Nucleotide sequence preservation of human mitochondrial DNA
International Nuclear Information System (INIS)
Monnat, R.J. Jr.; Loeb, L.A.
1985-01-01
Recombinant DNA techniques have been used to quantitate the amount of nucleotide sequence divergence in the mitochondrial DNA population of individual normal humans. Mitochondrial DNA was isolated from the peripheral blood lymphocytes of five normal humans and cloned in M13 mp11; 49 kilobases of nucleotide sequence information was obtained from 248 independently isolated clones from the five normal donors. Both between- and within-individual differences were identified. Between-individual differences were identified in approximately = to 1/200 nucleotides. In contrast, only one within-individual difference was identified in 49 kilobases of nucleotide sequence information. This high degree of mitochondrial nucleotide sequence homogeneity in human somatic cells is in marked contrast to the rapid evolutionary divergence of human mitochondrial DNA and suggests the existence of mechanisms for the concerted preservation of mammalian mitochondrial DNA sequences in single organisms
DNA Nucleotide Sequence Restricted by the RI Endonuclease
Hedgpeth, Joe; Goodman, Howard M.; Boyer, Herbert W.
1972-01-01
The sequence of DNA base pairs adjacent to the phosphodiester bonds cleaved by the RI restriction endonuclease in unmodified DNA from coliphage λ has been determined. The 5′-terminal nucleotide labeled with 32P and oligonucleotides up to the heptamer were analyzed from a pancreatic DNase digest. The following sequence of nucleotides adjacent to the RI break made in λ DNA was deduced from these data and from the 3′-dinucleotide sequence and nearest-neighbor analysis obtained from repair synthesis with the DNA polymerase of Rous sarcoma virus [Formula: see text] The RI endonuclease cleavage of the phosphodiester bonds (indicated by arrows) generates 5′-phosphoryls and short cohesive termini of four nucleotides, pApApTpT. The most striking feature of the sequence is its symmetry. PMID:4343974
Nucleotide sequence and genetic organization of barley stripe mosaic virus RNA gamma.
Gustafson, G; Hunter, B; Hanau, R; Armour, S L; Jackson, A O
1987-06-01
The complete nucleotide sequences of RNA gamma from the Type and ND18 strains of barley stripe mosaic virus (BSMV) have been determined. The sequences are 3164 (Type) and 2791 (ND18) nucleotides in length. Both sequences contain a 5'-noncoding region (87 or 88 nucleotides) which is followed by a long open reading frame (ORF1). A 42-nucleotide intercistronic region separates ORF1 from a second, shorter open reading frame (ORF2) located near the 3'-end of the RNA. There is a high degree of homology between the Type and ND18 strains in the nucleotide sequence of ORF1. However, the Type strain contains a 366 nucleotide direct tandem repeat within ORF1 which is absent in the ND18 strain. Consequently, the predicted translation product of Type RNA gamma ORF1 (mol wt 87,312) is significantly larger than that of ND18 RNA gamma ORF1 (mol wt 74,011). The amino acid sequence of the ORF1 polypeptide contains homologies with putative RNA polymerases from other RNA viruses, suggesting that this protein may function in replication of the BSMV genome. The nucleotide sequence of RNA gamma ORF2 is nearly identical in the Type and ND18 strains. ORF2 codes for a polypeptide with a predicted molecular weight of 17,209 (Type) or 17,074 (ND18) which is known to be translated from a subgenomic (sg) RNA. The initiation point of this sgRNA has been mapped to a location 27 nucleotides upstream of the ORF2 initiation codon in the intercistronic region between ORF1 and ORF2. The sgRNA is not coterminal with the 3'-end of the genomic RNA, but instead contains heterogeneous poly(A) termini up to 150 nucleotides long (J. Stanley, R. Hanau, and A. O. Jackson, 1984, Virology 139, 375-383). In the genomic RNA gamma, ORF2 is followed by a short poly(A) tract and a 238-nucleotide tRNA-like structure.
The nucleotide sequence of satellite RNA in grapevine fanleaf virus, strain F13.
Fuchs, M; Pinck, M; Serghini, M A; Ravelonandro, M; Walter, B; Pinck, L
1989-04-01
The nucleotide sequence of cDNA copies of grapevine fanleaf virus (strain F13) satellite RNA has been determined. The primary structure obtained was 1114 nucleotides in length, excluding the poly(A) tail, and contained only one long open reading frame encoding a 341 residue, highly hydrophilic polypeptide of Mr37275. The coding sequence was bordered by a leader of 14 nucleotides and a 3'-terminal non-coding region of 74 nucleotides. No homology has been found with small satellite RNAs associated with other nepoviruses. Two limited homologies of eight nucleotides have been detected between the satellite RNA in grapevine fanleaf virus and those in tomato black ring virus, and a consensus sequence U.G/UGAAAAU/AU/AU/A at the 5' end of nepovirus RNAs is reported. A less extended consensus exists in this region in comovirus and picornavirus RNA.
Quantum Point Contact Single-Nucleotide Conductance for DNA and RNA Sequence Identification.
Afsari, Sepideh; Korshoj, Lee E; Abel, Gary R; Khan, Sajida; Chatterjee, Anushree; Nagpal, Prashant
2017-11-28
Several nanoscale electronic methods have been proposed for high-throughput single-molecule nucleic acid sequence identification. While many studies display a large ensemble of measurements as "electronic fingerprints" with some promise for distinguishing the DNA and RNA nucleobases (adenine, guanine, cytosine, thymine, and uracil), important metrics such as accuracy and confidence of base calling fall well below the current genomic methods. Issues such as unreliable metal-molecule junction formation, variation of nucleotide conformations, insufficient differences between the molecular orbitals responsible for single-nucleotide conduction, and lack of rigorous base calling algorithms lead to overlapping nanoelectronic measurements and poor nucleotide discrimination, especially at low coverage on single molecules. Here, we demonstrate a technique for reproducible conductance measurements on conformation-constrained single nucleotides and an advanced algorithmic approach for distinguishing the nucleobases. Our quantum point contact single-nucleotide conductance sequencing (QPICS) method uses combed and electrostatically bound single DNA and RNA nucleotides on a self-assembled monolayer of cysteamine molecules. We demonstrate that by varying the applied bias and pH conditions, molecular conductance can be switched ON and OFF, leading to reversible nucleotide perturbation for electronic recognition (NPER). We utilize NPER as a method to achieve >99.7% accuracy for DNA and RNA base calling at low molecular coverage (∼12×) using unbiased single measurements on DNA/RNA nucleotides, which represents a significant advance compared to existing sequencing methods. These results demonstrate the potential for utilizing simple surface modifications and existing biochemical moieties in individual nucleobases for a reliable, direct, single-molecule, nanoelectronic DNA and RNA nucleotide identification method for sequencing.
The International Nucleotide Sequence Database Collaboration.
Cochrane, Guy; Karsch-Mizrachi, Ilene; Nakamura, Yasukazu
2011-01-01
Under the International Nucleotide Sequence Database Collaboration (INSDC; http://www.insdc.org), globally comprehensive public domain nucleotide sequence is captured, preserved and presented. The partners of this long-standing collaboration work closely together to provide data formats and conventions that enable consistent data submission to their databases and support regular data exchange around the globe. Clearly defined policy and governance in relation to free access to data and relationships with journal publishers have positioned INSDC databases as a key provider of the scientific record and a core foundation for the global bioinformatics data infrastructure. While growth in sequence data volumes comes no longer as a surprise to INSDC partners, the uptake of next-generation sequencing technology by mainstream science that we have witnessed in recent years brings a step-change to growth, necessarily making a clear mark on INSDC strategy. In this article, we introduce the INSDC, outline data growth patterns and comment on the challenges of increased growth.
Statistical properties and fractals of nucleotide clusters in DNA sequences
International Nuclear Information System (INIS)
Sun Tingting; Zhang Linxi; Chen Jin; Jiang Zhouting
2004-01-01
Statistical properties of nucleotide clusters in DNA sequences and their fractals are investigated in this paper. The average size of nucleotide clusters in non-coding sequence is larger than that in coding sequence. We investigate the cluster-size distribution P(S) for human chromosomes 21 and 22, and the results are different from previous works. The cluster-size distribution P(S 1 +S 2 ) with the total size of sequential Pu-cluster and Py-cluster S 1 +S 2 is studied. We observe that P(S 1 +S 2 ) follows an exponential decay both in coding and non-coding sequences. However, we get different results for human chromosomes 21 and 22. The probability distribution P(S 1 ,S 2 ) of nucleotide clusters with the size of sequential Pu-cluster and Py-cluster S 1 and S 2 respectively, is also examined. In the meantime, some of the linear correlations are obtained in the double logarithmic plots of the fluctuation F(l) versus nucleotide cluster distance l along the DNA chain. The power spectrums of nucleotide clusters are also discussed, and it is concluded that the curves are flat and hardly changed and the 1/3 frequency is neither observed in coding sequence nor in non-coding sequence. These investigations can provide some insights into the nucleotide clusters of DNA sequences
A novel Y-xylosidase, nucleotide sequence encoding it and use thereof.
Graaff, de L.H.; Peij, van N.N.M.E.; Broeck, van den H.C.; Visser, J.
1996-01-01
A nucleotide sequence is provided which encodes a peptide having beta-xylosidase activity and exhibits at least 30mino acid identity with the amino acid sequence shown in SEQ ID NO. 1 or hybridises under stringent conditions with a nucleotide sequence shown in SEQ ID NO. 1, or a part thereof having
The nucleotide sequences of two leghemoglobin genes from soybean
DEFF Research Database (Denmark)
Wiborg, O; Hyldig-Nielsen, J J; Jensen, E O
1982-01-01
We present the complete nucleotide sequences of two leghemoglobin genes isolated from soybean DNA. Both genes contain three intervening sequences in identical positions. Comparison of the coding sequences with known amino-acid sequences of soybean leghemoglobins suggest that the two genes...
Single-nucleotide polymorphism discovery by high-throughput sequencing in sorghum
Directory of Open Access Journals (Sweden)
White Frank F
2011-07-01
Full Text Available Abstract Background Eight diverse sorghum (Sorghum bicolor L. Moench accessions were subjected to short-read genome sequencing to characterize the distribution of single-nucleotide polymorphisms (SNPs. Two strategies were used for DNA library preparation. Missing SNP genotype data were imputed by local haplotype comparison. The effect of library type and genomic diversity on SNP discovery and imputation are evaluated. Results Alignment of eight genome equivalents (6 Gb to the public reference genome revealed 283,000 SNPs at ≥82% confirmation probability. Sequencing from libraries constructed to limit sequencing to start at defined restriction sites led to genotyping 10-fold more SNPs in all 8 accessions, and correctly imputing 11% more missing data, than from semirandom libraries. The SNP yield advantage of the reduced-representation method was less than expected, since up to one fifth of reads started at noncanonical restriction sites and up to one third of restriction sites predicted in silico to yield unique alignments were not sampled at near-saturation. For imputation accuracy, the availability of a genomically similar accession in the germplasm panel was more important than panel size or sequencing coverage. Conclusions A sequence quantity of 3 million 50-base reads per accession using a BsrFI library would conservatively provide satisfactory genotyping of 96,000 sorghum SNPs. For most reliable SNP-genotype imputation in shallowly sequenced genomes, germplasm panels should consist of pairs or groups of genomically similar entries. These results may help in designing strategies for economical genotyping-by-sequencing of large numbers of plant accessions.
Nucleotide sequence of the coat protein gene of the Skierniewice isolate of plum pox virus (PPV)
International Nuclear Information System (INIS)
Wypijewski, K.; Musial, W.; Augustyniak, J.; Malinowski, T.
1994-01-01
The coat protein (CP) gene of the Skierniewice isolate of plum pox virus (PPV-S) has been amplified using the reverse transcription - polymerase chain reaction (RT-PCR), cloned and sequenced. The nucleotide sequence of the gene and the deduced amino-acid sequences of PPV-S CP were compared with those of other PPV strains. The nucleotide sequence showed very high homology to most of the published sequences. The motif: Asp-Ala-Gly (DAG), important for the aphid transmissibility, was present in the amino-acid sequence. Our isolate did not react in ELISA with monoclonal antibodies MAb06 supposed to be specific for PPV-D. (author). 32 refs, 1 fig., 2 tabs
WEB-server for search of a periodicity in amino acid and nucleotide sequences
E Frenkel, F.; Skryabin, K. G.; Korotkov, E. V.
2017-12-01
A new web server (http://victoria.biengi.ac.ru/splinter/login.php) was designed and developed to search for periodicity in nucleotide and amino acid sequences. The web server operation is based upon a new mathematical method of searching for multiple alignments, which is founded on the position weight matrices optimization, as well as on implementation of the two-dimensional dynamic programming. This approach allows the construction of multiple alignments of the indistinctly similar amino acid and nucleotide sequences that accumulated more than 1.5 substitutions per a single amino acid or a nucleotide without performing the sequences paired comparisons. The article examines the principles of the web server operation and two examples of studying amino acid and nucleotide sequences, as well as information that could be obtained using the web server.
Resampling nucleotide sequences with closest-neighbor trimming and its comparison to other methods.
Directory of Open Access Journals (Sweden)
Kouki Yonezawa
Full Text Available A large number of nucleotide sequences of various pathogens are available in public databases. The growth of the datasets has resulted in an enormous increase in computational costs. Moreover, due to differences in surveillance activities, the number of sequences found in databases varies from one country to another and from year to year. Therefore, it is important to study resampling methods to reduce the sampling bias. A novel algorithm-called the closest-neighbor trimming method-that resamples a given number of sequences from a large nucleotide sequence dataset was proposed. The performance of the proposed algorithm was compared with other algorithms by using the nucleotide sequences of human H3N2 influenza viruses. We compared the closest-neighbor trimming method with the naive hierarchical clustering algorithm and [Formula: see text]-medoids clustering algorithm. Genetic information accumulated in public databases contains sampling bias. The closest-neighbor trimming method can thin out densely sampled sequences from a given dataset. Since nucleotide sequences are among the most widely used materials for life sciences, we anticipate that our algorithm to various datasets will result in reducing sampling bias.
Nucleotide sequence and genetic organization of Hungarian grapevine chrome mosaic nepovirus RNA2.
Brault, V; Hibrand, L; Candresse, T; Le Gall, O; Dunez, J
1989-10-11
The complete nucleotide sequence of hungarian grapevine chrome mosaic nepovirus (GCMV) RNA2 has been determined. The RNA sequence is 4441 nucleotides in length, excluding the poly(A) tail. A polyprotein of 1324 amino acids with a calculated molecular weight of 146 kDa is encoded in a single long open reading frame extending from nucleotides 218 to 4190. This polyprotein is homologous with the protein encoded by the S strain of tomato black ring virus (TBRV) RNA2, the only other nepovirus sequenced so far. Direct sequencing of the viral coat protein and in vitro translation of transcripts derived from cDNA sequences demonstrate that, as for comoviruses, the coat protein is located at the carboxy terminus of the polyprotein. A model for the expression of GCMV RNA2 is presented.
Tedersoo, Leho; Abarenkov, Kessy; Nilsson, R Henrik; Schüssler, Arthur; Grelet, Gwen-Aëlle; Kohout, Petr; Oja, Jane; Bonito, Gregory M; Veldre, Vilmar; Jairus, Teele; Ryberg, Martin; Larsson, Karl-Henrik; Kõljalg, Urmas
2011-01-01
Sequence analysis of the ribosomal RNA operon, particularly the internal transcribed spacer (ITS) region, provides a powerful tool for identification of mycorrhizal fungi. The sequence data deposited in the International Nucleotide Sequence Databases (INSD) are, however, unfiltered for quality and are often poorly annotated with metadata. To detect chimeric and low-quality sequences and assign the ectomycorrhizal fungi to phylogenetic lineages, fungal ITS sequences were downloaded from INSD, aligned within family-level groups, and examined through phylogenetic analyses and BLAST searches. By combining the fungal sequence database UNITE and the annotation and search tool PlutoF, we also added metadata from the literature to these accessions. Altogether 35,632 sequences belonged to mycorrhizal fungi or originated from ericoid and orchid mycorrhizal roots. Of these sequences, 677 were considered chimeric and 2,174 of low read quality. Information detailing country of collection, geographical coordinates, interacting taxon and isolation source were supplemented to cover 78.0%, 33.0%, 41.7% and 96.4% of the sequences, respectively. These annotated sequences are publicly available via UNITE (http://unite.ut.ee/) for downstream biogeographic, ecological and taxonomic analyses. In European Nucleotide Archive (ENA; http://www.ebi.ac.uk/ena/), the annotated sequences have a special link-out to UNITE. We intend to expand the data annotation to additional genes and all taxonomic groups and functional guilds of fungi.
Nucleotide sequence of Hungarian grapevine chrome mosaic nepovirus RNA1.
Le Gall, O; Candresse, T; Brault, V; Dunez, J
1989-01-01
The nucleotide sequence of the RNA1 of hungarian grapevine chrome mosaic virus, a nepovirus very closely related to tomato black ring virus, has been determined from cDNA clones. It is 7212 nucleotides in length excluding the 3' terminal poly(A) tail and contains a large open reading frame extending from nucleotides 216 to 6971. The presumably encoded polyprotein is 2252 amino acids in length with a molecular weight of 250 kDa. The primary structure of the polyprotein was compared with that o...
Nucleotide sequence of tomato ringspot virus RNA-2.
Rott, M E; Tremaine, J H; Rochon, D M
1991-07-01
The sequence of tomato ringspot virus (TomRSV) RNA-2 has been determined. It is 7273 nucleotides in length excluding the 3' poly(A) tail and contains a single long open reading frame (ORF) of 5646 nucleotides in the positive sense beginning at position 78 and terminating at position 5723. A second in-frame AUG at position 441 is in a more favourable context for initiation of translation and may act as a site for initiation of translation. The TomRSV RNA-2 3' noncoding region is 1550 nucleotides in length. The coat protein is located in the C-terminal region of the large polypeptide and shows significant but limited amino acid sequence similarity to the putative coat proteins of the nepoviruses tomato black ring (TBRV), Hungarian grapevine chrome mosaic (GCMV) and grapevine fanleaf (GFLV). Comparisons of the coding and non-coding regions of TomRSV RNA-2 and the RNA components of TBRV, GCMV, GFLV and the comovirus cowpea mosaic virus revealed significant similarity for over 300 amino acids between the coding region immediately to the N-terminal side of the putative coat proteins of TomRSV and GFLV; very little similarity could be detected among the non-coding regions of TomRSV and any of these viruses.
Naidu, Hariprasad; Subramanian, B Mohana; Chinchkar, Shankar Ramchandra; Sriraman, Rajan; Rana, Samir Kumar; Srinivasan, V A
2012-05-01
The antigenic types of canine parvovirus (CPV) are defined based on differences in the amino acids of the major capsid protein VP2. Type specificity is conferred by a limited number of amino acid changes and in particular by few nucleotide substitutions. PCR based methods are not particularly suitable for typing circulating variants which differ in a few specific nucleotide substitutions. Assays for determining SNPs can detect efficiently nucleotide substitutions and can thus be adapted to identify CPV types. In the present study, CPV typing was performed by single nucleotide extension using the mini-sequencing technique. A mini-sequencing signature was established for all the four CPV types (CPV2, 2a, 2b and 2c) and feline panleukopenia virus. The CPV typing using the mini-sequencing reaction was performed for 13 CPV field isolates and the two vaccine strains available in our repository. All the isolates had been typed earlier by full-length sequencing of the VP2 gene. The typing results obtained from mini-sequencing matched completely with that of sequencing. Typing could be achieved with less than 100 copies of standard plasmid DNA constructs or ≤10¹ FAID₅₀ of virus by mini-sequencing technique. The technique was also efficient for detecting multiple types in mixed infections. Copyright © 2012 Elsevier B.V. All rights reserved.
Nucleotide sequence composition and method for detection of neisseria gonorrhoeae
International Nuclear Information System (INIS)
Lo, A.; Yang, H.L.
1990-01-01
This patent describes a composition of matter that is specific for Neisseria gonorrhoeae. It comprises: at least one nucleotide sequence for which the ratio of the amount of the sequence which hybridizes to chromosomal DNA of Neisseria gonorrhoeae to the amount of the sequence which hybridizes to chromosomal DNA of Neisseria meningitidis is greater than about five. The ratio being obtained by a method described
cDNA cloning and nucleotide sequence comparison of Chinese hamster metallothionein I and II mRNAs
Energy Technology Data Exchange (ETDEWEB)
Griffith, B B; Walters, R A; Enger, M D; Hildebrand, C E; Griffith, J K
1983-01-01
Polyadenylated RNA was extracted from a cadmium resistant Chinese hamster (CHO) cell line, enriched for metal-induced, abundant RNA sequences and cloned as double-stranded cDNA in the plasmid pBR322. Two cDNA clones, pCHMT1 and pCHMT2, encoding two Chinese hamster isometallothioneins were identified, and the nucleotide sequence of each insert was determined. The two Chinese hamster metallothioneins show nucleotide sequence homologies of 80% in the protein coding region and approximately 35% in both the 5' and 3' untranslated regions. Interestingly, an 8 nucleotide sequence (TGTAAATA) has been conserved in sequence and position in the 3' untranslated regions of each metallothionein mRNA sequenced thus far. Estimated nucleotide substitution rates derived from interspecies comparisons were used to calculate a metallothionein gene duplication time of 45 to 120 million years ago. 39 references, 1 figure, 1 table.
Trucco, Verónica; de Breuil, Soledad; Bejerman, Nicolás; Lenardon, Sergio; Giolitti, Fabián
2014-06-01
The complete nucleotide sequence of an Alfalfa mosaic virus (AMV) isolate infecting alfalfa (Medicago sativa L.) in Argentina, AMV-Arg, was determined. The virus genome has the typical organization described for AMV, and comprises 3,643, 2,593, and 2,038 nucleotides for RNA1, 2 and 3, respectively. The whole genome sequence and each encoding region were compared with those of other four isolates that have been completely sequenced from China, Italy, Spain and USA. The nucleotide identity percentages ranged from 95.9 to 99.1 % for the three RNAs and from 93.7 to 99 % for the protein 1 (P1), protein 2 (P2), movement protein and coat protein (CP) encoding regions, whereas the amino acid identity percentages of these proteins ranged from 93.4 to 99.5 %, the lowest value corresponding to P2. CP sequences of AMV-Arg were compared with those of other 25 available isolates, and the phylogenetic analysis based on the CP gene was carried out. The highest percentage of nucleotide sequence identity of the CP gene was 98.3 % with a Chinese isolate and 98.6 % at the amino acid level with four isolates, two from Italy, one from Brazil and the remaining one from China. The phylogenetic analysis showed that AMV-Arg is closely related to subgroup I of AMV isolates. To our knowledge, this is the first report of a complete nucleotide sequence of AMV from South America and the first worldwide report of complete nucleotide sequence of AMV isolated from alfalfa as natural host.
Complete nucleotide sequences of avian metapneumovirus subtype B genome.
Sugiyama, Miki; Ito, Hiroshi; Hata, Yusuke; Ono, Eriko; Ito, Toshihiro
2010-12-01
Complete nucleotide sequences were determined for subtype B avian metapneumovirus (aMPV), the attenuated vaccine strain VCO3/50 and its parental pathogenic strain VCO3/60616. The genomes of both strains comprised 13,508 nucleotides (nt), with a 42-nt leader at the 3'-end and a 46-nt trailer at the 5'-end. The genome contains eight genes in the order 3'-N-P-M-F-M2-SH-G-L-5', which is the same order shown in the other metapneumoviruses. The genes are flanked on either side by conserved transcriptional start and stop signals and have intergenic sequences varying in length from 1 to 88 nt. Comparison of nt and predicted amino acid (aa) sequences of VCO3/60616 with those of other metapneumoviruses revealed higher homology with aMPV subtype A virus than with other metapneumoviruses. A total of 18 nt and 10 deduced aa differences were seen between the strains, and one or a combination of several differences could be associated with attenuation of VCO3/50.
Nucleotide sequence composition and method for detection of neisseria gonorrhoeae
Energy Technology Data Exchange (ETDEWEB)
Lo, A.; Yang, H.L.
1990-02-13
This patent describes a composition of matter that is specific for {ital Neisseria gonorrhoeae}. It comprises: at least one nucleotide sequence for which the ratio of the amount of the sequence which hybridizes to chromosomal DNA of {ital Neisseria gonorrhoeae} to the amount of the sequence which hybridizes to chromosomal DNA of {ital Neisseria meningitidis} is greater than about five. The ratio being obtained by a method described.
Sequencing genes in silico using single nucleotide polymorphisms
Directory of Open Access Journals (Sweden)
Zhang Xinyi
2012-01-01
Full Text Available Abstract Background The advent of high throughput sequencing technology has enabled the 1000 Genomes Project Pilot 3 to generate complete sequence data for more than 906 genes and 8,140 exons representing 697 subjects. The 1000 Genomes database provides a critical opportunity for further interpreting disease associations with single nucleotide polymorphisms (SNPs discovered from genetic association studies. Currently, direct sequencing of candidate genes or regions on a large number of subjects remains both cost- and time-prohibitive. Results To accelerate the translation from discovery to functional studies, we propose an in silico gene sequencing method (ISS, which predicts phased sequences of intragenic regions, using SNPs. The key underlying idea of our method is to infer diploid sequences (a pair of phased sequences/alleles at every functional locus utilizing the deep sequencing data from the 1000 Genomes Project and SNP data from the HapMap Project, and to build prediction models using flanking SNPs. Using this method, we have developed a database of prediction models for 611 known genes. Sequence prediction accuracy for these genes is 96.26% on average (ranges 79%-100%. This database of prediction models can be enhanced and scaled up to include new genes as the 1000 Genomes Project sequences additional genes on additional individuals. Applying our predictive model for the KCNJ11 gene to the Wellcome Trust Case Control Consortium (WTCCC Type 2 diabetes cohort, we demonstrate how the prediction of phased sequences inferred from GWAS SNP genotype data can be used to facilitate interpretation and identify a probable functional mechanism such as protein changes. Conclusions Prior to the general availability of routine sequencing of all subjects, the ISS method proposed here provides a time- and cost-effective approach to broadening the characterization of disease associated SNPs and regions, and facilitating the prioritization of candidate
Directory of Open Access Journals (Sweden)
Cheng-Chong Chou
2004-11-01
Full Text Available Enteroviruses are environmental triggers in the pathogenesis of type 1 diabetes mellitus (DM. A sequence of six identical amino acids (PEVKEK is shared by the 2C protein of Coxsackie virus B and the glutamic acid decarboxylase (GAD molecules. Between 1995 and 2002, we investigated 22 Coxsackie virus B5 (CVB5 isolates from southern Taiwan. Four of these isolates were obtained from four new-onset type 1 DM patients with diabetic ketoacidosis. We compared a 300 nucleotide sequence in the 2C protein gene (p2C in 24 CVB5 isolates (4 diabetogenic, 18 non-diabetogenic and 2 prototype. We found 0.3-10% nucleotide differences. In the four isolates from type 1 DM patients, there was only 2.4-3.4% nucleotide difference, and there was only 1.7-7.1% nucleotide difference between type 1 DM isolates and non-diabetogenic isolates. Comparison of the nucleotide sequence between prototype virus and 22 CVB5 isolates revealed 18.4-24.1% difference. Twenty-one CVB5 isolates from type 1 DM and non-type 1 DM patients contained the PEVKEK sequence, as shown by the p2C nucleotide sequence. Our data showed that the viral p2C sequence with homology with GAD is highly conserved in CVB5 isolates. There was no difference between diabetogenic and non-diabetogenic CVB5 isolates. All four type 1 DM patients had at least one of the genetic susceptibility alleles HLA-DR, DQA1, DQB1. Other genetic and autoimmune factors such as HLA genetic susceptibility and GAD may also play important roles in the pathogenesis in type 1 DM.
International Nuclear Information System (INIS)
Osanya, A.; Majiwa, P.A.O.; Kinyanjui, P.W.
2006-01-01
Specific oligonucleotide primers based on conserved nucleotide sequences of 18s ribisomal RNA (18s rRNA) gene of Trypanosoma brucei, Leishmania donovani, Triponema aequale and Lagenidium gigantum have been designed and used in the ploymerase chain reaction (PCR) to amplify genomic DNA from four different clones each representing a different genotypic group of T. congolence. PCR products of approximately 1Kb were generated using as template DNA from each of the trypanosomes. The PCR products cross-hybridized with genomic DNA from T.brucei, T. simiae and the four genotypes of T.congolense implying significant sequence homology of 18S rRNA gene among trypanosomes. The nucleotide sequence of a segment of the PCR products were determined by direct sequencing to provide partial nucleotide sequence of the 18s rRNA gene in each T.congolense genotypic group. The sequences obtained together with those that have been published for T.brucei reveals that although most regions show inter and intra species nucleotide identity, there are several sites where deletions, insertions and base changes have occured in nucleotide sequence of of T.brucei and the four genotypes of T.congolense.(author)
The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.
Hori, H; Osawa, S; Murao, K; Ishikura, H
1980-01-01
The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria. PMID:6780979
Nucleotide sequence of Hungarian grapevine chrome mosaic nepovirus RNA1.
Le Gall, O; Candresse, T; Brault, V; Dunez, J
1989-10-11
The nucleotide sequence of the RNA1 of hungarian grapevine chrome mosaic virus, a nepovirus very closely related to tomato black ring virus, has been determined from cDNA clones. It is 7212 nucleotides in length excluding the 3' terminal poly(A) tail and contains a large open reading frame extending from nucleotides 216 to 6971. The presumably encoded polyprotein is 2252 amino acids in length with a molecular weight of 250 kDa. The primary structure of the polyprotein was compared with that of other viral polyproteins, revealing the same general genetic organization as that of other picorna-like viruses (comoviruses, potyviruses and picornaviruses), except that an additional protein is suspected to occupy the N-terminus of the polyprotein.
Directory of Open Access Journals (Sweden)
Boulund Fredrik
2012-12-01
Full Text Available Abstract Background Broad-spectrum fluoroquinolone antibiotics are central in modern health care and are used to treat and prevent a wide range of bacterial infections. The recently discovered qnr genes provide a mechanism of resistance with the potential to rapidly spread between bacteria using horizontal gene transfer. As for many antibiotic resistance genes present in pathogens today, qnr genes are hypothesized to originate from environmental bacteria. The vast amount of data generated by shotgun metagenomics can therefore be used to explore the diversity of qnr genes in more detail. Results In this paper we describe a new method to identify qnr genes in nucleotide sequence data. We show, using cross-validation, that the method has a high statistical power of correctly classifying sequences from novel classes of qnr genes, even for fragments as short as 100 nucleotides. Based on sequences from public repositories, the method was able to identify all previously reported plasmid-mediated qnr genes. In addition, several fragments from novel putative qnr genes were identified in metagenomes. The method was also able to annotate 39 chromosomal variants of which 11 have previously not been reported in literature. Conclusions The method described in this paper significantly improves the sensitivity and specificity of identification and annotation of qnr genes in nucleotide sequence data. The predicted novel putative qnr genes in the metagenomic data support the hypothesis of a large and uncharacterized diversity within this family of resistance genes in environmental bacterial communities. An implementation of the method is freely available at http://bioinformatics.math.chalmers.se/qnr/.
Nucleotide sequence of the triosephosphate isomerase gene from Macaca mulatta
Energy Technology Data Exchange (ETDEWEB)
Old, S.E.; Mohrenweiser, H.W. (Univ. of Michigan, Ann Arbor (USA))
1988-09-26
The triosephosphate isomerase gene from a rhesus monkey, Macaca mulatta, charon 34 library was sequenced. The human and chimpanzee enzymes differ from the rhesus enzyme at ASN 20 and GLU 198. The nucleotide sequence identity between rhesus and human is 97% in the coding region and >94% in the flanking regions. Comparison of the rhesus and chimp genes, including the intron and flanking sequences, does not suggest a mechanism for generating the two TPI peptides of proliferating cells from hominoids and a single peptide from the rhesus gene.
Applications of High Throughput Nucleotide Sequencing
DEFF Research Database (Denmark)
Waage, Johannes Eichler
equally large demands in data handling, analysis and interpretation, perhaps defining the modern challenge of the computational biologist of the post-genomic era. The first part of this thesis consists of a general introduction to the history, common terms and challenges of next generation sequencing......-sequencing, a study of the effects on alternative RNA splicing of KO of the nonsense mediated RNA decay system in Mus, using digital gene expression and a custom-built exon-exon junction mapping pipeline is presented (article I). Evolved from this work, a Bioconductor package, spliceR, for classifying alternative...
Overlapping genomic sequences: a treasure trove of single-nucleotide polymorphisms.
Taillon-Miller, P; Gu, Z; Li, Q; Hillier, L; Kwok, P Y
1998-07-01
An efficient strategy to develop a dense set of single-nucleotide polymorphism (SNP) markers is to take advantage of the human genome sequencing effort currently under way. Our approach is based on the fact that bacterial artificial chromosomes (BACs) and P1-based artificial chromosomes (PACs) used in long-range sequencing projects come from diploid libraries. If the overlapping clones sequenced are from different lineages, one is comparing the sequences from 2 homologous chromosomes in the overlapping region. We have analyzed in detail every SNP identified while sequencing three sets of overlapping clones found on chromosome 5p15.2, 7q21-7q22, and 13q12-13q13. In the 200.6 kb of DNA sequence analyzed in these overlaps, 153 SNPs were identified. Computer analysis for repetitive elements and suitability for STS development yielded 44 STSs containing 68 SNPs for further study. All 68 SNPs were confirmed to be present in at least one of the three (Caucasian, African-American, Hispanic) populations studied. Furthermore, 42 of the SNPs tested (62%) were informative in at least one population, 32 (47%) were informative in two or more populations, and 23 (34%) were informative in all three populations. These results clearly indicate that developing SNP markers from overlapping genomic sequence is highly efficient and cost effective, requiring only the two simple steps of developing STSs around the known SNPs and characterizing them in the appropriate populations.
Directory of Open Access Journals (Sweden)
Shui-Lian He
Full Text Available Foxtail millet (Setaria italica (L. Beauv is one of the earliest domesticated grains, which has been cultivated in northern China by 8,700 years before present (YBP and across Eurasia by 4,000 YBP. Owing to a small genome and diploid nature, foxtail millet is a tractable model crop for studying functional genomics of millets and bioenergy grasses. In this study, we examined nucleotide sequence diversity, geographic structure, and levels of linkage disequilibrium at four nuclear loci (ADH1, G3PDH, IGS1 and TPI1 in representative samples of 311 landrace accessions across its cultivated range. Higher levels of nucleotide sequence and haplotype diversity were observed in samples from China relative to other sampled regions. Genetic assignment analysis classified the accessions into seven clusters based on nucleotide sequence polymorphisms. Intralocus LD decayed rapidly to half the initial value within ~1.2 kb or less.
He, Shui-Lian; Yang, Yang; Morrell, Peter L; Yi, Ting-Shuang
2015-01-01
Foxtail millet (Setaria italica (L.) Beauv) is one of the earliest domesticated grains, which has been cultivated in northern China by 8,700 years before present (YBP) and across Eurasia by 4,000 YBP. Owing to a small genome and diploid nature, foxtail millet is a tractable model crop for studying functional genomics of millets and bioenergy grasses. In this study, we examined nucleotide sequence diversity, geographic structure, and levels of linkage disequilibrium at four nuclear loci (ADH1, G3PDH, IGS1 and TPI1) in representative samples of 311 landrace accessions across its cultivated range. Higher levels of nucleotide sequence and haplotype diversity were observed in samples from China relative to other sampled regions. Genetic assignment analysis classified the accessions into seven clusters based on nucleotide sequence polymorphisms. Intralocus LD decayed rapidly to half the initial value within ~1.2 kb or less.
The nucleotide sequence of human transition protein 1 cDNA
Energy Technology Data Exchange (ETDEWEB)
Luerssen, H; Hoyer-Fender, S; Engel, W [Universitaet Goettingen (West Germany)
1988-08-11
The authors have screened a human testis cDNA library with an oligonucleotide of 81 mer prepared according to a part of the published nucleotide sequence of the rat transition protein TP 1. They have isolated a cDNA clone with the length of 441 bp containing the coding region of 162 bp for human transition protein 1. There is about 84% homology in the coding region of the sequence compared to rat. The human cDNA-clone encodes a polypeptide of 54 amino acids of which 7 are different to that of rat.
Palindromic nucleotide analysis in human T cell receptor rearrangements.
Directory of Open Access Journals (Sweden)
Santosh K Srivastava
Full Text Available Diversity of T cell receptor (TCR genes is primarily generated by nucleotide insertions upon rearrangement from their germ line-encoded V, D and J segments. Nucleotide insertions at V-D and D-J junctions are random, but some small subsets of these insertions are exceptional, in that one to three base pairs inversely repeat the sequence of the germline DNA. These short complementary palindromic sequences are called P nucleotides. We apply the ImmunoSeq deep-sequencing assay to the third complementarity determining region (CDR3 of the β chain of T cell receptors, and use the resulting data to study P nucleotides in the repertoire of naïve and memory CD8(+ and CD4(+ T cells. We estimate P nucleotide distributions in a cross section of healthy adults and different T cell subtypes. We show that P nucleotide frequency in all T cell subtypes ranges from 1% to 2%, and that the distribution is highly biased with respect to the coding end of the gene segment. Classification of observed palindromic sequences into P nucleotides using a maximum conditional probability model shows that single base P nucleotides are very rare in VDJ recombination; P nucleotides are primarily two bases long. To explore the role of P nucleotides in thymic selection, we compare P nucleotides in productive and non-productive sequences of CD8(+ naïve T cells. The naïve CD8(+ T cell clones with P nucleotides are more highly expanded.
The nucleotide sequence of a Polish isolate of Tomato torrado virus.
Budziszewska, Marta; Obrepalska-Steplowska, Aleksandra; Wieczorek, Przemysław; Pospieszny, Henryk
2008-12-01
A new virus was isolated from greenhouse tomato plants showing symptoms of leaf and apex necrosis in Wielkopolska province in Poland in 2003. The observed symptoms and the virus morphology resembled viruses previously reported in Spain called Tomato torrado virus (ToTV) and that in Mexico called Tomato marchitez virus (ToMarV). The complete genome of a Polish isolate Wal'03 was determined using RT-PCR amplification using oligonucleotide primers developed against the ToTV sequences deposited in Genbank, followed by cloning, sequencing, and comparison with the sequence of the type isolate. Phylogenetic analyses, performed on the basis of fragments of polyproteins sequences, established the relationship of Polish isolate Wal'03 with Spanish ToTV and Mexican ToMarV, as well as with other viruses from Sequivirus, Sadwavirus, and Cheravirus genera, reported to be the most similar to the new tomato viruses. Wal'03 genome strands has the same organization and very high homology with the ToTV type isolate, showing only some nucleotide and deduced amino acid changes, in contrast to ToMarV, which was significantly different. The phylogenetic tree clustered aforementioned viruses to the same group, indicating that they have a common origin.
[Replication of Streptomyces plasmids: the DNA nucleotide sequence of plasmid pSB 24.2].
Bolotin, A P; Sorokin, A V; Aleksandrov, N N; Danilenko, V N; Kozlov, Iu I
1985-11-01
The nucleotide sequence of DNA in plasmid pSB 24.2, a natural deletion derivative of plasmid pSB 24.1 isolated from S. cyanogenus was studied. The plasmid amounted by its size to 3706 nucleotide pairs. The G-C composition was equal to 73 per cent. The analysis of the DNA structure in plasmid pSB 24.2 revealed the protein-encoding sequence of DNA, the continuity of which was significant for replication of the plasmid containing more than 1300 nucleotide pairs. The analysis also revealed two A-T-rich areas of DNA, the G-C composition of which was less than 55 per cent and a DNA area with a branched pin structure. The results may be of value in investigation of plasmid replication in actinomycetes and experimental cloning of DNA with this plasmid as a vector.
Uncommon nucleotide excision repair phenotypes revealed by targeted high-throughput sequencing.
Calmels, Nadège; Greff, Géraldine; Obringer, Cathy; Kempf, Nadine; Gasnier, Claire; Tarabeux, Julien; Miguet, Marguerite; Baujat, Geneviève; Bessis, Didier; Bretones, Patricia; Cavau, Anne; Digeon, Béatrice; Doco-Fenzy, Martine; Doray, Bérénice; Feillet, François; Gardeazabal, Jesus; Gener, Blanca; Julia, Sophie; Llano-Rivas, Isabel; Mazur, Artur; Michot, Caroline; Renaldo-Robin, Florence; Rossi, Massimiliano; Sabouraud, Pascal; Keren, Boris; Depienne, Christel; Muller, Jean; Mandel, Jean-Louis; Laugel, Vincent
2016-03-22
Deficient nucleotide excision repair (NER) activity causes a variety of autosomal recessive diseases including xeroderma pigmentosum (XP) a disorder which pre-disposes to skin cancer, and the severe multisystem condition known as Cockayne syndrome (CS). In view of the clinical overlap between NER-related disorders, as well as the existence of multiple phenotypes and the numerous genes involved, we developed a new diagnostic approach based on the enrichment of 16 NER-related genes by multiplex amplification coupled with next-generation sequencing (NGS). Our test cohort consisted of 11 DNA samples, all with known mutations and/or non pathogenic SNPs in two of the tested genes. We then used the same technique to analyse samples from a prospective cohort of 40 patients. Multiplex amplification and sequencing were performed using AmpliSeq protocol on the Ion Torrent PGM (Life Technologies). We identified causative mutations in 17 out of the 40 patients (43%). Four patients showed biallelic mutations in the ERCC6(CSB) gene, five in the ERCC8(CSA) gene: most of them had classical CS features but some had very mild and incomplete phenotypes. A small cohort of 4 unrelated classic XP patients from the Basque country (Northern Spain) revealed a common splicing mutation in POLH (XP-variant), demonstrating a new founder effect in this population. Interestingly, our results also found ERCC2(XPD), ERCC3(XPB) or ERCC5(XPG) mutations in two cases of UV-sensitive syndrome and in two cases with mixed XP/CS phenotypes. Our study confirms that NGS is an efficient technique for the analysis of NER-related disorders on a molecular level. It is particularly useful for phenotypes with combined features or unusually mild symptoms. Targeted NGS used in conjunction with DNA repair functional tests and precise clinical evaluation permits rapid and cost-effective diagnosis in patients with NER-defects.
Reinharz, Vladimir; Ponty, Yann; Waldispühl, Jérôme
2013-07-01
The design of RNA sequences folding into predefined secondary structures is a milestone for many synthetic biology and gene therapy studies. Most of the current software uses similar local search strategies (i.e. a random seed is progressively adapted to acquire the desired folding properties) and more importantly do not allow the user to control explicitly the nucleotide distribution such as the GC-content in their sequences. However, the latter is an important criterion for large-scale applications as it could presumably be used to design sequences with better transcription rates and/or structural plasticity. In this article, we introduce IncaRNAtion, a novel algorithm to design RNA sequences folding into target secondary structures with a predefined nucleotide distribution. IncaRNAtion uses a global sampling approach and weighted sampling techniques. We show that our approach is fast (i.e. running time comparable or better than local search methods), seedless (we remove the bias of the seed in local search heuristics) and successfully generates high-quality sequences (i.e. thermodynamically stable) for any GC-content. To complete this study, we develop a hybrid method combining our global sampling approach with local search strategies. Remarkably, our glocal methodology overcomes both local and global approaches for sampling sequences with a specific GC-content and target structure. IncaRNAtion is available at csb.cs.mcgill.ca/incarnation/. Supplementary data are available at Bioinformatics online.
Kim, Kiyeon; Omori, Ryosuke; Ito, Kimihito
2017-12-01
The estimation of the basic reproduction number is essential to understand epidemic dynamics, and time series data of infected individuals are usually used for the estimation. However, such data are not always available. Methods to estimate the basic reproduction number using genealogy constructed from nucleotide sequences of pathogens have been proposed so far. Here, we propose a new method to estimate epidemiological parameters of outbreaks using the time series change of Tajima's D statistic on the nucleotide sequences of pathogens. To relate the time evolution of Tajima's D to the number of infected individuals, we constructed a parsimonious mathematical model describing both the transmission process of pathogens among hosts and the evolutionary process of the pathogens. As a case study we applied this method to the field data of nucleotide sequences of pandemic influenza A (H1N1) 2009 viruses collected in Argentina. The Tajima's D-based method estimated basic reproduction number to be 1.55 with 95% highest posterior density (HPD) between 1.31 and 2.05, and the date of epidemic peak to be 10th July with 95% HPD between 22nd June and 9th August. The estimated basic reproduction number was consistent with estimation by birth-death skyline plot and estimation using the time series of the number of infected individuals. These results suggested that Tajima's D statistic on nucleotide sequences of pathogens could be useful to estimate epidemiological parameters of outbreaks. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.
Bertolini, Francesca; Scimone, Concetta; Geraci, Claudia; Schiavo, Giuseppina; Utzeri, Valerio Joe; Chiofalo, Vincenzo; Fontanesi, Luca
2015-01-01
Few studies investigated the donkey (Equus asinus) at the whole genome level so far. Here, we sequenced the genome of two male donkeys using a next generation semiconductor based sequencing platform (the Ion Proton sequencer) and compared obtained sequence information with the available donkey draft genome (and its Illumina reads from which it was originated) and with the EquCab2.0 assembly of the horse genome. Moreover, the Ion Torrent Personal Genome Analyzer was used to sequence reduced representation libraries (RRL) obtained from a DNA pool including donkeys of different breeds (Grigio Siciliano, Ragusano and Martina Franca). The number of next generation sequencing reads aligned with the EquCab2.0 horse genome was larger than those aligned with the draft donkey genome. This was due to the larger N50 for contigs and scaffolds of the horse genome. Nucleotide divergence between E. caballus and E. asinus was estimated to be ~ 0.52-0.57%. Regions with low nucleotide divergence were identified in several autosomal chromosomes and in the whole chromosome X. These regions might be evolutionally important in equids. Comparing Y-chromosome regions we identified variants that could be useful to track donkey paternal lineages. Moreover, about 4.8 million of single nucleotide polymorphisms (SNPs) in the donkey genome were identified and annotated combining sequencing data from Ion Proton (whole genome sequencing) and Ion Torrent (RRL) runs with Illumina reads. A higher density of SNPs was present in regions homologous to horse chromosome 12, in which several studies reported a high frequency of copy number variants. The SNPs we identified constitute a first resource useful to describe variability at the population genomic level in E. asinus and to establish monitoring systems for the conservation of donkey genetic resources. PMID:26151450
Directory of Open Access Journals (Sweden)
Francesca Bertolini
Full Text Available Few studies investigated the donkey (Equus asinus at the whole genome level so far. Here, we sequenced the genome of two male donkeys using a next generation semiconductor based sequencing platform (the Ion Proton sequencer and compared obtained sequence information with the available donkey draft genome (and its Illumina reads from which it was originated and with the EquCab2.0 assembly of the horse genome. Moreover, the Ion Torrent Personal Genome Analyzer was used to sequence reduced representation libraries (RRL obtained from a DNA pool including donkeys of different breeds (Grigio Siciliano, Ragusano and Martina Franca. The number of next generation sequencing reads aligned with the EquCab2.0 horse genome was larger than those aligned with the draft donkey genome. This was due to the larger N50 for contigs and scaffolds of the horse genome. Nucleotide divergence between E. caballus and E. asinus was estimated to be ~ 0.52-0.57%. Regions with low nucleotide divergence were identified in several autosomal chromosomes and in the whole chromosome X. These regions might be evolutionally important in equids. Comparing Y-chromosome regions we identified variants that could be useful to track donkey paternal lineages. Moreover, about 4.8 million of single nucleotide polymorphisms (SNPs in the donkey genome were identified and annotated combining sequencing data from Ion Proton (whole genome sequencing and Ion Torrent (RRL runs with Illumina reads. A higher density of SNPs was present in regions homologous to horse chromosome 12, in which several studies reported a high frequency of copy number variants. The SNPs we identified constitute a first resource useful to describe variability at the population genomic level in E. asinus and to establish monitoring systems for the conservation of donkey genetic resources.
Directory of Open Access Journals (Sweden)
Yu-Hoon Kim
2014-01-01
Full Text Available Identification of insect species is an important task in forensic entomology. For more convenient species identification, the nucleotide sequences of cytochrome c oxidase subunit I (COI gene have been widely utilized. We analyzed full-length COI nucleotide sequences of 10 Muscidae and 6 Sarcophagidae fly species collected in Korea. After DNA extraction from collected flies, PCR amplification and automatic sequencing of the whole COI sequence were performed. Obtained sequences were analyzed for a phylogenetic tree and a distance matrix. Our data showed very low intraspecific sequence distances and species-level monophylies. However, sequence comparison with previously reported sequences revealed a few inconsistencies or paraphylies requiring further investigation. To the best of our knowledge, this study is the first report of COI nucleotide sequences from Hydrotaea occulta, Muscina angustifrons, Muscina pascuorum, Ophyra leucostoma, Sarcophaga haemorrhoidalis, Sarcophaga harpax, and Phaonia aureola.
Directory of Open Access Journals (Sweden)
Tautz Diethard
2002-03-01
Full Text Available Abstract Background The identification of species or species groups with specific oligo-nucleotides as molecular signatures is becoming increasingly popular for bacterial samples. However, it shows also great promise for other small organisms that are taxonomically difficult to tract. Results We have devised here an algorithm that aims to find the optimal probes for any given set of sequences. The program requires only a crude alignment of these sequences as input and is optimized for performance to deal also with very large datasets. The algorithm is designed such that the position of mismatches in the probes influences the selection and makes provision of single nucleotide outloops. Program implementations are available for Linux and Windows.
Nucleotide sequence, transcript mapping, and regulation of the RAD2 gene of Saccharomyces cerevisiae
International Nuclear Information System (INIS)
Madura, K.; Prakash, S.
1986-01-01
The authors determined the nucleotide sequence, mapped the 5' and 3' nRNA termini, and examined the regulation of the RAD2 gene of Saccharomyces cerevisiae. A long open reading frame within the RAD2 transcribed region encodes a protein of 1031 amino acids with a calculated molecular weight of 117,847. A disruption of the RAD2 gene that deletes the 78 carboxyl terminal codons results in loss of RAD2 function. The 5' ends of RAD2 mRNA show considerable heterogeneity, mapping 5 to 62 nucleotides upstream of the first ATG codon of the long RAD2 open reading frame. The longest RAD2 transcripts also contain a short open reading frame of 37 codons that precedes and overlaps the 5' end of the long RAD2 open reading frame. The RAD2 3' nRNA end maps 171 nucleotides downstream of the TAA termination codon and 20 nucleotides downstream from a 12-base-pair inverted repeat that might function in transcript termination. Northern blot analysis showed a ninefold increase in steady-state levels of RAD2 mRNA after treatment of yeast cells with UV light. The 5' flanking region of the RAD2 gene contains several direct and inverted repeats and a 44-nuclotide-long purine-rich tract. The sequence T G G A G G C A T T A A found at position - 167 to -156 in the RAD2 gene is similar to at sequence present in the 5' flanking regions of the RAD7 and RAD10 genes
Nucleotide sequence of the Agrobacterium tumefaciens octopine Ti plasmid-encoded tmr gene
Heidekamp, F.; Dirkse, W.G.; Hille, J.; Ormondt, H. van
1983-01-01
The nucleotide sequence of the tmr gene, encoded by the octopine Ti plasmid from Agrobacterium tumefaciens (pTiAch5), was determined. The T-DNA, which encompasses this gene, is involved in tumor formation and maintenance, and probably mediates the cytokinin-independent growth of transformed plant
NUCLEOTIDE COMPARISON OF GDF9 GENE IN INDIAN YAK AND GADDI GOAT: HIGH ALTITUDE LIVESTOCK ANIMALS
Directory of Open Access Journals (Sweden)
Lakshya Veer Singh
2013-06-01
Full Text Available The present study was undertaken to characterize exon 1 and exon 2 sequence of one of fecundity genes: GDF9 (Growth differentiation factor 9, in high altitude livestock animal (Yak and Gaddi goat. Six nucleotide differences were identified between sheep (AF078545 and goats (EF446168 in exon 1 and exon 2. Sequencing revealed nine novel single nucleotide mutations in exon 1 and exon 2 of Indian yak that compared with Bos taurus (GQ922451. These results preliminarily showed that the GDF9 gene might be a major gene that influences prolificacy of Gaddi goats and Indian yak.
Directory of Open Access Journals (Sweden)
Steven Y C Tong
Full Text Available We have developed a single nucleotide polymorphism (SNP nucleated high-resolution melting (HRM technique to genotype Enterococcus faecium. Eight SNPs were derived from the E. faecium multilocus sequence typing (MLST database and amplified fragments containing these SNPs were interrogated by HRM. We tested the HRM genotyping scheme on 85 E. faecium bloodstream isolates and compared the results with MLST, pulsed-field gel electrophoresis (PFGE and an allele specific real-time PCR (AS kinetic PCR SNP typing method. In silico analysis based on predicted HRM curves according to the G+C content of each fragment for all 567 sequence types (STs in the MLST database together with empiric data from the 85 isolates demonstrated that HRM analysis resolves E. faecium into 231 "melting types" (MelTs and provides a Simpson's Index of Diversity (D of 0.991 with respect to MLST. This is a significant improvement on the AS kinetic PCR SNP typing scheme that resolves 61 SNP types with D of 0.95. The MelTs were concordant with the known ST of the isolates. For the 85 isolates, there were 13 PFGE patterns, 17 STs, 14 MelTs and eight SNP types. There was excellent concordance between PFGE, MLST and MelTs with Adjusted Rand Indices of PFGE to MelT 0.936 and ST to MelT 0.973. In conclusion, this HRM based method appears rapid and reproducible. The results are concordant with MLST and the MLST based population structure.
Directory of Open Access Journals (Sweden)
Jonas Binladen
2007-02-01
Full Text Available The invention of the Genome Sequence 20 DNA Sequencing System (454 parallel sequencing platform has enabled the rapid and high-volume production of sequence data. Until now, however, individual emulsion PCR (emPCR reactions and subsequent sequencing runs have been unable to combine template DNA from multiple individuals, as homologous sequences cannot be subsequently assigned to their original sources.We use conventional PCR with 5'-nucleotide tagged primers to generate homologous DNA amplification products from multiple specimens, followed by sequencing through the high-throughput Genome Sequence 20 DNA Sequencing System (GS20, Roche/454 Life Sciences. Each DNA sequence is subsequently traced back to its individual source through 5'tag-analysis.We demonstrate that this new approach enables the assignment of virtually all the generated DNA sequences to the correct source once sequencing anomalies are accounted for (miss-assignment rate<0.4%. Therefore, the method enables accurate sequencing and assignment of homologous DNA sequences from multiple sources in single high-throughput GS20 run. We observe a bias in the distribution of the differently tagged primers that is dependent on the 5' nucleotide of the tag. In particular, primers 5' labelled with a cytosine are heavily overrepresented among the final sequences, while those 5' labelled with a thymine are strongly underrepresented. A weaker bias also exists with regards to the distribution of the sequences as sorted by the second nucleotide of the dinucleotide tags. As the results are based on a single GS20 run, the general applicability of the approach requires confirmation. However, our experiments demonstrate that 5'primer tagging is a useful method in which the sequencing power of the GS20 can be applied to PCR-based assays of multiple homologous PCR products. The new approach will be of value to a broad range of research areas, such as those of comparative genomics, complete mitochondrial
Plastid: nucleotide-resolution analysis of next-generation sequencing and genomics data.
Dunn, Joshua G; Weissman, Jonathan S
2016-11-22
Next-generation sequencing (NGS) informs many biological questions with unprecedented depth and nucleotide resolution. These assays have created a need for analytical tools that enable users to manipulate data nucleotide-by-nucleotide robustly and easily. Furthermore, because many NGS assays encode information jointly within multiple properties of read alignments - for example, in ribosome profiling, the locations of ribosomes are jointly encoded in alignment coordinates and length - analytical tools are often required to extract the biological meaning from the alignments before analysis. Many assay-specific pipelines exist for this purpose, but there remains a need for user-friendly, generalized, nucleotide-resolution tools that are not limited to specific experimental regimes or analytical workflows. Plastid is a Python library designed specifically for nucleotide-resolution analysis of genomics and NGS data. As such, Plastid is designed to extract assay-specific information from read alignments while retaining generality and extensibility to novel NGS assays. Plastid represents NGS and other biological data as arrays of values associated with genomic or transcriptomic positions, and contains configurable tools to convert data from a variety of sources to such arrays. Plastid also includes numerous tools to manipulate even discontinuous genomic features, such as spliced transcripts, with nucleotide precision. Plastid automatically handles conversion between genomic and feature-centric coordinates, accounting for splicing and strand, freeing users of burdensome accounting. Finally, Plastid's data models use consistent and familiar biological idioms, enabling even beginners to develop sophisticated analytical workflows with minimal effort. Plastid is a versatile toolkit that has been used to analyze data from multiple NGS assays, including RNA-seq, ribosome profiling, and DMS-seq. It forms the genomic engine of our ORF annotation tool, ORF-RATER, and is readily
Nucleotide sequence determination of the region in adenovirus 5 DNA involved in cell transformation
International Nuclear Information System (INIS)
Maat, J.
1978-01-01
A description is given of investigations into the primary structure of the transforming region of adenovirus type 5 DNA. The phenomenon of cell transformation is discussed in general terms and the principles of a number of fairly recent techniques, which have been in use for DNA sequence determination since 1975 are dealt with. A few of the author's own techniques are described which deal both with nucleotide sequence analysis and with the determination of DNA cleavage sites of restriction endonucleases. The results are given of the mapping of cleavage sites in the HpaI-E fragment of adenovirus DNA of HpaII, HaeIII, AluI, HinfI and TaqI and of the determination of the nucleotide sequence in the transforming region of adenovirus type 5 DNA. The results of the sequence determination of the Ad5 HindIII-G fragment are discussed in relation with the investigation on the transforming proteins isolated from in vitro and in vivo synthesizing systems. Labelling procedures of DNA are described including the exonuclease III/DNA polymerase 1 method and TA polynucleotide kinase labelling of DNA fragments. (Auth.)
Nucleotide sequence of the human N-myc gene
International Nuclear Information System (INIS)
Stanton, L.W.; Schwab, M.; Bishop, J.M.
1986-01-01
Human neuroblastomas frequently display amplification and augmented expression of a gene known as N-myc because of its similarity to the protooncogene c-myc. It has therefore been proposed that N-myc is itself a protooncogene, and subsequent tests have shown that N-myc and c-myc have similar biological activities in cell culture. The authors have now detailed the kinship between N-myc and c-myc by determining the nucleotide sequence of human N-myc and deducing the amino acid sequence of the protein encoded by the gene. The topography of N-myc is strikingly similar to that of c-myc: both genes contain three exons of similar lengths; the coding elements of both genes are located in the second and third exons; and both genes have unusually long 5' untranslated regions in their mRNAs, with features that raise the possibility that expression of the genes may be subject to similar controls of translation. The resemblance between the proteins encoded by N-myc and c-myc sustains previous suspicions that the genes encode related functions
Directory of Open Access Journals (Sweden)
Andréia B. Poletto
2008-01-01
Full Text Available Actin-encoding cDNAs of Nile tilapia (Oreochromis niloticus were isolated by RT-PCR using total RNA samples of different tissues and further characterized by nucleotide sequencing and in silico amino acid (aa sequence analysis. Comparisons among the actin gene sequences of O. niloticus and those of other species evidenced that the isolated genes present a high similarity to other fish and other vertebrate actin genes. The highest nucleotide resemblance was observed between O. niloticus and O. mossambicus a-actin and b-actin genes. Analysis of the predicted aa sequences revealed two distinct types of cytoplasmic actins, one cardiac muscle actin type and one skeletal muscle actin type that were expressed in different tissues of Nile tilapia. The evolutionary relationships between the Nile tilapia actin genes and diverse other organisms is discussed.
The complete nucleotide sequence of a recently discovered Florida (FL) isolate of Hibiscus infecting Cilevirus (HiCV) was determined by Sanger sequencing. The movement- and coat- protein gene sequences of the HiCV-FL isolate are more divergent than other genes of the previously sequenced HiCV-HA (Ha...
Molecular cloning and complete nucleotide sequence of a human ventricular myosin light chain 1
Energy Technology Data Exchange (ETDEWEB)
Hoffmann, E; Shi, Q W; Floroff, M; Mickle, D A.G.; Wu, T W; Olley, P M; Jackowski, G
1988-03-25
Human ventricular plasmid library was constructed. The library was screened with the oligonucleotide probe (17-mer) corresponding to a conserve region of myosin light chain 1 near the carboxy terminal. Full length cDNA recombinant plasmid containing 1100 bp insert was isolated. RNA blot hybridization with this insert detected a message of approximately 1500 bp corresponding to the size of VLCl and mRNA. Complete nucleotide sequence of the coding region was determined in M13 subclones using dideoxy chain termination method. With the isolation of this clone (pCD HLVCl), the publication of the complete nucleotide sequence of HVLCl and the predicted secondary structure of this protein will aid in understanding of the biochemistry of myosin and its function in contraction, the evolution of myosin light genes and the genetic, developmental and physiological regulation of myosin genes.
Directory of Open Access Journals (Sweden)
Jacqueline Morris
2017-12-01
Full Text Available Summary: A number of mitochondrial diseases arise from single-nucleotide variant (SNV accumulation in multiple mitochondria. Here, we present a method for identification of variants present at the single-mitochondrion level in individual mouse and human neuronal cells, allowing for extremely high-resolution study of mitochondrial mutation dynamics. We identified extensive heteroplasmy between individual mitochondrion, along with three high-confidence variants in mouse and one in human that were present in multiple mitochondria across cells. The pattern of variation revealed by single-mitochondrion data shows surprisingly pervasive levels of heteroplasmy in inbred mice. Distribution of SNV loci suggests inheritance of variants across generations, resulting in Poisson jackpot lines with large SNV load. Comparison of human and mouse variants suggests that the two species might employ distinct modes of somatic segregation. Single-mitochondrion resolution revealed mitochondria mutational dynamics that we hypothesize to affect risk probabilities for mutations reaching disease thresholds. : Morris et al. use independent sequencing of multiple individual mitochondria from mouse and human brain cells to show high pervasiveness of mutations. The mutations are heteroplasmic within single mitochondria and within and between cells. These findings suggest mechanisms by which mutations accumulate over time, resulting in mitochondrial dysfunction and disease. Keywords: single mitochondrion, single cell, human neuron, mouse neuron, single-nucleotide variation
Nucleotide sequence alignment of hdcA from Gram-positive bacteria.
Diaz, Maria; Ladero, Victor; Redruello, Begoña; Sanchez-Llana, Esther; Del Rio, Beatriz; Fernandez, Maria; Martin, Maria Cruz; Alvarez, Miguel A
2016-03-01
The decarboxylation of histidine -carried out mainly by some gram-positive bacteria- yields the toxic dietary biogenic amine histamine (Ladero et al. 2010 〈10.2174/157340110791233256〉 [1], Linares et al. 2016 〈http://dx.doi.org/10.1016/j.foodchem.2015.11.013〉〉 [2]). The reaction is catalyzed by a pyruvoyl-dependent histidine decarboxylase (Linares et al. 2011 〈10.1080/10408398.2011.582813〉 [3]), which is encoded by the gene hdcA. In order to locate conserved regions in the hdcA gene of Gram-positive bacteria, this article provides a nucleotide sequence alignment of all the hdcA sequences from Gram-positive bacteria present in databases. For further utility and discussion, see 〈http://dx.doi.org/ 10.1016/j.foodcont.2015.11.035〉〉 [4].
37 CFR 1.823 - Requirements for nucleotide and/or amino acid sequences as part of the application.
2010-07-01
... may not include material other than part of the sequence listing. A fixed-width font should be used... integer expressing the number of bases or amino acid residues M. Type Whether presented sequence molecule is DNA, RNA, or PRT (protein). If a nucleotide sequence contains both DNA and RNA fragments, the type...
Base Sequence Context Effects on Nucleotide Excision Repair
Directory of Open Access Journals (Sweden)
Yuqin Cai
2010-01-01
Full Text Available Nucleotide excision repair (NER plays a critical role in maintaining the integrity of the genome when damaged by bulky DNA lesions, since inefficient repair can cause mutations and human diseases notably cancer. The structural properties of DNA lesions that determine their relative susceptibilities to NER are therefore of great interest. As a model system, we have investigated the major mutagenic lesion derived from the environmental carcinogen benzo[a]pyrene (B[a]P, 10S (+-trans-anti-B[a]P-2-dG in six different sequence contexts that differ in how the lesion is positioned in relation to nearby guanine amino groups. We have obtained molecular structural data by NMR and MD simulations, bending properties from gel electrophoresis studies, and NER data obtained from human HeLa cell extracts for our six investigated sequence contexts. This model system suggests that disturbed Watson-Crick base pairing is a better recognition signal than a flexible bend, and that these can act in concert to provide an enhanced signal. Steric hinderance between the minor groove-aligned lesion and nearby guanine amino groups determines the exact nature of the disturbances. Both nearest neighbor and more distant neighbor sequence contexts have an impact. Regardless of the exact distortions, we hypothesize that they provide a local thermodynamic destabilization signal for repair.
The complete nucleotide sequence of RNA 3 of a peach isolate of Prunus necrotic ringspot virus.
Hammond, R W; Crosslin, J M
1995-04-01
The complete nucleotide sequence of RNA 3 of the PE-5 peach isolate of Prunus necrotic ringspot ilarvirus (PNRSV) was obtained from cloned cDNA. The RNA sequence is 1941 nucleotides and contains two open reading frames (ORFs). ORF 1 consisted of 284 amino acids with a calculated molecular weight of 31,729 Da and ORF 2 contained 224 amino acids with a calculated molecular weight of 25,018 Da. ORF 2 corresponds to the coat protein gene. Expression of ORF 2 engineered into a pTrcHis vector in Escherichia coli results in a fusion polypeptide of approximately 28 kDa which cross-reacts with PNRSV polyclonal antiserum. Analysis of the coat protein amino acid sequence reveals a putative "zinc-finger" domain at the amino-terminal portion of the protein. Two tetranucleotide AUGC motifs occur in the 3'-UTR of the RNA and may function in coat protein binding and genome activation. ORF 1 homologies to other ilarviruses and alfalfa mosaic virus are confined to limited regions of conserved amino acids. The translated amino acid sequence of the coat protein gene shows 92% similarity to one isolate of apple mosaic virus, a closely related member of the ilarvirus group of plant viruses, but only 66% similarity to the amino acid sequence of the coat protein gene of a second isolate. These relationships are also reflected at the nucleotide sequence level. These results in one instance confirm the close similarities observed at the biophysical and serological levels between these two viruses, but on the other hand call into question the nomenclature used to describe these viruses.
International Nuclear Information System (INIS)
Chiba, A.; Suzutani, T.; Koyano, S.; Azuma, M.; Saijo, M.
1998-01-01
To analyze the difference in the degree of divergence between genes from identical herpes virus species, we examined the nucleotide sequence of genes from the herpes simplex virus type 1 (HSV-l ) strains VR-3 and 17 encoding thymidine kinase (TK), deoxyribonuclease (DNase), protein kinase (PK; UL13) and virion-associated host shut off (vhs) protein (UL41). The frequency of nucleotide substitutions per 1 kb in TK gene was 2.5 to 4.3 times higher than those in the other three genes. To prove that the polymorphism of HSV-1 TK gene is common characteristic of herpes virus TK genes, we compared the diversity of TK genes among eight HSV-l , six herpes simplex virus type 2 (HSV-2) and seven varicella-zoster virus (VZV) strains. The average frequency of nucleotide substitutions per 1 kb in the TK gene of HSV-l strains was 4-fold higher than that in the TK gene of HSV-2 strains. The VZV TK gene was highly conserved and only two nucleotide changes were evident in VZV strains. However, the rate of non-synonymous substitutions in total nucleotide substitutions was similar among the TK genes of the three viruses. This result indicated that the mutational rates differed, but there were no significant differences in selective pressure. We conclude that HSV-l TK gene is highly diverged and analysis of variations in the gene is a useful approach for understanding the molecular evolution of HSV-l in a short period. (authors)
Meiler, Arno; Klinger, Claudia; Kaufmann, Michael
2012-09-08
The COG database is the most popular collection of orthologous proteins from many different completely sequenced microbial genomes. Per definition, a cluster of orthologous groups (COG) within this database exclusively contains proteins that most likely achieve the same cellular function. Recently, the COG database was extended by assigning to every protein both the corresponding amino acid and its encoding nucleotide sequence resulting in the NUCOCOG database. This extended version of the COG database is a valuable resource connecting sequence features with the functionality of the respective proteins. Here we present ANCAC, a web tool and MySQL database for the analysis of amino acid, nucleotide, and codon frequencies in COGs on the basis of freely definable phylogenetic patterns. We demonstrate the usefulness of ANCAC by analyzing amino acid frequencies, codon usage, and GC-content in a species- or function-specific context. With respect to amino acids we, at least in part, confirm the cognate bias hypothesis by using ANCAC's NUCOCOG dataset as the largest one available for that purpose thus far. Using the NUCOCOG datasets, ANCAC connects taxonomic, amino acid, and nucleotide sequence information with the functional classification via COGs and provides a GUI for flexible mining for sequence-bias. Thereby, to our knowledge, it is the only tool for the analysis of sequence composition in the light of physiological roles and phylogenetic context without requirement of substantial programming-skills.
Kumazaki, T; Hori, H; Osawa, S; Ishii, N; Suzuki, K
1982-11-11
The nucleotide sequences of 5S rRNAs from a rotifer, Brachionus plicatilis, and two nematodes, Rhabditis tokai and Caenorhabditis elegans have been determined. The rotifer has two 5S rRNA species that are composed of 120 and 121 nucleotides, respectively. The sequences of these two 5S rRNAs are the same except that the latter has an additional base at its 3'-terminus. The 5S rRNAs from the two nematode species are both 119 nucleotides long. The sequence similarity percents are 79% (Brachionus/Rhabditis), 80% (Brachionus/Caenorhabditis), and 95% (Rhabditis/Caenorhabditis) among these three species. Brachionus revealed the highest similarity to Lingula (89%), but not to the nematodes (79%).
Applications of High-Throughput Nucleotide Sequencing (PhD)
DEFF Research Database (Denmark)
Waage, Johannes
equally large demands in data handling, analysis and interpretation, perhaps defining the modern challenge of the computational biologist of the post-genomic era. The first part of this thesis consists of a general introduction to the history, common terms and challenges of next generation sequencing......-sequencing, a study of the effects on alternative RNA splicing of KO of the nonsense mediated RNA decay system in Mus, using digital gene expression and a custom-built exon-exon junction mapping pipeline is presented (article I). Evolved from this work, a Bioconductor package, spliceR, for classifying alternative...
Energy Technology Data Exchange (ETDEWEB)
Sakoyama, Y.; Hong, K.J.; Byun, S.M.; Hisajima, H.; Ueda, S.; Yaoita, Y.; Hayashida, H.; Miyata, T.; Honjo, T.
1987-02-01
To determine the phylogenetic relationships among hominoids and the dates of their divergence, the complete nucleotide sequences of the constant region of the immunoglobulin eta-chain (C/sub eta1/) genes from chimpanzee and orangutan have been determined. These sequences were compared with the human eta-chain constant-region sequence. A molecular clock (silent molecular clock), measured by the degree of sequence divergence at the synonymous (silent) positions of protein-encoding regions, was introduced for the present study. From the comparison of nucleotide sequences of ..cap alpha../sub 1/-antitrypsin and ..beta..- and delta-globulin genes between humans and Old World monkeys, the silent molecular clock was calibrated: the mean evolutionary rate of silent substitution was determined to be 1.56 x 10/sup -9/ substitutions per site per year. Using the silent molecular clock, the mean divergence dates of chimpanzee and orangutan from the human lineage were estimated as 6.4 +/- 2.6 million years and 17.3 +/- 4.5 million years, respectively. It was also shown that the evolutionary rate of primate genes is considerably slower than those of other mammalian genes.
Alvarez, Jose; Massey, Steven; Kalitsov, Alan; Velev, Julian
Nanopore sequencing via transverse current has emerged as a competitive candidate for mapping DNA methylation without needed bisulfite-treatment, fluorescent tag, or PCR amplification. By eliminating the error producing amplification step, long read lengths become feasible, which greatly simplifies the assembly process and reduces the time and the cost inherent in current technologies. However, due to the large error rates of nanopore sequencing, single base resolution has not been reached. A very important source of noise is the intrinsic structural noise in the electric signature of the nucleotide arising from the influence of neighboring nucleotides. In this work we perform calculations of the tunneling current through DNA molecules in nanopores using the non-equilibrium electron transport method within an effective multi-orbital tight-binding model derived from first-principles calculations. We develop a base-calling algorithm accounting for the correlations of the current through neighboring bases, which in principle can reduce the error rate below any desired precision. Using this method we show that we can clearly distinguish DNA methylation and other base modifications based on the reading of the tunneling current.
DEFF Research Database (Denmark)
Binladen, Jonas; Gilbert, M Thomas P; Bollback, Jonathan P
2007-01-01
BACKGROUND: The invention of the Genome Sequence 20 DNA Sequencing System (454 parallel sequencing platform) has enabled the rapid and high-volume production of sequence data. Until now, however, individual emulsion PCR (emPCR) reactions and subsequent sequencing runs have been unable to combine...... primers that is dependent on the 5' nucleotide of the tag. In particular, primers 5' labelled with a cytosine are heavily overrepresented among the final sequences, while those 5' labelled with a thymine are strongly underrepresented. A weaker bias also exists with regards to the distribution...
Winnowing DNA for rare sequences: highly specific sequence and methylation based enrichment.
Directory of Open Access Journals (Sweden)
Jason D Thompson
Full Text Available Rare mutations in cell populations are known to be hallmarks of many diseases and cancers. Similarly, differential DNA methylation patterns arise in rare cell populations with diagnostic potential such as fetal cells circulating in maternal blood. Unfortunately, the frequency of alleles with diagnostic potential, relative to wild-type background sequence, is often well below the frequency of errors in currently available methods for sequence analysis, including very high throughput DNA sequencing. We demonstrate a DNA preparation and purification method that through non-linear electrophoretic separation in media containing oligonucleotide probes, achieves 10,000 fold enrichment of target DNA with single nucleotide specificity, and 100 fold enrichment of unmodified methylated DNA differing from the background by the methylation of a single cytosine residue.
