISA were, respectively, 91% (49/54) and 81% (44/54) for the lymphocyte samples and 88% (28/32) and 75% (24/32) for the conjunctival samples. The CDV detection limits were 10 ng/50 μL for dot ELISA and 40 ng/50 μL for ELISA. The reliability of dot ELISA relative to electron microscopy was 96% with 22 samples: all 21 samples in which CDV particles were observed by electron microscopy yielded positive results with dot ELISA; the single sample in which particles were not observed yielded false-positive results with dot ELISA. The results indicate that the dot ELISA developed can serve as a reliable rapid diagnostic test in suspected cases of CD and also be useful for epidemiologic surveillance of the disease. PMID:24124274
Bilateral Second Premolars Agenesia Together with a Unilateral Canine Radiculomegaly.
Kemoli, Arthur Musakulu; Junior, Thomas Munyao
2017-01-01
Congenitally missing teeth is a common feature for the third molars. However, missing teeth, macrodontia and radiculomegaly occurring in a single patient is very rare. This article describes a case of agenesis of mandibular second premolars, radiculomegaly with dilacerations of a canine tooth together with elongated roots of other canines. All these features had been discerned through diagnostic radiographs taken during a routine treatment planning.
Genetic Mapping of Novel Loci Affecting Canine Blood Phenotypes.
Directory of Open Access Journals (Sweden)
Michelle E White
Full Text Available Since the publication of the dog genome and the construction of high-quality genome-wide SNP arrays, thousands of dogs have been genotyped for disease studies. For many of these dogs, additional clinical phenotypes are available, such as hematological and clinical chemistry results collected during routine veterinary care. Little is known about the genetic basis of variation in blood phenotypes, but this variation may play an important role in the etiology and progression of many diseases. From a cohort of dogs that had been previously genotyped on a semi-custom Illumina CanineHD array for various genome-wide association studies (GWAS at Cornell University Hospital for Animals, we chose 353 clinically healthy, adult dogs for our analysis of clinical pathologic test results (14 hematological tests and 25 clinical chemistry tests. After correcting for age, body weight and sex, genetic associations were identified for amylase, segmented neutrophils, urea nitrogen, glucose, and mean corpuscular hemoglobin. Additionally, a strong genetic association (P = 8.1×10-13 was evident between a region of canine chromosome 13 (CFA13 and alanine aminotransferase (ALT, explaining 23% of the variation in ALT levels. This region of CFA13 encompasses the GPT gene that encodes the transferase. Dogs homozygous for the derived allele exhibit lower ALT activity, making increased ALT activity a less useful marker of hepatic injury in these individuals. Overall, these associations provide a roadmap for identifying causal variants that could improve interpretation of clinical blood tests and understanding of genetic risk factors associated with diseases such as canine diabetes and anemia, and demonstrate the utility of holistic phenotyping of dogs genotyped for disease mapping studies.
Genetic Mapping of Novel Loci Affecting Canine Blood Phenotypes.
White, Michelle E; Hayward, Jessica J; Stokol, Tracy; Boyko, Adam R
2015-01-01
Since the publication of the dog genome and the construction of high-quality genome-wide SNP arrays, thousands of dogs have been genotyped for disease studies. For many of these dogs, additional clinical phenotypes are available, such as hematological and clinical chemistry results collected during routine veterinary care. Little is known about the genetic basis of variation in blood phenotypes, but this variation may play an important role in the etiology and progression of many diseases. From a cohort of dogs that had been previously genotyped on a semi-custom Illumina CanineHD array for various genome-wide association studies (GWAS) at Cornell University Hospital for Animals, we chose 353 clinically healthy, adult dogs for our analysis of clinical pathologic test results (14 hematological tests and 25 clinical chemistry tests). After correcting for age, body weight and sex, genetic associations were identified for amylase, segmented neutrophils, urea nitrogen, glucose, and mean corpuscular hemoglobin. Additionally, a strong genetic association (P = 8.1×10-13) was evident between a region of canine chromosome 13 (CFA13) and alanine aminotransferase (ALT), explaining 23% of the variation in ALT levels. This region of CFA13 encompasses the GPT gene that encodes the transferase. Dogs homozygous for the derived allele exhibit lower ALT activity, making increased ALT activity a less useful marker of hepatic injury in these individuals. Overall, these associations provide a roadmap for identifying causal variants that could improve interpretation of clinical blood tests and understanding of genetic risk factors associated with diseases such as canine diabetes and anemia, and demonstrate the utility of holistic phenotyping of dogs genotyped for disease mapping studies.
Recent advances in canine leptospirosis: focus on vaccine development
Directory of Open Access Journals (Sweden)
Klaasen HLBM
2015-06-01
Full Text Available Henricus LBM (Eric Klaasen,1 Ben Adler2 1Global Companion Animals Research and Development, Merck Sharp and Dohme Animal Health, Boxmeer, the Netherlands; 2Department of Microbiology, Monash University, Clayton, VIC, Australia Abstract: Leptospirosis is a global infection of humans and animals caused by pathogenic Leptospira spp. Leptospirosis is a major zoonosis, with infection acquired from wild and domestic animals. It is also a significant cause of morbidity, mortality, and economic loss in production and companion animals. Leptospirosis in dogs is prevalent worldwide and as well as a cause of canine disease, it presents a zoonotic risk to human contacts. Canine leptospirosis does not differ greatly from the syndromes seen in other animal species, with hepatic, renal, and pulmonary involvement being the main manifestations. While the pathogenesis of disease is well documented at the whole animal level, the cellular and molecular basis remains obscure. Killed, whole-cell bacterin vaccines are licensed worldwide and have not changed greatly over the past several decades. Vaccine-induced immunity is restricted to serologically related serovars and is generally short-lived, necessitating annual revaccination. The appearance of new serovars as causes of canine leptospirosis requires constant epidemiological surveillance and tailoring of vaccines to cover emerging serovars. At the present time, there is no realistic prospect of alternative, non-bacterin vaccines in the foreseeable future. Keywords: canine leptospirosis, vaccines, diagnosis, epidemiology, pathogenesis
Pinheiro, A O; Cardoso, M T; Vidane, A S; Casals, J B; Passarelli, D; Alencar, A L F; Sousa, R L M; Fantinato-Neto, P; Oliveira, V C; Lara, V M; Ambrósio, C E
2016-05-23
Distemper disease is an infectious disease reported in several species of domestic and wild carnivores. The high mortality rate of animals infected with canine distemper virus (CDV) treated with currently available therapies has driven the study of new efficacious treatments. Mesenchymal stem cell (MSC)-based therapy is a promising therapeutic option for many degenerative, hereditary, and inflammatory diseases. Therefore, the aim of this study was to characterize stem cells derived from the canine fetal olfactory epithelium and to assess the systemic response of animals infected with CDV to symptomatic therapy and treatment with MSCs. Eight domestic mongrel dogs (N = 8) were divided into two groups: support group (SG) (N = 5) and support group + cell therapy (SGCT) (N = 3), which were monitored over 15 days. Blood samples were collected on days 0, 6, 9, 12, and 15 to assess blood count and serum biochemistry (urea, creatinine, alanine transferase, alkaline phosphatase, gamma-glutamyl transferase, total protein, albumin, and globulin), and urine samples were obtained on days 0 and 15 for urinary evaluation (urine I). The results showed a high mortality rate (SG = 4 and SGCT = 2), providing inadequate data on the clinical course of CDV infection. MSC therapy resulted in no significant improvement when administered during the acute phase of canine distemper disease, and a prevalence of animals with high mortality rate was found in both groups due to the severity of symptoms.
Efficacy of feline anti-parvovirus antibodies in the treatment of canine parvovirus infection.
Gerlach, M; Proksch, A L; Unterer, S; Speck, S; Truyen, U; Hartmann, K
2017-07-01
This prospective, randomised, placebo-controlled, double-blinded study aimed to evaluate efficacy of commercially available feline anti-parvovirus antibodies in dogs with canine parvovirus infection. First, cross-protection of feline panleukopenia virus antibodies against canine parvovirus was evaluated in vitro. In the subsequent prospective clinical trial, 31 dogs with clinical signs of canine parvovirus infection and a positive faecal canine parvovirus polymerase chain reaction were randomly assigned to a group receiving feline panleukopenia virus antibodies (n=15) or placebo (n=16). All dogs received additional routine treatment. Clinical signs, blood parameters, time to clinical recovery and mortality were compared between the groups. Serum antibody titres and quantitative faecal polymerase chain reaction were compared on days 0, 3, 7, and 14. In vitro, canine parvovirus was fully neutralised by feline panleukopenia virus antibodies. There were no detected significant differences in clinical signs, time to clinical recovery, blood parameters, mortality, faecal virus load, or viral shedding between groups. Dogs in the placebo group showed a significant increase of serum antibody titres and a significant decrease of faecal virus load between day 14 and day 0, which was not detectable in dogs treated with feline panleukopenia virus antibodies. No significant beneficial effect of passively transferred feline anti-parvovirus antibodies in the used dosage regimen on the treatment of canine parvovirus infection was demonstrated. © 2017 British Small Animal Veterinary Association.
Impacted canines: Etiology, diagnosis, and orthodontic management
Directory of Open Access Journals (Sweden)
Ranjit Manne
2012-01-01
Full Text Available Impaction of maxillary and mandibular canines is a frequently encountered clinical problem, the treatment of which usually requires an interdisciplinary approach. Surgical exposure of the impacted tooth and the complex orthodontic mechanisms that are applied to align the tooth into the arch may lead to varying amounts of damage to the supporting structures of the tooth, not to mention the long treatment duration and the financial burden to the patient. Hence, it seems worthwhile to focus on the means of early diagnosis and interception of this clinical situation. In the present article, an overview of the incidence and sequelae, as well as the surgical, periodontal, and orthodontic considerations in the management of impacted canines is presented.
Leigh, S R; Jungers, W L
1994-12-01
A recent study suggests that differing populations of woolly spider monkeys exhibit a substantial degree of morphological, cytogenetic, and behavioral variation. We re-evaluate the differences between populations in the degree of canine tooth height sexual dimorphism and in the frequency of thumbs. Statistical analysis of variation in the degree of canine sexual dimorphism between these populations fails to provide strong evidence for subspecific variation: differences in the degree of canine dimorphism cannot be considered statistically significant. Differences between populations in the frequency of thumbs are, however, statistically significant. The lack of clear distinctions between populations in the degree of canine dimorphism complicates assessments of behavioral variation between these populations. We suggest that the level of geographic variation in woolly spider monkey canine dimorphism is not consistent with subspecific status.
High prevalence of small Babesia species in canines of Kerala, South India.
Jain, Kollannur Jose; Lakshmanan, Bindu; Syamala, Karunakaran; Praveena, Jose E; Aravindakshan, Thazhathuveetil
2017-11-01
Canine babesiosis is an important vector-borne hemoparasitic disease caused by Babesia canis vogeli and Babesia gibsoni , in India. The communication places on record the salient findings of the study directed to detect and characterize the pathogenic B. gibsoni isolates of Kerala state. A total of 150 dogs were examined for the presence of hemoparasites by light microscopy as well as by PCR targeting the 18S rRNA gene of B. gibsoni . Hematological parameters were also analysed. Phylogenetic tree was constructed based on Tamura kei model adopting ML method. A sensitive and specific polymerase chain reaction assay was developed with newly designed primer pair BAGI-F/BAGI-R for the amplification of 488 bp fragment of 18S rRNA gene of B. gibsoni . Out of the 150 dogs examined, molecular evidence of B. gibsoni was recorded in 47.3% animals, while light microscopy detected the infection in 26.67% cases. The phylogenetic analyses revealed that B. gibsoni , Kerala, isolate was closest and occurred together with Bareilly isolate. Anemia and thrombocytopenia were the significant hematological alterations in chronic B. gibsoni infection. A high prevalence of natural infection of B. gibsoni was detected among the study population. The affected animals showed anaemia and thrombocytopenia. Phylogenetic analysis of this pathogenic isolate from south India revealed the closest similarity with Bareilly isolates.
High prevalence of small Babesia species in canines of Kerala, South India
Directory of Open Access Journals (Sweden)
Kollannur Jose Jain
2017-11-01
Full Text Available Aim: Canine babesiosis is an important vector-borne hemoparasitic disease caused by Babesia canis vogeli and Babesia gibsoni, in India. The communication places on record the salient findings of the study directed to detect and characterize the pathogenic B. gibsoni isolates of Kerala state. Materials and Methods: A total of 150 dogs were examined for the presence of hemoparasites by light microscopy as well as by PCR targeting the 18S rRNA gene of B. gibsoni. Hematological parameters were also analysed. Phylogenetic tree was constructed based on Tamura kei model adopting ML method. Results: A sensitive and specific polymerase chain reaction assay was developed with newly designed primer pair BAGI-F/ BAGI-R for the amplification of 488 bp fragment of 18S rRNA gene of B. gibsoni. Out of the 150 dogs examined, molecular evidence of B. gibsoni was recorded in 47.3% animals, while light microscopy detected the infection in 26.67% cases. The phylogenetic analyses revealed that B. gibsoni, Kerala, isolate was closest and occurred together with Bareilly isolate. Anemia and thrombocytopenia were the significant hematological alterations in chronic B. gibsoni infection. Conclusion: A high prevalence of natural infection of B. gibsoni was detected among the study population. The affected animals showed anaemia and thrombocytopenia. Phylogenetic analysis of this pathogenic isolate from south India revealed the closest similarity with Bareilly isolates.
Cost-effectiveness of canine vaccination to prevent human rabies in rural Tanzania.
