Wilson, Thomas A; Nicolosi, Robert J; Delaney, Bryan; Chadwell, Kim; Moolchandani, Vikas; Kotyla, Timothy; Ponduru, Sridevi; Zheng, Guo-Hua; Hess, Richard; Knutson, Nathan; Curry, Leslie; Kolberg, Lore; Goulson, Melanie; Ostergren, Karen
2004-10-01
Consumption of concentrated barley beta-glucan lowers plasma cholesterol because of its soluble dietary fiber nature. The role of molecular weight (MW) in lowering serum cholesterol is not well established. Prior studies showed that enzymatic degradation of beta-glucan eliminates the cholesterol-lowering activity; however, these studies did not evaluate the MW of the beta-glucan. The current study was conducted to evaluate whether barley beta-glucan concentrates, partially hydrolyzed to reduce MW, possess cholesterol-lowering and antiatherogenic activities. The reduced MW fraction was compared with a high MW beta-glucan concentrate from the same barley flour. Concentrated beta-glucan preparations were evaluated in Syrian Golden F(1)B hamsters fed a hypercholesterolemic diet (HCD) with cholesterol, hydrogenated coconut oil, and cellulose. After 2 wk, hamsters were fed HCD or diets that contained high or reduced MW beta-glucan at a concentration of 8 g/100 g at the expense of cellulose. Decreases in plasma total cholesterol (TC) and non-HDL-cholesterol (non-HDL-C) concentrations occurred in the hamsters fed reduced MW and high MW beta-glucan diets. Plasma HDL-C concentrations did not differ. HCD-fed hamsters had higher plasma triglyceride concentrations. Liver TC, free cholesterol, and cholesterol ester concentrations did not differ. Aortic cholesterol ester concentrations were lower in the reduced MW beta-glucan-fed hamsters. Consumption of either high or reduced MW beta-glucan increased concentrations of fecal total neutral sterols and coprostanol, a cholesterol derivative. Fecal excretion of cholesterol was greater than in HCD-fed hamsters only in those fed the reduced MW beta-glucan. Study results demonstrate that the cholesterol-lowering activity of barley beta-glucan may occur at both lower and higher MW.
Kotaka, Atsushi; Bando, Hiroki; Kaya, Masahiko; Kato-Murai, Michiko; Kuroda, Kouichi; Sahara, Hiroshi; Hata, Yoji; Kondo, Akihiko; Ueda, Mitsuyoshi
2008-06-01
Three beta-glucosidase- and two endoglucanase-encoding genes were cloned from Aspergillus oryzae, and their gene products were displayed on the cell surface of the sake yeast, Saccharomyces cerevisiae GRI-117-UK. GRI-117-UK/pUDB7 displaying beta-glucosidase AO090009000356 showed the highest activity against various substrates and efficiently produced ethanol from cellobiose. On the other hand, GRI-117-UK/pUDCB displaying endoglucanase AO090010000314 efficiently degraded barley beta-glucan to glucose and smaller cellooligosaccharides. GRI-117-UK/pUDB7CB codisplaying both beta-glucosidase AO090009000356 and endoglucanase AO090010000314 was constructed. When direct ethanol fermentation from 20 g/l barley beta-glucan as a model substrate was performed with the codisplaying strain, the ethanol concentration reached 7.94 g/l after 24 h of fermentation. The conversion ratio of ethanol from beta-glucan was 69.6% of the theoretical ethanol concentration produced from 20 g/l barley beta-glucan. These results showed that sake yeast displaying A. oryzae cellulolytic enzymes can be used to produce ethanol from cellulosic materials. Our constructs have higher ethanol production potential than the laboratory constructs previously reported.
DEFF Research Database (Denmark)
Munck, L.; Møller, B.; Jacobsen, Susanne
2004-01-01
-->3,1-->4)-[beta]-glucan (up to 15-20%), thus, maintaining a constant production of polysaccharides at 50-55%, within the range of normal barley.The spectral tool was tested by an independent data set with six mutants with unknown polysaccharide composition. Spectral data from four of these were classified within...... the high (1-->3,1-->4)-[beta]-glucan BG lys5 cluster in a PCA. Their high (1-->3,1-->4)-[beta]-glucan and low starch content was verified. It is concluded that genetic diversity such as from gene regulated polysaccharide and storage protein pathways in the endosperm tissue can be discovered directly from...... the phenotype by chemometric classification of a spectral library, representing the digitised phenome from a barley gene bank....
DEFF Research Database (Denmark)
Seefeldt, Helene Fast; van den Berg, Frans W.J.; Köckenberger, Walter
2007-01-01
1H NMR imaging (MRI) was used as a noninvasive technique to study water distribution and mobility in hydrated barley (Hordeum vulgare L.) seeds of accessions with varying content of beta glucan (BG), a highly hygroscopic cell wall component. High contents of BG in barley are unfavorable in malting...... where it leads to clotting of filters and hazing of beer as well as in animal feed where it hinders the rapid uptake of energy. However, a high content of BG has a positive nutritional effect, as it lowers the cholesterol and the glycaemic index. It was studied whether water distribution and mobility...... were related to content and location of BG. Water mobility was investigated by following the rate and mode of desiccation in hydrated single seeds. In order to determine the different water components, a multispin echo experiment was set up to reveal the T2 transverse relaxation rates of water within...
DEFF Research Database (Denmark)
Pedersen, L.H.; Jacobsen, S.; Hejgaard, J.
1993-01-01
The plasma membrane bound beta-1,3-D-glucan (callose) synthase. assumed to be involved in the resistance to the powdery mildew fungus (Erysiphe graminis f.sp. hordei), was partially purified from a microsomal fraction of green barley leaves (Hordeum vulgare L.). Plasma membranes were enriched...
Method for hull-less barley transformation and manipulation of grain mixed-linkage beta-glucan.