Winnowing DNA for rare sequences: highly specific sequence and methylation based enrichment.
Thompson, Jason D; Shibahara, Gosuke; Rajan, Sweta; Pel, Joel; Marziali, Andre
2012-01-01
Rare mutations in cell populations are known to be hallmarks of many diseases and cancers. Similarly, differential DNA methylation patterns arise in rare cell populations with diagnostic potential such as fetal cells circulating in maternal blood. Unfortunately, the frequency of alleles with diagnostic potential, relative to wild-type background sequence, is often well below the frequency of errors in currently available methods for sequence analysis, including very high throughput DNA sequencing. We demonstrate a DNA preparation and purification method that through non-linear electrophoretic separation in media containing oligonucleotide probes, achieves 10,000 fold enrichment of target DNA with single nucleotide specificity, and 100 fold enrichment of unmodified methylated DNA differing from the background by the methylation of a single cytosine residue.
Complete nucleotide sequence of watermelon chlorotic stunt virus originating from Oman.
Khan, Akhtar J; Akhtar, Sohail; Briddon, Rob W; Ammara, Um; Al-Matrooshi, Abdulrahman M; Mansoor, Shahid
2012-07-01
Watermelon chlorotic stunt virus (WmCSV) is a bipartite begomovirus (genus Begomovirus, family Geminiviridae) that causes economic losses to cucurbits, particularly watermelon, across the Middle East and North Africa. Recently squash (Cucurbita moschata) grown in an experimental field in Oman was found to display symptoms such as leaf curling, yellowing and stunting, typical of a begomovirus infection. Sequence analysis of the virus isolated from squash showed 97.6-99.9% nucleotide sequence identity to previously described WmCSV isolates for the DNA A component and 93-98% identity for the DNA B component. Agrobacterium-mediated inoculation to Nicotiana benthamiana resulted in the development of symptoms fifteen days post inoculation. This is the first bipartite begomovirus identified in Oman. Overall the Oman isolate showed the highest levels of sequence identity to a WmCSV isolate originating from Iran, which was confirmed by phylogenetic analysis. This suggests that WmCSV present in Oman has been introduced from Iran. The significance of this finding is discussed.
Nucleotide Sequence and Characterization of the Broad-Host-Range Lactococcal Plasmid pWVO1
Leenhouts, Cornelis; Tolner, Berend; Bron, Sierd; Kok, Jan; Venema, Gerhardus; Seegers, Jozef
The nucleotide sequence of the Lactococcus lactis broad-host-range plasmid pWVO1, replicating in both gram-positive and gram-negative bacteria, was determined. This analysis revealed four open reading frames (ORFs). ORF A appeared to encode a trans-acting 26.8-kDa protein (RepA), necessary for
Ivanov, Peter A; Mukhamedzhanova, Anna A; Smirnov, Alexander A; Rodionova, Nina P; Karpova, Olga V; Atabekov, Joseph G
2011-04-01
A southeastern European isolate of Alternanthera mosaic virus (AltMV-MU) of the genus Potexvirus (family Flexiviridae) was purified from the ornamental plant Portulaca grandiflora. The complete nucleotide sequence (6606 nucleotides) of AltMV-MU genomic RNA was defined. The AltMV-MU genome is different from those of all isolates described earlier and is most closely related to genomes of partly sequenced portulaca isolates AltMV-Po (America) and AltMV-It (Italy). Phylogenetic analysis supports the view that AltMV-MU belongs to a new "portulaca" genotype distinguishable from the "phlox" genotype.
International Nuclear Information System (INIS)
Siebert, P.D.; Fukuda, M.
1987-01-01
The authors describe the isolation and nucleotide sequence of a human glycophorin B cDNA. The cDNA was identified by differential hybridization of synthetic oligonucleotide probes to a human erythroleukemic cell line (K562) cDNA library constructed in phage vector λgt10. The nucleotide sequence of the glycophorin B cDNA was compared with that of a previously cloned glycophorin A cDNA. The nucleotide sequences encoding the NH 2 -terminal leader peptide and first 26 amino acids of the two proteins are nearly identical. This homologous region is followed by areas specific to either glycophorin A or B and a number of small regions of homology, which in turn are followed by a very homologous region encoding the presumed membrane-spanning portion of the proteins. They used RNA blot hybridization with both cDNA and synthetic oligonucleotide probes to prove our previous hypothesis that glycophorin B is encoded by a single 0.5- to 0.6-kb mRNA and to show that glycophorins A and B are negatively and coordinately regulated by a tumor-promoting phorbol ester, phorbol 12-myristate 13-acetate. They established the intron/exon structure of the glycophorin A and B genes by oligonucleotide mapping; the results suggest a complex evolution of the glycophorin genes
Zhao, Zhenqing; Gu, Honghui; Sheng, Xiaoguang; Yu, Huifang; Wang, Jiansheng; Huang, Long; Wang, Dan
2016-01-01
Molecular markers and genetic maps play an important role in plant genomics and breeding studies. Cauliflower is an important and distinctive vegetable; however, very few molecular resources have been reported for this species. In this study, a novel, specific-locus amplified fragment (SLAF) sequencing strategy was employed for large-scale single nucleotide polymorphism (SNP) discovery and high-density genetic map construction in a double-haploid, segregating population of cauliflower. A total of 12.47 Gb raw data containing 77.92 M pair-end reads were obtained after processing and 6815 polymorphic SLAFs between the two parents were detected. The average sequencing depths reached 52.66-fold for the female parent and 49.35-fold for the male parent. Subsequently, these polymorphic SLAFs were used to genotype the population and further filtered based on several criteria to construct a genetic linkage map of cauliflower. Finally, 1776 high-quality SLAF markers, including 2741 SNPs, constituted the linkage map with average data integrity of 95.68%. The final map spanned a total genetic length of 890.01 cM with an average marker interval of 0.50 cM, and covered 364.9 Mb of the reference genome. The markers and genetic map developed in this study could provide an important foundation not only for comparative genomics studies within Brassica oleracea species but also for quantitative trait loci identification and molecular breeding of cauliflower. PMID:27047515
Directory of Open Access Journals (Sweden)
Meiler Arno
2012-09-01
Full Text Available Abstract Background The COG database is the most popular collection of orthologous proteins from many different completely sequenced microbial genomes. Per definition, a cluster of orthologous groups (COG within this database exclusively contains proteins that most likely achieve the same cellular function. Recently, the COG database was extended by assigning to every protein both the corresponding amino acid and its encoding nucleotide sequence resulting in the NUCOCOG database. This extended version of the COG database is a valuable resource connecting sequence features with the functionality of the respective proteins. Results Here we present ANCAC, a web tool and MySQL database for the analysis of amino acid, nucleotide, and codon frequencies in COGs on the basis of freely definable phylogenetic patterns. We demonstrate the usefulness of ANCAC by analyzing amino acid frequencies, codon usage, and GC-content in a species- or function-specific context. With respect to amino acids we, at least in part, confirm the cognate bias hypothesis by using ANCAC’s NUCOCOG dataset as the largest one available for that purpose thus far. Conclusions Using the NUCOCOG datasets, ANCAC connects taxonomic, amino acid, and nucleotide sequence information with the functional classification via COGs and provides a GUI for flexible mining for sequence-bias. Thereby, to our knowledge, it is the only tool for the analysis of sequence composition in the light of physiological roles and phylogenetic context without requirement of substantial programming-skills.
2012-01-01
Background The COG database is the most popular collection of orthologous proteins from many different completely sequenced microbial genomes. Per definition, a cluster of orthologous groups (COG) within this database exclusively contains proteins that most likely achieve the same cellular function. Recently, the COG database was extended by assigning to every protein both the corresponding amino acid and its encoding nucleotide sequence resulting in the NUCOCOG database. This extended version of the COG database is a valuable resource connecting sequence features with the functionality of the respective proteins. Results Here we present ANCAC, a web tool and MySQL database for the analysis of amino acid, nucleotide, and codon frequencies in COGs on the basis of freely definable phylogenetic patterns. We demonstrate the usefulness of ANCAC by analyzing amino acid frequencies, codon usage, and GC-content in a species- or function-specific context. With respect to amino acids we, at least in part, confirm the cognate bias hypothesis by using ANCAC’s NUCOCOG dataset as the largest one available for that purpose thus far. Conclusions Using the NUCOCOG datasets, ANCAC connects taxonomic, amino acid, and nucleotide sequence information with the functional classification via COGs and provides a GUI for flexible mining for sequence-bias. Thereby, to our knowledge, it is the only tool for the analysis of sequence composition in the light of physiological roles and phylogenetic context without requirement of substantial programming-skills. PMID:22958836
Nucleotide sequence of cloned cDNA for human sphingolipid activator protein 1 precursor
International Nuclear Information System (INIS)
Dewji, N.N.; Wenger, D.A.; O'Brien, J.S.
1987-01-01
Two cDNA clones encoding prepro-sphingolipid activator protein 1 (SAP-1) were isolated from a λ gt11 human hepatoma expression library using polyclonal antibodies. These had inserts of ≅ 2 kilobases (λ-S-1.2 and λ-S-1.3) and both were both homologous with a previously isolated clone (λ-S-1.1) for mature SAP-1. The authors report here the nucleotide sequence of the longer two EcoRI fragments of S-1.2 and S-1.3 that were not the same and the derived amino acid sequences of mature SAP-1 and its prepro form. The open reading frame encodes 19 amino acids, which are colinear with the amino-terminal sequence of mature SAP-1, and extends far beyond the predicted carboxyl terminus of mature SAP-1, indicating extensive carboxyl-terminal processing. The nucleotide sequence of cDNA encoding prepro-SAP-1 includes 1449 bases from the assigned initiation codon ATG at base-pair 472 to the stop codon TGA at base-pair 1921. The first 23 amino acids coded after the initiation ATG are characteristic of a signal peptide. The calculated molecular mass for a polypeptide encoded by 1449 bases is ≅ 53 kDa, in keeping with the reported value for pro-SAP-1. The data indicate that after removal of the signal peptide mature SAP-1 is generated by removing an additional 7 amino acids from the amino terminus and ≅ 373 amino acids from the carboxyl terminus. One potential glycosylation site was previously found in mature SAP-1. Three additional potential glycosylation sites are present in the processed carboxyl-terminal polypeptide, which they designate as P-2
JNSViewer-A JavaScript-based Nucleotide Sequence Viewer for DNA/RNA secondary structures.
Shi, Jieming; Li, Xi; Dong, Min; Graham, Mitchell; Yadav, Nehul; Liang, Chun
2017-01-01
Many tools are available for visualizing RNA or DNA secondary structures, but there is scarce implementation in JavaScript that provides seamless integration with the increasingly popular web computational platforms. We have developed JNSViewer, a highly interactive web service, which is bundled with several popular tools for DNA/RNA secondary structure prediction and can provide precise and interactive correspondence among nucleotides, dot-bracket data, secondary structure graphs, and genic annotations. In JNSViewer, users can perform RNA secondary structure predictions with different programs and settings, add customized genic annotations in GFF format to structure graphs, search for specific linear motifs, and extract relevant structure graphs of sub-sequences. JNSViewer also allows users to choose a transcript or specific segment of Arabidopsis thaliana genome sequences and predict the corresponding secondary structure. Popular genome browsers (i.e., JBrowse and BrowserGenome) were integrated into JNSViewer to provide powerful visualizations of chromosomal locations, genic annotations, and secondary structures. In addition, we used StructureFold with default settings to predict some RNA structures for Arabidopsis by incorporating in vivo high-throughput RNA structure profiling data and stored the results in our web server, which might be a useful resource for RNA secondary structure studies in plants. JNSViewer is available at http://bioinfolab.miamioh.edu/jnsviewer/index.html.
JNSViewer—A JavaScript-based Nucleotide Sequence Viewer for DNA/RNA secondary structures
Dong, Min; Graham, Mitchell; Yadav, Nehul
2017-01-01
Many tools are available for visualizing RNA or DNA secondary structures, but there is scarce implementation in JavaScript that provides seamless integration with the increasingly popular web computational platforms. We have developed JNSViewer, a highly interactive web service, which is bundled with several popular tools for DNA/RNA secondary structure prediction and can provide precise and interactive correspondence among nucleotides, dot-bracket data, secondary structure graphs, and genic annotations. In JNSViewer, users can perform RNA secondary structure predictions with different programs and settings, add customized genic annotations in GFF format to structure graphs, search for specific linear motifs, and extract relevant structure graphs of sub-sequences. JNSViewer also allows users to choose a transcript or specific segment of Arabidopsis thaliana genome sequences and predict the corresponding secondary structure. Popular genome browsers (i.e., JBrowse and BrowserGenome) were integrated into JNSViewer to provide powerful visualizations of chromosomal locations, genic annotations, and secondary structures. In addition, we used StructureFold with default settings to predict some RNA structures for Arabidopsis by incorporating in vivo high-throughput RNA structure profiling data and stored the results in our web server, which might be a useful resource for RNA secondary structure studies in plants. JNSViewer is available at http://bioinfolab.miamioh.edu/jnsviewer/index.html. PMID:28582416
JNSViewer-A JavaScript-based Nucleotide Sequence Viewer for DNA/RNA secondary structures.
Directory of Open Access Journals (Sweden)
Jieming Shi
Full Text Available Many tools are available for visualizing RNA or DNA secondary structures, but there is scarce implementation in JavaScript that provides seamless integration with the increasingly popular web computational platforms. We have developed JNSViewer, a highly interactive web service, which is bundled with several popular tools for DNA/RNA secondary structure prediction and can provide precise and interactive correspondence among nucleotides, dot-bracket data, secondary structure graphs, and genic annotations. In JNSViewer, users can perform RNA secondary structure predictions with different programs and settings, add customized genic annotations in GFF format to structure graphs, search for specific linear motifs, and extract relevant structure graphs of sub-sequences. JNSViewer also allows users to choose a transcript or specific segment of Arabidopsis thaliana genome sequences and predict the corresponding secondary structure. Popular genome browsers (i.e., JBrowse and BrowserGenome were integrated into JNSViewer to provide powerful visualizations of chromosomal locations, genic annotations, and secondary structures. In addition, we used StructureFold with default settings to predict some RNA structures for Arabidopsis by incorporating in vivo high-throughput RNA structure profiling data and stored the results in our web server, which might be a useful resource for RNA secondary structure studies in plants. JNSViewer is available at http://bioinfolab.miamioh.edu/jnsviewer/index.html.
Yang, Cheng-Hong; Wu, Kuo-Chuan; Dahms, Hans-Uwe; Chuang, Li-Yeh; Chang, Hsueh-Wei
2017-07-01
DNA barcodes are widely used in taxonomy, systematics, species identification, food safety, and forensic science. Most of the conventional DNA barcode sequences contain the whole information of a given barcoding gene. Most of the sequence information does not vary and is uninformative for a given group of taxa within a monophylum. We suggest here a method that reduces the amount of noninformative nucleotides in a given barcoding sequence of a major taxon, like the prokaryotes, or eukaryotic animals, plants, or fungi. The actual differences in genetic sequences, called single nucleotide polymorphism (SNP) genotyping, provide a tool for developing a rapid, reliable, and high-throughput assay for the discrimination between known species. Here, we investigated SNPs as robust markers of genetic variation for identifying different pigeon species based on available cytochrome c oxidase I (COI) data. We propose here a decision tree-based SNP barcoding (DTSB) algorithm where SNP patterns are selected from the DNA barcoding sequence of several evolutionarily related species in order to identify a single species with pigeons as an example. This approach can make use of any established barcoding system. We here firstly used as an example the mitochondrial gene COI information of 17 pigeon species (Columbidae, Aves) using DTSB after sequence trimming and alignment. SNPs were chosen which followed the rule of decision tree and species-specific SNP barcodes. The shortest barcode of about 11 bp was then generated for discriminating 17 pigeon species using the DTSB method. This method provides a sequence alignment and tree decision approach to parsimoniously assign a unique and shortest SNP barcode for any known species of a chosen monophyletic taxon where a barcoding sequence is available.
Clarke, Wayne E.; Parkin, Isobel A.; Gajardo, Humberto A.; Gerhardt, Daniel J.; Higgins, Erin; Sidebottom, Christine; Sharpe, Andrew G.; Snowdon, Rod J.; Federico, Maria L.; Iniguez-Luy, Federico L.
2013-01-01
Targeted genomic selection methodologies, or sequence capture, allow for DNA enrichment and large-scale resequencing and characterization of natural genetic variation in species with complex genomes, such as rapeseed canola (Brassica napus L., AACC, 2n=38). The main goal of this project was to combine sequence capture with next generation sequencing (NGS) to discover single nucleotide polymorphisms (SNPs) in specific areas of the B. napus genome historically associated (via quantitative trait loci –QTL– analysis) to traits of agronomical and nutritional importance. A 2.1 million feature sequence capture platform was designed to interrogate DNA sequence variation across 47 specific genomic regions, representing 51.2 Mb of the Brassica A and C genomes, in ten diverse rapeseed genotypes. All ten genotypes were sequenced using the 454 Life Sciences chemistry and to assess the effect of increased sequence depth, two genotypes were also sequenced using Illumina HiSeq chemistry. As a result, 589,367 potentially useful SNPs were identified. Analysis of sequence coverage indicated a four-fold increased representation of target regions, with 57% of the filtered SNPs falling within these regions. Sixty percent of discovered SNPs corresponded to transitions while 40% were transversions. Interestingly, fifty eight percent of the SNPs were found in genic regions while 42% were found in intergenic regions. Further, a high percentage of genic SNPs was found in exons (65% and 64% for the A and C genomes, respectively). Two different genotyping assays were used to validate the discovered SNPs. Validation rates ranged from 61.5% to 84% of tested SNPs, underpinning the effectiveness of this SNP discovery approach. Most importantly, the discovered SNPs were associated with agronomically important regions of the B. napus genome generating a novel data resource for research and breeding this crop species. PMID:24312619
Energy Technology Data Exchange (ETDEWEB)
Jones, J.S.; Prakash, L. (Univ. of Rochester School of Medicine, NY (USA)); Weber, S. (Kodak Research Park, Rochester, NY (USA))
1988-07-25
The RAD18 gene of Saccharomyces cerevisiae is required for postreplication repair of UV damaged DNA. The authors have isolated the RAD18 gene, determined its nucleotide sequence and examined if deletion mutations of this gene show different or more pronounced phenotypic effects than the previously described point mutations. The RAD18 gene open reading frame encodes a protein of 487 amino acids, with a calculated molecular weight of 55,512. The RAD18 protein contains three potential zinc finger domains for nucleic acid binding, and a putative nucleotide binding sequence that is present in many proteins that bind and hydrolyze ATP. The DNA binding and nucleotide binding activities could enable the RAD18 protein to bind damaged sites in the template DNA with high affinity. Alternatively, or in addition, RAD18 protein may be a transcriptional regulator. The RAD18 deletion mutation resembles the previously described point mutations in its effects on viability, DNA repair, UV mutagenesis, and sporulation.
High-Throughput Block Optical DNA Sequence Identification.
Sagar, Dodderi Manjunatha; Korshoj, Lee Erik; Hanson, Katrina Bethany; Chowdhury, Partha Pratim; Otoupal, Peter Britton; Chatterjee, Anushree; Nagpal, Prashant
2018-01-01
Optical techniques for molecular diagnostics or DNA sequencing generally rely on small molecule fluorescent labels, which utilize light with a wavelength of several hundred nanometers for detection. Developing a label-free optical DNA sequencing technique will require nanoscale focusing of light, a high-throughput and multiplexed identification method, and a data compression technique to rapidly identify sequences and analyze genomic heterogeneity for big datasets. Such a method should identify characteristic molecular vibrations using optical spectroscopy, especially in the "fingerprinting region" from ≈400-1400 cm -1 . Here, surface-enhanced Raman spectroscopy is used to demonstrate label-free identification of DNA nucleobases with multiplexed 3D plasmonic nanofocusing. While nanometer-scale mode volumes prevent identification of single nucleobases within a DNA sequence, the block optical technique can identify A, T, G, and C content in DNA k-mers. The content of each nucleotide in a DNA block can be a unique and high-throughput method for identifying sequences, genes, and other biomarkers as an alternative to single-letter sequencing. Additionally, coupling two complementary vibrational spectroscopy techniques (infrared and Raman) can improve block characterization. These results pave the way for developing a novel, high-throughput block optical sequencing method with lossy genomic data compression using k-mer identification from multiplexed optical data acquisition. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Steenbergh, P.H.; Sussenbach, J.S.
The nucleotide sequence of the right-hand terminal 3% of adenovirus type 5 (Ad5) DNA has been determined, using the chemical degradation technique developed by Maxam and Gilbert (1977). This region of the genome comprises the 1003 basepair long HindIII-I fragment and the first 75 nucleotides of the
Nucleotide sequence of the melA gene, coding for alpha-galactosidase in Escherichia coli K-12.
Liljeström, P L; Liljeström, P
1987-01-01
Melibiose uptake and hydrolysis in E.coli is performed by the MelB and MelA proteins, respectively. We report the cloning and sequencing of the melA gene. The nucleotide sequence data showed that melA codes for a 450 amino acid long protein with a molecular weight of 50.6 kd. The sequence data also supported the assumption that the mel locus forms an operon with melA in proximal position. A comparison of MelA with alpha-galactosidase proteins from yeast and human origin showed that these prot...
37 CFR 1.822 - Symbols and format to be used for nucleotide and/or amino acid sequence data.
2010-07-01
... mature protein, with the number 1. When presented, the amino acids preceding the mature protein, e.g... acids. (1) The amino acids in a protein or peptide sequence shall be listed using the three-letter... data. (a) The symbols and format to be used for nucleotide and/or amino acid sequence data shall...
Hong, Yanbin; Pandey, Manish K; Liu, Ying; Chen, Xiaoping; Liu, Hong; Varshney, Rajeev K; Liang, Xuanqiang; Huang, Shangzhi
2015-01-01
The cultivated peanut (Arachis hypogaea L.) is an allotetraploid (AABB) species derived from the A-genome (Arachis duranensis) and B-genome (Arachis ipaensis) progenitors. Presence of two versions of a DNA sequence based on the two progenitor genomes poses a serious technical and analytical problem during single nucleotide polymorphism (SNP) marker identification and analysis. In this context, we have analyzed 200 amplicons derived from expressed sequence tags (ESTs) and genome survey sequences (GSS) to identify SNPs in a panel of genotypes consisting of 12 cultivated peanut varieties and two diploid progenitors representing the ancestral genomes. A total of 18 EST-SNPs and 44 genomic-SNPs were identified in 12 peanut varieties by aligning the sequence of A. hypogaea with diploid progenitors. The average frequency of sequence polymorphism was higher for genomic-SNPs than the EST-SNPs with one genomic-SNP every 1011 bp as compared to one EST-SNP every 2557 bp. In order to estimate the potential and further applicability of these identified SNPs, 96 peanut varieties were genotyped using high resolution melting (HRM) method. Polymorphism information content (PIC) values for EST-SNPs ranged between 0.021 and 0.413 with a mean of 0.172 in the set of peanut varieties, while genomic-SNPs ranged between 0.080 and 0.478 with a mean of 0.249. Total 33 SNPs were used for polymorphism detection among the parents and 10 selected lines from mapping population Y13Zh (Zhenzhuhei × Yueyou13). Of the total 33 SNPs, nine SNPs showed polymorphism in the mapping population Y13Zh, and seven SNPs were successfully mapped into five linkage groups. Our results showed that SNPs can be identified in allotetraploid peanut with high accuracy through amplicon sequencing and HRM assay. The identified SNPs were very informative and can be used for different genetic and breeding applications in peanut.
The nucleotide sequence of parsnip yellow fleck virus: a plant picorna-like virus.
Turnbull-Ross, A D; Reavy, B; Mayo, M A; Murant, A F
1992-12-01
The complete sequence of 9871 nucleotides (nts) of parsnip yellow fleck virus (PYFV; isolate P-121) was determined from cDNA clones and by direct sequencing of viral RNA. The RNA contains a large open reading frame between nts 279 and 9362 which encodes a polyprotein of 3027 amino acids with a calculated M(r) of 336212 (336K). A PYFV polyclonal antiserum reacted with the proteins expressed from phage carrying cDNA clones from the 5' half of the PYFV genome. Comparison of the polyprotein sequence of PYFV with other viral polyprotein sequences reveals similarities to the putative NTP-binding and RNA polymerase domains of cowpea mosaic comovirus, tomato black ring nepovirus and several animal picornaviruses. The 3' untranslated region of PYFV RNA is 509 nts long and does not have a poly(A) tail. The 3'-terminal 121 nts may form a stem-loop structure which resembles that formed in the genomic RNA of mosquito-borne flaviviruses.
Lee, Chao-Hung; Helweg-Larsen, Jannik; Tang, Xing; Jin, Shaoling; Li, Baozheng; Bartlett, Marilyn S.; Lu, Jang-Jih; Lundgren, Bettina; Lundgren, Jens D.; Olsson, Mats; Lucas, Sebastian B.; Roux, Patricia; Cargnel, Antonietta; Atzori, Chiara; Matos, Olga; Smith, James W.
1998-01-01
Pneumocystis carinii f. sp. hominis isolates from 207 clinical specimens from nine countries were typed based on nucleotide sequence variations in the internal transcribed spacer regions I and II (ITS1 and ITS2, respectively) of rRNA genes. The number of ITS1 nucleotides has been revised from the previously reported 157 bp to 161 bp. Likewise, the number of ITS2 nucleotides has been changed from 177 to 192 bp. The number of ITS1 sequence types has increased from 2 to 15, and that of ITS2 has increased from 3 to 14. The 15 ITS1 sequence types are designated types A through O, and the 14 ITS2 types are named types a through n. A total of 59 types of P. carinii f. sp. hominis were found in this study. PMID:9508304
International Nuclear Information System (INIS)
Cohen, J.I.; Rosenblum, B.; Ticehurst, J.R.; Daemer, R.; Feinstone, S.; Purcell, R.H.
1987-01-01
Development of attenuated mutants for use as vaccines is in progress for other viruses, including influenza, rotavirus, varicella-zoster, cytomegalovirus, and hepatitis-A virus (HAV). Attenuated viruses may be derived from naturally occurring mutants that infect human or nonhuman hosts. Alternatively, attenuated mutants may be generated by passage of wild-type virus in cell culture. Production of attenuated viruses in cell culture is a laborious and empiric process. Despite previous empiric successes, understanding the molecular basis for attenuation of vaccine viruses could facilitate future development and use of live-virus vaccines. Comparison of the complete nucleotide sequences of wild-type (virulent) and vaccine (attenuated) viruses has been reported for polioviruses and yellow fever virus. Here, the authors compare the nucleotide sequence of wild-type HAV HM-175 with that of a candidate vaccine derivative
Management of High-Throughput DNA Sequencing Projects: Alpheus.
Miller, Neil A; Kingsmore, Stephen F; Farmer, Andrew; Langley, Raymond J; Mudge, Joann; Crow, John A; Gonzalez, Alvaro J; Schilkey, Faye D; Kim, Ryan J; van Velkinburgh, Jennifer; May, Gregory D; Black, C Forrest; Myers, M Kathy; Utsey, John P; Frost, Nicholas S; Sugarbaker, David J; Bueno, Raphael; Gullans, Stephen R; Baxter, Susan M; Day, Steve W; Retzel, Ernest F
2008-12-26
High-throughput DNA sequencing has enabled systems biology to begin to address areas in health, agricultural and basic biological research. Concomitant with the opportunities is an absolute necessity to manage significant volumes of high-dimensional and inter-related data and analysis. Alpheus is an analysis pipeline, database and visualization software for use with massively parallel DNA sequencing technologies that feature multi-gigabase throughput characterized by relatively short reads, such as Illumina-Solexa (sequencing-by-synthesis), Roche-454 (pyrosequencing) and Applied Biosystem's SOLiD (sequencing-by-ligation). Alpheus enables alignment to reference sequence(s), detection of variants and enumeration of sequence abundance, including expression levels in transcriptome sequence. Alpheus is able to detect several types of variants, including non-synonymous and synonymous single nucleotide polymorphisms (SNPs), insertions/deletions (indels), premature stop codons, and splice isoforms. Variant detection is aided by the ability to filter variant calls based on consistency, expected allele frequency, sequence quality, coverage, and variant type in order to minimize false positives while maximizing the identification of true positives. Alpheus also enables comparisons of genes with variants between cases and controls or bulk segregant pools. Sequence-based differential expression comparisons can be developed, with data export to SAS JMP Genomics for statistical analysis.
Chromosomal location and nucleotide sequence of the Escherichia coli dapA gene.
Richaud, F; Richaud, C; Ratet, P; Patte, J C
1986-01-01
In Escherichia coli, the first enzyme of the diaminopimelate and lysine pathway is dihydrodipicolinate synthetase, which is feedback-inhibited by lysine and encoded by the dapA gene. The location of the dapA gene on the bacterial chromosome has been determined accurately with respect to the neighboring purC and dapE genes. The complete nucleotide sequence and the transcriptional start of the dapA gene were determined. The results show that dapA consists of a single cistron encoding a 292-amin...
Sánchez-Navarro, J A; Pallás, V
1997-01-01
The complete nucleotide sequence of an isolate of prunus necrotic ringspot virus (PNRSV) RNA 3 has been determined. Elucidation of the amino acid sequence of the proteins encoded by the two large open reading frames (ORFs) allowed us to carry out comparative and phylogenetic studies on the movement (MP) and coat (CP) proteins in the ilarvirus group. Amino acid sequence comparison of the MP revealed a highly conserved basic sequence motif with an amphipathic alpha-helical structure preceding the conserved motif of the '30K superfamily' proposed by Mushegian and Koonin [26] for MP's. Within this '30K' motif a strictly conserved transmembrane domain is present in all ilarviruses sequenced so far. At the amino-terminal end, prune dwarf virus (PDV) has an extension not present in other ilarviruses but which is observed in all bromo- and cucumoviruses, suggesting a common ancestor or a recombinational event in the Bromoviridae family. Examination of the N-terminus of the CP's of all ilarviruses revealed a highly basic region, part of which resembles the Arg-rich motif that has been characterized in the RNA-binding protein family. This motif has also been found in the other members of the Bromoviridae family, suggesting its involvement in a structural function. Furthermore this region is required for infectivity in ilarviruses. The similarities found in this Arg-rich motif are discussed in terms of this process known as genome activation. Finally, phylogenetic analysis of both the MP and CP proteins revealed a higher relationship of A1MV to PNRSV, apple mosaic virus (ApMV) and PDV than any other member of the ilarvirus group. In that sense, A1MV should be considered as a true ilarvirus instead of forming a distinct group of viruses.
Burns, Cara C; Kilpatrick, David R; Iber, Jane C; Chen, Qi; Kew, Olen M
2016-01-01
Virologic surveillance is essential to the success of the World Health Organization initiative to eradicate poliomyelitis. Molecular methods have been used to detect polioviruses in tissue culture isolates derived from stool samples obtained through surveillance for acute flaccid paralysis. This chapter describes the use of realtime PCR assays to identify and serotype polioviruses. In particular, a degenerate, inosine-containing, panpoliovirus (panPV) PCR primer set is used to distinguish polioviruses from NPEVs. The high degree of nucleotide sequence diversity among polioviruses presents a challenge to the systematic design of nucleic acid-based reagents. To accommodate the wide variability and rapid evolution of poliovirus genomes, degenerate codon positions on the template were matched to mixed-base or deoxyinosine residues on both the primers and the TaqMan™ probes. Additional assays distinguish between Sabin vaccine strains and non-Sabin strains. This chapter also describes the use of generic poliovirus specific primers, along with degenerate and inosine-containing primers, for routine VP1 sequencing of poliovirus isolates. These primers, along with nondegenerate serotype-specific Sabin primers, can also be used to sequence individual polioviruses in mixtures.
Nucleotide sequences of two genomic DNAs encoding peroxidase of Arabidopsis thaliana.
Intapruk, C; Higashimura, N; Yamamoto, K; Okada, N; Shinmyo, A; Takano, M
1991-02-15
The peroxidase (EC 1.11.1.7)-encoding gene of Arabidopsis thaliana was screened from a genomic library using a cDNA encoding a neutral isozyme of horseradish, Armoracia rusticana, peroxidase (HRP) as a probe, and two positive clones were isolated. From the comparison with the sequences of the HRP-encoding genes, we concluded that two clones contained peroxidase-encoding genes, and they were named prxCa and prxEa. Both genes consisted of four exons and three introns; the introns had consensus nucleotides, GT and AG, at the 5' and 3' ends, respectively. The lengths of each putative exon of the prxEa gene were the same as those of the HRP-basic-isozyme-encoding gene, prxC3, and coded for 349 amino acids (aa) with a sequence homology of 89% to that encoded by prxC3. The prxCa gene was very close to the HRP-neutral-isozyme-encoding gene, prxC1b, and coded for 354 aa with 91% homology to that encoded by prxC1b. The aa sequence homology was 64% between the two peroxidases encoded by prxCa and prxEa.
Unprecedented high-resolution view of bacterial operon architecture revealed by RNA sequencing.
Conway, Tyrrell; Creecy, James P; Maddox, Scott M; Grissom, Joe E; Conkle, Trevor L; Shadid, Tyler M; Teramoto, Jun; San Miguel, Phillip; Shimada, Tomohiro; Ishihama, Akira; Mori, Hirotada; Wanner, Barry L
2014-07-08
We analyzed the transcriptome of Escherichia coli K-12 by strand-specific RNA sequencing at single-nucleotide resolution during steady-state (logarithmic-phase) growth and upon entry into stationary phase in glucose minimal medium. To generate high-resolution transcriptome maps, we developed an organizational schema which showed that in practice only three features are required to define operon architecture: the promoter, terminator, and deep RNA sequence read coverage. We precisely annotated 2,122 promoters and 1,774 terminators, defining 1,510 operons with an average of 1.98 genes per operon. Our analyses revealed an unprecedented view of E. coli operon architecture. A large proportion (36%) of operons are complex with internal promoters or terminators that generate multiple transcription units. For 43% of operons, we observed differential expression of polycistronic genes, despite being in the same operons, indicating that E. coli operon architecture allows fine-tuning of gene expression. We found that 276 of 370 convergent operons terminate inefficiently, generating complementary 3' transcript ends which overlap on average by 286 nucleotides, and 136 of 388 divergent operons have promoters arranged such that their 5' ends overlap on average by 168 nucleotides. We found 89 antisense transcripts of 397-nucleotide average length, 7 unannotated transcripts within intergenic regions, and 18 sense transcripts that completely overlap operons on the opposite strand. Of 519 overlapping transcripts, 75% correspond to sequences that are highly conserved in E. coli (>50 genomes). Our data extend recent studies showing unexpected transcriptome complexity in several bacteria and suggest that antisense RNA regulation is widespread. Importance: We precisely mapped the 5' and 3' ends of RNA transcripts across the E. coli K-12 genome by using a single-nucleotide analytical approach. Our resulting high-resolution transcriptome maps show that ca. one-third of E. coli operons are
Ghanem-Sabanadzovic, Nina Abou; Sabanadzovic, Sead; Digiaro, Michele; Martelli, Giovanni P
2005-05-01
The nucleotide sequence of RNA-2 of Grapevine Anatolian ringspot virus (GARSV) and Grapevine deformation virus (GDefV), two recently described nepoviruses, has been determined. These RNAs are 3753 nt (GDefV) and 4607 nt (GARSV) in size and contain a single open reading frame encoding a polyprotein of 122 kDa (GDefV) and 150 kDa (GARSV). Full-length nucleotide sequence comparison disclosed 71-73% homology between GDefV RNA-2 and that of Grapevine fanleaf virus (GFLV) and Arabis mosaic virus (ArMV), and 62-64% homology between GARSV RNA-2 and that of Grapevine chrome mosaic virus (GCMV) and Tomato black ring virus (TBRV). As previously observed in other nepoviruses, the 5' non-coding regions of both RNAs are capable of forming stem-loop structures. Phylogenetic analysis of the three proteins encoded by RNA-2 (i.e. protein 2A, movement protein and coat protein) confirmed that GDefV and GARSV are distinct viruses which can be assigned as definitive species in subgroup A and subgroup B of the genus Nepovirus, respectively.
Zhou, Cui-Ji; Xiang, Hai-Ying; Zhuo, Tao; Li, Da-Wei; Yu, Jia-Lin; Han, Cheng-Gui
2012-07-01
We determined the genome sequence of a new polerovirus that infects field pea and faba bean in China. Its entire nucleotide sequence (6021 nt) was most closely related (83.3% identity) to that of an Ethiopian isolate of chickpea chlorotic stunt virus (CpCSV-Eth). With the exception of the coat protein (encoded by ORF3), amino acid sequence identities of all gene products of this virus to those of CpCSV-Eth and other poleroviruses were Polerovirus, and the name pea mild chlorosis virus is proposed.
Kuznedelov, K D; Timoshkin, O A
1995-01-01
Polymerase chain reaction and direct sequencing of the 5'-end region of the 18S ribosomal RNA gene were used to infer phylogenetic relationship among turbellarian flatworms from Lake Baikal. Representatives of 5 orders (Tricladida--10 spp., Lecithoepitheliata--5 spp., Prolecithophora--3 spp., Proseriata and Kalyptorhynchia one for each) were studied; nucleotide sequence of more than 340 nucleotides was determined for each species. Consensus sequence for each order having more than one representative species was determined. Distance matrix and maximum parsimony approaches were applied to infer phylogenies. Bootstrap procedure was used to estimate confidence limits, at the 100% level by bootstrapping, the group of three orders: Kalyptorhynchia, Proseriata and Lecithoepitheliata was found to be monophyletic. However, subsets inside the group had no significant support to be preferred or rejected. Our data do not support traditional systematics which joins two suborders Tricladida and Proseriata into the single order Seriata, and also do not support comparative anatomical data which show close relationship of Lecithoepitheliata and lower Prolecithophora.
Nishizawa, M; Nishizawa, K
2000-10-01
The tendency for repetitiveness of nucleotides in DNA sequences has been reported for a variety of organisms. We show that the tendency for repetitive use of amino acids is widespread and is observed even for segments conserved between human and Drosophila melanogaster at the level of >50% amino acid identity. This indicates that repetitiveness influences not only the weakly constrained segments but also those sequence segments conserved among phyla. Not only glutamine (Q) but also many of the 20 amino acids show a comparable level of repetitiveness. Repetitiveness in bases at codon position 3 is stronger for human than for D.melanogaster, whereas local repetitiveness in intron sequences is similar between the two organisms. While genes for immune system-specific proteins, but not ancient human genes (i.e. human homologs of Escherichia coli genes), have repetitiveness at codon bases 1 and 2, repetitiveness at codon base 3 for these groups is similar, suggesting that the human genome has at least two mechanisms generating local repetitiveness. Neither amino acid nor nucleotide repetitiveness is observed beyond the exon boundary, denying the possibility that such repetitiveness could mainly stem from natural selection on mRNA or protein sequences. Analyses of mammalian sequence alignments show that while the 'between gene' GC content heterogeneity, which is linked to 'isochores', is a principal factor associated with the bias in substitution patterns in human, 'within gene' heterogeneity in nucleotide composition is also associated with such bias on a more local scale. The relationship amongst the various types of repetitiveness is discussed.
Chromosomal location and nucleotide sequence of the Escherichia coli dapA gene.
Richaud, F; Richaud, C; Ratet, P; Patte, J C
1986-04-01
In Escherichia coli, the first enzyme of the diaminopimelate and lysine pathway is dihydrodipicolinate synthetase, which is feedback-inhibited by lysine and encoded by the dapA gene. The location of the dapA gene on the bacterial chromosome has been determined accurately with respect to the neighboring purC and dapE genes. The complete nucleotide sequence and the transcriptional start of the dapA gene were determined. The results show that dapA consists of a single cistron encoding a 292-amino acid polypeptide of 31,372 daltons.
Chromosomal location and nucleotide sequence of the Escherichia coli dapA gene.
Richaud, F; Richaud, C; Ratet, P; Patte, J C
1986-01-01
In Escherichia coli, the first enzyme of the diaminopimelate and lysine pathway is dihydrodipicolinate synthetase, which is feedback-inhibited by lysine and encoded by the dapA gene. The location of the dapA gene on the bacterial chromosome has been determined accurately with respect to the neighboring purC and dapE genes. The complete nucleotide sequence and the transcriptional start of the dapA gene were determined. The results show that dapA consists of a single cistron encoding a 292-amino acid polypeptide of 31,372 daltons. Images PMID:3514578
Krawitz, Peter M; Schiska, Daniela; Krüger, Ulrike; Appelt, Sandra; Heinrich, Verena; Parkhomchuk, Dmitri; Timmermann, Bernd; Millan, Jose M; Robinson, Peter N; Mundlos, Stefan; Hecht, Jochen; Gross, Manfred
2014-09-01
Usher syndrome is an autosomal recessive disorder characterized both by deafness and blindness. For the three clinical subtypes of Usher syndrome causal mutations in altogether 12 genes and a modifier gene have been identified. Due to the genetic heterogeneity of Usher syndrome, the molecular analysis is predestined for a comprehensive and parallelized analysis of all known genes by next-generation sequencing (NGS) approaches. We describe here the targeted enrichment and deep sequencing for exons of Usher genes and compare the costs and workload of this approach compared to Sanger sequencing. We also present a bioinformatics analysis pipeline that allows us to detect single-nucleotide variants, short insertions and deletions, as well as copy number variations of one or more exons on the same sequence data. Additionally, we present a flexible in silico gene panel for the analysis of sequence variants, in which newly identified genes can easily be included. We applied this approach to a cohort of 44 Usher patients and detected biallelic pathogenic mutations in 35 individuals and monoallelic mutations in eight individuals of our cohort. Thirty-nine of the sequence variants, including two heterozygous deletions comprising several exons of USH2A, have not been reported so far. Our NGS-based approach allowed us to assess single-nucleotide variants, small indels, and whole exon deletions in a single test. The described diagnostic approach is fast and cost-effective with a high molecular diagnostic yield.
Matsuda, M; Tai, K; Moore, J E; Millar, B C; Murayama, O
2004-01-01
Nucleotide sequencing after TA cloning of the amplicon of the almost-full length recA gene from three strains of UPTC (A1, A2, and A3) isolated from seagulls in Northern Ireland, the phenotypical and genotypical characteristics of which have been demonstrated to be indistinguishable, clarified nucleotide differences at three nucleotide positions among the three strains. In conclusion, the nucleotide sequences of the recA gene were found to discriminate among the three strains of UPTC, A1, A2, and A3, which are indistinguishable phenotypically and genotypically. Thus, the present study strongly suggests that nucleotide sequence data of the amplicon of a suitable gene or region could aid in discriminating among isolates of the UPTC group, which are indistinguishable phenotypically and genotypically. Copyright 2004 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim
Quantum-Sequencing: Fast electronic single DNA molecule sequencing
Casamada Ribot, Josep; Chatterjee, Anushree; Nagpal, Prashant
2014-03-01
A major goal of third-generation sequencing technologies is to develop a fast, reliable, enzyme-free, high-throughput and cost-effective, single-molecule sequencing method. Here, we present the first demonstration of unique ``electronic fingerprint'' of all nucleotides (A, G, T, C), with single-molecule DNA sequencing, using Quantum-tunneling Sequencing (Q-Seq) at room temperature. We show that the electronic state of the nucleobases shift depending on the pH, with most distinct states identified at acidic pH. We also demonstrate identification of single nucleotide modifications (methylation here). Using these unique electronic fingerprints (or tunneling data), we report a partial sequence of beta lactamase (bla) gene, which encodes resistance to beta-lactam antibiotics, with over 95% success rate. These results highlight the potential of Q-Seq as a robust technique for next-generation sequencing.
Directory of Open Access Journals (Sweden)
Yuki Furuse
2015-11-01
Full Text Available Infection due to the Middle East respiratory syndrome coronavirus (MERS-CoV is widespread. The present study was performed to assess the protocols used for the molecular diagnosis of MERS-CoV by analyzing the nucleotide sequences of viruses detected between 2012 and 2015, including sequences from the large outbreak in eastern Asia in 2015. Although the diagnostic protocols were established only 2 years ago, mismatches between the sequences of primers/probes and viruses were found for several of the assays. Such mismatches could lead to a lower sensitivity of the assay, thereby leading to false-negative diagnosis. A slight modification in the primer design is suggested. Protocols for the molecular diagnosis of viral infections should be reviewed regularly after they are established, particularly for viruses that pose a great threat to public health such as MERS-CoV.
Directory of Open Access Journals (Sweden)
Li Xuehui
2012-10-01
Full Text Available Abstract Background Alfalfa, a perennial, outcrossing species, is a widely planted forage legume producing highly nutritious biomass. Currently, improvement of cultivated alfalfa mainly relies on recurrent phenotypic selection. Marker assisted breeding strategies can enhance alfalfa improvement efforts, particularly if many genome-wide markers are available. Transcriptome sequencing enables efficient high-throughput discovery of single nucleotide polymorphism (SNP markers for a complex polyploid species. Result The transcriptomes of 27 alfalfa genotypes, including elite breeding genotypes, parents of mapping populations, and unimproved wild genotypes, were sequenced using an Illumina Genome Analyzer IIx. De novo assembly of quality-filtered 72-bp reads generated 25,183 contigs with a total length of 26.8 Mbp and an average length of 1,065 bp, with an average read depth of 55.9-fold for each genotype. Overall, 21,954 (87.2% of the 25,183 contigs represented 14,878 unique protein accessions. Gene ontology (GO analysis suggested that a broad diversity of genes was represented in the resulting sequences. The realignment of individual reads to the contigs enabled the detection of 872,384 SNPs and 31,760 InDels. High resolution melting (HRM analysis was used to validate 91% of 192 putative SNPs identified by sequencing. Both allelic variants at about 95% of SNP sites identified among five wild, unimproved genotypes are still present in cultivated alfalfa, and all four US breeding programs also contain a high proportion of these SNPs. Thus, little evidence exists among this dataset for loss of significant DNA sequence diversity from either domestication or breeding of alfalfa. Structure analysis indicated that individuals from the subspecies falcata, the diploid subspecies caerulea, and the tetraploid subspecies sativa (cultivated tetraploid alfalfa were clearly separated. Conclusion We used transcriptome sequencing to discover large numbers of SNPs
Greiner, Stephan; Wang, Xi; Rauwolf, Uwe; Silber, Martina V; Mayer, Klaus; Meurer, Jörg; Haberer, Georg; Herrmann, Reinhold G
2008-04-01
The flowering plant genus Oenothera is uniquely suited for studying molecular mechanisms of speciation. It assembles an intriguing combination of genetic features, including permanent translocation heterozygosity, biparental transmission of plastids, and a general interfertility of well-defined species. This allows an exchange of plastids and nuclei between species often resulting in plastome-genome incompatibility. For evaluation of its molecular determinants we present the complete nucleotide sequences of the five basic, genetically distinguishable plastid chromosomes of subsection Oenothera (=Euoenothera) of the genus, which are associated in distinct combinations with six basic genomes. Sizes of the chromosomes range from 163 365 bp (plastome IV) to 165 728 bp (plastome I), display between 96.3% and 98.6% sequence similarity and encode a total of 113 unique genes. Plastome diversification is caused by an abundance of nucleotide substitutions, small insertions, deletions and repetitions. The five plastomes deviate from the general ancestral design of plastid chromosomes of vascular plants by a subsection-specific 56 kb inversion within the large single-copy segment. This inversion disrupted operon structures and predates the divergence of the subsection presumably 1 My ago. Phylogenetic relationships suggest plastomes I-III in one clade, while plastome IV appears to be closest to the common ancestor.
Greiner, Stephan; Wang, Xi; Rauwolf, Uwe; Silber, Martina V.; Mayer, Klaus; Meurer, Jörg; Haberer, Georg; Herrmann, Reinhold G.
2008-01-01
The flowering plant genus Oenothera is uniquely suited for studying molecular mechanisms of speciation. It assembles an intriguing combination of genetic features, including permanent translocation heterozygosity, biparental transmission of plastids, and a general interfertility of well-defined species. This allows an exchange of plastids and nuclei between species often resulting in plastome–genome incompatibility. For evaluation of its molecular determinants we present the complete nucleotide sequences of the five basic, genetically distinguishable plastid chromosomes of subsection Oenothera (=Euoenothera) of the genus, which are associated in distinct combinations with six basic genomes. Sizes of the chromosomes range from 163 365 bp (plastome IV) to 165 728 bp (plastome I), display between 96.3% and 98.6% sequence similarity and encode a total of 113 unique genes. Plastome diversification is caused by an abundance of nucleotide substitutions, small insertions, deletions and repetitions. The five plastomes deviate from the general ancestral design of plastid chromosomes of vascular plants by a subsection-specific 56 kb inversion within the large single-copy segment. This inversion disrupted operon structures and predates the divergence of the subsection presumably 1 My ago. Phylogenetic relationships suggest plastomes I–III in one clade, while plastome IV appears to be closest to the common ancestor. PMID:18299283
Fountain, Emily D.; Pauli, Jonathan N.; Reid, Brendan N.; Palsboll, Per J.; Peery, M. Zachariah
Restriction-enzyme-based sequencing methods enable the genotyping of thousands of single nucleotide polymorphism (SNP) loci in nonmodel organisms. However, in contrast to traditional genetic markers, genotyping error rates in SNPs derived from restriction-enzyme-based methods remain largely unknown.
Directory of Open Access Journals (Sweden)
Salem Mohamed
2009-11-01
Full Text Available Abstract Background To enhance capabilities for genomic analyses in rainbow trout, such as genomic selection, a large suite of polymorphic markers that are amenable to high-throughput genotyping protocols must be identified. Expressed Sequence Tags (ESTs have been used for single nucleotide polymorphism (SNP discovery in salmonids. In those strategies, the salmonid semi-tetraploid genomes often led to assemblies of paralogous sequences and therefore resulted in a high rate of false positive SNP identification. Sequencing genomic DNA using primers identified from ESTs proved to be an effective but time consuming methodology of SNP identification in rainbow trout, therefore not suitable for high throughput SNP discovery. In this study, we employed a high-throughput strategy that used pyrosequencing technology to generate data from a reduced representation library constructed with genomic DNA pooled from 96 unrelated rainbow trout that represent the National Center for Cool and Cold Water Aquaculture (NCCCWA broodstock population. Results The reduced representation library consisted of 440 bp fragments resulting from complete digestion with the restriction enzyme HaeIII; sequencing produced 2,000,000 reads providing an average 6 fold coverage of the estimated 150,000 unique genomic restriction fragments (300,000 fragment ends. Three independent data analyses identified 22,022 to 47,128 putative SNPs on 13,140 to 24,627 independent contigs. A set of 384 putative SNPs, randomly selected from the sets produced by the three analyses were genotyped on individual fish to determine the validation rate of putative SNPs among analyses, distinguish apparent SNPs that actually represent paralogous loci in the tetraploid genome, examine Mendelian segregation, and place the validated SNPs on the rainbow trout linkage map. Approximately 48% (183 of the putative SNPs were validated; 167 markers were successfully incorporated into the rainbow trout linkage map. In
Sánchez, Cecilia Castaño; Smith, Timothy P L; Wiedmann, Ralph T; Vallejo, Roger L; Salem, Mohamed; Yao, Jianbo; Rexroad, Caird E
2009-11-25
To enhance capabilities for genomic analyses in rainbow trout, such as genomic selection, a large suite of polymorphic markers that are amenable to high-throughput genotyping protocols must be identified. Expressed Sequence Tags (ESTs) have been used for single nucleotide polymorphism (SNP) discovery in salmonids. In those strategies, the salmonid semi-tetraploid genomes often led to assemblies of paralogous sequences and therefore resulted in a high rate of false positive SNP identification. Sequencing genomic DNA using primers identified from ESTs proved to be an effective but time consuming methodology of SNP identification in rainbow trout, therefore not suitable for high throughput SNP discovery. In this study, we employed a high-throughput strategy that used pyrosequencing technology to generate data from a reduced representation library constructed with genomic DNA pooled from 96 unrelated rainbow trout that represent the National Center for Cool and Cold Water Aquaculture (NCCCWA) broodstock population. The reduced representation library consisted of 440 bp fragments resulting from complete digestion with the restriction enzyme HaeIII; sequencing produced 2,000,000 reads providing an average 6 fold coverage of the estimated 150,000 unique genomic restriction fragments (300,000 fragment ends). Three independent data analyses identified 22,022 to 47,128 putative SNPs on 13,140 to 24,627 independent contigs. A set of 384 putative SNPs, randomly selected from the sets produced by the three analyses were genotyped on individual fish to determine the validation rate of putative SNPs among analyses, distinguish apparent SNPs that actually represent paralogous loci in the tetraploid genome, examine Mendelian segregation, and place the validated SNPs on the rainbow trout linkage map. Approximately 48% (183) of the putative SNPs were validated; 167 markers were successfully incorporated into the rainbow trout linkage map. In addition, 2% of the sequences from the
The sequence specificity of UV-induced DNA damage in a systematically altered DNA sequence.
Khoe, Clairine V; Chung, Long H; Murray, Vincent
2018-06-01
The sequence specificity of UV-induced DNA damage was investigated in a specifically designed DNA plasmid using two procedures: end-labelling and linear amplification. Absorption of UV photons by DNA leads to dimerisation of pyrimidine bases and produces two major photoproducts, cyclobutane pyrimidine dimers (CPDs) and pyrimidine(6-4)pyrimidone photoproducts (6-4PPs). A previous study had determined that two hexanucleotide sequences, 5'-GCTC*AC and 5'-TATT*AA, were high intensity UV-induced DNA damage sites. The UV clone plasmid was constructed by systematically altering each nucleotide of these two hexanucleotide sequences. One of the main goals of this study was to determine the influence of single nucleotide alterations on the intensity of UV-induced DNA damage. The sequence 5'-GCTC*AC was designed to examine the sequence specificity of 6-4PPs and the highest intensity 6-4PP damage sites were found at 5'-GTTC*CC nucleotides. The sequence 5'-TATT*AA was devised to investigate the sequence specificity of CPDs and the highest intensity CPD damage sites were found at 5'-TTTT*CG nucleotides. It was proposed that the tetranucleotide DNA sequence, 5'-YTC*Y (where Y is T or C), was the consensus sequence for the highest intensity UV-induced 6-4PP adduct sites; while it was 5'-YTT*C for the highest intensity UV-induced CPD damage sites. These consensus tetranucleotides are composed entirely of consecutive pyrimidines and must have a DNA conformation that is highly productive for the absorption of UV photons. Crown Copyright © 2018. Published by Elsevier B.V. All rights reserved.
Short sequence motifs, overrepresented in mammalian conservednon-coding sequences
Energy Technology Data Exchange (ETDEWEB)
Minovitsky, Simon; Stegmaier, Philip; Kel, Alexander; Kondrashov,Alexey S.; Dubchak, Inna
2007-02-21
Background: A substantial fraction of non-coding DNAsequences of multicellular eukaryotes is under selective constraint. Inparticular, ~;5 percent of the human genome consists of conservednon-coding sequences (CNSs). CNSs differ from other genomic sequences intheir nucleotide composition and must play important functional roles,which mostly remain obscure.Results: We investigated relative abundancesof short sequence motifs in all human CNSs present in the human/mousewhole-genome alignments vs. three background sets of sequences: (i)weakly conserved or unconserved non-coding sequences (non-CNSs); (ii)near-promoter sequences (located between nucleotides -500 and -1500,relative to a start of transcription); and (iii) random sequences withthe same nucleotide composition as that of CNSs. When compared tonon-CNSs and near-promoter sequences, CNSs possess an excess of AT-richmotifs, often containing runs of identical nucleotides. In contrast, whencompared to random sequences, CNSs contain an excess of GC-rich motifswhich, however, lack CpG dinucleotides. Thus, abundance of short sequencemotifs in human CNSs, taken as a whole, is mostly determined by theiroverall compositional properties and not by overrepresentation of anyspecific short motifs. These properties are: (i) high AT-content of CNSs,(ii) a tendency, probably due to context-dependent mutation, of A's andT's to clump, (iii) presence of short GC-rich regions, and (iv) avoidanceof CpG contexts, due to their hypermutability. Only a small number ofshort motifs, overrepresented in all human CNSs are similar to bindingsites of transcription factors from the FOX family.Conclusion: Human CNSsas a whole appear to be too broad a class of sequences to possess strongfootprints of any short sequence-specific functions. Such footprintsshould be studied at the level of functional subclasses of CNSs, such asthose which flank genes with a particular pattern of expression. Overallproperties of CNSs are affected by
International Nuclear Information System (INIS)
Steenbergh, P.H.
1979-01-01
The purpose of the investigations described is the determination of nucleotide sequences at the molecular ends of the linear adenovirus type 5 DNA. Knowledge of the primary structure at the termini of this DNA molecule is of particular interest in the study of the mechanism of replication of adenovirus DNA. The initiation- and termination sites of adenovirus DNA replication are located at the ends of the DNA molecule. (Auth.)
Lee, Mei-Ling Ting; Bulyk, Martha L; Whitmore, G A; Church, George M
2002-12-01
There is considerable scientific interest in knowing the probability that a site-specific transcription factor will bind to a given DNA sequence. Microarray methods provide an effective means for assessing the binding affinities of a large number of DNA sequences as demonstrated by Bulyk et al. (2001, Proceedings of the National Academy of Sciences, USA 98, 7158-7163) in their study of the DNA-binding specificities of Zif268 zinc fingers using microarray technology. In a follow-up investigation, Bulyk, Johnson, and Church (2002, Nucleic Acid Research 30, 1255-1261) studied the interdependence of nucleotides on the binding affinities of transcription proteins. Our article is motivated by this pair of studies. We present a general statistical methodology for analyzing microarray intensity measurements reflecting DNA-protein interactions. The log probability of a protein binding to a DNA sequence on an array is modeled using a linear ANOVA model. This model is convenient because it employs familiar statistical concepts and procedures and also because it is effective for investigating the probability structure of the binding mechanism.
DEFF Research Database (Denmark)
Liu, Siyang; Huang, Shujia; Rao, Junhua
2015-01-01
present a novel approach implemented in a single software package, AsmVar, to discover, genotype and characterize different forms of structural variation and novel sequence from population-scale de novo genome assemblies up to nucleotide resolution. Application of AsmVar to several human de novo genome......) as well as large deletions. However, these approaches consistently display a substantial bias against the recovery of complex structural variants and novel sequence in individual genomes and do not provide interpretation information such as the annotation of ancestral state and formation mechanism. We...... assemblies captures a wide spectrum of structural variants and novel sequences present in the human population in high sensitivity and specificity. Our method provides a direct solution for investigating structural variants and novel sequences from de novo genome assemblies, facilitating the construction...
Jaschob, Daniel; Davis, Trisha N; Riffle, Michael
2015-03-07
Sequence feature annotations (e.g., protein domain boundaries, binding sites, and secondary structure predictions) are an essential part of biological research. Annotations are widely used by scientists during research and experimental design, and are frequently the result of biological studies. A generalized and simple means of disseminating and visualizing these data via the web would be of value to the research community. Mason is a web site widget designed to visualize and compare annotated features of one or more nucleotide or protein sequence. Annotated features may be of virtually any type, ranging from annotating transcription binding sites or exons and introns in DNA to secondary structure or domain boundaries in proteins. Mason is simple to use and easy to integrate into web sites. Mason has a highly dynamic and configurable interface supporting multiple sets of annotations per sequence, overlapping regions, customization of interface and user-driven events (e.g., clicks and text to appear for tooltips). It is written purely in JavaScript and SVG, requiring no 3(rd) party plugins or browser customization. Mason is a solution for dissemination of sequence annotation data on the web. It is highly flexible, customizable, simple to use, and is designed to be easily integrated into web sites. Mason is open source and freely available at https://github.com/yeastrc/mason.
OrthoANI: An improved algorithm and software for calculating average nucleotide identity.
Lee, Imchang; Ouk Kim, Yeong; Park, Sang-Cheol; Chun, Jongsik
2016-02-01
Species demarcation in Bacteria and Archaea is mainly based on overall genome relatedness, which serves a framework for modern microbiology. Current practice for obtaining these measures between two strains is shifting from experimentally determined similarity obtained by DNA-DNA hybridization (DDH) to genome-sequence-based similarity. Average nucleotide identity (ANI) is a simple algorithm that mimics DDH. Like DDH, ANI values between two genome sequences may be different from each other when reciprocal calculations are compared. We compared 63 690 pairs of genome sequences and found that the differences in reciprocal ANI values are significantly high, exceeding 1 % in some cases. To resolve this problem of not being symmetrical, a new algorithm, named OrthoANI, was developed to accommodate the concept of orthology for which both genome sequences were fragmented and only orthologous fragment pairs taken into consideration for calculating nucleotide identities. OrthoANI is highly correlated with ANI (using BLASTn) and the former showed approximately 0.1 % higher values than the latter. In conclusion, OrthoANI provides a more robust and faster means of calculating average nucleotide identity for taxonomic purposes. The standalone software tools are freely available at http://www.ezbiocloud.net/sw/oat.
Directory of Open Access Journals (Sweden)
Sukdeb Nandi
2010-03-01
Full Text Available Canine parvovirus 2 (CPV‑2 is one of the most important viruses that causes haemorrhagic gastroenteritis and myocarditis of dogs worldwide. The picture has been complicated further due to the emergence of new mutants of CPV, namely: CPV‑2a, CPV‑2b and CPV‑2c. In this study, the molecular characterisation of strains present in the CPV vaccines available on the Indian market was performed using polymerase chain reaction and DNA sequencing. The VP1/VP2 genes of two vaccine strains and a field strain (Bhopal were sequenced and the nucleotide and the deduced amino acid sequences were compared. The results indicated that the isolate belonged to CPV type 2b and the strains in the vaccines belonged to type CPV‑2. From the study, it is inferred that the CPV strain used in commercially available vaccine preparation differed from the strains present in CPV infection in dogs in India
Nandi, Sukdeb; Anbazhagan, Rajendra; Kumar, Manoj
2010-01-01
Canine parvovirus 2 (CPV-2) is one of the most important viruses that causes haemorrhagic gastroenteritis and myocarditis of dogs worldwide. The picture has been complicated further due to the emergence of new mutants of CPV, namely: CPV-2a, CPV-2b and CPV-2c. In this study, the molecular characterisation of strains present in the CPV vaccines available on the Indian market was performed using polymerase chain reaction and DNA sequencing. The VP1/VP2 genes of two vaccine strains and a field strain (Bhopal) were sequenced and the nucleotide and the deduced amino acid sequences were compared. The results indicated that the isolate belonged to CPV type 2b and the strains in the vaccines belonged to type CPV-2. From the study, it is inferred that the CPV strain used in commercially available vaccine preparation differed from the strains present in CPV infection in dogs in India.
Directed PCR-free engineering of highly repetitive DNA sequences
Directory of Open Access Journals (Sweden)
Preissler Steffen
2011-09-01
Full Text Available Abstract Background Highly repetitive nucleotide sequences are commonly found in nature e.g. in telomeres, microsatellite DNA, polyadenine (poly(A tails of eukaryotic messenger RNA as well as in several inherited human disorders linked to trinucleotide repeat expansions in the genome. Therefore, studying repetitive sequences is of biological, biotechnological and medical relevance. However, cloning of such repetitive DNA sequences is challenging because specific PCR-based amplification is hampered by the lack of unique primer binding sites resulting in unspecific products. Results For the PCR-free generation of repetitive DNA sequences we used antiparallel oligonucleotides flanked by restriction sites of Type IIS endonucleases. The arrangement of recognition sites allowed for stepwise and seamless elongation of repetitive sequences. This facilitated the assembly of repetitive DNA segments and open reading frames encoding polypeptides with periodic amino acid sequences of any desired length. By this strategy we cloned a series of polyglutamine encoding sequences as well as highly repetitive polyadenine tracts. Such repetitive sequences can be used for diverse biotechnological applications. As an example, the polyglutamine sequences were expressed as His6-SUMO fusion proteins in Escherichia coli cells to study their aggregation behavior in vitro. The His6-SUMO moiety enabled affinity purification of the polyglutamine proteins, increased their solubility, and allowed controlled induction of the aggregation process. We successfully purified the fusions proteins and provide an example for their applicability in filter retardation assays. Conclusion Our seamless cloning strategy is PCR-free and allows the directed and efficient generation of highly repetitive DNA sequences of defined lengths by simple standard cloning procedures.
Allegre, Mathilde; Argout, Xavier; Boccara, Michel; Fouet, Olivier; Roguet, Yolande; Bérard, Aurélie; Thévenin, Jean Marc; Chauveau, Aurélie; Rivallan, Ronan; Clement, Didier; Courtois, Brigitte; Gramacho, Karina; Boland-Augé, Anne; Tahi, Mathias; Umaharan, Pathmanathan; Brunel, Dominique; Lanaud, Claire
2012-01-01
Theobroma cacao is an economically important tree of several tropical countries. Its genetic improvement is essential to provide protection against major diseases and improve chocolate quality. We discovered and mapped new expressed sequence tag-single nucleotide polymorphism (EST-SNP) and simple sequence repeat (SSR) markers and constructed a high-density genetic map. By screening 149 650 ESTs, 5246 SNPs were detected in silico, of which 1536 corresponded to genes with a putative function, while 851 had a clear polymorphic pattern across a collection of genetic resources. In addition, 409 new SSR markers were detected on the Criollo genome. Lastly, 681 new EST-SNPs and 163 new SSRs were added to the pre-existing 418 co-dominant markers to construct a large consensus genetic map. This high-density map and the set of new genetic markers identified in this study are a milestone in cocoa genomics and for marker-assisted breeding. The data are available at http://tropgenedb.cirad.fr. PMID:22210604
Presence of a consensus DNA motif at nearby DNA sequence of the mutation susceptible CG nucleotides.
Chowdhury, Kaushik; Kumar, Suresh; Sharma, Tanu; Sharma, Ankit; Bhagat, Meenakshi; Kamai, Asangla; Ford, Bridget M; Asthana, Shailendra; Mandal, Chandi C
2018-01-10
Complexity in tissues affected by cancer arises from somatic mutations and epigenetic modifications in the genome. The mutation susceptible hotspots present within the genome indicate a non-random nature and/or a position specific selection of mutation. An association exists between the occurrence of mutations and epigenetic DNA methylation. This study is primarily aimed at determining mutation status, and identifying a signature for predicting mutation prone zones of tumor suppressor (TS) genes. Nearby sequences from the top five positions having a higher mutation frequency in each gene of 42 TS genes were selected from a cosmic database and were considered as mutation prone zones. The conserved motifs present in the mutation prone DNA fragments were identified. Molecular docking studies were done to determine putative interactions between the identified conserved motifs and enzyme methyltransferase DNMT1. Collective analysis of 42 TS genes found GC as the most commonly replaced and AT as the most commonly formed residues after mutation. Analysis of the top 5 mutated positions of each gene (210 DNA segments for 42 TS genes) identified that CG nucleotides of the amino acid codons (e.g., Arginine) are most susceptible to mutation, and found a consensus DNA "T/AGC/GAGGA/TG" sequence present in these mutation prone DNA segments. Similar to TS genes, analysis of 54 oncogenes not only found CG nucleotides of the amino acid Arg as the most susceptible to mutation, but also identified the presence of similar consensus DNA motifs in the mutation prone DNA fragments (270 DNA segments for 54 oncogenes) of oncogenes. Docking studies depicted that, upon binding of DNMT1 methylates to this consensus DNA motif (C residues of CpG islands), mutation was likely to occur. Thus, this study proposes that DNMT1 mediated methylation in chromosomal DNA may decrease if a foreign DNA segment containing this consensus sequence along with CG nucleotides is exogenously introduced to dividing
Sequencing of 50 human exomes reveals adaptation to high altitude
DEFF Research Database (Denmark)
Yi, Xin; Liang, Yu; Huerta-Sanchez, Emilia
2010-01-01
Residents of the Tibetan Plateau show heritable adaptations to extreme altitude. We sequenced 50 exomes of ethnic Tibetans, encompassing coding sequences of 92% of human genes, with an average coverage of 18x per individual. Genes showing population-specific allele frequency changes, which repres...... in genetic adaptation to high altitude.......Residents of the Tibetan Plateau show heritable adaptations to extreme altitude. We sequenced 50 exomes of ethnic Tibetans, encompassing coding sequences of 92% of human genes, with an average coverage of 18x per individual. Genes showing population-specific allele frequency changes, which...... represent strong candidates for altitude adaptation, were identified. The strongest signal of natural selection came from endothelial Per-Arnt-Sim (PAS) domain protein 1 (EPAS1), a transcription factor involved in response to hypoxia. One single-nucleotide polymorphism (SNP) at EPAS1 shows a 78% frequency...
Viral to metazoan marine plankton nucleotide sequences from the Tara Oceans expedition.
Alberti, Adriana; Poulain, Julie; Engelen, Stefan; Labadie, Karine; Romac, Sarah; Ferrera, Isabel; Albini, Guillaume; Aury, Jean-Marc; Belser, Caroline; Bertrand, Alexis; Cruaud, Corinne; Da Silva, Corinne; Dossat, Carole; Gavory, Frédérick; Gas, Shahinaz; Guy, Julie; Haquelle, Maud; Jacoby, E'krame; Jaillon, Olivier; Lemainque, Arnaud; Pelletier, Eric; Samson, Gaëlle; Wessner, Mark; Acinas, Silvia G; Royo-Llonch, Marta; Cornejo-Castillo, Francisco M; Logares, Ramiro; Fernández-Gómez, Beatriz; Bowler, Chris; Cochrane, Guy; Amid, Clara; Hoopen, Petra Ten; De Vargas, Colomban; Grimsley, Nigel; Desgranges, Elodie; Kandels-Lewis, Stefanie; Ogata, Hiroyuki; Poulton, Nicole; Sieracki, Michael E; Stepanauskas, Ramunas; Sullivan, Matthew B; Brum, Jennifer R; Duhaime, Melissa B; Poulos, Bonnie T; Hurwitz, Bonnie L; Pesant, Stéphane; Karsenti, Eric; Wincker, Patrick
2017-08-01
A unique collection of oceanic samples was gathered by the Tara Oceans expeditions (2009-2013), targeting plankton organisms ranging from viruses to metazoans, and providing rich environmental context measurements. Thanks to recent advances in the field of genomics, extensive sequencing has been performed for a deep genomic analysis of this huge collection of samples. A strategy based on different approaches, such as metabarcoding, metagenomics, single-cell genomics and metatranscriptomics, has been chosen for analysis of size-fractionated plankton communities. Here, we provide detailed procedures applied for genomic data generation, from nucleic acids extraction to sequence production, and we describe registries of genomics datasets available at the European Nucleotide Archive (ENA, www.ebi.ac.uk/ena). The association of these metadata to the experimental procedures applied for their generation will help the scientific community to access these data and facilitate their analysis. This paper complements other efforts to provide a full description of experiments and open science resources generated from the Tara Oceans project, further extending their value for the study of the world's planktonic ecosystems.
Seo, Dong-Won; Oh, Jae-Don; Jin, Shil; Song, Ki-Duk; Park, Hee-Bok; Heo, Kang-Nyeong; Shin, Younhee; Jung, Myunghee; Park, Junhyung; Jo, Cheorun; Lee, Hak-Kyo; Lee, Jun-Heon
2015-02-01
There are five native chicken lines in Korea, which are mainly classified by plumage colors (black, white, red, yellow, gray). These five lines are very important genetic resources in the Korean poultry industry. Based on a next generation sequencing technology, whole genome sequence and reference assemblies were performed using Gallus_gallus_4.0 (NCBI) with whole genome sequences from these lines to identify common and novel single nucleotide polymorphisms (SNPs). We obtained 36,660,731,136 ± 1,257,159,120 bp of raw sequence and average 26.6-fold of 25-29 billion reference assembly sequences representing 97.288 % coverage. Also, 4,006,068 ± 97,534 SNPs were observed from 29 autosomes and the Z chromosome and, of these, 752,309 SNPs are the common SNPs across lines. Among the identified SNPs, the number of novel- and known-location assigned SNPs was 1,047,951 ± 14,956 and 2,948,648 ± 81,414, respectively. The number of unassigned known SNPs was 1,181 ± 150 and unassigned novel SNPs was 8,238 ± 1,019. Synonymous SNPs, non-synonymous SNPs, and SNPs having character changes were 26,266 ± 1,456, 11,467 ± 604, 8,180 ± 458, respectively. Overall, 443,048 ± 26,389 SNPs in each bird were identified by comparing with dbSNP in NCBI. The presently obtained genome sequence and SNP information in Korean native chickens have wide applications for further genome studies such as genetic diversity studies to detect causative mutations for economic and disease related traits.
Directory of Open Access Journals (Sweden)
Erena A. Edae
2013-07-01
Full Text Available Functional markers are needed for key genes involved in drought tolerance to improve selection for crop yield under moisture stress conditions. The objectives of this study were to (i characterize five drought tolerance candidate genes, namely dehydration responsive element binding 1A (, enhanced response to abscisic acid ( and , and fructan 1-exohydrolase ( and , in wheat ( L. for nucleotide and haplotype diversity, Tajima’s D value, and linkage disequilibrium (LD and (ii associate within-gene single nucleotide polymorphisms (SNPs with phenotypic traits in a spring wheat association mapping panel ( = 126. Field trials were grown under contrasting moisture regimes in Greeley, CO, and Melkassa, Ethiopia, in 2010 and 2011. Genome-specific amplification and DNA sequence analysis of the genes identified SNPs and revealed differences in nucleotide and haplotype diversity, Tajima’s D, and patterns of LD. showed associations (false discovery rate adjusted probability value = 0.1 with normalized difference vegetation index, heading date, biomass, and spikelet number. Both and were associated with harvest index, flag leaf width, and leaf senescence. was associated with grain yield, and was associated with thousand kernel weight and test weight. If validated in relevant genetic backgrounds, the identified marker–trait associations may be applied to functional marker-assisted selection.