Fitzpatrick, Meagan C; Hampson, Katie; Cleaveland, Sarah; Mzimbiri, Imam; Lankester, Felix; Lembo, Tiziana; Meyers, Lauren A; Paltiel, A David; Galvani, Alison P
2014-01-21
The annual mortality rate of human rabies in rural Africa is 3.6 deaths per 100 000 persons. Rabies can be prevented with prompt postexposure prophylaxis, but this is costly and often inaccessible in rural Africa. Because 99% of human exposures occur through rabid dogs, canine vaccination also prevents transmission of rabies to humans. To evaluate the cost-effectiveness of rabies control through annual canine vaccination campaigns in rural sub-Saharan Africa. We model transmission dynamics in dogs and wildlife and assess empirical uncertainty in the biological variables to make probability-based evaluations of cost-effectiveness. Epidemiologic variables from a contact-tracing study and literature and cost data from ongoing vaccination campaigns. Two districts of rural Tanzania: Ngorongoro and Serengeti. 10 years. Health policymaker. Vaccination coverage ranging from 0% to 95% in increments of 5%. Life-years for health outcomes and 2010 U.S. dollars for economic outcomes. Annual canine vaccination campaigns were very cost-effective in both districts compared with no canine vaccination. In Serengeti, annual campaigns with as much as 70% coverage were cost-saving. Across a wide range of variable assumptions and levels of societal willingness to pay for life-years, the optimal vaccination coverage for Serengeti was 70%. In Ngorongoro, although optimal coverage depended on willingness to pay, vaccination campaigns were always cost-effective and lifesaving and therefore preferred. Canine vaccination was very cost-effective in both districts, but there was greater uncertainty about the optimal coverage in Ngorongoro. Annual canine rabies vaccination campaigns conferred extraordinary value and dramatically reduced the health burden of rabies. National Institutes of Health.
Wilkes, Rebecca P; Tsai, Yun-Long; Lee, Pei-Yu; Lee, Fu-Chun; Chang, Hsiao-Fen Grace; Wang, Hwa-Tang Thomas
2014-09-09
Canine distemper virus (CDV) has been associated with outbreaks of canine infectious respiratory disease in shelters and boarding kennel environments. POCKITTM Nucleic Acid Analyzer is a field-deployable device capable of generating automatically interpreted insulated isothermal polymerase chain reaction (iiPCR) results from extracted nucleic acid within one hour. In this study, reverse transcription iiPCR (RT-iiPCR) was developed to facilitate point-of-need diagnosis of CDV infection. Analytical sensitivity (limit of detection 95%) of the established CDV RT-iiPCR was about 11 copies of in vitro transcribed RNA per reaction. CDV RT-iiPCR generated positive signals from CDV, but not Bordetella bronchiseptica, canine parvovirus, canine herpesvirus, canine adenovirus 2, canine influenza virus (subtype H3N8), canine parainfluenza virus, and canine respiratory coronavirus. To evaluate accuracy of the established reaction in canine distemper clinical diagnosis, 110 specimens from dogs, raccoons, and foxes suspected with CDV infection were tested simultaneously by CDV RT-iiPCR and real-time RT-PCR. CDV RT-iiPCR demonstrated excellent sensitivity (100%) and specificity (100%), compared to real-time RT-PCR. The results indicated an excellent correlation between RT-iiPCR and a reference real time RT-PCR method. Working in a lyophilized format, the established method has great potential to be used for point-of-care diagnosis of canine distemper in animals, especially in resource-limited facilities.
Lorenzoni, Diego Coelho; Janson, Guilherme; Bastos, Juliana Cunha; Carvalho, Roberta Martinelli; Bastos, José Carlos; de Cássia Moura Carvalho Lauris, Rita; Henriques, José Fernando Castanha; Ozawa, Terumi Okada
2017-01-01
Evaluate the results of secondary alveolar bone grafting (SABG) in patients with complete unilateral cleft lip and palate (UCLP), operated after permanent canine eruption (CE). Seventy-four periapical radiographs from patients with complete UCLP (mean age 14 years) submitted to SABG were retrospectively analyzed for the amount of bone in the cleft site through the Bergland and Chelsea scales. Of the cases, 47.3 % was classified as Bergland type I and Chelsea type A, 35.2 % as type II/C, 6.7 % as type III/D, and 10.8 % as type IV/failure. When the canine was moved into the grafted area, the success rate (type I/A) was 56.8 %; for cases in which the space was maintained for an implant or prosthetic finishing, the index was 45.8 %; however, this difference was not statistically significant. Even in advanced ages, after permanent canine eruption, SABG can be considered a highly successful procedure. This research shows good results of secondary alveolar bone grafting performed in patients with unilateral complete cleft lip and palate, even when it was performed after eruption of the permanent canine in the cleft area.
International Nuclear Information System (INIS)
Xie Jian; Li Minghua; Tan Huaqiao; Zhu Yueqi; Hu Dingjun; Qiao Ruihua; Fan Chunhua
2009-01-01
Objective: The aim of the experiment is to make an intracranial aneurysm model in canine. Methods: A digital tube was made based on raw magnetic resonance images of the human intracranial carotid artery. Then 6 tubes were made in the 3D rapid prototyping machine and coated with silicone. Finally we isolated the common carotid arteries of 6 canines and made them go through the tubes and anastomosed them end-to-side to get the aneurysm model. Six stents were implanted after one week. Results: Six aneurysm models were successfully made in canines. The parent artery had similar geometry of the human carotid siphon. All the aneurysms and parent arteries were patent in one week's follow-up. One canine died of excessive anesthesia after stenting. Two vascular models kept patent in one month without stenosis. The other 3 had some stenosis on the bends of the vessel. Conclusions: The aneurysm model in the experiment has high flexibility and reliability. The model provides an effective tool for research and testing neurovascular devices. It's also a useful device to train the neuroradiologists and interventional physicians. (authors)
Identification and function analysis of canine stimulator of interferon gene (STING).
Zhang, Yuxiang; Zhu, Mengyan; Li, Gairu; Liu, Jie; Zhai, Xiaofeng; Wang, Ruyi; Zhang, Junyan; Xing, Gang; Gu, Jinyan; Yan, Liping; Lei, Jing; Sun, Haifeng; Shi, Zhiyu; Liu, Fei; Hu, Boli; Su, Shuo; Zhou, Jiyong
2017-12-01
Stimulator of interferon gene (STING) plays an important role in the cyclic GMP-AMP synthase (cGAS)-mediated activation of type I IFN responses. In this study, we identified and cloned canine STING gene. Full-length STING encodes a 375 amino acid product that shares the highest similarity with feline STING. Highest levels of mRNA of canine STING were detected in the spleen and lungs while the lowest levels in the heart and muscle. Analysis of its cellular localization showed that STING is localizes to the endoplasmic reticulum. STING overexpression induced the IFN response via the IRF3 and NF-κB pathways and up-regulated the expression of ISG15 and viperin. However, knockdown of STING did not inhibit the IFN-β response triggered by poly(dA:dT), poly(I:C), or SeV. Finally, overexpression of STING significantly inhibited the replication of canine influenza virus H3N2. Collectively, our findings indicate that STING is involved in the regulation of the IFN-β pathway in canine. Copyright © 2017 Elsevier Ltd. All rights reserved.
Mandibular Canine Dimorphism in Establishing Sex Identity in the Lebanese Population
Directory of Open Access Journals (Sweden)
Fouad Ayoub
2014-01-01
Full Text Available Background and Objective. In forensic investigations, mandibular canines provide excellent materials to identify gender since they are more likely to survive disasters. The objective of this study was to investigate gender dimorphism by comparing the mesiodistal width of mandibular permanent canines and intercanine distance in a group of Lebanese population. Methods. Participants consisted of undergraduate students from the School of Dentistry, Lebanese University, for two academic years who fulfilled the inclusion criteria. Canine widths and intercanine distance were measured by one operator directly on dental casts using a digital caliper. Results. One hundred thirty-three Lebanese dental students (54 males and 69 females aged 18–25 were included in the study. The intercanine distance was significantly greater in males (P value 0.05 and females (P value > 0.05. The mean width of canine was greater than 7.188 mm for males. Conclusion. The parameters measured in the present study are of great help in sex identification in forensic investigations in the Lebanese adult population.
Directory of Open Access Journals (Sweden)
Jennifer Ann Foltz
2016-11-01
Full Text Available Canines spontaneously develop many cancers similar to humans - including osteosarcoma, leukemia, and lymphoma - offering the opportunity to study immune therapies in a genetically heterogeneous and immunocompetent environment. However, a lack of antibodies recognizing canine NK cell markers has resulted in suboptimal characterization and unknown purity of NK cell products, hindering the development of canine models of NK cell adoptive immunotherapy. To this end, we generated a novel antibody to canine NCR1 (NKp46, the putative species-wide marker of NK cells, enabling purification of NK cells for further characterization. We demonstrate that CD3-/NKp46+ cells in healthy and osteosarcoma-bearing canines have phenotypic similarity to human CD3-/NKp46+ NK cells, expressing mRNA for CD16 and the natural cytotoxicity receptors NKp30, NKp44, and NKp80. Functionally, we demonstrate with the calcein release assay that canine CD3-/NKp46+ cells kill canine tumor cell lines without prior sensitization and secrete IFN-γ, TNF-α, IL-8, IL-10, and GM-CSF as measured by Luminex. Like human NK cells, CD3-/NKp46+ cells expand rapidly on feeder cells expressing 4-1BBL and membrane-bound IL-21 (median= 20,283-fold in 21 days. Further, we identify a minor Null population (CD3-/CD21-/CD14-/NKp46- with reduced cytotoxicity against osteosarcoma cells, but similar cytokine secretion as CD3-/NKp46+ cells. Null cells in canines and humans have reduced expression of NKG2D, NKp44, and CD16 compared to NKp46+ NK cells, and can be induced to express NKp46 with further expansion on feeder cells. In conclusion, we have identified and characterized canine NK cells, including an NKp46- subset of canine and human NK cells, using a novel anti-canine NKp46 antibody, and report robust ex vivo expansion of canine NK cells sufficient for adoptive immunotherapy.
Sequence-independent VIDISCA-454 technique to discover new viruses in canine livers
van der Heijden, Mitzi; de Vries, Michel; van Steenbeek, Frank G.; Favier, Robert P.; Deijs, Martin; Brinkhof, Bas; Rothuizen, Jan; van der Hoek, Lia; Penning, Louis C.
2012-01-01
In many mammals, viruses cause hepatitis. Despite many efforts a specific virus responsible for canine idiopathic hepatitis has not been identified. The discovery of a viral etiology in canine hepatitis will promote the development of specific drugs and vaccines for the treatment of idiopathic
2013-05-21
...] Availability of an Environmental Assessment for Field Testing a Canine Lymphoma Vaccine, DNA AGENCY: Animal and... Canine Lymphoma Vaccine, DNA. The environmental assessment, which is based on a risk analysis prepared to... biological product: Requester: Merial, Inc. Product: Canine Lymphoma Vaccine, DNA. Possible Field Test...
Directory of Open Access Journals (Sweden)
Kimon C. Kanelakis
2009-01-01
Full Text Available The heme-regulated inhibitor (HRI negatively regulates protein synthesis by phosphorylating eukaryotic initiation factor-2α (eIF2α thereby inhibiting protein translation. The importance of HRI in regulating hemoglobin synthesis in erythroid cells makes it an attractive molecular target in need of further characterization. In this work, we have cloned and expressed the canine form of the HRI kinase. The canine nucleotide sequence has 86%, 82%, and 81% identity to the human, mouse, and rat HRI, respectively. It was noted that an isoleucine residue in the ATP binding site of human, rat, and mouse HRI is replaced by a valine in the canine kinase. The expression of canine HRI protein by in vitro translation using wheat germ lysate or in Sf9 cells using a baculovirus expression system was increased by the addition of hemin. Following purification, the canine protein was found to be 72 kD and showed kinase activity determined by its ability to phosphorylate a synthetic peptide substrate. Quercetin, a kinase inhibitor known to inhibit mouse and human HRI, inhibits canine HRI in a concentration-dependent manner. Additionally, quercetin is able to increase de novo protein synthesis in canine reticulocytes. We conclude that the canine is a suitable model species for studying the role of HRI in erythropoiesis.
Canine hypothyroidism. A diagnostic challenge?
International Nuclear Information System (INIS)
Boretti, Felicitos; Reusch, C.E.
2010-01-01
Hypothyroidism is one of the most common endocrinopathies in dogs. Clinical symptoms and hematological and biochemical parameters lead to a first suspicion. To confirm diagnosis can be challenging, however. Determination of total serum T4 concentration is accepted as the primary screening test for the disease, and low serum T4 concentrations are intuitively suggestive of hypothyroidism. However it is well known that low T4 concentrations are frequently encountered in euthyroid dogs with various nonthyroidal diseases and in dogs receiving certain pharmacologic agents. Since assessment of endogenous TSH (canine TSH) using current canine TSH assays shows normal values in a high percentage of hypothyroid dogs (up to 40%), its diagnostic value is only limited. The TSH-stimulation test can still be recognized as the gold standard for the diagnosis of hypothyroidism in dogs. Determination of circulating T4 concentration before and 6 hours after the administration of exogenous TSH (recombinant human TSH, Thyrogen registered ) provides an assessment of the functional reserve capacity of the thyroid gland with minimal change in post-TSH T4 concentration, compared with the basal concentration, expected in dogs with hypothyroidism. Also this test can be influenced by nonthyroidal illness and by medications known to affect thyroid function. This suppressing influence seems to be less pronounced using a higher dose of TSH. Therefore, to improve the discriminatory power of the TSH stimulation test to differentiate between euthyroid-sick and primary hypothyroidism, the higher dose should be used in cases in which testing cannot be delayed. More recently, ultrasonography and scintigraphy have been used for the diagnosis of primary hypothyroidism. Using ultrasonography, a sensitivity of 98% was reported if size and echogenicity of the gland were combined. However, specificity was as low as 77%. and care must be taken when measuring the gland because of a relatively high
Canine vector-borne diseases in Brazil
Dantas-Torres, Filipe
2008-01-01
Canine vector-borne diseases (CVBDs) are highly prevalent in Brazil and represent a challenge to veterinarians and public health workers, since some diseases are of great zoonotic potential. Dogs are affected by many protozoa (e.g., Babesia vogeli, Leishmania infantum, and Trypanosoma cruzi), bacteria (e.g., Anaplasma platys and Ehrlichia canis), and helminths (e.g., Dirofilaria immitis and Dipylidium caninum) that are transmitted by a diverse range of arthropod vectors, including ticks, fleas, lice, triatomines, mosquitoes, tabanids, and phlebotomine sand flies. This article focuses on several aspects (etiology, transmission, distribution, prevalence, risk factors, diagnosis, control, prevention, and public health significance) of CVBDs in Brazil and discusses research gaps to be addressed in future studies. PMID:18691408
Canine vector-borne diseases in Brazil
Directory of Open Access Journals (Sweden)
Dantas-Torres Filipe
2008-08-01
Full Text Available Abstract Canine vector-borne diseases (CVBDs are highly prevalent in Brazil and represent a challenge to veterinarians and public health workers, since some diseases are of great zoonotic potential. Dogs are affected by many protozoa (e.g., Babesia vogeli, Leishmania infantum, and Trypanosoma cruzi, bacteria (e.g., Anaplasma platys and Ehrlichia canis, and helminths (e.g., Dirofilaria immitis and Dipylidium caninum that are transmitted by a diverse range of arthropod vectors, including ticks, fleas, lice, triatomines, mosquitoes, tabanids, and phlebotomine sand flies. This article focuses on several aspects (etiology, transmission, distribution, prevalence, risk factors, diagnosis, control, prevention, and public health significance of CVBDs in Brazil and discusses research gaps to be addressed in future studies.
