WorldWideScience

Sample records for high resolution dna

  1. High resolution DNA content measurements of mammalian sperm

    Energy Technology Data Exchange (ETDEWEB)

    Pinkel, D.; Lake, S.; Gledhill, B.L.; Van Dilla, M.A.; Stephenson, D.; Watchmaker, G.

    1982-01-01

    The high condensation and flat shape of the mammalian sperm nucleus present unique difficulties to flow cytometric measurement of DNA content. Chromatin compactness makes quantitative fluorescent staining for DNA difficult and causes a high index of refraction. The refractive index makes optical measurements sensitive to sperm head orientation. We demonstrate that the optical problems can be overcome using the commercial ICP22 epiillumination flow cytometer (Ortho Instruments, Westwood, MA) or a specially built cell orientating flow cytometer (OFCM). The design and operation of the OFCM are described. Measurements of the angular dependence of fluorescence from acriflavine stained rabbit sperm show that it is capable of orienting flat sperm with a tolerance of +-7/sup 0/. Differences in the angular dependence for the similarly shaped bull and rabbit sperm allow discrimination of these cells. We show that DNA staining with 4-6 diamidino-2-phenylindole (DAPI) or an ethidium bromide mithramycin combination allows resolution of the X and Y populations in mouse sperm. They have also been successful with sperm from the bull, ram, rabbit, and boar. Reliable results with human sperm are not obtained. The accuracy of the staining and measurement techniques are verified by the correct determination of the relative content of these two populations in sperm from normal mice and those with the Cattanach (7 to X) translocation. Among the potential uses of these techniques are measurement of DNA content errors induced in sperm due to mutagen exposure, and assessment of the fractions of X and Y sperm in semen that may have one population artifically enriched.

  2. High-resolution analysis of cytosine methylation in ancient DNA.

    Directory of Open Access Journals (Sweden)

    Bastien Llamas

    Full Text Available Epigenetic changes to gene expression can result in heritable phenotypic characteristics that are not encoded in the DNA itself, but rather by biochemical modifications to the DNA or associated chromatin proteins. Interposed between genes and environment, these epigenetic modifications can be influenced by environmental factors to affect phenotype for multiple generations. This raises the possibility that epigenetic states provide a substrate for natural selection, with the potential to participate in the rapid adaptation of species to changes in environment. Any direct test of this hypothesis would require the ability to measure epigenetic states over evolutionary timescales. Here we describe the first single-base resolution of cytosine methylation patterns in an ancient mammalian genome, by bisulphite allelic sequencing of loci from late Pleistocene Bison priscus remains. Retrotransposons and the differentially methylated regions of imprinted loci displayed methylation patterns identical to those derived from fresh bovine tissue, indicating that methylation patterns are preserved in the ancient DNA. Our findings establish the biochemical stability of methylated cytosines over extensive time frames, and provide the first direct evidence that cytosine methylation patterns are retained in DNA from ancient specimens. The ability to resolve cytosine methylation in ancient DNA provides a powerful means to study the role of epigenetics in evolution.

  3. New Technique for High Resolution DNA Sizing in Epi-Illumination

    NARCIS (Netherlands)

    Schins, J.M.; Agronskaia, A.; Agronskaia, Alexandra; de Grooth, B.G.; Greve, Jan

    1998-01-01

    We present a high-resolution DNA-sizing technique based on the principles of flow cytometry, using a high numerical aperture objective and epi-illumination. The new technique, designed for small fluorescing samples/particles (sub-micron diameter) suspended in a weakly fluorescent medium, makes use

  4. High-Resolution Melting (HRM) of Hypervariable Mitochondrial DNA Regions for Forensic Science.

    Science.gov (United States)

    Dos Santos Rocha, Alípio; de Amorim, Isis Salviano Soares; Simão, Tatiana de Almeida; da Fonseca, Adenilson de Souza; Garrido, Rodrigo Grazinoli; Mencalha, Andre Luiz

    2017-08-23

    Forensic strategies commonly are proceeding by analysis of short tandem repeats (STRs); however, new additional strategies have been proposed for forensic science. Thus, this article standardized the high-resolution melting (HRM) of DNA for forensic analyzes. For HRM, mitochondrial DNA (mtDNA) from eight individuals were extracted from mucosa swabs by DNAzol reagent, samples were amplified by PCR and submitted to HRM analysis to identify differences in hypervariable (HV) regions I and II. To confirm HRM, all PCR products were DNA sequencing. The data suggest that is possible discriminate DNA from different samples by HRM curves. Also, uncommon dual-dissociation was identified in a single PCR product, increasing HRM analyzes by evaluation of melting peaks. Thus, HRM is accurate and useful to screening small differences in HVI and HVII regions from mtDNA and increase the efficiency of laboratory routines based on forensic genetics. © 2017 American Academy of Forensic Sciences.

  5. High resolution DNA flow cytometry of boar sperm cells in identification of boars carrying cytogenetic aberrations

    DEFF Research Database (Denmark)

    Larsen, Jacob; Christensen, Knud; Larsen, Jørgen K

    2004-01-01

    The cytogenetic quality of boars used for breeding determines the litter outcome and thus has large economical consequences. Traditionally, quality controls based on the examination of simple karyograms are time consuming and sometimes give uncertain results. As an alternative, the use of high-re......-resolution DNA flow cytometry on DAPI-stained sperm cell nuclei (CV...

  6. Refining DNA Barcoding Coupled High Resolution Melting for Discrimination of 12 Closely Related Croton Species.

    Directory of Open Access Journals (Sweden)

    Maslin Osathanunkul

    Full Text Available DNA barcoding coupled high resolution melting (Bar-HRM is an emerging method for species discrimination based on DNA dissociation kinetics. The aim of this work was to evaluate the suitability of different primer sets, derived from selected DNA regions, for Bar-HRM analysis of species in Croton (Euphorbiaceae, one of the largest genera of plants with over 1,200 species. Seven primer pairs were evaluated (matK, rbcL1, rbcL2, rbcL3, rpoC, trnL and ITS1 from four plastid regions, matK, rbcL, rpoC, and trnL, and the nuclear ribosomal marker ITS1. The primer pair derived from the ITS1 region was the single most effective region for the identification of the tested species, whereas the rbcL1 primer pair gave the lowest resolution. It was observed that the ITS1 barcode was the most useful DNA barcoding region overall for species discrimination out of all of the regions and primers assessed. Our Bar-HRM results here also provide further support for the hypothesis that both sequence and base composition affect DNA duplex stability.

  7. Inference of high resolution HLA types using genome-wide RNA or DNA sequencing reads.

    Science.gov (United States)

    Bai, Yu; Ni, Min; Cooper, Blerta; Wei, Yi; Fury, Wen

    2014-05-01

    Accurate HLA typing at amino acid level (four-digit resolution) is critical in hematopoietic and organ transplantations, pathogenesis studies of autoimmune and infectious diseases, as well as the development of immunoncology therapies. With the rapid adoption of genome-wide sequencing in biomedical research, HLA typing based on transcriptome and whole exome/genome sequencing data becomes increasingly attractive due to its high throughput and convenience. However, unlike targeted amplicon sequencing, genome-wide sequencing often employs a reduced read length and coverage that impose great challenges in resolving the highly homologous HLA alleles. Though several algorithms exist and have been applied to four-digit typing, some deliver low to moderate accuracies, some output ambiguous predictions. Moreover, few methods suit diverse read lengths and depths, and both RNA and DNA sequencing inputs. New algorithms are therefore needed to leverage the accuracy and flexibility of HLA typing at high resolution using genome-wide sequencing data. We have developed a new algorithm named PHLAT to discover the most probable pair of HLA alleles at four-digit resolution or higher, via a unique integration of a candidate allele selection and a likelihood scoring. Over a comprehensive set of benchmarking data (a total of 768 HLA alleles) from both RNA and DNA sequencing and with a broad range of read lengths and coverage, PHLAT consistently achieves a high accuracy at four-digit (92%-95%) and two-digit resolutions (96%-99%), outcompeting most of the existing methods. It also supports targeted amplicon sequencing data from Illumina Miseq. PHLAT significantly leverages the accuracy and flexibility of high resolution HLA typing based on genome-wide sequencing data. It may benefit both basic and applied research in immunology and related fields as well as numerous clinical applications.

  8. DNA Origami Reorganizes upon Interaction with Graphite: Implications for High-Resolution DNA Directed Protein Patterning.

    Science.gov (United States)

    Rahman, Masudur; Neff, David; Green, Nathaniel; Norton, Michael L

    2016-10-31

    Although there is a long history of the study of the interaction of DNA with carbon surfaces, limited information exists regarding the interaction of complex DNA-based nanostructures with the important material graphite, which is closely related to graphene. In view of the capacity of DNA to direct the assembly of proteins and optical and electronic nanoparticles, the potential for combining DNA-based materials with graphite, which is an ultra-flat, conductive carbon substrate, requires evaluation. A series of imaging studies utilizing Atomic Force Microscopy has been applied in order to provide a unified picture of this important interaction of structured DNA and graphite. For the test structure examined, we observe a rapid destabilization of the complex DNA origami structure, consistent with a strong interaction of single-stranded DNA with the carbon surface. This destabilizing interaction can be obscured by an intentional or unintentional primary intervening layer of single-stranded DNA. Because the interaction of origami with graphite is not completely dissociative, and because the frustrated, expanded structure is relatively stable over time in solution, it is demonstrated that organized structures of pairs of the model protein streptavidin can be produced on carbon surfaces using DNA origami as the directing material.

  9. DNA Origami Reorganizes upon Interaction with Graphite: Implications for High-Resolution DNA Directed Protein Patterning

    Directory of Open Access Journals (Sweden)

    Masudur Rahman

    2016-10-01

    Full Text Available Although there is a long history of the study of the interaction of DNA with carbon surfaces, limited information exists regarding the interaction of complex DNA-based nanostructures with the important material graphite, which is closely related to graphene. In view of the capacity of DNA to direct the assembly of proteins and optical and electronic nanoparticles, the potential for combining DNA-based materials with graphite, which is an ultra-flat, conductive carbon substrate, requires evaluation. A series of imaging studies utilizing Atomic Force Microscopy has been applied in order to provide a unified picture of this important interaction of structured DNA and graphite. For the test structure examined, we observe a rapid destabilization of the complex DNA origami structure, consistent with a strong interaction of single-stranded DNA with the carbon surface. This destabilizing interaction can be obscured by an intentional or unintentional primary intervening layer of single-stranded DNA. Because the interaction of origami with graphite is not completely dissociative, and because the frustrated, expanded structure is relatively stable over time in solution, it is demonstrated that organized structures of pairs of the model protein streptavidin can be produced on carbon surfaces using DNA origami as the directing material.

  10. High-resolution mapping of DNA copy alterations in human chromosome 22 using high-density tiling oligonucleotide arrays.

    Science.gov (United States)

    Urban, Alexander Eckehart; Korbel, Jan O; Selzer, Rebecca; Richmond, Todd; Hacker, April; Popescu, George V; Cubells, Joseph F; Green, Roland; Emanuel, Beverly S; Gerstein, Mark B; Weissman, Sherman M; Snyder, Michael

    2006-03-21

    Deletions and amplifications of the human genomic sequence (copy number polymorphisms) are the cause of numerous diseases and a potential cause of phenotypic variation in the normal population. Comparative genomic hybridization (CGH) has been developed as a useful tool for detecting alterations in DNA copy number that involve blocks of DNA several kilobases or larger in size. We have developed high-resolution CGH (HR-CGH) to detect accurately and with relatively little bias the presence and extent of chromosomal aberrations in human DNA. Maskless array synthesis was used to construct arrays containing 385,000 oligonucleotides with isothermal probes of 45-85 bp in length; arrays tiling the beta-globin locus and chromosome 22q were prepared. Arrays with a 9-bp tiling path were used to map a 622-bp heterozygous deletion in the beta-globin locus. Arrays with an 85-bp tiling path were used to analyze DNA from patients with copy number changes in the pericentromeric region of chromosome 22q. Heterozygous deletions and duplications as well as partial triploidies and partial tetraploidies of portions of chromosome 22q were mapped with high resolution (typically up to 200 bp) in each patient, and the precise breakpoints of two deletions were confirmed by DNA sequencing. Additional peaks potentially corresponding to known and novel additional CNPs were also observed. Our results demonstrate that HR-CGH allows the detection of copy number changes in the human genome at an unprecedented level of resolution.

  11. Transfer-printing of single DNA molecule arrays on graphene for high resolution electron imaging and analysis

    Science.gov (United States)

    Cerf, Aline; Alava, Thomas; Barton, Robert A.; Craighead, Harold G.

    2011-01-01

    Graphene represents the ultimate substrate for high-resolution transmission electron microscopy, but the deposition of biological samples on this highly hydrophobic material has until now been a challenge. We present a reliable method for depositing ordered arrays of individual elongated DNA molecules on single-layer graphene substrates for high resolution electron beam imaging and electron energy loss spectroscopy analysis. This method is a necessary step towards the observation of single elongated DNA molecules with single base spatial resolution to directly read genetic and epigenetic information. PMID:21919532

  12. Transfer-printing of single DNA molecule arrays on graphene for high-resolution electron imaging and analysis.

    Science.gov (United States)

    Cerf, Aline; Alava, Thomas; Barton, Robert A; Craighead, Harold G

    2011-10-12

    Graphene represents the ultimate substrate for high-resolution transmission electron microscopy, but the deposition of biological samples on this highly hydrophobic material has until now been a challenge. We present a reliable method for depositing ordered arrays of individual elongated DNA molecules on single-layer graphene substrates for high-resolution electron beam imaging and electron energy loss spectroscopy analysis. This method is a necessary step toward the observation of single elongated DNA molecules with single base spatial resolution to directly read genetic and epigenetic information.

  13. Reliable discrimination of 10 ungulate species using high resolution melting analysis of faecal DNA.

    Directory of Open Access Journals (Sweden)

    Ana Ramón-Laca

    Full Text Available Identifying species occupying an area is essential for many ecological and conservation studies. Faecal DNA is a potentially powerful method for identifying cryptic mammalian species. In New Zealand, 10 species of ungulate (Order: Artiodactyla have established wild populations and are managed as pests because of their impacts on native ecosystems. However, identifying the ungulate species present within a management area based on pellet morphology is unreliable. We present a method that enables reliable identification of 10 ungulate species (red deer, sika deer, rusa deer, fallow deer, sambar deer, white-tailed deer, Himalayan tahr, Alpine chamois, feral sheep, and feral goat from swabs of faecal pellets. A high resolution melting (HRM assay, targeting a fragment of the 12S rRNA gene, was developed. Species-specific primers were designed and combined in a multiplex PCR resulting in fragments of different length and therefore different melting behaviour for each species. The method was developed using tissue from each of the 10 species, and was validated in blind trials. Our protocol enabled species to be determined for 94% of faecal pellet swabs collected during routine monitoring by the New Zealand Department of Conservation. Our HRM method enables high-throughput and cost-effective species identification from low DNA template samples, and could readily be adapted to discriminate other mammalian species from faecal DNA.

  14. Quantitative high-resolution sensing of DNA hybridization using magnetic tweezers with evanescent illumination

    Science.gov (United States)

    Oliver, Piercen M.; Park, Jin Seon; Vezenov, Dmitri

    2011-02-01

    We applied the combined approach of evanescent nanometry and force spectroscopy using magnetic tweezers to quantify the degree of hybridization of a single synthetic single-stranded DNA oligomer to a resolution approaching a single-base. In this setup, the 200 nucleotide long DNA was covalently attached to the surface of an optically transparent solid support at one end and to the surface of a superparamagnetic fluorescent microsphere (force probe) at the other end. The force was applied to the probes using an electromagnet. The end-to-end molecular distance (i.e. out-of-image-plane position of the force probe) was determined from the intensity of the probe fluorescence image observed with total-internal reflectance microscopy. An equation of state for single stranded DNA molecules under tension (extensible freely jointed chain) was used to derive the penetration depth of the evanescent field and to calibrate the magnetic properties of the force probes. The parameters of the magnetic response of the force probes obtained from the equation of state remained constant when changing the penetration depth, indicating a robust calibration procedure. The results of such a calibration were also confirmed using independently measured probe-surface distances for probes mounted onto cantilevers of an atomic force microscope. Upon hybridization of the complementary 50 nucleotide-long oligomer to the surface-bound 200-mer, the changes in the force-distance curves were consistent with the quantitative conversion of 25% of the original single-stranded DNA to its double-stranded form, which was modeled as an elastic rod. The method presented here for quantifying the hybridization state of the single DNA molecules has potential for determining the degree of hybridization of individual molecules in a single molecule array with high accuracy.We applied the combined approach of evanescent nanometry and force spectroscopy using magnetic tweezers to quantify the degree of hybridization

  15. DNA binding mechanism revealed by high resolution crystal structure of Arabidopsis thaliana WRKY1 protein.

    Science.gov (United States)

    Duan, Ming-Rui; Nan, Jie; Liang, Yu-He; Mao, Peng; Lu, Lu; Li, Lanfen; Wei, Chunhong; Lai, Luhua; Li, Yi; Su, Xiao-Dong

    2007-01-01

    WRKY proteins, defined by the conserved WRKYGQK sequence, are comprised of a large superfamily of transcription factors identified specifically from the plant kingdom. This superfamily plays important roles in plant disease resistance, abiotic stress, senescence as well as in some developmental processes. In this study, the Arabidopsis WRKY1 was shown to be involved in the salicylic acid signaling pathway and partially dependent on NPR1; a C-terminal domain of WRKY1, AtWRKY1-C, was constructed for structural studies. Previous investigations showed that DNA binding of the WRKY proteins was localized at the WRKY domains and these domains may define novel zinc-binding motifs. The crystal structure of the AtWRKY1-C determined at 1.6 A resolution has revealed that this domain is composed of a globular structure with five beta strands, forming an antiparallel beta-sheet. A novel zinc-binding site is situated at one end of the beta-sheet, between strands beta4 and beta5. Based on this high-resolution crystal structure and site-directed mutagenesis, we have defined and confirmed that the DNA-binding residues of AtWRKY1-C are located at beta2 and beta3 strands. These results provided us with structural information to understand the mechanism of transcriptional control and signal transduction events of the WRKY proteins.

  16. Detection of somatic mutations by high-resolution DNA melting (HRM analysis in multiple cancers.

    Directory of Open Access Journals (Sweden)

    Jesus Gonzalez-Bosquet

    Full Text Available Identification of somatic mutations in cancer is a major goal for understanding and monitoring the events related to cancer initiation and progression. High resolution melting (HRM curve analysis represents a fast, post-PCR high-throughput method for scanning somatic sequence alterations in target genes. The aim of this study was to assess the sensitivity and specificity of HRM analysis for tumor mutation screening in a range of tumor samples, which included 216 frozen pediatric small rounded blue-cell tumors as well as 180 paraffin-embedded tumors from breast, endometrial and ovarian cancers (60 of each. HRM analysis was performed in exons of the following candidate genes known to harbor established commonly observed mutations: PIK3CA, ERBB2, KRAS, TP53, EGFR, BRAF, GATA3, and FGFR3. Bi-directional sequencing analysis was used to determine the accuracy of the HRM analysis. For the 39 mutations observed in frozen samples, the sensitivity and specificity of HRM analysis were 97% and 87%, respectively. There were 67 mutation/variants in the paraffin-embedded samples, and the sensitivity and specificity for the HRM analysis were 88% and 80%, respectively. Paraffin-embedded samples require higher quantity of purified DNA for high performance. In summary, HRM analysis is a promising moderate-throughput screening test for mutations among known candidate genomic regions. Although the overall accuracy appears to be better in frozen specimens, somatic alterations were detected in DNA extracted from paraffin-embedded samples.

  17. DNA Barcoding Coupled with High Resolution Melting Analysis Enables Rapid and Accurate Distinction of Aspergillus species.

    Science.gov (United States)

    Fidler, Gabor; Kocsube, Sandor; Leiter, Eva; Biro, Sandor; Paholcsek, Melinda

    2017-08-01

    We describe a high-resolution melting (HRM) analysis method that is rapid, reproducible, and able to identify reference strains and further 40 clinical isolates of Aspergillus fumigatus (14), A. lentulus (3), A. terreus (7), A. flavus (8), A. niger (2), A. welwitschiae (4), and A. tubingensis (2). Asp1 and Asp2 primer sets were designed to amplify partial sequences of the Aspergillus benA (beta-tubulin) genes in a closed-, single-tube system. Human placenta DNA, further Aspergillus (3), Candida (9), Fusarium (6), and Scedosporium (2) nucleic acids from type strains and clinical isolates were also included in this study to evaluate cross reactivity with other relevant pathogens causing invasive fungal infections. The barcoding capacity of this method proved to be 100% providing distinctive binomial scores; 14, 34, 36, 35, 25, 15, 26 when tested among species, while the within-species distinction capacity of the assay proved to be 0% based on the aligned thermodynamic profiles of the Asp1, Asp2 melting clusters allowing accurate species delimitation of all tested clinical isolates. The identification limit of this HRM assay was also estimated on Aspergillus reference gDNA panels where it proved to be 10-102 genomic equivalents (GE) except the A. fumigatus panel where it was 103 only. Furthermore, misidentification was not detected with human genomic DNA or with Candida, Fusarium, and Scedosporium strains. Our DNA barcoding assay introduced here provides results within a few hours, and it may possess further diagnostic utility when analyzing standard cultures supporting adequate therapeutic decisions. © The Author 2016. Published by Oxford University Press on behalf of The International Society for Human and Animal Mycology. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  18. Differentiation Borrelia Species in Environmental Samples with High-Resolution DNA Melting Analysis.

    Science.gov (United States)

    Wodecka, Beata; Skotarczak, Bogumiła

    2015-01-01

    Borrelia burgdorferi sensu lato includes at least 20 species in the world, and half of these are found in Europe. The usefulness of high resolution melting (HRM) analysis of DNA denaturation curves has been assessed for differentiation of Borrelia species. HRM protocol for Borrelia species was used to examine the 77 DNA extracts selected from earlier studies with the use of three different molecular markers: flaB, rplL, and groEL. The studies revealed that the best marker is the groEL gene, which enables identification of 8 Borrelia species, including B. miyamotoi from the relapsing fever borreliae group and 7 of B. burgdorferi s.l. complex (B. garinii, B, afzelii, B. burgdorferi s.s., B. valaisiana, B. lusitaniae, B. bissetii, B. spielmanii). The HRM method, when compared with other PCR variants with regard to the reduced time of analysis, is an alternative for the procedures used in the molecular diagnostics of borreliosis including testing of blood samples or saved Ixodes ticks for the presence and genotyping of Borrelia burgdorferi after biting a patient.

  19. Evaluation of DNA barcoding coupled high resolution melting for discrimination of closely related species in phytopharmaceuticals.

    Science.gov (United States)

    Osathanunkul, Maslin; Suwannapoom, Chatmongkon; Osathanunkul, Kitisak; Madesis, Panagiotis; de Boer, Hugo

    2016-02-15

    Phytopharmaceuticals are increasingly popular as alternative medicines, but poorly regulated in many countries. The manufacturers of these products should be subject to strict controls regarding each product's quality and constituents. Routine testing and identification of raw materials should be performed to ensure that the raw materials used in pharmaceutical products are suitable for their intended use. We have applied DNA Barcoding - High Resolution Melting (Bar-HRM), an emerging method for identifying of medicinal plant species based on DNA dissociation kinetics and DNA barcoding, for the authentication of medicinal plant species. Commonly commercialized Thai medicinal plants that are widely used for medicinal purposes were used in this study. Publicly available sequences of four plastid markers were used for universal primer design. Species discrimination efficiency of the designed primers was evaluated as single and multi-locus analyses by using the primers sets. HRM analysis was performed in triplicate on each of the 26 taxa to establish the Tm for each primer set (matK, rbcLA, rbcLB, rbcLC, rpoC1, and trnL). The shapes of the melting curves were analyzed to distinguish the different plant species. Bar-HRM species identification success rates were assessed for each single-locus as well as for multi-locus combinations to establish the optimal combination of primer sets. In single locus analysis the rpoC1 primer set gave the highest discrimination (58%), and in multi locus analysis this could be increased from 87% to 99% depending on the total number of regions included. Different combinations proved to be more or less effective at discrimination, depending on the genus or family examined. Bar-HRM has proven to be a cost-effective and reliable method for the identification of species in this study of Thai medicinal plants, and results show an identification success rate of 99% among species in the test set. Copyright © 2016 Elsevier GmbH. All rights reserved.

  20. High-resolution analysis of the 5'-end transcriptome using a next generation DNA sequencer.

    Directory of Open Access Journals (Sweden)

    Shin-ichi Hashimoto

    Full Text Available Massively parallel, tag-based sequencing systems, such as the SOLiD system, hold the promise of revolutionizing the study of whole genome gene expression due to the number of data points that can be generated in a simple and cost-effective manner. We describe the development of a 5'-end transcriptome workflow for the SOLiD system and demonstrate the advantages in sensitivity and dynamic range offered by this tag-based application over traditional approaches for the study of whole genome gene expression. 5'-end transcriptome analysis was used to study whole genome gene expression within a colon cancer cell line, HT-29, treated with the DNA methyltransferase inhibitor, 5-aza-2'-deoxycytidine (5Aza. More than 20 million 25-base 5'-end tags were obtained from untreated and 5Aza-treated cells and matched to sequences within the human genome. Seventy three percent of the mapped unique tags were associated with RefSeq cDNA sequences, corresponding to approximately 14,000 different protein-coding genes in this single cell type. The level of expression of these genes ranged from 0.02 to 4,704 transcripts per cell. The sensitivity of a single sequence run of the SOLiD platform was 100-1,000 fold greater than that observed from 5'end SAGE data generated from the analysis of 70,000 tags obtained by Sanger sequencing. The high-resolution 5'end gene expression profiling presented in this study will not only provide novel insight into the transcriptional machinery but should also serve as a basis for a better understanding of cell biology.

  1. High resolution DNA flow cytometry of boar sperm cells in identification of boars carrying cytogenetic aberrations

    DEFF Research Database (Denmark)

    Larsen, Jacob; Christensen, Knud; Larsen, Jørgen K

    2004-01-01

    -resolution DNA flow cytometry on DAPI-stained sperm cell nuclei (CV animals judged normal by their fertility statistics and a series of seven animals with known reciprocal translocations, a model...... for identifying sperm cells from cytogenetically aberrant animals was proposed. This model was applied to a series of 50 uncharacterized animals. The model successfully identified a mosaic or chimaeric carrier of an aberrant X chromosome. However, implementation of this technique for screening purposes would...

  2. Direct observation of iron-induced conformational changes of mitochondrial DNA by high-resolution field-emission in-lens scanning electron microscopy.

    OpenAIRE

    Yaffee, M; Walter, P; Richter, C; Müller, M

    1996-01-01

    When respiring rat liver mitochondria are incubated in the presence of Fe(III) gluconate, their DNA (mtDNA) relaxes from the supercoiled to the open circular form dependent on the iron dose. Anaerobiosis or antioxidants fail to completely inhibit the unwinding. High-resolution field-emission in-lens scanning electron microscopy imaging, in concert with backscattered electron detection, pinpoints nanometer-range iron colloids bound to mtDNA isolated from iron-exposed mitochondria. High-resolut...

  3. High-Resolution Profiling of Drosophila Replication Start Sites Reveals a DNA Shape and Chromatin Signature of Metazoan Origins

    Directory of Open Access Journals (Sweden)

    Federico Comoglio

    2015-05-01

    Full Text Available At every cell cycle, faithful inheritance of metazoan genomes requires the concerted activation of thousands of DNA replication origins. However, the genetic and chromatin features defining metazoan replication start sites remain largely unknown. Here, we delineate the origin repertoire of the Drosophila genome at high resolution. We address the role of origin-proximal G-quadruplexes and suggest that they transiently stall replication forks in vivo. We dissect the chromatin configuration of replication origins and identify a rich spatial organization of chromatin features at initiation sites. DNA shape and chromatin configurations, not strict sequence motifs, mark and predict origins in higher eukaryotes. We further examine the link between transcription and origin firing and reveal that modulation of origin activity across cell types is intimately linked to cell-type-specific transcriptional programs. Our study unravels conserved origin features and provides unique insights into the relationship among DNA topology, chromatin, transcription, and replication initiation across metazoa.

  4. Transcription-factor-mediated DNA looping probed by high-resolution, single-molecule imaging in live E. coli cells.

    Directory of Open Access Journals (Sweden)

    Zach Hensel

    Full Text Available DNA looping mediated by transcription factors plays critical roles in prokaryotic gene regulation. The "genetic switch" of bacteriophage λ determines whether a prophage stays incorporated in the E. coli chromosome or enters the lytic cycle of phage propagation and cell lysis. Past studies have shown that long-range DNA interactions between the operator sequences O(R and O(L (separated by 2.3 kb, mediated by the λ repressor CI (accession number P03034, play key roles in regulating the λ switch. In vitro, it was demonstrated that DNA segments harboring the operator sequences formed loops in the presence of CI, but CI-mediated DNA looping has not been directly visualized in vivo, hindering a deep understanding of the corresponding dynamics in realistic cellular environments. We report a high-resolution, single-molecule imaging method to probe CI-mediated DNA looping in live E. coli cells. We labeled two DNA loci with differently colored fluorescent fusion proteins and tracked their separations in real time with ∼40 nm accuracy, enabling the first direct analysis of transcription-factor-mediated DNA looping in live cells. Combining looping measurements with measurements of CI expression levels in different operator mutants, we show quantitatively that DNA looping activates transcription and enhances repression. Further, we estimated the upper bound of the rate of conformational change from the unlooped to the looped state, and discuss how chromosome compaction may impact looping kinetics. Our results provide insights into transcription-factor-mediated DNA looping in a variety of operator and CI mutant backgrounds in vivo, and our methodology can be applied to a broad range of questions regarding chromosome conformations in prokaryotes and higher organisms.

  5. Inferring coarse-grain histone-DNA interaction potentials from high-resolution structures of the nucleosome

    CERN Document Server

    Meyer, Sam

    2014-01-01

    The histone-DNA interaction in the nucleosome is a fundamental mechanism of genomic compaction and regulation, which remains largely unkown despite a growing structural knowledge of the complex. Here, we propose a framework for the extraction of a nanoscale histone-DNA force-field from a collection of high-resolution structures, which may be adapted to a larger class of protein-DNA complexes. We apply the procedure on a large crystallographic database extended by snapshots from molecular dynamics simulations. The comparison of the structural models first shows that, at the sites of histone-DNA contact, the DNA base-pairs are locally shifted outwards, consistent with locally repulsive forces exerted by the histones. In a second step, we show that the various force profiles of the analyzed structures derive locally from a unique, sequence-independent, quadratic repulsive force field, while the sequence preferences are entirely due to the internal DNA mechanics. We thus obtain the first knowledge-derived nanosca...

  6. Correlation between DNA ploidy, metaphase high-resolution comparative genomic hybridization results and clinical outcome of synovial sarcoma

    Directory of Open Access Journals (Sweden)

    Papp Gergő

    2011-11-01

    Full Text Available Abstract Background Although synovial sarcoma is the 3rd most commonly occurring mesenchymal tumor in young adults, usually with a highly aggressive clinical course; remarkable differences can be seen regarding the clinical outcome. According to comparative genomic hybridization (CGH data published in the literature, the simple and complex karyotypes show a correlation between the prognosis and clinical outcome. In addition, the connection between DNA ploidy and clinical course is controversial. The aim of this study was using a fine-tuning interpretation of our DNA ploidy results and to compare these with metaphase high-resolution CGH (HR-CGH results. Methods DNA ploidy was determined on Feulgen-stained smears in 56 synovial sarcoma cases by image cytometry; follow up was available in 46 cases (average: 78 months. In 9 cases HR-CGH analysis was also available. Results 10 cases were found DNA-aneuploid, 46 were DNA-diploid by image cytometry. With fine-tuning of the diploid cases according to the 5c exceeding events (single cell aneuploidy, 33 cases were so called "simple-diploid" (without 5c exceeding events and 13 cases were "complex-diploid"; containing 5c exceeding events (any number. Aneuploid tumors contained large numbers of genetic alterations with the sum gain of at least 2 chromosomes (A-, B- or C-group detected by HR-CGH. In the "simple-diploid" cases no or few genetic alterations could be detected, whereas the "complex-diploid" samples numerous aberrations (equal or more than 3 could be found. Conclusions Our results show a correlation between the DNA-ploidy, a fine-tuned DNA-ploidy and the HR-CGH results. Furthermore, we found significant correlation between the different ploidy groups and the clinical outcome (p

  7. High-Resolution Mapping of Modified DNA Nucleobases Using Excision Repair Enzymes.

    Science.gov (United States)

    Ransom, Monica; Bryan, D Suzi; Hesselberth, Jay R

    2018-01-01

    Modification of DNA nucleobases has a profound effect on genome function. We developed a method that maps the positions of the modified DNA nucleobases throughout genomic DNA. This method couples in vitro nucleobase excision with massively parallel DNA sequencing to determine the location of modified DNA nucleobases with single base precision. This protocol was used to map uracil incorporation and UV photodimers in DNA, and a modification of the protocol has been used to map sparse modification events in cells. The Excision-seq protocol is broadly applicable to a variety of base modifications for which an excision enzyme is available.

  8. High-resolution melt-curve analysis of random-amplified-polymorphic-DNA markers, for the characterisation of pathogenic Leptospira

    DEFF Research Database (Denmark)

    Tulsiani, Suhella; Craig, S B; Graham, G C

    2010-01-01

    A new test for pathogenic Leptospira isolates, based on RAPD-PCR and high-resolution melt (HRM) analysis (which measures the melting temperature of amplicons in real time, using a fluorescent DNA-binding dye), has recently been developed. A characteristic profile of the amplicons can be used...... to define serovars or detect genotypes. Ten serovars, of leptospires from the species Leptospira interrogans (serovars Australis, Robinsoni, Hardjo, Pomona, Zanoni, Copenhageni and Szwajizak), L. borgpetersenii (serovar Arborea), L. kirschneri (serovar Cynopteri) and L. weilii (serovar Celledoni), were...... of Leptospira serotypes using a DNA-based methodology is now possible. As an objective and relatively inexpensive and rapid method of serovar identification, at least for cultured isolates, RAPD-HRM assays show convincing potential....

  9. DNA template strand sequencing of single-cells maps genomic rearrangements at high resolution

    NARCIS (Netherlands)

    Falconer, Ester; Hills, Mark; Naumann, Ulrike; Poon, Steven S. S.; Chavez, Elizabeth A.; Sanders, Ashley D.; Zhao, Yongjun; Hirst, Martin; Lansdorp, Peter M.

    2012-01-01

    DNA rearrangements such as sister chromatid exchanges (SCEs) are sensitive indicators of genomic stress and instability, but they are typically masked by single-cell sequencing techniques. We developed Strand-seq to independently sequence parental DNA template strands from single cells, making it

  10. Comparative study of IDH1 mutations in gliomas by high resolution melting analysis, immunohistochemistry and direct DNA sequencing.

    Science.gov (United States)

    Li, Juan; Zhang, Haiyan; Wang, Li; Yang, Chuanhong; Lai, Huangwen; Zhang, Wei; Chen, Xiaodong; Wang, Jie

    2015-09-01

    Patients with glioblastomas with a specific mutation in the isocitrate dehydrogenase 1 (IDH1) gene have a better prognosis than those with gliomas with wild‑type IDH1. IDH1 analysis has become part of the standard diagnostic procedure and a promising tool used for stratification in clinical trials. The present study aimed to compare high resolution melting (HRM) analysis, immunohistochemistry (IHC) and direct DNA sequencing for the detection of IDH mutations in gliomas. Fifty‑one formalin‑fixed paraffin‑embedded tumor samples were selected. For the HRM analysis and direct DNA sequencing, DNA was extracted from the tissues. For IHC, sections were stained with an anti‑IDH1‑R132H specific antibody. The HRM analysis method identified 33 cases of IDH1 gene mutations, and all mutations occurred at the R132H site. There were 33 cases of IDH1 gene mutations found by IHC, which was consistent with that identified using the HRM analysis method. However, only 30 IDH1 samples were confirmed by sequencing, in which mutations occurred at the IDH1 exon 4 R132H site. No mutation was detected in the other three of these 33 cases (two grade II oligodendroglioma and one grade II diffuse astrocytoma) by sequencing, while IHC was positive for IDH1‑R132H. The results showed that the mutation detection rate was not identified to be significantly different (P=0.250) when determined by the HRM analysis method or by direct DNA sequencing, as the concordant rate between the two methods was high (κ=0.866). The HRM analysis method in glioma IDH1 gene mutation detection has advantages of high sensitivity, good repeatability, simple operation and accurate results. It provides a novel method for detecting mutations of the IDH1 gene in paraffin embedded tissue samples of clinical glioma. Related to a small amount of sample, there was no evidence showing that HRM analysis method is superior to IHC. Direct DNA sequencing, HRM analysis and IHC results were consistent; however, HRM and

  11. High resolution hydroxyl radical footprinting of the binding of mithramycin and related antibiotics to DNA.

    OpenAIRE

    Cons, B M; Fox, K R

    1989-01-01

    The preferred binding sites for mithramycin on three different DNA fragments have been determined by hydroxyl radical footprinting. Sequences which appear as one long protected region using DNAase I as a footprinting probe are resolved into several discrete binding domains. Each drug molecule protects three bases from radical attack, though adjacent regions show attenuated cleavage. Mithramycin and the other related compounds induce similar footprinting patterns and appear to recognise GC ric...

  12. High-resolution DNA melt-curve analysis for cost-effective mass screening of pairwise species interactions.

    Science.gov (United States)

    McCarthy, James K; Didham, Raphael K; Brockerhoff, Eckehard G; van Bysterveldt, Katherine A; Varsani, Arvind

    2013-09-01

    Ecological studies of pairwise interactions are constrained by the methods available for rapid species identification of the interacting organisms. The resolution of data required to characterize species interaction networks at multiple spatio-temporal scales can be intensive, and therefore laborious and costly to collect. We explore the utility of high-resolution DNA melt-curve analysis (HRM) as a rapid species identification method. An approach was developed to identify organisms at the pairwise interaction level, with particular application to cryptic species interactions that are traditionally difficult to study. Here, we selected a challenging application; to identify the presence/absence of pathogenic fungi (Sporothrix inflata, Ophiostoma nigrocarpum and Ophiostoma galeiforme) transported by bark beetle vectors (Hylastes ater and Hylurgus ligniperda). The technique was able to distinguish between different species of DNA within a single, pooled sample. In test applications, HRM was effective in the mass screening and identification of pathogenic fungal species carried by many individual bark beetle vectors (n = 455 beetles screened) across large geographic scales. For two of the fungal species, there was no difference in the frequency of association with either of their vectors, but for the third fungal species there was a shift in vector-pathogen associations across locations. This technique allows rapid, mass screening and characterization of species interactions at a fraction of the time and cost of traditional methods. It is anticipated that this method can be readily applied to explore other cryptic species interactions, or other studies requiring rapid generation of large data sets and/or high-throughput efficiency. © 2013 John Wiley & Sons Ltd.

  13. Application of high-resolution DNA melting for genotyping in lepidopteran non-model species: Ostrinia furnacalis (Crambidae.

    Directory of Open Access Journals (Sweden)

    FengBo Li

    Full Text Available Development of an ideal marker system facilitates a better understanding of the genetic diversity in lepidopteran non-model organisms, which have abundant species, but relatively limited genomic resources. Single nucleotide polymorphisms (SNPs discovered within single-copy genes have proved to be desired markers, but SNP genotyping by current techniques remain laborious and expensive. High resolution melting (HRM curve analysis represents a simple, rapid and inexpensive genotyping method that is primarily confined to clinical and diagnostic studies. In this study, we evaluated the potential of HRM analysis for SNP genotyping in the lepidopteran non-model species Ostrinia furnacalis (Crambidae. Small amplicon and unlabeled probe assays were developed for the SNPs, which were identified in 30 females of O. furnacalis from 3 different populations by our direct sequencing. Both assays were then applied to genotype 90 unknown female DNA by prior mixing with known wild-type DNA. The genotyping results were compared with those that were obtained using bi-directional sequencing analysis. Our results demonstrated the efficiency and reliability of the HRM assays. HRM has the potential to provide simple, cost-effective genotyping assays and facilitates genotyping studies in any non-model lepidopteran species of interest.

  14. A Fossil DNA Based High Resolution Record of Holocene Planktonic Taxa and Environmental Change in the Black Sea

    Science.gov (United States)

    Coolen, M. J.; Saenz, J. P.; Trowbridge, N.; Eglinton, T.

    2007-12-01

    A standard approach to study past planktonic taxa which carry information about past environments and climate variability is the microscopic determination and enumeration of microfossils. However, most planktonic taxa are soft-bodied and in cases where microfossils are absent or difficult to identify, chemical fossils (lipid biomarkers) can be used as paleoecological tools. Nevertheless, most lipids are not very specific, multiple sources are possible, or their biological source remains unknown. Recently, we and others have shown that under excellent preservation conditions, the analysis of preserved genetic signatures (fossil DNA) offers great potential to study past planktonic communities, including soft-bodied species, at the unprecedented species- and even strain-level (this work). Given the dramatic shifts in hydrography and the present anoxia that permeates most of the water column which promotes preservation of cellular materials, the Black Sea is an excellent setting to study the ancient species composition based on fossil DNA. We developed a high temporal resolution (50-100 yr) fossil DNA and lipid biomarker based stratigraphic record of planktonic community structure in the Black Sea spanning the complete Holocene development from the first post-glacial input of Mediterranean waters in the paleo-lacustrine Black Sea to the present. Preserved genetic markers for microbial communities dwelling at the surface (algal primary producers and zooplankton), the suboxic layer (marine Crenarchaeota), and the sulfidic chemocline (green sulfur bacteria) were targeted to provide information on past environmental change in the Black Sea. Specifically, we targeted markers that contributed to our understanding of past surface water temperature, salinity and stratification. Where possible, a side-by-side phylogenetic and lipid biomarker analyses was performed in order to carefully assess the validity of utilizing the former as proxies of a given biological input. As the

  15. High-resolution mitochondrial DNA analysis sheds light on human diversity, cultural interactions, and population mobility in Northwestern Amazonia.

    Science.gov (United States)

    Arias, Leonardo; Barbieri, Chiara; Barreto, Guillermo; Stoneking, Mark; Pakendorf, Brigitte

    2017-10-27

    Northwestern Amazonia (NWA) is a center of high linguistic and cultural diversity. Several language families and linguistic isolates occur in this region, as well as different subsistence patterns, with some groups being foragers and others agriculturalists. In addition, speakers of Eastern Tukanoan languages are known for practicing linguistic exogamy, a marriage system in which partners are taken from different language groups. In this study, we use high-resolution mitochondrial DNA sequencing to investigate the impact of this linguistic and cultural diversity on the genetic relationships and population structure of NWA groups. We collected saliva samples from individuals representing 40 different NWA ethnolinguistic groups and sequenced 439 complete mitochondrial genomes to an average coverage of 1,030×. The mtDNA data revealed that NWA populations have high genetic diversity with extensive sharing of haplotypes among groups. Moreover, groups who practice linguistic exogamy have higher genetic diversity, while the foraging Nukak have lower genetic diversity. We also find that rivers play a more important role than either geography or language affiliation in structuring the genetic relationships of populations. Contrary to the view of NWA as a pristine area inhabited by small human populations living in isolation, our data support a view of high diversity and contact among different ethnolinguistic groups, with movement along rivers probably facilitating this contact. Additionally, we provide evidence for the impact of cultural practices, such as linguistic exogamy, on patterns of genetic variation. Overall, this study provides new data and insights into a remote and little-studied region of the world. © 2017 Wiley Periodicals, Inc.

  16. Validation of high-resolution DNA melting analysis for mutation scanning of the CDKL5 gene: identification of novel mutations.

    Science.gov (United States)

    Raymond, Laure; Diebold, Bertrand; Leroux, Céline; Maurey, Hélène; Drouin-Garraud, Valérie; Delahaye, Andre; Dulac, Olivier; Metreau, Julia; Melikishvili, Gia; Toutain, Annick; Rivier, François; Bahi-Buisson, Nadia; Bienvenu, Thierry

    2013-01-01

    Mutations in the cyclin-dependent kinase-like 5 gene (CDKL5) have been predominantly described in epileptic encephalopathies of female, including infantile spasms with Rett-like features. Up to now, detection of mutations in this gene was made by laborious, expensive and/or time consuming methods. Here, we decided to validate high-resolution melting analysis (HRMA) for mutation scanning of the CDKL5 gene. Firstly, using a large DNA bank consisting to 34 samples carrying different mutations and polymorphisms, we validated our analytical conditions to analyse the different exons and flanking intronic sequences of the CDKL5 gene by HRMA. Secondly, we screened CDKL5 by both HRMA and denaturing high performance liquid chromatography (dHPLC) in a cohort of 135 patients with early-onset seizures. Our results showed that point mutations and small insertions and deletions can be reliably detected by HRMA. Compared to dHPLC, HRMA profiles are more discriminated, thereby decreasing unnecessary sequencing. In this study, we identified eleven novel sequence variations including four pathogenic mutations (2.96% prevalence). HRMA appears cost-effective, easy to set up, highly sensitive, non-toxic and rapid for mutation screening, ideally suited for large genes with heterogeneous mutations located along the whole coding sequence, such as the CDKL5 gene. Copyright © 2012 Elsevier B.V. All rights reserved.

  17. Comparison of high resolution cytogenetics, fluorescence in situ hybridisation, and DNA studies to validate the diagnosis of Prader-Willi and Angelman's syndromes.

    Science.gov (United States)

    Smith, A; Prasad, M; Deng, Z M; Robson, L; Woodage, T; Trent, R J

    1995-01-01

    Eighty seven referrals with Prader-Willi syndrome and 49 with Angelman's syndrome were studied. High resolution cytogenetics was performed on all probands. Molecular studies, performed on the proband and both parents in each case, utilised multiple probes from within and distal to the 15(q11-13) region in order to establish the presence of DNA deletion or uniparental disomy. In addition, FISH, with probes at D15S11 and GABR beta 3 from the Prader-Willi syndrome/Angelman's syndrome region, was performed on a subset of 25 of these patients. In the referral group with Prader-Willi syndrome, 62 patients had a normal karyotype and 25 were deleted on high resolution cytogenetics. Twenty nine were found to be deleted with DNA techniques. In the Angelman's syndrome group, 37 had a normal karyotype and 12 were deleted on high resolution cytogenetics while 26 were deleted on molecular studies. The diagnosis was reassessed in 35 referrals with Prader-Willi syndrome and 11 with Angelman's syndrome following a non-deleted, non-disomic result. Of individuals who were neither deleted nor disomic on DNA studies, a false positive rate of 11.4% (4/35) for Prader-Willi syndrome and 16.7% (2/12) for Angelman's syndrome was found for a cytogenetically detected deletion. The false negative rate for deletion detected on high resolution cytogenetics was 19.5% (12/62) for Prader-Willi syndrome and 35% (13/37) for Angelman's syndrome. Thus high resolution cytogenetics was shown to be unreliable for deletion detection and should not be used alone to diagnose either syndrome. There were no discrepancies with FISH in 25 cases when FISH was compared with the DNA results, indicating that FISH can be used reliably for deletion detection in both syndromes. Images Figure 1 Figure 2 PMID:7618904

  18. Development of a quantitation approach for total human and male DNA based on real time PCR followed by high resolution melting analysis.

    Science.gov (United States)

    Ginart, Santiago; Caputo, Mariela; Alechine, Evguenia; Corach, Daniel; Sala, Andrea

    2016-10-01

    We developed and validated a total human DNA quantitation technique that simultaneously allows male DNA detection. This assay, called Amel-Y, is a duplex Real Time PCR followed by HRM (high resolution melting) analysis using the intercalating dye SYTO9. Amel-Y duplex produces two amplicons, one for the amelogenin gene (106/112 bp, female/male) and another (84 bp) corresponding to human Y chromosome-specific fragment to detect male DNA. After HRM analysis, two melting peaks differing in 5.3°C-5.5°C are detected if both male and female DNA are present and only one if only female DNA is present. For specificity assessment, the inclusion of high concentrations of bacterial and fungal DNA in the quantitation reactions allowed discarding species cross-reactivity. A set of crime scene evidence from forensic casework has been quantified with commercial kits and compared with Amel-Y duplex. Our method detected male DNA from a concentration of 18 pg/μL and supports autosomal/Y DNA detection ratio up to 200:1. A limitation of the technique is its inability to quantify male and female donnors in a mixed sample. The Amel-Y duplex demonstrated to be an efficient system for quantifying total human DNA being a specific, rapid, sensitive, and cost-effective method suitable for mixed DNA samples and applicable to any field where human DNA quantification is required, such as molecular diagnosis, population genetics, and forensic identification. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  19. Detection of plant oil DNA using high resolution melting (HRM) post PCR analysis: a tool for disclosure of olive oil adulteration.

    Science.gov (United States)

    Vietina, Michelangelo; Agrimonti, Caterina; Marmiroli, Nelson

    2013-12-15

    Extra virgin olive oil is frequently subjected to adulterations with addition of oils obtained from plants other than olive. DNA analysis is a fast and economic tool to identify plant components in oils. Extraction and amplification of DNA by PCR was tested in olives, in milled seeds and in oils, to investigate its use in olive oil traceability. DNA was extracted from different oils made of hazelnut, maize, sunflower, peanut, sesame, soybean, rice and pumpkin. Comparing the DNA melting profiles in reference plant materials and in the oils, it was possible to identify any plant components in oils and mixtures of oils. Real-Time PCR (RT-PCR) platform has been added of the new methodology of high resolution melting (HRM), both were used to analyse olive oils mixed with different percentage of other oils. Results showed HRM a cost effective method for efficient detection of adulterations in olive oils. Copyright © 2013 Elsevier Ltd. All rights reserved.

  20. Quantitation of 7-ethylguanine in leukocyte DNA from smokers and nonsmokers by liquid chromatography-nanoelectrospray-high resolution tandem mass spectrometry.

    Science.gov (United States)

    Balbo, Silvia; Villalta, Peter W; Hecht, Stephen S

    2011-10-17

    There is considerable evidence for the exposure of humans to an unknown ethylating agent, and some studies indicate that cigarette smoking may be one source of this exposure. Therefore, we have developed a liquid chromatography-nanoelectrospray-high resolution tandem mass spectrometry-selected reaction monitoring (LC-NSI-HRMS/MS-SRM) method for the analysis of 7-ethyl-Gua in human leukocyte DNA, a readily available source of DNA. [(15)N(5)]7-Ethyl-Gua was used as the internal standard. Leukocyte DNA was isolated and treated by thermal neutral hydrolysis. The hydrolysate was partially purified by solid-phase extraction. The fraction containing 7-ethyl-Gua was analyzed by LC-NSI-HRMS/MS-SRM using the transition m/z 180 [M + H](+)→ m/z 152.05669 [Gua + H](+) for 7-ethyl-Gua and m/z 185 → m/z 157.04187 for the internal standard. The detection limit was approximately 10 amol on column, while the limit of quantitation was about 8 fmol/μmol Gua starting with 180 μg DNA (corresponding to 36 μg DNA on-column). Leukocyte DNA samples from 30 smokers and 30 nonsmokers were analyzed. Clear peaks for 7-ethyl-Gua and the internal standard were observed in most of the samples. The mean (±SD) level of 7-ethyl-Gua measured in leukocyte DNA from smokers was 49.6 ± 43.3 (range 14.6-181) fmol/μmol Gua, while that from nonsmokers was 41.3 ± 34.9 (range 9.64-157) fmol/μmol Gua. Although a significant difference between smokers and nonsmokers was not observed, the method described here is unique in the use of high resolution mass spectrometry and establishes for the first time the presence of 7-ethyl-Gua in human leukocyte DNA.

  1. High Resolution Elevation Contours

    Data.gov (United States)

    Minnesota Department of Natural Resources — This dataset contains contours generated from high resolution data sources such as LiDAR. Generally speaking this data is 2 foot or less contour interval.

  2. Motif oriented high-resolution analysis of ChIP-seq data reveals the topological order of CTCF and cohesin proteins on DNA.

    Science.gov (United States)

    Nagy, Gergely; Czipa, Erik; Steiner, László; Nagy, Tibor; Pongor, Sándor; Nagy, László; Barta, Endre

    2016-08-15

    ChIP-seq provides a wealth of information on the approximate location of DNA-binding proteins genome-wide. It is known that the targeted motifs in most cases can be found at the peak centers. A high resolution mapping of ChIP-seq peaks could in principle allow the fine mapping of the protein constituents within protein complexes, but the current ChIP-seq analysis pipelines do not target the basepair resolution strand specific mapping of peak summits. The approach proposed here is based on i) locating regions that are bound by a sufficient number of proteins constituting a complex; ii) determining the position of the underlying motif using either a direct or a de novo motif search approach; and iii) determining the exact location of the peak summits with respect to the binding motif in a strand specific manner. We applied this method for analyzing the CTCF/cohesin complex, which holds together DNA loops. The relative positions of the constituents of the complex were determined with one-basepair estimated accuracy. Mapping the positions on a 3D model of DNA made it possible to deduce the approximate local topology of the complex that allowed us to predict how the CTCF/cohesin complex locks the DNA loops. As the positioning of the proteins was not compatible with previous models of loop closure, we proposed a plausible "double embrace" model in which the DNA loop is held together by two adjacent cohesin rings in such a way that the ring anchored by CTCF to one DNA duplex encircles the other DNA double helix and vice versa. A motif-centered, strand specific analysis of ChIP-seq data improves the accuracy of determining peak positions. If a genome contains a large number of binding sites for a given protein complex, such as transcription factor heterodimers or transcription factor/cofactor complexes, the relative position of the constituent proteins on the DNA can be established with an accuracy that allow one to deduce the local topology of the protein complex. The

  3. Ultra high resolution tomography

    Energy Technology Data Exchange (ETDEWEB)

    Haddad, W.S.

    1994-11-15

    Recent work and results on ultra high resolution three dimensional imaging with soft x-rays will be presented. This work is aimed at determining microscopic three dimensional structure of biological and material specimens. Three dimensional reconstructed images of a microscopic test object will be presented; the reconstruction has a resolution on the order of 1000 A in all three dimensions. Preliminary work with biological samples will also be shown, and the experimental and numerical methods used will be discussed.

  4. High-resolution detection of DNA binding sites of the global transcriptional regulator GlxR in Corynebacterium glutamicum

    DEFF Research Database (Denmark)

    Jungwirth, Britta; Sala, Claudia; Kohl, Thomas A

    2013-01-01

    The transcriptional regulator GlxR has been characterized as a global hub within the gene-regulatory network of Corynebacterium glutamicum. Chromatin immunoprecipitation with a specific anti-GlxR antibody and subsequent high-throughput sequencing (ChIP-seq) was applied to C. glutamicum to get new...... in vivo insights into the gene composition of the GlxR regulon. In a comparative approach, C. glutamicum cells were grown with either glucose or acetate as the sole carbon source prior to immunoprecipitation. High-throughput sequencing resulted in 69 million reads and 2.6 Gb of genomic information. After...... mapping of these data on the genome sequence of C. glutamicum, 107 enriched DNA fragments were detected from cells grown with glucose as carbon source. GlxR binding sites were identified in the sequence of 79 enriched DNA fragments, of which 21 sites were not previously reported. Electrophoretic mobility...

  5. Whole-genome amplified DNA from stored dried blood spots is reliable in high resolution melting curve and sequencing analysis

    DEFF Research Database (Denmark)

    Winkel, Bo G; Hollegaard, Mads Vilhelm; Olesen, Morten S

    2011-01-01

    The use of dried blood spots (DBS) samples in genomic workup has been limited by the relative low amounts of genomic DNA (gDNA) they contain. It remains to be proven that whole genome amplified DNA (wgaDNA) from stored DBS samples, constitutes a reliable alternative to gDNA.We wanted to compare...

  6. Metrology of DNA arrays by super-resolution microscopy.

    Science.gov (United States)

    Green, Christopher M; Schutt, Kelly; Morris, Noah; Zadegan, Reza M; Hughes, William L; Kuang, Wan; Graugnard, Elton

    2017-07-27

    Recent results in the assembly of DNA into structures and arrays with nanoscale features and patterns have opened the possibility of using DNA for sub-10 nm lithographic patterning of semiconductor devices. Super-resolution microscopy is being actively developed for DNA-based imaging and is compatible with inline optical metrology techniques for high volume manufacturing. Here, we combine DNA tile assembly with state-dependent super-resolution microscopy to introduce crystal-PAINT as a novel approach for metrology of DNA arrays. Using this approach, we demonstrate optical imaging and characterization of DNA arrays revealing grain boundaries and the temperature dependence of array quality. For finite arrays, analysis of crystal-PAINT images provides further quantitative information of array properties. This metrology approach enables defect detection and classification and facilitates statistical analysis of self-assembled DNA nanostructures.

  7. Mutational analysis of the resolution sequence of vaccinia virus DNA: essential sequence consists of two separate AT-rich regions highly conserved among poxviruses.

    Science.gov (United States)

    Merchlinsky, M

    1990-01-01

    In replicative forms of vaccinia virus DNA, the unit genomes are connected by palindromic junction fragments that are resolved into mature viral genomes with hairpin termini. Bacterial plasmids containing the junction fragment for vaccinia virus or Shope fibroma virus were converted into linear minichromosomes of vector sequence flanked by poxvirus hairpin loops after transfection into infected cells. Analysis of a series of symmetrical deletion mutations demonstrated that in vaccinia virus the presence of the DNA sequence ATTTAGTGTCTAGAAAAAAA on both sides of the apical segment of the concatemer junction is crucial for resolution. To determine the precise architecture of the resolution site, a series of site-directed mutations within this tract of nucleotides were made and the relative contribution of each nucleotide to the efficaciousness of resolution was determined. The nucleotide sequence necessary for the resolution of the vaccinia virus concatemer junction, (A/T)TTT(A/G)N7-9AAAAAAA, is highly conserved among poxviruses and found proximal to the hairpin loop in the genomes of members of the Leporipoxvirus, Avipoxvirus, and Capripoxvirus genera. Images PMID:2398534

  8. Hydroxyl radical "footprinting": high-resolution information about DNA-protein contacts and application to lambda repressor and Cro protein.

    OpenAIRE

    Tullius, T D; Dombroski, B A

    1986-01-01

    A method has been developed for making "footprints" of proteins bound to DNA. The hydroxyl radical, generated by reduction of hydrogen peroxide by iron(II), is the reagent used to cut the DNA. Hydroxyl radical breaks the backbone of DNA with almost no sequence dependence, so all backbone positions may be monitored for contact with protein. In addition to defining the DNA sequence in contact with the protein, hydroxyl radical footprints embody structural information about the DNA-protein compl...

  9. Super-resolution microscopy with DNA-PAINT.

    Science.gov (United States)

    Schnitzbauer, Joerg; Strauss, Maximilian T; Schlichthaerle, Thomas; Schueder, Florian; Jungmann, Ralf

    2017-06-01

    Super-resolution techniques have begun to transform biological and biomedical research by allowing researchers to observe structures well below the classic diffraction limit of light. DNA points accumulation for imaging in nanoscale topography (DNA-PAINT) offers an easy-to-implement approach to localization-based super-resolution microscopy, owing to the use of DNA probes. In DNA-PAINT, transient binding of short dye-labeled ('imager') oligonucleotides to their complementary target ('docking') strands creates the necessary 'blinking' to enable stochastic super-resolution microscopy. Using the programmability and specificity of DNA molecules as imaging and labeling probes allows researchers to decouple blinking from dye photophysics, alleviating limitations of current super-resolution techniques, making them compatible with virtually any single-molecule-compatible dye. Recent developments in DNA-PAINT have enabled spectrally unlimited multiplexing, precise molecule counting and ultra-high, molecular-scale (sub-5-nm) spatial resolution, reaching ∼1-nm localization precision. DNA-PAINT can be applied to a multitude of in vitro and cellular applications by linking docking strands to antibodies. Here, we present a protocol for the key aspects of the DNA-PAINT framework for both novice and expert users. This protocol describes the creation of DNA origami test samples, in situ sample preparation, multiplexed data acquisition, data simulation, super-resolution image reconstruction and post-processing such as drift correction, molecule counting (qPAINT) and particle averaging. Moreover, we provide an integrated software package, named Picasso, for the computational steps involved. The protocol is designed to be modular, so that individual components can be chosen and implemented per requirements of a specific application. The procedure can be completed in 1-2 d.

  10. ITS2 barcoding DNA region combined with high resolution melting (HRM) analysis of Hyoscyami Semen, the mature seed of Hyoscyamus niger.

    Science.gov (United States)

    Xiong, Chao; Hu, Zhi-Gang; Tu, Yuan; Liu, He-Gang; Wang, Ping; Zhao, Ming-Ming; SHIi, Yu-Hua; Wu, Lan; Sun, Wei; Chen, Shi-Lin

    2016-12-01

    Hyoscyami Semen, the mature dried seed of Hyoscyamus niger L., has long been used as a traditional Chinese medicine to treat human diseases. Hyoscyami Semen is found in local markets in China. In markets, sellers and buyers commonly inadvertently mix the seeds of H. niger with the seeds of related species such as Hygrophila salicifolia (Vahl) Nees, Astragalus complanatus R. Br., Cuscuta australis R. Br., Cuscuta chinensis Lam., and Impatiens balsamina L. because of their similar morphologies or similar names. Thus, developing a reliable method for discriminating H. niger seeds from its adulterants is necessary to reduce confusion and ensure the safe use of Hyoscyami Semen. The present study was designed to evaluate the efficiency of high-resolution melting analysis combined with DNA barcoding (Bar-HRM) with internal transcribed spacer 2 to discriminate H. niger. Our results show that Bar-HRM successfully identified the adulterants and detected the proportion of H. niger DNA extract within an admixture. In particular, HRM detected H. niger DNA extract in A. complanatus DNA extract at concentrations as low as 1%. In conclusion, the Bar-HRM method developed in the present study for authenticating H. niger is rapid and cost-effective. It can be used in the future to guarantee the purity of Hyoscyami Semen for the clinical use. Copyright © 2016 China Pharmaceutical University. Published by Elsevier B.V. All rights reserved.

  11. High-resolution melting of 12S rRNA and cytochrome b DNA sequences for discrimination of species within distinct European animal families.

    Directory of Open Access Journals (Sweden)

    Jana Naue

    Full Text Available The cheap and easy identification of species is necessary within multiple fields of molecular biology. The use of high-resolution melting (HRM of DNA provides a fast closed-tube method for analysis of the sequence composition of the mitochondrial genes 12S rRNA and cytochrome b. We investigated the potential use of HRM for species identification within eleven different animal groups commonly found in Europe by animal-group-specific DNA amplification followed by DNA melting. Influence factors as DNA amount, additional single base alterations, and the existence of mixed samples were taken into consideration. Visual inspection combined with mathematical evaluation of the curve shapes did resolve nearly all species within an animal group. The assay can therefore not only be used for identification of animal groups and mixture analysis but also for species identification within the respective groups. The use of a universal 12S rRNA system additionally revealed a possible approach for species discrimination, mostly by exclusion. The use of the HRM assay showed to be a reliable, fast, and cheap method for species discrimination within a broad range of different animal species and can be used in a flexible "modular" manner depending on the question to be solved.

  12. Human paternal and maternal demographic histories: insights from high-resolution Y chromosome and mtDNA sequences.

    Science.gov (United States)

    Lippold, Sebastian; Xu, Hongyang; Ko, Albert; Li, Mingkun; Renaud, Gabriel; Butthof, Anne; Schröder, Roland; Stoneking, Mark

    2014-01-01

    Comparisons of maternally-inherited mitochondrial DNA (mtDNA) and paternally-inherited non-recombining Y chromosome (NRY) variation have provided important insights into the impact of sex-biased processes (such as migration, residence pattern, and so on) on human genetic variation. However, such comparisons have been limited by the different molecular methods typically used to assay mtDNA and NRY variation (for example, sequencing hypervariable segments of the control region for mtDNA vs. genotyping SNPs and/or STR loci for the NRY). Here, we report a simple capture array method to enrich Illumina sequencing libraries for approximately 500 kb of NRY sequence, which we use to generate NRY sequences from 623 males from 51 populations in the CEPH Human Genome Diversity Panel (HGDP). We also obtained complete mtDNA genome sequences from the same individuals, allowing us to compare maternal and paternal histories free of any ascertainment bias. We identified 2,228 SNPs in the NRY sequences and 2,163 SNPs in the mtDNA sequences. Our results confirm the controversial assertion that genetic differences between human populations on a global scale are bigger for the NRY than for mtDNA, although the differences are not as large as previously suggested. More importantly, we find substantial regional variation in patterns of mtDNA versus NRY variation. Model-based simulations indicate very small ancestral effective population sizes (<100) for the out-of-Africa migration as well as for many human populations. We also find that the ratio of female effective population size to male effective population size (Nf/Nm) has been greater than one throughout the history of modern humans, and has recently increased due to faster growth in Nf than Nm. The NRY and mtDNA sequences provide new insights into the paternal and maternal histories of human populations, and the methods we introduce here should be widely applicable for further such studies.

  13. A high-resolution structure of a DNA-chromomycin-Co(II) complex determined from pseudocontact shifts in nuclear magnetic resonance.

    Science.gov (United States)

    Gochin, M

    2000-04-15

    The drug chromomycin-A(3) binds to the minor groove of DNA and requires a divalent metal ion for complex formation. (1)H, (31)P and (13)C pseudocontact shifts occurring in the presence of a tightly bound divalent cobalt ion in the complex between d(TTGGCCAA)(2) and chromomycin-A(3) have been used to determine the structure of the complex. The accuracy of the structure was verified by validation with nuclear Overhauser enhancements (NOEs) and J-coupling constants not used in the structure calculation. The final structure was determined to 0.7 A resolution. The structure was compared with a structure obtained in an earlier study using NOEs, in order to assess the accuracy of NOEs in giving global structural information for a DNA complex. Although some basic features of the structures agreed, they differed substantially in the fine structural details and in the DNA axis curvature generated by the drug. The distortion of base-pair planarity that was observed in the NOE structure was not seen in our structure. Differences in drug orientation and hydrogen bonding also occurred. The curvature and elongation of the DNA that was obtained previously was not found to occur in our study. The use of pseudocontact shifts has enabled us to obtain a high-precision global structure of the chromomycin-DNA complex, which provides an accurate template on which to consider targeting minor groove binding drugs. The effect of such binding is not propagated far along the helix but is restricted to a local kink in the axis that reverts to its original direction within four base pairs.

  14. Single molecule real-time DNA sequencing of HLA genes at ultra-high resolution from 126 International HLA and Immunogenetics Workshop cell lines.

    Science.gov (United States)

    Turner, T R; Hayhurst, J D; Hayward, D R; Bultitude, W P; Barker, D J; Robinson, J; Madrigal, J A; Mayor, N P; Marsh, S G E

    2018-02-01

    The hyperpolymorphic HLA genes play important roles in disease and transplantation and act as genetic markers of migration and evolution. A panel of 107 B-lymphoblastoid cell lines (B-LCLs) was established in 1987 at the 10th International Histocompatibility Workshop as a resource for the immunogenetics community. These B-LCLs are well characterised and represent diverse ethnicities and HLA haplotypes. Here we have applied Pacific Biosciences' Single Molecule Real-Time (SMRT) DNA sequencing to HLA type 126 B-LCL, including the 107 International HLA and Immunogenetics Workshop (IHIW) cells, to ultra-high resolution. Amplicon sequencing of full-length HLA class I genes (HLA-A, -B and -C) and partial length HLA class II genes (HLA-DRB1, -DQB1 and -DPB1) was performed. We typed a total of 931 HLA alleles, 895 (96%) of which were consistent with the typing in the IPD-IMGT/HLA Database (Release 3.27.0, January 20, 2017), with 595 (64%) typed at a higher resolution. Discrepant types, including novel alleles (n = 10) and changes in zygosity (n = 13), as well as previously unreported types (n = 34) were observed. In addition, patterns of linkage disequilibrium were distinguished by four-field resolution typing of HLA-B and HLA-C. By improving and standardising the HLA typing of these B-LCLs, we have ensured their continued usefulness as a resource for the immunogenetics community in the age of next generation DNA sequencing. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  15. High Time Resolution Astrophysics

    CERN Document Server

    Phelan, Don; Shearer, Andrew

    2008-01-01

    High Time Resolution Astrophysics (HTRA) is an important new window to the universe and a vital tool in understanding a range of phenomena from diverse objects and radiative processes. This importance is demonstrated in this volume with the description of a number of topics in astrophysics, including quantum optics, cataclysmic variables, pulsars, X-ray binaries and stellar pulsations to name a few. Underlining this science foundation, technological developments in both instrumentation and detectors are described. These instruments and detectors combined cover a wide range of timescales and can measure fluxes, spectra and polarisation. These advances make it possible for HTRA to make a big contribution to our understanding of the Universe in the next decade.

  16. ‘‘Blind'' mapping of genic DNA sequence polymorphisms in Lolium perenne L. by high resolution melting curve analysis

    DEFF Research Database (Denmark)

    Studer, Bruno; Jensen, Louise Bach; Fiil, Alice

    2009-01-01

    curves. In this study, HRM was used for simultaneous screening and genotyping of genic DNA sequence polymorphisms identified in the Lolium perenne F2 mapping population VrnA. Melting profiles of PCR products amplified from previously published gene loci and from a novel gene putatively involved...... knowledge of allelic sequences in the key grassland species perennial ryegrass (Lolium perenne L.)....

  17. Ultrasensitive High-Resolution Mass Spectrometric Analysis of a DNA Adduct of the Carcinogen Benzo[a]pyrene in Human Lung.