Sahana, G; Guldbrandtsen, B; Thomsen, B; Holm, L-E; Panitz, F; Brøndum, R F; Bendixen, C; Lund, M S
2014-11-01
Mastitis is a mammary disease that frequently affects dairy cattle. Despite considerable research on the development of effective prevention and treatment strategies, mastitis continues to be a significant issue in bovine veterinary medicine. To identify major genes that affect mastitis in dairy cattle, 6 chromosomal regions on Bos taurus autosome (BTA) 6, 13, 16, 19, and 20 were selected from a genome scan for 9 mastitis phenotypes using imputed high-density single nucleotide polymorphism arrays. Association analyses using sequence-level variants for the 6 targeted regions were carried out to map causal variants using whole-genome sequence data from 3 breeds. The quantitative trait loci (QTL) discovery population comprised 4,992 progeny-tested Holstein bulls, and QTL were confirmed in 4,442 Nordic Red and 1,126 Jersey cattle. The targeted regions were imputed to the sequence level. The highest association signal for clinical mastitis was observed on BTA 6 at 88.97 Mb in Holstein cattle and was confirmed in Nordic Red cattle. The peak association region on BTA 6 contained 2 genes: vitamin D-binding protein precursor (GC) and neuropeptide FF receptor 2 (NPFFR2), which, based on known biological functions, are good candidates for affecting mastitis. However, strong linkage disequilibrium in this region prevented conclusive determination of the causal gene. A different QTL on BTA 6 located at 88.32 Mb in Holstein cattle affected mastitis. In addition, QTL on BTA 13 and 19 were confirmed to segregate in Nordic Red cattle and QTL on BTA 16 and 20 were confirmed in Jersey cattle. Although several candidate genes were identified in these targeted regions, it was not possible to identify a gene or polymorphism as the causal factor for any of these regions. Copyright © 2014 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
DEFF Research Database (Denmark)
Pujolar, J.M.; Jacobsen, M.W.; Frydenberg, J.
2013-01-01
Reduced representation genome sequencing such as restriction-site-associated DNA (RAD) sequencing is finding increased use to identify and genotype large numbers of single-nucleotide polymorphisms (SNPs) in model and nonmodel species. We generated a unique resource of novel SNP markers for the Eu...... 425 loci and 376 918 associated SNPs provides a valuable tool for future population genetics and genomics studies and allows for targeting specific genes and particularly interesting regions of the eel genome...
Reddy, Umesh K; Nimmakayala, Padma; Levi, Amnon; Abburi, Venkata Lakshmi; Saminathan, Thangasamy; Tomason, Yan R; Vajja, Gopinath; Reddy, Rishi; Abburi, Lavanya; Wehner, Todd C; Ronin, Yefim; Karol, Abraham
2014-09-15
We used genotyping by sequencing to identify a set of 10,480 single nucleotide polymorphism (SNP) markers for constructing a high-resolution genetic map of 1096 cM for watermelon. We assessed the genome-wide variation in recombination rate (GWRR) across the map and found an association between GWRR and genome-wide nucleotide diversity. Collinearity between the map and the genome-wide reference sequence for watermelon was studied to identify inconsistency and chromosome rearrangements. We assessed genome-wide nucleotide diversity, linkage disequilibrium (LD), and selective sweep for wild, semi-wild, and domesticated accessions of Citrullus lanatus var. lanatus to track signals of domestication. Principal component analysis combined with chromosome-wide phylogenetic study based on 1563 SNPs obtained after LD pruning with minor allele frequency of 0.05 resolved the differences between semi-wild and wild accessions as well as relationships among worldwide sweet watermelon. Population structure analysis revealed predominant ancestries for wild, semi-wild, and domesticated watermelons as well as admixture of various ancestries that were important for domestication. Sliding window analysis of Tajima's D across various chromosomes was used to resolve selective sweep. LD decay was estimated for various chromosomes. We identified a strong selective sweep on chromosome 3 consisting of important genes that might have had a role in sweet watermelon domestication. Copyright © 2014 Reddy et al.
Development of a single nucleotide polymorphism (SNP) marker for ...
African Journals Online (AJOL)
The nature of the single nucleotide polymorphism (SNP) marker was validated by DNA sequencing of the parental PCR products. Using high resolution melt (HRM) profiles and normalised difference plots, we successfully differentiated the homozygous dominant (wild type), homozygous recessive (LPA) and heterozygous ...
Using high-throughput barcode sequencing to efficiently map connectomes.
Peikon, Ian D; Kebschull, Justus M; Vagin, Vasily V; Ravens, Diana I; Sun, Yu-Chi; Brouzes, Eric; Corrêa, Ivan R; Bressan, Dario; Zador, Anthony M
2017-07-07
The function of a neural circuit is determined by the details of its synaptic connections. At present, the only available method for determining a neural wiring diagram with single synapse precision-a 'connectome'-is based on imaging methods that are slow, labor-intensive and expensive. Here, we present SYNseq, a method for converting the connectome into a form that can exploit the speed and low cost of modern high-throughput DNA sequencing. In SYNseq, each neuron is labeled with a unique random nucleotide sequence-an RNA 'barcode'-which is targeted to the synapse using engineered proteins. Barcodes in pre- and postsynaptic neurons are then associated through protein-protein crosslinking across the synapse, extracted from the tissue, and joined into a form suitable for sequencing. Although our failure to develop an efficient barcode joining scheme precludes the widespread application of this approach, we expect that with further development SYNseq will enable tracing of complex circuits at high speed and low cost. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Molecular cloning and nucleotide sequence of CYP6BF1 from the diamondback moth, Plutella xylostella
Li, Hongshan; Dai, Huaguo; Wei, Hui
2005-01-01
A novel cDNA clong encoding a cytochrome P450 was screened from the insecticide-susceptible strain of Plutella xylostella (L.) (Lepidoptera:Yponomeutidae). The nucleotide sequence of the clone, designated CYP6BF1, was determined. This is the first full-length sequence of the CYP6 family from Plutella xylostella (L.). The cDNA is 1661bp in length and contains an open reading frame from base pairs 26 to 1570, encoding a protein of 514 amino acid residues. It is similar to the other insect P450s in gene family 6, including CYP6AE1 from Depressaria pastinacella, (46%). The GenBank accession number is AY971374. PMID:17119627
ISRNA: an integrative online toolkit for short reads from high-throughput sequencing data.
Luo, Guan-Zheng; Yang, Wei; Ma, Ying-Ke; Wang, Xiu-Jie
2014-02-01
Integrative Short Reads NAvigator (ISRNA) is an online toolkit for analyzing high-throughput small RNA sequencing data. Besides the high-speed genome mapping function, ISRNA provides statistics for genomic location, length distribution and nucleotide composition bias analysis of sequence reads. Number of reads mapped to known microRNAs and other classes of short non-coding RNAs, coverage of short reads on genes, expression abundance of sequence reads as well as some other analysis functions are also supported. The versatile search functions enable users to select sequence reads according to their sub-sequences, expression abundance, genomic location, relationship to genes, etc. A specialized genome browser is integrated to visualize the genomic distribution of short reads. ISRNA also supports management and comparison among multiple datasets. ISRNA is implemented in Java/C++/Perl/MySQL and can be freely accessed at http://omicslab.genetics.ac.cn/ISRNA/.
Main: Nucleotide Analysis [KOME
Lifescience Database Archive (English)
Full Text Available Nucleotide Analysis Japonica genome blast search result Result of blastn search against jap...onica genome sequence kome_japonica_genome_blast_search_result.zip kome_japonica_genome_blast_search_result ...
On the optimal trimming of high-throughput mRNA sequence data
Directory of Open Access Journals (Sweden)
Matthew D MacManes
2014-01-01
Full Text Available The widespread and rapid adoption of high-throughput sequencing technologies has afforded researchers the opportunity to gain a deep understanding of genome level processes that underlie evolutionary change, and perhaps more importantly, the links between genotype and phenotype. In particular, researchers interested in functional biology and adaptation have used these technologies to sequence mRNA transcriptomes of specific tissues, which in turn are often compared to other tissues, or other individuals with different phenotypes. While these techniques are extremely powerful, careful attention to data quality is required. In particular, because high-throughput sequencing is more error-prone than traditional Sanger sequencing, quality trimming of sequence reads should be an important step in all data processing pipelines. While several software packages for quality trimming exist, no general guidelines for the specifics of trimming have been developed. Here, using empirically derived sequence data, I provide general recommendations regarding the optimal strength of trimming, specifically in mRNA-Seq studies. Although very aggressive quality trimming is common, this study suggests that a more gentle trimming, specifically of those nucleotides whose Phred score < 2 or < 5, is optimal for most studies across a wide variety of metrics.
Schürch, A C; Arredondo-Alonso, S; Willems, R J L; Goering, R V
2018-04-01
Whole genome sequence (WGS)-based strain typing finds increasing use in the epidemiologic analysis of bacterial pathogens in both public health as well as more localized infection control settings. This minireview describes methodologic approaches that have been explored for WGS-based epidemiologic analysis and considers the challenges and pitfalls of data interpretation. Personal collection of relevant publications. When applying WGS to study the molecular epidemiology of bacterial pathogens, genomic variability between strains is translated into measures of distance by determining single nucleotide polymorphisms in core genome alignments or by indexing allelic variation in hundreds to thousands of core genes, assigning types to unique allelic profiles. Interpreting isolate relatedness from these distances is highly organism specific, and attempts to establish species-specific cutoffs are unlikely to be generally applicable. In cases where single nucleotide polymorphism or core gene typing do not provide the resolution necessary for accurate assessment of the epidemiology of bacterial pathogens, inclusion of accessory gene or plasmid sequences may provide the additional required discrimination. As with all epidemiologic analysis, realizing the full potential of the revolutionary advances in WGS-based approaches requires understanding and dealing with issues related to the fundamental steps of data generation and interpretation. Copyright © 2018 The Authors. Published by Elsevier Ltd.. All rights reserved.
International Nuclear Information System (INIS)
Broderick, T.P.; Schaff, D.A.; Bertino, A.M.; Dush, M.K.; Tischfield, J.A.; Stambrook, P.J.
1987-01-01
The functional human adenine phosphoribosyltransferase (APRT) gene is <2.6 kilobases in length and contains five exons. The amino acid sequences of APRTs have been highly conserved throughout evolution. The human enzyme is 82%, 90%, and 40% identical to the mouse, hamster, and Escherichia coli enzymes, respectively. The promoter region of the human APRT gene, like that of several other housekeeping genes, lacks TATA and CCAAT boxes but contains five GC boxes that are potential binding sites for the Sp1 transcription factor. The distal three, however, are dispensable for gene expression. Comparison between human and mouse APRT gene nucleotide sequences reveals a high degree of homology within protein coding regions but an absence of significant homology in 5' flanking, 3' untranslated, and intron sequences, except for similarly positioned GC boxes in the promoter region and a 26-base-pair region in intron 3. This 26-base-pair sequence is 92% identical with a similarly positioned sequence in the mouse gene and is also found in intron 3 of the hamster gene, suggesting that its retention may be a consequence of stringent selection. The positions of all introns have been precisely retained in the human and both rodent genes. Retention of an elevated CpG dinucleotide content, despite loss of sequence homology, suggests that there may be selection for CpG dinucleotides in these regions and that their maintenance may be important for APRT gene function
Alvarez, Rene; Lwamba, Humphrey M.; Kapczynski, Darrell R.; Njenga, M. Kariuki; Seal, Bruce S.
2003-01-01
A serologically distinct avian metapneumovirus (aMPV) was isolated in the United States after an outbreak of turkey rhinotracheitis (TRT) in February 1997. The newly recognized U.S. virus was subsequently demonstrated to be genetically distinct from European subtypes and was designated aMPV serotype C (aMPV/C). We have determined the nucleotide sequence of the gene encoding the cell attachment glycoprotein (G) of aMPV/C (Colorado strain and three Minnesota isolates) and predicted amino acid sequence by sequencing cloned cDNAs synthesized from intracellular RNA of aMPV/C-infected cells. The nucleotide sequence comprised 1,321 nucleotides with only one predicted open reading frame encoding a protein of 435 amino acids, with a predicted Mr of 48,840. The structural characteristics of the predicted G protein of aMPV/C were similar to those of the human respiratory syncytial virus (hRSV) attachment G protein, including two mucin-like regions (heparin-binding domains) flanking both sides of a CX3C chemokine motif present in a conserved hydrophobic pocket. Comparison of the deduced G-protein amino acid sequence of aMPV/C with those of aMPV serotypes A, B, and D, as well as hRSV revealed overall predicted amino acid sequence identities ranging from 4 to 16.5%, suggesting a distant relationship. However, G-protein sequence identities ranged from 72 to 97% when aMPV/C was compared to other members within the aMPV/C subtype or 21% for the recently identified human MPV (hMPV) G protein. Ratios of nonsynonymous to synonymous nucleotide changes were greater than one in the G gene when comparing the more recent Minnesota isolates to the original Colorado isolate. Epidemiologically, this indicates positive selection among U.S. isolates since the first outbreak of TRT in the United States. PMID:12682171
Zhang, Wenwei; Cheng, Zhuomin; Xu, Lei; Wu, Maosen; Waterhouse, Peter; Zhou, Guanghe; Li, Shifang
2009-01-01
The complete nucleotide sequence of the ssRNA genome of a Chinese GPV isolate of barley yellow dwarf virus (BYDV) was determined. It comprised 5673 nucleotides, and the deduced genome organization resembled that of members of the genus Polerovirus. It was most closely related to cereal yellow dwarf virus-RPV (77% nt identity over the entire genome; coat protein amino acid identity 79%). The GPV isolate also differs in vector specificity from other BYDV strains. Biological properties, phylogenetic analyses and detailed sequence comparisons suggest that GPV should be considered a member of a new species within the genus, and the name Wheat yellow dwarf virus-GPV is proposed.
The Coding of Biological Information: From Nucleotide Sequence to Protein Recognition
Štambuk, Nikola
The paper reviews the classic results of Swanson, Dayhoff, Grantham, Blalock and Root-Bernstein, which link genetic code nucleotide patterns to the protein structure, evolution and molecular recognition. Symbolic representation of the binary addresses defining particular nucleotide and amino acid properties is discussed, with consideration of: structure and metric of the code, direct correspondence between amino acid and nucleotide information, and molecular recognition of the interacting protein motifs coded by the complementary DNA and RNA strands.
Evaluation of atpB nucleotide sequences for phylogenetic studies of ferns and other pteridophytes.
Wolf, P
1997-10-01
Inferring basal relationships among vascular plants poses a major challenge to plant systematists. The divergence events that describe these relationships occurred long ago and considerable homoplasy has since accrued for both molecular and morphological characters. A potential solution is to examine phylogenetic analyses from multiple data sets. Here I present a new source of phylogenetic data for ferns and other pteridophytes. I sequenced the chloroplast gene atpB from 23 pteridophyte taxa and used maximum parsimony to infer relationships. A 588-bp region of the gene appeared to contain a statistically significant amount of phylogenetic signal and the resulting trees were largely congruent with similar analyses of nucleotide sequences from rbcL. However, a combined analysis of atpB plus rbcL produced a better resolved tree than did either data set alone. In the shortest trees, leptosporangiate ferns formed a monophyletic group. Also, I detected a well-supported clade of Psilotaceae (Psilotum and Tmesipteris) plus Ophioglossaceae (Ophioglossum and Botrychium). The demonstrated utility of atpB suggests that sequences from this gene should play a role in phylogenetic analyses that incorporate data from chloroplast genes, nuclear genes, morphology, and fossil data.
Alabdullah, Abdulkader; Minafra, Angelantonio; Elbeaino, Toufic; Saponari, Maria; Savino, Vito; Martelli, Giovanni P
2010-09-01
The complete nucleotide sequence and the genome organization were determined of a putative new member of the family Tymoviridae, tentatively named Olive latent virus 3 (OLV-3), recovered in southern Italy from a symptomless olive tree. The sequenced ssRNA genome comprises 7148 nucleotides excluding the poly(A) tail and contains four open reading frames (ORFs). ORF1 encodes a polyprotein of 221.6kDa in size, containing the conserved signatures of the methyltransferase (MTR), papain-like protease (PRO), helicase (HEL) and RNA-dependent RNA polymerase (RdRp) domains of the replication-associated proteins of positive-strand RNA viruses. ORF2 overlaps completely ORF1 and encodes a putative protein of 43.33kDa showing limited sequence similarity with the putative movement protein of Maize rayado fino virus (MRFV). ORF3 codes for a protein with predicted molecular mass of 28.46kDa, identified as the coat protein (CP), whereas ORF4 overlaps ORF3 and encodes a putative protein of 16kDa with sequence similarity to the p16 and p31 proteins of Citrus sudden death-associated virus (CSDaV) and Grapevine fleck virus (GFkV), respectively. Within the family Tymoviridae, OLV-3 genome has the closest identity level (49-52%) with members of the genus Marafivirus, from which, however, it differs because of the diverse genome organization and the presence of a single type of CP subunits. Copyright (c) 2010 Elsevier B.V. All rights reserved.
International Nuclear Information System (INIS)
Janowski, M.; Merregaert, J.; Boniver, J.; Maisin, J.R.
1985-01-01
The proviral genome of a thymotropic and leukemogenic C57BL/Ka mouse retrovirus, RadLV/VL/sub 3/(T+L+), was cloned as a biologically active PstI insert in the bacterial plasmid pBR322. Its restriction map was compared to those, already known, of two nonthymotropic and nonleukemogenic viruses of the same mouse strain, the ecotropic BL/Ka(B) and the xenotropic constituent of the radiation leukemia virus complex (RadLV). Differences were observed in the pol gene and in the env gene. Moreover, the nucleotide sequence of the RadLV/VL/sub 3/(T+L+) long terminal repeat revealed the existence of two copies of a 42 bp long sequence, separated by 11 nucleotides and of which BL/Ka(B) possesses only one copy
Energy Technology Data Exchange (ETDEWEB)
Hatch, C L; Bonner, W M
1988-02-11
The nucleotide sequences of cDNAs for the evolutionarily diverged but highly conserved basal H2A isoprotein, H2A.Z, have been determined for the rat, cow, and human. As a basal histone, H2A.Z is synthesized throughout the cell cycle at a constant rate, unlinked to DNA replication, and at a much lower rate in quiescent cells. Each of the cDNA isolates encodes the entire H2A.Z polypeptide. The human isolate is about 1.0 kilobases long. It contains a coding region of 387 nucleotides flanked by 106 nucleotides of 5'UTR and 376 nucleotides of 3'UTR, which contains a polyadenylation signal followed by a poly A tail. The bovine and rat cDNAs have 97 and 94% nucleotide positional identity to the human cDNA in the coding region and 98% in the proximal 376 nucleotides of the 3'UTR which includes the polyadenylation signal. A potential stem-forming sequence imbedded in a direct repeat is found centered at 261 nucleotides into the 3'UTR. Each of the cDNA clones could be transcribed and translated in vitro to yield H2A.Z protein. The mammalian H2A.Z cDNA coding sequences are approximately 80% similar to those in chicken and 75% to those in sea urchin.
RANDNA: a random DNA sequence generator.
Piva, Francesco; Principato, Giovanni
2006-01-01
Monte Carlo simulations are useful to verify the significance of data. Genomic regularities, such as the nucleotide correlations or the not uniform distribution of the motifs throughout genomic or mature mRNA sequences, exist and their significance can be checked by means of the Monte Carlo test. The test needs good quality random sequences in order to work, moreover they should have the same nucleotide distribution as the sequences in which the regularities have been found. Random DNA sequences are also useful to estimate the background score of an alignment, that is a threshold below which the resulting score is merely due to chance. We have developed RANDNA, a free software which allows to produce random DNA or RNA sequences setting both their length and the percentage of nucleotide composition. Sequences having the same nucleotide distribution of exonic, intronic or intergenic sequences can be generated. Its graphic interface makes it possible to easily set the parameters that characterize the sequences being produced and saved in a text format file. The pseudo-random number generator function of Borland Delphi 6 is used, since it guarantees a good randomness, a long cycle length and a high speed. We have checked the quality of sequences generated by the software, by means of well-known tests, both by themselves and versus genuine random sequences. We show the good quality of the generated sequences. The software, complete with examples and documentation, is freely available to users from: http://www.introni.it/en/software.
Directory of Open Access Journals (Sweden)
Ouyang Shu
2005-09-01
Full Text Available Abstract Background The Solanaceae is a family of closely related species with diverse phenotypes that have been exploited for agronomic purposes. Previous studies involving a small number of genes suggested sequence conservation across the Solanaceae. The availability of large collections of Expressed Sequence Tags (ESTs for the Solanaceae now provides the opportunity to assess sequence conservation and divergence on a genomic scale. Results All available ESTs and Expressed Transcripts (ETs, 449,224 sequences for six Solanaceae species (potato, tomato, pepper, petunia, tobacco and Nicotiana benthamiana, were clustered and assembled into gene indices. Examination of gene ontologies revealed that the transcripts within the gene indices encode a similar suite of biological processes. Although the ESTs and ETs were derived from a variety of tissues, 55–81% of the sequences had significant similarity at the nucleotide level with sequences among the six species. Putative orthologs could be identified for 28–58% of the sequences. This high degree of sequence conservation was supported by expression profiling using heterologous hybridizations to potato cDNA arrays that showed similar expression patterns in mature leaves for all six solanaceous species. 16–19% of the transcripts within the six Solanaceae gene indices did not have matches among Solanaceae, Arabidopsis, rice or 21 other plant gene indices. Conclusion Results from this genome scale analysis confirmed a high level of sequence conservation at the nucleotide level of the coding sequence among Solanaceae. Additionally, the results indicated that part of the Solanaceae transcriptome is likely to be unique for each species.
I.K.G. Visser (Ilona); R.W.J. van der Heijden (Roger); M.W.G. van de Bildt (Marco); M.J.H. Kenter (Marcel); C. Örvell; A.D.M.E. Osterhaus (Albert)
1993-01-01
textabstractNucleotide sequencing of the fusion protein (F) gene of phocid distemper virus-2 (PDV-2), recently isolated from Baikal seals (Phoca sibirica), revealed an open reading frame (nucleotides 84 to 2075) with two potential in-frame ATG translation initiation codons. We suggest that the
Nucleotide sequence of the 3' ends of the double-stranded RNAs of grapevine chrome mosaic nepovirus.
Le Gall, O; Candresse, T; Dunez, J
1988-02-01
Attempts were made to label the termini of dsRNAs corresponding to the two genomic RNAs of grapevine chrome mosaic nepovirus (GCMV). It was not possible to label the 5' ends of the dsRNAs with [gamma-32P]ATP, which suggests that a genome-linked protein blocks their 5' ends. Both dsRNA species were labelled at their 3' ends with pCp. The 3'-terminal sequences were determined by 'wandering spot' or by partial enzymic cleavage analysis. One strand (presumably positive) ended in a poly(A) 30 to 50 nucleotides long whereas the other (presumably negative) ended in 3'-ACCUUUUAAAAAG (RNA1) or 3'-ACCUUUUAAUAAAG (RNA2). The sequences resemble closely those complementary to the 5' ends of the RNAs of tomato black ring virus (strain S), which is distantly related to GCMV.
Capillary gel electrophoresis for rapid, high resolution DNA sequencing.
Swerdlow, H; Gesteland, R
1990-01-01
Capillary gel electrophoresis has been demonstrated for the separation and detection of DNA sequencing samples. Enzymatic dideoxy nucleotide chain termination was employed, using fluorescently tagged oligonucleotide primers and laser based on-column detection (limit of detection is 6,000 molecules per peak). Capillary gel separations were shown to be three times faster, with better resolution (2.4 x), and higher separation efficiency (5.4 x) than a conventional automated slab gel DNA sequenci...
International Nuclear Information System (INIS)
Hummel, K.B.; Litwer, S.; Bradford, A.P.; Aitken, A.; Danner, D.J.; Yeaman, S.J.
1988-01-01
Nucleotide sequence was determined for a 1.6-kilobase human cDNA putative for the branched chain acyltransferase protein of the branched chain α-ketoacid dehydrogenase complex. Translation of the sequence reveals an open reading frame encoding a 315-amino acid protein of molecular weight 35,759 followed by 560 bases of 3'-untranslated sequence. Three repeats of the polyadenylation signal hexamer ATTAAA are present prior to the polyadenylate tail. Within the open reading frame is a 10-amino acid fragment which matches exactly the amino acid sequence around the lipoate-lysine residue in bovine kidney branched chain acyltransferase, thus confirming the identity of the cDNA. Analysis of the deduced protein structure for the human branched chain acyltransferase revealed an organization into domains similar to that reported for the acyltransferase proteins of the pyruvate and α-ketoglutarate dehydrogenase complexes. This similarity in organization suggests that a more detailed analysis of the proteins will be required to explain the individual substrate and multienzyme complex specificity shown by these acyltransferases
de la Bastide, Paul Y; Leung, Wai Lam; Hintz, William E
2015-01-01
The ITS region of the rDNA gene was compared for Saprolegnia spp. in order to improve our understanding of nucleotide sequence variability within and between species of this genus, determine species composition in Canadian fin fish aquaculture facilities, and to assess the utility of ITS sequence variability in genetic marker development. From a collection of more than 400 field isolates, ITS region nucleotide sequences were studied and it was determined that there was sufficient consistent inter-specific variation to support the designation of species identity based on ITS sequence data. This non-subjective approach to species identification does not rely upon transient morphological features. Phylogenetic analyses comparing our ITS sequences and species designations with data from previous studies generally supported the clade scheme of Diéguez-Uribeondo et al. (2007) and found agreement with the molecular taxonomic cluster system of Sandoval-Sierra et al. (2014). Our Canadian ITS sequence collection will thus contribute to the public database and assist the clarification of Saprolegnia spp. taxonomy. The analysis of ITS region sequence variability facilitated genus- and species-level identification of unknown samples from aquaculture facilities and provided useful information on species composition. A unique ITS-RFLP for the identification of S. parasitica was also described. Copyright © 2014 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Simon Reed
2012-09-01
Full Text Available Here we review our development of, and results with, high resolution studies on global genome nucleotide excision repair (GGNER in Saccharomyces cerevisiae. We have focused on how GGNER relates to histone acetylation for its functioning and we have identified the histone acetyl tranferase Gcn5 and acetylation at lysines 9/14 of histone H3 as a major factor in enabling efficient repair. We consider results employing primarily MFA2 as a model gene, but also those with URA3 located at subtelomeric sequences. In the latter case we also see a role for acetylation at histone H4. We then go on to outline the development of a high resolution genome-wide approach that enables one to examine correlations between histone modifications and the nucleotide excision repair (NER of UV-induced cyclobutane pyrimidine dimers throughout entire genomes. This is an approach that will enable rapid advances in understanding the complexities of how compacted chromatin in chromosomes is processed to access DNA damage and then returned to its pre-damaged status to maintain epigenetic codes.
Kutz, Russell; Okwumabua, Ogi
2008-10-01
The glutamate dehydrogenase (GDH) enzymes of 19 Streptococcus suis serotype 2 strains, consisting of 18 swine isolates and 1 human clinical isolate from a geographically varied collection, were analyzed by activity staining on a nondenaturing gel. All seven (100%) of the highly virulent strains tested produced an electrophoretic type (ET) distinct from those of moderately virulent and nonvirulent strains. By PCR and nucleotide sequence determination, the gdh genes of the 19 strains and of 2 highly virulent strains involved in recent Chinese outbreaks yielded a 1,820-bp fragment containing an open reading frame of 1,344 nucleotides, which encodes a protein of 448 amino acid residues with a calculated molecular mass of approximately 49 kDa. The nucleotide sequences contained base pair differences, but most were silent. Cluster analysis of the deduced amino acid sequences separated the isolates into three groups. Group I (ETI) consisted of the seven highly virulent isolates and the two Chinese outbreak strains, containing Ala(299)-to-Ser, Glu(305)-to-Lys, and Glu(330)-to-Lys amino acid substitutions compared with groups II and III (ETII). Groups II and III consisted of moderately virulent and nonvirulent strains, which are separated from each other by Tyr(72)-to-Asp and Thr(296)-to-Ala substitutions. Gene exchange studies resulted in the change of ETI to ETII and vice versa. A spectrophotometric activity assay for GDH did not show significant differences between the groups. These results suggest that the GDH ETs and sequence types may serve as useful markers in predicting the pathogenic behavior of strains of this serotype and that the molecular basis for the observed differences in the ETs was amino acid substitutions and not deletion, insertion, or processing uniqueness.
Condensing the information in DNA with double-headed nucleotides
DEFF Research Database (Denmark)
Hornum, Mick; Sharma, Pawan K; Reslow-Jacobsen, Charlotte
2017-01-01
A normal duplex holds as many Watson-Crick base pairs as the number of nucleotides in its constituent strands. Here we establish that single nucleotides can be designed to functionally imitate dinucleotides without compromising binding affinity. This effectively allows sequence information...
Yan, L.; Xu, Z.; Goldbach, R.W.; Chen, Y.K.; Prins, M.W.
2005-01-01
The complete nucleotide sequence of Peanut stunt virus strain Mi (PSV-Mi) from China was determined and compared to other viruses of the genus Cucumovirus. The tripartite genome of PSV-Mi encoded five open reading frames (ORFs) typical of cucumoviruses. Distance analyses of four ORFs indicated that
Improvements and impacts of GRCh38 human reference on high throughput sequencing data analysis.
Guo, Yan; Dai, Yulin; Yu, Hui; Zhao, Shilin; Samuels, David C; Shyr, Yu
2017-03-01
Analyses of high throughput sequencing data starts with alignment against a reference genome, which is the foundation for all re-sequencing data analyses. Each new release of the human reference genome has been augmented with improved accuracy and completeness. It is presumed that the latest release of human reference genome, GRCh38 will contribute more to high throughput sequencing data analysis by providing more accuracy. But the amount of improvement has not yet been quantified. We conducted a study to compare the genomic analysis results between the GRCh38 reference and its predecessor GRCh37. Through analyses of alignment, single nucleotide polymorphisms, small insertion/deletions, copy number and structural variants, we show that GRCh38 offers overall more accurate analysis of human sequencing data. More importantly, GRCh38 produced fewer false positive structural variants. In conclusion, GRCh38 is an improvement over GRCh37 not only from the genome assembly aspect, but also yields more reliable genomic analysis results. Copyright © 2017. Published by Elsevier Inc.
Goodacre, Norman; Aljanahi, Aisha; Nandakumar, Subhiksha; Mikailov, Mike; Khan, Arifa S
2018-01-01
Detection of distantly related viruses by high-throughput sequencing (HTS) is bioinformatically challenging because of the lack of a public database containing all viral sequences, without abundant nonviral sequences, which can extend runtime and obscure viral hits. Our reference viral database (RVDB) includes all viral, virus-related, and virus-like nucleotide sequences (excluding bacterial viruses), regardless of length, and with overall reduced cellular sequences. Semantic selection criteria (SEM-I) were used to select viral sequences from GenBank, resulting in a first-generation viral database (VDB). This database was manually and computationally reviewed, resulting in refined, semantic selection criteria (SEM-R), which were applied to a new download of updated GenBank sequences to create a second-generation VDB. Viral entries in the latter were clustered at 98% by CD-HIT-EST to reduce redundancy while retaining high viral sequence diversity. The viral identity of the clustered representative sequences (creps) was confirmed by BLAST searches in NCBI databases and HMMER searches in PFAM and DFAM databases. The resulting RVDB contained a broad representation of viral families, sequence diversity, and a reduced cellular content; it includes full-length and partial sequences and endogenous nonretroviral elements, endogenous retroviruses, and retrotransposons. Testing of RVDBv10.2, with an in-house HTS transcriptomic data set indicated a significantly faster run for virus detection than interrogating the entirety of the NCBI nonredundant nucleotide database, which contains all viral sequences but also nonviral sequences. RVDB is publically available for facilitating HTS analysis, particularly for novel virus detection. It is meant to be updated on a regular basis to include new viral sequences added to GenBank. IMPORTANCE To facilitate bioinformatics analysis of high-throughput sequencing (HTS) data for the detection of both known and novel viruses, we have
The arabidopsis cyclic nucleotide interactome
Donaldson, Lara Elizabeth
2016-05-11
Background Cyclic nucleotides have been shown to play important signaling roles in many physiological processes in plants including photosynthesis and defence. Despite this, little is known about cyclic nucleotide-dependent signaling mechanisms in plants since the downstream target proteins remain unknown. This is largely due to the fact that bioinformatics searches fail to identify plant homologs of protein kinases and phosphodiesterases that are the main targets of cyclic nucleotides in animals. Methods An affinity purification technique was used to identify cyclic nucleotide binding proteins in Arabidopsis thaliana. The identified proteins were subjected to a computational analysis that included a sequence, transcriptional co-expression and functional annotation analysis in order to assess their potential role in plant cyclic nucleotide signaling. Results A total of twelve cyclic nucleotide binding proteins were identified experimentally including key enzymes in the Calvin cycle and photorespiration pathway. Importantly, eight of the twelve proteins were shown to contain putative cyclic nucleotide binding domains. Moreover, the identified proteins are post-translationally modified by nitric oxide, transcriptionally co-expressed and annotated to function in hydrogen peroxide signaling and the defence response. The activity of one of these proteins, GLYGOLATE OXIDASE 1, a photorespiratory enzyme that produces hydrogen peroxide in response to Pseudomonas, was shown to be repressed by a combination of cGMP and nitric oxide treatment. Conclusions We propose that the identified proteins function together as points of cross-talk between cyclic nucleotide, nitric oxide and reactive oxygen species signaling during the defence response.
DEFF Research Database (Denmark)
Defoor, Els Marie Celine; Martinussen, Jan
A new lactococcal plasmid, pDBORO, was isolated from the Lactococcus lactis ssp. lactis biovar diacetylactis strain DB0410 responsible for the sensitivity of DB0410 towards the pyrimidine-analog 5´-fluoroorotate. The plasmid pDBORO amounts to 16404 bp and its complete nucleotide sequence has been...
Directory of Open Access Journals (Sweden)
Alain Stepanian
Full Text Available Preeclampsia is a frequent medical complication during pregnancy. Corin, a serine protease which activates pro-atrial natriuretic peptide, has recently been shown to be involved in the pathophysiology of preeclampsia. The aim of this study was to search for CORIN gene variations and their association to preeclampsia in Caucasian and African women. Our study population was composed of 571 pregnant women (295 with preeclampsia and 276 normotensive controls matched for maternal and gestational age, and ethnic origin. The 22 exons of the CORIN gene were sequenced in a discovery sample (n = 260, where 31 single nucleotide polymorphisms were identified. In a replication sample (n = 311, 4 single nucleotide polymorphisms were tested. Two minor alleles (C for rs2271036 and G for rs2271037 were significantly associated to preeclampsia. Adjusted odds ratios [95% confidence interval] were 2.5 [1.2-3.8] (p = 0.007 and 2.3 [1.5-3.5] (p = 1.3 × 10(-4, respectively. These associations were ethnic-specific, as only found in the Caucasian of subjects (odds ratio = 3.5 [1.8-6.6], p = 1.1 × 10(-4; odds ratio = 3.1 [1.7-5.8], p = 2.1 × 10(-4, for each single nucleotide polymorphism, respectively. The two single nucleotide polymorphisms are in almost perfect linkage disequilibrium (r(2 = 0.93. No specific association was found with severe preeclampsia, early-onset preeclampsia nor fetal growth retardation. In conclusion, this is the first report of a highly significant association between these two single nucleotide polymorphisms in CORIN gene and preeclampsia. Our findings further support the probability of a critical role of corin in preeclamspia pathophysiology at the uteroplacental interface.
Wang, Jianye; Huang, Yu; Zhou, Mingxu; Zhu, Guoqiang
2016-09-01
Genomic information about Muscovy duck parvovirus is still limited. In this study, the genome of the pathogenic MDPV strain YY was sequenced. The full-length genome of YY is 5075 nucleotides (nt) long, 57 nt shorter than that of strain FM. Sequence alignment indicates that the 5' and 3' inverted terminal repeats (ITR) of strain YY contain a 14-nucleotide-pair deletion in the stem of the palindromic hairpin structure in comparison to strain FM and FZ91-30. The deleted region contains one "E-box" site and one repeated motif with the sequence "TTCCGGT" or "ACCGGAA". Phylogenetic trees constructed based the protein coding genes concordantly showed that YY, together with nine other MDPV isolates from various places, clustered in a separate branch, distinct from the branch formed by goose parvovirus (GPV) strains. These results demonstrate that, despite the distinctive deletion, the YY strain still belongs to the classical MDPV group. Moreover, the deletion of ITR may contribute to the genome evolution of MDPV under immunization pressure.
In-silico single nucleotide polymorphisms (SNP) mining of Sorghum ...
African Journals Online (AJOL)
Single nucleotide polymorphisms (SNPs) may be considered the ultimate genetic markers as they represent the finest resolution of a DNA sequence (a single nucleotide), and are generally abundant in populations with a low mutation rate. SNPs are important tools in studying complex genetic traits and genome evolution.
Doublet, Benoît; Boyd, David; Douard, Gregory; Praud, Karine; Cloeckaert, Axel; Mulvey, Michael R
2012-10-01
To determine the complete nucleotide sequence of the multidrug resistance IncA/C plasmid pR55 from a clinical Klebsiella pneumoniae strain that was isolated from a urinary tract infection in 1969 in a French hospital and compare it with those of contemporary emerging IncA/C plasmids. The plasmid was purified and sequenced using a 454 sequencing approach. After draft assembly, additional PCRs and walking reads were performed for gap closure. Sequence comparisons and multiple alignments with other IncA/C plasmids were done using the BLAST algorithm and CLUSTAL W, respectively. Plasmid pR55 (170 810 bp) revealed a shared plasmid backbone (>99% nucleotide identity) with current members of the IncA/C(2) multidrug resistance plasmid family that are widely disseminating antibiotic resistance genes. Nevertheless, two specific multidrug resistance gene arrays probably acquired from other genetic elements were identified inserted at conserved hotspot insertion sites in the IncA/C backbone. A novel transposon named Tn6187 showed an atypical mixed transposon configuration composed of two mercury resistance operons and two transposition modules that are related to Tn21 and Tn1696, respectively, and an In0-type integron. IncA/C(2) multidrug resistance plasmids have a broad host range and have been implicated in the dissemination of antibiotic resistance among Enterobacteriaceae from humans and animals. This typical IncA/C(2) genetic scaffold appears to carry various multidrug resistance gene arrays and is now also a successful vehicle for spreading AmpC-like cephalosporinase and metallo-β-lactamase genes, such as bla(CMY) and bla(NDM), respectively.
Yoshida, Tetsuya; Kitazawa, Yugo; Komatsu, Ken; Neriya, Yutaro; Ishikawa, Kazuya; Fujita, Naoko; Hashimoto, Masayoshi; Maejima, Kensaku; Yamaji, Yasuyuki; Namba, Shigetou
2014-11-01
In this study, we detected a Japanese isolate of hibiscus latent Fort Pierce virus (HLFPV-J), a member of the genus Tobamovirus, in a hibiscus plant in Japan and determined the complete sequence and organization of its genome. HLFPV-J has four open reading frames (ORFs), each of which shares more than 98 % nucleotide sequence identity with those of other HLFPV isolates. Moreover, HLFPV-J contains a unique internal poly(A) region of variable length, ranging from 44 to 78 nucleotides, in its 3'-untranslated region (UTR), as is the case with hibiscus latent Singapore virus (HLSV), another hibiscus-infecting tobamovirus. The length of the HLFPV-J genome was 6431 nucleotides, including the shortest internal poly(A) region. The sequence identities of ORFs 1, 2, 3 and 4 of HLFPV-J to other tobamoviruses were 46.6-68.7, 49.9-70.8, 31.0-70.8 and 39.4-70.1 %, respectively, at the nucleotide level and 39.8-75.0, 43.6-77.8, 19.2-70.4 and 31.2-74.2 %, respectively, at the amino acid level. The 5'- and 3'-UTRs of HLFPV-J showed 24.3-58.6 and 13.0-79.8 % identity, respectively, to other tobamoviruses. In particular, when compared to other tobamoviruses, each ORF and UTR of HLFPV-J showed the highest sequence identity to those of HLSV. Phylogenetic analysis showed that HLFPV-J, other HLFPV isolates and HLSV constitute a malvaceous-plant-infecting tobamovirus cluster. These results indicate that the genomic structure of HLFPV-J has unique features similar to those of HLSV. To our knowledge, this is the first report of the complete genome sequence of HLFPV.
Nallaseth, Ferez Soli
The Y-chromosome presents a unique cytogenetic framework for the evolution of nucleotide sequences. Alignment of nine Y-chromosomal fragments in their increasing Y-specific/non Y-specific (male/female) sequence divergence ratios was directly and inversely related to their interspersion on these two respective genomic fractions. Sequence analysis confirmed a direct relationship between divergence ratios and the Alu, LINE-1, Satellite and their derivative oligonucleotide contents. Thus their relocation on the Y-chromosome is followed by sequence divergence rather than the well documented concerted evolution of these non-coding progenitor repeated sequences. Five of the nine Y-chromosomal fragments are non-pseudoautosomal and transcribed into heterogeneous PolyA^+ RNA and thus can be retrotransposed. Evolutionary and computer analysis identified homologous oligonucleotide tracts in several human loci suggesting common and random mechanistic origins. Dysgenic genomes represent the accelerated evolution driving sequence divergence (McClintock, 1984). Sex reversal and sterility characterizing dysgenesis occurs in C57BL/6JY ^{rm Pos} but not in 129/SvY^{rm Pos} derivative strains. High frequency, random, multi-locus deletion products of the feral Y^{ rm Pos}-chromosome are generated in the germlines of F1(C57BL/6J X 129/SvY^{ rm Pos})(male) and C57BL/6JY ^{rm Pos}(male) but not in 129/SvY^{rm Pos}(male). Equal, 10^{-1}, 10^ {-2}, and 0 copies (relative to males) of Y^{rm Pos}-specific deletion products respectively characterize C57BL/6JY ^{rm Pos} (HC), (LC), (T) and (F) females. The testes determining loci of inactive Y^{rm Pos}-chromosomes in C57BL/6JY^{rm Pos} HC females are the preferentially deleted/rearranged Y ^{rm Pos}-sequences. Disruption of regulation of plasma testosterone and hepatic MUP-A mRNA levels, TRD of a 4.7 Kbp EcoR1 fragment suggest disruption of autosomal/X-chromosomal sequences. These data and the highly repeated progenitor (Alu, GATA, LINE-1
Directory of Open Access Journals (Sweden)
Moore JE
2006-01-01
Full Text Available Abstract Background At present, six accessible sequences of 16S rDNA from Taylorella equigenitalis (T. equigenitalis are available, whose sequence differences occur at a few nucleotide positions. Thus it is important to determine these sequences from additional strains in other countries, if possible, in order to clarify any anomalies regarding 16S rDNA sequence heterogeneity. Here, we clone and sequence the approximate full-length 16S rDNA from additional strains of T. equigenitalis isolated in Japan, Australia and France and compare these sequences to the existing published sequences. Results Clarification of any anomalies regarding 16S rDNA sequence heterogeneity of T. equigenitalis was carried out. When cloning, sequencing and comparison of the approximate full-length 16S rDNA from 17 strains of T. equigenitalis isolated in Japan, Australia and France, nucleotide sequence differences were demonstrated at the six loci in the 1,469 nucleotide sequence. Moreover, 12 polymorphic sites occurred among 23 sequences of the 16S rDNA, including the six reference sequences. Conclusion High sequence similarity (99.5% or more was observed throughout, except from nucleotide positions 138 to 501 where substitutions and deletions were noted.
Matsuda, M; Tazumi, A; Kagawa, S; Sekizuka, T; Murayama, O; Moore, JE; Millar, BC
2006-01-01
Background At present, six accessible sequences of 16S rDNA from Taylorella equigenitalis (T. equigenitalis) are available, whose sequence differences occur at a few nucleotide positions. Thus it is important to determine these sequences from additional strains in other countries, if possible, in order to clarify any anomalies regarding 16S rDNA sequence heterogeneity. Here, we clone and sequence the approximate full-length 16S rDNA from additional strains of T. equigenitalis isolated in Japan, Australia and France and compare these sequences to the existing published sequences. Results Clarification of any anomalies regarding 16S rDNA sequence heterogeneity of T. equigenitalis was carried out. When cloning, sequencing and comparison of the approximate full-length 16S rDNA from 17 strains of T. equigenitalis isolated in Japan, Australia and France, nucleotide sequence differences were demonstrated at the six loci in the 1,469 nucleotide sequence. Moreover, 12 polymorphic sites occurred among 23 sequences of the 16S rDNA, including the six reference sequences. Conclusion High sequence similarity (99.5% or more) was observed throughout, except from nucleotide positions 138 to 501 where substitutions and deletions were noted. PMID:16398935
Mukhopadhyaya, R; Sadaie, M R
1993-02-01
Human T-cell leukemia virus type I (HTLV-I) has been associated with adult T-cell leukemia/lymphoma and the chronic neurologic disorder tropical spastic paraparesis/HTLV-I-associated myelopathy (TSP/HAM). To study the genetic structure of the virus associated with TSP/HAM, we have obtained and sequenced a partial genomic clone from an HTLV-I-positive cell line established from cerebrospinal fluid (CSF) of a Jamaican patient with TSP/HAM. This clone consisted of a 4.3-kb viral sequence containing the 5' long terminal repeat (LTR), gag, and N-terminal portion of the pol gene, with an overall 1.3% sequence variation resulting from mostly nucleotide substitutions, as compared to the prototype HTLV-I ATK-1. The gag and pol regions showed only 1.4% and 1.2% nucleotide variations, respectively. However, the U3 region of the LTR showed the highest sequence variation (3.6%), where several changes appear to be common among certain TSP/HAM isolates. Several of these changes reside within the 21-bp boundaries and the Tax-responsive element. It would be important to determine if the observed changes are sufficient to cause neurologic disorders similar to the murine leukemia virus system or simply reflect the divergent pool of HTLV-I from different geographic locations. At this time, we cannot rule out the possibility that the observed changes have either direct or indirect significance for the HTLV-I pathogenesis in TSP/HAM.
Suzuki, Hideaki; Yu, Jiwen; Wang, Fei; Zhang, Jinfa
2013-06-01
Cytoplasmic male sterility (CMS), which is a maternally inherited trait and controlled by novel chimeric genes in the mitochondrial genome, plays a pivotal role in the production of hybrid seed. In cotton, no PCR-based marker has been developed to discriminate CMS-D8 (from Gossypium trilobum) from its normal Upland cotton (AD1, Gossypium hirsutum) cytoplasm. The objective of the current study was to develop PCR-based single nucleotide polymorphic (SNP) markers from mitochondrial genes for the CMS-D8 cytoplasm. DNA sequence variation in mitochondrial genes involved in the oxidative phosphorylation chain including ATP synthase subunit 1, 4, 6, 8 and 9, and cytochrome c oxidase 1, 2 and 3 subunits were identified by comparing CMS-D8, its isogenic maintainer and restorer lines on the same nuclear genetic background. An allelic specific PCR (AS-PCR) was utilized for SNP typing by incorporating artificial mismatched nucleotides into the third or fourth base from the 3' terminus in both the specific and nonspecific primers. The result indicated that the method modifying allele-specific primers was successful in obtaining eight SNP markers out of eight SNPs using eight primer pairs to discriminate two alleles between AD1 and CMS-D8 cytoplasms. Two of the SNPs for atp1 and cox1 could also be used in combination to discriminate between CMS-D8 and CMS-D2 cytoplasms. Additionally, a PCR-based marker from a nine nucleotide insertion-deletion (InDel) sequence (AATTGTTTT) at the 59-67 bp positions from the start codon of atp6, which is present in the CMS and restorer lines with the D8 cytoplasm but absent in the maintainer line with the AD1 cytoplasm, was also developed. A SNP marker for two nucleotide substitutions (AA in AD1 cytoplasm to CT in CMS-D8 cytoplasm) in the intron (1,506 bp) of cox2 gene was also developed. These PCR-based SNP markers should be useful in discriminating CMS-D8 and AD1 cytoplasms, or those with CMS-D2 cytoplasm as a rapid, simple, inexpensive, and
Mitochondrial DNA analysis reveals a low nucleotide diversity of ...
African Journals Online (AJOL)
STORAGESEVER
2009-06-17
Jun 17, 2009 ... gene sequences of C. japonica in China to assess nucleotide sequence diversity (GenBank ... provide a scientific basis for the regional control of forestry .... population (AB015869) was downloaded from GenBank database.
Sasaya, Takahide; Ishikawa, Koichi; Koganezawa, Hiroki
2002-06-05
The complete nucleotide sequence of RNA1 from Lettuce big-vein virus (LBVV), the type member of the genus Varicosavirus, was determined. LBVV RNA1 consists of 6797 nucleotides and contains one large ORF that encodes a large (L) protein of 2040 amino acids with a predicted M(r) of 232,092. Northern blot hybridization analysis indicated that the LBVV RNA1 is a negative-sense RNA. Database searches showed that the amino acid sequence of L protein is homologous to those of L polymerases of nonsegmented negative-strand RNA viruses. A cluster dendrogram derived from alignments of the LBVV L protein and the L polymerases indicated that the L protein is most closely related to the L polymerases of plant rhabdoviruses. Transcription termination/polyadenylation signal-like poly(U) tracts that resemble those in rhabdovirus and paramyxovirus RNAs were present upstream and downstream of the coding region. Although LBVV is related to rhabdoviruses, a key distinguishing feature is that the genome of LBVV is segmented. The results reemphasize the need to reconsider the taxonomic position of varicosaviruses.
Nucleotide Interdependency in Transcription Factor Binding Sites in the Drosophila Genome.
Dresch, Jacqueline M; Zellers, Rowan G; Bork, Daniel K; Drewell, Robert A
2016-01-01
A long-standing objective in modern biology is to characterize the molecular components that drive the development of an organism. At the heart of eukaryotic development lies gene regulation. On the molecular level, much of the research in this field has focused on the binding of transcription factors (TFs) to regulatory regions in the genome known as cis-regulatory modules (CRMs). However, relatively little is known about the sequence-specific binding preferences of many TFs, especially with respect to the possible interdependencies between the nucleotides that make up binding sites. A particular limitation of many existing algorithms that aim to predict binding site sequences is that they do not allow for dependencies between nonadjacent nucleotides. In this study, we use a recently developed computational algorithm, MARZ, to compare binding site sequences using 32 distinct models in a systematic and unbiased approach to explore nucleotide dependencies within binding sites for 15 distinct TFs known to be critical to Drosophila development. Our results indicate that many of these proteins have varying levels of nucleotide interdependencies within their DNA recognition sequences, and that, in some cases, models that account for these dependencies greatly outperform traditional models that are used to predict binding sites. We also directly compare the ability of different models to identify the known KRUPPEL TF binding sites in CRMs and demonstrate that a more complex model that accounts for nucleotide interdependencies performs better when compared with simple models. This ability to identify TFs with critical nucleotide interdependencies in their binding sites will lead to a deeper understanding of how these molecular characteristics contribute to the architecture of CRMs and the precise regulation of transcription during organismal development.
Single Nucleotide Polymorphism
DEFF Research Database (Denmark)
Børsting, Claus; Pereira, Vania; Andersen, Jeppe Dyrberg
2014-01-01
Single nucleotide polymorphisms (SNPs) are the most frequent DNA sequence variations in the genome. They have been studied extensively in the last decade with various purposes in mind. In this chapter, we will discuss the advantages and disadvantages of using SNPs for human identification...... of SNPs. This will allow acquisition of more information from the sample materials and open up for new possibilities as well as new challenges....
Nature and distribution of feline sarcoma virus nucleotide sequences.
Frankel, A E; Gilbert, J H; Porzig, K J; Scolnick, E M; Aaronson, S A
1979-01-01
The genomes of three independent isolates of feline sarcoma virus (FeSV) were compared by molecular hybridization techniques. Using complementary DNAs prepared from two strains, SM- and ST-FeSV, common complementary DNA'S were selected by sequential hybridization to FeSV and feline leukemia virus RNAs. These DNAs were shown to be highly related among the three independent sarcoma virus isolates. FeSV-specific complementary DNAs were prepared by selection for hybridization by the homologous FeSV RNA and against hybridization by fline leukemia virus RNA. Sarcoma virus-specific sequences of SM-FeSV were shown to differ from those of either ST- or GA-FeSV strains, whereas ST-FeSV-specific DNA shared extensive sequence homology with GA-FeSV. By molecular hybridization, each set of FeSV-specific sequences was demonstrated to be present in normal cat cellular DNA in approximately one copy per haploid genome and was conserved throughout Felidae. In contrast, FeSV-common sequences were present in multiple DNA copies and were found only in Mediterranean cats. The present results are consistent with the concept that each FeSV strain has arisen by a mechanism involving recombination between feline leukemia virus and cat cellular DNA sequences, the latter represented within the cat genome in a manner analogous to that of a cellular gene. PMID:225544
RareVar: A Framework for Detecting Low-Frequency Single-Nucleotide Variants.
Hao, Yangyang; Xuei, Xiaoling; Li, Lang; Nakshatri, Harikrishna; Edenberg, Howard J; Liu, Yunlong
2017-07-01
Accurate identification of low-frequency somatic point mutations in tumor samples has important clinical utilities. Although high-throughput sequencing technology enables capturing such variants while sequencing primary tumor samples, our ability for accurate detection is compromised when the variant frequency is close to the sequencer error rate. Most current experimental and bioinformatic strategies target mutations with ≥5% allele frequency, which limits our ability to understand the cancer etiology and tumor evolution. We present an experimental and computational modeling framework, RareVar, to reliably identify low-frequency single-nucleotide variants from high-throughput sequencing data under standard experimental protocols. RareVar protocol includes a benchmark design by pooling DNAs from already sequenced individuals at various concentrations to target variants at desired frequencies, 0.5%-3% in our case. By applying a generalized, linear model-based, position-specific error model, followed by machine-learning-based variant calibration, our approach outperforms existing methods. Our method can be applied on most capture and sequencing platforms without modifying the experimental protocol.
US Agency for International Development — Nucleotide sequences were generated from 37 cowpea (Vigna unguiculata L. Walp.) accessions relevant to Africa, China and the USA to discover at type of genetic...
Directory of Open Access Journals (Sweden)
Bingjun eDang
2016-02-01
Full Text Available Plasmid pGA45 was isolated from the sediment of Haihe River using E. coli CV601 (gfp-tagged as recipients and indigenous bacteria from sediment as donors. This plasmid confers reduced susceptibility to imipenem which belongs to carbapenem group. Plasmid pGA45 was fully sequenced on an Illumina HiSeq 2000 sequencing system. The complete sequence of plasmid pGA45 was 140,698 bp in length with an average G+C content of 52.03%. Sequence analysis shows that pGA45 belongs to incFIIY group and harbors a backbone region shares high homology and gene synteny to several other incF plasmids including pNDM1_EC14653, pYDC644, pNDM-Ec1GN574, pRJF866, pKOX_NDM1 and pP10164-NDM. In addition to the backbone region, plasmid pGA45 harbors two notable features including one blaIMI-3-containing region and one type VI secretion system region. The blaIMI-3-containing region is responsible for bacteria carbapenem resistance and the type VI secretion system region is probably involved in bacteria virulence, respectively. Plasmid pGA45 represents the first complete nucleotide sequence of the blaIMI-harboring plasmid from environment sample and the sequencing of this plasmid provided insight into the architecture used for the dissemination of blaIMI carbapenemase genes.
Arai, Y T; Takahashi, H; Kameoka, Y; Shiino, T; Wimalaratne, O; Lodmell, D L
2001-01-01
Thirty-four suspected rabid brain samples from 2 humans, 24 dogs, 4 cats, 2 mongooses, I jackal and I water buffalo were collected in 1995-1996 in Sri Lanka. Total RNA was extracted directly from brain suspensions and examined using a one-step reverse transcription-polymerase chain reaction (RT-PCR) for the rabies virus nucleoprotein (N) gene. Twenty-eight samples were found positive for the virus N gene by RT-PCR and also for the virus antigens by fluorescent antibody (FA) test. Rabies virus isolates obtained from different animal species in different regions of Sri Lanka were genetically homogenous. Sequences of 203 nucleotides (nt)-long RT-PCR products obtained from 16 of 27 samples were found identical. Sequences of 1350 nt of N genes of 14 RT-PCR products were determined. The Sri Lanka isolates under study formed a specific cluster that included also an earlier isolate from India but did not include the known isolates from China, Thailand, Malaysia, Israel, Iran, Oman, Saudi Arabia, Russia, Nepal, Philippines, Japan and from several other countries. These results suggest that one type of rabies virus is circulating among human, dog, cat, mongoose, jackal and water buffalo living near Colombo City and in other five remote regions in Sri Lanka.
Sirena, Dominique; Ruzsics, Zsolt; Schaffner, Walter; Greber, Urs F; Hemmi, Silvio
2005-12-20
Human adenovirus (Ad) serotype 3 causes respiratory infections. It is considered highly virulent, accounting for about 13% of all Ad isolates. We report here the complete Ad3 DNA sequence of 35,343 base pairs (GenBank accession DQ086466). Ad3 shares 96.43% nucleotide identity with Ad7, another virulent subspecies B1 serotype, and 82.56 and 62.75% identity with the less virulent species B2 Ad11 and species C Ad5, respectively. The genomic organization of Ad3 is similar to the other human Ads comprising five early transcription units, E1A, E1B, E2, E3, and E4, two delayed early units IX and IVa2, and the major late unit, in total 39 putative and 7 hypothetical open reading frames. A recombinant E1-deleted Ad3 was generated on a bacterial artificial chromosome. This prototypic virus efficiently transduced CD46-positive rodent and human cells. Our results will help in clarifying the biology and pathology of adenoviruses and enhance therapeutic applications of viral vectors in clinical settings.
Nucleotide Selectivity in Abiotic RNA Polymerization Reactions
Coari, Kristin M.; Martin, Rebecca C.; Jain, Kopal; McGown, Linda B.
2017-09-01
In order to establish an RNA world on early Earth, the nucleotides must form polymers through chemical rather than biochemical reactions. The polymerization products must be long enough to perform catalytic functions, including self-replication, and to preserve genetic information. These functions depend not only on the length of the polymers, but also on their sequences. To date, studies of abiotic RNA polymerization generally have focused on routes to polymerization of a single nucleotide and lengths of the homopolymer products. Less work has been done the selectivity of the reaction toward incorporation of some nucleotides over others in nucleotide mixtures. Such information is an essential step toward understanding the chemical evolution of RNA. To address this question, in the present work RNA polymerization reactions were performed in the presence of montmorillonite clay catalyst. The nucleotides included the monophosphates of adenosine, cytosine, guanosine, uridine and inosine. Experiments included reactions of mixtures of an imidazole-activated nucleotide (ImpX) with one or more unactivated nucleotides (XMP), of two or more ImpX, and of XMP that were activated in situ in the polymerization reaction itself. The reaction products were analyzed using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) to identify the lengths and nucleotide compositions of the polymerization products. The results show that the extent of polymerization, the degree of heteropolymerization vs. homopolymerization, and the composition of the polymeric products all vary among the different nucleotides and depend upon which nucleotides and how many different nucleotides are present in the mixture.
Nucleotide Selectivity in Abiotic RNA Polymerization Reactions.
Coari, Kristin M; Martin, Rebecca C; Jain, Kopal; McGown, Linda B
2017-09-01
In order to establish an RNA world on early Earth, the nucleotides must form polymers through chemical rather than biochemical reactions. The polymerization products must be long enough to perform catalytic functions, including self-replication, and to preserve genetic information. These functions depend not only on the length of the polymers, but also on their sequences. To date, studies of abiotic RNA polymerization generally have focused on routes to polymerization of a single nucleotide and lengths of the homopolymer products. Less work has been done the selectivity of the reaction toward incorporation of some nucleotides over others in nucleotide mixtures. Such information is an essential step toward understanding the chemical evolution of RNA. To address this question, in the present work RNA polymerization reactions were performed in the presence of montmorillonite clay catalyst. The nucleotides included the monophosphates of adenosine, cytosine, guanosine, uridine and inosine. Experiments included reactions of mixtures of an imidazole-activated nucleotide (ImpX) with one or more unactivated nucleotides (XMP), of two or more ImpX, and of XMP that were activated in situ in the polymerization reaction itself. The reaction products were analyzed using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) to identify the lengths and nucleotide compositions of the polymerization products. The results show that the extent of polymerization, the degree of heteropolymerization vs. homopolymerization, and the composition of the polymeric products all vary among the different nucleotides and depend upon which nucleotides and how many different nucleotides are present in the mixture.
DEFF Research Database (Denmark)
Jutkina, Jekaterina; Hansen, Lars Hestbjerg; Li, Lili
2013-01-01
In the present study we report the complete nucleotide sequence of the toluene catabolic plasmid pD2RT of Pseudomonas migulae strain D2RT isolated from Baltic Sea water. The pD2RT is 129,894 base pairs in size with an average G+ C content of 53.75%. A total of 135 open reading frames (ORFs) were ...
Guo, D; Maiss, E; Adam, G; Casper, R
1995-05-01
The RNA3 of prunus necrotic ringspot ilarvirus (PNRSV) has been cloned and its entire sequence determined. The RNA3 consists of 1943 nucleotides (nt) and possesses two large open reading frames (ORFs) separated by an intergenic region of 74 nt. The 5' proximal ORF is 855 nt in length and codes for a protein of molecular mass 31.4 kDa which has homologies with the putative movement protein of other members of the Bromoviridae. The 3' proximal ORF of 675 nt is the cistron for the coat protein (CP) and has a predicted molecular mass of 24.9 kDa. The sequence of the 3' non-coding region (NCR) of PNRSV RNA3 showed a high degree of similarity with those of tobacco streak virus (TSV), prune dwarf virus (PDV), apple mosaic virus (ApMV) and also alfalfa mosaic virus (AIMV). In addition it contained potential stem-loop structures with interspersed AUGC motifs characteristic for ilar- and alfamoviruses. This conserved primary and secondary structure in all 3' NCRs may be responsible for the interaction with homologous and heterologous CPs and subsequent activation of genome replication. The CP gene of an ApMV isolate (ApMV-G) of 657 nt has also been cloned and sequenced. Although ApMV and PNRSV have a distant serological relationship, the deduced amino acid sequences of their CPs have an identity of only 51.8%. The N termini of PNRSV and ApMV CPs have in common a zinc-finger motif and the potential to form an amphipathic helix.
Directory of Open Access Journals (Sweden)
Alexander C Outhred
Full Text Available Improved tuberculosis control and the need to contain the spread of drug-resistant strains provide a strong rationale for exploring tuberculosis transmission dynamics at the population level. Whole-genome sequencing provides optimal strain resolution, facilitating detailed mapping of potential transmission pathways.We sequenced 22 isolates from a Mycobacterium tuberculosis cluster in New South Wales, Australia, identified during routine 24-locus mycobacterial interspersed repetitive unit typing. Following high-depth paired-end sequencing using the Illumina HiSeq 2000 platform, two independent pipelines were employed for analysis, both employing read mapping onto reference genomes as well as de novo assembly, to control biases in variant detection. In addition to single-nucleotide polymorphisms, the analyses also sought to identify insertions, deletions and structural variants.Isolates were highly similar, with a distance of 13 variants between the most distant members of the cluster. The most sensitive analysis classified the 22 isolates into 18 groups. Four of the isolates did not appear to share a recent common ancestor with the largest clade; another four isolates had an uncertain ancestral relationship with the largest clade.Whole genome sequencing, with analysis of single-nucleotide polymorphisms, insertions, deletions, structural variants and subpopulations, enabled the highest possible level of discrimination between cluster members, clarifying likely transmission pathways and exposing the complexity of strain origin. The analysis provides a basis for targeted public health intervention and enhanced classification of future isolates linked to the cluster.
DEFF Research Database (Denmark)
Frandsen, T P; Lok, F; Mirgorodskaya, E
2000-01-01
in the transition state complex. Mass spectrometry of tryptic fragments assigned the 92-kD protein to a barley cDNA (GenBank accession no. U22450) that appears to encode an alpha-glucosidase. A corresponding sequence (HvAgl97; GenBank accession no. AF118226) was isolated from a genomic phage library using a c......High-isoelectric-point (pI) alpha-glucosidase was purified 7, 300-fold from an extract of barley (Hordeum vulgare) malt by ammonium sulfate fractionation, ion-exchange, and butyl-Sepharose chromatography. The enzyme had high activity toward maltose (k(cat) = 25 s(-1)), with an optimum at pH 4...
First-principles study of high-conductance DNA sequencing with carbon nanotube electrodes
Chen, X.
2012-03-26
Rapid and cost-effective DNA sequencing at the single nucleotide level might be achieved by measuring a transverse electronic current as single-stranded DNA is pulled through a nanometer-sized pore. In order to enhance the electronic coupling between the nucleotides and the electrodes and hence the current signals, we employ a pair of single-walled close-ended (6,6) carbon nanotubes (CNTs) as electrodes. We then investigate the electron transport properties of nucleotides sandwiched between such electrodes by using first-principles quantum transport theory. In particular, we consider the extreme case where the separation between the electrodes is the smallest possible that still allows the DNA translocation. The benzene-like ring at the end cap of the CNT can strongly couple with the nucleobases and therefore it can both reduce conformational fluctuations and significantly improve the conductance. As such, when the electrodes are closely spaced, the nucleobases can pass through only with their base plane parallel to the plane of CNT end caps. The optimal molecular configurations, at which the nucleotides strongly couple to the CNTs, and which yield the largest transmission, are first identified. These correspond approximately to the lowest energy configurations. Then the electronic structures and the electron transport of these optimal configurations are analyzed. The typical tunneling currents are of the order of 50 nA for voltages up to 1 V. At higher bias, where resonant transport through the molecular states is possible, the current is of the order of several μA. Below 1 V, the currents associated to the different nucleotides are consistently distinguishable, with adenine having the largest current, guanine the second largest, cytosine the third and, finally, thymine the smallest. We further calculate the transmission coefficient profiles as the nucleotides are dragged along the DNA translocation path and investigate the effects of configurational variations
FASH: A web application for nucleotides sequence search
Directory of Open Access Journals (Sweden)
Chew Paul
2008-05-01
Full Text Available Abstract FASH (Fourier Alignment Sequence Heuristics is a web application, based on the Fast Fourier Transform, for finding remote homologs within a long nucleic acid sequence. Given a query sequence and a long text-sequence (e.g, the human genome, FASH detects subsequences within the text that are remotely-similar to the query. FASH offers an alternative approach to Blast/Fasta for querying long RNA/DNA sequences. FASH differs from these other approaches in that it does not depend on the existence of contiguous seed-sequences in its initial detection phase. The FASH web server is user friendly and very easy to operate. Availability FASH can be accessed at https://fash.bgu.ac.il:8443/fash/default.jsp (secured website
Complete Nucleotide Sequence Analysis of the Norovirus GII.4 Sydney Variant in South Korea
Directory of Open Access Journals (Sweden)
Ji-Sun Park
2015-01-01
Full Text Available Norovirus is the primary cause of acute gastroenteritis in individuals of all ages. In Australia, a new strain of norovirus (GII.4 was identified in March 2012, and this strain has spread rapidly around the world. In August 2012, this new GII.4 strain was identified in patients in South Korea. Therefore, to examine the characteristics of the epidemic norovirus GII.4 2012 variant in South Korea, we conducted KM272334 full-length genomic analysis. The genome of the gg-12-08-04 strain consisted of 7,558 bp and contained three open reading frame (ORF composites throughout the whole genome: ORF1 (5,100 bp, ORF2 (1,623 bp, and ORF3 (807 bp. Phylogenetic analyses showed that gg-12-08-04 belonged to the GII.4 Sydney 2012 variant, sharing 98.92% nucleotide similarity with this variant strain. According to SimPlot analysis, the gg-12-08-04 strain was a recombinant strain with breakpoint at the ORF1/2 junction between Osaka 2007 and Apeldoorn 2008 strains. This study is the first report of the complete sequence of the GII.4 Sydney 2012 strain in South Korea. Therefore, this may represent the standard sequence of the norovirus GII.4 2012 variant in South Korea and could therefore be useful for the development of norovirus vaccines.
Extraction of High Molecular Weight DNA from Fungal Rust Spores for Long Read Sequencing.
Schwessinger, Benjamin; Rathjen, John P
2017-01-01
Wheat rust fungi are complex organisms with a complete life cycle that involves two different host plants and five different spore types. During the asexual infection cycle on wheat, rusts produce massive amounts of dikaryotic urediniospores. These spores are dikaryotic (two nuclei) with each nucleus containing one haploid genome. This dikaryotic state is likely to contribute to their evolutionary success, making them some of the major wheat pathogens globally. Despite this, most published wheat rust genomes are highly fragmented and contain very little haplotype-specific sequence information. Current long-read sequencing technologies hold great promise to provide more contiguous and haplotype-phased genome assemblies. Long reads are able to span repetitive regions and phase structural differences between the haplomes. This increased genome resolution enables the identification of complex loci and the study of genome evolution beyond simple nucleotide polymorphisms. Long-read technologies require pure high molecular weight DNA as an input for sequencing. Here, we describe a DNA extraction protocol for rust spores that yields pure double-stranded DNA molecules with molecular weight of >50 kilo-base pairs (kbp). The isolated DNA is of sufficient purity for PacBio long-read sequencing, but may require additional purification for other sequencing technologies such as Nanopore and 10× Genomics.
DEFF Research Database (Denmark)
Oleksiewicz, M.B.; Bøtner, Anette; Nielsen, Jens
1999-01-01
We determined the untranslated 5'-leader sequence for three different isolates of porcine reproductive and respiratory syndrome virus (PRRSV): pathogenic European- and American-types, as well as an American-type vaccine strain. 5'-leader from European- and American-type PRRSV differed in length...... (220 and 190 nt, respectively), and exhibited only approximately 50% nucleotide homology. Nevertheless, highly conserved areas were identified in the leader of all 3 PRRSV isolates, which constitute candidate motifs for binding of protein(s) involved in viral replication. These comparative data provide...
The Matrix Method of Representation, Analysis and Classification of Long Genetic Sequences
Directory of Open Access Journals (Sweden)
Ivan V. Stepanyan
2017-01-01
Full Text Available The article is devoted to a matrix method of comparative analysis of long nucleotide sequences by means of presenting each sequence in the form of three digital binary sequences. This method uses a set of symmetries of biochemical attributes of nucleotides. It also uses the possibility of presentation of every whole set of N-mers as one of the members of a Kronecker family of genetic matrices. With this method, a long nucleotide sequence can be visually represented as an individual fractal-like mosaic or another regular mosaic of binary type. In contrast to natural nucleotide sequences, artificial random sequences give non-regular patterns. Examples of binary mosaics of long nucleotide sequences are shown, including cases of human chromosomes and penicillins. The obtained results are then discussed.
Classifying Coding DNA with Nucleotide Statistics
Directory of Open Access Journals (Sweden)
Nicolas Carels
2009-10-01
Full Text Available In this report, we compared the success rate of classification of coding sequences (CDS vs. introns by Codon Structure Factor (CSF and by a method that we called Universal Feature Method (UFM. UFM is based on the scoring of purine bias (Rrr and stop codon frequency. We show that the success rate of CDS/intron classification by UFM is higher than by CSF. UFM classifies ORFs as coding or non-coding through a score based on (i the stop codon distribution, (ii the product of purine probabilities in the three positions of nucleotide triplets, (iii the product of Cytosine (C, Guanine (G, and Adenine (A probabilities in the 1st, 2nd, and 3rd positions of triplets, respectively, (iv the probabilities of G in 1st and 2nd position of triplets and (v the distance of their GC3 vs. GC2 levels to the regression line of the universal correlation. More than 80% of CDSs (true positives of Homo sapiens (>250 bp, Drosophila melanogaster (>250 bp and Arabidopsis thaliana (>200 bp are successfully classified with a false positive rate lower or equal to 5%. The method releases coding sequences in their coding strand and coding frame, which allows their automatic translation into protein sequences with 95% confidence. The method is a natural consequence of the compositional bias of nucleotides in coding sequences.
Jo, Yeong Deuk; Choi, Yoomi; Kim, Dong-Hwan; Kim, Byung-Dong; Kang, Byoung-Cheorl
2014-07-04
Cytoplasmic male sterility (CMS) is an inability to produce functional pollen that is caused by mutation of the mitochondrial genome. Comparative analyses of mitochondrial genomes of lines with and without CMS in several species have revealed structural differences between genomes, including extensive rearrangements caused by recombination. However, the mitochondrial genome structure and the DNA rearrangements that may be related to CMS have not been characterized in Capsicum spp. We obtained the complete mitochondrial genome sequences of the pepper CMS line FS4401 (507,452 bp) and the fertile line Jeju (511,530 bp). Comparative analysis between mitochondrial genomes of peppers and tobacco that are included in Solanaceae revealed extensive DNA rearrangements and poor conservation in non-coding DNA. In comparison between pepper lines, FS4401 and Jeju mitochondrial DNAs contained the same complement of protein coding genes except for one additional copy of an atp6 gene (ψatp6-2) in FS4401. In terms of genome structure, we found eighteen syntenic blocks in the two mitochondrial genomes, which have been rearranged in each genome. By contrast, sequences between syntenic blocks, which were specific to each line, accounted for 30,380 and 17,847 bp in FS4401 and Jeju, respectively. The previously-reported CMS candidate genes, orf507 and ψatp6-2, were located on the edges of the largest sequence segments that were specific to FS4401. In this region, large number of small sequence segments which were absent or found on different locations in Jeju mitochondrial genome were combined together. The incorporation of repeats and overlapping of connected sequence segments by a few nucleotides implied that extensive rearrangements by homologous recombination might be involved in evolution of this region. Further analysis using mtDNA pairs from other plant species revealed common features of DNA regions around CMS-associated genes. Although large portion of sequence context was
DEFF Research Database (Denmark)
Leonardsen, L; DeClue, J E; Lybaek, H
1996-01-01
The substrate requirements for the catalytic activity of the mouse Cdc25 homolog Guanine nucleotide Release Factor, GRF, were determined using the catalytic domain of GRF expressed in insect cells and E. coli expressed H-Ras mutants. We found a requirement for the loop 7 residues in Ras (amino ac...... and the human Ras like proteins RhoA, Rap1A, Rac1 and G25K revealed a strict Ras specificity; of these only S. pombe Ras was GRF sensitive....