Hassan, Siba E; Hajeer, Mohammad Y; Alali, Osama H; Kaddah, Ayham S
2016-06-01
The results of previous studies about the efficacy of using self-ligating brackets (SLBs) in controlling canine movement during retraction are not in harmony. Therefore, the current study aimed to compare the effects of using new passive SLBs on maxillary canine retraction with sliding mechanics vs conventional ligating brackets (CLBs) tied with metal ligatures. The sample comprised 15 adult patients (4 males, 11 females; 18-24 years) requiring bilateral extraction of maxillary first premolars. Units of randomization are the left or right maxillary canines within the same patient. The two maxillary canines in each patient were randomly assigned to one of the two groups in a simple split-mouth design. The canines in the SLBs group (n = 15) were bracketed with SLBs (Damon Q™), while the canines in the CLBs group (n = 15) were bracketed with conventional brackets (Mini Master Series). Transpalatal bars were used for anchorage. After leveling and alignment, 0.019 × 0.025" stainless steel working archwires were placed. Canines were retracted using a nickel-titanium close-coil springs with a 150 gm force. The amount and rate of maxillary canine retraction, canine rotation, and loss of anchorage were measured on study models collected at the beginning of canine retraction (T0) and 12 weeks later (T1). Differences were analyzed using paired-samples t-tests. The effect differences were statistically significant (p brackets gave better results compared to the CLBs in terms of rate of movement, amount of canine rotation following extraction, and anchorage loss.
Canine osteosarcoma cells exhibit resistance to aurora kinase inhibitors.
Cannon, C M; Pozniak, J; Scott, M C; Ito, D; Gorden, B H; Graef, A J; Modiano, J F
2015-03-01
We evaluated the effect of Aurora kinase inhibitors AZD1152 and VX680 on canine osteosarcoma cells. Cytotoxicity was seen in all four cell lines; however, half-maximal inhibitory concentrations were significantly higher than in human leukaemia and canine lymphoma cells. AZD1152 reduced Aurora kinase B phosphorylation, indicating resistance was not because of failure of target recognition. Efflux mediated by ABCB1 and ABCG2 transporters is one known mechanism of resistance against these drugs and verapamil enhanced AZD1152-induced apoptosis; however, these transporters were only expressed by a small percentage of cells in each line and the effects of verapamil were modest, suggesting other mechanisms contribute to resistance. Our results indicate that canine osteosarcoma cells are resistant to Aurora kinase inhibitors and suggest that these compounds are unlikely to be useful as single agents for this disease. Further investigation of these resistance mechanisms and the potential utility of Aurora kinase inhibitors in multi-agent protocols is warranted. © 2013 Blackwell Publishing Ltd.
An RCT on treatment of palatally displaced canines with RME and/or a transpalatal arch.
Baccetti, Tiziano; Sigler, Lauren M; McNamara, James A
2011-12-01
To investigate the effect of rapid maxillary expansion (RME) and/or transpalatal arch (TPA) therapy in combination with deciduous canine extraction on the eruption of palatally displaced canines (PDCs). Hundred and twenty subjects were enrolled in an RCT based on PDCs diagnosed on panoramic radiographs and they were randomly assigned to one of four study groups. Three treatment groups (TGs) (RME followed by TPA therapy plus extraction of deciduous canines, RME/TPA/EC group, 40 subjects; TPA therapy plus extraction of deciduous canines, TPA/EC group, 25 subjects; extraction of deciduous canines, EC group, 25 subjects) were analyzed. A control group (CG, 30 subjects) received no orthodontic treatment. Prevalence rates of eruption of PDCs in the three TGs were compared with the CG at T2. Predictive features at T1 for successful canine eruption were tested in the three TGs. The prevalence of canine eruption was 80 per cent for the RME/TPA/EC group, 79 per cent for the TPA/EC group, 62.5 per cent for the EC group, versus 28 per cent in the CG, with statistically significant differences between all the groups, with the exception of the comparison between RME/TPA/EC and TPA/EC. Predictive pretreatment variables for the success of treatment were less severe sectors of canine displacement, prepubertal stages of skeletal maturity, and an open root apex of PDCs. The use of a TPA in absence of RME can be equally effective than the RME/TPA combination in PDC cases not requiring maxillary expansion, thus reducing the burden of treatment for the patient.
Bilateral second premolars agenesia together with a unilateral canine radiculomegaly
Directory of Open Access Journals (Sweden)
Arthur Musakulu Kemoli
2017-01-01
Full Text Available Congenitally missing teeth is a common feature for the third molars. However, missing teeth, macrodontia and radiculomegaly occurring in a single patient is very rare. This article describes a case of agenesis of mandibular second premolars, radiculomegaly with dilacerations of a canine tooth together with elongated roots of other canines. All these features had been discerned through diagnostic radiographs taken during a routine treatment planning.
Surgical Removal of a Canine Aortic Thromboembolism Secondary to Pancreatitis
Directory of Open Access Journals (Sweden)
Jill Narak
2015-01-01
Full Text Available A 7-year-old castrated male Pomeranian was evaluated on emergency for diagnostic work-up and treatment for acute nonpainful paraparesis. The neurologic examination suggested a L4-S3 myelopathy, but physical examination revealed lack of femoral pulses and rectal hypothermia, as well as a grade II/VI systolic heart murmur, so ischemic neuromyopathy was suspected. Clinicopathologic analysis revealed increased muscle enzymes and proteinuria. Abdominal ultrasonography confirmed aortic thromboembolism (ATE, and surgical histopathology diagnosed necrotizing pancreatitis. Surgical aortic thrombectomy was performed, and antithrombotic therapy was instituted. Pancreatitis was treated supportively. The dog was discharged to the owners after 10 days of hospitalization. Recheck examination 6 weeks after initial presentation revealed a normal neurologic examination and normal femoral pulses. The patient has had no further bouts of pancreatitis and remains neurologically normal 5 years after initial presentation. Canine ATE is relatively rare compared to the feline counterpart. Directed therapy for feline ATE is often not recommended, as underlying conditions are oftentimes ultimately fatal. Underlying etiologies for canine ATE include cardiovascular disease and endocrinopathies, but canine ATE secondary to pancreatitis has not yet been reported. Surgical removal of aortic thromboembolus should be considered as curative for pelvic limb dysfunction in the canine patient without a terminal underlying disease.
Typing of Canine Parvovirus Strains Circulating in North-East China.
Zhao, H; Wang, J; Jiang, Y; Cheng, Y; Lin, P; Zhu, H; Han, G; Yi, L; Zhang, S; Guo, L; Cheng, S
2017-04-01
Canine parvovirus (CPV) is highly contagious and is a major cause of haemorrhagic enteritis and myocarditis in dogs. We investigated the genetic variation of emerging CPV strains by sequencing 64 CPV VP2 genes from 216 clinical samples of dogs from Heilongjiang, Jilin, Liaoning, Shandong and Hebei in 2014. Genetic analysis revealed that CPV-2b was predominant in Hebei and CPV-2a was predominant in the other four provinces. In addition, a CPV-2c strain has emerged in Shandong province. All samples had a Ser-Ala substitution at residue 297 and an Ile-Arg substitution at residue 324. Interestingly, in five separate canine samples, we found a mutation of Gln370 to Arg, until now detected only in isolates from pandas. The phylogenetic analysis showed clear distinctions between epidemic isolates and vaccine strains and between Chinese CPV-2c strains and CPV-2c strains found in other countries. Monitoring recent incidence of CPV strains enables evaluation and implementation of disease control strategies. © 2015 Blackwell Verlag GmbH.
Kobayashi, Tetsuro; Fujisawa, Akiko; Amagai, Masayuki; Iwasaki, Toshiroh; Ohyama, Manabu
2011-10-01
The dermal papilla (DP) plays pivotal roles in hair follicle morphogenesis and cycling. However, our understanding of the biology of the canine DP is extremely limited. The aim of this study was to elucidate molecular biological and immunohistochemical characteristics of canine DP cells and determine appropriate conditions for in vitro expansion. Histological investigation revealed that the canine DP expressed biomarkers of human and rodent DP, including alkaline phosphatase (ALP) and versican. When microdissected, canine DP, but not fibroblasts, strongly expressed the DP-related genes for alkaline phosphatase, Wnt inhibitory factor 1 and lymphoid enhancer-binding factor 1, confirming successful isolation. The growth rate of isolated canine DP cells was moderate in conventional culture conditions for rodent and human DP; however, AmnioMAX-C100 complete medium allowed more efficient cultivation. Dermal papilla marker gene expression was maintained in early passage cultured DP cells, but gradually lost after the third passage. Approaches to mimic the in vivo DP environment in culture, such as supplementation of keratinocyte-conditioned medium or use of extracellular matrix-coated dishes, moderately ameliorated loss of DP gene expression in canine DP cells. It is possible that constituent factors in AmnioMAX may influence culture. These findings suggested that further refinements of culture conditions may enable DP cell expansion without impairing intrinsic properties and, importantly, demonstrated that AmnioMAX-cultured early passage canine DP cells partly maintained the biological characteristics of in vivo canine DP cells. This study provides crucial information necessary for further optimization of culture conditions of canine DP. © 2011 The Authors. Veterinary Dermatology. © 2011 ESVD and ACVD.
Development of high yielding Soybean variety MACS 450 by using Kalitur mutant-MACS 111
International Nuclear Information System (INIS)
Raut, V.M.; Taware, S.P.; Halvankar, G.B.; Varghese, Philips
2000-01-01
A mutant variety -MACS 111 developed by treating seeds of indigenous black seeded 'Kalitur' variety with gamma irradiation + Ethyleneimine was used in development of high yielding varieties. MACS 450 a promising high yielding variety was selected from Bragg x MACS 111 cross by pedigree selection method. This variety gave the highest average seed yield in station trials (3422 kg/ha), coordinated breeding trials (2361 kg/ha) and varieties cum plant population trial (2215 kg/ha). On the basis of its performance in these trials it was released for commercial cultivation in Southern India. On all India basis, it also recorded the highest seed yield of 4076 kg/ha and 3582 kg/ha in Front line Demonstrations conducted on the farmers' field during 1998 and 1999 respectively. (author)
Collett, A R; Fletcher, B
2000-12-01
A case report is detailed in which autotransplanted maxillary canines were removed and the spaces closed. Substantial surrounding bone loss was associated with the upper right canine, and a bone graft was needed to reestablish normal dentoalveolar ridge morphology. Bone was taken from the maxillary tuberosity and placed in the canine extraction site, fixed with a bone screw, and covered with GoreTex. Seven months after placement of the bone graft, the GoreTex and stabilizing screw were removed to allow for consolidation of the bone. The upper left canine and lower second premolars were extracted, and fixed appliances were placed in both arches to align the teeth and close the spaces. Protraction of the upper right first premolar and retraction of the lateral incisor into the graft site were kept slow and constant with continued periodontal assessment. During the space closure, there was some concern that the bone in the graft site might resorb, leaving the teeth with compromised periodontal support. However, no significant periodontal attachment loss occurred despite ongoing concern about the amount of keratinized tissue. Perhaps the relatively slow rate of tooth movement provided for bone to be maintained and recreated ahead of the tooth. Almost complete closure of the upper canine extraction spaces was achieved. The upper premolars were substituted for the maxillary canines, and unfavorable prosthetic options were thus avoided. The lower arch was aligned, and the extraction spaces completely closed.
Computerized digital image processing on radiographs of canine filariosis
International Nuclear Information System (INIS)
Miyatake, K.; Okamoto, Y.; Minami, S.
1999-01-01
For objective evaluation in the lung arterial lesions, density histogram revealed by survey thoracic radiographies of fifteen canine filariosis and five normal canine were digitally analyzed, and preparation of pulmonary artery angiogram with inflated-fixed lung, the changes in the histogram and the pulmonary arterial lesion by a soft X-ray examination were compared. In the lung areas affected by filariosis, the density histogram increased the white level and decreased the black level in each part compared to a normal lung. In comparison with the normal parameters, those of the filariosis it were significantly increased in minimum grey level values (Min), maximum grey level values (Max), and the maximum frequency grey level values (Mode) and, it was significantly decreased in maximum frequency values (MaF). The pulmonary arterial lesion of the filariosis showed obvious morphological changes such as in distinction, pruning, angiectasis, and meandering. In the grade of pulmonary arterial lesion, the parameter Min, Max, Mode and MaF were changed significantly. From these results, it was clear that the methods for the lung arterial lesions analysis of X-ray images were confirmed to be highly beneficial in the lung arterial lesions for objective diagnosis
"Fooling fido"--chemical and behavioral studies of pseudo-explosive canine training aids.
Kranz, William D; Strange, Nicholas A; Goodpaster, John V
2014-12-01
Genuine explosive materials are traditionally employed in the training and testing of explosive-detecting canines so that they will respond reliably to these substances. However, challenges arising from the acquisition, storage, handling, and transportation of explosives have given rise to the development of "pseudo-explosive" training aids. These products attempt to emulate the odor of real explosives while remaining inert. Therefore, a canine trained on a pseudo-explosive should respond to its real-life analog. Similarly, a canine trained on an actual explosive should respond to the pseudo-explosive as if it was real. This research tested those assumptions with a focus on three explosives: single-base smokeless powder, 2,4,6-trinitrotoluene (TNT), and a RDX-based plastic explosive (Composition C-4). Using gas chromatography-mass spectrometry with solid phase microextraction as a pre-concentration technique, we determined that the volatile compounds given off by pseudo-explosive products consisted of various solvents, known additives from explosive formulations, and common impurities present in authentic explosives. For example, simulated smokeless powders emitted terpenes, 2,4-dinitrotoluene, diphenylamine, and ethyl centralite. Simulated TNT products emitted 2,4- and 2,6-dinitrotoluene. Simulated C-4 products emitted cyclohexanone, 2-ethyl-1-hexanol, and dimethyldinitrobutane. We also conducted tests to determine whether canines trained on pseudo-explosives are capable of alerting to genuine explosives and vice versa. The results show that canines trained on pseudo-explosives performed poorly at detecting all but the pseudo-explosives they are trained on. Similarly, canines trained on actual explosives performed poorly at detecting all but the actual explosives on which they were trained.
