OBSERVATIONS OF THE YOUNG SUPERNOVA REMNANT RX J1713.7-3946 WITH THE FERMI LARGE AREA TELESCOPE

International Nuclear Information System (INIS)

Abdo, A. A.; Ackermann, M.; Ajello, M.; Allafort, A.; Berenji, B.; Blandford, R. D.; Bloom, E. D.; Borgland, A. W.; Baldini, L.; Bellazzini, R.; Bregeon, J.; Ballet, J.; Barbiellini, G.; Baring, M. G.; Bastieri, D.; Bonamente, E.; Bouvier, A.; Brandt, T. J.; Brigida, M.; Bruel, P.

2011-01-01

We present observations of the young supernova remnant (SNR) RX J1713.7-3946 with the Fermi Large Area Telescope (LAT). We clearly detect a source positionally coincident with the SNR. The source is extended with a best-fit extension of 0. 0 55 ± 0. 0 04 matching the size of the non-thermal X-ray and TeV gamma-ray emission from the remnant. The positional coincidence and the matching extended emission allow us to identify the LAT source with SNR RX J1713.7-3946. The spectrum of the source can be described by a very hard power law with a photon index of Γ = 1.5 ± 0.1 that coincides in normalization with the steeper H.E.S.S.-detected gamma-ray spectrum at higher energies. The broadband gamma-ray emission is consistent with a leptonic origin as the dominant mechanism for the gamma-ray emission.

Steam in RX Puppis

Energy Technology Data Exchange (ETDEWEB)

Barton, J R; Phillips, B A; Allen, D A [Anglo-Australian Observatory, Epping (Australia)

1979-06-01

The presence of H/sub 2/O and CO absorption in RX Puppis is demonstrated by means of 2-..mu..m spectroscopy. The existence of a Mira variable in this star is thereby confirmed. These data are not easily reconciled with a recent model in which a single B giant is invoked as the central energy source. It is believed instead that RX Pup is explicable in terms of a symbiotic binary model.

RxNorm

Data.gov (United States)

U.S. Department of Health & Human Services — RxNorm provides normalized names for clinical drugs and links its names to many of the drug vocabularies commonly used in pharmacy management and drug interaction...

On the origin of hyperfast neutron stars

NARCIS (Netherlands)

Gvaramadze, V.V.; Gualandris, A.; Portegies Zwart, S.

2007-01-01

We propose an explanation for the origin of hyperfast neutron stars (e.g. PSR B1508+55, PSR B2224+65, RX J0822-4300) based on the hypothesis that they could be the remnants of a symmetric supernova explosion of a high-velocity massive star (or its helium core) which attained its peculiar velocity

Some aspects of ICP-AES analysis of high purity rare earths

International Nuclear Information System (INIS)

Murty, P.S.; Biswas, S.S.

1991-01-01

Inductively coupled plasma atomic emission spectrometry (ICP-AES) is a technique capable of giving high sensitivity in trace elemental analysis. While the technique possesses high sensitivity, it lacks high selectivity. Selectivity is important where substances emitting complex spectra are to be analysed for trace elements. Rare earths emit highly complex spectra in a plasma source and the determination of adjacent rare earths in a high purity rare earth matrix, with high sensitivity, is not possible due to the inadequate selectivity of ICP-AES. One approach that has yielded reasonably good spectral selectivity in the high purity rare earth analysis by ICP-AES is by employing a combination of wavelength modulation techniques and high resolution echelle grating. However, it was found that by using a high resolution monochromator senstitivities either comparable to or better than those reported by the wavelength modulation technique could be obtained. (author). 2 refs., 2 figs., 2 tabs

An Alternating 5,5-Dimethylcyclopentadiene-based Copolymer prepared at Room Temperature for High Performance Organic Thin Film Transistors

KAUST Repository

Fei, Zhuping; Chen, Lei; Han, Yang; Gann, Eliot; Chesman, Anthony; McNeill, Christopher R.; Anthopoulos, Thomas D.; Heeney, Martin; Pietrangelo, Agostino

2017-01-01

We report that the inclusion of non-aromatic 5,5-dimethylcyclopentadiene monomer into a conjugated backbone is an attractive strategy to high performance semiconducting polymers. The use of this monomer enables a room temperature Suzuki copolymerization with a diketopyrrolopyrrole comono-mer to afford a highly soluble, high molecular weight material. The resulting low band gap polymer exhibits excellent photo and thermal stability, and despite a large π-π stacking distance of 4.26 Å, it demonstrates excellent performance in thin-film transistor devices.

An Alternating 5,5-Dimethylcyclopentadiene-based Copolymer prepared at Room Temperature for High Performance Organic Thin Film Transistors

KAUST Repository

Fei, Zhuping

2017-06-05

We report that the inclusion of non-aromatic 5,5-dimethylcyclopentadiene monomer into a conjugated backbone is an attractive strategy to high performance semiconducting polymers. The use of this monomer enables a room temperature Suzuki copolymerization with a diketopyrrolopyrrole comono-mer to afford a highly soluble, high molecular weight material. The resulting low band gap polymer exhibits excellent photo and thermal stability, and despite a large π-π stacking distance of 4.26 Å, it demonstrates excellent performance in thin-film transistor devices.

Using the RxNorm web services API for quality assurance purposes.

Science.gov (United States)

Peters, Lee; Bodenreider, Olivier

2008-11-06

Auditing large, rapidly evolving terminological systems is still a challenge. In the case of RxNorm, a standardized nomenclature for clinical drugs, we argue that quality assurance processes can benefit from the recently released application programming interface (API) provided by RxNav. We demonstrate the usefulness of the API by performing a systematic comparison of alternative paths in the RxNorm graph, over several thousands of drug entities. This study revealed potential errors in RxNorm, currently under review. The results also prompted us to modify the implementation of RxNav to navigate the RxNorm graph more accurately. The RxNav web services API used in this experiment is robust and fast.

36 CFR 331.5 - Explosives and fireworks.

Science.gov (United States)

2010-07-01

... 36 Parks, Forests, and Public Property 3 2010-07-01 2010-07-01 false Explosives and fireworks. 331... CONSERVATION AREA, KENTUCKY AND INDIANA § 331.5 Explosives and fireworks. Unless otherwise authorized in writing by the District Engineer. (a) The possession or use of fireworks is prohibited. (b) The possession...

Improving Materials Accountancy for Reprocessing using hiRX

International Nuclear Information System (INIS)

Cipiti, B.; McDaniel, M.; Havrilla, G.

2015-01-01

The High Resolution X-ray (hiRX) technology has the potential to replace K-Edge and Hybrid K-Edge Densitometry (HKED) for routine accountability measurements in reprocessing. This technology may significantly reduce plutonium measurement uncertainty in a simpler and less costly instrument. X-ray optics are used to generate monochromatic excitation of a sample and selectively collect emitted X-rays of the target elements. The result is a spectrum with a peak specific to one element with negligible background. Modeling was used to examine how safeguards could be improved through the use of hiRX at existing aqueous reprocessing plants. This work utilized the Separation and Safeguards Performance Model (SSPM), developed at Sandia National Laboratories, to examine how reduced measurement uncertainty decreases the overall inventory difference measurement error. Material loss scenarios were also modelled to determine the effect on detection probability for protracted diversion of nuclear material. Current testing of hiRX is being used to inform the modelling effort, but a 0.1% measurement uncertainty for uranium and plutonium concentration is an optimistic goal based on laboratory results. Modeling results showed that a three-fold improvement in the ability to detect a protracted diversion of plutonium may be possible if the 0.1% uncertainty goal can be achieved. The modelling results will be presented along with a discussion of the current experimental campaign results. In addition, a qualitative cost analysis will be presented to compare the use of hiRX with HKED. (author)

High-explosive driven crowbar switch

International Nuclear Information System (INIS)

Dike, R.S.; Kewish, R.W. Jr.

1976-01-01

The disclosure relates to a compact explosive driven switch for use as a low resistance, low inductance crowbar switch. A high-explosive charge extrudes a deformable conductive metallic plate through a polyethylene insulating layer to achieve a hard current contact with a supportive annular conductor

Introduction to High Explosives Science

Energy Technology Data Exchange (ETDEWEB)

Skidmore, Cary Bradford [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Preston, Daniel N. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

2016-11-17

These are a set of slides for educational outreach to children on high explosives science. It gives an introduction to the elements involved in this science: carbon, hydrogen, nitrogen, and oxygen. Combined, these form the molecule HMX. Many pictures are also included to illustrate explosions.

TRX-4 (TolerRx Inc).

Science.gov (United States)

Brown, William M

2006-04-01

TolerRx Inc, under license from BTG plc, is developing TRX-4, an anti-CD3 humanized monoclonal antibody for the potential treatment of type 1 diabetes and psoriasis. Phase II trials of the therapeutic antibody in type 1 diabetes have been completed and the company is planning a pivotal phase III trial for this indication. TolerRx is also enrolling psoriasis patients in a phase Ib clinical study of TRX-4. TRX-4 has been awarded Orphan Drug status for recent-onset type 1 diabetes.

AE Characteristics affecting the Notch Effect of the Cold Steel SKD11

Energy Technology Data Exchange (ETDEWEB)

Han, Eung Kyo; Kim, Ki Choong; Kwon, Dong Ho; Kim, Jae Yeor [Hanyang University, Seoul (Korea, Republic of)

1986-11-15

Acoustic Emission is not only expected as a non-destructive evaluation technique in practice but also noted as a new powerful means of evaluation of materials. AE occurs with plastic deformation and propagation of crack, and this patterns of occurrence of AE vary with materials. AE which comes from propagation of crack depends oil the shapes and properties of materials. Like this AE has characteristic of material. The present work is an attempt to evaluate characteristics of carbon steel (SM55C) and Die steel(SKD11) by means of dynamic response of AE method

RX LAPAN Rocket data Program With Dbase III Plus

International Nuclear Information System (INIS)

Sauman

2001-01-01

The components data rocket RX LAPAN are taken from workshop product and assembling rocket RX. In this application software, the test data are organized into two data files, i.e. test file and rocket file. Besides [providing facilities to add, edit and delete data, this software provides also data manipulation facility to support analysis and identification of rocket RX failures and success

Flash CS5.5 The Missing Manual

CERN Document Server

Grover, Chris

2011-01-01

You can build everything from simple animations to full-fledged iOS and Android apps with Flash CS5.5, but learning this complex program can be difficult-unless you have this fully updated, bestselling guide. Learn how to create gorgeous Flash effects even if you have no programming experience. With Flash CS5.5: The Missing Manual, you'll move from the basics to power-user tools with ease. Learn animation basics. Discover how to turn simple ideas into stunning animations.Master Flash's tools. Learn the animation and effects tools with clear explanations and hands-on examples.Use 3D effects. R

Molecular epidemiology and virulence of Escherichia coli O16:H5-ST131: comparison with H30 and H30-Rx subclones of O25b:H4-ST131.

Science.gov (United States)

Dahbi, Ghizlane; Mora, Azucena; Mamani, Rosalia; López, Cecilia; Alonso, María Pilar; Marzoa, Juan; Blanco, Miguel; Herrera, Alexandra; Viso, Susana; García-Garrote, Fernando; Tchesnokova, Veronika; Billig, Mariya; de la Cruz, Fernando; de Toro, María; González-López, Juan José; Prats, Guillermo; Chaves, Fernando; Martínez-Martínez, Luis; López-Cerezo, Lorena; Denamur, Erick; Blanco, Jorge

2014-11-01

The present study was carried out to evaluate the prevalence of the clonal subgroup O16:H5-ST131 and the H30 and H30-Rx subclones among E. coli isolates causing extraintestinal infections and to know their virulence potential. The ST131 clonal group accounted for 490 (16%) of the 2995 isolates obtained from clinical samples in five Spanish hospitals during the study period (2005-2012). Among those 490 ST131 isolates, 456 belonged to serotype O25b:H4, 27 to O16:H5 and seven were O-non-typeable:H4 (ONT:H4). All 27 O16:H5 isolates showed fimH41, whereas fimH30 and fimH22 alleles were the most frequently detected among O25b:H4 isolates. The majority (381/490; 78%) of ST131 isolates belonged to H30 subclone, and 302 of 381 (79%) H30 isolates belonged to the H30-Rx subclone. Of the 27 O16:H5 isolates, 48% produced CTX-M-14; however, none produced CTX-M-15. In contrast, 46% of O25b:H4 isolates produced CTX-M-15 while only 2% produced CTX-M-14. More than a half of the O16:H5 isolates (56%) showed the ExPEC status which was significantly more prevalent within O25b:H4 isolates (81%) (P<0.01), especially among H30-Rx (97%) isolates. In the present study, a modified virotype scheme was applied within which approximately half (52%) of the O16:H5 isolates showed the C1 specific virotype. Despite their low virulence-gene score (mean of virulence genes 6.4 versus 8.5 in O25b:H4 isolates), six out of the 10 O16:H5 isolates assayed showed high virulence in the mouse model of sepsis (killed 90-100% of mice challenged). Furthermore, four O16:H5 isolates of virotypes A and C1, carrying K2 variant of group II capsule, showed lethality at 24h. Thus, certain O16:H5 fimH41 isolates show a similar in vivo virulence to that reported with the highly virulent O25b:H4 H30-Rx isolates (Mora et al., PLOS ONE 2014, e87025), supporting their potential virulence for humans. Copyright © 2014 Elsevier GmbH. All rights reserved.

Green primary explosives: 5-nitrotetrazolato-N2-ferrate hierarchies.

Science.gov (United States)

Huynh, My Hang V; Coburn, Michael D; Meyer, Thomas J; Wetzler, Modi

2006-07-05

The sensitive explosives used in initiating devices like primers and detonators are called primary explosives. Successful detonations of secondary explosives are accomplished by suitable sources of initiation energy that is transmitted directly from the primaries or through secondary explosive boosters. Reliable initiating mechanisms are available in numerous forms of primers and detonators depending upon the nature of the secondary explosives. The technology of initiation devices used for military and civilian purposes continues to expand owing to variations in initiating method, chemical composition, quantity, sensitivity, explosive performance, and other necessary built-in mechanisms. Although the most widely used primaries contain toxic lead azide and lead styphnate, mixtures of thermally unstable primaries, like diazodinitrophenol and tetracene, or poisonous agents, like antimony sulfide and barium nitrate, are also used. Novel environmentally friendly primary explosives are expanded here to include cat[Fe(II)(NT)(3)(H(2)O)(3)], cat(2)[Fe(II)(NT)(4)(H(2)O)(2)], cat(3)[Fe(II)(NT)(5)(H(2)O)], and cat(4)[Fe(II)(NT)(6)] with cat = cation and NT(-) = 5-nitrotetrazolato-N(2). With available alkaline, alkaline earth, and organic cations as partners, four series of 5-nitrotetrazolato-N(2)-ferrate hierarchies have been prepared that provide a plethora of green primaries with diverse initiating sensitivity and explosive performance. They hold great promise for replacing not only toxic lead primaries but also thermally unstable primaries and poisonous agents. Strategies are also described for the systematic preparation of coordination complex green primaries based on appropriate selection of ligands, metals, and synthetic procedures. These strategies allow for maximum versatility in initiating sensitivity and explosive performance while retaining properties required for green primaries.

O vacancy formation in (Pr/Gd)BaCo2O5.5 and the role of antisite defects

KAUST Repository

Omotayo Akande, Salawu

2017-04-20

In search for materials for intermediate temperature solid oxide fuel cells, (Pr/Gd)BaCo2O5.5 is investigated by first principles calculations. Antisite defects are considered as they may modify the electronic and O diffusion properties but are rarely studied in double perovskite oxides. Octahedrally coordinated Co atoms are shown to realize intermediate and high spin states for PrBaCo2O5.5 and GdBaCo2O5.5, respectively, while pyramidally coordinated Co atoms always have high spin. It turns out that O vacancy formation is significantly easier in PrBaCo2O5.5 than in GdBaCo2O5.5, the difference in formation energy being hardly modified by antisite defects. While pyramidally coordinated Co atoms are not affected, we show that the presence of antisite defects causes parts of the octahedrally coordinated Co atoms to switch from intermediate to high spin.

Smart Mirrors for Photorefractive Control of Light with Tim Bunning, RX - Agile Filters Application

Science.gov (United States)

2016-11-08

AFRL-AFOSR-UK-TR-2017-0008 Smart Mirrors for photorefractive control of light with Tim Bunning, RX-- Agile filters application Luciano De Sio...DATE (DD-MM-YYYY)      10-02-2017 2. REPORT TYPE Final 3. DATES COVERED (From - To) 01 Feb 2014 to 31 Jan 2016 4. TITLE AND SUBTITLE Smart Mirrors for...photorefractive control of light with Tim Bunning, RX-- Agile filters application 5a.  CONTRACT NUMBER 5b.  GRANT NUMBER FA9550-14-1-0050 5c.  PROGRAM

Design and implementation of an ASIP-based cryptography processor for AES, IDEA, and MD5

Directory of Open Access Journals (Sweden)

Karim Shahbazi

2017-08-01

Full Text Available In this paper, a new 32-bit ASIP-based crypto processor for AES, IDEA, and MD5 is designed. The instruction-set consists of both general purpose and specific instructions for the above cryptographic algorithms. The proposed architecture has nine function units and two data buses. It has also two types of 32-bit instruction formats for executing Memory Reference (M.R., Register Reference (R.R., and Input/Output Reference (I/O R. instructions. The maximum achieved frequency is 166.916 MHz. The encoded output results of the encryption process of a 128-bit input block are obtained after 122, 146 and 170 clock cycles for AES-128, AES-192, and AES-256, respectively. Moreover, it takes 95 clock cycles to encrypt or decrypt a 64-bit input block by using IDEA. Finally, the MD5 hash algorithm requires 469 clock cycles to generate the coded outputs for a block of 512 bits. The performance of the proposed processor is compared to some previous and state-of-the-art implementations in terms of speed, latency, throughput, and flexibility.

Method for enhancing stability of high explosives, for purposes of transport or storage, and the stabilized high explosives

International Nuclear Information System (INIS)

Nutt, G.L.

1991-01-01

This papent describes a method for suppressing the tendency of a porous solid high explosive to ignite and detonate. It comprises: filling substantially all the press of the solid high explosive material with a predetermined pore radius of at least 10μm with a relatively inert, stable, pore filling material in liquid form, the pore filling being selected from gallium, rubidium-potassium eutectic, and Wood's metal; and solidifying the pore filling material in the pores of the explosive material

Peculiar Velocity Constraints from Five-band SZ Effect Measurements toward RX J1347.5-1145 with MUSIC and Bolocam from the CSO

Science.gov (United States)

Sayers, Jack; Zemcov, Michael; Glenn, Jason; Golwala, Sunil R.; Maloney, Philip R.; Siegel, Seth R.; Wheeler, Jordan; Bockstiegel, Clint; Brugger, Spencer; Czakon, Nicole G.; Day, Peter K.; Downes, Thomas P.; Duan, Ran P.; Gao, Jiansong; Hollister, Matthew I.; Lam, Albert; LeDuc, Henry G.; Mazin, Benjamin A.; McHugh, Sean G.; Miller, David A.; Mroczkowski, Tony K.; Noroozian, Omid; Nguyen, Hien T.; Radford, Simon J. E.; Schlaerth, James A.; Vayonakis, Anastasios; Wilson, Philip R.; Zmuidzinas, Jonas

2016-04-01

We present Sunyaev-Zel’dovich (SZ) effect measurements from wide-field images toward the galaxy cluster RX J1347.5-1145 obtained from the Caltech Submillimeter Observatory with the Multiwavelength Submillimeter Inductance Camera at 147, 213, 281, and 337 GHz and with Bolocam at 140 GHz. As part of our analysis, we have used higher frequency data from Herschel-SPIRE and previously published lower frequency radio data to subtract the signal from the brightest dusty star-forming galaxies behind RX J1347.5-1145 and from the AGN in RX J1347.5-1145’s BCG. Using these five-band SZ effect images, combined with X-ray spectroscopic measurements of the temperature of the intra-cluster medium (ICM) from Chandra, we constrain the ICM optical depth to be {τ }{{e}}={7.33}-0.97+0.96× {10}-3 and the ICM line of sight peculiar velocity to be {v}{pec}=-{1040}-840+870 km s-1. The errors for both quantities are limited by measurement noise rather than calibration uncertainties or astrophysical contamination, and significant improvements are possible with deeper observations. Our best-fit velocity is in good agreement with one previously published SZ effect analysis and in mild tension with the other, although some or all of that tension may be because that measurement samples a much smaller cluster volume. Furthermore, our best-fit optical depth implies a gas mass slightly larger than the Chandra-derived value, implying the cluster is elongated along the line of sight.

ACTN3 R577X polymorphism and explosive leg-muscle power in elite basketball players.

Science.gov (United States)

Garatachea, Nuria; Verde, Zoraida; Santos-Lozano, Alejandro; Yvert, Thomas; Rodriguez-Romo, Gabriel; Sarasa, Francisco J; Hernández-Sánchez, Sonsoles; Santiago, Catalina; Lucia, Alejandro

2014-03-01

To determine the association of the ACTN3 R577X polymorphism with leg-muscle explosive power in Spanish (white) elite basketball players and controls. 100 (60 men) elite basketball players (cases) and 283 nonathletic controls. The authors assessed power performance by means of the vertical-squat and countermovement-jump tests. Genotype distributions did not differ between groups (cases: 37.0% [RR], 42.0% [RX], and 21.0% [XX]; controls: 31.8% [RR], 49.8% [RX], and 18.4% [XX]; P = .353). The authors did not observe any effect of the ACTN3 R577X polymorphism on study phenotypes in either group, including when they performed the analyses separately in men and women. They found no association between the ACTN3 R577X polymorphism and the likelihood of being an elite basketball player using the dominant or the recessive model, and the results remained unaltered when the analyses were adjusted for sex, weight, height, and age or when performed for men and women separately. Although the ACTN3 R577X is associated with explosive muscle performance and this phenotype is important in the sport of basketball (ie, during jumps), the authors found no association with leg explosive power in elite basket players or with the status of being this type of athlete.

Analisis Pengaruh Rx Level Terhadap Kecepatan Download Data Pada Teknologi GPRS di PT XL Axiata Tbk. Purwokerto

Directory of Open Access Journals (Sweden)

Aldina Peto Bravi

2011-02-01

Full Text Available Data transfer speed on GPRS’s technology isaffected by the present of some obstacles between sender’s side and recipient’s side. Those obstacles cause propagation loss that affect the reduction of power level value (rx level. The reduction will affect the data speed. The lower rx level’s value means the lower dataspeed. This researchwas done by doing drive test on BTS North Purwokerto and BTS Tambaksogra to measure the amount of power measured (Pr andthe download data speed on GPRS’s network. The measuredpower level (Pr was normalized to get rx level value. Regression analysis was done to get the relation between the download speed and the rx level value. Theanalysis has resulted in a model: download speed = 4.1 (rx level 0.459 , with R^2 = 0.380. Correlation analysis shows high correlationbetween rx level and download speed (r = 0.608.

Confinement in TPE-RX reversed field pinch

International Nuclear Information System (INIS)

Yagi, Y.; Bolzonella, T.; Canton, A.

2001-01-01

Characteristics of the confinement properties of a reversed field pinch (RFP), the TPE-RX (R/a=1.72/0.45 m, R and a are major and minor radii), are presented for the plasma current, I p of 0.2-0.4 MA. TPE-RX has been operational since 1998, and I p =0.5 MA and duration time of up to 0.1 s have been obtained separately. It is found that I p /N (=12x10 -14 Am, N is the line density) is higher than those of other RFPs and poloidal beta, β p , and energy confinement time, τ E , are 5-10% and 0.5-1 ms, respectively, which are comparable with those of other RFPs of comparable sizes (RFX and MST). Pulsed poloidal current drive has recently been tested and the result has shown a twofold improvement of β p and τ E . The improvement is discussed in terms of the dynamic trajectories in the F-Θ plane, where F and Θ are reversal and pinch parameters, respectively. The global confinement properties are compared between the locked and non-locked discharges, which yields a better understanding of the mode-locking phenomena in RFP plasmas. (author)

High-mass dimuon resonances in Pb-Pb collisions at 5.5 TeV in CMS

CERN Document Server

AUTHOR|(CDS)2075387

2011-01-01

The measurement of the charmonium ($J/\\psi$, $\\psi'$) and bottomonium ($\\Upsilon$, $\\Upsilon'$, ${\\Upsilon''}$) resonances and $Z^0$ boson in nucleus-nucleus collisions provides crucial information on high density QCD matter. The observation of anomalous suppression of $J/\\psi$ at the CERN-SPS and RHIC is well established but the clarification of some important questions requires equivalent studies of the $\\Upsilon$ family, only possible at LHC energies. The $Z^0$ boson will be produced for the first time in heavy-ion collisions at the LHC and, since its dominant production channel is through $q{\\bar q}$ fusion, it is an excellent probe of the nuclear modification of quark distribution functions. This paper reports the capabilities of the CMS detector to study quarkonium and $Z^0$ production in Pb-Pb collisions at 5.5 TeV, through the dimuon decay channel.

High-mass dimuon resonances in Pb-Pb collisions at 5.5 TeV in CMS

CERN Document Server

Dutta, Dipanwita

2008-01-01

The measurement of the charmonium ($J/\\psi$, $\\psi'$) and bottomonium ($\\Upsilon$, $\\Upsilon'$, ${\\Upsilon''}$) resonances and $Z^0$ boson in nucleus-nucleus collisions provides crucial information on high density QCD matter. The observation of anomalous suppression of $J/\\psi$ at the CERN-SPS and RHIC is well established but the clarification of some important questions requires equivalent studies of the $\\Upsilon$ family, only possible at LHC energies. The $Z^0$ boson will be produced for the first time in heavy-ion collisions at the LHC and, since its dominant production channel is through $q{\\bar q}$ fusion, it is an excellent probe of the nuclear modification of quark distribution functions. This paper reports the capabilities of the CMS detector to study quarkonium and $Z^0$ production in Pb-Pb collisions at 5.5 TeV, through the dimuon decay channel.

Isolation and Characterization of a Broad Spectrum Bacteriocin from Bacillus amyloliquefaciens RX7

Directory of Open Access Journals (Sweden)

Kong Boon Lim

2016-01-01

Full Text Available We isolated a Bacillus strain, RX7, with inhibitory activity against Listeria monocytogenes from soil and identified it as Bacillus amyloliquefaciens based on 16S rRNA gene sequencing. The inhibitory activity was stable over a wide range of pH and was fully retained after 30 min at 80°C, after which it decreased gradually at higher temperatures. The activity was sensitive to the proteolytic action of α-chymotrypsin, proteinase-K, and trypsin, indicating its proteinaceous nature. This bacteriocin was active against a broad spectrum of bacteria and the fungus Candida albicans. Direct detection of antimicrobial activity on a sodium dodecyl sulfate-polyacrylamide gel suggested an apparent molecular mass of approximately 5 kDa. Ammonium sulfate precipitation and anion-exchange and gel permeation chromatography integrated with reverse phase-high-performance liquid chromatography were used for bacteriocin purification. Automated N-terminal Edman degradation of the purified RX7 bacteriocin recognized the first 15 amino acids as NH2-X-Ala-Trp-Tyr-Asp-Ile-Arg-Lys-Leu-Gly-Asn-Lys-Gly-Ala, where the letter X in the sequence indicates an unknown or nonstandard amino acid. Based on BLAST similarity search and multiple alignment analysis, the obtained partial sequence showed high homology with the two-peptide lantibiotic haloduracin (HalA1 from Bacillus halodurans, although at least two amino acids differed between the sequences. A time-kill study demonstrated a bactericidal mode of action of RX7 bacteriocin.

Multiwavelength analysis of dark matter annihilation and RX-DMFIT

International Nuclear Information System (INIS)

McDaniel, A.; Jeltema, T.; Profumo, S.; Storm, E.

2017-01-01

Dark matter (DM) particles are predicted by several well motivated models to yield Standard Model particles through self-annihilation that can potentially be detected by astrophysical observations. In particular, the production of charged particles from DM annihilation in astrophysical systems that contain magnetic fields yields radio emission through synchrotron radiation and X-ray emission through inverse Compton scattering of ambient photons. We introduce RX-DMFIT, a tool used for calculating the expected secondary emission from DM annihilation. RX-DMFIT includes a wide range of customizable astrophysical and particle parameters and incorporates important astrophysics including the diffusion of charged particles, relevant radiative energy losses, and magnetic field modelling. We demonstrate the use and versatility of RX-DMFIT by analyzing the potential radio and X-ray signals for a variety of DM particle models and astrophysical environments including galaxy clusters, dwarf spheroidal galaxies and normal galaxies. We then apply RX-DMFIT to a concrete example using Segue I radio data to place constraints for a range of assumed DM annihilation channels. For WIMP models with M χ ≤ 100 GeV and assuming weak diffusion, we find that the leptonic μ + μ − and τ + τ − final states provide the strongest constraints, placing limits on the DM particle cross-section well below the thermal relic cross-section, while even for the b b-bar channel we find limits close to the thermal relic cross-section. Our analysis shows that radio emission provides a highly competitive avenue for dark matter searches.

Multiwavelength analysis of dark matter annihilation and RX-DMFIT

Energy Technology Data Exchange (ETDEWEB)

McDaniel, A.; Jeltema, T.; Profumo, S. [Department of Physics, University of California, 1156 High St. Santa Cruz, CA, 95064 (United States); Storm, E., E-mail: alexmcdaniel@ucsc.edu, E-mail: tesla@ucsc.edu, E-mail: profumo@ucsc.edu, E-mail: e.m.storm@uva.nl [GRAPPA, Institute of Physics, Universiteit van Amsterdam Science Park 904, 1098XH Amsterdam (Netherlands)

2017-09-01

Dark matter (DM) particles are predicted by several well motivated models to yield Standard Model particles through self-annihilation that can potentially be detected by astrophysical observations. In particular, the production of charged particles from DM annihilation in astrophysical systems that contain magnetic fields yields radio emission through synchrotron radiation and X-ray emission through inverse Compton scattering of ambient photons. We introduce RX-DMFIT, a tool used for calculating the expected secondary emission from DM annihilation. RX-DMFIT includes a wide range of customizable astrophysical and particle parameters and incorporates important astrophysics including the diffusion of charged particles, relevant radiative energy losses, and magnetic field modelling. We demonstrate the use and versatility of RX-DMFIT by analyzing the potential radio and X-ray signals for a variety of DM particle models and astrophysical environments including galaxy clusters, dwarf spheroidal galaxies and normal galaxies. We then apply RX-DMFIT to a concrete example using Segue I radio data to place constraints for a range of assumed DM annihilation channels. For WIMP models with M {sub χ} ≤ 100 GeV and assuming weak diffusion, we find that the leptonic μ{sup +}μ{sup −} and τ{sup +}τ{sup −} final states provide the strongest constraints, placing limits on the DM particle cross-section well below the thermal relic cross-section, while even for the b b-bar channel we find limits close to the thermal relic cross-section. Our analysis shows that radio emission provides a highly competitive avenue for dark matter searches.

Criticality safety in high explosives dissolution

International Nuclear Information System (INIS)

Troyer, S.D.

1997-01-01

In 1992, an incident occurred at the Pantex Plant in which the cladding around a fissile material component (pit) cracked during dismantlement of the high explosives portion of a nuclear weapon. Although the event did not result in any significant contamination or personnel exposures, concerns about the incident led to the conclusion that the current dismantlement process was unacceptable. Options considered for redesign, dissolution tooling design considerations, dissolution tooling design features, and the analysis of the new dissolution tooling are summarized. The final tooling design developed incorporated a number of safety features and provides a simple, self-contained, low-maintenance method of high explosives removal for nuclear explosive dismantlement. Analyses demonstrate that the tooling design will remain subcritical under normal, abnormal, and credible accident scenarios. 1 fig

Compact and portable X-ray imager system using Medipix3RX

Science.gov (United States)

Garcia-Nathan, T. B.; Kachatkou, A.; Jiang, C.; Omar, D.; Marchal, J.; Changani, H.; Tartoni, N.; van Silfhout, R. G.

2017-10-01

In this paper the design and implementation of a novel portable X-ray imager system is presented. The design features a direct X-ray detection scheme by making use of a hybrid detector (Medipix3RX). Taking advantages of the capabilities of the Medipix3RX, like a high resolution, zero dead-time, single photon detection and charge-sharing mode, the imager has a better resolution and higher sensitivity compared to using traditional indirect detection schemes. A detailed description of the system is presented, which consists of a vacuum chamber containing the sensor, an electronic board for temperature management, conditioning and readout of the sensor and a data processing unit which also handles network connection and allow communication with clients by acting as a server. A field programmable gate array (FPGA) device is used to implement the readout protocol for the Medipix3RX, apart from the readout the FPGA can perform complex image processing functions such as feature extraction, histogram, profiling and image compression at high speeds. The temperature of the sensor is monitored and controlled through a PID algorithm making use of a Peltier cooler, improving the energy resolution and response stability of the sensor. Without implementing data compression techniques, the system is capable of transferring 680 profiles/s or 240 images/s in a continuous mode. Implementation of equalization procedures and tests on colour mode are presented in this paper. For the experimental measurements the Medipix3RX sensor was used with a Silicon layer. One of the tested applications of the system is as an X-ray beam position monitor (XBPM) device for synchrotron applications. The XBPM allows a non-destructive real time measurement of the beam position, size and intensity. A Kapton foil is placed in the beam path scattering radiation towards a pinhole camera setup that allows the sensor to obtain an image of the beam. By using profiles of the synchrotron X-ray beam, high frequency

Radiating Elements for Shared Aperture Tx/Rx Phased Arrays at K/Ka Band

KAUST Repository

Sandhu, Ali Imran; Arnieri, E.; Amendola, Giandomenico; Boccia, L.; Meniconi, Erika; Ziegler, Volker

2016-01-01

A dual band, Tx/Rx, self-diplexing phased array is presented. The antenna has been designed to cover Tx/Rx satellite communications at K/Ka band with a frequency ratio 1.5:1. To obtain dual band operations with a single radiating surface, a novel dual band radiator is adopted and placed in a configuration in which dual band and single band elements are interleaved. The proposed configuration reduces the number of radiating elements required by other solutions while avoiding the insurgence of grating lobes. The tightly packed arrangement of the elements poses many integration issues, which are solved with a novel integration technique. The array elements are optimized to scan the beam in excess of ° in both bands. A subarray with 49 Rx elements and 105 Tx elements was built and measured confirming the results obtained in simulations.

Radiating Elements for Shared Aperture Tx/Rx Phased Arrays at K/Ka Band

KAUST Repository

Sandhu, Ali Imran

2016-04-11

A dual band, Tx/Rx, self-diplexing phased array is presented. The antenna has been designed to cover Tx/Rx satellite communications at K/Ka band with a frequency ratio 1.5:1. To obtain dual band operations with a single radiating surface, a novel dual band radiator is adopted and placed in a configuration in which dual band and single band elements are interleaved. The proposed configuration reduces the number of radiating elements required by other solutions while avoiding the insurgence of grating lobes. The tightly packed arrangement of the elements poses many integration issues, which are solved with a novel integration technique. The array elements are optimized to scan the beam in excess of ° in both bands. A subarray with 49 Rx elements and 105 Tx elements was built and measured confirming the results obtained in simulations.

Explosive mixture of high power and high total energy content, and process for its manufacture

Energy Technology Data Exchange (ETDEWEB)

Cook, M.A.; Udy, L.L.

1973-05-10

This explosive consists of a viscous suspension of an inorganic oxidizer, finely divided aluminum, water, and a liquid organic material miscible with water; a thickener may also be added. The mixture contains 45 to 55% of a strong inorganic oxidizer, of which at least two-thirds is ammonium nitrate; 32 to 43% aluminum powder; 11 to 18% or liquid, mostly water with an organic water-soluble liquid such as ethylene glycol; and a high temperature resistant, gel-forming thickener made of crosslinked guar gum and not crosslinked xanthane gum made from a polysaccharide through bacterial action.

Tx-Rx Isolation Exploiting Tunable Balanced-Unbalanced Antennas Architecture

DEFF Research Database (Denmark)

Tatomirescu, Alexandru; Alrabadi, Osama; Pedersen, Gert Frølund

2012-01-01

The duplex filter is probably still the most expensive component in mobile handsets for the significant Transmitter (Tx) — Receiver (Rx) isolation required. This paper suggests to relax or even replace the duplex filter by equipping the Tx and the Rx with two separate antennas. The two antennas a...

40 CFR 205.55-5 - Labeling-exterior. [Reserved

Science.gov (United States)

2010-07-01

... 40 Protection of Environment 24 2010-07-01 2010-07-01 false Labeling-exterior. [Reserved] 205.55-5 Section 205.55-5 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) NOISE ABATEMENT PROGRAMS TRANSPORTATION EQUIPMENT NOISE EMISSION CONTROLS Medium and Heavy Trucks § 205.55-5 Labeling...

THE BIGGEST EXPLOSIONS IN THE UNIVERSE

International Nuclear Information System (INIS)

Johnson, Jarrett L.; Whalen, Daniel J.; Smidt, Joseph; Even, Wesley; Fryer, Chris L.; Heger, Alex; Chen, Ke-Jung

2013-01-01

Supermassive primordial stars are expected to form in a small fraction of massive protogalaxies in the early universe, and are generally conceived of as the progenitors of the seeds of supermassive black holes (BHs). Supermassive stars with masses of ∼55, 000 M ☉ , however, have been found to explode and completely disrupt in a supernova (SN) with an energy of up to ∼10 55 erg instead of collapsing to a BH. Such events, ∼10, 000 times more energetic than typical SNe today, would be among the biggest explosions in the history of the universe. Here we present a simulation of such a SN in two stages. Using the RAGE radiation hydrodynamics code, we first evolve the explosion from an early stage through the breakout of the shock from the surface of the star until the blast wave has propagated out to several parsecs from the explosion site, which lies deep within an atomic cooling dark matter (DM) halo at z ≅ 15. Then, using the GADGET cosmological hydrodynamics code, we evolve the explosion out to several kiloparsecs from the explosion site, far into the low-density intergalactic medium. The host DM halo, with a total mass of 4 × 10 7 M ☉ , much more massive than typical primordial star-forming halos, is completely evacuated of high-density gas after ∼ ☉ after ∼> 70 Myr. The chemical signature of supermassive star explosions may be found in such long-lived second-generation stars today

27 CFR 70.445 - Commerce in explosives.

Science.gov (United States)

2010-04-01

... 27 Alcohol, Tobacco Products and Firearms 2 2010-04-01 2010-04-01 false Commerce in explosives. 70... Cartridges, and Explosives § 70.445 Commerce in explosives. Part 55 of title 27 CFR contains the regulations..., explosives, (b) Permits for users who buy or transport explosives in interstate or foreign commerce, (c...

Mesoscale modeling of metal-loaded high explosives

Energy Technology Data Exchange (ETDEWEB)

Bdzil, John Bohdan [Los Alamos National Laboratory; Lieberthal, Brandon [UNIV OF ILLINOIS; Srewart, Donald S [UNIV OF ILLINOIS

2010-01-01

We describe a 3D approach to modeling multi-phase blast explosive, which is primarily condensed explosive by volume with inert embedded particles. These embedded particles are uniform in size and placed on the array of a regular lattice. The asymptotic theory of detonation shock dynamics governs the detonation shock propagation in the explosive. Mesoscale hydrodynamic simulations are used to show how the particles are compressed, deformed, and accelerated by the high-speed detonation products flow.

Application of a rule extraction algorithm family based on the Re-RX algorithm to financial credit risk assessment from a Pareto optimal perspective

Directory of Open Access Journals (Sweden)

Yoichi Hayashi

2016-01-01

Full Text Available Historically, the assessment of credit risk has proved to be both highly important and extremely difficult. Currently, financial institutions rely on the use of computer-generated credit scores for risk assessment. However, automated risk evaluations are currently imperfect, and the loss of vast amounts of capital could be prevented by improving the performance of computerized credit assessments. A number of approaches have been developed for the computation of credit scores over the last several decades, but these methods have been considered too complex without good interpretability and have therefore not been widely adopted. Therefore, in this study, we provide the first comprehensive comparison of results regarding the assessment of credit risk obtained using 10 runs of 10-fold cross validation of the Re-RX algorithm family, including the Re-RX algorithm, the Re-RX algorithm with both discrete and continuous attributes (Continuous Re-RX, the Re-RX algorithm with J48graft, the Re-RX algorithm with a trained neural network (Sampling Re-RX, NeuroLinear, NeuroLinear+GRG, and three unique rule extraction techniques involving support vector machines and Minerva from four real-life, two-class mixed credit-risk datasets. We also discuss the roles of various newly-extended types of the Re-RX algorithm and high performance classifiers from a Pareto optimal perspective. Our findings suggest that Continuous Re-RX, Re-RX with J48graft, and Sampling Re-RX comprise a powerful management tool that allows the creation of advanced, accurate, concise and interpretable decision support systems for credit risk evaluation. In addition, from a Pareto optimal perspective, the Re-RX algorithm family has superior features in relation to the comprehensibility of extracted rules and the potential for credit scoring with Big Data.

Rx for Library Management.

Science.gov (United States)

Cage, Alvin C.

1986-01-01

Examines recent developments in field of systems theory that can improve library management practices by broadening perspective in which these problems may be approached. The concept of organizational life cycles is discussed and a paradigm for application of its principles is developed. An Rx decision chart is appended. (9 references) (EJS)

Modeling Hot-Spot Contributions in Shocked High Explosives at the Mesoscale

Energy Technology Data Exchange (ETDEWEB)

Harrier, Danielle [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

2015-08-12

When looking at performance of high explosives, the defects within the explosive become very important. Plastic bonded explosives, or PBXs, contain voids of air and bonder between the particles of explosive material that aid in the ignition of the explosive. These voids collapse in high pressure shock conditions, which leads to the formation of hot spots. Hot spots are localized high temperature and high pressure regions that cause significant changes in the way the explosive material detonates. Previously hot spots have been overlooked with modeling, but now scientists are realizing their importance and new modeling systems that can accurately model hot spots are underway.

RX J1548.9+0851, a fossil cluster?

Science.gov (United States)

Eigenthaler, P.; Zeilinger, W. W.

2012-04-01

Context. Fossil galaxy groups are spatially extended X-ray sources with X-ray luminosities above L{X, bol ≥ 1042 h50-2} erg s-1 and a central elliptical galaxy dominating the optical, the second-brightest galaxy being at least 2 mag fainter in the R band. Whether these systems are a distinct class of objects resulting from exceptional formation and evolution histories is still unclear, mainly due to the small number of objects studied so far, mostly lacking spectroscopy of group members for group membership confirmation and a detailed kinematical analysis. Aims: To complement the scarce sample of spectroscopically studied fossils down to their faint galaxy populations, the fossil candidate RX J1548.9+0851 (z = 0.072) is studied in this work. Our results are compared with existing data from fossils in the literature. Methods: We use ESO VLT VIMOS multi-object spectroscopy to determine redshifts of the faint galaxy population and study the luminosity-weighted dynamics and luminosity function of the system. The full-spectrum fitting package ULySS is used to determine ages and metallicities of group members. VIMOS imaging data are used to study the morphology of the central elliptical. Results: We identify 40 group members spectroscopically within the central 300 kpc of the system and find 31 additional redshifts from the literature, resulting in a total number of 54 spectroscopically confirmed group members within 1 Mpc. RX J1548.9+0851 is made up of two bright ellipticals in the central region with a magnitude gap of Δm1,2 = 1.34 in the SDSS r' band leaving the definition of RX J1548.9+0851 being a fossil to the assumption of the virial radius. We find a luminosity-weighted velocity dispersion of 568 km s-1 and a mass of 2.5 × 1014 M⊙ for the system confirming previous studies that revealed fossils to be massive. An average mass-to-light ratio of M/L 400 M⊙/L⊙ is derived from the SDSS g', r', and i' bands. The central elliptical is well-fitted by a pure de

Resolvin E1 analog RX-10045 0.1% reduces corneal stromal haze in rabbits when applied topically after PRK.

Science.gov (United States)

Torricelli, Andre A M; Santhanam, Abirami; Agrawal, Vandana; Wilson, Steven E

2014-01-01

To perform a masked study to determine whether resolvin E1 (RvE1), a lipid-derived immunomodulator, could regulate the development of corneal haze and opacity-related myofibroblasts after opacity-generating high correction photorefractive keratectomy (PRK) in rabbits. Three groups of eight rabbits each were included in the study. Nine diopter (D) PRK for myopia was performed in each test cornea, and the eyes were treated with 30 µl of topical solution every 4 h (six times a day) for 5 days starting immediately after PRK. Group 1 was treated with 0.1% RX-10045, a prodrug of an RvE1 analog; group 2 was treated with 0.01% RX-10045; and group 3 was treated with vehicle control solution. At 1 month after PRK, haze was graded at the slit-lamp by a masked observer. Immunohistochemistry for α-smooth muscle actin (SMA) was performed on the central cornea of each test eye to determine the anterior stromal myofibroblast density. Corneal opacity was significantly lower in the 0.1% RX-10045 group, but not the 0.01% RX-10045 group, compared to the vehicle control group (p=0.029), at 1 month after -9.0D PRK. At 1 month after -9.0D PRK, SMA+ myofibroblast densities in the anterior stroma were not statistically significantly different among the three groups, although a trend toward lower myofibroblast generation was noted in the 0.1% RX-10045 group. Topical 0.1% RX-10045, a prodrug of an RvE1 analog, reduces corneal opacity after haze-generating PRK in rabbits. Further studies are needed to determine the precise points at which RvE1 decreases corneal opacity after injury.

Tet1 and Tet2 maintain mesenchymal stem cell homeostasis via demethylation of the P2rX7 promoter.

Science.gov (United States)

Yang, Ruili; Yu, Tingting; Kou, Xiaoxing; Gao, Xiang; Chen, Chider; Liu, Dawei; Zhou, Yanheng; Shi, Songtao

2018-06-01

Ten-eleven translocation (Tet) family-mediated DNA oxidation represents an epigenetic modification capable of converting 5-methylcytosine (5-mC) to 5-hydroxymethylcytosine (5-hmC), which regulates various biological processes. However, it is unknown whether Tet family affects mesenchymal stem cells (MSCs) or the skeletal system. Here we show that depletion of Tet1 and Tet2 results in impaired self-renewal and differentiation of bone marrow MSCs (BMMSCs) and a significant osteopenia phenotype. Tet1 and Tet2 deficiency reduces demethylation of the P2rX7 promoter and downregulates exosome release, leading to intracellular accumulation of miR-297a-5p, miR-297b-5p, and miR-297c-5p. These miRNAs inhibit Runx2 signaling to impair BMMSC function. We show that overexpression of P2rX7 rescues the impaired BMMSCs and osteoporotic phenotype in Tet1 and Tet2 double knockout mice. These results indicate that Tet1 and Tet2 play a critical role in maintaining BMMSC and bone homeostasis through demethylation of P2rX7 to control exosome and miRNA release. This Tet/P2rX7/Runx2 cascade may serve as a target for the development of novel therapies for osteopenia disorders.

Structural design and manufacturing of TPE-RX vacuum vessel

Energy Technology Data Exchange (ETDEWEB)

Sago, H.; Orita, J.; Kaguchi, H.; Ishigami, Y. [Mitsubishi Heavy Ind. Ltd., Kobe (Japan); Urata, K.; Kudough, F. [Mitsubishi Heavy Industries, Ltd., Tokyo (Japan); Hasegawa, M.; Oyabu, I. [Mitsubishi Electric Co., Tokyo (Japan); Yagi, Y.; Sekine, S.; Shimada, T.; Hirano, Y.; Sakakita, H.; Koguchi, H. [Electrotechnical Laboratory, Tsukuba (Japan)

1999-10-01

TPE-RX is a newly constructed, large-sized reversed field pinch (RFP) machine installed at the Electrotechnical Laboratory of the Ministry of International Trade and Industry in Japan. This is the third largest RFP in the world. Major and minor radii of the plasma are 1.72 and 0.45 m, respectively. TPE-RX aims to optimize plasma confinement up to 1 MA. RFP plasma configuration was successfully obtained in March 1998. This paper reports the structural design and manufacturing of the vacuum vessel of TPE-RX. The supporting system on the bellows sections of the vessel was designed based on a detailed finite element method. The integrity of the vacuum vessel against a plasma disruption has been confirmed using dynamic inelastic analyses. (orig.)

Structural design and manufacturing of TPE-RX vacuum vessel

International Nuclear Information System (INIS)

Sago, H.; Orita, J.; Kaguchi, H.; Ishigami, Y.; Urata, K.; Kudough, F.; Hasegawa, M.; Oyabu, I.; Yagi, Y.; Sekine, S.; Shimada, T.; Hirano, Y.; Sakakita, H.; Koguchi, H.

1999-01-01

TPE-RX is a newly constructed, large-sized reversed field pinch (RFP) machine installed at the Electrotechnical Laboratory of the Ministry of International Trade and Industry in Japan. This is the third largest RFP in the world. Major and minor radii of the plasma are 1.72 and 0.45 m, respectively. TPE-RX aims to optimize plasma confinement up to 1 MA. RFP plasma configuration was successfully obtained in March 1998. This paper reports the structural design and manufacturing of the vacuum vessel of TPE-RX. The supporting system on the bellows sections of the vessel was designed based on a detailed finite element method. The integrity of the vacuum vessel against a plasma disruption has been confirmed using dynamic inelastic analyses. (orig.)

Profiling structured product labeling with NDF-RT and RxNorm

Science.gov (United States)

2012-01-01

Background Structured Product Labeling (SPL) is a document markup standard approved by Health Level Seven (HL7) and adopted by United States Food and Drug Administration (FDA) as a mechanism for exchanging drug product information. The SPL drug labels contain rich information about FDA approved clinical drugs. However, the lack of linkage to standard drug ontologies hinders their meaningful use. NDF-RT (National Drug File Reference Terminology) and NLM RxNorm as standard drug ontology were used to standardize and profile the product labels. Methods In this paper, we present a framework that intends to map SPL drug labels with existing drug ontologies: NDF-RT and RxNorm. We also applied existing categorical annotations from the drug ontologies to classify SPL drug labels into corresponding classes. We established the classification and relevant linkage for SPL drug labels using the following three approaches. First, we retrieved NDF-RT categorical information from the External Pharmacologic Class (EPC) indexing SPLs. Second, we used the RxNorm and NDF-RT mappings to classify and link SPLs with NDF-RT categories. Third, we profiled SPLs using RxNorm term type information. In the implementation process, we employed a Semantic Web technology framework, in which we stored the data sets from NDF-RT and SPLs into a RDF triple store, and executed SPARQL queries to retrieve data from customized SPARQL endpoints. Meanwhile, we imported RxNorm data into MySQL relational database. Results In total, 96.0% SPL drug labels were mapped with NDF-RT categories whereas 97.0% SPL drug labels are linked to RxNorm codes. We found that the majority of SPL drug labels are mapped to chemical ingredient concepts in both drug ontologies whereas a relatively small portion of SPL drug labels are mapped to clinical drug concepts. Conclusions The profiling outcomes produced by this study would provide useful insights on meaningful use of FDA SPL drug labels in clinical applications through

Profiling structured product labeling with NDF-RT and RxNorm

Directory of Open Access Journals (Sweden)

Zhu Qian

2012-12-01

Full Text Available Abstract Background Structured Product Labeling (SPL is a document markup standard approved by Health Level Seven (HL7 and adopted by United States Food and Drug Administration (FDA as a mechanism for exchanging drug product information. The SPL drug labels contain rich information about FDA approved clinical drugs. However, the lack of linkage to standard drug ontologies hinders their meaningful use. NDF-RT (National Drug File Reference Terminology and NLM RxNorm as standard drug ontology were used to standardize and profile the product labels. Methods In this paper, we present a framework that intends to map SPL drug labels with existing drug ontologies: NDF-RT and RxNorm. We also applied existing categorical annotations from the drug ontologies to classify SPL drug labels into corresponding classes. We established the classification and relevant linkage for SPL drug labels using the following three approaches. First, we retrieved NDF-RT categorical information from the External Pharmacologic Class (EPC indexing SPLs. Second, we used the RxNorm and NDF-RT mappings to classify and link SPLs with NDF-RT categories. Third, we profiled SPLs using RxNorm term type information. In the implementation process, we employed a Semantic Web technology framework, in which we stored the data sets from NDF-RT and SPLs into a RDF triple store, and executed SPARQL queries to retrieve data from customized SPARQL endpoints. Meanwhile, we imported RxNorm data into MySQL relational database. Results In total, 96.0% SPL drug labels were mapped with NDF-RT categories whereas 97.0% SPL drug labels are linked to RxNorm codes. We found that the majority of SPL drug labels are mapped to chemical ingredient concepts in both drug ontologies whereas a relatively small portion of SPL drug labels are mapped to clinical drug concepts. Conclusions The profiling outcomes produced by this study would provide useful insights on meaningful use of FDA SPL drug labels in clinical

Profiling structured product labeling with NDF-RT and RxNorm.

Science.gov (United States)

Zhu, Qian; Jiang, Guoqian; Chute, Christopher G

2012-12-20

Structured Product Labeling (SPL) is a document markup standard approved by Health Level Seven (HL7) and adopted by United States Food and Drug Administration (FDA) as a mechanism for exchanging drug product information. The SPL drug labels contain rich information about FDA approved clinical drugs. However, the lack of linkage to standard drug ontologies hinders their meaningful use. NDF-RT (National Drug File Reference Terminology) and NLM RxNorm as standard drug ontology were used to standardize and profile the product labels. In this paper, we present a framework that intends to map SPL drug labels with existing drug ontologies: NDF-RT and RxNorm. We also applied existing categorical annotations from the drug ontologies to classify SPL drug labels into corresponding classes. We established the classification and relevant linkage for SPL drug labels using the following three approaches. First, we retrieved NDF-RT categorical information from the External Pharmacologic Class (EPC) indexing SPLs. Second, we used the RxNorm and NDF-RT mappings to classify and link SPLs with NDF-RT categories. Third, we profiled SPLs using RxNorm term type information. In the implementation process, we employed a Semantic Web technology framework, in which we stored the data sets from NDF-RT and SPLs into a RDF triple store, and executed SPARQL queries to retrieve data from customized SPARQL endpoints. Meanwhile, we imported RxNorm data into MySQL relational database. In total, 96.0% SPL drug labels were mapped with NDF-RT categories whereas 97.0% SPL drug labels are linked to RxNorm codes. We found that the majority of SPL drug labels are mapped to chemical ingredient concepts in both drug ontologies whereas a relatively small portion of SPL drug labels are mapped to clinical drug concepts. The profiling outcomes produced by this study would provide useful insights on meaningful use of FDA SPL drug labels in clinical applications through standard drug ontologies such as NDF-RT and

A Novel Recommendation To AES Limitation

Directory of Open Access Journals (Sweden)

Falguni Patel

2017-07-01

Full Text Available Among all available conventional encryption algorithms the AES Advanced Encryption Standard is the most secured and highly used algorithm. AES algorithm is widely used by variety of applications like Archive and Compression tools File Encryption Encryption File System Disk Partition Encryption Networking Signal Protocol among others. This paper highlights the Brute Force attack and Cryptanalysis attack on AES Algorithm. This paper also discusses about a novel recommendation of a combination model of AES Algorithm and Random-X Cipher.

High-explosive-driven delay line pulse generator

International Nuclear Information System (INIS)

Shearer, J.W.

1982-01-01

The inclusion of a delay line circuit into the design of a high-explosive-driven generator shortens the time constant of the output pulse. After a brief review of generator concepts and previously described pulse-shortening methods, a geometry is presented which incorporates delay line circuit techcniques into a coil generator. The circuit constants are adjusted to match the velocity of the generated electromagnetic wave to the detonation velocity of the high explosive. The proposed generator can be modeled by adding a variable inductance term to the telegrapher's equation. A particular solution of this equation is useful for exploring the operational parameters of the generator. The duration of the electromagnetic pulse equals the radial expansion time of the high-explosive-driven armature until it strikes the coil. Because the impedance of the generator is a constant, the current multiplication factor is limited only by nonlinear effects such as voltage breakdown, diffusion, and compression at high energies

Progress on TSV technology for Medipix3RX chip

Science.gov (United States)

Sarajlić, M.; Pennicard, D.; Smoljanin, S.; Fritzsch, T.; Zoschke, K.; Graafsma, H.

2017-12-01

The progress of Through Silicon Via (TSV) technology for Medipix3RX chip done at DESY is presented here. The goal of this development is to replace the wire bonds in X-ray detectors with TSVs, in order to reduce the dead area between detectors. We obtained the first working chips assembled together with Si based sensors for X-ray detection. The 3D integration technology, including TSV, Re-distribution layer deposition, bump bonding to the Si sensor and bump bonding to the carrier PCB, was done by Fraunhofer Institute IZM in Berlin. After assembly, the module was successfully tested by recording background radiation and making X-ray images of small objects. The active area of the Medipix3RX chip is 14.1 mm×14.1 mm or 256×256 pixels. During TSV processing, the Medipix3RX chip was thinned from 775 μm original thickness, to 130 μm. The diameter of the vias is 40 μm, and the pitch between the vias is 120 μm. A liner filling approach was used to contact the TSV with the RDL on the backside of the Medipix3RX readout chip.

Study on metallization on RX tubes of fluoroscopic equipment

International Nuclear Information System (INIS)

Ramos Caballero, L. J.; Angulo Pain, E.; Iborra Oquendo, M. a.; Seguro Fernandez, A.

2013-01-01

The PECCRD sets values for the performance of a team of rays x as a function of the total filtration of this (for 80 KV, a total filtration [2.5, 5] mm's to the). However it is recommended to check if the RX tube had metallization by exhaustion (part of anode tungsten evaporates and lining the inside of the envelope of the tube). This effect produces an increase in filtration tube and a decrease in performance. (Author)

RxPATROL: a Web-based tool for combating pharmacy theft.

Science.gov (United States)

Smith, Meredith Y; Graham, J Aaron; Haddox, J David; Steffey, Amy

2009-01-01

To report the incidence of pharmacy-related burglaries and robberies and characteristics of pharmacies where such crimes have occurred using recent data from Rx Pattern Analysis Tracking Robberies & Other Losses (RxPATROL), a national Web-based information clearinghouse on pharmacy-related theft of prescription medications and over-the-counter products. Descriptive, nonexperimental study. United States between 2005 and 2006. Not applicable. Not applicable. Number of pharmacy theft reports received; incident type, date, and location; point of entry; and pharmacy security features. Between 2005 and 2006, 202 pharmacy burglary and 299 pharmacy robbery reports from 45 different states were filed with RxPATROL. More than 70% of pharmacies reporting such crimes lacked a security camera. Among those reporting a burglary, 60% lacked dead bolt locks, a solid exterior door, a motion detector device, or a safe or vault for storage of controlled substances. Burglars most often obtained access to the pharmacy via the front door. RxPATROL is a Web-based tool that can assist pharmacies and law enforcement in collaborating more effectively to combat and prevent pharmacy-related crimes.

Computer code to predict the heat of explosion of high energy materials

International Nuclear Information System (INIS)

Muthurajan, H.; Sivabalan, R.; Pon Saravanan, N.; Talawar, M.B.

2009-01-01

The computational approach to the thermochemical changes involved in the process of explosion of a high energy materials (HEMs) vis-a-vis its molecular structure aids a HEMs chemist/engineers to predict the important thermodynamic parameters such as heat of explosion of the HEMs. Such a computer-aided design will be useful in predicting the performance of a given HEM as well as in conceiving futuristic high energy molecules that have significant potential in the field of explosives and propellants. The software code viz., LOTUSES developed by authors predicts various characteristics of HEMs such as explosion products including balanced explosion reactions, density of HEMs, velocity of detonation, CJ pressure, etc. The new computational approach described in this paper allows the prediction of heat of explosion (ΔH e ) without any experimental data for different HEMs, which are comparable with experimental results reported in literature. The new algorithm which does not require any complex input parameter is incorporated in LOTUSES (version 1.5) and the results are presented in this paper. The linear regression analysis of all data point yields the correlation coefficient R 2 = 0.9721 with a linear equation y = 0.9262x + 101.45. The correlation coefficient value 0.9721 reveals that the computed values are in good agreement with experimental values and useful for rapid hazard assessment of energetic materials

Evaluation of RxNorm for Medication Clinical Decision Support.

Science.gov (United States)

Freimuth, Robert R; Wix, Kelly; Zhu, Qian; Siska, Mark; Chute, Christopher G

2014-01-01

We evaluated the potential use of RxNorm to provide standardized representations of generic drug name and route of administration to facilitate management of drug lists for clinical decision support (CDS) rules. We found a clear representation of generic drug name but not route of administration. We identified several issues related to data quality, including erroneous or missing defined relationships, and the use of different concept hierarchies to represent the same drug. More importantly, we found extensive semantic precoordination of orthogonal concepts related to route and dose form, which would complicate the use of RxNorm for drug-based CDS. This study demonstrated that while RxNorm is a valuable resource for the standardization of medications used in clinical practice, additional work is required to enhance the terminology so that it can support expanded use cases, such as managing drug lists for CDS.

Sequence alterations in RX in patients with microphthalmia, anophthalmia, and coloboma

Science.gov (United States)

London, Nikolas J.S.; Kessler, Patricia; Williams, Bryan; Pauer, Gayle J.; Hagstrom, Stephanie A.