Lim, Wai Li; Collins, Helen M; Singh, Rohan R; Kibble, Natalie A J; Yap, Kuok; Taylor, Jillian; Fincher, Geoffrey B; Burton, Rachel A
2018-05-01
Hull-less barley is increasingly offering scope for breeding grains with improved characteristics for human nutrition; however, recalcitrance of hull-less cultivars to transformation has limited the use of these varieties. To overcome this limitation, we sought to develop an effective transformation system for hull-less barley using the cultivar Torrens. Torrens yielded a transformation efficiency of 1.8%, using a modified Agrobacterium transformation method. This method was used to over-express genes encoding synthases for the important dietary fiber component, (1,3;1,4)-β-glucan (mixed-linkage glucan), primarily present in starchy endosperm cell walls. Over-expression of the HvCslF6 gene, driven by an endosperm-specific promoter, produced lines where mixed-linkage glucan content increased on average by 45%, peaking at 70% in some lines, with smaller increases in transgenic HvCslH1 grain. Transgenic HvCslF6 lines displayed alterations where grain had a darker color, were more easily crushed than wild type and were smaller. This was associated with an enlarged cavity in the central endosperm and changes in cell morphology, including aleurone and sub-aleurone cells. This work provides proof-of-concept evidence that mixed-linkage glucan content in hull-less barley grain can be increased by over-expression of the HvCslF6 gene, but also indicates that hull-less cultivars may be more sensitive to attempts to modify cell wall composition. © 2017 Institute of Botany, Chinese Academy of Sciences.
Beta Glucan: Health Benefits in Obesity and Metabolic Syndrome
Directory of Open Access Journals (Sweden)
D. El Khoury
2012-01-01
Full Text Available Despite the lack of international agreement regarding the definition and classification of fiber, there is established evidence on the role of dietary fibers in obesity and metabolic syndrome. Beta glucan (β-glucan is a soluble fiber readily available from oat and barley grains that has been gaining interest due to its multiple functional and bioactive properties. Its beneficial role in insulin resistance, dyslipidemia, hypertension, and obesity is being continuously documented. The fermentability of β-glucans and their ability to form highly viscous solutions in the human gut may constitute the basis of their health benefits. Consequently, the applicability of β-glucan as a food ingredient is being widely considered with the dual purposes of increasing the fiber content of food products and enhancing their health properties. Therefore, this paper explores the role of β-glucans in the prevention and treatment of characteristics of the metabolic syndrome, their underlying mechanisms of action, and their potential in food applications.
Directory of Open Access Journals (Sweden)
Claudia Zielke
Full Text Available An extraction method for mixed-linkage β-glucan from oat and barley was developed in order to minimize the effect of extraction on the β-glucan structure. β-Glucan were characterized in terms of molecular size and molar mass distributions using asymmetric flow field-flow fractionation (AF4 coupled to multiangle light scattering (MALS, differential refractive index (dRI and fluorescence (FL detection. The carbohydrate composition of the extracts was analysed using polysaccharide analysis by carbohydrate gel electrophoresis (PACE and high-performance anion-exchange chromatography (HPAEC. Whether there were any proteinaceous moieties linked to β-glucan was also examined. Purified extracts contained 65% and 53% β-glucan for oats and barley, respectively. The main impurities were degradation products of starch. The extracts contained high molecular weight β-glucan (105-108 g/mol and large sizes (root-mean-square radii from 20 to 140 nm. No proteins covalently bound to β-glucan were detected; therefore, any suggested functionality of proteins regarding the health benefits of β-glucan can be discounted.
Barley β-glucan reduces blood cholesterol levels via interrupting bile acid metabolism.
Wang, Yanan; Harding, Scott V; Thandapilly, Sijo J; Tosh, Susan M; Jones, Peter J H; Ames, Nancy P
2017-11-01
Underlying mechanisms responsible for the cholesterol-lowering effect of β-glucan have been proposed, yet have not been fully demonstrated. The primary aim of this study was to determine whether the consumption of barley β-glucan lowers cholesterol by affecting the cholesterol absorption, cholesterol synthesis or bile acid synthesis. In addition, this study was aimed to assess whether the underlying mechanisms are related to cholesterol 7α hydroxylase (CYP7A1) SNP rs3808607 as proposed by us earlier. In a controlled, randomised, cross-over study, participants with mild hypercholesterolaemia (n 30) were randomly assigned to receive breakfast containing 3 g high-molecular weight (HMW), 5 g low-molecular weight (LMW), 3 g LMW barley β-glucan or a control diet, each for 5 weeks. Cholesterol absorption was determined by assessing the enrichment of circulating 13C-cholesterol over 96 h following oral administration; fractional rate of synthesis for cholesterol was assessed by measuring the incorporation rate of 2H derived from deuterium oxide within the body water pool into the erythrocyte cholesterol pool over 24 h; bile acid synthesis was determined by measuring serum 7α-hydroxy-4-cholesten-3-one concentrations. Consumption of 3 g HMW β-glucan decreased total cholesterol (TC) levels (P=0·029), but did not affect cholesterol absorption (P=0·25) or cholesterol synthesis (P=0·14). Increased bile acid synthesis after consumption of 3 g HMW β-glucan was observed in all participants (P=0·049), and more pronounced in individuals carrying homozygous G of rs3808607 (P=0·033). In addition, a linear relationship between log (viscosity) of β-glucan and serum 7α-HC concentration was observed in homozygous G allele carriers. Results indicate that increased bile acid synthesis rather than inhibition of cholesterol absorption or synthesis may be responsible for the cholesterol-lowering effect of barley β-glucan. The pronounced TC reduction in G allele carriers of rs
Directory of Open Access Journals (Sweden)
Alexandre H. Fujita
2003-08-01