International Nuclear Information System (INIS)
Kodama, Atsushi; Yanai, Tokuma; Sakai, Hiroki; Matsuura, Satoko; Murakami, Mami; Murai, Atsuko; Mori, Takashi; Maruo, Kouji; Kimura, Tohru; Masegi, Toshiaki
2009-01-01
Human hemangiosarcoma (HSA) tends to have a poor prognosis; its tumorigenesis has not been elucidated, as there is a dearth of HSA clinical specimens and no experimental model for HSA. However, the incidence of spontaneous HSA is relatively high in canines; therefore, canine HSA has been useful in the study of human HSA. Recently, the production of angiogenic growth factors and their receptors in human and canine HSA has been reported. Moreover, the growth-factor environment of HSA is very similar to that of pathophysiological angiogenesis, which some homeobox genes regulate in the transcription of angiogenic molecules. In the present study, we established 6 xenograft canine HSA tumors and detected the expression of growth factors, their receptors, and angiogenic homeobox genes. Six primary canine HSAs were xenografted to nude mice subcutaneously and serially transplanted. Subsequently, the expressions of vascular endothelial growth factor (VEGF)-A, basic fibroblast growth factors (bFGF), flt-1 and flk-1 (receptors of VEGF-A), FGFR-1, and angiogenic homeobox genes HoxA9, HoxB3, HoxB7, HoxD3, Pbx1, and Meis1 were investigated in original and xenograft tumors by histopathology, immunostaining, and reverse transcription polymerase chain reaction (RT-PCR), using canine-specific primer sets. Histopathologically, xenograft tumors comprised a proliferation of neoplastic cells that were varied in shape, from spindle-shaped and polygonal to ovoid; some vascular-like structures and vascular clefts of channels were observed, similar to those in the original tumors. The expression of endothelial markers (CD31 and vWF) was detected in xenograft tumors by immunohistochemistry and RT-PCR. Moreover, the expression of VEGF-A, bFGF, flt-1, flk-1, FGFR-1, HoxA9, HoxB3, HoxB7, HoxD3, Pbx1, and Meis1 was detected in xenograft tumors. Interestingly, expressions of bFGF tended to be higher in 3 of the xenograft HSA tumors than in the other tumors. We established 6 xenograft canine HSA
Morphological study of maxillary canine region based on CT
International Nuclear Information System (INIS)
Yamada, Maiko; Takamori, Hitoshi; Ide, Yoshiaki; Yosue, Takashi
2010-01-01
The maxilla is generally known as a site where anatomical limitations make it difficult to obtain sufficient bone volume. A large amount of bone exists in the canine region between the anterior margin of the maxillary sinus and the piriform aperture margin. Although this region is crucial for implant treatments, there have not been any reports on morphological studies of the region. In this study, we investigated the morphology of the canine region based on CT, and also the morphology and position of the maxillary sinus located posterior to the canine region. The results were as follows: In the area above the anterior nasal spine, the higher the level, the smaller the mesio-distal length and the bucco-lingual width tended to become. In the area above the anterior nasal spine, the mesio-distal length and the bucco-lingual width tended to be smaller in female patients than in male patients. In the area above the anterior nasal spine, no significant differences in mesio-distal length and bucco-lingual width were observed between dentulous and edentulous jaws. The morphology of the maxillary sinus was mainly of an inverse-trapezoidal, circular, or triangular form. The position of the anterior wall of the maxillary sinus was most frequently found at the site corresponding to the second premolar. Through this study, we have reconfirmed that the canine region is vital for implant treatments in the maxilla. (author)
Sterenczak, Katharina A; Kleinschmidt, Sven; Wefstaedt, Patrick; Eberle, Nina; Hewicker-Trautwein, Marion; Bullerdiek, Jörn; Nolte, Ingo; Murua Escobar, Hugo
2011-05-01
Disorders of histiocytic origin affecting humans and dogs share various similarities. Canine disseminated histiocytic sarcoma (DHS) (formerly known as malignant histiocytosis) is an aggressive neoplasm of interstitial dendritic cells (DCs). The receptor for glycation end products (RAGE) and the high mobility group box1 protein (HMGB1) have been shown to be required for the maturation and migration of DCs. Thus, deregulation of the expression of these genes could have a major effect on the progression of histiocytic disorders. Neoplastic canine DHS samples and non-neoplastic control samples were analysed immunohistochemically and via real-time PCR. Significant down-regulation of RAGE in the lung tumour samples and down-regulation of HMGB1 in the lung, lymph node and spleen tumour samples were detected compared to their non-neoplastic counterparts. RAGE and HMGB1 expression down-regulation in canine DHS points to a role in the progression of histiocytic disorders.
Establishment and bronchial arteriography of the models of canine lung cancer
International Nuclear Information System (INIS)
Cao Xicai; Wang Xiaodong; Li Bin; Shi Jianguang; Liu Yong; Xu Nanxun; Ma Weijun; Yang Haixian; Bai Jingwen; Li Weidong; Liu Shuping; Liu Anpu
2003-01-01
Objective: To investigate the establishment and bronchial arteriography of the models of canine lung cancer, and to facilitate further diagnosis and treatment of lung cancer. Methods: Twenty-two dogs were respectively administrated with 3 ml suspension of lipiodol-ultrafluid mixed with 3- methylcholanthrene (MCA) and diethylnitrosamine (DEN). The suspension was injected into the diaphragmic lobe of right lung with the co-axial catheter through endotracheal intubation. The dogs were randomly divided into 5 groups, group A (4 dogs), B (4), C (4), D (5), and E (5), which were sacrificed after observation for 1, 3, 6, 12, and 18 months, respectively. Then the image analysis and histopathologic examinations were carried out at different period. 5 dogs in group E were examined by bronchial arteriography. Results: Peribronchiolitis and atelectasis appeared at early stage (one month). Chronic granulomatous inflammation and fibrosis of lung tissue were gradually formed after 3 months. Proliferation of stem cells in bronchioles and atypical hyperplasia were found from 6 to 12 months. At last, the squamous carcinoma and bronchioloalveolar carcinoma were induced after 18 months. The lung cancer and precancerous lesion were found in 4 of 5 dogs at the 18 th month. The bronchial arteriography in the 5 dogs showed that 3 bronchial arteries were found as the supplying blood artery to the tumor. Conclusion: The suspension of lipiodol-ultrafluid mixed with MCA and DEN was exactly injected with the co-axial catheter through endotracheal intubation to establish the models of canine lung cancer. The inducible rate of the method was high and the location of lung cancer was accurate. It was affirmed that the blood supply artery of canine lung cancer was bronchial artery. Bronchial arteriography was of momentous significance to the diagnosis of early lung cancer. The establishment of the models of canine lung cancer was significant in the diagnosis and treatment of lung cancer. The models
Pathophysiology, diagnosis, and treatment of canine hip dysplasia
International Nuclear Information System (INIS)
Cook, J.L.; Tomlinson, J.L.; Constantinescu, G.M.
1996-01-01
Dogs with hip dysplasia are commonly presented to veterinarians for evaluation. Although many causes of the condition have been proposed, a definitive cause has not been established. The multifactorial nature of canine hip dysplasia can confuse client education and management ofthe disease. The basic concept involved is the biomechanical imbalance between the forces on the coxofemoral joint and the associated muscle mass; the result is joint laxity in young, growing dogs. This laxity leads to incongruity; the eventual result is degenerative joint disease. Canine hip dysplasia can affect any breed but is most often reported in large and giant breeds. Understanding the pathophysiology and biomechanics involved with this developmental disease is important in providing clients with diagnostic, therapeutic, and prognostic information. The selection of treatment is influenced by the following factors:the age, health, and intended use of the patient; clinical signs; diagnostic findings; the availability of treatment; and the financial constraints of the owner. This article discusses the current concepts concerning the pathophysiology and biomechanics of canine hip dysplasia and outlines diagnostic and therapeutic options. The objective of the article is to provide practitioners with a reference for decision making and client education
Does contemporary canine diet cause cancer? ; A review
Directory of Open Access Journals (Sweden)
Joseph B Gentzel
2013-07-01
Full Text Available Recent discoveries have discerned the presence of advanced glycation end products (AGEs and their impact on chronic diseases that include cancer in dogs. AGEs are closely allied with chronic systemic inflammation (metaflammation. These two occurrences are observed in many cancers in both humans and dogs. AGEs are exogenous and endogenous. Exogenous AGEs occur from, among other causes, ingestion of food that is affected by the Maillard reaction in its preparation. The result is an accumulation of AGEs and progressive metaflammation that is linked with many cancers in both humans and dogs. Aspects of AGE ingestion and formation are reviewed in association with the contemporary canine diet that is primarily a kibbled meal based diet. Anovel canine diet paradigm is offered as one that diminishes the AGE/ metaflammation axis. This is proposed to be less carcinogenic than the current canine diet in use by much of the civilized world. The proposed paradigm is a unique approach that offers opportunities to be tested for AGE and metaflammation accumulation that results in diminished prevalence and incidence of cancer in dogs. The paradigm diet is suggested as a prevention, treatment, and recovery aide from cancer
Almuhtaseb, Eyad; Mao, Jing; Mahony, Derek; Bader, Rawan; Zhang, Zhi-xing
2014-06-01
The purpose of this study was to develop a new way to localize the impacted canines from three dimensions and to investigate the root resorption of the adjacent teeth by using cone beam computed tomography (CBCT). Forty-six patients undergoing orthodontic treatments and having impacted canines in Tongji Hospital were examined. The images of CBCT scans were obtained from KaVo 3D exam vision. Angular and linear measurements of the cusp tip and root apex according to the three planes (mid-sagittal, occlusal and frontal) have been taken using the cephalometric tool of the InVivo Dental Anatomage Version 5.1.10. The measurements of the angular and linear coordinates of the maxillary and mandibular canines were obtained. Using this technique the operators could envision the location of the impacted canine according to the three clinical planes. Adjacent teeth root resorption of 28.26 % was in the upper lateral incisors while 17.39% in upper central incisors, but no lower root resorption was found in our samples. Accurate and reliable localization of the impacted canines could be obtained from the novel analysis system, which offers a better surgical and orthodontic treatment for the patients with impacted canines.
Successful management of refractory cases of canine demodicosis with homeopathy medicine Graphitis.
Ranjan, Rakesh; Dua, Kirti; Turkar, Sujata; Singh, Harkirat; Singla, L D
2014-12-01
Canine demodicosis is a refractory skin disease caused by excessive proliferation of mite Demodex canis. Despite availability of several treatment options, the disease poses a great challenge to clinicians for its long term management as some drugs may be ineffective or toxic. Present report describes successful treatment of two refractory cases of canine demodicosis using homeopathy medicine. After oral administration of Graphitis 200 C two drops once daily for 2 months, complete cure from the disease was observed. No adverse health effects of the medication were recorded during the treatment. Thus, it may be concluded that homeopathy medicine may be used safely for long-term management of canine demodicosis.
Mutation breeding of Bacillus subtilis YTB4 with high yield of ...
African Journals Online (AJOL)
DR TONUKARI NYEROVWO
2012-07-17
Jul 17, 2012 ... Helium-neon (He-Ne) laser irradiation is a highly efficient mutation breeding technology and is widely applied to various fields of biological science. Using Bacillus subtilis YTB4 with high yield of multienzyme complex as original strain, mutation breeding was carried out by He-Ne laser irradiation in.
Cherpillod, P; Tipold, A; Griot-Wenk, M; Cardozo, C; Schmid, I; Fatzer, R; Schobesberger, M; Zurbriggen, R; Bruckner, L; Roch, F; Vandevelde, M; Wittek, R; Zurbriggen, A
2000-07-01
Canine distemper virus (CDV), a member of the genus Morbillivirus induces a highly infectious, frequently lethal disease in dogs and other carnivores. Current vaccines against canine distemper consisting of attenuated viruses have been in use for many years and have greatly reduced the incidence of distemper in the dog population. However, certain strains may not guarantee adequate protection and others can induce post vaccinal encephalitis. We tested a DNA vaccine for its ability to protect dogs, the natural host of CDV, against distemper. We constructed plasmids containing the nucleocapsid, the fusion, and the attachment protein genes of a virulent canine distemper virus strain. Mice inoculated with these plasmids developed humoral and cellular immune responses against CDV antigens. Dogs immunized with the expression plasmids developed virus-neutralizing antibodies. Significantly, vaccinated dogs were protected against challenge with virulent CDV, whereas unvaccinated animals succumbed to distemper.
Target design for high fusion yield with the double Z-pinch-driven hohlraum
International Nuclear Information System (INIS)
Vesey, R. A.; Herrmann, M. C.; Lemke, R. W.; Desjarlais, M. P.; Cuneo, M. E.; Stygar, W. A.; Bennett, G. R.; Campbell, R. B.; Christenson, P. J.; Mehlhorn, T. A.; Porter, J. L.; Slutz, S. A.
2007-01-01
A key demonstration on the path to inertial fusion energy is the achievement of high fusion yield (hundreds of MJ) and high target gain. Toward this goal, an indirect-drive high-yield inertial confinement fusion (ICF) target involving two Z-pinch x-ray sources heating a central secondary hohlraum is described by Hammer et al. [Phys. Plasmas 6, 2129 (1999)]. In subsequent research at Sandia National Laboratories, theoretical/computational models have been developed and an extensive series of validation experiments have been performed to study hohlraum energetics, capsule coupling, and capsule implosion symmetry for this system. These models have been used to design a high-yield Z-pinch-driven ICF target that incorporates the latest experience in capsule design, hohlraum symmetry control, and x-ray production by Z pinches. An x-ray energy output of 9 MJ per pinch, suitably pulse-shaped, is sufficient for this concept to drive 0.3-0.5 GJ capsules. For the first time, integrated two-dimensional (2D) hohlraum/capsule radiation-hydrodynamics simulations have demonstrated adequate hohlraum coupling, time-dependent radiation symmetry control, and the successful implosion, ignition, and burn of a high-yield capsule in the double Z-pinch hohlraum. An important new feature of this target design is mode-selective symmetry control: the use of burn-through shields offset from the capsule that selectively tune certain low-order asymmetry modes (P 2 ,P 4 ) without significantly perturbing higher-order modes and without a significant energy penalty. This paper will describe the capsule and hohlraum design that have produced 0.4-0.5 GJ yields in 2D simulations, provide a preliminary estimate of the Z-pinch load and accelerator requirements necessary to drive the system, and suggest future directions for target design work
Electroencephalography as a diagnostic technique for canine neurological diseases
Directory of Open Access Journals (Sweden)
Wrzosek Marcin
2016-06-01
Full Text Available Electroencephalography (EEG is a non-invasive examination method for the assessment of functional central nervous system (CNS disturbances. In human medicine it has a special importance as a diagnostic tool for epilepsy. Although many studies were done on the use of EEG for diagnostics of canine central nervous system disorders, the technique is still not applied routinely. The purpose of this paper was to review the use of the electroencephalography in canine neurological disorders of central nervous system diagnosis and assess the future perspectives of this technique in veterinary medicine.