    Science.gov (United States)

    Villalta, Peter W; Hochalter, J Bradley; Hecht, Stephen S

    2017-12-05

    Benzo[a]pyrene (BaP), an archetypical polycyclic aromatic hydrocarbon, is classified as "carcinogenic to humans" and is ubiquitous in the environment, as evident by the measurable levels of BaP metabolites in virtually all human urine samples examined. BaP carcinogenicity is believed to occur mainly through its covalent modification of DNA, resulting in the formation of BPDE-N2-dG, an adduct formed between deoxyguanosine and a diol epoxide metabolite of BaP, with subsequent mutation of critical growth control genes. In spite of the liquid chromatography-mass spectrometry (LC-MS)-based detection of BPDE-N2-dG in BaP-treated rodents, and indirectly through high-performance liquid chromatography (HPLC)-fluorescence detection of BaP-7,8,9,10-tetraols released from human DNA upon acid hydrolysis, BPDE-N2-dG adducts have rarely if ever been observed directly in human samples using LC-MS techniques, even though sophisticated methodologies have been employed which should have had sufficient sensitivity. With this in mind, we developed a liquid chromatography-electrospray ionization tandem mass spectrometry (LC-ESI-MS/MS) methodology employing high-resolution/accurate mass analysis for detecting ultratrace levels of these adducts. These efforts are directly translatable to the development of sensitive detection of other small molecules using trap-based LC-ESI-MS/MS detection. The developed methodology had a limit of detection (LOD) of 1 amol of BPDE-N2-dG on-column, corresponding to 1 BPDE-N2-dG adduct per 1011 nucleotides (1 adduct per 10 human lung cells) using 40 μg of human lung DNA. To our knowledge, this is the most sensitive DNA adduct quantitation method yet reported, exceeding the sensitivity of the 32P-postlabeling assay (∼1 adduct per 1010 nucleotides). Twenty-nine human lung DNA samples resulted in 20 positive measurements above the LOD, with smoker and nonsmoker DNA containing 3.1 and 1.3 BPDE-N2-dG adducts per 1011 nucleotides, respectively.

  18. Clinical Relevance of Plasma DNA Methylation in Colorectal Cancer Patients Identified by Using a Genome-Wide High-Resolution Array.

    Science.gov (United States)

    Lin, Pei-Ching; Lin, Jen-Kou; Lin, Chien-Hsing; Lin, Hung-Hsin; Yang, Shung-Haur; Jiang, Jeng-Kai; Chen, Wei-Shone; Chou, Chih-Chi; Tsai, Shih-Feng; Chang, Shih-Ching

    2015-12-01

    DNA methylation is a potential tumor marker for several cancers, including colorectal cancer (CRC), because of its heritable and stable characteristics. Using a high-resolution, genome-wide approach, we epigenotyped >450,000 CpG sites in tumor and adjacent non-tumor tissues from 23 microsatellite instability (MSI)/microsatellite stability (MSS) CRC cases. Using matrix-assisted laser desorption ionization-time of flight mass spectrometry, the methylation status of five frequently hypermethylated genes were confirmed in 75 independent CRC series and 353 CRC patients with available plasma. Compared with non-tumor tissues, 13 MSI tumors had 34,836 (7 %) aberrant methylation sites, 87 % of which were hypermethylated. In contrast, only 9,806 (2 %) differentially methylated sites were identified in ten MSS cases (62 % hypermethylated). In both MSI and MSS, 228 promoter-associated CpG islands were hypermethylated, with AGBL4, ZNF625, MDFI, TWIST1, and FLI1 being most frequently hypermethylated. In an independent set of 35 MSI and 40 MSS cases, the methylation status of these five genes significantly differed between tumor and adjacent non-tumor tissues. Of 353 CRC patients, 230 (65.2 %), 232 (65.7 %), and 247 (70.0 %) had AGBL4, FLI1, and TWIST1 promoter hypermethylation in circulating cell-free DNA, respectively. In patients without metastasis, the sensitivity of any two or three hypermethylation markers was 52.8-57.8 and 27.9-38.9 %, respectively. The sensitivity of any two or three markers was significantly high in patients with stage IV disease (73.0 and 55.6 %, respectively). The prognostic value of these epimarkers was inconclusive. DNA methylation patterns differed in CRC subtypes. The identified hypermethylation markers in CRC patients may have good sensitivity in different CRC stages.

  19. High resolution analysis of interphase chromosome domains

    NARCIS (Netherlands)

    Visser, A. E.; Jaunin, F.; Fakan, S.; Aten, J. A.

    2000-01-01

    Chromosome territories need to be well defined at high resolution before functional aspects of chromosome organization in interphase can be explored. To visualize chromosomes by electron microscopy (EM), the DNA of Chinese hamster fibroblasts was labeled in vivo with thymidine analogue BrdU. Labeled

  20. The trans-Saharan slave trade - clues from interpolation analyses and high-resolution characterization of mitochondrial DNA lineages

    Directory of Open Access Journals (Sweden)

    Kandil Mostafa

    2010-05-01

    Full Text Available Abstract Background A proportion of 1/4 to 1/2 of North African female pool is made of typical sub-Saharan lineages, in higher frequencies as geographic proximity to sub-Saharan Africa increases. The Sahara was a strong geographical barrier against gene flow, at least since 5,000 years ago, when desertification affected a larger region, but the Arab trans-Saharan slave trade could have facilitate enormously this migration of lineages. Till now, the genetic consequences of these forced trans-Saharan movements of people have not been ascertained. Results The distribution of the main L haplogroups in North Africa clearly reflects the known trans-Saharan slave routes: West is dominated by L1b, L2b, L2c, L2d, L3b and L3d; the Center by L3e and some L3f and L3w; the East by L0a, L3h, L3i, L3x and, in common with the Center, L3f and L3w; while, L2a is almost everywhere. Ages for the haplogroups observed in both sides of the Saharan desert testify the recent origin (holocenic of these haplogroups in sub-Saharan Africa, claiming a recent introduction in North Africa, further strengthened by the no detection of local expansions. Conclusions The interpolation analyses and complete sequencing of present mtDNA sub-Saharan lineages observed in North Africa support the genetic impact of recent trans-Saharan migrations, namely the slave trade initiated by the Arab conquest of North Africa in the seventh century. Sub-Saharan people did not leave traces in the North African maternal gene pool for the time of its settlement, some 40,000 years ago.

  1. Differentiation of four strains of Chinese soft-shelled turtle (Pelodiscus sinensis) based on high-resolution melting analysis of single nucleotide polymorphism sites in mitochondrial DNA.

    Science.gov (United States)

    Zhang, H Q; Zhang, C; Xu, X J; Zhu, J J; He, Z Y; Shao, J Z

    2015-10-27

    The Chinese soft-shelled turtle (Pelodiscus sinensis) has been one of the most economically important aquatic animals in China for thousands of years, and several breeding strains have been formed. Since the morphological characteristics of some strains are similar, a rapid and accurate molecular method to differentiate between strains is required. In this study, partial sequences of mitochondrial DNA from four turtle strains, Taihu Lake Strain, Taiwan Strain, Japanese Strain, and Yellow River Strain, were amplified and sequenced based on selected strain-specific single nucleotide polymorphism (SNP) sites. The corresponding primers were designed and a high-resolution melting (HRM) technique was employed for genotyping these SNPs. The results indicated that a total of seven SNPs can be detected by HRM. Among these SNPs, one can be used for identifying the Taihu Lake Strain, one for the Japanese Strain, two for the Taiwan Strain, and three for the Yellow River Strain. This method is rapid and convenient, which offers technical support for strain identification and selective breeding in Chinese soft-shelled turtles.

  2. High resolution signal processing

    Science.gov (United States)

    Tufts, Donald W.

    1993-08-01

    Motivated by the goal of efficient, effective, high-speed integrated-circuit realization, we have discovered an algorithm for high speed Fourier analysis called the Arithmetic Fourier Transform (AFT). It is based on the number-theoretic method of Mobius inversion, a method that is well suited for integrated-circuit realization. The computation of the AFT can be carried out in parallel, pipelined channels, and the individual operations are very simple to execute and control. Except for a single scaling in each channel, all the operations are additions or subtractions. Thus, it can reduce the required power, volume, and cost. Also, analog switched-capacitor realizations of the AFT have been studied. We have also analyzed the performance of a broad and useful class of data adaptive signal estimation algorithms. This in turn has led to our proposed improvements in the methods. We have used perturbation analysis of the rank-reduced data matrix to calculate its statistical properties. The improvements made have been demonstrated by computer simulation as well as by comparison with the Cramer-Rao Bound.

  3. Enhanced High Resolution RBS System

    Science.gov (United States)

    Pollock, Thomas J.; Hass, James A.; Klody, George M.

    2011-06-01

    Improvements in full spectrum resolution with the second NEC high resolution RBS system are summarized. Results for 50 Å TiN/HfO films on Si yielding energy resolution on the order of 1 keV are also presented. Detector enhancements include improved pulse processing electronics, upgraded shielding for the MCP/RAE detector, and reduced noise generated from pumping. Energy resolution measurements on spectra front edge coupled with calculations using 0.4mStr solid angle show that beam energy spread at 400 KeV from the Pelletron® accelerator is less than 100 eV. To improve user throughput, magnet control has been added to the automatic data collection. Depth profiles derived from experimental data are discussed. For the thin films profiled, depth resolutions were on the Angstrom level with the non-linear energy/channel conversions ranging from 100 to 200 eV.

  4. High Spatiotemporal Resolution Prostate MRI

    Science.gov (United States)

    2017-09-01

    AWARD NUMBER: W81XWH-15-1-0341 TITLE: High Spatiotemporal Resolution Prostate MRI PRINCIPAL INVESTIGATOR: Stephen J. Riederer, Ph.D...Resolution Prostate MRI 5a. CONTRACT NUMBER 5b. GRANT NUMBER W81XWH-15-1-0341 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR(S) Stephen J. Riederer E-Mail...overall purpose of this project is to develop improved means using MRI for detecting prostate cancer with the potential for differentiating disease

  5. Identification of BRCA1/2 founder mutations in Southern Chinese breast cancer patients using gene sequencing and high resolution DNA melting analysis.

    Directory of Open Access Journals (Sweden)

    Ava Kwong

    Full Text Available BACKGROUND: Ethnic variations in breast cancer epidemiology and genetics have necessitated investigation of the spectra of BRCA1 and BRCA2 mutations in different populations. Knowledge of BRCA mutations in Chinese populations is still largely unknown. We conducted a multi-center study to characterize the spectra of BRCA mutations in Chinese breast and ovarian cancer patients from Southern China. METHODOLOGY/PRINCIPAL FINDINGS: A total of 651 clinically high-risk breast and/or ovarian cancer patients were recruited from the Hong Kong Hereditary Breast Cancer Family Registry from 2007 to 2011. Comprehensive BRCA1 and BRCA2 mutation screening was performed using bi-directional sequencing of all coding exons of BRCA1 and BRCA2. Sequencing results were confirmed by in-house developed full high resolution DNA melting (HRM analysis. Among the 451 probands analyzed, 69 (15.3% deleterious BRCA mutations were identified, comprising 29 in BRCA1 and 40 in BRCA2. The four recurrent BRCA1 mutations (c.470_471delCT, c.3342_3345delAGAA, c.5406+1_5406+3delGTA and c.981_982delAT accounted for 34.5% (10/29 of all BRCA1 mutations in this cohort. The four recurrent BRCA2 mutations (c.2808_2811delACAA, c.3109C>T, c.7436_7805del370 and c.9097_9098insA accounted for 40% (16/40 of all BRCA2 mutations. Haplotype analysis was performed to confirm 1 BRCA1 and 3 BRCA2 mutations are putative founder mutations. Rapid HRM mutation screening for a panel of the founder mutations were developed and validated. CONCLUSION: In this study, our findings suggest that BRCA mutations account for a substantial proportion of hereditary breast/ovarian cancer in Southern Chinese population. Knowing the spectrum and frequency of the founder mutations in this population will assist in the development of a cost-effective rapid screening assay, which in turn facilitates genetic counseling and testing for the purpose of cancer risk assessment.

  6. Identification of BRCA1/2 founder mutations in Southern Chinese breast cancer patients using gene sequencing and high resolution DNA melting analysis.

    Science.gov (United States)

    Kwong, Ava; Ng, Enders Kai On; Wong, Chris Lei Po; Law, Fian Bic Fai; Au, Tommy; Wong, Hong Nei; Kurian, Allison W; West, Dee W; Ford, James M; Ma, Edmond Siu Kwan

    2012-01-01

    Ethnic variations in breast cancer epidemiology and genetics have necessitated investigation of the spectra of BRCA1 and BRCA2 mutations in different populations. Knowledge of BRCA mutations in Chinese populations is still largely unknown. We conducted a multi-center study to characterize the spectra of BRCA mutations in Chinese breast and ovarian cancer patients from Southern China. A total of 651 clinically high-risk breast and/or ovarian cancer patients were recruited from the Hong Kong Hereditary Breast Cancer Family Registry from 2007 to 2011. Comprehensive BRCA1 and BRCA2 mutation screening was performed using bi-directional sequencing of all coding exons of BRCA1 and BRCA2. Sequencing results were confirmed by in-house developed full high resolution DNA melting (HRM) analysis. Among the 451 probands analyzed, 69 (15.3%) deleterious BRCA mutations were identified, comprising 29 in BRCA1 and 40 in BRCA2. The four recurrent BRCA1 mutations (c.470_471delCT, c.3342_3345delAGAA, c.5406+1_5406+3delGTA and c.981_982delAT) accounted for 34.5% (10/29) of all BRCA1 mutations in this cohort. The four recurrent BRCA2 mutations (c.2808_2811delACAA, c.3109C>T, c.7436_7805del370 and c.9097_9098insA) accounted for 40% (16/40) of all BRCA2 mutations. Haplotype analysis was performed to confirm 1 BRCA1 and 3 BRCA2 mutations are putative founder mutations. Rapid HRM mutation screening for a panel of the founder mutations were developed and validated. In this study, our findings suggest that BRCA mutations account for a substantial proportion of hereditary breast/ovarian cancer in Southern Chinese population. Knowing the spectrum and frequency of the founder mutations in this population will assist in the development of a cost-effective rapid screening assay, which in turn facilitates genetic counseling and testing for the purpose of cancer risk assessment.

  7. Detection and characterization of Leishmania (Leishmania and Leishmania (Viannia by SYBR green-based real-time PCR and high resolution melt analysis targeting kinetoplast minicircle DNA.

    Directory of Open Access Journals (Sweden)

    Marcello Ceccarelli

    Full Text Available Leishmaniasis is a neglected disease with a broad clinical spectrum which includes asymptomatic infection. A thorough diagnosis, able to distinguish and quantify Leishmania parasites in a clinical sample, constitutes a key step in choosing an appropriate therapy, making an accurate prognosis and performing epidemiological studies. Several molecular techniques have been shown to be effective in the diagnosis of leishmaniasis. In particular, a number of PCR methods have been developed on various target DNA sequences including kinetoplast minicircle constant regions. The first aim of this study was to develop a SYBR green-based qPCR assay for Leishmania (Leishmania infantum detection and quantification, using kinetoplast minicircle constant region as target. To this end, two assays were compared: the first used previously published primer pairs (qPCR1, whereas the second used a nested primer pairs generating a shorter PCR product (qPCR2. The second aim of this study was to evaluate the possibility to discriminate among subgenera Leishmania (Leishmania and Leishmania (Viannia using the qPCR2 assay followed by melting or High Resolution Melt (HRM analysis. Both assays used in this study showed good sensitivity and specificity, and a good correlation with standard IFAT methods in 62 canine clinical samples. However, the qPCR2 assay allowed to discriminate between Leishmania (Leishmania and Leishmania (Viannia subgenera through melting or HRM analysis. In addition to developing assays, we investigated the number and genetic variability of kinetoplast minicircles in the Leishmania (L. infantum WHO international reference strain (MHOM/TN/80/IPT1, highlighting the presence of minicircle subclasses and sequence heterogeneity. Specifically, the kinetoplast minicircle number per cell was estimated to be 26,566±1,192, while the subclass of minicircles amplifiable by qPCR2 was estimated to be 1,263±115. This heterogeneity, also observed in canine clinical

  8. Requirements on high resolution detectors

    Energy Technology Data Exchange (ETDEWEB)

    Koch, A. [European Synchrotron Radiation Facility, Grenoble (France)

    1997-02-01

    For a number of microtomography applications X-ray detectors with a spatial resolution of 1 {mu}m are required. This high spatial resolution will influence and degrade other parameters of secondary importance like detective quantum efficiency (DQE), dynamic range, linearity and frame rate. This note summarizes the most important arguments, for and against those detector systems which could be considered. This article discusses the mutual dependencies between the various figures which characterize a detector, and tries to give some ideas on how to proceed in order to improve present technology.

  9. High resolution tomographic instrument development

    Energy Technology Data Exchange (ETDEWEB)

    1992-01-01

    Our recent work has concentrated on the development of high-resolution PET instrumentation reflecting in part the growing importance of PET in nuclear medicine imaging. We have developed a number of positron imaging instruments and have the distinction that every instrument has been placed in operation and has had an extensive history of application for basic research and clinical study. The present program is a logical continuation of these earlier successes. PCR-I, a single ring positron tomograph was the first demonstration of analog coding using BGO. It employed 4 mm detectors and is currently being used for a wide range of biological studies. These are of immense importance in guiding the direction for future instruments. In particular, PCR-II, a volume sensitive positron tomograph with 3 mm spatial resolution has benefited greatly from the studies using PCR-I. PCR-II is currently in the final stages of assembly and testing and will shortly be placed in operation for imaging phantoms, animals and ultimately humans. Perhaps the most important finding resulting from our previous study is that resolution and sensitivity must be carefully balanced to achieve a practical high resolution system. PCR-II has been designed to have the detection characteristics required to achieve 3 mm resolution in human brain under practical imaging situations. The development of algorithms by the group headed by Dr. Chesler is based on a long history of prior study including his joint work with Drs. Pelc and Reiderer and Stearns. This body of expertise will be applied to the processing of data from PCR-II when it becomes operational.

  10. High resolution tomographic instrument development

    Energy Technology Data Exchange (ETDEWEB)

    1992-08-01

    Our recent work has concentrated on the development of high-resolution PET instrumentation reflecting in part the growing importance of PET in nuclear medicine imaging. We have developed a number of positron imaging instruments and have the distinction that every instrument has been placed in operation and has had an extensive history of application for basic research and clinical study. The present program is a logical continuation of these earlier successes. PCR-I, a single ring positron tomograph was the first demonstration of analog coding using BGO. It employed 4 mm detectors and is currently being used for a wide range of biological studies. These are of immense importance in guiding the direction for future instruments. In particular, PCR-II, a volume sensitive positron tomograph with 3 mm spatial resolution has benefited greatly from the studies using PCR-I. PCR-II is currently in the final stages of assembly and testing and will shortly be placed in operation for imaging phantoms, animals and ultimately humans. Perhaps the most important finding resulting from our previous study is that resolution and sensitivity must be carefully balanced to achieve a practical high resolution system. PCR-II has been designed to have the detection characteristics required to achieve 3 mm resolution in human brain under practical imaging situations. The development of algorithms by the group headed by Dr. Chesler is based on a long history of prior study including his joint work with Drs. Pelc and Reiderer and Stearns. This body of expertise will be applied to the processing of data from PCR-II when it becomes operational.

  11. Comparison of high-resolution melting analysis with direct sequencing for the detection of recurrent mutations in DNA methyltransferase 3A and isocitrate dehydrogenase 1 and 2 genes in acute myeloid leukemia patients.

    Science.gov (United States)

    Gorniak, Patryk; Ejduk, Anna; Borg, Katarzyna; Makuch-Lasica, Hanna; Nowak, Grazyna; Lech-Maranda, Ewa; Prochorec-Sobieszek, Monika; Warzocha, Krzysztof; Juszczynski, Przemyslaw

    2016-02-01

    Acute myeloid leukemia (AML) cells harbor frequent mutations in genes responsible for epigenetic modifications. Increasing evidence of clinical role of DNMT3A and IDH1/2 mutations highlights the need for a robust and inexpensive test to identify these mutations in routine diagnostic work-up. Herein, we compared routinely used direct sequencing method with high-resolution melting (HRM) assay for screening DNMT3A and IDH1/2 mutations in patients with AML. We show very high concordance between HRM and Sanger sequencing (100% samples for IDH2-R140 and DNMT3-R882 mutations, 99% samples for IDH1-R132 and IDH2-R172 mutations). HRM method reported no false-negative results, suggesting that it can be used for mutations screening. Moreover, HRM displayed much higher sensitivity in comparison with DNA sequencing in all assessed loci. With Sanger sequencing, robust calls were observed when the sample contained 50% of mutant DNA in the background of wild-type DNA. In marked contrast, the detection limit of HRM improved down to 10% of mutated DNA. Given the ubiquitous presence of wild-type DNA background in bone marrow aspirates and clonal variations regarding mutant allele burden, these results favor HRM as a sensitive, specific, labor-, and cost-effective tool for screening and detection of mutations in IDH1/2 and DNMT3A genes in patients with AML. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  12. Section on High Resolution Optical Imaging (HROI)

    Data.gov (United States)

    Federal Laboratory Consortium — The Section on High Resolution Optical Imaging (HROI) develops novel technologies for studying biological processes at unprecedented speed and resolution. Research...

  13. Particles with similar LET values generate DNA breaks of different complexity and reparability: a high-resolution microscopy analysis of γH2AX/53BP1 foci.

    Science.gov (United States)

    Jezkova, Lucie; Zadneprianetc, Mariia; Kulikova, Elena; Smirnova, Elena; Bulanova, Tatiana; Depes, Daniel; Falkova, Iva; Boreyko, Alla; Krasavin, Evgeny; Davidkova, Marie; Kozubek, Stanislav; Valentova, Olga; Falk, Martin

    2018-01-18

    Biological effects of high-LET (linear energy transfer) radiation have received increasing attention, particularly in the context of more efficient radiotherapy and space exploration. Efficient cell killing by high-LET radiation depends on the physical ability of accelerated particles to generate complex DNA damage, which is largely mediated by LET. However, the characteristics of DNA damage and repair upon exposure to different particles with similar LET parameters remain unexplored. We employed high-resolution confocal microscopy to examine phosphorylated histone H2AX (γH2AX)/p53-binding protein 1 (53BP1) focus streaks at the microscale level, focusing on the complexity, spatiotemporal behaviour and repair of DNA double-strand breaks generated by boron and neon ions accelerated at similar LET values (∼135 keV μm-1) and low energies (8 and 47 MeV per n, respectively). Cells were irradiated using sharp-angle geometry and were spatially (3D) fixed to maximize the resolution of these analyses. Both high-LET radiation types generated highly complex γH2AX/53BP1 focus clusters with a larger size, increased irregularity and slower elimination than low-LET γ-rays. Surprisingly, neon ions produced even more complex γH2AX/53BP1 focus clusters than boron ions, consistent with DSB repair kinetics. Although the exposure of cells to γ-rays and boron ions eliminated a vast majority of foci (94% and 74%, respectively) within 24 h, 45% of the foci persisted in cells irradiated with neon. Our calculations suggest that the complexity of DSB damage critically depends on (increases with) the particle track core diameter. Thus, different particles with similar LET and energy may generate different types of DNA damage, which should be considered in future research.

  14. Binding of an organo-osmium(II) anticancer complex to guanine and cytosine on DNA revealed by electron-based dissociations in high resolution Top-Down FT-ICR mass spectrometry.

    Science.gov (United States)

    Wootton, Christopher A; Sanchez-Cano, Carlos; Liu, Hong-Ke; Barrow, Mark P; Sadler, Peter J; O'Connor, Peter B

    2015-02-28

    The Os(II) arene anticancer complex [(η(6)-bip)Os(en)Cl](+) (Os1-Cl; where bip = biphenyl, and en = ethylenediamine) binds strongly to DNA. Here we investigate reactions between Os1-Cl and the self-complementary 12-mer oligonucleotide 5'-TAGTAATTACTA-3' (DNA12) using ultra high resolution Fourier Transform-Ion Cyclotron Resonance Mass Spectrometry (FT-ICR MS). Identification of the specific sites of DNA osmiation with {(η(6)-bip)Os(en)}(2+) was made possible by the use of Electron Detachment Dissociation (EDD) which produced a wide range of assignable osmiated MS/MS fragments. In contrast, the more commonly used CAD and IRMPD techniques produced fragments which lose the bound osmium. These studies reveal that not only is guanine G3 a strong binding site for {(η(6)-bip)Os(en)}(2+) but, unexpectedly, so too is cytosine C10. Interestingly, the G3/C10 di-osmiated adduct of DNA12 also formed readily but did not undergo such facile fragmentation by EDD, perhaps due to folding induced by van der Waal's interactions of the bound osmium arene species. These new insights into osmium arene DNA adducts should prove valuable for the design of new organometallic drugs and contribute to understanding the lack of cross resistance of this organometallic anticancer complex with cisplatin.

  15. High-resolution multiphoton cryomicroscopy.

    Science.gov (United States)

    König, Karsten; Uchugonova, Aisada; Breunig, Hans Georg

    2014-03-15

    An ultracompact high-resolution multiphoton cryomicroscope with a femtosecond near infrared fiber laser has been utilized to study the cellular autofluorescence during freezing and thawing of cells. Cooling resulted in an increase of the intracellular fluorescence intensity followed by morphological modifications at temperatures below -10 °C, depending on the application of the cryoprotectant DMSO and the cooling rate. Furthermore, fluorescence lifetime imaging revealed an increase of the mean lifetime with a decrease in temperature. Non-destructive, label-free optical biopsies of biomaterial in ice can be obtained with sub-20 mW mean powers. Copyright © 2013 Elsevier Inc. All rights reserved.

  16. Solar corona at high resolution

    Science.gov (United States)

    Golub, L.; Rosner, R.; Zombeck, M. V. Z.; Vaiana, G. S.

    1982-01-01

    The earth's surface is shielded from solar X rays almost completely by the atmosphere. It is, therefore, necessary to place X-ray detectors on rockets or orbiting satellites. Solar rays were detected for the first time in the late 1940's, using V-2 rockets. In 1960, the first true X-ray images of the sun were obtained with the aid of a simple pinhole camera. The spatial resolution of the X-ray images could be considerably improved by making use of reflective optics, operating at grazing incidence. Aspects of X-ray mirror developments are discussed along with the results obtained in coronal studies utilizing the new devices for the observation of solar X-ray emission. It is pointed out that the major achievements of the Skylab missions were due primarily to the unique opportunity to obtain data over an extended period of time. Attention is given to normal incidence X-ray optics, achievements possible by making use of high spatial resolution optics, and details of improved mirror design.

  17. Universal Super-Resolution Multiplexing by DNA Exchange.

    Science.gov (United States)

    Schueder, Florian; Strauss, Maximilian T; Hoerl, David; Schnitzbauer, Joerg; Schlichthaerle, Thomas; Strauss, Sebastian; Yin, Peng; Harz, Hartmann; Leonhardt, Heinrich; Jungmann, Ralf

    2017-03-27

    Super-resolution microscopy allows optical imaging below the classical diffraction limit of light with currently up to 20× higher spatial resolution. However, the detection of multiple targets (multiplexing) is still hard to implement and time-consuming to conduct. Here, we report a straightforward sequential multiplexing approach based on the fast exchange of DNA probes which enables efficient and rapid multiplexed target detection with common super-resolution techniques such as (d)STORM, STED, and SIM. We assay our approach using DNA origami nanostructures to quantitatively assess labeling, imaging, and washing efficiency. We furthermore demonstrate the applicability of our approach by imaging multiple protein targets in fixed cells. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. Evaluation of Advanced Bionics high resolution mode.

    Science.gov (United States)

    Buechner, Andreas; Frohne-Buechner, Carolin; Gaertner, Lutz; Lesinski-Schiedat, Anke; Battmer, Rolf-Dieter; Lenarz, Thomas

    2006-07-01

    The objective of this paper is to evaluate the advantages of the Advanced Bionic high resolution mode for speech perception, through a retrospective analysis. Forty-five adult subjects were selected who had a minimum experience of three months' standard mode (mean of 10 months) before switching to high resolution mode. Speech perception was tested in standard mode immediately before fitting with high resolution mode, and again after a maximum of six months high resolution mode usage (mean of two months). A significant improvement was found, between 11 and 17%, depending on the test material. The standard mode preference does not give any indication about the improvement when switching to high resolution. Users who are converted within any study achieve a higher performance improvement than those converted in the clinical routine. This analysis proves the significant benefits of high resolution mode for users, and also indicates the need for guidelines for individual optimization of parameter settings in a high resolution mode program.

  19. High-resolution infrared imaging

    Science.gov (United States)

    Falco, Charles M.

    2010-08-01

    The hands and mind of an artist are intimately involved in the creative process of image formation, intrinsically making paintings significantly more complex than photographs to analyze. In spite of this difficulty, several years ago the artist David Hockney and I identified optical evidence within a number of paintings that demonstrated artists began using optical projections as early as c1425 - nearly 175 years before Galileo - as aids for producing portions of their images. In the course of our work, Hockney and I developed insights that I have been applying to a new approach to computerized image analysis. Recently I developed and characterized a portable high resolution infrared for capturing additional information from paintings. Because many pigments are semi-transparent in the IR, in a number of cases IR photographs ("reflectograms") have revealed marks made by the artists that had been hidden under paint ever since they were made. I have used this IR camera to capture photographs ("reflectograms") of hundreds of paintings in over a dozen museums on three continents and, in some cases, these reflectograms have provided new insights into decisions the artists made in creating the final images that we see in the visible.

  20. VT Hydrography Dataset - High Resolution NHD

    Data.gov (United States)

    Vermont Center for Geographic Information — (Link to Metadata) The Vermont Hydrography Dataset (VHD) is compliant with the local resolution (also known as High Resolution) National Hydrography Dataset (NHD)...

  1. High Resolution, High Frame Rate Video Technology

    Science.gov (United States)

    1990-01-01

    Papers and working group summaries presented at the High Resolution, High Frame Rate Video (HHV) Workshop are compiled. HHV system is intended for future use on the Space Shuttle and Space Station Freedom. The Workshop was held for the dual purpose of: (1) allowing potential scientific users to assess the utility of the proposed system for monitoring microgravity science experiments; and (2) letting technical experts from industry recommend improvements to the proposed near-term HHV system. The following topics are covered: (1) State of the art in the video system performance; (2) Development plan for the HHV system; (3) Advanced technology for image gathering, coding, and processing; (4) Data compression applied to HHV; (5) Data transmission networks; and (6) Results of the users' requirements survey conducted by NASA.

  2. Roles of DNA polymerase I in leading and lagging-strand replication defined by a high-resolution mutation footprint of ColE1 plasmid replication.

    Science.gov (United States)

    Allen, Jennifer M; Simcha, David M; Ericson, Nolan G; Alexander, David L; Marquette, Jacob T; Van Biber, Benjamin P; Troll, Chris J; Karchin, Rachel; Bielas, Jason H; Loeb, Lawrence A; Camps, Manel

    2011-09-01

    DNA polymerase I (pol I) processes RNA primers during lagging-strand synthesis and fills small gaps during DNA repair reactions. However, it is unclear how pol I and pol III work together during replication and repair or how extensive pol I processing of Okazaki fragments is in vivo. Here, we address these questions by analyzing pol I mutations generated through error-prone replication of ColE1 plasmids. The data were obtained by direct sequencing, allowing an accurate determination of the mutation spectrum and distribution. Pol I's mutational footprint suggests: (i) during leading-strand replication pol I is gradually replaced by pol III over at least 1.3 kb; (ii) pol I processing of Okazaki fragments is limited to ∼20 nt and (iii) the size of Okazaki fragments is short (∼250 nt). While based on ColE1 plasmid replication, our findings are likely relevant to other pol I replicative processes such as chromosomal replication and DNA repair, which differ from ColE1 replication mostly at the recruitment steps. This mutation footprinting approach should help establish the role of other prokaryotic or eukaryotic polymerases in vivo, and provides a tool to investigate how sequence topology, DNA damage, or interactions with protein partners may affect the function of individual DNA polymerases.

  3. High-resolution neutron tomography

    Energy Technology Data Exchange (ETDEWEB)

    Mikerov, V.I. [P.N. Lebedev Physical Inst., RAN, Moscow (Russian Federation); Zhitnik, I.A. [P.N. Lebedev Physical Inst., RAN, Moscow (Russian Federation); Ignat`ev, A.P. [P.N. Lebedev Physical Inst., RAN, Moscow (Russian Federation); Isakov, A.I. [P.N. Lebedev Physical Inst., RAN, Moscow (Russian Federation); Korneev, V.V. [P.N. Lebedev Physical Inst., RAN, Moscow (Russian Federation); Krutov, V.V. [P.N. Lebedev Physical Inst., RAN, Moscow (Russian Federation); Kuzin, S.V. [P.N. Lebedev Physical Inst., RAN, Moscow (Russian Federation); Oparin, S.N. [P.N. Lebedev Physical Inst., RAN, Moscow (Russian Federation); Pertsov, A.A. [P.N. Lebedev Physical Inst., RAN, Moscow (Russian Federation); Podolyak, E.R. [P.N. Lebedev Physical Inst., RAN, Moscow (Russian Federation); Sobel`man, I.I. [P.N. Lebedev Physical Inst., RAN, Moscow (Russian Federation); Tindo, I.P. [P.N. Lebedev Physical Inst., RAN, Moscow (Russian Federation); Tukarev, B.A. [P.N. Lebedev Physical Inst., RAN, Moscow (Russian Federation)

    1995-12-31

    A neutron tomography technique with a coordinate resolution of several tens of micrometers has been developed. Our results indicate that the technique resolves details with dimensions less than 100 {mu}m and measures a linear attenuation of less than {approx} 0.1 cm{sup -1}. Tomograms can be reconstructed using incomplete data. Limits on the resolution of the restored pattern are analyzed, and ways to improve the sensitivity of the technique are discussed. (orig.).

  4. High-resolution DNA analysis of human embryonic stem cell lines reveals culture-induced copy number changes and loss of heterozygosity

    Czech Academy of Sciences Publication Activity Database

    Närvä, E.; Autio, R.; Rahkonen, N.; Kong, L.; Harrison, N.; Kitsberg, D.; Borghese, L.; Itskovitz-Eldor, J.; Rasool, O.; Dvořák, Petr; Hovatta, O.; Otonkoski, T.; Tuuri, T.; Cui, W.; Brüstle, O.; Baker, D.; Maltby, E.; Moore, H. D.; Benvenisty, N.; Andrews, P.W.; Yli-Harja, O.; Lehesmaa, R.

    2010-01-01

    Roč. 28, č. 4 (2010), s. 371-U103 ISSN 1087-0156 Institutional research plan: CEZ:AV0Z50390512 Keywords : DNA * stem cell * cancer Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 31.085, year: 2010

  5. High-resolution analysis of DNA copy number alterations in rectal cancer. Correlation with metastasis, survival, and mRNA expression

    Energy Technology Data Exchange (ETDEWEB)

    Doyen, Jerome; Gerard, Jean-Pierre [Centre Antoine-Lacassagne, Department of Radiation Oncology, Nice (France); University of Nice Sophia-Antipolis, Nice (France); Letouze, Eric; Marisa, Laetitia; Reynies, Aurelien de [Ligue Nationale Contre Le Cancer, Programme Cartes d' Identite des Tumeurs, Paris (France); Milano, Gerard; Etienne-Grimaldi, Marie-Christine [University of Nice Sophia-Antipolis, Nice (France); Centre Antoine-Lacassagne, Oncopharmacology Unit, Nice (France); Olschwang, Sylviane [INSERM U1068, Marseille (France); Gaedcke, Jochen; Ghadimi, Michael [University Medical Center Goettingen, Department of General and Visceral Surgery, Goettingen (Germany)

    2014-11-15

    This study aimed to determine the candidate genes and chromosomal imbalances capable of predicting occurrences of metastasis in patients with rectal cancer. Fresh frozen tumor tissues from 80 patients with rectal cancer were prospectively collected and analyzed using Affymetrix HG-U133 Plus 2.0 gene expression arrays and high-resolution Illumina single-nucleotide polymorphism (SNP) arrays. Endpoints of the study were metastasis-free survival (MFS) and cancer-specific survival (CSS). The median follow-up was 102 months (1-146). Deletions of 8p and 1p36-35 correlated with worse MFS (p = 0.005 and p = 0.01, respectively) and CSS (p = 0.001 and p = 0.01, respectively). Multivariate analysis identified 8p deletion as an independent prognostic factor for MFS (p = 0.04) and CSS (p = 0.003); 97 genes located on the 8p chromosome were significantly underexpressed in tumors with 8p deletion. This study shows for the first time in rectal cancer an independent correlation of 8p deletion with MFS and CSS and highlights potential new tumor suppressor genes. (orig.) [German] Diese Studie zielt darauf ab, Kandidatengene und chromosomale Ungleichgewichte vorherzusagen und das Auftreten von Metastasen bei Rektumkarzinompatienten zu bestimmen. Frisch gefrorenes Tumorgewebe von 80 Patienten mit Rektumkarzinom wurde prospektiv erfasst und mit Affymetrix-(HG-U133-Plus-2.0)-Genexpressionsarrays und hochaufloesenden Illumina-Single-Nukleotid-Polymorphismus-(SNP-)Arrays analysiert. Endpunkte der Studie waren fernmetastasenfreies Ueberleben (MFU) und krebsspezifisches Ueberleben (KSU). Die mediane Nachbeobachtungszeit betrug 102 Monate (1-146 Monate). Die Deletionen von 8p und 1p36-35 waren mit schlechterem MFU (jeweils p = 0,005 und p = 0,01) und KSU (jeweils p = 0,001 und p = 0,01) korreliert. Die multivariate Analyse identifizierte - 8p als unabhaengigen prognostischen Faktor fuer MFU (p = 0,04) und KSU (p = 0,003). In Tumoren mit einer 8p-Deletion waren 97 Gene auf Chromosom 8p

  6. Rapid analysis of heterogeneously methylated DNA using digital methylation-sensitive high resolution melting: application to the CDKN2B (p15) gene

    DEFF Research Database (Denmark)

    Candiloro, Ida Lm; Mikeska, Thomas; Hokland, Peter

    2008-01-01

    MS-HRM) that involves the amplification of single templates after limiting dilution to quantify and to determine the degree of methylation. We used this approach to study methylation of the CDKN2B (p15) cell cycle progression inhibitor gene which is inactivated by DNA methylation in haematological malignancies...... and other heterogeneously methylated genes. It eliminates both PCR and cloning bias towards either methylated or unmethylated DNA. Potentially complex information is simplified into a digital output, allowing counting of methylated and unmethylated alleles and providing an overall picture of methylation...... at the given locus. Downstream sequencing is minimised as dMS-HRM acts as a screen to select only methylated clones for further analysis....

  7. High-resolution electron microscopy

    CERN Document Server

    Spence, John C H

    2013-01-01

    This new fourth edition of the standard text on atomic-resolution transmission electron microscopy (TEM) retains previous material on the fundamentals of electron optics and aberration correction, linear imaging theory (including wave aberrations to fifth order) with partial coherence, and multiple-scattering theory. Also preserved are updated earlier sections on practical methods, with detailed step-by-step accounts of the procedures needed to obtain the highest quality images of atoms and molecules using a modern TEM or STEM electron microscope. Applications sections have been updated - these include the semiconductor industry, superconductor research, solid state chemistry and nanoscience, and metallurgy, mineralogy, condensed matter physics, materials science and material on cryo-electron microscopy for structural biology. New or expanded sections have been added on electron holography, aberration correction, field-emission guns, imaging filters, super-resolution methods, Ptychography, Ronchigrams, tomogr...

  8. Unearthing the ecology of soil microorganisms using a high resolution DNA-SIP approach to explore cellulose and xylose metabolism in soil

    Directory of Open Access Journals (Sweden)

    Charles ePepe-Ranney

    2016-05-01

    Full Text Available We explored microbial contributions to decomposition using a sophisticated approach to DNA Stable Isotope Probing (SIP. Our experiment evaluated the dynamics and ecological characteristics of functionally defined microbial groups that metabolize labile and structural C in soils. We added to soil a complex amendment representing plant derived organic matter substituted with either 13C-xylose or 13C-cellulose to represent labile and structural C pools derived from abundant components of plant biomass. We found evidence for 13C-incorporation into DNA from 13C-xylose and 13C-cellulose in 49 and 63 operational taxonomic units (OTUs, respectively. The types of microorganisms that assimilated 13C in the 13C-xylose treatment changed over time being predominantly Firmicutes at day 1 followed by Bacteroidetes at day 3 and then Actinobacteria at day 7. These 13C-labeling dynamics suggest labile C traveled through different trophic levels. In contrast, microorganisms generally metabolized cellulose-C after 14 days and did not change to the same extent in phylogenetic composition over time. Microorganisms that metabolized cellulose-C belonged to poorly characterized but cosmopolitan soil lineages including Verrucomicrobia, Chloroflexi and Planctomycetes.

  9. Influence of DNA Lesions on Polymerase-Mediated DNA Replication at Single-Molecule Resolution.

    Science.gov (United States)

    Gahlon, Hailey L; Romano, Louis J; Rueda, David

    2017-11-20

    Faithful replication of DNA is a critical aspect in maintaining genome integrity. DNA polymerases are responsible for replicating DNA, and high-fidelity polymerases do this rapidly and at low error rates. Upon exposure to exogenous or endogenous substances, DNA can become damaged and this can alter the speed and fidelity of a DNA polymerase. In this instance, DNA polymerases are confronted with an obstacle that can result in genomic instability during replication, for example, by nucleotide misinsertion or replication fork collapse. It is important to know how DNA polymerases respond to damaged DNA substrates to understand the mechanism of mutagenesis and chemical carcinogenesis. Single-molecule techniques have helped to improve our current understanding of DNA polymerase-mediated DNA replication, as they enable the dissection of mechanistic details that can otherwise be lost in ensemble-averaged experiments. These techniques have also been used to gain a deeper understanding of how single DNA polymerases behave at the site of the damage in a DNA substrate. In this review, we evaluate single-molecule studies that have examined the interaction between DNA polymerases and damaged sites on a DNA template.

  10. High Resolution Imaging with AEOS

    Energy Technology Data Exchange (ETDEWEB)

    Patience, J; Macintosh, B A; Max, C E

    2001-08-27

    The U. S. Air Force Advanced Electro-Optical System (AEOS) which includes a 941 actuator adaptive optics system on a 3.7m telescope has recently been made available for astronomical programs. Operating at a wavelength of 750 nm, the diffraction-limited angular resolution of the system is 0.04 inches; currently, the magnitude limit is V {approx} 7 mag. At the distances of nearby open clusters, diffraction-limited images should resolve companions with separations as small as 4-6 AU--comparable to the Sun-Jupiter distance. The ability to study such close separations is critical, since most companions are expected to have separations in the few AU to tens of AU range. With the exceptional angular resolution of the current AEOS setup, but restricted target magnitude range, we are conducting a companion search of a large, well-defined sample of bright early-type stars in nearby open clusters and in the field. Our data set will both characterize this relatively new adaptive optics system and answer questions in binary star formation and stellar X-ray activity. We will discuss our experience using AEOS, the data analysis involved, and our initial results.

  11. High Resolution Silicon Deformable Mirrors Project

    Data.gov (United States)

    National Aeronautics and Space Administration — This proposal describes a plan to build a prototype small stroke, high precision deformable mirror suitable for space-based operation in systems for high-resolution...

  12. High Resolution DNA Stable Isotope Probing Reveals that Root Exudate Addition to Soil Changes the Identity of the Microbes that Degrade Cellulose but not the Rate of Degradation

    Science.gov (United States)

    Campbell, A.; Pepe-Ranney, C. P.; Nguyen, A. V. T.; Buckley, D. H.

    2015-12-01

    Plant roots release compounds, such as root exudates, which can alter soil organic matter (SOM) decomposition and have large impacts on soil carbon (C) retention. The changes in SOM turnover resulting from the addition of organic and/or inorganic substrates are termed 'priming effects'. In this study we examine the effects of root exudates on the priming of cellulose added as particulate organic matter. We amended soil microcosms with 13C-cellulose in the presence or absence of artificial root exudate additions and incubated over time for 45 days. Soils receiving the root exudate (RE) were given either one large dose or multiple, small doses of RE. In each treatment we tracked operational taxonomic units (OTUs) assimilating 13C from cellulose (herein, known as a 'responder') over time using DNA stable isotope probing coupled with next generation sequencing. In all treatments the same amount of cellulose-13C was respired indicating the addition of RE did not result in the priming of cellulose decomposition. However, cellulose responders were different depending on treatment and time of sampling (days 14, 28 and 45). We identified a total of 10,361 OTUs, of which there were 369 cellulose responders in the cellulose only treatment, 273 in the repeated, small dose RE treatment, and 358 in the RE single, large dose treatment. Most of the cellulose responders found in all treatments belonged to phyla Bacteroidetes, Planctomycetes, Proteobacteria, Verrucomicrobia, and Chloroflexi. The response time of phyla varies; for instance, more OTUs in Bacteroidetes were observed on day 14 and diminish with each subsequent sampling time. On the other hand, OTUs in Verrucomicrobia increased in response over time. Our study shows no priming effect resulting from the addition of root exudates, although the identity of the microbial mediators of cellulose decomposition varies in each treatment.

  13. High-Resolution Data for a Low-Resolution World

    Energy Technology Data Exchange (ETDEWEB)

    Brady, Brendan Williams [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2016-05-10

    In the past 15 years, the upper section of Cañon de Valle has been severely altered by wildfires and subsequent runoff events. Loss of root structures on high-angle slopes results in debris flow and sediment accumulation in the narrow canyon bottom. The original intent of the study described here was to better understand the changes occurring in watershed soil elevations over the course of several post-fire years. An elevation dataset from 5 years post-Cerro Grande fire was compared to high-resolution LiDAR data from 14 years post-Cerro Grande fire (also 3 years post-Las Conchas fire). The following analysis was motivated by a problematic comparison of these datasets of unlike resolution, and therefore focuses on what the data reveals of itself. The objective of this study is to highlight the effects vegetation can have on remote sensing data that intends to read ground surface elevation.

  14. Identification of BRCA1/2 Founder Mutations in Southern Chinese Breast Cancer Patients Using Gene Sequencing and High Resolution DNA Melting Analysis

    OpenAIRE

    Ava Kwong; Enders Kai On Ng; Chris Lei Po Wong; Fian Bic Fai Law; Tommy Au; Hong Nei Wong; Kurian, Allison W.; West, Dee W.; Ford, James M.; Edmond Siu Kwan Ma

    2012-01-01

    Background: Ethnic variations in breast cancer epidemiology and genetics have necessitated investigation of the spectra of BRCA1 and BRCA2 mutations in different populations. Knowledge of BRCA mutations in Chinese populations is still largely unknown. We conducted a multi-center study to characterize the spectra of BRCA mutations in Chinese breast and ovarian cancer patients from Southern China. Methodology/Principal Findings: A total of 651 clinically high-risk breast and/or ovarian cancer p...

  15. Single-molecule kinetics and super-resolution microscopy by fluorescence imaging of transient binding on DNA origami.

    Science.gov (United States)

    Jungmann, Ralf; Steinhauer, Christian; Scheible, Max; Kuzyk, Anton; Tinnefeld, Philip; Simmel, Friedrich C

    2010-11-10

    DNA origami is a powerful method for the programmable assembly of nanoscale molecular structures. For applications of these structures as functional biomaterials, the study of reaction kinetics and dynamic processes in real time and with high spatial resolution becomes increasingly important. We present a single-molecule assay for the study of binding and unbinding kinetics on DNA origami. We find that the kinetics of hybridization to single-stranded extensions on DNA origami is similar to isolated substrate-immobilized DNA with a slight position dependence on the origami. On the basis of the knowledge of the kinetics, we exploit reversible specific binding of labeled oligonucleotides to DNA nanostructures for PAINT (points accumulation for imaging in nanoscale topography) imaging with <30 nm resolution. The method is demonstrated for flat monomeric DNA structures as well as multimeric, ribbon-like DNA structures.

  16. High Resolution Silicon Deformable Mirrors Project

    Data.gov (United States)

    National Aeronautics and Space Administration — In this proposal we describe a plan to build a deformable mirror suitable for space-based operation in systems for high-resolution imaging. The prototype DM will be...

  17. Ultra-high resolution coded wavefront sensor

    KAUST Repository

    Wang, Congli

    2017-06-08

    Wavefront sensors and more general phase retrieval methods have recently attracted a lot of attention in a host of application domains, ranging from astronomy to scientific imaging and microscopy. In this paper, we introduce a new class of sensor, the Coded Wavefront Sensor, which provides high spatio-temporal resolution using a simple masked sensor under white light illumination. Specifically, we demonstrate megapixel spatial resolution and phase accuracy better than 0.1 wavelengths at reconstruction rates of 50 Hz or more, thus opening up many new applications from high-resolution adaptive optics to real-time phase retrieval in microscopy.

  18. Structure of high-resolution NMR spectra

    CERN Document Server

    Corio, PL

    2012-01-01

    Structure of High-Resolution NMR Spectra provides the principles, theories, and mathematical and physical concepts of high-resolution nuclear magnetic resonance spectra.The book presents the elementary theory of magnetic resonance; the quantum mechanical theory of angular momentum; the general theory of steady state spectra; and multiple quantum transitions, double resonance and spin echo experiments.Physicists, chemists, and researchers will find the book a valuable reference text.

  19. Radiation length imaging with high resolution telescopes

    OpenAIRE

    Stolzenberg, U.; Frey, A.; Schwenker, B; Wieduwilt, P.; Marinas, C; Lütticke, F.

    2016-01-01

    The construction of low mass vertex detectors with a high level of system integration is of great interest for next generation collider experiments. Radiation length images with a sufficient spatial resolution can be used to measure and disentangle complex radiation length $X$/$X_0$ profiles and contribute to the understanding of vertex detector systems. Test beam experiments with multi GeV particle beams and high-resolution tracking telescopes provide an opportunity to obtain precise 2D imag...

  20. High resolution quantum metrology via quantum interpolation

    Science.gov (United States)

    Ajoy, Ashok; Liu, Yixiang; Saha, Kasturi; Marseglia, Luca; Jaskula, Jean-Christophe; Cappellaro, Paola

    2016-05-01

    Nitrogen Vacancy (NV) centers in diamond are a promising platform for quantum metrology - in particular for nanoscale magnetic resonance imaging to determine high resolution structures of single molecules placed outside the diamond. The conventional technique for sensing of external nuclear spins involves monitoring the effects of the target nuclear spins on the NV center coherence under dynamical decoupling (the CPMG/XY8 pulse sequence). However, the nuclear spin affects the NV coherence only at precise free evolution times - and finite timing resolution set by hardware often severely limits the sensitivity and resolution of the method. In this work, we overcome this timing resolution barrier by developing a technique to supersample the metrology signal by effectively implementing a quantum interpolation of the spin system dynamics. This method will enable spin sensing at high magnetic fields and high repetition rate, allowing significant improvements in sensitivity and spectral resolution. We experimentally demonstrate a resolution boost by over a factor of 100 for spin sensing and AC magnetometry. The method is shown to be robust, versatile to sensing normal and spurious signal harmonics, and ultimately limited in resolution only by the number of pulses that can be applied.

  1. High resolution technology for FPD lithography tools

    Science.gov (United States)

    Yabu, Nobuhiko; Nagai, Yoshiyuki; Tomura, Satoshi; Yoshikawa, Tomohiro

    2013-06-01

    As the resolution of LCD panels adapted for Smartphone and Tablet PC rapidly becomes higher, the performance needed for lithography tools to produce them also becomes higher than ever. To respond to such needs, we have developed new lithography tools for mass production of high resolution LCD panels. We have executed various exposure tests to evaluate their performance. In this paper, we present the results of these tests. By employing higher NA projection optics, high resolution (2.0μm and under) has been achieved. We also present the effect of special illumination and the difference in profile between kinds of photoresist. Furthermore, we also refer what will be needed for masks and blanks in the next generation. To achieve even higher resolution, it is necessary for masks and blanks to have high flatness, low level of defects and small linewidth error.

  2. Placing molecules with Bohr radius resolution using DNA origami.

    Science.gov (United States)

    Funke, Jonas J; Dietz, Hendrik

    2016-01-01

    Molecular self-assembly with nucleic acids can be used to fabricate discrete objects with defined sizes and arbitrary shapes. It relies on building blocks that are commensurate to those of biological macromolecular machines and should therefore be capable of delivering the atomic-scale placement accuracy known today only from natural and designed proteins. However, research in the field has predominantly focused on producing increasingly large and complex, but more coarsely defined, objects and placing them in an orderly manner on solid substrates. So far, few objects afford a design accuracy better than 5 nm, and the subnanometre scale has been reached only within the unit cells of designed DNA crystals. Here, we report a molecular positioning device made from a hinged DNA origami object in which the angle between the two structural units can be controlled with adjuster helices. To test the positioning capabilities of the device, we used photophysical and crosslinking assays that report the coordinate of interest directly with atomic resolution. Using this combination of placement and analysis, we rationally adjusted the average distance between fluorescent molecules and reactive groups from 1.5 to 9 nm in 123 discrete displacement steps. The smallest displacement step possible was 0.04 nm, which is slightly less than the Bohr radius. The fluctuation amplitudes in the distance coordinate were also small (±0.5 nm), and within a factor of two to three of the amplitudes found in protein structures.

  3. High-Resolution PET Detector. Final report

    Energy Technology Data Exchange (ETDEWEB)

    Karp, Joel

    2014-03-26

    The objective of this project was to develop an understanding of the limits of performance for a high resolution PET detector using an approach based on continuous scintillation crystals rather than pixelated crystals. The overall goal was to design a high-resolution detector, which requires both high spatial resolution and high sensitivity for 511 keV gammas. Continuous scintillation detectors (Anger cameras) have been used extensively for both single-photon and PET scanners, however, these instruments were based on NaI(Tl) scintillators using relatively large, individual photo-multipliers. In this project we investigated the potential of this type of detector technology to achieve higher spatial resolution through the use of improved scintillator materials and photo-sensors, and modification of the detector surface to optimize the light response function.We achieved an average spatial resolution of 3-mm for a 25-mm thick, LYSO continuous detector using a maximum likelihood position algorithm and shallow slots cut into the entrance surface.

  4. Heterodyne high-spectral-resolution lidar.

    Science.gov (United States)

    Chouza, Fernando; Witschas, Benjamin; Reitebuch, Oliver

    2017-10-10

    In this work, a novel lidar technique to perform high-spectral-resolution measurements of the atmospheric backscatter is discussed and the first results are presented. The proposed method, which relies on a heterodyne detection receiver, allows us not only to separate the molecular and the aerosol component of the atmospheric backscatter, but also to investigate the spectral shape of the Rayleigh-Brillouin line. As in the case of the direct-detection high-spectral-resolution lidars, the separation of the different scattering processes would allow an independent system calibration and aerosol extinction measurements. The proposed retrieval technique was successfully tested on the Deutsches Zentrum für Luft- und Raumfahrt airborne Doppler wind lidar system with measurements conducted during different measurement campaigns and under different atmospheric conditions. In light of these results, further ideas for the implementation of a dedicated heterodyne high-spectral-resolution lidar are discussed.

  5. Customized MFM probes with high lateral resolution

    Directory of Open Access Journals (Sweden)

    Óscar Iglesias-Freire

    2016-07-01

    Full Text Available Magnetic force microscopy (MFM is a widely used technique for magnetic imaging. Besides its advantages such as the high spatial resolution and the easy use in the characterization of relevant applied materials, the main handicaps of the technique are the lack of control over the tip stray field and poor lateral resolution when working under standard conditions. In this work, we present a convenient route to prepare high-performance MFM probes with sub-10 nm (sub-25 nm topographic (magnetic lateral resolution by following an easy and quick low-cost approach. This allows one to not only customize the tip stray field, avoiding tip-induced changes in the sample magnetization, but also to optimize MFM imaging in vacuum (or liquid media by choosing tips mounted on hard (or soft cantilevers, a technology that is currently not available on the market.

  6. Rapid HLA class I DNA typing using microtiter plate-reverse hybridization assay (MRHA) by simple thermoregulation: high-resolution subtyping of the HLA-A2 and -B40 antigen groups.

    Science.gov (United States)

    Moribe, T; Kaneshige, T; Inagawa, A; Nakatani, S; Hirai, H; Morita, F; Ito, Y; Inoko, H

    1999-06-01

    We have established a precise, rapid, simple and economical subtyping method for alleles encoding the HLA-A2 and -B40 antigens using microtiter plate-reverse hybridization assay (MRHA), which is based on the general principle of HLA oligotyping by reverse dot blot hybridization. Amino-modified sequence-specific oligonucleotide (SSO) probes were immobilized covalently onto a carboxylate-modified microtiter plate. In order to perform high-resolution subtyping of the HLA-A2 and -B40 antigen groups, the alpha1 and alpha2 domain regions were amplified using a pair of group-specific primers composed of an unlabeled sense primer and a biotinylated antisense primer. PCR-amplified products were hybridized with SSO probes in hybridization buffer containing formamide for 1 hour at 37 degrees C. After washing with 2 X SSC at room temperature, the bound PCR products were detected by alkaline phosphatase-conjugated streptavidine followed by color development. All of 8 HLA-B40 suballeles, all of 2 HLA-B47 suballeles (B40 group-specific primers used in this study allowed also B47 amplification) and 17 out of 21 HLA-A2 suballeles were discriminated. The remaining four HLA-A2 suballeles were determined by analysis after exon 4 amplification. HLA-DNA typing by this method was easily and exactly performed regardless of sample number. The greatest advantages of this technique are strong positive signals obtained, reproducibility and the ease of thermoregulation for hybridization and washing as compared to previously reported microtiter plate hybridization methods.

  7. Qualitative interpretation of high resolution aeromagnetic (HRAM ...

    African Journals Online (AJOL)

    Qualitative interpretation of high resolution aeromagnetic (HRAM) data from some parts of offshore Niger delta, Nigeria. ... Open Access DOWNLOAD FULL TEXT ... The original raster map, obtained from the Nigeria Geological Survey Agency (NGSA) in half degree sheet, was subjected to qualitative data analysis using the ...

  8. A High-Resolution Stopwatch for Cents

    Science.gov (United States)

    Gingl, Z.; Kopasz, K.

    2011-01-01

    A very low-cost, easy-to-make stopwatch is presented to support various experiments in mechanics. The high-resolution stopwatch is based on two photodetectors connected directly to the microphone input of a sound card. Dedicated free open-source software has been developed and made available to download. The efficiency is demonstrated by a free…

  9. Compressive sensing for high resolution radar imaging

    NARCIS (Netherlands)

    Anitori, L.; Otten, M.P.G.; Hoogeboom, P.

    2010-01-01

    In this paper we present some preliminary results on the application of Compressive Sensing (CS) to high resolution radar imaging. CS is a recently developed theory which allows reconstruction of sparse signals with a number of measurements much lower than what is required by the Shannon sampling

  10. Compact high-resolution spectral phase shaper

    NARCIS (Netherlands)

    Postma, S.; van der Walle, P.; Offerhaus, Herman L.; van Hulst, N.F.

    2005-01-01

    The design and operation of a high-resolution spectral phase shaper with a footprint of only 7×10 cm2 is presented. The liquid-crystal modulator has 4096 elements. More than 600 independent degrees of freedom can be positioned with a relative accuracy of 1 pixel. The spectral shaping of pulses from

  11. Influence of DNA-dye complex stability on separation resolution in microchip electrophoresis.

    Science.gov (United States)

    Lo, Roger C; Joffe, Aaron M

    2012-03-01

    Different markers have been used to label DNA for sample detection in gel electrophoresis. Intercalating dyes, (e.g., YOYO) have been widely used to label DNA for sample detection, because they do not require the use of radioisotopes, covalent attachment or enzyme reactions. The labeling of DNA fragments can be achieved by simply mixing solutions of the intercalating dye and DNA sample. However, the separation quality of DNA labeled with intercalating dyes is greatly influenced by the buffer used, which affects the DNA-dye complex stability. In this study, we investigated the effects of DNA-dye complex stability on separation resolution of dsDNA migrating in a photopolymerized polyacrylamide gel by measuring mobility and dispersion coefficients on a microfluidic chip and comparing predicted separation resolution under different dye and buffer conditions. We found that a buffer containing tetrapentylammonium (NPe(4)(+)) yielded better separation resolution than the frequently used TBE buffer on our microchip electrophoresis system.

  12. A Portable, High Resolution, Surface Measurement Device

    Science.gov (United States)

    Ihlefeld, Curtis M.; Burns, Bradley M.; Youngquist, Robert C.

    2012-01-01

    A high resolution, portable, surface measurement device has been demonstrated to provide micron-resolution topographical plots. This device was specifically developed to allow in-situ measurements of defects on the Space Shuttle Orbiter windows, but is versatile enough to be used on a wide variety of surfaces. This paper discusses the choice of an optical sensor and then the decisions required to convert a lab bench optical measurement device into an ergonomic portable system. The necessary trade-offs between performance and portability are presented along with a description of the device developed to measure Orbiter window defects.

  13. High-Resolution, Two-Wavelength Pyrometer

    Science.gov (United States)

    Bickler, Donald B.; Henry, Paul K.; Logiurato, D. Daniel

    1989-01-01

    Modified two-color pyrometer measures temperatures of objects with high spatial resolution. Image focused on hole 0.002 in. (0.05 mm) in diameter in brass sheet near end of bundle, causing image to be distributed so fibers covered by defocused radiation from target. Pinhole ensures radiation from only small part of target scene reaches detector, thus providing required spatial resolution. By spreading radiation over bundle, pinhole ensures entire active area of detectors utilized. Produces signal as quiet as conventional instruments but with only 1/64 input radiation.

  14. High Resolution Regional Climate Simulations over Alaska

    Science.gov (United States)

    Monaghan, A. J.; Clark, M. P.; Arnold, J.; Newman, A. J.; Musselman, K. N.; Barlage, M. J.; Xue, L.; Liu, C.; Gutmann, E. D.; Rasmussen, R.

    2016-12-01

    In order to appropriately plan future projects to build and maintain infrastructure (e.g., dams, dikes, highways, airports), a number of U.S. federal agencies seek to better understand how hydrologic regimes may shift across the country due to climate change. Building on the successful completion of a series of high-resolution WRF simulations over the Colorado River Headwaters and contiguous USA, our team is now extending these simulations over the challenging U.S. States of Alaska and Hawaii. In this presentation we summarize results from a newly completed 4-km resolution WRF simulation over Alaska spanning 2002-2016 at 4-km spatial resolution. Our aim is to gain insight into the thermodynamics that drive key precipitation processes, particularly the extremes that are most damaging to infrastructure.

  15. Constructing a WISE High Resolution Galaxy Atlas

    Science.gov (United States)

    Jarrett, T. H.; Masci, F.; Tsai, C. W.; Petty, S.; Cluver, M.; Assef, Roberto J.; Benford, D.; Blain, A.; Bridge, C.; Donoso, E.; hide

    2012-01-01

    After eight months of continuous observations, the Wide-field Infrared Survey Explorer (WISE) mapped the entire sky at 3.4 micron, 4.6 micron, 12 micron, and 22 micron. We have begun a dedicated WISE High Resolution Galaxy Atlas project to fully characterize large, nearby galaxies and produce a legacy image atlas and source catalog. Here we summarize the deconvolution techniques used to significantly improve the spatial resolution of WISE imaging, specifically designed to study the internal anatomy of nearby galaxies. As a case study, we present results for the galaxy NGC 1566, comparing the WISE enhanced-resolution image processing to that of Spitzer, Galaxy Evolution Explorer, and ground-based imaging. This is the first paper in a two-part series; results for a larger sample of nearby galaxies are presented in the second paper.

  16. Superconducting High Resolution Fast-Neutron Spectrometers

    Energy Technology Data Exchange (ETDEWEB)

    Hau, Ionel Dragos [Univ. of California, Berkeley, CA (United States)

    2006-01-01

    Superconducting high resolution fast-neutron calorimetric spectrometers based on 6LiF and TiB{sub 2} absorbers have been developed. These novel cryogenic spectrometers measure the temperature rise produced in exothermal (n, α) reactions with fast neutrons in 6Li and 10B-loaded materials with heat capacity C operating at temperatures T close to 0.1 K. Temperature variations on the order of 0.5 mK are measured with a Mo/Cu thin film multilayer operated in the transition region between its superconducting and its normal state. The advantage of calorimetry for high resolution spectroscopy is due to the small phonon excitation energies kBT on the order of μeV that serve as signal carriers, resulting in an energy resolution ΔE ~ (kBT2C)1/2, which can be well below 10 keV. An energy resolution of 5.5 keV has been obtained with a Mo/Cu superconducting sensor and a TiB2 absorber using thermal neutrons from a 252Cf neutron source. This resolution is sufficient to observe the effect of recoil nuclei broadening in neutron spectra, which has been related to the lifetime of the first excited state in 7Li. Fast-neutron spectra obtained with a 6Li-enriched LiF absorber show an energy resolution of 16 keV FWHM, and a response in agreement with the 6Li(n, α)3H reaction cross section and Monte Carlo simulations for energies up to several MeV. The energy resolution of order of a few keV makes this novel instrument applicable to fast-neutron transmission spectroscopy based on the unique elemental signature provided by the neutron absorption and scattering resonances. The optimization of the energy resolution based on analytical and numerical models of the detector response is discussed in the context of these applications.

  17. Low-resolution structure of vaccinia virus DNA replication machinery.

    Science.gov (United States)

    Sèle, Céleste; Gabel, Frank; Gutsche, Irina; Ivanov, Ivan; Burmeister, Wim P; Iseni, Frédéric; Tarbouriech, Nicolas

    2013-02-01

    Smallpox caused by the poxvirus variola virus is a highly lethal disease that marked human history and was eradicated in 1979 thanks to a worldwide mass vaccination campaign. This virus remains a significant threat for public health due to its potential use as a bioterrorism agent and requires further development of antiviral drugs. The viral genome replication machinery appears to be an ideal target, although very little is known about its structure. Vaccinia virus is the prototypic virus of the Orthopoxvirus genus and shares more than 97% amino acid sequence identity with variola virus. Here we studied four essential viral proteins of the replication machinery: the DNA polymerase E9, the processivity factor A20, the uracil-DNA glycosylase D4, and the helicase-primase D5. We present the recombinant expression and biochemical and biophysical characterizations of these proteins and the complexes they form. We show that the A20D4 polymerase cofactor binds to E9 with high affinity, leading to the formation of the A20D4E9 holoenzyme. Small-angle X-ray scattering yielded envelopes for E9, A20D4, and A20D4E9. They showed the elongated shape of the A20D4 cofactor, leading to a 150-Å separation between the polymerase active site of E9 and the DNA-binding site of D4. Electron microscopy showed a 6-fold rotational symmetry of the helicase-primase D5, as observed for other SF3 helicases. These results favor a rolling-circle mechanism of vaccinia virus genome replication similar to the one suggested for tailed bacteriophages.

  18. High-resolution flurescence spectroscopy in immunoanalysis

    Energy Technology Data Exchange (ETDEWEB)

    Grubor, Nenad M. [Iowa State Univ., Ames, IA (United States)

    2005-01-01

    The work presented in this dissertation combines highly sensitive and selective fluorescence line-narrowing spectroscopy (FLNS) detection with various modes of immunoanalytical techniques. It has been shown that FLNS is capable of directly probing molecules immunocomplexed with antibodies, eliminating analytical ambiguities that may arise from interferences that accompany traditional immunochemical techniques. Moreover, the utilization of highly cross-reactive antibodies for highly specific analyte determination has been demonstrated. Finally, they demonstrate the first example of the spectral resolution of diastereomeric analytes based on their interaction with a cross-reactive antibody.

  19. High-Resolution Broadband Spectral Interferometry

    Energy Technology Data Exchange (ETDEWEB)

    Erskine, D J; Edelstein, J

    2002-08-09

    We demonstrate solar spectra from a novel interferometric method for compact broadband high-resolution spectroscopy. The spectral interferometer (SI) is a hybrid instrument that uses a spectrometer to externally disperse the output of a fixed-delay interferometer. It also has been called an externally dispersed interferometer (EDI). The interferometer can be used with linear spectrometers for imaging spectroscopy or with echelle spectrometers for very broad-band coverage. EDI's heterodyning technique enhances the spectrometer's response to high spectral-density features, increasing the effective resolution by factors of several while retaining its bandwidth. The method is extremely robust to instrumental insults such as focal spot size or displacement. The EDI uses no moving parts, such as purely interferometric FTS spectrometers, and can cover a much wider simultaneous bandpass than other internally dispersed interferometers (e.g. HHS or SHS).