2009-01-01

Purpose Microphthalmia, anophthalmia, and coloboma are ocular malformations with a significant genetic component. Rx is a homeobox gene expressed early in the developing retina and is important in retinal cell fate specification as well as stem cell proliferation. We screened a group of 24 patients with microphthalmia, coloboma, and/or anophthalmia for RX mutations. Methods We used standard PCR and automated sequencing techniques to amplify and sequence each of the three RX exons. Patients’ charts were reviewed for clinical information. The pathologic impact of the identified sequence variant was analyzed by computational methods using PolyPhen and PMut algorithms. Results In addition to the polymorphisms we identified a single patient with coloboma having a heterozygous nucleotide change (g.197G>C) in the first exon that results in a missense mutation of arginine to threonine at amino acid position 66 (R66T). In silico analysis predicted R66T to be a deleterious mutation. Conclusions Sequence variations in RX are uncommon in patients with congenital ocular malformations, but may play a role in disease pathogenesis. We observed a missense mutation in RX in a patient with a small, typical chorioretinal coloboma, and postulate that the mutation is responsible for the patient’s phenotype. PMID:19158959

HPW-RX40 restores anoikis sensitivity of human breast cancer cells by inhibiting integrin/FAK signaling

Energy Technology Data Exchange (ETDEWEB)

Chen, I-Hua; Shih, Hsin-Chu [Graduate Institute of Natural Products, Kaohsiung Medical University, Kaohsiung, Taiwan (China); Hsieh, Pei-Wen [Graduate Institute of Natural Products, School of Traditional Chinese Medicine, and Graduate Institute of Biomedical Sciences, College of Medicine, Chang Gung University, Taoyuan, Taiwan (China); Chang, Fang-Rong [Graduate Institute of Natural Products, Kaohsiung Medical University, Kaohsiung, Taiwan (China); Cancer Center, Kaohsiung Medical University Hospital, Kaohsiung, Taiwan (China); Wu, Yang-Chang, E-mail: yachwu@mail.cmu.edu [School of Pharmacy, College of Pharmacy, China Medical University, Taichung, Taiwan (China); Wu, Chin-Chung, E-mail: ccwu@kmu.edu.tw [Graduate Institute of Natural Products, Kaohsiung Medical University, Kaohsiung, Taiwan (China); Department of Marine Biotechnology and Resources, National Sun Yat-sen University, Kaohsiung 80708, Taiwan (China); Research Center for Natural Products and Drug Development, Kaohsiung Medical University, Kaohsiung, Taiwan (China)

2015-12-01

Anoikis is defined as apoptosis, which is induced by inappropriate cell–matrix interactions. Cancer cells with anoikis resistance tend to undergo metastasis, and this phenomenon has been reported to be associated with integrin and FAK activity. HPW-RX40 is a derivative of 3,4-methylenedioxy-β-nitrostyrene, which is known to prevent platelet aggregation by inhibition of integrin. In the present study, we investigated the effect of HPW-RX40 on an anoikis-resistant human breast cancer cell line MDA-MB-231. HPW-RX40 inhibited cell aggregation and induced cell death in suspending MDA-MB-231 cells, but had only little effect on the monolayer growth of adherent cells. Analysis of caspase activation and poly (ADP-ribose) polymerase (PARP) cleavage confirmed anoikis in HPW-RX40-treated suspending cancer cells. HPW-RX40 also affected the Bcl-2 family proteins in detached cancer cells. Furthermore, HPW-RX40 inhibited detachment-induced activation of FAK and the downstream phosphorylation of Src and paxillin, but did not affect this pathway in adherent cancer cells. We also found that the expression and activation of β1 integrin in MDA-MB-231 cells were reduced by HPW-RX40. The combination of HPW-RX40 with an EGFR inhibitor led to enhanced anoikis and inhibition of the FAK pathway in breast cancer cells. Taken together, our results suggest that HPW-RX40 restores the anoikis sensitivity in the metastatic breast cancer cells by inhibiting integrin and subsequent FAK activation, and reveal a potential strategy for prevention of tumor metastasis. - Highlights: • The β-nitrostyrene derivative, HPW-RX40, induces anoikis in human breast cancer cells. • HPW-RX40 inhibits the integrin/FAK signaling pathway. • The combination of HPW-RX40 with an EGFR inhibitor leads to enhanced anoikis. • HPW-RX40 may have a potential to prevent the spread of metastatic breast cancer.

HPW-RX40 restores anoikis sensitivity of human breast cancer cells by inhibiting integrin/FAK signaling

International Nuclear Information System (INIS)

Chen, I-Hua; Shih, Hsin-Chu; Hsieh, Pei-Wen; Chang, Fang-Rong; Wu, Yang-Chang; Wu, Chin-Chung

2015-01-01

Anoikis is defined as apoptosis, which is induced by inappropriate cell–matrix interactions. Cancer cells with anoikis resistance tend to undergo metastasis, and this phenomenon has been reported to be associated with integrin and FAK activity. HPW-RX40 is a derivative of 3,4-methylenedioxy-β-nitrostyrene, which is known to prevent platelet aggregation by inhibition of integrin. In the present study, we investigated the effect of HPW-RX40 on an anoikis-resistant human breast cancer cell line MDA-MB-231. HPW-RX40 inhibited cell aggregation and induced cell death in suspending MDA-MB-231 cells, but had only little effect on the monolayer growth of adherent cells. Analysis of caspase activation and poly (ADP-ribose) polymerase (PARP) cleavage confirmed anoikis in HPW-RX40-treated suspending cancer cells. HPW-RX40 also affected the Bcl-2 family proteins in detached cancer cells. Furthermore, HPW-RX40 inhibited detachment-induced activation of FAK and the downstream phosphorylation of Src and paxillin, but did not affect this pathway in adherent cancer cells. We also found that the expression and activation of β1 integrin in MDA-MB-231 cells were reduced by HPW-RX40. The combination of HPW-RX40 with an EGFR inhibitor led to enhanced anoikis and inhibition of the FAK pathway in breast cancer cells. Taken together, our results suggest that HPW-RX40 restores the anoikis sensitivity in the metastatic breast cancer cells by inhibiting integrin and subsequent FAK activation, and reveal a potential strategy for prevention of tumor metastasis. - Highlights: • The β-nitrostyrene derivative, HPW-RX40, induces anoikis in human breast cancer cells. • HPW-RX40 inhibits the integrin/FAK signaling pathway. • The combination of HPW-RX40 with an EGFR inhibitor leads to enhanced anoikis. • HPW-RX40 may have a potential to prevent the spread of metastatic breast cancer.

AE 941.

Science.gov (United States)

2004-01-01

AE 941 [Arthrovas, Neoretna, Psovascar] is shark cartilage extract that inhibits angiogenesis. AE 941 acts by blocking the two main pathways that contribute to the process of angiogenesis, matrix metalloproteases and the vascular endothelial growth factor signalling pathway. When initial development of AE 941 was being conducted, AEterna assigned the various indications different trademarks. Neovastat was used for oncology, Psovascar was used for dermatology, Neoretna was used for ophthalmology and Arthrovas was used for rheumatology. However, it is unclear if these trademarks will be used in the future and AEterna appears to only be using the Neovastat trademark in its current publications regardless of the indication. AEterna Laboratories signed commercialisation agreements with Grupo Ferrer Internacional SA of Spain and Medac GmbH of Germany in February 2001. Under the terms of the agreement, AEterna has granted exclusive commercialisation and distribution rights to AE 941 in oncology to Grupo Ferrer Internacional for the Southern European countries of France, Belgium, Spain, Greece, Portugal and Italy. It also has rights in Central and South America. Medac GmbH will have marketing rights in Germany, the UK, Scandinavia, Switzerland, Austria, Ireland, the Netherlands and Eastern Europe. In October 2002, AEterna Laboratories announced that it had signed an agreement with Australian healthcare products and services company Mayne Group for marketing AE 941 (as Neovastat) in Australia, New Zealand, Canada and Mexico. In March 2003, AEterna Laboratories announced it has signed an agreement with Korean based LG Life Sciences Ltd for marketing AE 941 (as Neovastat) in South Korea. The agreement provides AEterna with upfront and milestone payments, as well as a return on manufacturing and sales of AE 941. AEterna Laboratories had granted Alcon Laboratories an exclusive worldwide licence for AE 941 for ophthalmic products. However, this licence has been terminated. In

Development of ICP-AES based method for the characterization of high level waste

International Nuclear Information System (INIS)

Seshagiri, T.K.; Thulsidas, S.K.; Adya, V.C.; Kumar, Mithlesh; Radhakrishnan, K.; Mary, G.; Kulkarni, P.G.; Bhalerao, Bharti; Pant, D.K.

2011-01-01

An Inductively Coupled Plasma Atomic Emission Spectrometry (ICP-AES) method was developed for the trace metal characterization of high level waste solutions (HLW) of different origin and the method was validated by analysis of synthetic samples of simulated high level waste solutions (SHLW) from spent fuels of varying composition. In this context, an inter-laboratory comparison exercise (ILCE) was carried out with the simulated HLW of different spent fuel types, viz., research reactor (RR), pressurized heavy water reactor (PHWR) and fast breeder reactor (FBR). An over view of the ICP-AES determination of trace metallic constituents in such SHLW solutions is presented. The overall agreement between the various laboratories was good. (author)

The effect of explosive percentage on underwater explosion energy release of hexanitrohexaazaisowurtzitane and octogen based aluminized explosives

Directory of Open Access Journals (Sweden)

Qingjie Jiao

2018-03-01

Full Text Available To control the explosion energy output by optimizing explosive components is a key requirement in a number of different application areas. The effect of different Al/O Ratio on underwater explosion of aluminized explosives has been studied detailedly. However, the effect of explosive percentage in the same Al/O Ratio is rarely researched, especially for Hexanitrohexaazaisowurtzitane (CL-20 based aluminized explosives. In this study, we performed the underwater explosion experiments with 1.2-kilogram explosives in order to investigate the explosion energy released from CL-20 and Octogen (HMX based aluminized explosives. The percentage of the explosive varied from 5% to 30% and it is shown that: the shockwave peak pressure (pm grows gradually; shock wave energy (Es continues increasing, bubble energy (Eb increases then decreases peaking at 15% for both formulas, and the total energy (E and energy release rate (η peak at 20% for CL-20 and 15% for HMX. This paper outlines the physical mechanism of Eb change under the influence of an aluminium initial reaction temperature and reaction active detonation product percentage coupling. The result shows that CL-20 is superior as a new high explosive and has promising application prospects in the regulation of explosive energy output for underwater explosives.

The effect of explosive percentage on underwater explosion energy release of hexanitrohexaazaisowurtzitane and octogen based aluminized explosives

Science.gov (United States)

Jiao, Qingjie; Wang, Qiushi; Nie, Jianxin; Guo, Xueyong; Zhang, Wei; Fan, Wenqi

2018-03-01

To control the explosion energy output by optimizing explosive components is a key requirement in a number of different application areas. The effect of different Al/O Ratio on underwater explosion of aluminized explosives has been studied detailedly. However, the effect of explosive percentage in the same Al/O Ratio is rarely researched, especially for Hexanitrohexaazaisowurtzitane (CL-20) based aluminized explosives. In this study, we performed the underwater explosion experiments with 1.2-kilogram explosives in order to investigate the explosion energy released from CL-20 and Octogen (HMX) based aluminized explosives. The percentage of the explosive varied from 5% to 30% and it is shown that: the shockwave peak pressure (pm) grows gradually; shock wave energy (Es) continues increasing, bubble energy (Eb) increases then decreases peaking at 15% for both formulas, and the total energy (E) and energy release rate (η) peak at 20% for CL-20 and 15% for HMX. This paper outlines the physical mechanism of Eb change under the influence of an aluminium initial reaction temperature and reaction active detonation product percentage coupling. The result shows that CL-20 is superior as a new high explosive and has promising application prospects in the regulation of explosive energy output for underwater explosives.

Analysis of B chromosome nondisjunction induced by the r-X1 deficiency in maize.

Science.gov (United States)

Tseng, Shih-Hsuan; Peng, Shu-Fen; Cheng, Ya-Ming

2017-11-20

The maize B chromosome typically undergoes nondisjunction during the second microspore division. For normal A chromosomes, the r-X1 deficiency in maize can induce nondisjunction during the second megaspore and first microspore divisions. However, it is not known whether the r-X1 deficiency also induces nondisjunction of the maize B chromosome during these cell divisions. To answer this question, chromosome numbers were determined in the progeny of r-X1/R-r female parents carrying two B chromosomes. Some of the r-X1-lacking progeny (21.2%) contained zero or two B chromosomes. However, a much higher percentage of the r-X1-containing progeny (43.4%) exhibited zero or two B chromosomes, but none displayed more than two B chromosomes. Thus, the results indicated that the r-X1 deficiency could also induce nondisjunction of the B chromosome during the second megaspore division; moreover, the B chromosome in itself could undergo nondisjunction during the same division. In addition, pollen grains from plants with two B chromosomes lacking or exhibiting the r-X1 deficiency were compared via pollen fluorescence in situ hybridization (FISH) using a B chromosome-specific probe. The results revealed that the r-X1 deficiency could induce the occurrence of B chromosome nondisjunction during the first microspore division and that the B chromosome in itself could undergo nondisjunction during the same division at a lower frequency. Our data shed more light on the behavior of the maize B chromosome during cell division.

MEEK OR OPPRESSED? READING MATTHEW 5:5 IN CONTEXT

African Journals Online (AJOL)

According to the Gospel of Matthew 5:5, Jesus pronounces a blessing on “the meek” ...... of one's land to the poor (J.T. Pe'ah, I, 15 b, 39). .... including the Sermon on the Plain (Matt 5:3-7:27 and Luke 6:20-49). ... New York: Harper Collins.

On the low pressure shock initiation of octahydro-1,3,5,7-tetranitro-1,3,5,7-tetrazocine based plastic bonded explosives

Science.gov (United States)

Vandersall, Kevin S.; Tarver, Craig M.; Garcia, Frank; Chidester, Steven K.

2010-05-01

In large explosive and propellant charges, relatively low shock pressures on the order of 1-2 GPa impacting large volumes and lasting tens of microseconds can cause shock initiation of detonation. The pressure buildup process requires several centimeters of shock propagation before shock to detonation transition occurs. In this paper, experimentally measured run distances to detonation for lower input shock pressures are shown to be much longer than predicted by extrapolation of high shock pressure data. Run distance to detonation and embedded manganin gauge pressure histories are measured using large diameter charges of six octahydro-1,3,5,7-tetranitro-1,3,5,7-tetrazocine (HMX) based plastic bonded explosives (PBX's): PBX 9404; LX-04; LX-07; LX-10; PBX 9501; and EDC37. The embedded gauge records show that the lower shock pressures create fewer and less energetic "hot spot" reaction sites, which consume the surrounding explosive particles at reduced reaction rates and cause longer distances to detonation. The experimental data is analyzed using the ignition and growth reactive flow model of shock initiation in solid explosives. Using minimum values of the degrees of compression required to ignite hot spot reactions, the previously determined high shock pressure ignition and growth model parameters for the six explosives accurately simulate the much longer run distances to detonation and much slower growths of pressure behind the shock fronts measured during the shock initiation of HMX PBX's at several low shock pressures.

Design and manufacturing of vacuum vessel of TPE-RX

Energy Technology Data Exchange (ETDEWEB)

Sago, H.; Kaguchi, H.; Orita, J.; Ishigami, Y. [Mitsubishi Heavy Industries Ltd., Kobe (Japan); Urata, K. [Mitsubishi Heavy Industries Ltd. (Japan). Nuclear Energy Systems Engineering Center; Hasegawa, M. [Mitsubishi Electric Co. (Japan). Nuclear Fusion Development; Yagi, Y.; Hirano, Y.; Shimada, T.; Sekine, S.; Sakakita, H. [Electrotechnical Lab. (Japan)

1998-07-01

Construction of a new, large reversed field pinch (RFP) machine called TPE-RX was complete at the end of 1997 as a successor of the previous TPE-1RM20 machine at the Electrotechnical Laboratory (ETL). RFP configuration has been successfully obtained in March 1998. This paper introduces structural design and manufacturing of the vacuum vessel of TPE-RX. The support positions were decided by structural analyses. The structural integrity of the vacuum vessel was evaluated by inelastic analyses. (author)

Design and manufacturing of vacuum vessel of TPE-RX

International Nuclear Information System (INIS)

Sago, H.; Kaguchi, H.; Orita, J.; Ishigami, Y.; Urata, K.

1998-01-01

Construction of a new, large reversed field pinch (RFP) machine called TPE-RX was complete at the end of 1997 as a successor of the previous TPE-1RM20 machine at the Electrotechnical Laboratory (ETL). RFP configuration has been successfully obtained in March 1998. This paper introduces structural design and manufacturing of the vacuum vessel of TPE-RX. The support positions were decided by structural analyses. The structural integrity of the vacuum vessel was evaluated by inelastic analyses. (author)

High-Speed Imaging of Explosive Droplet Boiling at the Superheat Limit

Science.gov (United States)

Ferris, F. Robert; Hermanson, Jim; Asadollahi, Arash; Esmaeeli, Asghar

2017-11-01

The explosive boiling processes of droplets of diethyl ether (1-2 mm in diameter) at the superheat limit were examined both experimentally and computationally. Experimentally, droplet explosion was studied using a heated bubble column to bring the test droplet to the superheat limit. The droplet fluid was diethyl ether (superheat limit 147 C at 1 bar) with immiscible glycerol employed as the heated host fluid. Tests were carried out at pressures between 0.5 and 4 bar absolute. The pressure rise associated with the explosive boiling event was captured using a piezoelectric quartz pressure transducer with a 1 MHz DAQ system. High-speed imaging of the interfacial behavior during explosive boiling was performed using a Phantom v12.1 camera at a frame rate of up to one million frames per second with the droplets illuminated by diffuse back-lighting. The imaging reveals features of the Rayleigh-Taylor instability at the vapor-liquid interface resulting from the unstable boiling process. Computationally, Direct Numerical Simulations are performed at Southern Illinois University Carbondale to compliment the experimental tests. NSF Award Number 1511152.

Cyanine 5.5 conjugated nanobubbles as a tumor selective contrast agent for dual ultrasound-fluorescence imaging in a mouse model.

Directory of Open Access Journals (Sweden)

Liyi Mai

Full Text Available Nanobubbles and microbubbles are non-invasive ultrasound imaging contrast agents that may potentially enhance diagnosis of tumors. However, to date, both nanobubbles and microbubbles display poor in vivo tumor-selectivity over non-targeted organs such as liver. We report here cyanine 5.5 conjugated nanobubbles (cy5.5-nanobubbles of a biocompatible chitosan-vitamin C lipid system as a dual ultrasound-fluorescence contrast agent that achieved tumor-selective imaging in a mouse tumor model. Cy5.5-nanobubble suspension contained single bubble spheres and clusters of bubble spheres with the size ranging between 400-800 nm. In the in vivo mouse study, enhancement of ultrasound signals at tumor site was found to persist over 2 h while tumor-selective fluorescence emission was persistently observed over 24 h with intravenous injection of cy5.5-nanobubbles. In vitro cell study indicated that cy5.5-flurescence dye was able to accumulate in cancer cells due to the unique conjugated nanobubble structure. Further in vivo fluorescence study suggested that cy5.5-nanobubbles were mainly located at tumor site and in the bladder of mice. Subsequent analysis confirmed that accumulation of high fluorescence was present at the intact subcutaneous tumor site and in isolated tumor tissue but not in liver tissue post intravenous injection of cy5.5-nanobubbles. All these results led to the conclusion that cy5.5-nanobubbles with unique crosslinked chitosan-vitamin C lipid system have achieved tumor-selective imaging in vivo.

Interface effects on the electronic transport properties in highly epitaxial LaBaCo2O(5.5+δ) films.

Science.gov (United States)

Ma, C R; Liu, M; Liu, J; Collins, G; Zhang, Y M; Wang, H B; Chen, C L; Lin, Y; He, J; Jiang, J C; Meletis, E I; Jacobson, A J

2014-02-26

Single-crystalline perovskite LaBaCo2O5.5+δ thin films were grown on a (110) NdGaO3 single-crystal substrate in order to systematically investigate the effect of lattice mismatch on the electrical transport properties in comparison to the films on LaAlO3, SrTiO3, and MgO substrates. Microstructure studies reveal that all of the LaBaCo2O5.5+δ films are of excellent quality with atomically sharp interface structures. The electrical and magnetic transport property studies indicate that the resistivity, magnetoresistance, and magnetic moment of the film are very sensitive to the substrate materials because of the lattice mismatch/interface strain. The Curie temperature, however, is almost independent of the strain imposed by the substrate, probably because of the strong coupling between the nanodomain boundary and interface strain.

Prospects for Cherenkov telescope array observations of the young supernova Remnant RX J1713.7-3946

Czech Academy of Sciences Publication Activity Database

Acero, F.; Aloisio, R.; Amans, J.; Blažek, Jiří; Chudoba, Jiří; Ebr, Jan; Janeček, Petr; Mandát, Dušan; Palatka, Miroslav; Prouza, Michael; Schovánek, Petr; Trávníček, Petr; Vraštil, Michal

2017-01-01

Roč. 840, č. 2 (2017), s. 1-14, č. článku 74. ISSN 0004-637X R&D Projects: GA MŠk(CZ) 7AMB14AR005; GA MŠk LE13012; GA ČR(CZ) GA14-17501S; GA MŠk LG14019 Institutional support: RVO:68378271 Keywords : cosmic rays * gamma rays: ISM * ISM: individual objects (RX J1713.7-3946, G347.3-0.5) Subject RIV: BF - Elementary Particles and High Energy Physics OBOR OECD: Particles and field physics Impact factor: 5.533, year: 2016

AE monitoring instrumentation for high performance superconducting dipoles and quadrupoles, Phase 2

Science.gov (United States)

Iwasa, Y.

1986-01-01

In the past year and a half, attention has been focused on the development of instrumentation for on-line monitoring of high-performance superconducting dipoles and quadrupoles. This instrumentation has been completed and satisfactorily demonstrated on a prototype Fermi dipole. Conductor motion is the principal source of acoustic emission (AE) and the major cause of quenches in the dipole, except during the virgin run when other sources are also present. The motion events are mostly microslips. The middle of the magnet is most susceptible to quenches. This result agrees with the peak field location in the magnet. In the virgin state the top and bottom of the magnet appeared acoustically similar but diverged after training, possibly due to minute structural asymmetry, for example differences in clamping and welding strength; however, the results do not indicate any major structural defects. There is good correlation between quench current and AE starting current. The correlation is reasonable if mechanical disturbances are indeed responsible for quench. Based on AE cumulative history, the average frictional power dissipation in the whole dipole winding is estimated to be approx. 10 (MU)W cm(-3). We expect to implement the following in the next phase of this project: Application of room-temperature techniques to detecting structural defects in the dipole; application of the system to other dipoles and quadrupoles in the same series to compare their performances; and further investigation of AE starting current approx. quench current relationship. Work has begun on the room temperature measurements. Preliminary Stress Wave Factor measurements have been made on a model dipole casing.

High explosive programmed burn in the FLAG code

Energy Technology Data Exchange (ETDEWEB)

Mandell, D.; Burton, D.; Lund, C.

1998-02-01

The models used to calculate the programmed burn high-explosive lighting times for two- and three-dimensions in the FLAG code are described. FLAG uses an unstructured polyhedra grid. The calculations were compared to exact solutions for a square in two dimensions and for a cube in three dimensions. The maximum error was 3.95 percent in two dimensions and 4.84 percent in three dimensions. The high explosive lighting time model described has the advantage that only one cell at a time needs to be considered.

Sox2, Tlx, Gli3, and Her9 converge on Rx2 to define retinal stem cells in vivo.

Science.gov (United States)

Reinhardt, Robert; Centanin, Lázaro; Tavhelidse, Tinatini; Inoue, Daigo; Wittbrodt, Beate; Concordet, Jean-Paul; Martinez-Morales, Juan Ramón; Wittbrodt, Joachim

2015-06-03

Transcriptional networks defining stemness in adult neural stem cells (NSCs) are largely unknown. We used the proximal cis-regulatory element (pCRE) of the retina-specific homeobox gene 2 (rx2) to address such a network. Lineage analysis in the fish retina identified rx2 as marker for multipotent NSCs. rx2-positive cells located in the peripheral ciliary marginal zone behave as stem cells for the neuroretina, or the retinal pigmented epithelium. We identified upstream regulators of rx2 interrogating the rx2 pCRE in a trans-regulation screen and focused on four TFs (Sox2, Tlx, Gli3, and Her9) activating or repressing rx2 expression. We demonstrated direct interaction of the rx2 pCRE with the four factors in vitro and in vivo. By conditional mosaic gain- and loss-of-function analyses, we validated the activity of those factors on regulating rx2 transcription and consequently modulating neuroretinal and RPE stem cell features. This becomes obvious by the rx2-mutant phenotypes that together with the data presented above identify rx2 as a transcriptional hub balancing stemness of neuroretinal and RPE stem cells in the adult fish retina. © 2015 The Authors. Published under the terms of the CC BY NC ND 4.0 license.

Detection method based on Kalman filter for high speed rail defect AE signal on wheel-rail rolling rig

Science.gov (United States)

Hao, Qiushi; Shen, Yi; Wang, Yan; Zhang, Xin

2018-01-01

Nondestructive test (NDT) of rails has been carried out intermittently in traditional approaches, which highly restricts the detection efficiency under rapid development of high speed railway nowadays. It is necessary to put forward a dynamic rail defect detection method for rail health monitoring. Acoustic emission (AE) as a practical real-time detection technology takes advantage of dynamic AE signal emitted from plastic deformation of material. Detection capacities of AE on rail defects have been verified due to its sensitivity and dynamic merits. Whereas the application under normal train service circumstance has been impeded by synchronous background noises, which are directly linked to the wheel speed. In this paper, surveys on a wheel-rail rolling rig are performed to investigate defect AE signals with varying speed. A dynamic denoising method based on Kalman filter is proposed and its detection effectiveness and flexibility are demonstrated by theory and computational results. Moreover, after comparative analysis of modelling precision at different speeds, it is predicted that the method is also applicable for high speed condition beyond experiments.

Chromosome isolation by flow sorting in Aegilops umbellulata and Ae. comosa and their allotetraploid hybrids Ae. biuncialis and Ae. geniculata.

Directory of Open Access Journals (Sweden)

István Molnár

Full Text Available This study evaluates the potential of flow cytometry for chromosome sorting in two wild diploid wheats Aegilops umbellulata and Ae. comosa and their natural allotetraploid hybrids Ae. biuncialis and Ae. geniculata. Flow karyotypes obtained after the analysis of DAPI-stained chromosomes were characterized and content of chromosome peaks was determined. Peaks of chromosome 1U could be discriminated in flow karyotypes of Ae. umbellulata and Ae. biuncialis and the chromosome could be sorted with purities exceeding 95%. The remaining chromosomes formed composite peaks and could be sorted in groups of two to four. Twenty four wheat SSR markers were tested for their position on chromosomes of Ae. umbellulata and Ae. comosa using PCR on DNA amplified from flow-sorted chromosomes and genomic DNA of wheat-Ae. geniculata addition lines, respectively. Six SSR markers were located on particular Aegilops chromosomes using sorted chromosomes, thus confirming the usefulness of this approach for physical mapping. The SSR markers are suitable for marker assisted selection of wheat-Aegilops introgression lines. The results obtained in this work provide new opportunities for dissecting genomes of wild relatives of wheat with the aim to assist in alien gene transfer and discovery of novel genes for wheat improvement.

High Explosives Research and Development (HERD) Facility

Data.gov (United States)

Federal Laboratory Consortium — The purpose is to provide high explosive formulation, chemical analysis, safety and performance testing, processing, X-ray, quality control and loading support for...

Study of nanometric thin pyrolytic carbon films for explosive electron emission cathode in high-voltage planar diode

Energy Technology Data Exchange (ETDEWEB)

Baryshevsky, Vladimir; Belous, Nikolai; Gurinovich, Alexandra; Gurnevich, Evgeny [Research Institute for Nuclear Problems, Belarusian State University, Bobruiskaya Str. 11, Minsk 220030 (Belarus); Kuzhir, Polina, E-mail: polina.kuzhir@gmail.com [Research Institute for Nuclear Problems, Belarusian State University, Bobruiskaya Str. 11, Minsk 220030 (Belarus); National Research Tomsk State University, 36 Lenin Prospekt, Tomsk 634050 (Russian Federation); Maksimenko, Sergey [Research Institute for Nuclear Problems, Belarusian State University, Bobruiskaya Str. 11, Minsk 220030 (Belarus); National Research Tomsk State University, 36 Lenin Prospekt, Tomsk 634050 (Russian Federation); Molchanov, Pavel; Shuba, Mikhail [Research Institute for Nuclear Problems, Belarusian State University, Bobruiskaya Str. 11, Minsk 220030 (Belarus); Roddatis, Vladimir [CIC energiGUNE, Albert Einstein 48, 01510 Minano, Alava (Spain); Institut für Materialphysik of Universität Göttingen, Friedrich-Hund-Platz 1, 37077 Göttingen (Germany); Kaplas, Tommi; Svirko, Yuri [Institute of Photonics, University of Eastern Finland, P.O. Box 111, Joensuu FI-80101 (Finland)

2015-04-30

We report on an experimental study of explosive electron emission properties of cathode made by nanometric thin pyrolytic carbon (PyC) films (2–150 nm) deposited on Cu substrate via methane-based chemical vapor deposition. High current density at level of 300 A/cm{sup 2} in 5 · 10{sup −5} Pa vacuum has been observed together with very stable explosive emission from the planar cathode. The Raman spectroscopy investigation proves that the PyC films remain the same after seven shots. According to the optical image analysis of the cathode before and after one and seven shots, we conclude that the most unusual and interesting feature of using the PyC films/Cu cathode for explosive emission is that the PyC layer on the top of the copper target prevents its evaporation and oxidation, which leads to higher emission stability compared to conventional graphitic/Cu cathodes, and therefore results in longer working life. - Highlights: • Explosive electron emission from pyrolytic carbon (PyC) cathode is reported. • We observe high current density, 300 A/cm{sup 2}, and stable emission parameters. • PyC integrity ensures a high application potential for high current electronics.

5,5-Dihydroxybarbituric acid 1,4-dioxane hemisolvate

Directory of Open Access Journals (Sweden)

Thomas Gelbrich

2010-05-01

Full Text Available The asymmetric unit of the title compound,, C4H4N2O5·0.5C4H8O2, contains one molecule of 5,5-dihydroxybarbituric acid with a nearly planar barbiturate ring and half a molecule of 1,4-dioxane. The geometry of the centrosymmetric dioxane molecule is close to an ideal chair conformation. The crystal structure exhibits a complex three-dimensional hydrogen-bonded network. Barbiturate molecules are connected to one another via N—H...O=C, O—H...O=C and N—H...O(hydroxy interactions, while the barbituric acid molecule is linked to dioxane by an O—H...O contact.

Syntheses, structures and properties of three new two-dimensional Cu(I)-Ln(III) heterometallic coordination polymers based on 2,2'-dipyridyl-5,5'-dicarboxylate ligands.

Science.gov (United States)

Zhao, Junwei; Cheng, Yamin; Shang, Sensen; Zhang, Fang; Chen, Li; Chen, Lijuan

2013-12-01

Three new two-dimensional Cu(I)-Ln(III) heterometallic coordination polymers [Ln(III)Cu2(I)(Hbpdc)4] · Cl · xH2O [Ln(III) = La(III), x = 8 (1); Ln(III) = Pr(III), x=9 (2); Ln(III) = Eu(III), x = 8 (3)] (H2bpdc = 2,2'-bipyridyl-5,5'-dicarboxylic acid) have been prepared under hydrothermal conditions and structurally characterized by elemental analyses, inductively coupled plasma atomic emission spectrometry (ICP-AES) analyses, IR spectra, X-ray photoelectron spectroscopy (XPS) and single-crystal X-ray diffraction. X-ray diffraction indicates that the isomorphic 1-3 display the two-dimensional sheet structure constructed from [Cu(I)(Hbpdc)2](-) fragments through Ln(3+) connectors. Moreover, the solid-state photoluminescence measurements of 3 indicate that the Eu(III) ions, Hbpdc(-) ligands and Cu(I) cations make contributions to its luminescent properties simultaneously. Copyright © 2013 Elsevier B.V. All rights reserved.

Sox2, Tlx, Gli3, and Her9 converge on Rx2 to define retinal stem cells in vivo

Science.gov (United States)

Reinhardt, Robert; Centanin, Lázaro; Tavhelidse, Tinatini; Inoue, Daigo; Wittbrodt, Beate; Concordet, Jean-Paul; Martinez-Morales, Juan Ramón; Wittbrodt, Joachim

2015-01-01

Transcriptional networks defining stemness in adult neural stem cells (NSCs) are largely unknown. We used the proximal cis-regulatory element (pCRE) of the retina-specific homeobox gene 2 (rx2) to address such a network. Lineage analysis in the fish retina identified rx2 as marker for multipotent NSCs. rx2-positive cells located in the peripheral ciliary marginal zone behave as stem cells for the neuroretina, or the retinal pigmented epithelium. We identified upstream regulators of rx2 interrogating the rx2 pCRE in a trans-regulation screen and focused on four TFs (Sox2, Tlx, Gli3, and Her9) activating or repressing rx2 expression. We demonstrated direct interaction of the rx2 pCRE with the four factors in vitro and in vivo. By conditional mosaic gain- and loss-of-function analyses, we validated the activity of those factors on regulating rx2 transcription and consequently modulating neuroretinal and RPE stem cell features. This becomes obvious by the rx2-mutant phenotypes that together with the data presented above identify rx2 as a transcriptional hub balancing stemness of neuroretinal and RPE stem cells in the adult fish retina. PMID:25908840

7 CFR 5.5 - Publication of season average, calendar year, and parity price data.

Science.gov (United States)

2010-01-01

... cases where preliminary marketing season average price data are used in estimating the adjusted base... Statistics Service, after consultation with the Agricultural Marketing Service, the Farm Service Agency, and... parity price data. 5.5 Section 5.5 Agriculture Office of the Secretary of Agriculture DETERMINATION OF...

Novel high explosive compositions

Science.gov (United States)

Perry, D.D.; Fein, M.M.; Schoenfelder, C.W.

1968-04-16

This is a technique of preparing explosive compositions by the in-situ reaction of polynitroaliphatic compounds with one or more carboranes or carborane derivatives. One or more polynitroaliphatic reactants are combined with one or more carborane reactants in a suitable container and mixed to a homogeneous reaction mixture using a stream of inert gas or conventional mixing means. Ordinarily the container is a fissure, crack, or crevice in which the explosive is to be implanted. The ratio of reactants will determine not only the stoichiometry of the system, but will effect the quality and quantity of combustion products, the explosive force obtained as well as the impact sensitivity. The test values can shift with even relatively slight changes or modifications in the reaction conditions. Eighteen illustrative examples accompany the disclosure. (46 claims)

Effects of Herbal vigRX on Premature Ejaculation: A randomized, double-blind study

Directory of Open Access Journals (Sweden)

Z Ghafuri

2010-05-01

Full Text Available Objective :   "nWe conducted a double-blind, placebo-controlled study todetermine the efficacy of an herbal sexual supplement (vigRX on premature ejaculation (PE. Method: "nA randomized double blind study was conducted on a fixed dose of herbal vigRX at Roozbeh Psychiatry Hospital, Tehran University of Medical Sciences. The sample consisted of 85 married patients diagnosed withprimary PE according to Diagnostic and Statistical Manual of Mental Disorders. Each patient underwent diagnostic evaluation by one trained psychiatrist, using Structured Clinical Interview for DSM-IV-TR. Each patient was evaluated by researchers to exclude the organic sexual dysfunctions. The patients were randomly assigned in to two groups: group 1 consisting of 42 patients receiving placebo, and group 2 consisting of 43 patients receiving 540 mg herbal vigRX for a 4-week treatment course. The effects of the drug on the ejaculatory function in each group were assessed by the intravaginal ejaculation latency time (IELT, and the Chinese Index of Premature Ejaculation (CIPE before and at the end of the treatment course. Statistical analysis was performed using SPSS software (15th version.      Results: "nThe mean IELT increased 22.4 and 32.0 seconds in the placebo and the vigRX group respectively after the treatment course. The mean IELT differences between the two groups was not significant. The mean CIPE score increased 2.40 and 4.37 in the placebo and the vigRX group respectively .The mean CIPE score differences between the two groups was not significant.No side effect was reported by the subjects in neither groups during the treatment course. "nConclusion: Although the improvement in IELT and CIPE scores in the herbal vigRX group was more than the placebo group, this difference was not statistically significant. The increasing of IELT and CIPE score in the placebo group may be due to the placebo effects. Further studies with higher vigRX doses, greater sample size

Structure of the Aeropyrum pernix L7Ae multifunctional protein and insight into its extreme thermostability

International Nuclear Information System (INIS)

Bhuiya, Mohammad Wadud; Suryadi, Jimmy; Zhou, Zholi; Brown, Bernard Andrew II

2013-01-01

The crystal structure of A. pernix L7Ae is reported, providing insight into the extreme thermostability of this protein. Archaeal ribosomal protein L7Ae is a multifunctional RNA-binding protein that directs post-transcriptional modification of archaeal RNAs. The L7Ae protein from Aeropyrum pernix (Ap L7Ae), a member of the Crenarchaea, was found to have an extremely high melting temperature (>383 K). The crystal structure of Ap L7Ae has been determined to a resolution of 1.56 Å. The structure of Ap L7Ae was compared with the structures of two homologs: hyperthermophilic Methanocaldococcus jannaschii L7Ae and the mesophilic counterpart mammalian 15.5 kD protein. The primary stabilizing feature in the Ap L7Ae protein appears to be the large number of ion pairs and extensive ion-pair network that connects secondary-structural elements. To our knowledge, Ap L7Ae is among the most thermostable single-domain monomeric proteins presently observed

Forensic analysis of high explosives residues in post-blast water samples employing solid phase extraction for analyte pro-concentration

International Nuclear Information System (INIS)

Umi Kalsom Ahmad; Rajendran, Sumathy; Ling, Lee Woan

2008-01-01

Nitro aromatic, nitramine and nitrate ester compounds are a major group of high order explosive or better known as military explosives. Octahydro-1,3,5,7-tetrazocine (HMX), 1,3,5-hexahydro-1,3,5-trinitro triazine (RDX), 2,4,6-trinitro-toluene (TNT), pentaerythritol tetranitrate (PETN) and 2,4-dinitrotoluene (2,4-DNT) are secondary high explosives classified as most commonly used explosives components. There is an increasing demand for pre-concentration of these compounds in water samples as the sensitivity achieved by instrumental analytical methods for these high explosives residues are the main drawback in the application at trace levels for forensic analysis. Hence, a simple cartridge solid phase extraction (SPE) procedure was optimized as the off-line extraction and pre-concentration method to enhance the detection limit of high explosive residues using micellar electrokinetic chromatography (MEKC) and gas chromatography with electron-capture detection (GC-ECD) methods. The SPE cartridges utilized LiChrolut EN as the SPE adsorbent. By emplying pre-concentration using SPE, the detection limits of the target analytes in water sample were lowered by more than 1000 times with good percentage recovery (>87%) for MEKC method and lowered by 120 times with more than 2 % percentage recovery for GC-ECD methods. In order to test the feasibility of the developed method to real cases, post-blast water samples were analyzed. The post-blast water samples which were collected from Baling Bom training range, Ulu Kinta, Perak contained RDX and PETN in the range of 0.05 - 0.17 ppm and 0.0124 - 0.0390 ppm respectively. (author)

Green primary explosives: 5-Nitrotetrazolato-N2-ferrate hierarchies

OpenAIRE

Huynh, My Hang V.; Coburn, Michael D.; Meyer, Thomas J.; Wetzler, Modi

2006-01-01

The sensitive explosives used in initiating devices like primers and detonators are called primary explosives. Successful detonations of secondary explosives are accomplished by suitable sources of initiation energy that is transmitted directly from the primaries or through secondary explosive boosters. Reliable initiating mechanisms are available in numerous forms of primers and detonators depending upon the nature of the secondary explosives. The technology of initiation devices used for mi...

Evaluation of nuclear reaction cross sections for optimization of production of the emerging diagnostic radionuclide "5"5Co

International Nuclear Information System (INIS)

Amjed, N.; Hussain, M.; Aslam, M.N.; Tárkányi, F.; Qaim, S.M.

2016-01-01

The excitation functions of the "5"4Fe(d,n)"5"5Co, "5"6Fe(p,2n)"5"5Co and "5"8Ni(p,α)"5"5Co reactions were analyzed with relevance to the production of the β"+-emitter "5"5Co (T_½=17.53 h), a promising cobalt radionuclide for PET imaging. The nuclear model codes ALICE-IPPE, EMPIRE and TALYS were used to check the consistency of the experimental data. The statistically fitted excitation function was employed to calculate the integral yield of the product. The amounts of the radioactive impurities "5"6Co and "5"7Co were assessed. A comparison of the three investigated production routes is given. - Highlights: • Evaluation of "5"4Fe(d,n)"5"5Co, "5"6Fe(p,2n)"5"5Co and "5"8Ni(p,α)"5"5Co reactions. • Detailed nuclear model calculations (TALYS and EMPIRE) and statistical fitting of the selected data. • Estimation of integral yield and impurity level in the production of "5"5Co. • Comparison of major production routes of "5"5Co.

The Continued Spectral Evolution of the Neutron Star RX J0720.4-3125

NARCIS (Netherlands)

Vink, Jacco; de Vries, Cor P.; Méndez, Mariano; Verbunt, Frank

2004-01-01

We observed the isolated neutron star RX J0720.4-3125 with Chandra's Low Energy Transmission Grating Spectrometer, following the XMM-Newton discovery of the long-term spectral evolution of this source. The new observation shows that the spectrum of RX J0720.4-3125 has continued to change in the

AE Recorder Characteristics and Development.

Energy Technology Data Exchange (ETDEWEB)

Partridge, Michael E. [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Curtis, Shane Keawe [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); McGrogan, David Paul [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States)

2016-11-01

The Anomalous Environment Recorder (AE Recorder) provides a robust data recording capability for multiple high-shock applications including earth penetrators. The AE Recorder, packaged as a 2.4" di ameter cylinder 3" tall, acquires 12 accelerometer, 2 auxiliary, and 6 discrete signal channels at 250k samples / second. Recording depth is 213 seconds plus 75ms of pre-trigger data. The mechanical, electrical, and firmware are described as well as support electro nics designed for the first use of the recorder.

Mapping Partners Master Drug Dictionary to RxNorm using an NLP-based approach.

Science.gov (United States)

Zhou, Li; Plasek, Joseph M; Mahoney, Lisa M; Chang, Frank Y; DiMaggio, Dana; Rocha, Roberto A

2012-08-01

To develop an automated method based on natural language processing (NLP) to facilitate the creation and maintenance of a mapping between RxNorm and a local medication terminology for interoperability and meaningful use purposes. We mapped 5961 terms from Partners Master Drug Dictionary (MDD) and 99 of the top prescribed medications to RxNorm. The mapping was conducted at both term and concept levels using an NLP tool, called MTERMS, followed by a manual review conducted by domain experts who created a gold standard mapping. The gold standard was used to assess the overall mapping between MDD and RxNorm and evaluate the performance of MTERMS. Overall, 74.7% of MDD terms and 82.8% of the top 99 terms had an exact semantic match to RxNorm. Compared to the gold standard, MTERMS achieved a precision of 99.8% and a recall of 73.9% when mapping all MDD terms, and a precision of 100% and a recall of 72.6% when mapping the top prescribed medications. The challenges and gaps in mapping MDD to RxNorm are mainly due to unique user or application requirements for representing drug concepts and the different modeling approaches inherent in the two terminologies. An automated approach based on NLP followed by human expert review is an efficient and feasible way for conducting dynamic mapping. Copyright © 2011 Elsevier Inc. All rights reserved.

33 CFR 55.5 - Who is eligible for child development services?

Science.gov (United States)

2010-07-01

... 33 Navigation and Navigable Waters 1 2010-07-01 2010-07-01 false Who is eligible for child development services? 55.5 Section 55.5 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY PERSONNEL CHILD DEVELOPMENT SERVICES General § 55.5 Who is eligible for child development services...

The path to CAM6: coupled simulations with CAM5.4 and CAM5.5

Science.gov (United States)

Bogenschutz, Peter A.; Gettelman, Andrew; Hannay, Cecile; Larson, Vincent E.; Neale, Richard B.; Craig, Cheryl; Chen, Chih-Chieh

2018-01-01

This paper documents coupled simulations of two developmental versions of the Community Atmosphere Model (CAM) towards CAM6. The configuration called CAM5.4 introduces new microphysics, aerosol, and ice nucleation changes, among others to CAM. The CAM5.5 configuration represents a more radical departure, as it uses an assumed probability density function (PDF)-based unified cloud parameterization to replace the turbulence, shallow convection, and warm cloud macrophysics in CAM. This assumed PDF method has been widely used in the last decade in atmosphere-only climate simulations but has never been documented in coupled mode. Here, we compare the simulated coupled climates of CAM5.4 and CAM5.5 and compare them to the control coupled simulation produced by CAM5.3. We find that CAM5.5 has lower cloud forcing biases when compared to the control simulations. Improvements are also seen in the simulated amplitude of the Niño-3.4 index, an improved representation of the diurnal cycle of precipitation, subtropical surface wind stresses, and double Intertropical Convergence Zone biases. Degradations are seen in Amazon precipitation as well as slightly colder sea surface temperatures and thinner Arctic sea ice. Simulation of the 20th century results in a credible simulation that ends slightly colder than the control coupled simulation. The authors find this is due to aerosol indirect effects that are slightly stronger in the new version of the model and propose a solution to ameliorate this. Overall, in these early coupled simulations, CAM5.5 produces a credible climate that is appropriate for science applications and is ready for integration into the National Center for Atmospheric Research's (NCAR's) next-generation climate model.

A More Compact AES

Science.gov (United States)

Canright, David; Osvik, Dag Arne

We explore ways to reduce the number of bit operations required to implement AES. One way involves optimizing the composite field approach for entire rounds of AES. Another way is integrating the Galois multiplications of MixColumns with the linear transformations of the S-box. Combined with careful optimizations, these reduce the number of bit operations to encrypt one block by 9.0%, compared to earlier work that used the composite field only in the S-box. For decryption, the improvement is 13.5%. This work may be useful both as a starting point for a bit-sliced software implementation, where reducing operations increases speed, and also for hardware with limited resources.

5@5 - A 5 GeV Energy Threshold Array of Imaging Atmospheric Cherenkov Telescopes at 5 km Altitude

Science.gov (United States)

Aharonian, F. A.; Konopelko, A. K.; Voelk, H. J.; Quintana, H.

2000-10-01

We discuss the concept and the performance of 5@5 - a stereoscopic array of several large imaging atmospheric Cherenkov telescopes installed at a very high mountain elevation of about 5 km a.s.l. or more - for the study of the gamma-ray sky at energies from several GeV to 100 GeV. With its capability to detect the ``standard'' EGRET sources with spectra extending up to 10 GeV in exposure times from 1 to 103 seconds, such a detector may serve as an ideal "Gamma-Ray Timing Explorer" for the study of transient non-thermal phenomena like gamma-radiation from AGN jets, synchrotron flares of microquasars, the high energy (GeV) counterparts of Gamma Ray Bursts, etc. Such an instrument would also allow detailed studies of the spectral characteristics of persistent gamma-ray sources like pulsars, supernova remnants, plerions, radiogalaxies, etc, in the energy region between 10 GeV and 100 GeV, where the capabilities of both the current space-based and ground-based gamma-ray projects are quite limited. The existing technological achievements in the design and construction of multi (1000) pixel, high resolution imagers, as well as of large, 20 m diameter class multi-mirror dishes with rather modest optical requirements, would allow the construction of the "5@5" in a foreseeable future. The Llano de Chajnantor (or the neighboring Cerro Toco) in the Atacama desert of Northern Chile seems an ideal site for such a ``post - CANGAROO/H.E.S.S./MAGIC/VERITAS'' era ground-based gamma-ray detector. The large flat area of that site, which was recently chosen for the installation of one of the most powerful future astronomical instruments - the Atacama Large Millimeter Array (ALMA) - could accomodate also an additional Cherenkov telescope array which requires a relatively compact area with a radius of about 100 m.

5.5nm wavelength-tunable high-power MOPA diode laser system at 971 nm

Science.gov (United States)

Tawfieq, Mahmoud; Müller, André; Fricke, Jörg; Della Casa, Pietro; Ressel, Peter; Ginolas, Arnim; Feise, David; Sumpf, Bernd; Tränkle, Günther

2018-02-01

In this work, a widely tunable hybrid master oscillator power amplifier (MOPA) diode laser with 6.2 W of output power at 971.8 nm will be presented. The MO is a DBR laser, with a micro heater embedded on top of the DBR grating for wavelength tunability. The emitted light of the MO is collimated and coupled into a tapered amplifier using micro cylindrical lenses, all constructed on a compact 25 mm × 25 mm conduction cooled laser package. The MOPA system emits light with a measured spectral width smaller than 17 pm, limited by the spectrometer, and with a beam propagation factor of M2 1/e2 = 1.3 in the slow axis. The emission is thus nearly diffraction limited with 79% of the total power within the central lobe (4.9 W diffraction limited). The electrically controlled micro-heater provides up to 5.5 nm of wavelength tunability, up to a wavelength of 977.3 nm, while maintaining an output power variation of only +/- 0.16 % for the entire tuning range.

Transition mechanism of Stone-Wales defect in armchair edge (5,5) carbon nanotube

Science.gov (United States)

Setiadi, Agung; Suprijadi

2015-04-01

We performed first principles calculations of Stone-Wales (SW) defects in armchair edge (5,5) carbon nanotube (CNT) by the density functional theory (DFT). Stone Wales (SW) defect is one kind of topological defect on the CNT. There are two kind of SW defect on the armchair edge (5,5) CNT, such as longitudinal and circumference SW defect. Barrier energy in the formation of SW defects is a good consideration to become one of parameter in controlling SW defects on the CNT. Our calculation results that a longitudinal SW defect is more stable than circumference SW defect. However, the barrier energy of circumference SW defect is lower than another one. We applied Climbing Image Nudge Elastic Band (CI-NEB) method to find minimum energy path (MEP) and barrier energy for SW defect transitions. We also found that in the case of circumference SW defect, armchair edge (5,5) CNT become semiconductor with the band gap of 0.0544 eV.

7 CFR 319.55-5 - Notice of arrival by permittee.

Science.gov (United States)

2010-01-01

... arrival, the permittee or his agent shall submit a notice, in duplicate, to the Plant Protection and... 7 Agriculture 5 2010-01-01 2010-01-01 false Notice of arrival by permittee. 319.55-5 Section 319.55-5 Agriculture Regulations of the Department of Agriculture (Continued) ANIMAL AND PLANT HEALTH...

Study of chromites YbMIICr2O5,5 (MII - Mg, Ca, Sr, Ba by X-ray diffraction

Directory of Open Access Journals (Sweden)

B. Kasenov

2012-03-01

Full Text Available Compounds of composition YbMeMnFeO5,5 (Me – Mg, Ca, Sr, Ba are synthesized from Yb2O3, , Cr2O3 and MgCO3, CaCO3, SrCO3, BaCO3 by solid phase method. X-ray powder diffraction showed that the compound YbMgCr2O5,5, YbCaCr2O5,5, YbSrCr2O5,5, YbBaCr2O5,5 crystallizes in the tetragonal crystal system.

A K/Ka band radiating element for Tx/Rx phased array

KAUST Repository

Sandhu, Ali Imran; Arnieri, E.; Amendola, G.; Boccia, L.; Meniconi, E.; Ziegler, V.

2017-01-01

The paper presents a K/Ka band radiating element for TX/RX phased arrays. Dual band operations is obtained using a single radiating surface: a novel radiator is adopted and placed in a configuration in which dual band and single band elements are interleaved. The array elements are optimized to scan the beam in excess of 50° in both bands. A subarray with 49 Rx elements and 105 Tx elements was built and measured confirming the results obtained in simulations.

A K/Ka band radiating element for Tx/Rx phased array

KAUST Repository

Sandhu, Ali Imran

2017-01-20

The paper presents a K/Ka band radiating element for TX/RX phased arrays. Dual band operations is obtained using a single radiating surface: a novel radiator is adopted and placed in a configuration in which dual band and single band elements are interleaved. The array elements are optimized to scan the beam in excess of 50° in both bands. A subarray with 49 Rx elements and 105 Tx elements was built and measured confirming the results obtained in simulations.

Energy efficiency analysis and implementation of AES on an FPGA

Science.gov (United States)

Kenney, David

The Advanced Encryption Standard (AES) was developed by Joan Daemen and Vincent Rjimen and endorsed by the National Institute of Standards and Technology in 2001. It was designed to replace the aging Data Encryption Standard (DES) and be useful for a wide range of applications with varying throughput, area, power dissipation and energy consumption requirements. Field Programmable Gate Arrays (FPGAs) are flexible and reconfigurable integrated circuits that are useful for many different applications including the implementation of AES. Though they are highly flexible, FPGAs are often less efficient than Application Specific Integrated Circuits (ASICs); they tend to operate slower, take up more space and dissipate more power. There have been many FPGA AES implementations that focus on obtaining high throughput or low area usage, but very little research done in the area of low power or energy efficient FPGA based AES; in fact, it is rare for estimates on power dissipation to be made at all. This thesis presents a methodology to evaluate the energy efficiency of FPGA based AES designs and proposes a novel FPGA AES implementation which is highly flexible and energy efficient. The proposed methodology is implemented as part of a novel scripting tool, the AES Energy Analyzer, which is able to fully characterize the power dissipation and energy efficiency of FPGA based AES designs. Additionally, this thesis introduces a new FPGA power reduction technique called Opportunistic Combinational Operand Gating (OCOG) which is used in the proposed energy efficient implementation. The AES Energy Analyzer was able to estimate the power dissipation and energy efficiency of the proposed AES design during its most commonly performed operations. It was found that the proposed implementation consumes less energy per operation than any previous FPGA based AES implementations that included power estimations. Finally, the use of Opportunistic Combinational Operand Gating on an AES cipher

Production of Mucosally Transmissible SHIV Challenge Stocks from HIV-1 Circulating Recombinant Form 01_AE env Sequences.

Directory of Open Access Journals (Sweden)

Lawrence J Tartaglia

2016-02-01

Full Text Available Simian-human immunodeficiency virus (SHIV challenge stocks are critical for preclinical testing of vaccines, antibodies, and other interventions aimed to prevent HIV-1. A major unmet need for the field has been the lack of a SHIV challenge stock expressing circulating recombinant form 01_AE (CRF01_AE env sequences. We therefore sought to develop mucosally transmissible SHIV challenge stocks containing HIV-1 CRF01_AE env derived from acutely HIV-1 infected individuals from Thailand. SHIV-AE6, SHIV-AE6RM, and SHIV-AE16 contained env sequences that were >99% identical to the original HIV-1 isolate and did not require in vivo passaging. These viruses exhibited CCR5 tropism and displayed a tier 2 neutralization phenotype. These challenge stocks efficiently infected rhesus monkeys by the intrarectal route, replicated to high levels during acute infection, and established chronic viremia in a subset of animals. SHIV-AE16 was titrated for use in single, high dose as well as repetitive, low dose intrarectal challenge studies. These SHIV challenge stocks should facilitate the preclinical evaluation of vaccines, monoclonal antibodies, and other interventions targeted at preventing HIV-1 CRF01_AE infection.

'Freestyle' - 5.5 kWp photovoltaic roof; Toiture photovoltaique Freestyle de 5,5 kWp

Energy Technology Data Exchange (ETDEWEB)

Affolter, P. [Solstis, Lausanne (Switzerland)

2005-07-01

This illustrated final report for the Swiss Federal Office of Energy (SFOE) describes a photovoltaics installation on a villa in the vineyards above the Lake of Geneva in Switzerland. The 'Freestyle' roofing system used, which allows a roof to be covered with an unglazed, watertight photovoltaic system, is described. This system features aluminium profiles that are fixed to the roof structure, corrugated panels that form a self-draining sub-roof and laminated photovoltaic (PV) cells based on triple-cell amorphous silicon technology. This pilot system with a peak power of 5.5 kW covers an area of 160 m{sup 2}. The active PV area amounts to 100 m{sup 2}. The aesthetics of the installation is discussed. The operation and performance of the system, which was put into service in May 2003, is discussed. The results of measurements made over a period of more than 12 months are presented. The author states that these results are far better than expected.

Medipix3RX: Characterizing the Medipix3 Redesign With Synchrotron Radiation

CERN Document Server

Gimenez, Eva N; Blaj, Gabriel; Campbell, Michael; Dolbnya, Igor; Frodjh, Erik; Horswell, Ian; Llopart, Xavier; Marchal, Julien; McGrath, John; Omar, David; Plackett, Richard; Sawhney, Kawal; Tartoni, Nicola

2015-01-01

The Medipix3RX is the latest version of the Medipix3 photon counting ASICs, which implements two new operational modes, with respect to the Medipix2 ASIC, aimed at eliminating charge shared events (referred to as Charge Summing Mode (CSM)) and at providing spectroscopic information (referred to as Colour Mode (CM)). The Medipix3RX is a redesign of the Medipix3v0 ASIC and corrects for the underperformance of CSM features observed in the previous version. This paper presents the results from synchrotron X-rays tests to evaluate the Medipix3RX ASIC performance. The newly implemented CSM algorithm eliminates the charge sharing effect at the same time as allocating the event to the readout pixel corresponding to the sensor pixel where the X-ray photon impinged. The new pixel trimming circuit led to a reduced dispersion between pixels. Further results of the linearity for all the gain modes, energy resolution and pixel uniformity are also presented.

Dynamical back-action at 5.5 GHz in a corrugated optomechanical beam

Energy Technology Data Exchange (ETDEWEB)

Navarro-Urrios, D., E-mail: daniel.navarrourrios@nano.cnr.it [Catalan Institute of Nanoscience and Nanotechnology, Campus UAB, Edifici ICN2, 08193 Bellaterra (Spain); NEST, Istituto Nanoscienze – CNR and Scuola Normale Superiore, Piazza San Silvestro 12, Pisa, I-56127 (Italy); Gomis-Bresco, J.; Alzina, F. [Catalan Institute of Nanoscience and Nanotechnology, Campus UAB, Edifici ICN2, 08193 Bellaterra (Spain); El-Jallal, S. [IEMN, Universite de Lille 1, Villeneuve d’Ascq (France); PRILM, Université Moulay Ismail, Faculté des sciences, Meknès (Morocco); Oudich, M.; Pennec, Y.; Djafari-Rouhani, B. [IEMN, Universite de Lille 1, Villeneuve d’Ascq (France); Pitanti, A. [NEST, Istituto Nanoscienze – CNR and Scuola Normale Superiore, Piazza San Silvestro 12, Pisa, I-56127 (Italy); Capuj, N. [Depto. Física, Universidad de la Laguna, 38206 (Spain); Tredicucci, A. [NEST, Istituto Nanoscienze – CNR and Scuola Normale Superiore, Piazza San Silvestro 12, Pisa, I-56127 (Italy); Dipartimento di Fisica, Universita di Pisa, Largo Pontecorvo 3, I-56127 Pisa (Italy); Griol, A.; Martínez, A. [Nanophotonics Technology Center, Universitat Politècnica de València, Valencia (Spain); Sotomayor Torres, C. M. [Catalan Institute of Nanoscience and Nanotechnology, Campus UAB, Edifici ICN2, 08193 Bellaterra (Spain); Catalan Institution for Research and Advanced Studies (ICREA), 08010 Barcelona (Spain)

2014-12-15

We report on the optomechanical properties of a breathing mechanical mode oscillating at 5.5 GHz in a 1D corrugated Si nanobeam. This mode has an experimental single-particle optomechanical coupling rate of |g{sub o,OM}| = 1.8 MHz (|g{sub o,OM}|/2π = 0.3 MHz) and shows strong dynamical back-action effects at room temperature. The geometrical flexibility of the unit-cell would lend itself to further engineering of the cavity region to localize the mode within the full phononic band-gap present at 4 GHz while keeping high g{sub o,OM} values. This would lead to longer lifetimes at cryogenic temperatures, due to the suppression of acoustic leakage.

1,3-Dibromo 5,5-dimethylhydantoin (DBH-Catalyzed Solvent-Free Synthesis of 2-arylbenzimidazoles under Microwave Irradiation

Directory of Open Access Journals (Sweden)

Mehdi Forouzani

2012-01-01

Full Text Available An expeditious synthesis of 2-aryl-benzimidazoles by the condensation of o-phenylenediamine with various arylaldehydes is described. This greener protocol is catalyzed by 1,3-Dibromo 5,5-dimethylhydantoin (DBH, and proceeds efficiently in the absence of any organic solvent under thermal condition and microwave irradiation in high yields.

New Mix Explosives for Explosive Welding

Science.gov (United States)

Andreevskikh, Leonid

2011-06-01

Suggested and tested were some mix explosives--powder mixtures of a brisant high explosive (HE = RDX, PETN) and an inert diluent (baking soda)--for use in explosive welding. RDX and PETN were selected in view of their high throwing ability and low critical diameter. Since the decomposition of baking soda yields a huge amount of gaseous products, its presence ensures (even at a low HE percentage) a throwing speed that is sufficient for realization of explosive welding, at a reduced brisant action of charge. Mix chargers containing 30-70 wt % HE (the rest baking soda) have been tested experimentally and optimized. For study of possibility to reduce critical diameter of HE mixture, the mixture was prepared where HE crystal sizes did not exceed 10 μm. The tests, which were performed with this HE, revealed that the mixture detonated stably with the velocity D ~ 2 km/s, if the layer thickness was d = 2 mm. The above explosives afford to markedly diminish deformations within the oblique impact zone and thus to carry out explosive welding of hollow items and thin metallic foils.

Trace explosives sensor testbed (TESTbed)

Science.gov (United States)

Collins, Greg E.; Malito, Michael P.; Tamanaha, Cy R.; Hammond, Mark H.; Giordano, Braden C.; Lubrano, Adam L.; Field, Christopher R.; Rogers, Duane A.; Jeffries, Russell A.; Colton, Richard J.; Rose-Pehrsson, Susan L.

2017-03-01

A novel vapor delivery testbed, referred to as the Trace Explosives Sensor Testbed, or TESTbed, is demonstrated that is amenable to both high- and low-volatility explosives vapors including nitromethane, nitroglycerine, ethylene glycol dinitrate, triacetone triperoxide, 2,4,6-trinitrotoluene, pentaerythritol tetranitrate, and hexahydro-1,3,5-trinitro-1,3,5-triazine. The TESTbed incorporates a six-port dual-line manifold system allowing for rapid actuation between a dedicated clean air source and a trace explosives vapor source. Explosives and explosives-related vapors can be sourced through a number of means including gas cylinders, permeation tube ovens, dynamic headspace chambers, and a Pneumatically Modulated Liquid Delivery System coupled to a perfluoroalkoxy total-consumption microflow nebulizer. Key features of the TESTbed include continuous and pulseless control of trace vapor concentrations with wide dynamic range of concentration generation, six sampling ports with reproducible vapor profile outputs, limited low-volatility explosives adsorption to the manifold surface, temperature and humidity control of the vapor stream, and a graphical user interface for system operation and testing protocol implementation.

The intracellular immune receptor Rx1 regulates the DNA-binding activity of a Golden2-like transcription factor.

Science.gov (United States)

Townsend, Philip D; Dixon, Christopher H; Slootweg, Erik J; Sukarta, Octavina C A; Yang, Ally W H; Hughes, Timothy R; Sharples, Gary J; Pålsson, Lars-Olof; Takken, Frank L W; Goverse, Aska; Cann, Martin J

2018-03-02

Plant nucleotide-binding leucine-rich repeat (NLR) proteins enable the immune system to recognize and respond to pathogen attack. An early consequence of immune activation is transcriptional reprogramming, and some NLRs have been shown to act in the nucleus and interact with transcription factors. The Rx1 NLR protein of potato is further able to bind and distort double-stranded DNA. However, Rx1 host targets that support a role for Rx1 in transcriptional reprogramming at DNA are unknown. Here, we report a functional interaction between Rx1 and Nb Glk1, a Golden2-like transcription factor. Rx1 binds to Nb Glk1 in vitro and in planta. Nb Glk1 binds to known Golden2-like consensus DNA sequences. Rx1 reduces the binding affinity of Nb Glk1 for DNA in vitro. Nb Glk1 activates cellular responses to potato virus X, whereas Rx1 associates with Nb Glk1 and prevents its assembly on DNA in planta unless activated by PVX. This study provides new mechanistic insight into how an NLR can coordinate an immune signaling response at DNA following pathogen perceptions. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.