Canine distemper virus detection in asymptomatic and non vaccinated dogs
Directory of Open Access Journals (Sweden)
Helen L. Del Puerto
2010-02-01
Full Text Available A quantitative real time polymerase chain reaction (PCR revealed canine distemper virus presence in peripheral blood samples from asymptomatic and non vaccinated dogs. Samples from eleven domestic dogs with no signs of canine distemper and not vaccinated at the month of collection were used. Canine distemper virus vaccine samples in VERO cells were used as positive controls. RNA was isolated with Trizol®, and treated with a TURBO DNA-free kit. Primers were designed for canine distemper virus nucleocapsid protein coding region fragment amplification (84 bp. Canine b-actin (93 bp was utilized as the endogenous control for normalization. Quantitative results of real time PCR generated by ABI Prism 7000 SDS Software showed that 54.5% of dogs with asymptomatic canine distemper were positive for canine distemper virus. Dissociation curves confirmed the specificity of the real time PCR fragments. This technique could detect even a few copies of viral RNA and identificate subclinically infected dogs providing accurate diagnosis of this disease at an early stage.A reação em cadeia da polimerase (PCR em tempo real revelou a presença do vírus da cinomose canina em amostra de sangue de cães assintomáticos e não vacinados. Amostra de onze cães domésticos sem nenhum sinal clínico de cinomose e que não foram vacinados no mês da coleta de sangue foram utilizados para análise. Amostra vacinal do vírus da cinomose canina em células VERO foi utilizada como controle positivo. O RNA total foi isolado utilizando-se Trizol®, e tratadas com o Kit TURBO DNA-free. Os iniciadores foram desenhados para amplificar a região do nucleocapsídeo viral com 319pb e 84pb para a PCR convencional e PCR em tempo real, respectivamente. O fragmento alvo da b-actina canina com 93pb foi utilizado como controle endógeno e normalizador. Resultados quantitativos da PCR em tempo real gerados pelo programa ABI Prism 7000 SDS demonstraram que 54,5% dos cães assintom
Wong, Yick Ching; Teh, Huey Fang; Mebus, Katharina; Ooi, Tony Eng Keong; Kwong, Qi Bin; Koo, Ka Loo; Ong, Chuang Kee; Mayes, Sean; Chew, Fook Tim; Appleton, David R; Kulaveerasingam, Harikrishna
2017-06-21
The oil yield trait of oil palm is expected to involve multiple genes, environmental influences and interactions. Many of the underlying mechanisms that contribute to oil yield are still poorly understood. In this study, we used a microarray approach to study the gene expression profiles of mesocarp tissue at different developmental stages, comparing genetically related high- and low- oil yielding palms to identify genes that contributed to the higher oil-yielding palm and might contribute to the wider genetic improvement of oil palm breeding populations. A total of 3412 (2001 annotated) gene candidates were found to be significantly differentially expressed between high- and low-yielding palms at at least one of the different stages of mesocarp development evaluated. Gene Ontologies (GO) enrichment analysis identified 28 significantly enriched GO terms, including regulation of transcription, fatty acid biosynthesis and metabolic processes. These differentially expressed genes comprise several transcription factors, such as, bHLH, Dof zinc finger proteins and MADS box proteins. Several genes involved in glycolysis, TCA, and fatty acid biosynthesis pathways were also found up-regulated in high-yielding oil palm, among them; pyruvate dehydrogenase E1 component Subunit Beta (PDH), ATP-citrate lyase, β- ketoacyl-ACP synthases I (KAS I), β- ketoacyl-ACP synthases III (KAS III) and ketoacyl-ACP reductase (KAR). Sucrose metabolism-related genes such as Invertase, Sucrose Synthase 2 and Sucrose Phosphatase 2 were found to be down-regulated in high-yielding oil palms, compared to the lower yield palms. Our findings indicate that a higher carbon flux (channeled through down-regulation of the Sucrose Synthase 2 pathway) was being utilized by up-regulated genes involved in glycolysis, TCA and fatty acid biosynthesis leading to enhanced oil production in the high-yielding oil palm. These findings are an important stepping stone to understand the processes that lead to
High Titer and Yields Achieved with Novel, Low-Severity Pretreatment Strategy
Energy Technology Data Exchange (ETDEWEB)
2016-03-01
NREL researchers obtained high concentration sugar syrups in enzymatic hydrolysis that are fermentable to ethanol and other advanced biofuels and intermediate products at high yields. The novel DMR process is simpler and bypasses all severe pretreatment methods, thus reducing the environmental impact. The results are unprecedented. Researchers achieved a high concentration of sugars (230g/L of monomeric sugar and 270 g/L total sugar) and this low toxicity, highly fermentable syrup yielded 86 g/L ethanol (> 90 percent conversion). In addition, the lignin streams from this process can readily be converted to jet or renewable diesel blendstocks through a hydrodeoxygenation step. The NREL-developed, low severity DMR process may potentially replace higher severity chemical pretreatments and associated expensive reactors constructed of exotic alloys with a simpler process, using commercial-scale equipment commonly associated with the pulp and paper industry, to produce high concentration, low toxicity sugar streams and highly reactive lignin streams from non-food renewable biomass for biological and catalytic upgrading to advanced biofuels and chemicals. The simpler DMR process with black liquor recycling could reduce environmental and life-cycle impacts, and repurpose shuttered pulp and paper mills to help revitalize rural economies.
Experimental study of pulmonary thromboembolism ischemia-reperfusion injury in canine model
International Nuclear Information System (INIS)
Li Jianjun; Zhai Renyou; Zhang Dongpo; Huang Qiang; Yu Ping; Dai Dingke; Bao Na
2009-01-01
Objective: To establish a canine model of pulmonary thromboembolism ischemia- reperfusion injury (PTE IRI) that may be used for imaging study. Methods: Ten male and 10 female healthy mongrel canines with (18.6±0.8) kg/body weight, were used. A Swan-Ganz catheter was introduced into the right internal jugular vein via a preset percutaneous sheath using the Seldinger technique, and then was with further insertion the pulmonary artery. Balloon occlusion of the right inferior lobe pulmonary artery for 4 hours was followed by removing the catheter and ending with 4 hours of reperfusion. CT was performed before ischemia, 4 h after ischemia and 4 h after reperfusion. At last, dogs were killed and the bilateral inferior lung tissues were prepared for the examination by light and electronic microscopy. Results: All canine models were successfully developed pulmonary thromboembolism ischemia-reperfusion injury. The examination of CT, light and electron microscopy consistently indicated the presence of permeability pulmonary edema after reperfusion. Conclusions: A closed-chest canine model in vivo of pulmonary thromboembolism ischemia-reperfusion injury can be established with virtual pathophysiological process in human and be as well as for imaging experimental study. (authors)
A survey of canine tick-borne diseases in India
Directory of Open Access Journals (Sweden)
Coleman Glen T
2011-07-01
Full Text Available Abstract Background There are few published reports on canine Babesia, Ehrlichia, Anaplasma, Hepatozoon and haemotropic Mycoplasma infections in India and most describe clinical disease in individual dogs, diagnosed by morphological observation of the microorganisms in stained blood smears. This study investigated the occurrence and distribution of canine tick-borne disease (TBD pathogens using a combination of conventional and molecular diagnostic techniques in four cities in India. Results On microscopy examination, only Hepatozoon gamonts were observed in twelve out of 525 (2.3%; 95% CI: 1.2, 4 blood smears. Using polymerase chain reaction (PCR, a total of 261 from 525 dogs (49.7%; 95% CI: 45.4, 54.1 in this study were infected with one or more canine tick-borne pathogen. Hepatozoon canis (30%; 95% CI: 26.0, 34.0 was the most common TBD pathogen found infecting dogs in India followed by Ehrlichia canis (20.6%; 95% CI: 17.2, 24.3, Mycoplasma haemocanis (12.2%; 95% CI: 9.5, 15.3, Anaplasma platys (6.5%; 95% CI: 4.5, 8.9, Babesia vogeli (5.5%, 95% CI: 3.7, 7.8 and Babesia gibsoni (0.2%, 95% CI: 0.01, 1.06. Concurrent infection with more than one TBD pathogen occurred in 39% of cases. Potential tick vectors, Rhipicephalus (most commonly and/or Haemaphysalis ticks were found on 278 (53% of dogs examined. Conclusions At least 6 species of canine tick-borne pathogens are present in India. Hepatozoon canis was the most common pathogen and ticks belonging to the genus Rhipicephalus were encountered most frequently. Polymerase chain reaction was more sensitive in detecting circulating pathogens compared with peripheral blood smear examination. As co-infections with canine TBD pathogens were common, Indian veterinary practitioners should be cognisant that the discovery of one such pathogen raises the potential for multiple infections which may warrant different clinical management strategies.
Tvarijonaviciute, Asta; Martínez-Subiela, Silvia; Ceron, José J
2010-10-01
The aim of this study was to validate 2 commercially available enzyme-linked immunosorbent assays (ELISAs) for adiponectin in dogs, 1 canine-specific and 1 originally designed for measurements in humans. Intra-assay and interassay precision was evaluated by multiple measurements in canine serum samples, and assay accuracy was indirectly determined by linearity under dilution. Interference caused by hemolysis and lipemia was also studied. Both assays were subsequently used for measuring adiponectin concentrations in clinically healthy dogs and those with different grades of obesity. The intra-assay and inter-assay precision was less than 7.5% and 13.5% in serum samples with low and high adiponectin concentrations, respectively. Lipemia and hemolysis did not affect the results of any of the assays. Both assays were able to differentiate lean dogs from those that were overweight or obese on the basis of the measured adiponectin concentrations. From these results it can be concluded that canine adiponectin concentrations can be measured reliably by means of the 2 ELISAs evaluated in this study.
New hominin fossils from Kanapoi, Kenya, and the mosaic evolution of canine teeth in early hominins
Directory of Open Access Journals (Sweden)
J. Michael Plavcan
2012-03-01
Full Text Available Whilst reduced size, altered shape and diminished sexual dimorphism of the canine–premolar complex are diagnostic features of the hominin clade, little is known about the rate and timing of changes in canine size and shape in early hominins. The earliest Australopithecus, Australopithecus anamensis, had canine crowns similar in size to those of its descendant Australopithecus afarensis, but a single large root alveolus has suggested that this species may have had larger and more dimorphic canines than previously recognised. Here we present three new associated dentitions attributed to A. anamensis, recently recovered from the type site of Kanapoi, Kenya, that provide evidence of canine evolution in early Australopithecus. These fossils include the largest mandibular canine root in the hominin fossil record. We demonstrate that, although canine crown height did not differ between these species, A. anamensis had larger and more dimorphic roots, more like those of extant great apes and Ardipithecus ramidus, than those of A. afarensis. The canine and premolar occlusal shapes of A. anamensis also resemble those of Ar. ramidus, and are intermediary between extant great apes and A. afarensis. A. afarensis achieved Homo-like maxillary crown basal proportions without a reduction in crown height. Thus, canine crown size and dimorphism remained stable during the early evolution of Australopithecus, but mandibular root dimensions changed only later within the A. anamensis–afarensis lineage, coincident with morphological changes in the canine–premolar complex. These observations suggest that selection on canine tooth crown height, shape and root dimensions was not coupled in early hominin evolution, and was not part of an integrated adaptive package.
Robust high-yield ~1 TBq production of cyclotron based sodium [99mTc]pertechnetate.
Andersson, J D; Thomas, B; Selivanova, S V; Berthelette, E; Wilson, J S; McEwan, A J B; Gagnon, K
2018-03-02
This paper presents the irradiation and processing of high-current 100 Mo targets at the University of Alberta (UofA) in a GMP compliant setting. For purpose of comparison with a second production facility, additional studies at Centre Hospitalier Universitaire de Sherbrooke (CHUS) are also described. More than 70% of today's diagnostic radiopharmaceuticals are based on 99m Tc, however the conventional supply chain for obtaining 99m Tc is fragile. The aim of this work was to demonstrate reliable high yield production and processing of 99m Tc with medium-energy, high-current, cyclotrons. We used two cyclotrons (TR-24, Advanced Cyclotron Systems, Inc) for irradiations with 22 MeV or 24 MeV incident energy and 400 μA current up to a maximum of 6 h. The irradiated 100 Mo was dissolved using peroxide, basified using ammonium carbonate, and purified using a PEG-based solid phase extraction technique. High-yield productions with 22 MeV (400 μA, 6 h) yielded an average isolated [ 99m Tc]TcO 4 - yield of 878 GBq ± 99 GBq (23.7 Ci ± 2.7 Ci) decay corrected to EOB, n = 8 (isolated saturation yield: 4.36 ± 0.49 GBq/μA). Irradiations with 24 MeV (400 μA, 6 h) resulted in an average isolated [ 99m Tc]TcO 4 - yield of 993 GBq ± 100 GBq (26.8 Ci ± 2.7 Ci) decay corrected to EOB, n = 7 (isolated saturation yield: 4.97 ± 0.50 GBq/μA). These yields corresponds to 600-700 GBq (16-19 Ci) of [ 99m Tc]TcO 4 - at release (i.e. 3 hour post-EOB). For all tested batches, the QC results were within the recently published specifications in the European Pharmacopoeia. Reliable near-TBq production yields for 99m Tc can be obtained using medium-energy cyclotrons. This work presents evidence that medium-energy high-current cyclotrons can provide high yields of [ 99m Tc]TcO 4 - with radionuclidic impurities levels within the specifications of the existing European Pharmacopoeia monograph, indicating that this
Isolation and identification of Helicobacter spp, from canine and feline gastric mucosa
DEFF Research Database (Denmark)
Jalava, K.; On, Stephen L.W.; VanDamme, P.A.R.