Full Text Available Foi utilizado o método enzimático recomendado pela AOAC para determinação de beta-glucanas em cereais e alimentos que os contém. O método, utiliza liquenase (EC 3.2.1.73 e beta-glucosidase (EC 3.2.1.21 para hidrólise debeta-glucanas, é rápido, fácil de executar e específico para beta-glucanas com ligações beta(1->3 e beta(1->4. As sementes analisadas foram subministradas pelo Instituto Agronômico de Campinas (IAC e os alimentos adquiridos nos supermercados. Aveia e cevada são os grãos com maior conteúdo de beta-glucanas. Na aveia os teores determinados foram 6,48 e 5,94%. Nos 10 cultivares de cevada os teores de beta-glucanas oscilaram entre 2,04 e 9,68%. Trigo e triticale apresentaram teores de b-glucanas menores que 1%. Nos produtos comerciais o teor de beta-glucanas estava relacionado ao tipo de cereal da fórmula. O produto comercial de maior conteúdo de beta-glucanas é o farelo de aveia. As beta-glucanas são ingredientes funcionais em potencial e a conveniência ou não de estimular sua incorporação em alimentos deve ser mais estudada. Quanto à composição centesimal dos grãos de cereais, o teor de proteínas foi o que apresentou a maior variação e isso se reflete na composição dos produtos comerciais.The method employed was the enzymatic one recommended by de AOAC for the determination of beta-glucans in cereals and in foodstuffs containing cereals in their formulation. The method, using lichenase (EC 3.2.1.73 and beta-glucosidase (EC 3.2.1.21 for the hydrolysis of beta-glucans, is quick and easy to execute, but is specific for beta-glucans with beta(1->3 and beta(1->4 bonds. The Agronomic Institute of Campinas (IAC supplied the seeds analyzed, and the foodstuffs were acquired in supermarkets. Oat and barley are the grains with the highest content of beta-glucans. In the oats, the determined values were 6.48 and 5.94%. In the 10 cultivars of barley, the content of beta-glucans varied between 2.04 and 9
Oat beta-glucan ameliorates insulin resistance in mice fed on high-fat and high-fructose diet
Directory of Open Access Journals (Sweden)
Jie Zheng
2013-12-01
Full Text Available Methods: This study sought to evaluate the impact of oat beta-glucan on insulin resistance in mice fed on high-fat and high-fructose diet with fructose (10%, w/v added in drinking water for 10 weeks. Results: The results showed that supplementation with oat beta-glucan could significantly reduce the insulin resistance both in low-dose (200 mg/kg−1 body weight and high-dose (500 mg/kg−1 body weight groups, but the high-dose group showed a more significant improvement in insulin resistance (P<0.01 compared with model control (MC group along with significant improvement in hepatic glycogen level, oral glucose, and insulin tolerance. Moreover, hepatic glucokinase activity was markedly enhanced both in low-dose and high-dose groups compared with that of MC group (P<0.05. Conclusion: These results suggested that supplementation of oat beta-glucan alleviated insulin resistance and the effect was dose dependent.
Zheng, Xueling; Li, Limin; Wang, Qi
2011-01-01
Six hull-less barley cultivars widely grown in China were roller-milled to produce bran, shorts and flour fractions. The distribution and molecular characteristics of β-glucans from the three roller-milled fractions were investigated. The β-glucan contents in the six hull-less barley cultivars varied from 4.96% to 7.62%. For all the six cultivars, the shorts fraction contained the highest concentration of β-glucan (8.12-13.01%), followed by bran (6.15-7.58%) and flour (2.48-2.95%). Crude β-glucans were prepared from the three roller-milled fractions using aqueous sodium carbonate (pH 10). These preparations contained 45.38-71.41% β-glucan, 10.81-17.26% arabinoxylan, 2.6-9.6% protein, 2.7-9.0% starch, and 5.23-9.68% ash. Purification using α-amylase and β-xylanase in combination with pH adjustment and dialysis produced high purity β-glucan preparations (91-95%). The molecular weight (Mw) of β-glucan preparations from roller-milled fractions ranged from 117,600 to 852,400 g/mol. β-Glucan from flour had higher Mw than those from shorts and bran within the same cultivar, and β-glucan preparations from bran had the lowest Mw.
Brennan, Margaret A; Derbyshire, Emma; Tiwari, Brijesh K; Brennan, Charles S
2013-03-01
β-glucan is a commonly researched plant cell wall component that when incorporated into food products has been associated with cholesterol and glycaemic response reductions. This study focusses on β-glucan rich fractions from barley and mushroom used in the production of extruded ready to eat snacks. Inclusion of barley β-glucan rich fractions and mushroom β-glucan fractions at 10 % levels increased the total dietary fibre content of extrudates compared to the control (P extruded snack products.
Effects of extrusion variables on the properties of waxy hulless barley extrudates.
Köksel, Hamit; Ryu, Gy-Hyung; Başman, Arzu; Demiralp, Hande; Ng, Perry K W
2004-02-01
The objective of this research was to investigate the extrudability of waxy hulless barley flour under various extrusion conditions. Waxy hulless barley flour was processed in a laboratory-scale corotating twin-screw extruder with different levels of feed moisture content (22.3, 26.8, and 30.7%) and die temperature (130, 150, and 170 degrees C) to develop a snack food with high beta-glucan content. The effects of extrusion condition variables (screw configuration, moisture, and temperature) on the system variables (pressure and specific mechanical energy), the extrudate physical properties (sectional expansion index, bulk density), starch gelatinization, pasting properties (cold peak viscosity, trough viscosity, and final viscosity), and beta-glucan contents were determined. Results were evaluated by using response surface methodology. Increased extrusion temperature and feed moisture content resulted in decreases in exit die pressure and specific mechanical energy values. For extrudates extruded under low shear screw configuration (LS), increased barrel temperature decreased sectional expansion index (SEI) values at both low and high moisture contents. The feed moisture seems to have an inverse relationship with SEI over the range studied. Bulk density was higher at higher moisture contents, for both low and high barrel temperatures, for samples extruded under high shear screw configuration (HS) and LS. Cold peak viscosities (CV) were observed in all samples. The CV increased with the increase in extrusion temperature and feed moisture content. Although beta-glucan contents of the LS extrudates were comparable to that of barley flour sample, HS samples had generally lower beta-glucan contents. The extrusion cooking technique seems to be promising for the production of snack foods with high beta-glucan content, especially using LS conditions.