Horai, Makiko; Mishima, Hiroyuki; Hayashida, Chisa; Kinoshita, Akira; Nakane, Yoshibumi; Matsuo, Tatsuki; Tsuruda, Kazuto; Yanagihara, Katsunori; Sato, Shinya; Imanishi, Daisuke; Imaizumi, Yoshitaka; Hata, Tomoko; Miyazaki, Yasushi; Yoshiura, Koh-Ichiro
2018-03-01
Ionizing radiation released by the atomic bombs at Hiroshima and Nagasaki, Japan, in 1945 caused many long-term illnesses, including increased risks of malignancies such as leukemia and solid tumours. Radiation has demonstrated genetic effects in animal models, leading to concerns over the potential hereditary effects of atomic bomb-related radiation. However, no direct analyses of whole DNA have yet been reported. We therefore investigated de novo variants in offspring of atomic-bomb survivors by whole-genome sequencing (WGS). We collected peripheral blood from three trios, each comprising a father (atomic-bomb survivor with acute radiation symptoms), a non-exposed mother, and their child, none of whom had any past history of haematological disorders. One trio of non-exposed individuals was included as a control. DNA was extracted and the numbers of de novo single nucleotide variants in the children were counted by WGS with sequencing confirmation. Gross structural variants were also analysed. Written informed consent was obtained from all participants prior to the study. There were 62, 81, and 42 de novo single nucleotide variants in the children of atomic-bomb survivors, compared with 48 in the control trio. There were no gross structural variants in any trio. These findings are in accord with previously published results that also showed no significant genetic effects of atomic-bomb radiation on second-generation survivors.
Watson, Christopher M; Crinnion, Laura A; Harrison, Sally M; Lascelles, Carolina; Antanaviciute, Agne; Carr, Ian M; Bonthron, David T; Sheridan, Eamonn
2016-01-01
Next generation sequencing methodologies are facilitating the rapid characterisation of novel structural variants at nucleotide resolution. These approaches are particularly applicable to variants initially identified using alternative molecular methods. We report a child born with bilateral postaxial syndactyly of the feet and bilateral fifth finger clinodactyly. This was presumed to be an autosomal recessive syndrome, due to the family history of consanguinity. Karyotype analysis revealed a homozygous pericentric inversion of chromosome 7 (46,XX,inv(7)(p15q21)x2) which was confirmed to be heterozygous in both unaffected parents. Since the resolution of the karyotype was insufficient to identify any putatively causative gene, we undertook medium-coverage whole genome sequencing using paired-end reads, in order to elucidate the molecular breakpoints. In a two-step analysis, we first narrowed down the region by identifying discordant read-pairs, and then determined the precise molecular breakpoint by analysing the mapping locations of "soft-clipped" breakpoint-spanning reads. PCR and Sanger sequencing confirmed the identified breakpoints, both of which were located in intergenic regions. Significantly, the 7p15 breakpoint was located 523 kb upstream of HOXA13, the locus for hand-foot-genital syndrome. By inference from studies of HOXA locus control in the mouse, we suggest that the inversion has delocalised a HOXA13 enhancer to produce the phenotype observed in our patient. This study demonstrates how modern genetic diagnostic approach can characterise structural variants at nucleotide resolution and provide potential insights into functional regulation.
An, Jianyu; Yin, Mengqi; Zhang, Qin; Gong, Dongting; Jia, Xiaowen; Guan, Yajing; Hu, Jin
2017-09-11
Luffa cylindrica (L.) Roem. is an economically important vegetable crop in China. However, the genomic information on this species is currently unknown. In this study, for the first time, a genome survey of L. cylindrica was carried out using next-generation sequencing (NGS) technology. In total, 43.40 Gb sequence data of L. cylindrica , about 54.94× coverage of the estimated genome size of 789.97 Mb, were obtained from HiSeq 2500 sequencing, in which the guanine plus cytosine (GC) content was calculated to be 37.90%. The heterozygosity of genome sequences was only 0.24%. In total, 1,913,731 contigs (>200 bp) with 525 bp N 50 length and 1,410,117 scaffolds (>200 bp) with 885.01 Mb total length were obtained. From the initial assembled L. cylindrica genome, 431,234 microsatellites (SSRs) (≥5 repeats) were identified. The motif types of SSR repeats included 62.88% di-nucleotide, 31.03% tri-nucleotide, 4.59% tetra-nucleotide, 0.96% penta-nucleotide and 0.54% hexa-nucleotide. Eighty genomic SSR markers were developed, and 51/80 primers could be used in both "Zheda 23" and "Zheda 83". Nineteen SSRs were used to investigate the genetic diversity among 32 accessions through SSR-HRM analysis. The unweighted pair group method analysis (UPGMA) dendrogram tree was built by calculating the SSR-HRM raw data. SSR-HRM could be effectively used for genotype relationship analysis of Luffa species.
Directory of Open Access Journals (Sweden)
Jae-Su Moon
Full Text Available The hepatitis C virus (HCV internal ribosome entry site (IRES that directs cap-independent viral translation is a primary target for small interfering RNA (siRNA-based HCV antiviral therapy. However, identification of potent siRNAs against HCV IRES by bioinformatics-based siRNA design is a challenging task given the complexity of HCV IRES secondary and tertiary structures and association with multiple proteins, which can also dynamically change the structure of this cis-acting RNA element. In this work, we utilized siRNA tiling approach whereby siRNAs were tiled with overlapping sequences that were shifted by one or two nucleotides over the HCV IRES stem-loop structures III and IV spanning nucleotides (nts 277-343. Based on their antiviral activity, we mapped a druggable region (nts 313-343 where the targets of potent siRNAs were enriched. siIE22, which showed the greatest anti-HCV potency, targeted a highly conserved sequence across diverse HCV genotypes, locating within the IRES subdomain IIIf involved in pseudoknot formation. Stepwise target shifting toward the 5' or 3' direction by 1 or 2 nucleotides reduced the antiviral potency of siIE22, demonstrating the importance of siRNA accessibility to this highly structured and sequence-conserved region of HCV IRES for RNA interference. Nanoparticle-mediated systemic delivery of the stability-improved siIE22 derivative gs_PS1 siIE22, which contains a single phosphorothioate linkage on the guide strand, reduced the serum HCV genome titer by more than 4 log10 in a xenograft mouse model for HCV replication without generation of resistant variants. Our results provide a strategy for identifying potent siRNA species against a highly structured RNA target and offer a potential pan-HCV genotypic siRNA therapy that might be beneficial for patients resistant to current treatment regimens.
Directory of Open Access Journals (Sweden)
Arehart Eric
2009-03-01
Full Text Available Abstract Background The fidelity of DNA replication serves as the nidus for both genetic evolution and genomic instability fostering disease. Single nucleotide polymorphisms (SNPs constitute greater than 80% of the genetic variation between individuals. A new theory regarding DNA replication fidelity has emerged in which selectivity is governed by base-pair geometry through interactions between the selected nucleotide, the complementary strand, and the polymerase active site. We hypothesize that specific nucleotide combinations in the flanking regions of SNP fragments are associated with mutation. Results We modeled the relationship between DNA sequence and observed polymorphisms using the novel multifactor dimensionality reduction (MDR approach. MDR was originally developed to detect synergistic interactions between multiple SNPs that are predictive of disease susceptibility. We initially assembled data from the Broad Institute as a pilot test for the hypothesis that flanking region patterns associate with mutagenesis (n = 2194. We then confirmed and expanded our inquiry with human SNPs within coding regions and their flanking sequences collected from the National Center for Biotechnology Information (NCBI database (n = 29967 and a control set of sequences (coding region not associated with SNP sites randomly selected from the NCBI database (n = 29967. We discovered seven flanking region pattern associations in the Broad dataset which reached a minimum significance level of p ≤ 0.05. Significant models (p Conclusion The present study represents the first use of this computational methodology for modeling nonlinear patterns in molecular genetics. MDR was able to identify distinct nucleotide patterning around sites of mutations dependent upon the observed nucleotide change. We discovered one flanking region set that included five nucleotides clustered around a specific type of SNP site. Based on the strongly associated patterns identified in
Brütting, Christine; Emmer, Alexander; Kornhuber, Malte; Staege, Martin S
2016-08-01
Although multiple sclerosis (MS) is one of the most common central nervous system diseases in young adults, little is known about its etiology. Several human endogenous retroviruses (ERVs) are considered to play a role in MS. We are interested in which ERVs can be identified in the vicinity of MS associated genetic marker to find potential initiators of MS. We analysed the chromosomal regions surrounding 58 single nucleotide polymorphisms (SNPs) that are associated with MS identified in one of the last major genome wide association studies. We scanned these regions for putative endogenous retrovirus sequences with large open reading frames (ORFs). We observed that more retrovirus-related putative ORFs exist in the relatively close vicinity of SNP marker indices in multiple sclerosis compared to control SNPs. We found very high homologies to HERV-K, HCML-ARV, XMRV, Galidia ERV, HERV-H/env62 and XMRV-like mouse endogenous retrovirus mERV-XL. The associated genes (CYP27B1, CD6, CD58, MPV17L2, IL12RB1, CXCR5, PTGER4, TAGAP, TYK2, ICAM3, CD86, GALC, GPR65 as well as the HLA DRB1*1501) are mainly involved in the immune system, but also in vitamin D regulation. The most frequently detected ERV sequences are related to the multiple sclerosis-associated retrovirus, the human immunodeficiency virus 1, HERV-K, and the Simian foamy virus. Our data shows that there is a relation between MS associated SNPs and the number of retroviral elements compared to control. Our data identifies new ERV sequences that have not been associated with MS, so far.
Optimization of sequence alignment for simple sequence repeat regions
Directory of Open Access Journals (Sweden)
Ogbonnaya Francis C
2011-07-01
Full Text Available Abstract Background Microsatellites, or simple sequence repeats (SSRs, are tandemly repeated DNA sequences, including tandem copies of specific sequences no longer than six bases, that are distributed in the genome. SSR has been used as a molecular marker because it is easy to detect and is used in a range of applications, including genetic diversity, genome mapping, and marker assisted selection. It is also very mutable because of slipping in the DNA polymerase during DNA replication. This unique mutation increases the insertion/deletion (INDELs mutation frequency to a high ratio - more than other types of molecular markers such as single nucleotide polymorphism (SNPs. SNPs are more frequent than INDELs. Therefore, all designed algorithms for sequence alignment fit the vast majority of the genomic sequence without considering microsatellite regions, as unique sequences that require special consideration. The old algorithm is limited in its application because there are many overlaps between different repeat units which result in false evolutionary relationships. Findings To overcome the limitation of the aligning algorithm when dealing with SSR loci, a new algorithm was developed using PERL script with a Tk graphical interface. This program is based on aligning sequences after determining the repeated units first, and the last SSR nucleotides positions. This results in a shifting process according to the inserted repeated unit type. When studying the phylogenic relations before and after applying the new algorithm, many differences in the trees were obtained by increasing the SSR length and complexity. However, less distance between different linage had been observed after applying the new algorithm. Conclusions The new algorithm produces better estimates for aligning SSR loci because it reflects more reliable evolutionary relations between different linages. It reduces overlapping during SSR alignment, which results in a more realistic
Directory of Open Access Journals (Sweden)
Berendonk Thomas U
2011-05-01
Full Text Available Abstract Background Despite the fact that the organization of the ciliate mitochondrial genome is exceptional, only few ciliate mitochondrial genomes have been sequenced until today. All ciliate mitochondrial genomes are linear. They are 40 kb to 47 kb long and contain some 50 tightly packed genes without introns. Earlier studies documented that the mitochondrial guanine + cytosine contents are very different between Paramecium tetraurelia and all studied Tetrahymena species. This raises the question of whether the high mitochondrial G+C content observed in P. tetraurelia is a characteristic property of Paramecium mtDNA, or whether it is an exception of the ciliate mitochondrial genomes known so far. To test this question, we determined the mitochondrial genome sequence of Paramecium caudatum and compared the gene content and sequence properties to the closely related P. tetraurelia. Results The guanine + cytosine content of the P. caudatum mitochondrial genome was significantly lower than that of P. tetraurelia (22.4% vs. 41.2%. This difference in the mitochondrial nucleotide composition was accompanied by significantly different codon usage patterns in both species, i.e. within P. caudatum clearly A/T ending codons dominated, whereas for P. tetraurelia the synonymous codons were more balanced with a higher number of G/C ending codons. Further analyses indicated that the nucleotide composition of most members of the genus Paramecium resembles that of P. caudatum and that the shift observed in P. tetraurelia is restricted to the P. aurelia species complex. Conclusions Surprisingly, the codon usage bias in the P. caudatum mitochondrial genome, exemplified by the effective number of codons, is more similar to the distantly related T. pyriformis and other single-celled eukaryotes such as Chlamydomonas, than to the closely related P. tetraurelia. These differences in base composition and codon usage bias were, however, not reflected in the amino
High-throughput sequencing of three Lemnoideae (duckweeds chloroplast genomes from total DNA.
Directory of Open Access Journals (Sweden)
Wenqin Wang
Full Text Available BACKGROUND: Chloroplast genomes provide a wealth of information for evolutionary and population genetic studies. Chloroplasts play a particularly important role in the adaption for aquatic plants because they float on water and their major surface is exposed continuously to sunlight. The subfamily of Lemnoideae represents such a collection of aquatic species that because of photosynthesis represents one of the fastest growing plant species on earth. METHODS: We sequenced the chloroplast genomes from three different genera of Lemnoideae, Spirodela polyrhiza, Wolffiella lingulata and Wolffia australiana by high-throughput DNA sequencing of genomic DNA using the SOLiD platform. Unfractionated total DNA contains high copies of plastid DNA so that sequences from the nucleus and mitochondria can easily be filtered computationally. Remaining sequence reads were assembled into contiguous sequences (contigs using SOLiD software tools. Contigs were mapped to a reference genome of Lemna minor and gaps, selected by PCR, were sequenced on the ABI3730xl platform. CONCLUSIONS: This combinatorial approach yielded whole genomic contiguous sequences in a cost-effective manner. Over 1,000-time coverage of chloroplast from total DNA were reached by the SOLiD platform in a single spot on a quadrant slide without purification. Comparative analysis indicated that the chloroplast genome was conserved in gene number and organization with respect to the reference genome of L. minor. However, higher nucleotide substitution, abundant deletions and insertions occurred in non-coding regions of these genomes, indicating a greater genomic dynamics than expected from the comparison of other related species in the Pooideae. Noticeably, there was no transition bias over transversion in Lemnoideae. The data should have immediate applications in evolutionary biology and plant taxonomy with increased resolution and statistical power.
Alabi, Olufemi J; Villegas, Cecilia; Gregg, Lori; Murray, K Daniel
2016-06-01
Two isolates of a novel bipartite begomovirus, tentatively named malvastrum bright yellow mosaic virus (MaBYMV), were molecularly characterized from naturally infected plants of the genus Malvastrum showing bright yellow mosaic disease symptoms in South Texas. Six complete DNA-A and five DNA-B genome sequences of MaBYMV obtained from the isolates ranged in length from 2,608 to 2,609 nucleotides (nt) and 2,578 to 2,605 nt, respectively. Both genome segments shared a 178- to 180-nt common region. In pairwise comparisons, the complete DNA-A and DNA-B sequences of MaBYMV were most similar (87-88 % and 79-81 % identity, respectively) and phylogenetically related to the corresponding sequences of sida mosaic Sinaloa virus-[MX-Gua-06]. Further analysis revealed that MaBYMV is a putative recombinant virus, thus supporting the notion that malvaceous hosts may be influencing the evolution of several begomoviruses. The design of new diagnostic primers enabled the detection of MaBYMV in cohorts of Bemisia tabaci collected from symptomatic Malvastrum sp. plants, thus implicating whiteflies as potential vectors of the virus.
Krishnan, Neeraja M; Seligmann, Hervé; Stewart, Caro-Beth; De Koning, A P Jason; Pollock, David D
2004-10-01
Reconstruction of ancestral DNA and amino acid sequences is an important means of inferring information about past evolutionary events. Such reconstructions suggest changes in molecular function and evolutionary processes over the course of evolution and are used to infer adaptation and convergence. Maximum likelihood (ML) is generally thought to provide relatively accurate reconstructed sequences compared to parsimony, but both methods lead to the inference of multiple directional changes in nucleotide frequencies in primate mitochondrial DNA (mtDNA). To better understand this surprising result, as well as to better understand how parsimony and ML differ, we constructed a series of computationally simple "conditional pathway" methods that differed in the number of substitutions allowed per site along each branch, and we also evaluated the entire Bayesian posterior frequency distribution of reconstructed ancestral states. We analyzed primate mitochondrial cytochrome b (Cyt-b) and cytochrome oxidase subunit I (COI) genes and found that ML reconstructs ancestral frequencies that are often more different from tip sequences than are parsimony reconstructions. In contrast, frequency reconstructions based on the posterior ensemble more closely resemble extant nucleotide frequencies. Simulations indicate that these differences in ancestral sequence inference are probably due to deterministic bias caused by high uncertainty in the optimization-based ancestral reconstruction methods (parsimony, ML, Bayesian maximum a posteriori). In contrast, ancestral nucleotide frequencies based on an average of the Bayesian set of credible ancestral sequences are much less biased. The methods involving simpler conditional pathway calculations have slightly reduced likelihood values compared to full likelihood calculations, but they can provide fairly unbiased nucleotide reconstructions and may be useful in more complex phylogenetic analyses than considered here due to their speed and
Hayashi, Kei; Mohanta, Uday K; Ohari, Yuma; Neeraja, Tambireddy; Singh, T Shantikumar; Sugiyama, Hiromu; Itagaki, Tadashi
2016-12-01
The aim of this study was to analyze the phylogenetic relationship between Explanatum explanatum populations in India and other countries of the Indian subcontinent. Seventy liver amphistomes collected from four localities in India were identified as E. explanatum based on the nucleotide sequences of ribosomal ITS2. The flukes were then analyzed phylogenetically based on the nucleotide sequence of the mitochondrial gene nad1 in comparison with flukes from Bangladesh and Nepal. In the resulting phylogenetic tree, the nad1 haplotypes from India were divided into four clades, and the flukes showing the haplotypes of clades A and C were predominant in India. The haplotypes of the clades A and C have also been detected in Bangladesh and Nepal, and therefore, it seems they occur commonly throughout the Indian subcontinent. The results of AMOVA suggested that gene flow was likely to occur between E. explanatum populations in these countries. These countries are geographically close and have been historically and culturally connected to each other, and therefore, the movements of host ruminants among these countries might have been involved in the migration of the flukes and their gene flow.
Matsumoto, Toshimi; Okumura, Naohiko; Uenishi, Hirohide; Hayashi, Takeshi; Hamasima, Noriyuki; Awata, Takashi
2012-01-01
We have collected more than 190000 porcine expressed sequence tags (ESTs) from full-length complementary DNA (cDNA) libraries and identified more than 2800 single nucleotide polymorphisms (SNPs). In this study, we tentatively chose 222 SNPs observed in assembled ESTs to study pigs of different breeds; 104 were selected by comparing the cDNA sequences of a Meishan pig and samples of three-way cross pigs (Landrace, Large White, and Duroc: LWD), and 118 were selected from LWD samples. To evaluate the genetic variation between the chosen SNPs from pig breeds, we determined the genotypes for 192 pig samples (11 pig groups) from our DNA reference panel with matrix-assisted laser desorption ionization time-of-flight mass spectrometry. Of the 222 reference SNPs, 186 were successfully genotyped. A neighbor-joining tree showed that the pig groups were classified into two large clusters, namely, Euro-American and East Asian pig populations. F-statistics and the analysis of molecular variance of Euro-American pig groups revealed that approximately 25% of the genetic variations occurred because of intergroup differences. As the F(IS) values were less than the F(ST) values(,) the clustering, based on the Bayesian inference, implied that there was strong genetic differentiation among pig groups and less divergence within the groups in our samples. © 2011 The Authors. Animal Science Journal © 2011 Japanese Society of Animal Science.
Holden, Todd; Tremberger, G., Jr.; Cheung, E.; Subramaniam, R.; Gadura, N.; Schneider, P.; Sullivan, R.; Flamholz, A.; Lieberman, D.; Cheung, T. D.
2009-08-01
The Single-Stranded DNA-Binding Protein (RPA) Genes in gamma ray radiation-resistant halophilic archaeon Halobacterium sp. NRC-1 were analyzed in terms of their nucleotide fluctuations. In an ATCG sequence, each base was assigned a number equal to its atomic number. The resulting numerical sequence was the basis of the statistical analysis in this study. Fractal analysis using the Higuchi method gave fractal dimensions of 2.04 and 2.06 for the gene sequences VNG2160 and VNG2162, respectively. The 16S rRNA sequence has a fractal dimension of 1.99. The di-nucleotide Shannon entropy values were found to be negatively correlated with the observed fractal dimensions (R2~ 0.992, N=3). Inclusion of Deinococcus radiodurans Rad-A in the regression analysis decreases the R2 slightly to 0.98 (N=4). A third VNG2163 RPA gene of unknown function but with upregulation activity under irradiation was found to have a fractal dimension of 2.05 and a Shannon entropy of 3.77 bits. The above results are similar to those found in bacterial Deinococcus radiodurans and suggest that their high radiation resistance property would have favored selection of CG di-nucleotide pairs. The two transcription factors TbpD (VNG7114) and TfbA (VNG 2184) were also studied. Using VNG7114, VNG2184, and VNG2163; the regression analysis of fractal dimension versus Shannon entropy shows that R2 ~ 0.997 for N =3. The VNG2163 unknown function may be related to the pathways with transcriptions closely regulated to sequences VNG7114 and VNG2184.
Reverchon, S; Huang, Y; Bourson, C; Robert-Baudouy, J
1989-12-21
The nucleotide sequences of the coding and regulatory regions of the genes encoding oligoglacturonate lyase (OGL) and pectate lyase e isoenzyme (PLe) from Erwinia chrysanthemi 3937 were determined. The ogl sequence contains an open reading frame (ORF) of 1164 bp coding for a 388-amino acid (aa) polypeptide with a predicted Mr of 44,124. A possible transcriptional start signal showing homology with the Escherichia coli promoter consensus sequence was detected. In addition, a sequence 3' to the coding region was found to be able to form a secondary structure which may function as an Rho-independent transcriptional termination signal. For the pelE sequence, a long ORF of 1212 bp coding for a 404-aa polypeptide was detected. PLe is secreted into the external medium by E. chrysanthemi, and a potential signal peptide sequence was identified in the pelE gene. In the 5' upstream pelE coding region, a putative promoter resembling E. coli promoter consensus sequences was detected. Furthermore, the region immediately 3' to the pelE translational stop codon may function as an Rho-independent translational termination signal. In strain 3937, the synthesis of OGL and PLe, as well as the other enzymes involved in the pectin-degradative pathway (particularly the kdgT product), are known to be regulated by the KdgR repressor, which mediates galacturonate and polygalacturonate induction. Synthesis of these enzymes is also regulated by the CRP-cAMP complex which mediates catabolite repression. Analysis of the regulatory regions of ogl and pelE allowed us to identify possible CRP-binding sites for these two genes.(ABSTRACT TRUNCATED AT 250 WORDS)
Supplementary Material for: The arabidopsis cyclic nucleotide interactome
Donaldson, Lara; Meier, Stuart; Gehring, Christoph A
2016-01-01
Abstract Background Cyclic nucleotides have been shown to play important signaling roles in many physiological processes in plants including photosynthesis and defence. Despite this, little is known about cyclic nucleotide-dependent signaling mechanisms in plants since the downstream target proteins remain unknown. This is largely due to the fact that bioinformatics searches fail to identify plant homologs of protein kinases and phosphodiesterases that are the main targets of cyclic nucleotides in animals. Methods An affinity purification technique was used to identify cyclic nucleotide binding proteins in Arabidopsis thaliana. The identified proteins were subjected to a computational analysis that included a sequence, transcriptional co-expression and functional annotation analysis in order to assess their potential role in plant cyclic nucleotide signaling. Results A total of twelve cyclic nucleotide binding proteins were identified experimentally including key enzymes in the Calvin cycle and photorespiration pathway. Importantly, eight of the twelve proteins were shown to contain putative cyclic nucleotide binding domains. Moreover, the identified proteins are post-translationally modified by nitric oxide, transcriptionally co-expressed and annotated to function in hydrogen peroxide signaling and the defence response. The activity of one of these proteins, GLYGOLATE OXIDASE 1, a photorespiratory enzyme that produces hydrogen peroxide in response to Pseudomonas, was shown to be repressed by a combination of cGMP and nitric oxide treatment. Conclusions We propose that the identified proteins function together as points of cross-talk between cyclic nucleotide, nitric oxide and reactive oxygen species signaling during the defence response.
High-specificity detection of rare alleles with Paired-End Low Error Sequencing (PELE-Seq).
Preston, Jessica L; Royall, Ariel E; Randel, Melissa A; Sikkink, Kristin L; Phillips, Patrick C; Johnson, Eric A
2016-06-14
Polymorphic loci exist throughout the genomes of a population and provide the raw genetic material needed for a species to adapt to changes in the environment. The minor allele frequencies of rare Single Nucleotide Polymorphisms (SNPs) within a population have been difficult to track with Next-Generation Sequencing (NGS), due to the high error rate of standard methods such as Illumina sequencing. We have developed a wet-lab protocol and variant-calling method that identifies both sequencing and PCR errors, called Paired-End Low Error Sequencing (PELE-Seq). To test the specificity and sensitivity of the PELE-Seq method, we sequenced control E. coli DNA libraries containing known rare alleles present at frequencies ranging from 0.2-0.4 % of the total reads. PELE-Seq had higher specificity and sensitivity than standard libraries. We then used PELE-Seq to characterize rare alleles in a Caenorhabditis remanei nematode worm population before and after laboratory adaptation, and found that minor and rare alleles can undergo large changes in frequency during lab-adaptation. We have developed a method of rare allele detection that mitigates both sequencing and PCR errors, called PELE-Seq. PELE-Seq was evaluated using control E. coli populations and was then used to compare a wild C. remanei population to a lab-adapted population. The PELE-Seq method is ideal for investigating the dynamics of rare alleles in a broad range of reduced-representation sequencing methods, including targeted amplicon sequencing, RAD-Seq, ddRAD, and GBS. PELE-Seq is also well-suited for whole genome sequencing of mitochondria and viruses, and for high-throughput rare mutation screens.
SNP calling using genotype model selection on high-throughput sequencing data
You, Na
2012-01-16
Motivation: A review of the available single nucleotide polymorphism (SNP) calling procedures for Illumina high-throughput sequencing (HTS) platform data reveals that most rely mainly on base-calling and mapping qualities as sources of error when calling SNPs. Thus, errors not involved in base-calling or alignment, such as those in genomic sample preparation, are not accounted for.Results: A novel method of consensus and SNP calling, Genotype Model Selection (GeMS), is given which accounts for the errors that occur during the preparation of the genomic sample. Simulations and real data analyses indicate that GeMS has the best performance balance of sensitivity and positive predictive value among the tested SNP callers. © The Author 2012. Published by Oxford University Press. All rights reserved.
Directory of Open Access Journals (Sweden)
Marcos César Lima de Mendonça
2011-06-01
Full Text Available Heteroduplex mobility assay, single-stranded conformation polymorphism and nucleotide sequencing were utilised to genotype human parvovirus B19 samples from Brazil and Paraguay. Ninety-seven serum samples were collected from individuals presenting with abortion or erythema infectiosum, arthropathies, severe anaemia and transient aplastic crisis; two additional skin samples were collected by biopsy. After the procedure, all clinical samples were classified as genotype 1.
Directory of Open Access Journals (Sweden)
Alban eRamette
2014-11-01
Full Text Available Oligotyping is a novel, supervised computational method that classifies closely related sequences into oligotypes (OTs based on subtle nucleotide variations (Eren et al. 2013. Its application to microbial datasets has helped reveal ecological patterns which are often hidden by the way sequence data are currently clustered to define operational taxonomic units (OTUs. Here, we implemented the OT entropy decomposition procedure and its unsupervised version, Minimal Entropy Decomposition (MED; Eren et al. 2014, in the statistical programming language and environment, R. The aims are to facilitate the integration of computational routines, interactive statistical analyses, and visualization into a single framework. In addition, two complementary approaches are implemented: 1 An analytical method (the broken stick model is proposed to help identify oligotypes of low abundance that could be generated by chance alone and 2 a one-pass profiling (OP method, to efficiently identify those OTUs whose subsequent oligotyping would be most promising. These enhancements are especially useful for large datasets, where a manual screening of entropy analysis results and the creation of a full set of OTs may not be feasible. The package and procedures are illustrated by several tutorials and examples.
Vongerichten, K F; Klein, J R; Matern, H; Plapp, R
1994-10-01
Cell extracts of Lactobacillus delbrueckii subsp. lactis DSM 7290 were found to exhibit unique peptolytic ability against unusual beta-alanyl-dipeptides. In order to clone the gene encoding this activity, designated pepV, a gene library of strain DSM 7290 genomic DNA, prepared in the low-copy-number plasmid pLG339, was screened for heterologous expression in Escherichia coli. Recombinant clones harbouring pepV were identified by their ability to allow the utilization of carnosine (beta-alanyl-histidine) as a source of histidine by the E. coli mutant strain UK197 (pepD, hisG). Complementation was observed in a colony harbouring a recombinant plasmid (pKV101), carrying pepV. A 2.4 kb fragment containing pepV was subcloned and its nucleotide sequence revealed an open reading frame (ORF) of 1413 nucleotides, corresponding to a protein with predicted molecular mass of 51998 Da. A single transcription initiation site 71 bp upstream of the ATG translational start codon was identified by primer extension. No significant homology was detected between pepV or its deduced amino acid sequence with any entry in the databases. The only similarity was found in a region conserved in the ArgE/DapE/CPG2/YscS family of proteins. This observation, and protease inhibitor studies, indicated that pepV is of the metalloprotease type. A second ORF present in the sequenced fragment showed extensive homology to a variety of amino acid permeases from E. coli and Saccharomyces cerevisiae.
Population genetic analysis of shotgun assemblies of genomic sequences from multiple individuals
DEFF Research Database (Denmark)
Hellmann, Ines; Mang, Yuan; Gu, Zhiping
2008-01-01
We introduce a simple, broadly applicable method for obtaining estimates of nucleotide diversity from genomic shotgun sequencing data. The method takes into account the special nature of these data: random sampling of genomic segments from one or more individuals and a relatively high error rate...... for individual reads. Applying this method to data from the Celera human genome sequencing and SNP discovery project, we obtain estimates of nucleotide diversity in windows spanning the human genome and show that the diversity to divergence ratio is reduced in regions of low recombination. Furthermore, we show...
Directory of Open Access Journals (Sweden)
Xu Xiangming
2010-12-01
Full Text Available Abstract Background Determining the position and order of contigs and scaffolds from a genome assembly within an organism's genome remains a technical challenge in a majority of sequencing projects. In order to exploit contemporary technologies for DNA sequencing, we developed a strategy for whole genome single nucleotide polymorphism sequencing allowing the positioning of sequence contigs onto a linkage map using the bin mapping method. Results The strategy was tested on a draft genome of the fungal pathogen Venturia inaequalis, the causal agent of apple scab, and further validated using sequence contigs derived from the diploid plant genome Fragaria vesca. Using our novel method we were able to anchor 70% and 92% of sequences assemblies for V. inaequalis and F. vesca, respectively, to genetic linkage maps. Conclusions We demonstrated the utility of this approach by accurately determining the bin map positions of the majority of the large sequence contigs from each genome sequence and validated our method by mapping single sequence repeat markers derived from sequence contigs on a full mapping population.
NU-IN: Nucleotide evolution and input module for the EvolSimulator genome simulation platform
Directory of Open Access Journals (Sweden)
Barker Michael S
2010-08-01
Full Text Available Abstract Background There is increasing demand to test hypotheses that contrast the evolution of genes and gene families among genomes, using simulations that work across these levels of organization. The EvolSimulator program was developed recently to provide a highly flexible platform for forward simulations of amino acid evolution in multiple related lineages of haploid genomes, permitting copy number variation and lateral gene transfer. Synonymous nucleotide evolution is not currently supported, however, and would be highly advantageous for comparisons to full genome, transcriptome, and single nucleotide polymorphism (SNP datasets. In addition, EvolSimulator creates new genomes for each simulation, and does not allow the input of user-specified sequences and gene family information, limiting the incorporation of further biological realism and/or user manipulations of the data. Findings We present modified C++ source code for the EvolSimulator platform, which we provide as the extension module NU-IN. With NU-IN, synonymous and non-synonymous nucleotide evolution is fully implemented, and the user has the ability to use real or previously-simulated sequence data to initiate a simulation of one or more lineages. Gene family membership can be optionally specified, as well as gene retention probabilities that model biased gene retention. We provide PERL scripts to assist the user in deriving this information from previous simulations. We demonstrate the features of NU-IN by simulating genome duplication (polyploidy in the presence of ongoing copy number variation in an evolving lineage. This example is initiated with real genomic data, and produces output that we analyse directly with existing bioinformatic pipelines. Conclusions The NU-IN extension module is a publicly available open source software (GNU GPLv3 license extension to EvolSimulator. With the NU-IN module, users are now able to simulate both drift and selection at the nucleotide
Directory of Open Access Journals (Sweden)
Walid Mottawea
2018-05-01
Full Text Available Non-typhoidal Salmonella is a leading cause of foodborne illness worldwide. Prompt and accurate identification of the sources of Salmonella responsible for disease outbreaks is crucial to minimize infections and eliminate ongoing sources of contamination. Current subtyping tools including single nucleotide polymorphism (SNP typing may be inadequate, in some instances, to provide the required discrimination among epidemiologically unrelated Salmonella strains. Prophage genes represent the majority of the accessory genes in bacteria genomes and have potential to be used as high discrimination markers in Salmonella. In this study, the prophage sequence diversity in different Salmonella serovars and genetically related strains was investigated. Using whole genome sequences of 1,760 isolates of S. enterica representing 151 Salmonella serovars and 66 closely related bacteria, prophage sequences were identified from assembled contigs using PHASTER. We detected 154 different prophages in S. enterica genomes. Prophage sequences were highly variable among S. enterica serovars with a median ± interquartile range (IQR of 5 ± 3 prophage regions per genome. While some prophage sequences were highly conserved among the strains of specific serovars, few regions were lineage specific. Therefore, strains belonging to each serovar could be clustered separately based on their prophage content. Analysis of S. Enteritidis isolates from seven outbreaks generated distinct prophage profiles for each outbreak. Taken altogether, the diversity of the prophage sequences correlates with genome diversity. Prophage repertoires provide an additional marker for differentiating S. enterica subtypes during foodborne outbreaks.
Cloning and sequencing of the gene for human β-casein
International Nuclear Information System (INIS)
Loennerdal, B.; Bergstroem, S.; Andersson, Y.; Hialmarsson, K.; Sundgyist, A.; Hernell, O.
1990-01-01
Human β-casein is a major protein in human milk. This protein is part of the casein micelle and has been suggested to have several physiological functions in the newborn. Since there is limited information on βcasein and the factors that affect its concentration in human milk, the authors have isolated and sequenced the gene for this protein. A human mammary gland cDNA library (Clontech) in gt 11 was screened by plaque hy-hybridization using a 42-mer synthetic 32 p-labelled oligo-nucleotide. Positive clones were identified and isolated, DNA was prepared and the gene isolated by cleavage with EcoR1. Following subcloning (PUC18), restriction mapping and Southern blotting, DNA for sequencing was prepared. The gene was sequenced by the dideoxy method. Human β-casein has 212 amino acids and the amino acid sequence deducted from the nucleotide sequence is to 91% identical to the published sequence for human β-casein show a high degree of conservation at the leader peptide and the highly phosphorylated sequences, but also deletions and divergence at several positions. These results provide insight into the structure of the human β-casein gene and will facilitate studies on factors affecting its expression
Directory of Open Access Journals (Sweden)
Zhao Patrick X
2011-07-01
Full Text Available Abstract Background Single nucleotide polymorphisms (SNPs are the most common type of sequence variation among plants and are often functionally important. We describe the use of 454 technology and high resolution melting analysis (HRM for high throughput SNP discovery in tetraploid alfalfa (Medicago sativa L., a species with high economic value but limited genomic resources. Results The alfalfa genotypes selected from M. sativa subsp. sativa var. 'Chilean' and M. sativa subsp. falcata var. 'Wisfal', which differ in water stress sensitivity, were used to prepare cDNA from tissue of clonally-propagated plants grown under either well-watered or water-stressed conditions, and then pooled for 454 sequencing. Based on 125.2 Mb of raw sequence, a total of 54,216 unique sequences were obtained including 24,144 tentative consensus (TCs sequences and 30,072 singletons, ranging from 100 bp to 6,662 bp in length, with an average length of 541 bp. We identified 40,661 candidate SNPs distributed throughout the genome. A sample of candidate SNPs were evaluated and validated using high resolution melting (HRM analysis. A total of 3,491 TCs harboring 20,270 candidate SNPs were located on the M. truncatula (MT 3.5.1 chromosomes. Gene Ontology assignments indicate that sequences obtained cover a broad range of GO categories. Conclusions We describe an efficient method to identify thousands of SNPs distributed throughout the alfalfa genome covering a broad range of GO categories. Validated SNPs represent valuable molecular marker resources that can be used to enhance marker density in linkage maps, identify potential factors involved in heterosis and genetic variation, and as tools for association mapping and genomic selection in alfalfa.
Roden, Suzanne E; Dutton, Peter H; Morin, Phillip A
2009-01-01
The green sea turtle, Chelonia mydas, was used as a case study for single nucleotide polymorphism (SNP) discovery in a species that has little genetic sequence information available. As green turtles have a complex population structure, additional nuclear markers other than microsatellites could add to our understanding of their complex life history. Amplified fragment length polymorphism technique was used to generate sets of random fragments of genomic DNA, which were then electrophoretically separated with precast gels, stained with SYBR green, excised, and directly sequenced. It was possible to perform this method without the use of polyacrylamide gels, radioactive or fluorescent labeled primers, or hybridization methods, reducing the time, expense, and safety hazards of SNP discovery. Within 13 loci, 2547 base pairs were screened, resulting in the discovery of 35 SNPs. Using this method, it was possible to yield a sufficient number of loci to screen for SNP markers without the availability of prior sequence information.
Wang, Dingzhong; Tang, Wei; Wu, Xiaojie; Wang, Xinyi; Chen, Gengjia; Chen, Qiang; Li, Na; Liu, Feng
2012-08-21
Toehold-mediated strand displacement reaction (SDR) is first introduced to develop a simple quartz crystal microbalance (QCM) biosensor without an enzyme or label at normal temperature for highly selective and sensitive detection of single-nucleotide polymorphism (SNP) in the p53 tumor suppressor gene. A hairpin capture probe with an external toehold is designed and immobilized on the gold electrode surface of QCM. A successive SDR is initiated by the target sequence hybridization with the toehold domain and ends with the unfolding of the capture probe. Finally, the open-loop capture probe hybridizes with the streptavidin-coupled reporter probe as an efficient mass amplifier to enhance the QCM signal. The proposed biosensor displays remarkable specificity to target the p53 gene fragment against single-base mutant sequences (e.g., the largest discrimination factor is 63 to C-C mismatch) and high sensitivity with the detection limit of 0.3 nM at 20 °C. As the crucial component of the fabricated biosensor for providing the high discrimination capability, the design rationale of the capture probe is further verified by fluorescence sensing and atomic force microscopy imaging. Additionally, a recovery of 84.1% is obtained when detecting the target sequence in spiked HeLa cells lysate, demonstrating the feasibility of employing this biosensor in detecting SNPs in biological samples.
Tanaka, Mizuki; Sakai, Yoshifumi; Yamada, Osamu; Shintani, Takahiro; Gomi, Katsuya
2011-01-01
To investigate 3′-end-processing signals in Aspergillus oryzae, we created a nucleotide sequence data set of the 3′-untranslated region (3′ UTR) plus 100 nucleotides (nt) sequence downstream of the poly(A) site using A. oryzae expressed sequence tags and genomic sequencing data. This data set comprised 1065 sequences derived from 1042 unique genes. The average 3′ UTR length in A. oryzae was 241 nt, which is greater than that in yeast but similar to that in plants. The 3′ UTR and 100 nt sequence downstream of the poly(A) site is notably U-rich, while the region located 15–30 nt upstream of the poly(A) site is markedly A-rich. The most frequently found hexanucleotide in this A-rich region is AAUGAA, although this sequence accounts for only 6% of all transcripts. These data suggested that A. oryzae has no highly conserved sequence element equivalent to AAUAAA, a mammalian polyadenylation signal. We identified that putative 3′-end-processing signals in A. oryzae, while less well conserved than those in mammals, comprised four sequence elements: the furthest upstream U-rich element, A-rich sequence, cleavage site, and downstream U-rich element flanking the cleavage site. Although these putative 3′-end-processing signals are similar to those in yeast and plants, some notable differences exist between them. PMID:21586533
Pausch, Hubert; Emmerling, Reiner; Gredler-Grandl, Birgit; Fries, Ruedi; Daetwyler, Hans D; Goddard, Michael E
2017-11-09
Genotyping and whole-genome sequencing data have been generated for hundreds of thousands of cattle. International consortia used these data to compile imputation reference panels that facilitate the imputation of sequence variant genotypes for animals that have been genotyped using dense microarrays. Association studies with imputed sequence variant genotypes allow for the characterization of quantitative trait loci (QTL) at nucleotide resolution particularly when individuals from several breeds are included in the mapping populations. We imputed genotypes for 28 million sequence variants in 17,229 cattle of the Braunvieh, Fleckvieh and Holstein breeds in order to compile large mapping populations that provide high power to identify QTL for milk production traits. Association tests between imputed sequence variant genotypes and fat and protein percentages in milk uncovered between six and thirteen QTL (P < 1e-8) per breed. Eight of the detected QTL were significant in more than one breed. We combined the results across breeds using meta-analysis and identified a total of 25 QTL including six that were not significant in the within-breed association studies. Two missense mutations in the ABCG2 (p.Y581S, rs43702337, P = 4.3e-34) and GHR (p.F279Y, rs385640152, P = 1.6e-74) genes were the top variants at QTL on chromosomes 6 and 20. Another known causal missense mutation in the DGAT1 gene (p.A232K, rs109326954, P = 8.4e-1436) was the second top variant at a QTL on chromosome 14 but its allelic substitution effects were inconsistent across breeds. It turned out that the conflicting allelic substitution effects resulted from flaws in the imputed genotypes due to the use of a multi-breed reference population for genotype imputation. Many QTL for milk production traits segregate across breeds and across-breed meta-analysis has greater power to detect such QTL than within-breed association testing. Association testing between imputed sequence variant genotypes and
Directory of Open Access Journals (Sweden)
Lefranc Marie-Paule
2008-10-01
Full Text Available Abstract Background Nucleotides are trimmed from the ends of variable (V, diversity (D and joining (J genes during immunoglobulin (IG and T cell receptor (TR rearrangements in B cells and T cells of the immune system. This trimming is followed by addition of nucleotides at random, forming the N regions (N for nucleotides of the V-J and V-D-J junctions. These processes are crucial for creating diversity in the immune response since the number of trimmed nucleotides and the number of added nucleotides vary in each B or T cell. IMGT® sequence analysis tools, IMGT/V-QUEST and IMGT/JunctionAnalysis, are able to provide detailed and accurate analysis of the final observed junction nucleotide sequences (tool "output". However, as trimmed nucleotides can potentially be replaced by identical N region nucleotides during the process, the observed "output" represents a biased estimate of the "true trimming process." Results A probabilistic approach based on an analysis of the standardized tool "output" is proposed to infer the probability distribution of the "true trimmming process" and to provide plausible biological hypotheses explaining this process. We collated a benchmark dataset of TR alpha (TRA and TR gamma (TRG V-J rearranged sequences and junctions analysed with IMGT/V-QUEST and IMGT/JunctionAnalysis, the nucleotide sequence analysis tools from IMGT®, the international ImMunoGeneTics information system®, http://imgt.cines.fr. The standardized description of the tool output is based on the IMGT-ONTOLOGY axioms and concepts. We propose a simple first-order model that attempts to transform the observed "output" probability distribution into an estimate closer to the "true trimming process" probability distribution. We use this estimate to test the hypothesis that Poisson processes are involved in trimming. This hypothesis was not rejected at standard confidence levels for three of the four trimming processes: TRAV, TRAJ and TRGV. Conclusion By
Bleakley, Kevin; Lefranc, Marie-Paule; Biau, Gérard
2008-10-02
Nucleotides are trimmed from the ends of variable (V), diversity (D) and joining (J) genes during immunoglobulin (IG) and T cell receptor (TR) rearrangements in B cells and T cells of the immune system. This trimming is followed by addition of nucleotides at random, forming the N regions (N for nucleotides) of the V-J and V-D-J junctions. These processes are crucial for creating diversity in the immune response since the number of trimmed nucleotides and the number of added nucleotides vary in each B or T cell. IMGT sequence analysis tools, IMGT/V-QUEST and IMGT/JunctionAnalysis, are able to provide detailed and accurate analysis of the final observed junction nucleotide sequences (tool "output"). However, as trimmed nucleotides can potentially be replaced by identical N region nucleotides during the process, the observed "output" represents a biased estimate of the "true trimming process." A probabilistic approach based on an analysis of the standardized tool "output" is proposed to infer the probability distribution of the "true trimmming process" and to provide plausible biological hypotheses explaining this process. We collated a benchmark dataset of TR alpha (TRA) and TR gamma (TRG) V-J rearranged sequences and junctions analysed with IMGT/V-QUEST and IMGT/JunctionAnalysis, the nucleotide sequence analysis tools from IMGT, the international ImMunoGeneTics information system, http://imgt.cines.fr. The standardized description of the tool output is based on the IMGT-ONTOLOGY axioms and concepts. We propose a simple first-order model that attempts to transform the observed "output" probability distribution into an estimate closer to the "true trimming process" probability distribution. We use this estimate to test the hypothesis that Poisson processes are involved in trimming. This hypothesis was not rejected at standard confidence levels for three of the four trimming processes: TRAV, TRAJ and TRGV. By using trimming of rearranged TR genes as a benchmark, we
Greiner, Stephan; Wang, Xi; Herrmann, Reinhold G; Rauwolf, Uwe; Mayer, Klaus; Haberer, Georg; Meurer, Jörg
2008-09-01
A unique combination of genetic features and a rich stock of information make the flowering plant genus Oenothera an appealing model to explore the molecular basis of speciation processes including nucleus-organelle coevolution. From representative species, we have recently reported complete nucleotide sequences of the 5 basic and genetically distinguishable plastid chromosomes of subsection Oenothera (I-V). In nature, Oenothera plastid genomes are associated with 6 distinct, either homozygous or heterozygous, diploid nuclear genotypes of the 3 basic genomes A, B, or C. Artificially produced plastome-genome combinations that do not occur naturally often display interspecific plastome-genome incompatibility (PGI). In this study, we compare formal genetic data available from all 30 plastome-genome combinations with sequence differences between the plastomes to uncover potential determinants for interspecific PGI. Consistent with an active role in speciation, a remarkable number of genes have high Ka/Ks ratios. Different from the Solanacean cybrid model Atropa/tobacco, RNA editing seems not to be relevant for PGIs in Oenothera. However, predominantly sequence polymorphisms in intergenic segments are proposed as possible sources for PGI. A single locus, the bidirectional promoter region between psbB and clpP, is suggested to contribute to compartmental PGI in the interspecific AB hybrid containing plastome I (AB-I), consistent with its perturbed photosystem II activity.
Chen, Sherry Xi; Seelig, Georg
2016-04-20
Even a single-nucleotide difference between the sequences of two otherwise identical biological nucleic acids can have dramatic functional consequences. Here, we use model-guided reaction pathway engineering to quantitatively improve the performance of selective hybridization probes in recognizing single nucleotide variants (SNVs). Specifically, we build a detection system that combines discrimination by competition with DNA strand displacement-based catalytic amplification. We show, both mathematically and experimentally, that the single nucleotide selectivity of such a system in binding to single-stranded DNA and RNA is quadratically better than discrimination due to competitive hybridization alone. As an additional benefit the integrated circuit inherits the property of amplification and provides at least 10-fold better sensitivity than standard hybridization probes. Moreover, we demonstrate how the detection mechanism can be tuned such that the detection reaction is agnostic to the position of the SNV within the target sequence. in contrast, prior strand displacement-based probes designed for kinetic discrimination are highly sensitive to position effects. We apply our system to reliably discriminate between different members of the let-7 microRNA family that differ in only a single base position. Our results demonstrate the power of systematic reaction network design to quantitatively improve biotechnology.
Prediction of Nucleotide Binding Peptides Using Star Graph Topological Indices.
Liu, Yong; Munteanu, Cristian R; Fernández Blanco, Enrique; Tan, Zhiliang; Santos Del Riego, Antonino; Pazos, Alejandro
2015-11-01
The nucleotide binding proteins are involved in many important cellular processes, such as transmission of genetic information or energy transfer and storage. Therefore, the screening of new peptides for this biological function is an important research topic. The current study proposes a mixed methodology to obtain the first classification model that is able to predict new nucleotide binding peptides, using only the amino acid sequence. Thus, the methodology uses a Star graph molecular descriptor of the peptide sequences and the Machine Learning technique for the best classifier. The best model represents a Random Forest classifier based on two features of the embedded and non-embedded graphs. The performance of the model is excellent, considering similar models in the field, with an Area Under the Receiver Operating Characteristic Curve (AUROC) value of 0.938 and true positive rate (TPR) of 0.886 (test subset). The prediction of new nucleotide binding peptides with this model could be useful for drug target studies in drug development. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
The diploid genome sequence of an Asian individual
DEFF Research Database (Denmark)
Wang, Jun; Wang, Wei; Li, Ruiqiang
2008-01-01
Here we present the first diploid genome sequence of an Asian individual. The genome was sequenced to 36-fold average coverage using massively parallel sequencing technology. We aligned the short reads onto the NCBI human reference genome to 99.97% coverage, and guided by the reference genome, we...... used uniquely mapped reads to assemble a high-quality consensus sequence for 92% of the Asian individual's genome. We identified approximately 3 million single-nucleotide polymorphisms (SNPs) inside this region, of which 13.6% were not in the dbSNP database. Genotyping analysis showed that SNP...... identification had high accuracy and consistency, indicating the high sequence quality of this assembly. We also carried out heterozygote phasing and haplotype prediction against HapMap CHB and JPT haplotypes (Chinese and Japanese, respectively), sequence comparison with the two available individual genomes (J...
Directory of Open Access Journals (Sweden)
Wang Nian
2012-08-01
Full Text Available Abstract Background Genetic mapping and QTL detection are powerful methodologies in plant improvement and breeding. Construction of a high-density and high-quality genetic map would be of great benefit in the production of superior grapes to meet human demand. High throughput and low cost of the recently developed next generation sequencing (NGS technology have resulted in its wide application in genome research. Sequencing restriction-site associated DNA (RAD might be an efficient strategy to simplify genotyping. Combining NGS with RAD has proven to be powerful for single nucleotide polymorphism (SNP marker development. Results An F1 population of 100 individual plants was developed. In-silico digestion-site prediction was used to select an appropriate restriction enzyme for construction of a RAD sequencing library. Next generation RAD sequencing was applied to genotype the F1 population and its parents. Applying a cluster strategy for SNP modulation, a total of 1,814 high-quality SNP markers were developed: 1,121 of these were mapped to the female genetic map, 759 to the male map, and 1,646 to the integrated map. A comparison of the genetic maps to the published Vitis vinifera genome revealed both conservation and variations. Conclusions The applicability of next generation RAD sequencing for genotyping a grape F1 population was demonstrated, leading to the successful development of a genetic map with high density and quality using our designed SNP markers. Detailed analysis revealed that this newly developed genetic map can be used for a variety of genome investigations, such as QTL detection, sequence assembly and genome comparison.
Directory of Open Access Journals (Sweden)
Budzanivska I. G.
2014-03-01
Full Text Available Aim. Identification of the widespread Ukrainian isolate(s of PVY (Potato virus Y in different potato cultivars and subsequent phylogenetic analysis of detected PVY isolates based on NA and AA sequences of coat protein. Methods. ELISA, RT-PCR, DNA sequencing and phylogenetic analysis. Results. PVY has been identified serologically in potato cultivars of Ukrainian selection. In this work we have optimized a method for total RNA extraction from potato samples and offered a sensitive and specific PCR-based test system of own design for diagnostics of the Ukrainian PVY isolates. Part of the CP gene of the Ukrainian PVY isolate has been sequenced and analyzed phylogenetically. It is demonstrated that the Ukrainian isolate of Potato virus Y (CP gene has a higher percentage of homology with the recombinant isolates (strains of this pathogen (approx. 98.8– 99.8 % of homology for both nucleotide and translated amino acid sequences of the CP gene. The Ukrainian isolate of PVY is positioned in the separate cluster together with the isolates found in Syria, Japan and Iran; these isolates possibly have common origin. The Ukrainian PVY isolate is confirmed to be recombinant. Conclusions. This work underlines the need and provides the means for accurate monitoring of Potato virus Y in the agroecosystems of Ukraine. Most importantly, the phylogenetic analysis demonstrated the recombinant nature of this PVY isolate which has been attributed to the strain group O, subclade N:O.
Giudicelli, Véronique; Duroux, Patrice; Kossida, Sofia; Lefranc, Marie-Paule
2017-06-26
IMGT®, the international ImMunoGeneTics information system® ( http://www.imgt.org ), was created in 1989 in Montpellier, France (CNRS and Montpellier University) to manage the huge and complex diversity of the antigen receptors, and is at the origin of immunoinformatics, a science at the interface between immunogenetics and bioinformatics. Immunoglobulins (IG) or antibodies and T cell receptors (TR) are managed and described in the IMGT® databases and tools at the level of receptor, chain and domain. The analysis of the IG and TR variable (V) domain rearranged nucleotide sequences is performed by IMGT/V-QUEST (online since 1997, 50 sequences per batch) and, for next generation sequencing (NGS), by IMGT/HighV-QUEST, the high throughput version of IMGT/V-QUEST (portal begun in 2010, 500,000 sequences per batch). In vitro combinatorial libraries of engineered antibody single chain Fragment variable (scFv) which mimic the in vivo natural diversity of the immune adaptive responses are extensively screened for the discovery of novel antigen binding specificities. However the analysis of NGS full length scFv (~850 bp) represents a challenge as they contain two V domains connected by a linker and there is no tool for the analysis of two V domains in a single chain. The functionality "Analyis of single chain Fragment variable (scFv)" has been implemented in IMGT/V-QUEST and, for NGS, in IMGT/HighV-QUEST for the analysis of the two V domains of IG and TR scFv. It proceeds in five steps: search for a first closest V-REGION, full characterization of the first V-(D)-J-REGION, then search for a second V-REGION and full characterization of the second V-(D)-J-REGION, and finally linker delimitation. For each sequence or NGS read, positions of the 5'V-DOMAIN, linker and 3'V-DOMAIN in the scFv are provided in the 'V-orientated' sense. Each V-DOMAIN is fully characterized (gene identification, sequence description, junction analysis, characterization of mutations and amino
Protein sequence annotation in the genome era: the annotation concept of SWISS-PROT+TREMBL.
Apweiler, R; Gateau, A; Contrino, S; Martin, M J; Junker, V; O'Donovan, C; Lang, F; Mitaritonna, N; Kappus, S; Bairoch, A
1997-01-01
SWISS-PROT is a curated protein sequence database which strives to provide a high level of annotation, a minimal level of redundancy and high level of integration with other databases. Ongoing genome sequencing projects have dramatically increased the number of protein sequences to be incorporated into SWISS-PROT. Since we do not want to dilute the quality standards of SWISS-PROT by incorporating sequences without proper sequence analysis and annotation, we cannot speed up the incorporation of new incoming data indefinitely. However, as we also want to make the sequences available as fast as possible, we introduced TREMBL (TRanslation of EMBL nucleotide sequence database), a supplement to SWISS-PROT. TREMBL consists of computer-annotated entries in SWISS-PROT format derived from the translation of all coding sequences (CDS) in the EMBL nucleotide sequence database, except for CDS already included in SWISS-PROT. While TREMBL is already of immense value, its computer-generated annotation does not match the quality of SWISS-PROTs. The main difference is in the protein functional information attached to sequences. With this in mind, we are dedicating substantial effort to develop and apply computer methods to enhance the functional information attached to TREMBL entries.
Directory of Open Access Journals (Sweden)
E. Gaitán-Solís
2008-11-01
Full Text Available Single nucleotide polymorphism (SNP markers are by far the most common form of DNA polymorphism in a genome. The objectives of this study were to discover SNPs in common bean ( L. by comparing sequences from coding and noncoding regions obtained from the GenBank and genomic DNA and to compare sequencing results with those obtained using single base extension (SBE assays on the Luminex-100 system for use in high-throughput germplasm evaluation. We assessed the frequency of SNPs in 47 fragments of common bean DNA, using SBE as the evaluation methodology. We conducted a sequence analysis of 10 genotypes of cultivated and wild beans belonging to the Mesoamerican and Andean genetic pools of . For the 10 genotypes evaluated, a total of 20,964 bp of sequence were analyzed in each genotype and compared, resulting in the discovery of 239 SNPs and 133 InDels, giving an average SNP frequency of one per 88 bp and an InDel frequency of one per 157 bp. This is the equivalent of a nucleotide diversity (θ of 6.27 × 10. Comparisons with the SNP genotypes previously obtained by direct sequencing showed that the SBE assays on the Luminex-100 were accurate, with 2.5% being miscalled and 1% showing no signal. These results indicate that the Luminex-100 provides a high-throughput system that can be used to analyze SNPs in large samples of genotypes both for purposes of assessing diversity and also for mapping studies.
Preparation of highly multiplexed small RNA sequencing libraries.
Persson, Helena; Søkilde, Rolf; Pirona, Anna Chiara; Rovira, Carlos
2017-08-01
MicroRNAs (miRNAs) are ~22-nucleotide-long small non-coding RNAs that regulate the expression of protein-coding genes by base pairing to partially complementary target sites, preferentially located in the 3´ untranslated region (UTR) of target mRNAs. The expression and function of miRNAs have been extensively studied in human disease, as well as the possibility of using these molecules as biomarkers for prognostication and treatment guidance. To identify and validate miRNAs as biomarkers, their expression must be screened in large collections of patient samples. Here, we develop a scalable protocol for the rapid and economical preparation of a large number of small RNA sequencing libraries using dual indexing for multiplexing. Combined with the use of off-the-shelf reagents, more samples can be sequenced simultaneously on large-scale sequencing platforms at a considerably lower cost per sample. Sample preparation is simplified by pooling libraries prior to gel purification, which allows for the selection of a narrow size range while minimizing sample variation. A comparison with publicly available data from benchmarking of miRNA analysis platforms showed that this method captures absolute and differential expression as effectively as commercially available alternatives.
D.J. Glass; N. Takebayashi; L. Olson; D.L. Taylor
2013-01-01
The number of sequences from both formally described taxa and uncultured environmental DNA deposited in the International Nucleotide Sequence Databases has increased substantially over the last two decades. Although the majority of these sequences represent authentic gene copies, there is evidence of DNA artifacts in these databases as well. These include lab artifacts...
E2FM: an encrypted and compressed full-text index for collections of genomic sequences.
Montecuollo, Ferdinando; Schmid, Giovannni; Tagliaferri, Roberto
2017-09-15
Next Generation Sequencing (NGS) platforms and, more generally, high-throughput technologies are giving rise to an exponential growth in the size of nucleotide sequence databases. Moreover, many emerging applications of nucleotide datasets-as those related to personalized medicine-require the compliance with regulations about the storage and processing of sensitive data. We have designed and carefully engineered E 2 FM -index, a new full-text index in minute space which was optimized for compressing and encrypting nucleotide sequence collections in FASTA format and for performing fast pattern-search queries. E 2 FM -index allows to build self-indexes which occupy till to 1/20 of the storage required by the input FASTA file, thus permitting to save about 95% of storage when indexing collections of highly similar sequences; moreover, it can exactly search the built indexes for patterns in times ranging from few milliseconds to a few hundreds milliseconds, depending on pattern length. Source code is available at https://github.com/montecuollo/E2FM . ferdinando.montecuollo@unicampania.it. Supplementary data are available at Bioinformatics online. © The Author (2017). Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com
Mo, Xiao-han; Chen, Zheng-bin; Chen, Jian-ping
2010-12-01
Tobacco bushy top disease is caused by tobacco bushy top virus (TBTV, a member of the genus Umbravirus) which is dependent on tobacco vein-distorting virus (TVDV) to act as a helper virus encapsidating TBTV and enabling its transmission by aphids. Isometric virions from diseased tobacco plants were purified and disease symptoms were reproduced after experimental aphid transmission. The complete genome of TVDV was determined from cloned RT-PCR products derived from viral RNA. It was 5,920 nucleotides (nts) long and had the six major open reading frames (ORFs) typical of a member of the genus Polerovirus. Sequence comparisons showed that it differed significantly from any of the other species in the genus and this was confirmed by phylogenetic analyses of the RdRp and coat protein. SDS-PAGE analysis of purified virions gave two protein bands of about 26 and 59 kDa both of which reacted strongly in Western blots with antiserum produced to prokaryotically expressed TVDV CP showing that the two forms of the TVDV CP were the only protein components of the capsid.
Blaiotta, Giuseppe; Pepe, Olimpia; Mauriello, Gianluigi; Villani, Francesco; Andolfi, Rosamaria; Moschetti, Giancarlo
2002-12-01
The intergenic spacer region (ISR) between the 16S and 23S rRNA genes was tested as a tool for differentiating lactococci commonly isolated in a dairy environment. 17 reference strains, representing 11 different species belonging to the genera Lactococcus, Streptococcus, Lactobacillus, Enterococcus and Leuconostoc, and 127 wild streptococcal strains isolated during the whole fermentation process of "Fior di Latte" cheese were analyzed. After 16S-23S rDNA ISR amplification by PCR, species or genus-specific patterns were obtained for most of the reference strains tested. Moreover, results obtained after nucleotide analysis show that the 16S-23S rDNA ISR sequences vary greatly, in size and sequence, among Lactococcus garvieae, Lactococcus raffinolactis, Lactococcus lactis as well as other streptococci from dairy environments. Because of the high degree of inter-specific polymorphism observed, 16S-23S rDNA ISR can be considered a good potential target for selecting species-specific molecular assays, such as PCR primer or probes, for a rapid and extremely reliable differentiation of dairy lactococcal isolates.
Rapid detection of SMARCB1 sequence variation using high resolution melting
Directory of Open Access Journals (Sweden)
Ashley David M
2009-12-01
Full Text Available Abstract Background Rhabdoid tumors are rare cancers of early childhood arising in the kidney, central nervous system and other organs. The majority are caused by somatic inactivating mutations or deletions affecting the tumor suppressor locus SMARCB1 [OMIM 601607]. Germ-line SMARCB1 inactivation has been reported in association with rhabdoid tumor, epitheloid sarcoma and familial schwannomatosis, underscoring the importance of accurate mutation screening to ascertain recurrence and transmission risks. We describe a rapid and sensitive diagnostic screening method, using high resolution melting (HRM, for detecting sequence variations in SMARCB1. Methods Amplicons, encompassing the nine coding exons of SMARCB1, flanking splice site sequences and the 5' and 3' UTR, were screened by both HRM and direct DNA sequencing to establish the reliability of HRM as a primary mutation screening tool. Reaction conditions were optimized with commercially available HRM mixes. Results The false negative rate for detecting sequence variants by HRM in our sample series was zero. Nine amplicons out of a total of 140 (6.4% showed variant melt profiles that were subsequently shown to be false positive. Overall nine distinct pathogenic SMARCB1 mutations were identified in a total of 19 possible rhabdoid tumors. Two tumors had two distinct mutations and two harbored SMARCB1 deletion. Other mutations were nonsense or frame-shifts. The detection sensitivity of the HRM screening method was influenced by both sequence context and specific nucleotide change and varied from 1: 4 to 1:1000 (variant to wild-type DNA. A novel method involving digital HRM, followed by re-sequencing, was used to confirm mutations in tumor specimens containing associated normal tissue. Conclusions This is the first report describing SMARCB1 mutation screening using HRM. HRM is a rapid, sensitive and inexpensive screening technology that is likely to be widely adopted in diagnostic laboratories to
Rapid detection of SMARCB1 sequence variation using high resolution melting
International Nuclear Information System (INIS)
Dagar, Vinod; Chow, Chung-Wo; Ashley, David M; Algar, Elizabeth M
2009-01-01
Rhabdoid tumors are rare cancers of early childhood arising in the kidney, central nervous system and other organs. The majority are caused by somatic inactivating mutations or deletions affecting the tumor suppressor locus SMARCB1 [OMIM 601607]. Germ-line SMARCB1 inactivation has been reported in association with rhabdoid tumor, epitheloid sarcoma and familial schwannomatosis, underscoring the importance of accurate mutation screening to ascertain recurrence and transmission risks. We describe a rapid and sensitive diagnostic screening method, using high resolution melting (HRM), for detecting sequence variations in SMARCB1. Amplicons, encompassing the nine coding exons of SMARCB1, flanking splice site sequences and the 5' and 3' UTR, were screened by both HRM and direct DNA sequencing to establish the reliability of HRM as a primary mutation screening tool. Reaction conditions were optimized with commercially available HRM mixes. The false negative rate for detecting sequence variants by HRM in our sample series was zero. Nine amplicons out of a total of 140 (6.4%) showed variant melt profiles that were subsequently shown to be false positive. Overall nine distinct pathogenic SMARCB1 mutations were identified in a total of 19 possible rhabdoid tumors. Two tumors had two distinct mutations and two harbored SMARCB1 deletion. Other mutations were nonsense or frame-shifts. The detection sensitivity of the HRM screening method was influenced by both sequence context and specific nucleotide change and varied from 1: 4 to 1:1000 (variant to wild-type DNA). A novel method involving digital HRM, followed by re-sequencing, was used to confirm mutations in tumor specimens containing associated normal tissue. This is the first report describing SMARCB1 mutation screening using HRM. HRM is a rapid, sensitive and inexpensive screening technology that is likely to be widely adopted in diagnostic laboratories to facilitate whole gene mutation screening
Bellerophon: a program to detect chimeric sequences in multiple sequence alignments.
Huber, Thomas; Faulkner, Geoffrey; Hugenholtz, Philip
2004-09-22
Bellerophon is a program for detecting chimeric sequences in multiple sequence datasets by an adaption of partial treeing analysis. Bellerophon was specifically developed to detect 16S rRNA gene chimeras in PCR-clone libraries of environmental samples but can be applied to other nucleotide sequence alignments. Bellerophon is available as an interactive web server at http://foo.maths.uq.edu.au/~huber/bellerophon.pl
One-Step PCR Sequencing. Final Technical Progress Report for February 15, 1997 - November 30, 2001
Energy Technology Data Exchange (ETDEWEB)
Shaw, B. R.
2004-04-16
We investigated new chemistries and alternate approaches for direct gene sequencing and detection based on the properties of boron-substituted nucleotides as chain delimiters in lieu of conventional chain terminators. Chain terminators, such as the widely used Sanger dideoxynucleotide truncators, stop DNA synthesis during replication and hence are incompatible with further PCR amplification. Chain delimiters, on the other hand, are chemically-modified, ''stealth'' nucleotides that act like normal nucleotides in DNA synthesis and PCR amplification, but can be unmasked following chain extension and exponential amplification. Specifically, chain delimiters give rise to an alternative sequencing strategy based on selective degradation of DNA chains generated by PCR amplification with modified nucleotides. The method as originally devised employed template-directed enzymatic, random incorporation of small amounts of boron-modified nucleotides (e.g., 2'-deoxynucleoside 5'-alpha-[P-borano]- triphosphates) during PCR amplification. Rather than incorporation of dideoxy chain terminators, which are less efficiently incorporated in PCR-based amplification than natural deoxynucleotides, our method is based on selective incorporation and exonuclease degradation of DNA chains generated by efficient PCR amplification of chemically-modified ''stealth'' nucleotides. The stealth nucleotides have a boranophosphate group instead of a normal phosphate, yet behave like normal nucleotides during PCR-amplification. The unique feature of our method is that the position of the stealth nucleotide, and hence DNA sequencing fragments, are revealed at the desired, appropriate moment following PCR amplification. During the current grant period, a variety of new boron-modified nucleotides were synthesized, and new chemistries and enzymatic methods and combinations thereof were explored to improve the method and study the effects of borane modified
Synthesis and degradation of cyclic nucleotides in brain after a high dose of ionizing radiation
International Nuclear Information System (INIS)
Hunt, W.A.; Dalton, T.K.
1981-01-01
Previous data from our laboratory have indicated that a high dose of ionizing radiation can deplete the cyclic nucleotides guanosine 3',5'-cyclic monophosphate (cGMP) and adenosine 3',5'-cyclic monophosphate (cAMP) on several areas of the rat brain. cGMP is more sensitive to radiation than cAMP and does not recover for at least 24 h after irradiation. The response of cAMP is transient and recovery occurs within 4 h. The purpose of the present paper is to determine whether alternations in the activity of the synthetic and degradative enzymes that regulate cyclic nucleotide levels could account for the observed effects. Guanylate and adenylate cyclase and cGMP and cAMP phosphodiesterase activities were determined 10 min after irradiation with 10,000 rad of high-energy electrons. No alteration was detected under these experimental conditions. The data suggest that the reduction in cyclic nucleotides is not a direct effect on their metabolic enzymes and is probably secondary to some as yet-undefined action of radiation on the brain
Expressed sequence tags (ESTs) and single nucleotide ...
African Journals Online (AJOL)
SERVER
2008-02-19
Feb 19, 2008 ... the discovery of the DNA, a new area of modern plant biotechnology begun. In plant ... Marker Assisted Breeding and Sequence Tagged Sites. (STS) are all in use in modern ...... and behaviour in the honey bee. Genome Res.
Retrieval and Representation of Nucleotide Sequence of ...
African Journals Online (AJOL)
Nigerian Journal of Basic and Applied Science (March, 2013), 21(1): 27-32 ... Full Length R esearch A rticle ... The present study highlights data retrieval and representation. .... the end of information and the start of the sequence on the next ...
Rasmussen, C; Purcell, M K; Gregg, J L; LaPatra, S E; Winton, J R; Hershberger, P K
2010-03-09
The mesomycetozoean parasite Ichthyophonus hoferi is most commonly associated with marine fish hosts but also occurs in some components of the freshwater rainbow trout Oncorhynchus mykiss aquaculture industry in Idaho, USA. It is not certain how the parasite was introduced into rainbow trout culture, but it might have been associated with the historical practice of feeding raw, ground common carp Cyprinus carpio that were caught by commercial fisherman. Here, we report a major genetic division between west coast freshwater and marine isolates of Ichthyophonus hoferi. Sequence differences were not detected in 2 regions of the highly conserved small subunit (18S) rDNA gene; however, nucleotide variation was seen in internal transcribed spacer loci (ITS1 and ITS2), both within and among the isolates. Intra-isolate variation ranged from 2.4 to 7.6 nucleotides over a region consisting of approximately 740 bp. Majority consensus sequences from marine/anadromous hosts differed in only 0 to 3 nucleotides (99.6 to 100% nucleotide identity), while those derived from freshwater rainbow trout had no nucleotide substitutions relative to each other. However, the consensus sequences between isolates from freshwater rainbow trout and those from marine/anadromous hosts differed in 13 to 16 nucleotides (97.8 to 98.2% nucleotide identity).
Le Gall, O L; Lanneau, M; Candresse, T; Dunez, J
1995-05-01
The RNA-2 of a carrot isolate from the English serotype of tomato black ring nepovirus (TBRV-ED) has been sequenced. It is 4618 nucleotides long and contains one open reading frame encoding a polypeptide of 1344 amino acids. The 5' non-coding region contains three repetitions of a stem-loop structure also conserved in TBRV-Scottish and grapevine chrome mosaic nepovirus (GCMV). The coat protein domain was mapped to the carboxy-terminal one-third of the polyprotein. Sequence comparisons indicate that TBRV-ED RNA-2 probably arose by an RNA recombination event that resulted in the exchange of the putative movement protein gene between TBRV and GCMV.
Li, Guang-Qing; Liu, Zi; Shen, Hong-Bin; Yu, Dong-Jun
2016-10-01
As one of the most ubiquitous post-transcriptional modifications of RNA, N 6 -methyladenosine ( [Formula: see text]) plays an essential role in many vital biological processes. The identification of [Formula: see text] sites in RNAs is significantly important for both basic biomedical research and practical drug development. In this study, we designed a computational-based method, called TargetM6A, to rapidly and accurately target [Formula: see text] sites solely from the primary RNA sequences. Two new features, i.e., position-specific nucleotide/dinucleotide propensities (PSNP/PSDP), are introduced and combined with the traditional nucleotide composition (NC) feature to formulate RNA sequences. The extracted features are further optimized to obtain a much more compact and discriminative feature subset by applying an incremental feature selection (IFS) procedure. Based on the optimized feature subset, we trained TargetM6A on the training dataset with a support vector machine (SVM) as the prediction engine. We compared the proposed TargetM6A method with existing methods for predicting [Formula: see text] sites by performing stringent jackknife tests and independent validation tests on benchmark datasets. The experimental results show that the proposed TargetM6A method outperformed the existing methods for predicting [Formula: see text] sites and remarkably improved the prediction performances, with MCC = 0.526 and AUC = 0.818. We also provided a user-friendly web server for TargetM6A, which is publicly accessible for academic use at http://csbio.njust.edu.cn/bioinf/TargetM6A.
International Nuclear Information System (INIS)
Hurley, L.H.; Needham-VanDevanter, D.R.