1998-01-01
It is known that virtually all healthy adult dogs and cats harbor spiral helicobacters in their gastric mucosa, Three species, Helicobacter felis, Helicobacter bizzozeronii, and Helicobacter salomonis have been isolated in vitro from the gastric mucosa of these animals. The aims of this study were...... conventional phenotypic tests, whole-cell protein profiling, and ultrastructural analysis in identifying the different species isolated from canine and feline gastric mucose. We cultured 95 and 22 gastric mucosal biopsies from dogs and cats, respectively. Twenty-one H. bizzozeronii strains, 8 H. felis strains......, 8 H. salomonis strains, 3 mixed cultures, 2 "Flexispira rappini"-like organisms, and 3 as get uncharacterized strains were isolated from the dogs, and 3 H. felis strains were isolated from the cats. The methods used here yielded Helicobacter isolation rates of 51% from dogs and 13.6% from cats...
A meiotic linkage map of the silver fox, aligned and compared to the canine genome.
Kukekova, Anna V; Trut, Lyudmila N; Oskina, Irina N; Johnson, Jennifer L; Temnykh, Svetlana V; Kharlamova, Anastasiya V; Shepeleva, Darya V; Gulievich, Rimma G; Shikhevich, Svetlana G; Graphodatsky, Alexander S; Aguirre, Gustavo D; Acland, Gregory M
2007-03-01
A meiotic linkage map is essential for mapping traits of interest and is often the first step toward understanding a cryptic genome. Specific strains of silver fox (a variant of the red fox, Vulpes vulpes), which segregate behavioral and morphological phenotypes, create a need for such a map. One such strain, selected for docility, exhibits friendly dog-like responses to humans, in contrast to another strain selected for aggression. Development of a fox map is facilitated by the known cytogenetic homologies between the dog and fox, and by the availability of high resolution canine genome maps and sequence data. Furthermore, the high genomic sequence identity between dog and fox allows adaptation of canine microsatellites for genotyping and meiotic mapping in foxes. Using 320 such markers, we have constructed the first meiotic linkage map of the fox genome. The resulting sex-averaged map covers 16 fox autosomes and the X chromosome with an average inter-marker distance of 7.5 cM. The total map length corresponds to 1480.2 cM. From comparison of sex-averaged meiotic linkage maps of the fox and dog genomes, suppression of recombination in pericentromeric regions of the metacentric fox chromosomes was apparent, relative to the corresponding segments of acrocentric dog chromosomes. Alignment of the fox meiotic map against the 7.6x canine genome sequence revealed high conservation of marker order between homologous regions of the two species. The fox meiotic map provides a critical tool for genetic studies in foxes and identification of genetic loci and genes implicated in fox domestication.
Breeding high yielding varieties of pigeon pea, mungbean and black gram using induced mutations
International Nuclear Information System (INIS)
Pawar, S.E.; Wanjari, K.B.
1994-01-01
The present communication emphasis the developing of high yielding varieties of pigeon pea, mungbean and black gram using induced mutation with disease resistance in these crops. This would help in stabilisation of the higher yield potential
Seroprevalence of Canine Parvovirus in Dogs in Lusaka District, Zambia
Saasa, Ngonda; Nalubamba, King Shimumbo; M’kandawire, Ethel; Siwila, Joyce
2016-01-01
Canine parvovirus (CPV) enteritis is a highly contagious enteric disease of young dogs. Limited studies have been done in Zambia to investigate the prevalence of CPV in dogs. Blood was collected from dogs from three veterinary clinics (clinic samples, n = 174) and one township of Lusaka (field samples, n = 56). Each dog's age, sex, breed, and vaccination status were recorded. A haemagglutination assay using pig erythrocytes and modified live parvovirus vaccine as the antigen was used. Antibod...
3D enamel thickness in Neandertal and modern human permanent canines.
Buti, Laura; Le Cabec, Adeline; Panetta, Daniele; Tripodi, Maria; Salvadori, Piero A; Hublin, Jean-Jacques; Feeney, Robin N M; Benazzi, Stefano
2017-12-01
Enamel thickness figures prominently in studies of human evolution, particularly for taxonomy, phylogeny, and paleodietary reconstruction. Attention has focused on molar teeth, through the use of advanced imaging technologies and novel protocols. Despite the important results achieved thus far, further work is needed to investigate all tooth classes. We apply a recent approach developed for anterior teeth to investigate the 3D enamel thickness of Neandertal and modern human (MH) canines. In terms of crown size, the values obtained for both upper and lower unworn/slightly worn canines are significantly greater in Neandertals than in Upper Paleolithic and recent MH. The 3D relative enamel thickness (RET) is significantly lower in Neandertals than in MH. Moreover, differences in 3D RET values between the two groups appear to decrease in worn canines beginning from wear stage 3, suggesting that both the pattern and the stage of wear may have important effects on the 3D RET value. Nevertheless, the 3D average enamel thickness (AET) does not differ between the two groups. In both groups, 3D AET and 3D RET indices are greater in upper canines than in lower canines, and overall the enamel is thicker on the occlusal half of the labial aspect of the crown, particularly in MH. By contrast, the few early modern humans investigated show the highest volumes of enamel while for all other components of 3D enamel, thickness this group holds an intermediate position between Neandertals and recent MH. Overall, our study supports the general findings that Neandertals have relatively thinner enamel than MH (as also observed in molars), indicating that unworn/slightly worn canines can be successfully used to discriminate between the two groups. Further studies, however, are needed to understand whether these differences are functionally related or are the result of pleiotropic or genetic drift effects. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.
Gebhard, Christiane; Fuchs-Baumgartinger, Andrea; Razzazi-Fazeli, Ebrahim; Miller, Ingrid; Walter, Ingrid
2016-01-01
Overexpression of matrix metalloproteinases (MMPs) has been associated with increased tumor aggressiveness and metastasis dissemination. We investigated whether the contrasting metastatic behavior of feline and canine osteosarcoma is related to levels and activities of MMP2 and MMP9. Zymography and immunohistochemistry were used to determine expression levels of MMP2 and MMP9 in canine and feline osteosarcoma. Using immunohistochemistry, increased MMP9 levels were identified in most canine os...
Mutation breeding of Bacillus subtilis YTB4 with high yield of ...
African Journals Online (AJOL)
Helium-neon (He-Ne) laser irradiation is a highly efficient mutation breeding technology and is widely applied to various fields of biological science. Using Bacillus subtilis YTB4 with high yield of multienzyme complex as original strain, mutation breeding was carried out by He-Ne laser irradiation in this study. Based on the ...
Directory of Open Access Journals (Sweden)
I Nyoman Suartha
2008-03-01
Full Text Available A study was conducted to apply reverse transcriptase-polymerase chain reaction (RT-PCR technique for the confirmative diagnosis of canine distemper in dogs. Twenty mongreal dogs with clinical symptoms of canine distemper were used in this study. The viral RNA was isolated from nasal swab using Trizol® and transcribed into cDNA using random primers 5’ACAGGATTGCTGAGGACCTAT 3’. The cDNA was amplified in one step RT-PCR using primers 5’-ACAGGATTGCTGAGGACCTAT-3’ (forward and 5’- CAAGATAACCATGTACGGTGC-3’ (backward. A single band of 300 bp which was specific for canine distemper virus CDV was detected in fifteen out of twenty samples. It is therefore evident that confirmative diagnostics of canine distemper disease can be established with RT-PCR technique.
Santarém, Nuno; Silvestre, Ricardo; Cardoso, Luís; Schallig, Henk; Reed, Steven G.; Cordeiro-da-Silva, Anabela
2010-01-01
Accurate diagnosis of canine leishmaniasis (CanL) is essential toward a more efficient control of this zoonosis, but it remains problematic due to the high incidence of asymptomatic infections. In this study, we present data on the development of enzyme-linked immunosorbent assay (ELISA)-based
DETECTION OF CANINE PARVOVIRUS ANTIGEN IN DOGS IN KUMASI, GHANA.
Folitse, R D; Kodie, D O; Amemor, E; Dei, D; Tasiame, W; Burimuah, V; Emikpe, B O
2018-01-01
Canine Parvovirus (CPV) in dogs has been documented in many countries. However, evidence of the infection is scanty in Ghana. This study was conducted to detect canine parvovirus antigen in dogs presented with diarrhoea to the Government Veterinary Clinic in Kumasi, Ghana. Faecal samples from 72 dogs presented with diarrhoea were tested for the presence of canine parvovirus antigen using commercially available rapid test kit (BIT ® Rapid Colour Canine Parvovirus Ag Test Kit, BIOINDIST Co. Ltd, Korea) based on the principle of immunochromatography. Influence of breed, sex, age, vaccination history and the nature of diarrhoea were assessed. Data obtained was analysed with SPSS and subjected to the chi-square test. Significance was at α 0.05 . We found 61.11% tested positive (44/72) for CPV. Based on sex, 61.54% of males (20/33) and 60.61% of females tested positive (24/39). A total of 65.67% of samples from puppies below 6 months were positive. 56.25% of CPV vaccinated dogs and 70.83% of unvaccinated dogs were positive respectively. 69.05% of samples from haemorrhagic diarrhoeic dogs and 50.00% from non-haemorrhagic diarrhoeic dogs were positive of CPV. The study is the first documented evidence of the existence of CPV in Ghana. It also revealed that absence of bloody diarrhoea does not necessarily rule out CPV infection.
DETECTION OF CANINE PARVOVIRUS ANTIGEN IN DOGS IN KUMASI, GHANA
Folitse, R. D; Kodie, D.O; Amemor, E.; Dei, D.; Tasiame, W.; Burimuah, V.; Emikpe, B.O
2018-01-01
Background: Canine Parvovirus (CPV) in dogs has been documented in many countries. However, evidence of the infection is scanty in Ghana. This study was conducted to detect canine parvovirus antigen in dogs presented with diarrhoea to the Government Veterinary Clinic in Kumasi, Ghana. Materials and Methods: Faecal samples from 72 dogs presented with diarrhoea were tested for the presence of canine parvovirus antigen using commercially available rapid test kit (BIT® Rapid Colour Canine Parvovirus Ag Test Kit, BIOINDIST Co. Ltd, Korea) based on the principle of immunochromatography. Influence of breed, sex, age, vaccination history and the nature of diarrhoea were assessed. Data obtained was analysed with SPSS and subjected to the chi-square test. Significance was at α0.05 Results: We found 61.11% tested positive (44/72) for CPV. Based on sex, 61.54% of males (20/33) and 60.61% of females tested positive (24/39). A total of 65.67% of samples from puppies below 6 months were positive. 56.25% of CPV vaccinated dogs and 70.83% of unvaccinated dogs were positive respectively. 69.05% of samples from haemorrhagic diarrhoeic dogs and 50.00% from non-haemorrhagic diarrhoeic dogs were positive of CPV. Conclusion: The study is the first documented evidence of the existence of CPV in Ghana. It also revealed that absence of bloody diarrhoea does not necessarily rule out CPV infection. PMID:29302647
Canine Detection of Illict Drugs: Sensory Apparatus Technology
National Research Council Canada - National Science Library
Morrison, Edward
2000-01-01
This report describes basic anatomical and physiological observations of the peripheral canine olfactory system, provided by means of investigations into its structural and molecular characteristics...
Directory of Open Access Journals (Sweden)
Cassali Geovanni D
2010-02-01
Full Text Available Abstract Background It has been suggested that columnar cell lesions indicate an alteration of the human mammary gland involved in the development of breast cancer. They have not previously been described in canine mammary gland. The aim of this paper is describe the morphologic spectrum of columnar cell lesions in canine mammary gland specimens and their association with other breast lesions. Methods A total of 126 lesions were subjected to a comprehensive morphological review based upon the human breast classification system for columnar cell lesions. The presence of preinvasive (epithelial hyperplasia and in situ carcinoma and invasive lesions was determined and immunophenotypic analysis (estrogen receptor (ER, progesterone receptor (PgR, high molecular weight cytokeratin (34βE-12, E-cadherin, Ki-67, HER-2 and P53 was perfomed. Results Columnar cell lesions were identified in 67 (53.1% of the 126 canine mammary glands with intraepithelial alterations. They were observed in the terminal duct lobular units and characterized at dilated acini may be lined by several layers of columnar epithelial cells with elongated nuclei. Of the columnar cell lesions identified, 41 (61.2% were without and 26 (38.8% with atypia. Association with ductal hyperplasia was observed in 45/67 (67.1%. Sixty (89.5% of the columnar cell lesions coexisted with neoplastic lesions (20 in situ carcinomas, 19 invasive carcinomas and 21 benign tumors. The columnar cells were ER, PgR and E-cadherin positive but negative for cytokeratin 34βE-12, HER-2 and P53. The proliferation rate as measured by Ki-67 appeared higher in the lesions analyzed than in normal TDLUs. Conclusions Columnar cell lesions in canine mammary gland are pathologically and immunophenotypically similar to those in human breast. This may suggest that dogs are a suitable model for the comparative study of noninvasive breast lesions.