  20. High Resolution Spectra of HE Detonations

    Science.gov (United States)

    1980-07-07

    region. We shall assume for present purposes that the emissivity of the detonation products of a 50 to 100 lb HE explosion is also in the viciity of... speed . Incorporated in the emulsion layers are dye forming coup- lers which react simultaneously during I , developmentto produce a separate dye S...Best Available Cop 1~EV~ AFTAC-TR-80-24 HIGH RESOLUTION SPECTRA OF HE DETONATIONS HSS Inc 2 Alfred Circle Bedford, MA 01730 7 JULY 1980 AUG 4 9D

  1. High resolution NMR theory and chemical applications

    CERN Document Server

    Becker, Edwin D

    1969-01-01

    High Resolution NMR: Theory and Chemical Applications focuses on the applications of nuclear magnetic resonance (NMR), as well as chemical shifts, lattices, and couplings. The book first offers information on the theory of NMR, including nuclear spin and magnetic moment, spin lattice relaxation, line widths, saturation, quantum mechanical description of NMR, and ringing. The text then ponders on instrumentation and techniques and chemical shifts. Discussions focus on the origin of chemical shifts, reference compounds, empirical correlations of chemical shifts, modulation and phase detection,

  2. High resolution measurement of the glycolytic rate

    Directory of Open Access Journals (Sweden)

    Carla X Bittner

    2010-09-01

    Full Text Available The glycolytic rate is sensitive to physiological activity, hormones, stress, aging and malignant transformation. Standard techniques to measure the glycolytic rate are based on radioactive isotopes, are not able to resolve single cells and have poor temporal resolution, limitations that hamper the study of energy metabolism in the brain and other organs. A new method is described in this article, which makes use of a recently-developed FRET glucose nanosensor to measure the rate of glycolysis in single cells with high temporal resolution. Used in cultured astrocytes, the method showed for the first time that glycolysis can be activated within seconds by a combination of glutamate and K+, supporting a role for astrocytes in neurometabolic and neurovascular coupling in the brain. It was also possible to make a direct comparison of metabolism in neurons and astrocytes lying in close proximity, paving the way to a high-resolution characterization of brain energy metabolism. Single-cell glycolytic rates were also measured in fibroblasts, adipocytes, myoblasts and tumor cells, showing higher rates for undifferentiated cells and significant metabolic heterogeneity within cell types. This method should facilitate the investigation of tissue metabolism at the single-cell level and is readily adaptable for high-throughput analysis.

  3. High-resolution mapping of bifurcations in nonlinear biochemical circuits

    Science.gov (United States)

    Genot, A. J.; Baccouche, A.; Sieskind, R.; Aubert-Kato, N.; Bredeche, N.; Bartolo, J. F.; Taly, V.; Fujii, T.; Rondelez, Y.

    2016-08-01

    Analog molecular circuits can exploit the nonlinear nature of biochemical reaction networks to compute low-precision outputs with fewer resources than digital circuits. This analog computation is similar to that employed by gene-regulation networks. Although digital systems have a tractable link between structure and function, the nonlinear and continuous nature of analog circuits yields an intricate functional landscape, which makes their design counter-intuitive, their characterization laborious and their analysis delicate. Here, using droplet-based microfluidics, we map with high resolution and dimensionality the bifurcation diagrams of two synthetic, out-of-equilibrium and nonlinear programs: a bistable DNA switch and a predator-prey DNA oscillator. The diagrams delineate where function is optimal, dynamics bifurcates and models fail. Inverse problem solving on these large-scale data sets indicates interference from enzymatic coupling. Additionally, data mining exposes the presence of rare, stochastically bursting oscillators near deterministic bifurcations.

  4. High Resolution Bathymetry Estimation Improvement with Single Image Super-Resolution Algorithm Super-Resolution Forests

    Science.gov (United States)

    2017-01-26

    Naval Research Laboratory Washington, DC 20375-5320 NRL/MR/5514--17-9692 High Resolution Bathymetry Estimation Improvement with Single Image Super...collection of information is estimated to average 1 hour per response, including the time for reviewing instructions, searching existing data sources...gathering and maintaining the data needed, and completing and reviewing this collection of information. Send comments regarding this burden estimate

  5. Single DNA molecule patterning for high-throughput epigenetic mapping.

    Science.gov (United States)

    Cerf, Aline; Cipriany, Benjamin R; Benítez, Jaime J; Craighead, Harold G

    2011-11-01

    We present a method for profiling the 5-methyl cytosine distribution on single DNA molecules. Our method combines soft-lithography and molecular elongation to form ordered arrays estimated to contain more than 250 000 individual DNA molecules immobilized on a solid substrate. The methylation state of the DNA is detected and mapped by binding of fluorescently labeled methyl-CpG binding domain peptides to the elongated dsDNA molecules and imaging of their distribution. The stretched molecules are fixed in their extended configuration by adsorption onto the substrate so analysis can be performed with high spatial resolution and signal averaging. We further prove this technique allows imaging of DNA molecules with different methylation states.

  6. Molecular Dynamics Simulation of High Density DNA Arrays

    Directory of Open Access Journals (Sweden)

    Rudolf Podgornik

    2018-01-01

    Full Text Available Densely packed DNA arrays exhibit hexagonal and orthorhombic local packings, as well as a weakly first order transition between them. While we have some understanding of the interactions between DNA molecules in aqueous ionic solutions, the structural details of its ordered phases and the mechanism governing the respective phase transitions between them remains less well understood. Since at high DNA densities, i.e., small interaxial spacings, one can neither neglect the atomic details of the interacting macromolecular surfaces nor the atomic details of the intervening ionic solution, the atomistic resolution is a sine qua non to properly describe and analyze the interactions between DNA molecules. In fact, in order to properly understand the details of the observed osmotic equation of state, one needs to implement multiple levels of organization, spanning the range from the molecular order of DNA itself, the possible ordering of counterions, and then all the way to the induced molecular ordering of the aqueous solvent, all coupled together by electrostatic, steric, thermal and direct hydrogen-bonding interactions. Multiscale simulations therefore appear as singularly suited to connect the microscopic details of this system with its macroscopic thermodynamic behavior. We review the details of the simulation of dense atomistically resolved DNA arrays with different packing symmetries and the ensuing osmotic equation of state obtained by enclosing a DNA array in a monovalent salt and multivalent (spermidine counterions within a solvent permeable membrane, mimicking the behavior of DNA arrays subjected to external osmotic stress. By varying the DNA density, the local packing symmetry, and the counterion type, we are able to analyze the osmotic equation of state together with the full structural characterization of the DNA subphase, the counterion distribution and the solvent structural order in terms of its different order parameters and

  7. Development of New High Resolution Neutron Detector

    Science.gov (United States)

    Mostella, L. D., III; Rajabali, M.; Loureiro, D. P.; Grzywacz, R.

    2017-09-01

    Beta-delayed neutron emission is a prevalent form of decay for neutron-rich nuclei. This occurs when an unstable nucleus undergoes beta decay, but produces a daughter nucleus in an excited state above the neutron separation energy. The daughter nucleus then de-excites by ejecting one or more neutrons. We wish to map the states from which these nuclei decay via neutron spectroscopy using NEXT, a new high resolution neutron detector. NEXT utilizes silicon photomultipliers and 6 mm thick pulse-shape discriminating plastic scintillators, allowing for smaller and more compact modular geometries in the NEXT array. Timing measurements for the detector were performed and a resolution of 893 ps (FWHM) has been achieved so far. Aspects of the detector that were investigated and will be presented here include scintillator geometry, wrapping materials, fitting functions for the digitized signals, and electronic components coupled to the silicon photomultipliers for signal shaping.

  8. Measuring true localization accuracy in super resolution microscopy with DNA-origami nanostructures

    Science.gov (United States)

    Reuss, Matthias; Fördős, Ferenc; Blom, Hans; Öktem, Ozan; Högberg, Björn; Brismar, Hjalmar

    2017-02-01

    A common method to assess the performance of (super resolution) microscopes is to use the localization precision of emitters as an estimate for the achieved resolution. Naturally, this is widely used in super resolution methods based on single molecule stochastic switching. This concept suffers from the fact that it is hard to calibrate measures against a real sample (a phantom), because true absolute positions of emitters are almost always unknown. For this reason, resolution estimates are potentially biased in an image since one is blind to true position accuracy, i.e. deviation in position measurement from true positions. We have solved this issue by imaging nanorods fabricated with DNA-origami. The nanorods used are designed to have emitters attached at each end in a well-defined and highly conserved distance. These structures are widely used to gauge localization precision. Here, we additionally determined the true achievable localization accuracy and compared this figure of merit to localization precision values for two common super resolution microscope methods STED and STORM.

  9. Base-Resolution Analysis of Cisplatin–DNA Adducts at the Genome Scale

    OpenAIRE

    Shu, Xiaoting; Xiong, Xushen; Song, Jinghui; He, Chuan; Yi, Chengqi

    2016-01-01

    Cisplatin, one of the most widely used anticancer drugs, crosslinks DNA and ultimately induces cell death. However, the genomic pattern of cisplatin–DNA adducts has remained unknown owing to the lack of a reliable and sensitive genome-wide method. Herein we present “cisplatin-seq” to identify genome-wide cisplatin crosslinking sites at base resolution. Cisplatin-seq reveals that mitochondrial DNA is a preferred target of cisplatin. For nuclear genomes, cisplatin–DNA adducts are enriched withi...

  10. High-Temporal-Resolution High-Spatial-Resolution Spaceborne SAR Based on Continuously Varying PRF.

    Science.gov (United States)

    Men, Zhirong; Wang, Pengbo; Li, Chunsheng; Chen, Jie; Liu, Wei; Fang, Yue

    2017-07-25

    Synthetic Aperture Radar (SAR) is a well-established and powerful imaging technique for acquiring high-spatial-resolution images of the Earth's surface. With the development of beam steering techniques, sliding spotlight and staring spotlight modes have been employed to support high-spatial-resolution applications. In addition to this strengthened high-spatial-resolution and wide-swath capability, high-temporal-resolution (short repeat-observation interval) represents a key capability for numerous applications. However, conventional SAR systems are limited in that the same patch can only be illuminated for several seconds within a single pass. This paper considers a novel high-squint-angle system intended to acquire high-spatial-resolution spaceborne SAR images with repeat-observation intervals varying from tens of seconds to several minutes within a single pass. However, an exponentially increased range cell migration would arise and lead to a conflict between the receive window and 'blind ranges'. An efficient data acquisition technique for high-temporal-resolution, high-spatial-resolution and high-squint-angle spaceborne SAR, in which the pulse repetition frequency (PRF) is continuously varied according to the changing slant range, is presented in this paper. This technique allows echo data to remain in the receive window instead of conflicting with the transmitted pulse or nadir echo. Considering the precision of hardware, a compromise and practical strategy is also proposed. Furthermore, a detailed performance analysis of range ambiguities is provided with respect to parameters of TerraSAR-X. For strong point-like targets, the range ambiguity of this technique would be better than that of uniform PRF technique. For this innovative technique, a resampling strategy and modified imaging algorithm have been developed to handle the non-uniformly sampled echo data. Simulations are performed to validate the efficiency of the proposed technique and the associated

  11. Integrated High Resolution Monitoring of Mediterranean vegetation

    Science.gov (United States)

    Cesaraccio, Carla; Piga, Alessandra; Ventura, Andrea; Arca, Angelo; Duce, Pierpaolo; Mereu, Simone

    2017-04-01

    The study of the vegetation features in a complex and highly vulnerable ecosystems, such as Mediterranean maquis, leads to the need of using continuous monitoring systems at high spatial and temporal resolution, for a better interpretation of the mechanisms of phenological and eco-physiological processes. Near-surface remote sensing techniques are used to quantify, at high temporal resolution, and with a certain degree of spatial integration, the seasonal variations of the surface optical and radiometric properties. In recent decades, the design and implementation of global monitoring networks involved the use of non-destructive and/or cheaper approaches such as (i) continuous surface fluxes measurement stations, (ii) phenological observation networks, and (iii) measurement of temporal and spatial variations of the vegetation spectral properties. In this work preliminary results from the ECO-SCALE (Integrated High Resolution Monitoring of Mediterranean vegetation) project are reported. The project was manly aimed to develop an integrated system for environmental monitoring based on digital photography, hyperspectral radiometry , and micrometeorological techniques during three years of experimentation (2013-2016) in a Mediterranean site of Italy (Capo Caccia, Alghero). The main results concerned the analysis of chromatic coordinates indices from digital images, to characterized the phenological patterns for typical shrubland species, determining start and duration of the growing season, and the physiological status in relation to different environmental drought conditions; then the seasonal patterns of canopy phenology, was compared to NEE (Net Ecosystem Exchange) patterns, showing similarities. However, maximum values of NEE and ER (Ecosystem respiration), and short term variation, seemed mainly tuned by inter annual pattern of meteorological variables, in particular of temperature recorded in the months preceding the vegetation green-up. Finally, green signals

  12. High-resolution phylogenetic microbial community profiling

    Energy Technology Data Exchange (ETDEWEB)

    Singer, Esther; Coleman-Derr, Devin; Bowman, Brett; Schwientek, Patrick; Clum, Alicia; Copeland, Alex; Ciobanu, Doina; Cheng, Jan-Fang; Gies, Esther; Hallam, Steve; Tringe, Susannah; Woyke, Tanja

    2014-03-17

    The representation of bacterial and archaeal genome sequences is strongly biased towards cultivated organisms, which belong to merely four phylogenetic groups. Functional information and inter-phylum level relationships are still largely underexplored for candidate phyla, which are often referred to as microbial dark matter. Furthermore, a large portion of the 16S rRNA gene records in the GenBank database are labeled as environmental samples and unclassified, which is in part due to low read accuracy, potential chimeric sequences produced during PCR amplifications and the low resolution of short amplicons. In order to improve the phylogenetic classification of novel species and advance our knowledge of the ecosystem function of uncultivated microorganisms, high-throughput full length 16S rRNA gene sequencing methodologies with reduced biases are needed. We evaluated the performance of PacBio single-molecule real-time (SMRT) sequencing in high-resolution phylogenetic microbial community profiling. For this purpose, we compared PacBio and Illumina metagenomic shotgun and 16S rRNA gene sequencing of a mock community as well as of an environmental sample from Sakinaw Lake, British Columbia. Sakinaw Lake is known to contain a large age of microbial species from candidate phyla. Sequencing results show that community structure based on PacBio shotgun and 16S rRNA gene sequences is highly similar in both the mock and the environmental communities. Resolution power and community representation accuracy from SMRT sequencing data appeared to be independent of GC content of microbial genomes and was higher when compared to Illumina-based metagenome shotgun and 16S rRNA gene (iTag) sequences, e.g. full-length sequencing resolved all 23 OTUs in the mock community, while iTags did not resolve closely related species. SMRT sequencing hence offers various potential benefits when characterizing uncharted microbial communities.

  13. High resolution extremity CT for biomechanics modeling

    Energy Technology Data Exchange (ETDEWEB)

    Ashby, A.E.; Brand, H.; Hollerbach, K.; Logan, C.M.; Martz, H.E.

    1995-09-23

    With the advent of ever more powerful computing and finite element analysis (FEA) capabilities, the bone and joint geometry detail available from either commercial surface definitions or from medical CT scans is inadequate. For dynamic FEA modeling of joints, precise articular contours are necessary to get appropriate contact definition. In this project, a fresh cadaver extremity was suspended in parafin in a lucite cylinder and then scanned with an industrial CT system to generate a high resolution data set for use in biomechanics modeling.

  14. Detailed mitochondrial phenotyping by high resolution metabolomics.

    Directory of Open Access Journals (Sweden)

    James R Roede

    Full Text Available Mitochondrial phenotype is complex and difficult to define at the level of individual cell types. Newer metabolic profiling methods provide information on dozens of metabolic pathways from a relatively small sample. This pilot study used "top-down" metabolic profiling to determine the spectrum of metabolites present in liver mitochondria. High resolution mass spectral analyses and multivariate statistical tests provided global metabolic information about mitochondria and showed that liver mitochondria possess a significant phenotype based on gender and genotype. The data also show that mitochondria contain a large number of unidentified chemicals.

  15. Novel high resolution tactile robotic fingertips

    DEFF Research Database (Denmark)

    Drimus, Alin; Jankovics, Vince; Gorsic, Matija

    2014-01-01

    This paper describes a novel robotic fingertip based on piezoresistive rubber that can sense pressure tactile stimuli with a high spatial resolution over curved surfaces. The working principle is based on a three-layer sandwich structure (conductive electrodes on top and bottom and piezoresistive...... rubber in the middle). For the conductive layers we use ring patterns of silver epoxy and flex PCB electrode arrays. The proposed sensorised fingertip has 60 sensitive regions (taxels) arranged in 5 rings and 12 columns that have a smooth pressure to resistance characteristic. Using the sensor...

  16. High-resolution gamma imaging; Imagerie gamma haute resolution

    Energy Technology Data Exchange (ETDEWEB)

    Parmentier, M.; Pousse, A.; Tamba, N.; Chavanelle, J.; Bakkali, A.; Kastler, B. [Centre Hospitalier Universitaire, Lab. Imagerie et Ingenierie pour la Sante, Faculte de Medecine, 25 - Besancon (France)

    2004-01-01

    Gamma imaging involves two-dimensional images of the volume distribution of a radioactive tracer previously injected into the organ under functional exploration. Our Besancon laboratory developed a gamma imager with a spatial resolution three or four times higher than a classic device, which is very useful for functional explorations on small animal, as recently demonstrated by work on myocyte apoptosis and necrosis scintigraphy in the rat. We expect progress in this promising medical imaging technology to be driven by developments in scintillating crystals and position-sensitive photomultiplier tubes, and by medical demand in applications such as early detection of breast cancer. (authors)

  17. High Resolution Global View of Io

    Science.gov (United States)

    1997-01-01

    Io, the most volcanic body in the solar system is seen in the highest resolution obtained to date by NASA's Galileo spacecraft. The smallest features that can be discerned are 2.5 kilometers in size. There are rugged mountains several kilometers high, layered materials forming plateaus, and many irregular depressions called volcanic calderas. Several of the dark, flow-like features correspond to hot spots, and may be active lava flows. There are no landforms resembling impact craters, as the volcanism covers the surface with new deposits much more rapidly than the flux of comets and asteroids can create large impact craters. The picture is centered on the side of Io that always faces away from Jupiter; north is to the top.Color images acquired on September 7, 1996 have been merged with higher resolution images acquired on November 6, 1996 by the Solid State Imaging (CCD) system aboard NASA's Galileo spacecraft. The color is composed of data taken, at a range of 487,000 kilometers, in the near-infrared, green, and violet filters and has been enhanced to emphasize the extraordinary variations in color and brightness that characterize Io's face. The high resolution images were obtained at ranges which varied from 245,719 kilometers to 403,100 kilometers.Launched in October 1989, Galileo entered orbit around Jupiter on December 7, 1995. The spacecraft's mission is to conduct detailed studies of the giant planet, its largest moons and the Jovian magnetic environment. The Jet Propulsion Laboratory, Pasadena, CA manages the mission for NASA's Office of Space Science, Washington, DC.This image and other images and data received from Galileo are posted on the World Wide Web, on the Galileo mission home page at URL http://galileo.jpl.nasa.gov. Background information and educational context for the images can be found at URL http://www.jpl.nasa.gov/galileo/sepo

  18. Principles of high resolution NMR in solids

    CERN Document Server

    Mehring, Michael

    1983-01-01

    The field of Nuclear Magnetic Resonance (NMR) has developed at a fascinating pace during the last decade. It always has been an extremely valuable tool to the organic chemist by supplying molecular "finger print" spectra at the atomic level. Unfortunately the high resolution achievable in liquid solutions could not be obtained in solids and physicists and physical chemists had to live with unresolved lines open to a wealth of curve fitting procedures and a vast amount of speculations. High resolution NMR in solids seemed to be a paradoxon. Broad structure­ less lines are usually encountered when dealing with NMR in solids. Only with the recent advent of mUltiple pulse, magic angle, cross-polarization, two-dimen­ sional and multiple-quantum spectroscopy and other techniques during the last decade it became possible to resolve finer details of nuclear spin interactions in solids. I have felt that graduate students, researchers and others beginning to get involved with these techniques needed a book which trea...

  19. Limiting liability via high resolution image processing

    Energy Technology Data Exchange (ETDEWEB)

    Greenwade, L.E.; Overlin, T.K.

    1996-12-31

    The utilization of high resolution image processing allows forensic analysts and visualization scientists to assist detectives by enhancing field photographs, and by providing the tools and training to increase the quality and usability of field photos. Through the use of digitized photographs and computerized enhancement software, field evidence can be obtained and processed as `evidence ready`, even in poor lighting and shadowed conditions or darkened rooms. These images, which are most often unusable when taken with standard camera equipment, can be shot in the worst of photographic condition and be processed as usable evidence. Visualization scientists have taken the use of digital photographic image processing and moved the process of crime scene photos into the technology age. The use of high resolution technology will assist law enforcement in making better use of crime scene photography and positive identification of prints. Valuable court room and investigation time can be saved and better served by this accurate, performance based process. Inconclusive evidence does not lead to convictions. Enhancement of the photographic capability helps solve one major problem with crime scene photos, that if taken with standard equipment and without the benefit of enhancement software would be inconclusive, thus allowing guilty parties to be set free due to lack of evidence.

  20. High-Resolution Scintimammography: A Pilot Study

    Energy Technology Data Exchange (ETDEWEB)

    Rachel F. Brem; Joelle M. Schoonjans; Douglas A. Kieper; Stan Majewski; Steven Goodman; Cahid Civelek

    2002-07-01

    This study evaluated a novel high-resolution breast-specific gamma camera (HRBGC) for the detection of suggestive breast lesions. Methods: Fifty patients (with 58 breast lesions) for whom a scintimammogram was clinically indicated were prospectively evaluated with a general-purpose gamma camera and a novel HRBGC prototype. The results of conventional and high-resolution nuclear studies were prospectively classified as negative (normal or benign) or positive (suggestive or malignant) by 2 radiologists who were unaware of the mammographic and histologic results. All of the included lesions were confirmed by pathology. Results: There were 30 benign and 28 malignant lesions. The sensitivity for detection of breast cancer was 64.3% (18/28) with the conventional camera and 78.6% (22/28) with the HRBGC. The specificity with both systems was 93.3% (28/30). For the 18 nonpalpable lesions, sensitivity was 55.5% (10/18) and 72.2% (13/18) with the general-purpose camera and the HRBGC, respectively. For lesions 1 cm, 7 of 15 were detected with the general-purpose camera and 10 of 15 with the HRBGC. Four lesions (median size, 8.5 mm) were detected only with the HRBGC and were missed by the conventional camera. Conclusion: Evaluation of indeterminate breast lesions with an HRBGC results in improved sensitivity for the detection of cancer, with greater improvement shown for nonpalpable and 1-cm lesions.

  1. High resolution multimodal clinical ophthalmic imaging system.

    Science.gov (United States)

    Mujat, Mircea; Ferguson, R Daniel; Patel, Ankit H; Iftimia, Nicusor; Lue, Niyom; Hammer, Daniel X

    2010-05-24

    We developed a multimodal adaptive optics (AO) retinal imager which is the first to combine high performance AO-corrected scanning laser ophthalmoscopy (SLO) and swept source Fourier domain optical coherence tomography (SSOCT) imaging modes in a single compact clinical prototype platform. Such systems are becoming ever more essential to vision research and are expected to prove their clinical value for diagnosis of retinal diseases, including glaucoma, diabetic retinopathy (DR), age-related macular degeneration (AMD), and retinitis pigmentosa. The SSOCT channel operates at a wavelength of 1 microm for increased penetration and visualization of the choriocapillaris and choroid, sites of major disease activity for DR and wet AMD. This AO system is designed for use in clinical populations; a dual deformable mirror (DM) configuration allows simultaneous low- and high-order aberration correction over a large range of refractions and ocular media quality. The system also includes a wide field (33 deg.) line scanning ophthalmoscope (LSO) for initial screening, target identification, and global orientation, an integrated retinal tracker (RT) to stabilize the SLO, OCT, and LSO imaging fields in the presence of lateral eye motion, and a high-resolution LCD-based fixation target for presentation of visual cues. The system was tested in human subjects without retinal disease for performance optimization and validation. We were able to resolve and quantify cone photoreceptors across the macula to within approximately 0.5 deg (approximately 100-150 microm) of the fovea, image and delineate ten retinal layers, and penetrate to resolve features deep into the choroid. The prototype presented here is the first of a new class of powerful flexible imaging platforms that will provide clinicians and researchers with high-resolution, high performance adaptive optics imaging to help guide therapies, develop new drugs, and improve patient outcomes.

  2. Single-stranded DNA library preparation from highly degraded DNA using T4 DNA ligase.

    Science.gov (United States)

    Gansauge, Marie-Theres; Gerber, Tobias; Glocke, Isabelle; Korlevic, Petra; Lippik, Laurin; Nagel, Sarah; Riehl, Lara Maria; Schmidt, Anna; Meyer, Matthias

    2017-06-02

    DNA library preparation for high-throughput sequencing of genomic DNA usually involves ligation of adapters to double-stranded DNA fragments. However, for highly degraded DNA, especially ancient DNA, library preparation has been found to be more efficient if each of the two DNA strands are converted into library molecules separately. We present a new method for single-stranded library preparation, ssDNA2.0, which is based on single-stranded DNA ligation with T4 DNA ligase utilizing a splinter oligonucleotide with a stretch of random bases hybridized to a 3΄ biotinylated donor oligonucleotide. A thorough evaluation of this ligation scheme shows that single-stranded DNA can be ligated to adapter oligonucleotides in higher concentration than with CircLigase (an RNA ligase that was previously chosen for end-to-end ligation in single-stranded library preparation) and that biases in ligation can be minimized when choosing splinters with 7 or 8 random nucleotides. We show that ssDNA2.0 tolerates higher quantities of input DNA than CircLigase-based library preparation, is less costly and better compatible with automation. We also provide an in-depth comparison of library preparation methods on degraded DNA from various sources. Most strikingly, we find that single-stranded library preparation increases library yields from tissues stored in formalin for many years by several orders of magnitude. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  3. High-resolution genotyping of Listeria monocytogenes by fluorescent amplified fragment length polymorphism analysis compared to pulsed-field gel electrophoresis, random amplified polymorphic DNA analysis, ribotyping, and PCR-restriction fragment length polymorphism analysis

    DEFF Research Database (Denmark)

    Vogel, Birte Fonnesbech; Fussing, V.; Ojeniyi, B.

    2004-01-01

    . Isolates with identical DNA profiles were distributed across the spectrum of origin. It was not possible to associate certain types with specific food sectors or clinical cases, which is indicative of the spread of L. monocytogenes clones across species. Overall, AFLP fingerprinting was suitable...... of different origin. The AFLP technique was compared with three other molecular typing methods - ribotyping, random amplified polymorphic DNA analysis (RAPD), and pulsed-field gel electrophoresis (PFGE) - in terms of discriminatory ability. PCR-restriction fragment length polymorphism was included......, while another main cluster consisted of all of the 72 L. monocytogenes hly allele 2 strains. This indicates the existence of two distinct phylogenetic divisions. Isolates of the remaining Listeria species were not included in the clusters. AFLP, PFGE, and RAPD typing were highly discriminatory methods...

  4. Concept for a new high resolution high intensity diffractometer

    Energy Technology Data Exchange (ETDEWEB)

    Stuhr, U. [Paul Scherrer Inst. (PSI), Villigen (Switzerland)

    1997-09-01

    A concept of a new time-of-flight powder-diffractometer for a thermal neutral beam tube at SINQ is presented. The design of the instrument optimises the contradictory conditions of high intensity and high resolution. The high intensity is achieved by using many neutron pulses simultaneously. By analysing the time-angle-pattern of the detected neutrons an assignment of the neutrons to a single pulse is possible. (author) 3 figs., tab., refs.

  5. Expectation values for low-resolution slit-scan flow prescreening: influence of nuclear shape and DNA density

    Energy Technology Data Exchange (ETDEWEB)

    Mullaney, P.F.; Mann, R.; Seger, G.H.; Achatz, M.

    1982-06-01

    We conducted high-resolution fluorescent image analysis with mithramycin-stained cells from clinical gynecologic specimens. Features characteristic of the usual, low-resolution, one-dimensional, slit-scan flow cytometric measurements were extracted from 250 high-resolution nuclear images. In addition to the measurement of the usual parameters, nuclear ellpticity and DNA density (DNA per unit nuclear size) were also determined. Our preliminary results indicate that both of these features offer increasded discrimination. When nuclear shape was included as a global feature, at least 77% of the diagnostic cells could be distinguished from normal cells, with no overlap. Both features hold promise for improving the discrimination possible with flow cytometry.

  6. A high-resolution microchip optomechanical accelerometer

    Science.gov (United States)

    Krause, Alexander G.; Winger, Martin; Blasius, Tim D.; Lin, Qiang; Painter, Oskar

    2012-11-01

    The monitoring of acceleration is essential for a variety of applications ranging from inertial navigation to consumer electronics. Typical accelerometer operation involves the sensitive displacement measurement of a flexibly mounted test mass, which can be realized using capacitive, piezo-electric, tunnel-current or optical methods. Although optical detection provides superior displacement resolution, resilience to electromagnetic interference and long-range readout, current optical accelerometers either do not allow for chip-scale integration or utilize relatively bulky test mass sensors of low bandwidth. Here, we demonstrate an optomechanical accelerometer that makes use of ultrasensitive displacement readout using a photonic-crystal nanocavity monolithically integrated with a nanotethered test mass of high mechanical Q-factor. This device achieves an acceleration resolution of 10 µg Hz-1/2 with submilliwatt optical power, bandwidth greater than 20 kHz and a dynamic range of greater than 40 dB. Moreover, the nanogram test masses used here allow for strong optomechanical backaction, setting the stage for a new class of motional sensors.

  7. Fast diffusion imaging with high angular resolution.

    Science.gov (United States)

    Chao, Tzu-Cheng; Chiou, Jr-Yuan George; Maier, Stephan E; Madore, Bruno

    2017-02-01

    High angular resolution diffusion imaging (HARDI) is a well-established method to help reveal the architecture of nerve bundles, but long scan times and geometric distortions inherent to echo planar imaging (EPI) have limited its integration into clinical protocols. A fast imaging method is proposed here that combines accelerated multishot diffusion imaging (AMDI), multiplexed sensitivity encoding (MUSE), and crossing fiber angular resolution of intravoxel structure (CFARI) to reduce spatial distortions and reduce total scan time. A multishot EPI sequence was used to improve geometrical fidelity as compared to a single-shot EPI acquisition, and acceleration in both k-space and diffusion sampling enabled reductions in scan time. The method is regularized and self-navigated for motion correction. Seven volunteers were scanned in this study, including four with volumetric whole brain acquisitions. The average similarity of microstructural orientations between undersampled datasets and their fully sampled counterparts was above 85%, with scan times below 5 min for whole-brain acquisitions. Up to 2.7-fold scan time acceleration along with four-fold distortion reduction was achieved. The proposed imaging strategy can generate HARDI results with relatively good geometrical fidelity and low scan duration, which may help facilitate the transition of HARDI from a successful research tool to a practical clinical one. Magn Reson Med 77:696-706, 2017. © 2016 International Society for Magnetic Resonance in Medicine. © 2016 International Society for Magnetic Resonance in Medicine.

  8. Base-resolution DNA methylation landscape of zebrafish brain and liver

    Directory of Open Access Journals (Sweden)

    Aniruddha Chatterjee

    2014-12-01

    To our knowledge, these datasets are the only RRBS datasets and base-resolution DNA methylation data available at this time for zebrafish brain and liver. These datasets could serve as a resource for future studies to document the functional role of DNA methylation in zebrafish. In addition, these datasets could be used as controls while performing analysis on treated samples.

  9. Detection of proximal caries with high-resolution and standard resolution digital radiographic systems

    NARCIS (Netherlands)

    Berkhout, W.E.R.; Verheij, H.G.C.; Syriopoulos, K.; Li, G.; Sanderink, G.C.H.; van der Stelt, P.F.

    2007-01-01

    Aims: The aim of this study was to: (1) compare the diagnostic accuracy of the high-resolution and standard resolution settings of four digital imaging systems for caries diagnosis and (2) compare the effect on the diagnostic accuracy of reducing the high-resolution image sizes to the standard

  10. MethBank: a database integrating next-generation sequencing single-base-resolution DNA methylation programming data.

    Science.gov (United States)

    Zou, Dong; Sun, Shixiang; Li, Rujiao; Liu, Jiang; Zhang, Jing; Zhang, Zhang

    2015-01-01

    DNA methylation plays crucial roles during embryonic development. Here we present MethBank (http://dnamethylome.org), a DNA methylome programming database that integrates the genome-wide single-base nucleotide methylomes of gametes and early embryos in different model organisms. Unlike extant relevant databases, MethBank incorporates the whole-genome single-base-resolution methylomes of gametes and early embryos at multiple different developmental stages in zebrafish and mouse. MethBank allows users to retrieve methylation levels, differentially methylated regions, CpG islands, gene expression profiles and genetic polymorphisms for a specific gene or genomic region. Moreover, it offers a methylome browser that is capable of visualizing high-resolution DNA methylation profiles as well as other related data in an interactive manner and thus is of great helpfulness for users to investigate methylation patterns and changes of gametes and early embryos at different developmental stages. Ongoing efforts are focused on incorporation of methylomes and related data from other organisms. Together, MethBank features integration and visualization of high-resolution DNA methylation data as well as other related data, enabling identification of potential DNA methylation signatures in different developmental stages and accordingly providing an important resource for the epigenetic and developmental studies. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  11. Classification of High Spatial Resolution, Hyperspectral ...

    Science.gov (United States)

    EPA announced the availability of the final report,Classification of High Spatial Resolution, Hyperspectral Remote Sensing Imagery of the Little Miami River Watershed in Southwest Ohio, USA . This report and associated land use/land cover (LULC) coverage is the result of a collaborative effort among an interdisciplinary team of scientists with the U.S. Environmental Protection Agency's (U.S. EPA's) Office of Research and Development in Cincinnati, Ohio. A primary goal of this project is to enhance the use of geography and spatial analytic tools in risk assessment, and to improve the scientific basis for risk management decisions affecting drinking water and water quality. The land use/land cover classification is derived from 82 flight lines of Compact Airborne Spectrographic Imager (CASI) hyperspectral imagery acquired from July 24 through August 9, 2002 via fixed-wing aircraft.

  12. High resolution imaging detectors and applications

    CERN Document Server

    Saha, Swapan K

    2015-01-01

    Interferometric observations need snapshots of very high time resolution of the order of (i) frame integration of about 100 Hz or (ii) photon-recording rates of several megahertz (MHz). Detectors play a key role in astronomical observations, and since the explanation of the photoelectric effect by Albert Einstein, the technology has evolved rather fast. The present-day technology has made it possible to develop large-format complementary metal oxide–semiconductor (CMOS) and charge-coupled device (CCD) array mosaics, orthogonal transfer CCDs, electron-multiplication CCDs, electron-avalanche photodiode arrays, and quantum-well infrared (IR) photon detectors. The requirements to develop artifact-free photon shot noise-limited images are higher sensitivity and quantum efficiency, reduced noise that includes dark current, read-out and amplifier noise, smaller point-spread functions, and higher spectral bandwidth. This book aims to address such systems, technologies and design, evaluation and calibration, control...

  13. Capillary detectors for high resolution tracking

    CERN Document Server

    Annis, P

    1997-01-01

    We present a new tracking device based on glass capillary bundles or layers filled with highly purified liquid scintillator and read out at one end by means of image intensifiers and CCD devices. A large-volume prototype consisting of 5 × 105 capillaries with a diameter of 20 μm and a length of 180 cm and read out by a megapixel CCD has been tested with muon and neutrino beams at CERN. With this prototype a two track resolution of 33 μm was achieved with passing through muons. Images of neutrino interactions in a capillary bundle have also been acquired and analysed. Read-out chains based on Electron Bombarded CCD (EBCCD) and image pipeline devices are also investigated. Preliminary results obtained with a capillary bundle read out by an EBCCD are presented.

  14. High resolution color band pyrometer ratioing

    Science.gov (United States)

    Bickler, Donald B. (Inventor); Henry, Paul K. (Inventor); LoGiurato, D. Daniel (Inventor)

    1989-01-01

    The sensing head of a two-color band ratioing pyrometer of a known type using a fiber optic cable to couple radiation to dual detector photodiodes is improved to have high spatial resolution by focusing the radiation received through an objective lens (i.e., by focusing the image of a target area) onto an opaque sheet spaced in front of the input end of the fiber optic cable. A two-mil hole in that sheet then passes radiation to the input end of the cable. The detector has two channels, one for each color band, with an electronic-chopper stabilized current amplifier as the input stage followed by an electronic-chopper stabilized voltage amplifier.

  15. High-Resolution Movement EEG Classification

    Directory of Open Access Journals (Sweden)

    Jakub Štastný

    2007-01-01

    Full Text Available The aim of the contribution is to analyze possibilities of high-resolution movement classification using human EEG. For this purpose, a database of the EEG recorded during right-thumb and little-finger fast flexion movements of the experimental subjects was created. The statistical analysis of the EEG was done on the subject's basis instead of the commonly used grand averaging. Statistically significant differences between the EEG accompanying movements of both fingers were found, extending the results of other so far published works. The classifier based on hidden Markov models was able to distinguish between movement and resting states (classification score of 94–100%, but it was unable to recognize the type of the movement. This is caused by the large fraction of other (nonmovement related EEG activities in the recorded signals. A classification method based on advanced EEG signal denoising is being currently developed to overcome this problem.

  16. Improved methods for high resolution electron microscopy

    Energy Technology Data Exchange (ETDEWEB)

    Taylor, J.R.

    1987-04-01

    Existing methods of making support films for high resolution transmission electron microscopy are investigated and novel methods are developed. Existing methods of fabricating fenestrated, metal reinforced specimen supports (microgrids) are evaluated for their potential to reduce beam induced movement of monolamellar crystals of C/sub 44/H/sub 90/ paraffin supported on thin carbon films. Improved methods of producing hydrophobic carbon films by vacuum evaporation, and improved methods of depositing well ordered monolamellar paraffin crystals on carbon films are developed. A novel technique for vacuum evaporation of metals is described which is used to reinforce microgrids. A technique is also developed to bond thin carbon films to microgrids with a polymer bonding agent. Unique biochemical methods are described to accomplish site specific covalent modification of membrane proteins. Protocols are given which covalently convert the carboxy terminus of papain cleaved bacteriorhodopsin to a free thiol. 53 refs., 19 figs., 1 tab.

  17. High-resolution transcriptome of human macrophages.

    Directory of Open Access Journals (Sweden)

    Marc Beyer

    Full Text Available Macrophages are dynamic cells integrating signals from their microenvironment to develop specific functional responses. Although, microarray-based transcriptional profiling has established transcriptional reprogramming as an important mechanism for signal integration and cell function of macrophages, current knowledge on transcriptional regulation of human macrophages is far from complete. To discover novel marker genes, an area of great need particularly in human macrophage biology but also to generate a much more thorough transcriptome of human M1- and M1-like macrophages, we performed RNA sequencing (RNA-seq of human macrophages. Using this approach we can now provide a high-resolution transcriptome profile of human macrophages under classical (M1-like and alternative (M2-like polarization conditions and demonstrate a dynamic range exceeding observations obtained by previous technologies, resulting in a more comprehensive understanding of the transcriptome of human macrophages. Using this approach, we identify important gene clusters so far not appreciated by standard microarray techniques. In addition, we were able to detect differential promoter usage, alternative transcription start sites, and different coding sequences for 57 gene loci in human macrophages. Moreover, this approach led to the identification of novel M1-associated (CD120b, TLR2, SLAMF7 as well as M2-associated (CD1a, CD1b, CD93, CD226 cell surface markers. Taken together, these data support that high-resolution transcriptome profiling of human macrophages by RNA-seq leads to a better understanding of macrophage function and will form the basis for a better characterization of macrophages in human health and disease.

  18. High-Resolution Transcriptome of Human Macrophages

    Science.gov (United States)

    Xue, Jia; Staratschek-Jox, Andrea; Vorholt, Daniela; Krebs, Wolfgang; Sommer, Daniel; Sander, Jil; Mertens, Christina; Nino-Castro, Andrea; Schmidt, Susanne V.; Schultze, Joachim L.

    2012-01-01

    Macrophages are dynamic cells integrating signals from their microenvironment to develop specific functional responses. Although, microarray-based transcriptional profiling has established transcriptional reprogramming as an important mechanism for signal integration and cell function of macrophages, current knowledge on transcriptional regulation of human macrophages is far from complete. To discover novel marker genes, an area of great need particularly in human macrophage biology but also to generate a much more thorough transcriptome of human M1- and M1-like macrophages, we performed RNA sequencing (RNA-seq) of human macrophages. Using this approach we can now provide a high-resolution transcriptome profile of human macrophages under classical (M1-like) and alternative (M2-like) polarization conditions and demonstrate a dynamic range exceeding observations obtained by previous technologies, resulting in a more comprehensive understanding of the transcriptome of human macrophages. Using this approach, we identify important gene clusters so far not appreciated by standard microarray techniques. In addition, we were able to detect differential promoter usage, alternative transcription start sites, and different coding sequences for 57 gene loci in human macrophages. Moreover, this approach led to the identification of novel M1-associated (CD120b, TLR2, SLAMF7) as well as M2-associated (CD1a, CD1b, CD93, CD226) cell surface markers. Taken together, these data support that high-resolution transcriptome profiling of human macrophages by RNA-seq leads to a better understanding of macrophage function and will form the basis for a better characterization of macrophages in human health and disease. PMID:23029029

  19. Localization microscopy of DNA in situ using Vybrant{sup ®} DyeCycle™ Violet fluorescent probe: A new approach to study nuclear nanostructure at single molecule resolution

    Energy Technology Data Exchange (ETDEWEB)

    Żurek-Biesiada, Dominika [Laboratory of Cell Biophysics, Faculty of Biochemistry, Biophysics and Biotechnology, Jagiellonian University, Gronostajowa 7, 30-387 Kraków (Poland); Szczurek, Aleksander T. [Institute of Molecular Biology (IMB), Ackermannweg 4, 55128 Mainz (Germany); Prakash, Kirti [Institute of Molecular Biology (IMB), Ackermannweg 4, 55128 Mainz (Germany); Institute for Pharmacy and Molecular Biotechnology (IPMB), University of Heidelberg, Im Neuenheimer Feld 364, D-69120 Heidelberg (Germany); Mohana, Giriram K. [Institute of Molecular Biology (IMB), Ackermannweg 4, 55128 Mainz (Germany); Lee, Hyun-Keun [Institute of Molecular Biology (IMB), Ackermannweg 4, 55128 Mainz (Germany); Department of Physics, University of Mainz (JGU), Staudingerweg 7, 55128 Mainz (Germany); Roignant, Jean-Yves [Institute of Molecular Biology (IMB), Ackermannweg 4, 55128 Mainz (Germany); Birk, Udo J. [Institute of Molecular Biology (IMB), Ackermannweg 4, 55128 Mainz (Germany); Department of Physics, University of Mainz (JGU), Staudingerweg 7, 55128 Mainz (Germany); Dobrucki, Jurek W., E-mail: jerzy.dobrucki@uj.edu.pl [Laboratory of Cell Biophysics, Faculty of Biochemistry, Biophysics and Biotechnology, Jagiellonian University, Gronostajowa 7, 30-387 Kraków (Poland); Cremer, Christoph, E-mail: c.cremer@imb-mainz.de [Institute of Molecular Biology (IMB), Ackermannweg 4, 55128 Mainz (Germany); Institute for Pharmacy and Molecular Biotechnology (IPMB), University of Heidelberg, Im Neuenheimer Feld 364, D-69120 Heidelberg (Germany); Department of Physics, University of Mainz (JGU), Staudingerweg 7, 55128 Mainz (Germany)

    2016-05-01

    Higher order chromatin structure is not only required to compact and spatially arrange long chromatids within a nucleus, but have also important functional roles, including control of gene expression and DNA processing. However, studies of chromatin nanostructures cannot be performed using conventional widefield and confocal microscopy because of the limited optical resolution. Various methods of superresolution microscopy have been described to overcome this difficulty, like structured illumination and single molecule localization microscopy. We report here that the standard DNA dye Vybrant{sup ®} DyeCycle™ Violet can be used to provide single molecule localization microscopy (SMLM) images of DNA in nuclei of fixed mammalian cells. This SMLM method enabled optical isolation and localization of large numbers of DNA-bound molecules, usually in excess of 10{sup 6} signals in one cell nucleus. The technique yielded high-quality images of nuclear DNA density, revealing subdiffraction chromatin structures of the size in the order of 100 nm; the interchromatin compartment was visualized at unprecedented optical resolution. The approach offers several advantages over previously described high resolution DNA imaging methods, including high specificity, an ability to record images using a single wavelength excitation, and a higher density of single molecule signals than reported in previous SMLM studies. The method is compatible with DNA/multicolor SMLM imaging which employs simple staining methods suited also for conventional optical microscopy. - Highlights: • Super-resolution imaging of nuclear DNA with Vybrant Violet and blue excitation. • 90nm resolution images of DNA structures in optically thick eukaryotic nuclei. • Enhanced resolution confirms the existence of DNA-free regions inside the nucleus. • Optimized imaging conditions enable multicolor super-resolution imaging.

  20. Development of an entangled polymer solution for improved resolution in DNA typing by CE.

    Science.gov (United States)

    Boulos, Stefano; Cabrices, Oscar; Blas, Maximilien; McCord, Bruce R

    2008-12-01

    A new sieving matrix consisting of a mixture of two commercial polymers with different chemical structures, PVP (Mw=1,000,000 g/mol) and hydroxyethyl cellulose (HEC, Mw=250,000 g/mol), has been successfully used for single-stranded DNA separation. This sieving matrix was optimized with a Doehlert design, a second-order model statistical design. A total concentration of 3.5% of polymer, which contains 20.4% of PVP relative to HEC, combines the superior coating capability of the PVP with the high efficiency of the HEC. The use of this new sieving matrix gives highly resolved and reproducible separations of single-stranded DNA ranging from 50 to 500 bp. The separation of these DNA fragments is accomplished in less than 30 min under 319 V/cm with efficiencies up to 4 million plates per meter (measured at 350 bp). More than 90 successive analyses were achieved without any deterioration of the separation performance. Repeatability values of resolution (given as %RSD) for the analyzed DNA fragments are 2.2% (measured with the couple 139/150 bp) and 5.3% (measured with the couple 490/500 bp). Moreover, this mixture has a low viscosity (388 cP), which permits easy filling of fused-silica capillaries. This new sieving matrix, which exhibits high sieving performance, good dynamic coating ability, and low viscosity, can be a useful alternative to other less easily synthesized sieving matrices and eliminates the need for precoating the capillary to eliminate electroosmosis.

  1. High-resolution downscaling for hydrological management

    Science.gov (United States)

    Ulbrich, Uwe; Rust, Henning; Meredith, Edmund; Kpogo-Nuwoklo, Komlan; Vagenas, Christos

    2017-04-01

    Hydrological modellers and water managers require high-resolution climate data to model regional hydrologies and how these may respond to future changes in the large-scale climate. The ability to successfully model such changes and, by extension, critical infrastructure planning is often impeded by a lack of suitable climate data. This typically takes the form of too-coarse data from climate models, which are not sufficiently detailed in either space or time to be able to support water management decisions and hydrological research. BINGO (Bringing INnovation in onGOing water management; ) aims to bridge the gap between the needs of hydrological modellers and planners, and the currently available range of climate data, with the overarching aim of providing adaptation strategies for climate change-related challenges. Producing the kilometre- and sub-daily-scale climate data needed by hydrologists through continuous simulations is generally computationally infeasible. To circumvent this hurdle, we adopt a two-pronged approach involving (1) selective dynamical downscaling and (2) conditional stochastic weather generators, with the former presented here. We take an event-based approach to downscaling in order to achieve the kilometre-scale input needed by hydrological modellers. Computational expenses are minimized by identifying extremal weather patterns for each BINGO research site in lower-resolution simulations and then only downscaling to the kilometre-scale (convection permitting) those events during which such patterns occur. Here we (1) outline the methodology behind the selection of the events, and (2) compare the modelled precipitation distribution and variability (preconditioned on the extremal weather patterns) with that found in observations.

  2. Multiplexed 3D Cellular Super-Resolution Imaging with DNA-PAINT and Exchange-PAINT

    Science.gov (United States)

    Jungmann, R.; Avendano, M.S.; Woehrstein, J.B.; Dai, M.; Shih, W.M.; Yin, P.

    2014-01-01

    While super-resolution fluorescence microscopy is a powerful tool for biological research, obtaining multiplexed images for a large number of distinct target species remains challenging. Here we use the transient binding of short fluorescently labeled oligonucleotides (DNA-PAINT, point accumulation for imaging in nanoscale topography) for simple and easy-to-implement multiplexed 3D super-resolution imaging inside fixed cells and achieve sub-10 nm spatial resolution in vitro using synthetic DNA structures. We also report a novel approach for multiplexing (Exchange-PAINT) that allows sequential imaging of multiple targets using only a single dye and a single laser source. We experimentally demonstrate ten-“color” super-resolution imaging in vitro on synthetic DNA structures and four-“color” imaging of proteins in a fixed cell. PMID:24487583

  3. Differentiation of Staphylococcus spp. by high-resolution melting analysis.

    Science.gov (United States)

    Slany, Michal; Vanerkova, Martina; Nemcova, Eva; Zaloudikova, Barbora; Ruzicka, Filip; Freiberger, Tomas

    2010-12-01

    High-resolution melting analysis (HRMA) is a fast (post-PCR) high-throughput method to scan for sequence variations in a target gene. The aim of this study was to test the potential of HRMA to distinguish particular bacterial species of the Staphylococcus genus even when using a broad-range PCR within the 16S rRNA gene where sequence differences are minimal. Genomic DNA samples isolated from 12 reference staphylococcal strains (Staphylococcus aureus, Staphylococcus capitis, Staphylococcus caprae, Staphylococcus epidermidis, Staphylococcus haemolyticus, Staphylococcus hominis, Staphylococcus intermedius, Staphylococcus saprophyticus, Staphylococcus sciuri, Staphylococcus simulans, Staphylococcus warneri, and Staphylococcus xylosus) were subjected to a real-time PCR amplification of the 16S rRNA gene in the presence of fluorescent dye EvaGreen™, followed by HRMA. Melting profiles were used as molecular fingerprints for bacterial species differentiation. HRMA of S. saprophyticus and S. xylosus resulted in undistinguishable profiles because of their identical sequences in the analyzed 16S rRNA region. The remaining reference strains were fully differentiated either directly or via high-resolution plots obtained by heteroduplex formation between coamplified PCR products of the tested staphylococcal strain and phylogenetically unrelated strain.

  4. HIGH RESOLUTION AIRBORNE SHALLOW WATER MAPPING

    Directory of Open Access Journals (Sweden)

    F. Steinbacher

    2012-07-01

    Full Text Available In order to meet the requirements of the European Water Framework Directive (EU-WFD, authorities face the problem of repeatedly performing area-wide surveying of all kinds of inland waters. Especially for mid-sized or small rivers this is a considerable challenge imposing insurmountable logistical efforts and costs. It is therefore investigated if large-scale surveying of a river system on an operational basis is feasible by employing airborne hydrographic laser scanning. In cooperation with the Bavarian Water Authority (WWA Weilheim a pilot project was initiated by the Unit of Hydraulic Engineering at the University of Innsbruck and RIEGL Laser Measurement Systems exploiting the possibilities of a new LIDAR measurement system with high spatial resolution and high measurement rate to capture about 70 km of riverbed and foreland for the river Loisach in Bavaria/Germany and the estuary and parts of the shoreline (about 40km in length of lake Ammersee. The entire area surveyed was referenced to classic terrestrial cross-section surveys with the aim to derive products for the monitoring and managing needs of the inland water bodies forced by the EU-WFD. The survey was performed in July 2011 by helicopter and airplane and took 3 days in total. In addition, high resolution areal images were taken to provide an optical reference, offering a wide range of possibilities on further research, monitoring, and managing responsibilities. The operating altitude was about 500 m to maintain eye-safety, even for the aided eye, the airspeed was about 55 kts for the helicopter and 75 kts for the aircraft. The helicopter was used in the alpine regions while the fixed wing aircraft was used in the plains and the urban area, using appropriate scan rates to receive evenly distributed point clouds. The resulting point density ranged from 10 to 25 points per square meter. By carefully selecting days with optimum water quality, satisfactory penetration down to the river

  5. High Resolution Airborne Shallow Water Mapping

    Science.gov (United States)

    Steinbacher, F.; Pfennigbauer, M.; Aufleger, M.; Ullrich, A.

    2012-07-01

    In order to meet the requirements of the European Water Framework Directive (EU-WFD), authorities face the problem of repeatedly performing area-wide surveying of all kinds of inland waters. Especially for mid-sized or small rivers this is a considerable challenge imposing insurmountable logistical efforts and costs. It is therefore investigated if large-scale surveying of a river system on an operational basis is feasible by employing airborne hydrographic laser scanning. In cooperation with the Bavarian Water Authority (WWA Weilheim) a pilot project was initiated by the Unit of Hydraulic Engineering at the University of Innsbruck and RIEGL Laser Measurement Systems exploiting the possibilities of a new LIDAR measurement system with high spatial resolution and high measurement rate to capture about 70 km of riverbed and foreland for the river Loisach in Bavaria/Germany and the estuary and parts of the shoreline (about 40km in length) of lake Ammersee. The entire area surveyed was referenced to classic terrestrial cross-section surveys with the aim to derive products for the monitoring and managing needs of the inland water bodies forced by the EU-WFD. The survey was performed in July 2011 by helicopter and airplane and took 3 days in total. In addition, high resolution areal images were taken to provide an optical reference, offering a wide range of possibilities on further research, monitoring, and managing responsibilities. The operating altitude was about 500 m to maintain eye-safety, even for the aided eye, the airspeed was about 55 kts for the helicopter and 75 kts for the aircraft. The helicopter was used in the alpine regions while the fixed wing aircraft was used in the plains and the urban area, using appropriate scan rates to receive evenly distributed point clouds. The resulting point density ranged from 10 to 25 points per square meter. By carefully selecting days with optimum water quality, satisfactory penetration down to the river bed was achieved

  6. Resolution enhancement of low quality videos using a high-resolution frame

    NARCIS (Netherlands)

    Pham, T.Q.; Van Vliet, L.J.; Schutte, K.

    2006-01-01

    This paper proposes an example-based Super-Resolution (SR) algorithm of compressed videos in the Discrete Cosine Transform (DCT) domain. Input to the system is a Low-Resolution (LR) compressed video together with a High-Resolution (HR) still image of similar content. Using a training set of

  7. High resolution surface plasmon imaging of nanoparticles

    Science.gov (United States)

    Berguiga, Lotfi; Roland, Thibault; Fahys, Audrey; Elezgaray, Juan; Argoul, Françoise

    2010-05-01

    We report a technique of surface plasmon resonance imaging (SPRi) called SSPM (Scanning Surface Plasmon Microscopy) which pushes down the resolution limit to sub-micronic scales. To confirm the sensitivity and resolution of this non labeling microscopy we show images of gold and dielectric nanoparticules detected in air. The contrast mechanism is discussed versus the defocusing and versus the nature of the particules.

  8. Super-resolution optical DNA Mapping via DNA methyltransferase-directed click chemistry

    DEFF Research Database (Denmark)

    Vranken, Charlotte; Deen, Jochem; Dirix, Lieve

    2014-01-01

    We demonstrate an approach to optical DNA mapping, which enables near single-molecule characterization of whole bacteriophage genomes. Our approach uses a DNA methyltransferase enzyme to target labelling to specific sites and copper-catalysed azide-alkyne cycloaddition to couple a fluorophore...... to the DNA. We achieve a labelling efficiency of ∼70% with an average labelling density approaching one site every 500 bp. Such labelling density bridges the gap between the output of a typical DNA sequencing experiment and the long-range information derived from traditional optical DNA mapping. We lay...... the foundations for a wider-scale adoption of DNA mapping by screening 11 methyltransferases for their ability to direct sequence-specific DNA transalkylation; the first step of the DNA labelling process and by optimizing reaction conditions for fluorophore coupling via a click reaction. Three of 11 enzymes...

  9. Non-B DNA Secondary Structures and Their Resolution by RecQ Helicases

    Directory of Open Access Journals (Sweden)

    Sudha Sharma

    2011-01-01

    Full Text Available In addition to the canonical B-form structure first described by Watson and Crick, DNA can adopt a number of alternative structures. These non-B-form DNA secondary structures form spontaneously on tracts of repeat sequences that are abundant in genomes. In addition, structured forms of DNA with intrastrand pairing may arise on single-stranded DNA produced transiently during various cellular processes. Such secondary structures have a range of biological functions but also induce genetic instability. Increasing evidence suggests that genomic instabilities induced by non-B DNA secondary structures result in predisposition to diseases. Secondary DNA structures also represent a new class of molecular targets for DNA-interactive compounds that might be useful for targeting telomeres and transcriptional control. The equilibrium between the duplex DNA and formation of multistranded non-B-form structures is partly dependent upon the helicases that unwind (resolve these alternate DNA structures. With special focus on tetraplex, triplex, and cruciform, this paper summarizes the incidence of non-B DNA structures and their association with genomic instability and emphasizes the roles of RecQ-like DNA helicases in genome maintenance by resolution of DNA secondary structures. In future, RecQ helicases are anticipated to be additional molecular targets for cancer chemotherapeutics.

  10. The High Time Resolution Radio Sky

    Science.gov (United States)

    Thornton, D.

    2013-11-01

    Pulsars are laboratories for extreme physics unachievable on Earth. As individual sources and possible orbital companions can be used to study magnetospheric, emission, and superfluid physics, general relativistic effects, and stellar and binary evolution. As populations they exhibit a wide range of sub-types, with parameters varying by many orders of magnitude signifying fundamental differences in their evolutionary history and potential uses. There are currently around 2200 known pulsars in the Milky Way, the Magellanic clouds, and globular clusters, most of which have been discovered with radio survey observations. These observations, as well as being suitable for detecting the repeating signals from pulsars, are well suited for identifying other transient astronomical radio bursts that last just a few milliseconds that either singular in nature, or rarely repeating. Prior to the work of this thesis non-repeating radio transients at extragalactic distances had possibly been discovered, however with just one example status a real astronomical sources was in doubt. Finding more of these sources was a vital to proving they were real and to open up the universe for millisecond-duration radio astronomy. The High Time Resolution Universe survey uses the multibeam receiver on the 64-m Parkes radio telescope to search the whole visible sky for pulsars and transients. The temporal and spectral resolution of the receiver and the digital back-end enable the detection of relatively faint, and distant radio sources. From the Parkes telescope a large portion of the Galactic plane can be seen, a rich hunting ground for radio pulsars of all types, while previously poorly surveyed regions away from the Galactic plane are also covered. I have made a number of pulsar discoveries in the survey, including some rare systems. These include PSR J1226-6208, a possible double neutron star system in a remarkably circular orbit, PSR J1431-471 which is being eclipsed by its companion with

  11. High Spectral Resolution Lidar (HSRL) Instrument Handbook

    Energy Technology Data Exchange (ETDEWEB)

    Goldsmith, John [Sandia National Lab. (SNL-CA), Livermore, CA (United States)

    2016-04-01

    High Spectral Resolution Lidar (HSRL) systems provide vertical profiles of optical depth, backscatter cross-section, depolarization, and backscatter phase function. All HSRL measurements are absolutely calibrated by reference to molecular scattering, which is measured at each point in the lidar profile. Like the Raman lidar but unlike simple backscatter lidars such as the micropulse lidar, the HSRL can measure backscatter cross-sections and optical depths without prior assumptions about the scattering properties of the atmosphere. The depolarization observations also allow robust discrimination between ice and water clouds. In addition, rigorous error estimates can be computed for all measurements. A very narrow, angular field of view reduces multiple scattering contributions. The small field of view, coupled with a narrow optical bandwidth, nearly eliminates noise due to scattered sunlight. There are two operational U.S. Department of Energy (DOE) Atmospheric Radiation Measurement (ARM) Climate Research Facility HSRL systems, one at the Barrow North Slope of Alaska (NSA) site and the other in the second ARM Mobile Facility (AMF2) collection of instrumentation.

  12. AIRBORNE HIGH-RESOLUTION DIGITAL IMAGING SYSTEM

    Directory of Open Access Journals (Sweden)

    Prado-Molina, J.

    2006-04-01

    Full Text Available A low-cost airborne digital imaging system capable to perform aerial surveys with small-format cameras isintroduced. The equipment is intended to obtain high-resolution multispectral digital photographs constituting so aviable alternative to conventional aerial photography and satellite imagery. Monitoring software handles all theprocedures involved in image acquisition, including flight planning, real-time graphics for aircraft position updatingin a mobile map, and supervises the main variables engaged in the imaging process. This software also creates fileswith the geographical position of the central point of every image, and the flight path followed by the aircraftduring the entire survey. The cameras are mounted on a three-axis stabilized platform. A set of inertial sensorsdetermines platform's deviations independently from the aircraft and an automatic control system keeps thecameras at a continuous nadir pointing and heading, with a precision better than ± 1 arc-degree in three-axis. Thecontrol system is also in charge of saving the platform’s orientation angles when the monitoring software triggersthe camera. These external orientation parameters, together with a procedure for camera calibration give theessential elements for image orthocorrection. Orthomosaics are constructed using commercial GIS software.This system demonstrates the feasibility of large area coverage in a practical and economical way using smallformatcameras. Monitoring and automatization reduce the work while increasing the quality and the amount ofuseful images.

  13. High spatial resolution probes for neurobiology applications

    Science.gov (United States)

    Gunning, D. E.; Kenney, C. J.; Litke, A. M.; Mathieson, K.

    2009-06-01

    Position-sensitive biological neural networks, such as the brain and the retina, require position-sensitive detection methods to identify, map and study their behavior. Traditionally, planar microelectrodes have been employed to record the cell's electrical activity with device limitations arising from the electrode's 2-D nature. Described here is the development and characterization of an array of electrically conductive micro-needles aimed at addressing the limitations of planar electrodes. The capability of this array to penetrate neural tissue improves the electrode-cell electrical interface and allows more complicated 3-D networks of neurons, such as those found in brain slices, to be studied. State-of-the-art semiconductor fabrication techniques were used to etch and passivate conformally the metal coat and fill high aspect ratio holes in silicon. These are subsequently transformed into needles with conductive tips. This process has enabled the fabrication of arrays of unprecedented dimensions: 61 hexagonally close-packed electrodes, ˜200 μm tall with 60 μm spacing. Electroplating the tungsten tips with platinum ensure suitable impedance values (˜600 kΩ at 1 kHz) for the recording of neuronal signals. Without compromising spatial resolution of the neuronal recordings, this array adds a new and exciting dimension to the study of biological neural networks.

  14. Super-resolution structure of DNA significantly differs in buccal cells of controls and Alzheimer's patients.

    Science.gov (United States)

    Garcia, Angeles; Huang, David; Righolt, Amanda; Righolt, Christiaan; Kalaw, Maria Carmela; Mathur, Shubha; McAvoy, Elizabeth; Anderson, James; Luedke, Angela; Itorralba, Justine; Mai, Sabine

    2017-09-01

    The advent of super-resolution microscopy allowed for new insights into cellular and physiological processes of normal and diseased cells. In this study, we report for the first time on the super-resolved DNA structure of buccal cells from patients with Alzheimer's disease (AD) versus age- and gender-matched healthy, non-caregiver controls. In this super-resolution study cohort of 74 participants, buccal cells were collected and their spatial DNA organization in the nucleus examined by 3D Structured Illumination Microscopy (3D-SIM). Quantitation of the super-resolution DNA structure revealed that the nuclear super-resolution DNA structure of individuals with AD significantly differs from that of their controls (p structure of AD significantly differs in mild, moderate, and severe disease with respect to the DNA-containing and DNA-free/poor spaces. We conclude that whole genome remodeling is a feature of buccal cells in AD. © 2016 The Authors. Journal of Cellular Physiology Published by Wiley Periodicals, Inc.

  15. Photoswitching of monomeric and dimeric DNA-intercalating cyanine dyes for super-resolution microscopy applications.

    Science.gov (United States)

    Flors, Cristina

    2010-05-01

    A growing trend in far-field super resolution fluorescence microscopy based on single molecule photoswitching involves the replacement of photoactivatable fluorophores by common organic dyes in which photoswitching reactions or blinking can be induced. This alternative strategy can greatly simplify the sample preparation and imaging scheme in some cases, and enables its application to a wider range of biological systems. This methodology has been applied successfully to unveil the nanoscale organisation of proteins, but little progress has been seen to date in DNA super-resolution imaging. Previous results have shown that blinking can be induced in the DNA-intercalating dimeric dye YOYO-1 in combination with a reducing buffer, and in turn super-resolution images of DNA can be reconstructed. However, monomeric intercalating dyes like YO-PRO-1 are more advantageous for biological applications. This paper shows that both YO-PRO-1 and YOYO-1 can be used in super-resolution imaging, and different sample preparation strategies are compared in terms of spatial resolution and homogeneity of the reconstructed super-resolution images. Moreover, ensemble and single-molecule experiments provide insight into the switching mechanism. The dyes YOYO-1 and YO-PRO-1 hold great potential for their use in nanoscale imaging of DNA topology in biology and nanoscience.

  16. Two high-mobility group box domains act together to underwind and kink DNA

    Energy Technology Data Exchange (ETDEWEB)

    Sánchez-Giraldo, R.; Acosta-Reyes, F. J. [Universitat Politecnica de Catalunya, 08028 Barcelona (Spain); Malarkey, C. S. [University of Colorado School of Medicine, Aurora, CO 80045 (United States); Saperas, N. [Universitat Politecnica de Catalunya, 08028 Barcelona (Spain); Churchill, M. E. A., E-mail: mair.churchill@ucdenver.edu [University of Colorado School of Medicine, Aurora, CO 80045 (United States); Campos, J. L., E-mail: mair.churchill@ucdenver.edu [Universitat Politecnica de Catalunya, 08028 Barcelona (Spain)

    2015-06-30

    The crystal structure of HMGB1 box A bound to an unmodified AT-rich DNA fragment is reported at a resolution of 2 Å. A new mode of DNA recognition for HMG box proteins is found in which two box A domains bind in an unusual configuration generating a highly kinked DNA structure. High-mobility group protein 1 (HMGB1) is an essential and ubiquitous DNA architectural factor that influences a myriad of cellular processes. HMGB1 contains two DNA-binding domains, box A and box B, which have little sequence specificity but have remarkable abilities to underwind and bend DNA. Although HMGB1 box A is thought to be responsible for the majority of HMGB1–DNA interactions with pre-bent or kinked DNA, little is known about how it recognizes unmodified DNA. Here, the crystal structure of HMGB1 box A bound to an AT-rich DNA fragment is reported at a resolution of 2 Å. Two box A domains of HMGB1 collaborate in an unusual configuration in which the Phe37 residues of both domains stack together and intercalate the same CG base pair, generating highly kinked DNA. This represents a novel mode of DNA recognition for HMGB proteins and reveals a mechanism by which structure-specific HMG boxes kink linear DNA.

  17. Fundamental constants and high-resolution spectroscopy

    Science.gov (United States)

    Bonifacio, P.; Rahmani, H.; Whitmore, J. B.; Wendt, M.; Centurion, M.; Molaro, P.; Srianand, R.; Murphy, M. T.; Petitjean, P.; Agafonova, I. I.; D'Odorico, S.; Evans, T. M.; Levshakov, S. A.; Lopez, S.; Martins, C. J. A. P.; Reimers, D.; Vladilo, G.

    2014-01-01

    Absorption-line systems detected in high resolution quasar spectra can be used to compare the value of dimensionless fundamental constants such as the fine-structure constant, α, and the proton-to-electron mass ratio, μ = m_p/m_e, as measured in remote regions of the Universe to their value today on Earth. In recent years, some evidence has emerged of small temporal and also spatial variations in α on cosmological scales which may reach a fractional level of ≈ 10 ppm (parts per million). We are conducting a Large Programme of observations with the Very Large Telescope's Ultraviolet and Visual Echelle Spectrograph (UVES), and are obtaining high-resolution ({R ≈ 60 000}) and high signal-to-noise ratio (S/N ≈ 100) spectra calibrated specifically to study the variations of the fundamental constants. We here provide a general overview of the Large Programme and report on the first results for these two constants, discussed in detail in Molaro et al. (2013) and Rahmani et al. (2013). A stringent bound for Δα/α is obtained for the absorber at z_abs = 1.6919 towards HE 2217-2818. The absorption profile is complex with several very narrow features, and is modeled with 32 velocity components. The relative variation in α in this system is +1.3± 2.4_stat ± 1.0_sys ppm if Al II λ 1670 Å and three Fe II transitions are used, and +1.1 ± 2.6_stat ppm in a slightly different analysis with only Fe II transitions used. This is one of the tightest bounds on α-variation from an individual absorber and reveals no evidence for variation in α at the 3-ppm precision level (1σ confidence). The expectation at this sky position of the recently-reported dipolar variation of α is (3.2-5.4)±1.7 ppm depending on dipole model used and this constraint of Δα/α at face value is not supporting this expectation but not inconsistent with it at the 3σ level. For the proton-to-electron mass ratio the analysis of the H_2 absorption lines of the z_abs ≈ 2.4018 damped Lyα system

  18. Super-Resolution Reconstruction of High-Resolution Satellite ZY-3 TLC Images.

    Science.gov (United States)

    Li, Lin; Wang, Wei; Luo, Heng; Ying, Shen

    2017-05-07

    Super-resolution (SR) image reconstruction is a technique used to recover a high-resolution image using the cumulative information provided by several low-resolution images. With the help of SR techniques, satellite remotely sensed images can be combined to achieve a higher-resolution image, which is especially useful for a two- or three-line camera satellite, e.g., the ZY-3 high-resolution Three Line Camera (TLC) satellite. In this paper, we introduce the application of the SR reconstruction method, including motion estimation and the robust super-resolution technique, to ZY-3 TLC images. The results show that SR reconstruction can significantly improve both the resolution and image quality of ZY-3 TLC images.