1986-01-01
DNA ligands which bind within the minor groove of DNA exhibit varying degrees of sequence selectivity. Factors which contribute to nucleotide sequence recognition by minor groove ligands have been extensively investigated. Electrostatic interactions, ligand and DNA dehydration energies, hydrophobic interactions and steric factors all play significant roles in sequence selectivity in the minor groove. Interestingly, ligand recognition of nucleotide sequence in the minor groove does not involve significant hydrogen bonding. This is in sharp contrast to cellular enzyme and protein recognition of nucleotide sequence, which is achieved in the major groove via specific hydrogen bond formation between individual bases and the ligand. The ability to read nucleotide sequence via hydrogen bonding allows precise binding of proteins to specific DNA sequences. Minor groove ligands examined to date exhibit a much lower sequence specificity, generally binding to a subset of possible sequences, rather than a single sequence. 19 refs., 7 figs
Amelia, Kassim; Khor, Chin Yin; Shah, Farida Habib; Bhore, Subhash J
2015-01-01
Common beans (Phaseolus vulgaris L.) are widely consumed as a source of proteins and natural products. However, its yield needs to be increased. In line with the agenda of Phaseomics (an international consortium), work of expressed sequence tags (ESTs) generation from bean pods was initiated. Altogether, 5972 ESTs have been isolated. Alcohol dehydrogenase (AD) encoding gene cDNA was a noticeable transcript among the generated ESTs. This AD is an important enzyme; therefore, to understand more about it this study was undertaken. The objective of this study was to elucidate P. vulgaris L. AD (PvAD) gene cDNA sequence and to predict the three-dimensional (3D) structure of deduced protein. positive and negative strands of the PvAD cDNA clone were sequenced using M13 forward and M13 reverse primers to elucidate the nucleotide sequence. Deduced PvAD cDNA and protein sequence was analyzed for their basic features using online bioinformatics tools. Sequence comparison was carried out using bl2seq program, and tree-view program was used to construct a phylogenetic tree. The secondary structures and 3D structure of PvAD protein were predicted by using the PHYRE automatic fold recognition server. The sequencing results analysis showed that PvAD cDNA is 1294 bp in length. It's open reading frame encodes for a protein that contains 371 amino acids. Deduced protein sequence analysis showed the presence of putative substrate binding, catalytic Zn binding, and NAD binding sites. Results indicate that the predicted 3D structure of PvAD protein is analogous to the experimentally determined crystal structure of s-nitrosoglutathione reductase from an Arabidopsis species. The 1294 bp long PvAD cDNA encodes for 371 amino acid long protein that contains conserved domains required for biological functions of AD. The predicted deduced PvAD protein's 3D structure reflects the analogy with the crystal structure of Arabidopsis thaliana s-nitrosoglutathione reductase. Further study is required
Zseq: An Approach for Preprocessing Next-Generation Sequencing Data.
Alkhateeb, Abedalrhman; Rueda, Luis
2017-08-01
Next-generation sequencing technology generates a huge number of reads (short sequences), which contain a vast amount of genomic data. The sequencing process, however, comes with artifacts. Preprocessing of sequences is mandatory for further downstream analysis. We present Zseq, a linear method that identifies the most informative genomic sequences and reduces the number of biased sequences, sequence duplications, and ambiguous nucleotides. Zseq finds the complexity of the sequences by counting the number of unique k-mers in each sequence as its corresponding score and also takes into the account other factors such as ambiguous nucleotides or high GC-content percentage in k-mers. Based on a z-score threshold, Zseq sweeps through the sequences again and filters those with a z-score less than the user-defined threshold. Zseq algorithm is able to provide a better mapping rate; it reduces the number of ambiguous bases significantly in comparison with other methods. Evaluation of the filtered reads has been conducted by aligning the reads and assembling the transcripts using the reference genome as well as de novo assembly. The assembled transcripts show a better discriminative ability to separate cancer and normal samples in comparison with another state-of-the-art method. Moreover, de novo assembled transcripts from the reads filtered by Zseq have longer genomic sequences than other tested methods. Estimating the threshold of the cutoff point is introduced using labeling rules with optimistic results.
Subnanomole detection and quantitation of high specific activity 32P-nucleotides
International Nuclear Information System (INIS)
Coniglio, C.; Pappas, G.; Gill, W.J.; Kashdan, M.; Maniscalco, M.
1991-01-01
Microbore liquid chromatography utilizes conventional HPLC and ultraviolet detection principles to determine subnanomole mass quantities of biologically significant molecules. This system takes advantage of specifically designed microflow equipment to analyze ultraviolet absorbing species at the picomole range. 32P-labeled nucleotides are examples of compounds routinely used at picomole quantities that are extremely difficult to accurately quantify using standard mass measurement techniques. The procedure described in this paper has the capability of measuring nucleotides down to 10 pmol using commercially available microbore ultraviolet detection equipment. The technique can be used to accurately measure the specific activity of as little as 10 microCi of an aqueous 32P-nucleotide solution
Characterization of single nucleotide polymorphism markers for eelgrass (Zostera marina)
Ferber, Steven; Reusch, Thorsten B. H.; Stam, Wytze T.; Olsen, Jeanine L.
We characterized 37 single nucleotide polymorphism (SNP) makers for eelgrass Zostera marina. SNP markers were developed using existing EST (expressed sequence tag)-libraries to locate polymorphic loci and develop primers from the functional expressed genes that are deposited in The ZOSTERA database
Cloning and sequence analysis of cDNA coding for rat nucleolar protein C23
International Nuclear Information System (INIS)
Ghaffari, S.H.; Olson, M.O.J.
1986-01-01
Using synthetic oligonucleotides as primers and probes, the authors have isolated and sequenced cDNA clones encoding protein C23, a putative nucleolus organizer protein. Poly(A + ) RNA was isolated from rat Novikoff hepatoma cells and enriched in C23 mRNA by sucrose density gradient ultracentrifugation. Two deoxyoligonuleotides, a 48- and a 27-mer, were synthesized on the basis of amino acid sequence from the C-terminal half of protein C23 and cDNA sequence data from CHO cell protein. The 48-mer was used a primer for synthesis of cDNA which was then inserted into plasmid pUC9. Transformed bacterial colonies were screened by hybridization with 32 P labeled 27-mer. Two clones among 5000 gave a strong positive signal. Plasmid DNAs from these clones were purified and characterized by blotting and nucleotide sequence analysis. The length of C23 mRNA was estimated to be 3200 bases in a northern blot analysis. The sequence of a 267 b.p. insert shows high homology with the CHO cDNA with only 9 nucleotide differences and an identical amino acid sequence. These studies indicate that this region of the protein is highly conserved
Directory of Open Access Journals (Sweden)
Trout-Yakel Keri M
2010-02-01
Full Text Available Abstract Background A large, multi-province outbreak of listeriosis associated with ready-to-eat meat products contaminated with Listeria monocytogenes serotype 1/2a occurred in Canada in 2008. Subtyping of outbreak-associated isolates using pulsed-field gel electrophoresis (PFGE revealed two similar but distinct AscI PFGE patterns. High-throughput pyrosequencing of two L. monocytogenes isolates was used to rapidly provide the genome sequence of the primary outbreak strain and to investigate the extent of genetic diversity associated with a change of a single restriction enzyme fragment during PFGE. Results The chromosomes were collinear, but differences included 28 single nucleotide polymorphisms (SNPs and three indels, including a 33 kbp prophage that accounted for the observed difference in AscI PFGE patterns. The distribution of these traits was assessed within further clinical, environmental and food isolates associated with the outbreak, and this comparison indicated that three distinct, but highly related strains may have been involved in this nationwide outbreak. Notably, these two isolates were found to harbor a 50 kbp putative mobile genomic island encoding translocation and efflux functions that has not been observed in other Listeria genomes. Conclusions High-throughput genome sequencing provided a more detailed real-time assessment of genetic traits characteristic of the outbreak strains than could be achieved with routine subtyping methods. This study confirms that the latest generation of DNA sequencing technologies can be applied during high priority public health events, and laboratories need to prepare for this inevitability and assess how to properly analyze and interpret whole genome sequences in the context of molecular epidemiology.
Prioritizing single-nucleotide polymorphisms and variants associated with clinical mastitis
Directory of Open Access Journals (Sweden)
Suravajhala P
2017-06-01
Full Text Available Prashanth Suravajhala,1 Alfredo Benso2 1Department of Molecular Biology and Genetics, Center for Quantitative Genetics and Genomics, Aarhus University, Aarhus, Denmark; 2Department of Control and Computer Engineering, Politecnico di Torino, Torino, Italy Abstract: Next-generation sequencing technology has provided resources to easily explore and identify candidate single-nucleotide polymorphisms (SNPs and variants. However, there remains a challenge in identifying and inferring the causal SNPs from sequence data. A problem with different methods that predict the effect of mutations is that they produce false positives. In this hypothesis, we provide an overview of methods known for identifying causal variants and discuss the challenges, fallacies, and prospects in discerning candidate SNPs. We then propose a three-point classification strategy, which could be an additional annotation method in identifying causalities. Keywords: clinical mastitis, single-nucleotide polymorphisms, variants, associations, diseases, linkage disequilibrium, GWAS
: Hemoglobin-y gene of channel catfish , lctalurus punctatus, was cloned and sequenced . Total RNA from head kidneys was isolated, reverse transcribed and amplified . The sequence of the channel catfish hemoglobin-y gene consists of 600 nucleotides . Analysis of the nucleotide sequence reveals one o...
Sequence-based prediction of protein-binding sites in DNA: comparative study of two SVM models.
Park, Byungkyu; Im, Jinyong; Tuvshinjargal, Narankhuu; Lee, Wook; Han, Kyungsook
2014-11-01
As many structures of protein-DNA complexes have been known in the past years, several computational methods have been developed to predict DNA-binding sites in proteins. However, its inverse problem (i.e., predicting protein-binding sites in DNA) has received much less attention. One of the reasons is that the differences between the interaction propensities of nucleotides are much smaller than those between amino acids. Another reason is that DNA exhibits less diverse sequence patterns than protein. Therefore, predicting protein-binding DNA nucleotides is much harder than predicting DNA-binding amino acids. We computed the interaction propensity (IP) of nucleotide triplets with amino acids using an extensive dataset of protein-DNA complexes, and developed two support vector machine (SVM) models that predict protein-binding nucleotides from sequence data alone. One SVM model predicts protein-binding nucleotides using DNA sequence data alone, and the other SVM model predicts protein-binding nucleotides using both DNA and protein sequences. In a 10-fold cross-validation with 1519 DNA sequences, the SVM model that uses DNA sequence data only predicted protein-binding nucleotides with an accuracy of 67.0%, an F-measure of 67.1%, and a Matthews correlation coefficient (MCC) of 0.340. With an independent dataset of 181 DNAs that were not used in training, it achieved an accuracy of 66.2%, an F-measure 66.3% and a MCC of 0.324. Another SVM model that uses both DNA and protein sequences achieved an accuracy of 69.6%, an F-measure of 69.6%, and a MCC of 0.383 in a 10-fold cross-validation with 1519 DNA sequences and 859 protein sequences. With an independent dataset of 181 DNAs and 143 proteins, it showed an accuracy of 67.3%, an F-measure of 66.5% and a MCC of 0.329. Both in cross-validation and independent testing, the second SVM model that used both DNA and protein sequence data showed better performance than the first model that used DNA sequence data. To the best of
International Nuclear Information System (INIS)
Kuppuswamy, M.N.; Hoffmann, J.W.; Spitzer, S.G.; Groce, S.L.; Bajaj, S.P.; Kasper, C.K.
1991-01-01
In this report, the authors describe an approach to detect the presence of abnormal alleles in those genetic diseases in which frequency of occurrence of the same mutation is high (e.g., hemophilia B). Initially, from each subject, the DNA fragment containing the putative mutation site is amplified by the polymerase chain reaction. For each fragment two reaction mixtures are then prepared. Each contains the amplified fragment, a primer (18-mer or longer) whose sequence is identical to the coding sequence of the normal gene immediately flanking the 5' end of the mutation site, and either an α- 32 P-labeled nucleotide corresponding to the normal coding sequence at the mutation site or an α- 32 P-labeled nucleotide corresponding to the mutant sequence. An essential feature of the present methodology is that the base immediately 3' to the template-bound primer is one of those altered in the mutant, since in this way an extension of the primer by a single base will give an extended molecule characteristic of either the mutant or the wild type. The method is rapid and should be useful in carrier detection and prenatal diagnosis of every genetic disease with a known sequence variation
Allen, Alexandra M; Barker, Gary L A; Berry, Simon T; Coghill, Jane A; Gwilliam, Rhian; Kirby, Susan; Robinson, Phil; Brenchley, Rachel C; D'Amore, Rosalinda; McKenzie, Neil; Waite, Darren; Hall, Anthony; Bevan, Michael; Hall, Neil; Edwards, Keith J
2011-12-01
Food security is a global concern and substantial yield increases in cereal crops are required to feed the growing world population. Wheat is one of the three most important crops for human and livestock feed. However, the complexity of the genome coupled with a decline in genetic diversity within modern elite cultivars has hindered the application of marker-assisted selection (MAS) in breeding programmes. A crucial step in the successful application of MAS in breeding programmes is the development of cheap and easy to use molecular markers, such as single-nucleotide polymorphisms. To mine selected elite wheat germplasm for intervarietal single-nucleotide polymorphisms, we have used expressed sequence tags derived from public sequencing programmes and next-generation sequencing of normalized wheat complementary DNA libraries, in combination with a novel sequence alignment and assembly approach. Here, we describe the development and validation of a panel of 1114 single-nucleotide polymorphisms in hexaploid bread wheat using competitive allele-specific polymerase chain reaction genotyping technology. We report the genotyping results of these markers on 23 wheat varieties, selected to represent a broad cross-section of wheat germplasm including a number of elite UK varieties. Finally, we show that, using relatively simple technology, it is possible to rapidly generate a linkage map containing several hundred single-nucleotide polymorphism markers in the doubled haploid mapping population of Avalon × Cadenza. © 2011 The Authors. Plant Biotechnology Journal © 2011 Society for Experimental Biology, Association of Applied Biologists and Blackwell Publishing Ltd.
Nostoc PCC7524, a cyanobacterium which contains five sequence-specific deoxyribonucleases
Reaston, J.; Duybesteyn, M.G.C.; Waard, Adrian de
1982-01-01
Five nucleotide sequence-specific deoxyribonucleases present in cell-free extracts of the filamentous cyanobacterium Nostoc PCC7524 have been purified and characterized. One of these enzymes, designated Nsp(7524)I cleaves at a new kind of nucleotide sequence i.e. 5'-PuCATG λ Py-3'. The other four
Recurrence plot analysis of DNA sequences
Energy Technology Data Exchange (ETDEWEB)
Wu Zuobing [State Key Laboratory of Nonlinear Mechanics, Institute of Mechanics, Chinese Academy of Sciences, Beijing 100080 (China)]. E-mail: wuzb@lnm.imech.ac.cn
2004-11-15
Recurrence plot technique of DNA sequences is established on metric representation and employed to analyze correlation structure of nucleotide strings. It is found that, in the transference of nucleotide strings, a human DNA fragment has a major correlation distance, but a yeast chromosome's correlation distance has a constant increasing.
McMeel, O M; Hoey, E M; Ferguson, A
2001-01-01
The cDNA nucleotide sequences of the lactate dehydrogenase alleles LDH-C1*90 and *100 of brown trout (Salmo trutta) were found to differ at position 308 where an A is present in the *100 allele but a G is present in the *90 allele. This base substitution results in an amino acid change from aspartic acid at position 82 in the LDH-C1 100 allozyme to a glycine in the 90 allozyme. Since aspartic acid has a net negative charge whilst glycine is uncharged, this is consistent with the electrophoretic observation that the LDH-C1 100 allozyme has a more anodal mobility relative to the LDH-C1 90 allozyme. Based on alignment of the cDNA sequence with the mouse genomic sequence, a local primer set was designed, incorporating the variable position, and was found to give very good amplification with brown trout genomic DNA. Sequencing of this fragment confirmed the difference in both homozygous and heterozygous individuals. Digestion of the polymerase chain reaction products with BslI, a restriction enzyme specific for the site difference, gave one, two and three fragments for the two homozygotes and the heterozygote, respectively, following electrophoretic separation. This provides a DNA-based means of routine screening of the highly informative LDH-C1* polymorphism in brown trout population genetic studies. Primer sets presented could be used to sequence cDNA of other LDH* genes of brown trout and other species.
Hu, Jiazhi; Meyers, Robin M; Dong, Junchao; Panchakshari, Rohit A; Alt, Frederick W; Frock, Richard L
2016-05-01
Unbiased, high-throughput assays for detecting and quantifying DNA double-stranded breaks (DSBs) across the genome in mammalian cells will facilitate basic studies of the mechanisms that generate and repair endogenous DSBs. They will also enable more applied studies, such as those to evaluate the on- and off-target activities of engineered nucleases. Here we describe a linear amplification-mediated high-throughput genome-wide sequencing (LAM-HTGTS) method for the detection of genome-wide 'prey' DSBs via their translocation in cultured mammalian cells to a fixed 'bait' DSB. Bait-prey junctions are cloned directly from isolated genomic DNA using LAM-PCR and unidirectionally ligated to bridge adapters; subsequent PCR steps amplify the single-stranded DNA junction library in preparation for Illumina Miseq paired-end sequencing. A custom bioinformatics pipeline identifies prey sequences that contribute to junctions and maps them across the genome. LAM-HTGTS differs from related approaches because it detects a wide range of broken end structures with nucleotide-level resolution. Familiarity with nucleic acid methods and next-generation sequencing analysis is necessary for library generation and data interpretation. LAM-HTGTS assays are sensitive, reproducible, relatively inexpensive, scalable and straightforward to implement with a turnaround time of <1 week.
Four new single nucleotide polymorphisms (SNPs) of toll-like ...
African Journals Online (AJOL)
In order to reveal the single nucleotide polymorphisms (SNPs), genotypes and allelic frequencies of each mutation site of TLR7 gene in Chinese native duck breeds, SNPs of duck TLR7 gene were detected by DNA sequencing. The genotypes of 465 native ducks from eight key protected duck breeds were determined by ...
DEFF Research Database (Denmark)
Larsen, Lars Erik; Uttenthal, Åse; Arctander, P.
1998-01-01
on the nucleotide sequence of the G protein. These findings indicated that the previously established variabilities of the G protein of RS virus isolates were not attributable to mutations induced during the propagation of the virus. The reactivity of the Danish isolates with G protein-specific MAbs were similar......Danish isolates of bovine respiratory syncytial virus (BRSV) were characterised by nucleotide sequencing of the G glycoprotein and by their reactivity with a panel of monoclonal antibodies (MAbs). Among the six Danish isolates, the overall sequence divergence ranged between 0 and 3...... part of the G gene of additional 11 field BRSV viruses, processed directly from lung samples without prior adaption to cell culture growth. revealed sequence variabilities in the range obtained with the propagated virus. In addition, several passages in cell culture and in calves had no major impact...
Detection of a divergent variant of grapevine virus F by next-generation sequencing.
Molenaar, Nicholas; Burger, Johan T; Maree, Hans J
2015-08-01
The complete genome sequence of a South African isolate of grapevine virus F (GVF) is presented. It was first detected by metagenomic next-generation sequencing of field samples and validated through direct Sanger sequencing. The genome sequence of GVF isolate V5 consists of 7539 nucleotides and contains a poly(A) tail. It has a typical vitivirus genome arrangement that comprises five open reading frames (ORFs), which share only 88.96 % nucleotide sequence identity with the existing complete GVF genome sequence (JX105428).
Predicting protein-binding RNA nucleotides with consideration of binding partners.
Tuvshinjargal, Narankhuu; Lee, Wook; Park, Byungkyu; Han, Kyungsook
2015-06-01
In recent years several computational methods have been developed to predict RNA-binding sites in protein. Most of these methods do not consider interacting partners of a protein, so they predict the same RNA-binding sites for a given protein sequence even if the protein binds to different RNAs. Unlike the problem of predicting RNA-binding sites in protein, the problem of predicting protein-binding sites in RNA has received little attention mainly because it is much more difficult and shows a lower accuracy on average. In our previous study, we developed a method that predicts protein-binding nucleotides from an RNA sequence. In an effort to improve the prediction accuracy and usefulness of the previous method, we developed a new method that uses both RNA and protein sequence data. In this study, we identified effective features of RNA and protein molecules and developed a new support vector machine (SVM) model to predict protein-binding nucleotides from RNA and protein sequence data. The new model that used both protein and RNA sequence data achieved a sensitivity of 86.5%, a specificity of 86.2%, a positive predictive value (PPV) of 72.6%, a negative predictive value (NPV) of 93.8% and Matthews correlation coefficient (MCC) of 0.69 in a 10-fold cross validation; it achieved a sensitivity of 58.8%, a specificity of 87.4%, a PPV of 65.1%, a NPV of 84.2% and MCC of 0.48 in independent testing. For comparative purpose, we built another prediction model that used RNA sequence data alone and ran it on the same dataset. In a 10 fold-cross validation it achieved a sensitivity of 85.7%, a specificity of 80.5%, a PPV of 67.7%, a NPV of 92.2% and MCC of 0.63; in independent testing it achieved a sensitivity of 67.7%, a specificity of 78.8%, a PPV of 57.6%, a NPV of 85.2% and MCC of 0.45. In both cross-validations and independent testing, the new model that used both RNA and protein sequences showed a better performance than the model that used RNA sequence data alone in
FALDO: a semantic standard for describing the location of nucleotide and protein feature annotation.
Bolleman, Jerven T; Mungall, Christopher J; Strozzi, Francesco; Baran, Joachim; Dumontier, Michel; Bonnal, Raoul J P; Buels, Robert; Hoehndorf, Robert; Fujisawa, Takatomo; Katayama, Toshiaki; Cock, Peter J A
2016-06-13
Nucleotide and protein sequence feature annotations are essential to understand biology on the genomic, transcriptomic, and proteomic level. Using Semantic Web technologies to query biological annotations, there was no standard that described this potentially complex location information as subject-predicate-object triples. We have developed an ontology, the Feature Annotation Location Description Ontology (FALDO), to describe the positions of annotated features on linear and circular sequences. FALDO can be used to describe nucleotide features in sequence records, protein annotations, and glycan binding sites, among other features in coordinate systems of the aforementioned "omics" areas. Using the same data format to represent sequence positions that are independent of file formats allows us to integrate sequence data from multiple sources and data types. The genome browser JBrowse is used to demonstrate accessing multiple SPARQL endpoints to display genomic feature annotations, as well as protein annotations from UniProt mapped to genomic locations. Our ontology allows users to uniformly describe - and potentially merge - sequence annotations from multiple sources. Data sources using FALDO can prospectively be retrieved using federalised SPARQL queries against public SPARQL endpoints and/or local private triple stores.
Manivannan, Abinaya; Kim, Jin-Hee; Yang, Eun-Young; Ahn, Yul-Kyun; Lee, Eun-Su; Choi, Sena; Kim, Do-Sun
2018-01-01
Pepper is an economically important horticultural plant that has been widely used for its pungency and spicy taste in worldwide cuisines. Therefore, the domestication of pepper has been carried out since antiquity. Owing to meet the growing demand for pepper with high quality, organoleptic property, nutraceutical contents, and disease tolerance, genomics assisted breeding techniques can be incorporated to develop novel pepper varieties with desired traits. The application of next-generation sequencing (NGS) approaches has reformed the plant breeding technology especially in the area of molecular marker assisted breeding. The availability of genomic information aids in the deeper understanding of several molecular mechanisms behind the vital physiological processes. In addition, the NGS methods facilitate the genome-wide discovery of DNA based markers linked to key genes involved in important biological phenomenon. Among the molecular markers, single nucleotide polymorphism (SNP) indulges various benefits in comparison with other existing DNA based markers. The present review concentrates on the impact of NGS approaches in the discovery of useful SNP markers associated with pungency and disease resistance in pepper. The information provided in the current endeavor can be utilized for the betterment of pepper breeding in future.
Directory of Open Access Journals (Sweden)
Abinaya Manivannan
2018-01-01
Full Text Available Pepper is an economically important horticultural plant that has been widely used for its pungency and spicy taste in worldwide cuisines. Therefore, the domestication of pepper has been carried out since antiquity. Owing to meet the growing demand for pepper with high quality, organoleptic property, nutraceutical contents, and disease tolerance, genomics assisted breeding techniques can be incorporated to develop novel pepper varieties with desired traits. The application of next-generation sequencing (NGS approaches has reformed the plant breeding technology especially in the area of molecular marker assisted breeding. The availability of genomic information aids in the deeper understanding of several molecular mechanisms behind the vital physiological processes. In addition, the NGS methods facilitate the genome-wide discovery of DNA based markers linked to key genes involved in important biological phenomenon. Among the molecular markers, single nucleotide polymorphism (SNP indulges various benefits in comparison with other existing DNA based markers. The present review concentrates on the impact of NGS approaches in the discovery of useful SNP markers associated with pungency and disease resistance in pepper. The information provided in the current endeavor can be utilized for the betterment of pepper breeding in future.
Molecular cloning and sequencing analysis of the interferon receptor (IFNAR-1) from Columba livia.
Li, Chao; Chang, Wei Shan
2014-01-01
Partial sequence cloning of interferon receptor (IFNAR-1) of Columba livia. In order to obtain a certain length (630 bp) of gene, a pair of primers was designed according to the conserved nucleotide sequence of Gallus (EU477527.1) and Taeniopygia guttata (XM_002189232.1) IFNAR-1 gene fragment that was published by GenBank. Special primers were designed by the Race method to amplify the 3'terminal cDNA. The Columba livia IFNAR-1 displayed 88.5%, 80.5% and 73.8% nucleotide identity to Falco peregrinus, Gallus and Taeniopygia guttata, respectively. Phylogenetic analysis of the IFNAR1 gene showed that the relationship of Columba livia, Falco peregrinus and chicken had high homology. We successfully obtained a Columba livia IFNAR-1 gene partial sequence. Analysis of the genetic tree showed that the relationship of Columba livia and Falco peregrinus IFNAR-1 had high homology. This result can be used as reference for further research and practical application.
Mapping RNA Structure In Vitro with SHAPE Chemistry and Next-Generation Sequencing (SHAPE-Seq).
Watters, Kyle E; Lucks, Julius B
2016-01-01
Mapping RNA structure with selective 2'-hydroxyl acylation analyzed by primer extension (SHAPE) chemistry has proven to be a versatile method for characterizing RNA structure in a variety of contexts. SHAPE reagents covalently modify RNAs in a structure-dependent manner to create adducts at the 2'-OH group of the ribose backbone at nucleotides that are structurally flexible. The positions of these adducts are detected using reverse transcriptase (RT) primer extension, which stops one nucleotide before the modification, to create a pool of cDNAs whose lengths reflect the location of SHAPE modification. Quantification of the cDNA pools is used to estimate the "reactivity" of each nucleotide in an RNA molecule to the SHAPE reagent. High reactivities indicate nucleotides that are structurally flexible, while low reactivities indicate nucleotides that are inflexible. These SHAPE reactivities can then be used to infer RNA structures by restraining RNA structure prediction algorithms. Here, we provide a state-of-the-art protocol describing how to perform in vitro RNA structure probing with SHAPE chemistry using next-generation sequencing to quantify cDNA pools and estimate reactivities (SHAPE-Seq). The use of next-generation sequencing allows for higher throughput, more consistent data analysis, and multiplexing capabilities. The technique described herein, SHAPE-Seq v2.0, uses a universal reverse transcription priming site that is ligated to the RNA after SHAPE modification. The introduced priming site allows for the structural analysis of an RNA independent of its sequence.
Canovas, Fernando; Mota, Catarina; Ferreira-Costa, Joana; Serrao, Ester; Coyer, Jim; Olsen, Jeanine; Pearson, Gareth
2011-01-01
We characterized 35 single nucleotide polymorphism (SNP) markers for the brown alga Fucus vesiculosus. Based on existing Fucus Expressed Sequence Tag libraries for heat and desiccation-stressed tissue, SNPs were developed and confirmed by re-sequencing cDNA from a diverse panel of individuals. SNP
The Pinus taeda genome is characterized by diverse and highly diverged repetitive sequences
Directory of Open Access Journals (Sweden)
Yandell Mark
2010-07-01
Full Text Available Abstract Background In today's age of genomic discovery, no attempt has been made to comprehensively sequence a gymnosperm genome. The largest genus in the coniferous family Pinaceae is Pinus, whose 110-120 species have extremely large genomes (c. 20-40 Gb, 2N = 24. The size and complexity of these genomes have prompted much speculation as to the feasibility of completing a conifer genome sequence. Conifer genomes are reputed to be highly repetitive, but there is little information available on the nature and identity of repetitive units in gymnosperms. The pines have extensive genetic resources, with approximately 329000 ESTs from eleven species and genetic maps in eight species, including a dense genetic map of the twelve linkage groups in Pinus taeda. Results We present here the Sanger sequence and annotation of ten P. taeda BAC clones and Genome Analyzer II whole genome shotgun (WGS sequences representing 7.5% of the genome. Computational annotation of ten BACs predicts three putative protein-coding genes and at least fifteen likely pseudogenes in nearly one megabase of sequence. We found three conifer-specific LTR retroelements in the BACs, and tentatively identified at least 15 others based on evidence from the distantly related angiosperms. Alignment of WGS sequences to the BACs indicates that 80% of BAC sequences have similar copies (≥ 75% nucleotide identity elsewhere in the genome, but only 23% have identical copies (99% identity. The three most common repetitive elements in the genome were identified and, when combined, represent less than 5% of the genome. Conclusions This study indicates that the majority of repeats in the P. taeda genome are 'novel' and will therefore require additional BAC or genomic sequencing for accurate characterization. The pine genome contains a very large number of diverged and probably defunct repetitive elements. This study also provides new evidence that sequencing a pine genome using a WGS approach is
Molecular cloning and nucleotide sequence of cDNA for human liver arginase
International Nuclear Information System (INIS)
Haraguchi, Y.; Takiguchi, M.; Amaya, Y.; Kawamoto, S.; Matsuda, I.; Mori, M.
1987-01-01
Arginase (EC3.5.3.1) catalyzes the last step of the urea cycle in the liver of ureotelic animals. Inherited deficiency of the enzyme results in argininemia, an autosomal recessive disorder characterized by hyperammonemia. To facilitate investigation of the enzyme and gene structures and to elucidate the nature of the mutation in argininemia, the authors isolated cDNA clones for human liver arginase. Oligo(dT)-primed and random primer human liver cDNA libraries in λ gt11 were screened using isolated rat arginase cDNA as a probe. Two of the positive clones, designated λ hARG6 and λ hARG109, contained an overlapping cDNA sequence with an open reading frame encoding a polypeptide of 322 amino acid residues (predicted M/sub r/, 34,732), a 5'-untranslated sequence of 56 base pairs, a 3'-untranslated sequence of 423 base pairs, and a poly(A) segment. Arginase activity was detected in Escherichia coli cells transformed with the plasmid carrying λ hARG6 cDNA insert. RNA gel blot analysis of human liver RNA showed a single mRNA of 1.6 kilobases. The predicted amino acid sequence of human liver arginase is 87% and 41% identical with those of the rat liver and yeast enzymes, respectively. There are several highly conserved segments among the human, rat, and yeast enzymes
International Nuclear Information System (INIS)
Siebert, P.D.; Fukuda, M.
1986-01-01
In an effort to understand the relationships among and the regulation of human glycophorins, the authors have isolated and characterized several glycophorin A-specific cDNA clones obtained from a human erythroleukemic K562 cell cDNA library. This was accomplished by using mixed synthetic oligonucleotides, corresponding to various regions of the known amino acid sequence, to prime the synthesis of the cDNA as well as to screen the cDNA library. They also used synthetic oligonucleotides to sequence the largest of the glycophorin cDNAs. The nucleotide sequence obtained suggests the presence of a potential leader peptide, consistent with the membrane localization of this glycoprotein. Examination of the structure of glycophorin mRNA by blot hybridization revealed the existence of several electrophoretically distinct mRNAs numbering three or four, depending on the size of the glycophorin cDNA used as a hybridization probe. The smaller cDNA hybridized to three mRNAs of approximately 2.8, 1.7, and 1.0 kilobases. In contrast, the larger cDNA hybridized to an additional mRNA of approximately 0.6 kilobases. Further examination of the relationships between these multiple mRNAs by blot hybridization was conducted with the use of exact-sequence oligonucleotide probes constructed from various regions of the cDNA representing portions of the amino acid sequence of glycophorin A with or without known homology with glycophorin B. In total, the results obtained are consistent with the hypothesis that the three larger mRNAs represent glycophorin A gene transcripts and that the smallest (0.6 kilobase) mRNA may be specific for glycophorin B
Sequence dependence of electron-induced DNA strand breakage revealed by DNA nanoarrays
DEFF Research Database (Denmark)
Keller, Adrian; Rackwitz, Jenny; Cauët, Emilie
2014-01-01
The electronic structure of DNA is determined by its nucleotide sequence, which is for instance exploited in molecular electronics. Here we demonstrate that also the DNA strand breakage induced by low-energy electrons (18 eV) depends on the nucleotide sequence. To determine the absolute cross sec...
Single nucleotide polymorphism discovery in bovine liver using RNA-seq technology
DEFF Research Database (Denmark)
Pareek, Chandra Shekhar; Błaszczyk, Paweł; Dziuba, Piotr
2017-01-01
Background RNA-seq is a useful next-generation sequencing (NGS) technology that has been widely used to understand mammalian transcriptome architecture and function. In this study, a breed-specific RNA-seq experiment was utilized to detect putative single nucleotide polymorphisms (SNPs) in liver...
Kim, Min Jung; Hwang, Kyung Hwan; Lee, Young-Seok; Park, Jae-Yoon; Kook, Joong-Ki
2011-03-01
The aim of this study was to develop Prevotella intermedia-specific PCR primers based on the P. intermedia-specific DNA probe. The P. intermedia-specific DNA probe was screened by inverted dot blot hybridization and confirmed by Southern blot hybridization. The nucleotide sequences of the species-specific DNA probes were determined using a chain termination method. Southern blot analysis showed that the DNA probe, Pig27, detected only the genomic DNA of P. intermedia strains. PCR showed that the PCR primers, Pin-F1/Pin-R1, had species-specificity for P. intermedia. The detection limits of the PCR primer sets were 0.4pg of the purified genomic DNA of P. intermedia ATCC 49046. These results suggest that the PCR primers, Pin-F1/Pin-R1, could be useful in the detection of P. intermedia as well as in the development of a PCR kit in epidemiological studies related to periodontal diseases. Crown Copyright © 2010. Published by Elsevier B.V. All rights reserved.
Single nucleotide polymorphism discovery from expressed sequence tags in the waterflea Daphnia magna
Directory of Open Access Journals (Sweden)
Souche Erika L
2011-06-01
Full Text Available Abstract Background Daphnia (Crustacea: Cladocera plays a central role in standing aquatic ecosystems, has a well known ecology and is widely used in population studies and environmental risk assessments. Daphnia magna is, especially in Europe, intensively used to study stress responses of natural populations to pollutants, climate change, and antagonistic interactions with predators and parasites, which have all been demonstrated to induce micro-evolutionary and adaptive responses. Although its ecology and evolutionary biology is intensively studied, little is known on the functional genomics underpinning of phenotypic responses to environmental stressors. The aim of the present study was to find genes expressed in presence of environmental stressors, and target such genes for single nucleotide polymorphic (SNP marker development. Results We developed three expressed sequence tag (EST libraries using clonal lineages of D. magna exposed to ecological stressors, namely fish predation, parasite infection and pesticide exposure. We used these newly developed ESTs and other Daphnia ESTs retrieved from NCBI GeneBank to mine for SNP markers targeting synonymous as well as non synonymous genetic variation. We validate the developed SNPs in six natural populations of D. magna distributed at regional scale. Conclusions A large proportion (47% of the produced ESTs are Daphnia lineage specific genes, which are potentially involved in responses to environmental stress rather than to general cellular functions and metabolic activities, or reflect the arthropod's aquatic lifestyle. The characterization of genes expressed under stress and the validation of their SNPs for population genetic study is important for identifying ecologically responsive genes in D. magna.
Ha, Wai Y; Reid, David G; Kam, Wan L; Lau, Yuk Y; Sham, Wing C; Tam, Silvia Y K; Sin, Della W M; Mok, Chuen S
2011-05-25
Abalones ( Haliotis species) are a popular delicacy and commonly preserved in dried form either whole or in slices or small pieces for consumption in Asian countries. Driven by the huge profit from trading abalones, dishonest traders may substitute other molluscan species for processed abalone, of which the morphological characteristics are frequently lost in the processed form. For protection of consumer rights and law enforcement against fraud, there is a need for an effective methodology to differentiate between fake and genuine abalone. This paper describes a method (validated according to the international forensic guidelines provided by SWGDAM) for the identification of fake abalone species using forensically informative nucleotide sequence (FINS) analysis. A study of the local market revealed that many claimed "abalone slice" samples on sale are not genuine. The fake abalone samples were found to be either volutids of the genus Cymbium (93%) or the muricid Concholepas concholepas (7%). This is the first report of Cymbium species being used for the preparation and sale as "abalone" in dried sliced form in Hong Kong.
Nucleotide sequence of a human tRNA gene heterocluster
International Nuclear Information System (INIS)
Chang, Y.N.; Pirtle, I.L.; Pirtle, R.M.
1986-01-01
Leucine tRNA from bovine liver was used as a hybridization probe to screen a human gene library harbored in Charon-4A of bacteriophage lambda. The human DNA inserts from plaque-pure clones were characterized by restriction endonuclease mapping and Southern hybridization techniques, using both [3'- 32 P]-labeled bovine liver leucine tRNA and total tRNA as hybridization probes. An 8-kb Hind III fragment of one of these γ-clones was subcloned into the Hind III site of pBR322. Subsequent fine restriction mapping and DNA sequence analysis of this plasmid DNA indicated the presence of four tRNA genes within the 8-kb DNA fragment. A leucine tRNA gene with an anticodon of AAG and a proline tRNA gene with an anticodon of AGG are in a 1.6-kb subfragment. A threonine tRNA gene with an anticodon of UGU and an as yet unidentified tRNA gene are located in a 1.1-kb subfragment. These two different subfragments are separated by 2.8 kb. The coding regions of the three sequenced genes contain characteristic internal split promoter sequences and do not have intervening sequences. The 3'-flanking region of these three genes have typical RNA polymerase III termination sites of at least four consecutive T residues
Sequencing and phylogenetic analysis of tobacco virus 2, a polerovirus from Nicotiana tabacum.
Zhou, Benguo; Wang, Fang; Zhang, Xuesong; Zhang, Lina; Lin, Huafeng
2017-07-01
The complete genome sequence of a new virus, provisionally named tobacco virus 2 (TV2), was determined and identified from leaves of tobacco (Nicotiana tabacum) exhibiting leaf mosaic, yellowing, and deformity, in Anhui Province, China. The genome sequence of TV2 comprises 5,979 nucleotides, with 87% nucleotide sequence identity to potato leafroll virus (PLRV). Its genome organization is similar to that of PLRV, containing six open reading frames (ORFs) that potentially encode proteins with putative functions in cell-to-cell movement and suppression of RNA silencing. Phylogenetic analysis of the nucleotide sequence placed TV2 alongside members of the genus Polerovirus in the family Luteoviridae. To the best our knowledge, this study is the first report of a complete genome sequence of a new polerovirus identified in tobacco.
Gritsun, T S; Frolova, T V; Pogodina, V V; Lashkevich, V A; Venugopal, K; Gould, E A
1993-02-01
A strain of tick-borne encephalitis virus known as Vasilchenko (Vs) exhibits relatively low virulence characteristics in monkeys, Syrian hamsters and humans. The gene encoding the envelope glycoprotein of this virus was cloned and sequenced. Alignment of the sequence with those of other known tick-borne flaviviruses and identification of the recognised amino acid genetic marker EHLPTA confirmed its identity as a member of the TBE complex. However, Vs virus was distinguishable from eastern and western tick-borne serotypes by the presence of the sequence AQQ at amino acid positions 232-234 and also by the presence of other specific amino acid substitutions which may be genetic markers for these viruses and could determine their pathogenetic characteristics. When compared with other tick-borne flaviviruses, Vs virus had 12 unique amino acid substitutions including an additional potential glycosylation site at position (315-317). The Vs virus strain shared closest nucleotide and amino acid homology (84.5% and 95.5% respectively) with western and far eastern strains of tick-borne encephalitis virus. Comparison with the far eastern serotype of tick-borne encephalitis virus, by cross-immunoelectrophoresis of Vs virions and PAGE analysis of the extracted virion proteins, revealed differences in surface charge and virus stability that may account for the different virulence characteristics of Vs virus. These results support and enlarge upon previous data obtained from molecular and serological analysis.
High resolution sequence stratigraphy in China
International Nuclear Information System (INIS)
Zhang Shangfeng; Zhang Changmin; Yin Yanshi; Yin Taiju
2008-01-01
Since high resolution sequence stratigraphy was introduced into China by DENG Hong-wen in 1995, it has been experienced two development stages in China which are the beginning stage of theory research and development of theory research and application, and the stage of theoretical maturity and widely application that is going into. It is proved by practices that high resolution sequence stratigraphy plays more and more important roles in the exploration and development of oil and gas in Chinese continental oil-bearing basin and the research field spreads to the exploration of coal mine, uranium mine and other strata deposits. However, the theory of high resolution sequence stratigraphy still has some shortages, it should be improved in many aspects. The authors point out that high resolution sequence stratigraphy should be characterized quantitatively and modelized by computer techniques. (authors)
BlockLogo: Visualization of peptide and sequence motif conservation
DEFF Research Database (Denmark)
Olsen, Lars Rønn; Kudahl, Ulrich Johan; Simon, Christian
2013-01-01
BlockLogo is a web-server application for the visualization of protein and nucleotide fragments, continuous protein sequence motifs, and discontinuous sequence motifs using calculation of block entropy from multiple sequence alignments. The user input consists of a multiple sequence alignment, se...
Brandon Schlautman; Vera Pfeiffer; Juan Zalapa; Johanne Brunet
2014-01-01
Numerous microsatellite markers were developed for Aquilegia formosafrom sequences deposited within the Expressed Sequence Tag (EST), Genomic Survey Sequence (GSS), and Nucleotide databases in NCBI. Microsatellites (SSRs) were identified and primers were designed for 9 SSR containing sequences in the Nucleotide database, 3803 sequences in the EST...
Brown, Allan F; Yousef, Gad G; Chebrolu, Kranthi K; Byrd, Robert W; Everhart, Koyt W; Thomas, Aswathy; Reid, Robert W; Parkin, Isobel A P; Sharpe, Andrew G; Oliver, Rebekah; Guzman, Ivette; Jackson, Eric W
2014-09-01
A high-resolution genetic linkage map of B. oleracea was developed from a B. napus SNP array. The work will facilitate genetic and evolutionary studies in Brassicaceae. A broccoli population, VI-158 × BNC, consisting of 150 F2:3 families was used to create a saturated Brassica oleracea (diploid: CC) linkage map using a recently developed rapeseed (Brassica napus) (tetraploid: AACC) Illumina Infinium single nucleotide polymorphism (SNP) array. The map consisted of 547 non-redundant SNP markers spanning 948.1 cM across nine chromosomes with an average interval size of 1.7 cM. As the SNPs are anchored to the genomic reference sequence of the rapid cycling B. oleracea TO1000, we were able to estimate that the map provides 96 % coverage of the diploid genome. Carotenoid analysis of 2 years data identified 3 QTLs on two chromosomes that are associated with up to half of the phenotypic variation associated with the accumulation of total or individual compounds. By searching the genome sequences of the two related diploid species (B. oleracea and B. rapa), we further identified putative carotenoid candidate genes in the region of these QTLs. This is the first description of the use of a B. napus SNP array to rapidly construct high-density genetic linkage maps of one of the constituent diploid species. The unambiguous nature of these markers with regard to genomic sequences provides evidence to the nature of genes underlying the QTL, and demonstrates the value and impact this resource will have on Brassica research.
International Nuclear Information System (INIS)
Xiong Gang; Wang, X.R.
2005-01-01
The zero-temperature transmission rate spectrum of a double-chain tight-binding model for real DNA is calculated. It is shown that a band of extended-like states exists only for finite chain length with strong inter-chain coupling. While the whole spectrum tends to zero in thermodynamic limit, regardless of the strength of inter-chain coupling. It is also shown that a more faithful model for real DNA with periodic sugar-phosphate chains in backbone structures can be mapped into the above simple double-chain tight-binding model. Combined with above results, the transmission rate of real DNA with long random sequence of nucleotides is expected to be poor
Directory of Open Access Journals (Sweden)
Desirée Villahermosa
2017-05-01
Full Text Available Defective mismatch repair (MMR in humans is associated with colon cancer and instability of microsatellites, that is, DNA sequences with one or several nucleotides repeated. Key factors of eukaryotic MMR are the heterodimers MutSα (Msh2-Msh6, which recognizes base-base mismatches and unpaired nucleotides in DNA, and MutLα (Mlh1-Pms1, which facilitates downstream steps. In addition, MutSβ (Msh2-Msh3 recognizes DNA loops of various sizes, although our previous data and the data presented here suggest that Msh3 of Schizosaccharomyces pombe does not play a role in MMR. To test microsatellite stability in S. pombe and hence DNA loop repair, we have inserted tetra-, penta-, and hepta-nucleotide repeats in the ade6 gene and determined their Ade+ reversion rates and spectra in wild type and various mutants. Our data indicate that loops with four unpaired nucleotides in the nascent and the template strand are the upper limit of MutSα- and MutLα-mediated MMR in S. pombe. Stability of hepta-nucleotide repeats requires Msh3 and Exo1 in MMR-independent processes as well as the DNA repair proteins Rad50, Rad51, and Rad2FEN1. Most strikingly, mutation rates in the double mutants msh3 exo1 and msh3 rad51 were decreased when compared to respective single mutants, indicating that Msh3 prevents error prone processes carried out by Exo1 and Rad51. We conclude that Msh3 has no obvious function in MMR in S. pombe, but contributes to DNA repeat stability in MMR-independent processes.
Differentiation of sheep pox and goat poxviruses by sequence analysis and PCR-RFLP of P32 gene.
Hosamani, Madhusudan; Mondal, Bimalendu; Tembhurne, Prabhakar A; Bandyopadhyay, Santanu Kumar; Singh, Raj Kumar; Rasool, Thaha Jamal
2004-08-01
Sheep pox and Goat pox are highly contagious viral diseases of small ruminants. These diseases were earlier thought to be caused by a single species of virus, as they are serologically indistinguishable. P32, one of the major immunogenic genes of Capripoxvirus, was isolated and Sequenced from two Indian isolates of goat poxvirus (GPV) and a vaccine strain of sheep poxvirus (SPV). The sequences were compared with other P32 sequences of capripoxviruses available in the database. Sequence analysis revealed that sheep pox and goat poxviruses share 97.5 and 94.7% homology at nucleotide and amino acid level, respectively. A major difference between them is the presence of an additional aspartic acid at 55th position of P32 of sheep poxvirus that is absent in both goat poxvirus and lumpy skin disease virus. Further, six unique neutral nucleotide substitutions were observed at positions 77, 275, 403, 552, 867 and 964 in the sequence of goat poxvirus, which can be taken as GPV signature residues. Similar unique nucleotide signatures could be identified in SPV and LSDV sequences also. Phylogenetic analysis showed that members of the Capripoxvirus could be delineated into three distinct clusters of GPV, SPV and LSDV based on the P32 genomic sequence. Using this information, a PCR-RFLP method has been developed for unequivocal genomic differentiation of SPV and GPV.
The complete nucleotide sequence, genome organization, and origin of human adenovirus type 11
International Nuclear Information System (INIS)
Stone, Daniel; Furthmann, Anne; Sandig, Volker; Lieber, Andre
2003-01-01
The complete DNA sequence and transcription map of human adenovirus type 11 are reported here. This is the first published sequence for a subgenera B human adenovirus and demonstrates a genome organization highly similar to those of other human adenoviruses. All of the genes from the early, intermediate, and late regions are present in the expected locations of the genome for a human adenovirus. The genome size is 34,794 bp in length and has a GC content of 48.9%. Sequence alignment with genomes of groups A (Ad12), C (Ad5), D (Ad17), E (Simian adenovirus 25), and F (Ad40) revealed homologies of 64, 54, 68, 75, and 52%, respectively. Detailed genomic analysis demonstrated that Ads 11 and 35 are highly conserved in all areas except the hexon hypervariable regions and fiber. Similarly, comparison of Ad11 with subgroup E SAV25 revealed poor homology between fibers but high homology in proteins encoded by all other areas of the genome. We propose an evolutionary model in which functional viruses can be reconstituted following fiber substitution from one serotype to another. According to this model either the Ad11 genome is a derivative of Ad35, from which the fiber was substituted with Ad7, or the Ad35 genome is the product of a fiber substitution from Ad21 into the Ad11 genome. This model also provides a possible explanation for the origin of group E Ads, which are evolutionarily derived from a group C fiber substitution into a group B genome
BOOGIE: Predicting Blood Groups from High Throughput Sequencing Data.
Giollo, Manuel; Minervini, Giovanni; Scalzotto, Marta; Leonardi, Emanuela; Ferrari, Carlo; Tosatto, Silvio C E
2015-01-01
Over the last decade, we have witnessed an incredible growth in the amount of available genotype data due to high throughput sequencing (HTS) techniques. This information may be used to predict phenotypes of medical relevance, and pave the way towards personalized medicine. Blood phenotypes (e.g. ABO and Rh) are a purely genetic trait that has been extensively studied for decades, with currently over thirty known blood groups. Given the public availability of blood group data, it is of interest to predict these phenotypes from HTS data which may translate into more accurate blood typing in clinical practice. Here we propose BOOGIE, a fast predictor for the inference of blood groups from single nucleotide variant (SNV) databases. We focus on the prediction of thirty blood groups ranging from the well known ABO and Rh, to the less studied Junior or Diego. BOOGIE correctly predicted the blood group with 94% accuracy for the Personal Genome Project whole genome profiles where good quality SNV annotation was available. Additionally, our tool produces a high quality haplotype phase, which is of interest in the context of ethnicity-specific polymorphisms or traits. The versatility and simplicity of the analysis make it easily interpretable and allow easy extension of the protocol towards other phenotypes. BOOGIE can be downloaded from URL http://protein.bio.unipd.it/download/.
Directory of Open Access Journals (Sweden)
Arthur W Pightling
Full Text Available The wide availability of whole-genome sequencing (WGS and an abundance of open-source software have made detection of single-nucleotide polymorphisms (SNPs in bacterial genomes an increasingly accessible and effective tool for comparative analyses. Thus, ensuring that real nucleotide differences between genomes (i.e., true SNPs are detected at high rates and that the influences of errors (such as false positive SNPs, ambiguously called sites, and gaps are mitigated is of utmost importance. The choices researchers make regarding the generation and analysis of WGS data can greatly influence the accuracy of short-read sequence alignments and, therefore, the efficacy of such experiments. We studied the effects of some of these choices, including: i depth of sequencing coverage, ii choice of reference-guided short-read sequence assembler, iii choice of reference genome, and iv whether to perform read-quality filtering and trimming, on our ability to detect true SNPs and on the frequencies of errors. We performed benchmarking experiments, during which we assembled simulated and real Listeria monocytogenes strain 08-5578 short-read sequence datasets of varying quality with four commonly used assemblers (BWA, MOSAIK, Novoalign, and SMALT, using reference genomes of varying genetic distances, and with or without read pre-processing (i.e., quality filtering and trimming. We found that assemblies of at least 50-fold coverage provided the most accurate results. In addition, MOSAIK yielded the fewest errors when reads were aligned to a nearly identical reference genome, while using SMALT to align reads against a reference sequence that is ∼0.82% distant from 08-5578 at the nucleotide level resulted in the detection of the greatest numbers of true SNPs and the fewest errors. Finally, we show that whether read pre-processing improves SNP detection depends upon the choice of reference sequence and assembler. In total, this study demonstrates that researchers
Directory of Open Access Journals (Sweden)
L.G. Mamonova
2007-01-01
Full Text Available The article reviews the application of nucleotides-metabolites, playing a key role in many biological processes, for the infant feeding. The researcher provides the date on the nucleotides in the women's milk according to the lactation stages. She also analyzes the foreign experience in feeding newborns with nucleotides-containing milk formulas. The article gives a comparison of nucleotides in the adapted formulas represented in the domestic market of the given products.Key words: children, feeding, nucleotides.
Paleogenomics in a temperate environment: shotgun sequencing from an extinct Mediterranean caprine.
Directory of Open Access Journals (Sweden)
Oscar Ramírez
Full Text Available BACKGROUND: Numerous endemic mammals, including dwarf elephants, goats, hippos and deers, evolved in isolation in the Mediterranean islands during the Pliocene and Pleistocene. Most of them subsequently became extinct during the Holocene. Recently developed high-throughput sequencing technologies could provide a unique tool for retrieving genomic data from these extinct species, making it possible to study their evolutionary history and the genetic bases underlying their particular, sometimes unique, adaptations. METHODOLOGY/PRINCIPALS FINDINGS: A DNA extraction of a approximately 6,000 year-old bone sample from an extinct caprine (Myotragus balearicus from the Balearic Islands in the Western Mediterranean, has been subjected to shotgun sequencing with the GS FLX 454 platform. Only 0.27% of the resulting sequences, identified from alignments with the cow genome and comprising 15,832 nucleotides, with an average length of 60 nucleotides, proved to be endogenous. CONCLUSIONS: A phylogenetic tree generated with Myotragus sequences and those from other artiodactyls displays an identical topology to that generated from mitochondrial DNA data. Despite being in an unfavourable thermal environment, which explains the low yield of endogenous sequences, our study demonstrates that it is possible to obtain genomic data from extinct species from temperate regions.
Spontaneous preterm birth and single nucleotide gene polymorphisms: a recent update.
Sheikh, Ishfaq A; Ahmad, Ejaz; Jamal, Mohammad S; Rehan, Mohd; Assidi, Mourad; Tayubi, Iftikhar A; AlBasri, Samera F; Bajouh, Osama S; Turki, Rola F; Abuzenadah, Adel M; Damanhouri, Ghazi A; Beg, Mohd A; Al-Qahtani, Mohammed
2016-10-17
Preterm birth (PTB), birth at PTBs are spontaneous with about a half without any apparent cause and the other half associated with a number of risk factors. Genetic factors are one of the significant risks for PTB. The focus of this review is on single nucleotide gene polymorphisms (SNPs) that are reported to be associated with PTB. A comprehensive evaluation of studies on SNPs known to confer potential risk of PTB was done by performing a targeted PubMed search for the years 2007-2015 and systematically reviewing all relevant studies. Evaluation of 92 studies identified 119 candidate genes with SNPs that had potential association with PTB. The genes were associated with functions of a wide spectrum of tissue and cell types such as endocrine, tissue remodeling, vascular, metabolic, and immune and inflammatory systems. A number of potential functional candidate gene variants have been reported that predispose women for PTB. Understanding the complex genomic landscape of PTB needs high-throughput genome sequencing methods such as whole-exome sequencing and whole-genome sequencing approaches that will significantly enhance the understanding of PTB. Identification of high risk women, avoidance of possible risk factors, and provision of personalized health care are important to manage PTB.
Sequence-specific bias correction for RNA-seq data using recurrent neural networks.
Zhang, Yao-Zhong; Yamaguchi, Rui; Imoto, Seiya; Miyano, Satoru
2017-01-25
The recent success of deep learning techniques in machine learning and artificial intelligence has stimulated a great deal of interest among bioinformaticians, who now wish to bring the power of deep learning to bare on a host of bioinformatical problems. Deep learning is ideally suited for biological problems that require automatic or hierarchical feature representation for biological data when prior knowledge is limited. In this work, we address the sequence-specific bias correction problem for RNA-seq data redusing Recurrent Neural Networks (RNNs) to model nucleotide sequences without pre-determining sequence structures. The sequence-specific bias of a read is then calculated based on the sequence probabilities estimated by RNNs, and used in the estimation of gene abundance. We explore the application of two popular RNN recurrent units for this task and demonstrate that RNN-based approaches provide a flexible way to model nucleotide sequences without knowledge of predetermined sequence structures. Our experiments show that training a RNN-based nucleotide sequence model is efficient and RNN-based bias correction methods compare well with the-state-of-the-art sequence-specific bias correction method on the commonly used MAQC-III data set. RNNs provides an alternative and flexible way to calculate sequence-specific bias without explicitly pre-determining sequence structures.
Du, Shuhui; Wang, Zhaoshan; Ingvarsson, Pär K; Wang, Dongsheng; Wang, Junhui; Wu, Zhiqiang; Tembrock, Luke R; Zhang, Jianguo
2015-10-01
Historical tectonism and climate oscillations can isolate and contract the geographical distributions of many plant species, and they are even known to trigger species divergence and ultimately speciation. Here, we estimated the nucleotide variation and speciation in three closely related Populus species, Populus tremuloides, P. tremula and P. davidiana, distributed in North America and Eurasia. We analysed the sequence variation in six single-copy nuclear loci and three chloroplast (cpDNA) fragments in 497 individuals sampled from 33 populations of these three species across their geographic distributions. These three Populus species harboured relatively high levels of nucleotide diversity and showed high levels of nucleotide differentiation. Phylogenetic analysis revealed that P. tremuloides diverged earlier than the other two species. The cpDNA haplotype network result clearly illustrated the dispersal route from North America to eastern Asia and then into Europe. Molecular dating results confirmed that the divergence of these three species coincided with the sundering of the Bering land bridge in the late Miocene and a rapid uplift of the Qinghai-Tibetan Plateau around the Miocene/Pliocene boundary. Vicariance-driven successful allopatric speciation resulting from historical tectonism and climate oscillations most likely played roles in the formation of the disjunct distributions and divergence of these three Populus species. © 2015 John Wiley & Sons Ltd.
DEFF Research Database (Denmark)
Martinussen, Jan; Willemoës, M.; Kilstrup, Mogens
2011-01-01
Metabolic pathways are connected through their utilization of nucleotides as supplier of energy, allosteric effectors, and their role in activation of intermediates. Therefore, any attempt to exploit a given living organism in a biotechnological process will have an impact on nucleotide metabolis...
Statistical properties of nucleotides in human chromosomes 21 and 22
International Nuclear Information System (INIS)
Zhang Linxi; Sun Tingting
2005-01-01
In this paper the statistical properties of nucleotides in human chromosomes 21 and 22 are investigated. The n-tuple Zipf analysis with n = 3, 4, 5, 6, and 7 is used in our investigation. It is found that the most common n-tuples are those which consist only of adenine (A) and thymine (T), and the rarest n-tuples are those in which GC or CG pattern appears twice. With the n-tuples become more and more frequent, the double GC or CG pattern becomes a single GC or CG pattern. The percentage of four nucleotides in the rarest ten and the most common ten n-tuples are also considered in human chromosomes 21 and 22, and different behaviors are found in the percentage of four nucleotides. Frequency of appearance of n-tuple f(r) as a function of rank r is also examined. We find the n-tuple Zipf plot shows a power-law behavior for r n-1 and a rapid decrease for r > 4 n-1 . In order to explore the interior statistical properties of human chromosomes 21 and 22 in detail, we divide the chromosome sequence into some moving windows and we discuss the percentage of ξη (ξ, η = A, C, G, T) pair in those moving windows. In some particular regions, there are some obvious changes in the percentage of ξη pair, and there maybe exist functional differences. The normalized number of repeats N 0 (l) can be described by a power law: N 0 (l) ∼ l -μ . The distance distributions P 0 (S) between two nucleotides in human chromosomes 21 and 22 are also discussed. A two-order polynomial fit exists in those distance distributions: log P 0 (S) = a + bS + cS 2 , and it is quite different from the random sequence
Directory of Open Access Journals (Sweden)
Peter Norberg
Full Text Available The complete nucleotide sequence of plasmids pMCBF1 and pMCBF6 was determined and analyzed. pMCBF1 and pMCBF6 form a novel clade within the IncP-1 plasmid family designated IncP-1 ς. The plasmids were exogenously isolated earlier from a marine biofilm. pMCBF1 (62 689 base pairs; bp and pMCBF6 (66 729 bp have identical backbones, but differ in their mercury resistance transposons. pMCBF1 carries Tn5053 and pMCBF6 carries Tn5058. Both are flanked by 5 bp direct repeats, typical of replicative transposition. Both insertions are in the vicinity of a resolvase gene in the backbone, supporting the idea that both transposons are "res-site hunters" that preferably insert close to and use external resolvase functions. The similarity of the backbones indicates recent insertion of the two transposons and the ongoing dynamics of plasmid evolution in marine biofilms. Both plasmids also carry the insertion sequence ISPst1, albeit without flanking repeats. ISPs1is located in an unusual site within the control region of the plasmid. In contrast to most known IncP-1 plasmids the pMCBF1/pMCBF6 backbone has no insert between the replication initiation gene (trfA and the vegetative replication origin (oriV. One pMCBF1/pMCBF6 block of about 2.5 kilo bases (kb has no similarity with known sequences in the databases. Furthermore, insertion of three genes with similarity to the multidrug efflux pump operon mexEF and a gene from the NodT family of the tripartite multi-drug resistance-nodulation-division (RND system in Pseudomonas aeruginosa was found. They do not seem to confer antibiotic resistance to the hosts of pMCBF1/pMCBF6, but the presence of RND on promiscuous plasmids may have serious implications for the spread of antibiotic multi-resistance.
Simulating efficiently the evolution of DNA sequences.
Schöniger, M; von Haeseler, A
1995-02-01
Two menu-driven FORTRAN programs are described that simulate the evolution of DNA sequences in accordance with a user-specified model. This general stochastic model allows for an arbitrary stationary nucleotide composition and any transition-transversion bias during the process of base substitution. In addition, the user may define any hypothetical model tree according to which a family of sequences evolves. The programs suggest the computationally most inexpensive approach to generate nucleotide substitutions. Either reproducible or non-repeatable simulations, depending on the method of initializing the pseudo-random number generator, can be performed. The corresponding options are offered by the interface menu.
International Nuclear Information System (INIS)
Bjoerheim, Jens; Abrahamsen, Torveig Weum; Kristensen, Annette Torgunrud; Gaudernack, Gustav; Ekstroem, Per O.
2003-01-01
Melting gel techniques have proven to be amenable and powerful tools in point mutation and single nucleotide polymorphism (SNP) analysis. With the introduction of commercially available capillary electrophoresis instruments, a partly automated platform for denaturant capillary electrophoresis with potential for routine screening of selected target sequences has been established. The aim of this article is to demonstrate the use of automated constant denaturant capillary electrophoresis (ACDCE) in single nucleotide polymorphism analysis of various target sequences. Optimal analysis conditions for different single nucleotide polymorphisms on ACDCE are evaluated with the Poland algorithm. Laboratory procedures include only PCR and electrophoresis. For direct genotyping of individual SNPs, the samples are analyzed with an internal standard and the alleles are identified by co-migration of sample and standard peaks. In conclusion, SNPs suitable for melting gel analysis based on theoretical thermodynamics were separated by ACDCE under appropriate conditions. With this instrumentation (ABI 310 Genetic Analyzer), 48 samples could be analyzed without any intervention. Several institutions have capillary instrumentation in-house, thus making this SNP analysis method accessible to large groups of researchers without any need for instrument modification
Few single nucleotide variations in exomes of human cord blood induced pluripotent stem cells.
Directory of Open Access Journals (Sweden)
Rui-Jun Su
Full Text Available The effect of the cellular reprogramming process per se on mutation load remains unclear. To address this issue, we performed whole exome sequencing analysis of induced pluripotent stem cells (iPSCs reprogrammed from human cord blood (CB CD34(+ cells. Cells from a single donor and improved lentiviral vectors for high-efficiency (2-14% reprogramming were used to examine the effects of three different combinations of reprogramming factors: OCT4 and SOX2 (OS, OS and ZSCAN4 (OSZ, OS and MYC and KLF4 (OSMK. Five clones from each group were subject to whole exome sequencing analysis. We identified 14, 11, and 9 single nucleotide variations (SNVs, in exomes, including untranslated regions (UTR, in the five clones of OSMK, OS, and OSZ iPSC lines. Only 8, 7, and 4 of these, respectively, were protein-coding mutations. An average of 1.3 coding mutations per CB iPSC line is remarkably lower than previous studies using fibroblasts and low-efficiency reprogramming approaches. These data demonstrate that point nucleotide mutations during cord blood reprogramming are negligible and that the inclusion of genome stabilizers like ZSCAN4 during reprogramming may further decrease reprogramming-associated mutations. Our findings provide evidence that CB is a superior source of cells for iPSC banking.
Directory of Open Access Journals (Sweden)
Xu Lizhe
2008-06-01
Full Text Available Abstract Background Serotypes of the Foot-and-Mouth disease viruses (FMDVs were generally determined by biological experiments. The computational genotyping is not well studied even with the availability of whole viral genomes, due to uneven evolution among genes as well as frequent genetic recombination. Naively using sequence comparison for genotyping is only able to achieve a limited extent of success. Results We used 129 FMDV strains with known serotype as training strains to select as many as 140 most serotype-specific nucleotide strings. We then constructed a linear-kernel Support Vector Machine classifier using these 140 strings. Under the leave-one-out cross validation scheme, this classifier was able to assign correct serotype to 127 of these 129 strains, achieving 98.45% accuracy. It also assigned serotype correctly to an independent test set of 83 other FMDV strains downloaded separately from NCBI GenBank. Conclusion Computational genotyping is much faster and much cheaper than the wet-lab based biological experiments, upon the availability of the detailed molecular sequences. The high accuracy of our proposed method suggests the potential of utilizing a few signature nucleotide strings instead of whole genomes to determine the serotypes of novel FMDV strains.
High-throughput sequence alignment using Graphics Processing Units
Directory of Open Access Journals (Sweden)
Trapnell Cole
2007-12-01
Full Text Available Abstract Background The recent availability of new, less expensive high-throughput DNA sequencing technologies has yielded a dramatic increase in the volume of sequence data that must be analyzed. These data are being generated for several purposes, including genotyping, genome resequencing, metagenomics, and de novo genome assembly projects. Sequence alignment programs such as MUMmer have proven essential for analysis of these data, but researchers will need ever faster, high-throughput alignment tools running on inexpensive hardware to keep up with new sequence technologies. Results This paper describes MUMmerGPU, an open-source high-throughput parallel pairwise local sequence alignment program that runs on commodity Graphics Processing Units (GPUs in common workstations. MUMmerGPU uses the new Compute Unified Device Architecture (CUDA from nVidia to align multiple query sequences against a single reference sequence stored as a suffix tree. By processing the queries in parallel on the highly parallel graphics card, MUMmerGPU achieves more than a 10-fold speedup over a serial CPU version of the sequence alignment kernel, and outperforms the exact alignment component of MUMmer on a high end CPU by 3.5-fold in total application time when aligning reads from recent sequencing projects using Solexa/Illumina, 454, and Sanger sequencing technologies. Conclusion MUMmerGPU is a low cost, ultra-fast sequence alignment program designed to handle the increasing volume of data produced by new, high-throughput sequencing technologies. MUMmerGPU demonstrates that even memory-intensive applications can run significantly faster on the relatively low-cost GPU than on the CPU.
Directory of Open Access Journals (Sweden)
Nedenia Bonvino Stafuzza
Full Text Available Whole-genome re-sequencing, alignment and annotation analyses were undertaken for 12 sires representing four important cattle breeds in Brazil: Guzerat (multi-purpose, Gyr, Girolando and Holstein (dairy production. A total of approximately 4.3 billion reads from an Illumina HiSeq 2000 sequencer generated for each animal 10.7 to 16.4-fold genome coverage. A total of 27,441,279 single nucleotide variations (SNVs and 3,828,041 insertions/deletions (InDels were detected in the samples, of which 2,557,670 SNVs and 883,219 InDels were novel. The submission of these genetic variants to the dbSNP database significantly increased the number of known variants, particularly for the indicine genome. The concordance rate between genotypes obtained using the Bovine HD BeadChip array and the same variants identified by sequencing was about 99.05%. The annotation of variants identified numerous non-synonymous SNVs and frameshift InDels which could affect phenotypic variation. Functional enrichment analysis was performed and revealed that variants in the olfactory transduction pathway was over represented in all four cattle breeds, while the ECM-receptor interaction pathway was over represented in Girolando and Guzerat breeds, the ABC transporters pathway was over represented only in Holstein breed, and the metabolic pathways was over represented only in Gyr breed. The genetic variants discovered here provide a rich resource to help identify potential genomic markers and their associated molecular mechanisms that impact economically important traits for Gyr, Girolando, Guzerat and Holstein breeding programs.
Khamrin, Pattara; Okitsu, Shoko; Ushijima, Hiroshi; Maneekarn, Niwat
2013-07-01
Epidemiological surveillance of human bocavirus (HBoV) was conducted on fecal specimens collected from hospitalized children with diarrhea in Chiang Mai, Thailand in 2011. By partial sequence analysis of VP1 gene, an unusual strain of HBoV (CMH-S011-11), was initially identified as HBoV4. The complete genome sequence of CMH-S011-11 was performed and analyzed further to clarify whether it was a recombinant strain or a new HBoV variant. Analysis of complete genome sequence revealed that the coding sequence starting from NS1, NP1 to VP1/VP2 was 4795 nucleotides long. Interestingly, the nucleotide sequence of NS1 gene of CMH-S011-11 was most closely related to the HBoV2 reference strains detected in Pakistan, which contradicted to the initial genotyping result of the partial VP1 region in the previous study. In addition, comparison of NP1 nucleotide sequence of CMH-S011-11 with those of other HBoV1-4 reference strains also revealed a high level of sequence identity with HBoV2. On the other hand, nucleotide sequence of VP1/VP2 gene of CMH-S011-11 was most closely related to those of HBoV4 reference strains detected in Nigeria. The overall full-length sequence analysis revealed that this CMH-S011-11 was grouped within HBoV4 species, but located in a separate branch from other HBoV4 prototype strains. Recombination analysis revealed that CMH-S011-11 was the result of recombination between HBoV2 and HBoV4 strains with the break point located near the start codon of VP2. Copyright © 2013 Elsevier B.V. All rights reserved.
Global sequence diversity of the lactate dehydrogenase gene in Plasmodium falciparum.
Simpalipan, Phumin; Pattaradilokrat, Sittiporn; Harnyuttanakorn, Pongchai
2018-01-09
Antigen-detecting rapid diagnostic tests (RDTs) have been recommended by the World Health Organization for use in remote areas to improve malaria case management. Lactate dehydrogenase (LDH) of Plasmodium falciparum is one of the main parasite antigens employed by various commercial RDTs. It has been hypothesized that the poor detection of LDH-based RDTs is attributed in part to the sequence diversity of the gene. To test this, the present study aimed to investigate the genetic diversity of the P. falciparum ldh gene in Thailand and to construct the map of LDH sequence diversity in P. falciparum populations worldwide. The ldh gene was sequenced for 50 P. falciparum isolates in Thailand and compared with hundreds of sequences from P. falciparum populations worldwide. Several indices of molecular variation were calculated, including the proportion of polymorphic sites, the average nucleotide diversity index (π), and the haplotype diversity index (H). Tests of positive selection and neutrality tests were performed to determine signatures of natural selection on the gene. Mean genetic distance within and between species of Plasmodium ldh was analysed to infer evolutionary relationships. Nucleotide sequences of P. falciparum ldh could be classified into 9 alleles, encoding 5 isoforms of LDH. L1a was the most common allelic type and was distributed in P. falciparum populations worldwide. Plasmodium falciparum ldh sequences were highly conserved, with haplotype and nucleotide diversity values of 0.203 and 0.0004, respectively. The extremely low genetic diversity was maintained by purifying selection, likely due to functional constraints. Phylogenetic analysis inferred the close genetic relationship of P. falciparum to malaria parasites of great apes, rather than to other human malaria parasites. This study revealed the global genetic variation of the ldh gene in P. falciparum, providing knowledge for improving detection of LDH-based RDTs and supporting the candidacy of
Menzel, Ulrike; Greiff, Victor; Khan, Tarik A; Haessler, Ulrike; Hellmann, Ina; Friedensohn, Simon; Cook, Skylar C; Pogson, Mark; Reddy, Sai T
2014-01-01
High-throughput sequencing (HTS) of antibody repertoire libraries has become a powerful tool in the field of systems immunology. However, numerous sources of bias in HTS workflows may affect the obtained antibody repertoire data. A crucial step in antibody library preparation is the addition of short platform-specific nucleotide adapter sequences. As of yet, the impact of the method of adapter addition on experimental library preparation and the resulting antibody repertoire HTS datasets has not been thoroughly investigated. Therefore, we compared three standard library preparation methods by performing Illumina HTS on antibody variable heavy genes from murine antibody-secreting cells. Clonal overlap and rank statistics demonstrated that the investigated methods produced equivalent HTS datasets. PCR-based methods were experimentally superior to ligation with respect to speed, efficiency, and practicality. Finally, using a two-step PCR based method we established a protocol for antibody repertoire library generation, beginning from inputs as low as 1 ng of total RNA. In summary, this study represents a major advance towards a standardized experimental framework for antibody HTS, thus opening up the potential for systems-based, cross-experiment meta-analyses of antibody repertoires.
FRESCO: Referential compression of highly similar sequences.
Wandelt, Sebastian; Leser, Ulf
2013-01-01
In many applications, sets of similar texts or sequences are of high importance. Prominent examples are revision histories of documents or genomic sequences. Modern high-throughput sequencing technologies are able to generate DNA sequences at an ever-increasing rate. In parallel to the decreasing experimental time and cost necessary to produce DNA sequences, computational requirements for analysis and storage of the sequences are steeply increasing. Compression is a key technology to deal with this challenge. Recently, referential compression schemes, storing only the differences between a to-be-compressed input and a known reference sequence, gained a lot of interest in this field. In this paper, we propose a general open-source framework to compress large amounts of biological sequence data called Framework for REferential Sequence COmpression (FRESCO). Our basic compression algorithm is shown to be one to two orders of magnitudes faster than comparable related work, while achieving similar compression ratios. We also propose several techniques to further increase compression ratios, while still retaining the advantage in speed: 1) selecting a good reference sequence; and 2) rewriting a reference sequence to allow for better compression. In addition,we propose a new way of further boosting the compression ratios by applying referential compression to already referentially compressed files (second-order compression). This technique allows for compression ratios way beyond state of the art, for instance,4,000:1 and higher for human genomes. We evaluate our algorithms on a large data set from three different species (more than 1,000 genomes, more than 3 TB) and on a collection of versions of Wikipedia pages. Our results show that real-time compression of highly similar sequences at high compression ratios is possible on modern hardware.