International Nuclear Information System (INIS)
Ferreira, Enio; Gobbi, Helenice; Saraiva, Bruna S; Cassali, Geovanni D
2010-01-01
It has been suggested that columnar cell lesions indicate an alteration of the human mammary gland involved in the development of breast cancer. They have not previously been described in canine mammary gland. The aim of this paper is describe the morphologic spectrum of columnar cell lesions in canine mammary gland specimens and their association with other breast lesions. A total of 126 lesions were subjected to a comprehensive morphological review based upon the human breast classification system for columnar cell lesions. The presence of preinvasive (epithelial hyperplasia and in situ carcinoma) and invasive lesions was determined and immunophenotypic analysis (estrogen receptor (ER), progesterone receptor (PgR), high molecular weight cytokeratin (34βE-12), E-cadherin, Ki-67, HER-2 and P53) was perfomed. Columnar cell lesions were identified in 67 (53.1%) of the 126 canine mammary glands with intraepithelial alterations. They were observed in the terminal duct lobular units and characterized at dilated acini may be lined by several layers of columnar epithelial cells with elongated nuclei. Of the columnar cell lesions identified, 41 (61.2%) were without and 26 (38.8%) with atypia. Association with ductal hyperplasia was observed in 45/67 (67.1%). Sixty (89.5%) of the columnar cell lesions coexisted with neoplastic lesions (20 in situ carcinomas, 19 invasive carcinomas and 21 benign tumors). The columnar cells were ER, PgR and E-cadherin positive but negative for cytokeratin 34βE-12, HER-2 and P53. The proliferation rate as measured by Ki-67 appeared higher in the lesions analyzed than in normal TDLUs. Columnar cell lesions in canine mammary gland are pathologically and immunophenotypically similar to those in human breast. This may suggest that dogs are a suitable model for the comparative study of noninvasive breast lesions
Kaewkong, Worasak; Intapan, Pewpan M; Sanpool, Oranuch; Janwan, Penchom; Thanchomnang, Tongjit; Kongklieng, Amornmas; Tantrawatpan, Chairat; Boonmars, Thidarut; Lulitanond, Viraphong; Taweethavonsawat, Piyanan; Chungpivat, Sudchit; Maleewong, Wanchai
2014-06-01
Canine babesiosis, hepatozoonosis, ehrlichiosis, and anaplasmosis are tick-borne diseases caused by different hemopathogens. These diseases are causes of morbidity and mortality in dogs. The classic method for parasite detection and differentiation is based on microscopic observation of blood smears. The limitations of the microscopic method are that its performance requires a specially qualified person with professional competence, and it is ineffective in differentiating closely related species. This study applied PCR amplification with high throughput pyrosequencing for molecular differential detection of the following 4 hemoparasites common to tropical areas in dog blood samples: Babesia vogeli, Hepatozoon canis, Ehrlichia canis, and Anaplasma platys. PCR was initially used to amplify specific target regions of the ribosomal RNA genes of each parasite using 2 primer pairs that included 18S rRNA for protozoa (B. vogeli and H. canis) and 16S rRNA for rickettsia (E. canis and A. platys). Babesia vogeli and H. canis were discriminated using 9 nucleotide positions out of 30 base pairs, whereas E. canis and A. platys were differentiated using 15 nucleotide positions out of 34 base pairs that were determined from regions adjacent to 3' ends of the sequencing primers. This method provides a challenging alternative for a rapid diagnosis and surveillance of these tick-borne diseases in canines. Copyright © 2014 Elsevier GmbH. All rights reserved.
Coryneform bacteria associated with canine otitis externa
DEFF Research Database (Denmark)
Aalbæk, Bent; Bemis, David A.; Schjærff, Mette
2010-01-01
This study aims to investigate the occurrence of coryneform bacteria in canine otitis externa. A combined case series and case-control study was carried out to improve the current knowledge on frequency and clinical significance of coryneform bacteria in samples from canine otitis externa. A total...... of 16 cases of otitis externa with involvement of coryneform bacteria were recorded at two referral veterinary hospitals in Denmark and the US, respectively. Coryneform bacteria were identified by partial 16S rRNA gene sequencing. Corynebacterium auriscanis was the most common coryneform species (10...... cases). Small colony variants of this species were also observed. Other coryneform isolates were identified as Corynebacterium amycolatum (3 cases), Corynebacterium freneyi (2 cases) and an Arcanobacterium-like species (1 case). The coryneform bacteria were in all cases isolated together with other...
Antigenic typing Polish isolates of canine parvovirus
Energy Technology Data Exchange (ETDEWEB)
Mizak, B. [National Veterinary Research Institute, Pulawy (Poland); Plucienniczak, A. [Polish Academy ofd Sciences. Microbiology and Virology Center, Lodz (Poland)
1995-12-31
Polish strains of canine parvovirus isolated between 1982 and 1993 were examined to determine the extent to which the virus has evolved antigenically and genetically over eleven years. Two CPV isolates obtained in Warsaw in 1982 and Pulawy in 1993, were examined using monoclonal antibody typing, restriction analysis and sequencing VP-2 protein gene. Five other isolates from Warsaw and Pulawy were tested with the panel of monoclonal antibodies specific to CPV-2, CPV-2a and common for canine parvovirus, feline panleukopenia virus and milk enteritis virus. Results of the studies demonstrated that all isolates tested represented CPV-2a antigenic type. Rapid antigenic strain replacement recorded by Parrish and Senda in the U.S.A and Japan was not confirmed in Poland. (author). 30 refs, 2 tabs.
Antigenic typing Polish isolates of canine parvovirus
International Nuclear Information System (INIS)
Mizak, B.; Plucienniczak, A.
1995-01-01
Polish strains of canine parvovirus isolated between 1982 and 1993 were examined to determine the extent to which the virus has evolved antigenically and genetically over eleven years. Two CPV isolates obtained in Warsaw in 1982 and Pulawy in 1993, were examined using monoclonal antibody typing, restriction analysis and sequencing VP-2 protein gene. Five other isolates from Warsaw and Pulawy were tested with the panel of monoclonal antibodies specific to CPV-2, CPV-2a and common for canine parvovirus, feline panleukopenia virus and milk enteritis virus. Results of the studies demonstrated that all isolates tested represented CPV-2a antigenic type. Rapid antigenic strain replacement recorded by Parrish and Senda in the U.S.A and Japan was not confirmed in Poland. (author). 30 refs, 2 tabs
Szarmach, I J; Szarmach, J; Waszkiel, D; Paniczko, A
2006-01-01
The aim of the study was to assess the effect of orthodontic movement of the impacted canines after surgical exposure and alignment on the periodontal status of the transpositioned and adjacent teeth as well as to compare certain parameters with those of spontaneously erupted teeth. Twenty-four patients (mean age 18.4 +/- 3.66) with unilaterally impacted 24 canines were enrolled in the study. The following parameters were assessed: pocket depth (PD), clinical attachment level (CAL), platelet index (PI) of Silness and Löe, and modified sulcus bleeding index (SBI). Optic density of the alveolar bone along the root surface of the aligned canine was analysed based on digital radiological images made with the right angle technique. Control group consisted of spontaneously erupted teeth. In comparison to the control group, in the orthodonticaly treated group PD was found to increase on the mesial buccal and palatal surfaces of the first premolar (p aligned canine (p aligned tooth were statistically significant (p alignment zone and the control, and there was no link between the method of treatment and periodontal status, either. The alignment of the impacted permanent maxillary canines poses a risk of periodontal deterioration. Patients subjected to surgical-orthodontic treatment require periodic periodontal follow-ups.
Ong, S M; Saeki, K; Kok, M K; Tanaka, Y; Choisunirachon, N; Yoshitake, R; Nishimura, R; Nakagawa, T
2017-08-01
Osteosarcoma (OSA) in dogs is locally invasive and highly malignant. Distant metastasis is the most common cause of death. To date, the survival rate in dogs with OSA remains poor. The cytotoxic effects of etoposide against canine OSA cell lines, either alone or in combination with piroxicam, have been previously demonstrated in vitro. The aim of this study was to evaluate the anti-tumour effect of etoposide alone and in combination with piroxicam on canine OSA using murine models. Etoposide single agent treatment significantly delayed tumour progression with a marked reduction in Ki-67 immunoreactivity in tumour tissue. Concomitant treatment with piroxicam did not enhance the anti-tumour efficacy of etoposide. Etoposide single agent treatment and combination treatment with piroxicam down-regulated survivin expression, but was not followed by increased apoptotic activity. These findings indicate that etoposide might be a promising novel therapeutic for canine OSA. Further investigations into its potential for clinical application in veterinary oncology are warranted. Copyright © 2017 Elsevier Ltd. All rights reserved.
In vitro antiviral efficacy of caffeic acid against canine distemper virus.
Wu, Zong-Mei; Yu, Zhen-Jiang; Cui, Zhen-Qiang; Peng, Lu-Yuan; Li, Hao-Ran; Zhang, Chun-Lei; Shen, Hai-Qing; Yi, Peng-Fei; Fu, Ben-Dong
2017-09-01
Canine distemper (CD) is a highly contagious disease caused by the canine distemper virus (CDV), and mortality can be as high as 100%. However, there is no specific treatment for CD. In this study, the antiviral activity of the caffeic acid against CDV was evaluated in vitro. The results showed that the IC 50 of the caffeic acid against CDV at 1 and 2 h post infection (PI) is 23.3 and 32.3 μg/mL, respectively. Consistently, at 1 and 2 h PI, the caffeic acid exhibited a reduced (23.3-57.0% and 37.2-38.1%) viral inhibitory effect in vero cells. Furthermore, the caffeic acid plus Ribavirin (RBV) has greater antiviral activity against CDV than the caffeic acid or RBV individually. In addition, the caffeic acid reduced the total viral RNA synthesis by 59-86% at 24-72 h. Therefore, our data provided the experimental evidence that the caffeic acid effectively inhibited CDV infection in vero cells, which may potentially be used to treat clinical disease associated with CDV infection. Copyright © 2017. Published by Elsevier Ltd.
Cathepsin K expression and activity in canine osteosarcoma.
Schmit, J M; Pondenis, H C; Barger, A M; Borst, L B; Garrett, L D; Wypij, J M; Neumann, Z L; Fan, T M
2012-01-01
Cathepsin K (CatK) is a lysosomal protease with collagenolytic activity, and its secretion by osteoclasts is responsible for degrading organic bone matrix. People with pathologic bone resorption have higher circulating CatK concentrations. Canine osteosarcoma (OS) cells will possess CatK, and its secretion will be cytokine inducible. Circulating CatK concentrations will be increased in dogs with OS, and will be a surrogate marker of bone resorption. Fifty-one dogs with appendicular OS and 18 age- and weight-matched healthy control dogs. In a prospective study, expressions of CatK mRNA and protein were investigated in OS cells. The inducible secretion and proteolytic activity of CatK from OS cells was assessed in vitro. Serum CatK concentrations were quantified in normal dogs and dogs with OS and its utility as a bone resorption marker was evaluated in dogs with OS treated with palliative radiation and antiresorptive agents. Canine OS cells contain preformed CatK within cytoplasmic vesicles. In OS cells, TGFβ1 induced the secretion of CatK, which degraded bone-derived type I collagen in vitro. CatK concentrations were higher in dogs with OS than healthy dogs (11.3 ± 5.2 pmol/L versus 8.1 ± 5.0 pmol/L, P = .03). In a subset of dogs with OS, pretreatment CatK concentrations gradually decreased after palliative radiation and antiresorptive treatment, from 9.3 ± 3.2 pmol/L to 5.0 ± 3.1 pmol/L, P = .03. Canine OS is associated with pathologic bone resorption, and CatK inhibitors might aid in the management of canine OS-related malignant osteolysis. Copyright © 2011 by the American College of Veterinary Internal Medicine.
Yield Evaluation of Nutrient-rich Potato Clones in High Hill of Nepal
Directory of Open Access Journals (Sweden)
Binod Prasad Luitel
2017-05-01
Full Text Available A study was conducted to evaluate the yield of nutrient-rich potato clones in high-hill districts: Dolakha and Jumla of Nepal during the years 2013 and 2014, respectively. Fourteen potato clones were tested as on-station and on-farm experiments at both districts, and those fourteen clones were compared to ‘Lady Rosita’ and ‘Jumli Local’ respectively as the check varieties in the first year experiment, 2013. Eight promising clones were selected from the first year experiment, and were evaluated and compared with same local varieties in the consecutive year, 2014. Two clones namely; CIP 395112.32 (19.3 tha-1 and CIP 393073.179 (17.8 tha-1 exhibited superior marketable tuber yield than that of ‘Lady Rosita’(14.2 tha-1 in Dolakha and five CIP clones namely; 395112.32 (25.5 tha-1, 393073.179 (22.5 tha-1, 394611.112 (20.9 tha-1, 390478.9 (19.9 tha-1 and 395017.229 (17.0 tha-1 showed higher marketable tuber yield than ‘Jumli Local’(14.5 tha-1. Based on two years’ phenotypic and tuber yield result, clones CIP 395112.32 and CIP 393073.179 are recommended to potato growers at high hills of Nepal for commercial cultivation.
Alberts, Melissa; Bandarenko, Nicholas; Gaca, Jeffrey; Lockhart, Evelyn; Milano, Carmelo; Alexander, Stanlin; Linder, Dean; Lombard, Frederick W; Welsby, Ian J
2014-05-01
Intraoperative autologous platelet (PLT) collection as part of a multimodal blood conservation program carries a Class IIa recommendation from the Societies of Thoracic Surgeons and Cardiovascular Anesthesiologists, but achieving a suitable PLT yield limits its application. A novel, autologous, intraoperative, high-yield plateletpheresis collection program was established and retrospectively analyzed to identify potential improvements over previously reported plateletpheresis protocols. Targeting complex cardiothoracic surgery patients without recent anti-PLT agents, thrombocytopenia, or severe anemia, the program aimed to achieve a PLT yield of at least one standard apheresis unit (3.0 × 10(11) ) within 60 to 90 minutes and using an automated plateletpheresis device (Trima, Terumo BCT). Anesthetized and invasively monitored patients underwent plateletpheresis via a large-bore, indwelling central line placed for the surgery. Collection-related data for quality control purposes and subsequent PLT transfusion requirements were analyzed and reported. Forty-two patients donated autologous PLTs between 2011 and 2012. PLT yield was 4.5 (3.9-5.0) × 10(11) , which significantly exceeds previously reported yields, and procedure duration was 53.2 (48.4-57.9) minutes. As anticipated, postcollection PLT count decreased from 268 (242-293) × 10(9) to 182 (163-201) × 10(9) /L; hypocalcemia was minimized by infusion of 1 g of CaCl2 . Autologous PLT yield was inversely correlated with allogeneic PLT use, and avoidance of allogeneic PLT transfusion was increased when the autologous yield was the equivalent of 2 or more apheresis units. High-yield, intraoperative autologous PLT collection is achievable using an automated plateletpheresis device. Initial experience shows a reduction in reliance on allogeneic PLTs for complex cardiothoracic surgery. © 2013 American Association of Blood Banks.
Obesity, expression of adipocytokines, and macrophage infiltration in canine mammary tumors.