  19. Single sensor processing to obtain high resolution color component signals

    Science.gov (United States)

    Glenn, William E. (Inventor)

    2010-01-01

    A method for generating color video signals representative of color images of a scene includes the following steps: focusing light from the scene on an electronic image sensor via a filter having a tri-color filter pattern; producing, from outputs of the sensor, first and second relatively low resolution luminance signals; producing, from outputs of the sensor, a relatively high resolution luminance signal; producing, from a ratio of the relatively high resolution luminance signal to the first relatively low resolution luminance signal, a high band luminance component signal; producing, from outputs of the sensor, relatively low resolution color component signals; and combining each of the relatively low resolution color component signals with the high band luminance component signal to obtain relatively high resolution color component signals.

  20. High resolution CT findings of pseudoalveolar sarcoidosis

    Energy Technology Data Exchange (ETDEWEB)

    Nam, Ji Eun; Park, Jun Gyun; Choe, Kyu Ok; Kim, Sang Jin [Yonsei University College of Medicine, Seoul (Korea, Republic of); Ryu, Young Hoon; Im, Jung Gi [Seoul National University College of Medicine, Seoul (Korea, Republic of); Lee, Kyoung Soo [Sungkunkwan University College of Medicine, Seoul (Korea, Republic of); Song, Koun Sik [University of Ulsan College of Medicine, Seoul (Korea, Republic of); Kim, Hyae Young [National Cancer Centar, Seoul (Korea, Republic of)

    2002-08-01

    To determine the specific high-resolution CT features of sarcoidosis in which the observed pattern is predominantly pseudoalveolar. We retrospectively reviewed the HRCT findings in 15 cases in which chest radiography demonstrated pseudoalveolar consolidation. In all 15, sarcoidosis was pathologically proven. The distribution and characterization of the following CT features was meticulously scrutinized: distribution and characterization of pseudoalveolar lesions, air-bronchograms, micronodules, thickening of bronchovascular bundles and interlobular septa, lung distortion, ground-glass opacities and combined hilar and mediastinal lymphadenopathy. Follow-up CT scans were available in three cases after corticosteroid administration. Between one and 12 (mean, 5.6) pseudoalveolar lesions appeared as dense homogeneous or inhomogeneous opacities 1-4.5 cm in diameter and with an irregular margin located either at the lung periphery adjacent to the pleural surface or along the bronchovascular bundles, with mainly bilateral distribution (n=14, 93%). An air-bronchogram was observed in ten cases. Micronodules were observed at the periphery of the lesion or surrounding lung, which along with a thickened bronchovascular bundle was a consistent feature in all cases. Additional CT features included hilar and mediastinal lymphadenopathy (n=14, 93%), thickened interlobular septa (n=12, 80%), and ground-glass opacity (n=10, 67%). Lung distortion was noted in only one case (7%). After steroid administration pseudoalveolar lesions decreased in number and size in all three cases in which follow-up CT was available. The consistent HRCT features of pseudoalveolar sarcoidosis are bilateral multifocal dense homogenous or inhomogenous opacity and an irregular margin located either at the lung periphery adjacent to the pleural surface or along the bronchovascular bundles. Micronodules are present at the periphery of the lesion or surrounding lung. The features are reversible administration.

  1. High time-resolution sprite observations

    Science.gov (United States)

    Stenbaek-Nielsen, H. C.; McHarg, G. G.

    2007-12-01

    Imaging sprites at 10,000 fps have revealed new details about their temporal development. TV observations show a highly structured central body with downward tendrils and upward branches. But rather than being leaders, as suggested by the long streaks in the TV recordings, tendrils and branches are actually formed by spatially compact streamer heads moving at velocities up to 0.3 c. In an individual sprite event the downward moving streamer heads start first forming the tendrils; later, and from a lower altitude and from existing luminous sprite structures, upward moving streamer heads may appear to form the branches. If there are no upward moving streamer heads the event would be classified as a C-sprite, otherwise it would be a carrot sprite. Following the streamer head activity we see afterglow in which little or no temporal and spatial activity is present. The streamer heads are very bright and they appear to be point sources, i.e. their spatial dimensions are less than our 100-200 m image resolution. Streamer head modeling indicates a scale size of ~25 m in which case the brightness would be in the range 1-100 GR. Other models predict volume emission rates leading to a streamer head spatial scale size in the 10 to 100 m range. Our observations conclusively show the downward and upward propagating streamer heads to be separated in time and space. This is in contrast to a number of models in which both down and up going streamer heads emanates from the origin of the process. We frequently see old sprites re-appear in response to new activity suggesting that sprite activity leaves some imprint on the background atmosphere. Given the very large brightness of the streamer heads it would not be surprising if sprite activity initiates chemical processes that could locally affect the composition of the atmosphere, but whether this affects the mesosphere on a larger scale remains uncertain.

  2. High Resolution Pulse Compression Imaging Using Super Resolution FM-Chirp Correlation Method (SCM)

    Science.gov (United States)

    Fujiwara, M.; Okubo, K.; Tagawa, N.

    This study addresses the issue of the super-resolution pulse compression technique (PCT) for ultrasound imaging. Time resolution of multiple ultrasonic echoes using the FM-Chirp PCT is limited by the bandwidth of the sweep-frequency. That is, the resolution depends on the sharpness of auto-correlation function. We propose the Super resolution FM-Chirp correlation Method (SCM) and evaluate its performance. This method is based on the multiple signal classification (MUSIC) algorithm. Our simulations were made for the model assuming multiple signals reflected from some scatterers. We confirmed that SCM detects time delay of complicated reflected signals successfully with high resolution.

  3. MULTIPULSE - high resolution and high power in one TDEM system

    Science.gov (United States)

    Chen, Tianyou; Hodges, Greg; Miles, Philip

    2015-09-01

    An airborne time domain electromagnetic (TEM) system with high resolution and great depth of exploration is desired for geological mapping as well as for mineral exploration. The MULTIPULSE technology enables an airborne TEM system to transmit a high power pulse (a half-sine, for instance) and one or multiple low power pulse(s) (trapezoid or square) within a half-cycle. The high power pulse ensures good depth of exploration and the low power pulse allows a fast transmitter current turn off and earlier off-time measurement thus providing higher frequency signals, which allows higher near-surface resolution and better sensitivity to weak conductors. The power spectrum of the MULTIPULSE waveform comprising a half-sine and a trapezoid pulse clearly shows increased power in the higher frequency range (> ~2.3 kHz) compared to that of a single half-sine waveform. The addition of the low power trapezoid pulse extends the range of the sensitivity 10-fold towards the weak conductors, expanding the geological conductivity range of a system and increasing the scope of its applications. The MULTIPULSE technology can be applied to standard single-pulse airborne TEM systems on both helicopter and fixed-wing. We field tested the HELITEM MULTIPULSE system over a wire-loop in Iroquois Falls, demonstrating the different sensitivity of the high and low power pulses to the overburden and the wire-loop. We also tested both HELITEM and GEOTEM MULTIPULSE systems over a layered oil sand geologic setting in Fort McMurray, Alberta, Canada. The results show comparable shallow geologic resolution of the MULTIPULSE to that of the RESOLVE system while maintaining superior depth of exploration, confirming the increased geological conductivity range of a system employing MULTIPULSE compared to the standard single-pulse systems.

  4. High Resolution Sensor for Nuclear Waste Characterization

    Energy Technology Data Exchange (ETDEWEB)

    Shah, Kanai; Higgins, William; Van Loef, Edgar V

    2006-01-23

    Gamma ray spectrometers are an important tool in the characterization of radioactive waste. Important requirements for gamma ray spectrometers used in this application include good energy resolution, high detection efficiency, compact size, light weight, portability, and low power requirements. None of the available spectrometers satisfy all of these requirements. The goal of the Phase I research was to investigate lanthanum halide and related scintillators for nuclear waste clean-up. LaBr3:Ce remains a very promising scintillator with high light yield and fast response. CeBr3 is attractive because it is very similar to LaBr3:Ce in terms of scintillation properties and also has the advantage of much lower self-radioactivity, which may be important in some applications. CeBr3 also shows slightly higher light yield at higher temperatures than LaBr3 and may be easier to produce with high uniformity in large volume since it does not require any dopants. Among the mixed lanthanum halides, the light yield of LaBrxI3-x:Ce is lower and the difference in crystal structure of the binaries (LaBr3 and LaI3) makes it difficult to grow high quality crystals of the ternary as the iodine concentration is increased. On the other hand, LaBrxCl3-x:Ce provides excellent performance. Its light output is high and it provides fast response. The crystal structures of the two binaries (LaBr3 and LaCl3) are very similar. Overall, its scintillation properties are very similar to those for LaBr3:Ce. While the gamma-ray stopping efficiency of LaBrxCl3-x:Ce is lower than that for LaBr3:Ce (primarily because the density of LaCl3 is lower than that of LaBr3), it may be easier to grow large crystals of LaBrxCl3-x:Ce than LaBr3:Ce since in some instances (for example, CdxZn1-xTe), the ternary compounds provide increased flexibility in the crystal lattice. Among the new dopants, Eu2+ and Pr3+, tried in LaBr3 host crystals, the Eu2+ doped samples exhibited low light output. This was mostly because a

  5. Rif1 Is Required for Resolution of Ultrafine DNA Bridges in Anaphase to Ensure Genomic Stability.

    Science.gov (United States)

    Hengeveld, Rutger C C; de Boer, H Rudolf; Schoonen, Pepijn M; de Vries, Elisabeth G E; Lens, Susanne M A; van Vugt, Marcel A T M

    2015-08-24

    Sister-chromatid disjunction in anaphase requires the resolution of DNA catenanes by topoisomerase II together with Plk1-interacting checkpoint helicase (PICH) and Bloom's helicase (BLM). We here identify Rif1 as a factor involved in the resolution of DNA catenanes that are visible as ultrafine DNA bridges (UFBs) in anaphase to which PICH and BLM localize. Rif1, which during interphase functions downstream of 53BP1 in DNA repair, is recruited to UFBs in a PICH-dependent fashion, but independently of 53BP1 or BLM. Similar to PICH and BLM, Rif1 promotes the resolution of UFBs: its depletion increases the frequency of nucleoplasmic bridges and RPA70-positive UFBs in late anaphase. Moreover, in the absence of Rif1, PICH, or BLM, more nuclear bodies with damaged DNA arise in ensuing G1 cells, when chromosome decatenation is impaired. Our data reveal a thus far unrecognized function for Rif1 in the resolution of UFBs during anaphase to protect genomic integrity. Copyright © 2015 Elsevier Inc. All rights reserved.

  6. Quantum interpolation for high-resolution sensing.

    Science.gov (United States)

    Ajoy, Ashok; Liu, Yi-Xiang; Saha, Kasturi; Marseglia, Luca; Jaskula, Jean-Christophe; Bissbort, Ulf; Cappellaro, Paola

    2017-02-28

    Recent advances in engineering and control of nanoscale quantum sensors have opened new paradigms in precision metrology. Unfortunately, hardware restrictions often limit the sensor performance. In nanoscale magnetic resonance probes, for instance, finite sampling times greatly limit the achievable sensitivity and spectral resolution. Here we introduce a technique for coherent quantum interpolation that can overcome these problems. Using a quantum sensor associated with the nitrogen vacancy center in diamond, we experimentally demonstrate that quantum interpolation can achieve spectroscopy of classical magnetic fields and individual quantum spins with orders of magnitude finer frequency resolution than conventionally possible. Not only is quantum interpolation an enabling technique to extract structural and chemical information from single biomolecules, but it can be directly applied to other quantum systems for superresolution quantum spectroscopy.

  7. Conformational dynamics of DNA hairpins at millisecond resolution obtained from analysis of single-molecule FRET histograms.

    Science.gov (United States)

    Tsukanov, Roman; Tomov, Toma E; Berger, Yaron; Liber, Miran; Nir, Eyal

    2013-12-19

    Here we provide high resolution study of DNA hairpin dynamics achieved by probability distribution analysis (PDA) of diffusion-based single-molecule Förster resonance energy transfer (sm-FRET) histograms. The opening and closing rates of three hairpins both free and attached to DNA origami were determined. The agreement with rates previously obtained using the total internal reflection (TIRF) technique and between free hairpins and hairpins attached to origami validated the PDA and demonstrated that the origami had no influence on the hairpin dynamics. From comparison of rates of four DNA hairpins, differing only in stem sequence, and from comparison with rates calculated using nearest-neighbor method and standard transition state theory, we conclude that the unfolding reaction resembles that of melting of DNA duplex with a corresponding sequence and that the folding reaction depends on counterion concentration and not on stem sequence. Our validation and demonstration of the PDA method will encourage its implementation in future high-resolution dynamic studies of freely diffusing biomolecules.

  8. High resolution, high bandwidth global shutter CMOS area scan sensors

    Science.gov (United States)

    Faramarzpour, Naser; Sonder, Matthias; Li, Binqiao

    2013-10-01

    Global shuttering, sometimes also known as electronic shuttering, enables the use of CMOS sensors in a vast range of applications. Teledyne DALSA Global shutter sensors are able to integrate light synchronously across millions of pixels with microsecond accuracy. Teledyne DALSA offers 5 transistor global shutter pixels in variety of resolutions, pitches and noise and full-well combinations. One of the recent generations of these pixels is implemented in 12 mega pixel area scan device at 6 um pitch and that images up to 70 frames per second with 58 dB dynamic range. These square pixels include microlens and optional color filters. These sensors also offer exposure control, anti-blooming and high dynamic range operation by introduction of a drain and a PPD reset gate to the pixel. The state of the art sense node design of Teledyne DALSA's 5T pixel offers exceptional shutter rejection ratio. The architecture is consistent with the requirements to use stitching to achieve very large area scan devices. Parallel or serial digital output is provided on these sensors using on-chip, column-wise analog to digital converters. Flexible ADC bit depth combined with windowing (adjustable region of interest, ROI) allows these sensors to run with variety of resolution/bandwidth combinations. The low power, state of the art LVDS I/O technology allows for overall power consumptions of less than 2W at full performance conditions.

  9. High resolution IVEM tomography of biological specimens

    Energy Technology Data Exchange (ETDEWEB)

    Sedat, J.W.; Agard, D.A. [Univ. of California, San Francisco, CA (United States)

    1997-02-01

    Electron tomography is a powerful tool for elucidating the three-dimensional architecture of large biological complexes and subcellular organelles. The introduction of intermediate voltage electron microscopes further extended the technique by providing the means to examine very large and non-symmetrical subcellular organelles, at resolutions beyond what would be possible using light microscopy. Recent studies using electron tomography on a variety of cellular organelles and assemblies such as centrosomes, kinetochores, and chromatin have clearly demonstrated the power of this technique for obtaining 3D structural information on non-symmetric cell components. When combined with biochemical and molecular observations, these 3D reconstructions have provided significant new insights into biological function.

  10. High resolution X-ray diffraction studies on unirradiated and ...

    Indian Academy of Sciences (India)

    High-resolution X-ray diffraction technique, employing a three-crystal monochromator–collimator ... observed by high-resolution electron microscopy in both ..... 1988 Nucl. Instrum. Meth. B34 228. Kato N 1992 J. Acta Crystallogr. A48 834. Kaur B, Bhat M, Licci F, Kumar R, Kotru P N and Bamzai K K. 2004 Nucl. Instrum. Meth ...

  11. Scalable Algorithms for Large High-Resolution Terrain Data

    DEFF Research Database (Denmark)

    Mølhave, Thomas; Agarwal, Pankaj K.; Arge, Lars Allan

    2010-01-01

    In this paper we demonstrate that the technology required to perform typical GIS computations on very large high-resolution terrain models has matured enough to be ready for use by practitioners. We also demonstrate the impact that high-resolution data has on common problems. To our knowledge, so...

  12. Achieving sensitive, high-resolution laser spectroscopy at CRIS

    Energy Technology Data Exchange (ETDEWEB)

    Groote, R. P. de [Instituut voor Kern- en Stralingsfysica, KU Leuven (Belgium); Lynch, K. M., E-mail: kara.marie.lynch@cern.ch [EP Department, CERN, ISOLDE (Switzerland); Wilkins, S. G. [The University of Manchester, School of Physics and Astronomy (United Kingdom); Collaboration: the CRIS collaboration

    2017-11-15

    The Collinear Resonance Ionization Spectroscopy (CRIS) experiment, located at the ISOLDE facility, has recently performed high-resolution laser spectroscopy, with linewidths down to 20 MHz. In this article, we present the modifications to the beam line and the newly-installed laser systems that have made sensitive, high-resolution measurements possible. Highlights of recent experimental campaigns are presented.

  13. High-resolution X-ray diffraction studies of multilayers

    DEFF Research Database (Denmark)

    Christensen, Finn Erland; Hornstrup, Allan; Schnopper, H. W.

    1988-01-01

    High-resolution X-ray diffraction studies of the perfection of state-of-the-art multilayers are presented. Data were obtained using a triple-axis perfect-crystal X-ray diffractometer. Measurements reveal large-scale figure errors in the substrate. A high-resolution triple-axis set up is required...

  14. High resolution UV spectroscopy and laser-focused nanofabrication

    NARCIS (Netherlands)

    Myszkiewicz, G.

    2005-01-01

    This thesis combines two at first glance different techniques: High Resolution Laser Induced Fluorescence Spectroscopy (LIF) of small aromatic molecules and Laser Focusing of atoms for Nanofabrication. The thesis starts with the introduction to the high resolution LIF technique of small aromatic

  15. Achieving sensitive, high-resolution laser spectroscopy at CRIS

    Science.gov (United States)

    de Groote, R. P.; Lynch, K. M.; Wilkins, S. G.

    2017-11-01

    The Collinear Resonance Ionization Spectroscopy (CRIS) experiment, located at the ISOLDE facility, has recently performed high-resolution laser spectroscopy, with linewidths down to 20 MHz. In this article, we present the modifications to the beam line and the newly-installed laser systems that have made sensitive, high-resolution measurements possible. Highlights of recent experimental campaigns are presented.

  16. On the Design of High Resolution Imaging Systems

    Science.gov (United States)

    Eckardt, A.; Reulke, R.

    2017-05-01

    The design of high-resolution systems is always a consideration of many parameters. Technological parameter of the imaging system, e.g. diameter of the imaging system, mass and power, as well as storage and data transfer, have an direct impact on spacecraft size and design. The paper describes the essential design parameters for the description of high-resolution systems.

  17. Towards high resolution data assimilation and ensemble forecasting

    NARCIS (Netherlands)

    Stappers, R.J.J.

    2013-01-01

    Due the increase in computational power of supercomputers the grid resolution of high resolution numerical weather prediction models is now reaching the 1 km scale. As a result, mesoscale processes related to high impact weather (such as deep convection) can now explicitly be resolved by the models.

  18. Serum induced degradation of 3D DNA box origami observed by high speed atomic force microscope

    DEFF Research Database (Denmark)

    Jiang, Zaixing; Zhang, Shuai; Yang, Chuanxu

    2015-01-01

    3D DNA origami holds tremendous potential to encapsulate and selectively release therapeutic drugs. Observations of real-time performance of 3D DNA origami structures in physiological environment will contribute much to its further applications. Here, we investigate the degradation kinetics of 3D...... DNA box origami in serum using high-speed atomic force microscope optimized for imaging 3D DNA origami in real time. The time resolution allows characterizing the stages of serum effects on individual 3D DNA box origami with nanometer resolution. Our results indicate that the whole digest process...... is a combination of a rapid collapse phase and a slow degradation phase. The damages of box origami mainly happen in the collapse phase. Thus, the structure stability of 3D DNA box origami should be further improved, especially in the collapse phase, before clinical applications...

  19. EMODnet High Resolution Seabed Mapping - further developing a high resolution digital bathymetry for European seas

    Science.gov (United States)

    Schaap, Dick M. A.; Schmitt, Thierry

    2017-04-01

    Access to marine data is a key issue for the EU Marine Strategy Framework Directive and the EU Marine Knowledge 2020 agenda and includes the European Marine Observation and Data Network (EMODnet) initiative. EMODnet aims at assembling European marine data, data products and metadata from diverse sources in a uniform way. The EMODnet data infrastructure is developed through a stepwise approach in three major phases. Currently EMODnet is entering its 3rd phase with operational portals providing access to marine data for bathymetry, geology, physics, chemistry, biology, seabed habitats and human activities, complemented by checkpoint projects, analysing the fitness for purpose of data provision. The EMODnet Bathymetry project has developed Digital Terrain Models (DTM) for the European seas. These have been produced from survey and aggregated data sets that are indexed with metadata by adopting the SeaDataNet Catalogue services. SeaDataNet is a network of major oceanographic data centres around the European seas that manage, operate and further develop a pan-European infrastructure for marine and ocean data management. The latest EMODnet Bathymetry DTM release has a resolution of 1/8 arcminute * 1/8 arcminute and covers all European sea regions. Use has been made of circa 7800 gathered survey datasets and composite DTMs from 27 European data providers from 15 countries. For areas without coverage use has been made of the latest GEBCO DTM. The catalogue services and the generated EMODnet DTM have been published at the dedicated EMODnet Bathymetry portal which includes a versatile DTM viewing service that also supports downloading in various formats. End December 2016 the Bathymetry project has been succeeded by EMODnet High Resolution Seabed Mapping (HRSM) as part of the third phase of EMODnet. This new project will continue gathering of bathymetric in-situ data sets with extra efforts for near coastal waters and coastal zones. In addition Satellite Derived Bathymetry

  20. High-Resolution Sonars: What Resolution Do We Need for Target Recognition?

    Directory of Open Access Journals (Sweden)

    Pailhas Yan

    2010-01-01

    Full Text Available Target recognition in sonar imagery has long been an active research area in the maritime domain, especially in the mine-counter measure context. Recently it has received even more attention as new sensors with increased resolution have been developed; new threats to critical maritime assets and a new paradigm for target recognition based on autonomous platforms have emerged. With the recent introduction of Synthetic Aperture Sonar systems and high-frequency sonars, sonar resolution has dramatically increased and noise levels decreased. Sonar images are distance images but at high resolution they tend to appear visually as optical images. Traditionally algorithms have been developed specifically for imaging sonars because of their limited resolution and high noise levels. With high-resolution sonars, algorithms developed in the image processing field for natural images become applicable. However, the lack of large datasets has hampered the development of such algorithms. Here we present a fast and realistic sonar simulator enabling development and evaluation of such algorithms.We develop a classifier and then analyse its performances using our simulated synthetic sonar images. Finally, we discuss sensor resolution requirements to achieve effective classification of various targets and demonstrate that with high resolution sonars target highlight analysis is the key for target recognition.

  1. The high spectral resolution (scanning) lidar (HSRL)

    Energy Technology Data Exchange (ETDEWEB)

    Eloranta, E. [Univ. of Wisconsin, Madison, WI (United States)

    1995-09-01

    Lidars enable the spatial resolution of optical depth variation in clouds. The optical depth must be inverted from the backscatter signal, a process which is complicated by the fact that both molecular and aerosol backscatter signals are present. The HSRL has the advantage of allowing these two signals to be separated. It has a huge dynamic range, allowing optical depth retrieval for t = 0.01 to 3. Depolarization is used to determine the nature of hydrometeors present. Experiments show that water clouds must almost always be taken into account during cirrus observations. An exciting new development is the possibility of measuring effective radius via diffraction peak width and variable field-of-view measurements. 2 figs.

  2. A Single Nucleotide Resolution Model for Large-Scale Simulations of Double Stranded DNA

    CERN Document Server

    Fosado, Y A G; Allan, J; Brackley, C; Henrich, O; Marenduzzo, D

    2016-01-01

    The computational modelling of DNA is becoming crucial in light of new advances in DNA nanotechnology, single-molecule experiments and in vivo DNA tampering. Here we present a mesoscopic model for double stranded DNA (dsDNA) at the single nucleotide level which retains the characteristic helical structure, while being able to simulate large molecules -- up to a million base pairs -- for time-scales which are relevant to physiological processes. This is made possible by an efficient and highly-parallelised implementation of the model which we discuss here. We compare the behaviour of our model with single molecule experiments where dsDNA is manipulated by external forces or torques. We also present some results on the kinetics of denaturation of linear DNA.

  3. A high-resolution vehicle emission inventory for China

    Science.gov (United States)

    Zheng, B.; Zhang, Q.; He, K.; Huo, H.; Yao, Z.; Wang, X.

    2012-12-01

    Developing high resolution emission inventory is an essential task for air quality modeling and management. However, current vehicle emission inventories in China are usually developed at provincial level and then allocated to grids based on various spatial surrogates, which is difficult to get high spatial resolution. In this work, we developed a new approach to construct a high-resolution vehicle emission inventory for China. First, vehicle population at county level were estimated by using the relationship between per-capita GDP and vehicle ownership. Then the Weather Research and Forecasting (WRF) model were used to drive the International Vehicle Emission (IVE) model to get monthly emission factors for each county. Finally, vehicle emissions by county were allocated to grids with 5-km horizon resolution by using high-resolution road network data. This work provides a better understanding of spatial representation of vehicle emissions in China and can benefit both air quality modeling and management with improved spatial accuracy.

  4. High Resolution Melting (HRM) applied to wine authenticity.

    Science.gov (United States)

    Pereira, Leonor; Gomes, Sónia; Castro, Cláudia; Eiras-Dias, José Eduardo; Brazão, João; Graça, António; Fernandes, José R; Martins-Lopes, Paula

    2017-02-01

    Wine authenticity methods are in increasing demand mainly in Denomination of Origin designations. The DNA-based methodologies are a reliable means of tracking food/wine varietal composition. The main aim of this work was the study of High Resolution Melting (HRM) application as a screening method for must and wine authenticity. Three sample types (leaf, must and wine) were used to validate the three developed HRM assays (Vv1-705bp; Vv2-375bp; and Vv3-119bp). The Vv1 HRM assay was only successful when applied to leaf and must samples. The Vv2 HRM assay successfully amplified all sample types, allowing genotype discrimination based on melting temperature values. The smallest amplicon, Vv3, produced a coincident melting curve shape in all sample types (leaf and wine) with corresponding genotypes. This study presents sensitive, rapid and efficient HRM assays applied for the first time to wine samples suitable for wine authenticity purposes. Copyright © 2016 Elsevier Ltd. All rights reserved.

  5. [High resolution melting and its application in identity study of traditional Chinese medicine].

    Science.gov (United States)

    Chen, Kang; Jiang, Chao; Yuan, Yuan; Huang, Lu-qi

    2015-12-01

    High resolution melting (HRM), based on melting curve analysis, requires not only saturating dyes that fluoresce in the presence of double-stranded DNA, but also higher resolution detection equipment. The melting curve is a novel method for sequence matching, genotyping and mutation scanning. The technology is simple, accurate, rapid, closed-tube, low-cost, and high-throughput, which make it gain more and more applications. This review article presents the basic principles, key factors and both the advantage and limitations of HRM. The potential application is discussed in the study of molecular identity of traditional Chinese medicine.

  6. Photobleaching of YOYO-1 in super-resolution single DNA fluorescence imaging.

    Science.gov (United States)

    Pyle, Joseph R; Chen, Jixin

    2017-01-01

    Super-resolution imaging of single DNA molecules via point accumulation for imaging in nanoscale topography (PAINT) has great potential to visualize fine DNA structures with nanometer resolution. In a typical PAINT video acquisition, dye molecules (YOYO-1) in solution sparsely bind to the target surfaces (DNA) whose locations can be mathematically determined by fitting their fluorescent point spread function. Many YOYO-1 molecules intercalate into DNA and remain there during imaging, and most of them have to be temporarily or permanently fluorescently bleached, often stochastically, to allow for the visualization of a few fluorescent events per DNA per frame of the video. Thus, controlling the fluorescence on-off rate is important in PAINT. In this paper, we study the photobleaching of YOYO-1 and its correlation with the quality of the PAINT images. At a low excitation laser power density, the photobleaching of YOYO-1 is too slow and a minimum required power density was identified, which can be theoretically predicted with the proposed method in this report.

  7. Photobleaching of YOYO-1 in super-resolution single DNA fluorescence imaging

    Directory of Open Access Journals (Sweden)

    Joseph R. Pyle

    2017-11-01

    Full Text Available Super-resolution imaging of single DNA molecules via point accumulation for imaging in nanoscale topography (PAINT has great potential to visualize fine DNA structures with nanometer resolution. In a typical PAINT video acquisition, dye molecules (YOYO-1 in solution sparsely bind to the target surfaces (DNA whose locations can be mathematically determined by fitting their fluorescent point spread function. Many YOYO-1 molecules intercalate into DNA and remain there during imaging, and most of them have to be temporarily or permanently fluorescently bleached, often stochastically, to allow for the visualization of a few fluorescent events per DNA per frame of the video. Thus, controlling the fluorescence on–off rate is important in PAINT. In this paper, we study the photobleaching of YOYO-1 and its correlation with the quality of the PAINT images. At a low excitation laser power density, the photobleaching of YOYO-1 is too slow and a minimum required power density was identified, which can be theoretically predicted with the proposed method in this report.

  8. High-resolution interference with programmable classical incoherent light.

    Science.gov (United States)

    Zhang, Er-Feng; Liu, Wei-Tao; Chen, Ping-Xing

    2015-07-01

    A scheme of high-resolution interference with classical incoherent light is proposed. In this scheme, the classical incoherent light is programmable in the amplitude distribution and wavefront, and with the programmable classical incoherent light we improve the resolution of the interference pattern by a factor of 2 compared with the scheme by Erkmen [J. Opt. Soc. Am. A29, 782 (2012)JOAOD60740-323210.1364/JOSAA.29.000782]. Compared with other schemes for observing interference patterns, only single-pixel detection is needed in our proposal. Moreover, the high-resolution interference pattern can be inverted to obtain an image with better resolution compared with that of the scheme proposed by Erkmen. Furthermore, this scheme of high-resolution interference is verified in detail by theoretical analysis and numerical simulations.

  9. Achieving High Resolution Timer Events in Virtualized Environment.

    Science.gov (United States)

    Adamczyk, Blazej; Chydzinski, Andrzej

    2015-01-01

    Virtual Machine Monitors (VMM) have become popular in different application areas. Some applications may require to generate the timer events with high resolution and precision. This however may be challenging due to the complexity of VMMs. In this paper we focus on the timer functionality provided by five different VMMs-Xen, KVM, Qemu, VirtualBox and VMWare. Firstly, we evaluate resolutions and precisions of their timer events. Apparently, provided resolutions and precisions are far too low for some applications (e.g. networking applications with the quality of service). Then, using Xen virtualization we demonstrate the improved timer design that greatly enhances both the resolution and precision of achieved timer events.

  10. High-Resolution Stamp Fabrication by Edge Lithography

    NARCIS (Netherlands)

    Zhao, Yiping

    2010-01-01

    The aim of the project was to create high resolution stamps for thermal nanoimprint applications. The creation of nanoridges with sub-100 nm resolutions was explored by means of edge lithography via top-down routes, i.e. in combination with micromachining technology. Edge lithography is an add-on

  11. Impact of high resolution land surface initialization in Indian summer ...

    Indian Academy of Sciences (India)

    The direct impact of high resolution land surface initialization on the forecast bias in a regional climatemodel in recent years over Indian summer monsoon region is investigated. Two sets of regional climatemodel simulations are performed, one with a coarse resolution land surface initial conditions and secondone used a ...

  12. Reproducible high-resolution multispectral image acquisition in dermatology

    Science.gov (United States)

    Duliu, Alexandru; Gardiazabal, José; Lasser, Tobias; Navab, Nassir

    2015-07-01

    Multispectral image acquisitions are increasingly popular in dermatology, due to their improved spectral resolution which enables better tissue discrimination. Most applications however focus on restricted regions of interest, imaging only small lesions. In this work we present and discuss an imaging framework for high-resolution multispectral imaging on large regions of interest.

  13. Resolution analysis of high-resolution marine seismic data acquired off Yeosu, Korea

    Science.gov (United States)

    Lee, Ho-Young; Kim, Wonsik; Koo, Nam-Hyung; Park, Keun-Pil; Yoo, Dong-Geun; Kang, Dong-Hyo; Kim, Young-Gun; Seo, Gab-Seok; Hwang, Kyu-Duk

    2014-05-01

    High-resolution marine seismic surveys have been conducted for the mineral exploration and engineering purpose survey. To improve the quality of high-resolution seismic data, small-scaled multi-channel seismic techniques are used. In this study, we designed high-resolution marine seismic survey using a small airgun and an 8-channel streamer cable and analyzed the resolution of the seismic data related to acquisition and processing parameters. The field survey was conducted off Yeosu, Korea where the stratified thin sedimentary layers are deposited. We used a 30 in3 airgun and an 8-channel streamer cable with a 5 m group interval. We shoot the airgun with a 5 m shot interval and recorded digital data with a 0.1 ms sample interval and 1 s record length. The offset between the source and the first channel was 20 m. We processed the acquired data with simple procedure such as gain recovery, deconvolution, digital filtering, CMP sorting, NMO correction, static correction and stacking. To understand the effect of the acquisition parameters on the vertical and horizontal resolution, we resampled the acquired data using various sample intervals and CMP intervals and produced seismic sections. The analysis results show that the detailed subsurface structures can be imaged with good resolution and continuity using acquisition parameters with a sample interval shorter than 0.2 ms and a CMP interval shorter than 2.5 m. A high-resolution marine 8-channel airgun seismic survey using appropriate acquisition and processing parameters can be effective in imaging marine subsurface structure with a high resolution. This study is a part of a National Research Laboratory (NRL) project and a part of an Energy Technology Innovation (ETI) Project of the Korea Institute of Energy Technology Evaluation and Planning (KETEP), funded by the Ministry of Trade, Industry and Energy (MOTIE). The authors thank the officers and crew of the R/V Tamhae II for their efforts in the field survey.

  14. Ultra-high resolution and high-brightness AMOLED

    Science.gov (United States)

    Wacyk, Ihor; Ghosh, Amal; Prache, Olivier; Draper, Russ; Fellowes, Dave

    2012-06-01

    As part of its continuing effort to improve both the resolution and optical performance of AMOLED microdisplays, eMagin has recently developed an SXGA (1280×3×1024) microdisplay under a US Army RDECOM CERDEC NVESD contract that combines the world's smallest OLED pixel pitch with an ultra-high brightness green OLED emitter. This development is aimed at next-generation HMD systems with "see-through" and daylight imaging requirements. The OLED pixel array is built on a 0.18-micron CMOS backplane and contains over 4 million individually addressable pixels with a pixel pitch of 2.7 × 8.1 microns, resulting in an active area of 0.52 inches diagonal. Using both spatial and temporal enhancement, the display can provide over 10-bits of gray-level control for high dynamic range applications. The new pixel design also enables the future implementation of a full-color QSXGA (2560 × RGB × 2048) microdisplay in an active area of only 1.05 inch diagonal. A low-power serialized low-voltage-differential-signaling (LVDS) interface is integrated into the display for use as a remote video link for tethered systems. The new SXGA backplane has been combined with the high-brightness green OLED device developed by eMagin under an NVESD contract. This OLED device has produced an output brightness of more than 8000fL with all pixels on; lifetime measurements are currently underway and will presented at the meeting. This paper will describe the operational features and first optical and electrical test results of the new SXGA demonstrator microdisplay.

  15. High spatial resolution distributed optical fiber dynamic strain sensor with enhanced frequency and strain resolution.

    Science.gov (United States)

    Masoudi, Ali; Newson, Trevor P

    2017-01-15

    A distributed optical fiber dynamic strain sensor with high spatial and frequency resolution is demonstrated. The sensor, which uses the ϕ-OTDR interrogation technique, exhibited a higher sensitivity thanks to an improved optical arrangement and a new signal processing procedure. The proposed sensing system is capable of fully quantifying multiple dynamic perturbations along a 5 km long sensing fiber with a frequency and spatial resolution of 5 Hz and 50 cm, respectively. The strain resolution of the sensor was measured to be 40 nε.

  16. High Resolution, Range/Range-Rate Imager Project

    Data.gov (United States)

    National Aeronautics and Space Administration — Visidyne proposes to develop a design for a small, lightweight, high resolution, in x, y, and z Doppler imager to assist in the guidance, navigation and control...

  17. Hurricane Satellite (HURSAT) from Advanced Very High Resolution Radiometer (AVHRR)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Huricane Satellite (HURSAT)-Advanced Very High Resolution Radiometer (AVHRR) is used to extend the HURSAT data set such that appling the Objective Dvorak technique...

  18. Methodology of high-resolution photography for mural condition database

    Science.gov (United States)

    Higuchi, R.; Suzuki, T.; Shibata, M.; Taniguchi, Y.

    2015-08-01

    Digital documentation is one of the most useful techniques to record the condition of cultural heritage. Recently, high-resolution images become increasingly useful because it is possible to show general views of mural paintings and also detailed mural conditions in a single image. As mural paintings are damaged by environmental stresses, it is necessary to record the details of painting condition on high-resolution base maps. Unfortunately, the cost of high-resolution photography and the difficulty of operating its instruments and software have commonly been an impediment for researchers and conservators. However, the recent development of graphic software makes its operation simpler and less expensive. In this paper, we suggest a new approach to make digital heritage inventories without special instruments, based on our recent our research project in Üzümlü church in Cappadocia, Turkey. This method enables us to achieve a high-resolution image database with low costs, short time, and limited human resources.

  19. A Forward-Looking High-Resolution GPR System

    National Research Council Canada - National Science Library

    Kositsky, Joel; Milanfar, Peyman

    1999-01-01

    A high-resolution ground penetrating radar (GPR) system was designed to help define the optimal radar parameters needed for the efficient standoff detection of buried and surface-laid antitank mines...

  20. High Resolution Orthoimagery = Orthorectified Metro Areas: 2000 - Present

    Data.gov (United States)

    U.S. Geological Survey, Department of the Interior — High resolution orthorectified images combine the image characteristics of an aerial photograph with the geometric qualities of a map. An orthoimage is a...

  1. Topological Data Analysis of High-Resolution Temporal Rainfall

    Science.gov (United States)

    Carsteanu, Alin Andrei; Fernández Méndez, Félix; Vásquez Aguilar, Raciel

    2017-04-01

    This study applies topological data analysis (TDA) to the state space representations of high-resolution temporal rainfall intensity data from Iowa City (IIHR, U of Iowa). Using a sufficient embedding dimension, topological properties of the underlying manifold are depicted.

  2. NOAA High-Resolution Sea Surface Temperature (SST) Analysis Products

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This archive covers two high resolution sea surface temperature (SST) analysis products developed using an optimum interpolation (OI) technique. The analyses have a...

  3. High-resolution Imaging Techniques for the Assessment of Osteoporosis

    OpenAIRE

    Krug, Roland; Burghardt, Andrew J.; Majumdar, Sharmila; Link, Thomas M.

    2010-01-01

    The importance of assessing the bone’s microarchitectural make-up in addition to its mineral density in the context of osteoporosis has been emphasized in a number of publications. The high spatial resolution required to resolve the bone’s microstructure in a clinically feasible scan time is challenging. Currently, the best suited modalities meeting these requirements in vivo are high-resolution peripheral quantitative imaging (HR-pQCT) and magnetic resonance imaging (MRI). Whereas HR-pQCT is...

  4. Developing Visual Editors for High-Resolution Haptic Patterns

    DEFF Research Database (Denmark)

    Cuartielles, David; Göransson, Andreas; Olsson, Tony

    2012-01-01

    In this article we give an overview of our iterative work in developing visual editors for creating high resolution haptic patterns to be used in wearable, haptic feedback devices. During the past four years we have found the need to address the question of how to represent, construct and edit high...... resolution haptic patterns so that they translate naturally to the user’s haptic experience. To solve this question we have developed and tested several visual editors...

  5. Dynamics of High-Resolution Networks

    DEFF Research Database (Denmark)

    Sekara, Vedran

    NETWORKS are everywhere. From the smallest confines of the cells within our bodies to the webs of social relations across the globe. Networks are not static, they constantly change, adapt, and evolve to suit new conditions. In order to understand the fundamental laws that govern networks we need...... the unprecedented amounts of information collected by mobile phones to gain detailed insight into the dynamics of social systems. This dissertation presents an unparalleled data collection campaign, collecting highly detailed traces for approximately 1000 people over the course of multiple years. The availability...

  6. Do high-resolution convection-permitting experiments on Europe need to be driven by high resolution global runs?

    Science.gov (United States)

    Berthou, Segolene; Chan, Steven; Kendon, Elizabeth; Roberts, Malcolm; Lee, Robert; Vanniere, Benoit

    2017-04-01

    Challenges of getting appropriate climate-change scenarios over Europe both come from having a good representation of the synoptic systems reaching Europe and having a good-enough representation of local and orographic processes in Europe. Therefore we perform both the evaluation of the driving global model and its dynamical downscaling with a 2.2km regional model on the present day period, in the perspective of using this configuration in a future climate scenario. 20-year long atmosphere-only simulations with the Unified Model of the Met Office were run at different global resolutions (130km, 60km and 25km) and the highest resolution was chosen to give the boundaries of a European-wide convection permitting simulation with a 2.2km resolution. The synoptic situation of the different global resolutions are comparable in terms of latitudinal distribution of the jets and weather regimes but there is consistent improvement in the frequency of storms reaching Europe at 25km resolution. High resolution global runs therefore mainly show added value in the high-frequency synoptic drivers. Compared to high resolution precipitation datasets, the 25km resolution is showing good representation of winter precipitation distribution, although with too many days of moderate precipitation in Western Europe. It shows a dry bias in summer, consistent with a mean jet too north.

  7. High-resolution simulations of turbidity currents

    Science.gov (United States)

    Biegert, Edward; Vowinckel, Bernhard; Ouillon, Raphael; Meiburg, Eckart

    2017-12-01

    We employ direct numerical simulations of the three-dimensional Navier-Stokes equations, based on a continuum formulation for the sediment concentration, to investigate the physics of turbidity currents in complex situations, such as when they interact with seafloor topography, submarine engineering infrastructure and stratified ambients. In order to obtain a more accurate representation of the dynamics of erosion and resuspension, we have furthermore developed a grain-resolving simulation approach for representing the flow in the high-concentration region near and within the sediment bed. In these simulations, the Navier-Stokes flow around each particle and within the pore spaces of the sediment bed is resolved by means of an immersed boundary method, with the particle-particle interactions being taken into account via a detailed collision model. [Figure not available: see fulltext.

  8. O-space with high resolution readouts outperforms radial imaging.

    Science.gov (United States)

    Wang, Haifeng; Tam, Leo; Kopanoglu, Emre; Peters, Dana C; Constable, R Todd; Galiana, Gigi

    2017-04-01

    While O-Space imaging is well known to accelerate image acquisition beyond traditional Cartesian sampling, its advantages compared to undersampled radial imaging, the linear trajectory most akin to O-Space imaging, have not been detailed. In addition, previous studies have focused on ultrafast imaging with very high acceleration factors and relatively low resolution. The purpose of this work is to directly compare O-Space and radial imaging in their potential to deliver highly undersampled images of high resolution and minimal artifacts, as needed for diagnostic applications. We report that the greatest advantages to O-Space imaging are observed with extended data acquisition readouts. A sampling strategy that uses high resolution readouts is presented and applied to compare the potential of radial and O-Space sequences to generate high resolution images at high undersampling factors. Simulations and phantom studies were performed to investigate whether use of extended readout windows in O-Space imaging would increase k-space sampling and improve image quality, compared to radial imaging. Experimental O-Space images acquired with high resolution readouts show fewer artifacts and greater sharpness than radial imaging with equivalent scan parameters. Radial images taken with longer readouts show stronger undersampling artifacts, which can cause small or subtle image features to disappear. These features are preserved in a comparable O-Space image. High resolution O-Space imaging yields highly undersampled images of high resolution and minimal artifacts. The additional nonlinear gradient field improves image quality beyond conventional radial imaging. Copyright © 2016 Elsevier Inc. All rights reserved.

  9. Compact and high-resolution optical orbital angular momentum sorter

    Directory of Open Access Journals (Sweden)

    Chenhao Wan

    2017-03-01

    Full Text Available A compact and high-resolution optical orbital angular momentum (OAM sorter is proposed and demonstrated. The sorter comprises a quadratic fan-out mapper and a dual-phase corrector positioned in the pupil plane and the Fourier plane, respectively. The optical system is greatly simplified compared to previous demonstrations of OAM sorting, and the performance in resolution and efficiency is maintained. A folded configuration is set up using a single reflective spatial light modulator (SLM to demonstrate the validity of the scheme. The two phase elements are implemented on the left and right halves of the SLM and connected by a right-angle prism. Experimental results demonstrate the high resolution of the compact OAM sorter, and the current limit in efficiency can be overcome by replacing with transmissive SLMs and removing the beam splitters. This novel scheme paves the way for the miniaturization and integration of high-resolution OAM sorters.

  10. High-resolution neutron diffraction studies of biological and industrial fibres

    Energy Technology Data Exchange (ETDEWEB)

    Langan, P.; Mason, S.A. [Institut Max von Laue - Paul Langevin (ILL), 38 - Grenoble (France); Fuller, W.; Forsyth, V.T.; Mahendrasingam, A.; Shotton, M.; Simpson, L. [Keele Univ. (United Kingdom); Grimm, H. [FZ, Juelich (Germany); Leberman, R. [EMBL, (Country Unknown)

    1997-04-01

    Neutron diffraction is becoming an important tool for studying fibres due to its complementarity to X-ray diffraction. Unlike X-rays, scattering of neutrons by polymer atoms is not a function of their atomic number. In high-resolution studies (1.5-3 A) on D19 deuteration (replacing H by D) is being used to change the relative scattering power of chosen groups making them easier to locate. Recent studies on DNA and cellulose are described. (author). 6 refs.

  11. High Resolution Melting Analysis for fast and cheap polymorphism screening of marine populations

    OpenAIRE

    sprotocols

    2015-01-01

    Authors: Anne-Leila Meistertzheim, Isabelle Calves, Sébastien Artigaud, Carolyn S. Friedman, Christine Paillard, Jean Laroche & Claude Ferec ### Abstract This protocol permits the mutation scanning of PCR products by high-resolution DNA melting analysis requiring the inclusion of a saturating intercalating dye in the PCR mix without labelled probe. During a scanning process, fluorescent melting curves of PCR amplicons are analyzed. Mutations modifying melting curve shapes, are allowed...

  12. Liquid Scintillation High Resolution Spectral Analysis

    Energy Technology Data Exchange (ETDEWEB)

    Grau Carles, A.; Grau Malonda, A.

    2010-08-06

    The CIEMAT/NIST and the TDCR methods in liquid scintillation counting are based on the determination of the efficiency for total counting. This paper tries to expand these methods analysing the pulse-height spectrum of radionuclides. To reach this objective we have to generalize the equations used in the model and to analyse the influence of ionization and chemical quench in both spectra and counting efficiency. We present equations to study the influence of different photomultipliers response in systems with one, two or three photomultipliers. We study the effect of the electronic noise discriminator level in both spectra and counting efficiency. The described method permits one to study problems that up to now was not possible to approach, such as the high uncertainty in the standardization of pure beta-ray emitter with low energy when we apply the TDCR method, or the discrepancies in the standardization of some electron capture radionuclides, when the CIEMAT/NIST method is applied. (Author) 107 refs.

  13. High-resolution spectroscopy of gases for industrial applications

    DEFF Research Database (Denmark)

    Fateev, Alexander; Clausen, Sønnik

    for analysis of complex experimental data and further development of the databases. High-temperature gas cell facilities available at DTU Chemical Engineering are presented and described. The gas cells and high-resolution spectrometers allow us to perform high-quality reference measurements of gases relevant...

  14. High-resolution neutron microtomography with noiseless neutron counting detector

    Science.gov (United States)

    Tremsin, A. S.; McPhate, J. B.; Vallerga, J. V.; Siegmund, O. H. W.; Feller, W. B.; Lehmann, E.; Butler, L. G.; Dawson, M.

    2011-10-01

    The improved collimation and intensity of thermal and cold neutron beamlines combined with recent advances in neutron imaging devices enable high-resolution neutron radiography and microtomography, which can provide information on the internal structure of objects not achievable with conventional X-ray imaging techniques. Neutron detection efficiency, spatial and temporal resolution (important for the studies of dynamic processes) and low background count rate are among the crucial parameters defining the quality of radiographic images and tomographic reconstructions. The unique capabilities of neutron counting detectors with neutron-sensitive microchannel plates (MCPs) and with Timepix CMOS readouts providing high neutron detection efficiency (˜70% for cold neutrons), spatial resolutions ranging from 15 to 55 μm and a temporal resolution of ˜1 μs—combined with the virtual absence of readout noise—make these devices very attractive for high-resolution microtomography. In this paper we demonstrate the capabilities of an MCP-Timepix detection system applied to microtomographic imaging, performed at the ICON cold neutron facility of the Paul Scherrer Institute. The high resolution and the absence of readout noise enable accurate reconstruction of texture in a relatively opaque wood sample, differentiation of internal tissues of a fly and imaging of individual ˜400 μm grains in an organic powder encapsulated in a ˜700 μm thick metal casing.

  15. Dual camera system for acquisition of high resolution images

    Science.gov (United States)

    Papon, Jeremie A.; Broussard, Randy P.; Ives, Robert W.

    2007-02-01

    Video surveillance is ubiquitous in modern society, but surveillance cameras are severely limited in utility by their low resolution. With this in mind, we have developed a system that can autonomously take high resolution still frame images of moving objects. In order to do this, we combine a low resolution video camera and a high resolution still frame camera mounted on a pan/tilt mount. In order to determine what should be photographed (objects of interest), we employ a hierarchical method which first separates foreground from background using a temporal-based median filtering technique. We then use a feed-forward neural network classifier on the foreground regions to determine whether the regions contain the objects of interest. This is done over several frames, and a motion vector is deduced for the object. The pan/tilt mount then focuses the high resolution camera on the next predicted location of the object, and an image is acquired. All components are controlled through a single MATLAB graphical user interface (GUI). The final system we present will be able to detect multiple moving objects simultaneously, track them, and acquire high resolution images of them. Results will demonstrate performance tracking and imaging varying numbers of objects moving at different speeds.

  16. A Procedure for High Resolution Satellite Imagery Quality Assessment

    Directory of Open Access Journals (Sweden)

    Mattia Crespi

    2009-05-01

    Full Text Available Data products generated from High Resolution Satellite Imagery (HRSI are routinely evaluated during the so-called in-orbit test period, in order to verify if their quality fits the desired features and, if necessary, to obtain the image correction parameters to be used at the ground processing center. Nevertheless, it is often useful to have tools to evaluate image quality also at the final user level. Image quality is defined by some parameters, such as the radiometric resolution and its accuracy, represented by the noise level, and the geometric resolution and sharpness, described by the Modulation Transfer Function (MTF. This paper proposes a procedure to evaluate these image quality parameters; the procedure was implemented in a suitable software and tested on high resolution imagery acquired by the QuickBird, WorldView-1 and Cartosat-1 satellites.

  17. Detection of proximal caries with high-resolution and standard resolution digital radiographic systems.

    Science.gov (United States)

    Berkhout, W E R; Verheij, J G C; Syriopoulos, K; Li, G; Sanderink, G C H; van der Stelt, P F

    2007-05-01

    The aim of this study was to: (1) compare the diagnostic accuracy of the high-resolution and standard resolution settings of four digital imaging systems for caries diagnosis and (2) compare the effect on the diagnostic accuracy of reducing the high-resolution image sizes to the standard resolution dimensions, and vice versa. 90 extracted human premolars were mounted in groups of 5 in plaster blocks, containing 4 test teeth and 1 non-test tooth. Two blocks at a time were placed in a jig to simulate a bitewing radiograph. Radiographs were taken using four digital systems (Planmeca Dixi 2; Gendex Visualix HDI; Dürr Vistascan; Digora Optime), each at two resolution settings. Next, the teeth were sectioned and a total of 65 surfaces were incorporated in the study. Additionally, the bicubic interpolation method was applied to reduce the high-resolution original images and to enlarge the standard resolution images. The original, reduced and enlarged images were randomly shown to five observers in two random sessions. The observers were asked to assess caries depth on a 4-point scale. The observers' scores were compared with the results from a histological examination. Data were analysed using the statistical theory for multivariate discrete data. Cohen's kappa was used to determine the agreement with the gold standard. None of the comparisons between the spatial resolution settings, or the comparisons between increased or reduced image size and the original image sizes, showed significant differences in the probability of caries detection (chi2=26.59, df=26, P approximately 0.50). The four digital systems used in this study differ significantly in the probability of caries detection (chi2=41.55, df=24, PCaries diagnosis does not improve when using high-resolution settings compared with the standard settings. The use of bicubic convolution interpolation for zooming has no detectable effect on caries diagnosis and therefore is recommended to use when enlarging or reducing

  18. Ocular Imaging Combining Ultrahigh Resolution and High Speed OCT

    Science.gov (United States)

    Schmoll, Tilman; Leitgeb, Rainer A.

    The impact of ultrahigh-resolution and ultrahigh-speed OCT technique on corneal and retinal imaging is shown. The capabilities of advanced OCT system for imaging of the cornea and the thickness determination of the tear film, corneal epithelium, and Bowman's layer over a wide field of view are demonstrated. The high transverse and axial resolution of OCT system allowing one to image individual nerve fiber bundles, the parafoveal capillary network, and individual cone photoreceptors is described.

  19. Automated data processing of high-resolution mass spectra

    DEFF Research Database (Denmark)

    Hansen, Michael Adsetts Edberg; Smedsgaard, Jørn

    infusion of crude extracts into the source taking advantage of the high sensitivity, high mass resolution and accuracy and the limited fragmentation. Unfortunately, there has not been a comparable development in the data processing techniques to fully exploit gain in high resolution and accuracy...... of the massive amounts of data. We present an automated data processing method to quantitatively compare large numbers of spectra from the analysis of complex mixtures, exploiting the full quality of high-resolution mass spectra. By projecting all detected ions - within defined intervals on both the time...... infusion analyses of crude extract to find the relationship between species from several species terverticillate Penicillium, and also that the ions responsible for the segregation can be identified. Furthermore the process can automate the process of detecting unique species and unique metabolites....

  20. Lynx: A High-Resolution Synthetic Aperture Radar

    Energy Technology Data Exchange (ETDEWEB)

    Doerry, A.W.; Hensley, W.H.; Pace, F.; Stence, J.; Tsunoda, S.I.; Walker, B.C.; Woodring, M.

    1999-03-08

    Lynx is a high resolution, synthetic aperture radar (SAR) that has been designed and built by Sandia National Laboratories in collaboration with General Atomics (GA). Although Lynx may be operated on a wide variety of manned and unmanned platforms, it is primarily intended to be fielded on unmanned aerial vehicles. In particular, it may be operated on the Predator, I-GNAT, or Prowler II platforms manufactured by GA Aeronautical Systems, Inc. The Lynx production weight is less than 120 lb. and has a slant range of 30 km (in 4 mm/hr rain). It has operator selectable resolution and is capable of 0.1 m resolution in spotlight mode and 0.3 m resolution in stripmap mode. In ground moving target indicator mode, the minimum detectable velocity is 6 knots with a minimum target cross-section of 10 dBsm. In coherent change detection mode, Lynx makes registered, complex image comparisons either of 0.1 m resolution (minimum) spotlight images or of 0.3 m resolution (minimum) strip images. The Lynx user interface features a view manager that allows it to pan and zoom like a video camera. Lynx was developed under corporate finding from GA and will be manufactured by GA for both military and commercial applications. The Lynx system architecture will be presented and some of its unique features will be described. Imagery at the finest resolutions in both spotlight and strip modes have been obtained and will also be presented.

  1. Comparison of High Resolution Negative Electron Beam Resists

    DEFF Research Database (Denmark)

    Olsen, Brian Bilenberg; Schøler, Mikkel; Shi, Peixiong

    2006-01-01

    Four high resolution negative electron beam resists are compared: TEBN-1 from Tokuyama Corp. Japan, ma-N 2401XP and mr-L 6000AXP from microresist technology GmbH Germany, and SU-8 2000 series from MicroChem Corp., USA. Narrow linewidth high density patterns are defined by 100 kV electron beam...

  2. High-Resolution Broadband Spectroscopy Using an Externally Dispersed Interferometer

    Science.gov (United States)

    Erskine, David J.; Edelstein, Jerry; Feuerstein, W. Michael; Welsh, Barry

    2003-08-01

    An externally dispersed interferometer (EDI) is a series combination of a fixed delay interferometer and an external grating spectrograph. We describe how the EDI can boost the effective resolving power of an echelle or linear grating spectrograph by a factor of 2-3 or more over the spectrograph's full bandwidth. The interferometer produces spectral fringes over the entire spectrograph's bandwidth. The fringes heterodyne with spectral features to provide a low spatial frequency moiré pattern. The heterodyning is numerically reversed to recover highly detailed spectral information unattainable by the spectrograph alone. We demonstrate resolution boosting for stellar and solar measurements of two-dimensional echelle and linear grating spectra. An effective spectral resolution of ~100,000 has been obtained from the ~50,000 resolution Lick Observatory two-dimensional echelle spectrograph, and that of ~50,000 from an ~20,000 resolution linear grating spectrograph.

  3. High-resolution structure of viruses from random diffraction snapshots

    CERN Document Server

    Hosseinizadeh, A; Dashti, A; Fung, R; D'Souza, R M; Ourmazd, A

    2014-01-01

    The advent of the X-ray Free Electron Laser (XFEL) has made it possible to record diffraction snapshots of biological entities injected into the X-ray beam before the onset of radiation damage. Algorithmic means must then be used to determine the snapshot orientations and thence the three-dimensional structure of the object. Existing Bayesian approaches are limited in reconstruction resolution typically to 1/10 of the object diameter, with the computational expense increasing as the eighth power of the ratio of diameter to resolution. We present an approach capable of exploiting object symmetries to recover three-dimensional structure to high resolution, and thus reconstruct the structure of the satellite tobacco necrosis virus to atomic level. Our approach offers the highest reconstruction resolution for XFEL snapshots to date, and provides a potentially powerful alternative route for analysis of data from crystalline and nanocrystalline objects.

  4. Achieving High Resolution Timer Events in Virtualized Environment.

    Directory of Open Access Journals (Sweden)

    Blazej Adamczyk

    Full Text Available Virtual Machine Monitors (VMM have become popular in different application areas. Some applications may require to generate the timer events with high resolution and precision. This however may be challenging due to the complexity of VMMs. In this paper we focus on the timer functionality provided by five different VMMs-Xen, KVM, Qemu, VirtualBox and VMWare. Firstly, we evaluate resolutions and precisions of their timer events. Apparently, provided resolutions and precisions are far too low for some applications (e.g. networking applications with the quality of service. Then, using Xen virtualization we demonstrate the improved timer design that greatly enhances both the resolution and precision of achieved timer events.

  5. Adaptive optics high resolution spectroscopy: present status and future direction

    Energy Technology Data Exchange (ETDEWEB)

    Alcock, C; Angel, R; Ciarlo, D; Fugate, R O; Ge, J; Kuzmenko, P; Lloyd-Hart, M; Macintosh, B; Najita, J; Woolf, N

    1999-07-27

    High resolution spectroscopy experiments with visible adaptive optics (AO) telescopes at Starfire Optical Range and Mt. Wilson have demonstrated that spectral resolution can be routinely improved by a factor of - 10 over the seeing-limited case with no extra light losses at visible wavelengths. With large CCDs now available, a very wide wavelength range can be covered in a single exposure. In the near future, most large ground-based telescopes will be equipped with powerful A0 systems. Most of these systems are aimed primarily at diffraction-limited operation in the near IR. An exciting new opportunity will thus open up for high resolution IR spectroscopy. Immersion echelle gratings with much coarser grooves being developed by us at LLNL will play a critical role in achieving high spectral resolution with a compact and low cost IR cryogenically cooled spectrograph and simultaneous large wavelength coverage on relatively small IR detectors. We have constructed a new A0 optimized spectrograph at Steward Observatory to provide R = 200,000 in the optical, which is being commissioned at the Starfire Optical Range 3.5m telescope. We have completed the optical design of the LLNL IR Immersion Spectrograph (LISPEC) to take advantage of improved silicon etching technology. Key words: adaptive optics, spectroscopy, high resolution, immersion gratings

  6. The theory and practice of high resolution scanning electron microscopy

    Energy Technology Data Exchange (ETDEWEB)

    Joy, D.C. (Tennessee Univ., Knoxville, TN (USA) Oak Ridge National Lab., TN (USA))

    1990-01-01

    Recent advances in instrumentation have produced the first commercial examples of what can justifiably be called High Resolution Scanning Electron Microscopes. The key components of such instruments are a cold field emission gun, a small-gap immersion probe-forming lens, and a clean dry-pumped vacuum. The performance of these microscopes is characterized by several major features including a spatial resolution, in secondary electron mode on solid specimens, which can exceed 1nm on a routine basis; an incident probe current density of the order of 10{sup 6} amps/cm{sup 2}; and the ability to maintain these levels of performance over an accelerating voltage range of from 1 to 30keV. This combination of high resolution, high probe current, low contamination and flexible electron-optical conditions provides many new opportunitites for the application of the SEM to materials science, physics, and the life sciences. 27 refs., 14 figs.

  7. High spatial resolution diffusion tensor imaging and its applications

    CERN Document Server

    Wang, J J

    2002-01-01

    Introduction Magnetic Resonance Imaging is at present the only imaging technique available to measure diffusion of water and metabolites in humans. It provides vital insights to brain connectivity and has proved to be an important tool in diagnosis and therapy planning in many neurological diseases such as brain tumour, ischaemia and multiple sclerosis. This project focuses on the development of a high resolution diffusion tensor imaging technique. In this thesis, the basic theory of diffusion tensor MR Imaging is presented. The technical challenges encountered during development of these techniques will be discussed, with proposed solutions. New sequences with high spatial resolution have been developed and the results are compared with the standard technique more commonly used. Overview The project aims at the development of diffusion tensor imaging techniques with a high spatial resolution. Chapter 2 will describe the basic physics of MRI, the phenomenon of diffusion and the measurement of diffusion by MRI...

  8. High-resolution genome-wide in vivo footprinting of diverse transcription factors in human cells.

    Science.gov (United States)

    Boyle, Alan P; Song, Lingyun; Lee, Bum-Kyu; London, Darin; Keefe, Damian; Birney, Ewan; Iyer, Vishwanath R; Crawford, Gregory E; Furey, Terrence S

    2011-03-01

    Regulation of gene transcription in diverse cell types is determined largely by varied sets of cis-elements where transcription factors bind. Here we demonstrate that data from a single high-throughput DNase I hypersensitivity assay can delineate hundreds of thousands of base-pair resolution in vivo footprints in human cells that precisely mark individual transcription factor-DNA interactions. These annotations provide a unique resource for the investigation of cis-regulatory elements. We find that footprints for specific transcription factors correlate with ChIP-seq enrichment and can accurately identify functional versus nonfunctional transcription factor motifs. We also find that footprints reveal a unique evolutionary conservation pattern that differentiates functional footprinted bases from surrounding DNA. Finally, detailed analysis of CTCF footprints suggests multiple modes of binding and a novel DNA binding motif upstream of the primary binding site.

  9. DNA barcodes from four loci provide poor resolution of taxonomic groups in the genus Crataegus

    Science.gov (United States)

    Zarrei, Mehdi; Talent, Nadia; Kuzmina, Maria; Lee, Jeanette; Lund, Jensen; Shipley, Paul R.; Stefanović, Saša; Dickinson, Timothy A.

    2015-01-01

    DNA barcodes can facilitate identification of organisms especially when morphological characters are limited or unobservable. To what extent this potential is realized in specific groups of plants remains to be determined. Libraries of barcode sequences from well-studied authoritatively identified plants represented by herbarium voucher specimens are needed in order for DNA barcodes to serve their intended purpose, where this is possible, and to understand the reasons behind their failure to do so, when this occurs. We evaluated four loci, widely regarded as universal DNA barcodes for plants, for their utility in hawthorn species identification. Three plastid regions, matK, rbcLa and psbA-trnH, and the internal transcribed spacer 2 (ITS2) of nuclear ribosomal DNA discriminate only some of the species of Crataegus that can be recognized on the basis of their morphology etc. This is, in part, because in Rosaceae tribe Maleae most individual plastid loci yield relatively little taxonomic resolution and, in part, because the effects of allopolyploidization have not been eliminated by concerted evolution of the ITS regions. Although individual plastid markers provided generally poor resolution of taxonomic groups in Crataegus, a few species were notable exceptions. In contrast, analyses of concatenated sequences of the 3 plastid barcode loci plus 11 additional plastid loci gave a well-resolved maternal phylogeny. In the ITS2 tree, different individuals of some species formed groups with taxonomically unrelated species. This is a sign of lineage sorting due to incomplete concerted evolution in ITS2. Incongruence between the ITS2 and plastid trees is best explained by hybridization between different lineages within the genus. In aggregate, limited between-species variation in plastid loci, hybridization and a lack of concerted evolution in ITS2 all combine to limit the utility of standard barcoding markers in Crataegus. These results have implications for authentication

  10. High-resolution low-dose scanning transmission electron microscopy.

    Science.gov (United States)

    Buban, James P; Ramasse, Quentin; Gipson, Bryant; Browning, Nigel D; Stahlberg, Henning

    2010-01-01

    During the past two decades instrumentation in scanning transmission electron microscopy (STEM) has pushed toward higher intensity electron probes to increase the signal-to-noise ratio of recorded images. While this is suitable for robust specimens, biological specimens require a much reduced electron dose for high-resolution imaging. We describe here protocols for low-dose STEM image recording with a conventional field-emission gun STEM, while maintaining the high-resolution capability of the instrument. Our findings show that a combination of reduced pixel dwell time and reduced gun current can achieve radiation doses comparable to low-dose TEM.

  11. Theoretical Problems in High Resolution Solar Physics, 2

    Science.gov (United States)

    Athay, G. (Editor); Spicer, D. S. (Editor)

    1987-01-01

    The Science Working Group for the High Resolution Solar Observatory (HRSO) laid plans beginning in 1984 for a series of workshops designed to stimulate a broadbased input from the scientific community to the HRSO mission. These workshops have the dual objectives of encouraging an early start on the difficult theoretical problems in radiative transfer, magnetohydrodynamics, and plasma physics that will be posed by the HRSO data, and maintaining current discussions of results in high resolution solar studies. This workshop was the second in the series. The workshop format presented invited review papers during the formal sessions and contributed poster papers for discussions during open periods. Both are presented.

  12. High-Resolution Reciprocal Space Mapping for Characterizing Deformation Structures

    DEFF Research Database (Denmark)

    Pantleon, Wolfgang; Wejdemann, Christian; Jakobsen, Bo

    2014-01-01

    With high-angular resolution three-dimensional X-ray diffraction (3DXRD), quantitative information is gained about dislocation structures in individual grains in the bulk of a macroscopic specimen by acquiring reciprocal space maps. In high-resolution 3D reciprocal space maps of tensile...... dynamics is followed in situ during varying loading conditions by reciprocal space mapping: during uninterrupted tensile deformation, formation of subgrains is observed concurrently with broadening of Bragg reflections shortly after the onset of plastic deformation. When the traction is terminated, stress...

  13. A fast high-spatial-resolution Raman distributed temperature sensor

    Science.gov (United States)

    Chen, Y.; Hartog, A. H.; Marsh, R. J.; Hilton, I. M.; Hadley, M. R.; Ross, P. A.

    2014-05-01

    Conventional high-spatial-resolution Raman distributed temperature sensing (DTS) systems are based on photoncounting techniques, which result in slow measurements over short sensing fibers. We describe an alternative approach that uses a high-power, short-pulse-width laser and provides fast measurements over fibers longer than 1 km. We demonstrate measurements with 1-s update times over fiber lengths greater than 1 km with better than 0.4-m spatial resolution. We introduce a figure of merit for DTS and we show a substantial improvement (x 100) over earlier results.

  14. Progress in high-resolution x-ray holographic microscopy

    Energy Technology Data Exchange (ETDEWEB)

    Jacobsen, C.; Kirz, J.; Howells, M.; McQuaid, K.; Rothman, S.; Feder, R.; Sayre, D.

    1987-07-01

    Among the various types of x-ray microscopes that have been demonstrated, the holographic microscope has had the largest gap between promise and performance. The difficulties of fabricating x-ray optical elements have led some to view holography as the most attractive method for obtaining the ultimate in high resolution x-ray micrographs; however, we know of no investigations prior to 1987 that clearly demonstrated submicron resolution in reconstructed images. Previous efforts suffered from problems such as limited resolution and dynamic range in the recording media, low coherent x-ray flux, and aberrations and diffraction limits in visible light reconstruction. We have addressed the recording limitations through the use of an undulator x-ray source and high-resolution photoresist recording media. For improved results in the readout and reconstruction steps, we have employed metal shadowing and transmission electron microscopy, along with numerical reconstruction techniques. We believe that this approach will allow holography to emerge as a practical method of high-resolution x-ray microscopy. 30 refs., 4 figs.

  15. Sharpening high resolution information in single particle electron cryomicroscopy.

    Science.gov (United States)

    Fernández, J J; Luque, D; Castón, J R; Carrascosa, J L

    2008-10-01

    Advances in single particle electron cryomicroscopy have made possible to elucidate routinely the structure of biological specimens at subnanometer resolution. At this resolution, secondary structure elements are discernable by their signature. However, identification and interpretation of high resolution structural features are hindered by the contrast loss caused by experimental and computational factors. This contrast loss is traditionally modeled by a Gaussian decay of structure factors with a temperature factor, or B-factor. Standard restoration procedures usually sharpen the experimental maps either by applying a Gaussian function with an inverse ad hoc B-factor, or according to the amplitude decay of a reference structure. EM-BFACTOR is a program that has been designed to widely facilitate the use of the novel method for objective B-factor determination and contrast restoration introduced by Rosenthal and Henderson [Rosenthal, P.B., Henderson, R., 2003. Optimal determination of particle orientation, absolute hand, and contrast loss in single-particle electron cryomicroscopy. J. Mol. Biol. 333, 721-745]. The program has been developed to interact with the most common packages for single particle electron cryomicroscopy. This sharpening method has been further investigated via EM-BFACTOR, concluding that it helps to unravel the high resolution molecular features concealed in experimental density maps, thereby making them better suited for interpretation. Therefore, the method may facilitate the analysis of experimental data in high resolution single particle electron cryomicroscopy.