Exploiting nucleotide composition to engineer promoters.
Directory of Open Access Journals (Sweden)
Manfred G Grabherr
Full Text Available The choice of promoter is a critical step in optimizing the efficiency and stability of recombinant protein production in mammalian cell lines. Artificial promoters that provide stable expression across cell lines and can be designed to the desired strength constitute an alternative to the use of viral promoters. Here, we show how the nucleotide characteristics of highly active human promoters can be modelled via the genome-wide frequency distribution of short motifs: by overlapping motifs that occur infrequently in the genome, we constructed contiguous sequence that is rich in GC and CpGs, both features of known promoters, but lacking homology to real promoters. We show that snippets from this sequence, at 100 base pairs or longer, drive gene expression in vitro in a number of mammalian cells, and are thus candidates for use in protein production. We further show that expression is driven by the general transcription factors TFIIB and TFIID, both being ubiquitously present across cell types, which results in less tissue- and species-specific regulation compared to the viral promoter SV40. We lastly found that the strength of a promoter can be tuned up and down by modulating the counts of GC and CpGs in localized regions. These results constitute a "proof-of-concept" for custom-designing promoters that are suitable for biotechnological and medical applications.
Sequence variation and phylogenetic analysis of envelope glycoprotein of hepatitis G virus.
Lim, M Y; Fry, K; Yun, A; Chong, S; Linnen, J; Fung, K; Kim, J P
1997-11-01
A transfusion-transmissible agent provisionally designated hepatitis G virus (HGV) was recently identified. In this study, we examined the variability of the HGV genome by analysing sequences in the putative envelope region from 72 isolates obtained from diverse geographical sources. The 1561 nucleotide sequence of the E1/E2/NS2a region of HGV was determined from 12 isolates, and compared with three published sequences. The most variability was observed in 400 nucleotides at the N terminus of E2. We next analysed this 400 nucleotide envelope variable region (EV) from an additional 60 HGV isolates. This sequence varied considerably among the 75 isolates, with overall identity ranging from 79.3% to 99.5% at the nucleotide level, and from 83.5% to 100% at the amino acid level. However, hypervariable regions were not identified. Phylogenetic analyses indicated that the 75 HGV isolates belong to a single genotype. A single-tier distribution of evolutionary distances was observed among the 15 E1/E2/NS2a sequences and the 75 EV sequences. In contrast, 11 isolates of HCV were analysed and showed a three-tiered distribution, representing genotypes, subtypes, and isolates. The 75 isolates of HGV fell into four clusters on the phylogenetic tree. Tight geographical clustering was observed among the HGV isolates from Japan and Korea.
A branch-heterogeneous model of protein evolution for efficient inference of ancestral sequences.
Groussin, M; Boussau, B; Gouy, M
2013-07-01
Most models of nucleotide or amino acid substitution used in phylogenetic studies assume that the evolutionary process has been homogeneous across lineages and that composition of nucleotides or amino acids has remained the same throughout the tree. These oversimplified assumptions are refuted by the observation that compositional variability characterizes extant biological sequences. Branch-heterogeneous models of protein evolution that account for compositional variability have been developed, but are not yet in common use because of the large number of parameters required, leading to high computational costs and potential overparameterization. Here, we present a new branch-nonhomogeneous and nonstationary model of protein evolution that captures more accurately the high complexity of sequence evolution. This model, henceforth called Correspondence and likelihood analysis (COaLA), makes use of a correspondence analysis to reduce the number of parameters to be optimized through maximum likelihood, focusing on most of the compositional variation observed in the data. The model was thoroughly tested on both simulated and biological data sets to show its high performance in terms of data fitting and CPU time. COaLA efficiently estimates ancestral amino acid frequencies and sequences, making it relevant for studies aiming at reconstructing and resurrecting ancestral amino acid sequences. Finally, we applied COaLA on a concatenate of universal amino acid sequences to confirm previous results obtained with a nonhomogeneous Bayesian model regarding the early pattern of adaptation to optimal growth temperature, supporting the mesophilic nature of the Last Universal Common Ancestor.
Yakoubi, S; Desbiez, C; Fakhfakh, H; Wipf-Scheibel, C; Marrakchi, M; Lecoq, H
2008-01-01
During a survey conducted in October 2005, cucurbit leaf samples showing virus-like symptoms were collected from the major cucurbit-growing areas in Tunisia. DAS-ELISA showed the presence of Moroccan watermelon mosaic virus (MWMV, Potyvirus), detected for the first time in Tunisia, in samples from the region of Cap Bon (Northern Tunisia). MWMV isolate TN05-76 (MWMV-Tn) was characterized biologically and its full-length genome sequence was established. MWMV-Tn was found to have biological properties similar to those reported for the MWMV type strain from Morocco. Phylogenetic analysis including the comparison of complete amino-acid sequences of 42 potyviruses confirmed that MWMV-Tn is related (65% amino-acid sequence identity) to Papaya ringspot virus (PRSV) isolates but is a member of a distinct virus species. Sequence analysis on parts of the CP gene of MWMV isolates from different geographical origins revealed some geographic structure of MWMV variability, with three different clusters: one cluster including isolates from the Mediterranean region, a second including isolates from western and central Africa, and a third one including isolates from the southern part of Africa. A significant correlation was observed between geographic and genetic distances between isolates. Isolates from countries in the Mediterranean region where MWMV has recently emerged (France, Spain, Portugal) have highly conserved sequences, suggesting that they may have a common and recent origin. MWMV from Sudan, a highly divergent variant, may be considered an evolutionary intermediate between MWMV and PRSV.
Sequence- vs. chip-assisted genomic selection: accurate biological information is advised.
Pérez-Enciso, Miguel; Rincón, Juan C; Legarra, Andrés
2015-05-09
The development of next-generation sequencing technologies (NGS) has made the use of whole-genome sequence data for routine genetic evaluations possible, which has triggered a considerable interest in animal and plant breeding fields. Here, we investigated whether complete or partial sequence data can improve upon existing SNP (single nucleotide polymorphism) array-based selection strategies by simulation using a mixed coalescence - gene-dropping approach. We simulated 20 or 100 causal mutations (quantitative trait nucleotides, QTN) within 65 predefined 'gene' regions, each 10 kb long, within a genome composed of ten 3-Mb chromosomes. We compared prediction accuracy by cross-validation using a medium-density chip (7.5 k SNPs), a high-density (HD, 17 k) and sequence data (335 k). Genetic evaluation was based on a GBLUP method. The simulations showed: (1) a law of diminishing returns with increasing number of SNPs; (2) a modest effect of SNP ascertainment bias in arrays; (3) a small advantage of using whole-genome sequence data vs. HD arrays i.e. ~4%; (4) a minor effect of NGS errors except when imputation error rates are high (≥20%); and (5) if QTN were known, prediction accuracy approached 1. Since this is obviously unrealistic, we explored milder assumptions. We showed that, if all SNPs within causal genes were included in the prediction model, accuracy could also dramatically increase by ~40%. However, this criterion was highly sensitive to either misspecification (including wrong genes) or to the use of an incomplete gene list; in these cases, accuracy fell rapidly towards that reached when all SNPs from sequence data were blindly included in the model. Our study shows that, unless an accurate prior estimate on the functionality of SNPs can be included in the predictor, there is a law of diminishing returns with increasing SNP density. As a result, use of whole-genome sequence data may not result in a highly increased selection response over high
Prospects of biomolecule sequencing with the techniques of translocation through nanopores: A review
International Nuclear Information System (INIS)
Nosik, V. L.; Rudakova, E. B.
2013-01-01
The interest in the functional properties of biomolecules in native solutions (in particular, their interaction with membranes) constantly increases with accumulation of data on the macromolecular structure, obtained by X-ray diffraction (with synchrotron radiation sources), nuclear magnetic resonance, and mass spectrometry; this interest is closely related to the development of new technologies of sequencing (i.e., determining the sequence of nucleotides in DNA biomolecule). One of the most promising “physical” approaches to sequencing is the application of methods based on the use of nanochannels or nanopores, through which biomolecules pass in ionic solutions under an electric field applied. A nanopore provides spatial localization of molecules and makes it possible to detect a signal (electric, fluorescent, etc.) from an individual nucleotide. In view of the development of new high-intensity pulsed X-ray sources, the popularity of fluorescence analysis constantly increases. The existing methods for simulating the motion of biomolecules and interpreting their structure, sequencing techniques, and the prospects of further development of investigations in this field are discussed
Complete Genome Sequence of the Soybean Symbiont Bradyrhizobium japonicum Strain USDA6T
Directory of Open Access Journals (Sweden)
Nobukazu Uchiike
2011-10-01
Full Text Available The complete nucleotide sequence of the genome of the soybean symbiont Bradyrhizobium japonicum strain USDA6T was determined. The genome of USDA6T is a single circular chromosome of 9,207,384 bp. The genome size is similar to that of the genome of another soybean symbiont, B. japonicum USDA110 (9,105,828 bp. Comparison of the whole-genome sequences of USDA6T and USDA110 showed colinearity of major regions in the two genomes, although a large inversion exists between them. A significantly high level of sequence conservation was detected in three regions on each genome. The gene constitution and nucleotide sequence features in these three regions indicate that they may have been derived from a symbiosis island. An ancestral, large symbiosis island, approximately 860 kb in total size, appears to have been split into these three regions by unknown large-scale genome rearrangements. The two integration events responsible for this appear to have taken place independently, but through comparable mechanisms, in both genomes.
Directory of Open Access Journals (Sweden)
Miri eMichaeli
2012-12-01
Full Text Available High throughput sequencing (HTS yields tens of thousands to millions of sequences that require a large amount of pre-processing work to clean various artifacts. Such cleaning cannot be performed manually. Existing programs are not suitable for immunoglobulin (Ig genes, which are variable and often highly mutated. This paper describes Ig-HTS-Cleaner (Ig High Throughput Sequencing Cleaner, a program containing a simple cleaning procedure that successfully deals with pre-processing of Ig sequences derived from HTS, and Ig-Indel-Identifier (Ig Insertion – Deletion Identifier, a program for identifying legitimate and artifact insertions and/or deletions (indels. Our programs were designed for analyzing Ig gene sequences obtained by 454 sequencing, but they are applicable to all types of sequences and sequencing platforms. Ig-HTS-Cleaner and Ig-Indel-Identifier have been implemented in Java and saved as executable JAR files, supported on Linux and MS Windows. No special requirements are needed in order to run the programs, except for correctly constructing the input files as explained in the text. The programs' performance has been tested and validated on real and simulated data sets.
Xie, Xian-Hua; Yu, Zu-Guo; Ma, Yuan-Lin; Han, Guo-Sheng; Anh, Vo
2017-09-01
There has been a growing interest in visualization of metagenomic data. The present study focuses on the visualization of metagenomic data using inter-nucleotide distances profile. We first convert the fragment sequences into inter-nucleotide distances profiles. Then we analyze these profiles by principal component analysis. Finally the principal components are used to obtain the 2-D scattered plot according to their source of species. We name our method as inter-nucleotide distances profiles (INP) method. Our method is evaluated on three benchmark data sets used in previous published papers. Our results demonstrate that the INP method is good, alternative and efficient for visualization of metagenomic data.
An extended sequence specificity for UV-induced DNA damage.
Chung, Long H; Murray, Vincent
2018-01-01
The sequence specificity of UV-induced DNA damage was determined with a higher precision and accuracy than previously reported. UV light induces two major damage adducts: cyclobutane pyrimidine dimers (CPDs) and pyrimidine(6-4)pyrimidone photoproducts (6-4PPs). Employing capillary electrophoresis with laser-induced fluorescence and taking advantages of the distinct properties of the CPDs and 6-4PPs, we studied the sequence specificity of UV-induced DNA damage in a purified DNA sequence using two approaches: end-labelling and a polymerase stop/linear amplification assay. A mitochondrial DNA sequence that contained a random nucleotide composition was employed as the target DNA sequence. With previous methodology, the UV sequence specificity was determined at a dinucleotide or trinucleotide level; however, in this paper, we have extended the UV sequence specificity to a hexanucleotide level. With the end-labelling technique (for 6-4PPs), the consensus sequence was found to be 5'-GCTC*AC (where C* is the breakage site); while with the linear amplification procedure, it was 5'-TCTT*AC. With end-labelling, the dinucleotide frequency of occurrence was highest for 5'-TC*, 5'-TT* and 5'-CC*; whereas it was 5'-TT* for linear amplification. The influence of neighbouring nucleotides on the degree of UV-induced DNA damage was also examined. The core sequences consisted of pyrimidine nucleotides 5'-CTC* and 5'-CTT* while an A at position "1" and C at position "2" enhanced UV-induced DNA damage. Crown Copyright © 2017. Published by Elsevier B.V. All rights reserved.
Zhou, Lin; Matsumoto, Tracie; Tan, Hua-Wei; Meinhardt, Lyndel W; Mischke, Sue; Wang, Boyi; Zhang, Dapeng
2015-01-01
Pineapple (Ananas comosus [L.] Merr.) is the third most important tropical fruit in the world after banana and mango. As a crop with vegetative propagation, genetic redundancy is a major challenge for efficient genebank management and in breeding. Using expressed sequence tag and nucleotide sequences from public databases, we developed 213 single nucleotide polymorphism (SNP) markers and validated 96 SNPs by genotyping the United States Department of Agriculture - Agricultural Research Service pineapple germplasm collection, maintained in Hilo, Hawaii. The validation resulted in designation of a set of 57 polymorphic SNP markers that revealed a high rate of duplicates in this pineapple collection. Twenty-four groups of duplicates were detected, encompassing 130 of the total 170 A cosmos accessions. The results show that somatic mutation has been the main source of intra-cultivar variations in pineapple. Multivariate clustering and a model-based population stratification suggest that the modern pineapple cultivars are comprised of progenies that are derived from different wild Ananas botanical varieties. Parentage analysis further revealed that both A. comosus var. bracteatus and A. comosus var. ananassoides are likely progenitors of pineapple cultivars. However, the traditional classification of cultivated pineapple into horticultural groups (e.g. 'Cayenne', 'Spanish', 'Queen') was not well supported by the present study. These SNP markers provide robust and universally comparable DNA fingerprints; thus, they can serve as an efficient genotyping tool to assist pineapple germplasm management, propagation of planting material, and pineapple cultivar protection. The high rate of genetic redundancy detected in this pineapple collection suggests the potential impact of applying this technology on other clonally propagated perennial crops.
Wu, Lucia R.; Chen, Sherry X.; Wu, Yalei; Patel, Abhijit A.; Zhang, David Yu
2018-01-01
Rare DNA-sequence variants hold important clinical and biological information, but existing detection techniques are expensive, complex, allele-specific, or don’t allow for significant multiplexing. Here, we report a temperature-robust polymerase-chain-reaction method, which we term blocker displacement amplification (BDA), that selectively amplifies all sequence variants, including single-nucleotide variants (SNVs), within a roughly 20-nucleotide window by 1,000-fold over wild-type sequences. This allows for easy detection and quantitation of hundreds of potential variants originally at ≤0.1% in allele frequency. BDA is compatible with inexpensive thermocycler instrumentation and employs a rationally designed competitive hybridization reaction to achieve comparable enrichment performance across annealing temperatures ranging from 56 °C to 64 °C. To show the sequence generality of BDA, we demonstrate enrichment of 156 SNVs and the reliable detection of single-digit copies. We also show that the BDA detection of rare driver mutations in cell-free DNA samples extracted from the blood plasma of lung-cancer patients is highly consistent with deep sequencing using molecular lineage tags, with a receiver operator characteristic accuracy of 95%. PMID:29805844
Tan, Yann-Chong; Blum, Lisa K; Kongpachith, Sarah; Ju, Chia-Hsin; Cai, Xiaoyong; Lindstrom, Tamsin M; Sokolove, Jeremy; Robinson, William H
2014-03-01
We developed a DNA barcoding method to enable high-throughput sequencing of the cognate heavy- and light-chain pairs of the antibodies expressed by individual B cells. We used this approach to elucidate the plasmablast antibody response to influenza vaccination. We show that >75% of the rationally selected plasmablast antibodies bind and neutralize influenza, and that antibodies from clonal families, defined by sharing both heavy-chain VJ and light-chain VJ sequence usage, do so most effectively. Vaccine-induced heavy-chain VJ regions contained on average >20 nucleotide mutations as compared to their predicted germline gene sequences, and some vaccine-induced antibodies exhibited higher binding affinities for hemagglutinins derived from prior years' seasonal influenza as compared to their affinities for the immunization strains. Our results show that influenza vaccination induces the recall of memory B cells that express antibodies that previously underwent affinity maturation against prior years' seasonal influenza, suggesting that 'original antigenic sin' shapes the antibody response to influenza vaccination. Published by Elsevier Inc.
Ma, X X; Feng, Y P; Gu, Y X; Zhou, J H; Ma, Z R
2016-06-01
As for the alternative AUGs in foot-and-mouth disease virus (FMDV), nucleotide bias of the context flanking the AUG(2nd) could be used as a strong signal to initiate translation. To determine the role of the specific nucleotide context, dicistronic reporter constructs were engineered to contain different versions of nucleotide context linking between internal ribosome entry site (IRES) and downstream gene. The results indicate that under FMDV IRES-dependent mechanism, the nucleotide contexts flanking start codon can influence the translation initiation efficiencies. The most optimal sequences for both start codons have proved to be UUU AUG(1st) AAC and AAG AUG(2nd) GAA.
Preparation of protected nucleotides usable in oligonucleotide synthesis
International Nuclear Information System (INIS)
Debiard, Jean-Pascal
1983-01-01
After having presented the components of DNA, the author of this research thesis outlines that, when dealing the chemical synthesis, the respect of the sequence of these components is the main problem as each nucleotide possesses several functions which may react with each other. In order to solve this problem, functional protection is used to protect functions which may react in an undesirable way and to let free those which participate to the desired reaction. But a selective protector group must be used and this group must remain stable during the operations it is not involved in. Therefore, its elimination will be easy and without any risk of deterioration of the synthesised molecule. This research thesis first addresses the various available techniques to perform these steps, and then reports the study of possible applications of synthetic nucleotides in the field of genetic engineering [fr
Directory of Open Access Journals (Sweden)
Nian-Zhang Zhang
2014-01-01
Full Text Available Genetic diversity of T. gondii is a concern of many studies, due to the biological and epidemiological diversity of this parasite. The present study examined sequence variation in rhoptry protein 17 (ROP17 gene among T. gondii isolates from different hosts and geographical regions. The rop17 gene was amplified and sequenced from 10 T. gondii strains, and phylogenetic relationship among these T. gondii strains was reconstructed using maximum parsimony (MP, neighbor-joining (NJ, and maximum likelihood (ML analyses. The partial rop17 gene sequences were 1375 bp in length and A+T contents varied from 49.45% to 50.11% among all examined T. gondii strains. Sequence analysis identified 33 variable nucleotide positions (2.1%, 16 of which were identified as transitions. Phylogeny reconstruction based on rop17 gene data revealed two major clusters which could readily distinguish Type I and Type II strains. Analyses of sequence variations in nucleotides and amino acids among these strains revealed high ratio of nonsynonymous to synonymous polymorphisms (>1, indicating that rop17 shows signs of positive selection. This study demonstrated the existence of slightly high sequence variability in the rop17 gene sequences among T. gondii strains from different hosts and geographical regions, suggesting that rop17 gene may represent a new genetic marker for population genetic studies of T. gondii isolates.
Screening for SNPs with Allele-Specific Methylation based on Next-Generation Sequencing Data
Hu, Bo; Ji, Yuan; Xu, Yaomin; Ting, Angela H
2013-01-01
Allele-specific methylation (ASM) has long been studied but mainly documented in the context of genomic imprinting and X chromosome inactivation. Taking advantage of the next-generation sequencing technology, we conduct a high-throughput sequencing experiment with four prostate cell lines to survey the whole genome and identify single nucleotide polymorphisms (SNPs) with ASM. A Bayesian approach is proposed to model the counts of short reads for each SNP conditional on its genotypes of multip...
High pressure {sup 31}P NMR spectroscopy on guanine nucleotides
Energy Technology Data Exchange (ETDEWEB)
Spoerner, Michael; Karl, Matthias; Lopes, Pedro; Hoering, Marcus; Loeffel, Karoline; Nuehs, Andrea; Adelsberger, Joseph; Kremer, Werner; Kalbitzer, Hans Robert, E-mail: hans-robert.kalbitzer@ur.de [University of Regensburg, Centre of Magnetic Resonance in Chemistry and Biomedicine, Institute of Biophysics and Physical Biochemistry (Germany)
2017-01-15
The {sup 31}P NMR pressure response of guanine nucleotides bound to proteins has been studied in the past for characterizing the pressure perturbation of conformational equilibria. The pressure response of the {sup 31}P NMR chemical shifts of the phosphate groups of GMP, GDP, and GTP as well as the commonly used GTP analogs GppNHp, GppCH{sub 2}p and GTPγS was measured in the absence and presence of Mg{sup 2+}-ions within a pressure range up to 200 MPa. The pressure dependence of chemical shifts is clearly non-linear. For all nucleotides a negative first order pressure coefficient B{sub 1} was determined indicating an upfield shift of the resonances with pressure. With exception of the α-phosphate group of Mg{sup 2+}·GMP and Mg{sup 2+}·GppNHp the second order pressure coefficients are positive. To describe the data of Mg{sup 2+}·GppCH{sub 2}p and GTPγS a Taylor expansion of 3rd order is required. For distinguishing pH effects from pressure effects a complete pH titration set is presented for GMP, as well as GDP and GTP in absence and presence of Mg{sup 2+} ions using indirect referencing to DSS under identical experimental conditions. By a comparison between high pressure {sup 31}P NMR data on free Mg{sup 2+}-GDP and Mg{sup 2+}-GDP in complex with the proto-oncogene Ras we demonstrate that pressure induced changes in chemical shift are clearly different between both forms.
Nucleotide polymorphisms and haplotype diversity of RTCS gene in China elite maize inbred lines.
Directory of Open Access Journals (Sweden)
Enying Zhang
Full Text Available The maize RTCS gene, encoding a LOB domain transcription factor, plays important roles in the initiation of embryonic seminal and postembryonic shoot-borne root. In this study, the genomic sequences of this gene in 73 China elite inbred lines, including 63 lines from 5 temperate heteroric groups and 10 tropic germplasms, were obtained, and the nucleotide polymorphisms and haplotype diversity were detected. A total of 63 sequence variants, including 44 SNPs and 19 indels, were identified at this locus, and most of them were found to be located in the regions of UTR and intron. The coding region of this gene in all tested inbred lines carried 14 haplotypes, which encoding 7 deferring RTCS proteins. Analysis of the polymorphism sites revealed that at least 6 recombination events have occurred. Among all 6 groups tested, only the P heterotic group had a much lower nucleotide diversity than the whole set, and selection analysis also revealed that only this group was under strong negative selection. However, the set of Huangzaosi and its derived lines possessed a higher nucleotide diversity than the whole set, and no selection signal were identified.
High-resolution characterization of sequence signatures due to non-random cleavage of cell-free DNA.
Chandrananda, Dineika; Thorne, Natalie P; Bahlo, Melanie
2015-06-17
High-throughput sequencing of cell-free DNA fragments found in human plasma has been used to non-invasively detect fetal aneuploidy, monitor organ transplants and investigate tumor DNA. However, many biological properties of this extracellular genetic material remain unknown. Research that further characterizes circulating DNA could substantially increase its diagnostic value by allowing the application of more sophisticated bioinformatics tools that lead to an improved signal to noise ratio in the sequencing data. In this study, we investigate various features of cell-free DNA in plasma using deep-sequencing data from two pregnant women (>70X, >50X) and compare them with matched cellular DNA. We utilize a descriptive approach to examine how the biological cleavage of cell-free DNA affects different sequence signatures such as fragment lengths, sequence motifs at fragment ends and the distribution of cleavage sites along the genome. We show that the size distributions of these cell-free DNA molecules are dependent on their autosomal and mitochondrial origin as well as the genomic location within chromosomes. DNA mapping to particular microsatellites and alpha repeat elements display unique size signatures. We show how cell-free fragments occur in clusters along the genome, localizing to nucleosomal arrays and are preferentially cleaved at linker regions by correlating the mapping locations of these fragments with ENCODE annotation of chromatin organization. Our work further demonstrates that cell-free autosomal DNA cleavage is sequence dependent. The region spanning up to 10 positions on either side of the DNA cleavage site show a consistent pattern of preference for specific nucleotides. This sequence motif is present in cleavage sites localized to nucleosomal cores and linker regions but is absent in nucleosome-free mitochondrial DNA. These background signals in cell-free DNA sequencing data stem from the non-random biological cleavage of these fragments. This
Sifrim, Alejandro; Van Houdt, Jeroen Kj; Tranchevent, Leon-Charles; Nowakowska, Beata; Sakai, Ryo; Pavlopoulos, Georgios A; Devriendt, Koen; Vermeesch, Joris R; Moreau, Yves; Aerts, Jan
2012-01-01
The increasing size and complexity of exome/genome sequencing data requires new tools for clinical geneticists to discover disease-causing variants. Bottlenecks in identifying the causative variation include poor cross-sample querying, constantly changing functional annotation and not considering existing knowledge concerning the phenotype. We describe a methodology that facilitates exploration of patient sequencing data towards identification of causal variants under different genetic hypotheses. Annotate-it facilitates handling, analysis and interpretation of high-throughput single nucleotide variant data. We demonstrate our strategy using three case studies. Annotate-it is freely available and test data are accessible to all users at http://www.annotate-it.org.
LNA-enhanced detection of single nucleotide polymorphisms in the apolipoprotein E
DEFF Research Database (Denmark)
Jacobsen, Nana; Bentzen, Joan; Meldgaard, Michael
2002-01-01
Genotyping of single nucleotide polymorphisms (SNPs) in large populations presents a great challenge, especially if the SNPs are embedded in GC-rich regions, such as the codon 112 SNP in the human apolipoprotein E (apoE). In the present study, we have used immobilized locked nucleic acid (LNA...... was applied to a panel of patient samples with simultaneous genotyping of the patients by DNA sequencing. The apoE genotyping assays for the codons 112 and 158 SNPs resulted in unambiguous results for all patient samples, concurring with those obtained by DNA sequencing....
Safa, Ahmad Hosseini; Harandi, Majid Fasihi; Tajaddini, Mohammadhasan; Rostami-Nejad, Mohammad; Mohtashami-Pour, Mehdi; Pestehchian, Nader
2016-07-22
High-resolution melting (HRM) is a reliable and sensitive scanning method to detect variation in DNA sequences. We used this method to better understand the epidemiology and transmission of Echinococcus granulosus. We tested the use of HRM to discriminate the genotypes of E. granulosus and E. canadensis. One hundred forty-one hydatid cysts were collected from slaughtered animals in different parts of Isfahan-Iran in 2013. After DNA extraction, the mitochondrial cytochrome c oxidase subunit 1 (cox1) gene was amplified using PCR coupled with the HRM curve. The result of HRM analysis using partial the sequences of cox1 gene revealed that 93, 35, and 2 isolates were identified as G1, G3, and G6 genotypes, respectively. A single nucleotide polymorphism (SNP) was found in locus 9867 of the cox1 gene. This is a critical locus for the differentiation between the G6 and G7 genotypes. In the phylogenic tree, the sample with a SNP was located between the G6 and G7 genotypes, which suggest that this isolate has a G6/G7 genotype. The HRM analysis developed in the present study provides a powerful technique for molecular and epidemiological studies on echinococcosis in humans and animals.
2012-01-01
Background Cotton is the world’s most important natural textile fiber and a significant oilseed crop. Decoding cotton genomes will provide the ultimate reference and resource for research and utilization of the species. Integration of high-density genetic maps with genomic sequence information will largely accelerate the process of whole-genome assembly in cotton. Results In this paper, we update a high-density interspecific genetic linkage map of allotetraploid cultivated cotton. An additional 1,167 marker loci have been added to our previously published map of 2,247 loci. Three new marker types, InDel (insertion-deletion) and SNP (single nucleotide polymorphism) developed from gene information, and REMAP (retrotransposon-microsatellite amplified polymorphism), were used to increase map density. The updated map consists of 3,414 loci in 26 linkage groups covering 3,667.62 cM with an average inter-locus distance of 1.08 cM. Furthermore, genome-wide sequence analysis was finished using 3,324 informative sequence-based markers and publicly-available Gossypium DNA sequence information. A total of 413,113 EST and 195 BAC sequences were physically anchored and clustered by 3,324 sequence-based markers. Of these, 14,243 ESTs and 188 BACs from different species of Gossypium were clustered and specifically anchored to the high-density genetic map. A total of 2,748 candidate unigenes from 2,111 ESTs clusters and 63 BACs were mined for functional annotation and classification. The 337 ESTs/genes related to fiber quality traits were integrated with 132 previously reported cotton fiber quality quantitative trait loci, which demonstrated the important roles in fiber quality of these genes. Higher-level sequence conservation between different cotton species and between the A- and D-subgenomes in tetraploid cotton was found, indicating a common evolutionary origin for orthologous and paralogous loci in Gossypium. Conclusion This study will serve as a valuable genomic resource
Draft Genome Sequence of Corynebacterium kefirresidentii SB, Isolated from Kefir.
Blasche, Sonja; Kim, Yongkyu; Patil, Kiran R
2017-09-14
The genus Corynebacterium includes Gram-positive species with a high G+C content. We report here a novel species, Corynebacterium kefirresidentii SB, isolated from kefir grains collected in Germany. Its draft genome sequence was remarkably dissimilar (average nucleotide identity, 76.54%) to those of other Corynebacterium spp., confirming that this is a unique novel species. Copyright © 2017 Blasche et al.
Xu, Chen; Zhang, Nan; Huo, Qianyu; Chen, Minghui; Wang, Rengfeng; Liu, Zhili; Li, Xue; Liu, Yunde; Bao, Huijing
2016-04-15
In this article, we discuss the polymerase chain reaction (PCR)-hybridization assay that we developed for high-throughput simultaneous detection and differentiation of Ureaplasma urealyticum and Ureaplasma parvum using one set of primers and two specific DNA probes based on urease gene nucleotide sequence differences. First, U. urealyticum and U. parvum DNA samples were specifically amplified using one set of biotin-labeled primers. Furthermore, amine-modified DNA probes, which can specifically react with U. urealyticum or U. parvum DNA, were covalently immobilized to a DNA-BIND plate surface. The plate was then incubated with the PCR products to facilitate sequence-specific DNA binding. Horseradish peroxidase-streptavidin conjugation and a colorimetric assay were used. Based on the results, the PCR-hybridization assay we developed can specifically differentiate U. urealyticum and U. parvum with high sensitivity (95%) compared with cultivation (72.5%). Hence, this study demonstrates a new method for high-throughput simultaneous differentiation and detection of U. urealyticum and U. parvum with high sensitivity. Based on these observations, the PCR-hybridization assay developed in this study is ideal for detecting and discriminating U. urealyticum and U. parvum in clinical applications. Copyright © 2016 Elsevier Inc. All rights reserved.
Investigation of a Quadruplex-Forming Repeat Sequence Highly Enriched in Xanthomonas and Nostoc sp.
Directory of Open Access Journals (Sweden)
Charlotte Rehm
Full Text Available In prokaryotes simple sequence repeats (SSRs with unit sizes of 1-5 nucleotides (nt are causative for phase and antigenic variation. Although an increased abundance of heptameric repeats was noticed in bacteria, reports about SSRs of 6-9 nt are rare. In particular G-rich repeat sequences with the propensity to fold into G-quadruplex (G4 structures have received little attention. In silico analysis of prokaryotic genomes show putative G4 forming sequences to be abundant. This report focuses on a surprisingly enriched G-rich repeat of the type GGGNATC in Xanthomonas and cyanobacteria such as Nostoc. We studied in detail the genomes of Xanthomonas campestris pv. campestris ATCC 33913 (Xcc, Xanthomonas axonopodis pv. citri str. 306 (Xac, and Nostoc sp. strain PCC7120 (Ana. In all three organisms repeats are spread all over the genome with an over-representation in non-coding regions. Extensive variation of the number of repetitive units was observed with repeat numbers ranging from two up to 26 units. However a clear preference for four units was detected. The strong bias for four units coincides with the requirement of four consecutive G-tracts for G4 formation. Evidence for G4 formation of the consensus repeat sequences was found in biophysical studies utilizing CD spectroscopy. The G-rich repeats are preferably located between aligned open reading frames (ORFs and are under-represented in coding regions or between divergent ORFs. The G-rich repeats are preferentially located within a distance of 50 bp upstream of an ORF on the anti-sense strand or within 50 bp from the stop codon on the sense strand. Analysis of whole transcriptome sequence data showed that the majority of repeat sequences are transcribed. The genetic loci in the vicinity of repeat regions show increased genomic stability. In conclusion, we introduce and characterize a special class of highly abundant and wide-spread quadruplex-forming repeat sequences in bacteria.
Investigation of a Quadruplex-Forming Repeat Sequence Highly Enriched in Xanthomonas and Nostoc sp.
Rehm, Charlotte; Wurmthaler, Lena A; Li, Yuanhao; Frickey, Tancred; Hartig, Jörg S
2015-01-01
In prokaryotes simple sequence repeats (SSRs) with unit sizes of 1-5 nucleotides (nt) are causative for phase and antigenic variation. Although an increased abundance of heptameric repeats was noticed in bacteria, reports about SSRs of 6-9 nt are rare. In particular G-rich repeat sequences with the propensity to fold into G-quadruplex (G4) structures have received little attention. In silico analysis of prokaryotic genomes show putative G4 forming sequences to be abundant. This report focuses on a surprisingly enriched G-rich repeat of the type GGGNATC in Xanthomonas and cyanobacteria such as Nostoc. We studied in detail the genomes of Xanthomonas campestris pv. campestris ATCC 33913 (Xcc), Xanthomonas axonopodis pv. citri str. 306 (Xac), and Nostoc sp. strain PCC7120 (Ana). In all three organisms repeats are spread all over the genome with an over-representation in non-coding regions. Extensive variation of the number of repetitive units was observed with repeat numbers ranging from two up to 26 units. However a clear preference for four units was detected. The strong bias for four units coincides with the requirement of four consecutive G-tracts for G4 formation. Evidence for G4 formation of the consensus repeat sequences was found in biophysical studies utilizing CD spectroscopy. The G-rich repeats are preferably located between aligned open reading frames (ORFs) and are under-represented in coding regions or between divergent ORFs. The G-rich repeats are preferentially located within a distance of 50 bp upstream of an ORF on the anti-sense strand or within 50 bp from the stop codon on the sense strand. Analysis of whole transcriptome sequence data showed that the majority of repeat sequences are transcribed. The genetic loci in the vicinity of repeat regions show increased genomic stability. In conclusion, we introduce and characterize a special class of highly abundant and wide-spread quadruplex-forming repeat sequences in bacteria.
Molecular characterization of Giardia psittaci by multilocus sequence analysis.
Abe, Niichiro; Makino, Ikuko; Kojima, Atsushi
2012-12-01
Multilocus sequence analyses targeting small subunit ribosomal DNA (SSU rDNA), elongation factor 1 alpha (ef1α), glutamate dehydrogenase (gdh), and beta giardin (β-giardin) were performed on Giardia psittaci isolates from three Budgerigars (Melopsittacus undulates) and four Barred parakeets (Bolborhynchus lineola) kept in individual households or imported from overseas. Nucleotide differences and phylogenetic analyses at four loci indicate the distinction of G. psittaci from the other known Giardia species: Giardia muris, Giardia microti, Giardia ardeae, and Giardia duodenalis assemblages. Furthermore, G. psittaci was related more closely to G. duodenalis than to the other known Giardia species, except for G. microti. Conflicting signals regarded as "double peaks" were found at the same nucleotide positions of the ef1α in all isolates. However, the sequences of the other three loci, including gdh and β-giardin, which are known to be highly variable, from all isolates were also mutually identical at every locus. They showed no double peaks. These results suggest that double peaks found in the ef1α sequences are caused not by mixed infection with genetically different G. psittaci isolates but by allelic sequence heterogeneity (ASH), which is observed in diplomonad lineages including G. duodenalis. No sequence difference was found in any G. psittaci isolates at the gdh and β-giardin, suggesting that G. psittaci is indeed not more diverse genetically than other Giardia species. This report is the first to provide evidence related to the genetic characteristics of G. psittaci obtained using multilocus sequence analysis. Copyright © 2012 Elsevier B.V. All rights reserved.
Morrison, Carl D.; Liu, Pengyuan; Woloszynska-Read, Anna; Zhang, Jianmin; Luo, Wei; Qin, Maochun; Bshara, Wiam; Conroy, Jeffrey M.; Sabatini, Linda; Vedell, Peter; Xiong, Donghai; Liu, Song; Wang, Jianmin; Shen, He; Li, Yinwei; Omilian, Angela R.; Hill, Annette; Head, Karen; Guru, Khurshid; Kunnev, Dimiter; Leach, Robert; Eng, Kevin H.; Darlak, Christopher; Hoeflich, Christopher; Veeranki, Srividya; Glenn, Sean; You, Ming; Pruitt, Steven C.; Johnson, Candace S.; Trump, Donald L.
2014-01-01
Using complete genome analysis, we sequenced five bladder tumors accrued from patients with muscle-invasive transitional cell carcinoma of the urinary bladder (TCC-UB) and identified a spectrum of genomic aberrations. In three tumors, complex genotype changes were noted. All three had tumor protein p53 mutations and a relatively large number of single-nucleotide variants (SNVs; average of 11.2 per megabase), structural variants (SVs; average of 46), or both. This group was best characterized by chromothripsis and the presence of subclonal populations of neoplastic cells or intratumoral mutational heterogeneity. Here, we provide evidence that the process of chromothripsis in TCC-UB is mediated by nonhomologous end-joining using kilobase, rather than megabase, fragments of DNA, which we refer to as “stitchers,” to repair this process. We postulate that a potential unifying theme among tumors with the more complex genotype group is a defective replication–licensing complex. A second group (two bladder tumors) had no chromothripsis, and a simpler genotype, WT tumor protein p53, had relatively few SNVs (average of 5.9 per megabase) and only a single SV. There was no evidence of a subclonal population of neoplastic cells. In this group, we used a preclinical model of bladder carcinoma cell lines to study a unique SV (translocation and amplification) of the gene glutamate receptor ionotropic N-methyl D-aspertate as a potential new therapeutic target in bladder cancer. PMID:24469795
Directory of Open Access Journals (Sweden)
Xiaolin Ji
Full Text Available Subgroup J avian leukosis virus (ALV-J was first isolated from meat-type chickens that had developed myeloid leukosis and since 2008, ALV-J infections in chickens have become widespread in China. A comparison of the sequence of ALV-J epidemic isolates with HPRS-103, the ALV-J prototype virus, revealed several distinct features, one of which is a 19-nucleotide (nt insertion in the leader sequence. To determine the role of the 19-nt insertion in ALV-J pathogenicity, a pair of viruses were constructed and rescued. The first virus was an ALV-J Chinese isolate (designated rSD1009 containing the 19-nt insertion in its leader sequence. The second virus was a clone, in which the leader sequence had a deleted 19-nt sequence (designated rSD1009△19. Compared with rSD1009△19, rSD1009 displayed a moderate growth advantage in vitro. However, no differences were demonstrated in either viral replication or oncogenicity between the two rescued viruses in chickens. These results indicated that the 19-nt insertion contributed to ALV-J replication in vitro but was not related to its pathogenicity in vivo.
Sakthivelkumar, S; Ramaraj, P; Veeramani, V; Janarthanan, S
2015-09-01
The basis of the present study was to distinguish the existence of any genetic variability among populations of Culex quinquefasciatus which would be a valuable tool in the management of mosquito control programmes. In the present study, population of Cx. quinquefasciatus collected at different locations in Tamil Nadu were analyzed for their genetic variation based on 28S rDNA D2 region nucleotide sequences. A high degree of genetic polymorphism was detected in the sequences of D2 region of 28S rDNA on the predicted secondary structures in spite of high nucleotide sequence similarity. The findings based on secondary structure using rDNA sequences suggested the existence of a complex genotypic diversity of Cx. quinquefasciatus population collected at different locations of Tamil Nadu, India. This complexity in genetic diversity in a single mosquito population collected at different locations is considered an important issue towards their influence and nature of vector potential of these mosquitoes.
DEFF Research Database (Denmark)
Fahnøe, Ulrik; Pedersen, Anders Gorm; Höper, Dirk
2013-01-01
to the consensus sequence. Additionally, we got an average sequence depth for the genome of 4000 for the Iontorrent PGM and 400 for the FLX platform making the mapping suitable for single nucleotide variant (SNV) detection. The analysis revealed a single non-silent SNV A10665G leading to the amino acid change D......Next Generation Sequencing (NGS) is becoming more adopted into viral research and will be the preferred technology in the years to come. We have recently sequenced several strains of Classical Swine Fever Virus (CSFV) by NGS on both Genome Sequencer FLX (GS FLX) and Iontorrent PGM platforms...
Directory of Open Access Journals (Sweden)
Andrea Giordano
Full Text Available BACKGROUND: Paspalum dilatatum Poir. (common name dallisgrass is a native grass species of South America, with special relevance to dairy and red meat production. P. dilatatum exhibits higher forage quality than other C4 forage grasses and is tolerant to frost and water stress. This species is predominantly cultivated in an apomictic monoculture, with an inherent high risk that biotic and abiotic stresses could potentially devastate productivity. Therefore, advanced breeding strategies that characterise and use available genetic diversity, or assess germplasm collections effectively are required to deliver advanced cultivars for production systems. However, there are limited genomic resources available for this forage grass species. RESULTS: Transcriptome sequencing using second-generation sequencing platforms has been employed using pooled RNA from different tissues (stems, roots, leaves and inflorescences at the final reproductive stage of P. dilatatum cultivar Primo. A total of 324,695 sequence reads were obtained, corresponding to c. 102 Mbp. The sequences were assembled, generating 20,169 contigs of a combined length of 9,336,138 nucleotides. The contigs were BLAST analysed against the fully sequenced grass species of Oryza sativa subsp. japonica, Brachypodium distachyon, the closely related Sorghum bicolor and foxtail millet (Setaria italica genomes as well as against the UniRef 90 protein database allowing a comprehensive gene ontology analysis to be performed. The contigs generated from the transcript sequencing were also analysed for the presence of simple sequence repeats (SSRs. A total of 2,339 SSR motifs were identified within 1,989 contigs and corresponding primer pairs were designed. Empirical validation of a cohort of 96 SSRs was performed, with 34% being polymorphic between sexual and apomictic biotypes. CONCLUSIONS: The development of genetic and genomic resources for P. dilatatum will contribute to gene discovery and expression
eShadow: A tool for comparing closely related sequences
Energy Technology Data Exchange (ETDEWEB)
Ovcharenko, Ivan; Boffelli, Dario; Loots, Gabriela G.
2004-01-15
Primate sequence comparisons are difficult to interpret due to the high degree of sequence similarity shared between such closely related species. Recently, a novel method, phylogenetic shadowing, has been pioneered for predicting functional elements in the human genome through the analysis of multiple primate sequence alignments. We have expanded this theoretical approach to create a computational tool, eShadow, for the identification of elements under selective pressure in multiple sequence alignments of closely related genomes, such as in comparisons of human to primate or mouse to rat DNA. This tool integrates two different statistical methods and allows for the dynamic visualization of the resulting conservation profile. eShadow also includes a versatile optimization module capable of training the underlying Hidden Markov Model to differentially predict functional sequences. This module grants the tool high flexibility in the analysis of multiple sequence alignments and in comparing sequences with different divergence rates. Here, we describe the eShadow comparative tool and its potential uses for analyzing both multiple nucleotide and protein alignments to predict putative functional elements. The eShadow tool is publicly available at http://eshadow.dcode.org/
Sequence variations in the FAD2 gene in seeded pumpkins.
Ge, Y; Chang, Y; Xu, W L; Cui, C S; Qu, S P
2015-12-21
Seeded pumpkins are important economic crops; the seeds contain various unsaturated fatty acids, such as oleic acid and linoleic acid, which are crucial for human and animal nutrition. The fatty acid desaturase-2 (FAD2) gene encodes delta-12 desaturase, which converts oleic acid to linoleic acid. However, little is known about sequence variations in FAD2 in seeded pumpkins. Twenty-seven FAD2 clones from 27 accessions of Cucurbita moschata, Cucurbita maxima, Cucurbita pepo, and Cucurbita ficifolia were obtained (totally 1152 bp; a single gene without introns). More than 90% nucleotide identities were detected among the 27 FAD2 clones. Nucleotide substitution, rather than nucleotide insertion and deletion, led to sequence polymorphism in the 27 FAD2 clones. Furthermore, the 27 FAD2 selected clones all encoded the FAD2 enzyme (delta-12 desaturase) with amino acid sequence identities from 91.7 to 100% for 384 amino acids. The same main-function domain between 47 and 329 amino acids was identified. The four species clustered separately based on differences in the sequences that were identified using the unweighted pair group method with arithmetic mean. Geographic origin and species were found to be closely related to sequence variation in FAD2.
Cloning and sequencing of the casein kinase 2 alpha subunit from Zea mays
DEFF Research Database (Denmark)
Dobrowolska, G; Boldyreff, B; Issinger, O G
1991-01-01
The nucleotide sequence of the cDNA coding for the alpha subunit of casein kinase 2 of Zea mays has been determined. The cDNA clone contains an open reading frame of 996 nucleotides encoding a polypeptide comprising 332 amino acids. The primary amino acid sequence exhibits 75% identity to the alpha...... subunit and 71% identity to the alpha' subunit of human casein kinase 2....
Rampersad, Sephra N; Hosein, Fazeeda N; Carrington, Christine Vf
2014-01-01
The Colletotrichum gloeosporioides species complex is among the most destructive fungal plant pathogens in the world, however, identification of isolates of quarantine importance to the intra-specific level is confounded by a number of factors that affect phylogenetic reconstruction. Information bias and quality parameters were investigated to determine whether nucleotide sequence alignments and phylogenetic trees accurately reflect the genetic diversity and phylogenetic relatedness of individuals. Sequence exploration of GAPDH, ACT, TUB2 and ITS markers indicated that the query sequences had different patterns of nucleotide substitution but were without evidence of base substitution saturation. Regions of high entropy were much more dispersed in the ACT and GAPDH marker alignments than for the ITS and TUB2 markers. A discernible bimodal gap in the genetic distance frequency histograms was produced for the ACT and GAPDH markers which indicated successful separation of intra- and inter-specific sequences in the data set. Overall, analyses indicated clear differences in the ability of these markers to phylogenetically separate individuals to the intra-specific level which coincided with information bias.
Quantum-Sequencing: Biophysics of quantum tunneling through nucleic acids
Casamada Ribot, Josep; Chatterjee, Anushree; Nagpal, Prashant
2014-03-01
Tunneling microscopy and spectroscopy has extensively been used in physical surface sciences to study quantum tunneling to measure electronic local density of states of nanomaterials and to characterize adsorbed species. Quantum-Sequencing (Q-Seq) is a new method based on tunneling microscopy for electronic sequencing of single molecule of nucleic acids. A major goal of third-generation sequencing technologies is to develop a fast, reliable, enzyme-free single-molecule sequencing method. Here, we present the unique ``electronic fingerprints'' for all nucleotides on DNA and RNA using Q-Seq along their intrinsic biophysical parameters. We have analyzed tunneling spectra for the nucleotides at different pH conditions and analyzed the HOMO, LUMO and energy gap for all of them. In addition we show a number of biophysical parameters to further characterize all nucleobases (electron and hole transition voltage and energy barriers). These results highlight the robustness of Q-Seq as a technique for next-generation sequencing.
Kumar, A; Kumar, J; Khan, J A
2010-04-01
Diseased cotton plants showing typical leaf curl symptoms were collected from experimental plot of Agriculture Research Station-Sriganganagar, Rajasthan. Complete DNA-A component from samples taken from two areas were amplified through rolling circle amplification (RCA) using templiphi kit (GE Healthcare) and characterized. DNA-A of one isolate consists of 2751 nucleotides and second isolate of 2759 nucleotide. Both sequences comprised six ORF's. Genome organization of DNA-A of one isolate shows high sequence similarity with other characterized local begomovirus isolates of Rajasthan, while other isolate shows high sequence similarity with CLCuV reported from Pakistan. The maximum similarity of first isolate, CLCuV-SG01, shows highest sequence identity with Cotton leaf curl Abohar (Rajasthan) virus, and second isolate, CLCuV-SG02, shows highest sequence identity with cotton leaf curl virus from Pakistan. Both isolates showed 85% similarities with each other. The sequence data revealed probable infiltration of some strains of Cotton leaf curl virus from Pakistan to India, or co-existence of different isolates under similar geographical conditions. While CLCuV-SG01 shows highest nt sequence similarity with CLCuV Rajasthan (Abohar), nt identity of V1 ORF (encoding coat protein) of SG01 shows the highest nt identity (100%) with CLCuV Multan (Bhatinda) and Abohar virus while AC1 region also showed difference. Complete nucleotide sequence of SG01 shows only 86% similarity with CLCuV Multan virus. Similarity search revealed significant difference in AV1 and AC1 regions with respect to DNA-A suggesting an evolutionary history of recombination. Computer based analysis, recombination detection Program (RDP) supports the recombination hypothesis, indicated that recombination with other begomoviruses had taken place within V1 ORF and AC1 ORF of CLCuV-SG01 and AC1 ORF of CLCuV-SG02 and also in noncoding intergenic region (IR).
Johnston, Christine; Magaret, Amalia; Roychoudhury, Pavitra; Greninger, Alexander L; Cheng, Anqi; Diem, Kurt; Fitzgibbon, Matthew P; Huang, Meei-Li; Selke, Stacy; Lingappa, Jairam R; Celum, Connie; Jerome, Keith R; Wald, Anna; Koelle, David M
2017-10-01
Understanding the variability in circulating herpes simplex virus type 2 (HSV-2) genomic sequences is critical to the development of HSV-2 vaccines. Genital lesion swabs containing ≥ 10 7 log 10 copies HSV DNA collected from Africa, the USA, and South America underwent next-generation sequencing, followed by K-mer based filtering and de novo genomic assembly. Sites of heterogeneity within coding regions in unique long and unique short (U L _U S ) regions were identified. Phylogenetic trees were created using maximum likelihood reconstruction. Among 46 samples from 38 persons, 1468 intragenic base-pair substitutions were identified. The maximum nucleotide distance between strains for concatenated U L_ U S segments was 0.4%. Phylogeny did not reveal geographic clustering. The most variable proteins had non-synonymous mutations in < 3% of amino acids. Unenriched HSV-2 DNA can undergo next-generation sequencing to identify intragenic variability. The use of clinical swabs for sequencing expands the information that can be gathered directly from these specimens. Copyright © 2017 Elsevier Inc. All rights reserved.
Genome-wide patterns of nucleotide polymorphism in domesticated rice
DEFF Research Database (Denmark)
Caicedo, Ana L; Williamson, Scott H; Hernandez, Ryan D
2007-01-01
Domesticated Asian rice (Oryza sativa) is one of the oldest domesticated crop species in the world, having fed more people than any other plant in human history. We report the patterns of DNA sequence variation in rice and its wild ancestor, O. rufipogon, across 111 randomly chosen gene fragments......, and use these to infer the evolutionary dynamics that led to the origins of rice. There is a genome-wide excess of high-frequency derived single nucleotide polymorphisms (SNPs) in O. sativa varieties, a pattern that has not been reported for other crop species. We developed several alternative models...... to explain contemporary patterns of polymorphisms in rice, including a (i) selectively neutral population bottleneck model, (ii) bottleneck plus migration model, (iii) multiple selective sweeps model, and (iv) bottleneck plus selective sweeps model. We find that a simple bottleneck model, which has been...
Screening of whole genome sequences identified high-impact variants for stallion fertility.
Schrimpf, Rahel; Gottschalk, Maren; Metzger, Julia; Martinsson, Gunilla; Sieme, Harald; Distl, Ottmar
2016-04-14
Stallion fertility is an economically important trait due to the increase of artificial insemination in horses. The availability of whole genome sequence data facilitates identification of rare high-impact variants contributing to stallion fertility. The aim of our study was to genotype rare high-impact variants retrieved from next-generation sequencing (NGS)-data of 11 horses in order to unravel harmful genetic variants in large samples of stallions. Gene ontology (GO) terms and search results from public databases were used to obtain a comprehensive list of human und mice genes predicted to participate in the regulation of male reproduction. The corresponding equine orthologous genes were searched in whole genome sequence data of seven stallions and four mares and filtered for high-impact genetic variants using SnpEFF, SIFT and Polyphen 2 software. All genetic variants with the missing homozygous mutant genotype were genotyped on 337 fertile stallions of 19 breeds using KASP genotyping assays or PCR-RFLP. Mixed linear model analysis was employed for an association analysis with de-regressed estimated breeding values of the paternal component of the pregnancy rate per estrus (EBV-PAT). We screened next generation sequenced data of whole genomes from 11 horses for equine genetic variants in 1194 human and mice genes involved in male fertility and linked through common gene ontology (GO) with male reproductive processes. Variants were filtered for high-impact on protein structure and validated through SIFT and Polyphen 2. Only those genetic variants were followed up when the homozygote mutant genotype was missing in the detection sample comprising 11 horses. After this filtering process, 17 single nucleotide polymorphism (SNPs) were left. These SNPs were genotyped in 337 fertile stallions of 19 breeds using KASP genotyping assays or PCR-RFLP. An association analysis in 216 Hanoverian stallions revealed a significant association of the splice-site disruption variant
Directory of Open Access Journals (Sweden)
Manju Soman
2018-04-01
Full Text Available Aim: This study aims at cloning, sequencing, and phylogenetic analysis of a partial CDS of ligA gene in pET-32a - Escherichia coli DH5α system, with the objective of identifying the conserved nature of the ligA gene in the genus Leptospira. Materials and Methods: A partial CDS (nucleotide 1873 to nucleotide 3363 of the ligA gene was amplified from genomic DNA of Leptospira interrogans serovar Canicola by polymerase chain reaction (PCR. The PCR-amplified DNA was cloned into pET-32a vector and transformed into competent E. coli DH5α bacterial cells. The partial ligA gene insert was sequenced and the nucleotide sequences obtained were aligned with the published ligA gene sequences of other Leptospira serovars, using nucleotide BLAST, NCBI. Phylogenetic analysis of the gene sequence was done by maximum likelihood method using Mega 6.06 software. Results: The PCR could amplify the 1491 nucleotide sequence spanning from nucleotide 1873 to nucleotide 3363 of the ligA gene and the partial ligA gene could be successfully cloned in E. coli DH5α cells. The nucleotide sequence when analyzed for homology with the reported gene sequences of other Leptospira serovars was found to have 100% homology to the 1910 bp to 3320 bp sequence of ligA gene of L. interrogans strain Kito serogroup Canicola. The predicted protein consisted of 470 aminoacids. Phylogenetic analysis revealed that the ligA gene was conserved in L. interrogans species. Conclusion: The partial ligA gene could be successfully cloned and sequenced from E. coli DH5α cells. The sequence showed 100% homology to the published ligA gene sequences. The phylogenetic analysis revealed the conserved nature of the ligA gene. Further studies on the expression and immunogenicity of the partial LigA protein need to be carried out to determine its competence as a subunit vaccine candidate.
Technical Considerations for Reduced Representation Bisulfite Sequencing with Multiplexed Libraries
Chatterjee, Aniruddha; Rodger, Euan J.; Stockwell, Peter A.; Weeks, Robert J.; Morison, Ian M.
2012-01-01
Reduced representation bisulfite sequencing (RRBS), which couples bisulfite conversion and next generation sequencing, is an innovative method that specifically enriches genomic regions with a high density of potential methylation sites and enables investigation of DNA methylation at single-nucleotide resolution. Recent advances in the Illumina DNA sample preparation protocol and sequencing technology have vastly improved sequencing throughput capacity. Although the new Illumina technology is now widely used, the unique challenges associated with multiplexed RRBS libraries on this platform have not been previously described. We have made modifications to the RRBS library preparation protocol to sequence multiplexed libraries on a single flow cell lane of the Illumina HiSeq 2000. Furthermore, our analysis incorporates a bioinformatics pipeline specifically designed to process bisulfite-converted sequencing reads and evaluate the output and quality of the sequencing data generated from the multiplexed libraries. We obtained an average of 42 million paired-end reads per sample for each flow-cell lane, with a high unique mapping efficiency to the reference human genome. Here we provide a roadmap of modifications, strategies, and trouble shooting approaches we implemented to optimize sequencing of multiplexed libraries on an a RRBS background. PMID:23193365
MSuPDA: A Memory Efficient Algorithm for Sequence Alignment.
Khan, Mohammad Ibrahim; Kamal, Md Sarwar; Chowdhury, Linkon
2016-03-01
Space complexity is a million dollar question in DNA sequence alignments. In this regard, memory saving under pushdown automata can help to reduce the occupied spaces in computer memory. Our proposed process is that anchor seed (AS) will be selected from given data set of nucleotide base pairs for local sequence alignment. Quick splitting techniques will separate the AS from all the DNA genome segments. Selected AS will be placed to pushdown automata's (PDA) input unit. Whole DNA genome segments will be placed into PDA's stack. AS from input unit will be matched with the DNA genome segments from stack of PDA. Match, mismatch and indel of nucleotides will be popped from the stack under the control unit of pushdown automata. During the POP operation on stack, it will free the memory cell occupied by the nucleotide base pair.
Dass, J Febin Prabhu; Sudandiradoss, C
2012-07-15
5-HT (5-Hydroxy-tryptamine) or serotonin receptors are found both in central and peripheral nervous system as well as in non-neuronal tissues. In the animal and human nervous system, serotonin produces various functional effects through a variety of membrane bound receptors. In this study, we focus on 5-HT receptor family from different mammals and examined the factors that account for codon and nucleotide usage variation. A total of 110 homologous coding sequences from 11 different mammalian species were analyzed using relative synonymous codon usage (RSCU), correspondence analysis (COA) and hierarchical cluster analysis together with nucleotide base usage frequency of chemically similar amino acid codons. The mean effective number of codon (ENc) value of 37.06 for 5-HT(6) shows very high codon bias within the family and may be due to high selective translational efficiency. The COA and Spearman's rank correlation reveals that the nucleotide compositional mutation bias as the major factors influencing the codon usage in serotonin receptor genes. The hierarchical cluster analysis suggests that gene function is another dominant factor that affects the codon usage bias, while species is a minor factor. Nucleotide base usage was reported using Goldman, Engelman, Stietz (GES) scale reveals the presence of high uracil (>45%) content at functionally important hydrophobic regions. Our in silico approach will certainly help for further investigations on critical inference on evolution, structure, function and gene expression aspects of 5-HT receptors family which are potential antipsychotic drug targets. Copyright © 2012 Elsevier B.V. All rights reserved.
High-Throughput Next-Generation Sequencing of Polioviruses
Montmayeur, Anna M.; Schmidt, Alexander; Zhao, Kun; Magaña, Laura; Iber, Jane; Castro, Christina J.; Chen, Qi; Henderson, Elizabeth; Ramos, Edward; Shaw, Jing; Tatusov, Roman L.; Dybdahl-Sissoko, Naomi; Endegue-Zanga, Marie Claire; Adeniji, Johnson A.; Oberste, M. Steven; Burns, Cara C.
2016-01-01
ABSTRACT The poliovirus (PV) is currently targeted for worldwide eradication and containment. Sanger-based sequencing of the viral protein 1 (VP1) capsid region is currently the standard method for PV surveillance. However, the whole-genome sequence is sometimes needed for higher resolution global surveillance. In this study, we optimized whole-genome sequencing protocols for poliovirus isolates and FTA cards using next-generation sequencing (NGS), aiming for high sequence coverage, efficiency, and throughput. We found that DNase treatment of poliovirus RNA followed by random reverse transcription (RT), amplification, and the use of the Nextera XT DNA library preparation kit produced significantly better results than other preparations. The average viral reads per total reads, a measurement of efficiency, was as high as 84.2% ± 15.6%. PV genomes covering >99 to 100% of the reference length were obtained and validated with Sanger sequencing. A total of 52 PV genomes were generated, multiplexing as many as 64 samples in a single Illumina MiSeq run. This high-throughput, sequence-independent NGS approach facilitated the detection of a diverse range of PVs, especially for those in vaccine-derived polioviruses (VDPV), circulating VDPV, or immunodeficiency-related VDPV. In contrast to results from previous studies on other viruses, our results showed that filtration and nuclease treatment did not discernibly increase the sequencing efficiency of PV isolates. However, DNase treatment after nucleic acid extraction to remove host DNA significantly improved the sequencing results. This NGS method has been successfully implemented to generate PV genomes for molecular epidemiology of the most recent PV isolates. Additionally, the ability to obtain full PV genomes from FTA cards will aid in facilitating global poliovirus surveillance. PMID:27927929
Directory of Open Access Journals (Sweden)
Jonathon Blake
Full Text Available Balanced chromosome abnormalities (BCAs occur at a high frequency in healthy and diseased individuals, but cost-efficient strategies to identify BCAs and evaluate whether they contribute to a phenotype have not yet become widespread. Here we apply genome-wide mate-pair library sequencing to characterize structural variation in a patient with unclear neurodevelopmental disease (NDD and complex de novo BCAs at the karyotype level. Nucleotide-level characterization of the clinically described BCA breakpoints revealed disruption of at least three NDD candidate genes (LINC00299, NUP205, PSMD14 that gave rise to abnormal mRNAs and could be assumed as disease-causing. However, unbiased genome-wide analysis of the sequencing data for cryptic structural variation was key to reveal an additional submicroscopic inversion that truncates the schizophrenia- and bipolar disorder-associated brain transcription factor ZNF804A as an equally likely NDD-driving gene. Deep sequencing of fluorescent-sorted wild-type and derivative chromosomes confirmed the clinically undetected BCA. Moreover, deep sequencing further validated a high accuracy of mate-pair library sequencing to detect structural variants larger than 10 kB, proposing that this approach is powerful for clinical-grade genome-wide structural variant detection. Our study supports previous evidence for a role of ZNF804A in NDD and highlights the need for a more comprehensive assessment of structural variation in karyotypically abnormal individuals and patients with neurocognitive disease to avoid diagnostic deception.
Blake, Jonathon; Riddell, Andrew; Theiss, Susanne; Gonzalez, Alexis Perez; Haase, Bettina; Jauch, Anna; Janssen, Johannes W. G.; Ibberson, David; Pavlinic, Dinko; Moog, Ute; Benes, Vladimir; Runz, Heiko
2014-01-01
Balanced chromosome abnormalities (BCAs) occur at a high frequency in healthy and diseased individuals, but cost-efficient strategies to identify BCAs and evaluate whether they contribute to a phenotype have not yet become widespread. Here we apply genome-wide mate-pair library sequencing to characterize structural variation in a patient with unclear neurodevelopmental disease (NDD) and complex de novo BCAs at the karyotype level. Nucleotide-level characterization of the clinically described BCA breakpoints revealed disruption of at least three NDD candidate genes (LINC00299, NUP205, PSMD14) that gave rise to abnormal mRNAs and could be assumed as disease-causing. However, unbiased genome-wide analysis of the sequencing data for cryptic structural variation was key to reveal an additional submicroscopic inversion that truncates the schizophrenia- and bipolar disorder-associated brain transcription factor ZNF804A as an equally likely NDD-driving gene. Deep sequencing of fluorescent-sorted wild-type and derivative chromosomes confirmed the clinically undetected BCA. Moreover, deep sequencing further validated a high accuracy of mate-pair library sequencing to detect structural variants larger than 10 kB, proposing that this approach is powerful for clinical-grade genome-wide structural variant detection. Our study supports previous evidence for a role of ZNF804A in NDD and highlights the need for a more comprehensive assessment of structural variation in karyotypically abnormal individuals and patients with neurocognitive disease to avoid diagnostic deception. PMID:24625750
Masking as an effective quality control method for next-generation sequencing data analysis.
Yun, Sajung; Yun, Sijung
2014-12-13
Next generation sequencing produces base calls with low quality scores that can affect the accuracy of identifying simple nucleotide variation calls, including single nucleotide polymorphisms and small insertions and deletions. Here we compare the effectiveness of two data preprocessing methods, masking and trimming, and the accuracy of simple nucleotide variation calls on whole-genome sequence data from Caenorhabditis elegans. Masking substitutes low quality base calls with 'N's (undetermined bases), whereas trimming removes low quality bases that results in a shorter read lengths. We demonstrate that masking is more effective than trimming in reducing the false-positive rate in single nucleotide polymorphism (SNP) calling. However, both of the preprocessing methods did not affect the false-negative rate in SNP calling with statistical significance compared to the data analysis without preprocessing. False-positive rate and false-negative rate for small insertions and deletions did not show differences between masking and trimming. We recommend masking over trimming as a more effective preprocessing method for next generation sequencing data analysis since masking reduces the false-positive rate in SNP calling without sacrificing the false-negative rate although trimming is more commonly used currently in the field. The perl script for masking is available at http://code.google.com/p/subn/. The sequencing data used in the study were deposited in the Sequence Read Archive (SRX450968 and SRX451773).
Energy Technology Data Exchange (ETDEWEB)
Kishimoto, Toshimitsu; Okajima, Hideki; Okumoto, Takeki [Yoshitomi Pharmaceutical Industries, Ltd., Saitama (Japan); Taniguchi, Masaru [Chiba Univ. (Japan)
1989-06-12
The human monoclonal antibody secreted from 4G12 hybridoma cells has broad reactivity to malignant tumor cells, especially for lung squamous cell carcinomas, and recognizes a new tumor-associated and differentiation antigen. The antigen detected by 4G12 is a glycoprotein with MW 195,000 and MW 65,000 under nonreducing and reducing conditions, respectively. Screening of a 4G12 {lambda}gt10 cDNA library with constant region probes for human immunoglobulin yielded full length clones for H- and L-chains. Nucleotide sequences revealed that subtypes of the variable regions were V{sub HIII} and {lambda}{sub 1}, respectively.
Vanni, Irene; Coco, Simona; Truini, Anna; Rusmini, Marta; Dal Bello, Maria Giovanna; Alama, Angela; Banelli, Barbara; Mora, Marco; Rijavec, Erika; Barletta, Giulia; Genova, Carlo; Biello, Federica; Maggioni, Claudia; Grossi, Francesco
2015-12-03
Next-generation sequencing (NGS) is a cost-effective technology capable of screening several genes simultaneously; however, its application in a clinical context requires an established workflow to acquire reliable sequencing results. Here, we report an optimized NGS workflow analyzing 22 lung cancer-related genes to sequence critical samples such as DNA from formalin-fixed paraffin-embedded (FFPE) blocks and circulating free DNA (cfDNA). Snap frozen and matched FFPE gDNA from 12 non-small cell lung cancer (NSCLC) patients, whose gDNA fragmentation status was previously evaluated using a multiplex PCR-based quality control, were successfully sequenced with Ion Torrent PGM™. The robust bioinformatic pipeline allowed us to correctly call both Single Nucleotide Variants (SNVs) and indels with a detection limit of 5%, achieving 100% specificity and 96% sensitivity. This workflow was also validated in 13 FFPE NSCLC biopsies. Furthermore, a specific protocol for low input gDNA capable of producing good sequencing data with high coverage, high uniformity, and a low error rate was also optimized. In conclusion, we demonstrate the feasibility of obtaining gDNA from FFPE samples suitable for NGS by performing appropriate quality controls. The optimized workflow, capable of screening low input gDNA, highlights NGS as a potential tool in the detection, disease monitoring, and treatment of NSCLC.
Complete sequence analysis reveals two distinct poleroviruses infecting cucurbits in China.
Xiang, Hai-ying; Shang, Qiao-xia; Han, Cheng-gui; Li, Da-wei; Yu, Jia-lin
2008-01-01
The complete RNA genomes of a Chinese isolate of cucurbit aphid-borne yellows virus (CABYV-CHN) and a new polerovirus tentatively referred to as melon aphid-borne yellows virus (MABYV) were determined. The entire genome of CABYV-CHN shared 89.0% nucleotide sequence identity with the French CABYV isolate. In contrast, nucleotide sequence identities between MABYV and CABYV and other poleroviruses were in the range of 50.7-74.2%, with amino acid sequence identities ranging from 24.8 to 82.9% for individual gene products. We propose that CABYV-CHN is a strain of CABYV and that MABYV is a member of a tentative distinct species within the genus Polerovirus.
Cloning and sequencing of Indian Water buffalo (Bubalus bubalis) interleukin-3 cDNA
Sugumar, Thennarasu
2011-12-12
Full-length cDNA (435 bp) of the interleukin-3(IL-3) gene of the Indian water buffalo was amplified by reverse transcriptase-polymerase chain reaction and sequenced. This sequence had 96% nucleotide identity and 92% amino acid identity with bovine IL-3. There are 10 amino acid substitutions in buffalo compared with that of bovine. The amino acid sequence of buffalo IL-3 also showed very high identity with that of other ruminants, indicating functional cross-reactivity. Structural homology modelling of buffalo IL-3 protein with human IL-3 showed the presence of five helical structures.
Reference genome sequence of the model plant Setaria.
Bennetzen, Jeffrey L; Schmutz, Jeremy; Wang, Hao; Percifield, Ryan; Hawkins, Jennifer; Pontaroli, Ana C; Estep, Matt; Feng, Liang; Vaughn, Justin N; Grimwood, Jane; Jenkins, Jerry; Barry, Kerrie; Lindquist, Erika; Hellsten, Uffe; Deshpande, Shweta; Wang, Xuewen; Wu, Xiaomei; Mitros, Therese; Triplett, Jimmy; Yang, Xiaohan; Ye, Chu-Yu; Mauro-Herrera, Margarita; Wang, Lin; Li, Pinghua; Sharma, Manoj; Sharma, Rita; Ronald, Pamela C; Panaud, Olivier; Kellogg, Elizabeth A; Brutnell, Thomas P; Doust, Andrew N; Tuskan, Gerald A; Rokhsar, Daniel; Devos, Katrien M
2012-05-13
We generated a high-quality reference genome sequence for foxtail millet (Setaria italica). The ∼400-Mb assembly covers ∼80% of the genome and >95% of the gene space. The assembly was anchored to a 992-locus genetic map and was annotated by comparison with >1.3 million expressed sequence tag reads. We produced more than 580 million RNA-Seq reads to facilitate expression analyses. We also sequenced Setaria viridis, the ancestral wild relative of S. italica, and identified regions of differential single-nucleotide polymorphism density, distribution of transposable elements, small RNA content, chromosomal rearrangement and segregation distortion. The genus Setaria includes natural and cultivated species that demonstrate a wide capacity for adaptation. The genetic basis of this adaptation was investigated by comparing five sequenced grass genomes. We also used the diploid Setaria genome to evaluate the ongoing genome assembly of a related polyploid, switchgrass (Panicum virgatum).
Reference genome sequence of the model plant Setaria
Energy Technology Data Exchange (ETDEWEB)
Bennetzen, Jeffrey L [ORNL; Schmutz, Jeremy [Hudson Alpha Institute of Biotechnology; Wang, Hao [University of Georgia, Athens, GA; Percifield, Ryan [University of Georgia, Athens, GA; Hawkins, Jennifer [University of Georgia, Athens, GA; Pontaroli, Ana C. [University of Georgia, Athens, GA; Estep, Matt [University of Georgia, Athens, GA; Feng, Liang [University of Georgia, Athens, GA; Vaughn, Justin N [ORNL; Grimwood, Jane [Hudson Alpha Institute of Biotechnology; Jenkins, Jerry [Hudson Alpha Institute of Biotechnology; Barry, Kerrie [U.S. Department of Energy, Joint Genome Institute; Lindquist, Erika [U.S. Department of Energy, Joint Genome Institute; Hellsten, Uffe [U.S. Department of Energy, Joint Genome Institute; Deshpande, Shweta [U.S. Department of Energy, Joint Genome Institute; Wang, Xuewen [University of Georgia, Athens, GA; Wu, Xiaomei [University of Georgia, Athens, GA; Mitros, Therese [University of California, Berkeley; Triplett, Jimmy [University of Missouri, St. Louis; Yang, Xiaohan [ORNL; Ye, Chuyu [ORNL; Mauro-Herrera, Margarita [Oklahoma State University; Wang, Lin [Cornell University; Li, Pinghua [Cornell University; Sharma, Manoj [University of California, Davis; Sharma, Rita [University of California, Davis; Ronald, Pamela [University of California, Davis; Panaud, Olivier [Universite de Perpignan, Perpignan, France; Kellogg, Elizabeth A. [University of Missouri, St. Louis; Brutnell, Thomas P. [Cornell University; Doust, Andrew N. [Oklahoma State University; Tuskan, Gerald A [ORNL; Rokhsar, Daniel [U.S. Department of Energy, Joint Genome Institute; Devos, Katrien M [ORNL
2012-01-01
We generated a high-quality reference genome sequence for foxtail millet (Setaria italica). The ~400-Mb assembly covers ~80% of the genome and >95% of the gene space. The assembly was anchored to a 992-locus genetic map and was annotated by comparison with >1.3 million expressed sequence tag reads. We produced more than 580 million RNA-Seq reads to facilitate expression analyses. We also sequenced Setaria viridis, the ancestral wild relative of S. italica, and identified regions of differential single-nucleotide polymorphism density, distribution of transposable elements, small RNA content, chromosomal rearrangement and segregation distortion. The genus Setaria includes natural and cultivated species that demonstrate a wide capacity for adaptation. The genetic basis of this adaptation was investigated by comparing five sequenced grass genomes. We also used the diploid Setaria genome to evaluate the ongoing genome assembly of a related polyploid, switchgrass (Panicum virgatum).