Zhu, X; Sun, X; Wang, M; Zhang, C; Cao, Y; Mo, G; Liang, J; Zhu, S
2015-08-01
A growing body of evidence suggests that beta-glucan derived from oats or barley can reduce cardiovascular disease risk through reductions in serum lipids. However, the effects of beta-glucan on lipid changes in hypercholesterolemic patient groups are inconsistent. The objective of this study was to identify and quantify the effect of beta-glucan, a marker of water-soluble fiber, on various lipid parameters and glucose level in hypercholesterolemic subjects. We performed a comprehensive literature search to identify the relevant randomized controlled trials (RCTs) that investigated the effects of beta-glucan consumption in hypercholesterolemic subjects. Mean differences (MDs) and 95% confidence intervals (CIs) were calculated for net changes in lipid concentrations by using fixed-effects or random-effects models according to heterogeneity. Publication bias, sensitivity analysis and subgroup analyses were also performed. Seventeen eligible RCTs with 916 subjects were included in the meta-analysis. The pooled result showed that beta-glucan consumption in hypercholesterolemic population significantly lowered the total cholesterol (TC) (MD, -0.26 mmol/L; 95% CI, -0.33 to -0.18; P consumption significantly decreased TC and LDL-cholesterol concentrations but did not affect TG, HDL-cholesterol, and glucose concentrations in hypercholesterolemic subjects. Copyright © 2015 Elsevier B.V. All rights reserved.
Beta-Glucan Synthase Gene Expression in Pleurotus sp
International Nuclear Information System (INIS)
Azhar Mohamad; Nie, H.J.
2016-01-01
Pleurotus sp. is a popular edible mushroom, containing various functional component, in particular, Beta-glucan. Beta-glucans is a part of glucan family of polysaccharides and supposedly contribute to medicinal and nutritional value of Pleurotus.sp. In order to understand the distribution of Beta-glucan in Pleurotus.sp, the Beta-glucan synthase gene expression was determined and compared in different part of Pleurotus, namely mycelium, stripe and cap. The Pleurotus.sp RNA was extracted using commercial kit, employing Tissuelyser ll (Qiagen, USA) to disrupt the cell walls. Then the RNA was quantified by Nano drop (Thermo Fisher, USA) and visualized using denaturing agarose gel. RNA with good OD 260.280 reading (∼2.0) was chosen and converted to cDNA. Using Laccase synthase gene as home keeping gene, Beta-glucan synthase gene expression was quantified using CFX 96 Real Time PCR detection system (Biorad, USA). Preliminary result shows that Beta-glucan synthase was relatively expressed the most in stripe, followed by mycelium and barely in cap. (author)
Regand, Alejandra; Tosh, Susan M; Wolever, Thomas M S; Wood, Peter J
2009-10-14
To assess the effect of food processing on the capacity of oat beta-glucan to attenuate postprandial glycemia, isocaloric crisp bread, granola, porridge, and pasta containing 4 g of beta-glucan as well as control products with low beta-glucan content were prepared. The physicochemical properties (viscosity, peak molecular weight (M(p)), and concentration (C)) of beta-glucan in in-vitro-digestion extracts were evaluated, and fasting and postprandial blood glucose concentrations were measured in human subjects. Porridge and granola had the highest efficacy in attenuating the peak blood glucose response (PBGR) because of their high M(p) and viscosity. beta-Glucan depolymerization in bread and pasta reduced beta-glucan bioactivity. Pastas, known to have low glycemic responses, showed the lowest PBGR. The analyses of these products with previously reported data indicated that 73% of the bioactivity in reducing PBGR can be explained by M(p) x C. Characterizing the physicochemical properties of beta-glucan in bioactive foods aids functional food development.
Effect of Enzyme Supplementation and Irradiation of Barley on Broiler Chicks Performance
International Nuclear Information System (INIS)
Farag, D.H.M.; Abd El-Hakeim, N.F.
1999-01-01
The experiments were conducted to study the influence of irradiation treatment at dose levels of 0.20 and 60 kGy on barley beta-glucan and the effect of enzyme supplementation and irradiation of barley on broiler chicks performance. The amount of total and water-soluble beta-glucan in raw barley was 36 kg -1 , respectively. The effect of irradiation treatment on total beta-glucan was insignificant while the level of soluble beta-glucan was increased with increasing the dose levels of irradiation. The effect of irradiation treatment and enzyme supplementation of barley diets on growth and conversion performance of broiler chicks indicated that birds fed raw barley diet had lower body weight, body weight gain and feed conversion than those fed control diet throughout the experimental period. Irradiation of barley at dose of 20 kGy did not affect the chick performance (feed consumption, weight gain feed-gain ratio) that received the B 20 diet from 7 to 21 days of age, but when bird maintained on B 20 diet from 7 28 days of age, only feed-gain ratio was improved by 14.4%. The results indicate that there was a significant effect of irradiation of barley at 60 kGy (B 60) on feed -gain ratio of chicks when were fed B 60 diet from 7 to 21 days of age. The corresponding improvement in feed-gain ratio was 16.4%. When birds were fed B 60 diet from 7-28 days of age, the improvement in body weight and feed-gain ratio was 25.5 and 19.6%, respectively
Energy Technology Data Exchange (ETDEWEB)
Woo, Yeon I; Park, Bong Joo; Kim, Hye-Lee; Lee, Mi Hee; Kim, Jungsung; Park, Jong-Chul [Department of Medical Engineering, Yonsei University College of Medicine, 134 Shinchon-dong, Seodaemun-gu, Seoul 120-752 (Korea, Republic of); Yang, Young-Il [Department of Pathology, School of Medicine, Paik Institute for Clinical Research, Inje University, 633-165 Gae-dong, Busan-jin-gu, Busan 614-735 (Korea, Republic of); Kim, Jung Koo [Department of Biomedical Engineering, College of Biomedical Science and Engineering, Inje University, Kimhae 621-749 (Korea, Republic of); Tsubaki, Kazufumi [R and D division, Asahi Denka Co. Ltd, 7-2-35 Higashi-ogu, Arakawa-ku, Tokyo 116-8554 (Japan); Han, Dong-Wook, E-mail: parkjc@yuhs.a [Department of Nanomedical Engineering, College of Nanoscience and Nanotechnology, Pusan National University, geumjeong-gu, Busan 609-735 (Korea, Republic of)
2010-08-01
In this study, we investigated the possible roles of (1,3)-(1,6)-{beta}-d-glucan ({beta}-glucan) and porous electrospun poly-lactide-co-glycolide (PLGA) membranes containing {beta}-glucan for skin wound healing, especially their effect on adult human dermal fibroblast (aHDF) and adipose tissue-derived stem cell (ADSC) activation, proliferation, migration, collagen gel contraction and biological safety tests of the prepared membrane. This study demonstrated that {beta}-glucan and porous PLGA membranes containing {beta}-glucan have enhanced the cellular responses, proliferation and migration, of aHDFs and ADSCs and the result of a collagen gel contraction assay also revealed that collagen gels contract strongly after 4 h post-gelation incubation with {beta}-glucan. Furthermore, we confirmed that porous PLGA membranes containing {beta}-glucan are biologically safe for wound healing study. These results indicate that the porous PLGA membranes containing {beta}-glucan interacted favorably with the membrane and the topical administration of {beta}-glucan was useful in promoting wound healing. Therefore, our study suggests that {beta}-glucan and porous PLGA membranes containing {beta}-glucan may be useful as a material for enhancing wound healing.