  16. Multi-resolution voxel phantom modeling: a high-resolution eye model for computational dosimetry

    Science.gov (United States)

    Caracappa, Peter F.; Rhodes, Ashley; Fiedler, Derek

    2014-09-01

    Voxel models of the human body are commonly used for simulating radiation dose with a Monte Carlo radiation transport code. Due to memory limitations, the voxel resolution of these computational phantoms is typically too large to accurately represent the dimensions of small features such as the eye. Recently reduced recommended dose limits to the lens of the eye, which is a radiosensitive tissue with a significant concern for cataract formation, has lent increased importance to understanding the dose to this tissue. A high-resolution eye model is constructed using physiological data for the dimensions of radiosensitive tissues, and combined with an existing set of whole-body models to form a multi-resolution voxel phantom, which is used with the MCNPX code to calculate radiation dose from various exposure types. This phantom provides an accurate representation of the radiation transport through the structures of the eye. Two alternate methods of including a high-resolution eye model within an existing whole-body model are developed. The accuracy and performance of each method is compared against existing computational phantoms.

  17. Structural information, resolution, and noise in high-resolution atomic force microscopy topographs.

    Science.gov (United States)

    Fechner, Peter; Boudier, Thomas; Mangenot, Stéphanie; Jaroslawski, Szymon; Sturgis, James N; Scheuring, Simon

    2009-05-06

    AFM has developed into a powerful tool in structural biology, providing topographs of proteins under close-to-native conditions and featuring an outstanding signal/noise ratio. However, the imaging mechanism exhibits particularities: fast and slow scan axis represent two independent image acquisition axes. Additionally, unknown tip geometry and tip-sample interaction render the contrast transfer function nondefinable. Hence, the interpretation of AFM topographs remained difficult. How can noise and distortions present in AFM images be quantified? How does the number of molecule topographs merged influence the structural information provided by averages? What is the resolution of topographs? Here, we find that in high-resolution AFM topographs, many molecule images are only slightly disturbed by noise, distortions, and tip-sample interactions. To identify these high-quality particles, we propose a selection criterion based on the internal symmetry of the imaged protein. We introduce a novel feature-based resolution analysis and show that AFM topographs of different proteins contain structural information beginning at different resolution thresholds: 10 A (AqpZ), 12 A (AQP0), 13 A (AQP2), and 20 A (light-harvesting-complex-2). Importantly, we highlight that the best single-molecule images are more accurate molecular representations than ensemble averages, because averaging downsizes the z-dimension and "blurs" structural details.

  18. Spectral domain optical coherence tomography - Ultra-high speed, ultra-high resolution ophthalmic imaging

    NARCIS (Netherlands)

    Chen, T.; Cense, B.; Pierce, M. C.; Nassif, N. A.; Park, B. H.; Yun, S. H.; White, B.; Bouma, B. E.; Tearney, G. J.; de Boer, J.F.

    2005-01-01

    Objective: To introduce a new ophthalmic optical coherence tomography technology that allows unprecedented simultaneous ultra-high speed and ultra-high resolution. Methods: Using a superluminescent diode source, a clinically viable ultra-high speed, ultra-high resolution spectral domain optical

  19. High-throughput genome editing and phenotyping facilitated by high resolution melting curve analysis.

    Science.gov (United States)

    Thomas, Holly R; Percival, Stefanie M; Yoder, Bradley K; Parant, John M

    2014-01-01

    With the goal to generate and characterize the phenotypes of null alleles in all genes within an organism and the recent advances in custom nucleases, genome editing limitations have moved from mutation generation to mutation detection. We previously demonstrated that High Resolution Melting (HRM) analysis is a rapid and efficient means of genotyping known zebrafish mutants. Here we establish optimized conditions for HRM based detection of novel mutant alleles. Using these conditions, we demonstrate that HRM is highly efficient at mutation detection across multiple genome editing platforms (ZFNs, TALENs, and CRISPRs); we observed nuclease generated HRM positive targeting in 1 of 6 (16%) open pool derived ZFNs, 14 of 23 (60%) TALENs, and 58 of 77 (75%) CRISPR nucleases. Successful targeting, based on HRM of G0 embryos correlates well with successful germline transmission (46 of 47 nucleases); yet, surprisingly mutations in the somatic tail DNA weakly correlate with mutations in the germline F1 progeny DNA. This suggests that analysis of G0 tail DNA is a good indicator of the efficiency of the nuclease, but not necessarily a good indicator of germline alleles that will be present in the F1s. However, we demonstrate that small amplicon HRM curve profiles of F1 progeny DNA can be used to differentiate between specific mutant alleles, facilitating rare allele identification and isolation; and that HRM is a powerful technique for screening possible off-target mutations that may be generated by the nucleases. Our data suggest that micro-homology based alternative NHEJ repair is primarily utilized in the generation of CRISPR mutant alleles and allows us to predict likelihood of generating a null allele. Lastly, we demonstrate that HRM can be used to quickly distinguish genotype-phenotype correlations within F1 embryos derived from G0 intercrosses. Together these data indicate that custom nucleases, in conjunction with the ease and speed of HRM, will facilitate future high

  20. High-throughput genome editing and phenotyping facilitated by high resolution melting curve analysis.

    Directory of Open Access Journals (Sweden)

    Holly R Thomas

    Full Text Available With the goal to generate and characterize the phenotypes of null alleles in all genes within an organism and the recent advances in custom nucleases, genome editing limitations have moved from mutation generation to mutation detection. We previously demonstrated that High Resolution Melting (HRM analysis is a rapid and efficient means of genotyping known zebrafish mutants. Here we establish optimized conditions for HRM based detection of novel mutant alleles. Using these conditions, we demonstrate that HRM is highly efficient at mutation detection across multiple genome editing platforms (ZFNs, TALENs, and CRISPRs; we observed nuclease generated HRM positive targeting in 1 of 6 (16% open pool derived ZFNs, 14 of 23 (60% TALENs, and 58 of 77 (75% CRISPR nucleases. Successful targeting, based on HRM of G0 embryos correlates well with successful germline transmission (46 of 47 nucleases; yet, surprisingly mutations in the somatic tail DNA weakly correlate with mutations in the germline F1 progeny DNA. This suggests that analysis of G0 tail DNA is a good indicator of the efficiency of the nuclease, but not necessarily a good indicator of germline alleles that will be present in the F1s. However, we demonstrate that small amplicon HRM curve profiles of F1 progeny DNA can be used to differentiate between specific mutant alleles, facilitating rare allele identification and isolation; and that HRM is a powerful technique for screening possible off-target mutations that may be generated by the nucleases. Our data suggest that micro-homology based alternative NHEJ repair is primarily utilized in the generation of CRISPR mutant alleles and allows us to predict likelihood of generating a null allele. Lastly, we demonstrate that HRM can be used to quickly distinguish genotype-phenotype correlations within F1 embryos derived from G0 intercrosses. Together these data indicate that custom nucleases, in conjunction with the ease and speed of HRM, will

  1. Generating High-Temporal and Spatial Resolution TIR Image Data

    Science.gov (United States)

    Herrero-Huerta, M.; Lagüela, S.; Alfieri, S. M.; Menenti, M.

    2017-09-01

    Remote sensing imagery to monitor global biophysical dynamics requires the availability of thermal infrared data at high temporal and spatial resolution because of the rapid development of crops during the growing season and the fragmentation of most agricultural landscapes. Conversely, no single sensor meets these combined requirements. Data fusion approaches offer an alternative to exploit observations from multiple sensors, providing data sets with better properties. A novel spatio-temporal data fusion model based on constrained algorithms denoted as multisensor multiresolution technique (MMT) was developed and applied to generate TIR synthetic image data at both temporal and spatial high resolution. Firstly, an adaptive radiance model is applied based on spectral unmixing analysis of . TIR radiance data at TOA (top of atmosphere) collected by MODIS daily 1-km and Landsat - TIRS 16-day sampled at 30-m resolution are used to generate synthetic daily radiance images at TOA at 30-m spatial resolution. The next step consists of unmixing the 30 m (now lower resolution) images using the information about their pixel land-cover composition from co-registered images at higher spatial resolution. In our case study, TIR synthesized data were unmixed to the Sentinel 2 MSI with 10 m resolution. The constrained unmixing preserves all the available radiometric information of the 30 m images and involves the optimization of the number of land-cover classes and the size of the moving window for spatial unmixing. Results are still being evaluated, with particular attention for the quality of the data streams required to apply our approach.

  2. GENERATING HIGH-TEMPORAL AND SPATIAL RESOLUTION TIR IMAGE DATA

    Directory of Open Access Journals (Sweden)

    M. Herrero-Huerta

    2017-09-01

    Full Text Available Remote sensing imagery to monitor global biophysical dynamics requires the availability of thermal infrared data at high temporal and spatial resolution because of the rapid development of crops during the growing season and the fragmentation of most agricultural landscapes. Conversely, no single sensor meets these combined requirements. Data fusion approaches offer an alternative to exploit observations from multiple sensors, providing data sets with better properties. A novel spatio-temporal data fusion model based on constrained algorithms denoted as multisensor multiresolution technique (MMT was developed and applied to generate TIR synthetic image data at both temporal and spatial high resolution. Firstly, an adaptive radiance model is applied based on spectral unmixing analysis of . TIR radiance data at TOA (top of atmosphere collected by MODIS daily 1-km and Landsat – TIRS 16-day sampled at 30-m resolution are used to generate synthetic daily radiance images at TOA at 30-m spatial resolution. The next step consists of unmixing the 30 m (now lower resolution images using the information about their pixel land-cover composition from co-registered images at higher spatial resolution. In our case study, TIR synthesized data were unmixed to the Sentinel 2 MSI with 10 m resolution. The constrained unmixing preserves all the available radiometric information of the 30 m images and involves the optimization of the number of land-cover classes and the size of the moving window for spatial unmixing. Results are still being evaluated, with particular attention for the quality of the data streams required to apply our approach.

  3. High resolution multiplexed functional imaging in live embryos (Conference Presentation)

    Science.gov (United States)

    Xu, Dongli; Zhou, Weibin; Peng, Leilei

    2017-02-01

    Fourier multiplexed fluorescence lifetime imaging (FmFLIM) scanning laser optical tomography (FmFLIM-SLOT) combines FmFLIM and Scanning laser optical tomography (SLOT) to perform multiplexed 3D FLIM imaging of live embryos. The system had demonstrate multiplexed functional imaging of zebrafish embryos genetically express Foster Resonant Energy Transfer (FRET) sensors. However, previous system has a 20 micron resolution because the focused Gaussian beam diverges quickly from the focused plane, makes it difficult to achieve high resolution imaging over a long projection depth. Here, we present a high-resolution FmFLIM-SLOT system with achromatic Bessel beam, which achieves 3 micron resolution in 3D deep tissue imaging. In Bessel-FmFLIM-SLOT, multiple laser excitation lines are firstly intensity modulated by a Michelson interferometer with a spinning polygon mirror optical delay line, which enables Fourier multiplexed multi-channel lifetime measurements. Then, a spatial light modulator and a prism are used to transform the modulated Gaussian laser beam to an achromatic Bessel beam. The achromatic Bessel beam scans across the whole specimen with equal angular intervals as sample rotated. After tomography reconstruction and the frequency domain lifetime analysis method, both the 3D intensity and lifetime image of multiple excitation-emission can be obtained. Using Bessel-FmFLIM-SLOT system, we performed cellular-resolution FLIM tomography imaging of live zebrafish embryo. Genetically expressed FRET sensors in these embryo will allow non-invasive observation of multiple biochemical processes in vivo.

  4. Automated Microfluidic Platform for Serial Polymerase Chain Reaction and High-Resolution Melting Analysis.

    Science.gov (United States)

    Cao, Weidong; Bean, Brian; Corey, Scott; Coursey, Johnathan S; Hasson, Kenton C; Inoue, Hiroshi; Isano, Taisuke; Kanderian, Sami; Lane, Ben; Liang, Hongye; Murphy, Brian; Owen, Greg; Shinoda, Nobuhiko; Zeng, Shulin; Knight, Ivor T

    2016-06-01

    We report the development of an automated genetic analyzer for human sample testing based on microfluidic rapid polymerase chain reaction (PCR) with high-resolution melting analysis (HRMA). The integrated DNA microfluidic cartridge was used on a platform designed with a robotic pipettor system that works by sequentially picking up different test solutions from a 384-well plate, mixing them in the tips, and delivering mixed fluids to the DNA cartridge. A novel image feedback flow control system based on a Canon 5D Mark II digital camera was developed for controlling fluid movement through a complex microfluidic branching network without the use of valves. The same camera was used for measuring the high-resolution melt curve of DNA amplicons that were generated in the microfluidic chip. Owing to fast heating and cooling as well as sensitive temperature measurement in the microfluidic channels, the time frame for PCR and HRMA was dramatically reduced from hours to minutes. Preliminary testing results demonstrated that rapid serial PCR and HRMA are possible while still achieving high data quality that is suitable for human sample testing. © 2015 Society for Laboratory Automation and Screening.

  5. Generating high-temporal and spatial resolution tir image data

    NARCIS (Netherlands)

    Herrero Huerta, M.; Lagüela, S.; Alfieri, S.M.; Menenti, M.; Lichti, D.; Weng, Q

    2017-01-01

    Remote sensing imagery to monitor global biophysical dynamics requires the availability of thermal infrared data at high temporal and spatial resolution because of the rapid development of crops during the growing season and the fragmentation of most agricultural landscapes. Conversely, no single

  6. Remote parallel rendering for high-resolution tiled display walls

    KAUST Repository

    Nachbaur, Daniel

    2014-11-01

    © 2014 IEEE. We present a complete, robust and simple to use hardware and software stack delivering remote parallel rendering of complex geometrical and volumetric models to high resolution tiled display walls in a production environment. We describe the setup and configuration, present preliminary benchmarks showing interactive framerates, and describe our contributions for a seamless integration of all the software components.

  7. Input variable selection for interpolating high-resolution climate ...

    African Journals Online (AJOL)

    2010-10-20

    Oct 20, 2010 ... Accurate climate surfaces are vital for applications relating to groundwater recharge modelling, evapotranspiration estima- ... with distance to oceans and elevation to generate 8 sets of high-resolution (i.e. 3 arc second) climate surfaces of the Western .... ANUSPLIN, developed by the Australian National.

  8. High resolution numerical weather prediction over the Indian ...

    Indian Academy of Sciences (India)

    In this study, the Florida State University Global Spectral Model (FSUGSM), in association with a high-resolution nested regional spectral model (FSUNRSM), is used for short-range weather forecasts over the Indian domain. Three-day forecasts for each day of August 1998 were performed using different versions of the ...

  9. Track prediction of very severe cyclone 'Nargis' using high resolution ...

    Indian Academy of Sciences (India)

    In the present study, a detailed diagnostic analysis of the system 'Nargis' is carried out initially to investigate the features associated with this unusual movement and subsequently the real time forecast of VSCS 'Nargis' using high resolution advanced version weather research forecasting (WRF) model is presented.

  10. HIGH RESOLUTION RESISTIVITY LEAK DETECTION DATA PROCESSING & EVALUATION MEHTODS & REQUIREMENTS

    Energy Technology Data Exchange (ETDEWEB)

    SCHOFIELD JS

    2007-10-04

    This document has two purposes: {sm_bullet} Describe how data generated by High Resolution REsistivity (HRR) leak detection (LD) systems deployed during single-shell tank (SST) waste retrieval operations are processed and evaluated. {sm_bullet} Provide the basic review requirements for HRR data when Hrr is deployed as a leak detection method during SST waste retrievals.

  11. Workshop on high-resolution, large-acceptance spectrometers

    Energy Technology Data Exchange (ETDEWEB)

    Zeidman, B. (ed.)

    1981-01-01

    The purpose of the Workshop on High-Resolution, Large-Acceptance Spectrometers was to provide a means for exchange of information among those actively engaged in the design and construction of these new spectrometers. Thirty-seven papers were prepared for the data base.

  12. High-resolution seismic imaging of the Sohagpur Gondwana basin ...

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Earth System Science; Volume 122; Issue 6 ... In this study, we illustrate how Gondwana tectonics affected the Sohagpur Gondwana basin that occurs at the junction of the Mahanadi and Son–Narmada rift systems in the central India, through a high-resolution seismic reflection study along six ...

  13. Bombs at High Resolution. I. Morphological Evidence for Photospheric Reconnection

    NARCIS (Netherlands)

    Watanabe, H.; Vissers, G.; Kitai, R.; Rouppe van der Voort, L.H.M.; Rutten, R.J.|info:eu-repo/dai/nl/074143662

    2011-01-01

    High-resolution imaging-spectroscopy movies of solar active region NOAA 10998 obtained with the Crisp Imaging Spectropolarimeter at the Swedish 1-m Solar Telescope show very bright, rapidly flickering, flame-like features that appear intermittently in the wings of the Balmer Hα line in a region with

  14. Calibration of a High Resolution Airborne 3-D SAR

    DEFF Research Database (Denmark)

    Dall, Jørgen; Grinder-Pedersen, Jan; Madsen, S.N.

    1997-01-01

    The potential of across-track interferometric (XTI) synthetic aperture radar (SAR) for producing high resolution 3D imagery has been demonstrated by several airborne systems including EMISAR, the dual frequency, polarimetric, and interferometric SAR developed at the Dept. of Electromagnetic Systems...

  15. High energy resolution off-resonant X-ray spectroscopy

    Energy Technology Data Exchange (ETDEWEB)

    Wojciech, Blachucki [Univ. of Fribourg (Switzerland). Dept. of Physics

    2015-10-16

    This work treats of the high energy resolution off-resonant X-ray spectroscopy (HEROS) method of determining the density of unoccupied electronic states in the vicinity of the absorption edge. HEROS is an alternative to the existing X-ray absorption spectroscopy (XAS) methods and opens the way for new studies not achievable before.

  16. High Resolution Digital Imaging of Paintings: The Vasari Project.

    Science.gov (United States)

    Martinez, Kirk

    1991-01-01

    Describes VASARI (the Visual Art System for Archiving and Retrieval of Images), a project funded by the European Community to show the feasibility of high resolution colormetric imaging directly from paintings. The hardware and software used in the system are explained, storage on optical disks is described, and initial results are reported. (five…

  17. Amplification of real-time high resolution melting analysis PCR ...

    African Journals Online (AJOL)

    In this study, we assessed the usefulness of eight common primers amplifying the respective genes in real-time high resolution melting analysis PCR (real-time HRMA PCR) in terms of time, cost and sensitivity with respect to PCR-SSCP method. We found that case sample can easily be differentiated from control sample by ...

  18. High resolution spectroscopy of the disk chromosphere. I - Observing procedures.

    Science.gov (United States)

    Beckers, J. M.; Mauter, H. A.; Mann, G. R.; Brown, D. R.

    1972-01-01

    Review of some of the main features of a high resolution spectroscopy program aimed at the precise photometric observation of chromospheric fine structures using the Sacramento Peak vacuum telescope. The observing procedures are described, and a sample of the first observational results is presented.

  19. High resolution STEM of quantum dots and quantum wires

    DEFF Research Database (Denmark)

    Kadkhodazadeh, Shima

    2013-01-01

    This article reviews the application of high resolution scanning transmission electron microscopy (STEM) to semiconductor quantum dots (QDs) and quantum wires (QWRs). Different imaging and analytical techniques in STEM are introduced and key examples of their application to QDs and QWRs...

  20. High resolution ultraviolet imaging spectrometer for latent image analysis.

    Science.gov (United States)

    Lyu, Hang; Liao, Ningfang; Li, Hongsong; Wu, Wenmin

    2016-03-21

    In this work, we present a close-range ultraviolet imaging spectrometer with high spatial resolution, and reasonably high spectral resolution. As the transmissive optical components cause chromatic aberration in the ultraviolet (UV) spectral range, an all-reflective imaging scheme is introduced to promote the image quality. The proposed instrument consists of an oscillating mirror, a Cassegrain objective, a Michelson structure, an Offner relay, and a UV enhanced CCD. The finished spectrometer has a spatial resolution of 29.30μm on the target plane; the spectral scope covers both near and middle UV band; and can obtain approximately 100 wavelength samples over the range of 240~370nm. The control computer coordinates all the components of the instrument and enables capturing a series of images, which can be reconstructed into an interferogram datacube. The datacube can be converted into a spectrum datacube, which contains spectral information of each pixel with many wavelength samples. A spectral calibration is carried out by using a high pressure mercury discharge lamp. A test run demonstrated that this interferometric configuration can obtain high resolution spectrum datacube. The pattern recognition algorithm is introduced to analyze the datacube and distinguish the latent traces from the base materials. This design is particularly good at identifying the latent traces in the application field of forensic imaging.

  1. High resolution EPR applications to metalloenzymes and metals in medicine

    CERN Document Server

    Berliner, Lawrence

    2009-01-01

    EPR spectroscopy has an important role in the geometric structural characterization of the redox cofactors in metalloproteins and their electronic structure, as this is crucial for their reactivity. This title covers high-resolution EPR methods, iron proteins, nickel and copper enzymes, and metals in medicine.

  2. A high resolution powder diffractometer using focusing optics

    Indian Academy of Sciences (India)

    Research Centre, Mumbai 400 085, India. *Corresponding author. E-mail: siruguri@csr.ernet.in. Abstract. In this paper, we describe the design, construction and performance of a new high resolution neutron powder diffractometer that has been installed at the Dhruva reactor, Trombay, India. The instrument employs novel ...

  3. High resolution reflection seismic mapping of shallow coal seams

    CSIR Research Space (South Africa)

    Mngadi, SB

    2013-10-01

    Full Text Available Subsidence and collapse of unmapped shallow coal mine workings poses a risk to the public and hampers the development of valuable property. A high-resolution reflection seismic survey was conducted to determine whether it is possible to map...

  4. High resolution X-ray diffraction studies on unirradiated and ...

    Indian Academy of Sciences (India)

    High-resolution X-ray diffraction technique, employing a three-crystal monochromator–collimator combination is used to study the irradiation induced defects in flux grown Sr-hexaferrite crystals irradiated with 50 MeV Li3+ ion beams at room temperature with a fluence value of 1 × 1014 ions/cm2. The diffraction curves of the ...

  5. High resolution mid-infrared spectroscopy based on frequency upconversion

    DEFF Research Database (Denmark)

    Dam, Jeppe Seidelin; Hu, Qi; Tidemand-Lichtenberg, Peter

    2013-01-01

    We present high resolution upconversion of incoherent infrared radiation by means of sum-frequency mixing with a laser followed by simple CCD Si-camera detection. Noise associated with upconversion is, in strong contrast to room temperature direct mid-IR detection, extremely small, thus very faint...

  6. Interpretation of high resolution aeromagnetic data over southern ...

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Earth System Science; Volume 125; Issue 2 ... High resolution airborne magnetic data of parts of the southern Benue Trough were digitally processed and analyzed in order to estimate the depth of magnetic sources and to map the distribution and orientation of subsurface structural features.

  7. Application of high-resolution melting for variant scanning in ...

    African Journals Online (AJOL)

    High-resolution melting (HRM) analysis is a rapid and sensitive method for single nucleotide polymorphism (SNP) analysis. In this study, a novel HRM assay was carried out to detect SNPs in the chloroplast gene atpB which encodes the beta subunit of the ATP synthase and atpB upstream intergenic region.

  8. High resolution resist-free lithography in the SEM

    NARCIS (Netherlands)

    Hari, S.

    2017-01-01

    Focussed Electron Beam Induced Processing is a high resolution direct-write nanopatterning technique. Its ability to fabricate sub-10 nm structures together with its versatility and ease of use, in that it is resist-free and implementable inside a Scanning Electron Microscope, make it attractive for

  9. A high-resolution record of Greenland mass balance

    NARCIS (Netherlands)

    McMillan, Malcolm; Leeson, Amber; Shepherd, Andrew; Briggs, Kate; Armitage, Thomas; Hogg, Anna; Kuipers Munneke, P.|info:eu-repo/dai/nl/304831891; van den Broeke, M.R.|info:eu-repo/dai/nl/073765643; Noël, B.P.Y.|info:eu-repo/dai/nl/370612345; van de Berg, W.J.|info:eu-repo/dai/nl/304831611; Ligtenberg, S.R.M.|info:eu-repo/dai/nl/32821177X; Horwath, M.; Groh, Andreas; Muir, A.; Gilbert, Lin

    2016-01-01

    We map recent Greenland Ice Sheet elevation change at high spatial (5 km) and temporal (monthly) resolution using CryoSat-2 altimetry. After correcting for the impact of changing snowpack properties associated with unprecedented surface melting in 2012, we find good agreement (3 cm/yr bias) with

  10. Systematic high-resolution assessment of global hydropower potential

    NARCIS (Netherlands)

    Hoes, Olivier A C; Meijer, Lourens J J; Van Der Ent, Ruud J.; Van De Giesen, Nick C.

    2017-01-01

    Population growth, increasing energy demand and the depletion of fossil fuel reserves necessitate a search for sustainable alternatives for electricity generation. Hydropower could replace a large part of the contribution of gas and oil to the present energy mix. However, previous high-resolution

  11. Very high resolution satellite data: New challenges in image analysis

    Digital Repository Service at National Institute of Oceanography (India)

    Sathe, P.V.; Muraleedharan, P.M.

    Early years of coming century will see a large number of satellites with very high spatial resolution reaching beyond 1 m in the visible range of electromagnetic spectrum. Such images will come very close to giving a ground-based view of a terrain...

  12. pattern of interstitial lung disease as seen by high resolution

    African Journals Online (AJOL)

    2012-09-01

    Sep 1, 2012 ... Background: Diffuse lung diseases constitute a major cause of morbidity and mortality worldwide. High Resolution Computed Tomography (HRCT) is the recommended imaging technique in the diagnosis, assessment and followup of these diseases. Objectives: To describe the pattern of HRCT findings in ...

  13. FMC cameras, high resolution films and very large scale mapping

    Science.gov (United States)

    Tachibana, Kikuo; Hasegawa, Hiroyuki

    1988-06-01

    Very large scale mapping (1/250) was experimented on the basis of FMC camera, high resolution film and total station surveying. The future attractive combination of precision photogrammetry and personal computer assisted terrestrial surveying was investigated from the point of view of accuracy, time effectiveness and total procedures control.

  14. Signal Processing for High Resolution FMCW SAR and Moving Target

    NARCIS (Netherlands)

    Meta, A.; Hoogeboom, P.

    2005-01-01

    The combination of Frequency Modulated ContinuousWave (FMCW) technology and Synthetic Aperture Radar (SAR) leads to lightweight, cost-effective imaging sensors of high resolution. In FMCW SAR applications the conventional stop-and-go approximation used in pulse radar algorithms cannot be considered

  15. Plant respirometer enables high resolution of oxygen consumption rates

    Science.gov (United States)

    Foster, D. L.

    1966-01-01

    Plant respirometer permits high resolution of relatively small changes in the rate of oxygen consumed by plant organisms undergoing oxidative metabolism in a nonphotosynthetic state. The two stage supply and monitoring system operates by a differential pressure transducer and provides a calibrated output by digital or analog signals.

  16. Sparse deconvolution of high-density super-resolution images

    NARCIS (Netherlands)

    S. Hugelier (Siewert); J.J. de Rooi (Johan); R. Bernex (Romain); S. Duwé (Sam); O. Devos (Olivier); M. Sliwa (Michel); P. Dedecker (Peter); P.H.C. Eilers (Paul); C. Ruckebusch (Cyril)

    2016-01-01

    textabstractIn wide-field super-resolution microscopy, investigating the nanoscale structure of cellular processes, and resolving fast dynamics and morphological changes in cells requires algorithms capable of working with a high-density of emissive fluorophores. Current deconvolution algorithms

  17. Pyrosequencing™ : A one-step method for high resolution HLA typing

    Directory of Open Access Journals (Sweden)

    Marincola Francesco M

    2003-11-01

    Full Text Available Abstract While the use of high-resolution molecular typing in routine matching of human leukocyte antigens (HLA is expected to improve unrelated donor selection and transplant outcome, the genetic complexity of HLA still makes the current methodology limited and laborious. Pyrosequencing™ is a gel-free, sequencing-by-synthesis method. In a Pyrosequencing reaction, nucleotide incorporation proceeds sequentially along each DNA template at a given nucleotide dispensation order (NDO that is programmed into a pyrosequencer. Here we describe the design of a NDO that generates a pyrogram unique for any given allele or combination of alleles. We present examples of unique pyrograms generated from each of two heterozygous HLA templates, which would otherwise remain cis/trans ambiguous using standard sequencing based typing (SBT method. In addition, we display representative data that demonstrate long read and linear signal generation. These features are prerequisite of high-resolution typing and automated data analysis. In conclusion Pyrosequencing is a one-step method for high resolution DNA typing.

  18. High-resolution mapping of transcription factor binding sites on native chromatin

    Science.gov (United States)

    Kasinathan, Sivakanthan; Orsi, Guillermo A.; Zentner, Gabriel E.; Ahmad, Kami; Henikoff, Steven

    2014-01-01

    Sequence-specific DNA-binding proteins including transcription factors (TFs) are key determinants of gene regulation and chromatin architecture. Formaldehyde cross-linking and sonication followed by Chromatin ImmunoPrecipitation (X-ChIP) is widely used for profiling of TF binding, but is limited by low resolution and poor specificity and sensitivity. We present a simple protocol that starts with micrococcal nuclease-digested uncross-linked chromatin and is followed by affinity purification of TFs and paired-end sequencing. The resulting ORGANIC (Occupied Regions of Genomes from Affinity-purified Naturally Isolated Chromatin) profiles of Saccharomyces cerevisiae Abf1 and Reb1 provide highly accurate base-pair resolution maps that are not biased toward accessible chromatin, and do not require input normalization. We also demonstrate the high specificity of our method when applied to larger genomes by profiling Drosophila melanogaster GAGA Factor and Pipsqueak. Our results suggest that ORGANIC profiling is a widely applicable high-resolution method for sensitive and specific profiling of direct protein-DNA interactions. PMID:24336359

  19. Single-base-resolution methylomes of populus trichocarpa reveal the association between DNA methylation and drought stress

    Science.gov (United States)

    2014-01-01

    Background DNA methylation is an important biological form of epigenetic modification, playing key roles in plant development and environmental responses. Results In this study, we examined single-base resolution methylomes of Populus under control and drought stress conditions using high-throughput bisulfite sequencing for the first time. Our data showed methylation levels of methylated cytosines, upstream 2kp, downstream 2kb, and repeatitive sequences significantly increased after drought treatment in Populus. Interestingly, methylation in 100 bp upstream of the transcriptional start site (TSS) repressed gene expression, while methylations in 100-2000bp upstream of TSS and within the gene body were positively associated with gene expression. Integrated with the transcriptomic data, we found that all cis-splicing genes were non-methylated, suggesting that DNA methylation may not associate with cis-splicing. However, our results showed that 80% of trans-splicing genes were methylated. Moreover, we found 1156 transcription factors (TFs) with reduced methylation and expression levels and 690 TFs with increased methylation and expression levels after drought treatment. These TFs may play important roles in Populus drought stress responses through the changes of DNA methylation. Conclusions These findings may provide valuable new insight into our understanding of the interaction between gene expression and methylation of drought responses in Populus. PMID:25080211

  20. Invited article: High resolution digital camera for infrared reflectography.

    Science.gov (United States)

    Falco, Charles M

    2009-07-01

    This paper describes the characteristics of a high resolution infrared (IR) imaging system operating over the wavelength range of 830-1100 nm, based on a modified 8 Mpixels commercial digital camera, with which nonspecialists can obtain IR reflectograms of works of art in situ in a museum environment. The relevant imaging properties of sensitivity, resolution, noise, and contrast are characterized and the capabilities of this system are illustrated with an example that has revealed important new information about the working practices of a 16th century artist.

  1. New block-copolymer thermoassociating matrices for DNA sequencing: effect of molecular structure on rheology and resolution.

    Science.gov (United States)

    Sudor, J; Barbier, V; Thirot, S; Godfrin, D; Hourdet, D; Millequant, M; Blanchard, J; Viovy, J L

    2001-01-01

    A new family of matrices for DNA sequencing by capillary electrophoresis is presented. These matrices combine easy injection with high sieving performances, due to thermal switching between a low and a high viscosity state through a modest increase in temperature (approximately 20 degrees C). They are constructed from a hydrophilic polymer backbone with grafted lower critical solution temperature (LCST) side chains. The comb-like LCST copolymers are characterized in terms of size of the polymer backbone, the size of LCST side chains and the grafting densities. The dependance of rheological behavior and electrophoretic performance of these copolymers is correlated with their microstructure. Without complete optimization, a resolution of order 0.5, corresponding to a very reasonable limit for read length with current base calling softwares, could be achieved for segments around 800 bases differing by 1 base in less than one hour in a commercial ABI 310 apparatus.

  2. Topography improvements in MEMS DMs for high-contrast, high-resolution imaging Project

    Data.gov (United States)

    National Aeronautics and Space Administration — This project will develop and demonstrate an innovative microfabrication process to substantially improve the surface quality achievable in high-resolution...

  3. Evaluation of a High-Resolution Regional Reanalysis for Europe

    Science.gov (United States)

    Ohlwein, C.; Wahl, S.; Keller, J. D.; Bollmeyer, C.

    2014-12-01

    Reanalyses gain more and more importance as a source of meteorological information for many purposes and applications. Several global reanalyses projects (e.g., ERA, MERRA, CSFR, JMA9) produce and verify these data sets to provide time series as long as possible combined with a high data quality. Due to a spatial resolution down to 50-70km and 3-hourly temporal output, they are not suitable for small scale problems (e.g., regional climate assessment, meso-scale NWP verification, input for subsequent models such as river runoff simulations). The implementation of regional reanalyses based on a limited area model along with a data assimilation scheme is able to generate reanalysis data sets with high spatio-temporal resolution. Within the Hans-Ertel-Centre for Weather Research (HErZ), the climate monitoring branch concentrates efforts on the assessment and analysis of regional climate in Germany and Europe. In joint cooperation with DWD (German Meteorological Service), a high-resolution reanalysis system based on the COSMO model has been developed. The regional reanalysis for Europe matches the domain of the CORDEX EURO-11 specifications, albeit at a higher spatial resolution, i.e., 0.055° (6km) instead of 0.11° (12km) and comprises the assimilation of observational data using the existing nudging scheme of COSMO complemented by a special soil moisture analysis with boundary conditions provided by ERA-Interim data. The reanalysis data set covers 6 years (2007-2012) and is currently extended to 16 years. Extensive evaluation of the reanalysis is performed using independent observations with special emphasis on precipitation and high-impact weather situations indicating a better representation of small scale variability. Further, the evaluation shows an added value of the regional reanalysis with respect to the forcing ERA Interim reanalysis and compared to a pure high-resolution dynamical downscaling approach without data assimilation.

  4. The high-resolution regional reanalysis COSMO-REA6

    Science.gov (United States)

    Ohlwein, C.

    2016-12-01

    Reanalyses gain more and more importance as a source of meteorological information for many purposes and applications. Several global reanalyses projects (e.g., ERA, MERRA, CSFR, JMA9) produce and verify these data sets to provide time series as long as possible combined with a high data quality. Due to a spatial resolution down to 50-70km and 3-hourly temporal output, they are not suitable for small scale problems (e.g., regional climate assessment, meso-scale NWP verification, input for subsequent models such as river runoff simulations). The implementation of regional reanalyses based on a limited area model along with a data assimilation scheme is able to generate reanalysis data sets with high spatio-temporal resolution. Within the Hans-Ertel-Centre for Weather Research (HErZ), the climate monitoring branch concentrates efforts on the assessment and analysis of regional climate in Germany and Europe. In joint cooperation with DWD (German Meteorological Service), a high-resolution reanalysis system based on the COSMO model has been developed. The regional reanalysis for Europe matches the domain of the CORDEX EURO-11 specifications, albeit at a higher spatial resolution, i.e., 0.055° (6km) instead of 0.11° (12km) and comprises the assimilation of observational data using the existing nudging scheme of COSMO complemented by a special soil moisture analysis with boundary conditions provided by ERA-Interim data. The reanalysis data set covers the past 20 years. Extensive evaluation of the reanalysis is performed using independent observations with special emphasis on precipitation and high-impact weather situations indicating a better representation of small scale variability. Further, the evaluation shows an added value of the regional reanalysis with respect to the forcing ERA Interim reanalysis and compared to a pure high-resolution dynamical downscaling approach without data assimilation.

  5. A High-resolution Reanalysis for the European CORDEX Region

    Science.gov (United States)

    Bentzien, Sabrina; Bollmeyer, Christoph; Crewell, Susanne; Friederichs, Petra; Hense, Andreas; Keller, Jan; Keune, Jessica; Kneifel, Stefan; Ohlwein, Christian; Pscheidt, Ieda; Redl, Stephanie; Steinke, Sandra

    2014-05-01

    A High-resolution Reanalysis for the European CORDEX Region Within the Hans-Ertel-Centre for Weather Research (HErZ), the climate monitoring branch concentrates efforts on the assessment and analysis of regional climate in Germany and Europe. In joint cooperation with DWD (German Meteorological Service), a high-resolution reanalysis system based on the COSMO model has been developed. Reanalyses gain more and more importance as a source of meteorological information for many purposes and applications. Several global reanalyses projects (e.g., ERA, MERRA, CSFR, JMA9) produce and verify these data sets to provide time series as long as possible combined with a high data quality. Due to a spatial resolution down to 50-70km and 3-hourly temporal output, they are not suitable for small scale problems (e.g., regional climate assessment, meso-scale NWP verification, input for subsequent models such as river runoff simulations). The implementation of regional reanalyses based on a limited area model along with a data assimilation scheme is able to generate reanalysis data sets with high spatio-temporal resolution. The work presented here focuses on the regional reanalysis for Europe with a domain matching the CORDEX-EURO-11 specifications, albeit at a higher spatial resolution, i.e., 0.055° (6km) instead of 0.11° (12km). The COSMO reanalysis system comprises the assimilation of observational data using the existing nudging scheme of COSMO and is complemented by a special soil moisture analysis and boundary conditions given by ERA-interim data. The reanalysis data set currently covers 6 years (2007-2012). The evaluation of the reanalyses is done using independent observations with special emphasis on precipitation and high-impact weather situations. The development and evaluation of the COSMO-based reanalysis for the CORDEX-Euro domain can be seen as a preparation for joint European activities on the development of an ensemble system of regional reanalyses for Europe.

  6. High-resolution axial MR imaging of tibial stress injuries

    Science.gov (United States)

    2012-01-01

    Purpose To evaluate the relative involvement of tibial stress injuries using high-resolution axial MR imaging and the correlation with MR and radiographic images. Methods A total of 33 patients with exercise-induced tibial pain were evaluated. All patients underwent radiograph and high-resolution axial MR imaging. Radiographs were taken at initial presentation and 4 weeks later. High-resolution MR axial images were obtained using a microscopy surface coil with 60 × 60 mm field of view on a 1.5T MR unit. All images were evaluated for abnormal signals of the periosteum, cortex and bone marrow. Results Nineteen patients showed no periosteal reaction at initial and follow-up radiographs. MR imaging showed abnormal signals in the periosteal tissue and partially abnormal signals in the bone marrow. In 7 patients, periosteal reaction was not seen at initial radiograph, but was detected at follow-up radiograph. MR imaging showed abnormal signals in the periosteal tissue and entire bone marrow. Abnormal signals in the cortex were found in 6 patients. The remaining 7 showed periosteal reactions at initial radiograph. MR imaging showed abnormal signals in the periosteal tissue in 6 patients. Abnormal signals were seen in the partial and entire bone marrow in 4 and 3 patients, respectively. Conclusions Bone marrow abnormalities in high-resolution axial MR imaging were related to periosteal reactions at follow-up radiograph. Bone marrow abnormalities might predict later periosteal reactions, suggesting shin splints or stress fractures. High-resolution axial MR imaging is useful in early discrimination of tibial stress injuries. PMID:22574840

  7. Scalable, flexible and high resolution patterning of CVD graphene.

    Science.gov (United States)

    Hofmann, Mario; Hsieh, Ya-Ping; Hsu, Allen L; Kong, Jing

    2014-01-07

    The unique properties of graphene make it a promising material for interconnects in flexible and transparent electronics. To increase the commercial impact of graphene in those applications, a scalable and economical method for producing graphene patterns is required. The direct synthesis of graphene from an area-selectively passivated catalyst substrate can generate patterned graphene of high quality. We here present a solution-based method for producing patterned passivation layers. Various deposition methods such as ink-jet deposition and microcontact printing were explored, that can satisfy application demands for low cost, high resolution and scalable production of patterned graphene. The demonstrated high quality and nanometer precision of grown graphene establishes the potential of this synthesis approach for future commercial applications of graphene. Finally, the ability to transfer high resolution graphene patterns onto complex three-dimensional surfaces affords the vision of graphene-based interconnects in novel electronics.

  8. A high resolution ion microscope for cold atoms

    Science.gov (United States)

    Stecker, Markus; Schefzyk, Hannah; Fortágh, József; Günther, Andreas

    2017-04-01

    We report on an ion-optical system that serves as a microscope for ultracold ground state and Rydberg atoms. The system is designed to achieve a magnification of up to 1000 and a spatial resolution in the 100 nm range, thereby surpassing many standard imaging techniques for cold atoms. The microscope consists of four electrostatic lenses and a microchannel plate in conjunction with a delay line detector in order to achieve single particle sensitivity with high temporal and spatial resolution. We describe the design process of the microscope including ion-optical simulations of the imaging system and characterize aberrations and the resolution limit. Furthermore, we present the experimental realization of the microscope in a cold atom setup and investigate its performance by patterned ionization with a structure size down to 2.7 μm. The microscope meets the requirements for studying various many-body effects, ranging from correlations in cold quantum gases up to Rydberg molecule formation.

  9. Bendable X-ray Optics for High Resolution Imaging

    Science.gov (United States)

    Gubarev, M.; Ramsey, B.; Kilaru, K.; Atkins, C.; Broadway, D.

    2014-01-01

    Current state-of the-art for x-ray optics fabrication calls for either the polishing of massive substrates into high-angular-resolution mirrors or the replication of thin, lower-resolution, mirrors from perfectly figured mandrels. Future X-ray Missions will require a change in this optics fabrication paradigm in order to achieve sub-arcsecond resolution in light-weight optics. One possible approach to this is to start with perfectly flat, light-weight surface, bend it into a perfect cone, form the desired mirror figure by material deposition, and insert the resulting mirror into a telescope structure. Such an approach is currently being investigated at MSFC, and a status report will be presented detailing the results of finite element analyses, bending tests and differential deposition experiments.

  10. High Resolution Software Defined Radar System for Target Detection

    Directory of Open Access Journals (Sweden)

    S. Costanzo

    2013-01-01

    Full Text Available The Universal Software Radio Peripheral USRP NI2920, a software defined transceiver so far mainly used in Software Defined Radio applications, is adopted in this work to design a high resolution L-Band Software Defined Radar system. The enhanced available bandwidth, due to the Gigabit Ethernet interface, is exploited to obtain a higher slant-range resolution with respect to the existing Software Defined Radar implementations. A specific LabVIEW application, performing radar operations, is discussed, and successful validations are presented to demonstrate the accurate target detection capability of the proposed software radar architecture. In particular, outdoor and indoor test are performed by adopting a metal plate as reference structure located at different distances from the designed radar system, and results obtained from the measured echo are successfully processed to accurately reveal the correct target position, with the predicted slant-range resolution equal to 6 m.

  11. High-resolution Imaging Techniques for the Assessment of Osteoporosis

    Science.gov (United States)

    Krug, Roland; Burghardt, Andrew J.; Majumdar, Sharmila; Link, Thomas M.

    2010-01-01

    Synopsis The importance of assessing the bone’s microarchitectural make-up in addition to its mineral density in the context of osteoporosis has been emphasized in a number of publications. The high spatial resolution required to resolve the bone’s microstructure in a clinically feasible scan time is challenging. Currently, the best suited modalities meeting these requirements in vivo are high-resolution peripheral quantitative imaging (HR-pQCT) and magnetic resonance imaging (MRI). Whereas HR-pQCT is limited to peripheral skeleton regions like the wrist and ankle, MRI can also image other sites like the proximal femur but usually with lower spatial resolution. In addition Multidetector-CT has been used for high-resolution imaging of trabecular bone structure, however, the radiation dose is a limiting factor. This article provides an overview of the different modalities, technical requirements and recent developments in this emerging field. Details regarding imaging protocols as well as image post-processing methods for bone structure quantification are discussed. PMID:20609895

  12. Photoacoustic lymphatic imaging with high spatial-temporal resolution

    Science.gov (United States)

    Martel, Catherine; Yao, Junjie; Huang, Chih-Hsien; Zou, Jun; Randolph, Gwendalyn J.; Wang, Lihong V.

    2014-11-01

    Despite its critical function in coordinating the egress of inflammatory and immune cells out of tissues and maintaining fluid balance, the causative role of lymphatic network dysfunction in pathological settings is still understudied. Engineered-animal models and better noninvasive high spatial-temporal resolution imaging techniques in both preclinical and clinical studies will help to improve our understanding of different lymphatic-related pathologic disorders. Our aim was to take advantage of our newly optimized noninvasive wide-field fast-scanning photoacoustic (PA) microcopy system to coordinately image the lymphatic vasculature and its flow dynamics, while maintaining high resolution and detection sensitivity. Here, by combining the optical-resolution PA microscopy with a fast-scanning water-immersible microelectromechanical system scanning mirror, we have imaged the lymph dynamics over a large field-of-view, with high spatial resolution and advanced detection sensitivity. Depending on the application, lymphatic vessels (LV) were spectrally or temporally differentiated from blood vessels. Validation experiments were performed on phantoms and in vivo to identify the LV. Lymphatic flow dynamics in nonpathological and pathological conditions were also visualized. These results indicate that our newly developed PA microscopy is a promising tool for lymphatic-related biological research.

  13. An Improved Method for High Quality Metagenomics DNA Extraction from Human and Environmental Samples

    DEFF Research Database (Denmark)

    Bag, Satyabrata; Saha, Bipasa; Mehta, Ojasvi

    2016-01-01

    and quantity from culturable and uncultured microbial species living in that environment. Proper lysis of heterogeneous community microbial cells without damaging their genomes is a major challenge. In this study, we have developed an improved method for extraction of community DNA from different environmental......To explore the natural microbial community of any ecosystems by high-resolution molecular approaches including next generation sequencing, it is extremely important to develop a sensitive and reproducible DNA extraction method that facilitate isolation of microbial DNA of sufficient purity...... and human origin samples. We introduced a combination of physical, chemical and mechanical lysis methods for proper lysis of microbial inhabitants. The community microbial DNA was precipitated by using salt and organic solvent. Both the quality and quantity of isolated DNA was compared with the existing...

  14. Validation of AIRS high-resolution stratospheric temperature retrievals

    Science.gov (United States)

    Meyer, Catrin I.; Hoffmann, Lars

    2014-10-01

    This paper focuses on stratospheric temperature observations by the Atmospheric InfraRed Sounder (AIRS) aboard NASA's Aqua satellite. We validate a nine-year record (2003 - 2011) of data retrieved with a scientific retrieval processor independent from the operational processor operated by NASA. The retrieval discussed here provides stratospheric temperature profiles for each individual AIRS footprint and has nine times better horizontal sampling than the operational data provided by NASA. The high-resolution temperature data are considered optimal for for gravity wave studies. For validation the high-resolution retrieval data are compared with results from the AIRS operational Level-2 data and the ERA-Interim meteorological reanalysis. Due to the large amount of data we performed statistical comparisons of monthly zonal mean cross-sections and time series. The comparisons show that the high-resolution temperature data are in good agreement with the validation data sets. The bias in the zonal averages is mostly within ±2K. The bias reaches a maximum of 7K to ERA-Interim and 4K to the AIRS operational data at the stratopause, it is related to the different resolutions of the data sets. Variability is nearly the same in all three data sets, having maximum standard deviations around the polar vortex in the mid and upper stratosphere. The validation presented here indicates that the high-resolution temperature retrievals are well-suited for scientific studies. In particular, we expect that they will become a valuable asset for future studies of stratospheric gravity waves.

  15. Genome-wide analysis of chromatin structures in Trypanosoma brucei using high-resolution MNase-ChIP-seq.

    Science.gov (United States)

    Wedel, Carolin; Siegel, T Nicolai

    2017-09-01

    Specific DNA-protein interactions are the basis for many important cellular mechanisms like the regulation of gene expression or replication. Knowledge about the precise genomic locations of DNA-protein interactions is important because it provides insight into the regulation of these processes. Recently, we have adapted an approach that combines micrococcal nuclease (MNase) digestion of chromatin with chromatin immunoprecipitation in Trypanosoma brucei. Here, we describe in detail how this method can be used to map the genome-wide distribution of nucleosomes or other DNA-binding proteins at high resolution in T. brucei. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  16. High resolution melting analysis as a new approach to discriminate gluten-containing cereals.

    Science.gov (United States)

    Martín-Fernández, Begoña; Costa, Joana; de-Los-Santos-Álvarez, Noemí; López-Ruiz, Beatriz; Oliveira, M Beatriz P P; Mafra, Isabel

    2016-11-15

    With this work, it is intended to propose a novel approach based on high resolution melting (HRM) analysis to detect wheat and discriminate it from other gluten-containing cereals. The method consisted of a real-time PCR assay targeting the gene encoding for the germ agglutinin isolectin A protein (Tri a 18 allergen), using the fluorescent Evagreen dye combined with HRM analysis. The results enabled wheat differentiation from other phylogenetically related cereals, namely barley, rye and oat with high level of confidence. Additionally, a quantitative real-time PCR approach was proposed, allowing detecting and quantifying wheat down to 20mg/kg in rice flour and 20pg of wheat DNA (∼1.1 DNA copies). Its application was successfully achieved in the analysis of processed foods to verify labelling compliance, being considered as a cost-effective tool for the specific detection of cereals in gluten-free foods. Copyright © 2016 Elsevier Ltd. All rights reserved.

  17. High-resolution metagenomics targets major functional types in complex microbial communities

    Energy Technology Data Exchange (ETDEWEB)

    Kalyuzhnaya, Marina G.; Lapidus, Alla; Ivanova, Natalia; Copeland, Alex C.; McHardy, Alice C.; Szeto, Ernest; Salamov, Asaf; Grigoriev, Igor V.; Suciu, Dominic; Levine, Samuel R.; Markowitz, Victor M.; Rigoutsos, Isidore; Tringe, Susannah G.; Bruce, David C.; Richardson, Paul M.; Lidstrom, Mary E.; Chistoserdova, Ludmila

    2009-08-01

    Most microbes in the biosphere remain uncultured and unknown. Whole genome shotgun (WGS) sequencing of environmental DNA (metagenomics) allows glimpses into genetic and metabolic potentials of natural microbial communities. However, in communities of high complexity metagenomics fail to link specific microbes to specific ecological functions. To overcome this limitation, we selectively targeted populations involved in oxidizing single-carbon (C{sub 1}) compounds in Lake Washington (Seattle, USA) by labeling their DNA via stable isotope probing (SIP), followed by WGS sequencing. Metagenome analysis demonstrated specific sequence enrichments in response to different C{sub 1} substrates, highlighting ecological roles of individual phylotypes. We further demonstrated the utility of our approach by extracting a nearly complete genome of a novel methylotroph Methylotenera mobilis, reconstructing its metabolism and conducting genome-wide analyses. This approach allowing high-resolution genomic analysis of ecologically relevant species has the potential to be applied to a wide variety of ecosystems.

  18. High-resolution NMR structures of the domains of Saccharomyces cerevisiae Tho1

    Energy Technology Data Exchange (ETDEWEB)

    Jacobsen, Julian O. B.; Allen, Mark D.; Freund, Stefan M. V.; Bycroft, Mark, E-mail: mxb@mrc-lmb.cam.ac.uk [MRC Laboratory of Molecular Biology, Hills Road, Cambridge CB2 0QH (United Kingdom)

    2016-05-23

    In this study, high-resolution structures of both the N-terminal DNA-binding SAP domain and the C-terminal RNA-binding domain of S. cerevisiae Tho1 have been determined. THO is a multi-protein complex involved in the formation of messenger ribonuclear particles (mRNPs) by coupling transcription with mRNA processing and export. THO is thought to be formed from five subunits, Tho2p, Hpr1p, Tex1p, Mft1p and Thp2p, and recent work has determined a low-resolution structure of the complex [Poulsen et al. (2014 ▸), PLoS One, 9, e103470]. A number of additional proteins are thought to be involved in the formation of mRNP in yeast, including Tho1, which has been shown to bind RNA in vitro and is recruited to actively transcribed chromatin in vivo in a THO-complex and RNA-dependent manner. Tho1 is known to contain a SAP domain at the N-terminus, but the ability to suppress the expression defects of the hpr1Δ mutant of THO was shown to reside in the RNA-binding C-terminal region. In this study, high-resolution structures of both the N-terminal DNA-binding SAP domain and C-terminal RNA-binding domain have been determined.

  19. Sparse Recovery Analysis of High-Resolution Climate Data

    Science.gov (United States)

    Archibald, R.

    2013-12-01

    The field of compressed sensing is vast and currently very active, with new results, methods, and algorithms appearing almost daily. The first notions of compressed sensing began with Prony's method, which was designed by the French mathematician Gaspard Riche de Prony to extract signal information from a limited number of measurements. Since then, sparsity has been used empirically in a variety of applications, including geology and geophysics, spectroscopy, signal processing, radio astronomy, and medical ultrasound. High-resolution climate studies performed on large scale high performance computing have been producing large amounts of data that can benefit from unique mathematical methods for analysis. This work demonstrates how sparse recovery and L1 regularization can be used effectively on large datasets from high-resolution climate studies.

  20. Design of UAV high resolution image transmission system

    Science.gov (United States)

    Gao, Qiang; Ji, Ming; Pang, Lan; Jiang, Wen-tao; Fan, Pengcheng; Zhang, Xingcheng

    2017-02-01

    In order to solve the problem of the bandwidth limitation of the image transmission system on UAV, a scheme with image compression technology for mini UAV is proposed, based on the requirements of High-definition image transmission system of UAV. The video codec standard H.264 coding module and key technology was analyzed and studied for UAV area video communication. Based on the research of high-resolution image encoding and decoding technique and wireless transmit method, The high-resolution image transmission system was designed on architecture of Android and video codec chip; the constructed system was confirmed by experimentation in laboratory, the bit-rate could be controlled easily, QoS is stable, the low latency could meets most applied requirement not only for military use but also for industrial applications.

  1. High-resolution dynamical modelling of the Antarctic stratospheric vortex

    Science.gov (United States)

    Haynes, P. H.

    1988-01-01

    Progress is reported on the high-resolution three-dimensional numerical simulation of flows characteristic of the Antarctic wintertime stratosphere. The numerical model is a modified version of the Reading University sigma-coordinate used previously for tropospheric studies. Physical parameterizations are kept to a minimum in order to concentrate as much computing power as possible on simulating details of the dynamical processes. The major question addressed is whether the features observed in recent high-resolution two-dimensional simulations - namely: (1) the formation of a sharp edge to the vortex (seen in the potential vorticity field), (2) the survival of the polar vortex in a material entity, and (3) the formation of small-scale eddies rough the break-up of tongues of high potential vorticity drawn out from the polar vortex - are realized in three-dimensional simulations.

  2. High-resolution electron microscopy of advanced materials

    Energy Technology Data Exchange (ETDEWEB)

    Mitchell, T.E.; Kung, H.H.; Sickafus, K.E.; Gray, G.T. III; Field, R.D.; Smith, J.F. [Los Alamos National Lab., NM (United States). Materials Science and Technology Div.

    1997-11-01

    This final report chronicles a three-year, Laboratory Directed Research and Development (LDRD) project at Los Alamos National Laboratory (LANL). The High-Resolution Electron Microscopy Facility has doubled in size and tripled in quality since the beginning of the three-year period. The facility now includes a field-emission scanning electron microscope, a 100 kV field-emission scanning transmission electron microscope (FE-STEM), a 300 kV field-emission high-resolution transmission electron microscope (FE-HRTEM), and a 300 kV analytical transmission electron microscope. A new orientation imaging microscope is being installed. X-ray energy dispersive spectrometers for chemical analysis are available on all four microscopes; parallel electron energy loss spectrometers are operational on the FE-STEM and FE-HRTEM. These systems enable evaluation of local atomic bonding, as well as chemical composition in nanometer-scale regions. The FE-HRTEM has a point-to-point resolution of 1.6 {angstrom}, but the resolution can be pushed to its information limit of 1 {angstrom} by computer reconstruction of a focal series of images. HRTEM has been used to image the atomic structure of defects such as dislocations, grain boundaries, and interfaces in a variety of materials from superconductors and ferroelectrics to structural ceramics and intermetallics.

  3. High-resolution digital imaging with storage phosphors.

    Science.gov (United States)

    Fuhrman, C R; Gur, D; Schaetzing, R

    1990-01-01

    This article describes the current status and potential applications of high-resolution storage phosphor for imaging of the chest. Digital imaging that uses storage phosphor technology is easily adaptable to existing x-ray--generating equipment and can also be used with mobile equipment. The wide latitude of the storage phosphor technique permits satisfactory imaging in situations in which exposure factors cannot be accurately estimated or easily controlled. Early experience with an experimental Kodak high-resolution (4K x 4K) storage phosphor system suggests that standard and portal chest images of excellent quality can be obtained. Many issues must be resolved, however, before digital radiology with a storage phosphor can be advocated as being preferable to conventional film-screen systems. These issues, which include display modalities (film or television monitor), resolution requirements, and the effects of image processing, can only be resolved by further large-scale accuracy studies. The change to a digital imaging system will involve major expenditures for equipment and computers. Cost will be related largely to the level of spatial resolution required for primary radiographic diagnosis.

  4. High resolution neutron diffractometer HRND at research reactor CMRR

    Science.gov (United States)

    Zhang, J.; Xia, Y.; Wang, Y.; Xie, C.; Sun, G.; Liu, L.; Pang, B.; Li, J.; Huang, C.; Liu, Y.; Gong, J.

    2018-01-01

    The high resolution neutron diffractometer HRND is located at the 20 MW China Mianyang Research Reactor (CMRR), which is a neutron powder diffractometer especially dedicated to crystal and magnetic structure studies for polycrystalline powder samples. A vertical focusing Ge (511) monochromator produce a monochromatic neutron beam with a wavelength of 1.885 Å at a fixed take-off angle of 120o. An array of 64 equidistant 3He filled proportional counters can acquire diffraction patterns with a large-scale diffraction angle range over 160o. As all the Soller slit collimators of HRND have a collimation angle of 10' and the monochromator has an average mosaicity of 0.359o, HRND obtains a best resolution of about 1.6\\textperthousand based on experiments, which makes the resolution of HRND can compete with the mainstream-level high resolution neutron powder diffractometers in the world. Equipped with a cryostat and a furnace, HRND allows structural characterization in an extremely broad temperature range. The details of the configuration and performance of the instrument are reported along with its specifications and performance assessments in the present paper.

  5. Accelerated high-resolution photoacoustic tomography via compressed sensing.

    Science.gov (United States)

    Arridge, Simon; Beard, Paul; Betcke, Marta; Cox, Ben; Huynh, Nam; Lucka, Felix; Ogunlade, Olumide; Zhang, Edward

    2016-12-21

    Current 3D photoacoustic tomography (PAT) systems offer either high image quality or high frame rates but are not able to deliver high spatial and temporal resolution simultaneously, which limits their ability to image dynamic processes in living tissue (4D PAT). A particular example is the planar Fabry-Pérot (FP) photoacoustic scanner, which yields high-resolution 3D images but takes several minutes to sequentially map the incident photoacoustic field on the 2D sensor plane, point-by-point. However, as the spatio-temporal complexity of many absorbing tissue structures is rather low, the data recorded in such a conventional, regularly sampled fashion is often highly redundant. We demonstrate that combining model-based, variational image reconstruction methods using spatial sparsity constraints with the development of novel PAT acquisition systems capable of sub-sampling the acoustic wave field can dramatically increase the acquisition speed while maintaining a good spatial resolution: first, we describe and model two general spatial sub-sampling schemes. Then, we discuss how to implement them using the FP interferometer and demonstrate the potential of these novel compressed sensing PAT devices through simulated data from a realistic numerical phantom and through measured data from a dynamic experimental phantom as well as from in vivo experiments. Our results show that images with good spatial resolution and contrast can be obtained from highly sub-sampled PAT data if variational image reconstruction techniques that describe the tissues structures with suitable sparsity-constraints are used. In particular, we examine the use of total variation (TV) regularization enhanced by Bregman iterations. These novel reconstruction strategies offer new opportunities to dramatically increase the acquisition speed of photoacoustic scanners that employ point-by-point sequential scanning as well as reducing the channel count of parallelized schemes that use detector arrays.

  6. Accelerated high-resolution photoacoustic tomography via compressed sensing

    Science.gov (United States)

    Arridge, Simon; Beard, Paul; Betcke, Marta; Cox, Ben; Huynh, Nam; Lucka, Felix; Ogunlade, Olumide; Zhang, Edward

    2016-12-01

    Current 3D photoacoustic tomography (PAT) systems offer either high image quality or high frame rates but are not able to deliver high spatial and temporal resolution simultaneously, which limits their ability to image dynamic processes in living tissue (4D PAT). A particular example is the planar Fabry-Pérot (FP) photoacoustic scanner, which yields high-resolution 3D images but takes several minutes to sequentially map the incident photoacoustic field on the 2D sensor plane, point-by-point. However, as the spatio-temporal complexity of many absorbing tissue structures is rather low, the data recorded in such a conventional, regularly sampled fashion is often highly redundant. We demonstrate that combining model-based, variational image reconstruction methods using spatial sparsity constraints with the development of novel PAT acquisition systems capable of sub-sampling the acoustic wave field can dramatically increase the acquisition speed while maintaining a good spatial resolution: first, we describe and model two general spatial sub-sampling schemes. Then, we discuss how to implement them using the FP interferometer and demonstrate the potential of these novel compressed sensing PAT devices through simulated data from a realistic numerical phantom and through measured data from a dynamic experimental phantom as well as from in vivo experiments. Our results show that images with good spatial resolution and contrast can be obtained from highly sub-sampled PAT data if variational image reconstruction techniques that describe the tissues structures with suitable sparsity-constraints are used. In particular, we examine the use of total variation (TV) regularization enhanced by Bregman iterations. These novel reconstruction strategies offer new opportunities to dramatically increase the acquisition speed of photoacoustic scanners that employ point-by-point sequential scanning as well as reducing the channel count of parallelized schemes that use detector arrays.

  7. A Modified SDS-Based DNA Extraction Method for High Quality Environmental DNA from Seafloor Environments

    OpenAIRE

    Natarajan, Vengadesh Perumal; Zhang, Xinxu; Morono, Yuki; Inagaki, Fumio; Wang, Fengping

    2016-01-01

    Recovering high quality genomic DNA from environmental samples is a crucial primary step to understand the genetic, metabolic, and evolutionary characteristics of microbial communities through molecular ecological approaches. However, it is often challenging because of the difficulty of effective cell lysis without fragmenting the genomic DNA. This work aims to improve the previous SDS-based DNA extraction methods for high-biomass seafloor samples, such as pelagic sediments and metal sulfide ...

  8. A Modified SDS-Based DNA Extraction Method for High Quality Environmental DNA from Seafloor Environments.

    Science.gov (United States)

    Natarajan, Vengadesh Perumal; Zhang, Xinxu; Morono, Yuki; Inagaki, Fumio; Wang, Fengping

    2016-01-01

    Recovering high quality genomic DNA from environmental samples is a crucial primary step to understand the genetic, metabolic, and evolutionary characteristics of microbial communities through molecular ecological approaches. However, it is often challenging because of the difficulty of effective cell lysis without fragmenting the genomic DNA. This work aims to improve the previous SDS-based DNA extraction methods for high-biomass seafloor samples, such as pelagic sediments and metal sulfide chimney, to obtain high quality and high molecular weight of the genomic DNA applicable for the subsequent molecular ecological analyses. In this regard, we standardized a modified SDS-based DNA extraction method (M-SDS), and its performance was then compared to those extracted by a recently developed hot-alkaline DNA extraction method (HA) and a commercial DNA extraction kit. Consequently, the M-SDS method resulted in higher DNA yield and cell lysis efficiency, lower DNA shearing, and higher diversity scores than other two methods, providing a comprehensive DNA assemblage of the microbial community on the seafloor depositional environment.

  9. High resolution microphotonic needle for endoscopic imaging (Conference Presentation)

    Science.gov (United States)

    Tadayon, Mohammad Amin; Mohanty, Aseema; Roberts, Samantha P.; Barbosa, Felippe; Lipson, Michal

    2017-02-01

    GRIN (Graded index) lens have revolutionized micro endoscopy enabling deep tissue imaging with high resolution. The challenges of traditional GRIN lenses are their large size (when compared with the field of view) and their limited resolution. This is because of the relatively weak NA in standard graded index lenses. Here we introduce a novel micro-needle platform for endoscopy with much higher resolution than traditional GRIN lenses and a FOV that corresponds to the whole cross section of the needle. The platform is based on polymeric (SU-8) waveguide integrated with a microlens micro fabricated on a silicon substrate using a unique molding process. Due to the high index of refraction of the material the NA of the needle is much higher than traditional GRIN lenses. We tested the probe in a fluorescent dye solution (19.6 µM Alexa Flour 647 solution) and measured a numerical aperture of 0.25, focal length of about 175 µm and minimal spot size of about 1.6 µm. We show that the platform can image a sample with the field of view corresponding to the cross sectional area of the waveguide (80x100 µm2). The waveguide size can in principle be modified to vary size of the imaging field of view. This demonstration, combined with our previous work demonstrating our ability to implant the high NA needle in a live animal, shows that the proposed system can be used for deep tissue imaging with very high resolution and high field of view.

  10. High Resolution Measurements and Electronic Structure Calculations of a Diazanaphthalene

    Science.gov (United States)

    Gruet, Sébastien; Goubet, Manuel; Pirali, Olivier

    2014-06-01

    Polycyclic Aromatic Hydrocarbons (PAHs) have long been suspected to be the carriers of so called Unidentified Infrared Bands (UIBs). Most of the results published in the literature report rotationally unresolved spectra of pure carbon as well as heteroatom-containing PAHs species. To date for this class of molecules, the principal source of rotational informations is ruled by microwave (MW) spectroscopy while high resolution measurements reporting rotational structure of the infrared (IR) vibrational bands are very scarce. Recently, some high resolution techniques provided interesting new results to rotationally resolve the IR and far-IR bands of these large carbonated molecules of astrophysical interest. One of them is to use the bright synchrotron radiation as IR continuum source of a high resolution Fourier transform (FTIR) spectrometer. We report the very complementary analysis of the [1,6] naphthyridine (a N-bearing PAH) for which we recorded the microwave spectrum at the PhLAM laboratory (Lille) and the high resolution far-infrared spectrum on the AILES beamline at synchrotron facility SOLEIL. MW spectroscopy provided highly accurate rotational constants in the ground state to perform Ground State Combinations Differences (GSCD) allowing the analysis of the two most intense FT-FIR bands in the 50-900 wn range. Moreover, during this presentation the negative value of the inertial defect in the GS of the molecule will be discussed. A. Leger, J. L. Puget, Astron. Astrophys. 137, L5-L8 (1984) L. J. Allamandola et al. Astrophys. J. 290, L25-L28 (1985). Z. Kisiel et al. J. Mol. Spectrosc. 217, 115 (2003) S. Thorwirth et al. Astrophys. J. 662, 1309 (2007) D. McNaughton et al. J. Chem. Phys. 124, 154305 (2011). S. Albert et al. Faraday Discuss. 150, 71-99 (2011) B. E. Brumfield et al. Phys. Chem. Lett. 3, 1985-1988 (2012) O. Pirali et al. Phys. Chem. Chem. Phys. 15, 10141 (2013).

  11. Adaptive optics with pupil tracking for high resolution retinal imaging.

    Science.gov (United States)

    Sahin, Betul; Lamory, Barbara; Levecq, Xavier; Harms, Fabrice; Dainty, Chris

    2012-02-01

    Adaptive optics, when integrated into retinal imaging systems, compensates for rapidly changing ocular aberrations in real time and results in improved high resolution images that reveal the photoreceptor mosaic. Imaging the retina at high resolution has numerous potential medical applications, and yet for the development of commercial products that can be used in the clinic, the complexity and high cost of the present research systems have to be addressed. We present a new method to control the deformable mirror in real time based on pupil tracking measurements which uses the default camera for the alignment of the eye in the retinal imaging system and requires no extra cost or hardware. We also present the first experiments done with a compact adaptive optics flood illumination fundus camera where it was possible to compensate for the higher order aberrations of a moving model eye and in vivo in real time based on pupil tracking measurements, without the real time contribution of a wavefront sensor. As an outcome of this research, we showed that pupil tracking can be effectively used as a low cost and practical adaptive optics tool for high resolution retinal imaging because eye movements constitute an important part of the ocular wavefront dynamics.

  12. Glacial lake mapping with very high resolution satellite SAR data

    Science.gov (United States)

    Strozzi, T.; Wiesmann, A.; Kääb, A.; Joshi, S.; Mool, P.