Reference genome sequence of the model plant Setaria
Energy Technology Data Exchange (ETDEWEB)
Bennetzen, Jeffrey L [ORNL; Yang, Xiaohan [ORNL; Ye, Chuyu [ORNL; Tuskan, Gerald A [ORNL
2012-01-01
We generated a high-quality reference genome sequence for foxtail millet (Setaria italica). The {approx}400-Mb assembly covers {approx}80% of the genome and >95% of the gene space. The assembly was anchored to a 992-locus genetic map and was annotated by comparison with >1.3 million expressed sequence tag reads. We produced more than 580 million RNA-Seq reads to facilitate expression analyses. We also sequenced Setaria viridis, the ancestral wild relative of S. italica, and identified regions of differential single-nucleotide polymorphism density, distribution of transposable elements, small RNA content, chromosomal rearrangement and segregation distortion. The genus Setaria includes natural and cultivated species that demonstrate a wide capacity for adaptation. The genetic basis of this adaptation was investigated by comparing five sequenced grass genomes. We also used the diploid Setaria genome to evaluate the ongoing genome assembly of a related polyploid, switchgrass (Panicum virgatum).
Symbolic complexity for nucleotide sequences: a sign of the genome structure
International Nuclear Information System (INIS)
Salgado-García, R; Ugalde, E
2016-01-01
We introduce a method for estimating the complexity function (which counts the number of observable words of a given length) of a finite symbolic sequence, which we use to estimate the complexity function of coding DNA sequences for several species of the Hominidae family. In all cases, the obtained symbolic complexities show the same characteristic behavior: exponential growth for small word lengths, followed by linear growth for larger word lengths. The symbolic complexities of the species we consider exhibit a systematic trend in correspondence with the phylogenetic tree. Using our method, we estimate the complexity function of sequences obtained by some known evolution models, and in some cases we observe the characteristic exponential-linear growth of the Hominidae coding DNA complexity. Analysis of the symbolic complexity of sequences obtained from a specific evolution model points to the following conclusion: linear growth arises from the random duplication of large segments during the evolution of the genome, while the decrease in the overall complexity from one species to another is due to a difference in the speed of accumulation of point mutations. (paper)
McAllister, Christine A; Miller, Allison J
2016-07-01
Autopolyploidy, genome duplication within a single lineage, can result in multiple cytotypes within a species. Geographic distributions of cytotypes may reflect the evolutionary history of autopolyploid formation and subsequent population dynamics including stochastic (drift) and deterministic (differential selection among cytotypes) processes. Here, we used a population genomic approach to investigate whether autopolyploidy occurred once or multiple times in Andropogon gerardii, a widespread, North American grass with two predominant cytotypes. Genotyping by sequencing was used to identify single nucleotide polymorphisms (SNPs) in individuals collected from across the geographic range of A. gerardii. Two independent approaches to SNP calling were used: the reference-free UNEAK pipeline and a reference-guided approach based on the sequenced Sorghum bicolor genome. SNPs generated using these pipelines were analyzed independently with genetic distance and clustering. Analyses of the two SNP data sets showed very similar patterns of population-level clustering of A. gerardii individuals: a cluster of A. gerardii individuals from the southern Plains, a northern Plains cluster, and a western cluster. Groupings of individuals corresponded to geographic localities regardless of cytotype: 6x and 9x individuals from the same geographic area clustered together. SNPs generated using reference-guided and reference-free pipelines in A. gerardii yielded unique subsets of genomic data. Both data sets suggest that the 9x cytotype in A. gerardii likely evolved multiple times from 6x progenitors across the range of the species. Genomic approaches like GBS and diverse bioinformatics pipelines used here facilitate evolutionary analyses of complex systems with multiple ploidy levels. © 2016 Botanical Society of America.
Rosinski-Chupin, Isabelle; Sauvage, Elisabeth; Sismeiro, Odile; Villain, Adrien; Da Cunha, Violette; Caliot, Marie-Elise; Dillies, Marie-Agnès; Trieu-Cuot, Patrick; Bouloc, Philippe; Lartigue, Marie-Frédérique; Glaser, Philippe
2015-05-30
Streptococcus agalactiae, or Group B Streptococcus, is a leading cause of neonatal infections and an increasing cause of infections in adults with underlying diseases. In an effort to reconstruct the transcriptional networks involved in S. agalactiae physiology and pathogenesis, we performed an extensive and robust characterization of its transcriptome through a combination of differential RNA-sequencing in eight different growth conditions or genetic backgrounds and strand-specific RNA-sequencing. Our study identified 1,210 transcription start sites (TSSs) and 655 transcript ends as well as 39 riboswitches and cis-regulatory regions, 39 cis-antisense non-coding RNAs and 47 small RNAs potentially acting in trans. Among these putative regulatory RNAs, ten were differentially expressed in response to an acid stress and two riboswitches sensed directly or indirectly the pH modification. Strikingly, 15% of the TSSs identified were associated with the incorporation of pseudo-templated nucleotides, showing that reiterative transcription is a pervasive process in S. agalactiae. In particular, 40% of the TSSs upstream genes involved in nucleotide metabolism show reiterative transcription potentially regulating gene expression, as exemplified for pyrG and thyA encoding the CTP synthase and the thymidylate synthase respectively. This comprehensive map of the transcriptome at the single nucleotide resolution led to the discovery of new regulatory mechanisms in S. agalactiae. It also provides the basis for in depth analyses of transcriptional networks in S. agalactiae and of the regulatory role of reiterative transcription following variations of intra-cellular nucleotide pools.
Co-operation between Polymerases and Nucleotide Synthetases in the RNA World.
Directory of Open Access Journals (Sweden)
Ye Eun Kim
2016-11-01
Full Text Available It is believed that life passed through an RNA World stage in which replication was sustained by catalytic RNAs (ribozymes. The two most obvious types of ribozymes are a polymerase, which uses a neighbouring strand as a template to make a complementary sequence to the template, and a nucleotide synthetase, which synthesizes monomers for use by the polymerase. When a chemical source of monomers is available, the polymerase can survive on its own. When the chemical supply of monomers is too low, nucleotide production by the synthetase is essential and the two ribozymes can only survive when they are together. Here we consider a computational model to investigate conditions under which coexistence and cooperation of these two types of ribozymes is possible. The model considers six types of strands: the two functional sequences, the complementary strands to these sequences (which are required as templates, and non-functional mutants of the two sequences (which act as parasites. Strands are distributed on a two-dimensional lattice. Polymerases replicate strands on neighbouring sites and synthetases produce monomers that diffuse in the local neighbourhood. We show that coexistence of unlinked polymerases and synthetases is possible in this spatial model under conditions in which neither sequence could survive alone; hence, there is a selective force for increasing complexity. Coexistence is dependent on the relative lengths of the two functional strands, the strand diffusion rate, the monomer diffusion rate, and the rate of deleterious mutations. The sensitivity of this two-ribozyme system suggests that evolution of a system of many types of ribozymes would be difficult in a purely spatial model with unlinked genes. We therefore speculate that linkage of genes onto mini-chromosomes and encapsulation of strands in protocells would have been important fairly early in the history of life as a means of enabling more complex systems to evolve.
Bancerz-Kisiel, Agata; Szczerba-Turek, Anna; Platt-Samoraj, Aleksandra; Michalczyk, Maria; Szweda, Wojciech
2017-03-01
Y. enterocolitica is the causative agent of yersiniosis. The objective of the article was a study of single nucleotide polymorphism in the ystB gene of Y. enterocolitica strains isolated from various wild animal species. High-resolution melting (HRM) analysis was applied to identify single nucleotide polymorphism (SNP) of ystB gene fragments of 88 Y. enterocolitica biotype 1A strains isolated from wild boar, roe deer, red deer and wild ducks. HRM analysis revealed 14 different melting profiles - 4 of them were defined as regular genotypes (G1, G2, G3, G4), whereas 10 as variations. 24 of the examined Y. enterocolitica strains were classified as G1, 18 strains as a G2, 21 strains as a G3, and 15 strains as a G4. Nucleotide sequences classified as G1 revealed 100% similarity with the Y. enterocolitica D88145.1 sequence (NCBI). Analysis of G2 revealed one point mutation - transition T111A. One mutation was also found in G3, but SNP was placed in a different gene region - transition G193A. Two SNPs - transitions G92C and T111A - were identified in G4. Direct sequencing of 10 variations revealed 5 new variants of the ystB nucleotide sequence: V1 - transition G129A (3 strains); V2 - transitions T111A and G193A (2 strains); V3 - transitions C118T and G193A (1 strain); V4 - transitions C141A and G193A (2 strains); and V5 characterized by 19 SNPs: G83A, T93A, A109G, G114T, C116T, A123G, T134C, T142G, T144C, A150C, G162A, T165G, T170G, T174A, T177G, G178A, A179G, A184G and G193A (2 strains). The predominant genotype in isolates from wild ducks was G1; in red deer G2; in wild boar G3; in roe deer G1 and G4. The proposed HRM method could be used to analyze Y. enterocolitica biotype 1A strains isolated from different sources, including humans.
Guilfoyle, Amy P; Deshpande, Chandrika N; Schenk, Gerhard; Maher, Megan J; Jormakka, Mika
2014-12-12
GDP release from GTPases is usually extremely slow and is in general assisted by external factors, such as association with guanine exchange factors or membrane-embedded GPCRs (G protein-coupled receptors), which accelerate the release of GDP by several orders of magnitude. Intrinsic factors can also play a significant role; a single amino acid substitution in one of the guanine nucleotide recognition motifs, G5, results in a drastically altered GDP release rate, indicating that the sequence composition of this motif plays an important role in spontaneous GDP release. In the present study, we used the GTPase domain from EcNFeoB (Escherichia coli FeoB) as a model and applied biochemical and structural approaches to evaluate the role of all the individual residues in the G5 loop. Our study confirms that several of the residues in the G5 motif have an important role in the intrinsic affinity and release of GDP. In particular, a T151A mutant (third residue of the G5 loop) leads to a reduced nucleotide affinity and provokes a drastically accelerated dissociation of GDP.
Nucleotide diversity analysis of three major bacterial blight resistance genes in rice.
Directory of Open Access Journals (Sweden)
Waikhom Bimolata
Full Text Available Nucleotide sequence polymorphisms among R gene alleles influence the process of co-evolutionary interaction between host and pathogen by shaping the response of host plants towards invading pathogens. Here, we present the DNA sequence polymorphisms and diversities present among natural alleles of three rice bacterial blight resistance genes, Xa21, Xa26 and xa5. The diversity was examined across different wild relatives and cultivars of Oryza species. Functional significance of selected alleles was evaluated through semi-quantitative reverse transcription polymerase chain reaction and real time PCR. The greatest nucleotide diversity and singleton variable sites (SVS were present in Xa26 (π = 0.01958; SVS = 182 followed by xa5 and Xa21 alleles. The highest frequency of single nucleotide polymorphisms were observed in Xa21 alleles and least in xa5. Transition bias was observed in all the genes and 'G' to 'A' transitions were more favored than other form of transitions. Neutrality tests failed to show the presence of selection at these loci, though negative Tajima's D values indicate the presence of a rare form of polymorphisms. At the interspecies level, O. nivara exhibited more diversity than O. sativa. We have also identified two nearly identical resistant alleles of xa5 and two sequentially identical alleles of Xa21. The alleles of xa5 showed basal levels of expression while Xa21 alleles were functionally not expressed.
A graphical method is presented for displaying how binding proteins and other macromolecules interact with individual bases of nucleotide sequences. Characters representing the sequence are either oriented normally and placed above a line indicating favorable contact, or upside-down and placed below the line indicating unfavorable contact. The positive or negative height of each letter shows the contribution of that base to the average sequence conservation of the binding site, as represented by a sequence logo.
Bergman, Casey M; Haddrill, Penelope R
2015-01-01
To contribute to our general understanding of the evolutionary forces that shape variation in genome sequences in nature, we have sequenced genomes from 50 isofemale lines and six pooled samples from populations of Drosophila melanogaster on three continents. Analysis of raw and reference-mapped reads indicates the quality of these genomic sequence data is very high. Comparison of the predicted and experimentally-determined Wolbachia infection status of these samples suggests that strain or sample swaps are unlikely to have occurred in the generation of these data. Genome sequences are freely available in the European Nucleotide Archive under accession ERP009059. Isofemale lines can be obtained from the Drosophila Species Stock Center.
Energy Technology Data Exchange (ETDEWEB)
Ross, J
1976-09-15
In view of the sensitivity and specificity of the solution hybridization assay for unlabeled globin mRNA a similar technique has been devised to detect radioactive globin mRNA sequences with unlabeled globin cDNA. Several properties of the hybridization reaction are presented since RNA kinetic experiments reported recently depend on the validity of this assay. Data on hybridization analysis of (/sup 3/H)RNA from mouse fetal liver or erythroleukemia cell cytoplasm are presented. These data indicate that the excess cDNA solution assay for radioactive globin mRNA detection is specific for globin mRNA sequences. It can be performed rapidly and is highly reproducible from experiment. It is at least 500-fold less sensitive than the assay for unlabeled globin mRNA, due to the RNAase backgrounds of 0.05 to 0.15 %. However, this limitation has not affected kinetic experiments with non-dividing fetal liver erythroid cells, which synthesize relatively large quantities of globin mRNA.
Chiron: translating nanopore raw signal directly into nucleotide sequence using deep learning
Teng, Haotian; Cao, Minh Duc; Hall, Michael B; Duarte, Tania; Wang, Sheng; Coin, Lachlan J M
2018-01-01
Sequencing by translocating DNA fragments through an array of nanopores is a rapidly maturing technology that offers faster and cheaper sequencing than other approaches. However, accurately deciphering the DNA sequence from the noisy and complex electrical signal is challenging. Here, we report Chiron, the first deep learning model to achieve end-to-end basecalling and directly translate the raw signal to DNA sequence without the error-prone segmentation step. Trained with only a small set of 4,000 reads, we show that our model provides state-of-the-art basecalling accuracy, even on previously unseen species. Chiron achieves basecalling speeds of more than 2,000 bases per second using desktop computer graphics processing units.
Chiron: translating nanopore raw signal directly into nucleotide sequence using deep learning
Teng, Haotian
2018-04-10
Sequencing by translocating DNA fragments through an array of nanopores is a rapidly maturing technology that offers faster and cheaper sequencing than other approaches. However, accurately deciphering the DNA sequence from the noisy and complex electrical signal is challenging. Here, we report Chiron, the first deep learning model to achieve end-to-end basecalling and directly translate the raw signal to DNA sequence without the error-prone segmentation step. Trained with only a small set of 4,000 reads, we show that our model provides state-of-the-art basecalling accuracy, even on previously unseen species. Chiron achieves basecalling speeds of more than 2,000 bases per second using desktop computer graphics processing units.
Wen, Chiu-Ming
2017-08-01
An aquabirnavirus was isolated from diseased marbled eels (Anguilla marmorata; MEIPNV1310) with gill haemorrhages and associated mortality. Its genome segment sequences were obtained through next-generation sequencing and compared with published aquabirnavirus sequences. The results indicated that the genome sequence of MEIPNV1310 contains segment A (3099 nucleotides) and segment B (2789 nucleotides). Phylogenetic analysis showed that MEIPNV1310 is closely related to the infectious pancreatic necrosis Ab strain within genogroup II. This genome sequence is beneficial for studying the geographic distribution and evolution of aquabirnaviruses.
International Nuclear Information System (INIS)
Yagi, A.; Sato, Y.; Miwa, Y.; Kabbash, A.; Moustafa, S.; Shimomura, K.; El-Bassuony, A.
2006-01-01
A comparison of the sequences in an internally transcribed spacer (ITS) 1 region of rDNA between clonally regenerated A.vera and same species in Japan, USA and Egypt revealed the presence of two types of nucleotide sequences, 252 and 254 bps. Based on the findings in the ITS 1 region, A.vera having 252 and 254 bps clearly showed a stable sequence similarity, suggesting high conversation of the base peak sequence in the ITS 1 region. However, frequent base substitutions in the 252 bps samples leaves that came from callus tissue and micropropagated plants were observed around the regions of nucleotide positions 66, 99 and 199-201. The minor deviation in clonally regenerated A.vera may be due to the stage of regeneration and cell specification in cases of the callus tissue. In the present study, the base peak sequence of the Its 1 region of rDNA was adopted as a molecular marker for differentiating A.vera plants from geographically distributed and clonally regenerated A.vera plants and it was suggested that the base peak substitutions in the ITS 1 region may arise from the different nutritional and environmental factors in cultivation and plant growth stages. (author)
Directory of Open Access Journals (Sweden)
Katharina Röltgen
Full Text Available Buruli ulcer (BU is an emerging necrotizing disease of the skin and subcutaneous tissue caused by Mycobacterium ulcerans. While proximity to stagnant or slow flowing water bodies is a risk factor for acquiring BU, the epidemiology and mode of M. ulcerans transmission is poorly understood. Here we have used high-throughput DNA sequencing and comparisons of the genomes of seven M. ulcerans isolates that appeared monomorphic by existing typing methods. We identified a limited number of single nucleotide polymorphisms (SNPs and developed a real-time PCR SNP typing method based on these differences. We then investigated clinical isolates of M. ulcerans on which we had detailed information concerning patient location and time of diagnosis. Within the Densu river basin of Ghana we observed dominance of one clonal complex and local clustering of some of the variants belonging to this complex. These results reveal focal transmission and demonstrate, that micro-epidemiological analyses by SNP typing has great potential to help us understand how M. ulcerans is transmitted.
Complete Genomic Sequence of Border Disease Virus, a Pestivirus from Sheep
Becher, Paul; Orlich, Michaela; Thiel, Heinz-Jürgen
1998-01-01
The genus Pestivirus of the family Flaviviridae comprises three established species, namely, bovine viral diarrhea virus (BVDV), classical swine fever virus (CSFV), and border disease virus from sheep (BDV). In this study, we report the first complete nucleotide sequence of BDV, that of strain X818. The genome is 12,333 nucleotides long and contains one long open reading frame encoding 3,895 amino acids. The 5′ noncoding region (NCR) of BDV X818 consists of 372 nucleotides and is thus similar in length to the 5′ NCR reported for other pestiviruses. The 3′ NCR of X818 is 273 nucleotides long and thereby at least 32 nucleotides longer than the 3′ NCR of pestiviruses analyzed thus far. Within the 3′ NCR of BDV X818, the sequence motif TATTTATTTA was identified at four locations. The same repeat was found at two or three locations within the 3′ NCR of different CSFV isolates but was absent in the 3′ NCR of BVDV. Analysis of five additional BDV strains showed that the 3′ NCR sequences are highly conserved within this species. Comparison of the deduced amino acid sequence of X818 with the ones of other pestiviruses allowed the prediction of polyprotein cleavage sites which were conserved with regard to the structural proteins. It has been reported for two BVDV strains that cleavage at the nonstructural (NS) protein sites 3/4A, 4A/4B, 4B/5A, and 5A/5B is mediated by the NS3 serine protease and for each site a conserved leucine was found at the P1 position followed by either serine or alanine at P1′ (N. Tautz, K. Elbers, D. Stoll, G. Meyers, and H.-J. Thiel, J. Virol. 71:5415–5422, 1997; J. Xu, E. Mendez, P. R. Caron, C. Lin, M. A. Murcko, M. S. Collett, and C. M. Rice, J. Virol. 71:5312–5322). Interestingly, P1′ of the predicted NS5A/5B cleavage site of BDV is represented by an asparagine residue. Transient expression studies demonstrated that this unusual NS5A/5B processing site is efficiently cleaved by the NS3 serine protease of BDV. PMID
Liu, Bin; Liu, Fule; Fang, Longyun; Wang, Xiaolong; Chou, Kuo-Chen
2015-04-15
In order to develop powerful computational predictors for identifying the biological features or attributes of DNAs, one of the most challenging problems is to find a suitable approach to effectively represent the DNA sequences. To facilitate the studies of DNAs and nucleotides, we developed a Python package called representations of DNAs (repDNA) for generating the widely used features reflecting the physicochemical properties and sequence-order effects of DNAs and nucleotides. There are three feature groups composed of 15 features. The first group calculates three nucleic acid composition features describing the local sequence information by means of kmers; the second group calculates six autocorrelation features describing the level of correlation between two oligonucleotides along a DNA sequence in terms of their specific physicochemical properties; the third group calculates six pseudo nucleotide composition features, which can be used to represent a DNA sequence with a discrete model or vector yet still keep considerable sequence-order information via the physicochemical properties of its constituent oligonucleotides. In addition, these features can be easily calculated based on both the built-in and user-defined properties via using repDNA. The repDNA Python package is freely accessible to the public at http://bioinformatics.hitsz.edu.cn/repDNA/. bliu@insun.hit.edu.cn or kcchou@gordonlifescience.org Supplementary data are available at Bioinformatics online. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
Nougairède, Antoine; Joffret, Marie-Line; Deshpande, Jagadish M.; Dubot-Pérès, Audrey; Héraud, Jean-Michel
2014-01-01
Most circulating strains of Human enterovirus 71 (EV-A71) have been classified primarily into three genogroups (A to C) on the basis of genetic divergence between the 1D gene, which encodes the VP1 capsid protein. The aim of the present study was to provide further insights into the diversity of the EV-A71 genogroups following the recent description of highly divergent isolates, in particular those from African countries, including Madagascar. We classified recent EV-A71 isolates by a large comparison of 3,346 VP1 nucleotidic sequences collected from GenBank. Analysis of genetic distances and phylogenetic investigations indicated that some recently-reported isolates did not fall into the genogroups A-C and clustered into three additional genogroups, including one Indian genogroup (genogroup D) and 2 African ones (E and F). Our Bayesian phylogenetic analysis provided consistent data showing that the genogroup D isolates share a recent common ancestor with the members of genogroup E, while the isolates of genogroup F evolved from a recent common ancestor shared with the members of the genogroup B. Our results reveal the wide diversity that exists among EV-A71 isolates and suggest that the number of circulating genogroups is probably underestimated, particularly in developing countries where EV-A71 epidemiology has been poorly studied. PMID:24598878
PseKNC: a flexible web server for generating pseudo K-tuple nucleotide composition.
Chen, Wei; Lei, Tian-Yu; Jin, Dian-Chuan; Lin, Hao; Chou, Kuo-Chen
2014-07-01
The pseudo oligonucleotide composition, or pseudo K-tuple nucleotide composition (PseKNC), can be used to represent a DNA or RNA sequence with a discrete model or vector yet still keep considerable sequence order information, particularly the global or long-range sequence order information, via the physicochemical properties of its constituent oligonucleotides. Therefore, the PseKNC approach may hold very high potential for enhancing the power in dealing with many problems in computational genomics and genome sequence analysis. However, dealing with different DNA or RNA problems may need different kinds of PseKNC. Here, we present a flexible and user-friendly web server for PseKNC (at http://lin.uestc.edu.cn/pseknc/default.aspx) by which users can easily generate many different modes of PseKNC according to their need by selecting various parameters and physicochemical properties. Furthermore, for the convenience of the vast majority of experimental scientists, a step-by-step guide is provided on how to use the current web server to generate their desired PseKNC without the need to follow the complicated mathematical equations, which are presented in this article just for the integrity of PseKNC formulation and its development. It is anticipated that the PseKNC web server will become a very useful tool in computational genomics and genome sequence analysis. Copyright © 2014 Elsevier Inc. All rights reserved.
Olson, Nathan D.; Lund, Steven P.; Zook, Justin M.; Rojas-Cornejo, Fabiola; Beck, Brian; Foy, Carole; Huggett, Jim; Whale, Alexandra S.; Sui, Zhiwei; Baoutina, Anna; Dobeson, Michael; Partis, Lina; Morrow, Jayne B.
2015-01-01
This study presents the results from an interlaboratory sequencing study for which we developed a novel high-resolution method for comparing data from different sequencing platforms for a multi-copy, paralogous gene. The combination of PCR amplification and 16S ribosomal RNA gene (16S rRNA) sequencing has revolutionized bacteriology by enabling rapid identification, frequently without the need for culture. To assess variability between laboratories in sequencing 16S rRNA, six laboratories sequenced the gene encoding the 16S rRNA from Escherichia coli O157:H7 strain EDL933 and Listeria monocytogenes serovar 4b strain NCTC11994. Participants performed sequencing methods and protocols available in their laboratories: Sanger sequencing, Roche 454 pyrosequencing®, or Ion Torrent PGM®. The sequencing data were evaluated on three levels: (1) identity of biologically conserved position, (2) ratio of 16S rRNA gene copies featuring identified variants, and (3) the collection of variant combinations in a set of 16S rRNA gene copies. The same set of biologically conserved positions was identified for each sequencing method. Analytical methods using Bayesian and maximum likelihood statistics were developed to estimate variant copy ratios, which describe the ratio of nucleotides at each identified biologically variable position, as well as the likely set of variant combinations present in 16S rRNA gene copies. Our results indicate that estimated variant copy ratios at biologically variable positions were only reproducible for high throughput sequencing methods. Furthermore, the likely variant combination set was only reproducible with increased sequencing depth and longer read lengths. We also demonstrate novel methods for evaluating variable positions when comparing multi-copy gene sequence data from multiple laboratories generated using multiple sequencing technologies. PMID:27077030
Directory of Open Access Journals (Sweden)
Nathan D. Olson
2015-03-01
Full Text Available This study presents the results from an interlaboratory sequencing study for which we developed a novel high-resolution method for comparing data from different sequencing platforms for a multi-copy, paralogous gene. The combination of PCR amplification and 16S ribosomal RNA gene (16S rRNA sequencing has revolutionized bacteriology by enabling rapid identification, frequently without the need for culture. To assess variability between laboratories in sequencing 16S rRNA, six laboratories sequenced the gene encoding the 16S rRNA from Escherichia coli O157:H7 strain EDL933 and Listeria monocytogenes serovar 4b strain NCTC11994. Participants performed sequencing methods and protocols available in their laboratories: Sanger sequencing, Roche 454 pyrosequencing®, or Ion Torrent PGM®. The sequencing data were evaluated on three levels: (1 identity of biologically conserved position, (2 ratio of 16S rRNA gene copies featuring identified variants, and (3 the collection of variant combinations in a set of 16S rRNA gene copies. The same set of biologically conserved positions was identified for each sequencing method. Analytical methods using Bayesian and maximum likelihood statistics were developed to estimate variant copy ratios, which describe the ratio of nucleotides at each identified biologically variable position, as well as the likely set of variant combinations present in 16S rRNA gene copies. Our results indicate that estimated variant copy ratios at biologically variable positions were only reproducible for high throughput sequencing methods. Furthermore, the likely variant combination set was only reproducible with increased sequencing depth and longer read lengths. We also demonstrate novel methods for evaluating variable positions when comparing multi-copy gene sequence data from multiple laboratories generated using multiple sequencing technologies.
Lombardo, Katharine A; Coffey, David G; Morales, Alicia J; Carlson, Christopher S; Towlerton, Andrea M H; Gerdts, Sarah E; Nkrumah, Francis K; Neequaye, Janet; Biggar, Robert J; Orem, Jackson; Casper, Corey; Mbulaiteye, Sam M; Bhatia, Kishor G; Warren, Edus H
2017-03-28
Burkitt lymphoma (BL), the most common pediatric cancer in sub-Saharan Africa, is a malignancy of antigen-experienced B lymphocytes. High-throughput sequencing (HTS) of the immunoglobulin heavy ( IGH ) and light chain ( IGK / IGL ) loci was performed on genomic DNA from 51 primary BL tumors: 19 from Uganda and 32 from Ghana. Reverse transcription polymerase chain reaction analysis and tumor RNA sequencing (RNAseq) was performed on the Ugandan tumors to confirm and extend the findings from the HTS of tumor DNA. Clonal IGH and IGK / IGL rearrangements were identified in 41 and 46 tumors, respectively. Evidence for rearrangement of the second IGH allele was observed in only 6 of 41 tumor samples with a clonal IGH rearrangement, suggesting that the normal process of biallelic IGHD to IGHJ diversity-joining (DJ) rearrangement is often disrupted in BL progenitor cells. Most tumors, including those with a sole dominant, nonexpressed DJ rearrangement, contained many IGH and IGK / IGL sequences that differed from the dominant rearrangement by < 10 nucleotides, suggesting that the target of ongoing mutagenesis of these loci in BL tumor cells is not limited to expressed alleles. IGHV usage in both BL tumor cohorts revealed enrichment for IGHV genes that are infrequently used in memory B cells from healthy subjects. Analysis of publicly available DNA sequencing and RNAseq data revealed that these same IGHV genes were overrepresented in dominant tumor-associated IGH rearrangements in several independent BL tumor cohorts. These data suggest that BL derives from an abnormal B-cell progenitor and that aberrant mutational processes are active on the immunoglobulin loci in BL cells.
Directory of Open Access Journals (Sweden)
Hae-Ryun Kwak
2015-12-01
Full Text Available Sweet potatoes (Ipomea batatas L. are grown extensively, in tropical and temperate regions, and are important food crops worldwide. In Korea, potyviruses, including Sweet potato feathery mottle virus (SPFMV, Sweet potato virus C (SPVC, Sweet potato virus G (SPVG, Sweet potato virus 2 (SPV2, and Sweet potato latent virus (SPLV, have been detected in sweet potato fields at a high (~95% incidence. In the present work, complete genome sequences of 18 isolates, representing the five potyviruses mentioned above, were compared with previously reported genome sequences. The complete genomes consisted of 10,081 to 10,830 nucleotides, excluding the poly-A tails. Their genomic organizations were typical of the Potyvirus genus, including one target open reading frame coding for a putative polyprotein. Based on phylogenetic analyses and sequence comparisons, the Korean SPFMV isolates belonged to the strains RC and O with >98% nucleotide sequence identity. Korean SPVC isolates had 99% identity to the Japanese isolate SPVC-Bungo and 70% identity to the SPFMV isolates. The Korean SPVG isolates showed 99% identity to the three previously reported SPVG isolates. Korean SPV2 isolates had 97% identity to the SPV2 GWB-2 isolate from the USA. Korean SPLV isolates had a relatively low (88% nucleotide sequence identity with the Taiwanese SPLV-TW isolates, and they were phylogenetically distantly related to SPFMV isolates. Recombination analysis revealed that possible recombination events occurred in the P1, HC-Pro and NIa-NIb regions of SPFMV and SPLV isolates and these regions were identified as hotspots for recombination in the sweet potato potyviruses.
Kobayashi, Masaaki
2017-04-20
Recent availability of large-scale genomic resources enables us to conduct so called genome-wide association studies (GWAS) and genomic prediction (GP) studies, particularly with next-generation sequencing (NGS) data. The effectiveness of GWAS and GP depends on not only their mathematical models, but the quality and quantity of variants employed in the analysis. In NGS single nucleotide polymorphism (SNP) calling, conventional tools ideally require more reads for higher SNP sensitivity and accuracy. In this study, we aimed to develop a tool, Heap, that enables robustly sensitive and accurate calling of SNPs, particularly with a low coverage NGS data, which must be aligned to the reference genome sequences in advance. To reduce false positive SNPs, Heap determines genotypes and calls SNPs at each site except for sites at the both ends of reads or containing a minor allele supported by only one read. Performance comparison with existing tools showed that Heap achieved the highest F-scores with low coverage (7X) restriction-site associated DNA sequencing reads of sorghum and rice individuals. This will facilitate cost-effective GWAS and GP studies in this NGS era. Code and documentation of Heap are freely available from https://github.com/meiji-bioinf/heap (29 March 2017, date last accessed) and our web site (http://bioinf.mind.meiji.ac.jp/lab/en/tools.html (29 March 2017, date last accessed)).
Identification of cyclic nucleotide gated channels using regular expressions
Zelman, Alice K.
2013-09-03
Cyclic nucleotide-gated channels (CNGCs) are nonselective cation channels found in plants, animals, and some bacteria. They have a six-transmembrane/one- pore structure, a cytosolic cyclic nucleotide-binding domain, and a cytosolic calmodulin-binding domain. Despite their functional similarities, the plant CNGC family members appear to have different conserved amino acid motifs within corresponding functional domains than animal and bacterial CNGCs do. Here we describe the development and application of methods employing plant CNGC-specific sequence motifs as diagnostic tools to identify novel candidate channels in different plants. These methods are used to evaluate the validity of annotations of putative orthologs of CNGCs from plant genomes. The methods detail how to employ regular expressions of conserved amino acids in functional domains of annotated CNGCs and together with Web tools such as PHI-BLAST and ScanProsite to identify novel candidate CNGCs in species including Physcomitrella patens. © Springer Science+Business Media New York 2013.
The SWISS-PROT protein sequence data bank: current status.
Bairoch, A; Boeckmann, B
1994-01-01
SWISS-PROT is an annotated protein sequence database established in 1986 and maintained collaboratively, since 1988, by the Department of Medical Biochemistry of the University of Geneva and the EMBL Data Library. The SWISS-PROT protein sequence data bank consist of sequence entries. Sequence entries are composed of different lines types, each with their own format. For standardization purposes the format of SWISS-PROT follows as closely as possible that of the EMBL Nucleotide Sequence Databa...
Using expected sequence features to improve basecalling accuracy of amplicon pyrosequencing data
DEFF Research Database (Denmark)
Rask, Thomas Salhøj; Petersen, Bent; Chen, Donald S.
2016-01-01
. The new basecalling method described here, named Multipass, implements a probabilistic framework for working with the raw flowgrams obtained by pyrosequencing. For each sequence variant Multipass calculates the likelihood and nucleotide sequence of several most likely sequences given the flowgram data....... This probabilistic approach enables integration of basecalling into a larger model where other parameters can be incorporated, such as the likelihood for observing a full-length open reading frame at the targeted region. We apply the method to 454 amplicon pyrosequencing data obtained from a malaria virulence gene...... family, where Multipass generates 20 % more error-free sequences than current state of the art methods, and provides sequence characteristics that allow generation of a set of high confidence error-free sequences. This novel method can be used to increase accuracy of existing and future amplicon...
The characterization of twenty sequenced human genomes.
Directory of Open Access Journals (Sweden)
Kimberly Pelak
2010-09-01
Full Text Available We present the analysis of twenty human genomes to evaluate the prospects for identifying rare functional variants that contribute to a phenotype of interest. We sequenced at high coverage ten "case" genomes from individuals with severe hemophilia A and ten "control" genomes. We summarize the number of genetic variants emerging from a study of this magnitude, and provide a proof of concept for the identification of rare and highly-penetrant functional variants by confirming that the cause of hemophilia A is easily recognizable in this data set. We also show that the number of novel single nucleotide variants (SNVs discovered per genome seems to stabilize at about 144,000 new variants per genome, after the first 15 individuals have been sequenced. Finally, we find that, on average, each genome carries 165 homozygous protein-truncating or stop loss variants in genes representing a diverse set of pathways.
Antinociceptive effect of purine nucleotides.
Mello, C F; Begnini, J; De-La-Vega, D D; Lopes, F P; Schwartz, C C; Jimenez-Bernal, R E; Bellot, R G; Frussa-Filho, R
1996-10-01
The antinociceptive effect of purine nucleotides administered systematically (sc) was determined using the formalin and writhing tests in adult male albino mice. The mechanisms underlying nucleotide-induced antinociception were investigated by preinjecting the animals (sc) with specific antagonists for opioid (naloxone, 1 mg/kg), purinergic P1 (caffeine, 5, 10, of 30 mg/kg); theophylline, 10 mg/kg) or purinergic P2 receptors (suramin, 100 mg/kg; Coomassie blue, 30-300 mg/kg; quinidine, 10 mg/kg). Adenosine, adenosine monophosphate (AMP), diphosphate (ADP) and triphosphate (ATP) caused a reduction in the number of writhes and in the time of licking the formalin-injected paw. Naloxone had no effect on adenosine- or adenine nucleotide-induced antinociception. Caffeine (30 mg/kg) and theophylline (10 mg/kg) reversed the antinociceptive action of adenosine and adenine nucleotide derivatives in both tests. P2 antagonists did not reverse adenine nucleotide-induced antinociception. These results suggest that antinociceptive effect of adenine nucleotides is mediated by adenosine.
Kishine, Masahiro; Tsutsumi, Katsuji; Kitta, Kazumi
2017-12-01
Simple sequence repeat (SSR) is a popular tool for individual fingerprinting. The long-core motif (e.g. tetra-, penta-, and hexa-nucleotide) simple sequence repeats (SSRs) are preferred because they make it easier to separate and distinguish neighbor alleles. In the present study, a new set of 8 tetra-nucleotide SSRs in potato ( Solanum tuberosum ) is reported. By using these 8 markers, 72 out of 76 cultivars obtained from Japan and the United States were clearly discriminated, while two pairs, both of which arose from natural variation, showed identical profiles. The combined probability of identity between two random cultivars for the set of 8 SSR markers was estimated to be 1.10 × 10 -8 , confirming the usefulness of the proposed SSR markers for fingerprinting analyses of potato.
Sequence analysis of putative swrW gene required for surfactant ...
African Journals Online (AJOL)
Serratia marcescens produces biosurfactant serrawettin, essential for its population migration behavior. Serrawettin W1 was revealed to be an antibiotic serratamolide that makes it significant for deoxyribonucleic acid (DNA) and protein sequence analysis. Four nucleotide and amino-acid sequences from local strains ...
Complete genome sequence of Fer-de-Lance Virus reveals a novel gene in reptilian Paramyxoviruses
Kurath, G.; Batts, W.N.; Ahne, W.; Winton, J.R.
2004-01-01
The complete RNA genome sequence of the archetype reptilian paramyxovirus, Fer-de-Lance virus (FDLV), has been determined. The genome is 15,378 nucleotides in length and consists of seven nonoverlapping genes in the order 3??? N-U-P-M-F-HN-L 5???, coding for the nucleocapsid, unknown, phospho-, matrix, fusion, hemagglutinin-neuraminidase, and large polymerase proteins, respectively. The gene junctions contain highly conserved transcription start and stop signal sequences and tri-nucleotide intergenic regions similar to those of other Paramyxoviridae. The FDLV P gene expression strategy is like that of rubulaviruses, which express the accessory V protein from the primary transcript and edit a portion of the mRNA to encode P and I proteins. There is also an overlapping open reading frame potentially encoding a small basic protein in the P gene. The gene designated U (unknown), encodes a deduced protein of 19.4 kDa that has no counterpart in other paramyxoviruses and has no similarity with sequences in the National Center for Biotechnology Information database. Active transcription of the U gene in infected cells was demonstrated by Northern blot analysis, and bicistronic N-U mRNA was also evident. The genomes of two other snake paramyxovirus genotypes were also found to have U genes, with 11 to 16% nucleotide divergence from the FDLV U gene. Pairwise comparisons of amino acid identities and phylogenetic analyses of all deduced FDLV protein sequences with homologous sequences from other Paramyxoviridae indicate that FDLV represents a new genus within the subfamily Paramyxovirinae. We suggest the name Ferlavirus for the new genus, with FDLV as the type species.
Directory of Open Access Journals (Sweden)
Zhang Xinmin
2011-05-01
Full Text Available Abstract Background In highly copy number variable (CNV regions such as the human defensin gene locus, comprehensive assessment of sequence variations is challenging. PCR approaches are practically restricted to tiny fractions, and next-generation sequencing (NGS approaches of whole individual genomes e.g. by the 1000 Genomes Project is confined by an affordable sequence depth. Combining target enrichment with NGS may represent a feasible approach. Results As a proof of principle, we enriched a ~850 kb section comprising the CNV defensin gene cluster DEFB, the invariable DEFA part and 11 control regions from two genomes by sequence capture and sequenced it by 454 technology. 6,651 differences to the human reference genome were found. Comparison to HapMap genotypes revealed sensitivities and specificities in the range of 94% to 99% for the identification of variations. Using error probabilities for rigorous filtering revealed 2,886 unique single nucleotide variations (SNVs including 358 putative novel ones. DEFB CN determinations by haplotype ratios were in agreement with alternative methods. Conclusion Although currently labor extensive and having high costs, target enriched NGS provides a powerful tool for the comprehensive assessment of SNVs in highly polymorphic CNV regions of individual genomes. Furthermore, it reveals considerable amounts of putative novel variations and simultaneously allows CN estimation.
Directory of Open Access Journals (Sweden)
Marais Gabriel AB
2011-07-01
Full Text Available Abstract Background The genus Silene is widely used as a model system for addressing ecological and evolutionary questions in plants, but advances in using the genus as a model system are impeded by the lack of available resources for studying its genome. Massively parallel sequencing cDNA has recently developed into an efficient method for characterizing the transcriptomes of non-model organisms, generating massive amounts of data that enable the study of multiple species in a comparative framework. The sequences generated provide an excellent resource for identifying expressed genes, characterizing functional variation and developing molecular markers, thereby laying the foundations for future studies on gene sequence and gene expression divergence. Here, we report the results of a comparative transcriptome sequencing study of eight individuals representing four Silene and one Dianthus species as outgroup. All sequences and annotations have been deposited in a newly developed and publicly available database called SiESTa, the Silene EST annotation database. Results A total of 1,041,122 EST reads were generated in two runs on a Roche GS-FLX 454 pyrosequencing platform. EST reads were analyzed separately for all eight individuals sequenced and were assembled into contigs using TGICL. These were annotated with results from BLASTX searches and Gene Ontology (GO terms, and thousands of single-nucleotide polymorphisms (SNPs were characterized. Unassembled reads were kept as singletons and together with the contigs contributed to the unigenes characterized in each individual. The high quality of unigenes is evidenced by the proportion (49% that have significant hits in similarity searches with the A. thaliana proteome. The SiESTa database is accessible at http://www.siesta.ethz.ch. Conclusion The sequence collections established in the present study provide an important genomic resource for four Silene and one Dianthus species and will help to
2011-01-01
Background The genus Silene is widely used as a model system for addressing ecological and evolutionary questions in plants, but advances in using the genus as a model system are impeded by the lack of available resources for studying its genome. Massively parallel sequencing cDNA has recently developed into an efficient method for characterizing the transcriptomes of non-model organisms, generating massive amounts of data that enable the study of multiple species in a comparative framework. The sequences generated provide an excellent resource for identifying expressed genes, characterizing functional variation and developing molecular markers, thereby laying the foundations for future studies on gene sequence and gene expression divergence. Here, we report the results of a comparative transcriptome sequencing study of eight individuals representing four Silene and one Dianthus species as outgroup. All sequences and annotations have been deposited in a newly developed and publicly available database called SiESTa, the Silene EST annotation database. Results A total of 1,041,122 EST reads were generated in two runs on a Roche GS-FLX 454 pyrosequencing platform. EST reads were analyzed separately for all eight individuals sequenced and were assembled into contigs using TGICL. These were annotated with results from BLASTX searches and Gene Ontology (GO) terms, and thousands of single-nucleotide polymorphisms (SNPs) were characterized. Unassembled reads were kept as singletons and together with the contigs contributed to the unigenes characterized in each individual. The high quality of unigenes is evidenced by the proportion (49%) that have significant hits in similarity searches with the A. thaliana proteome. The SiESTa database is accessible at http://www.siesta.ethz.ch. Conclusion The sequence collections established in the present study provide an important genomic resource for four Silene and one Dianthus species and will help to further develop Silene as a
Sen, Suman
DNA, RNA and Protein are three pivotal biomolecules in human and other organisms, playing decisive roles in functionality, appearance, diseases development and other physiological phenomena. Hence, sequencing of these biomolecules acquires the prime interest in the scientific community. Single molecular identification of their building blocks can be done by a technique called Recognition Tunneling (RT) based on Scanning Tunneling Microscope (STM). A single layer of specially designed recognition molecule is attached to the STM electrodes, which trap the targeted molecules (DNA nucleoside monophosphates, RNA nucleoside monophosphates or amino acids) inside the STM nanogap. Depending on their different binding interactions with the recognition molecules, the analyte molecules generate stochastic signal trains accommodating their "electronic fingerprints". Signal features are used to detect the molecules using a machine learning algorithm and different molecules can be identified with significantly high accuracy. This, in turn, paves the way for rapid, economical nanopore sequencing platform, overcoming the drawbacks of Next Generation Sequencing (NGS) techniques. To read DNA nucleotides with high accuracy in an STM tunnel junction a series of nitrogen-based heterocycles were designed and examined to check their capabilities to interact with naturally occurring DNA nucleotides by hydrogen bonding in the tunnel junction. These recognition molecules are Benzimidazole, Imidazole, Triazole and Pyrrole. Benzimidazole proved to be best among them showing DNA nucleotide classification accuracy close to 99%. Also, Imidazole reader can read an abasic monophosphate (AP), a product from depurination or depyrimidination that occurs 10,000 times per human cell per day. In another study, I have investigated a new universal reader, 1-(2-mercaptoethyl)pyrene (Pyrene reader) based on stacking interactions, which should be more specific to the canonical DNA nucleosides. In addition
Templated sequence insertion polymorphisms in the human genome
Onozawa, Masahiro; Aplan, Peter
2016-11-01
Templated Sequence Insertion Polymorphism (TSIP) is a recently described form of polymorphism recognized in the human genome, in which a sequence that is templated from a distant genomic region is inserted into the genome, seemingly at random. TSIPs can be grouped into two classes based on nucleotide sequence features at the insertion junctions; Class 1 TSIPs show features of insertions that are mediated via the LINE-1 ORF2 protein, including 1) target-site duplication (TSD), 2) polyadenylation 10-30 nucleotides downstream of a “cryptic” polyadenylation signal, and 3) preference for insertion at a 5’-TTTT/A-3’ sequence. In contrast, class 2 TSIPs show features consistent with repair of a DNA double-strand break via insertion of a DNA “patch” that is derived from a distant genomic region. Survey of a large number of normal human volunteers demonstrates that most individuals have 25-30 TSIPs, and that these TSIPs track with specific geographic regions. Similar to other forms of human polymorphism, we suspect that these TSIPs may be important for the generation of human diversity and genetic diseases.
A single nucleotide mutation in Nppc is associated with a long bone abnormality in lbab mice.
Jiao, Yan; Yan, Jian; Jiao, Feng; Yang, Hongbin; Donahue, Leah Rae; Li, Xinmin; Roe, Bruce A; Stuart, John; Gu, Weikuan
2007-04-17
The long bone abnormality (lbab) mouse is a new autosomal recessive mutant characterized by overall smaller body size with proportionate dwarfing of all organs and shorter long bones. Previous linkage analysis has located the lbab mutation on chromosome 1 between the markers D1Mit9 and D1Mit488. A genome-based positional approach was used to identify a mutation associated with lbab disease. A total of 122 genes and expressed sequence tags at the lbab region were screened for possible mutation by using genomic DNA from lbabl/lbab, lbab/+, and +/+ B6 mice and high throughput temperature gradient capillary electrophoresis. A sequence difference was identified in one of the amplicons of gene Nppc between lbab/lbab and +/+ mice. One-step reverse transcriptase polymerase chain reaction was performed to validate the difference of Nppc in different types of mice at the mRNA level. The mutation of Nppc was unique in lbab/lbab mice among multiple mouse inbred strains. The mutation of Nppc is co-segregated with lbab disease in 200 progenies produced from heterozygous lbab/+ parents. A single nucleotide mutation of Nppc is associated with dwarfism in lbab/lbab mice. Current genome information and technology allow us to efficiently identify single nucleotide mutations from roughly mapped disease loci. The lbab mouse is a useful model for hereditary human achondroplasia.
A single nucleotide mutation in Nppc is associated with a long bone abnormality in lbab mice
Directory of Open Access Journals (Sweden)
Roe Bruce A
2007-04-01
Full Text Available Abstract Background The long bone abnormality (lbab mouse is a new autosomal recessive mutant characterized by overall smaller body size with proportionate dwarfing of all organs and shorter long bones. Previous linkage analysis has located the lbab mutation on chromosome 1 between the markers D1Mit9 and D1Mit488. Results A genome-based positional approach was used to identify a mutation associated with lbab disease. A total of 122 genes and expressed sequence tags at the lbab region were screened for possible mutation by using genomic DNA from lbabl/lbab, lbab/+, and +/+ B6 mice and high throughput temperature gradient capillary electrophoresis. A sequence difference was identified in one of the amplicons of gene Nppc between lbab/lbab and +/+ mice. One-step reverse transcriptase polymerase chain reaction was performed to validate the difference of Nppc in different types of mice at the mRNA level. The mutation of Nppc was unique in lbab/lbab mice among multiple mouse inbred strains. The mutation of Nppc is co-segregated with lbab disease in 200 progenies produced from heterozygous lbab/+ parents. Conclusion A single nucleotide mutation of Nppc is associated with dwarfism in lbab/lbab mice. Current genome information and technology allow us to efficiently identify single nucleotide mutations from roughly mapped disease loci. The lbab mouse is a useful model for hereditary human achondroplasia.
Wang, Zan; Yu, Guohui; Shi, Binbin; Wang, Xuemin; Qiang, Haiping; Gao, Hongwen
2014-01-01
Sufficient codominant genetic markers are needed for various genetic investigations in alfalfa since the species is an outcrossing autotetraploid. With the newly developed next generation sequencing technology, a large amount of transcribed sequences of alfalfa have been generated and are available for identifying SSR markers by data mining. A total of 54,278 alfalfa non-redundant unigenes were assembled through the Illumina HiSeqTM 2000 sequencing technology. Based on 3,903 unigene sequences, 4,493 SSRs were identified. Tri-nucleotide repeats (56.71%) were the most abundant motif class while AG/CT (21.7%), AGG/CCT (19.8%), AAC/GTT (10.3%), ATC/ATG (8.8%), and ACC/GGT (6.3%) were the subsequent top five nucleotide repeat motifs. Eight hundred and thirty- seven EST-SSR primer pairs were successfully designed. Of these, 527 (63%) primer pairs yielded clear and scored PCR products and 372 (70.6%) exhibited polymorphisms. High transferability was observed for ssp falcata at 99.2% (523) and 71.7% (378) in M. truncatula. In addition, 313 of 527 SSR marker sequences were in silico mapped onto the eight M. truncatula chromosomes. Thirty-six polymorphic SSR primer pairs were used in the genetic relatedness analysis of 30 Chinese alfalfa cultivated accessions generating a total of 199 scored alleles. The mean observed heterozygosity and polymorphic information content were 0.767 and 0.635, respectively. The codominant markers not only enriched the current resources of molecular markers in alfalfa, but also would facilitate targeted investigations in marker-trait association, QTL mapping, and genetic diversity analysis in alfalfa. PMID:24642969
Molecular diagnosis of lyssaviruses and sequence comparison of Australian bat lyssavirus samples.
Foord, A J; Heine, H G; Pritchard, L I; Lunt, R A; Newberry, K M; Rootes, C L; Boyle, D B
2006-07-01
To evaluate and implement molecular diagnostic tests for the detection of lyssaviruses in Australia. A published hemi-nested reverse transcriptase polymerase chain reaction (RT-PCR) for the detection of all lyssavirus genotypes was modified to a fully nested RT-PCR format and compared with the original assay. TaqMan assays for the detection of Australian bat lyssavirus (ABLV) were compared with both the nested and hemi-nested RT-PCR assays. The sequences of RT-PCR products were determined to assess sequence variations of the target region (nucleocapsid gene) in samples of ABLV originating from different regions. The nested RT-PCR assay was highly analytically specific, and at least as analytically sensitive as the hemi-nested assay. The TaqMan assays were highly analytically specific and more analytically sensitive than either RT-PCR assay, with a detection level of approximately 10 genome equivalents per microl. Sequence of the first 544 nucleotides of the nucleocapsid protein coding sequence was obtained from all samples of ABLV received at Australian Animal Health Laboratory during the study period. The nested RT-PCR provided a means for molecular diagnosis of all tested genotypes of lyssavirus including classical rabies virus and Australian bat lyssavirus. The published TaqMan assay proved to be superior to the RT-PCR assays for the detection of ABLV in terms of analytical sensitivity. The TaqMan assay would also be faster and cross contamination is less likely. Nucleotide sequence analyses of samples of ABLV from a wide geographical range in Australia demonstrated the conserved nature of this region of the genome and therefore the suitability of this region for molecular diagnosis.
Nucleotide excision repair in the test tube.
N.G.J. Jaspers (Nicolaas); J.H.J. Hoeijmakers (Jan)
1995-01-01
textabstractThe eukaryotic nucleotide excision-repair pathway has been reconstituted in vitro, an achievement that should hasten the full enzymological characterization of this highly complex DNA-repair pathway.
Spreadsheet macros for coloring sequence alignments.
Haygood, M G
1993-12-01
This article describes a set of Microsoft Excel macros designed to color amino acid and nucleotide sequence alignments for review and preparation of visual aids. The colored alignments can then be modified to emphasize features of interest. Procedures for importing and coloring sequences are described. The macro file adds a new menu to the menu bar containing sequence-related commands to enable users unfamiliar with Excel to use the macros more readily. The macros were designed for use with Macintosh computers but will also run with the DOS version of Excel.
Ruhlman, Tracey A; Zhang, Jin; Blazier, John C; Sabir, Jamal S M; Jansen, Robert K
2017-04-01
There is a misinterpretation in the literature regarding the variable orientation of the small single copy region of plastid genomes (plastomes). The common phenomenon of small and large single copy inversion, hypothesized to occur through intramolecular recombination between inverted repeats (IR) in a circular, single unit-genome, in fact, more likely occurs through recombination-dependent replication (RDR) of linear plastome templates. If RDR can be primed through both intra- and intermolecular recombination, then this mechanism could not only create inversion isomers of so-called single copy regions, but also an array of alternative sequence arrangements. We used Illumina paired-end and PacBio single-molecule real-time (SMRT) sequences to characterize repeat structure in the plastome of Monsonia emarginata (Geraniaceae). We used OrgConv and inspected nucleotide alignments to infer ancestral nucleotides and identify gene conversion among repeats and mapped long (>1 kb) SMRT reads against the unit-genome assembly to identify alternative sequence arrangements. Although M. emarginata lacks the canonical IR, we found that large repeats (>1 kilobase; kb) represent ∼22% of the plastome nucleotide content. Among the largest repeats (>2 kb), we identified GC-biased gene conversion and mapping filtered, long SMRT reads to the M. emarginata unit-genome assembly revealed alternative, substoichiometric sequence arrangements. We offer a model based on RDR and gene conversion between long repeated sequences in the M. emarginata plastome and provide support that both intra-and intermolecular recombination between large repeats, particularly in repeat-rich plastomes, varies unit-genome structure while homogenizing the nucleotide sequence of repeats. © 2017 Botanical Society of America.
Adenine nucleotide depletion from endothelial cells exposed to xanthine oxidase
International Nuclear Information System (INIS)
Aalto, T.K.; Raivio, K.O.
1990-01-01
Hypoxia causes breakdown of cellular nucleotides, accumulation of hypoxanthine (HX), and conversion of xanthine dehydrogenase into xanthine oxidase (XO). Upon reoxygenation, the HX-XO reaction generates free radicals, one potential mechanism of tissue damage. Because endothelial cells contain XO and are exposed to circulating HX, they are a likely target for damage. We studied the effect of XO and/or HX at physiologically relevant concentrations on nucleotide metabolism of cultured endothelial cells from human umbilical veins. Cells were labeled with [14C]adenine and incubated for up to 6 h with HX, XO, or both, in the absence or presence of serum. Adenine nucleotides from cell extracts and nucleotide breakdown products (HX, xanthine, and urate) from the medium were separated and counted. HX alone had no effect. XO (80 mU/ml) alone caused a 70% (no serum) or 40% (with serum) fall in adenine nucleotides and an equivalent increase of xanthine and urate. The combination of HX and XO caused a 90% (no serum) or 70% (with serum) decrease in nucleotides, decrease in energy charge, and detachment of cells from the culture plate. Nucleotide depletion was not accounted for by proteolytic activity in the XO preparation. Albumin was only half as effective as serum in preventing nucleotide loss. Thus exogenous XO, in the presence of endogenous HX, triggers adenine nucleotide catabolism, but endogenous XO activity is too low to influence nucleotide levels even at high exogenous HX concentrations. Serum limits the catabolic effect of XO and thus protects cells from free radical damage
Zhou, Wei; Hu, Yiyi; Sui, Zhenghong; Fu, Feng; Wang, Jinguo; Chang, Lianpeng; Guo, Weihua; Li, Binbin
2013-01-01
Gracilariopsis lemaneiformis has a high economic value and is one of the most important aquaculture species in China. Despite it is economic importance, it has remained largely unstudied at the genomic level. In this study, we conducted a genome survey of Gp. lemaneiformis using next-generation sequencing (NGS) technologies. In total, 18.70 Gb of high-quality sequence data with an estimated genome size of 97 Mb were obtained by HiSeq 2000 sequencing for Gp. lemaneiformis. These reads were assembled into 160,390 contigs with a N50 length of 3.64 kb, which were further assembled into 125,685 scaffolds with a total length of 81.17 Mb. Genome analysis predicted 3490 genes and a GC% content of 48%. The identified genes have an average transcript length of 1,429 bp, an average coding sequence size of 1,369 bp, 1.36 exons per gene, exon length of 1,008 bp, and intron length of 191 bp. From the initial assembled scaffold, transposable elements constituted 54.64% (44.35 Mb) of the genome, and 7737 simple sequence repeats (SSRs) were identified. Among these SSRs, the trinucleotide repeat type was the most abundant (up to 73.20% of total SSRs), followed by the di- (17.41%), tetra- (5.49%), hexa- (2.90%), and penta- (1.00%) nucleotide repeat type. These characteristics suggest that Gp. lemaneiformis is a model organism for genetic study. This is the first report of genome-wide characterization within this taxon.
Sui, Zhenghong; Fu, Feng; Wang, Jinguo; Chang, Lianpeng; Guo, Weihua; Li, Binbin
2013-01-01
Gracilariopsis lemaneiformis has a high economic value and is one of the most important aquaculture species in China. Despite it is economic importance, it has remained largely unstudied at the genomic level. In this study, we conducted a genome survey of Gp. lemaneiformis using next-generation sequencing (NGS) technologies. In total, 18.70 Gb of high-quality sequence data with an estimated genome size of 97 Mb were obtained by HiSeq 2000 sequencing for Gp. lemaneiformis. These reads were assembled into 160,390 contigs with a N50 length of 3.64 kb, which were further assembled into 125,685 scaffolds with a total length of 81.17 Mb. Genome analysis predicted 3490 genes and a GC% content of 48%. The identified genes have an average transcript length of 1,429 bp, an average coding sequence size of 1,369 bp, 1.36 exons per gene, exon length of 1,008 bp, and intron length of 191 bp. From the initial assembled scaffold, transposable elements constituted 54.64% (44.35 Mb) of the genome, and 7737 simple sequence repeats (SSRs) were identified. Among these SSRs, the trinucleotide repeat type was the most abundant (up to 73.20% of total SSRs), followed by the di- (17.41%), tetra- (5.49%), hexa- (2.90%), and penta- (1.00%) nucleotide repeat type. These characteristics suggest that Gp. lemaneiformis is a model organism for genetic study. This is the first report of genome-wide characterization within this taxon. PMID:23875008
International Nuclear Information System (INIS)
Qurainy, F.A.; Gaafar, A.R.Z.
2014-01-01
Assessment and knowledge of the genetic diversity and variation within and between populations of rare and endangered plants is very important for effective conservation. Intergenic spacer sequences variation of psbA-trnH locus of chloroplast genome was assessed within Breonadia salicina (Rubiaceae), a critically endangered and endemic plant species to South western part of Kingdom of Saudi Arabia. The obtained sequence data from 19 individuals in three populations revealed nine haplotypes. The aligned sequences obtained from the overall Saudi accessions extended to 355 bp, revealing nine haplotypes. A high level of haplotype diversity (Hd = 0.842) and low level of nucleotide diversity (Pi = 0.0058) were detected. Consistently, both hierarchical analysis of molecular variance (AMOVA) and constructed neighbor-joining tree indicated null genetic differentiation among populations. This level of differentiation between populations or between regions in psbA-trnH sequences may be due to effects of the abundance of ancestral haplotype sharing and the presence of private haplotypes fixed for each population. Furthermore, the results revealed almost the same level of genetic diversity in comparison with Yemeni accessions, in which Saudi accessions were sharing three haplotypes from the four haplotypes found in Yemeni accessions. (author)
Giangaspero, Massimo; Harasawa, Ryô
2011-06-01
The palindromic nucleotide substitutions (PNS) at the three variable loci (V1, V2 and V3) in the 5'-untranslated region (UTR) of the Pestivirus genome have been considered for taxonomical segregation of the species, through the evaluation of 534 strains. On the basis of qualitative and quantitative secondary structure characteristics, species have been identified within the genus, determining genetic distances between species isolates, clarifying borderline and multirelated sequences, and characterizing and clustering the Pestivirus strains showing unexpected genomic sequences. Nine genomic groups have been identified: the species Bovine viral diarrhea virus 1 (BVDV-1), Bovine viral diarrhea virus 2 (BVDV-2), Border disease virus (BDV) and Classical swine fever virus (CSFV) and the tentative species Pronghorn, Giraffe, Bovine viral diarrhea virus 3 (BVDV-3) (HoBi group), Border disease virus 2 (BDV-2) (Italian small ruminant isolates) and Bungowannah. Palindromic positions have been characterized according to changes in nucleotide base-pairs identifying low variable positions (LVP) including base-pairs present in less than 80% of the genus. The determination of divergence between single strain sequences or genetic groups was obtained easily by comparing base-pairing combinations from aligned secondary structures. This provided clear information such as the level of heterogeneity within a species, the relatedness between species, or facilitating the characterization and clustering of specific strains. The BVDV-1 and BDV species resulted heterogeneous, showing isolates located on a borderline in the species. Within the BVDV-2 species, two main genogroups were identified, with strains showing common sequence characteristics to both groups (multirelated strains). They could be allocated correctly by quantitative analysis. Similarly, the relation between CSFV and BDV species appeared very clearly. Also in this case, ambiguous strain sequences could be clustered in the
Unveiling Mycoplasma hyopneumoniae Promoters: Sequence Definition and Genomic Distribution
Weber, Shana de Souto; Sant'Anna, Fernando Hayashi; Schrank, Irene Silveira
2012-01-01
Several Mycoplasma species have had their genome completely sequenced, including four strains of the swine pathogen Mycoplasma hyopneumoniae. Nevertheless, little is known about the nucleotide sequences that control transcriptional initiation in these microorganisms. Therefore, with the objective of investigating the promoter sequences of M. hyopneumoniae, 23 transcriptional start sites (TSSs) of distinct genes were mapped. A pattern that resembles the σ70 promoter −10 element was found upstream of the TSSs. However, no −35 element was distinguished. Instead, an AT-rich periodic signal was identified. About half of the experimentally defined promoters contained the motif 5′-TRTGn-3′, which was identical to the −16 element usually found in Gram-positive bacteria. The defined promoters were utilized to build position-specific scoring matrices in order to scan putative promoters upstream of all coding sequences (CDSs) in the M. hyopneumoniae genome. Two hundred and one signals were found associated with 169 CDSs. Most of these sequences were located within 100 nucleotides of the start codons. This study has shown that the number of promoter-like sequences in the M. hyopneumoniae genome is more frequent than expected by chance, indicating that most of the sequences detected are probably biologically functional. PMID:22334569
Energy Technology Data Exchange (ETDEWEB)
Harger, Carol A.
1999-10-28
Since September 1997 NCGR has produced two web-based tools for researchers to use to access and analyze data in the Genome Sequence DataBase (GSDB). These tools are: Sequence Viewer, a nucleotide sequence and annotation visualization tool, and MAR-Finder, a tool that predicts, base upon statistical inferences, the location of matrix attachment regions (MARS) within a nucleotide sequence. [The annual report for June 1996 to August 1997 is included as an attachment to this final report.
Porcine MYF6 gene: sequence, homology analysis, and variation in the promoter region.
Wyszyńska-Koko, J; Kurył, J
2004-01-01
MYF6 gene codes for the bHLH transcription factor belonging to MyoD family. Its expression accompanies the processes of differentiation and maturation of myotubes during embriogenesis and continues on a relatively high level after birth, affecting the muscle phenotype. The porcine MYF6 gene was amplified and sequenced and compared with MYF6 gene sequences of other species. The amino acid sequence was deduced and an interspecies homology analysis was performed. Myf-6 protein shows a high conservation among species of 99 and 97% identity when comparing pig with cow and human, respectively, and of 93% when comparing pig with mouse and rat. The single nucleotide polymorphism (SNP) was revealed within the promoter region, which appeared to be T --> C transition recognized by a MspI restriction enzyme.
Centrifuge: rapid and sensitive classification of metagenomic sequences.
Kim, Daehwan; Song, Li; Breitwieser, Florian P; Salzberg, Steven L
2016-12-01
Centrifuge is a novel microbial classification engine that enables rapid, accurate, and sensitive labeling of reads and quantification of species on desktop computers. The system uses an indexing scheme based on the Burrows-Wheeler transform (BWT) and the Ferragina-Manzini (FM) index, optimized specifically for the metagenomic classification problem. Centrifuge requires a relatively small index (4.2 GB for 4078 bacterial and 200 archaeal genomes) and classifies sequences at very high speed, allowing it to process the millions of reads from a typical high-throughput DNA sequencing run within a few minutes. Together, these advances enable timely and accurate analysis of large metagenomics data sets on conventional desktop computers. Because of its space-optimized indexing schemes, Centrifuge also makes it possible to index the entire NCBI nonredundant nucleotide sequence database (a total of 109 billion bases) with an index size of 69 GB, in contrast to k-mer-based indexing schemes, which require far more extensive space. © 2016 Kim et al.; Published by Cold Spring Harbor Laboratory Press.
Non-invasive prenatal detection of trisomy 21 using tandem single nucleotide polymorphisms.
Directory of Open Access Journals (Sweden)
Sujana Ghanta
Full Text Available BACKGROUND: Screening tests for Trisomy 21 (T21, also known as Down syndrome, are routinely performed for the majority of pregnant women. However, current tests rely on either evaluating non-specific markers, which lead to false negative and false positive results, or on invasive tests, which while highly accurate, are expensive and carry a risk of fetal loss. We outline a novel, rapid, highly sensitive, and targeted approach to non-invasively detect fetal T21 using maternal plasma DNA. METHODS AND FINDINGS: Highly heterozygous tandem Single Nucleotide Polymorphism (SNP sequences on chromosome 21 were analyzed using High-Fidelity PCR and Cycling Temperature Capillary Electrophoresis (CTCE. This approach was used to blindly analyze plasma DNA obtained from peripheral blood from 40 high risk pregnant women, in adherence to a Medical College of Wisconsin Institutional Review Board approved protocol. Tandem SNP sequences were informative when the mother was heterozygous and a third paternal haplotype was present, permitting a quantitative comparison between the maternally inherited haplotype and the paternally inherited haplotype to infer fetal chromosomal dosage by calculating a Haplotype Ratio (HR. 27 subjects were assessable; 13 subjects were not informative due to either low DNA yield or were not informative at the tandem SNP sequences examined. All results were confirmed by a procedure (amniocentesis/CVS or at postnatal follow-up. Twenty subjects were identified as carrying a disomy 21 fetus (with two copies of chromosome 21 and seven subjects were identified as carrying a T21 fetus. The sensitivity and the specificity of the assay was 100% when HR values lying between 3/5 and 5/3 were used as a threshold for normal subjects. CONCLUSIONS: In summary, a targeted approach, based on calculation of Haplotype Ratios from tandem SNP sequences combined with a sensitive and quantitative DNA measurement technology can be used to accurately detect fetal
Georges, Arthur; Li, Qiye; Lian, Jinmin; O'Meally, Denis; Deakin, Janine; Wang, Zongji; Zhang, Pei; Fujita, Matthew; Patel, Hardip R; Holleley, Clare E; Zhou, Yang; Zhang, Xiuwen; Matsubara, Kazumi; Waters, Paul; Graves, Jennifer A Marshall; Sarre, Stephen D; Zhang, Guojie
2015-01-01
The lizards of the family Agamidae are one of the most prominent elements of the Australian reptile fauna. Here, we present a genomic resource built on the basis of a wild-caught male ZZ central bearded dragon Pogona vitticeps. The genomic sequence for P. vitticeps, generated on the Illumina HiSeq 2000 platform, comprised 317 Gbp (179X raw read depth) from 13 insert libraries ranging from 250 bp to 40 kbp. After filtering for low-quality and duplicated reads, 146 Gbp of data (83X) was available for assembly. Exceptionally high levels of heterozygosity (0.85 % of single nucleotide polymorphisms plus sequence insertions or deletions) complicated assembly; nevertheless, 96.4 % of reads mapped back to the assembled scaffolds, indicating that the assembly included most of the sequenced genome. Length of the assembly was 1.8 Gbp in 545,310 scaffolds (69,852 longer than 300 bp), the longest being 14.68 Mbp. N50 was 2.29 Mbp. Genes were annotated on the basis of de novo prediction, similarity to the green anole Anolis carolinensis, Gallus gallus and Homo sapiens proteins, and P. vitticeps transcriptome sequence assemblies, to yield 19,406 protein-coding genes in the assembly, 63 % of which had intact open reading frames. Our assembly captured 99 % (246 of 248) of core CEGMA genes, with 93 % (231) being complete. The quality of the P. vitticeps assembly is comparable or superior to that of other published squamate genomes, and the annotated P. vitticeps genome can be accessed through a genome browser available at https://genomics.canberra.edu.au.
Highly conserved non-coding sequences are associated with vertebrate development.
Directory of Open Access Journals (Sweden)
Adam Woolfe
2005-01-01
Full Text Available In addition to protein coding sequence, the human genome contains a significant amount of regulatory DNA, the identification of which is proving somewhat recalcitrant to both in silico and functional methods. An approach that has been used with some success is comparative sequence analysis, whereby equivalent genomic regions from different organisms are compared in order to identify both similarities and differences. In general, similarities in sequence between highly divergent organisms imply functional constraint. We have used a whole-genome comparison between humans and the pufferfish, Fugu rubripes, to identify nearly 1,400 highly conserved non-coding sequences. Given the evolutionary divergence between these species, it is likely that these sequences are found in, and furthermore are essential to, all vertebrates. Most, and possibly all, of these sequences are located in and around genes that act as developmental regulators. Some of these sequences are over 90% identical across more than 500 bases, being more highly conserved than coding sequence between these two species. Despite this, we cannot find any similar sequences in invertebrate genomes. In order to begin to functionally test this set of sequences, we have used a rapid in vivo assay system using zebrafish embryos that allows tissue-specific enhancer activity to be identified. Functional data is presented for highly conserved non-coding sequences associated with four unrelated developmental regulators (SOX21, PAX6, HLXB9, and SHH, in order to demonstrate the suitability of this screen to a wide range of genes and expression patterns. Of 25 sequence elements tested around these four genes, 23 show significant enhancer activity in one or more tissues. We have identified a set of non-coding sequences that are highly conserved throughout vertebrates. They are found in clusters across the human genome, principally around genes that are implicated in the regulation of development
Precise detection of de novo single nucleotide variants in human genomes.
Gómez-Romero, Laura; Palacios-Flores, Kim; Reyes, José; García, Delfino; Boege, Margareta; Dávila, Guillermo; Flores, Margarita; Schatz, Michael C; Palacios, Rafael
2018-05-07
The precise determination of de novo genetic variants has enormous implications across different fields of biology and medicine, particularly personalized medicine. Currently, de novo variations are identified by mapping sample reads from a parent-offspring trio to a reference genome, allowing for a certain degree of differences. While widely used, this approach often introduces false-positive (FP) results due to misaligned reads and mischaracterized sequencing errors. In a previous study, we developed an alternative approach to accurately identify single nucleotide variants (SNVs) using only perfect matches. However, this approach could be applied only to haploid regions of the genome and was computationally intensive. In this study, we present a unique approach, coverage-based single nucleotide variant identification (COBASI), which allows the exploration of the entire genome using second-generation short sequence reads without extensive computing requirements. COBASI identifies SNVs using changes in coverage of exactly matching unique substrings, and is particularly suited for pinpointing de novo SNVs. Unlike other approaches that require population frequencies across hundreds of samples to filter out any methodological biases, COBASI can be applied to detect de novo SNVs within isolated families. We demonstrate this capability through extensive simulation studies and by studying a parent-offspring trio we sequenced using short reads. Experimental validation of all 58 candidate de novo SNVs and a selection of non-de novo SNVs found in the trio confirmed zero FP calls. COBASI is available as open source at https://github.com/Laura-Gomez/COBASI for any researcher to use. Copyright © 2018 the Author(s). Published by PNAS.
Krueger, Elizabeth N; Beckett, Randy J; Gray, Stewart M; Miller, W Allen
2013-01-01
The yellow dwarf viruses (YDVs) of the Luteoviridae family represent the most widespread group of cereal viruses worldwide. They include the Barley yellow dwarf viruses (BYDVs) of genus Luteovirus, the Cereal yellow dwarf viruses (CYDVs) and Wheat yellow dwarf virus (WYDV) of genus Polerovirus. All of these viruses are obligately aphid transmitted and phloem-limited. The first described YDVs (initially all called BYDV) were classified by their most efficient vector. One of these viruses, BYDV-RMV, is transmitted most efficiently by the corn leaf aphid, Rhopalosiphum maidis. Here we report the complete 5612 nucleotide sequence of the genomic RNA of a Montana isolate of BYDV-RMV (isolate RMV MTFE87, Genbank accession no. KC921392). The sequence revealed that BYDV-RMV is a polerovirus, but it is quite distantly related to the CYDVs or WYDV, which are very closely related to each other. Nor is BYDV-RMV closely related to any other particular polerovirus. Depending on the gene that is compared, different poleroviruses (none of them a YDV) share the most sequence similarity to BYDV-RMV. Because of its distant relationship to other YDVs, and because it commonly infects maize via its vector, R. maidis, we propose that BYDV-RMV be renamed Maize yellow dwarf virus-RMV (MYDV-RMV).