Barley β-Glucans-Containing Food Enhances Probiotic Performances of Beneficial Bacteria
Directory of Open Access Journals (Sweden)
Mattia P. Arena
2014-02-01
Full Text Available Currently, the majority of prebiotics in the market are derived from non-digestible oligosaccharides. Very few studies have focused on non-digestible long chain complex polysaccharides in relation to their potential as novel prebiotics. Cereals β-glucans have been investigated for immune-modulating properties and beneficial effects on obesity, cardiovascular diseases, diabetes, and cholesterol levels. Moreover, β-glucans have been reported to be highly fermentable by the intestinal microbiota in the caecum and colon, and can enhance both growth rate and lactic acid production of microbes isolated from the human intestine. In this work, we report the effects of food matrices containing barley β-glucans on growth and probiotic features of four Lactobacillus strains. Such matrices were able to improve the growth rate of the tested bacteria both in unstressed conditions and, importantly, after exposure to in vitro simulation of the digestive tract. Moreover, the effect of β-glucans-containing food on bacterial adhesion to enterocyte-like cells was analyzed and a positive influence on probiotic-enterocyte interaction was observed.
Isolation of beta-glucan from the cell wall of Saccharomyces cerevisiae.
Shokri, Hojjatollah; Asadi, Farzad; Khosravi, Ali Reza
2008-03-20
Beta-glucan, one of the major cell wall components of Saccharomyces cerevisiae (S. cerevisiae), has been found to enhance immune functions. At present study, we developed an optimal procedure to extract and purify beta-glucan. At first, yeast cells were grown in sabouraud dextrose agar and then cultured in yeast extract-peptone-glucose (YPG) broth. After incubation, cells were harvested, washed and disrupted by means of sonication method. The obtained cell walls were used to prepare alkali-soluble beta-glucan (glucan-S1). In this regard, 2% sodium hydroxide (NaOH) and 3% acetic acid were used in alkaline-acid extraction, respectively. This preparation contained 2.4% protein. In the next step, DEAE sephacel chromatography was used to remove remaining proteins (glucan-S2). Subsequently this preparation was applied into concanavalin-A sepharose column to remove manann. Finally, beta-glucan free of mannoprotein complexes was prepared (glucan-S3).
Comparison of functional and nutritional characteristics of barley and oat mixed linkage ß-glucans
DEFF Research Database (Denmark)
Mikkelsen, Mette Skau
-functionality relationship of β-glucans, the exact functional principle remain elusive. The overall aim of this project was to provide new knowledge into the relation between β-glucan and health at a molecular level. For the first time two barley and one oat fractions of well-defined and structurally different β...
High plasma concentration of beta-D-glucan after administration of sizofiran for cervical cancer
Directory of Open Access Journals (Sweden)
Hirokazu Tokuyasu
2010-09-01
Full Text Available Hirokazu Tokuyasu1, Kenichi Takeda1, Yuji Kawasaki1, Yasuto Sakaguchi2, Noritaka Isowa2, Eiji Shimizu3, Yasuto Ueda31Divisions of Respiratory Medicine, 2Thoracic Surgery, Matsue Red Cross Hospital, 200 Horomachi, Matsue, Shimane; 3Division of Medical Oncology and Molecular Respirology, Department of Multidisciplinary Internal Medicine, Faculty of Medicine, Tottori University, Yonago, JapanAbstract: A 69-year-old woman with a history of cervical cancer was admitted to our hospital for further investigation of abnormal shadows on her chest roentgenogram. Histologic examination of transbronchial lung biopsy specimens revealed epithelioid cell granuloma, and Mycobacterium intracellulare was detected in the bronchial lavage fluid. The plasma level of (1→3-beta-D-glucan was very high, and this elevated level was attributed to administration of sizofiran for treatment of cervical cancer 18 years previously. Therefore, in patients with cervical cancer, it is important to confirm whether or not sizofiran has been administered before measuring (1→3-beta-D-glucan levels.Keywords: (1→3-beta-D-glucan, cervical cancer, Mycobacterium intracellulare, sizofiran
Czech Academy of Sciences Publication Activity Database
Šíma, Petr; Vannucci, Luca; Větvička, V.