High-speed imaging of explosive eruptions: applications and perspectives

Science.gov (United States)

Taddeucci, Jacopo; Scarlato, Piergiorgio; Gaudin, Damien; Capponi, Antonio; Alatorre-Ibarguengoitia, Miguel-Angel; Moroni, Monica

2013-04-01

Explosive eruptions, being by definition highly dynamic over short time scales, necessarily call for observational systems capable of relatively high sampling rates. "Traditional" tools, like as seismic and acoustic networks, have recently been joined by Doppler radar and electric sensors. Recent developments in high-speed camera systems now allow direct visual information of eruptions to be obtained with a spatial and temporal resolution suitable for the analysis of several key eruption processes. Here we summarize the methods employed to gather and process high-speed videos of explosive eruptions, and provide an overview of the several applications of these new type of data in understanding different aspects of explosive volcanism. Our most recent set up for high-speed imaging of explosive eruptions (FAMoUS - FAst, MUltiparametric Set-up,) includes: 1) a monochrome high speed camera, capable of 500 frames per second (fps) at high-definition (1280x1024 pixel) resolution and up to 200000 fps at reduced resolution; 2) a thermal camera capable of 50-200 fps at 480-120x640 pixel resolution; and 3) two acoustic to infrasonic sensors. All instruments are time-synchronized via a data logging system, a hand- or software-operated trigger, and via GPS, allowing signals from other instruments or networks to be directly recorded by the same logging unit or to be readily synchronized for comparison. FAMoUS weights less than 20 kg, easily fits into four, hand-luggage-sized backpacks, and can be deployed in less than 20' (and removed in less than 2', if needed). So far, explosive eruptions have been recorded in high-speed at several active volcanoes, including Fuego and Santiaguito (Guatemala), Stromboli (Italy), Yasur (Vanuatu), and Eyjafiallajokull (Iceland). Image processing and analysis from these eruptions helped illuminate several eruptive processes, including: 1) Pyroclasts ejection. High-speed videos reveal multiple, discrete ejection pulses within a single Strombolian

Effect of heat treatment on the microstructures and mechanical properties of Al-5.5Zn-2.5Mg alloy

Energy Technology Data Exchange (ETDEWEB)

Acer, Emine [Erciyes University, Institute of Science, Department of Physics, Kayseri (Turkey); Çadırlı, Emin [Niğde University, Faculty of Arts and Sciences, Department of Physics, Niğde (Turkey); Erol, Harun [Erciyes University, Institute of Science, Department of Physics, Kayseri (Turkey); Karatekin University Faculty of Arts and Sciences, Department of Physics, Çankırı (Turkey); Kırındı, Talip [Kırıkkale University, Faculty of Education, Department of Elementary Education, Kırıkkale (Turkey); Gündüz, Mehmet, E-mail: gunduz@erciyes.edu.tr [Erciyes University, Faculty of Science, Department of Physics, Kayseri (Turkey)

2016-04-26

The Al-5.5 Zn-2.5 Mg (wt%) ternary alloy was prepared using a vacuum melting furnace and a casting furnace. Microstructural and mechanical properties of the alloy were investigated as-cast and under heat-treated conditions. To investigate the effect of heat treatment, numerous designed Al-5.5 Zn-2.5 Mg samples were homogenized under different conditions and then aged under different regimes. The effects of heat treatment on the microstructures were examined by OM, SEM, and TEM, and mechanical properties of the Al-Zn-Mg alloy were studied. A good combination of high microhardness and reasonable tensile strength were obtained by successive and suitable heat treatments. After aging for 24 h at 150°C, the peak microhardnes and tensile strength values were achieved as 157 MPa and 188.8 MPa, respectively. The microscopic fracture surfaces of the aged samples under different homogenization and aging conditions were observed using scanning electron microscopy. Fractographic analysis of the tensile fracture surfaces shows that the type of fracture changed significantly from ductile to more ductile depending on the aging regime.

Initial mechanisms for the decomposition of electronically excited energetic materials: 1,5′-BT, 5,5′-BT, and AzTT

International Nuclear Information System (INIS)

Yuan, Bing; Yu, Zijun; Bernstein, Elliot R.

2015-01-01

Decomposition of nitrogen-rich energetic materials 1,5′-BT, 5,5′-BT, and AzTT (1,5′-Bistetrazole, 5,5′-Bistetrazole, and 5-(5-azido-(1 or 4)H-1,2,4-triazol-3-yl)tetrazole, respectively), following electronic state excitation, is investigated both experimentally and theoretically. The N 2 molecule is observed as an initial decomposition product from the three materials, subsequent to UV excitation, with a cold rotational temperature (<30 K). Initial decomposition mechanisms for these three electronically excited materials are explored at the complete active space self-consistent field (CASSCF) level. Potential energy surface calculations at the CASSCF(12,8)/6-31G(d) level illustrate that conical intersections play an essential role in the decomposition mechanism. Electronically excited S 1 molecules can non-adiabatically relax to their ground electronic states through (S 1 /S 0 ) CI conical intersections. 1,5′-BT and 5,5′-BT materials have several (S 1 /S 0 ) CI conical intersections between S 1 and S 0 states, related to different tetrazole ring opening positions, all of which lead to N 2 product formation. The N 2 product for AzTT is formed primarily by N–N bond rupture of the –N 3 group. The observed rotational energy distributions for the N 2 products are consistent with the final structures of the respective transition states for each molecule on its S 0 potential energy surface. The theoretically derived vibrational temperature of the N 2 product is high, which is similar to that found for energetic salts and molecules studied previously

Helical EMG module with explosive current opening switches

International Nuclear Information System (INIS)

Chernyshev, V.K.; Vakhrushev, V.V.; Volkov, G.I.; Ivanov, V.A.; Fetisov, I.K.

1990-01-01

To carry out the experimental work to study plasma properties, electromagnetic sources with 10 6 to 10 8 J of stored energy delivered to the load in microsecond time, are required. Among the current electromagnetic storage devices, the explosive magnetic generators (EMG) are of the largest energy capacity. The disadvantages of this type of generators is relatively long time (ten of microseconds) of electromagnetic energy cumulation in the deformable circuit. To reduce the time of energy transfer to the load to a microsecond range the switching scheme is generally used, where the cumulation circuit and that of the load are separated and connected in parallel via a switching element (opening switch) providing generation of desired power. In this paper, some ways and means of designing opening switches to generate high current pulses have been investigated. The opening switches to generate high current pulses have been investigated. The opening switches which operation is based on mechanic destruction of the conductor using high explosive, have the highest and most reliable performance. The authors have explored the mechanic disruption of a thin conductor (foil), the technique based on throwing the foil at the ribbed barrier of electric insulator material. The report presents the data obtained in studying the operation of this type of opening switch having cylindrical shape, 200 mm in diameter and 200 mm long, designed for generation of 5.5 MA current pulse in the load

Building a drug ontology based on RxNorm and other sources.

Science.gov (United States)

Hanna, Josh; Joseph, Eric; Brochhausen, Mathias; Hogan, William R

2013-12-18

We built the Drug Ontology (DrOn) because we required correct and consistent drug information in a format for use in semantic web applications, and no existing resource met this requirement or could be altered to meet it. One of the obstacles we faced when creating DrOn was the difficulty in reusing drug information from existing sources. The primary external source we have used at this stage in DrOn's development is RxNorm, a standard drug terminology curated by the National Library of Medicine (NLM). To build DrOn, we (1) mined data from historical releases of RxNorm and (2) mapped many RxNorm entities to Chemical Entities of Biological Interest (ChEBI) classes, pulling relevant information from ChEBI while doing so. We built DrOn in a modular fashion to facilitate simpler extension and development of the ontology and to allow reasoning and construction to scale. Classes derived from each source are serialized in separate modules. For example, the classes in DrOn that are programmatically derived from RxNorm are stored in a separate module and subsumed by classes in a manually-curated, realist, upper-level module of DrOn with terms such as 'clinical drug role', 'tablet', 'capsule', etc. DrOn is a modular, extensible ontology of drug products, their ingredients, and their biological activity that avoids many of the fundamental flaws found in other, similar artifacts and meets the requirements of our comparative-effectiveness research use-case.

Design of a spheromak compressor driven by high explosives

International Nuclear Information System (INIS)

Henins, I.; Fernandez, J.C.; Jarboe, T.R.; Marsh, S.P.; Marklin, G.J.; Mayo, R.M.; Wysocki, F.J.

1990-01-01

High energy density spheromaks can be used to accelerate a thin section of the flux conserver wall to high velocities. The energy density of a spheromak, formed by conventional helicity injection into a flux conserver, can be increased by reducing the flux conserver volume after the spheromak is formed. A method of accomplishing this is by imploding one wall of the flux conserver with high explosives. The authors have embarked on a program to demonstrate that a spheromak can be used as an energy transfer medium, and that a velocity gain over high-explosive driven plate velocities can be achieved. To do this, a plasma gun helicity source that will inject a spheromak with suitable initial energy density and lifetime is needed. Also, an implodable flux conserver that remains intact and clean during the implosion must be developed. The flux conserver problem is probably the more challenging one, because very little experimental work has been done in the past on explosively driven metal plates into a high vacuum, with sizes and travel distances appropriate for their application. There are two necessary practical requirements for an explosive compression of a flux conserver. The first is that the imploding wall does not rupture. The second is that gasses or other debri are not ejected which could penetrate and poison the spheromak plasma, and thus reduce the spheromak lifetime below what is necessary to carry out the spheromak compression and the subsequent acceleration of the flyer plate. The authors have designed and fabricated a plasma gun to be used for injecting the initial spheromak plasma into the collapsible flux conserver

Influence of 45S5 Bioglass addition on microstructure and properties of ultrafine grained (Mg-4Y-5.5Dy-0.5Zr) alloy

Energy Technology Data Exchange (ETDEWEB)

Kowalski, K., E-mail: kamil.kowalski@put.poznan.pl [Institute of Materials Science and Engineering, Poznan University of Technology, Jana Pawla II 24, 61-138 Poznan (Poland); Jurczyk, M.U. [Division of Mother’s and Child’s Health, Poznan University of Medical Sciences, Polna 33, 60-535 Poznan (Poland); Wirstlein, P.K. [Department of Gynecology and Obstetrics, Division of Reproduction, Poznan University of Medical Sciences, Polna 33, 60-535 Poznan (Poland); Jakubowicz, J.; Jurczyk, M. [Institute of Materials Science and Engineering, Poznan University of Technology, Jana Pawla II 24, 61-138 Poznan (Poland)

2017-05-15

Highlights: • Ultrafine grained composites were formed by consolidating mechanically alloyed powders. • Mechanical properties were sensitive to the content of 45S5 Bioglass in Mg-4Y-5.5Dy-0.5Zr alloy. • Fluoride treated composites displayed superior corrosion resistance in Ringer solution. • Composites modified with MgF{sub 2} have a higher degree of biocompatibility in comparison with the unmodified reference material. - Abstract: Bulk samples of an ultrafine grained (Mg-4Y-5.5Dy-0.5Zr)-x wt% 45S5 Bioglass (x = 0, 5) and (Mg-4Y-5.5Dy-0.5Zr)-5 wt% 45S5 Bioglass-1 wt% Ag composites have been synthesized by consolidating mechanically alloyed powders. The influence of the chemical composition on the microstructure, mechanical properties and corrosion behavior of bulk composites were studied. The sintering of (Mg-4Y-5.5Dy-0.5Zr)-5 wt% 45S5 Bioglass powders led to the formation of a bulk composite with grain size of approx. 95 nm. The corrosion behavior of Mg-based composites before and after hydrofluoric acid treatment was also investigated. The ultrafine grained (Mg-4Y-5.5Dy-0.5Zr)-5 wt% 45S5 Bioglass composite was more corrosion resistant than the bulk Mg-4Y-5.5Dy-0.5Zr alloy after HF treatment. The in vitro biocompatibility of synthesized composites was evaluated and compared with microcrystalline magnesium. Magnesium, (Mg-4Y-5.5Dy-0.5Zr)-5 wt% 45S5 Bioglass and (Mg-4Y-5.5Dy-0.5Zr)-5 wt% 45S5 Bioglass-1 wt% Ag composites modified with MgF{sub 2} have a higher degree of biocompatibility in comparison with the unmodified reference material.

Design of equilibrium field control coil system of TPE-RX

Energy Technology Data Exchange (ETDEWEB)

Sato, F.; Hasegawa, M.; Yamane, M.; Oyabu, I.; Urata, K.; Kudough, F. [Mitsubishi Fusion Center, Chiyoda-ku, Tokyo (Japan); Minato, T.; Kiryu, A.; Takagi, S.; Kuno, K.; Sako, K. [Mitsubishi Electric Corp. (Japan). Energy and Industrial Systems Center; Hirano, Y.; Yagi, Y.; Shimada, T.; Sekine, S.; Sakakita, H. [Electrotechnical Lab. (Japan)

1998-07-01

The construction of TPE-RX reversed field pinch(RFP) machine at the Electrotechnical Laboratory (ETL) was complete at the end of 1997 and the coil system showed the expected performances on the test at the ETL site. In the reversed field pinch machine, the plasma is surrounded by a thick metal shell to maintain plasma equilibrium and to obtain plasma stability. We designed the coil system considering an error magnetic field which is generated by an iron core and the poloidal shell gap of the thick shell. This paper describes designs and the related studies of the equilibrium field control coil system of TPE-RX. (author)

Characteristics of a large reversed field pinch machine, TPE-RX

International Nuclear Information System (INIS)

Yagi, Y.; Shimada, T.; Hirano, Y.; Sekine, S.; Sakakita, H.; Koguchi, H.; Kiyama, S.; Maejima, Y.; Hirota, I.; Hayase, K.; Sato, Y.; Sugisaki, K.; Oyabu, I.; Hasegawa, M.; Yamane, M.; Sato, F.; Kuno, K.; Minato, T.; Kiryu, A.; Takagi, S.; Sako, K.; Kudough, F.; Urata, K.; Orita, J.; Kaguchi, H.; Sago, H.; Ue, K.

1998-01-01

Construction of a new, large reversed field pinch (RFP) machine called TPE-RX was complete at the end of 1997 as a successor of the previous TPE-1RM20 machine at the Electrotechnical Laboratory (ETL). RFP configuration has been successfully obtained in March 1998. The optimization of the operating condition and discharge cleaning of the wall are presently undergoing with the first physics experiments. This paper is the first report of TPE-RX especially on the goals, overall machine characteristics and the present status. Other papers accompanying with this one will present specific topics on the magnetic coil system and the vacuum vessel system. (author)

Design of equilibrium field control coil system of TPE-RX

International Nuclear Information System (INIS)

Sato, F.; Hasegawa, M.; Yamane, M.; Oyabu, I.; Urata, K.; Kudough, F.; Minato, T.; Kiryu, A.; Takagi, S.; Kuno, K.; Sako, K.

1998-01-01

The construction of TPE-RX reversed field pinch(RFP) machine at the Electrotechnical Laboratory (ETL) was complete at the end of 1997 and the coil system showed the expected performances on the test at the ETL site. In the reversed field pinch machine, the plasma is surrounded by a thick metal shell to maintain plasma equilibrium and to obtain plasma stability. We designed the coil system considering an error magnetic field which is generated by an iron core and the poloidal shell gap of the thick shell. This paper describes designs and the related studies of the equilibrium field control coil system of TPE-RX. (author)

Characteristics of a large reversed field pinch machine, TPE-RX

Energy Technology Data Exchange (ETDEWEB)

Yagi, Y.; Shimada, T.; Hirano, Y.; Sekine, S.; Sakakita, H.; Koguchi, H.; Kiyama, S.; Maejima, Y.; Hirota, I.; Hayase, K.; Sato, Y.; Sugisaki, K. [Electrotechnical Lab., Tsukuba-shi, Ibaraki (Japan); Oyabu, I.; Hasegawa, M.; Yamane, M.; Sato, F.; Kuno, K.; Minato, T.; Kiryu, A.; Takagi, S.; Sako, K. [Mitsubishi Electric Corp. (Japan); Kudough, F.; Urata, K.; Orita, J.; Kaguchi, H.; Sago, H.; Ue, K. [Mitsubishi Heavy Industries Ltd. (Japan)

1998-07-01

Construction of a new, large reversed field pinch (RFP) machine called TPE-RX was complete at the end of 1997 as a successor of the previous TPE-1RM20 machine at the Electrotechnical Laboratory (ETL). RFP configuration has been successfully obtained in March 1998. The optimization of the operating condition and discharge cleaning of the wall are presently undergoing with the first physics experiments. This paper is the first report of TPE-RX especially on the goals, overall machine characteristics and the present status. Other papers accompanying with this one will present specific topics on the magnetic coil system and the vacuum vessel system. (author)

One in Four Individuals of African-American Ancestry Harbors a 5.5kb Deletion at chromosome 11q13.1

Science.gov (United States)

Zainabadi, Kayvan; Jain, Anuja V.; Donovan, Frank X.; Elashoff, David; Rao, Nagesh P.; Murty, Vundavalli V.; Chandrasekharappa, Settara C.; Srivatsan, Eri S.

2014-01-01

Cloning and sequencing of 5.5kb deletion at chromosome 11q13.1 from the HeLa cells, tumorigenic hybrids and two fibroblast cell lines has revealed homologous recombination between AluSx and AluY resulting in the deletion of intervening sequences. Long-range PCR of the 5.5kb sequence in 494 normal lymphocyte samples showed heterozygous deletion in 28.3% of African- American ancestry samples but only in 4.8% of Caucasian samples (pdeletion occurs in 27% of YRI (Yoruba – West African) population but none in non-African populations. The HapMap analysis further identified strong linkage disequilibrium between 5 single nucleotide polymorphisms and the 5.5kb deletion in the people of African ancestry. Computational analysis of 175kb sequence surrounding the deletion site revealed enhanced flexibility, low thermodynamic stability, high repetitiveness, and stable stem-loop/hairpin secondary structures that are hallmarks of common fragile sites. PMID:24412158

Flutter Analysis of RX-420 Balistic Rocket Fin Involving Rigid Body Modes of Rocket Structures

Directory of Open Access Journals (Sweden)

Novi Andria

2013-03-01

Full Text Available Flutter is a phenomenon that has brought a catastrophic failure to the flight vehicle structure. In this experiment, flutter was analyzed for its symmetric and antisymmetric configuration to understand the effect of rocket rigid modes to the fin flutter characteristic. This research was also expected to find out the safety level of RX-420 structure design. The analysis was performed using half rocket model. Fin structure used in this research was a fin which has semispan 600 mm, thickness 12 mm, chord root 700 mm, chord tip 400 mm, made by Al 6061-T651, double spar configuration with skin thickness of 2 mm. Structural dynamics and flutter stability were analyzed using finite element software implemented on MSC. Nastran. The analysis shows that the antisymmetric flutter mode is more critical than symmetric flutter mode. At sea level altitude, antisymmetric flutter occurs at 6.4 Mach, and symmetric flutter occurs at 10.15 Mach. Compared to maximum speed of RX-420 which is 4.5 Mach at altitude 11 km or equivalent to 2.1 Mach at sea level, it can be concluded that the RX-420 structure design is safe, and flutter will not occur during flight.

An ICP AES method for determination of dysprosium and terbium in high purity yttrium oxide

International Nuclear Information System (INIS)

Rupawate, V.H.; Hareendran, K.N.; Roy, S.B.

2011-01-01

High purity yttrium finds interesting application in astronavigation, luminescence, nuclear energy and metallurgical industries. Most of these applications require yttrium oxide of highest purity. Consequently there is a need for production of high purity yttrium oxide. Separation and purification of yttrium from other rare earths is a challenging task due to their close chemical properties. Liquid-liquid extraction and ion exchange have been widely used in the production of yttrium oxide of highest purity. Determination of impurities, especially other rare earths, in ppm level is required for process development and chemical characterization of the high purity Y 2 O 3 . Many methods have been described in literature. However since the advent of ICP AES much work in this area has been carried out by this technique. This paper describes the work done for determination of dysprosium (Dy) and terbium (Tb) in yttrium oxide using a high resolution sequential ICP AES. Emission spectra of rare earth elements are very complex and due to this complexity it is important to select spectral interference free analyte lines for determination of rare earths in rare earth matrix. For the determination of Dy and Tb in Y 2 O 3 , sensitive lines of Dy and Tb are selected from the instrument wavelength table and spectral interference free emission lines for the determination is selected by scanning around the selected wavelengths using 5 g/L Y solution and 5 mg/L standard solutions of Dy and Tb prepared in 4% nitric acid. It is found 353.170 nm line of Dy and 350.917 nm line Tb is suitable for quantitative determination. The signal to background ratio increases with increase in matrix concentration, i.e. from 1 to 5 mg/L. The optimum forward power is determined and it is found to be 1100W for Dy and 1000W for Tb. The instrument is calibrated using matrix matched standards containing 5g/L of Y matrix. Samples are dissolved in nitric acid and Y concentration is maintained at 5g/L. Two

Research topics in explosives - a look at explosives behaviors

International Nuclear Information System (INIS)

Maienschein, J L

2014-01-01

The behaviors of explosives under many conditions - e.g., sensitivity to inadvertent reactions, explosion, detonation - are controlled by the chemical and physical properties of the explosive materials. Several properties are considered for a range of improvised and conventional explosives. Here I compare these properties across a wide range of explosives to develop an understanding of explosive behaviors. For improvised explosives, which are generally heterogeneous mixtures of ingredients, a range of studies is identified as needed to more fully understand their behavior and properties. For conventional explosives, which are generally comprised of crystalline explosive molecules held together with a binder, I identify key material properties that determine overall sensitivity, including the extremely safe behavior of Insensitive High Explosives, and discuss an approach to predicting the sensitivity or insensitivity of an explosive.

5,5-Dimethyl-2-methylseleno-1,3,2-dioxaphosphorinan-2-one

Directory of Open Access Journals (Sweden)

Grzegorz Cholewinski

2010-04-01

Full Text Available The title compound, C6H13O3PSe, was obtained in the reaction of 5,5-dimethyl-2-oxo-2-seleno-1,3,2-dioxaphosphorinane potassium salt with methyl iodide. The selenomethyl group is in the axial position in relation to the six-membered dioxaphosphorinane ring.

Near Infrared High Resolution Spectroscopy and Spectro-astrometry of Gas in Disks around Herbig Ae/Be Stars

OpenAIRE

Brittain, Sean D.; Najita, Joan R.; Carr, John S.

2015-01-01

In this review, we describe how high resolution near infrared spectroscopy and spectro-astrometry have been used to study the disks around Herbig~Ae/Be stars. We show how these tools can be used to identify signposts of planet formation and elucidate the mechanism by which Herbig Ae/Be stars accrete. We also highlight some of the artifacts that can complicate the interpretation of spectro-astrometric measurements and discuss best practices for mitigating these effects. We conclude with a brie...

16 CFR 5.55 - Conduct of investigation.

Science.gov (United States)

2010-01-01

... Commercial Practices FEDERAL TRADE COMMISSION ORGANIZATION, PROCEDURES AND RULES OF PRACTICE STANDARDS OF CONDUCT Disciplinary Actions Concerning Postemployment Conflict of Interest § 5.55 Conduct of... to part 2 of these rules. He may also recommend that the Commission issue compulsory process in...

A scalable synthesis of 5,5'-dibromo-2,2'-bipyridine and its stepwise functionalization via Stille couplings.

Science.gov (United States)

D'Souza, Daniel M; Leigh, David A; Papmeyer, Marcus; Woltering, Steffen L

2012-11-01

The synthesis of 5,5'-dibromo-2,2'-bipyridine and 5-bromo-2,2'-bipyridine, useful intermediates for elaboration into more complex ligands through metal-catalyzed coupling reactions, can be efficiently conducted on a multigram scale from inexpensive starting materials. The described procedure is reliably scalable and suitable for the synthesis of tens of grams of 5,5'-dibromo-2,2'-bipyridine. 5-Bromo-2,2'-bipyridine is produced as a minor product. The 5,5'-disubstituted-2,2'-bipyridine motif has excellent coordination properties and is a versatile building block for the synthesis of functional materials (including biodiagnostics, photovoltaics and organic light-emitting diodes) and complex molecular topologies (including catenanes and trefoil and pentafoil knots). The selective stepwise functionalization of 5,5'-dibromo-2,2'-bipyridine by consecutive Stille couplings is therefore illustrated and documented in detail. The synthesis of 5,5'-dibromo-2,2'-bipyridine takes 4-5 d: 1 d to prepare the key intermediate 2,2'-bipyridine dihydrobromide, 3 d for its reaction with bromine in a steel bomb reaction vessel and 8 h to isolate and purify the final product.

Characterization Of High Explosives Detonations Via Laser-Induced Plasmas

Energy Technology Data Exchange (ETDEWEB)

Villa-Aleman, E. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL)

2015-10-08

One objective of the Department of Energy’s National Security Administration is to develop technologies that can help the United States government to detect foreign nuclear weapons development activities. The realm of high explosive (HE) experiments is one of the key areas to assess the nuclear ambitions of a country. SRNL has participated in the collection of particulates from HE experiments and characterized the material with the purpose to correlate particulate matter with HE. Since these field campaigns are expensive, on-demand simulated laboratory-scale explosion experiments are needed to further our knowledge of the chemistry and particle formation in the process. Our goal is to develop an experimental test bed in the laboratory to test measurement concepts and correlate particle formation processes with the observables from the detonation fireball. The final objective is to use this knowledge to tailor our experimental setups in future field campaigns. The test bed uses pulsed laser-induced plasmas to simulate micro-explosions, with the intent to study the temporal behavior of the fireball observed in field tests. During FY15, a plan was prepared and executed which assembled two laser ablation systems, procured materials for study, and tested a Step-Scan Fourier Transform Infrared Spectrometer (SS-FTIR). Designs for a shadowgraph system for shock wave analysis, design for a micro-particulate collector from ablated pulse were accomplished. A novel spectroscopic system was conceived and a prototype system built for acquisition of spectral/temporal characterization of a high speed event such as from a high explosive detonation. Experiments and analyses will continue into FY16.

Study, analysis, assess and compare the nuclear engineering systems of nuclear power plant with different reactor types VVER-1000, namely AES-91, AES-92 and AES-2006

International Nuclear Information System (INIS)

Le Van Hong; Tran Chi Thanh; Hoang Minh Giang; Le Dai Dien; Nguyen Nhi Dien; Nguyen Minh Tuan

2015-01-01

On November 25, 2009, in Hanoi, the National Assembly had been approved the resolution about policy for investment of nuclear power project in Ninh Thuan province which include two sites, each site has two units with power around 1000 MWe. For the nuclear power project at Ninh Thuan 1, Vietnam Government signed the Joint-Governmental Agreement with Russian Government for building the nuclear power plant with reactor type VVER. At present time, the Russian Consultant proposed four reactor technologies can be used for Ninh Thuan 1 project, namely: AES-91, AES-92, AES-2006/V491 and AES-2006/V392M. This report presents the main reactor engineering systems of nuclear power plants with VVER-1000/1200. The results from analysis, comparison and assessment between the designs of AES-91, AES-92 and AES-2006 are also presented. The obtained results show that the type AES-2006 is appropriate selection for Vietnam. (author)

Characterization of laser-induced plasmas as a complement to high-explosive large-scale detonations

Directory of Open Access Journals (Sweden)

Clare Kimblin

2017-09-01

Full Text Available Experimental investigations into the characteristics of laser-induced plasmas indicate that LIBS provides a relatively inexpensive and easily replicable laboratory technique to isolate and measure reactions germane to understanding aspects of high-explosive detonations under controlled conditions. Spectral signatures and derived physical parameters following laser ablation of aluminum, graphite and laser-sparked air are examined as they relate to those observed following detonation of high explosives and as they relate to shocked air. Laser-induced breakdown spectroscopy (LIBS reliably correlates reactions involving atomic Al and aluminum monoxide (AlO with respect to both emission spectra and temperatures, as compared to small- and large-scale high-explosive detonations. Atomic Al and AlO resulting from laser ablation and a cited small-scale study, decay within ∼10-5 s, roughly 100 times faster than the Al and AlO decay rates (∼10-3 s observed following the large-scale detonation of an Al-encased explosive. Temperatures and species produced in laser-sparked air are compared to those produced with laser ablated graphite in air. With graphite present, CN is dominant relative to N2+. In studies where the height of the ablating laser’s focus was altered relative to the surface of the graphite substrate, CN concentration was found to decrease with laser focus below the graphite surface, indicating that laser intensity is a critical factor in the production of CN, via reactive nitrogen.

Multielement determination and speciation of major-to-trace elements in black tea leaves by ICP-AES and ICP-MS with the aid of size exclusion chromatography

International Nuclear Information System (INIS)

Matsuura, Hirotaka; Hokura, Akiko; Katsuki, Fumie; Itoh, Akihide; Haraguchi, Hiroki

2001-01-01

A multielement determination of major-to-trace elements in black tea leaves and their tea infusions was carried out by ICP-AES (inductively coupled plasma atomic emission spectrometry) and ICP-MS (inductively coupled plasma mass spectrometry). Tea infusions were prepared as usual tea beverage by brewing black tea leaves in boiling water for 5 min. About 40 elements in tea leaves and tea infusions could be determined over the wide concentration range in 8 orders of magnitude. The extraction efficiency of each element was estimated as the ratio of its concentration in tea infusions to that in tea leaves. From the experimental results for the extraction efficiencies, the elements in black tea leaves were classified into three characteristic groups: (i) highly-extractable elements (>55%): Na, K, Co, Ni, Rb, Cs and Tl, (ii) moderately-extractable elements (20-55%): Mg, Al, P, Mn and Zn, and (iii) poorly-extractable elements (<20%): Ca, Fe, Cu, Sr, Y, Zr, Mo, Sn, Ba and lanthanoid elements. Furthermore, speciation of major-to-trace elements in tea infusions was performed by using a combined system of size exclusion chromatography (SEC) and ICP-MS (or ICP-AES). As a result, many diverse elements were found to be present as complexes associated with large organic molecules in tea infusions. (author)

Simulation Study of Near-Surface Coupling of Nuclear Devices vs. Equivalent High-Explosive Charges

Energy Technology Data Exchange (ETDEWEB)

Fournier, Kevin B [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Walton, Otis R [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Benjamin, Russ [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Dunlop, William H [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)

2014-09-29

A computational study was performed to examine the differences in near-surface ground-waves and air-blast waves generated by high-explosive energy sources and those generated by much higher energy - density low - yield nuclear sources. The study examined the effect of explosive-source emplacement (i.e., height-of-burst, HOB, or depth-of-burial, DOB) over a range from depths of -35m to heights of 20m, for explosions with an explosive yield of 1-kt . The chemical explosive was modeled by a JWL equation-of-state model for a ~14m diameter sphere of ANFO (~1,200,000kg – 1 k t equivalent yield ), and the high-energy-density source was modeled as a one tonne (1000 kg) plasma of ‘Iron-gas’ (utilizing LLNL’s tabular equation-of-state database, LEOS) in a 2m diameter sphere, with a total internal-energy content equivalent to 1 k t . A consistent equivalent-yield coupling-factor approach was developed to compare the behavior of the two sources. The results indicate that the equivalent-yield coupling-factor for air-blasts from 1 k t ANFO explosions varies monotonically and continuously from a nearly perfec t reflected wave off of the ground surface for a HOB ≈ 20m, to a coupling factor of nearly zero at DOB ≈ -25m. The nuclear air - blast coupling curve, on the other hand, remained nearly equal to a perfectly reflected wave all the way down to HOB’s very near zero, and then quickly dropped to a value near zero for explosions with a DOB ≈ -10m. The near - surface ground - wave traveling horizontally out from the explosive source region to distances of 100’s of meters exhibited equivalent - yield coupling - factors t hat varied nearly linearly with HOB/DOB for the simulated ANFO explosive source, going from a value near zero at HOB ≈ 5m to nearly one at DOB ≈ -25m. The nuclear-source generated near-surface ground wave coupling-factor remained near zero for almost all HOB’s greater than zero, and then appeared to vary nearly - linearly with depth

Cy5.5 conjugated MnO nanoparticles for magnetic resonance/near-infrared fluorescence dual-modal imaging of brain gliomas.

Science.gov (United States)

Chen, Ning; Shao, Chen; Li, Shuai; Wang, Zihao; Qu, Yanming; Gu, Wei; Yu, Chunjiang; Ye, Ling

2015-11-01

The fusion of molecular and anatomical modalities facilitates more reliable and accurate detection of tumors. Herein, we prepared the PEG-Cy5.5 conjugated MnO nanoparticles (MnO-PEG-Cy5.5 NPs) with magnetic resonance (MR) and near-infrared fluorescence (NIRF) imaging modalities. The applicability of MnO-PEG-Cy5.5 NPs as a dual-modal (MR/NIRF) imaging nanoprobe for the detection of brain gliomas was investigated. In vivo MR contrast enhancement of the MnO-PEG-Cy5.5 nanoprobe in the tumor region was demonstrated. Meanwhile, whole-body NIRF imaging of glioma bearing nude mouse exhibited distinct tumor localization upon injection of MnO-PEG-Cy5.5 NPs. Moreover, ex vivo CLSM imaging of the brain slice hosting glioma indicated the preferential accumulation of MnO-PEG-Cy5.5 NPs in the glioma region. Our results therefore demonstrated the potential of MnO-PEG-Cy5.5 NPs as a dual-modal (MR/NIRF) imaging nanoprobe in improving the diagnostic efficacy by simultaneously providing anatomical information from deep inside the body and more sensitive information at the cellular level. Copyright © 2015 Elsevier Inc. All rights reserved.

Reactions of 5,5\\'-dithiobis(2-nitrobenzoate) with CysB5(23)β and ...

African Journals Online (AJOL)

The reactivities of the sulphydryl groups of duck minor hemoglobin have been studied for a comparison with those of duck major hemoglobin. Boyer titration with p-hydroxymercuri(II)benzoic acid (pMB) gave four reactive sulphydryl groups per (tetramer) molecule. Titration with 5,5'- dithiobis(2-nitrobenzoic acid) (DTNB) also ...

Synthesis and steriostructure of 5-(5-R-2- furfur lidene)- barbituric acid

International Nuclear Information System (INIS)

Abdel-Wahab, A.

2012-01-01

Heterocyclic compounds 5-(5-R-2-furfur lidene)- barbituric acid were obtained and their physical and chemical properties were studied. Their structures were identified by spectroscopic methods. This study proved by 1 H-NMR Spectroscopy data that these compounds exist in S-cis form. (author)

A New Structural-Differential Property of 5-Round AES

DEFF Research Database (Denmark)

Grassi, Lorenzo; Rechberger, Christian; Ronjom, Sondre

2017-01-01

AES is probably the most widely studied and used block cipher. Also versions with a reduced number of rounds are used as a building block in many cryptographic schemes, e.g. several candidates of the SHA-3 and CAESAR competition are based on it.So far, non-random properties which are independent ...... a random permutation with only 2 32 chosen texts that has a computational cost of 2(35.6) look-ups into memory of size 2 36 bytes which has a success probability greater than 99%....

Forensic Analysis of High Explosive Residues from Selected Cloth

International Nuclear Information System (INIS)

Mohamad Afiq Mohamed Huri; Umi Kalthom Ahmad

2014-01-01

Increased terrorist activities around the Asian region have resulted in the need for improved analytical techniques in forensic analysis. High explosive residues from post-blast clothing are often encountered as physical evidence submitted to a forensic laboratory. Therefore, this study was initiated to detect high explosives residues of cyclotrimethylenetrinitramine (RDX) and pentaerythritol tetranitrate (PETN) on selected cloth in this study. Cotton swabbing technique was employed as a simple and rapid method in recovering analytes from the sample matrix. Analytes were analyzed using Griess spot test, TLC and HPLC. TLC separation employed toluene-ethyl acetate (9:1) as a good solvent system. Reversed phase HPLC separation employed acetonitrile-water (65:35) as the mobile phase and analytes detected using a programmed wavelength. RDX was detected at 235 nm for the first 3.5 min and then switched to 215 nm for PETN. Limits of detection (LODs) of analytes were in the low ppm range (0.05 ppm for RDX and 0.25 ppm for PETN). Analyte recovery studies revealed that the type of cloth has a profound effect on the extraction efficiency. Analytes were recovered better for nylon as compared to cotton cloth. However, no analytes could be recovered from denim cloth. For post-blast samples, only RDX was detected in low concentration for both nylon and cotton cloth. (author)

Explosive material treatment in particular the explosive compaction of powders

International Nuclear Information System (INIS)

Pruemmer, R.

1985-01-01

The constructive use of explosives in the last decades has led to new procedures in manufacturing techniques. The most important of these are explosive forming and cladding, the latter especially for the production of compound materials. The method of explosive compaction has the highest potential for further innovation. Almost theoretical densities are achievable in the green compacts as the pressure released by detonating explosives are very high. Also, the production of new conditions of materials (metastable high pressure phases) is possible. (orig.) [de

Joint Improvised-Threat Defeat Agency Needs to Improve Assessment and Documentation of Counter-Improvised Explosive Device Initiatives (Redacted)

Science.gov (United States)

2016-08-09

E XC E L L E N C E Joint Improvised ‑Threat Defeat Agency Needs to Improve Assessment and Documentation of Counter‑ Improvised Explosive Device...USE ONLY DODIG-2016-120 (Project No. D2015-D000AE-0222.000) │ i Results in Brief Joint Improvised ‑Threat Defeat Agency Needs to Improve Assessment and...Documentation of Counter‑ Improvised Explosive Device Initiatives Visit us at www.dodig.mil Objective Our audit objective was to determine whether

High methane natural gas/air explosion characteristics in confined vessel.

Science.gov (United States)

Tang, Chenglong; Zhang, Shuang; Si, Zhanbo; Huang, Zuohua; Zhang, Kongming; Jin, Zebing

2014-08-15

The explosion characteristics of high methane fraction natural gas were investigated in a constant volume combustion vessel at different initial conditions. Results show that with the increase of initial pressure, the peak explosion pressure, the maximum rate of pressure rise increase due to a higher amount (mass) of flammable mixture, which delivers an increased amount of heat. The increased total flame duration and flame development time result as a consequence of the higher amount of flammable mixture. With the increase of the initial temperature, the peak explosion pressures decrease, but the pressure increase during combustion is accelerated, which indicates a faster flame speed and heat release rate. The maximum value of the explosion pressure, the maximum rate of pressure rise, the minimum total combustion duration and the minimum flame development time is observed when the equivalence ratio of the mixture is 1.1. Additionally, for higher methane fraction natural gas, the explosion pressure and the maximum rate of pressure rise are slightly decreased, while the combustion duration is postponed. The combustion phasing is empirically correlated with the experimental parameters with good fitting performance. Furthermore, the addition of dilute gas significantly reduces the explosion pressure, the maximum rate of pressure rise and postpones the flame development and this flame retarding effect of carbon dioxide is stronger than that of nitrogen. Copyright © 2014 Elsevier B.V. All rights reserved.

Evaluation of Radiology Teachers' Performance and Identification of the "Best Teachers" in a Residency Program: Mixed Methodology and Pilot Study of the MEDUC-RX32 Questionnaire.

Science.gov (United States)

Huete, Álvaro; Julio, Rodrigo; Rojas, Viviana; Herrera, Cristián; Padilla, Oslando; Solís, Nancy; Pizarro, Margarita; Etcheberry, Lorena; Sarfatis, Alberto; Pérez, Gonzalo; Díaz, Luis A; Delfino, Alejandro; Muñoz, Estrella; Rivera, Horacio; Parra, Dimitri A; Bitran, Marcela; Riquelme, Arnoldo

2016-07-01

Radiology teachers are well trained in their specialty; however, when working in academic institutions, faculty development and promotion through the education pathway tends to be based on their teaching knowledge and skills. The aim of this study is to assess psychometric properties of the Medicina Universidad Católica-Radiology 32 items (MEDUC-RX32), an instrument designed to evaluate the performance of postgraduate radiology teachers and to identify the best teachers. Mixed methodology was used, including qualitative and quantitative phases. The psychometric properties of the MEDUC-RX32 survey were performed by factor analysis (validity), Cronbach alpha coefficient, and G coefficient (reliability). The residents assessed their teachers and simultaneously voted for the "best teacher," which was used as a gold standard for the receiver operating characteristic curves construction comparing their votes with the global score. A total of 28 residents answered 164 surveys. The global score was 6.23 ± 0.8 (scale from 1 to 7). The factor analysis showed six domains of the resident's perception: (1) tutorial teaching, feedback, and independent learning; (2) communication and teamwork; (3) learning objectives; (4) respectful behavior; (5) radiological report; and (6) teaching and care support. The tutor's strengths were related with respectful behavior and teamwork. The instrument is highly reliable with a Cronbach alpha of 0.937 and a G coefficient of 0.831 (with a minimum of 8 residents). The MEDUC-RX32 instrument has a sensitivity of 91.7% and specificity of 83.3% to identify tutors as best teachers with at least one vote with an area under the receiver operating characteristic curve of 0.931 with a cutoff of 5.94. The MEDC-RX32 instrument is a multidimensional, valid, and highly reliable method to evaluate radiology teachers, identifying teachers with excellence in tutorial teaching in a postgraduate radiology program. Copyright © 2016 The Association of

Water-bearing explosive compositions

Energy Technology Data Exchange (ETDEWEB)

Gay, G M

1970-12-21

An explosive water-bearing composition, with high detonation velocity, comprises a mixture of (1) an inorganic oxidizer salt; (2) nitroglycerine; (3) nitrocellulose; (4) water; and (5) a water thickening agent. (11 claims)

Characterization of structures and novel magnetic response of Fe87.5Si7Al5.5 alloy processed by ball milling

International Nuclear Information System (INIS)

Duan, Yuping; Gu, Shuchao; Zhang, Zhonglun; Wen, Ming

2012-01-01

Highlights: ► The water atomized Fe 87.5 Si 7 Al 5.5 (Wt.%) alloy was processed by ball-milling. ► The microstructure and magnetic properties of alloy changed following milling. ► The powders milled for 10 h have the largest M s and strongest reflection loss. ► The permeability of the powders milled for 2 h is the largest. ► The charge exchange between Fe and Si is discussed base on first-principles. - Abstract: The water atomized Fe 87.5 Si 7 Al 5.5 (Wt.%) alloy was processed by a high-energy planetary ball-milling. The characterization of morphology, microstructure, and electromagnetic properties were measured by scanning electron microscope (SEM), X-ray diffractometer, vibrating sample magnetometer (VSM), vector network analyzer and the first principle method. The analysis results showed that the powders shape became flaky from fusiform. The powders showed a reduction of the average grain size and the increase of the internal strain, and then presented an adverse variation trend after 55 h milling. The powders that milled 10 h had the largest saturation magnetization M S (131 emu/g). The value μ′ of the powders decreased with increasing milling time at relatively lower frequency (2–8 GHz), but opposite variation tendency happened at higher frequency (8–18 GHz). Also, only short time milling can enhance the value of μ″ in the test frequency. The powders after 10 h milling showed excellent microwave absorption (RL < −10 dB) at the frequency 9.0–15.6 GHz and the absorption peak shifted regularly to the high frequency as the increased milling time. Furthermore, the effect of charge exchange between the Fe and Si on the saturation magnetization in the ball-milling process was also investigated by using density functional theory (DFT) of first principle.

Crystal structure of ferroelectric Bi{sub 2}VO{sub 5.5}

Energy Technology Data Exchange (ETDEWEB)

Sooryanarayana, K.; Guru Row, T.N.; Varma, K.B.R. [Indian Inst. of Science, Bangalore (India)

1997-12-01

The structure of the {alpha}-phase of bismuth vanadate Bi{sub 2}VO{sub 5.5} has been determined using single crystal X-ray diffraction data in the space group Aba2. The refinement involves a well defined disorder at the vanadium site, which incorporates the features of the superlattice structure with vanadium tetrahedra and oxygen-deficient octahedra that is displaced about the twofold axis.

An 8/15-channel Tx/Rx head neck RF coil combination with region-specific B1 + shimming for whole-brain MRI focused on the cerebellum at 7T.

Science.gov (United States)

Pfaffenrot, Viktor; Brunheim, Sascha; Rietsch, Stefan H G; Koopmans, Peter J; Ernst, Thomas M; Kraff, Oliver; Orzada, Stephan; Quick, Harald H

2018-02-09

To design and evaluate an 8/15-channel transmit/receive (Tx/Rx) head-neck RF coil combination with region-specific B1+ shimming for whole-brain MRI with focus on improved functional MRI of the cerebellum at 7 T. An 8-channel transceiver RF head coil was combined with a 7-channel receive-only array. The noise parameters and acceleration capabilities of this 8Tx/15Rx coil setup were compared with a commercially available 1Tx/32Rx RF head coil. Region-specific 8-channel B1+ shimming was applied when using the 8Tx/15Rx RF coil. To evaluate the capability for functional MRI of the cerebellum, temporal SNR and statistical nonparametric maps for finger-tapping experiments with 14 healthy subjects were derived by applying a variable slice thickness gradient-echo echo-planar functional MRI sequence. The 8Tx/15Rx setup had a lower maximum noise correlation between channels, but higher average correlations compared with the 1Tx/32Rx coil. Both RF coils exhibited identical g-factors in the cerebellum with R = 3 acceleration. The enlarged FOV of the 8Tx/15Rx coil in combination with region-specific B1+ shimming increased homogeneity of the transmission field and temporal SNR in caudal cerebellar regions. Temporal SNR losses in cranial parts were reduced, resulting in more highly significant voxels in the caudally activated areas and identical patterns in the cranial cerebellar parts during a finger-tapping task. Compared with the 1Tx/32Rx RF coil, the presented 8Tx/15Rx RF coil combination successfully improves functional MRI of the human cerebellum at 7 T while maintaining whole-brain coverage. A clear temporal SNR gain in caudal cerebellar regions is shown. © 2018 International Society for Magnetic Resonance in Medicine.

Control de criaderos de Aedes aegypti con el programa Recicla por tu bienestar en Mérida, México

Directory of Open Access Journals (Sweden)

Mario Barrera Pérez

2015-05-01

Full Text Available Objetivos. Determinar la importancia de los criaderos de Ae. aegypti en Mérida; evaluar el impacto del programa Recicla or tu bienestar (RxB sobre la presencia/abundancia de éstos y la percepción de los habitantes. Material y métodos. Se calculó la importancia de los criaderos por su productividad pupal. Se realizaron muestreos pre y post RxB en colonias para cuantificar el total de recipientes/criaderos. Se aplicó una encuesta a participantes sobre la percepción sobre RxB en colonias seleccionadas. Resultados. Los botes, cubetas y diversos objetos chicos fueron los criaderos más importantes. RxB tuvo un impacto significativo en la reducción del número de recipientes (IRR=0.74, en los recipientes positivos (IRR=0.33 y en la positividad de las viviendas para Ae. aegypti (OR=0.41. Todos los entrevistados opinaron que RxB es necesario la gran mayoría piensa que es útil. Conclusiones. RxB debe ser considerada una buena práctica para el control del vector del dengue.

The Potato Nucleotide-binding Leucine-rich Repeat (NLR) Immune Receptor Rx1 Is a Pathogen-dependent DNA-deforming Protein*

Science.gov (United States)

Fenyk, Stepan; Townsend, Philip D.; Dixon, Christopher H.; Spies, Gerhard B.; de San Eustaquio Campillo, Alba; Slootweg, Erik J.; Westerhof, Lotte B.; Gawehns, Fleur K. K.; Knight, Marc R.; Sharples, Gary J.; Goverse, Aska; Pålsson, Lars-Olof; Takken, Frank L. W.; Cann, Martin J.

2015-01-01

Plant nucleotide-binding leucine-rich repeat (NLR) proteins enable cells to respond to pathogen attack. Several NLRs act in the nucleus; however, conserved nuclear targets that support their role in immunity are unknown. Previously, we noted a structural homology between the nucleotide-binding domain of NLRs and DNA replication origin-binding Cdc6/Orc1 proteins. Here we show that the NB-ARC (nucleotide-binding, Apaf-1, R-proteins, and CED-4) domain of the Rx1 NLR of potato binds nucleic acids. Rx1 induces ATP-dependent bending and melting of DNA in vitro, dependent upon a functional P-loop. In situ full-length Rx1 binds nuclear DNA following activation by its cognate pathogen-derived effector protein, the coat protein of potato virus X. In line with its obligatory nucleocytoplasmic distribution, DNA binding was only observed when Rx1 was allowed to freely translocate between both compartments and was activated in the cytoplasm. Immune activation induced by an unrelated NLR-effector pair did not trigger an Rx1-DNA interaction. DNA binding is therefore not merely a consequence of immune activation. These data establish a role for DNA distortion in Rx1 immune signaling and define DNA as a molecular target of an activated NLR. PMID:26306038

Intrinsic defect processes and O migration in PrBa(Co/Fe)2O5.5

KAUST Repository

Salawu, Omotayo Akande

2016-02-10

© 2016 The Royal Society of Chemistry. New mixed ion-electron conductors are desired to lower the operating temperature of solid oxide fuel cells. The O Frenkel energy and migration of O ions in PrBa(Co/Fe)2O5.5 are studied for this purpose by density functional theory. The electronic structure and charge redistribution during defect formation are analyzed. We demonstrate that Co → Fe substitution strongly affects the formation of defects and consequently the O migration. The low O Frenkel energy points to a high concentration of O vacancies. The migration of the O ions shows a distinct anisotropy.

Point-Defect Mediated Bonding of Pt Clusters on (5,5) Carbon Nanotubes

DEFF Research Database (Denmark)

Wang, J. G.; Lv, Y. A.; Li, X. N.

2009-01-01

The adhesion of various sizes of Pt clusters on the metallic (5,5) carbon nanotubes (CNTs) with and without the point defect has been investigated by means of density functional theory (DFT). The calculations show that the binding energies of Pt-n (n = 1-6) clusters on the defect free CNTs are mo...

Impact of functional determinants on 5.5-year mortality in Amazon riparian elderly

Directory of Open Access Journals (Sweden)

Tiago C. Antonini

Full Text Available ABSTRACT Objective To ascertain whether modifiable physical performance–based measurements predicted 5.5-year mortality in a riparian elderly cohort in the Amazon rainforest region. Methods A longitudinal study evaluating the impact of functional determinants on 5.5-year mortality in a riparian elderly cohort from Maués City in the state of Amazonas, Brazil, was performed. The study was a follow-up of a previous observational investigation that evaluated various fitness tests in 630 Amazonian riparian elderly (291 males and 339 females aged 72.3 ± 8.0 (60–99 years old. The cohort was selected for its adverse environmental conditions, which increased the risk of falls yet required maintenance of good physical condition for carrying out relatively rigorous daily activities, and restricted access to specialized health services. Official death records were obtained from the Maués Municipal Health Department. Results A total of 80 study participants (12.7% died over the 5.5-year study period. Kaplan-Meier regression analysis showed significant association between Timed Up and Go (TUG test scores ≥ 14 seconds and mortality risk, independent of sex, age, and other health variables. Conclusions The study results suggest that the TUG test can be used as an indicator for initiating therapeutic and preventive actions, including conducting exercises or physical activities adapted to the health and functional conditions of the elderly, by identifying elderly people with a higher relative risk of mortality.

Understanding the shock and detonation response of high explosives at the continuum and meso scales

Science.gov (United States)

Handley, C. A.; Lambourn, B. D.; Whitworth, N. J.; James, H. R.; Belfield, W. J.

2018-03-01

The shock and detonation response of high explosives has been an active research topic for more than a century. In recent years, high quality data from experiments using embedded gauges and other diagnostic techniques have inspired the development of a range of new high-fidelity computer models for explosives. The experiments and models have led to new insights, both at the continuum scale applicable to most shock and detonation experiments, and at the mesoscale relevant to hotspots and burning within explosive microstructures. This article reviews the continuum and mesoscale models, and their application to explosive phenomena, gaining insights to aid future model development and improved understanding of the physics of shock initiation and detonation propagation. In particular, it is argued that "desensitization" and the effect of porosity on high explosives can both be explained by the combined effect of thermodynamics and hydrodynamics, rather than the traditional hotspot-based explanations linked to pressure-dependent reaction rates.

Assessing the economic impact of Rx-to-OTC switches: systematic review and guidelines for future development.

Science.gov (United States)

Cohen, J; Millier, A; Karray, S; Toumi, M

2013-01-01

Switching drugs from prescription to non-prescription status (Rx-to-OTC) presents a unique set of challenges and opportunities to policy-makers and the industry in terms of managing health outcomes, pharmaceutical spending, and steering of consumer choices of therapy. Decision-analytic models are used to address uncertainty and produce reasonable estimates of the economic impact of switches for payers. This article presents a critical literature review of existing models which assess the economic impact of Rx-to-OTC switches, and provides guidelines in which future economic evaluations of Rx-to-OTC switches could be improved. A comprehensive search strategy was implemented in Medline and Embase, to retrieve published economic evaluations on Rx-to-OTC switches from 1995-2010. The research digest of the International Society of Pharmacoeconomics and Outcomes Research (ISPOR) was reviewed for potentially relevant abstracts for the past 3 years. Each model used was critically evaluated in terms of structure, relevance of inputs, methodology used, and robustness of results. Worldwide, the economic impact of Rx-to-OTC switches has only been evaluated in a total of 12 peer-reviewed publications. Ten out of 12 studies were US-based, and two European-based. The models covered various disease categories, including allergy, hypercholesterolemia, gastroenterology, contraception, pulmonology, and virology. Seventy-five per cent of the models predicted cost savings for payers and patients. Limitations of the models mainly included use of strong assumptions and non-inclusion of specific populations due to lack of data. Guidelines were developed to help future model development. They cover structural issues on decision context, health states, and clinical outcomes, and other considerations for model specifications. Although reviewed studies lacked quality, this review of economic evidence of Rx-to-OTC switches suggests that switches may produce cost savings to public and private

Forensic analysis of explosive residues from hand swabs

International Nuclear Information System (INIS)

Umi Khairul Ahmad; Sumathy Rajendran; Syahidah Abu Hassan

2008-01-01

In the forensic examination of physical evidence for organic explosives, cotton swabs are often used to collect residue from surfaces, such as skin and post-blast debris. A preliminary study has been conducted to develop extraction method of a common energetic compound, pentaerythritol tetranitrate (PETN) from hand swabs followed by direct analysis of the resulting extract solution using high-performance liquid chromatography (HPLC) with ultraviolet (UV) detector. Analysis was performed on an octadecylsilane-based (C 18 ) column using acetonitrile-water mixture (55:45) as mobile phase. The mobile phase was pumped at 1.0 mL/ min and separation affected using an isocratic mode with the detection wavelength of 230 nm. The explosive residue was extracted from cotton swabs using acetone in an ultrasonic cold bath. The developed method was later applied to the real hand swabs samples, which were taken from three army personnel who handled PETN during a munition disposal operation at Asahan Camp Military Firing range. The acetone extract obtained using sonication method was found to be effective in recovering PETN from cotton swabs with relatively high recovery (89.5 %) and good sensitivity with detection limit as low as 2 ng. The content of PETN in the real hand swab samples were found to be in the range of 4.7-130 mg. (author)

The Novel Synthesis Route for 3-Poly (vinylbenzyl-5,5-Dimethylimidazolidine-2,4-dione Nanofibers and Study of Its Antibacterial Properties

Directory of Open Access Journals (Sweden)

Bozorgmehr Maddah

2016-01-01

Full Text Available As part of our ongoing interest in exploring the synthesis of antibacterial agent, we report an efficient, mild, one pot and chemoselective procedure for preparation of 3-poly (vinylbenzyl-5,5-dimethylimidazolidine-2,4-dione as a antimicrobial agent from poly(vinylbenzyl chloride and 5,5-dimethylhydantoin in the presence of a base in DMF as a solven. The FT-IR technique and melting point confirmed the desire product. Then, 3-poly (vinylbenzyl-5,5-dimethylimidazolidine-2,4-dione nanofibers was produced by electrospinning process. To confirm the nanofiber materials, SEM image was applied. Then, these nanofibers were, chlorinated with sodium hypochlorite. Finally, the antibacterial activity of synthesized nanofibers was evaluated by against Staphylococcus aureus as gram-positive bacteria and Escherichia coli as gram-negative bacteria. The results from culture media and halo diameters of nanofibers showed that high biocidal effect of fibers against these bacteria. These nanofibes could be used in order to construct filters needed to clean and disinfect drinking water in emergency.

Fabrication and study of stability of Ca{sub 2}AlWO{sub 5,5} ceramic in crude petroleum for applications in petroleum industry; Fabricacao e estudo da estabilidade em petroleo cru da ceramica Ca{sub 2}AlWO{sub 5,5} para aplicacao em industria petrolifera

Energy Technology Data Exchange (ETDEWEB)

Yadava, Y.P.; Silva, N.D.G.; Sousa, A.G. de; Sanguinetti Ferreira, R.A., E-mail: dea.a@hotmail.co [Universidade Federal de Pernambuco (UFPE), Recife, PE (Brazil). Dept. de Engenharia Mecanica

2010-07-01

Perovskite-type ceramic oxides or their derivatives are used for applications in high technology because of their enormous range of physic-chemical properties with little change in structural characteristics. In this paper we report manufacture ceramic components of a new ceramic Ca{sub 2}AlWO{sub 5,5} by thermo-mechanical process. Stoichiometric amounts of chemical constituents with high degree of purity, were homogenized using a ball mill and high purity alumina balls, compacted by uniaxial pressing and annealed at 1200 deg C for 48 hours. The structural characterization studied by x-ray diffraction that this material has a typical complex ordered cubic perovskite structure. For the study the stability of these ceramics in crude petroleum circular discs of 20 mm diameter and 2 mm thickness were produced and sintering. These discs were submerged in crude petroleum for 15, 30 and 45 days and were examined at each stage by X-ray diffraction, optical microscopy and hardness testing and these results show that Ca{sub 2}AlWO{sub 5,5} are stable in crude petroleum environment. (author)

Measuring the BNF of Soybean Using 15N-Labelled Urea with Different Atom Excess (A.E. Content

Directory of Open Access Journals (Sweden)

A. Citraresmini

2012-12-01

Full Text Available The soybean is a legume which has an ability to supply its major nitrogen need by the biological nitrogen fixation (BNF process. This process is made possible by nodules formed in their roots, colonized by Rhizobium sp.bacteria. An accurate estimation of N gained by BNF is necessary to predict the increase or decrease of chemical fertilizer-N requirements to increase soybean production. Among several methods, the 15N method was used to estimate the ability of legumes to perform BNF. The study involved soybean var. Willis (W and a completely non-BNF soybean var. CV, which is termed as a standard crop. The standard crop is non-nodulated soybean, but it has the same main physiological traits with var. Willis. The aim of this study was to determine whether15N-labelled fertilizer with different %a.e. given to nodulated and non-nodulated soybean would not be of significant consequences for the calculation of N-BNF of W. The treatments applied were different rates of urea (20 kg N/ha and 100 kg N/ha combined with different atom excess percentages (%a.e.15N (2% and 10%. Thus, the combination of treatments were as follows:(1 W-ll (20 kg N; 2% a.e; (2 CV-hl (100 kg N; 2% a.e; (3 W-lh (20 kg N; 10% a.e; (4 CV-hh (100 kg N; 10% a.e; (5 CV-ll (20 kg N; 2% a.e; (6 W-hl (100 kg N; 2% a.e; (7 CV-lh (20 kg N; 10% a.e; (8 W-hh (100 kg N; 10% a.e. The result of the experiment showed that a high %a.e. with a low rate of 15N and a low %a.e. with a high rate of N should be used to study the %N-BNF of nodulated plants.

Design and implementation of an ASIP-based cryptography processor for AES, IDEA, and MD5

OpenAIRE

Karim Shahbazi; Mohammad Eshghi; Reza Faghih Mirzaee

2017-01-01

In this paper, a new 32-bit ASIP-based crypto processor for AES, IDEA, and MD5 is designed. The instruction-set consists of both general purpose and specific instructions for the above cryptographic algorithms. The proposed architecture has nine function units and two data buses. It has also two types of 32-bit instruction formats for executing Memory Reference (M.R.), Register Reference (R.R.), and Input/Output Reference (I/O R.) instructions. The maximum achieved frequency is 166.916 MHz. T...

Pulmonary toxicity and kinetic study of Cy5.5-conjugated superparamagnetic iron oxide nanoparticles by optical imaging

International Nuclear Information System (INIS)

Cho, Wan-Seob; Cho, Minjung; Kim, Seoung Ryul; Choi, Mina; Lee, Jeong Yeon; Han, Beom Seok; Park, Sue Nie; Yu, Mi Kyung; Jon, Sangyong; Jeong, Jayoung

2009-01-01

Recent advances in the development of nanotechnology and devices now make it possible to accurately deliver drugs or genes to the lung. Magnetic nanoparticles can be used as contrast agents, thermal therapy for cancer, and be made to concentrate to target sites through an external magnetic field. However, these advantages may also become problematic when taking into account safety and toxicological factors. This study demonstrated the pulmonary toxicity and kinetic profile of anti-biofouling polymer coated, Cy5.5-conjugated thermally cross-linked superparamagnetic iron oxide nanoparticles (TCL-SPION) by optical imaging. Negatively charged, 36 nm-sized, Cy5.5-conjugated TCL-SPION was prepared for optical imaging probe. Cy5.5-conjugated TCL-SPION was intratracheally instilled into the lung by a non-surgical method. Cy5.5-conjugated TCL-SPION slightly induced pulmonary inflammation. The instilled nanoparticles were distributed mainly in the lung and excreted in the urine via glomerular filtration. Urinary excretion was peaked at 3 h after instillation. No toxicity was found under the concentration of 1.8 mg/kg and the half-lives of nanoparticles in the lung and urine were estimated to be about 14.4 ± 0.54 h and 24.7 ± 1.02 h, respectively. Although further studies are required, our results showed that Cy5.5-conjugated TCL-SPION can be a good candidate for use in pulmonary delivery vehicles and diagnostic probes.

Toepassing ICP-AES op het RIKILT

NARCIS (Netherlands)

Ruig, de W.G.

1980-01-01

Rapportage over de toepassing van ICP-AES op het RIKILT. Bij ICP-AES worden twee manieren van lichtemissie detectie toegepast nl. simultaan en sequentieel. De voor- en nadelen van ICP-AES t.o.v. AAS worden op een rij gezet.

Development of a high efficient conventional type cold neutron source using a non-explosive material

International Nuclear Information System (INIS)

Kiyanagi, Y.; Satoh, S.

1999-01-01

An efficient cold moderator that can be used easily at a small neutron source would be useful for neutron radiography, prompt gamma ray analysis and so on. Non-explosive materials are chosen for a cold moderator since explosive materials such as hydrogen and methane require a safety system. Neutronic performances of coupled moderators of various non-explosive materials are studied so as to develop such a cold moderator since the coupled moderator system is the best to obtain high intensity of cold neutrons. Effect of premoderator is studied and neutron spectra from methanol, ethanol, benzene, mesitylene and benzene methanol are measured around 20 K. The premoderator increased the cold neutron intensity by about 50∼70%. Methanol and mesitylene gave the highest cold neutron intensity. Effect of Be filter-reflector is also studied and a intensity gain of about 20% was obtained below about 5 MeV. (author)

A high-resolution spectropolarimetric survey of Herbig Ae/Be stars - II. Rotation

Science.gov (United States)

Alecian, E.; Wade, G. A.; Catala, C.; Grunhut, J. H.; Landstreet, J. D.; Böhm, T.; Folsom, C. P.; Marsden, S.