    2012-08-01

    Floods resulting from the outbursts of glacial lakes are among the most far-reaching disasters in high mountain regions. Glacial lakes are typically located in remote areas and space-borne remote sensing data are an important source of information about the occurrence and development of such lakes. Here we show that very high resolution satellite Synthetic Aperture Radar (SAR) data can be employed for reliably mapping glacial lakes. Results in the Alps, Pamir and Himalaya using TerraSAR-X and Radarsat-2 data are discussed in comparison to in-situ information, and high-resolution satellite optical and radar imagery. The performance of the satellite SAR data is best during the snow- and ice-free season. In the broader perspective of hazard management, the detection of glacial lakes and the monitoring of their changes from very high-resolution satellite SAR intensity images contributes to the initial assessment of hazards related to glacial lakes, but a more integrated, multi-level approach needs also to include other relevant information such as glacier outlines and outline changes or the identification of unstable slopes above the lake and the surrounding area, information types to which SAR analysis techniques can also contribute.

  13. Use of ancient sedimentary DNA as a novel conservation tool for high-altitude tropical biodiversity.

    Science.gov (United States)

    Boessenkool, Sanne; McGlynn, Gayle; Epp, Laura S; Taylor, David; Pimentel, Manuel; Gizaw, Abel; Nemomissa, Sileshi; Brochmann, Christian; Popp, Magnus

    2014-04-01

    Conservation of biodiversity may in the future increasingly depend upon the availability of scientific information to set suitable restoration targets. In traditional paleoecology, sediment-based pollen provides a means to define preanthropogenic impact conditions, but problems in establishing the exact provenance and ecologically meaningful levels of taxonomic resolution of the evidence are limiting. We explored the extent to which the use of sedimentary ancient DNA (sedaDNA) may complement pollen data in reconstructing past alpine environments in the tropics. We constructed a record of afro-alpine plants retrieved from DNA preserved in sediment cores from 2 volcanic crater sites in the Albertine Rift, eastern Africa. The record extended well beyond the onset of substantial anthropogenic effects on tropical mountains. To ensure high-quality taxonomic inference from the sedaDNA sequences, we built an extensive DNA reference library covering the majority of the afro-alpine flora, by sequencing DNA from taxonomically verified specimens. Comparisons with pollen records from the same sediment cores showed that plant diversity recovered with sedaDNA improved vegetation reconstructions based on pollen records by revealing both additional taxa and providing increased taxonomic resolution. Furthermore, combining the 2 measures assisted in distinguishing vegetation change at different geographic scales; sedaDNA almost exclusively reflects local vegetation, whereas pollen can potentially originate from a wide area that in highlands in particular can span several ecozones. Our results suggest that sedaDNA may provide information on restoration targets and the nature and magnitude of human-induced environmental changes, including in high conservation priority, biodiversity hotspots, where understanding of preanthropogenic impact (or reference) conditions is highly limited. © 2013 Society for Conservation Biology.

  14. Cross-Validation of High-Resolution Melting Analysis-Based Genotyping Platform.

    Science.gov (United States)

    Langaee, Taimour; Stauffer, Lynda; Galloway, Cheryl; Solayman, Mohamed H; Cavallari, Larisa

    2017-04-01

    Developing genetic and pharmacogenetic panels enhances genetic testing in clinical molecular diagnostics and precision medicine. This study was designed to cross-validate the performance of Canon's multiplex high-resolution DNA melting analysis platform with the Applied Biosystems TaqMan®-based Quant Studio Real-Time PCR System and Pyrosequencing® genotyping platforms for common genetic polymorphisms of the vitamin K epoxide reductase complex 1 (VKORC1) and CYP2C9. Genomic DNA isolated from 240 blood and saliva samples was used to genotype the VKORC1-1639 G/A (rs9923231), CYP2C9*2 (430C>T, rs28371674), and CYP2C9*3 (1075A>C, rs1057910) single-nucleotide polymorphisms (SNPs) on the three above-mentioned genotyping platforms. There was 99.2%, 100%, and 100% concordance among the Canon DNA analyzer, the TaqMan-based QuantStudio, and the Pyrosequencing genotyping results for the VKORC1 (rs9923231), CYP2C9*2, and CYP2C9*3 SNPs, respectively, in DNA samples isolated from blood. The DNA samples isolated from saliva showed 100% concordance among the three test platforms for the three tested SNPs. These results show that, the DNA analyzer performed very well when compared with two commonly used genotyping platforms. The reliability, multiple genetic variant testing capability, and short turnaround time for up to eight samples make the DNA analyzer an ideal genotyping platform for genetic testing in the clinical practice setting, where efficient genotyping is important to prevent delays in optimizing drug therapy.

  15. Tests of a High Resolution Beam Profile Monitor

    Energy Technology Data Exchange (ETDEWEB)

    Norem, J.

    2004-10-28

    High energy linear colliders require very small beams at the interaction point to produce high luminosities, and these beams must be measured and monitored. We have developed and tested a technique where the profile can be obtained from an extension of pinhole camera optics using thick, single sided collimators and slits. Very high resolutions (a few nm) should be possible. Gamma beams can be obtained from bremsstrahlung, Compton or beamstrahlung radiation. We describe tests of the technique using bremsstrahlung from an 800 MeV electron beam at Bates/MIT, Compton scattered photons from 47 GeV Final Focus Test Beam (FFTB) at SLAC, and other applications, such as linear colliders.

  16. High resolution reservoir geological modelling using outcrop information

    Energy Technology Data Exchange (ETDEWEB)

    Zhang Changmin; Lin Kexiang; Liu Huaibo [Jianghan Petroleum Institute, Hubei (China)] [and others

    1997-08-01

    This is China`s first case study of high resolution reservoir geological modelling using outcrop information. The key of the modelling process is to build a prototype model and using the model as a geological knowledge bank. Outcrop information used in geological modelling including seven aspects: (1) Determining the reservoir framework pattern by sedimentary depositional system and facies analysis; (2) Horizontal correlation based on the lower and higher stand duration of the paleo-lake level; (3) Determining the model`s direction based on the paleocurrent statistics; (4) Estimating the sandbody communication by photomosaic and profiles; (6) Estimating reservoir properties distribution within sandbody by lithofacies analysis; and (7) Building the reservoir model in sandbody scale by architectural element analysis and 3-D sampling. A high resolution reservoir geological model of Youshashan oil field has been built by using this method.

  17. Object-Based Building Extraction from High Resolution Satellite Imagery

    Directory of Open Access Journals (Sweden)

    R. Attarzadeh

    2012-07-01

    Full Text Available Automatic building extraction from high resolution satellite imagery is considered as an important field of research in remote sensing and machine vision. Many algorithms for extraction of buildings from satellite images have been presented so far. These algorithms mainly have considered radiometric, geometric, edge detection and shadow criteria approaches to perform the building extraction. In this paper, we propose a novel object based approach for automatic and robust detection and extraction of building in high spatial resolution images. To achieve this goal, we use stable and variable features together. Stable features are derived from inherent characteristics of building phenomenon and variable features are extracted using SEparability and THresholds analysis tool. The proposed method has been applied on a QuickBird imagery of an urban area in Isfahan city and visual validation demonstrates that the proposed method provides promising results.

  18. Fabricating High-Resolution X-Ray Collimators

    Science.gov (United States)

    Appleby, Michael; Atkinson, James E.; Fraser, Iain; Klinger, Jill

    2008-01-01

    A process and method for fabricating multi-grid, high-resolution rotating modulation collimators for arcsecond and sub-arcsecond x-ray and gamma-ray imaging involves photochemical machining and precision stack lamination. The special fixturing and etching techniques that have been developed are used for the fabrication of multiple high-resolution grids on a single array substrate. This technology has application in solar and astrophysics and in a number of medical imaging applications including mammography, computed tomography (CT), single photon emission computed tomography (SPECT), and gamma cameras used in nuclear medicine. This collimator improvement can also be used in non-destructive testing, hydrodynamic weapons testing, and microbeam radiation therapy.

  19. Localized corrosion information using high resolution measurement devices

    DEFF Research Database (Denmark)

    Ambat, Rajan

    2005-01-01

    High performance demand for several engineering alloys and components, and miniaturization of electronics and development of MEMS requires better understanding of local corrosion characteristics frequently down to µm scale. This is because in metallic materials corrosion is a sensitive function...... in conjunction with microstructural analysis, using advanced microscopic tools, becomes very important. Corrosion of microelectronics circuits and MEMs is also a recent problem, which demands measurement resolution down to few microns as the components are extremely small, and measurement needs to be carried out...... of the technique could be further enhanced by adding new features such as high resolution video visualization systems, fretting/tribo-corroson attachments, and also by integrating it with stress corrosion testing, corrosion investigation of concrete for a few to name with. The corrosion group in MPT, Technical...

  20. Automatic Matching of High Resolution Satellite Images Based on RFM

    Directory of Open Access Journals (Sweden)

    JI Shunping

    2016-02-01

    Full Text Available A matching method for high resolution satellite images based on RFM is presented.Firstly,the RFM parameters are used to predict the initial parallax of corresponding points and the prediction accuracy is analyzed.Secondly,the approximate epipolar equation is constructed based on projection tracking and its accuracy is analyzed.Thirdly,approximate 1D image matching is executed on pyramid images and least square matching on base images.At last RANSAC is imbedded to eliminate mis-matching points and matching results are obtained.Test results verified the method more robust and with higher matching rate,compared to 2D gray correlation method and the popular SIFT matching method,and the method preferably solved the question of high resolution satellite image matching with different stereo model,different time and large rotation images.

  1. High-Resolution Fluorescence Microscope Imaging of Erythroblast Structure.

    Science.gov (United States)

    Smith, Alyson S; Nowak, Roberta B; Fowler, Velia M

    2018-01-01

    During erythropoiesis, erythroblasts undergo dramatic morphological changes to produce mature erythrocytes. Many unanswered questions regarding the molecular mechanisms behind these changes can be addressed with high-resolution fluorescence imaging. Immunofluoresence staining enables localization of specific molecules, organelles, and membrane components in intact cells at different phases of erythropoiesis. Confocal laser scanning microscopy can provide high-resolution, three-dimensional images of stained structures, which can be used to dissect the molecular mechanisms driving erythropoiesis. The sample preparation, staining procedure, imaging parameters, and image analysis methods used directly affect the quality of the confocal images and the amount and accuracy of information that they can provide. Here, we describe methods to dissect erythropoietic tissues from mice, to perform immunofluorescence staining and confocal imaging of various molecules, organelles and structures of interest in erythroblasts, and to present and quantitatively analyze the data obtained in these fluorescence images.

  2. X-ray optics high-energy-resolution applications

    CERN Document Server

    Shvyd’ko, Yuri

    2004-01-01

    The generation of radiation with well-defined frequency and wavelength, and the ability to precisely determine these quantities, are of fundamental importance in physics and other natural sciences Monochromatic radiation enables both very accurate structure determinations and studies of the dynamics of living and non-living matter It is crucial for the realization of standards of time and length, for the determination of fundamental constants, and for many other aspects of basic research Bragg backscattering from perfect crystals is a tool for creating, manipulating, and analyzing x-rays with highest spectral purity It has the unique feature of selecting x-rays with narrow spectral bandwidth This book describes the theoretical foundations and principles of x-ray crystal optics with high spectral resolution Various experimental studies and applications are presented and the author also addresses the development of instrumentation, such as high-resolution x-ray monochromators, analyzers, wavelength meters, reso...

  3. Measuring large-scale social networks with high resolution.

    Science.gov (United States)

    Stopczynski, Arkadiusz; Sekara, Vedran; Sapiezynski, Piotr; Cuttone, Andrea; Madsen, Mette My; Larsen, Jakob Eg; Lehmann, Sune

    2014-01-01

    This paper describes the deployment of a large-scale study designed to measure human interactions across a variety of communication channels, with high temporal resolution and spanning multiple years-the Copenhagen Networks Study. Specifically, we collect data on face-to-face interactions, telecommunication, social networks, location, and background information (personality, demographics, health, politics) for a densely connected population of 1000 individuals, using state-of-the-art smartphones as social sensors. Here we provide an overview of the related work and describe the motivation and research agenda driving the study. Additionally, the paper details the data-types measured, and the technical infrastructure in terms of both backend and phone software, as well as an outline of the deployment procedures. We document the participant privacy procedures and their underlying principles. The paper is concluded with early results from data analysis, illustrating the importance of multi-channel high-resolution approach to data collection.

  4. Measuring large-scale social networks with high resolution.

    Directory of Open Access Journals (Sweden)

    Arkadiusz Stopczynski

    Full Text Available This paper describes the deployment of a large-scale study designed to measure human interactions across a variety of communication channels, with high temporal resolution and spanning multiple years-the Copenhagen Networks Study. Specifically, we collect data on face-to-face interactions, telecommunication, social networks, location, and background information (personality, demographics, health, politics for a densely connected population of 1000 individuals, using state-of-the-art smartphones as social sensors. Here we provide an overview of the related work and describe the motivation and research agenda driving the study. Additionally, the paper details the data-types measured, and the technical infrastructure in terms of both backend and phone software, as well as an outline of the deployment procedures. We document the participant privacy procedures and their underlying principles. The paper is concluded with early results from data analysis, illustrating the importance of multi-channel high-resolution approach to data collection.

  5. Space to Think: Large, High-Resolution Displays for Sensemaking

    Energy Technology Data Exchange (ETDEWEB)

    Andrews, Christopher P.; Endert, Alexander; North, Chris

    2010-05-05

    Space supports human cognitive abilities in a myriad of ways. The note attached to the side of the monitor, the papers spread out on the desk, diagrams scrawled on a whiteboard, and even the keys left out on the counter are all examples of using space to recall, reveal relationships, and think. Technological advances have made it possible to construct large display environments in which space has real meaning. This paper examines how increased space affects the way displays are regarded and used within the context of the cognitively demanding task of sensemaking. A study was conducted observing analysts using a prototype large, high-resolution display to solve an analytic problem. This paper reports on the results of this study and suggests a number of potential design criteria for future sensemaking tools developed for large, high-resolution displays.

  6. Spatial Ensemble Postprocessing of Precipitation Forecasts Using High Resolution Analyses

    Science.gov (United States)

    Lang, Moritz N.; Schicker, Irene; Kann, Alexander; Wang, Yong

    2017-04-01

    Ensemble prediction systems are designed to account for errors or uncertainties in the initial and boundary conditions, imperfect parameterizations, etc. However, due to sampling errors and underestimation of the model errors, these ensemble forecasts tend to be underdispersive, and to lack both reliability and sharpness. To overcome such limitations, statistical postprocessing methods are commonly applied to these forecasts. In this study, a full-distributional spatial post-processing method is applied to short-range precipitation forecasts over Austria using Standardized Anomaly Model Output Statistics (SAMOS). Following Stauffer et al. (2016), observation and forecast fields are transformed into standardized anomalies by subtracting a site-specific climatological mean and dividing by the climatological standard deviation. Due to the need of fitting only a single regression model for the whole domain, the SAMOS framework provides a computationally inexpensive method to create operationally calibrated probabilistic forecasts for any arbitrary location or for all grid points in the domain simultaneously. Taking advantage of the INCA system (Integrated Nowcasting through Comprehensive Analysis), high resolution analyses are used for the computation of the observed climatology and for model training. The INCA system operationally combines station measurements and remote sensing data into real-time objective analysis fields at 1 km-horizontal resolution and 1 h-temporal resolution. The precipitation forecast used in this study is obtained from a limited area model ensemble prediction system also operated by ZAMG. The so called ALADIN-LAEF provides, by applying a multi-physics approach, a 17-member forecast at a horizontal resolution of 10.9 km and a temporal resolution of 1 hour. The performed SAMOS approach statistically combines the in-house developed high resolution analysis and ensemble prediction system. The station-based validation of 6 hour precipitation sums

  7. Regional High Resolution Reanalysis Covered European North East Shelf

    Science.gov (United States)

    Bourdalle-Badie, R.; Benkiran, M.; Chanut, J.; Drillet, Y.; Reffray, G.

    2011-12-01

    Mercator-Ocean has developed a regional forecasting system at 1/12° resolution over the North East Atlantic (IBI: Iberia, Biscay and Irish), taking advantage of the recent developments in NEMO. This regional forecasting system uses boundary conditions from the Mercator-Ocean global reanalysis (GLORYS: Global Ocean ReanalYses and Simulations). The assimilation component of the Mercator Ocean system, is based on a reduced-order Kalman filter (the SEEK or Singular Extended Evolutive Kalman filter). An IAU method (Incremental Analysis Updates) is used to apply the increments in the system. The error statistics are represented in a sub-space spanned by a small number of dominant 3D error directions. The data assimilation system allows to constrain the model in a multivariate way with Sea Surface Temperature (AVHRR + Multi-satellite High resolution), together with all available satellite Sea Level Anomalies, and with in situ observations from the CORA-03 data base, including ARGO floats temperature and salinity measurements. This reanalysis covers the period from January 2002 to December 2009. In this presentation, the results obtained with this reanalysis system (1/12°) are compared to the GLORYS ones. A special focus will be made on the gain thanks to the higher resolution of the model and higher resolution of the SST assimilated in this reanalysis.

  8. Astrophysical applications of high angular resolution array-telescopes

    Science.gov (United States)

    Linsley, J.

    1985-01-01

    The air shower array-telescopes which are currently being used to search for and study point sources of UHE gamma-rays have angular resolution similar to 1 deg, limited by either the small total area of particle detectors or poor timing resolution. As the signal to noise ratio depends sensitively on the angular resolution, it seems certain that this figure will quickly be surpassed when second generation instruments come into operation. Since the trajectories of galactic cosmic rays with E 100,000 GeV are practically straight lines on scales of 1 A.U. or less, these new instruments will be able to observe a shadow cast by the Moon (angular diameter 0.5 deg). Although the angular diameter of the Sun is practically the same, its shadow will be more complex because of its magnetic field. Thus, high angular resolution observations of the Sun afford a means of investigating the solar magnetic field, and also the charge composition of cosmic rays, including the ratio of antiprotons to protons.

  9. Very High Resolution SAR Tomography via Compressive Sensing

    Science.gov (United States)

    Zhu, Xiao Xiang; Bamler, Richard

    2010-03-01

    By using multi-pass SAR acquisitions, SAR tomography (TomoSAR) extends the synthetic aperture principle into the elevation direction for 3-D imaging. Since the orbits of modern space-borne SAR systems, like TerraSAR-X, are tightly controlled, the elevation resolution (depending on the elevation aperture size) is at least an order of magnitude lower than in range and azimuth. Hence, super- resolution algorithms are desired. The high anisotropic 3- D resolution element renders the signals sparse in elevation. This property suggests using compressive sensing (CS) methods. The paper presents the theory of 4- D (i.e. space-time) CS TomoSAR and compares it with classical tomographic methods. Super-resolution properties and point localization accuracies are demonstrated using simulations and real data. A CS reconstruction of a building complex from TerraSAR-X spotlight data is presented. In addition, the model based time warp method for differential tomographic non-linear motion monitoring is proposed and validated by reconstructing seasonal motion (caused by thermal expansion) of a building complex.

  10. Quantitative High-Resolution Transmission Electron Microscopy of Single Atoms

    OpenAIRE

    Gamm, B.; Popescu, R.; Blank, H.; Schneider, R; Beyer, A.; Gölzhäuser, A.; Gerthsen, D.

    2010-01-01

    Single atoms can be considered as basic objects for electron microscopy to test the microscope performance and basic concepts for modeling of image contrast. In this work high-resolution transmission electron microscopy was applied to image single platinum atoms in an aberration-corrected transmission electron microscope. The atoms are deposited on a self-assembled monolayer substrate which induces only negligible contrast. Single-atom contrast simulations were performed on the basis of Weick...

  11. A high resolution cavity BPM for the CLIC Test Facility

    CERN Document Server

    Chritin, N.; Soby, L.; Lunin, A.; Solyak, N.; Wendt, M.; Yakovlev, V.

    2012-01-01

    In frame of the development of a high resolution BPM system for the CLIC Main Linac we present the design of a cavity BPM prototype. It consists of a waveguide loaded dipole mode resonator and a monopole mode reference cavity, both operating at 15 GHz, to be compatible with the bunch frequencies at the CLIC Test Facility. Requirements, design concept, numerical analysis, and practical considerations are discussed.

  12. Automatic Matching of High Resolution Satellite Images Based on RFM

    OpenAIRE

    JI Shunping; YUAN Xiuxiao

    2016-01-01

    A matching method for high resolution satellite images based on RFM is presented.Firstly,the RFM parameters are used to predict the initial parallax of corresponding points and the prediction accuracy is analyzed.Secondly,the approximate epipolar equation is constructed based on projection tracking and its accuracy is analyzed.Thirdly,approximate 1D image matching is executed on pyramid images and least square matching on base images.At last RANSAC is imbedded to eliminate mis-matching points...

  13. Progress Toward A Very High Angular Resolution Imaging Spectrometer (VERIS)

    Science.gov (United States)

    Korendyke, Clarence M.; Vourlidas, A.; Landi, E.; Seely, J.; Klimchuck, J.

    2007-07-01

    Recent imaging at arcsecond (TRACE) and sub-arcsecond (VAULT) spatial resolution clearly show that structures with fine spatial scales play a key role in the physics of the upper solar atmosphere. Both theoretical and observational considerations point to the importance of small spatial scales, impulsive energy release, strong dynamics, and extreme plasma nonuniformity. Fundamental questions regarding the nature, structure, properties and dynamics of loops and filamentary structures in the upper atmosphere have been raised. To address these questions, we are developing a next generation, VEry high angular Resolution Imaging Spectrometer (VERIS) as a sounding rocket instrument. VERIS will obtain the necessary high spatial resolution, high fidelity measurements of plasma temperatures, densities and velocities. With broad simultaneous temperature coverage, the VERIS observations will directly address unresolved issues relating to interconnections of various temperature solar plasmas. VERIS will provide the first ever subarcsecond spectra of transition region and coronal structures. It will do so with a sufficient spectral resolution of to allow centroided Doppler velocity determinations to better than 3 km/s. VERIS uses a novel two element, normal incidence optical design with highly reflective EUV coatings to access a spectral range with broad temperature coverage (0.03-15 MK) and density-sensitive line ratios. Finally, in addition to the spectra, VERIS will simultaneously obtain spectrally pure slot images (10x150 arcsec) in the +/-1 grating orders, which can be combined to make instantaneous line-of-sight velocity maps with 8km/s accuracy over an unprecedented field of view. The VERIS program is beginning the second year of its three year development cycle. All design activities and reviews are complete. Fabrication of all major components has begun. Brassboard electronics cards have been fabricated, assembled and tested. The paper presents the essential scientific

  14. Tuberculous otitis media: findings on high-resolution CT

    Energy Technology Data Exchange (ETDEWEB)

    Lungenschmid, D. [Dept. of Radiodiagnostics, University Hospital Innsbruck (Austria)]|[Dept. of Magnetic Resonance and Spectroscopy, University Hospital of Innsbruck (Austria); Buchberger, W. [Dept. of Radiodiagnostics, University Hospital Innsbruck (Austria)]|[Dept. of Magnetic Resonance and Spectroscopy, University Hospital of Innsbruck (Austria); Schoen, G. [Dept. of Radiodiagnostics, University Hospital Innsbruck (Austria); Schoepf, R. [Radiologic Inst., Landeck (Austria); Mihatsch, T. [Dept. of Oto-Rhino-Laryngology, University Hospital of Innsbruck (Austria); Birbamer, G. [Dept. of Magnetic Resonance and Spectroscopy, University Hospital of Innsbruck (Austria); Wicke, K. [Inst. of Computed Tomography, University Hospital of Innsbruck (Austria)

    1993-12-01

    We describe two cases of tuberculous otitis media studied with high-resolution computed tomography (CT). Findings included extensive soft tissue densities with fluid levels in the tympanic cavity, the antrum, the mastoid and petrous air cells. Multifocal bony erosions and reactive bone sclerosis were seen as well. CT proved valuable for planning therapy by accurately displaying the involvement of the various structures of the middle and inner ear. However, the specific nature of the disease could only be presumed. (orig.)

  15. High-Resolution Wind Measurements for Offshore Wind Energy Development

    Science.gov (United States)

    Nghiem, Son V.; Neumann, Gregory

    2011-01-01

    A mathematical transform, called the Rosette Transform, together with a new method, called the Dense Sampling Method, have been developed. The Rosette Transform is invented to apply to both the mean part and the fluctuating part of a targeted radar signature using the Dense Sampling Method to construct the data in a high-resolution grid at 1-km posting for wind measurements over water surfaces such as oceans or lakes.

  16. Acute pulmonary injury: high-resolution CT and histopathological spectrum

    Science.gov (United States)

    Obadina, E T; Torrealba, J M

    2013-01-01

    Acute lung injury usually causes hypoxaemic respiratory failure and acute respiratory distress syndrome (ARDS). Although diffuse alveolar damage is the hallmark of ARDS, other histopathological patterns of injury, such as acute and fibrinoid organising pneumonia, can be associated with acute respiratory failure. Acute eosinophilic pneumonia can also cause acute hypoxaemic respiratory failure and mimic ARDS. This pictorial essay reviews the high-resolution CT findings of acute lung injury and the correlative histopathological findings. PMID:23659926

  17. High Resolution Analysis of Copy Number Mutation in Breast Cancer

    Science.gov (United States)

    2005-05-01

    Pon , in Polysaccharides in Medic- copy number at high resolution throughout the other diseases, we must distinguish abnormal inal Applications, S...was determined to in- leles . In all experiments, there were a total of silico from the human genome sequence as- volve an interchromosomal duplication...well (3), although we do not explore that approach here. PON ) = e -pb o#regular( - )#deviated [1] The negative log likelihood function satisfies an

  18. High Resolution Wavenumber Standards for the Infrared. (IUPAC Recommendations 1995)

    Science.gov (United States)

    Guelachvili, G.; Birk, M.; Bord, C.; Brault, J.; Brown, L.; Carli, B.; Cole, A.; Evenson, D.; Fayt, A.; Hausamann, D.; hide

    1995-01-01

    The calibration of high resolution infrared spectra is generally more precise than accurate even when they are recorded with Fourier interferometers. In order to improve the consistency of the spectral measurements, an IUPAC project has been undertaken. Its aim was to recommend a selection of spectral lines as wavenumber standards for absolute calibration in the infrared. This paper will report the final recommendations in the spectral range extending from about 4 to about 7000 cm(be).

  19. High-resolution x-ray photoemission spectra of silver

    DEFF Research Database (Denmark)

    Barrie, A.; Christensen, N. E.

    1976-01-01

    An electron spectrometer fitted with an x-ray monochromator for Al Kα1,2 radiation (1486.6 eV) has been used to record high-resolution x-ray photoelectron spectra for the 4d valence band as well as the 3d spin doublet in silver. The core-level spectrum has a line shape that can be described...

  20. High Time Resolution Photon Counting 3D Imaging Sensors

    Science.gov (United States)

    Siegmund, O.; Ertley, C.; Vallerga, J.

    2016-09-01

    Novel sealed tube microchannel plate (MCP) detectors using next generation cross strip (XS) anode readouts and high performance electronics have been developed to provide photon counting imaging sensors for Astronomy and high time resolution 3D remote sensing. 18 mm aperture sealed tubes with MCPs and high efficiency Super-GenII or GaAs photocathodes have been implemented to access the visible/NIR regimes for ground based research, astronomical and space sensing applications. The cross strip anode readouts in combination with PXS-II high speed event processing electronics can process high single photon counting event rates at >5 MHz ( 80 ns dead-time per event), and time stamp events to better than 25 ps. Furthermore, we are developing a high speed ASIC version of the electronics for low power/low mass spaceflight applications. For a GaAs tube the peak quantum efficiency has degraded from 30% (at 560 - 850 nm) to 25% over 4 years, but for Super-GenII tubes the peak quantum efficiency of 17% (peak at 550 nm) has remained unchanged for over 7 years. The Super-GenII tubes have a uniform spatial resolution of MCP gain photon counting operation also permits longer overall sensor lifetimes and high local counting rates. Using the high timing resolution, we have demonstrated 3D object imaging with laser pulse (630 nm 45 ps jitter Pilas laser) reflections in single photon counting mode with spatial and depth sensitivity of the order of a few millimeters. A 50 mm Planacon sealed tube was also constructed, using atomic layer deposited microchannel plates which potentially offer better overall sealed tube lifetime, quantum efficiency and gain stability. This tube achieves standard bialkali quantum efficiency levels, is stable, and has been coupled to the PXS-II electronics and used to detect and image fast laser pulse signals.

  1. High-resolution genotypic analysis of the genus Aeromonas by AFLP fingerprinting.

    Science.gov (United States)

    Huys, G; Coopman, R; Janssen, P; Kersters, K

    1996-04-01

    We investigated the ability of a recently developed genomic fingerprinting technique, named AFLP, to differentiate the 14 currently defined DNA hybridization groups (HGs) in the genus Aeromonas. We also determined the taxonomic positions of the phenospecies Aeromonas allosaccharophila, Aeromonas encheleia, Aeromonas enteropelogenes, and Aeromonas ichthiosmia, which have not been assigned to HGs yet. A total of 98 Aeromonas type and reference strains were included in this study. For the AFLP analysis, the total genomic DNA of each strain was digested with restriction endonucleases ApaI and TaqI. Subsequently, restriction fragments were selectively amplified under high-stringency PCR conditions. The amplification products were electrophoretically separated on a polyacrylamide gel and visualized by autoradiography. Following high-resolution densitometric scanning of the resulting band patterns, AFLP data were further processed for a computer-assisted comparison. A numerical analysis of the digitized fingerprints revealed 13 AFLP clusters which, in general, clearly supported the current Aeromonas taxonomy derived from DNA homology data. In addition, our results indicated that there is significant genotypic heterogeneity in Aeromonas eucrenophila (HG6), which may lead to a further subdivision of this species. A. allosaccharophila and A. encheleia did not represent a separate AFLP cluster but were found to be genotypically related to HG8/10 and HG6, respectively. In addition, the results of the AFLP analysis also confirmed the phylogenetic findings that A. enteropelogenes and A. ichthiosmia are in fact identical to Aeromonas trota (HG13) and Aeromonas veronii (HG8/10), respectively. The results of this study clearly show that the AFLP technique is a valuable new high-resolution genotypic tool for classification of Aeromonas species and also emphasize that this powerful DNA fingerprinting method is important for bacterial taxonomy in general.

  2. High-resolution CT findings in Streptococcus milleri pulmonary infection.

    Science.gov (United States)

    Okada, F; Ono, A; Ando, Y; Nakayama, T; Ishii, H; Hiramatsu, K; Sato, H; Kira, A; Otabe, M; Mori, H

    2013-06-01

    To assess pulmonary high-resolution computed tomography (CT) findings in patients with acute Streptococcus milleri pulmonary infection. Sixty consecutive patients with acute S. milleri pneumonia who had undergone high-resolution CT chest examinations between January 2004 and March 2010 were retrospectively identified. Twenty-seven patients with concurrent infections were excluded. The final study group comprised 33 patients (25 men, 8 women; aged 20-88 years, mean 63.1 years) with S. milleri infection. The patients' clinical findings were assessed. Parenchymal abnormalities, enlarged lymph nodes, and pleural effusion were evaluated on high-resolution CT. Underlying conditions included malignancy (n = 15), a smoking habit (n = 11), and diabetes mellitus (n = 8). CT images of all patients showed abnormal findings, including ground-glass opacity (n = 24), bronchial wall thickening (n = 23), consolidation (n = 17), and cavities (n = 7). Pleural effusion was found in 18 patients, and complex pleural effusions were found in seven patients. Pulmonary infection caused by S. milleri was observed mostly in male patients with underlying conditions such as malignancy or a smoking habit. The CT findings in patients with S. milleri consisted mainly of ground-glass opacity, bronchial wall thickening, pleural effusions, and cavities. Copyright © 2013 The Royal College of Radiologists. Published by Elsevier Ltd. All rights reserved.

  3. Ultrathin high-resolution flexographic printing using nanoporous stamps.

    Science.gov (United States)

    Kim, Sanha; Sojoudi, Hossein; Zhao, Hangbo; Mariappan, Dhanushkodi; McKinley, Gareth H; Gleason, Karen K; Hart, A John

    2016-12-01

    Since its invention in ancient times, relief printing, commonly called flexography, has been used to mass-produce artifacts ranging from decorative graphics to printed media. Now, higher-resolution flexography is essential to manufacturing low-cost, large-area printed electronics. However, because of contact-mediated liquid instabilities and spreading, the resolution of flexographic printing using elastomeric stamps is limited to tens of micrometers. We introduce engineered nanoporous microstructures, comprising polymer-coated aligned carbon nanotubes (CNTs), as a next-generation stamp material. We design and engineer the highly porous microstructures to be wetted by colloidal inks and to transfer a thin layer to a target substrate upon brief contact. We demonstrate printing of diverse micrometer-scale patterns of a variety of functional nanoparticle inks, including Ag, ZnO, WO3, and CdSe/ZnS, onto both rigid and compliant substrates. The printed patterns have highly uniform nanoscale thickness (5 to 50 nm) and match the stamp features with high fidelity (edge roughness, ~0.2 μm). We derive conditions for uniform printing based on nanoscale contact mechanics, characterize printed Ag lines and transparent conductors, and achieve continuous printing at a speed of 0.2 m/s. The latter represents a combination of resolution and throughput that far surpasses industrial printing technologies.

  4. Development of a high resolution module for PET scanners

    Science.gov (United States)

    Stringhini, G.; Pizzichemi, M.; Ghezzi, A.; Stojkovic, A.; Tavernier, S.; Niknejad, T.; Varela, J.; Paganoni, M.; Auffray, E.

    2017-02-01

    Positron Emission Tomography (PET) scanners require high performances in term of spatial resolution and sensitivity to allow early detection of cancer masses. In small animal and organ dedicated PET scanners the Depth of Interaction (DOI) information has to be obtained to avoid parallax errors and to reconstruct high resolution images. In the whole body PET, the DOI information can be useful to correct for the time jitter of the optical photons along the main axis of the scintillator, improving the time performances. In this work we present the development of PET module designed to reach high performance as compared to the current scanners while keeping the complexity of the system reasonably low. The module presented is based on a 64 LYSO (Lutetium-yttrium oxyorthosilicate) crystals matrix and on a 4×4 MPPC (Multi Pixels Photon Counter) array as detector in a 4 to 1 coupling between the crystals and the detector and a single side readout. The lateral surfaces of the crystals are optically treated to be unpolished. The DOI and the energy resolution of the PET module are presented and a fast method to obtain the DOI calibration is discussed.

  5. High Resolution Observations of Escaping Ions in the Martian Magnetotail

    Science.gov (United States)

    Halekas, J. S.; Raman, C.; Brain, D.; DiBraccio, G. A.; Harada, Y.; McFadden, J. P.; Mitchell, D. L.; Connerney, J. E. P.; Jakosky, B. M.

    2016-12-01

    Ions escape from the Martian upper atmosphere via a number of channels, including the central plasmasheet of the magnetotail. Mars Express observations show that the heavy ions O+ and O2+ escaping through the central tail often have approximately the same energy, suggesting acceleration in a quasi-static electric field, which has been interpreted as a Hall electric field. The Solar Wind Ion Analyzer (SWIA) on MAVEN was designed to measure the upstream solar wind. However, during orbit segments with appropriate spacecraft attitude, SWIA can also make high resolution measurements of escaping ions in the tail. During the prime mission, these observations were only returned sporadically, during periods of intense escaping fluxes that fortuitously triggered a mode switch. Now, in the extended mission, we return high resolution observations from SWIA routinely. Some of these high resolution measurements reveal slight differences in both the direction and energy of escaping O+ and O2+ ions, which may help determine the acceleration process(es). We investigate the location and solar wind conditions for which the escaping ions separate in energy and angle and the systematics of their energies and flow vectors, and discuss the implications for ion acceleration and the overall picture of Martian atmospheric escape.

  6. High resolution, MRI-based, segmented, computerized head phantom

    Energy Technology Data Exchange (ETDEWEB)

    Zubal, I.G.; Harrell, C.R.; Smith, E.O.; Smith, A.L.; Krischlunas, P. [Yale Univ., New Haven, CT (United States). Dept. of Diagnostic Radiology

    1999-01-01

    The authors have created a high-resolution software phantom of the human brain which is applicable to voxel-based radiation transport calculations yielding nuclear medicine simulated images and/or internal dose estimates. A software head phantom was created from 124 transverse MRI images of a healthy normal individual. The transverse T2 slices, recorded in a 256x256 matrix from a GE Signa 2 scanner, have isotropic voxel dimensions of 1.5 mm and were manually segmented by the clinical staff. Each voxel of the phantom contains one of 62 index numbers designating anatomical, neurological, and taxonomical structures. The result is stored as a 256x256x128 byte array. Internal volumes compare favorably to those described in the ICRP Reference Man. The computerized array represents a high resolution model of a typical human brain and serves as a voxel-based anthropomorphic head phantom suitable for computer-based modeling and simulation calculations. It offers an improved realism over previous mathematically described software brain phantoms, and creates a reference standard for comparing results of newly emerging voxel-based computations. Such voxel-based computations lead the way to developing diagnostic and dosimetry calculations which can utilize patient-specific diagnostic images. However, such individualized approaches lack fast, automatic segmentation schemes for routine use; therefore, the high resolution, typical head geometry gives the most realistic patient model currently available.

  7. Improved design for high resolution electrospray ionization ion mobility spectrometry.

    Science.gov (United States)

    Jafari, M T

    2009-03-15

    An improved design for high resolution electrospray ionization ion mobility spectrometry (ESI-IMS) was developed by making some salient modifications to the IMS cell and its performance was investigated. To enhance desolvation of electrospray droplets at high sample flow rates in this new design, volume of the desolvation region was decreased by reducing its diameter and the entrance position of the desolvation gas was shifted to the end of the desolvation region (near the ion gate). In addition, the ESI source (both needle and counter electrode) was positioned outside of the heating oven of the IMS. This modification made it possible to use the instrument at higher temperatures, and preventing needle clogging in the electrospray process. The ion mobility spectra of different chemical compounds were obtained. The resolving power and resolution of the instrument were increased by about 15-30% relative to previous design. In this work, the baseline separation of the two adjacent ion peaks of morphine and those of codeine was achieved for the first time with resolutions of 1.5 and 1.3, respectively. These four ion peaks were well separated from each other using carbon dioxide (CO(2)) rather than nitrogen as the drift gas. Finally, the analytical parameters obtained for ethion, metalaxyl, and tributylamine indicated the high performance of the instrument for quantitative analysis.

  8. Climatologies at high resolution for the earth's land surface areas

    Science.gov (United States)

    Karger, Dirk Nikolaus; Conrad, Olaf; Böhner, Jürgen; Kawohl, Tobias; Kreft, Holger; Soria-Auza, Rodrigo Wilber; Zimmermann, Niklaus E.; Linder, H. Peter; Kessler, Michael

    2017-09-01

    High-resolution information on climatic conditions is essential to many applications in environmental and ecological sciences. Here we present the CHELSA (Climatologies at high resolution for the earth's land surface areas) data of downscaled model output temperature and precipitation estimates of the ERA-Interim climatic reanalysis to a high resolution of 30 arc sec. The temperature algorithm is based on statistical downscaling of atmospheric temperatures. The precipitation algorithm incorporates orographic predictors including wind fields, valley exposition, and boundary layer height, with a subsequent bias correction. The resulting data consist of a monthly temperature and precipitation climatology for the years 1979-2013. We compare the data derived from the CHELSA algorithm with other standard gridded products and station data from the Global Historical Climate Network. We compare the performance of the new climatologies in species distribution modelling and show that we can increase the accuracy of species range predictions. We further show that CHELSA climatological data has a similar accuracy as other products for temperature, but that its predictions of precipitation patterns are better.

  9. The Impact of Horizontal and Temporal Resolution on Convection and Precipitation with High-Resolution GEOS-5

    Science.gov (United States)

    Putman, William P.

    2012-01-01

    Using a high-resolution non-hydrostatic version of GEOS-5 with the cubed-sphere finite-volume dynamical core, the impact of spatial and temporal resolution on cloud properties will be evaluated. There are indications from examining convective cluster development in high resolution GEOS-5 forecasts that the temporal resolution within the model may playas significant a role as horizontal resolution. Comparing modeled convective cloud clusters versus satellite observations of brightness temperature, we have found that improved. temporal resolution in GEOS-S accounts for a significant portion of the improvements in the statistical distribution of convective cloud clusters. Using satellite simulators in GEOS-S we will compare the cloud optical properties of GEOS-S at various spatial and temporal resolutions with those observed from MODIS. The potential impact of these results on tropical cyclone formation and intensity will be examined as well.

  10. High Spectral Resolution, High Cadence, Imaging X-ray Microcalorimeters for Solar Physics - Phase 2 Project

    Data.gov (United States)

    National Aeronautics and Space Administration — Microcalorimeter x-ray instruments are non-dispersive, high spectral resolution, broad-band, high cadence imaging spectrometers. We have been developing these...

  11. High resolution modeling of a small urban catchment

    Science.gov (United States)

    Skouri-Plakali, Ilektra; Ichiba, Abdellah; Gires, Auguste; Tchiguirinskaia, Ioulia; Schertzer, Daniel

    2016-04-01

    Flooding is one of the most complex issues that urban environments have to deal with. In France, flooding remains the first natural risk with 72% of decrees state of natural disaster issued between October 1982 and mid-November 2014. Flooding is a result of meteorological extremes that are usually aggravated by the hydrological behavior of urban catchments and human factors. The continuing urbanization process is indeed changing the whole urban water cycle by limiting the infiltration and promoting runoff. Urban environments are very complex systems due to their extreme variability, the interference between human activities and natural processes but also the effect of the ongoing urbanization process that changes the landscape and hardly influences their hydrologic behavior. Moreover, many recent works highlight the need to simulate all urban water processes at their specific temporal and spatial scales. However, considering urban catchments heterogeneity still challenging for urban hydrology, even after advances noticed in term of high-resolution data collection and computational resources. This issue is more to be related to the architecture of urban models being used and how far these models are ready to take into account the extreme variability of urban catchments. In this work, high spatio-temporal resolution modeling is performed for a small and well-equipped urban catchment. The aim of this work is to identify urban modeling needs in terms of spatial and temporal resolution especially for a very small urban area (3.7 ha urban catchment located in the Perreux-sur-Marne city at the southeast of Paris) MultiHydro model was selected to carry out this work, it is a physical based and fully distributed model that interacts four existing modules each of them representing a portion of the water cycle in urban environments. MultiHydro was implemented at 10m, 5m and 2m resolution. Simulations were performed at different spatio-temporal resolutions and analyzed with

  12. High resolution OCT image generation using super resolution via sparse representation

    Science.gov (United States)

    Asif, Muhammad; Akram, Muhammad Usman; Hassan, Taimur; Shaukat, Arslan; Waqar, Razi

    2017-02-01

    In this paper we propose a technique for obtaining a high resolution (HR) image from a single low resolution (LR) image -using joint learning dictionary - on the basis of image statistic research. It suggests that with an appropriate choice of an over-complete dictionary, image patches can be well represented as a sparse linear combination. Medical imaging for clinical analysis and medical intervention is being used for creating visual representations of the interior of a body, as well as visual representation of the function of some organs or tissues (physiology). A number of medical imaging techniques are in use like MRI, CT scan, X-rays and Optical Coherence Tomography (OCT). OCT is one of the new technologies in medical imaging and one of its uses is in ophthalmology where it is being used for analysis of the choroidal thickness in the eyes in healthy and disease states such as age-related macular degeneration, central serous chorioretinopathy, diabetic retinopathy and inherited retinal dystrophies. We have proposed a technique for enhancing the OCT images which can be used for clearly identifying and analyzing the particular diseases. Our method uses dictionary learning technique for generating a high resolution image from a single input LR image. We train two joint dictionaries, one with OCT images and the second with multiple different natural images, and compare the results with previous SR technique. Proposed method for both dictionaries produces HR images which are comparatively superior in quality with the other proposed method of SR. Proposed technique is very effective for noisy OCT images and produces up-sampled and enhanced OCT images.

  13. Gold rotor bead tracking for high-speed measurements of DNA twist, torque and extension.

    Science.gov (United States)

    Lebel, Paul; Basu, Aakash; Oberstrass, Florian C; Tretter, Elsa M; Bryant, Zev

    2014-04-01

    Single-molecule measurements of DNA twist and extension have been used to reveal physical properties of the double helix and to characterize structural dynamics and mechanochemistry in nucleoprotein complexes. However, the spatiotemporal resolution of twist measurements has been limited by the use of angular probes with high rotational drag, which prevents detection of short-lived intermediates or small angular steps. We introduce gold rotor bead tracking (AuRBT), which yields >100× improvement in time resolution over previous techniques. AuRBT employs gold nanoparticles as bright low-drag rotational and extensional probes, which are monitored by instrumentation that combines magnetic tweezers with objective-side evanescent darkfield microscopy. Our analysis of high-speed structural dynamics of DNA gyrase using AuRBT revealed an unanticipated transient intermediate. AuRBT also enables direct measurements of DNA torque with >50× shorter integration times than previous techniques; we demonstrated high-resolution torque spectroscopy by mapping the conformational landscape of a Z-forming DNA sequence.

  14. Rapid identification of HBB gene mutations by high-resolution melting analysis.

    Science.gov (United States)

    Shih, Hung-Chang; Er, Tze-Kiong; Chang, Tien-Jye; Chang, Ya-Sian; Liu, Ta-Chih; Chang, Jan-Gowth

    2009-11-01

    This study was undertaken to identify HBB gene mutation. Herein we evaluated high-resolution melting analysis in the identification of HBB mutations. We have successfully established a diagnostic strategy for identifying HBB gene mutations including c.-78A>G, c.-79A>G, c.2T>G, c.79_80insT, c.84_85insC, c.123_124insT, c.125_128delTCTT, c.130 G>T, c.170G>A, c.216_217ins A and c.316-197 C>T from wild-type DNA using HRM analysis. The results of HRM analysis were confirmed by direct DNA sequencing. In summary, we report that HRM analysis is an appealing technique for the identification of HBB mutations. We also believe that HRM can be used as a method for prenatal diagnosis of beta-thalassemia.

  15. High spatial resolution diffusion tensor imaging and its applications

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Jiun-Jie

    2002-07-01

    Introduction Magnetic Resonance Imaging is at present the only imaging technique available to measure diffusion of water and metabolites in humans. It provides vital insights to brain connectivity and has proved to be an important tool in diagnosis and therapy planning in many neurological diseases such as brain tumour, ischaemia and multiple sclerosis. This project focuses on the development of a high resolution diffusion tensor imaging technique. In this thesis, the basic theory of diffusion tensor MR Imaging is presented. The technical challenges encountered during development of these techniques will be discussed, with proposed solutions. New sequences with high spatial resolution have been developed and the results are compared with the standard technique more commonly used. Overview The project aims at the development of diffusion tensor imaging techniques with a high spatial resolution. Chapter 2 will describe the basic physics of MRI, the phenomenon of diffusion and the measurement of diffusion by MRI. The basic parameters used all through the projects will be presented. In Chapter 3, a reproducibility study on DTI with the single shot EPI sequence will be conducted. The single shot DT-EPI was carried out on a stroke patient. In Chapter 4, current techniques on high spatial resolution DTI will be explored. Sequences of Interleaved EPI of two segments and EPI with Half Fourier acquisition will be developed. The sources of artefacts which contaminate most DT images will be discussed with solution proposed. Chapter 5 proposed a new selective averaging algorithm for the data acquired by the sequences of interleaved EPI. It does not require cardiac gating during data acquisition period and thus increase the speed of data collection. A new ghost free segmented EPI sequence will be presented in Chapter 6: Half-FOV EPI. The technique will be tested on a phantom in vitro as well as in two normal male volunteers in vivo. A comparison study on diffusion tensor imaging

  16. Large-Scale Monitoring of Plants through Environmental DNA Metabarcoding of Soil: Recovery, Resolution, and Annotation of Four DNA Markers

    National Research Council Canada - National Science Library

    Fahner, Nicole A; Shokralla, Shadi; Baird, Donald J; Hajibabaei, Mehrdad

    2016-01-01

    .... Ecological monitoring often uses plant community composition to infer quality of sites but conventional aboveground surveys only capture a snapshot of the actively growing plant diversity. Environmental DNA (eDNA...

  17. High-resolution multimodal clinical multiphoton tomography of skin

    Science.gov (United States)

    König, Karsten

    2011-03-01

    This review focuses on multimodal multiphoton tomography based on near infrared femtosecond lasers. Clinical multiphoton tomographs for 3D high-resolution in vivo imaging have been placed into the market several years ago. The second generation of this Prism-Award winning High-Tech skin imaging tool (MPTflex) was introduced in 2010. The same year, the world's first clinical CARS studies have been performed with a hybrid multimodal multiphoton tomograph. In particular, non-fluorescent lipids and water as well as mitochondrial fluorescent NAD(P)H, fluorescent elastin, keratin, and melanin as well as SHG-active collagen has been imaged with submicron resolution in patients suffering from psoriasis. Further multimodal approaches include the combination of multiphoton tomographs with low-resolution wide-field systems such as ultrasound, optoacoustical, OCT, and dermoscopy systems. Multiphoton tomographs are currently employed in Australia, Japan, the US, and in several European countries for early diagnosis of skin cancer, optimization of treatment strategies, and cosmetic research including long-term testing of sunscreen nanoparticles as well as anti-aging products.

  18. Radiation length imaging with high-resolution telescopes

    Science.gov (United States)

    Stolzenberg, U.; Frey, A.; Schwenker, B.; Wieduwilt, P.; Marinas, C.; Lütticke, F.

    2017-02-01

    The construction of low mass vertex detectors with a high level of system integration is of great interest for next generation collider experiments. Radiation length images with a sufficient spatial resolution can be used to measure and disentangle complex radiation length X/X0 profiles and contribute to the understanding of vertex detector systems. Test beam experiments with multi GeV particle beams and high-resolution tracking telescopes provide an opportunity to obtain precise 2D images of the radiation length of thin planar objects. At the heart of the X/X0 imaging is a spatially resolved measurement of the scattering angles of particles traversing the object under study. The main challenges are the alignment of the reference telescope and the calibration of its angular resolution. In order to demonstrate the capabilities of X/X0 imaging, a test beam experiment has been conducted. The devices under test were two mechanical prototype modules of the Belle II vertex detector. A data sample of 100 million tracks at 4 GeV has been collected, which is sufficient to resolve complex material profiles on the 30 μm scale.

  19. Hyperresolution: an hyperspectral and high resolution imager for Earth observation

    Science.gov (United States)

    De Vidi, R.; Chiarantini, L.; Bini, A.

    2017-11-01

    Hyperspectral space imagery is an emerging technology that supports many scientific, civil, security and defence operational applications. The main advantage of this remote sensing technique is that it allows the so-called Feature Extraction: in fact the spectral signature allows the recognition of the materials composing the scene. Hyperspectral Products and their applications have been investigated in the past years by Galileo Avionica to direct the instrument characteristics design. Sample products have been identified in the civil / environment monitoring fields (such as coastal monitoring, vegetation, hot spot and urban classification) and in defense / security applications: their performances have been verified by means of airborne flight campaigns. The Hyperspectral and High Resolution Imager is a space-borne instrument that implement a pushbroom technique to get strip spectral images over the Hyperspectral VNIR and SWIR bands, with a ground sample distance at nadir of 20m in a 20 km wide ground swath, with 200 spectral channels, realizing an average spectral resolution of 10nm. The High Resolution Panchromatic Channel insists in the same swath to allow for multiresolution data fusion of hyperspectral imagery.

  20. 3D detectors with high space and time resolution

    Science.gov (United States)

    Loi, A.

    2018-01-01

    For future high luminosity LHC experiments it will be important to develop new detector systems with increased space and time resolution and also better radiation hardness in order to operate in high luminosity environment. A possible technology which could give such performances is 3D silicon detectors. This work explores the possibility of a pixel geometry by designing and simulating different solutions, using Sentaurus Tecnology Computer Aided Design (TCAD) as design and simulation tool, and analysing their performances. A key factor during the selection was the generated electric field and the carrier velocity inside the active area of the pixel.

  1. High resolution study of magnetic ordering at absolute zero.

    Science.gov (United States)

    Lee, M; Husmann, A; Rosenbaum, T F; Aeppli, G

    2004-05-07

    High resolution pressure measurements in the zero-temperature limit provide a unique opportunity to study the behavior of strongly interacting, itinerant electrons with coupled spin and charge degrees of freedom. Approaching the precision that has become the hallmark of experiments on classical critical phenomena, we characterize the quantum critical behavior of the model, elemental antiferromagnet chromium, lightly doped with vanadium. We resolve the sharp doubling of the Hall coefficient at the quantum critical point and trace the dominating effects of quantum fluctuations up to surprisingly high temperatures.

  2. High Resolution-Resonance Ionization Spectroscopy on uranium

    Energy Technology Data Exchange (ETDEWEB)

    Hakimi, Amin, E-mail: hakimi@uni-mainz.de; Fischbach, Thomas [Johannes Gutenberg-Universitaet Mainz, Institut fuer Physik (Germany); Raeder, Sebastian [TRIUMF (Canada); Trautmann, Norbert [Johannes Gutenberg-Universitaet Mainz, Institut fuer Kernchemie (Germany); Wendt, Klaus [Johannes Gutenberg-Universitaet Mainz, Institut fuer Physik (Germany)

    2013-04-15

    High Resolution-Resonance Ionization Spectroscopy (HR-RIS) allows for sensitive probing of atomic structures and energy level schemes even for highly complex systems. This work explores the applicability of commercial diode lasers for isotope selective spectroscopy of uranium. Using narrow bandwidth continuous-wave (cw) diode lasers, multi step excitation processes were investigated involving levels which could be populated with the radiation of 405 nm BluRay{sup Copyright-Sign} laser diodes as a first step for ultra trace analysis of uranium.

  3. High performance DNA separation media using synergistic radiation grafting

    Energy Technology Data Exchange (ETDEWEB)

    Mueller-Schulte, Detlef E-mail: detlef.mueller2@post.rwth-aachen.de; Hodenius, Michel

    2002-03-01

    Simultaneous radiation grafting technique was carried out using 2-diethylaminoethyl methacrylate as monomer to introduce positively charged groups into polyethylene and polyamide microcarriers. Special selection of diverse solvents and comonomers like N-vinylpyrrolidone, 2-hydroxyethyl methacrylate leads to high grafting yields. The functionality of the cationic carriers were examined with regard to their DNA binding properties using a high molecular weight phage {lambda} DNA. Comparative examinations with commercial DNA and cationic separation gels revealed an up to 50% higher DNA binding capacity of the grafted carriers.

  4. Microcalorimetry for High-Resolution X-Ray Spectroscopy

    Energy Technology Data Exchange (ETDEWEB)

    Friedrich, Stephen [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)

    2017-01-03

    Magnetic Microcalorimeters (MMCs) are gamma-ray detectors with an energy resolution 10x higher than high-purity germanium detectors. They can increase the accuracy of non-destructive analysis of nuclear materials, enable the detection of new isotopes (e.g. Pu-242 of U-236), and improve nuclear data in cases where Ge detectors are limited by line overlap. MMCs consist of a magnetic sensor operated at temperatures below 50 mK, and they infer gamma-ray energies from the change in magnetization due to the temperature increase after gamma-ray absorption. The goal of this project is to further increase the energy resolution and sensitivity of MMC gamma detectors.

  5. High-Resolution Characterization of UMo Alloy Microstructure

    Energy Technology Data Exchange (ETDEWEB)

    Devaraj, Arun [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Kovarik, Libor [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Joshi, Vineet V. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Jana, Saumyadeep [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Manandhar, Sandeep [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Arey, Bruce W. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Lavender, Curt A. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States)

    2016-11-30

    This report highlights the capabilities and procedure for high-resolution characterization of UMo fuels in PNNL. Uranium-molybdenum (UMo) fuel processing steps, from casting to forming final fuel, directly affect the microstructure of the fuel, which in turn dictates the in-reactor performance of the fuel under irradiation. In order to understand the influence of processing on UMo microstructure, microstructure characterization techniques are necessary. Higher-resolution characterization techniques like transmission electron microscopy (TEM) and atom probe tomography (APT) are needed to interrogate the details of the microstructure. The findings from TEM and APT are also directly beneficial for developing predictive multiscale modeling tools that can predict the microstructure as a function of process parameters. This report provides background on focused-ion-beam–based TEM and APT sample preparation, TEM and APT analysis procedures, and the unique information achievable through such advanced characterization capabilities for UMo fuels, from a fuel fabrication capability viewpoint.

  6. High resolution capacitance detection circuit for rotor micro-gyroscope

    Directory of Open Access Journals (Sweden)

    Ming-Yuan Ren

    2014-03-01

    Full Text Available Conventional methods for rotor position detection of micro-gyroscopes include common exciting electrodes (single frequency and common sensing electrodes (frequency multiplex, but they have encountered some problems. So we present a high resolution and low noise pick-off circuit for micro-gyroscopes which utilizes the time multiplex method. The detecting circuit adopts a continuous-time current sensing circuit for capacitance measurement, and its noise analysis of the charge amplifier is introduced. The equivalent output noise power spectral density of phase-sensitive demodulation is 120 nV/Hz1/2. Tests revealed that the whole circuitry has a relative capacitance resolution of 1 × 10−8.

  7. DMD based digital speckle illumination for high resolution imaging

    Science.gov (United States)

    Shinde, Anant; Mishra, Ayush; Perinchery, Sandeep M.; Murukeshan, V. M.

    2017-06-01

    Spatially non-uniform illumination patterns have shown significant potential to improve the imaging. Recent developments in the patterned illumination microscopy have demonstrated that the use of an optical speckle as an illumination pattern significantly improves the imaging resolution at the same time reducing the computational overheads. We present a DMD based method for generation of digital speckle pattern. The generated digital speckle and uniform white light illumination are used as two illuminations to acquire images. The image reconstruction algorithm for blind structured illumination microscopy is used to get the high resolution image. Our approach does not require any calibration step or stringent control of the illumination, and dramatically simplifies the experimental set-up.

  8. High spatial resolution soft-x-ray microscopy

    Energy Technology Data Exchange (ETDEWEB)

    Meyer-Ilse, W.; Medecki, H.; Brown, J.T. [Ernest Orlando Lawrence Berkeley National Lab., CA (United States)] [and others

    1997-04-01

    A new soft x-ray microscope (XM-1) with high spatial resolution has been constructed by the Center for X-ray Optics. It uses bending magnet radiation from beamline 6.1 at the Advanced Light Source, and is used in a variety of projects and applications in the life and physical sciences. Most of these projects are ongoing. The instrument uses zone plate lenses and achieves a resolution of 43 nm, measured over 10% to 90% intensity with a knife edge test sample. X-ray microscopy permits the imaging of relatively thick samples, up to 10 {mu}m thick, in water. XM-1 has an easy to use interface, that utilizes visible light microscopy to precisely position and focus the specimen. The authors describe applications of this device in the biological sciences, as well as in studying industrial applications including structured polymer samples.

  9. A compact high-resolution X-ray powder diffractometer.

    Science.gov (United States)

    Fewster, Paul F; Trout, David R D

    2013-12-01

    A new powder diffractometer operating in transmission mode is described. It can work as a rapid very compact instrument or as a high-resolution instrument, and the sample preparation is simplified. The incident beam optics create pure Cu K α 1 radiation, giving rise to peak widths of ∼0.1° in 2θ in compact form with a sample-to-detector minimum radius of 55 mm, reducing to peak widths of advantage of this geometry is that the resolution of the diffractometer can be calculated precisely and the instrumental artefacts can be analysed easily without a sample present. The performance is demonstrated with LaB 6 and paracetamol, and a critical appraisal of the uncertainties in the measurements is presented. The instantaneous data collection offers possibilities in dynamic experiments.

  10. High resolution ultrasound and photoacoustic imaging of single cells

    Directory of Open Access Journals (Sweden)

    Eric M. Strohm

    2016-03-01

    Full Text Available High resolution ultrasound and photoacoustic images of stained neutrophils, lymphocytes and monocytes from a blood smear were acquired using a combined acoustic/photoacoustic microscope. Photoacoustic images were created using a pulsed 532 nm laser that was coupled to a single mode fiber to produce output wavelengths from 532 nm to 620 nm via stimulated Raman scattering. The excitation wavelength was selected using optical filters and focused onto the sample using a 20× objective. A 1000 MHz transducer was co-aligned with the laser spot and used for ultrasound and photoacoustic images, enabling micrometer resolution with both modalities. The different cell types could be easily identified due to variations in contrast within the acoustic and photoacoustic images. This technique provides a new way of probing leukocyte structure with potential applications towards detecting cellular abnormalities and diseased cells at the single cell level.

  11. Enhanced beetle luciferase for high-resolution bioluminescence imaging.

    Directory of Open Access Journals (Sweden)

    Yoshihiro Nakajima

    Full Text Available We developed an enhanced green-emitting luciferase (ELuc to be used as a bioluminescence imaging (BLI probe. ELuc exhibits a light signal in mammalian cells that is over 10-fold stronger than that of the firefly luciferase (FLuc, which is the most widely used luciferase reporter gene. We showed that ELuc produces a strong light signal in primary cells and tissues and that it enables the visualization of gene expression with high temporal resolution at the single-cell level. Moreover, we successfully imaged the nucleocytoplasmic shuttling of importin alpha by fusing ELuc at the intracellular level. These results demonstrate that the use of ELuc allows a BLI spatiotemporal resolution far greater than that provided by FLuc.

  12. Realization of matching conditions for high-resolution spectrometers

    CERN Document Server

    Fujita, H; Berg, G P A; Bacher, A D; Foster, C C; Hara, K; Hatanaka, K; Kawabata, T; Noro, T; Sakaguchi, H; Shimbara, Y; Shinada, T; Stephenson, E J; Ueno, H; Yosoi, M

    2002-01-01

    For precise measurements of nuclear-reaction spectra using a beam from an accelerator, a high-resolution magnetic spectrometer is a powerful tool. The full capability of a magnetic spectrometer, however, can be achieved only if the characteristics of the beam coming from the accelerator are matched to those required by the spectrometer by properly adjusting the beam line conditions. The matching methods, lateral dispersion matching, focus matching and also the kinematic correction compensate the spectrum line-broadening effects caused by the beam momentum spread and reaction kinematics. In addition, angular dispersion matching should be performed if good resolution of the scattering angle is important. Diagnostic methods developed to realize these matching conditions for the spectrometers K600 at IUCF and Grand Raiden at RCNP are presented.

  13. High-resolution mapping of motor vehicle carbon dioxide emissions

    Science.gov (United States)

    McDonald, Brian C.; McBride, Zoe C.; Martin, Elliot W.; Harley, Robert A.

    2014-05-01

    A fuel-based inventory for vehicle emissions is presented for carbon dioxide (CO2) and mapped at various spatial resolutions (10 km, 4 km, 1 km, and 500 m) using fuel sales and traffic count data. The mapping is done separately for gasoline-powered vehicles and heavy-duty diesel trucks. Emission estimates from this study are compared with the Emissions Database for Global Atmospheric Research (EDGAR) and VULCAN. All three inventories agree at the national level within 5%. EDGAR uses road density as a surrogate to apportion vehicle emissions, which leads to 20-80% overestimates of on-road CO2 emissions in the largest U.S. cities. High-resolution emission maps are presented for Los Angeles, New York City, San Francisco-San Jose, Houston, and Dallas-Fort Worth. Sharp emission gradients that exist near major highways are not apparent when emissions are mapped at 10 km resolution. High CO2 emission fluxes over highways become apparent at grid resolutions of 1 km and finer. Temporal variations in vehicle emissions are characterized using extensive day- and time-specific traffic count data and are described over diurnal, day of week, and seasonal time scales. Clear differences are observed when comparing light- and heavy-duty vehicle traffic patterns and comparing urban and rural areas. Decadal emission trends were analyzed from 2000 to 2007 when traffic volumes were increasing and a more recent period (2007-2010) when traffic volumes declined due to recession. We found large nonuniform changes in on-road CO2 emissions over a period of 5 years, highlighting the importance of timely updates to motor vehicle emission inventories.

  14. High Range Resolution Profile Construction Exploiting Modified Fractional Fourier Transformation

    Directory of Open Access Journals (Sweden)

    Feng Wang

    2015-01-01

    Full Text Available This paper addresses the discrimination of closely spaced high speed group targets with radar transmitting linear frequency modulation (LFM pulses. The high speed target motion leads to range migration and target dispersion and thereby the discriminating capability of the high range resolution profile (HRRP deteriorating significantly. An effective processing approach composed of stretch processing (SP, modified fractional Fourier transform (FrFT, and multiple signal classification (MUSIC algorithm is proposed to deal with this problem. Firstly, SP is adopted to transform the received LFM with Doppler distortions into narrow band LFM signals. Secondly, based on the two-dimensional range/velocity plane constructed by the modified FrFT, the velocity of the high speed group target is estimated and compensated with just one single pulse. After the compensation of range migration and target dispersion simultaneously, the resolution of the HRRP achieved by single pulse transmission improves significantly in the high speed group targets scenarios. Finally, MUSIC algorithm with superresolution capability is utilized to make a more explicit discrimination between the scatterers in comparison with the conventional SP method. Simulation results show the effectiveness of the proposed scheme.

  15. Quadruplex MAPH: improvement of throughput in high-resolution copy number screening

    Directory of Open Access Journals (Sweden)

    Walker Susan

    2009-09-01

    Full Text Available Abstract Background Copy number variation (CNV in the human genome is recognised as a widespread and important source of human genetic variation. Now the challenge is to screen for these CNVs at high resolution in a reliable, accurate and cost-effective way. Results Multiplex Amplifiable Probe Hybridisation (MAPH is a sensitive, high-resolution technology appropriate for screening for CNVs in a defined region, for a targeted population. We have developed MAPH to a highly multiplexed format ("QuadMAPH" that allows the user a four-fold increase in the number of loci tested simultaneously. We have used this method to analyse a genomic region of 210 kb, including the MSH2 gene and 120 kb of flanking DNA. We show that the QuadMAPH probes report copy number with equivalent accuracy to simplex MAPH, reliably demonstrating diploid copy number in control samples and accurately detecting deletions in Hereditary Non-Polyposis Colorectal Cancer (HNPCC samples. Conclusion QuadMAPH is an accurate, high-resolution method that allows targeted screening of large numbers of subjects without the expense of genome-wide approaches. Whilst we have applied this technique to a region of the human genome, it is equally applicable to the genomes of other organisms.

  16. Multiplex APLP System for High-Resolution Haplogrouping of Extremely Degraded East-Asian Mitochondrial DNAs.

    Directory of Open Access Journals (Sweden)

    Tsuneo Kakuda

    Full Text Available Mitochondrial DNA (mtDNA serves as a powerful tool for exploring matrilineal phylogeographic ancestry, as well as for analyzing highly degraded samples, because of its polymorphic nature and high copy numbers per cell. The recent advent of complete mitochondrial genome sequencing has led to improved techniques for phylogenetic analyses based on mtDNA, and many multiplex genotyping methods have been developed for the hierarchical analysis of phylogenetically important mutations. However, few high-resolution multiplex genotyping systems for analyzing East-Asian mtDNA can be applied to extremely degraded samples. Here, we present a multiplex system for analyzing mitochondrial single nucleotide polymorphisms (mtSNPs, which relies on a novel amplified product-length polymorphisms (APLP method that uses inosine-flapped primers and is specifically designed for the detailed haplogrouping of extremely degraded East-Asian mtDNAs. We used fourteen 6-plex polymerase chain reactions (PCRs and subsequent electrophoresis to examine 81 haplogroup-defining SNPs and 3 insertion/deletion sites, and we were able to securely assign the studied mtDNAs to relevant haplogroups. Our system requires only 1×10-13 g (100 fg of crude DNA to obtain a full profile. Owing to its small amplicon size (<110 bp, this new APLP system was successfully applied to extremely degraded samples for which direct sequencing of hypervariable segments using mini-primer sets was unsuccessful, and proved to be more robust than conventional APLP analysis. Thus, our new APLP system is effective for retrieving reliable data from extremely degraded East-Asian mtDNAs.