2017-01-01
Roč. 41, č. 4 (2017), s. 1799-1808 ISSN 1107-3756 Institutional support: RVO:61388971 Keywords : cholesterol * beta-glucans * diet Subject RIV: EE - Microbiology, Virology OBOR OECD: Microbiology Impact factor: 2.341, year: 2016
Beta-glucans in the treatment of diabetes and associated cardiovascular risks
Directory of Open Access Journals (Sweden)
Jiezhong Chen
2008-12-01
Full Text Available Jiezhong Chen1,3, Kenneth Raymond21John Curtin School of Medical Research, Australian National University, Acton, ACT, Australia; 2School of Pharmacy and Applied Science, Faculty of Science, Technology and Engineering, LaTrobe University, Bendigo, Vic, Australia; 3Adjunct Senior Research Fellow, University of Canberra, ACT, AustraliaAbstract: Diabetes mellitus is characterized by high blood glucose level with typical manifestations of thirst, polyuria, polydipsia, and weight loss. It is caused by defects in insulin-mediated signal pathways, resulting in decreased glucose transportation from blood into muscle and fat cells. The major risk is vascular injury leading to heart disease, which is accelerated by increased lipid levels and hypertension. Management of diabetes includes: control of blood glucose level and lipids; and reduction of hypertension. Dietary intake of beta-glucans has been shown to reduce all these risk factors to benefit the treatment of diabetes and associated complications. In addition, beta-glucans also promote wound healing and alleviate ischemic heart injury. However, the mechanisms behind the effect of beta-glucans on diabetes and associated complications need to be further studied using pure beta-glucan.Keywords: diabetes mellitus, hyperglycemia, prevalence, pathogenesis
EFFECTS OF BARLEY FLOUR ADDITION AND BAKING TEMPERATURE ON Β-GLUCANS CONTENT AND BISCUITS PROPERTIES
Džafić, A; Oručević-Žuljević, Sanja; Spaho, Nermina; Akagić, Asima
2017-01-01
The aim of this study was to investigate opportunities to improve the nutritional value of biscuits. Therefore, the content of β-glucans, physical, chemical and sensory properties of biscuits were determined in relation to a share of added barley flour and a baking temperature. Five different blends of barley and wheat were used for biscuit production: barley/wheat flours in combinations: 0/100; 25/75; 50/50; 75/25 and 100/0 according to the procedure described in AACC method 10-52. The temp...
Directory of Open Access Journals (Sweden)
Robert T Wheeler
2008-12-01
Full Text Available Candida albicans, a clinically important dimorphic fungal pathogen that can evade immune attack by masking its cell wall beta-glucan from immune recognition, mutes protective host responses mediated by the Dectin-1 beta-glucan receptor on innate immune cells. Although the ability of C. albicans to switch between a yeast- or hyphal-form is a key virulence determinant, the role of each morphotype in beta-glucan masking during infection and treatment has not been addressed. Here, we show that during infection of mice, the C. albicans beta-glucan is masked initially but becomes exposed later in several organs. At all measured stages of infection, there is no difference in beta-glucan exposure between yeast-form and hyphal cells. We have previously shown that sub-inhibitory doses of the anti-fungal drug caspofungin can expose beta-glucan in vitro, suggesting that the drug may enhance immune activity during therapy. This report shows that caspofungin also mediates beta-glucan unmasking in vivo. Surprisingly, caspofungin preferentially unmasks filamentous cells, as opposed to yeast form cells, both in vivo and in vitro. The fungicidal activity of caspofungin in vitro is also filament-biased, as corroborated using yeast-locked and hyphal-locked mutants. The uncloaking of filaments is not a general effect of anti-fungal drugs, as another anti-fungal agent does not have this effect. These results highlight the advantage of studying host-pathogen interaction in vivo and suggest new avenues for drug development.
The beta-glucan receptor dectin-1 recognizes specific morphologies of Aspergillus fumigatus.
Directory of Open Access Journals (Sweden)
Chad Steele
2005-12-01
Full Text Available Alveolar macrophages represent a first-line innate host defense mechanism for clearing inhaled Aspergillus fumigatus from the lungs, yet contradictory data exist as to which alveolar macrophage recognition receptor is critical for innate immunity to A. fumigatus. Acknowledging that the A. fumigatus cell wall contains a high beta-1,3-glucan content, we questioned whether the beta-glucan receptor dectin-1 played a role in this recognition process. Monoclonal antibody, soluble receptor, and competitive carbohydrate blockage indicated that the alveolar macrophage inflammatory response, specifically the production of tumor necrosis factor-alpha (TNF-alpha, interleukin-1alpha (IL-1alpha, IL-1beta, IL-6, CXCL2/macrophage inflammatory protein-2 (MIP-2, CCL3/macrophage inflammatory protein-1alpha (MIP-1alpha, granulocyte-colony stimulating factor (G-CSF, and granulocyte monocyte-CSF (GM-CSF, to live A. fumigatus was dependent on recognition via the beta-glucan receptor dectin-1. The inflammatory response was triggered at the highest level by A. fumigatus swollen conidia and early germlings and correlated to the levels of surface-exposed beta glucans, indicating that dectin-1 preferentially recognizes specific morphological forms of A. fumigatus. Intratracheal administration of A. fumigatus conidia to mice in the presence of a soluble dectin-Fc fusion protein reduced both lung proinflammatory cytokine/chemokine levels and cellular recruitment while modestly increasing the A. fumigatus fungal burden, illustrating the importance of beta-glucan-initiated dectin-1 signaling in defense against this pathogen. Collectively, these data show that dectin-1 is centrally required for the generation of alveolar macrophage proinflammatory responses to A. fumigatus and to our knowledge provides the first in vivo evidence for the role of dectin-1 in fungal innate defense.
Theuwissen, Elke; Mensink, Ronald P
2007-03-01
Intake of food products rich in water-soluble fiber beta-glucan and products enriched with plant stanol esters lower serum cholesterol. Combining 2 functional food ingredients into one food product may achieve additional reductions of serum cholesterol. Our objective was to investigate the effects of a simultaneous intake of beta-glucan plus plant stanol esters on lipid metabolism in mildly hypercholesterolemic volunteers. In a randomized, controlled, 3-period crossover study, 40 mildly hypercholesterolemic men and women received muesli in random order twice a day for 4 wk, which provided, in total, 5 g control fiber from wheat (control muesli), 5 g oat beta-glucan (beta-glucan muesli), or 5 g oat beta-glucan plus 1.5 g plant stanols (combination muesli). beta-Glucan muesli decreased serum LDL cholesterol by 5.0% compared with control muesli (P = 0.013). Combination muesli reduced LDL cholesterol by 9.6% compared with control muesli (P < 0.001), and by 4.4% compared with beta-glucan muesli (P = 0.036). Serum HDL cholesterol and triacylglycerol concentrations did not differ after the 3 treatments. Compared with control muesli, beta-glucan muesli increased bile acid synthesis (P = 0.043) and decreased cholesterol absorption (P = 0.011). Addition of plant stanols did not influence bile acid synthesis but decreased cholesterol absorption (P < 0.001) and raised cholesterol synthesis (P = 0.016) compared with control muesli, and the plant stanols decreased cholesterol absorption compared with beta-glucan muesli (P = 0.004). The combination muesli decreased serum concentrations of sitostanol compared with control muesli (P = 0.010). Plasma concentrations of lipid-soluble antioxidants did not differ after the 3 treatments. beta-Glucan muesli effectively lowered serum LDL cholesterol concentrations. The addition of plant stanol esters to beta-glucan-enriched muesli further lowered serum LDL cholesterol, although effects were slightly less than predicted.