2013-02-01

We report the analysis of the rotational properties of our sample of Herbig Ae/Be (HAeBe) and related stars for which we have obtained high-resolution spectropolarimetric observations. Using the projected rotational velocities measured at the surface of the stars, we have calculated the angular momentum of the sample and plotted it as a function of age. We have then compared the angular momentum and the v sin i distributions of the magnetic to the non-magnetic HAeBe stars. Finally, we have predicted v sin i of the non-magnetic, non-binary (`normal') stars in our sample when they reach the zero-age main sequence (ZAMS), and compared them to various catalogues of v sin i of main-sequence stars. First, we observe that magnetic HAeBe stars are much slower rotators than normal stars, indicating that they have been more efficiently braked than the normal stars. In fact, the magnetic stars have already lost most of their angular momentum, despite their young ages (lower than 1 Myr for some of them). Secondly, our analysis suggests that the low-mass (1.5 5 M⊙) are losing angular momentum. We propose that winds, which are expected to be stronger in massive stars, are at the origin of this phenomenon.

Numerical simulation of the ionization effects of low- and high-altitude nuclear explosions

International Nuclear Information System (INIS)

Zhao Zhengyu; Wang Xiang

2007-01-01

Low-altitude and high-altitude nuclear explosions are sources of intensive additional ionization in ionosphere. In this paper, in terms of the ionization equilibrium equation system and the equation of energy deposition of radiation in atmosphere, and considering the influence of atmosphere, the temporal and spatial distribution of ionization effects caused by atmospheric nuclear detonation are investigated. The calculated results show that the maximum of additional free electron density produced by low-altitude nuclear explosion is greater than that by the high-altitude nuclear burst. As to the influence of instant nuclear radiation, there is obvious difference between the low-altitude and the high-altitude explosions. The influence range and the continuance time caused by delayed nuclear radiation is less for the low-altitude nuclear detonation than that for the high-altitude one. (authors)

The Potato Nucleotide-binding Leucine-rich Repeat (NLR) Immune Receptor Rx1 Is a Pathogen-dependent DNA-deforming Protein.

Science.gov (United States)

Fenyk, Stepan; Townsend, Philip D; Dixon, Christopher H; Spies, Gerhard B; de San Eustaquio Campillo, Alba; Slootweg, Erik J; Westerhof, Lotte B; Gawehns, Fleur K K; Knight, Marc R; Sharples, Gary J; Goverse, Aska; Pålsson, Lars-Olof; Takken, Frank L W; Cann, Martin J

2015-10-09

Plant nucleotide-binding leucine-rich repeat (NLR) proteins enable cells to respond to pathogen attack. Several NLRs act in the nucleus; however, conserved nuclear targets that support their role in immunity are unknown. Previously, we noted a structural homology between the nucleotide-binding domain of NLRs and DNA replication origin-binding Cdc6/Orc1 proteins. Here we show that the NB-ARC (nucleotide-binding, Apaf-1, R-proteins, and CED-4) domain of the Rx1 NLR of potato binds nucleic acids. Rx1 induces ATP-dependent bending and melting of DNA in vitro, dependent upon a functional P-loop. In situ full-length Rx1 binds nuclear DNA following activation by its cognate pathogen-derived effector protein, the coat protein of potato virus X. In line with its obligatory nucleocytoplasmic distribution, DNA binding was only observed when Rx1 was allowed to freely translocate between both compartments and was activated in the cytoplasm. Immune activation induced by an unrelated NLR-effector pair did not trigger an Rx1-DNA interaction. DNA binding is therefore not merely a consequence of immune activation. These data establish a role for DNA distortion in Rx1 immune signaling and define DNA as a molecular target of an activated NLR. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

Mineral distribution in rice: Measurement by Microwave Plasma Atomic Emission Spectroscopy (MP-AES)

International Nuclear Information System (INIS)

Ramos, Nerissa C.; Ramos, R.G.A.; Quirit, L.L.; Arcilla, C.A.

2015-01-01

Microwave Plasma Atomic Emission Spectroscopy (MP-AES) is a new technology with comparable performance and sensitivity to Inductively Coupled Plasma Optical Emission Spectroscopy (ICP-OES). Both instrument use plasma as the energy source that produces atomic and ionic emission lines. However, MP-AES uses nitrogen as the plasma gas instead of argon which is an additional expense for ICP-OES. Thus, MP-AES is more economical. This study quantified six essential minerals (Se, Zn, Fe, Cu, Mn and K) in rice using MP-AES. Hot plate digestion was used for sample extraction and the detection limit for each instrument was compared with respect to the requirement for routine analysis in rice. Black, red and non-pigmented rice samples were polished in various intervals to determine the concentration loss of minerals. The polishing time corresponds to the structure of the rice grains such as outer bran layer (0 to 15), inner bran layer (15 to 30), outer endosperm layer (30 to 45), and middle endosperm layer (45 to 60). Results of MP-AES analysis showed that black rice had all essential materials (except K) in high concentration at the outer bran layer. The red and non-pigmented rice samples on the other hand, contained high levels of Se, Zn, Fe, and Mn in the whole bran portion. After 25 seconds, the mineral concentrations remained constant. The concentration of Cu however, gave consistent value in all polishing intervals, hence Cu might be located in the inner endosperm layer. Results also showed that K was uniformly distributed in all samples where 5% loss was consistently observed for every polishing interval. Therefore, the concentration of K was also affected by polishing time. Thus, the new MP-AES technology with comparable performance to ICP-OES is a promising tool for routine analysis in rice. (author)

Genetic and physical mapping of homologues of the virus resistance gene Rx1 and the cyst nematode resistance gene Gpa2 in potato.

Science.gov (United States)

Bakker, E; Butterbach, P; Rouppe van der Voort, J; van der Vossen, E; van Vliet, J; Bakker, J; Goverse, A

2003-05-01

Nine resistance gene homologues (RGHs) were identified in two diploid potato clones (SH and RH), with a specific primer pair based on conserved motifs in the LRR domain of the potato cyst nematode resistance gene Gpa2 and the potato virus X resistance gene Rx1. A modified AFLP method was used to facilitate the genetic mapping of the RGHs in the four haplotypes under investigation. All nine RGHs appeared to be located in the Gpa2/ Rx1 cluster on chromosome XII. Construction of a physical map using bacterial artificial chromosome (BAC) clones for both the Solanum tuberosum ssp. tuberosum and the S. tuberosum ssp. andigena haplotype of SH showed that the RGHs are located within a stretch of less than 200 kb. Sequence analysis of the RGHs revealed that they are highly similar (93 to 95%) to Gpa2 and Rx1. The sequence identities among all RGHs range from 85 to 100%. Two pairs of RGHs are identical, or nearly so (100 and 99.9%), with each member located in a different genotype. Southern-blot analysis on genomic DNA revealed no evidence for additional homologues outside the Gpa2/ Rx1 cluster on chromosome XII.

Fabrication and study of stability of Ca2AlWO5,5 ceramic in crude petroleum for applications in petroleum industry

International Nuclear Information System (INIS)

Yadava, Y.P.; Silva, N.D.G.; Sousa, A.G. de; Sanguinetti Ferreira, R.A.

2010-01-01

Perovskite-type ceramic oxides or their derivatives are used for applications in high technology because of their enormous range of physic-chemical properties with little change in structural characteristics. In this paper we report manufacture ceramic components of a new ceramic Ca 2 AlWO 5,5 by thermo-mechanical process. Stoichiometric amounts of chemical constituents with high degree of purity, were homogenized using a ball mill and high purity alumina balls, compacted by uniaxial pressing and annealed at 1200 deg C for 48 hours. The structural characterization studied by x-ray diffraction that this material has a typical complex ordered cubic perovskite structure. For the study the stability of these ceramics in crude petroleum circular discs of 20 mm diameter and 2 mm thickness were produced and sintering. These discs were submerged in crude petroleum for 15, 30 and 45 days and were examined at each stage by X-ray diffraction, optical microscopy and hardness testing and these results show that Ca 2 AlWO 5,5 are stable in crude petroleum environment. (author)

The cause of high-intensity long-duration continuous AE activity (HILDCAAS): interplanetary Alfven wave trains

International Nuclear Information System (INIS)

Tsurutani, B.T.; Gonzalez, W.D.

1987-01-01

It is shown that high intensity (AE > 1,000 nT), long duration (T > 2 d) continuous auroral activity (HILDCAA) events are caused by outward (from the sun) propagating interplanetary Alfven wave trains. The Alfven waves are often (but not always) detected several days after major interplanetary events, such as shocks and solar wind density enhancements. Presumably magnetic reconnection between the southward components of the Alfven wave magnetic fields and magnetospheric fields is the mechanism for transfer of solar wind energy to the magnetosphere. If the stringent requirements for HILDCAA events are relaxed, there are many more AE events of this type. A brief inspection indicates that these are also related to interplanetary Alfvenic fluctuations. We therefore suggest that most auroral activity may be caused by reconnection associated with Alfven waves in the interplanetary medium. (author)

High explosive spot test analyses of samples from Operable Unit (OU) 1111

Energy Technology Data Exchange (ETDEWEB)

McRae, D.; Haywood, W.; Powell, J.; Harris, B.

1995-01-01

A preliminary evaluation has been completed of environmental contaminants at selected sites within the Group DX-10 (formally Group M-7) area. Soil samples taken from specific locations at this detonator facility were analyzed for harmful metals and screened for explosives. A sanitary outflow, a burn pit, a pentaerythritol tetranitrate (PETN) production outflow field, an active firing chamber, an inactive firing chamber, and a leach field were sampled. Energy dispersive x-ray fluorescence (EDXRF) was used to obtain semi-quantitative concentrations of metals in the soil. Two field spot-test kits for explosives were used to assess the presence of energetic materials in the soil and in items found at the areas tested. PETN is the major explosive in detonators manufactured and destroyed at Los Alamos. No measurable amounts of PETN or other explosives were detected in the soil, but items taken from the burn area and a high-energy explosive (HE)/chemical sump were contaminated. The concentrations of lead, mercury, and uranium are given.

Temperament in infancy and behavioral and emotional problems at age 5.5: The EDEN mother-child cohort.

Directory of Open Access Journals (Sweden)

Xian Abulizi

Full Text Available Early temperamental characteristics may influence children's developmental pathways and predict future psychopathology. However, the environmental context may also shape or interact with infant temperament and indirectly contribute to increased vulnerability to adverse developmental outcomes. The aim of the present study is to explore the long-term contribution of temperamental traits at twelve months of age to the presence of emotional and behavioral problems later in childhood, and whether this association varies with the child's sex, parental separation, family socioeconomic status and maternal depression.1184 mother-child pairs from the EDEN mother-child birth cohort study based in France (2003-2011, were followed from 24-28 weeks of pregnancy to the child's fifth birthday. Infant temperament at 12 months was assessed with the Emotionality Activity and Sociability (EAS questionnaire and behavior at 5.5 years was assessed with the Strengths and Difficulties Questionnaire (SDQ.Emotional temperament in infancy predicts children's overall behavioral scores (β = 1.16, p<0.001, emotional difficulties (β = 0.30, p<0.001, conduct problems (β = 0.51, p<0.001 and symptoms of hyperactivity/inattention (β = 0.31, p = 0.01 at 5.5 years. Infants' active temperament predicts later conduct problems (β = 0.30, p = 0.02, while shyness predicts later emotional problems (β = 0.22, p = 0.04. The association between the child's temperament in infancy and later behavior did not vary with children's own or family characteristics.An emotional temperament in infancy is associated with higher levels of emotional and behavioral difficulties at the age of 5.5 years. Children who show high emotionality early on may require early prevention and intervention efforts to divert possible adverse developmental pathways.

Biclique cryptanalysis of the full AES

DEFF Research Database (Denmark)

Bogdanov, Andrey; Khovratovich, Dmitry; Rechberger, Christian

2011-01-01

Since Rijndael was chosen as the Advanced Encryption Standard (AES), improving upon 7-round attacks on the 128-bit key variant (out of 10 rounds) or upon 8-round attacks on the 192/256-bit key variants (out of 12/14 rounds) has been one of the most difficult challenges in the cryptanalysis of block...... ciphers for more than a decade. In this paper, we present the novel technique of block cipher cryptanalysis with bicliques, which leads to the following results: The first key recovery method for the full AES-128 with computational complexity 2126.1. The first key recovery method for the full AES-192...... with computational complexity 2189.7. The first key recovery method for the full AES-256 with computational complexity 2254.4. Key recovery methods with lower complexity for the reduced-round versions of AES not considered before, including cryptanalysis of 8-round AES-128 with complexity 2124.9. Preimage search...

O vacancy formation in (Pr/Gd)BaCo2O5.5 and the role of antisite defects

KAUST Repository

Omotayo Akande, Salawu; Chroneos, Alexander; Schwingenschlö gl, Udo

2017-01-01

that O vacancy formation is significantly easier in PrBaCo2O5.5 than in GdBaCo2O5.5, the difference in formation energy being hardly modified by antisite defects. While pyramidally coordinated Co atoms are not affected, we show that the presence

THE HIGH-METALLICITY EXPLOSION ENVIRONMENT OF THE RELATIVISTIC SUPERNOVA 2009bb

International Nuclear Information System (INIS)

Levesque, E. M.; Kewley, L. J.; Soderberg, A. M.; Foley, R. J.; Berger, E.; Torres, M. A. P.; Challis, P.; Kirshner, R. P.; Copete, A.; Chakraborti, S.; Ray, A.; Barthelmy, S. D.; Bietenholz, M. F.; Chandra, P.; Chaplin, V.; Connaughton, V.; Chevalier, R. A.; Fox, O.; Chugai, N.; Fransson, C.

2010-01-01

We investigate the environment of the nearby (d ∼ 40 Mpc) broad-lined Type Ic supernova (SN) 2009bb. This event was observed to produce a relativistic outflow likely powered by a central accreting compact object. While such a phenomenon was previously observed only in long-duration gamma-ray bursts (LGRBs), no LGRB was detected in association with SN 2009bb. Using an optical spectrum of the SN 2009bb explosion site, we determine a variety of interstellar medium properties for the host environment, including metallicity, young stellar population age, and star formation rate. We compare the SN explosion site properties to observations of LGRB and broad-lined SN Ic host environments on optical emission line ratio diagnostic diagrams. Based on these analyses, we find that the SN 2009bb explosion site has a metallicity between 1.7 Z sun and 3.5 Z sun , in agreement with other broad-lined SN Ic host environments and at odds with the low-redshift LGRB host environments and recently proposed maximum metallicity limits for relativistic explosions. We consider the implications of these findings and the impact that SN 2009bb's unusual explosive properties and environment have on our understanding of the key physical ingredient that enables some SNe to produce a relativistic outflow.

Electron stimulated carbon adsorption in ultra high vacuum monitored by Auger Electron Spectroscopy (AES)

CERN Document Server

Scheuerlein, C

2001-01-01

Electron stimulated carbon adsorption at room temperature (RT) has been studied in the context of radiation induced surface modifications in the vacuum system of particle accelerators. The stimulated carbon adsorption was monitored by AES during continuous irradiation by 2.5 keV electrons and simultaneous exposure of the sample surface to CO, CO2 or CH4. The amount of adsorbed carbon was estimated by measuring the carbon Auger peak intensity as a function of the electron irradiation time. Investigated substrate materials are technical OFE copper and TiZrV non-evaporable getter (NEG) thin film coatings, which are saturated either in air or by CO exposure inside the Auger electron spectrometer. On the copper substrate electron induced carbon adsorption from gas phase CO and CO2 is below the detection limit of AES. During electron irradiation of the non-activated TiZrV getter thin films, electron stimulated carbon adsorption from gas phase molecules is detected when either CO or CO2 is injected, whereas the CH4 ...

The sodium channel activator Lu AE98134 normalizes the altered firing properties of fast spiking interneurons in Dlx5/6+/- mice

DEFF Research Database (Denmark)

von Schoubye, Nadia Lybøl; Frederiksen, Kristen; Kristiansen, Uffe

2018-01-01

Mental disorders such as schizophrenia are associated with impaired firing properties of fast spiking inhibitory interneurons (FSINs) causing reduced task-evoked gamma-oscillation in prefrontal cortex. The voltage-gated sodium channel NaV1.1 is highly expressed in PV-positive interneurons, but only...... at low levels in principal cells. Positive modulators of Nav1.1 channels are for this reason considered potential candidates for the treatment of cognitive disorders. Here we examined the effect of the novel positive modulator of voltage-gated sodium channels Lu AE98134. We found that Lu AE98134...... facilitated the sodium current mediated by NaV1.1 expressed in HEK cells by shifting its activation to more negative values, decreasing its inactivation kinetics and promoting a persistent inward current. In a slice preparation from the brain of adult mice, Lu AE98134 promoted the excitability of fast spiking...

Steam explosion pretreatment of softwood: the effect of the explosive decompression on enzymatic digestibility.

Science.gov (United States)

Pielhop, Thomas; Amgarten, Janick; von Rohr, Philipp Rudolf; Studer, Michael H

2016-01-01

Steam explosion pretreatment has been examined in many studies for enhancing the enzymatic digestibility of lignocellulosic biomass and is currently the most common pretreatment method in commercial biorefineries. The information available about the effect of the explosive decompression on the biochemical conversion is, however, very limited, and no studies prove that the latter is actually enhanced by the explosion. Hence, it is of great value to discern between the effect of the explosion on the one hand and the steaming on the other hand, to identify their particular influences on enzymatic digestibility. The effect of the explosive decompression in the steam explosion pretreatment of spruce wood chips on their enzymatic cellulose digestibility was studied systematically. The explosion had a high influence on digestibility, improving it by up to 90 % compared to a steam pretreatment without explosion. Two factors were identified to be essentially responsible for the effect of the explosion on enzymatic digestibility: pretreatment severity and pressure difference of the explosion. A higher pretreatment severity can soften up and weaken the lignocellulose structure more, so that the explosion can better break up the biomass and decrease its particle size, which enhances its digestibility. In particular, increasing the pressure difference of the explosion leads to more defibration, a smaller particle size and a better digestibility. Though differences were found in the micro- and nanostructure of exploded and non-exploded biomass, the only influence of the explosion on digestibility was found to be the macroscopic particle size reduction. Steam explosion treatments with a high severity and a high pressure difference of the explosion lead to a comparatively high cellulose digestibility of the-typically very recalcitrant-softwood biomass. This is the first study to show that explosion can enhance the enzymatic digestibility of lignocellulosic biomass. If the

Systematic study of spin crossover and structure in [Co(terpyRX)2](Y)2 systems (terpyRX = 4'-alkoxy-2,2':6',2''-terpyridine, X = 4, 8, 12, Y = BF4(-), ClO4(-), PF6(-), BPh4(-))

DEFF Research Database (Denmark)

Nielsen, Pia; Nielsen, Hans Toftlund; Bond, Andrew

2009-01-01

A family of spin crossover cobalt(II) complexes of the type [Co(terpyRX)(2)](Y)(2) x nH(2)O (X = 4, 8, 12 and Y = BF(4)(-), ClO(4)(-), PF(6)(-), BPh(4)(-)) has been synthesized, whereby the alkyl chain length, RX, and counteranion, Y, have been systematically varied. The structural (single crystal...

Synthesis of Racemic β-Chamigrene, a Spiro[5.5]undecane Sequiterpene

Directory of Open Access Journals (Sweden)

Simen Antonsen

2014-12-01

Full Text Available The present paper describes a total synthesis of racemic β-chamigrene (1, a sesquiterpene with a spiro[5.5]undecane carbon framework. Compared with previously reported β-chamigrene syntheses, we were able to reduce the total number of reaction steps, which also resulted in a significant improvement of the overall yield. The commercially available ketone 6-methylhept-5-en-2-one was transformed by known simple procedures into 3,3-dimethyl-2-methylenecyclohexanone. This reacted with isoprene by a Diels-Alder reaction to give a spiro ketone. An olefination reaction on this compound gave the target molecule.

Equalization method for Medipix3RX

Energy Technology Data Exchange (ETDEWEB)

Rinkel, Jean, E-mail: jean.rinkel@lnls.br [Brazilian Synchrotron Light Laboratory (LNLS/CNPEM), Rua Giuseppe Máximo Scolfaro, 10.000, Caixa Postal 6192, 13083-970 Campinas, SP (Brazil); Magalhães, Debora; Wagner, Franz [Brazilian Synchrotron Light Laboratory (LNLS/CNPEM), Rua Giuseppe Máximo Scolfaro, 10.000, Caixa Postal 6192, 13083-970 Campinas, SP (Brazil); Frojdh, Erik; Ballabriga Sune, Rafael [CERN, Route de Meyrin 385, Geneva (Switzerland)

2015-11-21

This paper describes a new method of threshold equalization for X-ray detectors based on the Medipix3RX ASIC, using electrical pulses to calibrate and correct for the threshold dispersion between pixels. This method involves a coarse threshold tuning, based on two 8 bits global DACs and which sets the range of variation of the threshold values; and a fine-tuning, based on two 5-bits adjustment DACs per pixel. As our fine-tuning approach is based on a state-of-the-art methodology, our coarse tuning relies on an original theoretical model. This model takes into account the noise level of the ASIC, which varies with temperature and received radiation dose. The experimental results using 300 μm Si sensor and Kα fluorescence of Zn show a global energy resolution improvement of 14% compared to previous equalization methods. We compared these results with the best achievable global energy resolution given by the resolution of individual pixels and concluded that the remaining 14% difference was due to the discretization error limited by the number of equalization bits.

Equalization method for Medipix3RX

CERN Document Server

Rinkel, Jean; Wagner, Franz; Frojdh, Erik; Ballabriga Sune, Rafael

2015-01-01

This paper describes a new method of threshold equalization for X-ray detectors based on the Medipix3RX ASIC, using electrical pulses to calibrate and correct for the threshold dispersion between pixels. This method involves a coarse threshold tuning, based on two 8 bits global DACs and which sets the range of variation of the threshold values; and a fine-tuning, based on two 5-bits adjustment DACs per pixel. As our fine-tuning approach is based on a state-of-the-art methodology, our coarse tuning relies on an original theoretical model. This model takes into account the noise level of the ASIC, which varies with temperature and received radiation dose. The experimental results using 300 μm Si sensor and Kα fluorescence of Zn show a global energy resolution improvement of 14% compared to previous equalization methods. We compared these results with the best achievable global energy resolution given by the resolution of individual pixels and concluded that the remaining 14% difference was due to the discreti...

Alpha-Actinin-3 (ACTN3 R/X Gene Polymorphism and Physical Performance of Multi-Ethnic Malaysian Population

Directory of Open Access Journals (Sweden)

Hazwani Ahmad Yusof

2016-09-01

Full Text Available A disparity population data set in the current literature with limited reports among Asian samples and the inconsistent findings among different ethnic groups warrant further investigation on the association between alpha-actinin-3 (ACTN3 R/X gene polymorphism and human physical performance in Asian population. This study was designed to examine the association between ACTN3 R/X gene polymorphism and physical performance of multi-ethnic Malaysian population. One hundred eighty well-trained athletes (34 endurance, 41 strength, and 105 intermittent and 180 controls were drawn from four ethnic groups in Malaysia (Malay, Chinese, Indian, and Other Bumiputra. A sample of deoxyribonucleic acid (DNA was retrieved from a buccal swab from each participant and the ACTN3 R/X genotype was identified through polymerase chain reaction and restriction fragment length polymorphism analysis. The strength and endurance performances of the athletes were evaluated with maximal voluntary contraction and Yo-Yo intermittent recovery level 2 tests, respectively. The independent t-test, chi-square, multivariate, and one-way analysis of variance were used for data analysis. ACTN3 R/X alleles (p = 0.672 and genotype (p = 0.355 frequencies did not vary much between the multi-ethnic groups of Malaysian athletes. These small variations did not have any influence on handgrip strength (p = 0.334, leg strength (p = 0.256, and Yo-Yo intermittent recovery level 2 performance (p = 0.425 between these ethnic groups. The RR and XX genotypes were more frequent among strength and intermittent athletes, respectively. Athletes with the RR genotype had greater handgrip than those with the RX genotype (p = 0.031, but not different from athletes with the XX genotype (p = 0.228. Athletes with RR genotype also have a higher leg strength than those with the RX (p = 0.001 and XX genotype (p = 0.010. However, the endurance performance was similar among genotype groups (p = 0.385. The ACTN3 R/X

Strategies for the disposition of high explosives resulting from dismantlement of nuclear weapons

International Nuclear Information System (INIS)

Pruneda, C.; Humphrey, J.

1993-03-01

Many thousands of pounds of high quality main-charge explosives will result as surplus from the dismantlement of returns from the US nuclear weapons stockpile. The method most often employed for dealing with this surplus explosive is destruction by open burning. However, open burning as a means of treating excess explosives is losing favor because of environmental concerns associated with such an uncontrolled thermal destruction process. Thus, alternative processes for treatment of excess explosives from weapon dismantlement is discussed. These alternatives include: reformulation, crystalline component recovery, chemical conversion of the crystalline component to higher value products which may have civilian or military applications and, when necessary, treatment as waste in an environmentally benign fashion

On the polarization of Herbig Ae/Be star radiation

Energy Technology Data Exchange (ETDEWEB)

Petrova, N I; Shevchenko, V S

1987-08-01

Results of multicolor UBVRI polarimetry of 14 Herbig Ae/Be stars including 7 stars for which observations of polarization have been made for the first time are presented. 6 bright Herbig Ae/Be stars (As 441, AS 442, LK H..cap alpha..134, LK H..cap alpha..135, Lk H..cap alpha..169 and V517 Cyg) which belong to star formation region connected with IC 5070 show the polarization from 1 to 4.5. per cent with similar theta (approx. 180 deg) (basically of interstellar nature). The polarimetrical variability of BD+46 deg 3471, BD+65 deg 1637, HD 200775 and Lk H..cap alpha..234 is confirmed. Mechanismes of polarization in Herbig Ae/Be stars in circumstellar formations are discussed.

Techno-economical study of biogas production improved by steam explosion pretreatment.

Science.gov (United States)

Shafiei, Marzieh; Kabir, Maryam M; Zilouei, Hamid; Sárvári Horváth, Ilona; Karimi, Keikhosro

2013-11-01

Economic feasibility of steam explosion pretreatment for improvement of biogas production from wheat straw and paper tube residuals was investigated. The process was simulated by Aspen plus ®, and the economical feasibility of five different plant capacities was studied by Aspen Process Economic Analyzer. Total project investment of a plant using paper tube residuals or wheat straw was 63.9 or 61.8 million Euros, respectively. The manufacturing cost of raw biogas for these two feedstocks was calculated to 0.36 or 0.48 €/m(3) of methane, respectively. Applying steam explosion pretreatment resulted in 13% higher total capital investment while significantly improved the economy of the biogas plant and decreased the manufacturing cost of methane by 36%. The sensitivity analysis showed that 5% improvement in the methane yield and 20% decrease in the raw material price resulted in 5.5% and 8% decrease in the manufacturing cost of methane, respectively. Copyright © 2013 Elsevier Ltd. All rights reserved.

Comparisons between simulation and measurements taken with the Medipix3RX detector

Science.gov (United States)

McGrath, J.; Marchal, J.; Plackett, R.; Horswell, I.; Omar, D.; Gimenez, E. N.; Tartoni, N.

2014-05-01

A simulation toolkit developed for use at Diamond Light Source is presented, accompanied with experimental validation using a silicon pixel-array sensor coupled to a Medipix3RX chip controlled via the Merlin Readout System. The simulation makes use of Geant4, where photons are tracked in order to determine their position of interaction and energy deposition. Further to this, a Finite Element Methods package, Comsol, is used to model the Charge Induction Efficiencies of various sensors. Results are coupled to Geant4 simulations to provide an accurate method for computing the signals generated on each pixel within the sensor and then an algorithm to model the front-end electronics of the device. The validity of the simulation toolkit is tested by investigating charge-sharing effects using a Medipix3RX chip bump-bonded to a silicon pixel-array sensor. The dependence of the imaging parameters, on the energy threshold, is presented from both simulation and experiment for the Medipix3RX chip operated with and without the charge sharing compensation circuitry enabled. This simulation toolkit can be used to calculate image quality parameters for the next generation of detectors, including CdTe, as well as to improve data corrections on existing detectors on synchrotron beamlines.

Comparisons between simulation and measurements taken with the Medipix3RX detector

International Nuclear Information System (INIS)

McGrath, J; Marchal, J; Plackett, R; Horswell, I; Omar, D; Gimenez, E N; Tartoni, N

2014-01-01

A simulation toolkit developed for use at Diamond Light Source is presented, accompanied with experimental validation using a silicon pixel-array sensor coupled to a Medipix3RX chip controlled via the Merlin Readout System. The simulation makes use of Geant4, where photons are tracked in order to determine their position of interaction and energy deposition. Further to this, a Finite Element Methods package, Comsol, is used to model the Charge Induction Efficiencies of various sensors. Results are coupled to Geant4 simulations to provide an accurate method for computing the signals generated on each pixel within the sensor and then an algorithm to model the front-end electronics of the device. The validity of the simulation toolkit is tested by investigating charge-sharing effects using a Medipix3RX chip bump-bonded to a silicon pixel-array sensor. The dependence of the imaging parameters, on the energy threshold, is presented from both simulation and experiment for the Medipix3RX chip operated with and without the charge sharing compensation circuitry enabled. This simulation toolkit can be used to calculate image quality parameters for the next generation of detectors, including CdTe, as well as to improve data corrections on existing detectors on synchrotron beamlines

Optical detection of explosives: spectral signatures for the explosive bouquet

Science.gov (United States)

Osborn, Tabetha; Kaimal, Sindhu; Causey, Jason; Burns, William; Reeve, Scott

2009-05-01

Research with canines suggests that sniffer dogs alert not on the odor from a pure explosive, but rather on a set of far more volatile species present in an explosive as impurities. Following the explosive trained canine example, we have begun examining the vapor signatures for many of these volatile impurities utilizing high resolution spectroscopic techniques in several molecular fingerprint regions. Here we will describe some of these high resolution measurements and discuss strategies for selecting useful spectral signature regions for individual molecular markers of interest.

AE Test of Calcareous Sands with Particle Rushing

Directory of Open Access Journals (Sweden)

Tan Fengyi

2017-08-01

Full Text Available The particle of calcareous sands was forced to crush, then the energy from the crushing was released by the form of sound waves. Therefore the AE technique was used to detect the calcareous sands AE signal when it crushed. by to study the AE characteristics, the mechanics of calcareous sands was studied. Study showed that: (1 there was the AE activities on the low confining pressure condition at the beginnig of test, (2 there was more and more AE activities with the continuing of test until to the end, (3 the calcareous sands’ AE activities was on the whole testing, (4 the calcareous sands’ particle crushing and mutual friction played different roles for its AE activities. Then the AE model based on the calcarous sands’ particle crushing was discussed.

Expression of Aspergillus niger N5-5 in E. coli and purification and identification of products.

Science.gov (United States)

Zhang, Shuai; Cao, Yong; Cheng, Hao

2017-12-01

Due to the feature of high hydrolysis, tannase is widely used in food, beverage, brewing and other fields. However, high cost in producing natural tannase makes it difficult to apply tannase to industry in a large-scale. Microbial expression systems can be used for preparing numerous amount of enzyme at low cost, so in this paper Aspergillus niger N5-5 was expressed using E. coli system. Specific primers were designed based on the Aspergillus niger N5-5 sequence N3 (GenBank, No.: KP677552), and tannase gene tan was promoted to carry 6 His tag and enzyme cutting site which contains NdeI/HindIII using PCR amplification. Then, tannase gene tan was connected to expression vector by NdeI/HindIII enzyme cutting. In this way, recombinant expression vector tan -pET43.1a was formed. Then, the expression vector pET43.1a by NdeI/HindIII enzyme cutting was transformed into E. coli BL21 (DE3) to induce expression of Aspergillus niger N5-5. When the induced fungi were disrupted by the ultrasonic wave, the crude enzyme was extracted and purified by using the IMAC, and then the activity of the crude enzyme and pure enzyme was determined. According to the results of determination of the tannase activity, the tannase activity of the crude enzyme was greatly improved after the crude enzyme was purified, and the specific activity of the pure enzyme was about 8 times of that of the crude enzyme. The results of SDS-PAGE of the pure enzyme showed that the molecular mass of the pure enzyme was about 65 kDa/64-65 kDa, which was consistent with the expected result (64.2 kDa), It can be concluded that the crude enzyme solution was purified successfully. The results of pure enzyme's protein identification by Western Blotting showed that clear protein bands pro -3 were observed. Molecular mass of clear protein bands pro-3 was about 65 kDa, which was in line with the expected results (64.2 kDa). It can be seen that the aforementioned expression protein could be specifically combined

THE HOST GALAXY OF THE SUPER-LUMINOUS SN 2010gx AND LIMITS ON EXPLOSIVE 56Ni PRODUCTION

International Nuclear Information System (INIS)

Chen, Ting-Wan; Smartt, Stephen J.; Kotak, Rubina; McCrum, Matt; Fraser, Morgan; Bresolin, Fabio; Kudritzki, Rolf-Peter; Pastorello, Andrea; Valenti, Stefano

2013-01-01

Super-luminous supernovae have a tendency to occur in faint host galaxies which are likely to have low mass and low metallicity. While these extremely luminous explosions have been observed from z = 0.1 to 1.55, the closest explosions allow more detailed investigations of their host galaxies. We present a detailed analysis of the host galaxy of SN 2010gx (z = 0.23), one of the best studied super-luminous type Ic supernovae. The host is a dwarf galaxy (M g = –17.42 ± 0.17) with a high specific star formation rate. It has a remarkably low metallicity of 12 + log (O/H) = 7.5 ± 0.1 dex as determined from the detection of the [O III] λ4363 line. This is the first reliable metallicity determination of a super-luminous stripped-envelope supernova host. We collected deep multi-epoch imaging with Gemini + GMOS between 240 and 560 days after explosion to search for any sign of radioactive 56 Ni, which might provide further insights on the explosion mechanism and the progenitor's nature. We reach griz magnitudes of m AB ∼ 26, but do not detect SN 2010gx at these epochs. The limit implies that any 56 Ni production was similar to or below that of SN 1998bw (a luminous type Ic SN that produced around 0.4 M ☉ of 56 Ni). The low volumetric rates of these supernovae (∼10 –4 of the core-collapse population) could be qualitatively matched if the explosion mechanism requires a combination of low-metallicity (below 0.2 Z ☉ ), high progenitor mass (>60 M ☉ ) and high rotation rate (fastest 10% of rotators).

Novel high-fidelity realistic explosion damage simulation for urban environments

Science.gov (United States)

Liu, Xiaoqing; Yadegar, Jacob; Zhu, Youding; Raju, Chaitanya; Bhagavathula, Jaya

2010-04-01

Realistic building damage simulation has a significant impact in modern modeling and simulation systems especially in diverse panoply of military and civil applications where these simulation systems are widely used for personnel training, critical mission planning, disaster management, etc. Realistic building damage simulation should incorporate accurate physics-based explosion models, rubble generation, rubble flyout, and interactions between flying rubble and their surrounding entities. However, none of the existing building damage simulation systems sufficiently faithfully realize the criteria of realism required for effective military applications. In this paper, we present a novel physics-based high-fidelity and runtime efficient explosion simulation system to realistically simulate destruction to buildings. In the proposed system, a family of novel blast models is applied to accurately and realistically simulate explosions based on static and/or dynamic detonation conditions. The system also takes account of rubble pile formation and applies a generic and scalable multi-component based object representation to describe scene entities and highly scalable agent-subsumption architecture and scheduler to schedule clusters of sequential and parallel events. The proposed system utilizes a highly efficient and scalable tetrahedral decomposition approach to realistically simulate rubble formation. Experimental results demonstrate that the proposed system has the capability to realistically simulate rubble generation, rubble flyout and their primary and secondary impacts on surrounding objects including buildings, constructions, vehicles and pedestrians in clusters of sequential and parallel damage events.

High-intensity, long-duration, continuous AE activity events associated with Alfvénic fluctuations in 2003

Science.gov (United States)

Prestes, Alan; Klausner, Virginia; Ojeda-González, Arian

2017-11-01

The interaction between a fast-speed and a low-speed stream causes large-amplitude Alfvénic fluctuations; consequently, the intermittency and the brief intervals of southward magnetic field associated with Alfvén waves may cause high levels of AE activity, the so-called high-intensity, long-duration, continuous AE activity (HILDCAA). In this article, the 4 h windowed Pearson cross-correlation (4WPCC) between the solar wind velocity and the interplanetary magnetic field (IMF) components is performed in order to confirm that the less strict HILDCAA (HILDCAAs*) events include a larger number of Alfvén waves than the HILDCAA events, once HILDCAAs disregard part of the phenomenon. Actually, a HILDCAA event is entirely contained within a HILDCAA* event. However, the opposite is not necessarily true. This article provides a new insight, since the increase of Alfvén waves results in an increase of auroral electrojet activity; consequently, it can cause HILDCAAs* events. Another important aspect of this article is that the superposed epoch analysis (SEA) results reaffirm that the HILDCAAs* are associated with high-speed solar streams (HSSs), and also the HILDCAAs* present the same physical characteristics of the traditional HILDCAA events.

Explosive magnetic flux compression plate generators as fast high-energy power sources

International Nuclear Information System (INIS)

Caird, R.S.; Erickson, D.J.; Garn, W.B.; Fowler, C.M.

1976-01-01

A type of explosive driven generator, called a plate generator, is described. It is capable of delivering electrical energies in the MJ range at TW power levels. Plane wave detonated explosive systems accelerate two large-area metal plates to high opposing velocities. An initial magnetic field is compressed and the flux transferred to an external load. The characteristics of the plate generator are described and compared with those of other types of generators. Methods of load matching are discussed. The results of several high-power experiments are also given

Genome-Wide Identification and Expression Analysis of the UGlcAE Gene Family in Tomato

Directory of Open Access Journals (Sweden)

Xing Ding

2018-05-01

Full Text Available The UGlcAE has the capability of interconverting UDP-d-galacturonic acid and UDP-d-glucuronic acid, and UDP-d-galacturonic acid is an activated precursor for the synthesis of pectins in plants. In this study, we identified nine UGlcAE protein-encoding genes in tomato. The nine UGlcAE genes that were distributed on eight chromosomes in tomato, and the corresponding proteins contained one or two trans-membrane domains. The phylogenetic analysis showed that SlUGlcAE genes could be divided into seven groups, designated UGlcAE1 to UGlcAE6, of which the UGlcAE2 were classified into two groups. Expression profile analysis revealed that the SlUGlcAE genes display diverse expression patterns in various tomato tissues. Selective pressure analysis indicated that all of the amino acid sites of SlUGlcAE proteins are undergoing purifying selection. Fifteen stress-, hormone-, and development-related elements were identified in the upstream regions (0.5 kb of these SlUGlcAE genes. Furthermore, we investigated the expression patterns of SlUGlcAE genes in response to three hormones (indole-3-acetic acid (IAA, gibberellin (GA, and salicylic acid (SA. We detected firmness, pectin contents, and expression levels of UGlcAE family genes during the development of tomato fruit. Here, we systematically summarize the general characteristics of the SlUGlcAE genes in tomato, which could provide a basis for further function studies of tomato UGlcAE genes.

Numerical Simulation for Frictional Loss and Local Loss of a 5*5 SMART Rod Bundle

International Nuclear Information System (INIS)

Park, Jong-Pil; Kim, Seong Jin; Kwon, Hyuk; Seo, Kyong-Won; Hwang, Dae-Hyun

2014-01-01

The results showed good agreement with experimental data and/or reasonable values. However, these results were dependent on computational meshes and turbulence models and it still remains important issues in CFD analysis. The aim of present work is to assess the pressure drop in a 5*5 SMART rod bundle using 3D CFD code with various computational meshes and turbulence models. In the present work, 3D CFD code was utilized to investigate pressure drop in a SMART 5*5 rod bundle. The predicted pressure drop was strongly dependent with computational meshes and turbulence models. Based on CFD results in this study, least five of six meshes within the subchannel gap are required to get reliable result which is insensitive to the number of meshes. The friction factor predicted by k - ε model is good agreement with McAdams's correlation while SST model overestimate McAdams's correlation. However, it is difficult to judge performance of turbulence model because of lock of experimental data for a 5*5 SMART bare rod bundle. For nominal condition (Re-194,000) of SMART, SST model predict k-factor of MV and IFM grid as 1.304 and 0.748, respectively. This value is reasonable as compared with designed k-factor, 1.320 and 0.78

INFRARED SPECTROSCOPY OF SYMBIOTIC STARS. VIII. ORBITS FOR THREE S-TYPE SYSTEMS: AE ARAE, Y CORONAE AUSTRALIS, AND SS 73-147

International Nuclear Information System (INIS)

Fekel, Francis C.; Hinkle, Kenneth H.; Joyce, Richard R.; Wood, Peter R.

2010-01-01

With new infrared radial velocities we have computed orbits of the M giants in three southern S-type symbiotic systems. AE Ara and SS 73-147 have circular orbits with periods of 803 and 820 days, respectively. The eccentric orbit of Y CrA has a period that is about twice as long, 1619 days. Except for CH Cyg it is currently the S-type symbiotic system with the longest period for which a spectroscopic orbit has been determined. The Paschen δ emission line velocities of AE Ara are nearly in antiphase with the M giant absorption feature velocities and result in a mass ratio of 2.7. Emission lines in the 1.005 μm region for the other two symbiotic systems are not good proxies for the hot components in those systems. There is no evidence that these three symbiotics are eclipsing. With spectral classes of M5.5 or M6, the three giants presumably also have velocity variations that result from pulsations, but we have been unable to identify specific pulsation periods in the absorption line velocity residuals.

AES in deficit on Georgian trade

International Nuclear Information System (INIS)

TREND

2003-01-01

According to Vedomosti journal Russian state energy company RAO JES Rossii paid for Georgian assets acquisition to American company AES only 23 million USD, what is less than a tenth of sum which AES had originally paid for it. Thus total transaction value including debts reached 80 millions USD. But internal documents of American AES confirm that Americans paid 260 millions USD for Georgian assets and they took besides over 60 millions USD of obligations. Russians bought Georgian AES assets through Finnish filial Nordic Oy. Thus they obtained 75 per cent share in Telasi company which operates distributive network in Tbilisi, two blocks of plant in Tbilisi and half share in AES-Transenergy company which exports electric energy from Georgia to Turkey. RAO JES besides got managerial laws on Hramesi company which owns two water plants. Russian company controls one fifth of production and 35 per cent of electric energy sale in Georgia by these assets

Research Amplitudo Vibration On Holder Due To The Process Of Lathe Nozzle Rocket RX 450

Science.gov (United States)

Ediwan; Budi Djatmiko, Agus; Dody Arisandi, EfFendy; Purnomo, Heri; Ibadi, Mahfud

2018-04-01

The main function of the rocket nozzle is to convert the enthalpy efficiency from combustion gas to kinetic energy and also to make high velocity out of the gas. The rocket nozzle usually consists of a converging and diverging part. With a smaller area on the neck and enlarged at the exit area. The velocity flow through the nozzle enlarges into the speed of sound through the neck and then becomes super sonic in the divergent part. Nozzle making or machining using conventional lathes, first performed is drilling on a massive metal that is bonded to the veneer, then after a sufficient gap is done deep-boring. At the time of the process of lathe in the nozzle RX 450 there is an obstacle that is vibrating tool holder chisel or holder so it is worried about not precision of the process of lathe. This should not happen because it can cause failure in the latter for it needs to be studied and studied further so that the lathe process goes accordingly. The holder material of ST 60 with a modulus of elasticity 200 GPa and a nozzle material of AISI 4340 alloy steel with σyield = 470 MPa, Shear Modulus G = 80 GPa. The purpose of this research is to observe the amplitude of vibration on the holder due to RX- 450 nozzle lathe processing for the purpose of amplitude that occurs in accordance with the desired so that the nozzle structure is no damage process. The result of the research was obtained holder with length (L) 80cm, profile width (B) 5 cm, height of profile (H) 10 cm, turning machine ω = 8.98 rad / sec and natural holder frequency ωn = 89.8 rad / second, Amplitude of vibration of δ = 1.21 mm, while the amplitude of the design X = 1.22 mm From the results of this study it can be said that the holder of a chisel or holder can be used as a tool at the time of RX nozzle retrieval process and is quite safe because it works under the condition ω/ω n Rocket Payload "AKPV Engineering University of Wyoming 2009 )

Analysis of the characteristics of AE wave using boring core of sedimentary soft rock and study on the field measurement of AE for the evaluation of EDZ (Joint research)

International Nuclear Information System (INIS)

Aoki, Kenji; Mito, Yoshitada; Minami, Masayuki; Matsui, Hiroya; Niunoya, Sumio

2007-09-01

To understand the size and state of EDZ accurately is one of the key issues in the technological development for geological disposal of High-Level Radioactive Waste. As one of these evaluation technologies, AE which is measured directly and evaluates EDZ is paid to attention inside and outside the country, and the utility is reported for the crystalline rock. However, there are few cases to apply AE in sedimentary soft rocks to EDZ evaluation because of the difficulty to measure a few AE waves with small energy. In this study, the authors made a series of laboratory tests including tri-axial test using the stiff and servo-controlled testing machine in order to clarify the possibility to measure AE waves in Neogene siliceous rocks in Horonobe, Hokkaido, Japan (2005). The authors conducted the high stiffness tri-axial compression tests with AE measurements. And, the authors extracted an effective AE parameter to the evaluation of EDZ in the neogene (2005). The authors evaluated the mechanism of EDZ, which assumed from the result in occurrence of crack in the rock by measurement system and DEM analysis, by using the effective parameter (2006). In the EDZ examination which is planned since the second stage, the authors constructed a concept of the necessary measurement and evaluation system (2007). (author)

H.E.S.S. observations of RX J1713.7-3946 with improved angular and spectral resolution: Evidence for gamma-ray emission extending beyond the X-ray emitting shell

Science.gov (United States)

H. E. S. S. Collaboration; Abdalla, H.; Abramowski, A.; Aharonian, F.; Benkhali, F. Ait; Akhperjanian, A. G.; Andersson, T.; Angüner, E. O.; Arrieta, M.; Aubert, P.; Backes, M.; Balzer, A.; Barnard, M.; Becherini, Y.; Tjus, J. Becker; Berge, D.; Bernhard, S.; Bernlöhr, K.; Blackwell, R.; Böttcher, M.; Boisson, C.; Bolmont, J.; Bordas, P.; Bregeon, J.; Brun, F.; Brun, P.; Bryan, M.; Bulik, T.; Capasso, M.; Carr, J.; Casanova, S.; Cerruti, M.; Chakraborty, N.; Chalme-Calvet, R.; Chaves, R. C. G.; Chen, A.; Chevalier, J.; Chrétien, M.; Colafrancesco, S.; Cologna, G.; Condon, B.; Conrad, J.; Cui, Y.; Davids, I. D.; Decock, J.; Degrange, B.; Deil, C.; Devin, J.; deWilt, P.; Dirson, L.; Djannati-Ataï, A.; Domainko, W.; Donath, A.; Drury, L. O.'C.; Dubus, G.; Dutson, K.; Dyks, J.; Edwards, T.; Egberts, K.; Eger, P.; Ernenwein, J.-P.; Eschbach, S.; Farnier, C.; Fegan, S.; Fernandes, M. V.; Fiasson, A.; Fontaine, G.; Förster, A.; Fukuyama, T.; Funk, S.; Füßling, M.; Gabici, S.; Gajdus, M.; Gallant, Y. A.; Garrigoux, T.; Giavitto, G.; Giebels, B.; Glicenstein, J. F.; Gottschall, D.; Goyal, A.; Grondin, M.-H.; Hadasch, D.; Hahn, J.; Haupt, M.; Hawkes, J.; Heinzelmann, G.; Henri, G.; Hermann, G.; Hervet, O.; Hinton, J. A.; Hofmann, W.; Hoischen, C.; Holler, M.; Horns, D.; Ivascenko, A.; Jacholkowska, A.; Jamrozy, M.; Janiak, M.; Jankowsky, D.; Jankowsky, F.; Jingo, M.; Jogler, T.; Jouvin, L.; Jung-Richardt, I.; Kastendieck, M. A.; Katarzyński, K.; Katz, U.; Kerszberg, D.; Khélifi, B.; Kieffer, M.; King, J.; Klepser, S.; Klochkov, D.; Kluźniak, W.; Kolitzus, D.; Komin, Nu.; Kosack, K.; Krakau, S.; Kraus, M.; Krayzel, F.; Krüger, P. P.; Laffon, H.; Lamanna, G.; Lau, J.; Lees, J.-P.; Lefaucheur, J.; Lefranc, V.; Lemière, A.; Lemoine-Goumard, M.; Lenain, J.-P.; Leser, E.; Lohse, T.; Lorentz, M.; Liu, R.; López-Coto, R.; Lypova, I.; Marandon, V.; Marcowith, A.; Mariaud, C.; Marx, R.; Maurin, G.; Maxted, N.; Mayer, M.; Meintjes, P. J.; Meyer, M.; Mitchell, A. M. W.; Moderski, R.; Mohamed, M.; Mohrmann, L.; Morå, K.; Moulin, E.; Murach, T.; Naurois, M. de; Niederwanger, F.; Niemiec, J.; Oakes, L.; O'Brien, P.; Odaka, H.; Öttl, S.; Ohm, S.; Ostrowski, M.; Oya, I.; Padovani, M.; Panter, M.; Parsons, R. D.; Pekeur, N. W.; Pelletier, G.; Perennes, C.; Petrucci, P.-O.; Peyaud, B.; Piel, Q.; Pita, S.; Poon, H.; Prokhorov, D.; Prokoph, H.; Pühlhofer, G.; Punch, M.; Quirrenbach, A.; Raab, S.; Reimer, A.; Reimer, O.; Renaud, M.; los Reyes, R. de; Rieger, F.; Romoli, C.; Rosier-Lees, S.; Rowell, G.; Rudak, B.; Rulten, C. B.; Sahakian, V.; Salek, D.; Sanchez, D. A.; Santangelo, A.; Sasaki, M.; Schlickeiser, R.; Schüssler, F.; Schulz, A.; Schwanke, U.; Schwemmer, S.; Settimo, M.; Seyffert, A. S.; Shafi, N.; Shilon, I.; Simoni, R.; Sol, H.; Spanier, F.; Spengler, G.; Spies, F.; Stawarz, Ł.; Steenkamp, R.; Stegmann, C.; Stinzing, F.; Stycz, K.; Sushch, I.; Takahashi, T.; Tavernet, J.-P.; Tavernier, T.; Taylor, A. M.; Terrier, R.; Tibaldo, L.; Tiziani, D.; Tluczykont, M.; Trichard, C.; Tuffs, R.; Uchiyama, Y.; van der Walt, D. J.; Eldik, C. van; Rensburg, C. van; Soelen, B. van; Vasileiadis, G.; Veh, J.; Venter, C.; Viana, A.; Vincent, P.; Vink, J.; Voisin, F.; Völk, H. J.; Volpe, F.; Vuillaume, T.; Wadiasingh, Z.; Wagner, S. J.; Wagner, P.; Wagner, R. M.; White, R.; Wierzcholska, A.; Willmann, P.; Wörnlein, A.; Wouters, D.; Yang, R.; Zabalza, V.; Zaborov, D.; Zacharias, M.; Zdziarski, A. A.; Zech, A.; Zefi, F.; Ziegler, A.; Żywucka, N.

2018-04-01

Supernova remnants exhibit shock fronts (shells) that can accelerate charged particles up to very high energies. In the past decade, measurements of a handful of shell-type supernova remnants in very high-energy gamma rays have provided unique insights into the acceleration process. Among those objects, RX J1713.7-3946 (also known as G347.3-0.5) has the largest surface brightness, allowing us in the past to perform the most comprehensive study of morphology and spatially resolved spectra of any such very high-energy gamma-ray source. Here we present extensive new H.E.S.S. measurements of RX J1713.7-3946, almost doubling the observation time compared to our previous publication. Combined with new improved analysis tools, the previous sensitivity is more than doubled. The H.E.S.S. angular resolution of 0.048° (0.036° above 2 TeV) is unprecedented in gamma-ray astronomy and probes physical scales of 0.8 (0.6) parsec at the remnant's location. The new H.E.S.S. image of RX J1713.7-3946 allows us to reveal clear morphological differences between X-rays and gamma rays. In particular, for the outer edge of the brightest shell region, we find the first ever indication for particles in the process of leaving the acceleration shock region. By studying the broadband energy spectrum, we furthermore extract properties of the parent particle populations, providing new input to the discussion of the leptonic or hadronic nature of the gamma-ray emission mechanism. All images (FITS files) are available at the CDS via anonymous ftp to http://cdsarc.u-strasbg.fr (http://130.79.128.5) or via http://cdsarc.u-strasbg.fr/viz-bin/qcat?J/A+A/612/A6

Stereoselective synthesis of diazaspiro[5.5]undecane derivatives via base promoted [5+1] double Michael addition of N,N-dimethylbarbituric acid to diaryliedene acetones

Directory of Open Access Journals (Sweden)

Mohammad Shahidul Islam

2017-01-01

Full Text Available The nitrogen containing spiro-heterocycle is one of the privileged synthetic motif that constitutes various naturally occurring molecules and displays a broad range of pharmaceutical and biological activities. A new methodology was developed for the synthesis of 2,4-diazaspiro[5.5]undecane-1,3,5,9-tetraones spiro-heterocyclic derivatives via cascade cyclization of [5+1] double Michael addition reaction of N,N-dimethylbarbituric acid with the derivatives of diaryldivinylketones in the presence of diethylamine at ambient temperature. The developed protocol is highly capable of furnishing diazaspiro[5.5]undecane derivatives 3a–m in excellent yields (up to 98%, from easily accessible symmetric and non-symmetric divinylketones 2a–m, containing aryl and heteroaryl substituents. The diazaspiro-heterocyclic structure was mainly elucidated by NMR and X-ray crystallographic techniques. The single-crystal X-ray studies revealed that, the cyclohexanone unit of spirocycles often prefers a chair conformation rather than twisted conformation. The intermolecular hydrogen bonding and CArH⋯π, π–π stacking interactions driving forces are mainly responsible for the crystal packing.

Elastic, piezoelectric and dielectric properties of La3Ga5.5Nb0.5O14 crystals

International Nuclear Information System (INIS)

Sil'vestrova, I.M.; Pisarevskij, Yu.V.; Kaminskij, A.A.; Mill', B.V.

1987-01-01

The results of investigation into piezoelectric, electric, acoustic and dielectric properties of monocrystals of niobium lanthanum gallate La 3 Ga 5.5 Nb 0.5 O 14 at room temperature are presented. It is concluded that niobium lanthanum gallate belongs to moderate strong piezoelectrics with a comparatively low level of acoustic losses up to hypersound frequencies

15 CFR 758.2 - Automated Export System (AES).

Science.gov (United States)

2010-01-01

... 15 Commerce and Foreign Trade 2 2010-01-01 2010-01-01 false Automated Export System (AES). 758.2... CLEARANCE REQUIREMENTS § 758.2 Automated Export System (AES). The Census Bureau's Foreign Trade Statistics...) electronically using the Automated Export System (AES). In order to use AES, you must apply directly to the...

Effect of ECAP processing on corrosion resistance of AE21 and AE42 magnesium alloys

Science.gov (United States)

Minárik, P.; Král, R.; Janeček, M.

2013-09-01

Corrosion properties of AE21 and AE42 magnesium alloys were investigated in the extruded state and after subsequent 8 passes of Equal Channel Angular Pressing (ECAP) via route Bc, by Electrochemical Impedance Spectroscopy (EIS) in 0.1 M NaCl solution. The resulting microstructure was observed by the Transmission Electron Microscope (TEM) and the Scanning Electron Microscope (SEM). Corrosion layer created after 7 days of immersion was observed by (SEM) in order to explain different evolution of the corrosion resistance after ECAP processing in both alloys. It was found that Al-rich Al11RE3 dispersed particles (present in both alloys) strongly influence the corrosion process and enhance the corrosion resistance. Ultra-fine grained structure was found to reduce the corrosion resistance in AE21. On the other hand, the microstructure of AE42 after ECAP and particularly the better distribution of the alloying elements in the matrix enhance the corrosion resistance when compared to the extruded material.

Effect of ECAP processing on corrosion resistance of AE21 and AE42 magnesium alloys

Energy Technology Data Exchange (ETDEWEB)

Minárik, P., E-mail: peter.minarik@mff.cuni.cz [Charles University, Department of Physics of Materials, Prague (Czech Republic); Král, R.; Janeček, M. [Charles University, Department of Physics of Materials, Prague (Czech Republic)

2013-09-15

Corrosion properties of AE21 and AE42 magnesium alloys were investigated in the extruded state and after subsequent 8 passes of Equal Channel Angular Pressing (ECAP) via route Bc, by Electrochemical Impedance Spectroscopy (EIS) in 0.1 M NaCl solution. The resulting microstructure was observed by the Transmission Electron Microscope (TEM) and the Scanning Electron Microscope (SEM). Corrosion layer created after 7 days of immersion was observed by (SEM) in order to explain different evolution of the corrosion resistance after ECAP processing in both alloys. It was found that Al-rich Al11RE3 dispersed particles (present in both alloys) strongly influence the corrosion process and enhance the corrosion resistance. Ultra-fine grained structure was found to reduce the corrosion resistance in AE21. On the other hand, the microstructure of AE42 after ECAP and particularly the better distribution of the alloying elements in the matrix enhance the corrosion resistance when compared to the extruded material.

Effect of ECAP processing on corrosion resistance of AE21 and AE42 magnesium alloys

International Nuclear Information System (INIS)

Minárik, P.; Král, R.; Janeček, M.

2013-01-01

Corrosion properties of AE21 and AE42 magnesium alloys were investigated in the extruded state and after subsequent 8 passes of Equal Channel Angular Pressing (ECAP) via route Bc, by Electrochemical Impedance Spectroscopy (EIS) in 0.1 M NaCl solution. The resulting microstructure was observed by the Transmission Electron Microscope (TEM) and the Scanning Electron Microscope (SEM). Corrosion layer created after 7 days of immersion was observed by (SEM) in order to explain different evolution of the corrosion resistance after ECAP processing in both alloys. It was found that Al-rich Al11RE3 dispersed particles (present in both alloys) strongly influence the corrosion process and enhance the corrosion resistance. Ultra-fine grained structure was found to reduce the corrosion resistance in AE21. On the other hand, the microstructure of AE42 after ECAP and particularly the better distribution of the alloying elements in the matrix enhance the corrosion resistance when compared to the extruded material.

Dynamics of the formation of the condensed phase particles at detonation of high explosives

CERN Document Server

Evdokov, O V; Kulipanov, G N; Luckjanchikov, L A; Lyakhov, N Z; Mishnev, S I; Sharafutdinov, M R; Sheromov, M A; Ten, K A; Titov, V M; Tolochko, B P; Zubkov, P I

2001-01-01

The article presents the results of the experimental study SAXS on condensed carbon particles that appear at the detonation of a high explosive. It was shown that the SAXS signal rises for 1.5-4 mu s after the detonation front passing. The SAXS signal in trotyl and its alloys with hexogen starts just after the compression of the material in the detonation wave. In octogen, hexogen and PETN, the SAXS signal appears in 0.5 mu s and is much smaller than the signal at the detonation of trotyl and its alloys with hexogen.

Application of AE to evaluate deterioration of prt and harbor structures

International Nuclear Information System (INIS)

Matsuyama, Kimitoshi; Ishibashi, Akichika; Fujiwara, Tetsuro; Kanemoto, Yasuhiro; Hamada, Shigenori; Ohtsu, Masayasu

1997-01-01

The degree of concrete deterioration is normally evaluated by uniaxial compression tests of core samples taken from existing concrete structures. The uniaxial compression test can give details on concrete strength, elastic modulus and so forth. By using AE(acoustic emission) technique with uniaxial compression tests, we can get more useful information on interior failures of the core sample. The observation of AE activity was conducted during uniaxial compression tests of concrete specimens and samples. The specimens were cast with 5, 10, 15 and 20% air content. The samples were taken from 2 harbor sites in Japan. Generating behavior of AE was studied quantitatively on the basis of rate process theory. Distribution of pores in the concrete could be measured by the porosimeter. The relation between AE activity in the uniaxial compression test of core samples and concrete property is clarified.

Enhanced ATM Security using Biometric Authentication and Wavelet Based AES

Directory of Open Access Journals (Sweden)

Sreedharan Ajish

2016-01-01

Full Text Available The traditional ATM terminal customer recognition systems rely only on bank cards, passwords and such identity verification methods are not perfect and functions are too single. Biometrics-based authentication offers several advantages over other authentication methods, there has been a significant surge in the use of biometrics for user authentication in recent years. This paper presents a highly secured ATM banking system using biometric authentication and wavelet based Advanced Encryption Standard (AES algorithm. Two levels of security are provided in this proposed design. Firstly we consider the security level at the client side by providing biometric authentication scheme along with a password of 4-digit long. Biometric authentication is achieved by considering the fingerprint image of the client. Secondly we ensure a secured communication link between the client machine to the bank server using an optimized energy efficient and wavelet based AES processor. The fingerprint image is the data for encryption process and 4-digit long password is the symmetric key for the encryption process. The performance of ATM machine depends on ultra-high-speed encryption, very low power consumption, and algorithmic integrity. To get a low power consuming and ultra-high speed encryption at the ATM machine, an optimized and wavelet based AES algorithm is proposed. In this system biometric and cryptography techniques are used together for personal identity authentication to improve the security level. The design of the wavelet based AES processor is simulated and the design of the energy efficient AES processor is simulated in Quartus-II software. Simulation results ensure its proper functionality. A comparison among other research works proves its superiority.

Attacks and countermeasures on AES and ECC

DEFF Research Database (Denmark)

Tange, Henrik; Andersen, Birger

2013-01-01

AES (Advanced Encryption Standard) is widely used in LTE and Wi-Fi communication systems. AES has recently been exposed to new attacks which have questioned the overall security of AES. The newest attack is a so called biclique attack, which is using the fact that the content of the state array...

Metallic → Semiconducting transitions in HX(X=F, Br, Cl) adsorbed (5,5) and (7,7) carbon nanotubes: DFT study

Science.gov (United States)

Srivastava, Reena; Shrivastava, Sadhana; Srivastava, Anurag

2018-05-01

The edge sensitivity of two different chirality (5,5) and (7,7) armchair carbon nanotubes towards toxic hydrogen halides (HF, HBr and HCl) has been analyzed by using density functional theory based ab-initio approach. The edge sensitivity has been discussed in terms of the variations in the electronic band structure of (5,5) and (7,7) carbon nanotube. The observation shows metallic to semiconducting phase transition in HF and HBr adsorbed (5,5) CNT, whereas for HCl adsorbed, it is more metallic. Whereas HBr and HCl adsorbed (7,7) CNT confirms metallic→semiconducting transition and shows diameter dependence of properties of CNTs.