Lim, H Y; Im, K S; Kim, N H; Kim, H W; Shin, J I; Sur, J H
2015-03-01
Obesity influences the development, progression and prognosis of human breast cancer and canine mammary cancer (MC) but the precise underlying mechanism is not well-documented in the fields of either human or veterinary oncology. In the present study, the expression of major adipocytokines, including leptin, adiponectin, and leptin receptor (ObR) in benign (n = 28) and malignant (n = 70) canine mammary tumors was investigated by immunohistochemistry and on the basis of the subject's body condition score (BCS). To evaluate the relationship between obesity and chronic inflammation of the mammary gland, macrophages infiltrating within and around tumoral areas were counted. The mean age of MC development was lower in overweight or obese dogs (9.0 ± 1.8 years) than in lean dogs or optimal bodyweight (10.2 ± 2.9 years), and the evidence of lymphatic invasion of carcinoma cells was found more frequently in overweight or obese group than in lean or optimal groups. Decreased adiponectin expression and increased macrophage numbers in overweight or obese subjects were significantly correlated with factors related to a poor prognosis, such as high histological grade and lymphatic invasion. Leptin expression was correlated with progesterone receptor status, and ObR expression was correlated with estrogen receptor status of MCs, regardless of BCS. Macrophage infiltration within and around the tumor may play an important role in tumor progression and metastasis in obese female dogs and may represent a prognostic factor for canine MCs. Copyright © 2015 Elsevier Ltd. All rights reserved.
Canine trypanosomosis: Clinical observations and morphological ...
African Journals Online (AJOL)
Clinical and pathological aspects of canine trypanosomosis were determined in naturally infected dogs presented to the Veterinary Teaching Hospital, Federal University of Agriculture, Abeokuta, at different times between 2012 and 2013. The breeds, sexes, ages and body weights of the dogs were recorded. Clinical signs ...
High yield silicon carbide pre-ceramic polymers
International Nuclear Information System (INIS)
Baney, R.H.
1982-01-01
Polysilanes which are substituted with (CH 3 ) 3 SiO-groups are useful for the preparation in high yields of fine grained silicon carbide ceramic materials. They consist of 0 to 60 mole % (CH 3 ) 2 Si units and 100 to 40 mole % CH 3 Si units, all Si valences not satisfied by CH 3 groups or Si atoms being directed to groups (CH 3 ) 3 SiO-, which siloxane groups amount to 23 to 61 weight % of the polysilane. They are prepared by reaction of the corresponding chloro- or bromo-methyl polysilanes with at least the stoichiometric amounts of (CH 3 ) 3 SiOSi(CH 3 ) 3 and water in the presence of a strong acid. (author)
Prevention approaches in a preclinical canine model of Alzheimer’s disease: Benefits and challenges
Directory of Open Access Journals (Sweden)
Paulina R. Davis
2014-03-01
Full Text Available Aged dogs spontaneously develop many features of human aging and Alzheimer’s disease (AD including cognitive decline and neuropathology. In this review, we discuss age-dependent learning tasks, memory tasks, and functional measures that can be used in aged dogs for sensitive treatment outcome measures. Neuropathology that is linked to cognitive decline is described along with examples of treatment studies that show reduced neuropathology in aging dogs (dietary manipulations, behavioral enrichment, immunotherapy, and statins. Studies in canine show that multi-targeted approaches may be more beneficial than single pathway manipulations (e.g. antioxidants combined with behavioral enrichment. Aging canine studies show good predictive validity for human clinical trials outcomes (e.g. immunotherapy and several interventions tested in dogs strongly support a prevention approach (e.g. immunotherapy and statins. Further, dogs are ideally suited for prevention studies as they the age because onset of cognitive decline and neuropathology strongly support longitudinal interventions that can be completed within a 3-5 year period. Disadvantages to using the canine model are that they lengthy, use labor-intensive comprehensive cognitive testing, and involve costly housing (almost as high as that of nonhuman primates. However overall, using the dog as a preclinical model for testing preventive approaches for AD may complement work in rodents and nonhuman primates.
The unerupted maxillary canine - a post-surgical review.
LENUS (Irish Health Repository)
O'Dowling, Ian
2009-10-01
The orthodontic records of 685 patients referred for surgical exposure of an unerupted impacted maxillary canine tooth were examined. The condition was more common among females than males, slightly less than 2:1. The impacted teeth had a palatal-labial ratio of 3:1. All of the teeth were exposed using the open surgical technique and in 98% of cases the tooth erupted and was orthodontically aligned. In 2% of cases ankylosis occurred and the teeth were subsequently extracted. The presence of peg-shaped lateral incisors associated with the impacted maxillary canine tooth was 3.4% of the total number of impacted teeth and congenital absence was found in 1.7% of impacted teeth.
The unerupted maxillary canine--a post-surgical review.
O'Dowling, Ian
2009-01-01
The orthodontic records of 685 patients referred for surgical exposure of an unerupted impacted maxillary canine tooth were examined. The condition was more common among females than males, slightly less than 2:1. The impacted teeth had a palatal-labial ratio of 3:1. All of the teeth were exposed using the open surgical technique and in 98% of cases the tooth erupted and was orthodontically aligned. In 2% of cases ankylosis occurred and the teeth were subsequently extracted. The presence of peg-shaped lateral incisors associated with the impacted maxillary canine tooth was 3.4% of the total number of impacted teeth and congenital absence was found in 1.7% of impacted teeth.
Canine distemper spillover in domestic dogs from urban wildlife.
Kapil, Sanjay; Yeary, Teresa J
2011-11-01
Canine distemper virus (CDV) causes a major disease of domestic dogs that develops as a serious systemic infection in unvaccinated or improperly vaccinated dogs. Domesticated dogs are the main reservoir of CDV, a multihost pathogen. This virus of the genus Morbillivirus in the family Paramyxoviridae occurs in other carnivorous species including all members of the Canidae and Mustelidae families and in some members of the Procyonidae, Hyaenidae, Ursidae, and Viverridae families. Canine distemper also has been reported in the Felidae family and marine mammals. The spread and incidences of CDV epidemics in dogs and wildlife here and worldwide are increasing.
Relation between agenesis and shape anomaly of maxillary lateral incisors and canine impaction
Directory of Open Access Journals (Sweden)
Anísio Bueno de Carvalho
2012-12-01
Full Text Available OBJECTIVE: The purpose was to obtain information about the relation between agenesis and shape anomaly of maxillary lateral incisors and canine impaction. METHODS: Seventy-three patients with canine impaction and 73 control patients, without canine impaction, were evaluated. The mesiodistal distances of the maxillary lateral incisors adjacent to the impacted canines and the correspondent mandibular lateral incisors were measured. The adjacent lateral incisors were classified in: 1 - absent, 2 - small, 3 - peg-shaped, 4 - standard. RESULTS: The results showed that among the patients with impacted canines, there were 21 anomalous teeth (small and peg-shaped and among the control patients there were only three small and peg-shaped teeth, with a statistically significant difference (p = 0.001. No patients were found with impacted canines and absent lateral incisors. CONCLUSION: It was concluded that in patients with anomalous lateral incisors (small and peg-shaped there is a probability to present impacted canines and this must be considered.OBJETIVO: o objetivo foi obter informação sobre a relação existente entre a agenesia e/ou anomalia de forma de incisivos laterais superiores e impacção de caninos. MÉTODOS: foram avaliados 73 pacientes com impacção de caninos e 73 pacientes controle, sem impacção de caninos. Foram medidas as distâncias mesiodistais dos incisivos laterais superiores adjacentes aos caninos impactados e os incisivos laterais correspondentes inferiores. Os incisivos laterais adjacentes foram classificados em: 1 - ausentes; 2 - pequenos; 3 - conoides; 4 - normais. RESULTADOS: os resultados mostraram que no grupo de pacientes com caninos impactados foram encontrados 22 dentes anômalos (pequenos e conoides, e no grupo controle apenas três dentes pequenos e conoides, sendo uma diferença estatisticamente significativa (p=0,001. Não foram encontrados pacientes com canino impactado e incisivo lateral ausente. CONCLUS
Vulnerability of cultured canine lung tumor cells to NK cell-mediated cytolysis
International Nuclear Information System (INIS)
Haley, P.J.; Kohr, J.M.; Kelly, G.; Muggenburg, B.A.; Guilmette, B.A.
1988-01-01
Five cell lines, designated as canine lung epithelial cell (CLEP), derived from radiation induced canine lung tumors and canine thyroid adeno-carcinoma (CTAC) cells were compared for their susceptibility to NK cell-mediated cytolysis using peripheral blood lymphocytes from normal, healthy Beagle dogs as effector cells. Effector cells and chromium 51 radiolabeled target cells were incubated for 16 h at ratios of 12.5:1, 25:1, 50:1, and 100:1. Increasing cytolysis was observed for all cell lines as the effector-to-target-cell ratios increased from 12.5:1 to 100:1. The percent cytotoxicity was significantly less for all lung tumor cell lines as compared to CTAC at the 100:1 ratio. One lung tumor cell line, CLEP-9, had 85% of the lytic vulnerability of the CTAC cell line and significantly greater susceptibility to NK cell-mediated lysis than all of the other lung tumor cell lines. Susceptibility to NK cell cytolysis did not correlate with in vivo malignant behavior of the original tumor. These data suggest that cultured canine lung tumor cells are susceptible to NK cell cytolytic activity in vitro and that at least one of these cell lines (CLEP-9) is a candidate for substitution of the standard canine NK cell target, CTAC, in NK cell assays. The use of lung tumor cells in NK cell assays may provide greater insight into the control of lung tumors by immune mechanisms. (author)
International Nuclear Information System (INIS)
Alif, Sheikh Mohammad; Haque, Sejuty; Nimmi, Naima; Ashraf, Ali; Khan, Saeed Hossain; Khan, Mahfujul Haq
2011-01-01
This study was performed to determine the prevalence of maxillary canine impaction on a basis of a single panoramic radiograph in Bangladeshi population. A random sample of seven hundred panoramic radiographs was collected from the patient record of a dental clinic. All the selected panoramic radiographs were taken from January 2009 to August 2010 by a single panoramic radiograph machine with the same exposure time (19 seconds) for all radiographs. One hundred and twenty panoramic radiographs were excluded to minimize the selection bias. In a dim lit room, an observer assessed the radiographs on a standard radiographic light box. The position of the impacted maxillary canine was recorded in line with the longitudinal axis of a tooth using the edge of a metal ruler. Data were subsequently put on SPSS 11.5 software and chi-square (x 2 ) tests were applied to find out the association. Among 580 panoramic radiographs it was found that impacted maxillary canines were present in only 7 (1.2%) radiographs. A statistical significant difference was found between the age of the patients and the vertical position of the impacted canines (p=0.000) and between the age of the patients and the horizontal position of the impacted canines (p=0.003). The prevalence was found to be low compared with the present study from the limitation of panoramic image. Further study needs to include three-dimensional imaging modality.
Grozdanic, Sinisa D; Kecova, Helga; Lazic, Tatjana
2013-09-01
To develop fast and reliable testing routines for diagnosing retina and optic nerve diseases in canine cataract patients based on chromatic properties of the pupillary light reflex response. Seventy-seven canine patients with a history of cataract and decreased vision (43 patients with cataracts and no evidence of retina or optic nerve disease, 21 patients with cataracts and retinal degeneration [RD], 13 patients with cataracts and retinal detachment [RDT]), 11 canine patients with optic neuritis (ON) and 23 healthy dogs were examined using chromatic pupillary light reflex (cPLR) analysis with red and blue light and electroretinography. Electroretinography analysis showed statistically significant deficits in a- and b-wave amplitudes in dogs with cataracts and RD, or cataracts and RDT, when compared to dogs with cataracts without evidence of retinal abnormalities. Evaluation of b-wave amplitudes showed that presence of 78.5-μV (or lower) amplitudes had high sensitivity of 100% (95% CI: 87.2-100%) and high specificity of 96.7% (95% CI: 88.4-100%) in RD and RDT. Evaluation of cPLR responses using red light showed that presence of the pupil end constriction diameter of 5.5 mm (or higher) had moderately high sensitivity of 76.5% (95% CI: 50.1-93.2%) and high specificity of 100% (95% CI: 91.2-100%) in detecting RD and RDT. Optic neuritis patients had absent cPLR responses, regardless of the visual status. Chromatic evaluation of the pupillary light reflex is a rapid and accurate test for diagnosing retina and optic nerve diseases in canine patients. © 2012 American College of Veterinary Ophthalmologists.
A comparative study between mixed-type tumours from human salivary and canine mammary glands
International Nuclear Information System (INIS)
Genelhu, Marisa CLS; Cardoso, Sérgio V; Gobbi, Helenice; Cassali, Geovanni D
2007-01-01
In comparative pathology, canine mammary tumours have special interest because of their similarities with human breast cancer. Mixed tumours are uncommon lesions in the human breast, but they are found most frequently in the mammary gland of the female dogs and in the human salivary glands. The aim of the study was to compare clinical, morphological and immunohistochemical features of human salivary and canine mammary gland mixed tumours, in order to evaluate the latter as an experimental model for salivary gland tumours. Ten examples of each mixed tumour type (human pleomorphic adenoma and carcinomas ex-pleomorphic adenomas and canine mixed tumour and metaplastic carcinoma) were evaluated. First, clinical and morphologic aspects of benign and malignant variants were compared between the species. Then, streptavidin-biotin-peroxidase immunohistochemistry was performed to detect the expression of cytokeratins, vimentin, p63 protein, estrogen receptor, β-catenin, and E-cadherin. After standardization, similar age and site distributions were observed in human and canine tumours. Histological similarities were identified in the comparison of the benign lesions as well. Metaplastic carcinomas also resembled general aspects of carcinomas ex-pleomorphic adenomas in morphological evaluation. Additionally, immunohistochemical staining further presented similar antigenic expression between lesions. There are many similar features between human salivary and canine mammary gland mixed tumours. This observation is of great relevance for those interested in the study and management of salivary gland tumours, since canine lesions may constitute useful comparative models for their investigations
International Nuclear Information System (INIS)
Yuan Zengyu
1985-01-01
The effect of high-position grafting of apple trees on cold-resistance and high yield was significant. The yields of varieties 'Huantaiping' etc. grafted on high posotion after 7 years were increased by up to 100 kg per plant in comparing with that grafted on low position. The photosynthetic products synthesized by high grafting trees and 32 P absorbed by roots were studied by measuring the radioactivity of 32 P and 14 C, and by autoradiograph. The distribution of nutrient in various organs was affected by graft union, and the accumulation of photosynthetic produts in fruit bearing portions was in favour of the differentiation of flowers and the formation of fruits