An in vitro assay for (1-->6)-beta-D-glucan synthesis in Saccharomyces cerevisiae.
Vink, E.; Rodriguez-Suarez, R.J.; Gerard-Vincent, M.; Ribas, J.C.; de Nobel, J.G.; van den Ende, H.; Duran, A.; Klis, F.M.; Bussey, H.
2004-01-01
(1 --> 6)-beta-D-glucan is a key cell wall component of Saccharomyces cerevisiae and Candida albicans. Many genes are known to affect the levels or structure of this glucan, but their roles and a molecular description of the synthesis of (1 --> 6)-beta-D-glucan remain to be established and a method
Beta-glucan ameliorates gamma-rays induced oxidative injury in male Swiss albino rats
International Nuclear Information System (INIS)
Salama, S.F.
2011-01-01
1,3-beta-D-Glucan is a natural polysaccharide derived from the cell walls of bakers yeast Saccharomyces cerevsiae with immunoenhancing and potent antioxidant effects. This study investigated the pathways through which beta-glucan gavage treatment (50mg/kg) exerts its effect on radiation-induced oxidative damage in male rats. Beta-glucan was given orally to male rats; 3 hours post gamma-irradiation at dose 5Gy, for 10 and 20 days post-irradiation level were assayed, being remarkable indicators in cell oxidative stress. Results pointed out that irradiation at 5Gy significantly depressed all blood parameters, such as erythrocytes count (RBCs), hemoglobin content (Hb), hematocrit value (Hct), total leucocytes count and absolute lymphocytes and neutrophils counts, blood glutathione (GSH) level and conversely elevated level of serum ascorbyl radical (AsR), product of lipid peroxidation (MDA melanodialdehyde), triglycerides and cholesterol. Total leucocytes count and absolute lymphocytes and neutrophils counts, RBCs, Hb, Hct, blood GSH and serum MDA of irradiated animals receiving beta-glucan administration were exhibited significant differences compared to the irradiated group. Marrow count and the percentage of viability and spleenocytes viability were also significantly decreased. Beta-glucan treatment accelerates recovery of cell damage induced by ionizing irradiation through its potential immune-enhancing activity and free radical scavenging ability that is partially mediated through stimulation of immunohaematological system thus could play a role in regulating irradiation complications
Rosburg, Valerie; Boylston, Terri; White, Pamela
2010-06-01
Probiotics must be consumed at a level of 10(7) CFU/mL for successful colonization of the gut. In yogurts containing beneficial cultures, the survival of probiotic strains can quickly decline below this critical concentration during cold storage. We hypothesized that beta-glucan would increase the viability of bifidobacteria strains in yogurt during cold storage. Yogurts were produced containing 0.44% beta-glucan (concentrated or freeze-dried) extracted from whole oat flour and/or 1.33% modified corn starch, and bifidobacteria (B. breve or B. longum) at a concentration of at least 10(9) CFU/mL. All yogurts were stored at 4 degrees C. Bifidobacteria and yogurt cultures, Streptococcus thermophilus and Lactobacillus delbureckii subsp. bulgaricus, were enumerated from undisturbed aliquots before fermentation, after fermentation, and once a week for 5 wk. S. thermophilus and L. bulgaricus maintained a concentration of at least 10(8) CFU/mL in yogurts containing concentrated or freeze-dried beta-glucan regardless of starch addition, and in the control with no added beta-glucan or starch. Similarly, the probiotic, Bifidobacterium breve, survived above a therapeutic level in all treatments. The addition of beta-glucan prolonged the survival of Bifidobacterium longum at a concentration of at least 10(7) CFU/mL by up to 2 wk on average beyond the control. Further, the inclusion of concentrated beta-glucan in yogurt improved survival of B. longum above 10(7) CFU/mL by 1 wk longer than did freeze-dried beta-glucan. Study results suggest that beta-glucan has a protective effect on bifidobacteria in yogurt when stressed by low-temperature storage.
Kupetz, M; Sacher, B; Becker, T
2016-06-05
Structural polymers such as cereal β-glucan may cause various processing problems in beverage industry depending on concentration, molar size distribution and agglomeration behaviour. In this context, influences of the beer volatiles dodecanoic acid, octyl butanoate, ethyl decanoate and decyl acetate on molar mass and radii of barley β-glucan were investigated in ethanolic (4% w/w) model solution. After addition of 100mg/l ethyl decanoate and decyl acetate to the β-glucan solution, a wider-ranging molar mass distribution could be observed by means of asymmetric field-flow-fractionation. Due to agglomeration, average molar mass of β-glucan standard (MW=6.8×10(6)g/mol) increased by 2×10(6)g/mol (P<0.05) in solution containing decyl acetate. Furthermore, a significant growth (P<0.05) from 86 to 102 nm in gyration radius was measured. The obtained results elucidate the importance of fatty acid derived flavouring substance composition in beer regarding the aggregation behaviour of β-glucan. Copyright © 2016 Elsevier Ltd. All rights reserved.
Metabolic profiling of lymph from pigs fed with ß-glucan by high-resolution 1H NMR spectroscopy
DEFF Research Database (Denmark)
Larsen, Flemming Hofmann; Jørgensen, Henry Johs. Høgh; Engelsen, Søren Balling
2010-01-01
To gain information about the effect of ingesting different β-glucan sources on intestinal lymph metabolic profile, 10 growing pigs (30-36 kg) were fitted with a catheter in the jejunal lymphatic trunk, and lymph samples collected continuously -1 to 8 h postprandial and again at 24 h after feeding...... a diet containing either 0.4% added yeast or barley β-glucan and compared to a Control diet. The lymph samples were analysed by proton nuclear magnetic resonance (1H NMR) spectroscopy and subsequently subjected to chemometric analysis. The dominant resonances in the 1H NMR spectra of lymph arose...... of increased lymph viscosity induced by barley β-glucan compared to yeast β-glucan were observed...