A More Compact AES

OpenAIRE

Canright, David; Osvik, Dag Arne

2009-01-01

We explore ways to reduce the number of bit operations required to implement AES. One way involves optimizing the composite field approach for entire rounds of AES. Another way is integrating the Galois multiplications of MixColumns with the linear transformations of the S-box. Combined with careful optimizations, these reduce the number of bit operations to encrypt one block by 9.0%, compared to earlier work that used the composite field only in the S-box. For decryption, ...

Determination of glufosinate ammonium and its metabolite (AE F064619 and AE F061517) residues in water by gas chromatography with tandem mass spectrometry after ion exchange cleanup and derivatization.

Science.gov (United States)

Royer, A; Beguin, S; Sochor, H; Communal, P Y

2000-11-01

An analytical method for the determination of glufosinate ammonium and its principal metabolites, AE F064619 and AE F061517, in water of two different hardnesses (5 and 30 DH, French hardness) has been developed and validated. Samples were spiked at different levels (0. 05 and 0.5 microgram/L) and were purified by column chromatography on ion-exchange resins. After derivatization with glacial acetic acid and trimethylarthoacetate mixture, the derivatives were quantified by using capillary gas chromatography with an ion-trap tandem mass spectrometric detector. Analytical conditions for MS/MS detection were optimized, and the quantification was carried out on the areas of the most representative ions. The limit of quantification was validated at 0.05 microgram/L for each compound. The mean recovery value and the relative standard deviation (n = 20) were 92.0% and 17. 8% for glufosinate ammonium, 90.2% and 15.8% for AE F064619, and 89. 7% and 12.7% for AE F061517.

Time dependence of the UV resonance lines in the cataclysmic variables SU UMa, RX And and 0623+71

International Nuclear Information System (INIS)

Woods, J.A.; Drew, J.E.; Verbunt, Frank

1990-01-01

We present IUE observations of the dwarf novae SU UMa and RX And, and of the nova-like variable 0623 + 71. At the time of observation, SU UMa and RX And were in outburst. All three systems show variability in the wind-formed UV resonance lines of N v λ 1240, Si IV λ 1397 and C IV λ 1549 on timescale of hours. The amplitude of variation is smallest in RX And and largest in 0623 + 71. There is evidence that the variations observed in SU UMa's UV spectrum repeat on the orbital period. Our observations of SU UMa also reveal variability in the continuum flux during the decline from outburst maximum that is much more marked in the UV than at optical wavelengths. (author)

Aluminum-Enhanced Underwater Electrical Discharges for Steam Explosion Triggering

International Nuclear Information System (INIS)

HOGELAND, STEVE R.; NELSON, LLOYD S.; ROTH, THOMAS CHRISTOPHER

1999-01-01

For a number of years, we have been initiating steam explosions of single drops of molten materials with pressure and flow (bubble growth) transients generated by discharging a capacitor bank through gold bridgewires placed underwater. Recent experimental and theoretical advances in the field of steam explosions, however, have made it important to substantially increase these relatively mild transients in water without using high explosives, if possible. To do this with the same capacitor bank, we have discharged similar energies through tiny strips of aluminum foil submerged in water. By replacing the gold wires with the aluminum strips, we were able to add the energy of the aluminum-water combustion to that normally deposited electrically by the bridgewire explosion in water. The chemical enhancement of the explosive characteristics of the discharges was substantial: when the same electrical energies were discharged through the aluminum strips, peak pressures increased as much as 12-fold and maximum bubble volumes as much as 5-fold above those generated with the gold wires. For given weights of aluminum, the magnitudes of both parameters appeared to exceed those produced by the underwater explosion of equivalent weights of high explosives

Abbreviations [Annex to The Fukushima Daiichi Accident, Technical Volume 5/5

International Nuclear Information System (INIS)

2015-01-01

This annex is a list of abbreviations used in the publication The Fukushima Daiichi Accident, Technical Volume 5/5. The list includes the abbreviations for: • General Safety Requirements; • International Commission on Radiological Protection; • Intensive Contamination Survey Area; • International Experts Meeting; • Ministry of Education, Culture, Sports, Science and Technology; • Ministry of the Environment; • Nuclear Damage Compensation and Decommissioning Facilitation Corporation; • Nuclear Emergency Response Headquarters; • nuclear power plant; • Nuclear Safety Commission; • OECD Nuclear Energy Agency; • Special Decontamination Area; • Specific Safety Requirements; • technical cooperation; • Three Mile Island; • United Nations Scientific Committee on the Effects of Atomic Radiation

The ionization effects from nuclear explosions in high-altitude and their effect to radio propagation

International Nuclear Information System (INIS)

Guan Rongsheng; Li Qin

1997-01-01

A high-altitude nuclear explosions releases large quantities of energetic particles and electromagnetic radiation capable of producing ionization in the atmosphere. These particles and rays radiation character in the atmosphere are discussed. Ionizations due to explosion X rays, γ rays, neutrons and β particles are considered separately. The time-space distribution of additional electron density is computed and its nature is analyzed. The effects of explosion-induced ionization on the absorption of radio wave is considered and the dependence of the absorption on explosion characteristics, distance from the earth's atmosphere, and frequency of the radio wave is determined

Trend analysis of explosion events at overseas nuclear power plants

International Nuclear Information System (INIS)

Shimada, Hiroki

2008-01-01

We surveyed failures caused by disasters (e.g., severe storms, heavy rainfall, earthquakes, explosions and fires) which occurred during the 13 years from 1995 to 2007 at overseas nuclear power plants (NPPs) from the nuclear information database of the Institute of Nuclear Safety System. Incorporated (INSS). The results revealed that explosions were the second most frequent type of failure after fires. We conducted a trend analysis on such explosion events. The analysis by equipment, cause, and effect on the plant showed that the explosions occurred mainly at electrical facilities, and thus it is essential to manage the maintenance of electrical facilities for preventing explosions. In addition, it was shown that explosions at transformers and batteries, which have never occurred at Japan's NPPs, accounted for as much as 55% of all explosions. The fact infers that this difference is attributable to the difference in maintenance methods of transformers (condition based maintenance adopted by NPPs) and workforce organization of batteries (inspections performed by utilities' own maintenance workers at NPPs). (author)

Lead-free primary explosives

Science.gov (United States)

Huynh, My Hang V.

2010-06-22

Lead-free primary explosives of the formula (cat).sub.Y[M.sup.II(T).sub.X(H.sub.2O).sub.6-X].sub.Z, where T is 5-nitrotetrazolate, and syntheses thereof are described. Substantially stoichiometric equivalents of the reactants lead to high yields of pure compositions thereby avoiding dangerous purification steps.

Validation and empirical correction of MODIS AOT and AE over ocean

Directory of Open Access Journals (Sweden)

N. A. J. Schutgens

2013-09-01

Full Text Available We present a validation study of Collection 5 MODIS level 2 Aqua and Terra AOT (aerosol optical thickness and AE (Ångström exponent over ocean by comparison to coastal and island AERONET (AErosol RObotic NETwork sites for the years 2003–2009. We show that MODIS (MODerate-resolution Imaging Spectroradiometer AOT exhibits significant biases due to wind speed and cloudiness of the observed scene, while MODIS AE, although overall unbiased, exhibits less spatial contrast on global scales than the AERONET observations. The same behaviour can be seen when MODIS AOT is compared against Maritime Aerosol Network (MAN data, suggesting that the spatial coverage of our datasets does not preclude global conclusions. Thus, we develop empirical correction formulae for MODIS AOT and AE that significantly improve agreement of MODIS and AERONET observations. We show these correction formulae to be robust. Finally, we study random errors in the corrected MODIS AOT and AE and show that they mainly depend on AOT itself, although small contributions are present due to wind speed and cloud fraction in AOT random errors and due to AE and cloud fraction in AE random errors. Our analysis yields significantly higher random AOT errors than the official MODIS error estimate (0.03 + 0.05 τ, while random AE errors are smaller than might be expected. This new dataset of bias-corrected MODIS AOT and AE over ocean is intended for aerosol model validation and assimilation studies, but also has consequences as a stand-alone observational product. For instance, the corrected dataset suggests that much less fine mode aerosol is transported across the Pacific and Atlantic oceans.

Magnetic fields of Herbig Ae/Be stars

Directory of Open Access Journals (Sweden)

Hubrig S.

2014-01-01

Full Text Available We report on the status of our spectropolarimetric studies of Herbig Ae/Be stars carried out during the last years. The magnetic field geometries of these stars, investigated with spectropolarimetric time series, can likely be described by centred dipoles with polar magnetic field strengths of several hundred Gauss. A number of Herbig Ae/Be stars with detected magnetic fields have recently been observed with X-shooter in the visible and the near-IR, as well as with the high-resolution near-IR spectrograph CRIRES. These observations are of great importance to understand the relation between the magnetic field topology and the physics of the accretion flow and the accretion disk gas emission.

High incidence of micronuclei in lymphocytes from residents of the area near the Semipalatinsk nuclear explosion test site

International Nuclear Information System (INIS)

Tanaka, Kimio; Hoshi, Masaharu; Kamada, Nanao; Tchaijunusova, N.J.; Takatsuji, Toshihiro; Gusev, B.I.; Sakerbaev, A.K.H.

2000-01-01

The Semipalatinsk area is highly contaminated with radioactive fallout from 40 years of continuous nuclear testing. The biological effects on human health in this area have not been studied. Significant remaining radioactivities include long-lived radioisotopes of 238, 239, 400 Pu, 137 Cs and 90 Sr. To evaluate the long-term biological effects of the radioactive fallout, the incidence of micronuclei in lymphocytes from residents of the area was observed. Blood was obtained from 10 residents (5 females and 5 males, aged 47 to 55 years old) from each of the 3 areas of Znamenka, Dolon and Semipalatinsk, which are about 50-150 km from the nuclear explosion test site. For micronucleus assay. PHA-stimulated lymphocytes were cultured for 72 h and cytochalasin B was added at 44 h for detecting binuclear lymphocytes. Five thousand binuclear lymphocytes in each resident were scored. The means of micronucleus counts in 1,000 lymphocytes in residents of Semipalatinsk, Dolon and Znamenka were 16.3, 12.6, and 7.80, respectively, which were higher than those of the normal Japanese persons (4.66). These values were equivalent to the results obtained from 0.187-0.47 Gy of chronic exposure to γ-rays at a dose rate of 0.02 cGy/min. The high incidence of micronuclei in residents of the Semipalatinsk nuclear test site area was mainly caused by internal exposure rather than external exposure received for the past 40 years. (author)

Progress in model development to quantify High Explosive Violent Response (HEVR) to mechanical insult

International Nuclear Information System (INIS)

Reaugh, J.E.

2008-01-01

The rapid release of chemical energy has found application for industrial and military purposes since the invention of gunpowder. Black powder, smokeless powder of various compositions, and pyrotechnics all exhibit the rapid release of energy without detonation when they are being used as designed. The rapidity of energy release for these materials is controlled by adjustments to the particle surface area (propellant grain configuration or powder particle size) in conjunction with the measured pressure-dependent burning rate, which is very subsonic. In this way a manufacturing process can be used to engineer the desired violence of the explosion. Detonations in molecular explosives, in contrast, propagate with a supersonic velocity that depends on the loading density, but is independent of the surface area. In ideal detonations, the reaction is complete within a small distance of the propagating shock front. Non-ideal detonations in molecular and composite explosives proceed with a slower velocity, and the reaction may continue well behind the shock front. We are developing models to describe the circumstances when molecular and composite explosives undergo a rapid release of energy without detonating. The models also apply to the behavior of rocket propellants subject to mechanical insult, whether for accidents (Hazards) or the suite of standardized tests used to assess whether the system can be designated an Insensitive Munition (IM). In the application described here, we are studying an HMX (1,3,5,7-tetranitro-1,3,5,7-tetraazacyclooctane) explosive developed in the UK, which is 91% by weight HMX and 9% binder-plasticizer. Most explosives and propellants, when subjected to a mechanical insult, drop or impact that is well below the threshold for detonation have been observed to react violently. This behavior is known as High Explosive Violent Reaction (HEVR). The basis of our model is the observation that the mechanical insult produces damage in a volume of the

Expression and properties of the highly alkalophilic phenylalanine ammonia-lyase of thermophilic Rubrobacter xylanophilus.

Directory of Open Access Journals (Sweden)

Klaudia Kovács

Full Text Available The sequence of a phenylalanine ammonia-lyase (PAL; EC: 4.3.1.24 of the thermophilic and radiotolerant bacterium Rubrobacter xylanophilus (RxPAL was identified by screening the genomes of bacteria for members of the phenylalanine ammonia-lyase family. A synthetic gene encoding the RxPAL protein was cloned and overexpressed in Escherichia coli TOP 10 in a soluble form with an N-terminal His6-tag and the recombinant RxPAL protein was purified by Ni-NTA affinity chromatography. The activity assay of RxPAL with l-phenylalanine at various pH values exhibited a local maximum at pH 8.5 and a global maximum at pH 11.5. Circular dichroism (CD studies showed that RxPAL is associated with an extensive α-helical character (far UV CD and two distinctive near-UV CD peaks. These structural characteristics were well preserved up to pH 11.0. The extremely high pH optimum of RxPAL can be rationalized by a three-dimensional homology model indicating possible disulfide bridges, extensive salt-bridge formation and an excess of negative electrostatic potential on the surface. Due to these properties, RxPAL may be a candidate as biocatalyst in synthetic biotransformations leading to unnatural l- or d-amino acids or as therapeutic enzyme in treatment of phenylketonuria or leukemia.

Numerical Simulation and Experimental Study on Formation of High Concentration of H2 Generated by Gas Explosion

Directory of Open Access Journals (Sweden)

Lei Baiwei

2016-10-01

Full Text Available In coal mine fire rescues, if the abnormal increase of gas concentration occurs, it is the primary thing to analyze the reasons and identify sources of the abnormal forming, which is also the basis of judge the combustion state of fire area and formulate proper fire reliefs. Nowadays, related researches have recognized the methane explosion as the source of high concentration of H2 formation, but there are few studies about the conditions and reaction mechanism of gas explosion generating high concentration of H2.Therefore, this paper uses the chemical kinetic calculation software, ChemKin, and the 20L spherical explosion experimental device to simulate the generating process and formation conditions of H2 in gas explosion. The experimental results show that: the decomposition of water vapor is the main base element reaction (R84 which leads to the generation of H2.The free radical H is the key factor to influence the formation of H2 generated from gas explosion. With the gradual increase of gas explosion concentration, the explosive reaction becomes more incomplete, and then the generating quantity of H2 increases gradually. Experimental results of 20L spherical explosion are consistent with the change trend about simulation results, which verifies the accuracy of simulation analysis. The results of explosion experiments show that when gas concentration is higher than 9%, the incomplete reaction of methane explosion increases which leads to the gradual increase of H2 formation.

Optical spectrophotometry of oscillations and flickering in AE Aquarii

Science.gov (United States)

Welsh, William F.; Horne, Keith; Oke, J. B.

1993-01-01

We observed rapid variations in the nova-like cataclysmic variable AE Aquarii for 1.7 hr with 4.3 s time resolution using the 30-channel (3227-10494 A) spectrophotometer on the Hale 5 m telescope. The 16.5 and 33.0 s oscillations show a featureless blue spectrum that can be represented by a blackbody with temperature and area much smaller than the accretion disk. Models consisting of the sum of a K star spectrum and a hydrogen slab in LTE at T = 6000-10,000 K can fit the spectrum of AE Aquarii reasonably well. The spectrum of a flare indicates optically thin gas with T = 8000-12,000 K. The energy released by the flare is large compared to typical stellar flares.

AE/flaw characterization for nuclear pressure vessels

International Nuclear Information System (INIS)

Hutton, P.H.; Kurtz, R.J.; Pappas, R.A.

1984-01-01

This chapter discusses the use of acoustic emission (AE) detected during continuous monitoring to identify and evaluate growing flaws in pressure vessels. Off-reactor testing and on-reactor testing are considered. Relationships for identifying acoustic emission (AE) from crack growth and using the AE data to estimate flaw severity have been developed experimentally by laboratory testing. The purpose of the off-reactor vessel test is to evaluate AE monitoring/interpretation methodology on a heavy section steel vessel under simulated reactor operating conditions. The purpose of on-reactor testing is to evaluate the capability of a monitor system to function in the reactor environment, calibrate the ability to detect AE signals, and to demonstrate that a meaningful criteria can be established to prevent false alarms. An expanded data base is needed from application testing and methodology standardization

Genomic Analysis of Multidrug-Resistant Escherichia coli from North Carolina Community Hospitals: Ongoing Circulation of CTX-M-Producing ST131-H30Rx and ST131-H30R1 Strains.

Science.gov (United States)

Kanamori, Hajime; Parobek, Christian M; Juliano, Jonathan J; Johnson, James R; Johnston, Brian D; Johnson, Timothy J; Weber, David J; Rutala, William A; Anderson, Deverick J

2017-08-01

Escherichia coli sequence type 131 (ST131) predominates globally among multidrug-resistant (MDR) E. coli strains. We used whole-genome sequencing (WGS) to investigate 63 MDR E. coli isolates from 7 North Carolina community hospitals (2010 to 2015). Of these, 39 (62%) represented ST131, including 37 (95%) from the ST131- H 30R subclone: 10 (27%) from its H 30R1 subset and 27 (69%) from its H 30Rx subset. ST131 core genomes differed by a median of 15 (range, 0 to 490) single-nucleotide variants (SNVs) overall versus only 7 within H 30R1 (range, 3 to 12 SNVs) and 11 within H 30Rx (range, 0 to 21). The four isolates with identical core genomes were all H 30Rx. Epidemiological and clinical characteristics did not vary significantly by strain type, but many patients with MDR E. coli or H 30Rx infection were critically ill and had poor outcomes. H 30Rx isolates characteristically exhibited fluoroquinolone resistance and CTX-M-15 production, had a high prevalence of trimethoprim-sulfamethoxazole resistance (89%), sul1 (89%), and dfrA17 (85%), and were enriched for specific virulence traits, and all qualified as extraintestinal pathogenic E. coli The high overall prevalence of CTX-M-15 appeared to be possibly attributable to its association with the ST131- H 30Rx subclone and IncF[F2:A1:B-] plasmids. Some phylogenetically clustered non-ST131 MDR E. coli isolates also had distinctive serotypes/ fimH types, fluoroquinolone mutations, CTX-M variants, and IncF types. Thus, WGS analysis of our community hospital source MDR E. coli isolates suggested ongoing circulation and differentiation of E. coli ST131 subclones, with clonal segregation of CTX-M variants, other resistance genes, Inc-type plasmids, and virulence genes. Copyright © 2017 American Society for Microbiology.

A novel method for the measurement of the von Neumann spike in detonating high explosives

Science.gov (United States)

Sollier, A.; Bouyer, V.; Hébert, P.; Doucet, M.

2016-06-01

We present detonation wave profiles measured in T2 (97 wt. % TATB) and TX1 (52 wt. % TATB and 45 wt. % HMX) high explosives. The experiments consisted in initiating a detonation wave in a 15 mm diameter cylinder of explosive using an explosive wire detonator and an explosive booster. Free surface velocity wave profiles were measured at the explosive/air interface using a Photon Doppler Velocimetry system. We demonstrate that a comparison of these free surface wave profiles with those measured at explosive/window interfaces in similar conditions allows to bracket the von Neumann spike in a narrow range. For T2, our measurements show that the spike pressure lies between 35.9 and 40.1 GPa, whereas for TX1, it lies between 42.3 and 47.0 GPa. The numerical simulations performed in support to these measurements show that they can be used to calibrate reactive burn models and also to check the accuracy of the detonation products equation of state at low pressure.

Collection of trace evidence of explosive residues from the skin in a death due to a disguised letter bomb. The synergy between confocal laser scanning microscope and inductively coupled plasma atomic emission spectrometer analyses.

Science.gov (United States)

Turillazzi, Emanuela; Monaci, Fabrizio; Neri, Margherita; Pomara, Cristoforo; Riezzo, Irene; Baroni, Davide; Fineschi, Vittorio

2010-04-15

In most deaths caused by explosive, the victim's body becomes a depot for fragments of explosive materials, so contributing to the collection of trace evidence which may provide clues about the specific type of device used with explosion. Improvised explosive devices are used which contain "homemade" explosives rather than high explosives because of the relative ease with which such components can be procured. Many methods such as chromatography-mass spectrometry, scanning electron microscopy, stereomicroscopy, capillary electrophoresis are available for use in the identification of explosive residues on objects and bomb fragments. Identification and reconstruction of the distribution of explosive residues on the decedent's body may give additional hints in assessing the position of the victim in relation to the device. Traditionally these residues are retrieved by swabbing the body and clothing during the early phase, at autopsy. Gas chromatography-mass spectrometry and other analytical methods may be used to analyze the material swabbed from the victim body. The histological examination of explosive residues on skin samples collected during the autopsy may reveal significant details. The information about type, quantity and particularly about anatomical distribution of explosive residues obtained utilizing confocal laser scanning microscope (CLSM) together with inductively coupled plasma atomic emission spectrometer (ICP-AES), may provide very significant evidence in the clarification and reconstruction of the explosive-related events. Copyright 2009 Elsevier Ireland Ltd. All rights reserved.

Fracture Surgery of the extremities with the intra-operative use of 3D-RX: A randomized multicenter trial (EF3X-trial

Directory of Open Access Journals (Sweden)

Marmor Meir

2011-07-01

wrist, ankle or calcaneus eligible for surgery will be subjected to additional intra-operative 3D-RX. In half of the patients the surgeon will be blinded to these results, in the other half the surgeon may use the 3D-RX results to further optimize fracture reduction. In both randomization groups a CT-scan will be performed postoperatively. Based on these CT-scans the quality of fracture reduction and fixation will be determined. During the follow-up visits after hospital discharge at 6 and 12 weeks and 1 year postoperatively the patient relevant outcomes will be determined by joint specific, health economic and quality of life questionnaires. In addition a follow up study will be performed to determine the patient relevant outcomes and prevalence of posttraumatic osteoarthritis at 2 and 5 years postoperatively. Discussion The results of the study will provide more information on the effectiveness of the intra-operative use of 3D-imaging during surgical treatment of intra-articular fractures of the wrist, ankle and calcaneus. A randomized design in which patients will be allocated to a treatment arm during surgery will be used because of its high methodological quality and the ability to detect incongruences in the reduction and/or fixation that occur intra-operatively in the blinded arm of the 3D-RX. An alternative, pragmatic design could be to randomize before the start of the surgery, then two surgical strategies would be compared. This resembles clinical practice better, but introduces more bias and does not allow the assessment of incongruences that would have been detected by 3D-RX in the blinded arm. Trial registration Dutch Trial Register NTR 1902

Development of AE monitoring system for journal bearing

International Nuclear Information System (INIS)

Yoon, Dong Jin; Kwon, Oh Yang; Chung, Min Hwa

1994-01-01

For the purpose of monitoring of the bearing conditions in rotating machinery, a system for journal bearing diagnosis by AE was developed. Acoustic emission technique is used to detect abnormal conditions in the bearing system. And various data such as AE events, rms voltage level of AE signals, and AE parameters were acquired during experiments with the simulated journal bearing system. Based on the above results and practical application for power plant, algorithms and judgement criteria for diagnosis system was accomplished. Bearing diagnosis system is composed of four parts as follows : sensing part for AE sensor and preamplifier, signal processing part for rms-to-dc converting to measure AE rms voltage, interface part for connecting rms signal to PC using A/D converter, graphic display and software part for display of bearing condition and for managing of diagnosis program.

New high-nitrogen materials based on nitroguanyl-tetrazines: explosive properties, thermal decomposition and combustion studies

Energy Technology Data Exchange (ETDEWEB)

Chavez, David E.; Tappan, Bryce C.; Hiskey, Michael A.; Son, Steve F.; Harry, Herbert; Montoya, Dennis; Hagelberg, Stephanie [Dynamic Experimentation Division, DX-2 Materials Dynamics Group, Los Alamos National Laboratory, Los Alamos, NM 87545 (United States)

2005-12-01

This paper describes the explosive sensitivity and performance properties of two novel high-nitrogen materials, 3,6-bis-nitroguanyl-1,2,4,5-tetrazine (1, (NQ{sub 2}Tz)) and its corresponding bis-triaminoguanidinium salt (2, (TAG){sub 2}(NQ){sub 2}Tz). These materials exhibit very low pressure dependence in burning rate. Flash pyrolysis/FTIR spectroscopy was performed, and insight into this interesting burning behavior was obtained. Our studies indicate that 1 and 2 exhibit highly promising energetic materials properties. (Abstract Copyright [2005], Wiley Periodicals, Inc.)

NuSTAR discovery of a cyclotron line in the Be/X-ray binary RX J0520.5–6932 during outburst

Energy Technology Data Exchange (ETDEWEB)

Tendulkar, Shriharsh P.; Fürst, Felix; Harrison, Fiona A.; Walton, Dominic J. [Space Radiation Laboratory, California Institute of Technology, 1200 East California Boulevard, MC 249-17, Pasadena, CA 91125 (United States); Pottschmidt, Katja [Center for Research and Exploration in Space Science and Technology, University of Maryland, Baltimore County, Baltimore, MD 21250 (United States); Bachetti, Matteo [Université de Toulouse, UPS-OMP, IRAP, F-31400 Toulouse (France); Bhalerao, Varun B. [Inter-University Centre for Astronomy and Astrophysics, Post Bag 4, Ganeshkhind, Pune University Campus, Pune 411007 (India); Boggs, Steven E.; Tomsick, John A. [Space Sciences Laboratory, University of California, Berkeley, CA 94720 (United States); Christensen, Finn E. [DTU Space, National Space Institute, Technical University of Denmark, Elektrovej 327, DK-2800 Lyngby (Denmark); Craig, William W.; Hailey, Charles A. [Columbia Astrophysics Laboratory, Columbia University, New York, NY 10027 (United States); Stern, Daniel [Jet Propulsion Laboratory, California Institute of Technology, Pasadena, CA 91109 (United States); Zhang, William, E-mail: spt@astro.caltech.edu [NASA Goddard Space Flight Center, Astrophysics Science Division, Code 661, Greenbelt, MD 20771 (United States)

2014-11-10

We present spectral and timing analysis of NuSTAR observations of RX J0520.5–6932 in the 3-79 keV band collected during its outburst in 2014 January. The target was observed on two epochs and we report the detection of a cyclotron resonant scattering feature with central energies of E{sub CRSF}=31.3{sub −0.7}{sup +0.8} keV and 31.5{sub −0.6}{sup +0.7} keV during the two observations, respectively, corresponding to a magnetic field of B ≈ 2 × 10{sup 12} G. The 3-79 keV luminosity of the system during the two epochs, assuming a nominal distance of 50 kpc, was 3.667 ± 0.007 × 10{sup 38} erg s{sup –1} and 3.983 ± 0.007 × 10{sup 38} erg s{sup –1}. Both values are much higher than the critical luminosity of ≈1.5 × 10{sup 37} erg s{sup –1}, above which a radiation-dominated shock front may be expected. This adds a new object to the sparse set of three systems that have a cyclotron line observed at luminosities in excess of 10{sup 38} erg s{sup –1}. A broad (σ ≈ 0.45 keV) Fe emission line is observed in the spectrum at a central energy of 6.58{sub −0.05}{sup +0.05} keV in both epochs. The pulse profile of the pulsar was observed to be highly asymmetric with a sharply rising and slowly falling profile of the primary peak. We also observed minor variations in the cyclotron line energy and width as a function of the rotation phase.

Intrinsic defect process and O migration in PrBa(Co/Fe)2O5.5

KAUST Repository

Salawu, Omotayo Akande

2017-01-01

New mixed ion-electron conductors ar desired to lower the operating temperature of solid oxide fuel cells. The O Frenkel energy and migration of O ions in rBa(Co/Fe)2O5.5 are studied for this purpose by density functional theory. We demonstrate

Intrinsic defect processes and O migration in PrBa(Co/Fe)2O5.5

KAUST Repository

Salawu, Omotayo Akande; Boulfrad, Samir; Schwingenschlö gl, Udo

2016-01-01

© 2016 The Royal Society of Chemistry. New mixed ion-electron conductors are desired to lower the operating temperature of solid oxide fuel cells. The O Frenkel energy and migration of O ions in PrBa(Co/Fe)2O5.5 are studied for this purpose

In situ Micrometeorological Measurements during RxCADRE

Science.gov (United States)

Clements, C. B.; Hiers, J. K.; Strenfel, S. J.

2009-12-01

The Prescribed Fire Combustion and Atmospheric Dynamics Research Experiment (RxCADRE) was a collaborative research project designed to fully instrument prescribed fires in the Southeastern United States. Data were collected on pre-burn fuel loads, post burn consumption, ambient weather, in situ atmospheric dynamics, plume dynamics, radiant heat release (both from in-situ and remote sensors), in-situ fire behavior, and select fire effects. The sampling was conducted at Eglin Air Force Base, Florida, and the Joseph W. Jones Ecological Research Center in Newton, Georgia, from February 29 to March 6, 2008. Data were collected on 5 prescribed burns, totaling 4458 acres. The largest aerial ignition totaled 2,290 acres and the smallest ground ignition totaled 104 acres. Quantifying fire-atmospheric interactions is critical for understanding wildland fire dynamics and enhancing modeling of smoke plumes. During Rx-CADRE, atmospheric soundings using radiosondes were made at each burn prior to ignition. In situ micrometeorological measurements were made within each burn unit using five portable, 10-m towers equipped with sonic and prop anemometers, fine-wire thermocouples, and a carbon dioxide probes. The towers were arranged within the burn units to capture the wind and temperature fields as the fire front and plume passed the towers. Due to the interaction of fire lines following ignition, several of the fire fronts that passed the towers were backing fires and thus less intense. Preliminary results indicate that the average vertical velocities associated with the fire front passage were on the order of 3-5 m s-1 and average plume temperatures were on the order of 30-50 °C above ambient. During two of the experimental burns, radiosondes were released into the fire plumes to determine the vertical structure of the plume temperature, humidity, and winds. A radiosonde released into the plume during the burn conducted on 3 March 2008 indicated a definite plume boundary in the

Otologic consequences of blast exposure: a Finnish case study of a shopping mall bomb explosion.

Science.gov (United States)

Mrena, Roderik; Pääkkönen, Rauno; Bäck, Leif; Pirvola, Ulla; Ylikoski, Jukka

2004-10-01

On 11 October, 2002, in the Myyrmanni shopping mall, Vantaa city, Finland, an explosion by a suicide bomber killed 7 people and injured at least 160,44 of whom had ear trauma. We investigated the acute and subacute otologic consequences of the explosion. Otologic examination of the 29 patients treated for ear trauma at the ENT clinic of the University Hospital of Helsinki was performed during the first month after the explosion, and a questionnaire was completed regarding subjective aural symptoms. Symptoms occurring directly after the explosion and for up to 1 month afterwards were assessed. Of the 29 patients, 66% had tinnitus as the initial symptom, 55% hearing loss, 41% pain in the ears and 28% sound distortion. Tinnitus and hearing loss in combination were experienced by 12 patients (41%). Eight patients who had been situated<10 m from the center of the explosion had a rupture of the tympanic membrane. This supported the initial evaluation by the authorities that the bomb had consisted of approximately 3 kg ammonium nitrate, equivalent to approximately 0.5 kg of trinitrotoluene. It was estimated that some kind of ear injury was likely for individuals situated<70 m from the center of the explosion. People often think that tinnitus and hearing impairment are naturally occurring phenomena after blast exposure, and if their symptoms resolve they do not seek medical advice. However, some of them may have substantial hearing impairment, particularly at high frequencies. Otologic consultation, or at least an audiometric screening test to exclude hearing impairment, should be performed regardless of symptoms, on the basis of exposure data only. Some symptoms, such as tinnitus and hearing loss, may be permanent consequences of a blast injury and their effect on quality of life may be substantial.

Triggering of the dsRNA sensors TLR3, MDA5, and RIG-I induces CD55 expression in synovial fibroblasts.

Directory of Open Access Journals (Sweden)

Olga N Karpus

Full Text Available CD55 (decay-accelerating factor is a complement-regulatory protein highly expressed on fibroblast-like synoviocytes (FLS. CD55 is also a ligand for CD97, an adhesion-type G protein-coupled receptor abundantly present on leukocytes. Little is known regarding the regulation of CD55 expression in FLS.FLS isolated from arthritis patients were stimulated with pro-inflammatory cytokines and Toll-like receptor (TLR ligands. Transfection with polyinosinic-polycytidylic acid (poly(I:C and 5'-triphosphate RNA were used to activate the cytoplasmic double-stranded (dsRNA sensors melanoma differentiation-associated gene 5 (MDA5 and retinoic acid-inducible gene-I (RIG-I. CD55 expression, cell viability, and binding of CD97-loaded beads were quantified by flow cytometry.CD55 was expressed at equal levels on FLS isolated from patients with rheumatoid arthritis (RA, osteoarthritis, psoriatic arthritis and spondyloarthritis. CD55 expression in RA FLS was significantly induced by IL-1β and especially by the TLR3 ligand poly(I:C. Activation of MDA5 and RIG-I also enhanced CD55 expression. Notably, activation of MDA5 dose-dependently induced cell death, while triggering of TLR3 or RIG-I had a minor effect on viability. Upregulation of CD55 enhanced the binding capacity of FLS to CD97-loaded beads, which could be blocked by antibodies against CD55.Activation of dsRNA sensors enhances the expression of CD55 in cultured FLS, which increases the binding to CD97. Our findings suggest that dsRNA promotes the interaction between FLS and CD97-expressing leukocytes.

Discovery of 16 New z  ∼ 5.5 Quasars: Filling in the Redshift Gap of Quasar Color Selection

Energy Technology Data Exchange (ETDEWEB)

Yang, Jinyi; Wu, Xue-Bing; Wang, Feige; Yang, Qian; Yue, Minghao; Wang, Shu; Li, Zefeng [Department of Astronomy, School of Physics, Peking University, Beijing 100871 (China); Fan, Xiaohui; Jiang, Linhua [Kavli Institute for Astronomy and Astrophysics, Peking University, Beijing 100871 (China); Bian, Fuyan [Research School of Astronomy and Astrophysics, Australian National University, Weston Creek, ACT 2611 (Australia); McGreer, Ian D.; Green, Richard; Ding, Jiani [Steward Observatory, University of Arizona, 933 North Cherry Avenue, Tucson, AZ 85721 (United States); Yi, Weimin [Yunnan Observatories, Chinese Academy of Sciences, Kunming 650011 (China); Dye, Simon [School of Physics and Astronomy, Nottingham University, University Park, Nottingham, NG7 2RD (United Kingdom); Lawrence, Andy [Institute for Astronomy, University of Edinburgh, Royal Observatory, Blackford Hill, Edinburgh, EH9 3HJ (United Kingdom)

2017-04-01

We present initial results from the first systematic survey of luminous z  ∼ 5.5 quasars. Quasars at z ∼ 5.5, the post-reionization epoch, are crucial tools to explore the evolution of intergalactic medium, quasar evolution, and the early super-massive black hole growth. However, it has been very challenging to select quasars at redshifts 5.3 ≤ z ≤ 5.7 using conventional color selections, due to their similar optical colors to late-type stars, especially M dwarfs, resulting in a glaring redshift gap in quasar redshift distributions. We develop a new selection technique for z ∼ 5.5 quasars based on optical, near-IR, and mid-IR photometric data from Sloan Digital Sky Survey (SDSS), UKIRT InfraRed Deep Sky Surveys—Large Area Survey (ULAS), VISTA Hemisphere Survey (VHS), and Wide Field Infrared Survey Explorer . From our pilot observations in the SDSS-ULAS/VHS area, we have discovered 15 new quasars at 5.3 ≤ z ≤ 5.7 and 6 new lower redshift quasars, with SDSS z band magnitude brighter than 20.5. Including other two z ∼ 5.5 quasars already published in our previous work, we now construct a uniform quasar sample at 5.3 ≤ z ≤ 5.7, with 17 quasars in a ∼4800 square degree survey area. For further application in a larger survey area, we apply our selection pipeline to do a test selection by using the new wide field J-band photometric data from a preliminary version of the UKIRT Hemisphere Survey (UHS). We successfully discover the first UHS selected z ∼ 5.5 quasar.

Infrared observations of AE Aquarii

Science.gov (United States)

Tanzi, E. G.; Chincarini, G.; Tarenghi, M.

1981-01-01

Broadband infrared observations of the cataclysmic variable AE Aquarii are reported. The observations were obtained in the J, H, K and L filters with the InSb photometer attached to the 1-m telescope of the European Southern Observatory. The infrared energy distribution observed from 0.35 to 3.5 microns for phase 0.5 suggests a spectral type of K5 V for the secondary and a distance to the system of approximately 70 pc if an absolute magnitude of 7.3 is assumed. Monitoring of the flux at 2.2 microns reveals a variability with an amplitude of approximately 0.3 magnitude over one third of the orbital period, the nature of which is under investigation.

On the Origin of Hyperfast Neutron Stars

Science.gov (United States)

Gvaramadze, V. V.; Gualandris, A.; Portegies Zwart, S.

2008-05-01

We propose an explanation for the origin of hyperfast neutron stars (e.g. PSR B1508+55, PSR B2224+65, RX J0822 4300) based on the hypothesis that they could be the remnants of a symmetric supernova explosion of a high-velocity massive star (or its helium core) which attained its peculiar velocity (similar to that of the neutron star) in the course of a strong three- or four-body dynamical encounter in the core of a young massive star cluster. This hypothesis implies that the dense cores of star clusters (located either in the Galactic disk or near the Galactic centre) could also produce the so-called hypervelocity stars ordinary stars moving with a speed of ~ 1 000 km s-1.

Research of explosives in an environment of high pressure and temperature using a new test stand

Directory of Open Access Journals (Sweden)

Jan Drzewiecki

2015-01-01

Full Text Available In this article the test stand for determining the blast abilities of explosives in high pressure and temperature conditions as well as the initial results of the research are presented. Explosives are used in rock burst and methane prevention to destroy precisely defined fragments of the rock mass where energy and methane are accumulated. Using this preventive method for fracturing the structure of the rocks which accumulate the energy or coal of the methane seam very often does not bring the anticipated results. It is because of the short range of destructive action of the post-blast gases around the blast hole. Evaluation of the blast dynamics of explosives in a test chamber, i.e. in the pressure and temperature conditions comparable to those found “in situ”, will enable evaluation of their real usefulness in commonly used mining hazard preventive methods. At the same time, it will enable the development of new designs of the explosive charges used for precisely determined mining hazards. In order to test the explosives for their use in difficult environmental conditions and to determine the characteristics of their explosion, a test chamber has been built. It is equipped with a system of sensors and a high-frequency recording system of pressure and temperature during a controlled explosion of an explosive charge. The results of the research will enable the development of new technologies for rock burst and methane prevention which will significantly increase workplace health and safety level. This paper presented results constitute the initial phase of research started in the middle of 2014.

Energetic lanthanide complexes: coordination chemistry and explosives applications

International Nuclear Information System (INIS)

Manner, V W; Barker, B J; Sanders, V E; Laintz, K E; Scott, B L; Preston, D N; Sandstrom, M; Reardon, B L

2014-01-01

Metals are generally added to organic molecular explosives in a heterogeneous composite to improve overall heat and energy release. In order to avoid creating a mixture that can vary in homogeneity, energetic organic molecules can be directly bonded to high molecular weight metals, forming a single metal complex with Angstrom-scale separation between the metal and the explosive. To probe the relationship between the structural properties of metal complexes and explosive performance, a new series of energetic lanthanide complexes has been prepared using energetic ligands such as NTO (5-nitro-2,4-dihydro-1,2,4-triazole-3-one). These are the first examples of lanthanide NTO complexes where no water is coordinated to the metal, demonstrating novel control of the coordination environment. The complexes have been characterized by X-ray crystallography, NMR and IR spectroscopies, photoluminescence, and sensitivity testing. The structural and energetic properties are discussed in the context of enhanced blast effects and detection. Cheetah calculations have been performed to fine-tune physical properties, creating a systematic method for producing explosives with 'tailor made' characteristics. These new complexes will be benchmarks for further study in the field of metalized high explosives.

Development of a Schottky CdTe Medipix3RX hybrid photon counting detector with spatial and energy resolving capabilities

Energy Technology Data Exchange (ETDEWEB)

Gimenez, E.N., E-mail: Eva.Gimenez@diamond.ac.uk [Diamond Light Source, Harwell Campus, Oxforshire OX11 0DE (United Kingdom); Astromskas, V. [University of Surrey (United Kingdom); Horswell, I.; Omar, D.; Spiers, J.; Tartoni, N. [Diamond Light Source, Harwell Campus, Oxforshire OX11 0DE (United Kingdom)

2016-07-11

A multichip CdTe-Medipix3RX detector system was developed in order to bring the advantages of photon-counting detectors to applications in the hard X-ray range of energies. The detector head consisted of 2×2 Medipix3RX ASICs bump-bonded to a 28 mm×28 mm e{sup −} collection Schottky contact CdTe sensor. Schottky CdTe sensors undergo performance degrading polarization which increases with temperature, flux and the longer the HV is applied. Keeping the temperature stable and periodically refreshing the high voltage bias supply was used to minimize the polarization and achieve a stable and reproducible detector response. This leads to good quality images and successful results on the energy resolving capabilities of the system. - Highlights: • A high atomic number (CdTe sensor based) photon-counting detector was developed. • Polarization effects affected the image were minimized by regularly refreshing the bias voltage and stabilizing the temperature. • Good spatial resolution and image quality was achieved following this procedure.

Deeper H.E.S.S. observations of Vela Junior (RX J0852.0-4622): Morphology studies and resolved spectroscopy

Science.gov (United States)

H.E.S.S. Collaboration; Abdalla, H.; Abramowski, A.; Aharonian, F.; Ait Benkhali, F.; Akhperjanian, A. G.; Angüner, E. O.; Arakawa, M.; Arrieta, M.; Aubert, P.; Backes, M.; Balzer, A.; Barnard, M.; Becherini, Y.; Becker Tjus, J.; Berge, D.; Bernhard, S.; Bernlöhr, K.; Blackwell, R.; Böttcher, M.; Boisson, C.; Bolmont, J.; Bordas, P.; Bregeon, J.; Brun, F.; Brun, P.; Bryan, M.; Büchele, M.; Bulik, T.; Capasso, M.; Carr, J.; Casanova, S.; Cerruti, M.; Chakraborty, N.; Chalme-Calvet, R.; Chaves, R. C. G.; Chen, A.; Chevalier, J.; Chrétien, M.; Coffaro, M.; Colafrancesco, S.; Cologna, G.; Condon, B.; Conrad, J.; Cui, Y.; Davids, I. D.; Decock, J.; Degrange, B.; Deil, C.; Devin, J.; deWilt, P.; Dirson, L.; Djannati-Ataï, A.; Domainko, W.; Donath, A.; Drury, L. O.'C.; Dutson, K.; Dyks, J.; Edwards, T.; Egberts, K.; Eger, P.; Ernenwein, J.-P.; Eschbach, S.; Farnier, C.; Fegan, S.; Fernandes, M. V.; Fiasson, A.; Fontaine, G.; Förster, A.; Funk, S.; Füßling, M.; Gabici, S.; Gajdus, M.; Gallant, Y. A.; Garrigoux, T.; Giavitto, G.; Giebels, B.; Glicenstein, J. F.; Gottschall, D.; Goyal, A.; Grondin, M.-H.; Hahn, J.; Haupt, M.; Hawkes, J.; Heinzelmann, G.; Henri, G.; Hermann, G.; Hervet, O.; Hinton, J. A.; Hofmann, W.; Hoischen, C.; Holler, M.; Horns, D.; Ivascenko, A.; Iwasaki, H.; Jacholkowska, A.; Jamrozy, M.; Janiak, M.; Jankowsky, D.; Jankowsky, F.; Jingo, M.; Jogler, T.; Jouvin, L.; Jung-Richardt, I.; Kastendieck, M. A.; Katarzyński, K.; Katsuragawa, M.; Katz, U.; Kerszberg, D.; Khangulyan, D.; Khélifi, B.; Kieffer, M.; King, J.; Klepser, S.; Klochkov, D.; Kluźniak, W.; Kolitzus, D.; Komin, Nu.; Krakau, S.; Kraus, M.; Krüger, P. P.; Laffon, H.; Lamanna, G.; Lau, J.; Lees, J.-P.; Lefaucheur, J.; Lefranc, V.; Lemière, A.; Lemoine-Goumard, M.; Lenain, J.-P.; Leser, E.; Lohse, T.; Lorentz, M.; Liu, R.; López-Coto, R.; Lypova, I.; Marandon, V.; Marcowith, A.; Mariaud, C.; Marx, R.; Maurin, G.; Maxted, N.; Mayer, M.; Meintjes, P. J.; Meyer, M.; Mitchell, A. M. W.; Moderski, R.; Mohamed, M.; Mohrmann, L.; Morå, K.; Moulin, E.; Murach, T.; Nakashima, S.; de Naurois, M.; Niederwanger, F.; Niemiec, J.; Oakes, L.; O'Brien, P.; Odaka, H.; Öttl, S.; Ohm, S.; Ostrowski, M.; Oya, I.; Padovani, M.; Panter, M.; Parsons, R. D.; Paz Arribas, M.; Pekeur, N. W.; Pelletier, G.; Perennes, C.; Petrucci, P.-O.; Peyaud, B.; Piel, Q.; Pita, S.; Poon, H.; Prokhorov, D.; Prokoph, H.; Pühlhofer, G.; Punch, M.; Quirrenbach, A.; Raab, S.; Reimer, A.; Reimer, O.; Renaud, M.; de los Reyes, R.; Richter, S.; Rieger, F.; Romoli, C.; Rowell, G.; Rudak, B.; Rulten, C. B.; Sahakian, V.; Saito, S.; Salek, D.; Sanchez, D. A.; Santangelo, A.; Sasaki, M.; Schlickeiser, R.; Schüssler, F.; Schulz, A.; Schwanke, U.; Schwemmer, S.; Seglar-Arroyo, M.; Settimo, M.; Seyffert, A. S.; Shafi, N.; Shilon, I.; Simoni, R.; Sol, H.; Spanier, F.; Spengler, G.; Spies, F.; Stawarz, Ł.; Steenkamp, R.; Stegmann, C.; Stycz, K.; Sushch, I.; Takahashi, T.; Tavernet, J.-P.; Tavernier, T.; Taylor, A. M.; Terrier, R.; Tibaldo, L.; Tiziani, D.; Tluczykont, M.; Trichard, C.; Tsuji, N.; Tuffs, R.; Uchiyama, Y.; van der Walt, D. J.; van Eldik, C.; van Rensburg, C.; van Soelen, B.; Vasileiadis, G.; Veh, J.; Venter, C.; Viana, A.; Vincent, P.; Vink, J.; Voisin, F.; Völk, H. J.; Vuillaume, T.; Wadiasingh, Z.; Wagner, S. J.; Wagner, P.; Wagner, R. M.; White, R.; Wierzcholska, A.; Willmann, P.; Wörnlein, A.; Wouters, D.; Yang, R.; Zabalza, V.; Zaborov, D.; Zacharias, M.; Zanin, R.; Zdziarski, A. A.; Zech, A.; Zefi, F.; Ziegler, A.; Żywucka, N.

2018-04-01

Aims: We study γ-ray emission from the shell-type supernova remnant (SNR) RX J0852.0-4622 to better characterize its spectral properties and its distribution over the SNR. Methods: The analysis of an extended High Energy Spectroscopic System (H.E.S.S.) data set at very high energies (E > 100 GeV) permits detailed studies, as well as spatially resolved spectroscopy, of the morphology and spectrum of the whole RX J0852.0-4622 region. The H.E.S.S. data are combined with archival data from other wavebands and interpreted in the framework of leptonic and hadronic models. The joint Fermi-LAT-H.E.S.S. spectrum allows the direct determination of the spectral characteristics of the parent particle population in leptonic and hadronic scenarios using only GeV-TeV data. Results: An updated analysis of the H.E.S.S. data shows that the spectrum of the entire SNR connects smoothly to the high-energy spectrum measured by Fermi-LAT. The increased data set makes it possible to demonstrate that the H.E.S.S. spectrum deviates significantly from a power law and is well described by both a curved power law and a power law with an exponential cutoff at an energy of Ecut = (6.7 ± 1.2stat ± 1.2syst) TeV. The joint Fermi-LAT-H.E.S.S. spectrum allows the unambiguous identification of the spectral shape as a power law with an exponential cutoff. No significant evidence is found for a variation of the spectral parameters across the SNR, suggesting similar conditions of particle acceleration across the remnant. A simple modeling using one particle population to model the SNR emission demonstrates that both leptonic and hadronic emission scenarios remain plausible. It is also shown that at least a part of the shell emission is likely due to the presence of a pulsar wind nebula around PSR J0855-4644. A FITS image of the region of interest and two text files describing the H.E.S.S. spectrum of RX J0852.0-4622 are only available at the CDS via anonymous ftp to http://cdsarc.u-strasbg.fr (http

Zidovudine ameliorates pathology in the mouse model of Duchenne muscular dystrophy via P2RX7 purinoceptor antagonism.

Science.gov (United States)

Al-Khalidi, Rasha; Panicucci, Chiara; Cox, Paul; Chira, Natalia; Róg, Justyna; Young, Christopher N J; McGeehan, Rhiannon E; Ambati, Kameshwari; Ambati, Jayakrishna; Zabłocki, Krzysztof; Gazzerro, Elisabetta; Arkle, Stephen; Bruno, Claudio; Górecki, Dariusz C

2018-04-11

Duchenne muscular dystrophy (DMD) is the most common inherited muscle disorder that causes severe disability and death of young men. This disease is characterized by progressive muscle degeneration aggravated by sterile inflammation and is also associated with cognitive impairment and low bone density. Given that no current treatment can improve the long-term outcome, approaches with a strong translational potential are urgently needed. Duchenne muscular dystrophy (DMD) alters P2RX7 signaling in both muscle and inflammatory cells and inhibition of this receptor resulted in a significant attenuation of muscle and non-muscle symptoms in DMD mdx mouse model. As P2RX7 is an attractive target in a range of human diseases, specific antagonists have been developed. Yet, these will require lengthy safety testing in the pediatric population of Duchenne muscular dystrophy (DMD) patients. In contrast, Nucleoside Reverse Transcriptase Inhibitors (NRTIs) can act as P2RX7 antagonists and are drugs with an established safety record, including in children. We demonstrate here that AZT (Zidovudine) inhibits P2RX7 functions acting via the same allosteric site as other antagonists. Moreover, short-term AZT treatment at the peak of disease in DMD mdx mice attenuated the phenotype without any detectable side effects. Recovery was evident in the key parameters such as reduced sarcolemma permeability confirmed by lower serum creatine kinase levels and IgG influx into myofibres, decreased inflammatory cell numbers and inflammation markers in leg and heart muscles of treated mice. Moreover, this short-term therapy had some positive impact on muscle strength in vivo and no detrimental effect on mitochondria, which is the main side-effect of Nucleoside Reverse Transcriptase Inhibitors (NRTIs). Given these results, we postulate that AZT could be quickly re-purposed for the treatment of this highly debilitating and lethal disease. This approach is not constrained by causative DMD mutations and

Environmental application of XRF, ICP-AES and INAA on biological matrix

International Nuclear Information System (INIS)

Zararsiz, A.; Dogangun, A.; Tuncel, S.

2004-01-01

Full text: It is very important to determine trace quantities of metals in different matrices with high accuracy since the metals are used as markers for different sources in air pollution studies. In this study, the analytical capabilities of XRF, ICP-AES and INM techniques on a biological matrix namely lichens, which are widely used as bio monitoring organisms for the pollutants mapping in the atmosphere, were tested. Lichen samples were collected in Aegean Region of Turkey where pollution is an important issue. 9 elements were determined by XRF, 14 elements by ICP-AES and 13 elements by INM. Quality assurance was achieved using lichen SRM (IAEA-336) and Orchard leaves SRM (NIST- 1571). Produced data are subjected to statistical tests, like t-test, Q-test in order to determine the accuracy and precision of each technique. A recommendation list of the proper analytical technique is obtained for determination of each specific element considering analytical capabilities of ICP-AES, XRF and INM. As a result we can recommend that the first choice for Cd, Cu, Mg is ICP-AES, for In, K, Rb is INAA, for Br is XRF, if the concentrations are not close to the detection limit of XRF. For V, Cr, AI, Na, Fe ICP-AES and INM are both well, for Pb ICP-AES and XRF are both well, if the concentrations are not close to the detection limit of XRF, for Mn and Ca INM, XRF and ICP-AES are all give similar results for this type of biological matrix

XPS, AES and laser raman spectroscopy: A fingerprint for a materials surface characterisation

International Nuclear Information System (INIS)

Zaidi Embong

2011-01-01

This review briefly describes some of the techniques available for analysing surfaces and illustrates their usefulness with a few examples such as a metal and alloy. In particular, Auger electron spectroscopy (AES), X-ray photoelectron spectroscopy (XPS) and laser Raman spectroscopy are all described as advanced surface analytical techniques. In analysing a surface, AES and XPS would normally be considered first, with AES being applied where high spatial resolution is required and XPS where chemical state information is needed. Laser Raman spectroscopy is useful for determining molecular bonding. A combination of XPS, AES and Laser Raman spectroscopy can give quantitative analysis from the top few atomic layers with a lateral spatial resolution of < 10 nm. (author)

High magnetic field study of HoBaCo2O5.5 and GdBaCo2O5.5 layered cobaltites: the effect of rare-earth size

International Nuclear Information System (INIS)

Frontera, C.; Respaud, M.; Garcia-Munoz, J.L.; Llobet, A.; Carrillo, A.E.; Caneiro, A.; Broto, J.M.

2004-01-01

By means of high-pulsed magnetic field up to μ 0 H=32 T we have studied HoBaCo 2 O 5+δ (δ=0.52(1)). The high-field M(H) integrated curves evidence a magnetic field-induced phase transition visible from about T=75 to 275 K. The obtained results are compared with the field-induced transition found for GdBaCo 2 O 5+δ (with δ=0.54(2)). The jump of the magnetization at the field-induced transition is independent of the rare earth at this level of oxygen content. In contrast, we have observed larger values of the critical field, and that the transition persists up to higher temperature, when reducing the rare-earth size. This indicates that the low-temperature antiferromagnetic phase becomes more stable when the size of the rare earth is reduced

P2RX7 purinoceptor: a therapeutic target for ameliorating the symptoms of duchenne muscular dystrophy.

Directory of Open Access Journals (Sweden)

Anthony Sinadinos

2015-10-01

Full Text Available Duchenne muscular dystrophy (DMD is the most common inherited muscle disease, leading to severe disability and death in young men. Death is caused by the progressive degeneration of striated muscles aggravated by sterile inflammation. The pleiotropic effects of the mutant gene also include cognitive and behavioral impairments and low bone density. Current interventions in DMD are palliative only as no treatment improves the long-term outcome. Therefore, approaches with a translational potential should be investigated, and key abnormalities downstream from the absence of the DMD product, dystrophin, appear to be strong therapeutic targets. We and others have demonstrated that DMD mutations alter ATP signaling and have identified P2RX7 purinoceptor up-regulation as being responsible for the death of muscles in the mdx mouse model of DMD and human DMD lymphoblasts. Moreover, the ATP-P2RX7 axis, being a crucial activator of innate immune responses, can contribute to DMD pathology by stimulating chronic inflammation. We investigated whether ablation of P2RX7 attenuates the DMD model mouse phenotype to assess receptor suitability as a therapeutic target.Using a combination of molecular, histological, and biochemical methods and behavioral analyses in vivo we demonstrate, to our knowledge for the first time, that genetic ablation of P2RX7 in the DMD model mouse produces a widespread functional attenuation of both muscle and non-muscle symptoms. In dystrophic muscles at 4 wk there was an evident recovery in key functional and molecular parameters such as improved muscle structure (minimum Feret diameter, p < 0.001, increased muscle strength in vitro (p < 0.001 and in vivo (p = 0.012, and pro-fibrotic molecular signatures. Serum creatine kinase (CK levels were lower (p = 0.025, and reduced cognitive impairment (p = 0.006 and bone structure alterations (p < 0.001 were also apparent. Reduction of inflammation and fibrosis persisted at 20 mo in leg (p = 0

Evolution of microstructure and hardness of AE42 alloy after heat treatments

DEFF Research Database (Denmark)

Huang, Y.D.; Dieringa, H.; Hort, N.

2008-01-01

properties even further. It is shown that the microstructure of the squeeze-cast AE42 alloy is stable at high temperature 450 degrees C. The subsequent solution and ageing treatments have a limited effect on the hardness. The weak age-hardening is attributed to the precipitation of small amount Of Mg17Al12......The AE42 magnesium alloy was developed for high pressure die casting (HPDC) from low-aluminum magnesium alloys. In this alloy the rare earth (RE) elements were shown to increase creep resistance by forming AlxREy intermetallics along the grain boundaries. The present work investigates...... the microstructure of squeeze cast AE42 magnesium alloy and evaluates its hardness before and after heat treatments. The change in hardness is discussed based on the microstructural observations. Some suggestions are given concerning future design of alloy compositions in order to improve high temperature creep...

Decoupling of TX and RX antennas in a full-duplex mobile terminal

DEFF Research Database (Denmark)

Foroozanfard, Ehsan; Carvalho, Elisabeth De; Pedersen, Gert F.

2016-01-01

In this paper, a Full-duplex (FD) antenna system is presented with a high isolation between the TX and RX antennas. The isolation method is based on utilizing balanced antennas to localize the current on the ground plane and single mode excitation of the ground plane with capacitive coupling...... elements. The simulation results show a promising isolation level of 75 dB. User impact investigation on the antenna isolation, antenna matching and efficiency is presented. The isolation level varies from 60 dB to 30 dB in the worst user scenarios. The proposed antenna system can be used in a MISO/SIMO FD...

PIXE analysis of human stones: comparison with data from ICP-AES

International Nuclear Information System (INIS)

Pougnet, M.A.B.; Peisach, M.; Pineda, C.A.; Rodgers, A.L.

1987-01-01

25 human stone samples previously analyzed by inductively coupled plasma atomic emission spectroscopy (ICP-AES) and the IAEA Animal Bone Standard Reference Material were used to evaluate trace element analysis by PIXE. Bombardment with 4 MeV protons was used for the determination of Mn, Fe, Cu, Pb, Br, Rb, Sr and Ca. PIXE and ICP-AES data gave correlation factors better than 0.97 for the elements Ca, Fe, Zn, Sr and Pb. (author) 9 refs.; 5 figs

Corrosion of Zn5Al and Zn55Al alloys with cerium, praseodymium and neodymium

International Nuclear Information System (INIS)

Alikhanova, S.D.

2017-01-01

The present work is devoted to corrosion of Zn5Al and Zn55Al alloys with cerium, praseodymium and neodymium. The purpose of present work is elaboration of optimal composition of zinc-aluminium alloys Zn5Al and Zn55Al alloyed by rare-earth metals of cerium subgroup which are used as anode covers for protection of steel from corrosion. Therefore, the regularities of change of corrosion-electrochemical properties in various corrosive mediums have been determined; processes mechanisms of high temperature oxidation of alloys in solid state have been studied; in the products of alloys oxidation their phase components have been defined and their role in the corrosion process have been revealed; the optimal compositions of zinc-aluminium alloys alloyed by rare earth metals, which are protected by two patents of the Republic of Tajikistan have been elaborated.

Multiple Lookup Table-Based AES Encryption Algorithm Implementation

Science.gov (United States)

Gong, Jin; Liu, Wenyi; Zhang, Huixin

Anew AES (Advanced Encryption Standard) encryption algorithm implementation was proposed in this paper. It is based on five lookup tables, which are generated from S-box(the substitution table in AES). The obvious advantages are reducing the code-size, improving the implementation efficiency, and helping new learners to understand the AES encryption algorithm and GF(28) multiplication which are necessary to correctly implement AES[1]. This method can be applied on processors with word length 32 or above, FPGA and others. And correspondingly we can implement it by VHDL, Verilog, VB and other languages.

AES/STEM grain boundary analysis of stabilized zirconia ceramics

NARCIS (Netherlands)

Winnubst, Aloysius J.A.; Kroot, P.J.M.; Burggraaf, A.J.

1983-01-01

Semiquantitative Auger Electron Spectroscopy (AES) on pure monophasic (ZrO2)0.83(YO1.5)0.17 was used to determine the chemical composition of the grain boundaries. Grain boundary enrichment with Y was observed with an enrichment factor of about 1.5. The difference in activation energy of the ionic

TX-RX isolation method based on polarization diversity, spatial diversity and TX beamforming

DEFF Research Database (Denmark)

Foroozanfard, Ehsan; Carvalho, Elisabeth De; Pedersen, Gert F.

2016-01-01

In this paper, the feasibility of an antenna isolation technique based on null-steer beamforming, polarization diversity and spatial diversity is investigated. The proposed system consists of six patch antennas which are fed by a feeding network to obtain a null-steer beamformer. To achieve spatial...... diversity, antenna elements are located on two layers, facing in a different direction. Moreover, the antenna elements in two layers use different polarization. The measured results of the antenna system present a high TX-RX isolation in the order of 70 dB which shows the feasibility of such a system...

Functional diversity for biomass deconstruction in family 5 subfamily 5 (GH5_5) of fungal endo-β1,4-glucanases.

Science.gov (United States)

Li, Bingyao; Walton, Jonathan D

2017-05-01

Endo-β1,4-glucanases in glycosyl hydrolase family 5 (GH5) are ubiquitous enzymes in the multicellular fungi and are common components of enzyme cocktails for biomass conversion. We recently showed that an endo-glucanase of subfamily 5 of GH5 (GH5_5) from Sporotrichum thermophile (StCel5A) was more effective at releasing glucose from pretreated corn stover, when part of an eight-component synthetic enzyme mixture, compared to its closely related counterpart from Trichoderma reesei, TrCel5A. StCel5A and TrCel5A belong to different clades of GH5_5 (GH5_5_1 and GH5_5_2, respectively). To test whether the superior activity of StCel5A was a general property of all enzymes in the GH5_5_2 clade, StCel5A, TrCel5A, and two additional members of each subfamily were expressed in a common host that had been engineered to suppress its native cellulases (T. reesei Δxyr1) and compared against each other alone on pure substrates, in synthetic mixtures on pure substrates, and against each other in synthetic mixtures on real biomass. The results indicated that superiority is a unique property of StCel5A and not of GH5_5_2 generally. The six Cel5A enzymes had significant differences in relative activities on different substrates, in specific activities, and in sensitivities to mannan inhibition. Importantly, the behavior of the six endo-glucanases on pure cellulose substrates did not predict their behavior in combination with other cellulolytic enzymes on a real lignocellulosic biomass substrate.

Modeling a High Explosive Cylinder Experiment

Science.gov (United States)

Zocher, Marvin A.