  17. Performance evaluation of a high resolution dedicated breast PET scanner

    Energy Technology Data Exchange (ETDEWEB)

    García Hernández, Trinitat, E-mail: mtrinitat@eresa.com; Vicedo González, Aurora; Brualla González, Luis; Granero Cabañero, Domingo [Department of Medical Physics, ERESA, Hospital General Universitario, Valencia 46014 (Spain); Ferrer Rebolleda, Jose; Sánchez Jurado, Raúl; Puig Cozar Santiago, Maria del [Department of Nuclear Medicine, ERESA, Hospital General Universitario, Valencia 46014 (Spain); Roselló Ferrando, Joan [Department of Medical Physics, ERESA, Hospital General Universitario, Valencia 46014 (Spain); Department of Physiology, University of Valencia, Valencia 46010 (Spain)

    2016-05-15

    Purpose: Early stage breast cancers may not be visible on a whole-body PET scan. To overcome whole-body PET limitations, several dedicated breast positron emission tomography (DbPET) systems have emerged nowadays aiming to improve spatial resolution. In this work the authors evaluate the performance of a high resolution dedicated breast PET scanner (Mammi-PET, Oncovision). Methods: Global status, uniformity, sensitivity, energy, and spatial resolution were measured. Spheres of different sizes (2.5, 4, 5, and 6 mm diameter) and various 18 fluorodeoxyglucose ({sup 18}F-FDG) activity concentrations were randomly inserted in a gelatine breast phantom developed at our institution. Several lesion-to-background ratios (LBR) were simulated, 5:1, 10:1, 20:1, 30:1, and 50:1. Images were reconstructed using different voxel sizes. The ability of experienced reporters to detect spheres was tested as a function of acquisition time, LBR, sphere size, and matrix reconstruction voxel size. For comparison, phantoms were scanned in the DbPET camera and in a whole body PET (WB-PET). Two patients who just underwent WB-PET/CT exams were imaged with the DbPET system and the images were compared. Results: The measured absolute peak sensitivity was 2.0%. The energy resolution was 24.0% ± 1%. The integral and differential uniformity were 10% and 6% in the total field of view (FOV) and 9% and 5% in the central FOV, respectively. The measured spatial resolution was 2.0, 1.9, and 1.7 mm in the radial, tangential, and axial directions. The system exhibited very good detectability for spheres ≥4 mm and LBR ≥10 with a sphere detection of 100% when acquisition time was set >3 min/bed. For LBR = 5 and acquisition time of 7 min the detectability was 100% for spheres of 6 mm and 75% for spheres of 5, 4, and 2.5 mm. Lesion WB-PET detectability was only comparable to the DbPET camera for lesion sizes ≥5 mm when acquisition time was >3 min and LBR > 10. Conclusions: The DbPET has a good

  18. Convex optimization of coincidence time resolution for a high-resolution PET system.

    Science.gov (United States)

    Reynolds, Paul D; Olcott, Peter D; Pratx, Guillem; Lau, Frances W Y; Levin, Craig S

    2011-02-01

    We are developing a dual panel breast-dedicated positron emission tomography (PET) system using LSO scintillators coupled to position sensitive avalanche photodiodes (PSAPD). The charge output is amplified and read using NOVA RENA-3 ASICs. This paper shows that the coincidence timing resolution of the RENA-3 ASIC can be improved using certain list-mode calibrations. We treat the calibration problem as a convex optimization problem and use the RENA-3's analog-based timing system to correct the measured data for time dispersion effects from correlated noise, PSAPD signal delays and varying signal amplitudes. The direct solution to the optimization problem involves a matrix inversion that grows order (n(3)) with the number of parameters. An iterative method using single-coordinate descent to approximate the inversion grows order (n). The inversion does not need to run to convergence, since any gains at high iteration number will be low compared to noise amplification. The system calibration method is demonstrated with measured pulser data as well as with two LSO-PSAPD detectors in electronic coincidence. After applying the algorithm, the 511 keV photopeak paired coincidence time resolution from the LSO-PSAPD detectors under study improved by 57%, from the raw value of 16.3 ±0.07 ns full-width at half-maximum (FWHM) to 6.92 ±0.02 ns FWHM ( 11.52 ±0.05 ns to 4.89 ±0.02 ns for unpaired photons).

  19. High-Resolution Mammography Detector Employing Optical Switching Readout

    Science.gov (United States)

    Irisawa, Kaku; Kaneko, Yasuhisa; Yamane, Katsutoshi; Sendai, Tomonari; Hosoi, Yuichi

    Conceiving a new detector structure, FUJIFILM Corporation has successfully put its invention of an X-ray detector employing "Optical Switching" into practical use. Since Optical Switching Technology allows an electrode structure to be easily designed, both high resolution of pixel pitch and low electrical noise readout have been achieved, which have consequently realized the world's smallest pixel size of 50×50 μm2 from a Direct-conversion FPD system as well as high DQE. The digital mammography system equipped with this detector enables to acquire high definition images while maintaining granularity. Its outstanding feature is to be able to acquire high-precision images of microcalcifications which is an important index in breast examination.

  20. Compact high-resolution VIS/NIR hyperspectral sensor

    Science.gov (United States)

    Hyvärinen, Timo; Herrala, Esko; Procino, Wes; Weatherbee, Oliver

    2011-06-01

    Current hyperspectral imagers are either bulky with good performance, or compact with only moderate performance. This paper presents a new hyperspectral technology which overcomes this drawback, and makes it possible to integrate extremely compact and high performance push-broom hyperspectral imagers for Unmanned Aerial Vehicles (UAV) and other demanding applications. Hyperspectral imagers in VIS/NIR, SWIR, MWIR and LWIR spectral ranges have been implemented. This paper presents the measured performance attributes for a VIS/NIR imager which covers 350 to 1000 nm with spectral resolution of 3 nm. The key innovation is a new imaging spectrograph design which employs both transmissive and reflective optics in order to achieve high light throughput and large spatial image size in an extremely compact format. High light throughput is created by numerical aperture of F/2.4 and high diffraction efficiency. Image distortions are negligible, keystone being gimbals. In addition to laboratory characterization, results from a flight test mission are presented.

  1. Multilayer Patterning of High Resolution Intrinsically Stretchable Electronics

    Science.gov (United States)

    Tybrandt, Klas; Stauffer, Flurin; Vörös, Janos

    2016-05-01

    Stretchable electronics can bridge the gap between hard planar electronic circuits and the curved, soft and elastic objects of nature. This has led to applications like conformal displays, electronic skin and soft neuroprosthetics. A remaining challenge, however, is to match the dimensions of the interfaced systems, as all require feature sizes well below 100 μm. Intrinsically stretchable nanocomposites are attractive in this context as the mechanical deformations occur on the nanoscale, although methods for patterning high performance materials have been lacking. Here we address these issues by reporting on a multilayer additive patterning approach for high resolution fabrication of stretchable electronic devices. The method yields highly conductive 30 μm tracks with similar performance to their macroscopic counterparts. Further, we demonstrate a three layer micropatterned stretchable electroluminescent display with pixel sizes down to 70 μm. These presented findings pave the way towards future developments of high definition displays, electronic skins and dense multielectrode arrays.

  2. High-resolution analysis of the mechanical behavior of tissue

    Science.gov (United States)

    Hudnut, Alexa W.; Armani, Andrea M.

    2017-06-01

    The mechanical behavior and properties of biomaterials, such as tissue, have been directly and indirectly connected to numerous malignant physiological states. For example, an increase in the Young's Modulus of tissue can be indicative of cancer. Due to the heterogeneity of biomaterials, it is extremely important to perform these measurements using whole or unprocessed tissue because the tissue matrix contains important information about the intercellular interactions and the structure. Thus, developing high-resolution approaches that can accurately measure the elasticity of unprocessed tissue samples is of great interest. Unfortunately, conventional elastography methods such as atomic force microscopy, compression testing, and ultrasound elastography either require sample processing or have poor resolution. In the present work, we demonstrate the characterization of unprocessed salmon muscle using an optical polarimetric elastography system. We compare the results of compression testing within different samples of salmon skeletal muscle with different numbers of collagen membranes to characterize differences in heterogeneity. Using the intrinsic collagen membranes as markers, we determine the resolution of the system when testing biomaterials. The device reproducibly measures the stiffness of the tissues at variable strains. By analyzing the amount of energy lost by the sample during compression, collagen membranes that are 500 μm in size are detected.

  3. A high resolution, low background fast neutron spectrometer

    CERN Document Server

    Abdurashitov, J N; Kalikhov, A V; Matushko, V L; Shikhin, A A; Yants, V E; Zaborskaia, O S; Adams, J M; Nico, J S; Thompson, A K

    2002-01-01

    We discuss the possibility to create a spectrometer of full absorption based on liquid scintillator doped with enriched sup 6 Li. Of specific interest, the spectrometer will have energy resolution estimated to lie in the range 5-10% for 14 MeV neutrons. It will be sensitive to fluxes from 10 sup - sup 4 to 10 sup 6 cm sup - sup 2 s sup - sup 1 above a threshold of 1 MeV in a gamma-background of up to 10 sup 4 s sup - sup 1. The detector's efficiency will be determined by the volume of the scintillator only (approx 3 l) and is estimated to be 0.2-10%. The main reason for the poor resolution of an organic scintillator based spectrometer of full absorption is a non-linear light-yield of the scintillator for recoil protons. The neutron energy is occasionally distributed among recoil protons, and due to non-linear light-yield the total amount of light from all recoil protons ambiguously determines the initial neutron energy. The high-energy resolution will be achieved by compensation of the non-linear light-yield ...

  4. Extraction and labeling high-resolution images from PDF documents

    Science.gov (United States)

    Chachra, Suchet K.; Xue, Zhiyun; Antani, Sameer; Demner-Fushman, Dina; Thoma, George R.

    2013-12-01

    Accuracy of content-based image retrieval is affected by image resolution among other factors. Higher resolution images enable extraction of image features that more accurately represent the image content. In order to improve the relevance of search results for our biomedical image search engine, Open-I, we have developed techniques to extract and label high-resolution versions of figures from biomedical articles supplied in the PDF format. Open-I uses the open-access subset of biomedical articles from the PubMed Central repository hosted by the National Library of Medicine. Articles are available in XML and in publisher supplied PDF formats. As these PDF documents contain little or no meta-data to identify the embedded images, the task includes labeling images according to their figure number in the article after they have been successfully extracted. For this purpose we use the labeled small size images provided with the XML web version of the article. This paper describes the image extraction process and two alternative approaches to perform image labeling that measure the similarity between two images based upon the image intensity projection on the coordinate axes and similarity based upon the normalized cross-correlation between the intensities of two images. Using image identification based on image intensity projection, we were able to achieve a precision of 92.84% and a recall of 82.18% in labeling of the extracted images.

  5. High-Resolution Infrared Imaging of Young Outflow-Sources

    Science.gov (United States)

    Preibisch, Thomas; Schertl, Dieter; Weigelt, Gerd

    For a better understanding of the mechanisms by which jets and outflows from young stellar objects are generated accelerated and collimated it is essential to look as close as possible to their launching point at the disk/star boundary. High-spatial resolution is therefore of crucial importance for further progress in this field. In this contribution we present recent results from our near-infrared bispectrum speckle interferometry studies of several outflow sources. With a spatial resolution of up to 0.055'' our images have the highest spatial resolution achieved so far for these objects and exhibit previously unseen complex structures. Our results include the identification of two distinct bipolar outflow systems originating simultaneously from the protostar S140 IRS1 the detection of an episodic precessing jet from S140 IRS3 and the discovery of a micro-jet from one of the embedded sources in Mon R2 IRS3. We will also discuss the relation of the observed circumstellar structures to the jets and outflows from the young stellar objects

  6. High energy resolution with transparent ceramic garnet scintillators

    Science.gov (United States)

    Cherepy, N. J.; Seeley, Z. M.; Payne, S. A.; Beck, P. R.; Swanberg, E. L.; Hunter, S.; Ahle, L.; Fisher, S. E.; Melcher, C.; Wei, H.; Stefanik, T.; Chung, Y.-S.; Kindem, J.

    2014-09-01

    Breakthrough energy resolution, R(662keV) Gadolinium Yttrium Gallium Aluminum Garnet, or GYGAG(Ce). Transparent ceramic GYGAG(Ce), has a peak emission wavelength of 550 nm that is better matched to Silicon photodetectors than to standard PMTs. We are therefore developing a spectrometer based on pixelated GYGAG(Ce) on a Silicon photodiode array that can provide R(662 keV) = 3.6%. In comparison, with large 1-2 in3 size GYGAG(Ce) ceramics we obtain R(662 keV) = 4.6% with PMT readout. We find that ceramic GYGAG(Ce) of a given stoichiometric chemical composition can exhibit very different scintillation properties, depending on sintering conditions and post-anneal treatments. Among the characteristics of transparent ceramic garnet scintillators that can be controlled by fabrication conditions are: scintillation decay components and their amplitudes, intensity and duration of afterglow, thermoluminescence glow curve peak positions and amplitudes, integrated light yield, light yield non-proportionality - as measured in the Scintillator Light Yield Non-Proportionality Characterization Instrument (SLYNCI), and energy resolution for gamma spectroscopy. Garnet samples exhibiting a significant fraction of Cerium dopant in the tetravalent valence also exhibit: faster overall scintillation decay, very low afterglow, high light yield, but poor light yield proportionality and degraded energy resolution.

  7. CSpace high-resolution volumetric 3D display

    Science.gov (United States)

    Refai, Hakki H.; Melnik, George; Willner, Mark

    2013-05-01

    We are currently in the process of developing a static-volume 3D display, CSpace® display, that has the capability to produce images of much larger size than any other static-volume display currently under development, with up to nearly 800 million voxel resolution. A key component in achieving the size and resolution of the display is the optical system that transfers the pixel data from a standard DMD projection unit to the voxel size required by the display with high contrast and minimal distortion. The current optical system is capable of such performance for only small image sizes, and thus new designs of the optical system must be developed. We report here on the design and testing of a new optical projection system with the intent of achieving performance close to that of a telecentric lens. Theoretical analysis with Zemax allowed selection of appropriate lens size, spacing, and focal length, and identified the need for tilting the assembly to produce the desired beam properties. Experimental analysis using the CSpace® prototype showed that the improved beam parameters allowed for higher resolution and brighter images than those previously achieved, though their remains room for further improvement of the design. Heating of the DMD and its housing components were also addressed to minimize heating effects on the optical system. A combination of a thermo-electric cooler and a small fan produced sufficient cooling to stabilize the temperature of the system to acceptable levels.

  8. Cockayne syndrome group A and B proteins converge on transcription-linked resolution of non-B DNA.

    Science.gov (United States)

    Scheibye-Knudsen, Morten; Tseng, Anne; Borch Jensen, Martin; Scheibye-Alsing, Karsten; Fang, Evandro Fei; Iyama, Teruaki; Bharti, Sanjay Kumar; Marosi, Krisztina; Froetscher, Lynn; Kassahun, Henok; Eckley, David Mark; Maul, Robert W; Bastian, Paul; De, Supriyo; Ghosh, Soumita; Nilsen, Hilde; Goldberg, Ilya G; Mattson, Mark P; Wilson, David M; Brosh, Robert M; Gorospe, Myriam; Bohr, Vilhelm A

    2016-11-01

    Cockayne syndrome is a neurodegenerative accelerated aging disorder caused by mutations in the CSA or CSB genes. Although the pathogenesis of Cockayne syndrome has remained elusive, recent work implicates mitochondrial dysfunction in the disease progression. Here, we present evidence that loss of CSA or CSB in a neuroblastoma cell line converges on mitochondrial dysfunction caused by defects in ribosomal DNA transcription and activation of the DNA damage sensor poly-ADP ribose polymerase 1 (PARP1). Indeed, inhibition of ribosomal DNA transcription leads to mitochondrial dysfunction in a number of cell lines. Furthermore, machine-learning algorithms predict that diseases with defects in ribosomal DNA (rDNA) transcription have mitochondrial dysfunction, and, accordingly, this is found when factors involved in rDNA transcription are knocked down. Mechanistically, loss of CSA or CSB leads to polymerase stalling at non-B DNA in a neuroblastoma cell line, in particular at G-quadruplex structures, and recombinant CSB can melt G-quadruplex structures. Indeed, stabilization of G-quadruplex structures activates PARP1 and leads to accelerated aging in Caenorhabditis elegans In conclusion, this work supports a role for impaired ribosomal DNA transcription in Cockayne syndrome and suggests that transcription-coupled resolution of secondary structures may be a mechanism to repress spurious activation of a DNA damage response.

  9. The Suzaku High Resolution X-Ray Spectrometer

    Science.gov (United States)

    Kelley, Richard L.; Mitsuda, Kazuhisa; Allen, Christine A.; Arsenovic, Petar; Audley, Michael D.; Bialas, Thomas G.; Boyce, Kevin R.; Boyle, Robert F.; Breon, Susan R.; Brown, Gregory V.; Cottam, Jean; Dipirro, Michael J.; Fujimoto, Ryuichi; Furusho, Tae; Gendreau, Keith C.; Gochar, Gene G.; Gonzalez, Oscar; Hirabayashi, Masayuki; Holt, Stephen S.; Inoue, Hajime; Ishida, Manabu; Ishisaki, Yoshitaka; Jones, Carol S.; Keski-Kuha, Ritva; Kilbourne, Caroline A.; McCammon, Dan; Morita, Umeyo; Moseley, S. Harvey; Mott, Brent; Narasaki, Katsuhiro; Ogawara, Yoshiaki; Ohashi, Takaya; Ota, Naomi; Panek, John S.; Porter, F. Scott; Serlemitsos, Aristides; Shirron, Peter J.; Sneiderman, Gary A.; Szymkowiak, Andrew E.; Takei, Yoh; Tveekrem, June L.; Volz, Stephen M.; Yamamoto, Mikio; Yamasaki, Noriko Y.

    2007-01-01

    The X-Ray Spectrometer (XRS) has been designed to provide the Suzaku Observatory with non-dispersive, high-resolution X-ray spectroscopy. As designed, the instrument covers the energy range 0.3 to 12keV, which encompasses the most diagnostically rich part of the X-ray band. The sensor consists of a 32-channel array of X-ray microcalorimeters, each with an energy resolution of about 6eV. The very low temperature required for operation of the array (60mK) is provided by a four-stage cooling system containing a single-stage adiabatic demagnetization refrigerator, a superfluid-helium cryostat, a solid-neon dewar, and a single-stage, Stirling-cycle cooler. The Suzaku/XRS is the first orbiting X-ray microcalorimeter spectrometer and was designed to last more than three years in orbit. The early verification phase of the mission demonstrated that the instrument worked properly and that the cryogen consumption rate was low enough to ensure a mission lifetime exceeding 3 years. However, the liquid-He cryogen was completely vaporized two weeks after opening the dewar guard vacuum vent. The problem has been traced to inadequate venting of the dewar He and Ne gases out of the spacecraft and into space. In this paper we present the design and ground testing of the XRS instrument, and then describe the in-flight performance. An energy resolution of 6eV was achieved during pre-launch tests and a resolution of 7eV was obtained in orbit. The slight degradation is due to the effects of cosmic rays.

  10. High resolution solar observations from first principles to applications

    Science.gov (United States)

    Verdoni, Angelo P.

    2009-10-01

    The expression "high-resolution observations" in Solar Physics refers to the spatial, temporal and spectral domains in their entirety. High-resolution observations of solar fine structure are a necessity to answer many of the intriguing questions related to solar activity. However, a researcher building instruments for high-resolution observations has to cope with the fact that these three domains often have diametrically opposed boundary conditions. Many factors have to be considered in the design of a successful instrument. Modern post-focus instruments are more closely linked with the solar telescopes that they serve than in past. In principle, the quest for high-resolution observations already starts with the selection of the observatory site. The site survey of the Advanced Technology Solar Telescope (ATST) under the stewardship of the National Solar Observatory (NSO) has identified Big Bear Solar Observatory (BBSO) as one of the best sites for solar observations. In a first step, the seeing characteristics at BBSO based on the data collected for the ATST site survey are described. The analysis will aid in the scheduling of high-resolution observations at BBSO as well as provide useful information concerning the design and implementation of a thermal control system for the New Solar Telescope (NST). NST is an off-axis open-structure Gregorian-style telescope with a 1.6 m aperture. NST will be housed in a newly constructed 5/8-sphere ventilated dome. With optics exposed to the surrounding air, NST's open-structure design makes it particularly vulnerable to the effects of enclosure-related seeing. In an effort to mitigate these effects, the initial design of a thermal control system for the NST dome is presented. The goal is to remediate thermal related seeing effects present within the dome interior. The THermal Control System (THCS) is an essential component for the open-telescope design of NST to work. Following these tasks, a calibration routine for the

  11. Mapping Global Atmospheric CO2 Concentration at High Spatiotemporal Resolution

    Directory of Open Access Journals (Sweden)

    Yingying Jing

    2014-11-01

    Full Text Available Satellite measurements of the spatiotemporal distributions of atmospheric CO2 concentrations are a key component for better understanding global carbon cycle characteristics. Currently, several satellite instruments such as the Greenhouse gases Observing SATellite (GOSAT, SCanning Imaging Absorption Spectrometer for Atmospheric CHartographY (SCIAMACHY, and Orbiting Carbon Observatory-2 can be used to measure CO2 column-averaged dry air mole fractions. However, because of cloud effects, a single satellite can only provide limited CO2 data, resulting in significant uncertainty in the characterization of the spatiotemporal distribution of atmospheric CO2 concentrations. In this study, a new physical data fusion technique is proposed to combine the GOSAT and SCIAMACHY measurements. On the basis of the fused dataset, a gap-filling method developed by modeling the spatial correlation structures of CO2 concentrations is presented with the goal of generating global land CO2 distribution maps with high spatiotemporal resolution. The results show that, compared with the single satellite dataset (i.e., GOSAT or SCIAMACHY, the global spatial coverage of the fused dataset is significantly increased (reaching up to approximately 20%, and the temporal resolution is improved by two or three times. The spatial coverage and monthly variations of the generated global CO2 distributions are also investigated. Comparisons with ground-based Total Carbon Column Observing Network (TCCON measurements reveal that CO2 distributions based on the gap-filling method show good agreement with TCCON records despite some biases. These results demonstrate that the fused dataset as well as the gap-filling method are rather effective to generate global CO2 distribution with high accuracies and high spatiotemporal resolution.

  12. Proceedings of the workshop on high resolution computed microtomography (CMT)

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1997-02-01

    The purpose of the workshop was to determine the status of the field, to define instrumental and computational requirements, and to establish minimum specifications required by possible users. The most important message sent by implementers was the remainder that CMT is a tool. It solves a wide spectrum of scientific problems and is complementary to other microscopy techniques, with certain important advantages that the other methods do not have. High-resolution CMT can be used non-invasively and non-destructively to study a variety of hierarchical three-dimensional microstructures, which in turn control body function. X-ray computed microtomography can also be used at the frontiers of physics, in the study of granular systems, for example. With high-resolution CMT, for example, three-dimensional pore geometries and topologies of soils and rocks can be obtained readily and implemented directly in transport models. In turn, these geometries can be used to calculate fundamental physical properties, such as permeability and electrical conductivity, from first principles. Clearly, use of the high-resolution CMT technique will contribute tremendously to the advancement of current R and D technologies in the production, transport, storage, and utilization of oil and natural gas. It can also be applied to problems related to environmental pollution, particularly to spilling and seepage of hazardous chemicals into the Earth's subsurface. Applications to energy and environmental problems will be far-ranging and may soon extend to disciplines such as materials science--where the method can be used in the manufacture of porous ceramics, filament-resin composites, and microelectronics components--and to biomedicine, where it could be used to design biocompatible materials such as artificial bones, contact lenses, or medication-releasing implants. Selected papers are indexed separately for inclusion in the Energy Science and Technology Database.

  13. Measuring Large-Scale Social Networks with High Resolution

    DEFF Research Database (Denmark)

    Stopczynski, Arkadiusz; Sekara, Vedran; Sapiezynski, Piotr

    2014-01-01

    , telecommunication, social networks, location, and background information (personality, demographics, health, politics) for a densely connected population of 1 000 individuals, using state-of-the-art smartphones as social sensors. Here we provide an overview of the related work and describe the motivation...... and research agenda driving the study. Additionally, the paper details the data-types measured, and the technical infrastructure in terms of both backend and phone software, as well as an outline of the deployment procedures. We document the participant privacy procedures and their underlying principles....... The paper is concluded with early results from data analysis, illustrating the importance of multi-channel high-resolution approach to data collection....

  14. High resolution wind turbine wake measurements with a scanning lidar

    DEFF Research Database (Denmark)

    Herges, T. G.; Maniaci, D. C.; Naughton, B. T.

    2017-01-01

    High-resolution lidar wake measurements are part of an ongoing field campaign being conducted at the Scaled Wind Farm Technology facility by Sandia National Laboratories and the National Renewable Energy Laboratory using a customized scanning lidar from the Technical University of Denmark. One...... of the primary objectives is to collect experimental data to improve the predictive capability of wind plant computational models to represent the response of the turbine wake to varying inflow conditions and turbine operating states. The present work summarizes the experimental setup and illustrates several...

  15. High-resolution AMLCD for the electronic library system

    Science.gov (United States)

    Martin, Russel A.; Middo, Kathy; Turner, William D.; Lewis, Alan; Thompson, Malcolm J.; Silverstein, Louis D.

    1994-06-01

    The Electronic Library System (ELS), is a proposed data resource for the cockpit which can provide the aircrew with a vast array of technical information on their aircraft and flight plan. This information includes, but is not limited to, approach plates, Jeppeson Charts, and aircraft technical manuals. Most of these data are appropriate for digitization at high resolution (300 spi). Xerox Corporation has developed a flat panel active matrix liquid crystal display, AMLCD, that is an excellent match to the ELS, due to its innovative and aggressive design.

  16. High resolution X-ray spectroscopy in light antiprotonic atoms

    CERN Document Server

    Borchert, G L; Augsburger, M A; Castelli, C M; Chatellard, D; Egger, J P; El-Khoury, P; Elble, M; Gorke, H; Gotta, D; Hauser, P R; Indelicato, P J; Kirch, K; Lenz, S; Nelms, N; Rashid, K; Schult, O W B; Siems, T; Simons, L M

    2000-01-01

    At the LEAR facility, CERN, antiprotonic L alpha transitions in light elements have been investigated with a focussing crystal spectrometer. The high resolution of the experiment allowed for the first time to resolve in pH/pH the 2/sup 3/P/sub 0/ state from the close-lying states 2/sup 3/P/sub 2/, 2/sup 1/P/sub 1/, and 2/sup 3/P /sub 1/. In pD the corresponding transitions were found to be more than an order of magnitude broader. To a large extent the results for pH support the meson exchange model. (15 refs).

  17. Laser ablated hydantoin: A high resolution rotational study

    Science.gov (United States)

    Alonso, Elena R.; Kolesniková, Lucie; Alonso, José L.

    2017-09-01

    Laser ablation techniques coupled with broadband and narrowband Fourier transform microwave spectroscopies have allowed the high resolution rotational study of solid hydantoin, an important target in astrochemistry as a possible precursor of glycine. The complicated hyperfine structure arising from the presence of two 14N nuclei in non-equivalent positions has been resolved and interpreted in terms of the nuclear quadrupole coupling interactions. The results reported in this work provide a solid base for the interstellar searches of hydantoin in the astrophysical surveys. The values of the nuclear quadrupole coupling constants have been also discussed in terms of the electronic environment around the respective nitrogen atom.

  18. Geomorphology of Impact Features on Tethys Using High Resolution Mosaics

    Science.gov (United States)

    2017-03-01

    GEOMORPHOLOGY OF IMPACT FEATURES ON TETHYS USING HIGH NIA RESOLUTION MOSAICS. 5b. GRANT NUMBER NIA 5c. PROGRAM ELEMENT NUMBER NIA 6. AUTHOR(S) 5d...PROJECT NUMBER A.R. Rhoden, M. Nayak, E. Asphaug NIA 5e. TASK NUMBER NIA 5f. WORK UNIT NUMBER NIA T. PERFORMING ORGANIZATION NAME(S) AND ADDRESS(ES...Space Exploration, Arizona State University, Tempe, AZ 85282 NIA 9. SPONSORING/MONITORING AGENCY NAME(S) AND ADDRESS(ES) 10. SPONSOR/MONITOR’S ACRONYM

  19. High-resolution ultrasound of the extrinsic carpal ligaments☆

    Science.gov (United States)

    Orlandi, D.; Fabbro, E.; Ferrero, G.; Martini, C.; Lacelli, F.; Serafini, G.; Silvestri, E.; Sconfienza, L.M.

    2012-01-01

    Thanks to its intrinsic high spatial resolution, ultrasound is an ideal imaging modality for examining very thin, superficial structures, and this makes it very helpful in the evaluation of extrinsic carpal ligaments. These structures, which arise from the radius and ulna and insert on the carpal bones, are extremely important for wrist stability. Previous studies have assessed the use of ultrasound to study the extrinsic carpal ligaments in cadavers, healthy asymptomatic subjects, and patients with rheumatoid arthritis. In the present report, we review the normal anatomy, biomechanics, and ultrasound appearance of these ligaments. PMID:23730393

  20. High resolution projection micro stereolithography system and method

    Energy Technology Data Exchange (ETDEWEB)

    Spadaccini, Christopher M.; Farquar, George; Weisgraber, Todd; Gemberling, Steven; Fang, Nicholas; Xu, Jun; Alonso, Matthew; Lee, Howon

    2016-11-15

    A high-resolution P.mu.SL system and method incorporating one or more of the following features with a standard P.mu.SL system using a SLM projected digital image to form components in a stereolithographic bath: a far-field superlens for producing sub-diffraction-limited features, multiple spatial light modulators (SLM) to generate spatially-controlled three-dimensional interference holograms with nanoscale features, and the integration of microfluidic components into the resin bath of a P.mu.SL system to fabricate microstructures of different materials.

  1. Clickstream data yields high-resolution maps of science

    Energy Technology Data Exchange (ETDEWEB)

    Bollen, Johan [Los Alamos National Laboratory; Van De Sompel, Herbert [Los Alamos National Laboratory; Hagberg, Aric [Los Alamos National Laboratory; Bettencourt, Luis [Los Alamos National Laboratory; Chute, Ryan [Los Alamos National Laboratory; Rodriguez, Marko A [Los Alamos National Laboratory; Balakireva, Lyudmila [Los Alamos National Laboratory

    2009-01-01

    Intricate maps of science have been created from citation data to visualize the structure of scientific activity. However, most scientific publications are now accessed online. Scholarly web portals record detailed log data at a scale that exceeds the number of all existing citations combined. Such log data is recorded immediately upon publication and keeps track of the sequences of user requests (clickstreams) that are issued by a variety of users across many different domains. Given these advantagees of log datasets over citation data, we investigate whether they can produce high-resolution, more current maps of science.

  2. High-resolution seismic wave propagation using local time stepping

    KAUST Repository

    Peter, Daniel

    2017-03-13

    High-resolution seismic wave simulations often require local refinements in numerical meshes to accurately capture e.g. steep topography or complex fault geometry. Together with explicit time schemes, this dramatically reduces the global time step size for ground-motion simulations due to numerical stability conditions. To alleviate this problem, local time stepping (LTS) algorithms allow an explicit time stepping scheme to adapt the time step to the element size, allowing nearoptimal time steps everywhere in the mesh. This can potentially lead to significantly faster simulation runtimes.

  3. High-resolution overtone spectra of molecular complexes

    Science.gov (United States)

    Didriche, K.; Földes, T.

    2013-02-01

    A high-resolution spectrum of the acetylene-water complex has been recorded in the overtone range. Two bands of C2H2-D2O were analysed, corresponding to the overtone excitations of either the acetylene or the water units. The vibrational shifts and the upper states rotational constants were retrieved, demonstrating that the geometry of the complex is only slightly modified by the excitation. A larger linewidth was observed for the 2CH band than for the 2OD + DOD band, probably due to the direct coupling of the 2CH excitation with the dissociation coordinate.

  4. High resolution skin colorimetry, strain mapping and mechanobiology.

    Science.gov (United States)

    Devillers, C; Piérard-Franchimont, C; Schreder, A; Docquier, V; Piérard, G E

    2010-08-01

    Skin colours are notoriously different between individuals. They are governed by ethnicities and phototypes, and further influenced by a variety of factors including photoexposures and sustained mechanical stress. Indeed, mechanobiology is a feature affecting the epidermal melanization. High-resolution epiluminescence colorimetry helps in deciphering the effects of forces generated by Langer's lines or relaxed skin tension lines on the melanocyte activity. The same procedure shows a prominent laddering pattern of melanization in striae distensae contrasting with the regular honeycomb pattern in the surrounding skin.

  5. A System for High-Resolution Topology Optimization.

    Science.gov (United States)

    Wu, Jun; Dick, Christian; Westermann, Rudiger

    2016-03-01

    A key requirement in 3D fabrication is to generate objects with individual exterior shapes and their interior being optimized to application-specific force constraints and low material consumption. Accomplishing this task is challenging on desktop computers, due to the extreme model resolutions that are required to accurately predict the physical shape properties, requiring memory and computational capacities going beyond what is currently available. Moreover, fabrication-specific constraints need to be considered to enable printability. To address these challenges, we present a scalable system for generating 3D objects using topology optimization, which allows to efficiently evolve the topology of high-resolution solids towards printable and light-weight-high-resistance structures. To achieve this, the system is equipped with a high-performance GPU solver which can efficiently handle models comprising several millions of elements. A minimum thickness constraint is built into the optimization process to automatically enforce printability of the resulting shapes. We further shed light on the question how to incorporate geometric shape constraints, such as symmetry and pattern repetition, in the optimization process. We analyze the performance of the system and demonstrate its potential by a variety of different shapes such as interior structures within closed surfaces, exposed support structures, and surface models.

  6. Providing Internet Access to High-Resolution Mars Images

    Science.gov (United States)

    Plesea, Lucian

    2008-01-01

    The OnMars server is a computer program that provides Internet access to high-resolution Mars images, maps, and elevation data, all suitable for use in geographical information system (GIS) software for generating images, maps, and computational models of Mars. The OnMars server is an implementation of the Open Geospatial Consortium (OGC) Web Map Service (WMS) server. Unlike other Mars Internet map servers that provide Martian data using an Earth coordinate system, the OnMars WMS server supports encoding of data in Mars-specific coordinate systems. The OnMars server offers access to most of the available high-resolution Martian image and elevation data, including an 8-meter-per-pixel uncontrolled mosaic of most of the Mars Global Surveyor (MGS) Mars Observer Camera Narrow Angle (MOCNA) image collection, which is not available elsewhere. This server can generate image and map files in the tagged image file format (TIFF), Joint Photographic Experts Group (JPEG), 8- or 16-bit Portable Network Graphics (PNG), or Keyhole Markup Language (KML) format. Image control is provided by use of the OGC Style Layer Descriptor (SLD) protocol. The OnMars server also implements tiled WMS protocol and super-overlay KML for high-performance client application programs.

  7. Providing Internet Access to High-Resolution Lunar Images

    Science.gov (United States)

    Plesea, Lucian

    2008-01-01

    The OnMoon server is a computer program that provides Internet access to high-resolution Lunar images, maps, and elevation data, all suitable for use in geographical information system (GIS) software for generating images, maps, and computational models of the Moon. The OnMoon server implements the Open Geospatial Consortium (OGC) Web Map Service (WMS) server protocol and supports Moon-specific extensions. Unlike other Internet map servers that provide Lunar data using an Earth coordinate system, the OnMoon server supports encoding of data in Moon-specific coordinate systems. The OnMoon server offers access to most of the available high-resolution Lunar image and elevation data. This server can generate image and map files in the tagged image file format (TIFF) or the Joint Photographic Experts Group (JPEG), 8- or 16-bit Portable Network Graphics (PNG), or Keyhole Markup Language (KML) format. Image control is provided by use of the OGC Style Layer Descriptor (SLD) protocol. Full-precision spectral arithmetic processing is also available, by use of a custom SLD extension. This server can dynamically add shaded relief based on the Lunar elevation to any image layer. This server also implements tiled WMS protocol and super-overlay KML for high-performance client application programs.

  8. High resolution micro-pattern gas detectors for particle physics

    Science.gov (United States)

    Shekhtman, L.; Aulchenko, V.; Bobrovnikov, V.; Bondar, A.; Fedotovich, G.; Kudryavtsev, V.; Maltsev, T.; Nikolenko, D.; Rachek, I.; Zhilich, V.; Zhulanov, V.

    2017-07-01

    Micro-pattern gaseous detectors (MPGDs) allow operation at very high background particle flux with high efficiency and spatial resolution. This combination of parameters determines the main application of these detectors in particle physics experiments: precise tracking in the areas close to the beam and in the end-cap regions of general-purpose detectors. MPGDs of different configurations have been developed and are under development for several experiments in the Budker INP. The system of eight two-coordinate detectors based on a cascade of Gas Electron Multipliers (GEM) is working in the KEDR experiment at the VEPP-4M collider in the tagging system that detects electrons and positrons that lost their energy in two-photon interactions and left the equilibrium orbit due to a dedicated magnetic system. Another set of cascaded GEM detectors is developed for the almost-real Photon Tagging System (PTS) of the DEUTRON facility at the VEPP-3 storage ring. The PTS contains three very light detectors with very high spatial resolution (below 50 μm). Dedicated detectors based on cascaded GEMs are developed for the extracted electron beam facility at the VEPP-4M collider. These devices will allow precise particle tracking with minimal multiple scattering due to very low material content. An upgrade of the coordinate system of the CMD-3 detector at the VEPP-2000 collider is proposed on the basis of the resistive micro-WELL (μ-rWELL). A research activity on this subject has just started.

  9. Montecarlo simulation for a new high resolution elemental analysis methodology

    Energy Technology Data Exchange (ETDEWEB)

    Figueroa S, Rodolfo; Brusa, Daniel; Riveros, Alberto [Universidad de La Frontera, Temuco (Chile). Facultad de Ingenieria y Administracion

    1996-12-31

    Full text. Spectra generated by binary, ternary and multielement matrixes when irradiated by a variable energy photon beam are simulated by means of a Monte Carlo code. Significative jumps in the counting rate are shown when the photon energy is just over the edge associated to each element, because of the emission of characteristic X rays. For a given associated energy, the net height of these jumps depends mainly on the concentration and of the sample absorption coefficient. The spectra were obtained by a monochromatic energy scan considering all the emitted radiation by the sample in a 2{pi} solid angle, associating a single multichannel spectrometer channel to each incident energy (Multichannel Scaling (MCS) mode). The simulated spectra were made with Monte Carlo simulation software adaptation of the package called PENELOPE (Penetration and Energy Loss of Positrons and Electrons in matter). The results show that it is possible to implement a new high resolution spectroscopy methodology, where a synchrotron would be an ideal source, due to the high intensity and ability to control the energy of the incident beam. The high energy resolution would be determined by the monochromating system and not by the detection system and not by the detection system, which would basicalbe a photon counter. (author)

  10. MR-Venography Using High Resolution True-FISP

    Energy Technology Data Exchange (ETDEWEB)

    Spuentrup, E. [Technische Hochschule Aachen (Germany). Klinik fuer Radiologische Diagnostik; Beth Israel Deaconess Medical Center, Boston, MA (United States). Dept. of Medicine; Harvard Medical School, Boston, MA (United States); Buecker, A.; Guenther, R.W. [Technische Hochschule Aachen (Germany). Klinik fuer Radiologische Diagnostik; Stuber, M. [Beth Israel Deaconess Medical Center, Boston, MA (United States). Dept. of Medicine; Harvard Medical School, Boston, MA (United States); Philips Med. Syst., Best (Netherlands)

    2001-08-01

    A new fast MR-venography approach using a high resolution True-FISP imaging sequence was investigated in 20 patients suffering from 23 deep vein thromboses. Diagnosis was proven by X-ray venography, CT or ultrasound examination. The presented technique allowed for clear thrombus visualization with a high contrast to the surrounding blood pool even in calf veins. Acquisition time was less than 10 minutes for imaging the pelvis and the legs. No contrast media was needed. The presented high resolution True-FISP MR-veography is a promising non-invasive, fast MR-venography approach for detection of deep venous thrombosis. (orig.) [German] Eine neue schnelle, oertlich hochaufgeloeste MR-Phlebographietechnik mit einer axialen True-FISP Bildgebungssequenz wurde an 20 Patienten mit 23 nach-gewiesenen tiefen Beinvenenthrombosen untersucht. Die Befunde wurden mit einer konventionellen Roentgenphlebographie, einer CT oder einer Sonographie gesichert. Die vorgestellte Technik erlaubte in allen Faellen eine Thrombusdarstellung mit hohem Kontrast zum umgebenden venoesen Blut, wobei aufgrund der hohen Ortsaufloesung auch die Unterschenkelvenen beurteilt werden konnten. Die Datenaufnahmezeit zur Untersuchung des Beckens und der Beine betrug weniger als 10 Minuten. Kontrastmittel wurde nicht benoetigt. Die vorgestellte MR-Phlebographietechnik unter Verwendung einer oertlich hochauf-geloesten True-FISP Sequenz ist eine neue, vielversprechende, nicht-invasive Technik zur Diagnostik der tiefen Bein- und Beckenvenenthrombose. (orig.)

  11. Highly efficient DNA extraction method from skeletal remains

    Directory of Open Access Journals (Sweden)

    Irena Zupanič Pajnič

    2011-03-01

    Full Text Available Background: This paper precisely describes the method of DNA extraction developed to acquire high quality DNA from the Second World War skeletal remains. The same method is also used for molecular genetic identification of unknown decomposed bodies in routine forensic casework where only bones and teeth are suitable for DNA typing. We analysed 109 bones and two teeth from WWII mass graves in Slovenia. Methods: We cleaned the bones and teeth, removed surface contaminants and ground the bones into powder, using liquid nitrogen . Prior to isolating the DNA in parallel using the BioRobot EZ1 (Qiagen, the powder was decalcified for three days. The nuclear DNA of the samples were quantified by real-time PCR method. We acquired autosomal genetic profiles and Y-chromosome haplotypes of the bones and teeth with PCR amplification of microsatellites, and mtDNA haplotypes 99. For the purpose of traceability in the event of contamination, we prepared elimination data bases including genetic profiles of the nuclear and mtDNA of all persons who have been in touch with the skeletal remains in any way. Results: We extracted up to 55 ng DNA/g of the teeth, up to 100 ng DNA/g of the femurs, up to 30 ng DNA/g of the tibias and up to 0.5 ng DNA/g of the humerus. The typing of autosomal and YSTR loci was successful in all of the teeth, in 98 % dekalof the femurs, and in 75 % to 81 % of the tibias and humerus. The typing of mtDNA was successful in all of the teeth, and in 96 % to 98 % of the bones. Conclusions: We managed to obtain nuclear DNA for successful STR typing from skeletal remains that were over 60 years old . The method of DNA extraction described here has proved to be highly efficient. We obtained 0.8 to 100 ng DNA/g of teeth or bones and complete genetic profiles of autosomal DNA, Y-STR haplotypes, and mtDNA haplotypes from only 0.5g bone and teeth samples.

  12. Preliminary clinical evaluation of a high-resolution telemammography system.

    Science.gov (United States)

    Maitz, G S; Chang, T S; Sumkin, J H; Wintz, P W; Johns, C M; Ganott, M; Holbert, B L; Hakim, C M; Harris, K M; Gur, D; Herron, J M

    1997-04-01

    The authors designed, assembled, tested, and clinically evaluated a high-quality, fast, and relatively inexpensive telemammography system. The authors designed a telemammography system that uses a high-resolution film digitizer and high data compression (> or = 40:1) to send images over regular telephone lines to a high-resolution laser printer that produces images with the look and feel of the original image and can operate in a hub and spokes mode. The authors then evaluated the system's performance. In a preliminary clinical study, interpretations of the laser-printed system's output of 119 cases were compared with the original interpretations, followed by a review of any clinically significant differences. With the exception of the laser printer, which is a modified off-the-shelf product, all hardware components of the system are commercially available products. The system digitizes (50 microns pixel size), compresses, transmits, receives, decompresses, and prints a 30 MB mammography file in less than 4 minutes. In the clinical study, there were 13 differences (in 13 cases) in the level of concern or recommendations. Seven were found to be clinically insignificant by a third-party review. The remaining six were reviewed by the original interpreter, and three were determined to be significant enough for further action. All were found to result from intra-reader variability rather than differences in visualization of possible abnormalities. Almost real-time, high-quality telemammography without geographic boundaries is possible with the use of high-level data compression. Telemammography with laser-printed film as the display may make it possible to offer mammographic services in remote locations while using commercially available technology.

  13. Genotyping of single-nucleotide polymorphisms by high-resolution melting of small amplicons.

    Science.gov (United States)

    Liew, Michael; Pryor, Robert; Palais, Robert; Meadows, Cindy; Erali, Maria; Lyon, Elaine; Wittwer, Carl

    2004-07-01

    High-resolution melting of PCR amplicons with the DNA dye LCGreen I was recently introduced as a homogeneous, closed-tube method of genotyping that does not require probes or real-time PCR. We adapted this system to genotype single-nucleotide polymorphisms (SNPs) after rapid-cycle PCR (12 min) of small amplicons (SNP base changes. In addition, clinical protocols for factor V (Leiden) 1691G>A, prothrombin 20210G>A, methylenetetrahydrofolate reductase (MTHFR) 1298A>C, hemochromatosis (HFE) 187C>G, and beta-globin (hemoglobin S) 17A>T were developed. LCGreen I was included in the reaction mixture before PCR, and high-resolution melting was obtained within 2 min after amplification. In all cases, heterozygotes were easily identified because heteroduplexes altered the shape of the melting curves. Approximately 84% of human SNPs involve a base exchange between A::T and G::C base pairs, and the homozygotes are easily genotyped by melting temperatures (T(m)s) that differ by 0.8-1.4 degrees C. However, in approximately 16% of SNPs, the bases only switch strands and preserve the base pair, producing very small T(m) differences between homozygotes (G protocol, but, as predicted from the sequence changes, was not needed for the other four clinical protocols. SNP genotyping by high-resolution melting analysis is simple, rapid, and inexpensive, requiring only PCR, a DNA dye, and melting instrumentation. The method is closed-tube, performed without probes or real-time PCR, and can be completed in less than 2 min after completion of PCR.

  14. High resolution remote sensing of water surface patterns

    Science.gov (United States)

    Woodget, A.; Visser, F.; Maddock, I.; Carbonneau, P.

    2012-12-01

    The assessment of in-stream habitat availability within fluvial environments in the UK traditionally includes the mapping of patterns which appear on the surface of the water, known as 'surface flow types' (SFTs). The UK's River Habitat Survey identifies ten key SFTs, including categories such as rippled flow, upwelling, broken standing waves and smooth flow. SFTs result from the interaction between the underlying channel morphology, water depth and velocity and reflect the local flow hydraulics. It has been shown that SFTs can be both biologically and hydraulically distinct. SFT mapping is usually conducted from the river banks where estimates of spatial coverage are made by eye. This approach is affected by user subjectivity and inaccuracies in the spatial extent of mapped units. Remote sensing and specifically the recent developments in unmanned aerial systems (UAS) may now offer an alternative approach for SFT mapping, with the capability for rapid and repeatable collection of very high resolution imagery from low altitudes, under bespoke flight conditions. This PhD research is aimed at investigating the mapping of SFTs using high resolution optical imagery (less than 10cm) collected from a helicopter-based UAS flown at low altitudes (less than 100m). This paper presents the initial findings from a series of structured experiments on the River Arrow, a small lowland river in Warwickshire, UK. These experiments investigate the potential for mapping SFTs from still and video imagery of different spatial resolutions collected at different flying altitudes and from different viewing angles (i.e. vertical and oblique). Imagery is processed using 3D mosaicking software to create orthophotos and digital elevation models (DEM). The types of image analysis which are tested include a simple, manual visual assessment undertaken in a GIS environment, based on the high resolution optical imagery. In addition, an object-based image analysis approach which makes use of the

  15. Synthesis of rainfall time series in a high temporal resolution

    Science.gov (United States)

    Callau Poduje, Ana Claudia; Haberlandt, Uwe

    2014-05-01

    In order to optimize the design and operation of urban drainage systems, long and continuous rain series in a high temporal resolution are essential. As the length of the rainfall records is often short, particularly the data available with the temporal and regional resolutions required for urban hydrology, it is necessary to find some numerical representation of the precipitation phenomenon to generate long synthetic rainfall series. An Alternating Renewal Model (ARM) is applied for this purpose, which consists of two structures: external and internal. The former is the sequence of wet and dry spells, described by their durations which are simulated stochastically. The internal structure is characterized by the amount of rain corresponding to each wet spell and its distribution within the spell. A multivariate frequency analysis is applied to analyze the internal structure of the wet spells and to generate synthetic events. The stochastic time series must reproduce the statistical characteristics of observed high resolution precipitation measurements used to generate them. The spatio-temporal interdependencies between stations are addressed by resampling the continuous synthetic series based on the Simulated Annealing (SA) procedure. The state of Lower-Saxony and surrounding areas, located in the north-west of Germany is used to develop the ARM. A total of 26 rainfall stations with high temporal resolution records, i.e. rainfall data every 5 minutes, are used to define the events, find the most suitable probability distributions, calibrate the corresponding parameters, simulate long synthetic series and evaluate the results. The length of the available data ranges from 10 to 20 years. The rainfall series involved in the different steps of calculation are compared using a rainfall-runoff model to simulate the runoff behavior in urban areas. The EPA Storm Water Management Model (SWMM) is applied for this evaluation. The results show a good representation of the

  16. High Resolution X-ray Views of Solar System Objects

    Science.gov (United States)

    Branduardi-Raymont, Graziella

    2011-05-01

    Over the last decade Chandra, and XMM-Newton, have revealed the beauty and multiplicity of X-ray emissions in our solar system: high resolution data, in both spectral and spatial domains, have been crucial in disentangling the physical processes at work. The talk will review the main findings in this area at the boundary between astrophysics and planetary science, and will show how the solar system offers `next door’ examples of widespread astrophysical phenomena. Jupiter shows bright X-ray aurorae, arising from the interactions of local and/or solar wind ions, and electrons, with its powerful magnetic environment: the ions undergo charge exchange with atmospheric neutrals and generate soft X-ray line emission, and the electrons give rise to bremsstrahlung X-rays. Chandra's unparalleled spatial resolution has shown how the X-ray footprints of the electrons in the aurorae coincide with the bright FUV auroral oval, indicating that the same electron population is likely to be at the origin of both emissions. Moreover, Jupiter's disk scatters solar X-rays, displaying a spectrum that closely resembles that of solar flares. Saturn has not revealed X-ray aurorae (yet), but its disk X-ray brightness, like Jupiter's, is strictly correlated with the Sun's X-ray output. A bright X-ray spot has also been resolved by Chandra on the eastern ansa of Saturn's rings, and its spectrum suggests an origin in the fluorescent scattering of solar X-rays on the rings icy particles. Both Mars and Venus have X-ray emitting disks and exospheres, which can be clearly resolved at high spectral and spatial resolution. And the Earth has bright X-ray aurorae that have been targets of Chandra observations. Finally, comets, with their extended neutral comae and extremely line-rich X-ray spectra, are spectacular X-ray sources, and ideal probes of the conditions of the solar wind in the Sun's proximity.

  17. Metallic magnetic calorimeters for high resolution X-ray spectroscopy

    Energy Technology Data Exchange (ETDEWEB)

    Krantz, M.; Hengstler, D.; Geist, J.; Schoetz, C.; Hassel, K.; Hendricks, S.; Keller, M.; Kempf, S.; Gastaldo, L.; Fleischmann, A.; Enss, C. [Heidelberg Univ. (Germany). KIP

    2015-07-01

    We develop microfabricated, energy dispersive particle detector arrays based on metallic magnetic calorimeters (MMCs) for high resolution X-ray spectroscopy to challenge bound-state QED calculations. Our MMCs are operated at about T=30 mK and use a paramagnetic temperature sensor, read-out by a SQUID, to measure the energy deposited by single X-ray photons. We discuss the physics of MMCs, the detector performance and the cryogenic setups for two different detector arrays. We present their microfabrication layouts with focus on challenges like the heatsinking of each pixel of the detector and the overhanging absorbers. The maXs-20 detector is a linear 1x8-pixel array with excellent linearity in its designated energy range up to 20 keV and unsurpassed energy resolution of 1.6 eV for 6 keV x-rays. MaXs-20 operated in a highly portable pulse tube cooled ADR setup has already been used at the EBIT facilities of the MPI-K for new reference measurements of V-like and Ti-like tungsten. The maXs-30 detector currently in development is a 8x8-pixel 2d-array with an active detection area of 16 mm{sup 2} and is designed to detect X-rays up to 50 keV with a designated energy resolution below 5 eV. MaXs-30 will be operated in a cryogen free 3He/4He-dilution refrigerator at the tip of a 40 cm long cold finger at T=20 mK.

  18. High resolution 3D imaging of synchrotron generated microbeams

    Energy Technology Data Exchange (ETDEWEB)

    Gagliardi, Frank M., E-mail: frank.gagliardi@wbrc.org.au [Alfred Health Radiation Oncology, The Alfred, Melbourne, Victoria 3004, Australia and School of Medical Sciences, RMIT University, Bundoora, Victoria 3083 (Australia); Cornelius, Iwan [Imaging and Medical Beamline, Australian Synchrotron, Clayton, Victoria 3168, Australia and Centre for Medical Radiation Physics, University of Wollongong, Wollongong, New South Wales 2500 (Australia); Blencowe, Anton [Division of Health Sciences, School of Pharmacy and Medical Sciences, The University of South Australia, Adelaide, South Australia 5000, Australia and Division of Information Technology, Engineering and the Environment, Mawson Institute, University of South Australia, Mawson Lakes, South Australia 5095 (Australia); Franich, Rick D. [School of Applied Sciences and Health Innovations Research Institute, RMIT University, Melbourne, Victoria 3000 (Australia); Geso, Moshi [School of Medical Sciences, RMIT University, Bundoora, Victoria 3083 (Australia)

    2015-12-15

    Purpose: Microbeam radiation therapy (MRT) techniques are under investigation at synchrotrons worldwide. Favourable outcomes from animal and cell culture studies have proven the efficacy of MRT. The aim of MRT researchers currently is to progress to human clinical trials in the near future. The purpose of this study was to demonstrate the high resolution and 3D imaging of synchrotron generated microbeams in PRESAGE® dosimeters using laser fluorescence confocal microscopy. Methods: Water equivalent PRESAGE® dosimeters were fabricated and irradiated with microbeams on the Imaging and Medical Beamline at the Australian Synchrotron. Microbeam arrays comprised of microbeams 25–50 μm wide with 200 or 400 μm peak-to-peak spacing were delivered as single, cross-fire, multidirectional, and interspersed arrays. Imaging of the dosimeters was performed using a NIKON A1 laser fluorescence confocal microscope. Results: The spatial fractionation of the MRT beams was clearly visible in 2D and up to 9 mm in depth. Individual microbeams were easily resolved with the full width at half maximum of microbeams measured on images with resolutions of as low as 0.09 μm/pixel. Profiles obtained demonstrated the change of the peak-to-valley dose ratio for interspersed MRT microbeam arrays and subtle variations in the sample positioning by the sample stage goniometer were measured. Conclusions: Laser fluorescence confocal microscopy of MRT irradiated PRESAGE® dosimeters has been validated in this study as a high resolution imaging tool for the independent spatial and geometrical verification of MRT beam delivery.

  19. High-Resolution EUV Spectroscopy of White Dwarfs

    Science.gov (United States)

    Kowalski, Michael P.; Wood, K. S.; Barstow, M. A.

    2014-01-01

    We compare results of high-resolution EUV spectroscopic measurements of the isolated white dwarf G191-B2B and the binary system Feige 24 obtained with the J-PEX (Joint Plasmadynamic Experiment), which was sponsored jointly by the U.S. Naval Research Laboratory and NASA. J-PEX delivers the world's highest resolution in EUV and does so at high effective area (e.g., more effective area in a sounding rocket than is available with Chandra at adjacent energies, but in a waveband Chandra cannot reach). The capability J-PEX represents is applicable to the astrophysics of hot plasmas in stellar coronae, white dwarfs and the ISM. G191-B2B and Feige 24 are quite distinct hot white dwarf systems having in common that they are bright in the portion of the EUV where He emission features and edges occur, hence they can be exploited to probe both the stellar atmosphere and the ISM, separating those components by model-fitting that sums over all relevant (He) spectral features in the band. There is evidence from these fits that atmospheric He is being detected but the result is more conservatively cast as a pair of upper limits. We discuss how longer duration satellite observations with the same instrumentation could increase exposure to detect atmospheric He in these and other nearby hot white dwarfs.

  20. High Resolution Spectral Analysis for Irregularly Sampled Helioseismic Data

    Science.gov (United States)

    Seghouani, N.

    2006-11-01

    Astronomical ground based data are very often irregularly sampled due to many factors such as: diurnal effect, weather conditions, etc. The analysis of such data cannot be performed with classical tools (such as periodigram) and new adapted methods are required. After presenting some of these techniques, we will focus on a regularized approach of the spectral analysis problem, which gives very good results in the case of band limited and narrow peaks spectrum. We will also show that with this approach we can achieve high-resolution spectra. Indeed, in classical Fourier analysis, spectral resolution is inversely proportional to the observation time T. Considering the spectral analysis problem as an inverse problem and introducing the “a priori” knowledge of band limited and narrow peak spectrum, this limit (1/T) can be exceeded and thus we can achieve highly resolved spectra, even with irregularly sampled data. This technique will be first applied to relevant simulated data, then to helioseismic data. Additional talk: “Brief description of solar projects in Algiers Observatory” A brief description of all projects developed in our department and that are related to the sun: helioseismology, solar data analysis (pipelines description), solar activity, VLF project, solar astrolabe (for solar diameter measurement), site testing for day-time observations, and the project of solar observatory in the Tamanrasset area.

  1. Bright Semiconductor Scintillator for High Resolution X-Ray Imaging

    Energy Technology Data Exchange (ETDEWEB)

    Nagarkar, Vivek V.; Gaysinskiy, Valeriy; Ovechkina, Olena E.; Miller, Stuart; Singh, Bipin; Guo, Liang; Irving, Thomas (IIT); (Rad. Monitoring)

    2011-08-16

    We report on a novel approach to produce oxygen-doped zinc telluride (ZnTe:O), a remarkable group II-VI semiconductor scintillator, fabricated in the columnar-structured or polycrystalline forms needed to fulfill the needs of many demanding X-ray and {gamma}-ray imaging applications. ZnTe:O has one of the highest conversion efficiencies among known scintillators, emission around 680 nm (which is ideally suited for CCD sensors), high density of 6.4 g/cm{sup 3}, fast decay time of {approx}1 {micro}s with negligible afterglow, and orders of magnitude higher radiation resistance compared to commonly used scintillators. These properties allow the use of ZnTe:O in numerous applications, including X-ray imaging, nuclear medicine (particularly SPECT), room temperature radioisotope identification, and homeland security. Additionally, ZnTe:O offers distinct advantages for synchrotron-based high resolution imaging due to the absence of atomic absorption edges in the low energy range, which otherwise reduce resolution due to secondary X-ray formations. We have fabricated films of ZnTe:O using a vapor deposition technique that allows large-area structured scintillator fabrication in a time- and cost-efficient manner, and evaluated its performance for small-angle X-ray scattering (SAXS) at an Argonne National Laboratory synchrotron beamline. Details of the fabrication and characterization of the optical, scintillation and imaging properties of the ZnTe:O films are presented in this paper.

  2. High-resolution diffraction grating interferometric transducer of linear displacements

    Science.gov (United States)

    Shang, Ping; Xia, Haojie; Fei, Yetai

    2016-01-01

    A high-resolution transducer of linear displacements is presented. The system is based on semiconductor laser illumination and a diffraction grating applied as a length master. The theory of the optical method is formulated using Doppler description. The relationship model among the interference strips, measurement errors, grating deflection around the X, Y and Z axes and translation along the Z axis is built. The grating interference strips' direction and space is not changed with movement along the X (direction of grating movement), Y (direction of grating line), Z axis, and the direction and space has a great effect when rotating around the X axis. Moreover the space is little affected by deflection around the Z axis however the direction is changed dramatically. In addition, the strips' position shifted rightward or downwards respectively for deflection around the X or Y axis. Because the emitted beams are separated on the grating plane, the tilt around the X axis error of the stage during motion will lead to the optical path difference of the two beams resulting in phase shift. This study investigates the influence of the tilt around the X axis error. Experiments show that after yaw error compensation, the high-resolution diffraction grating interferometric transducer readings can be significantly improved. The error can be reduced from +/-80 nm to +/-30 nm in maximum.

  3. A New, Adaptable, Optical High-Resolution 3-Axis Sensor

    Directory of Open Access Journals (Sweden)

    Niels Buchhold

    2017-01-01

    Full Text Available This article presents a new optical, multi-functional, high-resolution 3-axis sensor which serves to navigate and can, for example, replace standard joysticks in medical devices such as electric wheelchairs, surgical robots or medical diagnosis devices. A light source, e.g., a laser diode, is affixed to a movable axis and projects a random geometric shape on an image sensor (CMOS or CCD. The downstream microcontroller’s software identifies the geometric shape’s center, distortion and size, and then calculates x, y, and z coordinates, which can be processed in attached devices. Depending on the image sensor in use (e.g., 6.41 megapixels, the 3-axis sensor features a resolution of 1544 digits from right to left and 1038 digits up and down. Through interpolation, these values rise by a factor of 100. A unique feature is the exact reproducibility (deflection to coordinates and its precise ability to return to its neutral position. Moreover, optical signal processing provides a high level of protection against electromagnetic and radio frequency interference. The sensor is adaptive and adjustable to fit a user’s range of motion (stroke and force. This recommendation aims to optimize sensor systems such as joysticks in medical devices in terms of safety, ease of use, and adaptability.

  4. Optimized generation of high resolution breast anthropomorphic software phantoms

    Science.gov (United States)

    Pokrajac, David D.; Maidment, Andrew D. A.; Bakic, Predrag R.

    2012-01-01

    Purpose: The authors present an efficient method for generating anthropomorphic software breast phantoms with high spatial resolution. Employing the same region growing principles as in their previous algorithm for breast anatomy simulation, the present method has been optimized for computational complexity to allow for fast generation of the large number of phantoms required in virtual clinical trials of breast imaging. Methods: The new breast anatomy simulation method performs a direct calculation of the Cooper’s ligaments (i.e., the borders between simulated adipose compartments). The calculation corresponds to quadratic decision boundaries of a maximum a posteriori classifier. The method is multiscale due to the use of octree-based recursive partitioning of the phantom volume. The method also provides user-control of the thickness of the simulated Cooper’s ligaments and skin. Results: Using the proposed method, the authors have generated phantoms with voxel size in the range of (25–1000 μm)3/voxel. The power regression of the simulation time as a function of the reciprocal voxel size yielded a log-log slope of 1.95 (compared to a slope of 4.53 of our previous region growing algorithm). Conclusions: A new algorithm for computer simulation of breast anatomy has been proposed that allows for fast generation of high resolution anthropomorphic software phantoms. PMID:22482649

  5. CHIRON – A new high resolution spectrometer for CTIO

    Directory of Open Access Journals (Sweden)

    Marcy G.W.

    2011-07-01

    Full Text Available Small telescopes can play an important role in the search for exoplanets because they offer an opportunity for high cadence observations that are not possible with large aperture telescopes. However, there is a shortage of high resolution spectrometers for precision Doppler planet searches. We report on an innovative design for CHIRON, an inexpensive spectrometer that we are building for the 1.5-m telescope at CTIO in Chile. The resolution will be R >80.000, the spectral format spanning 410 to 880 nm. The total throughput of the telescope and spectrometer will be better than 12%, comparable with the efficiency of state-of-the-art spectrometers. The design is driven by the requirements for precision Doppler searches for exoplanets using an iodine cell. The optical layout is a classical echelle with 140 mm beam size. The bench-mounted spectrometer will be fibre-fed followed by an image slicer. An apochromatic refractor is used as the camera. Image quality and throughput of the design are excellent over the full spectral range. Extensive use of commercially available components and avoidance of complicated custom optics are key for quick and resource-efficient implementation.

  6. Quantitative analysis of cholesteatoma using high resolution computed tomography

    Energy Technology Data Exchange (ETDEWEB)

    Kikuchi, Shigeru; Yamasoba, Tatsuya (Kameda General Hospital, Chiba (Japan)); Iinuma, Toshitaka

    1992-05-01

    Seventy-three cases of adult cholesteatoma, including 52 cases of pars flaccida type cholesteatoma and 21 of pars tensa type cholesteatoma, were examined using high resolution computed tomography, in both axial (lateral semicircular canal plane) and coronal sections (cochlear, vestibular and antral plane). These cases were classified into two subtypes according to the presence of extension of cholesteatoma into the antrum. Sixty cases of chronic otitis media with central perforation (COM) were also examined as controls. Various locations of the middle ear cavity were measured in terms of size in comparison with pars flaccida type cholesteatoma, pars tensa type cholesteatoma and COM. The width of the attic was significantly larger in both pars flaccida type and pars tensa type cholesteatoma than in COM. With pars flaccida type cholesteatoma there was a significantly larger distance between the malleus and lateral wall of the attic than with COM. In contrast, the distance between the malleus and medial wall of the attic was significantly larger with pars tensa type cholesteatoma than with COM. With cholesteatoma extending into the antrum, regardless of the type of cholesteatoma, there were significantly larger distances than with COM at the following sites: the width and height of the aditus ad antrum, and the width, height and anterior-posterior diameter of the antrum. However, these distances were not significantly different between cholesteatoma without extension into the antrum and COM. The hitherto demonstrated qualitative impressions of bone destruction in cholesteatoma were quantitatively verified in detail using high resolution computed tomography. (author).

  7. High-Resolution Mars Camera Test Image of Moon (Infrared)

    Science.gov (United States)

    2005-01-01

    This crescent view of Earth's Moon in infrared wavelengths comes from a camera test by NASA's Mars Reconnaissance Orbiter spacecraft on its way to Mars. The mission's High Resolution Imaging Science Experiment camera took the image on Sept. 8, 2005, while at a distance of about 10 million kilometers (6 million miles) from the Moon. The dark feature on the right is Mare Crisium. From that distance, the Moon would appear as a star-like point of light to the unaided eye. The test verified the camera's focusing capability and provided an opportunity for calibration. The spacecraft's Context Camera and Optical Navigation Camera also performed as expected during the test. The Mars Reconnaissance Orbiter, launched on Aug. 12, 2005, is on course to reach Mars on March 10, 2006. After gradually adjusting the shape of its orbit for half a year, it will begin its primary science phase in November 2006. From the mission's planned science orbit about 300 kilometers (186 miles) above the surface of Mars, the high resolution camera will be able to discern features as small as one meter or yard across.

  8. High-Resolution Displacement Sensor Using a SQUID Array Amplifier

    Science.gov (United States)

    Chui, Talso; Penanen, Konstantin; Barmatz, M.; Paik, Ho Jung

    2004-01-01

    Improvement in the measurement of displacement has profound implications for both exploration technologies and fundamental physics. For planetary exploration, the new SQUID-based capacitive displacement sensor will enable a more sensitive gravity gradiometer for mapping the interior of planets and moons. A new concept of a superfluid clock to be reported by Penanen and Chui at this workshop is also based on a high-resolution displacement sensor. Examples of high-impact physics projects that can benefit from a better displacement sensor are: detection of gravitational waves, test of the equivalence principle, search for the postulated "axion" particle, and test of the inverse square law of gravity. We describe the concept of a new displacement sensor that makes use of a recent development in the Superconducting Quantum Interference Device (SQUID) technology. The SQUID array amplifier, invented by Welty and Martinis (IEEE Trans. Appl. Superconductivity 3, 2605, 1993), has about the same noise as a conventional SQUID; however, it can work at a much higher frequency of up to 5 MHz. We explain how the higher bandwidth can be translated into higher resolution using a bridge-balancing scheme that can simultaneously balance out both the carrier signal at the bridge output and the electrostatic force acting on the test mass.

  9. High temporal resolution functional MRI using parallel echo volumar imaging

    Energy Technology Data Exchange (ETDEWEB)

    Rabrait, C.; Ciuciu, P.; Ribes, A.; Poupon, C.; Dehaine-Lambertz, G.; LeBihan, D.; Lethimonnier, F. [CEA Saclay, DSV, I2BM, Neurospin, F-91191 Gif Sur Yvette (France); Le Roux, P. [GEHC, Buc (France); Dehaine-Lambertz, G. [Unite INSERM 562, Gif Sur Yvette (France)

    2008-07-01

    Purpose: To combine parallel imaging with 3D single-shot acquisition (echo volumar imaging, EVI) in order to acquire high temporal resolution volumar functional MRI (fMRI) data. Materials and Methods: An improved EVI sequence was associated with parallel acquisition and field of view reduction in order to acquire a large brain volume in 200 msec. Temporal stability and functional sensitivity were increased through optimization of all imaging parameters and Tikhonov regularization of parallel reconstruction. Two human volunteers were scanned with parallel EVI in a 1.5 T whole-body MR system, while submitted to a slow event-related auditory paradigm. Results: Thanks to parallel acquisition, the EVI volumes display a low level of geometric distortions and signal losses. After removal of low-frequency drifts and physiological artifacts,activations were detected in the temporal lobes of both volunteers and voxel-wise hemodynamic response functions (HRF) could be computed. On these HRF different habituation behaviors in response to sentence repetition could be identified. Conclusion: This work demonstrates the feasibility of high temporal resolution 3D fMRI with parallel EVI. Combined with advanced estimation tools,this acquisition method should prove useful to measure neural activity timing differences or study the nonlinearities and non-stationarities of the BOLD response. (authors)

  10. Characterization of ceramic archaeological by high resolution X ray microtomography

    Energy Technology Data Exchange (ETDEWEB)

    Machado, Alessandra C.; Freitas, Renato; Calza, Cristiane F.; Lopes, Ricardo T.; Lima, Inaya, E-mail: alecastro@lin.ufrj.br [Coordenacao dos Programas de Pos-Graduacao de Engenharia (COPPE/UFRJ), Rio de Janeiro, RJ (Brazil). Lab. de Instrumentacao Nuclear; Carvalho, Daniele D.; Gaspar, Maria D. [Museu Nacional (MN/UFRJ), RJ (Brazil). Centro de Tecnologia

    2013-07-01

    Characterization of ceramic fragments is a very important area of research in art and archeometry area because it enables a greater understanding of how ancient civilizations behave and what were their traditions and customs. Petrography and chemical analyses are commonly used, but these techniques are destructive, which is not interesting for this type of sample. Through the exchange of multidisciplinary scientific knowledge and new partnerships, high resolution X-ray microtomography has been introduced in archaeological area as a great possibility of 3D inspection in a non-destructive way. The goal of this work is to investigate the internal microstructures of four samples of archeological ceramic, from the Archaeological Site of Macacu - RJ. The X-ray microtomography were performed in a high resolution setup, and can be used to infer the nature of organic temper even with all plant remains completely burnt out during the firing process and also to ensure the homogeneity of samples envisaged for geochemical analyses, especially with respect to the distribution of chemically diverse fabric compounds. In this way this study intends to contribute to our understanding of the archaeological and historical formations of this region. (author)

  11. Segmentation of Striatal Brain Structures from High Resolution PET Images

    Directory of Open Access Journals (Sweden)

    Ricardo J. P. C. Farinha

    2009-01-01

    Full Text Available We propose and evaluate an automatic segmentation method for extracting striatal brain structures (caudate, putamen, and ventral striatum from parametric C11-raclopride positron emission tomography (PET brain images. We focus on the images acquired using a novel brain dedicated high-resolution (HRRT PET scanner. The segmentation method first extracts the striatum using a deformable surface model and then divides the striatum into its substructures based on a graph partitioning algorithm. The weighted kernel k-means algorithm is used to partition the graph describing the voxel affinities within the striatum into the desired number of clusters. The method was experimentally validated with synthetic and real image data. The experiments showed that our method was able to automatically extract caudate, ventral striatum, and putamen from the images. Moreover, the putamen could be subdivided into anterior and posterior parts. An automatic method for the extraction of striatal structures from high-resolution PET images allows for inexpensive and reproducible extraction of the quantitative information from these images necessary in brain research and drug development.