Directory of Open Access Journals (Sweden)
Elizabeth N. Krueger
2013-07-01
Full Text Available The yellow dwarf viruses (YDVs of the Luteoviridae family represent the most widespread group of cereal viruses worldwide. They include the Barley yellow dwarf viruses (BYDVs of genus Luteovirus, the Cereal yellow dwarf viruses (CYDVs and Wheat yellow dwarf virus (WYDV of genus Polerovirus. All of these viruses are obligately aphid transmitted and phloem-limited. The first described YDVs (initially all called BYDV were classified by their most efficient vector. One of these viruses, BYDV-RMV, is transmitted most efficiently by the corn leaf aphid, Rhopalosiphum maidis. Here we report the complete 5612 nucleotide sequence of the genomic RNA of a Montana isolate of BYDV-RMV (isolate RMV MTFE87, Genbank accession no. KC921392. The sequence revealed that BYDV-RMV is a polerovirus, but it is quite distantly related to the CYDVs or WYDV, which are very closely related to each other. Nor is BYDV-RMV closely related to any other particular polerovirus. Depending on the gene that is compared, different poleroviruses (none of them a YDV share the most sequence similarity to BYDV-RMV. Because of its distant relationship to other YDVs, and because it commonly infects maize via its vector, R. maidis, we propose that BYDV-RMV be renamed Maize yellow dwarf virus-RMV (MYDV-RMV.
Next generation sequencing and comparative analyses of Xenopus mitogenomes
Directory of Open Access Journals (Sweden)
Lloyd Rhiannon E
2012-09-01
Full Text Available Abstract Background Mitochondrial genomes comprise a small but critical component of the total DNA in eukaryotic organisms. They encode several key proteins for the cell’s major energy producing apparatus, the mitochondrial respiratory chain. Additonally, their nucleotide and amino acid sequences are of great utility as markers for systematics, molecular ecology and forensics. Their characterization through nucleotide sequencing is a fundamental starting point in mitogenomics. Methods to amplify complete mitochondrial genomes rapidly and efficiently from microgram quantities of tissue of single individuals are, however, not always available. Here we validate two approaches, which combine long-PCR with Roche 454 pyrosequencing technology, to obtain two complete mitochondrial genomes from individual amphibian species. Results We obtained two new xenopus frogs (Xenopus borealis and X. victorianus complete mitochondrial genome sequences by means of long-PCR followed by 454 of individual genomes (approach 1 or of multiple pooled genomes (approach 2, the mean depth of coverage per nucleotide was 9823 and 186, respectively. We also characterised and compared the new mitogenomes against their sister taxa; X. laevis and Silurana tropicalis, two of the most intensely studied amphibians. Our results demonstrate how our approaches can be used to obtain complete amphibian mitogenomes with depths of coverage that far surpass traditional primer-walking strategies, at either the same cost or less. Our results also demonstrate: that the size, gene content and order are the same among xenopus mitogenomes and that S. tropicalis form a separate clade to the other xenopus, among which X. laevis and X. victorianus were most closely related. Nucleotide and amino acid diversity was found to vary across the xenopus mitogenomes, with the greatest diversity observed in the Complex 1 gene nad4l and the least diversity observed in Complex 4 genes (cox1-3. All protein
RNA2 of grapevine fanleaf virus: sequence analysis and coat protein cistron location.
Serghini, M A; Fuchs, M; Pinck, M; Reinbolt, J; Walter, B; Pinck, L
1990-07-01
The nucleotide sequence of the genomic RNA2 (3774 nucleotides) of grapevine fanleaf virus strain F13 was determined from overlapping cDNA clones and its genetic organization was deduced. Two rapid and efficient methods were used for cDNA cloning of the 5' region of RNA2. The complete sequence contained only one long open reading frame of 3555 nucleotides (1184 codons, 131K product). The analysis of the N-terminal sequence of purified coat protein (CP) and identification of its C-terminal residue have allowed the CP cistron to be precisely positioned within the polyprotein. The CP produced by proteolytic cleavage at the Arg/Gly site between residues 680 and 681 contains 504 amino acids (Mr 56019) and has hydrophobic properties. The Arg/Gly cleavage site deduced by N-terminal amino acid sequence analysis is the first for a nepovirus coat protein and for plant viruses expressing their genomic RNAs by polyprotein synthesis. Comparison of GFLV RNA2 with M RNA of cowpea mosaic comovirus and with RNA2 of two closely related nepoviruses, tomato black ring virus and Hungarian grapevine chrome mosaic virus, showed strong similarities among the 3' non-coding regions but less similarity among the 5' end non-coding sequences than reported among other nepovirus RNAs.
Fenyk, Stepan; de San Eustaquio Campillo, Alba; Pohl, Ehmke; Hussey, Patrick J.; Cann, Martin J.
2012-01-01
Plant resistance proteins (R-proteins) are key components of the plant immune system activated in response to a plethora of different pathogens. R-proteins are P-loop NTPase superfamily members, and current models describe their main function as ATPases in defense signaling pathways. Here we show that a subset of R-proteins have evolved a new function to combat pathogen infection. This subset of R-proteins possesses a nucleotide phosphatase activity in the nucleotide-binding domain. Related R-proteins that fall in the same phylogenetic clade all show the same nucleotide phosphatase activity indicating a conserved function within at least a subset of R-proteins. R-protein nucleotide phosphatases catalyze the production of nucleoside from nucleotide with the nucleotide monophosphate as the preferred substrate. Mutation of conserved catalytic residues substantially reduced activity consistent with the biochemistry of P-loop NTPases. Kinetic analysis, analytical gel filtration, and chemical cross-linking demonstrated that the nucleotide-binding domain was active as a multimer. Nuclear magnetic resonance and nucleotide analogues identified the terminal phosphate bond as the target of a reaction that utilized a metal-mediated nucleophilic attack by water on the phosphoester. In conclusion, we have identified a group of R-proteins with a unique function. This biochemical activity appears to have co-evolved with plants in signaling pathways designed to resist pathogen attack. PMID:22157756
Fenyk, Stepan; Campillo, Alba de San Eustaquio; Pohl, Ehmke; Hussey, Patrick J; Cann, Martin J
2012-02-03
Plant resistance proteins (R-proteins) are key components of the plant immune system activated in response to a plethora of different pathogens. R-proteins are P-loop NTPase superfamily members, and current models describe their main function as ATPases in defense signaling pathways. Here we show that a subset of R-proteins have evolved a new function to combat pathogen infection. This subset of R-proteins possesses a nucleotide phosphatase activity in the nucleotide-binding domain. Related R-proteins that fall in the same phylogenetic clade all show the same nucleotide phosphatase activity indicating a conserved function within at least a subset of R-proteins. R-protein nucleotide phosphatases catalyze the production of nucleoside from nucleotide with the nucleotide monophosphate as the preferred substrate. Mutation of conserved catalytic residues substantially reduced activity consistent with the biochemistry of P-loop NTPases. Kinetic analysis, analytical gel filtration, and chemical cross-linking demonstrated that the nucleotide-binding domain was active as a multimer. Nuclear magnetic resonance and nucleotide analogues identified the terminal phosphate bond as the target of a reaction that utilized a metal-mediated nucleophilic attack by water on the phosphoester. In conclusion, we have identified a group of R-proteins with a unique function. This biochemical activity appears to have co-evolved with plants in signaling pathways designed to resist pathogen attack.
Directory of Open Access Journals (Sweden)
Martin Beránek
2012-01-01
Full Text Available Dideoxynucleotide DNA sequencing is one of the principal procedures in molecular biology. Loss of an initial part of nucleotides behind the 3' end of the sequencing primer limits the readability of sequenced amplicons. We present a method which extends the readability by using sequencing primers modified by polyadenylated tails attached to their 5' ends. Performing a polymerase chain reaction, we amplified eight amplicons of six human genes (AMELX, APOE, HFE, MBL2, SERPINA1 and TGFB1 ranging from 106 bp to 680 bp. Polyadenylation of the sequencing primers minimized the loss of bases in all amplicons. Complete sequences of shorter products (AMELX 106 bp, SERPINA1 121 bp, HFE 208 bp, APOE 244 bp, MBL2 317 bp were obtained. In addition, in the case of TGFB1 products (366 bp, 432 bp, and 680 bp, respectively, the lengths of sequencing readings were significantly longer if adenylated primers were used. Thus, single strand dideoxynucleotide sequencing with adenylated primers enables complete or near complete readability of short PCR amplicons.
Selection on start codons in prokaryotes and potential compensatory nucleotide substitutions.
Belinky, Frida; Rogozin, Igor B; Koonin, Eugene V
2017-09-29
Reconstruction of the evolution of start codons in 36 groups of closely related bacterial and archaeal genomes reveals purifying selection affecting AUG codons. The AUG starts are replaced by GUG and especially UUG significantly less frequently than expected under the neutral expectation derived from the frequencies of the respective nucleotide triplet substitutions in non-coding regions and in 4-fold degenerate sites. Thus, AUG is the optimal start codon that is actively maintained by purifying selection. However, purifying selection on start codons is significantly weaker than the selection on the same codons in coding sequences, although the switches between the codons result in conservative amino acid substitutions. The only exception is the AUG to UUG switch that is strongly selected against among start codons. Selection on start codons is most pronounced in evolutionarily conserved, highly expressed genes. Mutation of the start codon to a sub-optimal form (GUG or UUG) tends to be compensated by mutations in the Shine-Dalgarno sequence towards a stronger translation initiation signal. Together, all these findings indicate that in prokaryotes, translation start signals are subject to weak but significant selection for maximization of initiation rate and, consequently, protein production.
Rhaese, H J; Hoch, J A; Groscurth, R
1977-03-01
To test our model on the mechanism of initiation of differentiation in Bacillus subtilis, we tested early blocked (stage 0) sporulation mutants for their ability to synthesize highly phosphorylated nucleotides. We also isolated early blocked asporogenous mutants with the aid of the intercalating drug tilorone. Among all mutants tested we found that the spo0F-bearing strain was unable to synthesize adenosine 3'(2')-triphosphate 5'-triphosphate, pppAppp. A revertant of this mutant regained the ability to both sporulate and synthesize pppAppp. Ribosomes of the asporogenous mutant isolated at T2 (2 hr after the end of logarithmic growth) of sporulation, in contrast to the wild type, do not synthesize adenosine 3'(2')-diphosphate 5'-diphosphate, ppApp, or adenosine 3'(2')-diphosphate 5'-triphosphate, pppApp, but synthesize guanosine 3'(2')-diphosphate 5'-diphosphate, ppGpp, and guanosine 3'(2')-diphosphate 5'-triphosphate, pppGpp. This behavior is characteristic of ribosomes from vegetative, not sporulating, cells. Ribosomes from the sporogenous revertant behave like those of the wild type. The results suggest that the spo0F mutation may be a mutation in the structural gene for pppAppp synthetase. The inability to synthesize pppAppp in this strain also prevents the formation of "sporulation-specific ribosomes," i.e., ribosomes that synthetize ppApp and pppApp. The present experiments suggest that the nucleotide pppAppp participates in the initiation of sporulation by triggering a sequencies of events required for the production of heat-resistant spores.
Intra-species sequence comparisons for annotating genomes
Energy Technology Data Exchange (ETDEWEB)
Boffelli, Dario; Weer, Claire V.; Weng, Li; Lewis, Keith D.; Shoukry, Malak I.; Pachter, Lior; Keys, David N.; Rubin, Edward M.
2004-07-15
Analysis of sequence variation among members of a single species offers a potential approach to identify functional DNA elements responsible for biological features unique to that species. Due to its high rate of allelic polymorphism and ease of genetic manipulability, we chose the sea squirt, Ciona intestinalis, to explore intra-species sequence comparisons for genome annotation. A large number of C. intestinalis specimens were collected from four continents and a set of genomic intervals amplified, resequenced and analyzed to determine the mutation rates at each nucleotide in the sequence. We found that regions with low mutation rates efficiently demarcated functionally constrained sequences: these include a set of noncoding elements, which we showed in C intestinalis transgenic assays to act as tissue-specific enhancers, as well as the location of coding sequences. This illustrates that comparisons of multiple members of a species can be used for genome annotation, suggesting a path for the annotation of the sequenced genomes of organisms occupying uncharacterized phylogenetic branches of the animal kingdom and raises the possibility that the resequencing of a large number of Homo sapiens individuals might be used to annotate the human genome and identify sequences defining traits unique to our species. The sequence data from this study has been submitted to GenBank under accession nos. AY667278-AY667407.
Vishnevskaia, M S; Pavlov, A V; Dziubenko, E A; Dziubenko, N I; Potokina, E K
2014-04-01
Based on legume genome syntheny, the nucleotide sequence of Srlk gene, key role of which in response to salt stress was demonstrated for the model species Medicago truncatula, was identified in the major forage and siderate crop alfalfa (Medicago sativa). In twelve alfalfa samples originating from regions with contrasting growing conditions, 19 SNPs were revealed in the Srlk gene. For two nonsynonymous SNPs, molecular markers were designed that could be further used to analyze the association between Srlk gene nucleotide polymorphism and the variability in salt stress tolerance among alfalfa cultivars.
Sheveleva, Anna; Kudryavtseva, Anna; Speranskaya, Anna; Belenikin, Maxim; Melnikova, Natalia; Chirkov, Sergei
2013-10-01
The near-complete (99.7 %) genome sequence of a novel Russian Plum pox virus (PPV) isolate Pk, belonging to the strain Winona (W), has been determined by 454 pyrosequencing with the exception of the thirty-one 5'-terminal nucleotides. This region was amplified using 5'RACE kit and sequenced by the Sanger method. Genomic RNA released from immunocaptured PPV particles was employed for generation of cDNA library using TransPlex Whole transcriptome amplification kit (WTA2, Sigma-Aldrich). The entire Pk genome has identity level of 92.8-94.5 % when compared to the complete nucleotide sequences of other PPV-W isolates (W3174, LV-141pl, LV-145bt, and UKR 44189), confirming a high degree of variability within the PPV-W strain. The isolates Pk and LV-141pl are most closely related. The Pk has been found in a wild plum (Prunus domestica) in a new region of Russia indicating widespread dissemination of the PPV-W strain in the European part of the former USSR.
International Nuclear Information System (INIS)
Harger, Carol A.
1999-01-01
Since September 1997 NCGR has produced two web-based tools for researchers to use to access and analyze data in the Genome Sequence DataBase (GSDB). These tools are: Sequence Viewer, a nucleotide sequence and annotation visualization tool, and MAR-Finder, a tool that predicts, base upon statistical inferences, the location of matrix attachment regions (MARS) within a nucleotide sequence.[The annual report for June 1996 to August 1997 is included as an attachment to this final report.
CodonLogo: a sequence logo-based viewer for codon patterns.
Sharma, Virag; Murphy, David P; Provan, Gregory; Baranov, Pavel V
2012-07-15
Conserved patterns across a multiple sequence alignment can be visualized by generating sequence logos. Sequence logos show each column in the alignment as stacks of symbol(s) where the height of a stack is proportional to its informational content, whereas the height of each symbol within the stack is proportional to its frequency in the column. Sequence logos use symbols of either nucleotide or amino acid alphabets. However, certain regulatory signals in messenger RNA (mRNA) act as combinations of codons. Yet no tool is available for visualization of conserved codon patterns. We present the first application which allows visualization of conserved regions in a multiple sequence alignment in the context of codons. CodonLogo is based on WebLogo3 and uses the same heuristics but treats codons as inseparable units of a 64-letter alphabet. CodonLogo can discriminate patterns of codon conservation from patterns of nucleotide conservation that appear indistinguishable in standard sequence logos. The CodonLogo source code and its implementation (in a local version of the Galaxy Browser) are available at http://recode.ucc.ie/CodonLogo and through the Galaxy Tool Shed at http://toolshed.g2.bx.psu.edu/.
International Nuclear Information System (INIS)
Cordis, G.A.; Das, D.K.
1987-01-01
In order to follow the energy metabolism and the levels of high-energy phosphate compounds in porcine myocardium subjected to ischemic insult, it was necessary to develop a high-performance liquid chromatography (HPLC) method where creatine phosphate (CP) and the adenine nucleotides could be measured simultaneously in a single run. Currently available ion-pair reverse-phase HPLC methods require a separate injection with a change in wavelength and mobile phase in order to measure the creatine phosphate, while baseline separation of AMP is lacking. The ion-exchange HPLC method includes a simultaneous determination, but the baseline drifts due to the gradient and baseline separation of AMP is not achieved. In the following ion-pair reverse-phase HPLC method, simultaneous measurements of porcine myocardial adenine nucleotides and creatine phosphate were achieved along with a stable baseline and homogeneous baseline separation of each measured compound, allowing accurate quantification
Menezes, Camila Braz; Durgante, Juliano; de Oliveira, Rafael Rodrigues; Dos Santos, Victor Hugo Jacks Mendes; Rodrigues, Luiz Frederico; Garcia, Solange Cristina; Dos Santos, Odelta; Tasca, Tiana
2016-05-01
Trichomonas vaginalis is the aethiologic agent of trichomoniasis, the most common non-viral sexually transmitted disease in the world. The purinergic signaling pathway is mediated by extracellular nucleotides and nucleosides that are involved in many biological effects as neurotransmission, immunomodulation and inflammation. Extracellular nucleotides can be hydrolyzed by a family of enzymes known as ectonucleotidases including the ecto-nucleoside triphosphate diphosphohydrolases (E-NTPDases) family which hydrolyses nucleosides triphosphate and diphosphate as preferential substrates and ecto-5'-nucleotidase which catalyzes the conversion of monophosphates into nucleosides. In T. vaginalis the E-NTPDase and ecto-5'-nucleotidase activities upon adenine nucleotides have already been characterized in intact trophozoites but little is known concerning guanine nucleotides and nucleoside. These enzymes may exert a crucial role on nucleoside generation, providing the purine sources for the synthesis de novo of these essential nutrients, sustaining parasite growth and survival. In this study, we investigated the hydrolysis profile of guanine-related nucleotides and nucleoside in intact trophozoites from long-term-grown and fresh clinical isolates of T. vaginalis. Knowing that guanine nucleotides are also substrates for T. vaginalis ectoenzymes, we evaluated the profile of nucleotides consumption and guanosine uptake in trophozoites submitted to a serum limitation condition. Results show that guanine nucleotides (GTP, GDP, GMP) were substrates for T. vaginalis ectonucleotidases, with expected kinetic parameters for this enzyme family. Different T. vaginalis isolates (two from the ATCC and nine fresh clinical isolates) presented a heterogeneous hydrolysis profile. The serum culture condition increased E-NTPDase and ecto-5'-nucleotidase activities with high consumption of extracellular GTP generating enhanced GDP, GMP and guanosine levels as demonstrated by HPLC, with final
Human Chromosome 7: DNA Sequence and Biology
Scherer, Stephen W.; Cheung, Joseph; MacDonald, Jeffrey R.; Osborne, Lucy R.; Nakabayashi, Kazuhiko; Herbrick, Jo-Anne; Carson, Andrew R.; Parker-Katiraee, Layla; Skaug, Jennifer; Khaja, Razi; Zhang, Junjun; Hudek, Alexander K.; Li, Martin; Haddad, May; Duggan, Gavin E.
2003-01-01
DNA sequence and annotation of the entire human chromosome 7, encompassing nearly 158 million nucleotides of DNA and 1917 gene structures, are presented. To generate a higher order description, additional structural features such as imprinted genes, fragile sites, and segmental duplications were integrated at the level of the DNA sequence with medical genetic data, including 440 chromosome rearrangement breakpoints associated with disease. This approach enabled the discovery of candidate gene...
Lestari, D.; Bustamam, A.; Novianti, T.; Ardaneswari, G.
2017-07-01
DNA sequence can be defined as a succession of letters, representing the order of nucleotides within DNA, using a permutation of four DNA base codes including adenine (A), guanine (G), cytosine (C), and thymine (T). The precise code of the sequences is determined using DNA sequencing methods and technologies, which have been developed since the 1970s and currently become highly developed, advanced and highly throughput sequencing technologies. So far, DNA sequencing has greatly accelerated biological and medical research and discovery. However, in some cases DNA sequencing could produce any ambiguous and not clear enough sequencing results that make them quite difficult to be determined whether these codes are A, T, G, or C. To solve these problems, in this study we can introduce other representation of DNA codes namely Quaternion Q = (PA, PT, PG, PC), where PA, PT, PG, PC are the probability of A, T, G, C bases that could appear in Q and PA + PT + PG + PC = 1. Furthermore, using Quaternion representations we are able to construct the improved scoring matrix for global sequence alignment processes, by applying a dot product method. Moreover, this scoring matrix produces better and higher quality of the match and mismatch score between two DNA base codes. In implementation, we applied the Needleman-Wunsch global sequence alignment algorithm using Octave, to analyze our target sequence which contains some ambiguous sequence data. The subject sequences are the DNA sequences of Streptococcus pneumoniae families obtained from the Genebank, meanwhile the target DNA sequence are received from our collaborator database. As the results we found the Quaternion representations improve the quality of the sequence alignment score and we can conclude that DNA sequence target has maximum similarity with Streptococcus pneumoniae.
Putaporntip, Chaturong; Thongaree, Siriporn; Jongwutiwes, Somchai
2013-08-01
To determine the genetic diversity and potential transmission routes of Plasmodium knowlesi, we analyzed the complete nucleotide sequence of the gene encoding the merozoite surface protein-1 of this simian malaria (Pkmsp-1), an asexual blood-stage vaccine candidate, from naturally infected humans and macaques in Thailand. Analysis of Pkmsp-1 sequences from humans (n=12) and monkeys (n=12) reveals five conserved and four variable domains. Most nucleotide substitutions in conserved domains were dimorphic whereas three of four variable domains contained complex repeats with extensive sequence and size variation. Besides purifying selection in conserved domains, evidence of intragenic recombination scattering across Pkmsp-1 was detected. The number of haplotypes, haplotype diversity, nucleotide diversity and recombination sites of human-derived sequences exceeded that of monkey-derived sequences. Phylogenetic networks based on concatenated conserved sequences of Pkmsp-1 displayed a character pattern that could have arisen from sampling process or the presence of two independent routes of P. knowlesi transmission, i.e. from macaques to human and from human to humans in Thailand. Copyright © 2013 Elsevier B.V. All rights reserved.
Molecular identification based on ITS sequences for Kappaphycus and Eucheuma cultivated in China
Zhao, Sufen; He, Peimin
2011-11-01
The systematic classification of the Eucheumatoideae is difficult because of their variable morphology and interpretation of reproductive structures. Kappaphycus and Eucheuma specimens cultivated on the Hainan and Fujian coast of China were introduced from Vietnam, the Philippines and Indonesia. Combined with morphological characteristics, all Kappaphycus and Eucheuma cultivated strains were identified by internal transcribed spacer (ITS) sequences. The phylogenetic tree was constructed using neighbor-joining and maximum likelihood methods. The results indicate that different ITS sequence lengths occurred in the different genera and species. An obvious difference in morphology could be found in the protuberance shape between Kappaphycus and Eucheuma. The protuberance in Eucheuma was thorn-like and in Kappaphycus was wartlike or papillate. Their ITS sequence lengths differed significantly in nucleotide variation rates up to 58.55%-63.90%. All nucleotide variations occurred in the ITS1 and ITS2 regions except for five nucleotide transversions in the 5.8S rDNA region. In addition, the difference was at the branches among congeneric species. Kappaphycus sp. had branches with small buds, while K. alvarezii did not have such a feature. The nucleotide variation rates varied from 7.02% to 7.48% among species; within the same species of the clades it was K. alvarezii, Kappaphycus sp., and E. denticulatum. The results indicate that ITS sequence analysis was an effective way for identification of interspecies and intraspecies phylogenetic relationships and might provide a clue for molecular identification of algal Eucheumatoideae.
"Shovel-ready" Sequences as a Stimulus for the Next Generation of Life Scientists.
Boyle, Michael D
2010-01-01
Genomics and bioinformatics are dynamic fields well-suited for capturing the imagination of undergraduates in both research laboratories and classrooms. Currently, raw nucleotide sequence is being provided, as part of several genomics research initiatives, for undergraduate research and teaching. These initiatives could be easily extended and much more effective if the source of the sequenced material and the subsequent focus of the data analysis were aligned with the research interests of individual faculty at undergraduate institutions. By judicious use of surplus capacity in existing nucleotide sequencing cores, raw sequence data could be generated to support ongoing research efforts involving undergraduates. This would allow these students to participate actively in discovery research, with a goal of making novel contributions to their field through original research while nurturing the next generation of talented research scientists.
Thoroughbred Horse Single Nucleotide Polymorphism and Expression Database: HSDB
Directory of Open Access Journals (Sweden)
Joon-Ho Lee
2014-09-01
Full Text Available Genetics is important for breeding and selection of horses but there is a lack of well-established horse-related browsers or databases. In order to better understand horses, more variants and other integrated information are needed. Thus, we construct a horse genomic variants database including expression and other information. Horse Single Nucleotide Polymorphism and Expression Database (HSDB (http://snugenome2.snu.ac.kr/HSDB provides the number of unexplored genomic variants still remaining to be identified in the horse genome including rare variants by using population genome sequences of eighteen horses and RNA-seq of four horses. The identified single nucleotide polymorphisms (SNPs were confirmed by comparing them with SNP chip data and variants of RNA-seq, which showed a concordance level of 99.02% and 96.6%, respectively. Moreover, the database provides the genomic variants with their corresponding transcriptional profiles from the same individuals to help understand the functional aspects of these variants. The database will contribute to genetic improvement and breeding strategies of Thoroughbreds.
Directory of Open Access Journals (Sweden)
Huihui Yu
Full Text Available Huge efforts have been invested in the last two decades to dissect the genetic bases of complex traits including yields of many crop plants, through quantitative trait locus (QTL analyses. However, almost all the studies were based on linkage maps constructed using low-throughput molecular markers, e.g. restriction fragment length polymorphisms (RFLPs and simple sequence repeats (SSRs, thus are mostly of low density and not able to provide precise and complete information about the numbers and locations of the genes or QTLs controlling the traits. In this study, we constructed an ultra-high density genetic map based on high quality single nucleotide polymorphisms (SNPs from low-coverage sequences of a recombinant inbred line (RIL population of rice, generated using new sequencing technology. The quality of the map was assessed by validating the positions of several cloned genes including GS3 and GW5/qSW5, two major QTLs for grain length and grain width respectively, and OsC1, a qualitative trait locus for pigmentation. In all the cases the loci could be precisely resolved to the bins where the genes are located, indicating high quality and accuracy of the map. The SNP map was used to perform QTL analysis for yield and three yield-component traits, number of tillers per plant, number of grains per panicle and grain weight, using data from field trials conducted over years, in comparison to QTL mapping based on RFLPs/SSRs. The SNP map detected more QTLs especially for grain weight, with precise map locations, demonstrating advantages in detecting power and resolution relative to the RFLP/SSR map. Thus this study provided an example for ultra-high density map construction using sequencing technology. Moreover, the results obtained are helpful for understanding the genetic bases of the yield traits and for fine mapping and cloning of QTLs.
SEQUENCING OF FLAX LIS-1 INSERTION SITE IN THE ALBIDUM GENOTYPE
Directory of Open Access Journals (Sweden)
Jana Žiarovská
2012-12-01
Full Text Available The paper presents a methodology of identifying the insertion site of LIS-1-1 (Linum Insertion Sequence 1 element in flax Albidum variety when growing under the in vitro combined with environmental stress conditions. Abiotic stress was induced by a reduced nutrient content in a growth medium. The LIS-1 insertion site amplification was reaLIS-1ed using the forward LIS-L: 5'-GGG CAG TTT AAC TGT AAC GAA - 3 'and revers LIS-R: 5'-GCT TGG ATT TAG ACT TGG CAA C - 3' primers by PCR. PCR product was sequenced by direct sequencing method to proove the nucleotide sequence for matching with database LIS-1 sequence. A comparison has been matched with the sequence of the amplified segment in the database for all nucleotides except the 11-position in the 5'-3 ' direction, where instead of the three adenine pair is a couple in the Albidum variety. Changes caused by mobile elements or insertion sequences result in common flax in variability that can be used for the purposes of development of effective marker identification or environment based markers development.
Sequence determinants of human microsatellite variability
Directory of Open Access Journals (Sweden)
Jakobsson Mattias
2009-12-01
Full Text Available Abstract Background Microsatellite loci are frequently used in genomic studies of DNA sequence repeats and in population studies of genetic variability. To investigate the effect of sequence properties of microsatellites on their level of variability we have analyzed genotypes at 627 microsatellite loci in 1,048 worldwide individuals from the HGDP-CEPH cell line panel together with the DNA sequences of these microsatellites in the human RefSeq database. Results Calibrating PCR fragment lengths in individual genotypes by using the RefSeq sequence enabled us to infer repeat number in the HGDP-CEPH dataset and to calculate the mean number of repeats (as opposed to the mean PCR fragment length, under the assumption that differences in PCR fragment length reflect differences in the numbers of repeats in the embedded repeat sequences. We find the mean and maximum numbers of repeats across individuals to be positively correlated with heterozygosity. The size and composition of the repeat unit of a microsatellite are also important factors in predicting heterozygosity, with tetra-nucleotide repeat units high in G/C content leading to higher heterozygosity. Finally, we find that microsatellites containing more separate sets of repeated motifs generally have higher heterozygosity. Conclusions These results suggest that sequence properties of microsatellites have a significant impact in determining the features of human microsatellite variability.
Directory of Open Access Journals (Sweden)
Kei-ichi Morita
Full Text Available Gorlin syndrome (GS is an autosomal dominant disorder that predisposes affected individuals to developmental defects and tumorigenesis, and caused mainly by heterozygous germline PTCH1 mutations. Despite exhaustive analysis, PTCH1 mutations are often unidentifiable in some patients; the failure to detect mutations is presumably because of mutations occurred in other causative genes or outside of analyzed regions of PTCH1, or copy number alterations (CNAs. In this study, we subjected a cohort of GS-affected individuals from six unrelated families to next-generation sequencing (NGS analysis for the combined screening of causative alterations in Hedgehog signaling pathway-related genes. Specific single nucleotide variations (SNVs of PTCH1 causing inferred amino acid changes were identified in four families (seven affected individuals, whereas CNAs within or around PTCH1 were found in two families in whom possible causative SNVs were not detected. Through a targeted resequencing of all coding exons, as well as simultaneous evaluation of copy number status using the alignment map files obtained via NGS, we found that GS phenotypes could be explained by PTCH1 mutations or deletions in all affected patients. Because it is advisable to evaluate CNAs of candidate causative genes in point mutation-negative cases, NGS methodology appears to be useful for improving molecular diagnosis through the simultaneous detection of both SNVs and CNAs in the targeted genes/regions.
Morita, Kei-ichi; Naruto, Takuya; Tanimoto, Kousuke; Yasukawa, Chisato; Oikawa, Yu; Masuda, Kiyoshi; Imoto, Issei; Inazawa, Johji; Omura, Ken; Harada, Hiroyuki
2015-01-01
Gorlin syndrome (GS) is an autosomal dominant disorder that predisposes affected individuals to developmental defects and tumorigenesis, and caused mainly by heterozygous germline PTCH1 mutations. Despite exhaustive analysis, PTCH1 mutations are often unidentifiable in some patients; the failure to detect mutations is presumably because of mutations occurred in other causative genes or outside of analyzed regions of PTCH1, or copy number alterations (CNAs). In this study, we subjected a cohort of GS-affected individuals from six unrelated families to next-generation sequencing (NGS) analysis for the combined screening of causative alterations in Hedgehog signaling pathway-related genes. Specific single nucleotide variations (SNVs) of PTCH1 causing inferred amino acid changes were identified in four families (seven affected individuals), whereas CNAs within or around PTCH1 were found in two families in whom possible causative SNVs were not detected. Through a targeted resequencing of all coding exons, as well as simultaneous evaluation of copy number status using the alignment map files obtained via NGS, we found that GS phenotypes could be explained by PTCH1 mutations or deletions in all affected patients. Because it is advisable to evaluate CNAs of candidate causative genes in point mutation-negative cases, NGS methodology appears to be useful for improving molecular diagnosis through the simultaneous detection of both SNVs and CNAs in the targeted genes/regions.
Roche genome sequencer FLX based high-throughput sequencing of ancient DNA
DEFF Research Database (Denmark)
Alquezar-Planas, David E; Fordyce, Sarah Louise
2012-01-01
Since the development of so-called "next generation" high-throughput sequencing in 2005, this technology has been applied to a variety of fields. Such applications include disease studies, evolutionary investigations, and ancient DNA. Each application requires a specialized protocol to ensure...... that the data produced is optimal. Although much of the procedure can be followed directly from the manufacturer's protocols, the key differences lie in the library preparation steps. This chapter presents an optimized protocol for the sequencing of fossil remains and museum specimens, commonly referred...
DEFF Research Database (Denmark)
Hansen, Mette H H; Young, Sewall; Jørgensen, Hanne Birgitte Hede
2011-01-01
We establish a TaqMan-based assay panel for genotyping single-nucleotide polymorphisms in rainbow trout and steelhead (Oncorhynchus mykiss). We develop 22 novel single-nucleotide polymorphism markers based on new steelhead sequence data and on assays from sister taxa. Additionally, we adapt 154 p...
Current trend of annotating single nucleotide variation in humans--A case study on SNVrap.
Li, Mulin Jun; Wang, Junwen
2015-06-01
As high throughput methods, such as whole genome genotyping arrays, whole exome sequencing (WES) and whole genome sequencing (WGS), have detected huge amounts of genetic variants associated with human diseases, function annotation of these variants is an indispensable step in understanding disease etiology. Large-scale functional genomics projects, such as The ENCODE Project and Roadmap Epigenomics Project, provide genome-wide profiling of functional elements across different human cell types and tissues. With the urgent demands for identification of disease-causal variants, comprehensive and easy-to-use annotation tool is highly in demand. Here we review and discuss current progress and trend of the variant annotation field. Furthermore, we introduce a comprehensive web portal for annotating human genetic variants. We use gene-based features and the latest functional genomics datasets to annotate single nucleotide variation (SNVs) in human, at whole genome scale. We further apply several function prediction algorithms to annotate SNVs that might affect different biological processes, including transcriptional gene regulation, alternative splicing, post-transcriptional regulation, translation and post-translational modifications. The SNVrap web portal is freely available at http://jjwanglab.org/snvrap. Copyright © 2014 Elsevier Inc. All rights reserved.
Complete cDNA sequence coding for human docking protein
Energy Technology Data Exchange (ETDEWEB)
Hortsch, M; Labeit, S; Meyer, D I
1988-01-11
Docking protein (DP, or SRP receptor) is a rough endoplasmic reticulum (ER)-associated protein essential for the targeting and translocation of nascent polypeptides across this membrane. It specifically interacts with a cytoplasmic ribonucleoprotein complex, the signal recognition particle (SRP). The nucleotide sequence of cDNA encoding the entire human DP and its deduced amino acid sequence are given.
Kondo, Jiro; Westhof, Eric
2011-10-01
Nucleotide bases are recognized by amino acid residues in a variety of DNA/RNA binding and nucleotide binding proteins. In this study, a total of 446 crystal structures of nucleotide-protein complexes are analyzed manually and pseudo pairs together with single and bifurcated hydrogen bonds observed between bases and amino acids are classified and annotated. Only 5 of the 20 usual amino acid residues, Asn, Gln, Asp, Glu and Arg, are able to orient in a coplanar fashion in order to form pseudo pairs with nucleotide bases through two hydrogen bonds. The peptide backbone can also form pseudo pairs with nucleotide bases and presents a strong bias for binding to the adenine base. The Watson-Crick side of the nucleotide bases is the major interaction edge participating in such pseudo pairs. Pseudo pairs between the Watson-Crick edge of guanine and Asp are frequently observed. The Hoogsteen edge of the purine bases is a good discriminatory element in recognition of nucleotide bases by protein side chains through the pseudo pairing: the Hoogsteen edge of adenine is recognized by various amino acids while the Hoogsteen edge of guanine is only recognized by Arg. The sugar edge is rarely recognized by either the side-chain or peptide backbone of amino acid residues.
Polymorphism Sequence - JSNP | LSDB Archive [Life Science Database Archive metadata
Lifescience Database Archive (English)
Full Text Available List Contact us JSNP Polymorphism Sequence Data detail Data name Polymorphism Sequence DOI 10.18908/lsdba.nb...dc00114-001 Description of data contents Information on polymorphisms (SNPs and insertions/deletions) and th...se Name database name JSNP_SNP: single nucleotide polymorphism JSNP_InsDel_IND: insertion/deletion JSNP_InsD...ved allele observed 3' Flanking Sequence 3' flanking sequence Offset in Flanking Sequence position of the polymorphism...uence Accession No. accession No. of the sequence for polymorphism screening Offset in Record position of the polymorphism
Chen, Honglin; Wang, Lixia; Wang, Suhua; Liu, Chunji; Blair, Matthew Wohlgemuth; Cheng, Xuzhen
2015-01-01
Mung bean (Vigna radiate (L.) Wilczek) is an important traditional food legume crop, with high economic and nutritional value. It is widely grown in China and other Asian countries. Despite its importance, genomic information is currently unavailable for this crop plant species or some of its close relatives in the Vigna genus. In this study, more than 103 million high quality cDNA sequence reads were obtained from mung bean using Illumina paired-end sequencing technology. The processed reads were assembled into 48,693 unigenes with an average length of 874 bp. Of these unigenes, 25,820 (53.0%) and 23,235 (47.7%) showed significant similarity to proteins in the NCBI non-redundant protein and nucleotide sequence databases, respectively. Furthermore, 19,242 (39.5%) could be classified into gene ontology categories, 18,316 (37.6%) into Swiss-Prot categories and 10,918 (22.4%) into KOG database categories (E-value SSR), and 2,303 sequences contained more than one SSR together in the same expressed sequence tag (EST). A total of 13,134 EST-SSRs were identified as potential molecular markers, with mono-nucleotide A/T repeats being the most abundant motif class and G/C repeats being rare. In this SSR analysis, we found five main repeat motifs: AG/CT (30.8%), GAA/TTC (12.6%), AAAT/ATTT (6.8%), AAAAT/ATTTT (6.2%) and AAAAAT/ATTTTT (1.9%). A total of 200 SSR loci were randomly selected for validation by PCR amplification as EST-SSR markers. Of these, 66 marker primer pairs produced reproducible amplicons that were polymorphic among 31 mung bean accessions selected from diverse geographical locations. The large number of SSR-containing sequences found in this study will be valuable for the construction of a high-resolution genetic linkage maps, association or comparative mapping and genetic analyses of various Vigna species.
High-throughput sequencing of RNA silencing-associated small RNAs in olive (Olea europaea L..
Directory of Open Access Journals (Sweden)
Livia Donaire
Full Text Available Small RNAs (sRNAs of 20 to 25 nucleotides (nt in length maintain genome integrity and control gene expression in a multitude of developmental and physiological processes. Despite RNA silencing has been primarily studied in model plants, the advent of high-throughput sequencing technologies has enabled profiling of the sRNA component of more than 40 plant species. Here, we used deep sequencing and molecular methods to report the first inventory of sRNAs in olive (Olea europaea L.. sRNA libraries prepared from juvenile and adult shoots revealed that the 24-nt class dominates the sRNA transcriptome and atypically accumulates to levels never seen in other plant species, suggesting an active role of heterochromatin silencing in the maintenance and integrity of its large genome. A total of 18 known miRNA families were identified in the libraries. Also, 5 other sRNAs derived from potential hairpin-like precursors remain as plausible miRNA candidates. RNA blots confirmed miRNA expression and suggested tissue- and/or developmental-specific expression patterns. Target mRNAs of conserved miRNAs were computationally predicted among the olive cDNA collection and experimentally validated through endonucleolytic cleavage assays. Finally, we use expression data to uncover genetic components of the miR156, miR172 and miR390/TAS3-derived trans-acting small interfering RNA (tasiRNA regulatory nodes, suggesting that these interactive networks controlling developmental transitions are fully operational in olive.
DEFF Research Database (Denmark)
Friis-Nielsen, Jens; Kjartansdóttir, Kristín Rós; Mollerup, Sarah
2016-01-01
have developed a species independent pipeline that utilises sequence clustering for the identification of nucleotide sequences that co-occur across multiple sequencing data instances. We applied the workflow to 686 sequencing libraries from 252 cancer samples of different cancer and tissue types, 32...
Isolation of laccase gene-specific sequences from white rot and brown rot fungi by PCR.
D'Souza, T M; Boominathan, K; Reddy, C A
1996-01-01
Degenerate primers corresponding to the consensus sequences of the copper-binding regions in the N-terminal domains of known basidiomycete laccases were used to isolate laccase gene-specific sequences from strains representing nine genera of wood rot fungi. All except three gave the expected PCR product of about 200 bp. Computer searches of the databases identified the sequence of each of the PCR products analyzed as a laccase gene sequence, suggesting the specificity of the primers. PCR products of the white rot fungi Ganoderma lucidum, Phlebia brevispora, and Trametes versicolor showed 65 to 74% nucleotide sequence similarity to each other; the similarity in deduced amino acid sequences was 83 to 91%. The PCR products of Lentinula edodes and Lentinus tigrinus, on the other hand, showed relatively low nucleotide and amino acid similarities (58 to 64 and 62 to 81%, respectively); however, these similarities were still much higher than when compared with the corresponding regions in the laccases of the ascomycete fungi Aspergillus nidulans and Neurospora crassa. A few of the white rot fungi, as well as Gloeophyllum trabeum, a brown rot fungus, gave a 144-bp PCR fragment which had a nucleotide sequence similarity of 60 to 71%. Demonstration of laccase activity in G. trabeum and several other brown rot fungi was of particular interest because these organisms were not previously shown to produce laccases. PMID:8837429
Directory of Open Access Journals (Sweden)
Sun Yu
2011-11-01
Full Text Available Abstract Background Enterovirus 71 (EV71 and Coxsackievirus A16 (CA16 are two major etiological agents of Hand, Foot and Mouth Disease (HFMD. EV71 is associated with severe cases but not CA16. The mechanisms contributed to the different pathogenesis of these two viruses are unknown. VP1 and VP4 are two major structural proteins of these viruses, and should be paid close attention to. Results The sequences of vp1s from 14 EV71 and 14 CA16, and vp4s from 10 EV71 and 1 CA16 isolated in this study during 2007 to 2009 HFMD seasons were analyzed together with the corresponding sequences available in GenBank using DNAStar and MEGA 4.0. Phylogenetic analysis of complete vp1s or vp4s showed that EV71 isolated in Beijing belonged to C4 and CA16 belonged to lineage B2 (lineage C. VP1s and VP4s from 4 strains of viruses expressed in E. coli BL21 cells were used to detect IgM and IgG in human sera by Western Blot. The detection of IgM against VP1s of EV71 and CA16 showed consistent results with current infection, while none of the sera were positive against VP4s of EV71 and CA16. There was significant difference in the positive rates between EV71 VP1 and CA16 VP1 (χ2 = 5.02, P 2 = 15.30, P 2 = 26.47, P 2 = 16.78, P Conclusions EV71 and CA16 were highly diverse in the nucleotide sequences of vp1s and vp4s. The sera positive rates of VP1 and VP4 of EV71 were lower than those of CA16 respectively, which suggested a less exposure rate to EV71 than CA16 in Beijing population. Human serum antibodies detected by Western blot using VP1s and VP4s as antigen indicated that the immunological reaction to VP1 and VP4 of both EV71 and CA16 was different.
Nucleotide Selectivity at a Preinsertion Checkpoint of T7 RNA Polymerase Transcription Elongation.
E, Chao; Duan, Baogen; Yu, Jin
2017-04-20
Nucleotide selection is crucial for transcription fidelity control, in particular, for viral T7 RNA polymerase (RNAP) lack of proofreading activity. It has been recognized that multiple kinetic checkpoints exist prior to full nucleotide incorporation. In this work, we implemented intensive atomistic molecular dynamics (MD) simulations to quantify how strong the nucleotide selection is at the initial checkpoint of an elongation cycle of T7 RNAP. The incoming nucleotides bind into a preinsertion site where a critical tyrosine residue locates nearby to assist the nucleotide selection. We calculated the relative binding free energy between a noncognate nucleotide and a cognate one at a preinsertion configuration via alchemical simulations, showing that a small selection free energy or the binding free energy difference (∼3 k B T) exists between the two nucleotides. Indeed, another preinsertion configuration favored by the noncognate nucleotides was identified, which appears to be off path for further nucleotide insertion and additionally assists the nucleotide selection. By chemical master equation (CME) approach, we show that the small selection free energy at the preinsertion site along with the off-path noncognate nucleotide filtering can help substantially to reduce the error rate and to maintain the elongation rate high in the T7 RNAP transcription.
Giangaspero, Massimo; Harasawa, Ryô
2007-12-01
The palindromic nucleotide substitutions (PNS) at the three variable loci (V1, V2 and V3) in the 5' untranslated region (UTR) of Pestivirus RNA have been considered for taxonomical segregation of species, through the evaluation of 430 genomic sequences. On the basis of qualitative and quantitative secondary structure characteristics, six species have been identified: Bovine viral diarrhea virus 1 (BVDV-1), Bovine viral diarrhea virus 2 (BVDV-2), Classical swine fever virus (CSFV), Border disease virus (BDV), the tentative species Giraffe and a new proposed taxon named Pronghorn. The first step was qualitative and consisted in the characterization of the different positions of the three stems and loops in the 5' UTR sequences of all the strains under consideration belonging to the genus. Secondary structure sequences showing divergent base-pair combinations have been aligned for comparison. Palindromic positions have been characterized according to changes in nucleotide base-pairs identifying low-variable positions (LVP) including base-pairs present in less than 80% of the genus. The second step was quantitative, allowing the identification of genomic groups by clustering the base-pair combinations according to LVP. Relatedness among types was evaluated to identify homogeneous groups. Cross comparisons between types within the genus have been evaluated by computing the divergence percentage thus clarifying borderline and multirelated sequences.
Exome Sequence Analysis of 14 Families With High Myopia
DEFF Research Database (Denmark)
Kloss, Bethany A.; Tompson, Stuart W.; Whisenhunt, Kristina N.
2017-01-01
Purpose: To identify causal gene mutations in 14 families with autosomal dominant (AD) high myopia using exome sequencing. Methods: Select individuals from 14 large Caucasian families with high myopia were exome sequenced. Gene variants were filtered to identify potential pathogenic changes. Sang...
International Nuclear Information System (INIS)
Kwon, Y.K.; Hecht, N.B.
1991-01-01
The expression of the protamines, the predominant nuclear proteins of mammalian spermatozoa, is regulated translationally during male germ-cell development. The 3' untranslated region (UTR) of protamine 1 mRNA has been reported to control its time of translation. To understand the mechanisms controlling translation of the protamine mRNAs, we have sought to identify cis elements of the 3' UTR of protamine 2 mRNA that are recognized by cytoplasmic factors. From gel retardation assays, two sequence elements are shown to form specific RNA-protein complexes. Protein binding sites of the two complexes were determined by RNase T1 mapping, by blocking the putative binding sites with antisense oligonucleotides, and by competition assays. The sequences of these elements, located between nucleotides + 537 and + 572 in protamine 2 mRNA, are highly conserved among postmeiotic translationally regulated nuclear proteins of the mammalian testis. Two closely linked protein binding sites were detected. UV-crosslinking studies revealed that a protein of about 18 kDa binds to one of the conserved sequences. These data demonstrate specific protein binding to a highly conserved 3' UTR of translationally regulated testicular mRNA
DEFF Research Database (Denmark)
Friis-Nielsen, Jens; Kjartansdóttir, Kristín Rós; Mollerup, Sarah
2016-01-01
non-template controls, and 24 test samples. Recurrent sequences were statistically associated to biological, methodological or technical features with the aim to identify novel pathogens or plausible contaminants that may associate to a particular kit or method. We provide examples of identified......Virus discovery from high throughput sequencing data often follows a bottom-up approach where taxonomic annotation takes place prior to association to disease. Albeit effective in some cases, the approach fails to detect novel pathogens and remote variants not present in reference databases. We...... have developed a species independent pipeline that utilises sequence clustering for the identification of nucleotide sequences that co-occur across multiple sequencing data instances. We applied the workflow to 686 sequencing libraries from 252 cancer samples of different cancer and tissue types, 32...
Complete sequence of RNA1 of grapevine Anatolian ringspot virus.
Digiaro, Michele; Nahdi, Sabrine; Elbeaino, Toufic
2012-10-01
The nucleotide sequence of RNA1 of grapevine Anatolian ringspot virus (GARSV), a nepovirus of subgroup B, was determined from cDNA clones. It is 7,288 nucleotides in length excluding the 3' terminal poly(A) tail and contains a large open reading frame (ORF), extending from nucleotides 272 to 7001, encoding a polypeptide of 2,243 amino acids with a predicted molecular mass of 250 kDa. The primary structure of the polyprotein, compared with that of other viral polyproteins, revealed the presence of all the characteristic domains of members of the order Picornavirales, i.e., the NTP-binding protein (1B(Hel)), the viral genome-linked protein (1C(VPg)), the proteinase (1D(Prot)), the RNA-dependent RNA polymerase (1E(Pol)), and of the protease cofactor (1A(Pro-cof)) shared by members of the subfamily Comovirinae within the family Secoviridae. The cleavage sites predicted within the polyprotein were found to be in agreement with those previously reported for nepoviruses of subgroup B, processing from 1A to 1E proteins of 67, 64, 3, 23 and 92 kDa, respectively. The RNA1-encoded polyprotein (p1) shared the highest amino acid sequence identity (66 %) with tomato black ring virus (TBRV) and beet ringspot virus (BRSV). The 5'- and 3'-noncoding regions (NCRs) of GARSV-RNA1 shared 89 % and 95 % nucleotide sequence identity respectively with the corresponding regions in RNA2. Phylogenetic analysis confirmed the close relationship of GARSV to members of subgroup B of the genus Nepovirus.
Directory of Open Access Journals (Sweden)
Guangtu Gao
2018-04-01
Full Text Available Single-nucleotide polymorphisms (SNPs are highly abundant markers, which are broadly distributed in animal genomes. For rainbow trout (Oncorhynchus mykiss, SNP discovery has been previously done through sequencing of restriction-site associated DNA (RAD libraries, reduced representation libraries (RRL and RNA sequencing. Recently we have performed high coverage whole genome resequencing with 61 unrelated samples, representing a wide range of rainbow trout and steelhead populations, with 49 new samples added to 12 aquaculture samples from AquaGen (Norway that we previously used for SNP discovery. Of the 49 new samples, 11 were double-haploid lines from Washington State University (WSU and 38 represented wild and hatchery populations from a wide range of geographic distribution and with divergent migratory phenotypes. We then mapped the sequences to the new rainbow trout reference genome assembly (GCA_002163495.1 which is based on the Swanson YY doubled haploid line. Variant calling was conducted with FreeBayes and SAMtools mpileup, followed by filtering of SNPs based on quality score, sequence complexity, read depth on the locus, and number of genotyped samples. Results from the two variant calling programs were compared and genotypes of the double haploid samples were used for detecting and filtering putative paralogous sequence variants (PSVs and multi-sequence variants (MSVs. Overall, 30,302,087 SNPs were identified on the rainbow trout genome 29 chromosomes and 1,139,018 on unplaced scaffolds, with 4,042,723 SNPs having high minor allele frequency (MAF > 0.25. The average SNP density on the chromosomes was one SNP per 64 bp, or 15.6 SNPs per 1 kb. Results from the phylogenetic analysis that we conducted indicate that the SNP markers contain enough population-specific polymorphisms for recovering population relationships despite the small sample size used. Intra-Population polymorphism assessment revealed high level of polymorphism and
Exploring the Mechanisms of Gastrointestinal Cancer Development Using Deep Sequencing Analysis
International Nuclear Information System (INIS)
Matsumoto, Tomonori; Shimizu, Takahiro; Takai, Atsushi; Marusawa, Hiroyuki
2015-01-01
Next-generation sequencing (NGS) technologies have revolutionized cancer genomics due to their high throughput sequencing capacity. Reports of the gene mutation profiles of various cancers by many researchers, including international cancer genome research consortia, have increased over recent years. In addition to detecting somatic mutations in tumor cells, NGS technologies enable us to approach the subject of carcinogenic mechanisms from new perspectives. Deep sequencing, a method of optimizing the high throughput capacity of NGS technologies, allows for the detection of genetic aberrations in small subsets of premalignant and/or tumor cells in noncancerous chronically inflamed tissues. Genome-wide NGS data also make it possible to clarify the mutational signatures of each cancer tissue by identifying the precise pattern of nucleotide alterations in the cancer genome, providing new information regarding the mechanisms of tumorigenesis. In this review, we highlight these new methods taking advantage of NGS technologies, and discuss our current understanding of carcinogenic mechanisms elucidated from such approaches
Exploring the Mechanisms of Gastrointestinal Cancer Development Using Deep Sequencing Analysis
Energy Technology Data Exchange (ETDEWEB)
Matsumoto, Tomonori; Shimizu, Takahiro; Takai, Atsushi; Marusawa, Hiroyuki, E-mail: maru@kuhp.kyoto-u.ac.jp [Department of Gastroenterology and Hepatology, Graduate School of Medicine, Kyoto University, 54 Shogoin-Kawahara-cho, Sakyo-ku, Kyoto 606-8507 (Japan)
2015-06-15
Next-generation sequencing (NGS) technologies have revolutionized cancer genomics due to their high throughput sequencing capacity. Reports of the gene mutation profiles of various cancers by many researchers, including international cancer genome research consortia, have increased over recent years. In addition to detecting somatic mutations in tumor cells, NGS technologies enable us to approach the subject of carcinogenic mechanisms from new perspectives. Deep sequencing, a method of optimizing the high throughput capacity of NGS technologies, allows for the detection of genetic aberrations in small subsets of premalignant and/or tumor cells in noncancerous chronically inflamed tissues. Genome-wide NGS data also make it possible to clarify the mutational signatures of each cancer tissue by identifying the precise pattern of nucleotide alterations in the cancer genome, providing new information regarding the mechanisms of tumorigenesis. In this review, we highlight these new methods taking advantage of NGS technologies, and discuss our current understanding of carcinogenic mechanisms elucidated from such approaches.
The arabidopsis cyclic nucleotide interactome
Donaldson, Lara Elizabeth; Meier, Stuart Kurt; Gehring, Christoph A
2016-01-01
Cyclic nucleotides have been shown to play important signaling roles in many physiological processes in plants including photosynthesis and defence. Despite this, little is known about cyclic nucleotide-dependent signaling mechanisms
DEFF Research Database (Denmark)
Clausen, Anders; Mikkelsen, Marie Just; Schrøder, I.
2004-01-01
The nucleotide sequence of two novel plasmids isolated from the extreme thermophilic anaerobic bacterium Anaerocellum thermophilum DSM6725 (A. thermophilum), growing optimally at 70degreesC, has been determined. pBAS2 was found to be a 3653 bp plasmid with a GC content of 43%, and the sequence re...... with highest similarity to DNA repair protein from Campylobacter jejuni (25% aa). Orf34 showed similarity to sigma factors with highest similarity (28% aa) to the sporulation specific Sigma factor, Sigma 28(K) from Bacillus thuringiensis....
Comparative analysis of the prion protein gene sequences in African lion.
Wu, Chang-De; Pang, Wan-Yong; Zhao, De-Ming
2006-10-01
The prion protein gene of African lion (Panthera Leo) was first cloned and polymorphisms screened. The results suggest that the prion protein gene of eight African lions is highly homogenous. The amino acid sequences of the prion protein (PrP) of all samples tested were identical. Four single nucleotide polymorphisms (C42T, C81A, C420T, T600C) in the prion protein gene (Prnp) of African lion were found, but no amino acid substitutions. Sequence analysis showed that the higher homology is observed to felis catus AF003087 (96.7%) and to sheep number M31313.1 (96.2%) Genbank accessed. With respect to all the mammalian prion protein sequences compared, the African lion prion protein sequence has three amino acid substitutions. The homology might in turn affect the potential intermolecular interactions critical for cross species transmission of prion disease.
Characteristics of alternating current hopping conductivity in DNA sequences
Institute of Scientific and Technical Information of China (English)
Ma Song-Shan; Xu Hui; Wang Huan-You; Guo Rui
2009-01-01
This paper presents a model to describe alternating current (AC) conductivity of DNA sequences,in which DNA is considered as a one-dimensional (1D) disordered system,and electrons transport via hopping between localized states.It finds that AC conductivity in DNA sequences increases as the frequency of the external electric field rises,and it takes the form of σac(ω)~ω2 ln2(1/ω).Also AC conductivity of DNA sequences increases with the increase of temperature,this phenomenon presents characteristics of weak temperature-dependence.Meanwhile,the AC conductivity in an off diagonally correlated case is much larger than that in the uncorrelated case of the Anderson limit in low temperatures,which indicates that the off-diagonal correlations in DNA sequences have a great effect on the AC conductivity,while at high temperature the off-diagonal correlations no longer play a vital role in electric transport. In addition,the proportion of nucleotide pairs p also plays an important role in AC electron transport of DNA sequences.For p<0.5,the conductivity of DNA sequence decreases with the increase of p,while for p > 0.5,the conductivity increases with the increase of p.
Kuznedelov, K D; Timoshkin, O A; Goldman, E
1997-01-01
Polymerase chain reaction (PCR) and direct sequencing of small ribosomal RNA genes were used for analysis of genetic differences among Asiatic species of freshwater triclad genus Bdellocephala. Representatives of four species and four subspecies of this genus were used to establish homology between nucleotides in the 5'-end portion of small ribosomal RNA gene sequences. Within 552 nucleotide sites of aligned sequences compared, six variable base positions were discovered, dividing Bdellocephala into five different genotypes. Sequence data allow to distinguish two groups of these genotypes. One of them unites species from Kamchatka and Japan, another one unites Baikalian taxa. Agreement between available morphological, cytological and sequence data is discussed.
Zhang, Xueru; McGown, Linda B
2013-06-01
DNA analysis has widespread applicability in biology, medicine, biotechnology, and forensics. DNA separation by length is readily achieved using sieving gels in electrophoresis. Separation by sequence is less simple, generally requiring adequate differences in native or induced conformation or differences in thermal or chemical stability of the strands that are hybridized prior to measurement. We previously demonstrated separation of four single-stranded DNA 76-mers that differ by only a few A-G substitutions based solely on sequence using guanosine-5'-monophosphate (GMP) in the running buffer. We attributed separation to the unique self-assembly of GMP to form higher order structures. Here, we examine an expanded set of 76-mers designed to probe the mechanism of the separation and effects of experimental conditions. We were surprised to find that other ribonucleotides achieved the similar separation to GMP, and that some separation was achieved using sodium phosphate instead of GMP. Potassium phosphate achieved almost as good separations as the ribonucleotides. This suggests that the separation medium provides a physicochemical environment for the DNA that effects strand migration in a sequence-selective manner. Further investigation is needed to determine whether the mechanism involves specific interactions between the phosphates and the DNA strands or is a result of other properties of the separation medium. Phosphate generally has been avoided in DNA separations by capillary gel electrophoresis because its high ionic strength exacerbates Joule heating. Our results suggest that phosphate compounds should be examined for separation of DNA based on sequence. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Directory of Open Access Journals (Sweden)
Geldner Niko
2005-02-01
Full Text Available Abstract Background Small G proteins, which are essential regulators of multiple cellular functions, are activated by guanine nucleotide exchange factors (GEFs that stimulate the exchange of the tightly bound GDP nucleotide by GTP. The catalytic domain responsible for nucleotide exchange is in general associated with non-catalytic domains that define the spatio-temporal conditions of activation. In the case of small G proteins of the Arf subfamily, which are major regulators of membrane trafficking, GEFs form a heterogeneous family whose only common characteristic is the well-characterized Sec7 catalytic domain. In contrast, the function of non-catalytic domains and how they regulate/cooperate with the catalytic domain is essentially unknown. Results Based on Sec7-containing sequences from fully-annotated eukaryotic genomes, including our annotation of these sequences from Paramecium, we have investigated the domain architecture of large ArfGEFs of the BIG and GBF subfamilies, which are involved in Golgi traffic. Multiple sequence alignments combined with the analysis of predicted secondary structures, non-structured regions and splicing patterns, identifies five novel non-catalytic structural domains which are common to both subfamilies, revealing that they share a conserved modular organization. We also report a novel ArfGEF subfamily with a domain organization so far unique to alveolates, which we name TBS (TBC-Sec7. Conclusion Our analysis unifies the BIG and GBF subfamilies into a higher order subfamily, which, together with their being the only subfamilies common to all eukaryotes, suggests that they descend from a common ancestor from which species-specific ArfGEFs have subsequently evolved. Our identification of a conserved modular architecture provides a background for future functional investigation of non-catalytic domains.
International Nuclear Information System (INIS)
Shaheen, T.; Zafar, Y.; Rahman, M.
2014-01-01
Single nucleotide polymorphism analysis is an expedient way to study polymorphisms at genomic level. In the present study we have explored Ubiquitin extension protein gene of G. arboreum (A2) and G. herbaceum (A1) of cotton which is a multiple copy gene. We have found SNPs at 16 positions in 200 bp region within A genome of cotton indicating frequency of SNPs 1/13 bp. Both sequences from cotton have shown maximum similarity with UBQ5 and UBQ6 of Arabidopsis thaliana. Sequence obtained from G. arboreum has shown SNPs at 28 positions in comparison with each UBQ5 and UBQ6 of Arabidopsis thaliana while sequence obtained from G. herbaceum has shown SNPs at 31 positions in comparison with each UBQ5 and UBQ6 of Arabidopsis thaliana. In conclusion although during pace of evolution ubiquitin extension protein genes of both A genome species have got some mutations from nature but still most of their sequence is similar. Single nucleotide polymorphism study can prove a vital tool to identify gene type in case of Multicopy genes. (author)
Kwon, Andrew T.; Chou, Alice Yi; Arenillas, David J.; Wasserman, Wyeth W.
2011-01-01
We performed a genome-wide scan for muscle-specific cis-regulatory modules (CRMs) using three computational prediction programs. Based on the predictions, 339 candidate CRMs were tested in cell culture with NIH3T3 fibroblasts and C2C12 myoblasts for capacity to direct selective reporter gene expression to differentiated C2C12 myotubes. A subset of 19 CRMs validated as functional in the assay. The rate of predictive success reveals striking limitations of computational regulatory sequence analysis methods for CRM discovery. Motif-based methods performed no better than predictions based only on sequence conservation. Analysis of the properties of the functional sequences relative to inactive sequences identifies nucleotide sequence composition can be an important characteristic to incorporate in future methods for improved predictive specificity. Muscle-related TFBSs predicted within the functional sequences display greater sequence conservation than non-TFBS flanking regions. Comparison with recent MyoD and histone modification ChIP-Seq data supports the validity of the functional regions. PMID:22144875
Directory of Open Access Journals (Sweden)
Andrew T Kwon
2011-12-01
Full Text Available We performed a genome-wide scan for muscle-specific cis-regulatory modules (CRMs using three computational prediction programs. Based on the predictions, 339 candidate CRMs were tested in cell culture with NIH3T3 fibroblasts and C2C12 myoblasts for capacity to direct selective reporter gene expression to differentiated C2C12 myotubes. A subset of 19 CRMs validated as functional in the assay. The rate of predictive success reveals striking limitations of computational regulatory sequence analysis methods for CRM discovery. Motif-based methods performed no better than predictions based only on sequence conservation. Analysis of the properties of the functional sequences relative to inactive sequences identifies nucleotide sequence composition can be an important characteristic to incorporate in future methods for improved predictive specificity. Muscle-related TFBSs predicted within the functional sequences display greater sequence conservation than non-TFBS flanking regions. Comparison with recent MyoD and histone modification ChIP-Seq data supports the validity of the functional regions.
Spontaneous preterm birth and single nucleotide gene polymorphisms: a recent update
Directory of Open Access Journals (Sweden)
Ishfaq A. Sheikh
2016-10-01
Full Text Available Abstract Background Preterm birth (PTB, birth at <37 weeks of gestation, is a significant global public health problem. World-wide, about 15 million babies are born preterm each year resulting in more than a million deaths of children. Preterm neonates are more prone to problems and need intensive care hospitalization. Health issues may persist through early adulthood and even be carried on to the next generation. Majority (70 % of PTBs are spontaneous with about a half without any apparent cause and the other half associated with a number of risk factors. Genetic factors are one of the significant risks for PTB. The focus of this review is on single nucleotide gene polymorphisms (SNPs that are reported to be associated with PTB. Results A comprehensive evaluation of studies on SNPs known to confer potential risk of PTB was done by performing a targeted PubMed search for the years 2007–2015 and systematically reviewing all relevant studies. Evaluation of 92 studies identified 119 candidate genes with SNPs that had potential association with PTB. The genes were associated with functions of a wide spectrum of tissue and cell types such as endocrine, tissue remodeling, vascular, metabolic, and immune and inflammatory systems. Conclusions A number of potential functional candidate gene variants have been reported that predispose women for PTB. Understanding the complex genomic landscape of PTB needs high-throughput genome sequencing methods such as whole-exome sequencing and whole-genome sequencing approaches that will significantly enhance the understanding of PTB. Identification of high risk women, avoidance of possible risk factors, and provision of personalized health care are important to manage PTB.
Genome Sequence Databases (Overview): Sequencing and Assembly
Energy Technology Data Exchange (ETDEWEB)
Lapidus, Alla L.
2009-01-01
From the date its role in heredity was discovered, DNA has been generating interest among scientists from different fields of knowledge: physicists have studied the three dimensional structure of the DNA molecule, biologists tried to decode the secrets of life hidden within these long molecules, and technologists invent and improve methods of DNA analysis. The analysis of the nucleotide sequence of DNA occupies a special place among the methods developed. Thanks to the variety of sequencing technologies available, the process of decoding the sequence of genomic DNA (or whole genome sequencing) has become robust and inexpensive. Meanwhile the assembly of whole genome sequences remains a challenging task. In addition to the need to assemble millions of DNA fragments of different length (from 35 bp (Solexa) to 800 bp (Sanger)), great interest in analysis of microbial communities (metagenomes) of different complexities raises new problems and pushes some new requirements for sequence assembly tools to the forefront. The genome assembly process can be divided into two steps: draft assembly and assembly improvement (finishing). Despite the fact that automatically performed assembly (or draft assembly) is capable of covering up to 98% of the genome, in most cases, it still contains incorrectly assembled reads. The error rate of the consensus sequence produced at this stage is about 1/2000 bp. A finished genome represents the genome assembly of much higher accuracy (with no gaps or incorrectly assembled areas) and quality ({approx}1 error/10,000 bp), validated through a number of computer and laboratory experiments.
Directory of Open Access Journals (Sweden)
Corti Stefania
2011-03-01
Full Text Available Abstract Background Duchenne and Becker Muscular dystrophies (DMD/BMD are allelic disorders caused by mutations in the dystrophin gene, which encodes a sarcolemmal protein responsible for muscle integrity. Deletions and duplications account for approximately 75% of mutations in DMD and 85% in BMD. The implementation of techniques allowing complete gene sequencing has focused attention on small point mutations and other mechanisms underlying complex rearrangements. Methods We selected 47 patients (41 families; 35 DMD, 6 BMD without deletions and duplications in DMD gene (excluded by multiplex ligation-dependent probe amplification and multiplex polymerase chain reaction analysis. This cohort was investigated by systematic direct sequence analysis to study sequence variation. We focused our attention on rare mutational events which were further studied through transcript analysis. Results We identified 40 different nucleotide alterations in DMD gene and their clinical correlates; altogether, 16 mutations were novel. DMD probands carried 9 microinsertions/microdeletions, 19 nonsense mutations, and 7 splice-site mutations. BMD patients carried 2 nonsense mutations, 2 splice-site mutations, 1 missense substitution, and 1 single base insertion. The most frequent stop codon was TGA (n = 10 patients, followed by TAG (n = 7 and TAA (n = 4. We also analyzed the molecular mechanisms of five rare mutational events. They are two frame-shifting mutations in the DMD gene 3'end in BMD and three novel splicing defects: IVS42: c.6118-3C>A, which causes a leaky splice-site; c.9560A>G, which determines a cryptic splice-site activation and c.9564-426 T>G, which creates pseudoexon retention within IVS65. Conclusion The analysis of our patients' sample, carrying point mutations or complex rearrangements in DMD gene, contributes to the knowledge on phenotypic correlations in dystrophinopatic patients and can provide a better understanding of pre-mRNA maturation defects
DNA Nucleotides Detection via capacitance properties of Graphene
Khadempar, Nahid; Berahman, Masoud; Yazdanpanah, Arash
2016-05-01
In the present paper a new method is suggested to detect the DNA nucleotides on a first-principles calculation of the electronic features of DNA bases which chemisorbed to a graphene sheet placed between two gold electrodes in a contact-channel-contact system. The capacitance properties of graphene in the channel are surveyed using non-equilibrium Green's function coupled with the Density Functional Theory. Thus, the capacitance properties of graphene are theoretically investigated in a biological environment, and, using a novel method, the effect of the chemisorbed DNA nucleotides on electrical charges on the surface of graphene is deciphered. Several parameters in this method are also extracted including Electrostatic energy, Induced density, induced electrostatic potential, Electron difference potential and Electron difference density. The qualitative and quantitative differences among these parameters can be used to identify DNA nucleotides. Some of the advantages of this approach include its ease and high accuracy. What distinguishes the current research is that it is the first experiment to investigate the capacitance properties of gaphene changes in the biological environment and the effect of chemisorbed DNA nucleotides on the surface of graphene on the charge.
“Shovel-ready” Sequences as a Stimulus for the Next Generation of Life Scientists
Boyle, Michael D.
2010-01-01
Genomics and bioinformatics are dynamic fields well-suited for capturing the imagination of undergraduates in both research laboratories and classrooms. Currently, raw nucleotide sequence is being provided, as part of several genomics research initiatives, for undergraduate research and teaching. These initiatives could be easily extended and much more effective if the source of the sequenced material and the subsequent focus of the data analysis were aligned with the research interests of individual faculty at undergraduate institutions. By judicious use of surplus capacity in existing nucleotide sequencing cores, raw sequence data could be generated to support ongoing research efforts involving undergraduates. This would allow these students to participate actively in discovery research, with a goal of making novel contributions to their field through original research while nurturing the next generation of talented research scientists. PMID:23653696
Perry, George H; Reeves, Darryl; Melsted, Páll; Ratan, Aakrosh; Miller, Webb; Michelini, Katelyn; Louis, Edward E; Pritchard, Jonathan K; Mason, Christopher E; Gilad, Yoav
2012-01-01
We present a high-coverage draft genome assembly of the aye-aye (Daubentonia madagascariensis), a highly unusual nocturnal primate from Madagascar. Our assembly totals ~3.0 billion bp (3.0 Gb), roughly the size of the human genome, comprised of ~2.6 million scaffolds (N50 scaffold size = 13,597 bp) based on short paired-end sequencing reads. We compared the aye-aye genome sequence data with four other published primate genomes (human, chimpanzee, orangutan, and rhesus macaque) as well as with the mouse and dog genomes as nonprimate outgroups. Unexpectedly, we observed strong evidence for a relatively slow substitution rate in the aye-aye lineage compared with these and other primates. In fact, the aye-aye branch length is estimated to be ~10% shorter than that of the human lineage, which is known for its low substitution rate. This finding may be explained, in part, by the protracted aye-aye life-history pattern, including late weaning and age of first reproduction relative to other lemurs. Additionally, the availability of this draft lemur genome sequence allowed us to polarize nucleotide and protein sequence changes to the ancestral primate lineage-a critical period in primate evolution, for which the relevant fossil record is sparse. Finally, we identified 293,800 high-confidence single nucleotide polymorphisms in the donor individual for our aye-aye genome sequence, a captive-born individual from two wild-born parents. The resulting heterozygosity estimate of 0.051% is the lowest of any primate studied to date, which is understandable considering the aye-aye's extensive home-range size and relatively low population densities. Yet this level of genetic diversity also suggests that conservation efforts benefiting this unusual species should be prioritized, especially in the face of the accelerating degradation and fragmentation of Madagascar's forests.
Gao, Yangchun; Li, Shiguo; Zhan, Aibin
2018-04-01
Invasive species cause huge damages to ecology, environment and economy globally. The comprehensive understanding of invasion mechanisms, particularly genetic bases of micro-evolutionary processes responsible for invasion success, is essential for reducing potential damages caused by invasive species. The golden star tunicate, Botryllus schlosseri, has become a model species in invasion biology, mainly owing to its high invasiveness nature and small well-sequenced genome. However, the genome-wide genetic markers have not been well developed in this highly invasive species, thus limiting the comprehensive understanding of genetic mechanisms of invasion success. Using restriction site-associated DNA (RAD) tag sequencing, here we developed a high-quality resource of 14,119 out of 158,821 SNPs for B. schlosseri. These SNPs were relatively evenly distributed at each chromosome. SNP annotations showed that the majority of SNPs (63.20%) were located at intergenic regions, and 21.51% and 14.58% were located at introns and exons, respectively. In addition, the potential use of the developed SNPs for population genomics studies was primarily assessed, such as the estimate of observed heterozygosity (H O ), expected heterozygosity (H E ), nucleotide diversity (π), Wright's inbreeding coefficient (F IS ) and effective population size (Ne). Our developed SNP resource would provide future studies the genome-wide genetic markers for genetic and genomic investigations, such as genetic bases of micro-evolutionary processes responsible for invasion success.
International Nuclear Information System (INIS)
Priebe, S.D.; Hadi, S.M.; Greenberg, B.; Lacks, S.A.
1988-01-01
The Hex system of heteroduplex DNA base mismatch repair operates in Streptococcus pneumoniae after transformation and replication to correct donor and nascent DNA strands, respectively. A functionally similar system, called Mut, operates in Escherichia coli and Salmonella typhimurium. The nucleotide sequence of a 3.8-kilobase segment from the S. pneumoniae chromosome that includes the 2.7-kilobase hexA gene was determined. Chromosomal DNA used as donor to measure Hex phenotype was irradiated with UV light. An open reading frame that could encode a 17-kilodalton polypeptide (OrfC) was located just upstream of the gene encoding a polypeptide of 95 kilodaltons corresponding to HexA. Shine-Dalgarno sequences and putative promoters were identified upstream of each protein start site. Insertion mutations showed that only HexA functioned in mismatch repair and that the promoter for hexA transcription was located within the OrfC-coding region. The HexA polypeptide contains a consensus sequence for ATP- or GTP-binding sites in proteins. Comparison of the entire HexA protein sequence to that of MutS of S. typhimurium, showed the proteins to be homologous, inasmuch as 36% of their amino acid residues were identical. This homology indicates that the Hex and Mut systems of mismatch repair evolved from an ancestor common to the gram-positive streptococci and the gram-negative enterobacteria. It is the first direct evidence linking the two systems