2017-06-01

Cylindrical assemblies constructed from high explosives encased in an inert confining material are often used in experiments aimed at calibrating and validating continuum level models for the so-called equation of state (constitutive model for the spherical part of the Cauchy tensor). Such is the case in the work to be discussed here. In particular, work will be described involving the modeling of a series of experiments involving PBX-9501 encased in a copper cylinder. The objective of the work is to test and perhaps refine a set of phenomenological parameters for the Wescott-Stewart-Davis reactive burn model. The focus of this talk will be on modeling the experiments, which turned out to be non-trivial. The modeling is conducted using ALE methodology.

Synthesis and Determination of Acid Dissociation Constants in Dimethyl Sulfoxide–Water Hydroorganic Solvent of 5,5-Diphenylpyrrolidine N-Aroylthiourea Derivatives

Directory of Open Access Journals (Sweden)

Yahya Nural

2017-08-01

Full Text Available Novel 5,5-diphenylpyrrolidineN-aroylthioureas, containing 4-methylbenzoyl, 2-chlorobenzoyl,2,4-dichlorobenzoyl, and2-naphthoyl, were synthesized and their structural analysis was performed using 1H nuclear magnetic resonance (NMR, 13C NMR, Fourier transform infrared spectroscopy, mass spectrometry (MS, and high-resolution MS (HRMS techniques. The acid dissociation constants of the 5,5-diphenylpyrrolidineN-aroylthiourea derivative compounds were determined using Hyperquad computer program for data obtained using potentiometric titration method in 25% (v/v dimethyl sulfoxide–water hydroorganic solvent in the presence of 0.1 mol×L-1 ionic strength of NaCl and in the acidic medium at 25±0.1°C, using sodium hydroxide base as a titrant. Two acid dissociation constants were obtained for 3a, 3b, and 3d, and it was suggested that they were related to N-H and enol groups. Furthermore, three acid dissociation constants obtained for 3a indicated that they were related to N-H, enthiol, and enol groups, and four acid dissociation constants obtained for 3c suggested that they were related to N-H, enthiol, enol, and carboxyl groups.

Characterization of Aes nuclear foci in colorectal cancer cells

Science.gov (United States)

Itatani, Yoshiro; Sonoshita, Masahiro; Kakizaki, Fumihiko; Okawa, Katsuya; Stifani, Stefano; Itoh, Hideaki; Sakai, Yoshiharu; Taketo, M. Mark

2016-01-01

Amino-terminal enhancer of split (Aes) is a member of Groucho/Transducin-like enhancer (TLE) family. Aes is a recently found metastasis suppressor of colorectal cancer (CRC) that inhibits Notch signalling, and forms nuclear foci together with TLE1. Although some Notch-associated proteins are known to form subnuclear bodies, little is known regarding the dynamics or functions of these structures. Here, we show that Aes nuclear foci in CRC observed under an electron microscope are in a rather amorphous structure, lacking surrounding membrane. Investigation of their behaviour during the cell cycle by time-lapse cinematography showed that Aes nuclear foci dissolve during mitosis and reassemble after completion of cytokinesis. We have also found that heat shock cognate 70 (HSC70) is an essential component of Aes foci. Pharmacological inhibition of the HSC70 ATPase activity with VER155008 reduces Aes focus formation. These results provide insight into the understanding of Aes-mediated inhibition of Notch signalling. PMID:26229111

Optimization of DIII-D discharges to avoid AE destabilization

Science.gov (United States)

Varela, Jacobo; Spong, Donald; Garcia, Luis; Huang, Juan; Murakami, Masanori

2017-10-01

The aim of the study is to analyze the stability of Alfven Eigenmodes (AE) perturbed by energetic particles (EP) during DIII-D operation. We identify the optimal NBI operational regimes that avoid or minimize the negative effects of AE on the device performance. We use the reduced MHD equations to describe the linear evolution of the poloidal flux and the toroidal component of the vorticity in a full 3D system, coupled with equations of density and parallel velocity moments for the energetic particles, including the effect of the acoustic modes. We add the Landau damping and resonant destabilization effects using a closure relation. We perform parametric studies of the MHD and AE stability, taking into account the experimental profiles of the thermal plasma and EP, also using a range of values of the energetic particles β, density and velocity as well the effect of the toroidal couplings. We reproduce the AE activity observed in high poloidal β discharge at the pedestal and reverse shear discharges. This material based on work is supported both by the U.S. Department of Energy, Office of Science, under Contract DE-AC05-00OR22725 with UT-Battelle, LLC. Research sponsored in part by the Ministerio de Economia y Competitividad of Spain under the project.

Point-Defect Mediated Bonding of Pt Clusters on (5,5) Carbon Nanotubes

DEFF Research Database (Denmark)

Wang, J. G.; Lv, Y. A.; Li, X. N.

2009-01-01

The adhesion of various sizes of Pt clusters on the metallic (5,5) carbon nanotubes (CNTs) with and without the point defect has been investigated by means of density functional theory (DFT). The calculations show that the binding energies of Pt-n (n = 1-6) clusters on the defect free CNTs are more......). The stronger orbital hybridization between the Pt atom and the carbon atom shows larger charge transfers on the defective CNTs than on the defect free CNTs, which allows the strong interaction between Pt clusters and CNTs. On the basis of DFT calculations, CNTs with point defect can be used as the catalyst...

Changes in histopathology and cytokeratin AE1/AE3 expression in skin graft with different time on Indonesian local cats.

Science.gov (United States)

Erwin; Etriwati; Gunanti; Handharyani, Ekowati; Noviana, Deni

2017-06-01

A good skin graft histopathology is followed by formation of hair follicle, sweat gland, sebaceous gland, blood vessel, lightly dense connective tissue, epidermis, and dermis layer. This research aimed to observe histopathology feature and cytokeratin AE1/AE3 expression on cat skin post skin grafting within a different period of time. Nine male Indonesian local cats aged 1-2 years old weighing 3-4 kg were separated into three groups. First surgery created defect wound of 2 cm × 2 cm in size to whole groups. The wounds were left alone for several days, differing in interval between each group, respectively: Group I (for 2 days), Group II (for 4 days), and Group III (for 6 days). The second surgery was done to each group which harvested skin of thoracic area and applied it on recipient wound bed. On day 24 th post skin graft was an examination of histopathology and cytokeratin AE1/AE3 immunohistochemistry. Group I donor skin's epidermis layer had not formed completely whereas epidermis of donor skin of Groups II and III had completely formed. In all group hair follicle, sweat gland, sebaceous gland, and neovascularization were found. The density of connective tissue in Group I was very solid than other groups. Cytokeratin AE1/AE3 expression was found on donor skin's epithelial cell in epidermis and dermis layer with very brown intensity for Group II, brown intensity for Group II, and lightly brown for Group I. Histopathological structure and cytokeratin AE1/AE3 expression post skin graft are better in Groups II and III compared to Group I.

Theoretical characterization of quaternary iridium based hydrides NaAeIrH{sub 6} (Ae = Ca, Ba and Sr)

Energy Technology Data Exchange (ETDEWEB)

Bouras, S. [Laboratory of Studies Surfaces and Interfaces of Solids Materials, Department of Physics, Faculty of Science, University of Setif 1, 19000 (Algeria); Ghebouli, B., E-mail: bghebouli@yahoo.fr [Laboratory of Studies Surfaces and Interfaces of Solids Materials, Department of Physics, Faculty of Science, University of Setif 1, 19000 (Algeria); Benkerri, M. [Laboratory of Studies Surfaces and Interfaces of Solids Materials, Department of Physics, Faculty of Science, University of Setif 1, 19000 (Algeria); Ghebouli, M.A., E-mail: med.amineghebouli@yahoo.fr [Microelectronic Laboratory (LMSE), University of Bachir Ibrahimi, Bordj-Bou-Arreridj 34000 (Algeria); Research Unit on Emerging Materials (RUEM), University of Setif 1, 19000 (Algeria); Choutri, H. [Microelectronic Laboratory (LMSE), University of Bachir Ibrahimi, Bordj-Bou-Arreridj 34000 (Algeria); Louail, L.; Chihi, T.; Fatmi, M. [Research Unit on Emerging Materials (RUEM), University of Setif 1, 19000 (Algeria); Bouhemadou, A. [Laboratory for Developing New Materials and Their Characterization, Department of Physics, Faculty of Science, University of Setif 1, 19000 (Algeria); Department of Physics and Astronomy, College of Science, King Saud University, P.O. Box 2455, Riyadh 11451 (Saudi Arabia); Khenata, R.; Khachai, H. [Laboratoire de Physique Quantique et de Modélisation Mathématique, Université de Mascara, 29000 (Algeria)

2015-01-15

The quaternary iridium based hydrides NaAeIrH{sub 6} (Ae = Ca, Ba and Sr) are promising candidates as hydrogen storage materials. We have studied the structural, elastic, electronic, optical and thermodynamic properties of NaAeIrH{sub 6} (Ae = Ca, Ba and Sr) within the generalized gradient approximation, the local density approximation (LDA) and mBj in the frame of density functional perturbation theory. These alloys have a large indirect Γ–X band gap. The thermodynamic functions were computed using the phonon density of states. The origin of the possible transitions from valence band to conduction band was illustrated. By using the complex dielectric function, the optical properties such as absorption, reflectivity, loss function, refractive index and optical conductivity have been obtained. - Graphical abstract: Real and imaginary parts of the dielectric function, the absorption spectrum α(ω), reflectivity R(ω) and energy-loss spectrum L(ω). - Highlights: • NaAeIrH{sub 6} (Ae = Ca, Ba and Sr) alloys have been investigated. • The elastic moduli, energy gaps are predicted. • The optical and thermal properties were studied.

On the Mechanism of Berberine-INF55 (5-Nitro-2-phenylindole) Hybrid Antibacterials.

Science.gov (United States)

Dolla, Naveen K; Chen, Chao; Larkins-Ford, Jonah; Rajamuthiah, Rajmohan; Jagadeesan, Sakthimala; Conery, Annie L; Ausubel, Frederick M; Mylonakis, Eleftherios; Bremner, John B; Lewis, Kim; Kelso, Michael J

Berberine-INF55 hybrids are a promising class of antibacterials that combine berberine and the NorA multidrug resistance pump inhibitor INF55 (5-nitro-2-phenylindole) together in one molecule via a chemically stable linkage. Previous studies demonstrated the potential of these compounds for countering efflux-mediated antibacterial drug resistance but they didn't establish whether the compounds function as originally intended, i.e. with the berberine moiety providing antibacterial activity and the attached INF55 component independently blocking multidrug resistance pumps, thereby enhancing the activity of berberine by reducing its efflux. We hypothesised that if the proposed mechanism is correct, then hybrids carrying more potent INF55 pump inhibitor structures should show enhanced antibacterial effects relative to those bearing weaker inhibitors. Two INF55 analogues showing graded reductions in NorA inhibitory activity compared with INF55 were identified and their corresponding berberine-INF55 hybrids carrying equivalent INF55 inhibitor structures synthesised. Multiple assays comparing the antibacterial effects of the hybrids and their corresponding berberine-INF55 analogue combinations showed that the three hybrids all show very similar activities, leading us to conclude that the antibacterial mechanism(s) of berberine-INF55 hybrids is different from berberine-INF55 combinations.

Dynamic AES – Extending the Lifetime?

DEFF Research Database (Denmark)

Tange, Henrik; Andersen, Birger

2014-01-01

proven that AES is vulnerable to side-channelattacks, related sub-key attacks and biclicque attacks. This paper introducesa new dynamic version of AES where the main flow is depending on theTNAF (τ -adic Non-Adjacent Form) value. This new approach can preventside-channel attacks, related sub-key attacks...... and biclique attacks....

Biodegradation of Nitro-Substituted Explosives 2,4,6-Trinitrotoluene, Hexahydro-1,3,5-Trinitro-1,3,5-Triazine, and Octahydro-1,3,5,7-Tetranitro-1,3,5-Tetrazocine by a Phytosymbiotic Methylobacterium sp. Associated with Poplar Tissues (Populus deltoides × nigra DN34)

Science.gov (United States)

Van Aken, Benoit; Yoon, Jong Moon; Schnoor, Jerald L.

2004-01-01

A pink-pigmented symbiotic bacterium was isolated from hybrid poplar tissues (Populus deltoides × nigra DN34). The bacterium was identified by 16S and 16S-23S intergenic spacer ribosomal DNA analysis as a Methylobacterium sp. (strain BJ001). The isolated bacterium was able to use methanol as the sole source of carbon and energy, which is a specific attribute of the genus Methylobacterium. The bacterium in pure culture was shown to degrade the toxic explosives 2,4,6-trinitrotoluene (TNT), hexahydro-1,3,5-trinitro-1,3,5-triazene (RDX), and octahydro-1,3,5,7-tetranitro-1,3,5-tetrazocine (HMX). [U-ring-14C]TNT (25 mg liter−1) was fully transformed in less than 10 days. Metabolites included the reduction derivatives amino-dinitrotoluenes and diamino-nitrotoluenes. No significant release of 14CO2 was recorded from [14C]TNT. In addition, the isolated methylotroph was shown to transform [U-14C]RDX (20 mg liter−1) and [U-14C]HMX (2.5 mg liter−1) in less than 40 days. After 55 days of incubation, 58.0% of initial [14C]RDX and 61.4% of initial [14C]HMX were mineralized into 14CO2. The radioactivity remaining in solution accounted for 12.8 and 12.7% of initial [14C]RDX and [14C]HMX, respectively. Metabolites detected from RDX transformation included a mononitroso RDX derivative and a polar compound tentatively identified as methylenedinitramine. Since members of the genus Methylobacterium are distributed in a wide diversity of natural environments and are very often associated with plants, Methylobacterium sp. strain BJ001 may be involved in natural attenuation or in situ biodegradation (including phytoremediation) of explosive-contaminated sites. PMID:14711682

Impulsive shock induced single drop steam explosion visualized by high-speed x-ray radiography and photography - metallic melt

International Nuclear Information System (INIS)

Park, H. S.; Hansson, R. C.; Sehgal, B. R.

2003-01-01

Experimental investigation of fine fragmentation process during vapor explosion was conducted in a small-scale single drop system employing continuous high-speed X-ray radiography and photography. A molten tin drop of about 0.7 g at approximately 1000 .deg. C was dropped into a water pool, at temperatures ranging from 20 to 90 .deg. C, and the explosion was triggered by an external shock pulse of about 1 MPa. X-ray radiographs show that finely fragmented melt particles accelerates to the vapor bubble boundary and forms a particle shell during the period of vapor bubble expansion due to vapor explosions. From the photographs, it was possible to observe a number of counter-jets on the vapor boundary. For tests with highly subcooled coolant, local explosion due to external impulsive shock trigger initiates the stratified mode of explosion along the entire melt surface. For tests with lower subcooled coolant local explosions were initiated by an external impulsive shock trigger and by collapse of vapor/gas pocket attached on the top of the melt drop. Transient spatial distribution map of melt fragments during vapor explosion was obtained by a series of image processing and calibration tests

Proof testing of an explosion containment vessel

Energy Technology Data Exchange (ETDEWEB)

Esparza, E.D. [Esparza (Edward D.), San Antonio, TX (United States); Stacy, H.; Wackerle, J. [Los Alamos National Lab., NM (United States)

1996-10-01

A steel containment vessel was fabricated and proof tested for use by the Los Alamos National Laboratory at their M-9 facility. The HY-100 steel vessel was designed to provide total containment for high explosives tests up to 22 lb (10 kg) of TNT equivalent. The vessel was fabricated from an 11.5-ft diameter cylindrical shell, 1.5 in thick, and 2:1 elliptical ends, 2 in thick. Prior to delivery and acceptance, three types of tests were required for proof testing the vessel: a hydrostatic pressure test, air leak tests, and two full design charge explosion tests. The hydrostatic pressure test provided an initial static check on the capacity of the vessel and functioning of the strain instrumentation. The pneumatic air leak tests were performed before, in between, and after the explosion tests. After three smaller preliminary charge tests, the full design charge weight explosion tests demonstrated that no yielding occurred in the vessel at its rated capacity. The blast pressures generated by the explosions and the dynamic response of the vessel were measured and recorded with 33 strain channels, 4 blast pressure channels, 2 gas pressure channels, and 3 displacement channels. This paper presents an overview of the test program, a short summary of the methodology used to predict the design blast loads, a brief description of the transducer locations and measurement systems, some of the hydrostatic test strain and stress results, examples of the explosion pressure and dynamic strain data, and some comparisons of the measured data with the design loads and stresses on the vessel.

Motivation for a High Explosive Testing Program in South Africa

Science.gov (United States)

2015-12-04

environment for several decades. Much has been learned about the impact of high in situ stress and its influence on rock bursts (violent rock ...is the possibility of evasive nuclear testing in deep mine environments where the release of high stress fields by an explosion can resemble a rock ... burst or natural earthquake. This paper provides background information on previous research in and around the deep mines of South Africa and lays

iVCJ: A tool for Interactive Visualization of high explosives CJ states

Energy Technology Data Exchange (ETDEWEB)

Wooten, Hasani Omar [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Aslam, Tariq Dennis [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Whitley, Von Howard [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

2016-12-12

A graphical user interface (GUI) tool has been developed that facilitates the visualization and analysis of the Chapman-Jouguet state for high explosives gaseous products using the Jones- Wilkins-Lee equation of state.

Biodegradation of the High Explosive Hexanitrohexaazaiso-wurtzitane (CL-20)

OpenAIRE

Karakaya, Pelin; Christodoulatos, Christos; Koutsospyros, Agamemnon; Balas, Wendy; Nicolich, Steve; Sidhoum, Mohammed

2009-01-01

The aerobic biodegradability of the high explosive CL-20 by activated sludge and the white rot fungus Phanerochaete chrysosporium has been investigated. Although activated sludge is not effective in degrading CL-20 directly, it can mineralize the alkaline hydrolysis products. Phanerochaete chrysosporium degrades CL-20 in the presence of supplementary carbon and nitrogen sources. Biodegradation studies were conducted using various nutrient media under diverse conditions. Variables included the...

Information Rx Program Requires More Promotion, More Support and Some Adjustment. A Review of: Meeks, K. (2009. Information Rx: Promotion and utilization by Georgia librarians and the Georgia American College of Physicians. Journal of Consumer Health on the Internet, 13, 129-134.

Directory of Open Access Journals (Sweden)

Matthew Thomas

2010-12-01

Full Text Available Objective – To determine the level of awareness of the Information Rx program by Georgia librarians and Georgia American College of Physicians (GACP members, and the use of Information Rx pads, with which physicians would “prescribe” information for their patients.Design – Descriptive (surveys and interviews.Setting – Georgia, U.S. Surveys were distributed and responded to online. The face-to-face interview locations were not specified.Subjects – One survey, which was provided to the Georgia American College of Physicians (GACP membership including internal medicine physicians and medical students interested in internal medicine, had 46 respondents. The second survey was sent to librarians who were members of the Georgia Public Library Service (GPLS and the Georgia Health Sciences Library Association (GHSLA. There were 72 public librarians, 14 hospital librarians and 13 academic medical librarians who responded (as well as 6 not specified in the article. A select group of four medical librarians was chosen for more in-depth interviews. The number of surveys sent out was not provided.Methods – Two online surveys, one for physicians and one for librarians, were administered. No information concerning response rate was provided. Face-to-face interviews with four academic medical librarians were conducted. No further information about the interviewing process was provided such as who conducted the interviews, methods used to ensure objectivity or consistency, or where the interviews were conducted.Main Results – Out of 46 GACP survey respondents, only 4 were familiar with the Information Rx program and only 2 of those had used the information Rx pads, neither of whom had referred anyone to a library for further assistance. The two who had not used the pads were either too busy or didn’t understand the program well enough. Of 105 librarian survey respondents, 46 had heard of Information Rx, 37 had received Information Rx promotional

Feasibility and early outcome of high-dose-rate Ir-192 brachytherapy as monotherapy in two fractions within 1 day for high-/very high-risk prostate cancer.

Science.gov (United States)

Ashida, Shingo; Yamasaki, Ichiro; Tamura, Kenji; Shimamoto, Tsutomu; Inoue, Keiji; Kariya, Shinji; Kobayashi, Kana; Yamagami, Takuji; Shuin, Taro

2016-05-01

The aim of the present study was to evaluate the feasibility and preliminary outcomes of high-dose-rate (HDR)-brachytherapy as a monotherapy in two fractions within 1 day for localized prostate cancer, including high-/very high-risk cases. Among the 68 patients treated with HDR monotherapy between July 2011 and December 2014, 65 had a minimal follow-up of 12 months without adjuvant androgen deprivation therapy and were enrolled in the present study [42/65 (64.6%) exhibited high-/very high-risk diseases]. HDR monotherapy was performed in two fractions with a minimal interval of 6 h and the prescribed dose was 13.5 Gy (×2). Adverse events (AEs) were assessed using Common Terminology Criteria for Adverse Events (version 4; http://ctep.cancer.gov/protocolDevelopment/electronic_applications/ctc.htm#ctc_40), and biochemical failure was assessed by the Phoenix definition. The median follow-up time was 30.1 months. The majority of patients had Grade 0-1 acute AEs. Four patients (6.2%) exhibited urinary retention, requiring a Foley catheter. Grade 3 acute AEs occurred at a frequency of 3.1% and hematuria at 1.5%. The majority of patients also exhibited Grade 0-1 chronic AEs. Grade 3 chronic AEs occurred at a frequency of 1.5% and urethral stricture at 1.5%, for which endoscopic treatment was indicated. Acute and chronic gastrointestinal AEs were uncommon, and no Grade 3 or above AEs developed. Biochemical failure occurred in 4 patients who all exhibited high-/very high-risk diseases. Kaplan-Meier estimated that 3 year biochemical failure-free survival was 91.6% overall and 88.0% in high-/very high-risk cases. The present two-fraction 1 day HDR monotherapy is feasible with minimal AEs and achieved acceptable biochemical control of localized prostate cancer, including high-/very high-risk cases, although long-term follow-up is required.

Dosimetry of 64Cu-DOTA-AE105, a PET tracer for uPAR imaging

DEFF Research Database (Denmark)

Persson, Morten; El Ali, Henrik H.; Binderup, Tina

2014-01-01

64Cu-DOTA-AE105 is a novel positron emission tomography (PET) tracer specific to the human urokinase-type plasminogen activator receptor (uPAR). In preparation of using this tracer in humans, as a new promising method to distinguish between indolent and aggressive cancers, we have performed PET...... studies in mice to evaluate the in vivo biodistribution and estimate human dosimetry of 64Cu-DOTA-AE105. MethodsFive mice received iv tail injection of 64Cu-DOTA-AE105 and were PET/CT scanned 1, 4.5 and 22h post injection. Volume-of-interest (VOI) were manually drawn on the following organs: heart, lung......Favorable dosimetry estimates together with previously reported uPAR PET data fully support human testing of 64Cu-DOTA-AE105....

1,3-Dibromo-5,5-dimethylhydantoin: a versatile catalyst for synthesis of 3,3-bis(indolyloxindoles

Directory of Open Access Journals (Sweden)

Seyyedeh Fatemeh Hojati

2013-10-01

Full Text Available A condensation of various isatins with indole derivatives has been carried out in the presence of 1,3-dibromo-5,5-dimethylhydantoin (DBDMH as catalyst at 50 °C in ethanol in order to form 3,3-bis(indolyl oxindoles. The products were obtained within 20-90 min by 70-96% yields. The efficacy of the procedure has been confirmed by catalyzing the condensation reaction of pyrrole which was used as another sort of heterocycle with indole to obtain its corresponding 3,3-bis(2-pyrrolyloxinole. A plausible mechanism of the condensation based on DBDMH activating role has also been proposed. DBDMH is an effective, commercially available, insensitive to moisture and easily handling catalyst. Simple procedure, easy work-up, mild reaction conditions, high yields and short reaction times are the highlighted points of reported method.

Rx for Consumer Health Information: The Magic is in the Right Source

OpenAIRE

Blue, Ana Rosa; Curry, Jane

2010-01-01

Health information is one of the most popular topics requested, in libraries, by the public. These handouts supported the session titled: "Rx for Consumer Health Information: The Magic is in the Right Source" presented at the 2010 BC Library Conference (theme: Seriously Entertaining: Learning through Fun and Games).

NA62 Level 0 trigger: TELDES, TX mezzanine, RX mezzanine integration scenario

CERN Multimedia

Lupi, Matteo

2015-01-01

TELDES is a TEL62 daughter-board used in the generation of the Liquid Krypton Calorimeter primitive for the Level 0 Trigger of the NA62 Experiment. TX and RX mezzanines are daughter boards used in the same trigger system to communicate between different levels of the trigger.

Prospects for Cherenkov Telescope Array Observations of the Young Supernova Remnant RX J1713.7−3946

Energy Technology Data Exchange (ETDEWEB)

Acero, F. [CEA/IRFU/SAp, CEA Saclay, Bat 709, Orme des Merisiers, F-91191 Gif-sur-Yvette (France); Aloisio, R.; Amato, E. [Osservatorio Astrofisico di Arcetri, Largo E. Fermi, 5, I-50125 Firenze (Italy); Amans, J. [LUTH and GEPI, Observatoire de Paris, CNRS, PSL Research University, 5 place Jules Janssen, F-92190, Meudon (France); Antonelli, L. A. [INAF—Osservatorio Astronomico di Roma, Via di Frascati 33, I-00040, Monteporzio Catone (Italy); Aramo, C. [INFN Sezione di Napoli, Via Cintia, ed. G, I-80126 Napoli (Italy); Armstrong, T. [Department of Physics and Centre for Advanced Instrumentation, Durham University, South Road, Durham DH1 3LE (United Kingdom); Arqueros, F.; Barrio, J. A. [Grupo de Altas Energías, Universidad Complutense de Madrid., Av Complutense s/n, E-28040 Madrid (Spain); Asano, K. [Institute for Cosmic Ray Research, University of Tokyo, 5-1-5, Kashi-wanoha, Kashiwa, Chiba 277-8582 (Japan); Ashley, M. [School of Physics, University of New South Wales, Sydney NSW 2052 (Australia); Backes, M. [University of Namibia, Department of Physics, 340 Mandume Ndemufayo Ave., Pioneerspark Windhoek (Namibia); Balazs, C. [School of Physics and Astronomy, Monash University, Melbourne, Victoria 3800 (Australia); Balzer, A. [Astronomical Institute Anton Pannekoek, University of Amsterdam, Science Park 904 1098 XH Amsterdam (Netherlands); Bamba, A. [Department of Physics, Graduate School of Science, University of Tokyo, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113-0033 (Japan); Barkov, M. [Riken, Institute of Physical and Chemical Research, 2-1 Hirosawa, Wako, Saitama, 351-0198 (Japan); Benbow, W. [Harvard-Smithsonian Center for Astrophysics, 60 Garden St., Cambridge, MA 02180 (United States); Bernlöhr, K., E-mail: sano@a.phys.nagoya-u.ac.jp, E-mail: nakamori@sci.kj.yamagata-u.ac.jp [Max-Planck-Institut für Kernphysik, Saupfercheckweg 1, D-69117 Heidelberg (Germany); and others

2017-05-10

We perform simulations for future Cherenkov Telescope Array (CTA) observations of RX J1713.7−3946, a young supernova remnant (SNR) and one of the brightest sources ever discovered in very high energy (VHE) gamma rays. Special attention is paid to exploring possible spatial (anti)correlations of gamma rays with emission at other wavelengths, in particular X-rays and CO/H i emission. We present a series of simulated images of RX J1713.7−3946 for CTA based on a set of observationally motivated models for the gamma-ray emission. In these models, VHE gamma rays produced by high-energy electrons are assumed to trace the nonthermal X-ray emission observed by XMM-Newton , whereas those originating from relativistic protons delineate the local gas distributions. The local atomic and molecular gas distributions are deduced by the NANTEN team from CO and H i observations. Our primary goal is to show how one can distinguish the emission mechanism(s) of the gamma rays (i.e., hadronic versus leptonic, or a mixture of the two) through information provided by their spatial distribution, spectra, and time variation. This work is the first attempt to quantitatively evaluate the capabilities of CTA to achieve various proposed scientific goals by observing this important cosmic particle accelerator.

Intrinsic defect process and O migration in PrBa(Co/Fe)2O5.5

KAUST Repository

Salawu, Omotayo Akande

2017-01-08

New mixed ion-electron conductors ar desired to lower the operating temperature of solid oxide fuel cells. The O Frenkel energy and migration of O ions in rBa(Co/Fe)2O5.5 are studied for this purpose by density functional theory. We demonstrate that Fe substitution strongly affects the formation of defects and consequently the O migration.

Parametric Explosion Spectral Model

Energy Technology Data Exchange (ETDEWEB)

Ford, S R; Walter, W R

2012-01-19

Small underground nuclear explosions need to be confidently detected, identified, and characterized in regions of the world where they have never before occurred. We develop a parametric model of the nuclear explosion seismic source spectrum derived from regional phases that is compatible with earthquake-based geometrical spreading and attenuation. Earthquake spectra are fit with a generalized version of the Brune spectrum, which is a three-parameter model that describes the long-period level, corner-frequency, and spectral slope at high-frequencies. Explosion spectra can be fit with similar spectral models whose parameters are then correlated with near-source geology and containment conditions. We observe a correlation of high gas-porosity (low-strength) with increased spectral slope. The relationship between the parametric equations and the geologic and containment conditions will assist in our physical understanding of the nuclear explosion source.

Explosive simulants for testing explosive detection systems

Science.gov (United States)

Kury, John W.; Anderson, Brian L.

1999-09-28

Explosives simulants that include non-explosive components are disclosed that facilitate testing of equipment designed to remotely detect explosives. The simulants are non-explosive, non-hazardous materials that can be safely handled without any significant precautions. The simulants imitate real explosives in terms of mass density, effective atomic number, x-ray transmission properties, and physical form, including moldable plastics and emulsions/gels.

Manufacturing of 5.5 Meter Diameter Cryogenic Fuel Tank Domes for the NASA Ares I Rocket

Science.gov (United States)

Jones, Ronald E.; Carter, Robert W.

2012-01-01

The Ares I rocket is the first launch vehicle scheduled for manufacture under the National Aeronautic and Space Administration s (NASA s) Constellation program. A series of full-scale Ares I development articles have been constructed on the Robotic Weld Tool at the NASA George C. Marshall Space Flight Center in Huntsville, Alabama. The Robotic Weld Tool is a 100 ton, 7-axis, robotic manufacturing system capable of machining and friction stir welding large-scale space hardware. This presentation will focus on the friction stir welding of 5.5m diameter cryogenic fuel tank components; specifically, the liquid hydrogen forward dome (LH2 MDA) and the common bulkhead manufacturing development articles (CBMDA). The LH2 MDA was the first full-scale, flight-like Ares I hardware produced under the Constellation Program. It is a 5.5m diameter elliptical dome assembly consisting of eight gore panels, a y-ring stiffener and a manhole fitting. All components are made from aluminum-lithium alloy 2195. Conventional and self-reacting friction stir welding was used on this article. Manufacturing solutions will be discussed including the implementation of photogrammetry, an advanced metrology technique, as well as fixtureless welding. The LH2 MDA is the first known fully friction stir welded dome ever produced. The completion of four Common Bulkhead Manufacturing Development Articles (CBMDA) will also be highlighted. Each CBMDA consists of a 5.5m diameter spun-formed dome friction stir welded to a y-ring stiffener. The domes and y-rings are made of aluminum 2014 and 2219 respectively. An overview of CBMDA manufacturing processes and the effect of tooling on weld defect formation will be discussed.

Characterization of ["1"1C]Lu AE92686 as a PET radioligand for phosphodiesterase 10A in the nonhuman primate brain

International Nuclear Information System (INIS)

Yang, Kai-Chun; Stepanov, Vladimir; Amini, Nahid; Martinsson, Stefan; Takano, Akihiro; Halldin, Christer; Nielsen, Jacob; Bundgaard, Christoffer; Bang-Andersen, Benny; Grimwood, Sarah; Farde, Lars; Finnema, Sjoerd J.

2017-01-01

["1"1C]Lu AE92686 is a positron emission tomography (PET) radioligand that has recently been validated for examining phosphodiesterase 10A (PDE10A) in the human striatum. ["1"1C]Lu AE92686 has high affinity for PDE10A (IC_5_0 = 0.39 nM) and may also be suitable for examination of the substantia nigra, a region with low density of PDE10A. Here, we report characterization of regional ["1"1C]Lu AE92686 binding to PDE10A in the nonhuman primate (NHP) brain. A total of 11 PET measurements, seven baseline and four following pretreatment with unlabeled Lu AE92686 or the structurally unrelated PDE10A inhibitor MP-10, were performed in five NHPs using a high resolution research tomograph (HRRT). ["1"1C]Lu AE92686 binding was quantified using a radiometabolite-corrected arterial input function and compartmental and graphical modeling approaches. Regional time-activity curves were best described with the two-tissue compartment model (2TCM). However, the distribution volume (V_T) values for all regions were obtained by the Logan plot analysis, as reliable cerebellar V_T values could not be derived by the 2TCM. For cerebellum, a proposed reference region, V_T values increased by ∝30 % with increasing PET measurement duration from 63 to 123 min, while V_T values in target regions remained stable. Both pretreatment drugs significantly decreased ["1"1C]Lu AE92686 binding in target regions, while no significant effect on cerebellum was observed. Binding potential (BP_N_D) values, derived with the simplified reference tissue model (SRTM), were 13-17 in putamen and 3-5 in substantia nigra and correlated well to values from the Logan plot analysis. The method proposed for quantification of ["1"1C]Lu AE92686 binding in applied studies in NHP is based on 63 min PET data and SRTM with cerebellum as a reference region. The study supports that ["1"1C]Lu AE92686 can be used for PET examinations of PDE10A binding also in substantia nigra. (orig.)

Phenomenological modelling of steam explosions

International Nuclear Information System (INIS)

Corradini, M.L.; Drumheller, D.S.

1980-01-01

During a hypothetical core meltdown accident, an important safety issue to be addressed is the potential for steam explosions. This paper presents analysis and modelling of experimental results. There are four observations that can be drawn from the analysis: (1) vapor explosions are suppressed by noncondensible gases generated by fuel oxidation, by high ambient pressure, and by high water temperatures; (2) these effects appear to be trigger-related in that an explosion can again be induced in some cases by increasing the trigger magnitude; (3) direct fuel liquid-coolant liquid contact can explain small scale fuel fragmentation; (4) heat transfer during the expansion phase of the explosion can reduce the work potential

Inversion of Orkney M5.5 earthquake South Africa using strain meters at very close distances

Science.gov (United States)

Yasutomi, T.; Mori, J. J.; Yamada, M.; Ogasawara, H.; Okubo, M.; Ogasawara, H.; Ishida, A.

2017-12-01

The largest event recorded in a South African gold mining region, a M5.5 earthquake took place near Orkney on 5 August 2014. The mainshock and afterhocks were recorded by 46 geophones at 2-3 km depths, 3 Ishii borehole strainmeters at 2.9km depth, and 17 surface strong motion instruments at close distances. The upper edge of the planar distribution of aftershock activity dips almost vertically and was only several hundred meters below the sites where the strainmeters were installed. In addition the seismic data, drilling across this fault is now in progress (Jun 2017 to December 2017) and will contribute valuable geological and stress information. Although the geophones data were saturated during the mainshock, the strainmeters recorded clear nearfield waveforms. We try to model the source of the M5.5 mainshock using the nearfield strainmeter data. Two strain meters located at same place, depth at 2.8km. Remaining one is located depth at 2.9km. Distance of each other is only 150m. Located at depth 2.9km recorded large stable strain, on the other hand, located at depth 2.8 km recorded three or four times smaller stable strain than 2.9km. These data indicates the distance between M5.5 fault and 2.9km depth strainmeter is a few hundred meters order. The strain Green functions were calculated assuming an infinite medium and using a finite difference method. We use small aftershocks to verify the Green function. Matching of the waveforms for the small events validates and Green functions used for the mainshock inversion. We present a model of the source rupture using these strain data. The nearfield data provide good resolution of the nearby earthquake rupture. There are two large subevents, one near the hypocenter and the second several hundred meters to the west.

Fatigue Crack Growth Behavior of and Recognition of AE Signals from Composite Patch-Repaired Aluminum Panel

International Nuclear Information System (INIS)

Kim, Sung Jin; Kwon, Oh Yang; Jang, Yong Joon

2007-01-01

The fatigue crack growth behavior of a cracked and patch-repaired Ah2024-T3 panel has been monitored by acoustic emission(AE). The overall crack growth rate was reduced The crack propagation into the adjacent hole was also retarded by introducing the patch repair. AE signals due to crack growth after the patch repair and those due to debonding of the plate-patch interface were discriminated by using the principal component analysis. The former showed high center frequency and low amplitude, whereas the latter showed long rise tine, low frequency and high amplitude. This type of AE signal recognition method could be effective for the prediction of fatigue crack growth behavior in the patch-repaired structures with the aid of AE source location

Test and Verification of AES Used for Image Encryption

Science.gov (United States)

Zhang, Yong

2018-03-01

In this paper, an image encryption program based on AES in cipher block chaining mode was designed with C language. The encryption/decryption speed and security performance of AES based image cryptosystem were tested and used to compare the proposed cryptosystem with some existing image cryptosystems based on chaos. Simulation results show that AES can apply to image encryption, which refutes the widely accepted point of view that AES is not suitable for image encryption. This paper also suggests taking the speed of AES based image encryption as the speed benchmark of image encryption algorithms. And those image encryption algorithms whose speeds are lower than the benchmark should be discarded in practical communications.

The experimental investigation of explosive opening switch

Energy Technology Data Exchange (ETDEWEB)

Jiande, Zhang; Huihuang, Zhong; Chuanlu, Li; Yonggui, Liu; Dongqun, Cheng; Xianyang, Peng [National Univ. of Defense Technology, Changsha (China). Dept. of Applied Physics

1997-12-31

The explosive opening switch (EOS) used in explosive-driven magnetic-flux compression generator (EMCG) circuits was investigated. It is shown that (1) under certain conditions, the EOS voltage is hardly dependent on the size of the explosive and aluminium foil used in EOS; (2) with the explosive coated by an insulator pipe, the opening effect of EOS is better; (3) by use of EOS, a pulse with 5 kA current, 100 kV voltage and 250 ns risetime has been transferred into a resistance load. (author). 12 figs., 5 refs.

The experimental investigation of explosive opening switch

International Nuclear Information System (INIS)

Zhang Jiande; Zhong Huihuang; Li Chuanlu; Liu Yonggui; Cheng Dongqun; Peng Xianyang

1996-01-01

The explosive opening switch (EOS) used in explosive-driven magnetic-flux compression generator (EMCG) circuits was investigated. It is shown that (1) under certain conditions, the EOS voltage is hardly dependent on the size of the explosive and aluminium foil used in EOS; (2) with the explosive coated by an insulator pipe, the opening effect of EOS is better; (3) by use of EOS, a pulse with 5 kA current, 100 kV voltage and 250 ns risetime has been transferred into a resistance load. (author). 12 figs., 5 refs

Liquid crystal europium(III) β-diketonato complex with 5,5'-di(heptadecyl)-2,2'-bipyridine

International Nuclear Information System (INIS)

Knyazev, A.A.; Lobkov, V.S.; Galyametdinov, Yu.G.

2004-01-01

Liquid crystal europium(III) complex containing β-diketone and 5,5-di(heptadecyl)-2,2'-bipyridine as ligands was prepared in ethanol solution and was isolated as a yellow precipitate with 62% yield. The product was characterized by data of elementary analysis, thermography, IR spectroscopy and luminescence spectra. Temperatures of crystal-mesophase and mesophase-isotropic liquid phase transitions amount to 95 and 130 Deg C respectively [ru

Deep H.E.S.S. observations of the supernova remnant RX J0852.0-4622

Science.gov (United States)

Sushch, Iurii; Paz Arribas, Manuel; Komin, Nukri; Schwanke, Ullrich

2016-06-01

The largest TeV source, RX J0852.0-4622 (Vela Jr.), is one of the few supernova remnants (SNRs) with well resolved shell-like morphology at very-high-energy (VHE; E>100 GeV) gamma-rays. Strong non-thermal emission across the electromagnetic spectrum from radio to VHE gamma-rays, young age and proximity of the remnant makes it one of the prime objects for the study of particle acceleration aiming to test the paradigm of SNRs being sources of Galactic cosmic rays. Here we present deep H.E.S.S. observations of RX J0852.0-4622 with roughly doubled exposure comparing to previously published results. Improved statistics together with new analysis techniques result in a firm determination of the cut-off in the gamma-ray spectrum and allow the spatially resolved spectroscopy studies. A smooth connection of the H.E.S.S. spectrum to the spectrum at GeV energies as reported by Fermi/LAT provides an exciting opportunity to recover the present-time parent particle population in both leptonic and hadronic scenarios directly from the gamma-ray data alone. These new observations provide us a deeper insight and better understanding of the physical processes in SNRs.

Tracing explosive in solvent using quantum cascade laser with pulsed electric discharge system

Energy Technology Data Exchange (ETDEWEB)

Park, Seong-Wook; Tian, Chao; Martini, Rainer, E-mail: rmartini@stevens.edu [Department of Physics and Engineering Physics, Stevens Institute of Technology, 1 Castle Point on Hudson, Hoboken, New Jersey 07030 (United States); Chen, Gang [School of Optoelectronic Engineering, Chongqing University, Chongqing 400044 (China); Chen, I-chun Anderson [Newport Corporation/Oriel Instruments, 150 Long Beach Boulevard, Stratford, Connecticut 06615 (United States)

2014-11-03

We demonstrated highly sensitive detection of explosive dissolved in solvent with a portable spectroscopy system (Q-MACS) by tracing the explosive byproduct, N{sub 2}O, in combination with a pulsed electric discharge system for safe explosive decomposition. Using Octahydro-1,3,5,7-tetranitro-1,3,5,7-tetrazocine (HMX), the gas was monitored and analyzed by Q-MACS and the presence of the dissolved explosive clearly detected. While HMX presence could be identified directly in the air above the solutions even without plasma, much better results were achieved under the decomposition. The experiment results give an estimated detection limit of 10 ppb, which corresponds to a 15 pg of HMX.

Tracing explosive in solvent using quantum cascade laser with pulsed electric discharge system

International Nuclear Information System (INIS)

Park, Seong-Wook; Tian, Chao; Martini, Rainer; Chen, Gang; Chen, I-chun Anderson

2014-01-01

We demonstrated highly sensitive detection of explosive dissolved in solvent with a portable spectroscopy system (Q-MACS) by tracing the explosive byproduct, N 2 O, in combination with a pulsed electric discharge system for safe explosive decomposition. Using Octahydro-1,3,5,7-tetranitro-1,3,5,7-tetrazocine (HMX), the gas was monitored and analyzed by Q-MACS and the presence of the dissolved explosive clearly detected. While HMX presence could be identified directly in the air above the solutions even without plasma, much better results were achieved under the decomposition. The experiment results give an estimated detection limit of 10 ppb, which corresponds to a 15 pg of HMX

High energy materials. Propellants, explosives and pyrotechnics

Energy Technology Data Exchange (ETDEWEB)

Agrawal, Jai Prakash

2010-07-01

Authored by an insider with over 40 years of high energy materials (HEMs) experience in academia, industry and defence organizations, this handbook and ready reference covers all important HEMs from the 1950s to the present with their respective properties and intended purposes. Written at an attainable level for professionals, engineers and technicians alike, the book provides a comprehensive view of the current status and suggests further directions for research and development. An introductory chapter on the chemical and thermodynamic basics allows the reader to become acquainted with the fundamental features of explosives, before moving on to the important safety aspects in processing, handling, transportation and storage of high energy materials. With its collation of results and formulation strategies hitherto scattered in the literature, this should be on the shelf of every HEM researcher and developer. (orig.)

Home Rx: The Health Benefits of Home Performance

Energy Technology Data Exchange (ETDEWEB)

Wilson, Jonathan [National Center for Healthy Housing (NCHH), Columbia, MD (United States); Jacobs, David [National Center for Healthy Housing (NCHH), Columbia, MD (United States); Reddy, Amanda [National Center for Healthy Housing (NCHH), Columbia, MD (United States); Tohn, Ellen [Tohn Environmental Strategies, Wayland, MA (United States); Cohen, Jonathan [Dept. of Energy (DOE), Washington DC (United States); Jacobsohn, Ely [Dept. of Energy (DOE), Washington DC (United States)

2016-12-01

Evidence in a new, groundbreaking U.S. Department of Energy report, Home Rx: The Health Benefits of Home Performance, shows that home performance upgrades can improve the quality of a home’s indoor environment by reducing the prevalence of harmful indoor air pollutants and contaminants. Until recently, no systematic review of this evidence had been conducted, limiting full understanding of the link between home performance and health. This new report summarizes current knowledge and identifies research gaps. The design characteristics and results of each of the 40 studies considered in the report are summarized in a searchable matrix.

The effect of CFRP on retrofitting of damaged HSRC beams using AE technique

Science.gov (United States)

Soffian Noor, M. S.; Noorsuhada, M. N.

2017-12-01

This paper presents the effect of carbon fibre reinforced polymer (CFRP) on retrofitted high strength reinforced concrete (HSRC) beams using acoustic emission (AE) technique. Two RC beam parameters were prepared. The first was the control beam which was undamaged HSRC beam. The second was the damaged HSRC beam retrofitted with CFRP on the soffit. The main objective of this study is to assess the crack modes of HSRC beams using AE signal strength. The relationship between signal strength, load and time were analysed and discussed. The crack pattern observed from the visual observation was also investigated. HSRC beam retrofitted with CFRP produced high signal strength compared to control beam. It demonstrates the effect of the AE signal strength for interpretation and prediction of failure modes that might occur in the beam specimens.

Evaluation of the use of envelope analysis and DWT on AE signals generated from degrading shafts

International Nuclear Information System (INIS)

Gu, Dongsik; Kim, Jaegu; Kelimu, Tulugan; Huh, Sun-Chul; Choi, Byeong-Keun

2012-01-01

Vibration analysis is widely used in machinery diagnosis. Wavelet transforms and envelope analysis, which have been implemented in many applications in the condition monitoring of machinery, are applied in the development of a condition monitoring system for early detection of faults generated in several key components of machinery. Early fault detection is a very important factor in condition monitoring and a basic component for the application of condition-based maintenance (CBM) and predictive maintenance (PM). In addition, acoustic emission (AE) sensors have specific characteristics that are highly sensitive to high-frequency and low-energy signals. Therefore, the AE technique has been applied recently in studies on the early detection of failure. In this paper, AE signals caused by crack growth on a rotating shaft were captured through an AE sensor. The AE signatures were pre-processed using the proposed signal processing method, after which power spectrums were generated from the FFT results. In the power spectrum, some peaks from fault frequencies were presented. According to the results, crack growth in rotating machinery can be considered and detected using an AE sensor and the signal processing method.

Nanotwin Formation in High-Manganese Austenitic Steels Under Explosive Shock Loading

Science.gov (United States)

Canadinc, D.; Uzer, B.; Elmadagli, M.; Guner, F.

2018-04-01

The micro-deformation mechanisms active in a high-manganese austenitic steel were investigated upon explosive shock loading. Single system of nanotwins forming within primary twins were shown to govern the deformation despite the elevated temperatures attained during testing. The benefits of nanotwin formation for potential armor materials were demonstrated.

A Rotational and Axial Motion System Load Frame Insert for In Situ High Energy X-Ray Studies (Postprint)

Science.gov (United States)

2015-09-08

Paul A. Shade, Jay C. Schuren, and Todd J. Turner AFRL/RX Basil Blank PulseRay Peter Kenesei, Kurt Goetze, Ulrich Lienert, and Jonathan Almer...AFRL/RX 2) Basil Blank – PulseRay (continued on page 2) 5d. PROJECT NUMBER 4349 5e. TASK NUMBER 0001 5f...2015) A rotational and axial motion system load frame insert for in situ high energy x-ray studies Paul A. Shade,1,a) Basil Blank,2 Jay C. Schuren,1,b

Electron stereodynamics in coulomb explosion of molecules by slow highly charged ions

International Nuclear Information System (INIS)

Ichimura, Atsushi; Ohyama-Yamaguchi, Tomoko

2008-01-01

The three-center Coulombic over-the-barrier model is developed for Coulomb explosion of a homonuclear diatomic molecule in collisions with a slow (∼10 eV/amu) highly charged ion. A conventional two-step picture of multiple electron transfer followed by Coulomb explosion is far from appropriate because the molecule sets out to dissociate before the incident ion approaches the closest distance. We treat the formation of a quasi-molecule and its decay into the three moving atomic ions. Charge-asymmetric population between fragment ions observed in a triple-coincidence measurement is suggested to reflect the bond elongation during a collision. Collisions of Kr 8+ + N 2 are analyzed. (author)

Nucleocytoplasmic distribution is required for activation of resistance by the potato NB-LRR receptor Rx1 and is balanced by its functional domains

NARCIS (Netherlands)

Slootweg, E.J.; Roosien, J.; Spiridon, L.N.; Petrescu, A.J.; Tameling, W.I.L.; Joosten, M.H.A.J.; Pomp, H.; Schaik, van C.C.; Dees, R.H.L.; Borst, J.W.; Smant, G.; Schots, A.; Bakker, J.; Goverse, A.

2010-01-01

The Rx1 protein, as many resistance proteins of the nucleotide binding–leucine-rich repeat (NB-LRR) class, is predicted to be cytoplasmic because it lacks discernable nuclear targeting signals. Here, we demonstrate that Rx1, which confers extreme resistance to Potato virus X, is located both in the

AES Modular Power Systems

Data.gov (United States)

National Aeronautics and Space Administration — The AES Modular Power Systems (AMPS) project will demonstrate and infuse modular power electronics, batteries, fuel cells, and autonomous control for exploration...

Electronic structure, Fermi surface topology and spectroscopic optical properties of LaBaCo{sub 2}O{sub 5.5} compound

Energy Technology Data Exchange (ETDEWEB)

Reshak, A.H. [New Technologies – Research Center, University of West Bohemia, Univerzitni 8, Pilsen 306 14 (Czech Republic); Center of Excellence Geopolymer and Green Technology, School of Material Engineering, University Malaysia Perlis, 01007 Kangar, Perlis (Malaysia); Al-Douri, Y. [Institute of Nano Electronic Engineering, University Malaysia Perlis, 01000 Kangar, Perlis (Malaysia); Khenata, R. [Laboratoire de Physique Quantique et de Modélisation Mathématique (LPQ3M), Département de Technologie, Université de Mascara, Mascara 29000 (Algeria); Khan, Wilayat; Khan, Saleem Ayaz [New Technologies – Research Center, University of West Bohemia, Univerzitni 8, Pilsen 306 14 (Czech Republic); Azam, Sikander, E-mail: sikander.physicst@gmail.com [New Technologies – Research Center, University of West Bohemia, Univerzitni 8, Pilsen 306 14 (Czech Republic)

2014-08-01

We have investigated the electronic band structure, Fermi surface topology, chemical bonding and optical properties of LaBaCo{sub 2}O{sub 5.5} compound. The first-principle calculations based on density functional theory (DFT) by means of the full-potential linearized augmented plane-wave method were employed. The atomic positions of LaBaCo{sub 2}O{sub 5.5} compound were optimized by minimizing the forces acting on atoms. We employed the local density approximation (LDA), generalized gradient approximation (GGA) and Engel–Vosko GGA (EVGGA) to treat the exchange correlation potential by solving Kohn–Sham equations. Electronic structure and bonding properties are studied throughout the calculation of densities of states, Fermi surfaces and charge densities. Furthermore, the optical properties are investigated via the calculation of the dielectric tensor component in order to characterize the linear optical properties. Optical spectra are analyzed by means of the electronic structure, which provides theoretical understanding of the conduction mechanism of the investigated compound. - Highlights: • DFT-FPLAPW method used for calculating the properties of LaBaCo{sub 2}O{sub 5.5} compound. • This study shows that nature of the compound is metallic. • Crystallographic plane which shows covalent character of O–Co bond. • The optical properties were also calculated and analyzed. • The Fermi surface of LaBaCo{sub 2}O{sub 5.5} is composed of five bands crossing along Γ–Z direction.

Explosive Characteristics of Carbonaceous Nanoparticles

Science.gov (United States)

Turkevich, Leonid; Fernback, Joseph; Dastidar, Ashok

2013-03-01

Explosion testing has been performed on 20 codes of carbonaceous particles. These include SWCNTs (single-walled carbon nanotubes), MWCNTs (multi-walled carbon nanotubes), CNFs (carbon nanofibers), graphene, diamond, fullerene, carbon blacks and graphites. Explosion screening was performed in a 20 L explosion chamber (ASTM E1226-10 protocol), at a (dilute) concentration of 500 g/m3, using a 5 kJ ignition source. Time traces of overpressure were recorded. Samples exhibited overpressures of 5-7 bar, and deflagration index KSt = V1/3 (dp/pt)max ~ 10 - 80 bar-m/s, which places these materials in European Dust Explosion Class St-1 (similar to cotton and wood dust). There was minimal variation between these different materials. The explosive characteristics of these carbonaceous powders are uncorrelated with particle size (BET specific surface area). Additional tests were performed on selected materials to identify minimum explosive concentration [MEC]. These materials exhibit MEC ~ 101 -102 g/m3 (lower than the MEC for coals). The concentration scans confirm that the earlier screening was performed under fuel-rich conditions (i.e. the maximum over-pressure and deflagration index exceed the screening values); e.g. the true fullerene KSt ~ 200 bar-m/s, placing it borderline St-1/St-2. Work supported through the NIOSH Nanotechnology Research Center (NTRC)

High Resolution Digital Elevation Models of Pristine Explosion Craters

Science.gov (United States)

Farr, T. G.; Krabill, W.; Garvin, J. B.

2004-01-01

In order to effectively capture a realistic terrain applicable to studies of cratering processes and landing hazards on Mars, we have obtained high resolution digital elevation models of several pristine explosion craters at the Nevada Test Site. We used the Airborne Terrain Mapper (ATM), operated by NASA's Wallops Flight Facility to obtain DEMs with 1 m spacing and 10 cm vertical errors of 4 main craters and many other craters and collapse pits. The main craters that were mapped are Sedan, Scooter, Schooner, and Danny Boy. The 370 m diameter Sedan crater, located on Yucca Flat, is the largest and freshest explosion crater on Earth that was formed under conditions similar to hypervelocity impact cratering. As such, it is effectively pristine, having been formed in 1962 as a result of a controlled detonation of a 100 kiloton thermonuclear device, buried at the appropriate equivalent depth of burst required to make a simple crater. Sedan was formed in alluvium of mixed lithology and subsequently studied using a variety of field-based methods. Nearby secondary craters were also formed at the time and were also mapped by ATM. Adjacent to Sedan and also in alluvium is Scooter, about 90 m in diameter and formed by a high-explosive event. Schooner (240 m) and Danny Boy (80 m) craters were also important targets for ATM as they were excavated in hard basalt and therefore have much rougher ejecta. This will allow study of ejecta patterns in hard rock as well as engineering tests of crater and rock avoidance and rover trafficability. In addition to the high resolution DEMs, crater geometric characteristics, RMS roughness maps, and other higher-order derived data products will be generated using these data. These will provide constraints for models of landing hazards on Mars and for rover trafficability. Other planned studies will include ejecta size-frequency distribution at the resolution of the DEM and at finer resolution through air photography and field measurements

Steam explosion studies review

International Nuclear Information System (INIS)

Hwang, Moon Kyu; Kim, Hee Dong

1999-03-01

When a cold liquid is brought into contact with a molten material with a temperature significantly higher than the liquid boiling point, an explosive interaction due to sudden fragmentation of the melt and rapid evaporation of the liquid may take place. This phenomenon is referred to as a steam explosion or vapor explosion. Depending upon the amount of the melt and the liquid involved, the mechanical energy released during a vapor explosion can be large enough to cause serious destruction. In hypothetical severe accidents which involve fuel melt down, subsequent interactions between the molten fuel and coolant may cause steam explosion. This process has been studied by many investigators in an effort to assess the likelihood of containment failure which leads to large scale release of radioactive materials to the environment. In an effort to understand the phenomenology of steam explosion, extensive studies has been performed so far. The report presents both experimental and analytical studies on steam explosion. As for the experimental studies, both small scale tests which involve usually less than 20 g of high temperature melt and medium/large scale tests which more than 1 kg of melt is used are reviewed. For the modelling part of steam explosions, mechanistic modelling as well as thermodynamic modelling is reviewed. (author)

About factors of disintegration of nonideal plasma at explosion of the tungstic conductor in water

International Nuclear Information System (INIS)

Fedorovich, O.A.; Vojtenko, L.M.

2010-01-01

Results of experimental definition of disintegration coefficient of the nonideal plasma, formed at explosion of tungsten wires in water, are resulted. Disintegration coefficient are investigated at electron density from 10 20 cm-3 to 5,5 · 10 21 cm -3 . With reduction of concentration in the indicated electron density range disintegration coefficients increase from 4 · 10 -18 to 1 · 10 -15 cm 3 /s at brightness temperature (7...10) ·10 3 K. Supposed mechanisms of increase in disintegration coefficient with reduction of electron concentration are presented.

R-22 vapor explosions

International Nuclear Information System (INIS)

Anderson, R.P.; Armstrong, D.R.

1977-01-01

Previous experimental and theoretical studies of R-22 vapor explosions are reviewed. Results from two experimental investigations of vapor explosions in a medium scale R-22/water system are reported. Measurements following the drop of an unrestrained mass of R-22 into a water tank demonstrated the existence of two types of interaction behavior. Release of a constrained mass of R-22 beneath the surface of a water tank improved the visual resolution of the system thus allowing identification of two interaction mechansims: at low water temperatures, R-22/water contact would produce immediate violent boiling; at high water temperatures a vapor film formed around its R-22 as it was released, explosions were generated by a surface wave which initiated at a single location and propagated along the vapor film as a shock wave. A new vapor explosion model is proposed, it suggests explosions are the result of a sequence of three independent steps: an initial mixing phase, a trigger and growth phase, and a mature phase where a propagating shock wave accelerates the two liquids into a collapsing vapor layer causing a high velocity impact which finely fragments and intermixes the two liquids

Dosimetry of 64Cu-DOTA-AE105, a PET tracer for uPAR imaging

International Nuclear Information System (INIS)

Persson, Morten; El Ali, Henrik H.; Binderup, Tina; Pfeifer, Andreas; Madsen, Jacob; Rasmussen, Palle; Kjaer, Andreas

2014-01-01

64 Cu-DOTA-AE105 is a novel positron emission tomography (PET) tracer specific to the human urokinase-type plasminogen activator receptor (uPAR). In preparation of using this tracer in humans, as a new promising method to distinguish between indolent and aggressive cancers, we have performed PET studies in mice to evaluate the in vivo biodistribution and estimate human dosimetry of 64 Cu-DOTA-AE105. Methods: Five mice received iv tail injection of 64 Cu-DOTA-AE105 and were PET/CT scanned 1, 4.5 and 22 h post injection. Volume-of-interest (VOI) were manually drawn on the following organs: heart, lung, liver, kidney, spleen, intestine, muscle, bone and bladder. The activity concentrations in the mentioned organs [%ID/g] were used for the dosimetry calculation. The %ID/g of each organ at 1, 4.5 and 22 h was scaled to human value based on a difference between organ and body weights. The scaled values were then exported to OLINDA software for computation of the human absorbed doses. The residence times as well as effective dose equivalent for male and female could be obtained for each organ. To validate this approach, of human projection using mouse data, five mice received iv tail injection of another 64 Cu-DOTA peptide-based tracer, 64 Cu-DOTA-TATE, and underwent same procedure as just described. The human dosimetry estimates were then compared with observed human dosimetry estimate recently found in a first-in-man study using 64 Cu-DOTA-TATE. Results: Human estimates of 64 Cu-DOTA-AE105 revealed the heart wall to receive the highest dose (0.0918 mSv/MBq) followed by the liver (0.0815 mSv/MBq), All other organs/tissue were estimated to receive doses in the range of 0.02–0.04 mSv/MBq. The mean effective whole-body dose of 64 Cu-DOTA-AE105 was estimated to be 0.0317 mSv/MBq. Relatively good correlation between human predicted and observed dosimetry estimates for 64 Cu-DOTA-TATE was found. Importantly, the effective whole body dose was predicted with very high

Dosimetry of 64Cu-DOTA-AE105, a PET tracer for uPAR imaging.

Science.gov (United States)

Persson, Morten; El Ali, Henrik H; Binderup, Tina; Pfeifer, Andreas; Madsen, Jacob; Rasmussen, Palle; Kjaer, Andreas

2014-03-01

(64)Cu-DOTA-AE105 is a novel positron emission tomography (PET) tracer specific to the human urokinase-type plasminogen activator receptor (uPAR). In preparation of using this tracer in humans, as a new promising method to distinguish between indolent and aggressive cancers, we have performed PET studies in mice to evaluate the in vivo biodistribution and estimate human dosimetry of (64)Cu-DOTA-AE105. Five mice received iv tail injection of (64)Cu-DOTA-AE105 and were PET/CT scanned 1, 4.5 and 22 h post injection. Volume-of-interest (VOI) were manually drawn on the following organs: heart, lung, liver, kidney, spleen, intestine, muscle, bone and bladder. The activity concentrations in the mentioned organs [%ID/g] were used for the dosimetry calculation. The %ID/g of each organ at 1, 4.5 and 22 h was scaled to human value based on a difference between organ and body weights. The scaled values were then exported to OLINDA software for computation of the human absorbed doses. The residence times as well as effective dose equivalent for male and female could be obtained for each organ. To validate this approach, of human projection using mouse data, five mice received iv tail injection of another (64)Cu-DOTA peptide-based tracer, (64)Cu-DOTA-TATE, and underwent same procedure as just described. The human dosimetry estimates were then compared with observed human dosimetry estimate recently found in a first-in-man study using (64)Cu-DOTA-TATE. Human estimates of (64)Cu-DOTA-AE105 revealed the heart wall to receive the highest dose (0.0918 mSv/MBq) followed by the liver (0.0815 mSv/MBq), All other organs/tissue were estimated to receive doses in the range of 0.02-0.04 mSv/MBq. The mean effective whole-body dose of (64)Cu-DOTA-AE105 was estimated to be 0.0317 mSv/MBq. Relatively good correlation between human predicted and observed dosimetry estimates for (64)Cu-DOTA-TATE was found. Importantly, the effective whole body dose was predicted with very high precision

Laser photoacoustic spectroscopy helps fight terrorism: High sensitivity detection of chemical Warfare Agent and explosives

Science.gov (United States)

Patel, C. K. N.