  12. Coded aperture subreflector array for high resolution radar imaging

    Science.gov (United States)

    Lynch, Jonathan J.; Herrault, Florian; Kona, Keerti; Virbila, Gabriel; McGuire, Chuck; Wetzel, Mike; Fung, Helen; Prophet, Eric

    2017-05-01

    HRL Laboratories has been developing a new approach for high resolution radar imaging on stationary platforms. High angular resolution is achieved by operating at 235 GHz and using a scalable tile phased array architecture that has the potential to realize thousands of elements at an affordable cost. HRL utilizes aperture coding techniques to minimize the size and complexity of the RF electronics needed for beamforming, and wafer level fabrication and integration allow tiles containing 1024 elements to be manufactured with reasonable costs. This paper describes the results of an initial feasibility study for HRL's Coded Aperture Subreflector Array (CASA) approach for a 1024 element micromachined antenna array with integrated single-bit phase shifters. Two candidate electronic device technologies were evaluated over the 170 - 260 GHz range, GaN HEMT transistors and GaAs Schottky diodes. Array structures utilizing silicon micromachining and die bonding were evaluated for etch and alignment accuracy. Finally, the overall array efficiency was estimated to be about 37% (not including spillover losses) using full wave array simulations and measured device performance, which is a reasonable value at 235 GHz. Based on the measured data we selected GaN HEMT devices operated passively with 0V drain bias due to their extremely low DC power dissipation.

  13. Rapid high resolution genotyping of Francisella tularensis by whole genome sequence comparison of annotated genes ("MLST+".

    Directory of Open Access Journals (Sweden)

    Markus H Antwerpen

    Full Text Available The zoonotic disease tularemia is caused by the bacterium Francisella tularensis. This pathogen is considered as a category A select agent with potential to be misused in bioterrorism. Molecular typing based on DNA-sequence like canSNP-typing or MLVA has become the accepted standard for this organism. Due to the organism's highly clonal nature, the current typing methods have reached their limit of discrimination for classifying closely related subpopulations within the subspecies F. tularensis ssp. holarctica. We introduce a new gene-by-gene approach, MLST+, based on whole genome data of 15 sequenced F. tularensis ssp. holarctica strains and apply this approach to investigate an epidemic of lethal tularemia among non-human primates in two animal facilities in Germany. Due to the high resolution of MLST+ we are able to demonstrate that three independent clones of this highly infectious pathogen were responsible for these spatially and temporally restricted outbreaks.

  14. Rapid high resolution genotyping of Francisella tularensis by whole genome sequence comparison of annotated genes ("MLST+").

    Science.gov (United States)

    Antwerpen, Markus H; Prior, Karola; Mellmann, Alexander; Höppner, Sebastian; Splettstoesser, Wolf D; Harmsen, Dag

    2015-01-01

    The zoonotic disease tularemia is caused by the bacterium Francisella tularensis. This pathogen is considered as a category A select agent with potential to be misused in bioterrorism. Molecular typing based on DNA-sequence like canSNP-typing or MLVA has become the accepted standard for this organism. Due to the organism's highly clonal nature, the current typing methods have reached their limit of discrimination for classifying closely related subpopulations within the subspecies F. tularensis ssp. holarctica. We introduce a new gene-by-gene approach, MLST+, based on whole genome data of 15 sequenced F. tularensis ssp. holarctica strains and apply this approach to investigate an epidemic of lethal tularemia among non-human primates in two animal facilities in Germany. Due to the high resolution of MLST+ we are able to demonstrate that three independent clones of this highly infectious pathogen were responsible for these spatially and temporally restricted outbreaks.

  15. Comparison of three genomic DNA extraction methods to obtain high DNA quality from maize.

    Science.gov (United States)

    Abdel-Latif, Amani; Osman, Gamal

    2017-01-01

    The world's top three cereals, based on their monetary value, are rice, wheat, and corn. In cereal crops, DNA extraction is difficult owing to rigid non-cellulose components in the cell wall of leaves and high starch and protein content in grains. The advanced techniques in molecular biology require pure and quick extraction of DNA. The majority of existing DNA extraction methods rely on long incubation and multiple precipitations or commercially available kits to produce contaminant-free high molecular weight DNA. In this study, we compared three different methods used for the isolation of high-quality genomic DNA from the grains of cereal crop, Zea mays, with minor modifications. The DNA from the grains of two maize hybrids, M10 and M321, was extracted using extraction methods DNeasy Qiagen Plant Mini Kit, CTAB-method (with/without 1% PVP) and modified Mericon extraction. Genes coding for 45S ribosomal RNA are organized in tandem arrays of up to several thousand copies and contain codes for 18S, 5.8S and 26S rRNA units separated by internal transcribed spacers ITS1 and ITS2. While the rRNA units are evolutionary conserved, ITS regions show high level of interspecific divergence and have been used frequently in genetic diversity and phylogenetic studies. In this study, the genomic DNA was then amplified with PCR using primers specific for ITS gene. PCR products were then visualized on agarose gel. The modified Mericon extraction method was found to be the most efficient DNA extraction method, capable to provide high DNA yields with better quality, affordable cost and less time.

  16. Photometric correction of VIR high space resolution data of Ceres

    Science.gov (United States)

    Longobardo, Andrea; Palomba, Ernesto; De Sanctis, Maria Cristina; Ciarniello, Mauro; Tosi, Federico; Giacomo Carrozzo, Filippo; Capria, Maria Teresa; Zambon, Francesca; Raponi, Andrea; Ammannito, Eleonora; Zinzi, Angelo; Raymond, Carol; Russell, Christopher T.; VIR-Dawn Team

    2016-10-01

    NASA's Dawn spacecraft [1] has been orbiting Ceres since early 2015. The mission is divided into five stages, characterized by different spacecraft altitudes corresponding to different space resolutions, i.e. Approach (CSA), Rotational Characterization (CSR), Survey (CSS), High Altitude Mapping Orbit (HAMO), and Low Altitude Mapping Orbit (LAMO).Ceres is a dark body (i.e. average albedo at 1.2 um is 0.08 [2]), hence photometric correction is much more important than for brighter asteroids (e.g. S-type and achondritric). Indeed, the negligible role of multiple scattering increases the reflectance dependence on phase angle.A photometric correction of VIR data at low spatial resolution (i.e. CSA, CSR, CSS) has already been applied with different methodologies (e.g. [2], [3]), These techniques highlight a reflectance and band depths dependency on the phase angle which is homogeneous on the entire surface in agreement with C-type taxonomy.However, with increasing spatial resolution (i.e. HAMO and LAMO data), the retrieval of a unique set of parameters for the photometric correction is no longer sufficient to obtain reliable albedo/band depth maps. In this work, a new photometric correction is obtained and applied to all the high resolution VIR data of Ceres, taking into account the reflectance variations observed at small scales. The developed algorithm will be implemented on the MATISSE tool [4] in order to be visualized on the Ceres shape model.Finally, an interpretation of the obtained phase functions is given in terms of optical and physical properties of the Ceres regolith.AcknowledgementsVIR was funded and coordinated by the Italian Space Agency, and built by SELEX ES, with the scientific leadership of IAPS-INAF, Rome, Italy, and is operated by IAPS-INAF, Rome, Italy. Support of the Dawn Science, Instrument, and Operation Teams is gratefully acknowledged.References[1] Russell, C. T. et al., 2012, Science 336, 686[2] Longobardo A., et al., 2016, LPSC, 2239

  17. Impacts of high resolution model downscaling in coastal regions

    Science.gov (United States)

    Bricheno, Lucy; Wolf, Judith

    2013-04-01

    With model development and cheaper computational resources ocean forecasts are becoming readily available, high resolution coastal forecasting is now a reality. This can only be achieved, however, by downscaling global or basin-scale products such as the MyOcean reanalyses and forecasts. These model products have resolution ranging from 1/16th - 1/4 degree, which are often insufficient for coastal scales, but can provide initialisation and boundary data. We present applications of downscaling the MyOcean products for use in shelf-seas and the nearshore. We will address the question 'Do coastal predictions improve with higher resolution modelling?' with a few focused examples, while also discussing what is meant by an improved result. Increasing resolution appears to be an obvious route for getting more accurate forecasts in operational coastal models. However, when models resolve finer scales, this may lead to the introduction of high-frequency variability which is not necessarily deterministic. Thus a flow may appear more realistic by generating eddies but the simple statistics like rms error and correlation may become less good because the model variability is not exactly in phase with the observations (Hoffman et al., 1995). By deciding on a specific process to simulate (rather than concentrating on reducing rms error) we can better assess the improvements gained by downscaling. In this work we will select two processes which are dominant in our case-study site: Liverpool Bay. Firstly we consider the magnitude and timing of a peak in tide-surge elevations, by separating out the event into timing (or displacement) and intensity (or amplitude) errors. The model can thus be evaluated on how well it predicts the timing and magnitude of the surge. The second important characteristic of Liverpool Bay is the position of the freshwater front. To evaluate model performance in this case, the location, sharpness, and temperature difference across the front will be

  18. Rapid high resolution single nucleotide polymorphism-comparative genome hybridization mapping in Caenorhabditis elegans.

    Science.gov (United States)

    Flibotte, Stephane; Edgley, Mark L; Maydan, Jason; Taylor, Jon; Zapf, Rick; Waterston, Robert; Moerman, Donald G

    2009-01-01

    We have developed a significantly improved and simplified method for high-resolution mapping of phenotypic traits in Caenorhabditis elegans using a combination of single nucleotide polymorphisms (SNPs) and oligo array comparative genome hybridization (array CGH). We designed a custom oligonucleotide array using a subset of confirmed SNPs between the canonical wild-type Bristol strain N2 and the Hawaiian isolate CB4856, populated with densely overlapping 50-mer probes corresponding to both N2 and CB4856 SNP sequences. Using this method a mutation can be mapped to a resolution of approximately 200 kb in a single genetic cross. Six mutations representing each of the C. elegans chromosomes were detected unambiguously and at high resolution using genomic DNA from populations derived from as few as 100 homozygous mutant segregants of mutant N2/CB4856 heterozygotes. Our method completely dispenses with the PCR, restriction digest, and gel analysis of standard SNP mapping and should be easy to extend to any organism with interbreeding strains. This method will be particularly powerful when applied to difficult or hard-to-map low-penetrance phenotypes. It should also be possible to map polygenic traits using this method.

  19. High-Resolution Transmission Electron Microscopy - and Associated Techniques

    Science.gov (United States)

    Buseck, Peter; Cowley, John; Eyring, Leroy

    1989-02-01

    This book provides an introduction to the fundamental concepts, techniques, and methods used for electron microscopy at high resolution in space, energy, and even in time. It delineates the theory of elastic scattering, which is most useful for spectroscopic and chemical analyses. There are also discussions of the theory and practice of image calculations, and applications of HRTEM to the study of solid surfaces, highly disordered materials, solid state chemistry, mineralogy, semiconductors and metals. Contributors include J. Cowley, J. Spence, P. Buseck, P. Self, and M.A. O'Keefe. Compiled by experts in the fields of geology, physics and chemistry, this comprehensive text will be the standard reference for years to come.

  20. Sparse Representation Denoising for Radar High Resolution Range Profiling

    Directory of Open Access Journals (Sweden)

    Min Li

    2014-01-01

    Full Text Available Radar high resolution range profile has attracted considerable attention in radar automatic target recognition. In practice, radar return is usually contaminated by noise, which results in profile distortion and recognition performance degradation. To deal with this problem, in this paper, a novel denoising method based on sparse representation is proposed to remove the Gaussian white additive noise. The return is sparsely described in the Fourier redundant dictionary and the denoising problem is described as a sparse representation model. Noise level of the return, which is crucial to the denoising performance but often unknown, is estimated by performing subspace method on the sliding subsequence correlation matrix. Sliding window process enables noise level estimation using only one observation sequence, not only guaranteeing estimation efficiency but also avoiding the influence of profile time-shift sensitivity. Experimental results show that the proposed method can effectively improve the signal-to-noise ratio of the return, leading to a high-quality profile.

  1. High resolution image reconstruction with constrained, total-variation minimization

    CERN Document Server

    Sidky, Emil Y; Duchin, Yuval; Ullberg, Christer; Pan, Xiaochuan

    2011-01-01

    This work is concerned with applying iterative image reconstruction, based on constrained total-variation minimization, to low-intensity X-ray CT systems that have a high sampling rate. Such systems pose a challenge for iterative image reconstruction, because a very fine image grid is needed to realize the resolution inherent in such scanners. These image arrays lead to under-determined imaging models whose inversion is unstable and can result in undesirable artifacts and noise patterns. There are many possibilities to stabilize the imaging model, and this work proposes a method which may have an advantage in terms of algorithm efficiency. The proposed method introduces additional constraints in the optimization problem; these constraints set to zero high spatial frequency components which are beyond the sensing capability of the detector. The method is demonstrated with an actual CT data set and compared with another method based on projection up-sampling.

  2. Software-defined microwave photonic filter with high reconfigurable resolution.

    Science.gov (United States)

    Wei, Wei; Yi, Lilin; Jaouën, Yves; Hu, Weisheng

    2016-10-19

    Microwave photonic filters (MPFs) are of great interest in radio frequency systems since they provide prominent flexibility on microwave signal processing. Although filter reconfigurability and tunability have been demonstrated repeatedly, it is still difficult to control the filter shape with very high precision. Thus the MPF application is basically limited to signal selection. Here we present a polarization-insensitive single-passband arbitrary-shaped MPF with ~GHz bandwidth based on stimulated Brillouin scattering (SBS) in optical fibre. For the first time the filter shape, bandwidth and central frequency can all be precisely defined by software with ~MHz resolution. The unprecedented multi-dimensional filter flexibility offers new possibilities to process microwave signals directly in optical domain with high precision thus enhancing the MPF functionality. Nanosecond pulse shaping by implementing precisely defined filters is demonstrated to prove the filter superiority and practicability.

  3. High-resolution 3-T MR neurography of peroneal neuropathy

    Energy Technology Data Exchange (ETDEWEB)

    Chhabra, Avneesh; Faridian-Aragh, Neda; Chalian, Majid; Soldatos, Theodoros; Thawait, Shrey K. [Johns Hopkins Hospital, The Russell H. Morgan Department of Radiology and Radiological Science, Baltimore, MD (United States); Williams, Eric H. [Johns Hopkins Hospital, Department of Plastic Surgery, Baltimore, MD (United States); Dellon Institute for Peripheral Nerve Surgery, Baltimore, MD (United States); Andreisek, Gustav [University Hospital Zurich, Institute for Diagnostic Radiology, Department of Medical Radiology, Zurich (Switzerland)

    2012-03-15

    The common peroneal nerve (CPN), a major terminal branch of the sciatic nerve, can be subject to a variety of pathologies, which may affect the nerve at any level from the lumbar plexus to its distal branches. Although the diagnosis of peripheral neuropathy is traditionally based on a patient's clinical findings and electrodiagnostic tests, magnetic resonance neurography (MRN) is gaining an increasing role in the definition of the type, site, and extent of peripheral nerve disorders. Current high-field MR scanners enable high-resolution and excellent soft-tissue contrast imaging of peripheral nerves. In the lower extremities, MR neurography has been employed in the demonstration of the anatomy and pathology of the CPN, as well as in the detection of associated secondary muscle denervation changes. This article reviews the normal appearance of the CPN as well as typical pathologies and abnormal findings at 3.0-T MR neurography of the lower extremity. (orig.)

  4. Controllable printing droplets for high-resolution patterns.

    Science.gov (United States)

    Kuang, Minxuan; Wang, Libin; Song, Yanlin

    2014-10-29

    Inkjet printing has attracted wide attention due to the important applications in fabricating biological, optical, and electrical devices. During the inkjet printing process, the solutes prefer to deposit along the droplet periphery and form an inhomogeneous morphology, known as the coffee-ring effect. Besides, the feature size of printed dots or lines of conventional inkjet printing is usually limited to tens or even hundreds of micrometers. The above two issues greatly restrict the extensive application of printed patterns in high-performance devices. This paper reviews the recent advances in precisely controlling the printing droplets for high-resolution patterns and three-dimensional structures, with a focus on the development to suppress the coffee-ring effect and minimize the feature size of printed dots or lines. A perspective on the remaining challenges of the research is also proposed. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. High-resolution eye tracking using V1 neuron activity

    Science.gov (United States)

    McFarland, James M.; Bondy, Adrian G.; Cumming, Bruce G.; Butts, Daniel A.

    2014-01-01

    Studies of high-acuity visual cortical processing have been limited by the inability to track eye position with sufficient accuracy to precisely reconstruct the visual stimulus on the retina. As a result, studies on primary visual cortex (V1) have been performed almost entirely on neurons outside the high-resolution central portion of the visual field (the fovea). Here we describe a procedure for inferring eye position using multi-electrode array recordings from V1 coupled with nonlinear stimulus processing models. We show that this method can be used to infer eye position with one arc-minute accuracy – significantly better than conventional techniques. This allows for analysis of foveal stimulus processing, and provides a means to correct for eye-movement induced biases present even outside the fovea. This method could thus reveal critical insights into the role of eye movements in cortical coding, as well as their contribution to measures of cortical variability. PMID:25197783

  6. THE HIGH-RESOLUTION INFRARED SPECTRUM OF HCl{sup +}

    Energy Technology Data Exchange (ETDEWEB)

    Doménech, J. L.; Herrero, V. J.; Tanarro, I. [Molecular Physics Department, Instituto de Estructura de la Materia (IEM-CSIC), Serrano 123, E-28006 Madrid (Spain); Drouin, B. J. [Jet Propulsion Laboratory, California Institute of Technology, 4800 Oak Grove Drive, Pasadena, CA 91109-8099 (United States); Cernicharo, J., E-mail: jl.domenech@csic.es [Molecular Astrophysics Group, Instituto de Ciencia de Materiales de Madrid (ICMM-CSIC), Sor Juana Inés de la Cruz 3, Cantoblanco, E-28049 Madrid (Spain)

    2016-12-20

    The chloroniumyl cation, HCl{sup +}, has been recently identified in space from Herschel 's spectra. A joint analysis of extensive vis-UV spectroscopy emission data together with a few high-resolution and high-accuracy millimeter-wave data provided the necessary rest frequencies to support the astronomical identification. Nevertheless, the analysis did not include any infrared (IR) vibration–rotation data. Furthermore, with the end of the Herschel mission, IR observations from the ground may be one of the few available means to further study this ion in space. In this work, we provide a set of accurate rovibrational transition wavenumbers, as well as a new and improved global fit of vis-UV, IR, and millimeter-wave spectroscopy laboratory data, that will aid in future studies of this molecule.

  7. High-resolution ZTE imaging of human teeth.

    Science.gov (United States)

    Weiger, Markus; Pruessmann, Klaas P; Bracher, Anna-Katinka; Köhler, Sascha; Lehmann, Volker; Wolfram, Uwe; Hennel, Franciszek; Rasche, Volker

    2012-10-01

    MRI with zero echo time (ZTE) is achieved by 3D radial centre-out encoding and hard-pulse RF excitation while the projection gradient is already on. Targeting short-T(2) samples, the efficient, robust and silent ZTE approach was implemented for high-bandwidth high-resolution imaging requiring particularly rapid transmit-receive switching and algebraic image reconstruction. The ZTE technique was applied to image extracted human teeth at 11.7T field strength, yielding detailed depictions with very good delineation of the mineralised dentine and enamel layers. ZTE results are compared with UTE (ultra-short echo time) MRI and micro-computed tomography (μCT), revealing significant differences in SNR and CNR yields. Compared to μCT, ZTE MRI appears to be less susceptible to artefacts caused by dental fillings and to offer superior sensitivity for the detection of early demineralisation and caries lesions. Copyright © 2012 John Wiley & Sons, Ltd.

  8. High resolution X-ray CT for advanced electronics packaging

    Science.gov (United States)

    Oppermann, M.; Zerna, T.

    2017-02-01

    Advanced electronics packaging is a challenge for non-destructive Testing (NDT). More, smaller and mostly hidden interconnects dominate modern electronics components and systems. To solve the demands of customers to get products with a high functionality by low volume, weight and price (e.g. mobile phones, personal medical monitoring systems) often the designers use System-in-Package solutions (SiP). The non-destructive testing of such devices is a big challenge. So our paper will impart fundamentals and applications for non-destructive evaluation of inner structures of electronics packaging for quality assurance and reliability investigations with a focus on X-ray methods, especially on high resolution X-ray computed tomography (CT).

  9. Seismic investigations for high resolution exploration ahead and around boreholes

    Science.gov (United States)

    Jaksch, Katrin; Giese, Ruediger; Kopf, Matthias

    2013-04-01

    Deep reservoirs usually will be explored with a surface seismic survey often in combination with borehole seismic measurements like VSP or SWD which can improve the velocity model of the underground. Reservoirs especially in geothermal fields are often characterized by small-scale structures. Additionally, with depth the need for exploration methods with a high resolution increases because standard methods like borehole seismic measurements cannot improve their resolution with depth. To localize structures with more accuracy methods with higher resolution in the range of meters are necessary. Within the project SPWD - Seismic Prediction While Drilling a new exploration method will be developed. With an implementation of seismic sources and receivers in one device an exploration method ahead and around the borehole will be enabled. Also, a high resolution independent from the depth will be achieved. Therefore active and powerful seismic sources are necessary to reach an acceptable penetration depth. Step by step seismic borehole devices were developed, which can be used under different conditions. Every borehole device contains four seismic sources and several three-component geophones. A small distance between actuators and geophones allows detecting also the high frequency content of the wave field reflected at geological structures. Also, exploration with a high resolution is possible. A first borehole device was developed for basic conditions in horizontal boreholes without special terms to temperature or pressure. In a mine first methodical measurements for the initiated wave field were performed. Therefor an existing seismic test area at the research and education mine of the TU Bergakademie Freiberg was extended with boreholes. In the seismic test area, consisting of a dense geophone array with three-component geophone anchors, two horizontal and one vertical borehole was drilled. To achieve a radiation pattern in predefined directions by constructive

  10. High resolution multi-scalar drought indices for Iberia

    Science.gov (United States)

    Russo, Ana; Gouveia, Célia; Trigo, Ricardo; Jerez, Sonia

    2014-05-01

    The Iberian Peninsula has been recurrently affected by drought episodes and by adverse associated effects (Gouveia et al., 2009), ranging from severe water shortages to losses of hydroelectricity production, increasing risk of forest fires, forest decline and triggering processes of land degradation and desertification. Moreover, Iberia corresponds to one of the most sensitive areas to current and future climate change and is nowadays considered a hot spot of climate change with high probability for the increase of extreme events (Giorgi and Lionello, 2008). The spatial and temporal behavior of climatic droughts at different time scales was analyzed using spatially distributed time series of multi-scalar drought indicators, such as the Standardized Precipitation Evapotranspiration Index (SPEI) (Vicente-Serrano et al., 2010). This new climatic drought index is based on the simultaneous use of precipitation and temperature fields with the advantage of combining a multi-scalar character with the capacity to include the effects of temperature variability on drought assessment. Moreover, reanalysis data and the higher resolution hindcasted databases obtained from them are valuable surrogates of the sparse observations and widely used for in-depth characterizations of the present-day climate. Accordingly, this work aims to enhance the knowledge on high resolution drought patterns in Iberian Peninsula, taking advantage of high-resolution (10km) regional MM5 simulations of the recent past (1959-2007) over Iberia. It should be stressed that these high resolution meteorological fields (e.g. temperature, precipitation) have been validated for various purposes (Jerez et al., 2013). A detailed characterization of droughts since the 1960s using the 10 km resolution hidncasted simulation was performed with the aim to explore the conditions favoring drought onset, duration and ending, as well as the subsequent short, medium and long-term impacts affecting the environment and the

  11. Impact of High Resolution SST Data on Regional Weather Forecasts

    Science.gov (United States)

    Jedlovec, Gary J.; Case, Jonathon; LaFontaine, Frank; Vazquez, Jorge; Mattocks, Craig

    2010-01-01

    Past studies have shown that the use of coarse resolution SST products such as from the real-time global (RTG) SST analysis[1] or other coarse resolution once-a-day products do not properly portray the diurnal variability of fluxes of heat and moisture from the ocean that drive the formation of low level clouds and precipitation over the ocean. For example, the use of high resolution MODIS SST composite [2] to initialize the Advanced Research Weather Research and Forecast (WRF) (ARW) [3] has been shown to improve the prediction of sensible weather parameters in coastal regions [4][5}. In an extend study, [6] compared the MODIS SST composite product to the RTG SST analysis and evaluated forecast differences for a 6 month period from March through August 2007 over the Florida coastal regions. In a comparison to buoy data, they found that that the MODIS SST composites reduced the bias and standard deviation over that of the RTG data. These improvements led to significant changes in the initial and forecasted heat fluxes and the resulting surface temperature fields, wind patterns, and cloud distributions. They also showed that the MODIS composite SST product, produced for the Terra and Aqua satellite overpass times, captured a component of the diurnal cycle in SSTs not represented in the RTG or other one-a-day SST analyses. Failure to properly incorporate these effects in the WRF initialization cycle led to temperature biases in the resulting short term forecasts. The forecast impact was limited in some situations however, due to composite product inaccuracies brought about by data latency during periods of long-term cloud cover. This paper focuses on the forecast impact of an enhanced MODIS/AMSR-E composite SST product designed to reduce inaccuracies due data latency in the MODIS only composite product.

  12. High resolution functional photoacoustic tomography of breast cancer

    Energy Technology Data Exchange (ETDEWEB)

    Li, Xiaoqi; Yao, Lei; Xi, Lei; Jiang, Huabei, E-mail: hjiang@bme.ufl.edu [Department of Biomedical Engineering, University of Florida, Gainesville, Florida 32611 (United States); Heldermon, Coy D. [Department of Medicine, University of Florida, Gainesville, Florida 32611 (United States)

    2015-09-15

    Purpose: To evaluate the feasibility of functional photoacoustic tomography (fPAT) for high resolution detection and characterization of breast cancer and to demonstrate for the first time quantitative hemoglobin concentration and oxygen saturation images of breasts that were formed with model-based reconstruction of tomographic photoacoustic data. Methods: The study was HIPAA compliant and was approved by the university institutional review board. Written informed consents were obtained from all the participants. Ten cases, including six cancer and four healthy (mean age = 50 yr; age range = 41–66 yr), were examined. Functional images of breast tissue including absolute total hemoglobin concentration (Hb{sub T}) and oxygen saturation (StO{sub 2}%) were obtained by fPAT and cross validated with magnetic resonance imaging (MRI) readings and/or histopathology. Results: Hb{sub T} and StO{sub 2}% maps from all six pathology-confirmed cancer cases (60%) show clear detection of tumor, while MR images indicate clear detection of tumor for five of six cancer cases; one small tumor was read as near-complete-resolution by MRI. The average Hb{sub T} and StO{sub 2}% value of suspicious lesion area for the cancer cases was 61.6 ± 18.9 μM/l and 67.5% ± 5.2% compared to 25.6 ± 7.4 μM/l and 65.2% ± 3.8% for background normal tissue. Conclusions: fPAT has the potential to be a significant add-on in breast cancer detection and characterization as it provides submillimeter resolution functional images of breast lesions.

  13. Analysis of the impact of spatial resolution on land/water classifications using high-resolution aerial imagery

    Science.gov (United States)

    Enwright, Nicholas M.; Jones, William R.; Garber, Adrienne L.; Keller, Matthew J.

    2014-01-01

    Long-term monitoring efforts often use remote sensing to track trends in habitat or landscape conditions over time. To most appropriately compare observations over time, long-term monitoring efforts strive for consistency in methods. Thus, advances and changes in technology over time can present a challenge. For instance, modern camera technology has led to an increasing availability of very high-resolution imagery (i.e. submetre and metre) and a shift from analogue to digital photography. While numerous studies have shown that image resolution can impact the accuracy of classifications, most of these studies have focused on the impacts of comparing spatial resolution changes greater than 2 m. Thus, a knowledge gap exists on the impacts of minor changes in spatial resolution (i.e. submetre to about 1.5 m) in very high-resolution aerial imagery (i.e. 2 m resolution or less). This study compared the impact of spatial resolution on land/water classifications of an area dominated by coastal marsh vegetation in Louisiana, USA, using 1:12,000 scale colour-infrared analogue aerial photography (AAP) scanned at four different dot-per-inch resolutions simulating ground sample distances (GSDs) of 0.33, 0.54, 1, and 2 m. Analysis of the impact of spatial resolution on land/water classifications was conducted by exploring various spatial aspects of the classifications including density of waterbodies and frequency distributions in waterbody sizes. This study found that a small-magnitude change (1–1.5 m) in spatial resolution had little to no impact on the amount of water classified (i.e. percentage mapped was less than 1.5%), but had a significant impact on the mapping of very small waterbodies (i.e. waterbodies ≤ 250 m2). These findings should interest those using temporal image classifications derived from very high-resolution aerial photography as a component of long-term monitoring programs.

  14. Super-resolution T1 estimation: Quantitative high resolution T1 mapping from a set of low resolution T1 -weighted images with different slice orientations.

    Science.gov (United States)

    Van Steenkiste, Gwendolyn; Poot, Dirk H J; Jeurissen, Ben; den Dekker, Arnold J; Vanhevel, Floris; Parizel, Paul M; Sijbers, Jan

    2017-05-01

    Quantitative T1 mapping is a magnetic resonance imaging technique that estimates the spin-lattice relaxation time of tissues. Even though T1 mapping has a broad range of potential applications, it is not routinely used in clinical practice as accurate and precise high resolution T1 mapping requires infeasibly long acquisition times. To improve the trade-off between the acquisition time, signal-to-noise ratio and spatial resolution, we acquire a set of low resolution T1 -weighted images and directly estimate a high resolution T1 map by means of super-resolution reconstruction. Simulation and in vivo experiments show an increased spatial resolution of the T1 map, while preserving a high signal-to-noise ratio and short scan time. Moreover, the proposed method outperforms conventional estimation in terms of root-mean-square error. Super resolution T1 estimation enables resolution enhancement in T1 mapping with the use of standard (inversion recovery) T1 acquisition sequences. Magn Reson Med 77:1818-1830, 2017. © 2016 International Society for Magnetic Resonance in Medicine. © 2016 International Society for Magnetic Resonance in Medicine.

  15. High resolution infrared acquisitions droning over the LUSI mud eruption.

    Science.gov (United States)

    Di Felice, Fabio; Romeo, Giovanni; Di Stefano, Giuseppe; Mazzini, Adriano

    2016-04-01

    The use of low-cost hand-held infrared (IR) thermal cameras based on uncooled micro-bolometer detector arrays became more widespread during the recent years. Thermal cameras have the ability to estimate temperature values without contact and therefore can be used in circumstances where objects are difficult or dangerous to reach such as volcanic eruptions. Since May 2006 the Indonesian LUSI mud eruption continues to spew boiling mud, water, aqueous vapor, CO2, CH4 and covers a surface of nearly 7 km2. At this locality we performed surveys over the unreachable erupting crater. In the framework of the LUSI Lab project (ERC grant n° 308126), in 2014 and 2015, we acquired high resolution infrared images using a specifically equipped remote-controlled drone flying at an altitude of m 100. The drone is equipped with GPS and an autopilot system that allows pre-programming the flying path or designing grids. The mounted thermal camera has peak spectral sensitivity in LW wavelength (μm 10) that is characterized by low water vapor and CO2 absorption. The low distance (high resolution) acquisitions have a temperature detail every cm 40, therefore it is possible to detect and observe physical phenomena such as thermodynamic behavior, hot mud and fluids emissions locations and their time shifts. Despite the harsh logistics and the continuously varying gas concentrations we managed to collect thermal images to estimate the crater zone spatial thermal variations. We applied atmosphere corrections to calculate infrared absorption by high concentration of water vapor. Thousands of images have been stitched together to obtain a mosaic of the crater zone. Regular monitoring with heat variation measurements collected, e.g. every six months, could give important information about the volcano activity estimating its evolution. A future data base of infrared high resolution and visible images stored in a web server could be a useful monitoring tool. An interesting development will be

  16. Optical Histology: High-Resolution Visualization of Tissue Microvasculature

    Science.gov (United States)

    Moy, Austin Jing-Ming

    Mammalian tissue requires the delivery of nutrients, growth factors, and the exchange of oxygen and carbon dioxide gases to maintain normal function. These elements are delivered by the blood, which travels through the connected network of blood vessels, known as the vascular system. The vascular system consists of large feeder blood vessels (arteries and veins) that are connected to the small blood vessels (arterioles and venules), which in turn are connected to the capillaries that are directly connected to the tissue and facilitate gas exchange and nutrient delivery. These small blood vessels and capillaries make up an intricate but organized network of blood vessels that exist in all mammalian tissues known as the microvasculature and are very important in maintaining the health and proper function of mammalian tissue. Due to the importance of the microvasculature in tissue survival, disruption of the microvasculature typically leads to tissue dysfunction and tissue death. The most prevalent method to study the microvasculature is visualization. Immunohistochemistry (IHC) is the gold-standard method to visualize tissue microvasculature. IHC is very well-suited for highly detailed interrogation of the tissue microvasculature at the cellular level but is unwieldy and impractical for wide-field visualization of the tissue microvasculature. The objective my dissertation research was to develop a method to enable wide-field visualization of the microvasculature, while still retaining the high-resolution afforded by optical microscopy. My efforts led to the development of a technique dubbed "optical histology" that combines chemical and optical methods to enable high-resolution visualization of the microvasculature. The development of the technique first involved preliminary studies to quantify optical property changes in optically cleared tissues, followed by development and demonstration of the methodology. Using optical histology, I successfully obtained high

  17. High resolution modelling of extreme precipitation events in urban areas

    Science.gov (United States)

    Siemerink, Martijn; Volp, Nicolette; Schuurmans, Wytze; Deckers, Dave

    2015-04-01

    The present day society needs to adjust to the effects of climate change. More extreme weather conditions are expected, which can lead to longer periods of drought, but also to more extreme precipitation events. Urban water systems are not designed for such extreme events. Most sewer systems are not able to drain the excessive storm water, causing urban flooding. This leads to high economic damage. In order to take appropriate measures against extreme urban storms, detailed knowledge about the behaviour of the urban water system above and below the streets is required. To investigate the behaviour of urban water systems during extreme precipitation events new assessment tools are necessary. These tools should provide a detailed and integral description of the flow in the full domain of overland runoff, sewer flow, surface water flow and groundwater flow. We developed a new assessment tool, called 3Di, which provides detailed insight in the urban water system. This tool is based on a new numerical methodology that can accurately deal with the interaction between overland runoff, sewer flow and surface water flow. A one-dimensional model for the sewer system and open channel flow is fully coupled to a two-dimensional depth-averaged model that simulates the overland flow. The tool uses a subgrid-based approach in order to take high resolution information of the sewer system and of the terrain into account [1, 2]. The combination of using the high resolution information and the subgrid based approach results in an accurate and efficient modelling tool. It is now possible to simulate entire urban water systems using extreme high resolution (0.5m x 0.5m) terrain data in combination with a detailed sewer and surface water network representation. The new tool has been tested in several Dutch cities, such as Rotterdam, Amsterdam and The Hague. We will present the results of an extreme precipitation event in the city of Schiedam (The Netherlands). This city deals with

  18. The high resolution mapping of the Venice Lagoon tidal network

    Science.gov (United States)

    Madricardo, Fantina; Foglini, Federica; Kruss, Aleksandra; Bellafiore, Debora; Trincardi, Fabio

    2017-04-01

    One of the biggest challenges of the direct observation of the ocean is to achieve a high resolution mapping of its seafloor morphology and benthic habitats. So far, sonars have mapped just 0.05% of the ocean floor with less than ten-meter resolution. The recent efforts of the scientific community have been devoted towards the mapping of both Deep Ocean and very shallow coastal areas. Coastal and transitional environments in particular undergo strong morphological changes due to natural and anthropogenic pressure. Nowadays, only about 5% of the seafloor of these environments † have been mapped: the shallowness of these environments has prevented the use of underwater acoustics to reveal their morphological features. The recent technological development of multibeam echosounder systems, however, enables these instruments to achieve very high performances also in such shallow environments. In this work, we present results and case studies of an extensive multibeam survey carried out in the Lagoon of Venice in 2013. The Lagoon of Venice is the biggest lagoon in the Mediterranean Sea with a surface of about 550 km2 and with an average depth of about 1 m. In the last century, the morphological and ecological properties of the lagoon changed dramatically: the surface of the salt marshes was reduced by 60% and some parts of the lagoon are deepening with a net sediment flux exiting from the inlets. Moreover, major engineering interventions are currently ongoing at the inlets (MOSE project). These changes at the inlets could affect substantially the lagoon environment. To understand and monitor the future evolution of the Lagoon of Venice, ISMAR within the project RITMARE (a National Research Programme funded by the Italian Ministry of University and Research) carried out an extensive survey, involving a team of more than 25 scientists, to collect high resolution (0.5 m) bathymetry of key study areas such as the tidal inlets and channels. Following a broad

  19. High yield DNA fragmentation using cyclical hydrodynamic shearing

    NARCIS (Netherlands)

    Shui, Lingling; Sparreboom, Wouter; Spang, Peter; Roeser, Tina; Nieto, Benjamin; Guasch, Francesc; Corbera, Antoni Homs; van den Berg, Albert; Carlen, Edwin

    2013-01-01

    We report a new DNA fragmentation technique that significantly simplifies conventional hydrodynamic shearing fragmentation by eliminating the need for sample recirculation while maintaining high fragmentation yield and low fragment length variation, and therefore, reduces instrument complexity and

  20. Forensic soil DNA analysis using high-throughput sequencing: a comparison of four molecular markers.

    Science.gov (United States)

    Young, Jennifer M; Weyrich, Laura S; Cooper, Alan

    2014-11-01

    Soil analysis, such as mineralogy, geophysics, texture and colour, are commonly used in forensic casework to link a suspect to a crime scene. However, DNA analysis can also be applied to characterise the vast diversity of organisms present in soils. DNA metabarcoding and high-throughput sequencing (HTS) now offer a means to improve discrimination between forensic soil samples by identifying individual taxa and exploring non-culturable microbial species. Here, we compare the small-scale reproducibility and resolution of four molecular markers targeting different taxa (bacterial 16S rRNA, eukaryotic18S rRNA, plant trnL intron and fungal internal transcribed spacer I (ITS1) rDNA) to distinguish two sample sites. We also assess the background DNA level associated with each marker and examine the effects of filtering Operational Taxonomic Units (OTUs) detected in extraction blank controls. From this study, we show that non-bacterial taxa in soil, particularly fungi, can provide the greatest resolution between the sites, whereas plant markers may be problematic for forensic discrimination. ITS and 18S markers exhibit reliable amplification, and both show high discriminatory power with low background DNA levels. The 16S rRNA marker showed comparable discriminatory power post filtering; however, presented the highest level of background DNA. The discriminatory power of all markers was increased by applying OTU filtering steps, with the greatest improvement observed by the removal of any sequences detected in extraction blanks. This study demonstrates the potential use of multiple DNA markers for forensic soil analysis using HTS, and identifies some of the standardisation and evaluation steps necessary before this technique can be applied in casework. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  1. Linearized inversion frameworks toward high-resolution seismic imaging

    KAUST Repository

    Aldawood, Ali

    2016-09-01

    Seismic exploration utilizes controlled sources, which emit seismic waves that propagate through the earth subsurface and get reflected off subsurface interfaces and scatterers. The reflected and scattered waves are recorded by recording stations installed along the earth surface or down boreholes. Seismic imaging is a powerful tool to map these reflected and scattered energy back to their subsurface scattering or reflection points. Seismic imaging is conventionally based on the single-scattering assumption, where only energy that bounces once off a subsurface scatterer and recorded by a receiver is projected back to its subsurface position. The internally multiply scattered seismic energy is considered as unwanted noise and is usually suppressed or removed from the recorded data. Conventional seismic imaging techniques yield subsurface images that suffer from low spatial resolution, migration artifacts, and acquisition fingerprint due to the limited acquisition aperture, number of sources and receivers, and bandwidth of the source wavelet. Hydrocarbon traps are becoming more challenging and considerable reserves are trapped in stratigraphic and pinch-out traps, which require highly resolved seismic images to delineate them. This thesis focuses on developing and implementing new advanced cost-effective seismic imaging techniques aiming at enhancing the resolution of the migrated images by exploiting the sparseness of the subsurface reflectivity distribution and utilizing the multiples that are usually neglected when imaging seismic data. I first formulate the seismic imaging problem as a Basis pursuit denoise problem, which I solve using an L1-minimization algorithm to obtain the sparsest migrated image corresponding to the recorded data. Imaging multiples may illuminate subsurface zones, which are not easily illuminated by conventional seismic imaging using primary reflections only. I then develop an L2-norm (i.e. least-squares) inversion technique to image

  2. Trace metal imaging with high spatial resolution: applications in biomedicine.

    Science.gov (United States)

    Qin, Zhenyu; Caruso, Joseph A; Lai, Barry; Matusch, Andreas; Becker, J Sabine

    2011-01-01

    New generations of analytical techniques for imaging of metals are pushing hitherto boundaries of spatial resolution and quantitative analysis in biology. Because of this, the application of these imaging techniques described herein to the study of the organization and dynamics of metal cations and metal-containing biomolecules in biological cell and tissue is becoming an important issue in biomedical research. In the current review, three common metal imaging techniques in biomedical research are introduced, including synchrotron X-ray fluorescence (SXRF) microscopy, secondary ion mass spectrometry (SIMS), and laser ablation inductively coupled plasma mass spectrometry (LA-ICP-MS). These are exemplified by a demonstration of the dopamine-Fe complexes, by assessment of boron distribution in a boron neutron capture therapy cell model, by mapping Cu and Zn in human brain cancer and a rat brain tumor model, and by the analysis of metal topography within neuromelanin. These studies have provided solid evidence that demonstrates that the sensitivity, spatial resolution, specificity, and quantification ability of metal imaging techniques is suitable and highly desirable for biomedical research. Moreover, these novel studies on the nanometre scale (e.g., of individual single cells or cell organelles) will lead to a better understanding of metal processes in cells and tissues.

  3. A Unitary Anesthetic Binding Site at High Resolution

    Energy Technology Data Exchange (ETDEWEB)

    L Vedula; G Brannigan; N Economou; J Xi; M Hall; R Liu; M Rossi; W Dailey; K Grasty; et. al.

    2011-12-31

    Propofol is the most widely used injectable general anesthetic. Its targets include ligand-gated ion channels such as the GABA{sub A} receptor, but such receptor-channel complexes remain challenging to study at atomic resolution. Until structural biology methods advance to the point of being able to deal with systems such as the GABA{sub A} receptor, it will be necessary to use more tractable surrogates to probe the molecular details of anesthetic recognition. We have previously shown that recognition of inhalational general anesthetics by the model protein apoferritin closely mirrors recognition by more complex and clinically relevant protein targets; here we show that apoferritin also binds propofol and related GABAergic anesthetics, and that the same binding site mediates recognition of both inhalational and injectable anesthetics. Apoferritin binding affinities for a series of propofol analogs were found to be strongly correlated with the ability to potentiate GABA responses at GABA{sub A} receptors, validating this model system for injectable anesthetics. High resolution x-ray crystal structures reveal that, despite the presence of hydrogen bond donors and acceptors, anesthetic recognition is mediated largely by van der Waals forces and the hydrophobic effect. Molecular dynamics simulations indicate that the ligands undergo considerable fluctuations about their equilibrium positions. Finally, apoferritin displays both structural and dynamic responses to anesthetic binding, which may mimic changes elicited by anesthetics in physiologic targets like ion channels.

  4. A Unitary Anesthetic Binding Site at High Resolution

    Energy Technology Data Exchange (ETDEWEB)

    Vedula, L. Sangeetha; Brannigan, Grace; Economou, Nicoleta J.; Xi, Jin; Hall, Michael A.; Liu, Renyu; Rossi, Matthew J.; Dailey, William P.; Grasty, Kimberly C.; Klein, Michael L.; Eckenhoff, Roderic G.; Loll, Patrick J.; (Drexel-MED); (UPENN)

    2009-10-21

    Propofol is the most widely used injectable general anesthetic. Its targets include ligand-gated ion channels such as the GABA{sub A} receptor, but such receptor-channel complexes remain challenging to study at atomic resolution. Until structural biology methods advance to the point of being able to deal with systems such as the GABA{sub A} receptor, it will be necessary to use more tractable surrogates to probe the molecular details of anesthetic recognition. We have previously shown that recognition of inhalational general anesthetics by the model protein apoferritin closely mirrors recognition by more complex and clinically relevant protein targets; here we show that apoferritin also binds propofol and related GABAergic anesthetics, and that the same binding site mediates recognition of both inhalational and injectable anesthetics. Apoferritin binding affinities for a series of propofol analogs were found to be strongly correlated with the ability to potentiate GABA responses at GABA{sub A} receptors, validating this model system for injectable anesthetics. High resolution x-ray crystal structures reveal that, despite the presence of hydrogen bond donors and acceptors, anesthetic recognition is mediated largely by van der Waals forces and the hydrophobic effect. Molecular dynamics simulations indicate that the ligands undergo considerable fluctuations about their equilibrium positions. Finally, apoferritin displays both structural and dynamic responses to anesthetic binding, which may mimic changes elicited by anesthetics in physiologic targets like ion channels.

  5. Quantitative stratigraphy of snow resolved by high-resolution penetrometry

    Science.gov (United States)

    Proksch, Martin; Reuter, Benjamin; Schneebeli, Martin; Löwe, Henning

    2014-05-01

    Precise measurements of snow structural parameters are essential to understand and model snow physical processes. Snow metamorphism, mass and energy balance of snow, radiative properties or the snowpack stability with respect to avalanche formation, all these processes depend on the snow structural parameters and the stratigraphy of the snowpack. However, most snow measurements are limited in spatial and temporal resolution and by extensive measurement times. For this reason, we developed a statistical model to derive three major snow structural parameters, density, correlation length and specific surface area (SSA) solely from a portable, high-resolution penetrometer. We demonstrate the potential of the method by a transect through Alpine snow in the Wannengrat study site, Davos, Switzerland. The two-dimensional plot of the transect reveals the depositional and metamorphic events. The results for the density are compared to independent density measurements from snow profiles. Based on these data, we are able to give a more complete interpretation of the snow stratigraphy and the underlying physical processes.

  6. Understanding reconstructed Dante spectra using high resolution spectroscopy

    Energy Technology Data Exchange (ETDEWEB)

    May, M. J., E-mail: may13@llnl.gov; Widmann, K.; Kemp, G. E.; Thorn, D.; Colvin, J. D.; Schneider, M. B.; Moore, A.; Blue, B. E. [L-170 Lawrence Livermore National Laboratory, 7000 East Ave., Livermore, California 94551 (United States); Weaver, J. [Naval Research Laboratory, 4555 Overlook Ave. SW, Washington, DC 20375 (United States)

    2016-11-15

    The Dante is an 18 channel filtered diode array used at the National Ignition Facility (NIF) to measure the spectrally and temporally resolved radiation flux between 50 eV and 20 keV from various targets. The absolute flux is determined from the radiometric calibration of the x-ray diodes, filters, and mirrors and a reconstruction algorithm applied to the recorded voltages from each channel. The reconstructed spectra are very low resolution with features consistent with the instrument response and are not necessarily consistent with the spectral emission features from the plasma. Errors may exist between the reconstructed spectra and the actual emission features due to assumptions in the algorithm. Recently, a high resolution convex crystal spectrometer, VIRGIL, has been installed at NIF with the same line of sight as the Dante. Spectra from L-shell Ag and Xe have been recorded by both VIRGIL and Dante. Comparisons of these two spectroscopic measurements yield insights into the accuracy of the Dante reconstructions.

  7. High Resolution Imaging Spectrometer (HIRIS): Science and Instrument

    Science.gov (United States)

    Goetz, Alexander F. H.; Davis, Curtiss O.

    1991-01-01

    The High Resolution Imaging Spectrometer (HIRIS) is a facility instrument slated for flight on the second of the EOS-A series of platforms. HIRIS is designed to acquire 24-km wide, 30-m pixel images in 192 spectral bands simultaneously in the 0.4-2.45-micrometer wavelength region. With pointing mirrors it can sample any place on Earth, except the poles, every two days. HIRIS operates at the intermediate scale between the human and the global and therefore links studies of Earth surface processes to global monitoring carried out by lower-resolution instruments. So far, over 50 science data products from HIRIS images have been identified in the fields of atmospheric gases, clouds, snow and ice, water, vegetation, and rocks and soils. The key attribute of imaging spectrometry that makes it possible to derive quantitative information from the data is the large number of contiguous spectral bands. Therefore spectrum matching techniques can be applied. Such techniques are not possible with present-day, multispectral scanner data.

  8. Understanding reconstructed Dante spectra using high resolution spectroscopy

    Science.gov (United States)

    May, M. J.; Weaver, J.; Widmann, K.; Kemp, G. E.; Thorn, D.; Colvin, J. D.; Schneider, M. B.; Moore, A.; Blue, B. E.

    2016-11-01

    The Dante is an 18 channel filtered diode array used at the National Ignition Facility (NIF) to measure the spectrally and temporally resolved radiation flux between 50 eV and 20 keV from various targets. The absolute flux is determined from the radiometric calibration of the x-ray diodes, filters, and mirrors and a reconstruction algorithm applied to the recorded voltages from each channel. The reconstructed spectra are very low resolution with features consistent with the instrument response and are not necessarily consistent with the spectral emission features from the plasma. Errors may exist between the reconstructed spectra and the actual emission features due to assumptions in the algorithm. Recently, a high resolution convex crystal spectrometer, VIRGIL, has been installed at NIF with the same line of sight as the Dante. Spectra from L-shell Ag and Xe have been recorded by both VIRGIL and Dante. Comparisons of these two spectroscopic measurements yield insights into the accuracy of the Dante reconstructions.

  9. Towards a High-Resolution Global Inundation Delineation Dataset

    Science.gov (United States)

    Fluet-Chouinard, E.; Lehner, B.

    2011-12-01

    Although their importance for biodiversity, flow regulation and ecosystem service provision is widely recognized, wetlands and temporarily inundated landscapes remain poorly mapped globally because of their inherent elusive nature. Inventorying of wetland resources has been identified in international agreements as an essential component of appropriate conservation efforts and management initiatives of these threatened ecosystems. However, despite recent advances in remote sensing surface water monitoring, current inventories of surface water variations remain incomplete at the regional-to-global scale due to methodological limitations restricting truly global application. Remote sensing wetland applications such as SAR L-band are particularly constrained by image availability and heterogeneity of acquisition dates, while coarse resolution passive microwave and multi-sensor methods cannot discriminate distinct surface water bodies. As a result, the most popular global wetland dataset remains to this day the Global Lake & Wetland Database (Lehner and Doll, 2004) a spatially inconsistent database assembled from various existing data sources. The approach taken in this project circumvents the limitations of current global wetland monitoring methods by combining globally available topographic and hydrographic data to downscale coarse resolution global inundation data (Prigent et al., 2007) and thus create a superior inundation delineation map product. The developed procedure downscales inundation data from the coarse resolution (~27km) of current passive microwave sensors to the finer spatial resolution (~500m) of the topographic and hydrographic layers of HydroSHEDS' data suite (Lehner et al., 2006), while retaining the high temporal resolution of the multi-sensor inundation dataset. From the downscaling process emerges new information on the specific location of inundation, but also on its frequency and duration. The downscaling algorithm employs a decision tree

  10. The Singapore high resolution single cell imaging facility

    Science.gov (United States)

    Watt, Frank; Chen, Xiao; Vera, Armin Baysic De; Udalagama, Chammika N. B.; Ren, M.; Kan, Jeroen A. van; Bettiol, Andrew A.

    2011-10-01

    The Centre for Ion Beam Applications, National University of Singapore has recently expanded from three state-of-the-art beam lines to five. Two new beam lines have been constructed: A second generation proton beam writing line, and a high resolution single cell imaging facility. Both systems feature high demagnification lens systems based on compact Oxford Microbeams OM52 lenses, coupled with reduced lens/image distances. The single cell imaging facility is designed around OM52 compact lenses capable of operating in a variety of high demagnification configurations including the spaced Oxford triplet and the double crossover Russian quadruplet. The new facility has design specifications aimed at spatial resolutions below 50 nm, with a variety of techniques including STIM, secondary electron and fluorescence imaging, and an in-built optical and fluorescence microscope for sample imaging, identification and positioning. Preliminary tests using the single space Oxford triplet configuration have indicated a beam spot size of 31 × 39 nm in the horizontal and vertical directions respectively, at beam currents of ∼10,000 protons per second. However, a weakness in the specifications of the electrostatic scanning system has been identified, and a more stable scanning system needs to be implemented before we can fully realize the optimum performance. A single whole fibroblast cell has been scanned using 1.5 MeV protons, and a median fit to the proton transmission energy loss data has shown that proton STIM gives excellent details of the cell structure despite the relatively poor contrast of proton STIM compared with alpha STIM.

  11. The Singapore high resolution single cell imaging facility

    Energy Technology Data Exchange (ETDEWEB)

    Watt, Frank, E-mail: phywattf@nus.edu.sg [Centre for Ion Beam Applications, Dept. of Physics, National University of Singapore, Science Drive 3, Singapore 117542 (Singapore); Chen, Xiao; Vera, Armin Baysic De; Udalagama, Chammika N.B.; Ren, M.; Kan, Jeroen A van; Bettiol, Andrew A [Centre for Ion Beam Applications, Dept. of Physics, National University of Singapore, Science Drive 3, Singapore 117542 (Singapore)

    2011-10-15

    The Centre for Ion Beam Applications, National University of Singapore has recently expanded from three state-of-the-art beam lines to five. Two new beam lines have been constructed: A second generation proton beam writing line, and a high resolution single cell imaging facility. Both systems feature high demagnification lens systems based on compact Oxford Microbeams OM52 lenses, coupled with reduced lens/image distances. The single cell imaging facility is designed around OM52 compact lenses capable of operating in a variety of high demagnification configurations including the spaced Oxford triplet and the double crossover Russian quadruplet. The new facility has design specifications aimed at spatial resolutions below 50 nm, with a variety of techniques including STIM, secondary electron and fluorescence imaging, and an in-built optical and fluorescence microscope for sample imaging, identification and positioning. Preliminary tests using the single space Oxford triplet configuration have indicated a beam spot size of 31 x 39 nm in the horizontal and vertical directions respectively, at beam currents of {approx}10,000 protons per second. However, a weakness in the specifications of the electrostatic scanning system has been identified, and a more stable scanning system needs to be implemented before we can fully realize the optimum performance. A single whole fibroblast cell has been scanned using 1.5 MeV protons, and a median fit to the proton transmission energy loss data has shown that proton STIM gives excellent details of the cell structure despite the relatively poor contrast of proton STIM compared with alpha STIM.

  12. A PICTORIAL PRESENTATION OF ESOPHAGEAL HIGH RESOLUTION MANOMETRY CURRENT PARAMETERS.

    Science.gov (United States)

    Lafraia, Fernanda M; Herbella, Fernando A M; Kalluf, Julia R; Patti, Marco G

    2017-01-01

    High resolution manometry is the current technology used to the study of esophageal motility and is replacing conventional manometry in important centers for esophageal motility with parameters used on esophageal motility, following the Chicago Classification. This classification unifies high resolution manometry interpretation and classifies esophageal disorders. This review shows, in a pictorial presentation, the new parameters established by the Chicago Classification, version 3.0, aimed to allow an easy comprehension and interpretation of high resolution manometry. Esophageal manometries performed by the authors were reviewed to select illustrative tracings representing Chicago Classification parameters. The parameters are: Esophagogastric Morphology, that classifies this junction according to its physiology and anatomy; Integrated Relaxation Pressure, that measures the lower esophageal sphincter relaxation; Distal Contractile Integral, that evaluates the contraction vigor of each wave; and, Distal Latency, that measures the peristalsis velocity from the beginning of the swallow to the epiphrenic ampulla. Clinical applications of these new concepts is still under evaluation. Mostrar, de forma pictórica, os novos parâmetros compilados na versão 3.0 da Classificação de Chicago, buscando facilitar a compreensão e interpretação da manometria de alta resolução. Foram revistas as manometrias da casuística dos autores e selecionados os traçados representativos dos parâmetros da Classificação de Chicago. Entre os parâmetros apresentados foram considerados a Morfologia da Transição Gastroesofágica, que classifica o segmento de acordo com sua fisiologia e anatomia; a Integral da Pressão de Relaxamento, que mede o relaxamento do esfíncter esofagiano inferior; a Integral Contrátil Distal, que avalia o vigor contrátil da onda peristáltica; e, a Latência Distal, que mede o tempo da peristalse, desde o início da deglutição até a ampola epifr

  13. Isolation and analysis of high quality nuclear DNA with reduced organellar DNA for plant genome sequencing and resequencing.

    Science.gov (United States)

    Lutz, Kerry A; Wang, Wenqin; Zdepski, Anna; Michael, Todd P

    2011-05-20

    High throughput sequencing (HTS) technologies have revolutionized the field of genomics by drastically reducing the cost of sequencing, making it feasible for individual labs to sequence or resequence plant genomes. Obtaining high quality, high molecular weight DNA from plants poses significant challenges due to the high copy number of chloroplast and mitochondrial DNA, as well as high levels of phenolic compounds and polysaccharides. Multiple methods have been used to isolate DNA from plants; the CTAB method is commonly used to isolate total cellular DNA from plants that contain nuclear DNA, as well as chloroplast and mitochondrial DNA. Alternatively, DNA can be isolated from nuclei to minimize chloroplast and mitochondrial DNA contamination. We describe optimized protocols for isolation of nuclear DNA from eight different plant species encompassing both monocot and eudicot species. These protocols use nuclei isolation to minimize chloroplast and mitochondrial DNA contamination. We also developed a protocol to determine the number of chloroplast and mitochondrial DNA copies relative to the nuclear DNA using quantitative real time PCR (qPCR). We compared DNA isolated from nuclei to total cellular DNA isolated with the CTAB method. As expected, DNA isolated from nuclei consistently yielded nuclear DNA with fewer chloroplast and mitochondrial DNA copies, as compared to the total cellular DNA prepared with the CTAB method. This protocol will allow for analysis of the quality and quantity of nuclear DNA before starting a plant whole genome sequencing or resequencing experiment. Extracting high quality, high molecular weight nuclear DNA in plants has the potential to be a bottleneck in the era of whole genome sequencing and resequencing. The methods that are described here provide a framework for researchers to extract and quantify nuclear DNA in multiple types of plants.

  14. Isolation and analysis of high quality nuclear DNA with reduced organellar DNA for plant genome sequencing and resequencing

    Directory of Open Access Journals (Sweden)

    Zdepski Anna

    2011-05-01

    Full Text Available Abstract Background High throughput sequencing (HTS technologies have revolutionized the field of genomics by drastically reducing the cost of sequencing, making it feasible for individual labs to sequence or resequence plant genomes. Obtaining high quality, high molecular weight DNA from plants poses significant challenges due to the high copy number of chloroplast and mitochondrial DNA, as well as high levels of phenolic compounds and polysaccharides. Multiple methods have been used to isolate DNA from plants; the CTAB method is commonly used to isolate total cellular DNA from plants that contain nuclear DNA, as well as chloroplast and mitochondrial DNA. Alternatively, DNA can be isolated from nuclei to minimize chloroplast and mitochondrial DNA contamination. Results We describe optimized protocols for isolation of nuclear DNA from eight different plant species encompassing both monocot and eudicot species. These protocols use nuclei isolation to minimize chloroplast and mitochondrial DNA contamination. We also developed a protocol to determine the number of chloroplast and mitochondrial DNA copies relative to the nuclear DNA using quantitative real time PCR (qPCR. We compared DNA isolated from nuclei to total cellular DNA isolated with the CTAB method. As expected, DNA isolated from nuclei consistently yielded nuclear DNA with fewer chloroplast and mitochondrial DNA copies, as compared to the total cellular DNA prepared with the CTAB method. This protocol will allow for analysis of the quality and quantity of nuclear DNA before starting a plant whole genome sequencing or resequencing experiment. Conclusions Extracting high quality, high molecular weight nuclear DNA in plants has the potential to be a bottleneck in the era of whole genome sequencing and resequencing. The methods that are described here provide a framework for researchers to extract and quantify nuclear DNA in multiple types of plants.

  15. Isolation and analysis of high quality nuclear DNA with reduced organellar DNA for plant genome sequencing and resequencing

    Science.gov (United States)

    2011-01-01

    Background High throughput sequencing (HTS) technologies have revolutionized the field of genomics by drastically reducing the cost of sequencing, making it feasible for individual labs to sequence or resequence plant genomes. Obtaining high quality, high molecular weight DNA from plants poses significant challenges due to the high copy number of chloroplast and mitochondrial DNA, as well as high levels of phenolic compounds and polysaccharides. Multiple methods have been used to isolate DNA from plants; the CTAB method is commonly used to isolate total cellular DNA from plants that contain nuclear DNA, as well as chloroplast and mitochondrial DNA. Alternatively, DNA can be isolated from nuclei to minimize chloroplast and mitochondrial DNA contamination. Results We describe optimized protocols for isolation of nuclear DNA from eight different plant species encompassing both monocot and eudicot species. These protocols use nuclei isolation to minimize chloroplast and mitochondrial DNA contamination. We also developed a protocol to determine the number of chloroplast and mitochondrial DNA copies relative to the nuclear DNA using quantitative real time PCR (qPCR). We compared DNA isolated from nuclei to total cellular DNA isolated with the CTAB method. As expected, DNA isolated from nuclei consistently yielded nuclear DNA with fewer chloroplast and mitochondrial DNA copies, as compared to the total cellular DNA prepared with the CTAB method. This protocol will allow for analysis of the quality and quantity of nuclear DNA before starting a plant whole genome sequencing or resequencing experiment. Conclusions Extracting high quality, high molecular weight nuclear DNA in plants has the potential to be a bottleneck in the era of whole genome sequencing and resequencing. The methods that are described here provide a framework for researchers to extract and quantify nuclear DNA in multiple types of plants. PMID:21599914

  16. Development of high speed integrated circuit for very high resolution timing measurements

    Energy Technology Data Exchange (ETDEWEB)

    Mester, Christian

    2009-10-15

    A multi-channel high-precision low-power time-to-digital converter application specific integrated circuit for high energy physics applications has been designed and implemented in a 130 nm CMOS process. To reach a target resolution of 24.4 ps, a novel delay element has been conceived. This nominal resolution has been experimentally verified with a prototype, with a minimum resolution of 19 ps. To further improve the resolution, a new interpolation scheme has been described. The ASIC has been designed to use a reference clock with the LHC bunch crossing frequency of 40 MHz and generate all required timing signals internally, to ease to use within the framework of an LHC upgrade. Special care has been taken to minimise the power consumption. (orig.)

  17. Ribbon scanning confocal for high-speed high-resolution volume imaging of brain.

    Directory of Open Access Journals (Sweden)

    Alan M Watson

    Full Text Available Whole-brain imaging is becoming a fundamental means of experimental insight; however, achieving subcellular resolution imagery in a reasonable time window has not been possible. We describe the first application of multicolor ribbon scanning confocal methods to collect high-resolution volume images of chemically cleared brains. We demonstrate that ribbon scanning collects images over ten times faster than conventional high speed confocal systems but with equivalent spectral and spatial resolution. Further, using this technology, we reconstruct large volumes of mouse brain infected with encephalitic alphaviruses and demonstrate that regions of the brain with abundant viral replication were inaccessible to vascular perfusion. This reveals that the destruction or collapse of large regions of brain micro vasculature may contribute to the severe disease caused by Venezuelan equine encephalitis virus. Visualization of this fundamental impact of infection would not be possible without sampling at subcellular resolution within large brain volumes.

  18. A new high-resolution electromagnetic method for subsurface imaging

    Science.gov (United States)

    Feng, Wanjie

    For most electromagnetic (EM) geophysical systems, the contamination of primary fields on secondary fields ultimately limits the capability of the controlled-source EM methods. Null coupling techniques were proposed to solve this problem. However, the small orientation errors in the null coupling systems greatly restrict the applications of these systems. Another problem encountered by most EM systems is the surface interference and geologic noise, which sometimes make the geophysical survey impossible to carry out. In order to solve these problems, the alternating target antenna coupling (ATAC) method was introduced, which greatly removed the influence of the primary field and reduced the surface interference. But this system has limitations on the maximum transmitter moment that can be used. The differential target antenna coupling (DTAC) method was proposed to allow much larger transmitter moments and at the same time maintain the advantages of the ATAC method. In this dissertation, first, the theoretical DTAC calculations were derived mathematically using Born and Wolf's complex magnetic vector. 1D layered and 2D blocked earth models were used to demonstrate that the DTAC method has no responses for 1D and 2D structures. Analytical studies of the plate model influenced by conductive and resistive backgrounds were presented to explain the physical phenomenology behind the DTAC method, which is the magnetic fields of the subsurface targets are required to be frequency dependent. Then, the advantages of the DTAC method, e.g., high-resolution, reducing the geologic noise and insensitive to surface interference, were analyzed using surface and subsurface numerical examples in the EMGIMA software. Next, the theoretical advantages, such as high resolution and insensitive to surface interference, were verified by designing and developing a low-power (moment of 50 Am 2) vertical-array DTAC system and testing it on controlled targets and scaled target coils. At last, a

  19. A Comparative Analysis of Translesion DNA Synthesis Catalyzed by a High-Fidelity DNA Polymerase.

    Science.gov (United States)

    Dasari, Anvesh; Deodhar, Tejal; Berdis, Anthony J

    2017-07-21

    Translesion DNA synthesis (TLS) is the ability of DNA polymerases to incorporate nucleotides opposite and beyond damaged DNA. TLS activity is an important risk factor for the initiation and progression of genetic diseases such as cancer. In this study, we evaluate the ability of a high-fidelity DNA polymerase to perform TLS with 8-oxo-guanine (8-oxo-G), a highly pro-mutagenic DNA lesion formed by reactive oxygen species. Results of kinetic studies monitoring the incorporation of modified nucleotide analogs demonstrate that the binding affinity of the incoming dNTP is controlled by the overall hydrophobicity of the nucleobase. However, the rate constant for the polymerization step is regulated by hydrogen-bonding interactions made between the incoming nucleotide with 8-oxo-G. Results generated here for replicating the miscoding 8-oxo-G are compared to those published for the replication of the non-instructional abasic site. During the replication of both lesions, binding of the nucleotide substrate is controlled by energetics associated with nucleobase desolvation, whereas the rate constant for the polymerization step is influenced by the physical nature of the DNA lesion, that is, miscoding versus non-instructional. Collectively, these studies highlight the importance of nucleobase desolvation as a key physical feature that enhances the misreplication of structurally diverse DNA lesions. Copyright © 2017 Elsevier Ltd. All rights reserved.

  20. Subnuclear localization, rates and effectiveness of UVC-induced unscheduled DNA synthesis visualized by fluorescence widefield, confocal and super-resolution microscopy.

    Science.gov (United States)

    Pierzyńska-Mach, Agnieszka; Szczurek, Aleksander; Cella Zanacchi, Francesca; Pennacchietti, Francesca; Drukała, Justyna; Diaspro, Alberto; Cremer, Christoph; Darzynkiewicz, Zbigniew; Dobrucki, Jurek W

    2016-01-01

    Unscheduled DNA synthesis (UDS) is the final stage of the process of repair of DNA lesions induced by UVC. We detected UDS using a DNA precursor, 5-ethynyl-2'-deoxyuridine (EdU). Using wide-field, confocal and super-resolution fluorescence microscopy and normal human fibroblasts, derived from healthy subjects, we demonstrate that the sub-nuclear pattern of UDS detected via incorporation of EdU is different from that when BrdU is used as DNA precursor. EdU incorporation occurs evenly throughout chromatin, as opposed to just a few small and large repair foci detected by BrdU. We attribute this difference to the fact that BrdU antibody is of much larger size than EdU, and its accessibility to the incorporated precursor requires the presence of denatured sections of DNA. It appears that under the standard conditions of immunocytochemical detection of BrdU only fragments of DNA of various length are being denatured. We argue that, compared with BrdU, the UDS pattern visualized by EdU constitutes a more faithful representation of sub-nuclear distribution of the final stage of nucleotide excision repair induced by UVC. Using the optimized integrated EdU detection procedure we also measured the relative amount of the DNA precursor incorporated by cells during UDS following exposure to various doses of UVC. Also described is the high degree of heterogeneity in terms of the UVC-induced EdU incorporation per cell, presumably reflecting various DNA repair efficiencies or differences in the level of endogenous dT competing with EdU within a population of normal human fibroblasts.