2008-01-01

Tunable laser photoacoustic spectroscopy is maturing rapidly in its applications to real world problems. One of the burning problems of the current turbulent times is the threat of terrorist acts against civilian population. This threat appears in two distinct forms. The first is the potential release of chemical warfare agents (CWA), such as the nerve agents, in a crowded environment. An example of this is the release of Sarin by Aum Shinrikyo sect in a crowded Tokyo subway in 1995. An example of the second terrorist threat is the ever-present possible suicide bomber in crowded environment such as airports, markets and large buildings. Minimizing the impact of both of these threats requires early detection of the presence of the CWAs and explosives. Photoacoustic spectroscopy is an exquisitely sensitive technique for the detection of trace gaseous species, a property that Pranalytica has extensively exploited in its CO2 laser based commercial instrumentation for the sub-ppb level detection of a number of industrially important gases including ammonia, ethylene, acrolein, sulfur hexafluoride, phosphine, arsine, boron trichloride and boron trifluoride. In this presentation, I will focus, however, on our recent use of broadly tunable single frequency high power room temperature quantum cascade lasers (QCL) for the detection of the CWAs and explosives. Using external grating cavity geometry, we have developed room temperature QCLs that produce continuously tunable single frequency CW power output in excess of 300 mW at wavelengths covering 5 μm to 12 μm. I will present data that show a CWA detection capability at ppb levels with false alarm rates below 1:108. I will also show the capability of detecting a variety of explosives at a ppb level, again with very low false alarm rates. Among the explosives, we have demonstrated the capability of detecting homemade explosives such as triacetone triperoxide and its liquid precursor, acetone which is a common household

28 CFR 55.5 - Coverage under section 4(f)(4).

Science.gov (United States)

2010-07-01

... THE VOTING RIGHTS ACT REGARDING LANGUAGE MINORITY GROUPS Nature of Coverage § 55.5 Coverage under section 4(f)(4). (a) Coverage formula. Section 4(f)(4) applies to any State or political subdivision in...) Coverage may be determined with regard to section 4(f)(4) on a statewide or political subdivision basis. (1...

Composite Cryotank Technologies and Development 2.4 and 5.5M out of Autoclave Tank Test Results

Science.gov (United States)

Jackson, Justin R.; Vickers, John; Fikes, John

2015-01-01

The Composite Cryotank Technologies and Demonstration (CCTD) project substantially matured composite, cryogenic propellant tank technology. The project involved the design, analysis, fabrication, and testing of large-scale (2.4-m-diameter precursor and 5.5-m-diameter) composite cryotanks. Design features included a one-piece wall design that minimized tank weight, a Y-joint that incorporated an engineered material to alleviate stress concentration under combined loading, and a fluted core cylindrical section that inherently allows for venting and purging. The tanks used out-of-autoclave (OoA) cured graphite/epoxy material and processes to enable large (up to 10-m-diameter) cryotank fabrication, and thin-ply prepreg to minimize hydrogen permeation through tank walls. Both tanks were fabricated at Boeing using automated fiber placement on breakdown tooling. A fluted core skirt that efficiently carried axial loads and enabled hydrogen purging was included on the 5.5-m-diameter tank. Ultrasonic inspection was performed, and a structural health monitoring system was installed to identify any impact damage during ground processing. The precursor and 5.5-m-diameter tanks were tested in custom test fixtures at the National Aeronautics and Space Administration Marshall Space Flight Center. The testing, which consisted of a sequence of pressure and thermal cycles using liquid hydrogen, was successfully concluded and obtained valuable structural, thermal, and permeation performance data. This technology can be applied to a variety of aircraft and spacecraft applications that would benefit from 30 to 40% weight savings and substantial cost savings compared to aluminum lithium tanks.

Investigation of anodic TiO2 nanotube composition with high spatial resolution AES and ToF SIMS

Science.gov (United States)

Dronov, Alexey; Gavrilin, Ilya; Kirilenko, Elena; Dronova, Daria; Gavrilov, Sergey

2018-03-01

High resolution Scanning Auger Electron Spectroscopy (AES) and Time-of-Flight Secondary Ion Mass-Spectrometry (ToF SIMS) were used to investigate structure and elemental composition variation of both across an array of TiO2 nanotubes (NTs) and single tube of an array. The TiO2 NT array was grown by anodic oxidation of Ti foil in fluorine-containing ethylene glycol electrolyte. It was found that the studied anodic TiO2 nanotubes have a layered structure with rather sharp interfaces. The differences in AES depth profiling results of a single tube with the focused primary electron beam (point analysis) and over an area of 75 μm in diameter of a nanotube array with the defocused primary electron beam are discussed. Depth profiling by ToF SIMS was carried out over approximately the same size of a nanotube array to determine possible ionic fragments in the structure. The analysis results show that the combination of both mentioned methods is useful for a detailed analysis of nanostructures with complex morphology and multi-layered nature.

3-D high-speed imaging of volcanic bomb trajectory in basaltic explosive eruptions

Science.gov (United States)

Gaudin, D.; Taddeucci, J; Houghton, Bruce F.; Orr, Tim R.; Andronico, D.; Del Bello, E.; Kueppers, U.; Ricci, T.; Scarlato, P.

2016-01-01

Imaging, in general, and high speed imaging in particular are important emerging tools for the study of explosive volcanic eruptions. However, traditional 2-D video observations cannot measure volcanic ejecta motion toward and away from the camera, strongly hindering our capability to fully determine crucial hazard-related parameters such as explosion directionality and pyroclasts' absolute velocity. In this paper, we use up to three synchronized high-speed cameras to reconstruct pyroclasts trajectories in three dimensions. Classical stereographic techniques are adapted to overcome the difficult observation conditions of active volcanic vents, including the large number of overlapping pyroclasts which may change shape in flight, variable lighting and clouding conditions, and lack of direct access to the target. In particular, we use a laser rangefinder to measure the geometry of the filming setup and manually track pyroclasts on the videos. This method reduces uncertainties to 10° in azimuth and dip angle of the pyroclasts, and down to 20% in the absolute velocity estimation. We demonstrate the potential of this approach by three examples: the development of an explosion at Stromboli, a bubble burst at Halema'uma'u lava lake, and an in-flight collision between two bombs at Stromboli.

Maternal-infant relationship quality and risk of obesity at age 5.5 years in a national US cohort

Science.gov (United States)

2014-01-01

Background Poor quality relationships between mothers and toddlers have been associated with higher risk for childhood obesity, but few prospective studies of obesity have assessed maternal-child relationship quality in infancy. In addition it is not known whether the increased risk is associated with the mother’s or the child’s contribution to the relationship quality. Methods We analyzed data (n = 5650) from the Early Childhood Longitudinal Study, Birth Cohort, a national study of U.S. children born in 2001 and followed until they entered kindergarten. At 9 months of age, the Nursing Child Assessment Teaching Scale (NCATS) was used to assess the quality of observed playtime interactions between mothers and infants, yielding separate scores for maternal and infant behaviors. Obesity (BMI ≥95th percentile) at age 5.5 years was based on measured weight and height. Results The prevalence (95% confidence interval) of obesity at 5.5 years of age was higher among children in the lowest quartile of maternal NCATS score (20.2% [95% CI: 17.2%, 23.2%]) than in the highest quartile (13.9% [11.3%, 16.5%]), but maternal NCATS score was not significantly associated with obesity after adjustment for race/ethnicity, maternal education and household income. The prevalence of obesity at 5.5 years of age was similar among children in the lowest quartile of infant NCATS score (17.4% [14.4%, 20.3%]) and in the highest quartile (17.6% 14.4%, 20.8%]), and was not changed with covariate adjustment. Conclusions Maternal-infant relationship quality, assessed by direct observation at 9 months of age in a national sample, was not associated with an increased risk of obesity at age 5.5 years after controlling for sociodemographic characteristics. PMID:24564412

HI associated with the supernova remnant G. 261. 9, plus 5. 5

Energy Technology Data Exchange (ETDEWEB)

Colomb, F R; Dubner, G M

1979-01-01

The results of 21 cm H line observations of the southern SNR G.261.9, plus 5.5 are reported, considering the problem of H I shells around SNRs. Two clouds that are probably related to the SNR were found, and the prominent H I features around it are discussed. The first cloud is an emission region with velocities between 22 and 46 km/s which shows the contours of brightness temperature remarkably distorted, resembling an explosive event. The gas appears approximately ring-shaped around the remnant, suggesting an expanding shell, and the calculated parameters are in good agreement with those derived for other SNRs. The other cloud is a high velocity emission region with velocities between 70 and 100 km/s, and there is a region of low density emission between these two features.

Emission spectroscopy of hypervelocity impacts on aluminum, organic and high-explosive targets

NARCIS (Netherlands)

Verreault, J.; Day, J.P.R.; Halswijk, W.H.C.; Loiseau, J.; Huneault, J.; Higgins, A.J.; Devir, A.D.

2015-01-01

Laboratory experiments of hypervelocity impacts on aluminum, nylon and high-explosive targets are presented. Spectral measurements of the impact flash are recorded, together with radiometric measurements to derive the temperature of the flash. Such experiments aim at demonstrating that the impact

Temporal Trends in Antimicrobial Resistance and Virulence-Associated Traits within the Escherichia coli Sequence Type 131 Clonal Group and Its H30 and H30-Rx Subclones, 1968 to 2012

DEFF Research Database (Denmark)

Olesen, Bente; Frimodt-Møller, Jakob; Leihof, Rikke Fleron

2014-01-01

occurred only after 2000 and 2002, respectively, in association with the H30 and H30-Rx subclones, which were characterized by multidrug resistance (including extended-spectrum-beta-lactamase [ESBL] production: H30-Rx) and absence of biofilm production. Capsular antigen K100 occurred exclusively among H30......-Rx ST131 subclones, rather than representing acquisition of resistance by diverse ST131 strains. Distinctive characteristics of the H30-Rx subclone-including specific virulence genes (iutA, afa and dra, kpsII), the K100 capsule, multidrug resistance, and ESBL production-possibly contributed...

Characterization of Al-Cu-Mg-Ag Alloy RX226-T8 Plate

Science.gov (United States)

Lach, Cynthia L.; Domack, Marcia S.

2003-01-01

Aluminum-copper-magnesium-silver (Al-Cu-Mg-Ag) alloys that were developed for thermal stability also offer attractive ambient temperature strength-toughness combinations, and therefore, can be considered for a broad range of airframe structural applications. The current study evaluated Al-Cu-Mg-Ag alloy RX226-T8 in plate gages and compared performance with sheet gage alloys of similar composition. Uniaxial tensile properties, plane strain initiation fracture toughness, and plane stress tearing resistance of RX226-T8 were examined at ambient temperature as a function of orientation and thickness location in the plate. Properties were measured near the surface and at the mid-plane of the plate. Tensile strengths were essentially isotropic, with variations in yield and ultimate tensile strengths of less than 2% as a function of orientation and through-thickness location. However, ductility varied by more than 15% with orientation. Fracture toughness was generally higher at the mid-plane and greater for the L-T orientation, although the differences were small near the surface of the plate. Metallurgical analysis indicated that the microstructure was primarily recrystallized with weak texture and was uniform through the plate with the exception of a fine-grained layer near the surface of the plate. Scanning electron microscope analysis revealed Al-Cu-Mg second phase particles which varied in composition and were primarily located on grain boundaries parallel to the rolling direction. Fractography of toughness specimens for both plate locations and orientations revealed that fracture occurred predominantly by transgranular microvoid coalescence. Introduction High-strength, low-density Al-Cu-Mg-Ag alloys were initially developed to replace conventional 2000 (Al-Cu-Mg) and 7000 (Al-Zn-Cu-Mg) series aluminum alloys for aircraft structural applications [1]. During the High Speed Civil Transport (HSCT) program, improvements in thermal stability were demonstrated for candidate

A model of vulcanian explosions

International Nuclear Information System (INIS)

Woods, A.W.

1995-01-01

We present a model of the initial stages of the explosive eruption of magma from a volcanic conduit as occurs in Vulcanian style eruptions. We assume there is a volatile rich (1-10 wt%) mixture of magma, vaporised groundwater and exsolved volatiles, trapped at high pressure (1-100 atm) just below a plug in a volcanic conduit. If the plug disrupts, there is an explosive eruption in which a rarefaction wave propagates into the conduit allowing the volatile rich mixture to expand and discharge into the atmosphere ahead of the vent. Typically, the explosions are so rapid that coarse grained ejecta (>0.5 mm) do not remain in thermal equilibrium with the gas, and this leads to significantly lower velocities and temperatures than predicted by an equilibrium model. Material may erupt from the vent at speeds of 100-400 m s -1 with an initial mass flux of order 10 7 -10 9 kg s -1 , consistent with video observations of eruptions and measurements of the ballistic dispersal of large clasts. (orig.)

Ship Detection in Optical Satellite Image Based on RX Method and PCAnet

Science.gov (United States)

Shao, Xiu; Li, Huali; Lin, Hui; Kang, Xudong; Lu, Ting

2017-12-01

In this paper, we present a novel method for ship detection in optical satellite image based on the ReedXiaoli (RX) method and the principal component analysis network (PCAnet). The proposed method consists of the following three steps. First, the spatially adjacent pixels in optical image are arranged into a vector, transforming the optical image into a 3D cube image. By taking this process, the contextual information of the spatially adjacent pixels can be integrated to magnify the discrimination between ship and background. Second, the RX anomaly detection method is adopted to preliminarily extract ship candidates from the produced 3D cube image. Finally, real ships are further confirmed among ship candidates by applying the PCAnet and the support vector machine (SVM). Specifically, the PCAnet is a simple deep learning network which is exploited to perform feature extraction, and the SVM is applied to achieve feature pooling and decision making. Experimental results demonstrate that our approach is effective in discriminating between ships and false alarms, and has a good ship detection performance.

A Weighted Spatial-Spectral Kernel RX Algorithm and Efficient Implementation on GPUs

Directory of Open Access Journals (Sweden)

Chunhui Zhao

2017-02-01

Full Text Available The kernel RX (KRX detector proposed by Kwon and Nasrabadi exploits a kernel function to obtain a better detection performance. However, it still has two limits that can be improved. On the one hand, reasonable integration of spatial-spectral information can be used to further improve its detection accuracy. On the other hand, parallel computing can be used to reduce the processing time in available KRX detectors. Accordingly, this paper presents a novel weighted spatial-spectral kernel RX (WSSKRX detector and its parallel implementation on graphics processing units (GPUs. The WSSKRX utilizes the spatial neighborhood resources to reconstruct the testing pixels by introducing a spectral factor and a spatial window, thereby effectively reducing the interference of background noise. Then, the kernel function is redesigned as a mapping trick in a KRX detector to implement the anomaly detection. In addition, a powerful architecture based on the GPU technique is designed to accelerate WSSKRX. To substantiate the performance of the proposed algorithm, both synthetic and real data are conducted for experiments.

Crack classification in concrete beams using AE parameters

Science.gov (United States)

Bahari, N. A. A. S.; Shahidan, S.; Abdullah, S. R.; Ali, N.; Zuki, S. S. Mohd; Ibrahim, M. H. W.; Rahim, M. A.

2017-11-01

The acoustic emission (AE) technique is an effective tool for the evaluation of crack growth. The aim of this study is to evaluate crack classification in reinforced concrete beams using statistical analysis. AE has been applied for the early monitoring of reinforced concrete structures using AE parameters such as average frequency, rise time, amplitude counts and duration. This experimental study focuses on the utilisation of this method in evaluating reinforced concrete beams. Beam specimens measuring 150 mm × 250 mm × 1200 mm were tested using a three-point load flexural test using Universal Testing Machines (UTM) together with an AE monitoring system. The results indicated that RA value can be used to determine the relationship between tensile crack and shear movement in reinforced concrete beams.

Pretreatment of forest residues of Douglas fir by wet explosion for enhanced enzymatic saccharification.

Science.gov (United States)

Biswas, Rajib; Teller, Philip J; Ahring, Birgitte K

2015-09-01

The logging and lumbering industry in the Pacific Northwest region generates huge amount of forest residues, offering an inexpensive raw material for biorefineries. Wet explosion (WEx) pretreatment was applied to the recalcitrant biomass to optimize process conditions including temperature (170-190 °C), time (10-30 min), and oxygen loading (0.5-7.5% of DM) through an experimental design. Optimal pH for enzymatic hydrolysis of the optimized samples and a complete mass balance have been evaluated. Results indicated that cellulose digestibility improved in all conditions tested with maximum digestibility achieved at 190 °C, time 30 min, and oxygen loading of 7.5%. Glucose yield at optimal pH of 5.5 was 63.3% with an excellent recovery of cellulose and lignin of 99.9% and 96.3%, respectively. Hemicellulose sugars recovery for xylose and mannose was found to be 69.2% and 76.0%, respectively, indicating that WEx is capable of producing relative high sugar yield even from the recalcitrant forest residues. Copyright © 2015 Elsevier Ltd. All rights reserved.

Continuous A.E. monitoring of nuclear systems: some feasibility studies now in-progress in France

International Nuclear Information System (INIS)

Roget, J.; Germain, J.L.

1986-01-01

Continuous A.E. monitoring of Nuclear systems can give some unique information about abnormal behaviour (leak appearance...) or crack initiation or propagation. Some feasibility studies have been undertaken in France in this field and this paper presents the results we have got in two cases. The study showed that an A.E. surveillance of pressurized safety valves indicates the appearance or the presence of a leak. Functioning noise is not a problem in this case. Secondly a large study have been undertaken to test the resistance of the pipe inner sleeve to thermal fatigue. An A.E. monitoring showed that it is possible to separate A.E. due to Crack extension from other signals by a location method in spite of high noise level. A.E. seems applicable for continuous monitoring. So, complementary tests are in progress to confirm and improve these results

Perceptions, practices and health seeking behaviour constrain JE/AES interventions in high endemic district of North India.

Science.gov (United States)

Chaturvedi, Sanjay; Sharma, Neha; Kakkar, Manish

2017-08-08

Acute Encephalitis Syndrome (AES) and Japanese Encephalitis (JE) stay as poorly understood phenomena in India. Multiple linkages to determinants such as poverty, socio-economic status, gender, environment, and population distribution, make it a greater developmental issue than just a zoonotic disease. A qualitative study was conducted to map knowledge, perceptions and practices of community and health systems level stakeholders. Seventeen interviews with utilizers of AES care, care givers from human and veterinary sectors, Non-governmental Organizations (NGOs), and pig owners and 4 Focused Group Discussions (FGDs) with farmers, community leaders, and students were conducted in an endemic north Indian district-Kushinagar. Core themes that emerged were: JE/AES been perceived as a deadly disease, but not a major health problem; filthy conditions, filthy water and mosquitoes seen to be associated with JE/AES; pigs not seen as a source of infection; minimal role of government health workers in the first-contact care of acute Illness; no social or cultural resistance to JE vaccination or mosquito control; no gender-based discrimination in the care of acute Illness; and non-utilization of funds available with local self govt. Serious challenges and systematic failures in delivery of care during acute illness, which can critically inform the health systems, were also identified. There is an urgent need for promotive interventions to address lack of awareness about the drivers of JE/AES. Delivery of care during acute illness suffers with formidable challenges and systematic failures. A large portion of mortality can be prevented by early institution of rational management at primary and secondary level, and by avoiding wastage of time and resources for investigations and medications that are not actually required.

Spontaneous wheat-Aegilops biuncialis, Ae. geniculata and Ae. triuncialis amphiploid production, a potential way of gene transference

OpenAIRE

Loureiro, I.; Escorial, C.; García-Baudin, J.M.; Chueca, C.

2009-01-01

Some F1 hybrid plants between three species of the Aegilops genus and different hexaploid wheat Triticum aestivum cultivars show certain self-fertility, with averages of F1 hybrids bearing F2 seeds of 8.17%, 5.12% and 48.14% for Aegilops biuncialis, Aegilops geniculata and Aegilops triuncialis respectively. In the Ae. triuncialis-wheat combination with ";Astral" wheat cultivar, the fertility was higher than that found in the other combinations. All the F2 seeds studied were spontaneous amphip...

22 CFR 120.30 - The Automated Export System (AES).

Science.gov (United States)

2010-04-01

... 22 Foreign Relations 1 2010-04-01 2010-04-01 false The Automated Export System (AES). 120.30... DEFINITIONS § 120.30 The Automated Export System (AES). The Automated Export System (AES) is the Department of... system for collection of export data for the Department of State. In accordance with this subchapter U.S...

Optimization of uncatalyzed steam explosion pretreatment of rapeseed straw for biofuel production.

Science.gov (United States)

López-Linares, Juan C; Ballesteros, Ignacio; Tourán, Josefina; Cara, Cristóbal; Castro, Eulogio; Ballesteros, Mercedes; Romero, Inmaculada

2015-08-01

Rapeseed straw constitutes an agricultural residue with great potential as feedstock for ethanol production. In this work, uncatalyzed steam explosion was carried out as a pretreatment to increase the enzymatic digestibility of rapeseed straw. Experimental statistical design and response surface methodology were used to evaluate the influence of the temperature (185-215°C) and the process time (2.5-7.5min). According to the rotatable central composite design applied, 215°C and 7.5min were confirmed to be the optimal conditions, considering the maximization of enzymatic hydrolysis yield as optimization criterion. These conditions led to a maximum yield of 72.3%, equivalent to 81% of potential glucose in pretreated solid. Different configurations for bioethanol production from steam exploded rapeseed straw were investigated using the pretreated solid obtained under optimal conditions as a substrate. As a relevant result, concentrations of ethanol as high as 43.6g/L (5.5% by volume) were obtained as a consequence of using 20% (w/v) solid loading, equivalent to 12.4g ethanol/100g biomass. Copyright © 2015 Elsevier Ltd. All rights reserved.

Idaho Explosives Detection System

International Nuclear Information System (INIS)

Reber, Edward L.; Blackwood, Larry G.; Edwards, Andrew J.; Jewell, J. Keith; Rohde, Kenneth W.; Seabury, Edward H.; Klinger, Jeffery B.

2005-01-01

The Idaho Explosives Detection System was developed at the Idaho National Laboratory (INL) to respond to threats imposed by delivery trucks potentially carrying explosives into military bases. A full-scale prototype system has been built and is currently undergoing testing. The system consists of two racks, one on each side of a subject vehicle. Each rack includes a neutron generator and an array of NaI detectors. The two neutron generators are pulsed and synchronized. A laptop computer controls the entire system. The control software is easily operable by minimally trained staff. The system was developed to detect explosives in a medium size truck within a 5-min measurement time. System performance was successfully demonstrated with explosives at the INL in June 2004 and at Andrews Air Force Base in July 2004

Idaho Explosives Detection System

Energy Technology Data Exchange (ETDEWEB)

Reber, Edward L. [Idaho National Laboratory, 2525 N. Freemont Ave., Idaho Falls, ID 83415-2114 (United States)]. E-mail: reber@inel.gov; Blackwood, Larry G. [Idaho National Laboratory, 2525 N. Freemont Ave., Idaho Falls, ID 83415-2114 (United States); Edwards, Andrew J. [Idaho National Laboratory, 2525 N. Freemont Ave., Idaho Falls, ID 83415-2114 (United States); Jewell, J. Keith [Idaho National Laboratory, 2525 N. Freemont Ave., Idaho Falls, ID 83415-2114 (United States); Rohde, Kenneth W. [Idaho National Laboratory, 2525 N. Freemont Ave., Idaho Falls, ID 83415-2114 (United States); Seabury, Edward H. [Idaho National Laboratory, 2525 N. Freemont Ave., Idaho Falls, ID 83415-2114 (United States); Klinger, Jeffery B. [Idaho National Laboratory, 2525 N. Freemont Ave., Idaho Falls, ID 83415-2114 (United States)

2005-12-15

The Idaho Explosives Detection System was developed at the Idaho National Laboratory (INL) to respond to threats imposed by delivery trucks potentially carrying explosives into military bases. A full-scale prototype system has been built and is currently undergoing testing. The system consists of two racks, one on each side of a subject vehicle. Each rack includes a neutron generator and an array of NaI detectors. The two neutron generators are pulsed and synchronized. A laptop computer controls the entire system. The control software is easily operable by minimally trained staff. The system was developed to detect explosives in a medium size truck within a 5-min measurement time. System performance was successfully demonstrated with explosives at the INL in June 2004 and at Andrews Air Force Base in July 2004.

References: AePW publications

Data.gov (United States)

National Aeronautics and Space Administration — This page is the repository for the publications resulting from the AePW. This includes the special sessions at conferences: AIAA ASM 2012, Grapevine TX; AIAA SDM...

Mechanism of action and efficacy of RX-111, a thieno[2,3-c]pyridine derivative and small molecule inhibitor of protein interaction with glycosaminoglycans (SMIGs), in delayed-type hypersensitivity, TNBS-induced colitis and experimental autoimmune encephalomyelitis.

Science.gov (United States)

Harris, Nicholas; Koppel, Juraj; Zsila, Ferenc; Juhas, Stefan; Il'kova, Gabriela; Kogan, Faina Yurgenzon; Lahmy, Orly; Wildbaum, Gizi; Karin, Nathan; Zhuk, Regina; Gregor, Paul

2016-04-01

Elucidate the mechanism of action of the small molecule inhibitor of protein binding to glycosaminoglycans, RX-111 and assay its anti-inflammatory activity in animal models of inflammatory disease. The glycosaminoglycan, heparin, was used in the mechanism of action study of RX-111. Human T lymphocytes and umbilical vein endothelial cells were used to assay the in vitro activity of RX-111. Mouse and rat models of disease were used to assay the anti-inflammatory activity of RX-111 in vivo. Circular dichroism and UV/Vis absorption spectroscopy were used to study the binding of RX-111 to the glycosaminoglycan, heparin. T lymphocyte rolling on endothelial cells under shear flow was used to assay RX-111 activity in vitro. Delayed-type hypersensitivity (DTH) and tri-nitrobenzene sulfonic acid (TNBS)-induced colitis in mice and experimental autoimmune encephalomyelitis (EAE) in rats were used to assay anti-inflammatory activity of RX-111 in vivo. RX-111 was shown to bind directly to heparin. It inhibited leukocyte rolling on endothelial cells under shear flow and reduced inflammation in the mouse model of DTH. RX-111 was efficacious in the mouse model of inflammatory bowel disease, TNBS-induced colitis and the rat model of multiple sclerosis, EAE. RX-111 exercises its broad spectrum anti-inflammatory activity by a singular mechanism of action, inhibition of protein binding to the cell surface GAG, heparan sulfate. RX-111 and related thieno[2,3-c]pyridine derivatives are potential therapeutics for the treatment of inflammatory and autoimmune diseases.

Elaboration of the Charge Constructions of Explosives for the Structure of Facing Stone

Science.gov (United States)

Khomeriki, Sergo; Mataradze, Edgar; Chikhradze, Nikoloz; Losaberidze, Marine; Khomeriki, Davit; Shatberashvili, Grigol

2017-12-01

Increased demand for high-strength facing material caused the enhancement of the volume of explosives use in modern technologies of blocks production. The volume of broken rocks and crushing quality depends on the rock characteristics and on the properties of the explosive, in particular on its brisance and serviceability. Therefore, the correct selection of the explosive for the specific massif is of a considerable practical importance. For efficient mining of facing materials by explosion method the solving of such problems as determination of the method of blasthole drilling as well as of the regime and charge values, selection of the explosive, blastholes distribution in the face and their order is necessary. This paper focuses on technical solutions for conservation of rock natural structure in the blocks of facing material, mined by the use of the explosives. It has been established that the efficient solving of mentioned problem is attained by reducing of shock pulse duration. In such conditions the rigidity of crystalline lattice increases in high pressure area. As a result, the hazard if crack formation in structural unites and the increases of natural cracks are excluded. Short-time action of explosion pulse is possible only by linear charges of the explosives, characterized by high detonation velocity which detonate by the velocity of 7-7.5 km/sec and are characterized by very small critical diameter.

Effects of a prostagrandin EP4-receptor agonist ONO-AE1-329 on the left ventricular pressure-volume relationship in the halothane-anesthetized dogs.

Science.gov (United States)

Honda, Atsushi; Nakamura, Yuji; Ohara, Hiroshi; Cao, Xin; Nomura, Hiroaki; Katagi, Jun; Wada, Takeshi; Izumi-Nakaseko, Hiroko; Ando, Kentaro; Sugiyama, Atsushi

2016-03-15

Cardiac effects of a prostagrandin EP4-receptor agonist ONO-AE1-329 were assessed in the halothane-anesthetized dogs under the monitoring of left ventricular pressure-volume relationship, which were compared with those of clinically recommended doses of dopamine, dobutamine and milrinone (n=4-5 for each treatment). ONO-AE1-329 was intravenously administered in doses of 0.3, 1 and 3 ng/kg/min for 10 min with a pause of 20 min. Dopamine in a dose of 3 µg/kg/min for 10 min, dobutamine in a dose of 1 µg/kg/min for 10 min and milrinone in a dose of 5 µg/kg/min for 10 min followed by 0.5 µg/kg/min for 10 min were intravenously administered. Low dose of ONO-AE1-329 increased the stroke volume. Middle dose of ONO-AE1-329 increased the cardiac output, left ventricular end-diastolic volume, ejection fraction, maximum upstroke/downstroke velocities of the left ventricular pressure and external work, but decreased the end-systolic pressure and internal work besides the change by the low dose. High dose of ONO-AE1-329 increased the heart rate and maximum elastance, but decreased the end-systolic volume besides the changes by the middle dose. Dopamine, dobutamine and milrinone exerted essentially similar cardiac effects to ONO-AE1-329, but they did not significantly change the end-diastolic volume, end-systolic volume, stroke volume, ejection fraction, end-systolic pressure, maximum elastance, external work or internal work. Thus, EP4-receptor stimulation by ONO-AE1-329 may have potential to better promote the passive ventricular filling than the conventional cardiotonic drugs, which could become a candidate of novel therapeutic strategy for the treatment of heart failure with preserved ejection fraction. Copyright © 2016 Elsevier B.V. All rights reserved.

A study on the determination of phosphorus in Th-U matrix by a high resolution spectroanalyser (ICP-AES)

International Nuclear Information System (INIS)

Save, Neeta; Kumar, Neeraj; Jaiswal, Rajesh; Ghosh, Seema; Malav, R.K.; Das, D.K.; Prakash, Amrit; Behere, P.G.; Afzal, Mohd

2013-01-01

Phosphorus is present as an impurity in Thoria and constitutes an important chemical specification of the Thoria based fuel. The present paper depicts the importance of determination of phosphorus, which forms an important quality control step during the fabrication of mixed oxide (Th-U)O 2 pellet. A high resolution spectroanalyser using ICP-AES has been used for the determination of Phosphorus in (ThO 2 -3.25%UO 2 ). (author)

Review of Soviet studies related to peaceful underground nuclear explosions

International Nuclear Information System (INIS)

Lin, W.

1978-01-01

Theoretical and empirical studies of contained and crater-forming underground nuclear explosions by USSR investigators are reviewed and summarized. Published data on U.S., USSR, and French cavity-forming nuclear explosions are compared with those predicted by the formula. Empirical studies on U.S. and USSR cratering explosions, both high explosions, both high explosive and nuclear are summarized. The parameters governing an excavation explosion are reviewed

Perceptions, practices and health seeking behaviour constrain JE/AES interventions in high endemic district of North India

Directory of Open Access Journals (Sweden)

Sanjay Chaturvedi

2017-08-01

Full Text Available Abstract Background Acute Encephalitis Syndrome (AES and Japanese Encephalitis (JE stay as poorly understood phenomena in India. Multiple linkages to determinants such as poverty, socio-economic status, gender, environment, and population distribution, make it a greater developmental issue than just a zoonotic disease. Methods A qualitative study was conducted to map knowledge, perceptions and practices of community and health systems level stakeholders. Seventeen interviews with utilizers of AES care, care givers from human and veterinary sectors, Non-governmental Organizations (NGOs, and pig owners and 4 Focused Group Discussions (FGDs with farmers, community leaders, and students were conducted in an endemic north Indian district-Kushinagar. Results Core themes that emerged were: JE/AES been perceived as a deadly disease, but not a major health problem; filthy conditions, filthy water and mosquitoes seen to be associated with JE/AES; pigs not seen as a source of infection; minimal role of government health workers in the first-contact care of acute Illness; no social or cultural resistance to JE vaccination or mosquito control; no gender-based discrimination in the care of acute Illness; and non-utilization of funds available with local self govt. Serious challenges and systematic failures in delivery of care during acute illness, which can critically inform the health systems, were also identified. Conclusion There is an urgent need for promotive interventions to address lack of awareness about the drivers of JE/AES. Delivery of care during acute illness suffers with formidable challenges and systematic failures. A large portion of mortality can be prevented by early institution of rational management at primary and secondary level, and by avoiding wastage of time and resources for investigations and medications that are not actually required.

Research on Initiation Sensitivity of Solid Explosive and Planer Initiation System

Directory of Open Access Journals (Sweden)

N Matsuo

2016-09-01

Full Text Available Firstly, recently, there are a lot of techniques being demanded for complex process, various explosive initiation method and highly accurate control of detonation are needed. In this research, the metal foil explosion using high current is focused attention on the method to obtain linear or planate initiation easily, and the main evaluation of metal foil explosion to initiate explosive was conducted. The explosion power was evaluated by observing optically the underwater shock wave generated from the metal foil explosion. Secondly, in high energy explosive processing, there are several applications, such as shock compaction, explosive welding, food processing and explosive forming. In these explosive applications, a high sensitive explosive has been mainly used. The high sensitive explosive is so dangerous, since it can lead to explosion suddenly. So, for developing explosives, the safety is the most important thing as well as low manufacturing cost and explosive characteristics. In this work, we have focused on the initiation sensitivity of a solid explosive and performed numerical analysis of sympathetic detonation. The numerical analysis is calculated by LS-DYNA 3D (commercial code. To understand the initiation reaction of an explosive, Lee-Tarver equation was used and impact detonation process was analyzed by ALE code. Configuration of simulation model is a quarter of circular cylinder. The donor type of explosive (SEP was used as initiation explosive. When the donor explosive is exploded, a shock wave is generated and it propagates into PMMA, air and metallic layers in order. During passing through the layers, the shock wave is attenuated and finally, it has influence on the acceptor explosive, Comp. B. Here, we evaluate the initiation of acceptor explosive and discuss about detonation pressure, reactive rate of acceptor explosive and attenuation of impact pressure.

Power Consumption and Calculation Requirement Analysis of AES for WSN IoT.

Science.gov (United States)

Hung, Chung-Wen; Hsu, Wen-Ting

2018-05-23

Because of the ubiquity of Internet of Things (IoT) devices, the power consumption and security of IoT systems have become very important issues. Advanced Encryption Standard (AES) is a block cipher algorithm is commonly used in IoT devices. In this paper, the power consumption and cryptographic calculation requirement for different payload lengths and AES encryption types are analyzed. These types include software-based AES-CB, hardware-based AES-ECB (Electronic Codebook Mode), and hardware-based AES-CCM (Counter with CBC-MAC Mode). The calculation requirement and power consumption for these AES encryption types are measured on the Texas Instruments LAUNCHXL-CC1310 platform. The experimental results show that the hardware-based AES performs better than the software-based AES in terms of power consumption and calculation cycle requirements. In addition, in terms of AES mode selection, the AES-CCM-MIC64 mode may be a better choice if the IoT device is considering security, encryption calculation requirement, and low power consumption at the same time. However, if the IoT device is pursuing lower power and the payload length is generally less than 16 bytes, then AES-ECB could be considered.

Evaluation of fracturing process of soft rocks at great depth by AE measurement and DEM simulation

International Nuclear Information System (INIS)

Aoki, Kenji; Mito, Yoshitada; Kurokawa, Susumu; Matsui, Hiroya; Niunoya, Sumio; Minami, Masayuki

2007-01-01

The authors developed the stress-based evaluation system of EDZ by AE monitoring and Distinct Element Method (DEM) simulation. In order to apply this system to the soft rock site, the authors try to grasp the relationship between AE parameters, stress change and rock fracturing process by performing the high stiffness tri-axial compression tests including AE measurements on the soft rock samples, and its simulations by DEM using bonded particle model. As the result, it is found that change in predominant AE frequency is effective to evaluate fracturing process in sedimentary soft rocks, and the relationship between stress change and fracturing process is also clarified. (author)

PET attenuation correction for rigid MR Tx/Rx coils from 176Lu background activity

Science.gov (United States)

Lerche, Christoph W.; Kaltsas, Theodoris; Caldeira, Liliana; Scheins, Jürgen; Rota Kops, Elena; Tellmann, Lutz; Pietrzyk, Uwe; Herzog, Hans; Shah, N. Jon

2018-02-01

One challenge for PET-MR hybrid imaging is the correction for attenuation of the 511 keV annihilation radiation by the required RF transmit and/or RF receive coils. Although there are strategies for building PET transparent Tx/Rx coils, such optimised coils still cause significant attenuation of the annihilation radiation leading to artefacts and biases in the reconstructed activity concentrations. We present a straightforward method to measure the attenuation of Tx/Rx coils in simultaneous MR-PET imaging based on the natural 176Lu background contained in the scintillator of the PET detector without the requirement of an external CT scanner or PET scanner with transmission source. The method was evaluated on a prototype 3T MR-BrainPET produced by Siemens Healthcare GmbH, both with phantom studies and with true emission images from patient/volunteer examinations. Furthermore, the count rate stability of the PET scanner and the x-ray properties of the Tx/Rx head coil were investigated. Even without energy extrapolation from the two dominant γ energies of 176Lu to 511 keV, the presented method for attenuation correction, based on the measurement of 176Lu background attenuation, shows slightly better performance than the coil attenuation correction currently used. The coil attenuation correction currently used is based on an external transmission scan with rotating 68Ge sources acquired on a Siemens ECAT HR  +  PET scanner. However, the main advantage of the presented approach is its straightforwardness and ready availability without the need for additional accessories.

Shock waves & explosions

CERN Document Server

Sachdev, PL

2004-01-01

Understanding the causes and effects of explosions is important to experts in a broad range of disciplines, including the military, industrial and environmental research, aeronautic engineering, and applied mathematics. Offering an introductory review of historic research, Shock Waves and Explosions brings analytic and computational methods to a wide audience in a clear and thorough way. Beginning with an overview of the research on combustion and gas dynamics in the 1970s and 1980s, the author brings you up to date by covering modeling techniques and asymptotic and perturbative methods and ending with a chapter on computational methods.Most of the book deals with the mathematical analysis of explosions, but computational results are also included wherever they are available. Historical perspectives are provided on the advent of nonlinear science, as well as on the mathematical study of the blast wave phenomenon, both when visualized as a point explosion and when simulated as the expansion of a high-pressure ...

Preparation of graphene by electrical explosion of graphite sticks.

Science.gov (United States)

Gao, Xin; Xu, Chunxiao; Yin, Hao; Wang, Xiaoguang; Song, Qiuzhi; Chen, Pengwan

2017-08-03

Graphene nanosheets were produced by electrical explosion of high-purity graphite sticks in distilled water at room temperature. The as-prepared samples were characterized by various techniques to find different forms of carbon phases, including graphite nanosheets, few-layer graphene, and especially, mono-layer graphene with good crystallinity. Delicate control of energy injection is critical for graphene nanosheet formation, whereas mono-layer graphene was produced under the charging voltage of 22.5-23.5 kV. On the basis of electrical wire explosion and our experimental results, the underlying mechanism that governs the graphene generation was carefully illustrated. This work provides a simple but innovative route for producing graphene nanosheets.

78 FR 64246 - Commerce in Explosives; List of Explosives Materials

Science.gov (United States)

2013-10-28

..., including non-cap sensitive slurry and water gel explosives. Blasting caps. Blasting gelatin. Blasting.... Explosive conitrates. Explosive gelatins. Explosive liquids. Explosive mixtures containing oxygen-releasing... powder. [[Page 64247

Clinical epidemiology of human AE in Europe.

Science.gov (United States)

Vuitton, D A; Demonmerot, F; Knapp, J; Richou, C; Grenouillet, F; Chauchet, A; Vuitton, L; Bresson-Hadni, S; Millon, L

2015-10-30

This review gives a critical update of the situation regarding alveolar echinococcosis (AE) in Europe in humans, based on existing publications and on findings of national and European surveillance systems. All sources point to an increase in human cases of AE in the "historic endemic areas" of Europe, namely Germany, Switzerland, Austria and France and to the emergence of human cases in countries where the disease had never been recognised until the end of the 20th century, especially in central-eastern and Baltic countries. Both increase and emergence could be only due to methodological biases; this point is discussed in the review. One explanation may be given by changes in the animal reservoir of the parasite, Echinococcus multilocularis (increase in the global population of foxes in Europe and its urbanisation, as well as a possible increased involvement of pet animals as definitive infectious hosts). The review also focuses onto 2 more original approaches: (1) how changes in therapeutic attitudes toward malignant and chronic inflammatory diseases may affect the epidemiology of AE in the future in Europe, since a recent survey of such cases in France showed the emergence of AE in patients with immune suppression since the beginning of the 21st century; (2) how setting a network of referral centres in Europe based on common studies on the care management of patients might contribute to a better knowledge of AE epidemiology in the future. Copyright © 2015. Published by Elsevier B.V.

AE characteristic for monitoring of fatigue crack in steel bridge members

Science.gov (United States)

Yoon, Dong-Jin; Jung, Juong-Chae; Park, Philip; Lee, Seung-Seok

2000-06-01

Acoustic emission technique was employed for the monitoring of crack activity in both steel bridge members and laboratory specimen. Laboratory experiment was carried out to identify AE characteristics of fatigue cracks for compact tension specimen. The relationship between a stress intensity factor and AE signals activity as well as conventional AE parameter analysis was discussed. A field test was also conducted on a railway bridge, which contain several fatigue cracks. Crack activities were investigated while in service with strain measurement. From the results, in the laboratory tests, the features of three parameters such as the length of crack growth, the AE energy, and the cumulative AE events, showed the almost same trend in their increase as the number of fatigue cycle increased. From the comparisons of peak amplitude and AE energy with stress intensity factor, it was verified that the higher stress intensity factors generated AE signals with higher peak amplitude and a large number of AE counts. In the field test, real crack propagation signals were captured and the crack activity was verified in two cases.

The effect of explosive percentage on underwater explosion energy release of hexanitrohexaazaisowurtzitane and octogen based aluminized explosives

OpenAIRE

Qingjie Jiao; Qiushi Wang; Jianxin Nie; Xueyong Guo; Wei Zhang; Wenqi Fan

2018-01-01

To control the explosion energy output by optimizing explosive components is a key requirement in a number of different application areas. The effect of different Al/O Ratio on underwater explosion of aluminized explosives has been studied detailedly. However, the effect of explosive percentage in the same Al/O Ratio is rarely researched, especially for Hexanitrohexaazaisowurtzitane (CL-20) based aluminized explosives. In this study, we performed the underwater explosion experiments with 1.2-...

Caraterização composicional do AES - um copolímero de enxertia de poli(estireno-co-acrilonitrila em poli(etileno-co-propileno-co-dieno Compositional characterization of AES a graft copolymer based on poly(styrene-co-acrylonitrile and poly(etyhlene-co-propylene-co-diene

Directory of Open Access Journals (Sweden)

Renato Turchet

2006-06-01

Full Text Available O objetivo deste trabalho é a caracterização do AES, um copolímero de enxertia de poli(estireno-co-acrilonitrila, SAN, em poli(etileno-co-propileno-co-dieno, EPDM. Para tanto, o AES foi submetido à extração seletiva de seus componentes: o SAN livre, o EDPM livre, e o copolímero de enxertia EPDM-g-SAN. O AES e suas frações foram caracterizados por espectroscopia de infravermelho, análise elementar, calorimetria diferencial de varredura e ressonância magnética nuclear, RMN¹H e RMN13C. O AES analisado apresenta a seguinte composição em massa: 65% de EPDM-g-SAN, 13% de EPDM livre e 22% de SAN livre. O EPDM apresenta 69,8% em massa de etileno, 26,5% em massa de propileno e 4,6% em massa do dieno, 2-etilideno-5-norboneno, ENB. O SAN apresenta razão em massa acrilonitrila/estireno de 28/72 e distribuição randômica de comonômeros de estireno e acrilonitrila. Estes resultados são concordantes com a composição do AES fornecida pelo fabricante, indicando que a metodologia proposta é adequada.This work aims the characterization of AES, a graft copolymer based on poly(styrene-co-acrylonitrile, SAN, and poly(etyhlene-co-propylene-co-diene, EPDM. AES was submitted to selective extraction of its components: free SAN, EPDM chains and the graft copolymer EPDM-g-SAN. AES and its fractions were characterized by infrared spectroscopy, elemental analysis, differential scanning calorimetry, 13C and ¹H nuclear magnetic resonance. The AES has 65 wt % of EPDM-g-SAN, 13 wt % of free EPDM and 22 wt % of free SAN. EPDM has 69.8 wt % of ethylene, 26.5 wt % of propylene and 4.6 wt % of diene, 2-ethylidene-5-norbonene ENB. SAN presents acrylonitrile/styrene mass ratio of 28/72 and a random distribution of acrylonitrile and styrene comonomers. These results are in agreement with the composition reported by the AES supplier, indicating that the proposed methodology is adequate.

The Hydrogen Bonded Structures of Two 5-Bromobarbituric Acids and Analysis of Unequal C5–X and C5–X′ Bond Lengths (X = X′ = F, Cl, Br or Me in 5,5-Disubstituted Barbituric Acids

Directory of Open Access Journals (Sweden)

Thomas Gelbrich

2016-04-01

Full Text Available The crystal structure of the methanol hemisolvate of 5,5-dibromobarbituric acid (1MH displays an H-bonded layer structure which is based on N–H∙∙∙O=C, N–H∙∙∙O(MeOH and (MeOHO–H∙∙∙O interactions. The barbiturate molecules form an H-bonded substructure which has the fes topology. 5,5′-Methanediylbis(5-bromobarbituric acid 2, obtained from a solution of 5,5-dibromobarbituric acid in nitromethane, displays a N–H···O=C bonded framework of the sxd type. The conformation of the pyridmidine ring and the lengths of the ring substituent bonds C5–X and C5–X′ in crystal forms of 5,5-dibromobarbituric acid and three closely related analogues (X = X′ = Br, Cl, F, Me have been investigated. In each case, a conformation close to a C5-endo envelope is correlated with a significant lengthening of the axial C5–X′ in comparison to the equatorial C5–X bond. Isolated molecule geometry optimizations at different levels of theory confirm that the C5-endo envelope is the global conformational energy minimum of 5,5-dihalogenbarbituric acids. The relative lengthening of the axial bond is therefore interpreted as an inherent feature of the preferred envelope conformation of the pyrimidine ring, which minimizes repulsive interactions between the axial substituent and pyrimidine ring atoms.

Magnetic ordering in the monoclinic structure of Nd5Si1.45Ge2.55 and Pr5Si1.5Ge2.5 studied by means of neutron powder diffraction

International Nuclear Information System (INIS)

Magen, C; Ritter, C; Morellon, L; Algarabel, P A; Ibarra, M R

2004-01-01

The compounds Nd 5 Si 1.45 Ge 2.55 and Pr 5 Si 1.5 Ge 2.5 have been investigated by means of magnetization measurements and neutron powder diffraction techniques. These alloys present a room-temperature monoclinic Gd 5 Si 2 Ge 2 -type crystallographic structure and, on cooling, both systems order ferromagnetically, at T C = 56 and 32 K, respectively, from a high-temperature paramagnetic to a low-temperature complex canted ferromagnetic state. The monoclinic crystallographic structure remains unchanged upon cooling down to 4 K, demonstrating the existence of a monoclinic ferromagnetic phase, and the possibility of a full decoupling of magnetic and crystallographic degrees of freedom in the 5:4 lanthanide intermetallic compounds

Robotic Manufacturing of 5.5 Meter Cryogenic Fuel Tank Dome Assemblies for the NASA Ares I Rocket

Science.gov (United States)

Jones, Ronald E.

2012-01-01

The Ares I rocket is the first launch vehicle scheduled for manufacture under the National Aeronautic and Space Administration's (NASA's) Constellation program. A series of full-scale Ares I development articles have been constructed on the Robotic Weld Tool at the NASA George C. Marshall Space Flight Center in Huntsville, Alabama. The Robotic Weld Tool is a 100 ton, 7-axis, robotic manufacturing system capable of machining and friction stir welding large-scale space hardware. This presentation will focus on the friction stir welding of 5.5m diameter cryogenic fuel tank components; specifically, the liquid hydrogen forward dome (LH2 MDA), the common bulkhead manufacturing development articles (CBMDA) and the thermal protection system demonstration dome (TPS Dome). The LH2 MDA was the first full-scale, flight-like Ares I hardware produced under the Constellation Program. It is a 5.5m diameter elliptical dome assembly consisting of eight gore panels, a y-ring stiffener and a manhole fitting. All components are made from aluminumlithium alloy 2195. Conventional and self-reacting friction stir welding was used on this article. An overview of the manufacturing processes will be discussed. The LH2 MDA is the first known fully friction stir welded dome ever produced. The completion of four Common Bulkhead Manufacturing Development Articles (CBMDA) and the TPS Dome will also be highlighted. Each CBMDA and the TPS Dome consists of a 5.5m diameter spun-formed dome friction stir welded to a y-ring stiffener. The domes and y-rings are made of aluminum 2014 and 2219 respectively. The TPS Dome has an additional aluminum alloy 2195 barrel section welded to the y-ring. Manufacturing solutions will be discussed including "fixtureless" welding with self reacting friction stir welding.

Nitrogen-rich salts of 5,5‧-bistetrazole-1,1‧-diolate: Syntheses, structures and properties

Science.gov (United States)

Yang, Ting; Zhang, Jian-Guo; Zhang, Zhi-Bin; Gozin, Michael

2018-03-01

A series of new nitrogen-rich energetic salts containing 1H,1‧H-[5,5‧-bitetrazole]-1,1‧-diol (BTO) anion and ethane-1,2-diaminium (1), 1-amino-1H-1,2,3-triazol-3-ium (2), 4-amino-4H-1,2,4-triazol-1-ium (3) and 4,5-diamino-4H-1,2,4-triazol-1-ium (4) cations were synthesized by direct salt formation or by metathesis strategy. The structures of energetic salts 1-4 were comprehensively characterized by elemental analysis, mass spectrometry, IR and NMR spectroscopies and by X-ray crystallography. DSC and TGA methods were used to study thermal properties of these salts. Additionally, the non-isothermal kinetic parameters and thermodynamic parameters were calculated by utilizing the Kissinger's and Ozawa-Doyle's methods. The enthalpies of formation for all target compounds in this study were calculated, and their sensitivity to mechanical impact and friction was tested according to BAM guidelines. We found these new energetic salts exhibit good thermal stability and have typical decomposition temperatures above 230 °C, except for the salt 2. All our salts have highly-positive enthalpies of formation (311.1-473.6 kJ mol-1) and are insensitive to impact and friction stimuli (>40 J, 120 N). With a high nitrogen-rich content, high enthalpy of formation, good thermostability and very low sensitivity to impact, some of these new salts may have a potential for application in the field of environmentally friendly insensitive energetic materials.

Sensitivities of ionic explosives

Science.gov (United States)

Politzer, Peter; Lane, Pat; Murray, Jane S.

2017-03-01

We have investigated the relevance for ionic explosive sensitivity of three factors that have been demonstrated to be related to the sensitivities of molecular explosives. These are (1) the maximum available heat of detonation, (2) the amount of free space per molecule (or per formula unit) in the crystal lattice and (3) specific features of the electrostatic potential on the molecular or ionic surface. We find that for ionic explosives, just as for molecular ones, there is an overall tendency for impact sensitivity to increase as the maximum detonation heat release is greater. This means that the usual emphasis upon designing explosives with large heats of detonation needs to be tempered somewhat. We also show that a moderate detonation heat release does not preclude a high level of detonation performance for ionic explosives, as was already demonstrated for molecular ones. Relating the free space per formula unit to sensitivity may require a modified procedure for ionic explosives; this will continue to be investigated. Finally, an encouraging start has been made in linking impact sensitivities to the electrostatic potentials on ionic surfaces, although limited so far to ammonium salts.

High explosive characterization for the dice throw event

Energy Technology Data Exchange (ETDEWEB)

Helm, F.; Finger, M.; Hayes, B.; Lee, E.; Cheung, H.; Walton, J.

1976-06-16

An equation of state for detonation products was developed to describe the detonation of large charges of ammonium nitrate/fuel oil (ANFO). The equation of state will be used to predict air-blast and ground-motion effects in the Dice Throw Event. The explosive performance of ANFO is highly dependent on charge size. The equation developed from this work is applicable to heavily confined detonations 101.6 mm in diameter or larger. The equation of state is based on results from experiments in cylinders and hemispheres, and a large field test. The report contains a detailed discussion of the diagnostic and initiation techniques used in these experiments.

Determining the Coalescence of Hotspots into Uniform Detonation Fronts in High Explosives

Energy Technology Data Exchange (ETDEWEB)

Steward, G. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Purdue Univ., West Lafayette, IN (United States); Mays, R. O. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Converse, M. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Baluyot, E. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Tringe, J. W. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Kane, R. J. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)

2017-08-14

Microwave Interferometry (MI) offers the advantage of a continuous time measurement of detonation front velocity from detonation initiation to disassembly, which is an important step to assure the quality of stockpile high explosives. However, the method is currently characterized by areas of poor signal strength, which lead to low confidence measurements. Experiments in inert materials were conducted to determine if reflective hot spots, pockets of plasma that form during detonation, are responsible due to varying hot spot concentrations. Instead, it was found that the copper tube used in a range of standard HE test configurations is the cause of the poor signal reception. Hot spots were represented by microwave reflective aluminum particles. The aluminum was mixed with Titanium Dioxide, a material electrically similar to the insensitive high explosive, triaminotrinitrobenzene (TATB), in volume percent fractions (VPFs) between 0 and 100% aluminum, in increments of 10%. Reflectivity was measured based on input and reflection received from a test apparatus with a layer representing undetonated explosive and another representing an approaching shockwave. The results showed no correlation between VPF and measured reflectivity test cases while enclosed in the standard copper tube. Upon further testing, each sample’s measured reflectivity independent of the copper enclosure did correlate with VPF. This revealed that the test enclosure currently used for MI measurements is causing poor MI signal reception, and new methods must be developed to account for this aberration in MI measurements.

The L7Ae protein binds to two kink-turns in the Pyrococcus furiosus RNase P RNA

Science.gov (United States)

Lai, Stella M.; Lai, Lien B.; Foster, Mark P.; Gopalan, Venkat

2014-01-01

The RNA-binding protein L7Ae, known for its role in translation (as part of ribosomes) and RNA modification (as part of sn/oRNPs), has also been identified as a subunit of archaeal RNase P, a ribonucleoprotein complex that employs an RNA catalyst for the Mg2+-dependent 5′ maturation of tRNAs. To better understand the assembly and catalysis of archaeal RNase P, we used a site-specific hydroxyl radical-mediated footprinting strategy to pinpoint the binding sites of Pyrococcus furiosus (Pfu) L7Ae on its cognate RNase P RNA (RPR). L7Ae derivatives with single-Cys substitutions at residues in the predicted RNA-binding interface (K42C/C71V, R46C/C71V, V95C/C71V) were modified with an iron complex of EDTA-2-aminoethyl 2-pyridyl disulfide. Upon addition of hydrogen peroxide and ascorbate, these L7Ae-tethered nucleases were expected to cleave the RPR at nucleotides proximal to the EDTA-Fe–modified residues. Indeed, footprinting experiments with an enzyme assembled with the Pfu RPR and five protein cofactors (POP5, RPP21, RPP29, RPP30 and L7Ae–EDTA-Fe) revealed specific RNA cleavages, localizing the binding sites of L7Ae to the RPR's catalytic and specificity domains. These results support the presence of two kink-turns, the structural motifs recognized by L7Ae, in distinct functional domains of the RPR and suggest testable mechanisms by which L7Ae contributes to RNase P catalysis. PMID:25361963

Production and study of the behavior of ceramic sintering SR2ALWO5,5 to application on the oil industry

International Nuclear Information System (INIS)

Lima, M.M.; Ferreira, R.A. Sanguinetti; Yadava, Y.P.

2011-01-01

The complex perovskita ceramics based on tungsten are highly inert corrosive environments. For this reason, this type of ceramic is used in the manufacture of parts and components for the oil industry where the hostile environment is constant problem. We are working in manufacturing temperature sensors encased in ceramic to petroleum industry. Produce ceramic Sr 2 AlWO 5,5 thermo-mechanical process using a ball mill and subsequently heat treatment temperature of 1200°C for 24 hours. Studied the sintering behavior in the temperature range from 1200 to 1350 °C. In this process, the ceramic powder had a high homogeneity in terms of size and distribution of particles, which facilitates sintering at low temperature and shorter time. Structure and microstructure of calcined ceramic was analyzed by X-ray diffraction and scanning electron microscopy and presented at the congress. (author)

Magnesium Aluminum Borides as Explosive Materials

Science.gov (United States)

2011-12-20

pestle and screened -325 mesh to remove the filter paper. However, some of the filter paper remained in this powder. Table 13 Compositions of...Property of Si-B System Ceramics,” J. Japan Soc. Pow. and Pow. Met., 41[11] 1299-1303 (1994). 53. H. Nakamura, K. Murata, T. Anan, and Y. Hara...Oxidation of Zirconium Borides,” J. Japan Explosives Society, 55[4] 142-146 (1994). 54. M. Woerle, R.Nesper, G. Mair, M. Schwarz, and H. G. von Schnering

A DETAILED STUDY OF THE MOLECULAR AND ATOMIC GAS TOWARD THE {gamma}-RAY SUPERNOVA REMNANT RX J1713.7-3946: SPATIAL TeV {gamma}-RAY AND INTERSTELLAR MEDIUM GAS CORRESPONDENCE

Energy Technology Data Exchange (ETDEWEB)

Fukui, Y.; Sano, H.; Sato, J.; Torii, K.; Horachi, H.; Hayakawa, T.; Inutsuka, S.; Kawamura, A.; Yamamoto, H.; Okuda, T.; Mizuno, N.; Onishi, T. [Department of Physics and Astrophysics, Nagoya University, Nagoya, Aichi 464-8601 (Japan); McClure-Griffiths, N. M. [CSIRO Astronomy and Space Science, Epping NSW 1710 (Australia); Rowell, G. [School of Chemistry and Physics, University of Adelaide, Adelaide 5005 (Australia); Inoue, T. [Department of Physics and Mathematics, Aoyama Gakuin University, Sagamihara, Kanagawa 252-5258 (Japan); Mizuno, A. [Solar-Terrestrial Environment Laboratory, Nagoya University, Nagoya, Aichi 464-8601 (Japan); Ogawa, H., E-mail: fukui@a.phys.nagoya-u.ac.jp [Department of Astrophysics, Graduate School of Science, Osaka Prefecture University, Sakai, Osaka 599-8531 (Japan)

2012-02-10

RX J1713.7-3946 is the most remarkable TeV {gamma}-ray supernova remnant (SNR) that emits {gamma}-rays in the highest energy range. We have made a new combined analysis of CO and H I in the SNR and derived the total protons in the interstellar medium (ISM). We have found that the inclusion of the H I gas provides a significantly better spatial match between the TeV {gamma}-rays and ISM protons than the H{sub 2} gas alone. In particular, the southeastern rim of the {gamma}-ray shell has a counterpart only in the H I. The finding shows that the ISM proton distribution is consistent with the hadronic scenario that cosmic-ray (CR) protons react with ISM protons to produce the {gamma}-rays. This provides another step forward for the hadronic origin of the {gamma}-rays by offering one of the necessary conditions missing in the previous hadronic interpretations. We argue that the highly inhomogeneous distribution of the ISM protons is crucial in the origin of the {gamma}-rays. Most of the neutral gas was likely swept up by the stellar wind of an OB star prior to the supernova (SN) explosion to form a low-density cavity and a swept-up dense wall. The cavity explains the low-density site where the diffusive shock acceleration of charged particles takes place with suppressed thermal X-rays, whereas the CR protons can reach the target protons in the wall to produce the {gamma}-rays. The present finding allows us to estimate the total CR proton energy to be {approx}10{sup 48} erg, 0.1% of the total energy of the SN explosion.

Problems in the theory of point explosions

Science.gov (United States)

Korobeinikov, V. P.

The book is concerned with the development of the theory of point explosions, which is relevant to the study of such phenomena as the initiation of detonation, high-power explosions, electric discharges, cosmic explosions, laser blasts, and hypersonic aerodynamics. The discussion covers the principal equations and the statement of problems; linearized non-self-similar one-dimensional problems; spherical, cylindrical, and plane explosions with allowance for counterpressure under conditions of constant initial density; explosions in a combustible mixture of gases; and point explosions in inhomogeneous media with nonsymmetric energy release. Attention is also given to point explosions in an electrically conducting gas with allowance for the effect of the magnetic field and to the propagation of perturbations from solar flares.

Electron and nuclear dynamics of molecular clusters in ultraintense laser fields. IV. Coulomb explosion of molecular heteroclusters.

Science.gov (United States)

Last, Isidore; Jortner, Joshua

2004-11-01

In this paper we present a theoretical and computational study of the temporal dynamics and energetics of Coulomb explosion of (CD4)(n) and (CH4)(n) (n=55-4213) molecular heteroclusters in ultraintense (I=10(16)-10(19) W cm(-2)) laser fields, addressing the manifestation of electron dynamics, together with nuclear energetic and kinematic effects on the heterocluster Coulomb instability. The manifestations of the coupling between electron and nuclear dynamics were explored by molecular dynamics simulations for these heteroclusters coupled to Gaussian laser fields (pulse width tau=25 fs), elucidating outer ionization dynamics, nanoplasma screening effects (being significant for Icharges and masses. Nonuniform heterocluster Coulomb explosion (eta >1) manifests an overrun effect of the light ions relative to the heavy ions, exhibiting the expansion of two spatially separated subclusters, with the light ions forming the outer subcluster at the outer edge of the spatial distribution. Important features of the energetics of heterocluster Coulomb explosion originate from energetic triggering effects of the driving of the light ions by the heavy ions (C(4+) for I=10(17)-10(18) W cm(-2) and C(6+) for I=10(19) W cm(-2)), as well as for kinematic effects. Based on the CVI assumption, scaling laws for the cluster size (radius R(0)) dependence of the energetics of uniform Coulomb explosion of heteroclusters (eta=1) were derived, with the size dependence of the average (E(j,av)) and maximal (E(j,M)) ion energies being E(j,av)=aR(0) (2) and E(j,M)=(5a/3)R(0) (2), as well as for the ion energy distributions P(E(j)) proportional to E(j) (1/2); E(j)1) result in an isotope effect, predicting the enhancement (by 9%-11%) of E(H,av) for Coulomb explosion of (C(4+)H(4) (+))(eta) (eta=3) relative to E(D,av) for Coulomb explosion of (C(4+)D(4) (+))(eta) (eta=1.5), with the isotope effect being determined by the ratio of the kinematic parameters for the pair of Coulomb exploding clusters

29 CFR 570.55 - Occupations involved in the operation of power-driven woodworking machines (Order 5).

Science.gov (United States)

2010-07-01

... woodworking machines (Order 5). 570.55 Section 570.55 Labor Regulations Relating to Labor (Continued) WAGE AND... woodworking machines (Order 5). Link to an amendment published at 75 FR 28455, May 20, 2010. (a) Finding and declaration of fact. The following occupations involved in the operation of power-driven wood-working machines...

Atomic-AES: A compact implementation of the AES encryption/decryption core

DEFF Research Database (Denmark)

Banik, Subhadeep; Bogdanov, Andrey; Regazzoni, Francesco

2016-01-01

The implementation of the AES encryption core by Moradi et al. at Eurocrypt 2011 is one of the smallest in terms of gate area. The circuit takes around 2400 gates and operates on an 8 bit datapath. However this is an encryption only core and unable to cater to block cipher modes like CBC and ELm...

Reconfigurable Secure Video Codec Based on DWT and AES Processor

Directory of Open Access Journals (Sweden)

Rached Tourki

2010-01-01

Full Text Available In this paper, we proposed a secure video codec based on the discrete wavelet transformation (DWT and the Advanced Encryption Standard (AES processor. Either, use of video coding with DWT or encryption using AES is well known. However, linking these two designs to achieve secure video coding is leading. The contributions of our work are as follows. First, a new method for image and video compression is proposed. This codec is a synthesis of JPEG and JPEG2000,which is implemented using Huffman coding to the JPEG and DWT to the JPEG2000. Furthermore, an improved motion estimation algorithm is proposed. Second, the encryptiondecryption effects are achieved by the AES processor. AES is aim to encrypt group of LL bands. The prominent feature of this method is an encryption of LL bands by AES-128 (128-bit keys, or AES-192 (192-bit keys, or AES-256 (256-bit keys.Third, we focus on a method that implements partial encryption of LL bands. Our approach provides considerable levels of security (key size, partial encryption, mode encryption, and has very limited adverse impact on the compression efficiency. The proposed codec can provide up to 9 cipher schemes within a reasonable software cost. Latency, correlation, PSNR and compression rate results are analyzed and shown.

Equations of state for detonation products of high energy PBX explosives

Energy Technology Data Exchange (ETDEWEB)

Lee, E. L.; Helm, F. H.; Finger, M.; Walton, J. R.

1977-08-01

It has become apparent that the accumulated changes in the analysis of cylinder test data, in the material specifications, and in the hydrodynamic code simulation of the cylinder test necessitated an update of the detonation product EOS description for explosives in common use at LLL. The explosives reviewed are PBX-9404-3, LX-04-1, LX-10-1, LX-14-0 and LX-09-1. In order to maintain the proper relation of predicted performance of these standard explosives, they have been revised as a single set.

An ultra-low-power RF transceiver for WBANs in medical applications

Energy Technology Data Exchange (ETDEWEB)

Zhang Qi; Wu Nanjian [State Key Laboratory for Superlattices and Microstructures, Institute of Semiconductors, Chinese Academy of Sciences, Beijing 100083 (China); Kuang Xiaofei, E-mail: nanjian@semi.ac.cn [College of Electronic Information, Hangzhou Dianzi University, Hangzhou 310018 (China)

2011-06-15

A 2.4 GHz ultra-low-power RF transceiver with a 900 MHz auxiliary wake-up link for wireless body area networks (WBANs) in medical applications is presented. The RF transceiver with an asymmetric architecture is proposed to achieve high energy efficiency according to the asymmetric communication in WBANs. The transceiver consists of a main receiver (RX) with an ultra-low-power free-running ring oscillator and a high speed main transmitter (TX) with fast lock-in PLL. A passive wake-up receiver (WuRx) for wake-up function with a high power conversion efficiency (PCE) CMOS rectifier is designed to offer the sensor node the capability of work-on-demand with zero standby power. The chip is implemented in a 0.18 {mu}m CMOS process. Its core area is 1.6 mm{sup 2}. The main RX achieves a sensitivity of -55 dBm at a 100 kbps OOK data rate while consuming just 210 {mu}A current from the 1 V power supply. The main TX achieves +3 dBm output power with a 4 Mbps/500 kbps/200 kbps data rate for OOK/4 FSK/2 FSK modulation and dissipates 3.25 mA/6.5 mA/6.5 mA current from a 1.8 V power supply. The minimum detectable RF input energy for the wake-up RX is -15 dBm and the PCE is more than 25%. (semiconductor integrated circuits)

An ultra-low-power RF transceiver for WBANs in medical applications

International Nuclear Information System (INIS)

Zhang Qi; Wu Nanjian; Kuang Xiaofei

2011-01-01

A 2.4 GHz ultra-low-power RF transceiver with a 900 MHz auxiliary wake-up link for wireless body area networks (WBANs) in medical applications is presented. The RF transceiver with an asymmetric architecture is proposed to achieve high energy efficiency according to the asymmetric communication in WBANs. The transceiver consists of a main receiver (RX) with an ultra-low-power free-running ring oscillator and a high speed main transmitter (TX) with fast lock-in PLL. A passive wake-up receiver (WuRx) for wake-up function with a high power conversion efficiency (PCE) CMOS rectifier is designed to offer the sensor node the capability of work-on-demand with zero standby power. The chip is implemented in a 0.18 μm CMOS process. Its core area is 1.6 mm 2 . The main RX achieves a sensitivity of -55 dBm at a 100 kbps OOK data rate while consuming just 210 μA current from the 1 V power supply. The main TX achieves +3 dBm output power with a 4 Mbps/500 kbps/200 kbps data rate for OOK/4 FSK/2 FSK modulation and dissipates 3.25 mA/6.5 mA/6.5 mA current from a 1.8 V power supply. The minimum detectable RF input energy for the wake-up RX is -15 dBm and the PCE is more than 25%. (semiconductor integrated circuits)

Detection of multiple AE signal by triaxial hodogram analysis; Sanjiku hodogram ho ni yoru taju acoustic emission no kenshutsu

Energy Technology Data Exchange (ETDEWEB)

Nagano, K; Yamashita, T [Muroran Institute of Technology, Hokkaido (Japan)

1997-05-27

In order to evaluate dynamic behavior of underground cracks, analysis and detection were attempted on multiple acoustic emission (AE) events. The multiple AE is a phenomenon in which multiple AE signals generated by underground cracks developed in an extremely short time interval are superimposed, and observed as one AE event. The multiple AE signal consists of two AE signals, whereas the second P-wave is supposed to have been inputted before the first S-wave is inputted. The first P-wave is inputted first, where linear three-dimensional particle movements are observed, but the movements are made random due to scattering and sensor characteristics. When the second P-wave is inputted, the linear particle movements are observed again, but are superimposed with the existing input signals and become multiple AE, which creates poor S/N ratio. The multiple AE detection determines it a multiple AE event when three conditions are met, i. e. a condition of equivalent time interval of a maximum value in a scalogram analysis, a condition of P-wave vibrating direction, and a condition of the linear particle movement. Seventy AE signals observed in the Kakkonda geothermal field were analyzed and AE signals that satisfy the multiple AE were detected. However, further development is required on an analysis method with high resolution for the time. 4 refs., 4 figs.

RELATIVISTIC (E > 0.6, > 2.0, AND > 4.0 MeV) ELECTRON ACCELERATION AT GEOSYNCHRONOUS ORBIT DURING HIGH-INTENSITY, LONG-DURATION, CONTINUOUS AE ACTIVITY (HILDCAA) EVENTS

International Nuclear Information System (INIS)

Hajra, Rajkumar; Echer, Ezequiel; Gonzalez, Walter D.; Tsurutani, Bruce T.; Santolik, Ondrej

2015-01-01

Radiation-belt relativistic (E > 0.6, > 2.0, and > 4.0 MeV) electron acceleration is studied for solar cycle 23 (1995-2008). High-intensity, long-duration, continuous AE activity (HILDCAA) events are considered as the basis of the analyses. All of the 35 HILDCAA events under study were found to be characterized by flux enhancements of magnetospheric relativistic electrons of all three energies compared to the pre-event flux levels. For the E > 2.0 MeV electron fluxes, enhancement of >50% occurred during 100% of HILDCAAs. Cluster-4 passes were examined for electromagnetic chorus waves in the 5 < L < 10 and 0 < MLT < 12 region when wave data were available. Fully 100% of these HILDCAA cases were associated with enhanced whistler-mode chorus waves. The enhancements of E > 0.6, > 2.0, and > 4.0 MeV electrons occurred ∼1.0 day, ∼1.5 days, and ∼2.5 days after the statistical HILDCAA onset, respectively. The statistical acceleration rates for the three energy ranges were ∼1.8 × 10 5 , 2.2 × 10 3 , and 1.0 × 10 1 cm –2 s –1 sr –1 d –1 , respectively. The relativistic electron-decay timescales were determined to be ∼7.7, 5.5, and 4.0 days for the three energy ranges, respectively. The HILDCAAs were divided into short-duration (D ≤ 3 days) and long-duration (D > 3 days) events to study the dependence of relativistic electron variation on HILDCAA duration. For long-duration events, the flux enhancements during HILDCAAs with respect to pre-event fluxes were ∼290%, 520%, and 82% for E > 0.6, > 2.0, and > 4.0 MeV electrons, respectively. The enhancements were ∼250%, 400%, and 27% respectively, for short-duration events. The results are discussed with respect to the current understanding of radiation-belt dynamics

Analysis and modeling of flow blockage-induced steam explosion events in the High-Flux Isotope Reactor

International Nuclear Information System (INIS)

Taleyarkhan, R.P.; Georgevich, V.; Lestor, C.W.; Gat, U.; Lepard, B.L.; Cook, D.H.; Freels, J.; Chang, S.J.; Luttrell, C.; Gwaltney, R.C.; Kirkpatrick, J.

1993-01-01

This paper provides a perspective overview of the analysis and modeling work done to evaluate the threat from steam explosion loads in the High-Flux Isotope Reactor during flow blockage events. The overall workscope included modeling and analysis of core melt initiation, melt propagation, bounding and best-estimate steam explosion energetics, vessel failure from fracture, bolts failure from exceedance of elastic limits, and finally, missile evolution and transport. Aluminum ignition was neglected. Evaluations indicated that a thermally driven steam explosion with more than 65 MJ of energy insertion in the core region over several miliseconds would be needed to cause a sufficiently energetic missile with a capacity to cause early confinement failure. This amounts to about 65% of the HFIR core mass melting and participating in a steam explosion. Conservative melt propagation analyses have indicated that at most only 24% of the HFIR core mass could melt during flow blockage events under full-power conditions. Therefore, it is judged that the HFIR vessel and top head structure will be able to withstand loads generated from thermally driven steam explosions initiated by any credible flow blockage event. A substantial margin to safety was demonstrated

ALMA view of RX J1131-1231: Sub-kpc CO (2-1) mapping of a molecular disk in a lensed star-forming quasar host galaxy

Science.gov (United States)

Paraficz, D.; Rybak, M.; McKean, J. P.; Vegetti, S.; Sluse, D.; Courbin, F.; Stacey, H. R.; Suyu, S. H.; Dessauges-Zavadsky, M.; Fassnacht, C. D.; Koopmans, L. V. E.

2018-05-01

We present ALMA 2-mm continuum and CO (2-1) spectral line imaging of the gravitationally lensed z = 0.654 star-forming/quasar composite RX J1131-1231 at 240-400 mas angular resolution. The continuum emission is found to be compact and coincident with the optical emission, whereas the molecular gas forms a complete Einstein ring, which shows strong differential magnification. The de-lensed source structure is determined on 400-parsec-scales resolution using a Bayesian pixelated visibility-fitting lens modelling technique. The reconstructed molecular gas velocity-field is consistent with a large rotating disk with a major-axis FWHM 9.4 kpc at an inclination angle of i = 54° and with a maximum rotational velocity of 280 km s-1. From dynamical model fitting we find an enclosed mass within 5 kpc of M(r conversion factor of α = 5.5 ± 2.0 M⊙ (K km s-1 pc2)-1. This suggests that the star-formation efficiency is dependent on the host galaxy morphology as opposed to the nature of the AGN. The far-infrared continuum spectral energy distribution shows evidence for heated dust, equivalent to an obscured star-formation rate of SFR = 69-25+41 × (7.3/μIR) M⊙ yr-1, which demonstrates the composite star-forming and AGN nature of this system.

0e39-0e47.xlsx

Indian Academy of Sciences (India)

5, AeKVR-4, (TC)6, 389, TCCGATGAGGAACTAGATGGAT, CCCAGTTGGACCTTGAGAGA, 55. 6, AeKVR-5, (TA)10, 396, GGAAAGCGAAGAAATCACAGTT, AACGTAAACTAGGAAACGGACG, 51. 7, AeKVR-6, (AT)14, 311, ACGACACGTATATGCCTACTTGAG, ACGTCCTAAACGAACGTCCTTA, 49. 8, AeKVR-7, (AC)7, 202 ...

ACUTE ENCEPHALITIS SYNDROME (AES ASSOCIATED WITH SOCIOCULTURAL AND ENVIRONMENTAL RISK FACTORS IN INFANTS/CHILDREN OF MUZAFFARPUR, BIHARHOSPITAL-BASED, PROSPECTIVE STUDY

Directory of Open Access Journals (Sweden)

Sudhir

2018-01-01

Full Text Available BACKGROUND Acute encephalitis syndrome is a group of clinical neurologic manifestation caused by wide range of viruses, bacteria, fungus, parasites, spirochetes, chemicals and toxins. According to AES guidelines- Acute encephalitis syndrome due to unknown agent is defined as a suspected case in which no diagnostic testing is performed or in which testing was performed, but no aetiological agent was identified or in which the test results were indeterminate. Acute encephalitis syndrome in children is due to interaction of several factors in combination. The aim of the study is to evaluate the sociocultural and environmental factors, which plays a major role in AES. MATERIALS AND METHODS The study design was non-interventional, hospital-based, prospective study. The study was conducted at Paediatric Department of S.K.M.C.H., Muzaffarpur, Bihar, over a period of January 1, 2015, to July 31, 2017. Infants/children admitted in S.K.M.C.H., Muzaffarpur, were included in study. All defined cases according to AES guidelines were included and 92 infants/children were selected. Percentage, proportion and Chi-square test were performed for statistical analysis. RESULTS Among 92 selected infants/children, AES was highest in rural area, 80 (86.95%. The seasonal incidence of AES was March to July in which highest incidence was found in June, 63 (68.47%. Highest incidence of AES was seen between 1-5 years of age. There was significant statistical association among age of children and AES. AES was more common in male than female. AES was highest in dwellers of kachcha (mud house. AES was highest, 90 (97.82% among children of labour/farmer. AES was highest, 90 (97.82% in which mother was illiterate. Incidence of AES was highest in Hindu religion. All AES, 92 (100% was seen in malnourished/undernourished children. CONCLUSION Sociocultural and environmental factors were the major determinant risk factors for AES. Among these, malnutrition/under nutrition was the

Development and validation of fuel height models for terrestrial lidar - RxCADRE 2012

Science.gov (United States)

Eric M. Rowell; Carl A. Seielstad; Roger D. Ottmar

2016-01-01

Terrestrial laser scanning (TLS) was used to collect spatially continuous measurements of fuelbed characteristics across the plots and burn blocks of the 2012 RxCADRE experiments in Florida. Fuelbeds were scanned obliquely from plot/block edges at a height of 20 m above ground. Pre-fire blocks were scanned from six perspectives and four perspectives for post-...

Atmospheric emission of NOx from mining explosives: A critical review

Science.gov (United States)

Oluwoye, Ibukun; Dlugogorski, Bogdan Z.; Gore, Jeff; Oskierski, Hans C.; Altarawneh, Mohammednoor

2017-10-01

High-energy materials such as emulsions, slurries and ammonium-nitrate fuel-oil (ANFO) explosives play crucial roles in mining, quarrying, tunnelling and many other infrastructure activities, because of their excellent transport and blasting properties. These explosives engender environmental concerns, due to atmospheric pollution caused by emission of dust and nitrogen oxides (NOx) from blasts, the latter characterised by the average emission factor of 5 kg (t AN explosive)-1. This first-of-its-kind review provides a concise literature account of the formation of NOx during blasting of AN-based explosives, employed in surface operations. We estimate the total NOx emission rate from AN-based explosives as 0.05 Tg (i.e., 5 × 104 t) N per annum, compared to the total global annual anthropogenic NOx emissions of 41.3 × 106 t N y-1. Although minor in the global sense, the large localised plumes from blasting exhibit high NOx concentration (500 ppm) exceeding up to 3000 times the international standards. This emission has profound consequences at mining sites and for adjacent atmospheric environment, necessitating expensive management of exclusion zones. The review describes different types of AN energetic materials for civilian applications, and summarises the essential properties and terminologies pertaining to their use. Furthermore, we recapitulate the mechanisms that lead to the formation of the reactive nitrogen species in blasting of AN-based explosives, review their implications to atmospheric air pollution, and compare the mechanisms with those experienced in other thermal and combustion operations. We also examine the mitigation approaches, including guidelines and operational-control measures. The review discusses the abatement technologies such as the formulation of new explosive mixtures, comprising secondary fuels, spin traps and other additives, in light of their effectiveness and efficiency. We conclude the review with a summary of unresolved problems

Primary explosives

Energy Technology Data Exchange (ETDEWEB)

Matyas, Robert; Pachman, Jiri [Pardubice Univ. (Czech Republic). Faculty of Chemical Technology

2013-06-01

The first chapter provides background such as the basics of initiation and differences between requirements on primary explosives used in detonators and igniters. The authors then clarify the influence of physical characteristics on explosive properties, focusing on those properties required for primary explosives. Furthermore, the issue of sensitivity is discussed. All the chapters on particular groups of primary explosives are structured in the same way, including introduction, physical and chemical properties, explosive properties, preparation and documented use.

Simulation of first SERENA KROTOS steam explosion experiment

International Nuclear Information System (INIS)

Leskovar, Matjaz; Ursic, Mitja

2009-01-01

A steam explosion may occur when, during a severe reactor accident, the molten core comes into contact with the coolant water. A strong enough steam explosion in a nuclear power plant could jeopardize the containment integrity and so lead to a direct release of radioactive material to the environment. To resolve the open issues in steam explosion understanding and modeling, the OECD program SERENA Phase 2 was launched at the end of year 2007, focusing on nuclear applications. SERENA comprises an experimental program, which is being carried out in the complementary KROTOS and TROI corium facilities, accompanied by a comprehensive analytical program, where also pre- and post-test calculations are foreseen. In the paper the sensitivity post-test calculations of the first SERENA KROTOS experiment KS-1, which were performed with the code MC3D, are presented and discussed. Since the results of the SERENA tests are restricted to SERENA members, only the various calculation results are given, not comparing them to experimental measurements. Various premixing and explosion simulations were performed on a coarse and a fine numerical mesh, applying two different jet breakup models (global, local) and varying the minimum bubble diameter in the explosion simulations (0.5 mm, 5 mm). The simulations revealed that all varied parameters have a significant influence on the calculation results, as was expected since the fuel coolant interaction process is a highly complex phenomenon. The results of the various calculations are presented in comparison and the observed differences are discussed and explained. (author)

Unbelievable security : Matching AES using public key systems

NARCIS (Netherlands)

Lenstra, A.K.; Boyd, C.

2001-01-01

The Advanced Encryption Standard (AES) provides three levels of security: 128, 192, and 256 bits. Given a desired level of security for the AES, this paper discusses matching public key sizes for RSA and the ElGamal family of protocols. For the latter both traditional multiplicative groups of finite

Analysis and modeling of flow-blockage-induced steam explosion events in the high-flux isotope reactor

International Nuclear Information System (INIS)

Taleyarkhan, R.P.; Georgevich, V.; Nestor, C.W.; Gat, U.; Lepard, B.L.; Cook, D.H.; Freels, J.; Chang, S.J.; Luttrell, C.; Gwaltney, R.C.

1994-01-01

This article provides a perspective overview of the analysis and modeling work done to evaluate the threat from steam explosion loads in the High-Flux Isotope Reactor (HFIR) during flow blockage events. The overall work scope included modeling and analysis of core-melt initiation, melt propagation, bounding and best-estimate steam explosion energetics, vessel failure from fracture, bolts failure from exceedance of elastic limits, and, finally, missile evolution and transport. Aluminum ignition was neglected. Evaluations indicated that a thermally driven steam explosion with more than 65 MJ of energy insertion in the core region over several milliseconds would be needed to cause a sufficiently energetic missile with a capacity to cause early confinement failure. This amounts to about 65% of the HFIR core mass melting and participating in a steam explosion. Conservative melt propagation analyses have indicated that at most only 24% of the HFIR core mass could melt during flow blockage events under full-power conditions. 19 refs., 11 figs

High-temperature explosive development for geothermal well stimulation. Final report

Energy Technology Data Exchange (ETDEWEB)

Schmidt, E.W.; Mars, J.E.; Wang, C.

1978-03-31

A two-component, temperature-resistant liquid explosive called HITEX has been developed which is capable of withstanding 561/sup 0/K (550/sup 0/F) for 24 hours in a geothermal environment. The explosive is intended for the stimulation of nonproducing or marginally producing geothermal (hot dry rock, vapor-dominated or hydrothermal) reservoirs by fracturing the strata in the vicinity of a borehole. The explosive is inherently safe because it is mixed below ground downhole from two nondetonable liquid components. Development and safety tests included differential scanning calorimetry, thermal stability, minerals compatibility, drop-weight sensitivity, adiabatic compression, electrostatic discharge sensitivity, friction sensitivity, detonation arrest capability, cook-off tests, detonability at ambient and elevated pressure, detonation velocity and thin film propagation in a wedge.

Investigation of the stable combustion of initiating explosives at high pressures

Energy Technology Data Exchange (ETDEWEB)

Fogelzang, A.E.; Egorshev, V.IU.; Pimenov, A.IU.; Sinditskii, V.P.; Saklantii, A.R.

1985-01-01

The combustion of typical initiating explosives - tetrazene, tricycloacetone peroxide, diazodinitrophenol, hexamethylene triperoxide diamine, and cyanur triazide - was studied experimentally in the 0.1-40 MPa pressure range. The dependence of combustion rate on pressure was studied for these explosives. 8 references.

Estimation of metal ions during the dissolution of corrosion product oxides by ICP-AES

International Nuclear Information System (INIS)

Sathyaseelan, V.S.; Mittal, Vinit Kumar; Velmurugan, S.

2012-01-01

Inductively coupled plasma atomic emission spectroscopy (ICP-AES) is one of the several techniques, which is being widely used for both qualitative and quantitative estimation of various elements. Determination of metals in wine, arsenic in food, trace elements in soil, nutrient levels in agricultural soils, trace elements bound to protein, motor oil analysis etc. are the examples of its application. ICP-AES utilizes plasma as the atomization and excitation source. The plasma temperature in the analytical zone ranges from 5000-8000 K. This high temperature assures that most of the compounds in the samples are completely atomized. Advantages of ICP-AES are high sensitivity and linear dynamic range, multi-element capability, low chemical interference and a stable and reproducible signal. The typical limits of detection for some of the elements like Mg, Sr, Ca, Li, Cu etc are well below 1 μg L -1

Kaliski's explosive driven fusion experiments

International Nuclear Information System (INIS)

Marshall, J.

1979-01-01

An experiment performed by a group in Poland on the production of DD fusion neutrons by purely explosive means is discussed. A method for multiplying shock velocities ordinarily available from high explosives by a factor of ten is described, and its application to DD fusion experiments is discussed

The Off-Site Plowshare and Vela Uniform Programs: Assessing Potential Environmental Liabilities through an Examination of Proposed Nuclear Projects,High Explosive Experiments, and High Explosive Construction Activities Volume 1 of 3

Energy Technology Data Exchange (ETDEWEB)

Beck Colleen M,Edwards Susan R.,King Maureen L.

2011-09-01

This document presents the results of nearly six years (2002-2008) of historical research and field studies concerned with evaluating potential environmental liabilities associated with U.S. Atomic Energy Commission projects from the Plowshare and Vela Uniform Programs. The Plowshare Program's primary purpose was to develop peaceful uses for nuclear explosives. The Vela Uniform Program focused on improving the capability of detecting, monitoring and identifying underground nuclear detonations. As a result of the Project Chariot site restoration efforts in the early 1990s, there were concerns that there might be other project locations with potential environmental liabilities. The Desert Research Institute conducted archival research to identify projects, an analysis of project field activities, and completed field studies at locations where substantial fieldwork had been undertaken for the projects. Although the Plowshare and Vela Uniform nuclear projects are well known, the projects that are included in this research are relatively unknown. They are proposed nuclear projects that were not executed, proposed and executed high explosive experiments, and proposed and executed high explosive construction activities off the Nevada Test Site. The research identified 170 Plowshare and Vela Uniform off-site projects and many of these had little or no field activity associated with them. However, there were 27 projects that merited further investigation and field studies were conducted at 15 locations.

The Off-Site Plowshare and Vela Uniform Programs: Assessing Potential Environmental Liabilities through an Examination of Proposed Nuclear Projects,High Explosive Experiments, and High Explosive Construction Activities Volume 2 of 3

Energy Technology Data Exchange (ETDEWEB)

Beck Colleen M.,Edwards Susan R.,King Maureen L.

2011-09-01

This document presents the results of nearly six years (2002-2008) of historical research and field studies concerned with evaluating potential environmental liabilities associated with U.S. Atomic Energy Commission projects from the Plowshare and Vela Uniform Programs. The Plowshare Program's primary purpose was to develop peaceful uses for nuclear explosives. The Vela Uniform Program focused on improving the capability of detecting, monitoring and identifying underground nuclear detonations. As a result of the Project Chariot site restoration efforts in the early 1990s, there were concerns that there might be other project locations with potential environmental liabilities. The Desert Research Institute conducted archival research to identify projects, an analysis of project field activities, and completed field studies at locations where substantial fieldwork had been undertaken for the projects. Although the Plowshare and Vela Uniform nuclear projects are well known, the projects that are included in this research are relatively unknown. They are proposed nuclear projects that were not executed, proposed and executed high explosive experiments, and proposed and executed high explosive construction activities off the Nevada Test Site. The research identified 170 Plowshare and Vela Uniform off-site projects and many of these had little or no field activity associated with them. However, there were 27 projects that merited further investigation and field studies were conducted at 15 locations.

The Off-Site Plowshare and Vela Uniform Programs: Assessing Potential Environmental Liabilities through an Examination of Proposed Nuclear Projects,High Explosive Experiments, and High Explosive Construction Activities Volume 3 of 3

Energy Technology Data Exchange (ETDEWEB)

Beck Colleen M.,Edwards Susan R.,King Maureen L.

2011-09-01

This document presents the results of nearly six years (2002-2008) of historical research and field studies concerned with evaluating potential environmental liabilities associated with U.S. Atomic Energy Commission projects from the Plowshare and Vela Uniform Programs. The Plowshare Program's primary purpose was to develop peaceful uses for nuclear explosives. The Vela Uniform Program focused on improving the capability of detecting, monitoring and identifying underground nuclear detonations. As a result of the Project Chariot site restoration efforts in the early 1990s, there were concerns that there might be other project locations with potential environmental liabilities. The Desert Research Institute conducted archival research to identify projects, an analysis of project field activities, and completed field studies at locations where substantial fieldwork had been undertaken for the projects. Although the Plowshare and Vela Uniform nuclear projects are well known, the projects that are included in this research are relatively unknown. They are proposed nuclear projects that were not executed, proposed and executed high explosive experiments, and proposed and executed high explosive construction activities off the Nevada Test Site. The research identified 170 Plowshare and Vela Uniform off-site projects and many of these had little or no field activity associated with them. However, there were 27 projects that merited further investigation and field studies were conducted at 15 locations.

Intensive evaporation and boiling of a heterogeneous liquid droplet with an explosive disintegration in high-temperature gas area

Directory of Open Access Journals (Sweden)

Piskunov Maxim V.

2016-01-01

Full Text Available The using of the high-speed (not less than 105 frames per second video recording tools (“Phantom” and the software package ("TEMA Automotive" allowed carrying out an experimental research of laws of intensive vaporization with an explosive disintegration of heterogeneous (with a single solid nontransparent inclusion liquid droplet (by the example of water in high-temperature (500-800 K gases (combustion products. Times of the processes under consideration and stages (liquid heat-up, evaporation from an external surface, bubble boiling at internal interfaces, growth of bubble sizes, explosive droplet breakup were established. Necessary conditions of an explosive vaporization of a heterogeneous droplet were found out. Mechanisms of this process and an influence of properties of liquid and inclusion material on them were determined.

In vitro translocation experiments with RxLR-reporter fusion proteins of Avr1b from Phytophthora sojae and AVR3a from Phytophthora infestans fail to demonstrate specific autonomous uptake in plant and animal cells.

Science.gov (United States)

Wawra, Stephan; Djamei, Armin; Albert, Isabell; Nürnberger, Thorsten; Kahmann, Regine; van West, Pieter

2013-05-01

Plant-pathogenic oomycetes have a large set of secreted effectors that can be translocated into their host cells during infection. One group of these effectors are the RxLR effectors for which it has been shown, in a few cases, that the RxLR motif is important for their translocation. It has been suggested that the RxLR-leader sequences alone are enough to translocate the respective effectors into eukaryotic cells through binding to surface-exposed phosphoinositol-3-phosphate. These conclusions were primary based on translocation experiments conducted with recombinant fusion proteins whereby the RxLR leader of RxLR effectors (i.e., Avr1b from Phytophthora sojae) were fused to the green fluorescent protein reporter-protein. However, we failed to observe specific cellular uptake for a comparable fusion protein where the RxLR leader of the P. infestans AVR3a was fused to monomeric red fluorescent protein. Therefore, we reexamined the ability of the reported P. sojae AVR1b RxLR leader to enter eukaryotic cells. Different relevant experiments were performed in three independent laboratories, using fluorescent reporter fusion constructs of AVR3a and Avr1b proteins in a side-by-side comparative study on plant tissue and human and animal cells. We report that we were unable to obtain conclusive evidence for specific RxLR-mediated translocation.

AES Encryption Algorithm Optimization Based on 64-bit Processor Android Platform

Directory of Open Access Journals (Sweden)

ZHAO Jun

2017-06-01

Full Text Available Algorithm implemented on the mobile phone is different from one on PC． It requires little storage space and low power consumption． Standard AES S-box design uses look up table，and has high complexity and high power consumption，so it needs to be optimized when used in mobile phones． In our optimization AES encryption algorithm，the packet length is expanded to 256 bits，which would increase the security of our algorithm; look up table is replaced by adding the affine transformation based on inversion，which would reduce the storage space; operation is changed into 16-bit input and 64-bit output by merging the three steps，namely SubWords，ShiftＲows MixColumns and AddＲoundKey，which would improve the operation efficiency of the algorithm． The experimental results show that our algorithm not only can greatly enhance the encryption strength，but also maintain high computing efficiency．

Terminal velocity of liquids and granular materials dispersed by a high explosive

Science.gov (United States)

Loiseau, J.; Pontalier, Q.; Milne, A. M.; Goroshin, S.; Frost, D. L.

2018-04-01

The explosive dispersal of a layer of solid particles or a layer of liquid surrounding a spherical high-explosive charge generates a turbulent, multiphase flow. Shock compression of the material layer during the initial acceleration may partially consolidate the material, leading to the formation of jet-like structures when the layer fragments and sheds particles upon release. Similarly, release of a shock-compressed liquid shell causes the nucleation of cavitation sites, leading to the radial breakup of the shell and the formation of jets upon expansion. In the current study, a wide variety of granular materials and liquids were explosively dispersed. The maximum terminal jet tip or shell velocity was measured using high-speed videography. Charges were constructed using thin-walled glass bulbs of various diameters and contained a central C-4 charge surrounded by the material to be dispersed. This permitted variation of the ratio of material mass to charge mass (M/C) from 4 to 300. Results indicated that material velocity broadly correlates with predictions of the Gurney model. For liquids, the terminal velocity was accurately predicted by the Gurney model. For granular materials, Gurney over-predicted the terminal velocity by 25-60%, depending on the M/C ratio, with larger M/C values exhibiting larger deficits. These deficits are explained by energy dissipation during the collapse of voids in the granular material bed. Velocity deficits were insensitive to the degree of jetting and granular material properties. Empirical corrections to the Gurney model are presented with improved agreement with the dry powder experimental velocities.

Terminal velocity of liquids and granular materials dispersed by a high explosive

Science.gov (United States)

Loiseau, J.; Pontalier, Q.; Milne, A. M.; Goroshin, S.; Frost, D. L.

2018-05-01

The explosive dispersal of a layer of solid particles or a layer of liquid surrounding a spherical high-explosive charge generates a turbulent, multiphase flow. Shock compression of the material layer during the initial acceleration may partially consolidate the material, leading to the formation of jet-like structures when the layer fragments and sheds particles upon release. Similarly, release of a shock-compressed liquid shell causes the nucleation of cavitation sites, leading to the radial breakup of the shell and the formation of jets upon expansion. In the current study, a wide variety of granular materials and liquids were explosively dispersed. The maximum terminal jet tip or shell velocity was measured using high-speed videography. Charges were constructed using thin-walled glass bulbs of various diameters and contained a central C-4 charge surrounded by the material to be dispersed. This permitted variation of the ratio of material mass to charge mass ( M/ C) from 4 to 300. Results indicated that material velocity broadly correlates with predictions of the Gurney model. For liquids, the terminal velocity was accurately predicted by the Gurney model. For granular materials, Gurney over-predicted the terminal velocity by 25-60%, depending on the M/ C ratio, with larger M/ C values exhibiting larger deficits. These deficits are explained by energy dissipation during the collapse of voids in the granular material bed. Velocity deficits were insensitive to the degree of jetting and granular material properties. Empirical corrections to the Gurney model are presented with improved agreement with the dry powder experimental velocities.

Uranium and zirconium mass transfer testing of 5.5-cm-diam centrifugal contactors

International Nuclear Information System (INIS)

DeMuth, S.F.; Randolph, J.D.

1988-01-01

As part of the Consolidated Fuel Reprocessing Program of the Oak Ridge National Laboratory, compact centrifugal contacts were designed and prototypes build for the Breeder Reprocessing Engineering Test (BRET) facility with a throughput capacity of 0.1 t/d of heavy metals. While the construction of BRET has been put on hold indefinitely, development of the 5.5-cm-diam centrifugal contactors has advanced due to the contactor's broad applicability in other areas of fuel reprocessing and other liquid-liquid extraction. Due to the short residence time of the process fluids in a centrifugal contactor, it was necessary to measure the mass transfer efficiency for a typical process flowsheet. This was done with depleted uranium and 91 Zr. The results of mass transfer tests with uranium and zirconium are reported in this paper

Behavior of surface residual stress in explosion hardened high manganese austenitic cast steel due to repeated impact loads

International Nuclear Information System (INIS)

Oda, Akira; Miyagawa, Hideaki

1985-01-01

Explosion hardened high manganese austenitic cast steel is being tried for rail crossing recently. From the previous studies, it became clear that high tensile residual stress was generated in the hardened surface layer by explosion and microcracks were observed. In this study, therefore, the behavior of surface residual stress in explosion hardened steel due to repeated impact loads was examined and compared with those of the original and shot peened steels. The results obtained are summarized as follows: (1) In the initial stage of the repetition of impact, high tensile surface residual stress in explosion hardened steel decreased rapidly with the repetition of impact, while those of the original and shot peened steels increased rapidly. This difference was attributed to the difference in depth of the work hardened layer in three testing materials. (2) Beyond 20 impacts the residual stress of three test specimens decreased gradually, and at more than 2000 impacts the compressive stress of about 500 MPa was produced regardless of the histories of working of testing materials. (3) The linear law in the second stage of residual stress fading was applicable to this case, and the range of the linear relationship was related to the depth of the work hardened layer of testing material. (4) From the changes in half-value breadth and peak intensity of diffraction X-ray, it was supposed that a peculiar microscopic strain exists in explosion hardened steel. (author)

High Satisfaction and Return to Sports After Total Shoulder Arthroplasty in Patients Aged 55 Years and Younger.

Science.gov (United States)

Garcia, Grant H; Liu, Joseph N; Sinatro, Alec; Wu, Hao-Hua; Dines, Joshua S; Warren, Russell F; Dines, David M; Gulotta, Lawrence V

2017-06-01

Young, active candidates for total shoulder arthroplasty (TSA) are a unique group of patients. Not only do they demand longevity and improved function, but they also desire a return to physical activities. To determine the rate of return to sports in patients aged ≤55 years undergoing TSA. Case series; Level of evidence, 4. This was a retrospective review of consecutive patients who underwent anatomic TSA at a single institution. Exclusion criteria included age at the time of surgery >55 years and sports questionnaire, American Shoulder and Elbow Surgeons (ASES) score, and visual analog scale (VAS) score. From 70 eligible patients, 59 patients (61 shoulders) were included with an average follow-up of 61.0 months (range, 25-103 months) and average age at the time of surgery of 48.9 years (range, 25-55 years). The average VAS score improved from 5.6 to 0.9 ( P sports. Moreover, patients in 96.4% of shoulders (55/57) restarted at least 1 sport at an average of 6.7 months. Direct rates of return were as follows: fitness sports (97.2%), golf (93.3%), singles tennis (87.5%), swimming (77.7%), basketball (75.0%), and flag football (66.7%). Patients in 47 shoulders (82.4%) returned to a similar or higher level of sports; 90.3% returned to high-demand sports, and 83.8% returned to high upper extremity sports. There was no significant difference in rates of return to sports by body mass index, sex, age, preoperative diagnosis, revision status, and dominant extremity. In patients aged ≤55 years undergoing TSA, there was a 96.4% rate of return to ≥1 previous sports at an average of 6.7 months. Furthermore, at an average follow-up of 61.0 months, no patients needed revision of their glenoid component, despite an 83.8% rate of return to high upper extremity sports. While caution should still be advised in young, active patients undergoing TSA, these results demonstrate a high satisfaction rate and improved ability to return to most sports after surgery.

Electromagnetic field effects in explosives

Science.gov (United States)

Tasker, Douglas

2009-06-01

Present and previous research on the effects of electromagnetic fields on the initiation and detonation of explosives and the electromagnetic properties of explosives are reviewed. Among the topics related to detonating explosives are: measurements of conductivity; enhancement of performance; and control of initiation and growth of reaction. Hayes...()^1 showed a strong correlation of peak electrical conductivity with carbon content of the detonation products. Ershov.......^2 linked detailed electrical conductivity measurements with reaction kinetics and this work was extended to enhance detonation performance electrically;...^3 for this, electrical power densities of the order of 100 TW/m^2 of explosive surface normal to the detonation front were required. However, small electrical powers are required to affect the initiation and growth of reaction.......^4,5 A continuation of this work will be reported. LA-UR 09-00873 .^1 B. Hayes, Procs. of 4th Symposium (International) on Detonation (1965), p. 595. ^2 A. Ershov, P. Zubkov, and L. Luk'yanchikov, Combustion, Explosion, and Shock Waves 10, 776-782 (1974). ^3 M. Cowperthwaite, Procs. 9th Detonation Symposium (1989), p. 388-395. ^4 M. A. Cook and T. Z. Gwyther, ``Influence of Electric Fields on Shock to Detonation Transition,'' (1965). ^5 D. Salisbury, R. Winter, and L. Biddle, Procs. of the APS Topical Conference on Shock Compression of Condensed Matter (2005) p. 1010-1013.

Hydrogen explosion testing with a simulated transuranic drum

International Nuclear Information System (INIS)

Dykes, K.L.; Meyer, M.L.

1990-01-01

Transuranic (TRU) waste generated at the Savannah River Site (SRS) is currently stored onsite for future retrieval and permanent disposal at the Waste Isolation Pilot Plant (WIPP). Some of the TRU waste is stored in vented 210-liter (55-gallon) drums and consists of gloves, wipes, plastic valves, tools, etc. Gas generation caused by radiolysis and biodegradation of these organic waste materials may produce a flammable hydrogen-air mixture (>4% v/v) in the multi-layer plastic waste bags. Using a worst case scenario, a drum explosion test program was carried out to determine the hydrogen concentration necessary to cause removal of the drum lid. Test results indicate an explosive mixture up to 15% v/v of hydrogen can be contained in an SRS TRU drum without total integrity failure via lid removal

The preparation and ethanol fermentation of high-concentration sugars from steam-explosion corn stover.

Science.gov (United States)

Xie, Hui; Wang, Fengqin; Yin, Shuangyao; Ren, Tianbao; Song, Andong

2015-05-01

In the field of biofuel ethanol, high-concentration- reducing sugars made from cellulosic materials lay the foundation for high-concentration ethanol fermentation. In this study, corn stover was pre-treated in a process combining chemical methods and steam explosion; the cellulosic hydrolyzed sugars obtained by fed-batch saccharification were then used as the carbon source for high-concentration ethanol fermentation. Saccharomyces cerevisiae 1308, Angel yeast, and Issatchenkia orientalis were shake-cultured with Pachysolen tannophilus P-01 for fermentation. Results implied that the ethanol yields from the three types of mixed strains were 4.85 g/100 mL, 4.57 g/100 mL, and 5.02 g/100 mL (separately) at yield rates of 91.6, 89.3, and 92.2%, respectively. Therefore, it was inferred that shock-fermentation using mixed strains achieved a higher ethanol yield at a greater rate in a shorter fermentation period. This study provided a theoretical basis and technical guidance for the fermentation of industrial high-concentrated cellulosic ethanol.

ICP-AES determination of trace elements in carbon steel

International Nuclear Information System (INIS)

Sengupta, Arijit; Rajeswari, B.; Kadam, R.M.; Babu, Y.; Godbole, S.V.

2010-01-01

Full text: Carbon steel, a combination of the elements iron and carbon, can be classified into four types as mild, medium, high and very high depending on the carbon content which varies from 0.05% to 2.1%. Carbon steel of different types finds application in medical devices, razor blades, cutlery and spring. In the nuclear industry, it is used in feeder pipes in the reactor. A strict quality control measure is required to monitor the trace elements, which have deleterious effects on the mechanical properties of the carbon steel. Thus, it becomes imperative to check the purity of carbon steel as a quality control measure before it is used in feeder pipes in the reactor. Several methods have been reported in literature for trace elemental determination in high purity iron. Some of these include neutron activation analysis, atomic absorption spectrometry and atomic emission spectrometry. Inductively coupled plasma atomic emission spectrometry (ICP-AES) is widely recognized as a sensitive technique for the determination of trace elements in various matrices, its major advantages being good accuracy and precision, high sensitivity, multi-element capability, large linear dynamic range and relative freedom from matrix effects. The present study mainly deals with the direct determination of trace elements in carbon steel using ICP-AES. An axially viewing ICP spectrometer having a polychromator with 35 fixed analytical channels and limited sequential facility to select any analytical line within 2.2 nm of a polychromator line was used in these studies. Iron, which forms one of the main constituents of carbon steel, has a multi electronic configuration with line rich emission spectrum and, therefore, tends to interfere in the determination of trace impurities in carbon steel matrix. Spectral interference in ICP-AES can be seriously detrimental to the accuracy and reliability of trace element determinations, particularly when they are performed in the presence of high

Luminescent, optical and electronic properties of La{sub 3}Ta{sub 0.5}Ga{sub 5.5}O{sub 14} single crystals grown in different atmospheres

Energy Technology Data Exchange (ETDEWEB)

Spassky, D.A., E-mail: deris2002@mail.ru [National University of Science and Technology (MISiS), Leninsky Prospekt, 4, Moscow 119049 (Russian Federation); Institute of Physics, University of Tartu, Ravila 14c, Tartu 50411 (Estonia); Skobeltsyn Institute of Nuclear Physics, M.V. Lomonosov Moscow State University, 119991 Moscow (Russian Federation); Brik, M.G. [Institute of Physics, University of Tartu, Ravila 14c, Tartu 50411 (Estonia); College of Sciences, Chongqing University of Posts and Telecommunications, Chongqing 400065 (China); Institute of Physics, Jan Dlugosz University, Armii Krajowej 13/15, PL-42200 Czestochowa (Poland); Kozlova, N.S.; Kozlova, A.P.; Zabelina, E.V. [National University of Science and Technology (MISiS), Leninsky Prospekt, 4, Moscow 119049 (Russian Federation); Buzanov, O.A. [Fomos-Materials, Buzheninova 16, Moscow 107023 (Russian Federation); Belsky, A. [Institute of Light and Matter, CNRS, University Lyon1, Villeurbanne 69622 (France)

2016-09-15

Luminescent, optical and electronic properties of La{sub 3}Ta{sub 0.5}Ga{sub 5.5}O{sub 14} single crystals grown in different atmospheres are presented. The absorption bands at 255, 290, 350 and 480 nm were detected; the intensity of bands increases with the concentration of oxygen in the growth atmosphere. It is shown that the shift of the fundamental absorption edge with the temperature obeys Urbach rule. The corresponding fitting allowed to estimate the slope coefficient σ=0.35, which implies self-trapping of excitons in La{sub 3}Ta{sub 0.5}Ga{sub 5.5}O{sub 14}. Calculations of the band structure, partial densities of states and reflectivity spectra were performed. The bandgap of La{sub 3}Ta{sub 0.5}Ga{sub 5.5}O{sub 14} was determined as E{sub g}=5.6 eV. The luminescence properties under UV, VUV and X-ray excitation were studied. Intrinsic emission band at 440–450 nm is attributed to the excitons self-trapped at TaO{sub 6} molecular complexes. Extrinsic emission bands at 410, 440 and 550 nm are attributed to the emission of excitons trapped by antisite defects, F-centers and oxygen deficient oxyanionic complexes.

Close-in airblast from underground explosions

Energy Technology Data Exchange (ETDEWEB)

Vortman, L J [Sandia Laboratories, Albuquerque, NM (United States)

1970-05-15

Air overpressures as a function of time have been measured from surface zero to about 170 ft/lb{sup 1/3} along the ground from nuclear and chemical explosions. Charge depths varied from the surface to depths below which explosion gases are contained. A ground-shock-induced air pressure pulse is clearly distinguishable from the pulse caused by venting gases. Measured peak overpressures show reasonable agreement with the theoretical treatment by Monta. In a given medium the suppression of blast with explosion burial depth is a function of the relative distance at which the blast is observed. Rates of suppression of peak overpressure with charge burial are different for the two pulses. Rates are determined for each pulse over the range of distances at which measurements have been made of air overpressure from chemical explosions in several media. Nuclear data are available from too few shots for similar dependence on burial depth and distance to be developed, but it is clear that the gas venting peak overpressure from nuclear explosions is much more dependent on medium than that from chemical explosions. For above-ground explosions, experiment has shown that airblast from a I-kiloton nuclear explosion is equal to that from a 0.5-kiloton TNT explosion. Data on ground-shock-induced airblast is now sufficient to show that a similar relationship may exist for buried explosions. Because of medium dependence of the gas venting pulse from nuclear explosions, data from additional nuclear events will be required before a chemical/nuclear airblast equivalence can be determined for the gas-venting pulse. (author)

Characterization of [{sup 11}C]Lu AE92686 as a PET radioligand for phosphodiesterase 10A in the nonhuman primate brain

Energy Technology Data Exchange (ETDEWEB)

Yang, Kai-Chun; Stepanov, Vladimir; Amini, Nahid; Martinsson, Stefan; Takano, Akihiro; Halldin, Christer [Karolinska Institutet, Karolinska University Hospital, Department of Clinical Neuroscience, Center for Psychiatric Research, Stockholm (Sweden); Nielsen, Jacob [H. Lundbeck A/S, Synaptic Transmission, Valby (Denmark); Bundgaard, Christoffer; Bang-Andersen, Benny [H. Lundbeck A/S, Discovery Chemistry and DMPK, Valby (Denmark); Grimwood, Sarah [Pfizer Inc., Neuroscience and Pain Research Unit, Cambridge, MA (United States); Farde, Lars [Karolinska Institutet, Karolinska University Hospital, Department of Clinical Neuroscience, Center for Psychiatric Research, Stockholm (Sweden); AstraZeneca PET Science Center at Karolinska Institutet, Personalized Health Care and Biomarkers, Stockholm (Sweden); Finnema, Sjoerd J. [Karolinska Institutet, Karolinska University Hospital, Department of Clinical Neuroscience, Center for Psychiatric Research, Stockholm (Sweden); Yale University, Department of Radiology and Biomedical Imaging, New Haven, CT (United States)

2017-02-15

[{sup 11}C]Lu AE92686 is a positron emission tomography (PET) radioligand that has recently been validated for examining phosphodiesterase 10A (PDE10A) in the human striatum. [{sup 11}C]Lu AE92686 has high affinity for PDE10A (IC{sub 50} = 0.39 nM) and may also be suitable for examination of the substantia nigra, a region with low density of PDE10A. Here, we report characterization of regional [{sup 11}C]Lu AE92686 binding to PDE10A in the nonhuman primate (NHP) brain. A total of 11 PET measurements, seven baseline and four following pretreatment with unlabeled Lu AE92686 or the structurally unrelated PDE10A inhibitor MP-10, were performed in five NHPs using a high resolution research tomograph (HRRT). [{sup 11}C]Lu AE92686 binding was quantified using a radiometabolite-corrected arterial input function and compartmental and graphical modeling approaches. Regional time-activity curves were best described with the two-tissue compartment model (2TCM). However, the distribution volume (V{sub T}) values for all regions were obtained by the Logan plot analysis, as reliable cerebellar V{sub T} values could not be derived by the 2TCM. For cerebellum, a proposed reference region, V{sub T} values increased by ∝30 % with increasing PET measurement duration from 63 to 123 min, while V{sub T} values in target regions remained stable. Both pretreatment drugs significantly decreased [{sup 11}C]Lu AE92686 binding in target regions, while no significant effect on cerebellum was observed. Binding potential (BP{sub ND}) values, derived with the simplified reference tissue model (SRTM), were 13-17 in putamen and 3-5 in substantia nigra and correlated well to values from the Logan plot analysis. The method proposed for quantification of [{sup 11}C]Lu AE92686 binding in applied studies in NHP is based on 63 min PET data and SRTM with cerebellum as a reference region. The study supports that [{sup 11}C]Lu AE92686 can be used for PET examinations of PDE10A binding also in substantia

Multistage reaction pathways in detonating high explosives

International Nuclear Information System (INIS)

Li, Ying; Kalia, Rajiv K.; Nakano, Aiichiro; Nomura, Ken-ichi; Vashishta, Priya

2014-01-01

Atomistic mechanisms underlying the reaction time and intermediate reaction products of detonating high explosives far from equilibrium have been elusive. This is because detonation is one of the hardest multiscale physics problems, in which diverse length and time scales play important roles. Here, large spatiotemporal-scale reactive molecular dynamics simulations validated by quantum molecular dynamics simulations reveal a two-stage reaction mechanism during the detonation of cyclotrimethylenetrinitramine crystal. Rapid production of N 2 and H 2 O within ∼10 ps is followed by delayed production of CO molecules beyond ns. We found that further decomposition towards the final products is inhibited by the formation of large metastable carbon- and oxygen-rich clusters with fractal geometry. In addition, we found distinct unimolecular and intermolecular reaction pathways, respectively, for the rapid N 2 and H 2 O productions

Multistage reaction pathways in detonating high explosives

Energy Technology Data Exchange (ETDEWEB)

Li, Ying [Collaboratory for Advanced Computing and Simulations, Department of Physics and Astronomy, Department of Computer Science, and Department of Chemical Engineering and Materials Science, University of Southern California, Los Angeles, California 90089-0242 (United States); Argonne Leadership Computing Facility, Argonne National Laboratory, Argonne, Illinois 60439 (United States); Kalia, Rajiv K.; Nakano, Aiichiro; Nomura, Ken-ichi; Vashishta, Priya [Collaboratory for Advanced Computing and Simulations, Department of Physics and Astronomy, Department of Computer Science, and Department of Chemical Engineering and Materials Science, University of Southern California, Los Angeles, California 90089-0242 (United States)

2014-11-17

Atomistic mechanisms underlying the reaction time and intermediate reaction products of detonating high explosives far from equilibrium have been elusive. This is because detonation is one of the hardest multiscale physics problems, in which diverse length and time scales play important roles. Here, large spatiotemporal-scale reactive molecular dynamics simulations validated by quantum molecular dynamics simulations reveal a two-stage reaction mechanism during the detonation of cyclotrimethylenetrinitramine crystal. Rapid production of N{sub 2} and H{sub 2}O within ∼10 ps is followed by delayed production of CO molecules beyond ns. We found that further decomposition towards the final products is inhibited by the formation of large metastable carbon- and oxygen-rich clusters with fractal geometry. In addition, we found distinct unimolecular and intermolecular reaction pathways, respectively, for the rapid N{sub 2} and H{sub 2}O productions.

Analysis of Nitro-aromatic and Nitramine Explosives by Atmospheric Pressure Chemical Ionization / High Performance Liquid Chromatography / Mass Spectrometry / Mass Spectrometry

International Nuclear Information System (INIS)

Hicks, B.J.; Han, W.; Robben, J.R.

2009-01-01

This procedure is capable of separating and quantifying twenty-nine high explosives and internal surrogates with a single injection. After the initial preparation step, the sample is introduced to the high performance liquid chromatograph for target separation, ionized by atmospheric pressure chemical ionization and the explosives of interest are isolated / quantified by mass spectrometry / mass spectrometry. Concentrations of the target explosives are measured relative to the response of both internal and external standard concentrations. A C-18 reverse phase high performance liquid chromatograph column is used for separation. Ionization is performed using both positive and negative atmospheric pressure chemical ionization resulting in a molecular ion with little fragmentation. These ions are isolated at the first quadrupole of the mass spectrometer, dissociated by collision with argon in the collision cell and the resulting daughter ions are isolated at the second quadrupole. These daughter ions then reach the detector where they are quantified. To date this procedure represents the most thorough high performance liquid chromatography / mass spectrometry / mass spectrometry explosives analysis available in the environmental chemistry market. (authors)

The global compendium of Aedes aegypti and Ae. albopictus occurrence

Science.gov (United States)

Kraemer, Moritz U. G.; Sinka, Marianne E.; Duda, Kirsten A.; Mylne, Adrian; Shearer, Freya M.; Brady, Oliver J.; Messina, Jane P.; Barker, Christopher M.; Moore, Chester G.; Carvalho, Roberta G.; Coelho, Giovanini E.; van Bortel, Wim; Hendrickx, Guy; Schaffner, Francis; Wint, G. R. William; Elyazar, Iqbal R. F.; Teng, Hwa-Jen; Hay, Simon I.

2015-07-01

Aedes aegypti and Ae. albopictus are the main vectors transmitting dengue and chikungunya viruses. Despite being pathogens of global public health importance, knowledge of their vectors’ global distribution remains patchy and sparse. A global geographic database of known occurrences of Ae. aegypti and Ae. albopictus between 1960 and 2014 was compiled. Herein we present the database, which comprises occurrence data linked to point or polygon locations, derived from peer-reviewed literature and unpublished studies including national entomological surveys and expert networks. We describe all data collection processes, as well as geo-positioning methods, database management and quality-control procedures. This is the first comprehensive global database of Ae. aegypti and Ae. albopictus occurrence, consisting of 19,930 and 22,137 geo-positioned occurrence records respectively. Both datasets can be used for a variety of mapping and spatial analyses of the vectors and, by inference, the diseases they transmit.

Evocative allusions in Matthew: Matthew 5:5 as a test case

Directory of Open Access Journals (Sweden)

Robert L. Brawley

2003-10-01

Full Text Available Combining theories of intertextuality and abductive reasoning, this article demonstrates the figurative nature of scriptural allusions in Matthew. Allusions form figurations that open new perspectives for readers inasmuch as the source text and the new text stand in a tensive relationship in which each modifies the other and in which together they evoke meaning beyond the mere sum of the two independent texts. Allusions also form figurations inasmuch as arguments that are analogous to logic. Surprising, original, uncanny correlations between the source text and the new text involve what Charles Peirce called abductive reasoning which also challenges constructs of reality. This article interprets Matthew 5:5 as an allusion to the Abrahamic promise of the inheritance of the land and the blessing of all the families of the earth mediated through Psalm 36 (LXX and describes the figurative nature of the allusion using Harold Bloom’s revisionary ratios. Another version of the article will also be published in Kim, P & Ringe, S (eds, Literary encounters with the reign of God: Essays in honor of Robert C Tannehill, Harrisburg, PA: Trinity Press International (Forthcoming.

AES ALGORITHM IMPLEMENTATION IN PROGRAMMING LANGUAGES

Directory of Open Access Journals (Sweden)

Luminiţa DEFTA

2010-12-01

Full Text Available Information encryption represents the usage of an algorithm to convert an unknown message into an encrypted one. It is used to protect the data against unauthorized access. Protected data can be stored on a media device or can be transmitted through the network. In this paper we describe a concrete implementation of the AES algorithm in the Java programming language (available from Java Development Kit 6 libraries and C (using the OpenSSL library. AES (Advanced Encryption Standard is an asymmetric key encryption algorithm formally adopted by the U.S. government and was elected after a long process of standardization.

Addressing Social Determinants of Health in a Clinic Setting: The WellRx Pilot in Albuquerque, New Mexico.

Science.gov (United States)

Page-Reeves, Janet; Kaufman, Will; Bleecker, Molly; Norris, Jeffrey; McCalmont, Kate; Ianakieva, Veneta; Ianakieva, Dessislava; Kaufman, Arthur

2016-01-01

Although it is known that the social determinants of health have a larger influence on health outcomes than health care, there currently is no structured way for primary care providers to identify and address nonmedical social needs experienced by patients seen in a clinic setting. We developed and piloted WellRx, an 11-question instrument used to screen 3048 patients for social determinants in 3 family medicine clinics over a 90-day period. Results showed that 46% of patients screened positive for at least 1 area of social need, and 63% of those had multiple needs. Most of these needs were previously unknown to the clinicians. Medical assistants and community health workers then offered to connect patients with appropriate services and resources to address the identified needs. The WellRx pilot demonstrated that it is feasible for a clinic to implement such an assessment system, that the assessment can reveal important information, and that having information about patients' social needs improves provider ease of practice. Demonstrated feasibility and favorable outcomes led to institutionalization of the WellRx process at a university teaching hospital and influenced the state department of health to require managed care organizations to have community health workers available to care for Medicaid patients. © Copyright 2016 by the American Board of Family Medicine.

PBFA Z: A 55 TW/4.5 MJ electrical generator

International Nuclear Information System (INIS)

Spielman, R.B.; Stygar, W.A.; Struve, K.W.; Seamen, J.F.

1997-01-01

PBFA Z is a new 55 TW/4.5 MJ short pulse electrical driver located at Sandia National Laboratories. The authors use PBFA Z to magnetically-implode plasma shells. These configurations are historically known as z pinches. The pulsed power design of PBFA Z is based on conventional single-pulse Marx generator, water-line pulse-forming technology used on the earlier Saturn and PBFA II accelerators. PBFA Z stores 11.4 MJ in a 55-TW/105-ns pulse to the output water transmission lines, and delivers up to 3.0 MJ and 40 TW of electrical energy to the z-pinch load. Depending on the initial load inductance and the implosion time, they attain peak currents of 16--20 MA with a rise time of 105 ns. Current is fed to the z-pinch load through self magnetically-insulated transmission lines (MITLs). Peak electric fields in the MITLs exceed 2 MV/cm. The current from the four independent conical disk MITLs is combined together in a double post-hole vacuum convolute with an efficiency greater than 95%. The measured system performance of the water transmission lines, the vacuum insulator stack, the MITLs, and the double post-hole vacuum convolute differed from preshot predictions by ∼ 5%. Using a 2-cm radius and a 2-cm length tungsten wire array with 240, 7.5-microm diameter wires (4.1-mg mass) as the z-pinch load, they achieved x-ray powers of 200 TW and x-ray energies of 1.85 MJ as measured by x-ray diodes and resistive bolometry

15 CFR Appendix D to Part 30 - AES Filing Citation, Exemption and Exclusion Legends

Science.gov (United States)

2010-01-01

... 15 Commerce and Foreign Trade 1 2010-01-01 2010-01-01 false AES Filing Citation, Exemption and... Appendix D to Part 30—AES Filing Citation, Exemption and Exclusion Legends I. USML Proof of Filing Citation AES ITN Example: AES X20060101987654. II. AES Proof of Filing Citation subpart A § 30.7 AES ITN...

Flow sorting of C-genome chromosomes from wild relatives of wheat Aegilops markgrafii, Ae. triuncialis and Ae. cylindrica, and their molecular organization

Czech Academy of Sciences Publication Activity Database

Molnár, I.; Vrána, Jan; Farkas, A.; Kubaláková, Marie; Cseh, A.; Molnár-Láng, M.; Doležel, Jaroslav

2015-01-01

Roč. 116, č. 2 (2015), s. 189-200 ISSN 0305-7364 R&D Projects: GA MŠk(CZ) LO1204 Institutional support: RVO:61389030 Keywords : Aegilops markgrafii * Ae. triuncialis * Ae. cylindrica Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.982, year: 2015

Differential Weighting in Multi-Attribute Utility Measurement: When it Should Not and When it does make a Difference

Science.gov (United States)

1976-08-01

of the motoring public. "The design should balance and optimize characteristics serving environmental, safety, and conservation goals " (McDonald...59 9,738 165 Datsun 610 58 4,766 82 Buick Century 55 5,558 101 Mazda RX4 54 5,207 96 Volkswagen Rabbit 54 4,353 81 AMC Matador 53 4,837 91 Toyota...53 Ford Maverick 8 92 4,229 46 ANMC Hornet 6 94 4,127 44 A’X Pacer 95 4,569 48 Audi Fox 96 5,678 59 Mazda RX4 96 5,207 54 Toyota Corona MIK II 98

Energy calibration of a 5.5 MV Van de Graaff accelerator using a time-of-flight technique

Science.gov (United States)

Andrade, E.; Feregrino, M.; Zavala, E. P.; Pineda, J. C.; Jiménez, R.; Jaidar, A.

1990-02-01

Energy calibration of the analysing magnet for the University of México 5.5 MV Van de Graaff accelerator has been carried out using a time-of-flight method. The pulsed and bunched beam produced by the accelerator was used to deduce the energy E of the beam particles from the transit time between a coaxial pickup and a charged particle detector separated by 1.5 m. The measured FWHM energy resolution of this system was about 20 keV.

Quench detection/protection of an HTS coil by AE signals

International Nuclear Information System (INIS)

Yoneda, M.; Nanato, N.; Aoki, D.; Kato, T.; Murase, S.

2011-01-01

A quench detection/protection system based on measuring AE signals was developed. The system was tested for a Bi2223 coil. Temperature rise after a quench occurrence was restrained at very low value. The normal zone propagation velocities in high T c superconductors are slow at high operation temperature and therefore local and excessive temperature rise generates at quench occurrence, and then the superconductors are degraded or burned. Therefore it is essential to detect the temperature rise in high T c superconducting (HTS) coils as soon as possible and protect them. The authors have presented a quench detection method for HTS coils by time-frequency visualization of AE signals and have shown its usefulness for a HTS coil with height and outer diameter of 40-50 mm. In this paper, the authors present a quench detection/protection system based on superior method in quench detection time to the previous method and show its usefulness for a larger HTS coil (height and outer diameter: 160-190 mm) than the previous coil.

AE/VCE Unconfirmed Vernal Pools

Data.gov (United States)

Vermont Center for Geographic Information — This dataset is derived from a project by the Vermont Center for Ecostudies(VCE) and Arrowwood Environmental(AE) to map vernal pools throughout the state of Vermont....

AE/VCE Confirmed Vernal Pools

Data.gov (United States)

Vermont Center for Geographic Information — This dataset is derived from a project by the Vermont Center for Ecostudies(VCE) and Arrowwood Environmental(AE) to map vernal pools throughout the state of Vermont....