Directory of Open Access Journals (Sweden)
Fatemeh Mokhtari
2018-04-01
Full Text Available Background: The incidence of type 2 diabetes increases with aging, unhealthy diets, obesity and sedentary lifestyles. The aim of this study was to investigate the combinational effect of a 12-week aerobic exercise and barley β-glucan (BBG on blood glucose, body composition and blood pressure in women with type 2 diabetes. Materials and Methods: In this semi-experimental study, 24 women with the mean age of 49 years and a blood glucose level of 110-280 mg/dl were purposefully selected and randomly divided into three groups: a group of aerobic exercise with diet (n=8, b diet group (n=8 c control group (n=8. The diet group consumed one barley bread, containing 4 g of β glucan, each day for 12 weeks. The group of aerobic exercise, who was on diet, participated in a progressive walking program with the intensity of %60-70% of maximal heart rate in addition to diet program (barley bread. Blood glucose, weight, fat percentage, and systolic and diastolic blood pressure levels were measured in pre-and post-training. Results: Results showed a significant decrease in the blood glucose level in the experimental groups compared to the control group, while no major changes were observed in body composition and blood pressure. Conclusion: It seems that the combined program (aerobic training with diet or consumption of β-glucan alone can decrease blood glucose in patients with diabetes.
Energy Technology Data Exchange (ETDEWEB)
Satoh, S; Matsuda, K; Tamari, K
1976-12-01
A small amount of cytoplasmic ..beta..-1,4-glucan, which might be involved in the synthesis of cellulose in the cell wall, was found in the homogenate prepared from the hypocotyls of seedlings of Phaseolus aureus. Upon hydrolysis by cellulase of the 20,000xg pellet from the cytoplasmic fraction of segments incubated in a (/sup 14/C)-glucose solution, (/sup 14/C)-cellobiose was produced, with specific radioactivities 3 to 10 times greater than those of the cellobiose from cellulose in the cell wall at various incubation periods. The incoporation of radioactivity from (/sup 14/C)-glucose into this cytoplasmic ..beta..-1,4-glucan was therefore faster than that into cellulose constituting the cell wall. Hence, it seemed that the former ..beta..-1,4-glucan could be turned over. To examine whether the cytoplasmic ..beta..-1,4-glucan is carried by some subcellular components, cytoplasmic ..beta..-1,4-glucan in the cell was fractionated by differential centrifugation, two enzyme activities being measured as the markers of subcellular components. The distribution of ..beta..-1,4-glucan was similar to that of UDPG-glucosyl-transferase activity but not to that of IDP-ase activity. The result suggests that the cytoplasmic ..beta..-1,4-glucan has some relation to plasma membranes. Coumarin, known as a specific inhibitor for the biosynthesis of cellulose in plant cells, was shown to inhibit the incorporation of radio-carbon from (/sup 14/C)-glucose into cytoplasmic ..beta..-1,4-glucan to the same extent as that into cellulose in the cell wall of the hypocotyls.
Andrade, Eric Francelino; Lima, Andressa Ribeiro Veiga; Nunes, Ingrid Edwiges; Orlando, Débora Ribeiro; Gondim, Paula Novato; Zangeronimo, Márcio Gilberto; Alves, Fernando Henrique Ferrari; Pereira, Luciano José
2016-12-17
Physical activity and the ingestion of dietary fiber are non-drug alternatives commonly used as adjuvants to glycemic control in diabetic individuals. Among these fibers, we can highlight beta-glucans. However, few studies have compared isolated and synergic effects of physical exercise and beta-glucan ingestion, especially in type 2 diabetic rats. Therefore, we evaluated the effects beta-glucan ( Saccharomyces cerevisiae ) consumption, associated or not to exercise, on metabolic parameters of diabetic Wistar rats. The diabetes mellitus (DM) was induced by high-fat diet (HFD) associated with a low dose of streptozotocin (STZ-35 mg/kg). Trained groups were submitted to eight weeks of exercise in aquatic environment. In the last 28 days of experiment, animals received 30 mg/kg/day of beta-glucan by gavage. Isolated use of beta-glucan decreased glucose levels in fasting, Glycated hemoglobin (HbA1c), triglycerides (TAG), total cholesterol (TC), low-density lipoprotein (LDL-C), the atherogenic index of plasma. Exercise alone also decreased blood glucose levels, HbA1c, and renal lesions. An additive effect for reducing the atherogenic index of plasma and renal lesions was observed when both treatments were combined. It was concluded that both beta-glucan and exercise improved metabolic parameters in type 2 (HFD/STZ) diabetic rats.
Combined effects of added beta glucan and black tea in breads on starch functionality.
Jalil, Abbe Maleyki M; Edwards, Christine A; Combet, Emilie; Ibrahim, Muhammad; Garcia, Ada L
2015-03-01
Bread and tea are usually consumed separately, but there may be different food-matrix interactions and changes in starch characteristics when they are combined in bread. This study developed breads (white bread, WF; black tea, BT; beta glucan, βG; beta glucan plus black tea, βGBT) and determined their starch functionalities. Breads were developed using a standard baking recipe and determined their starch characteristics. There was no significant difference in starch hydrolysis between BT and WF but βGBT reduced early (10 min) starch hydrolysis compared with βG. The starch granules in βG and βGBT were elliptical and closely packed together. These results suggest that the addition of beta glucan and black tea to bread preserved the elliptical starch granules and lowered short-term starch hydrolysis.
Zevenhuizen, L P; van Veldhuizen, A; Fokkens, R H
1990-04-01
Gel-filtration and thin layer chromatography of low molecular weight carbohydrates from culture filtrates of Agrobacterium radiobacter, Isolate II, have shown, that next to the neutral beta-1,2-glucan fraction a major acidic fraction was present which was found to be glycerophosphorylated cyclic beta-1,2-glucans. Re-examination of cyclic beta-1,2-glucan preparations which had been obtained by extraction of Rhizobium cells with hot phenol-water also showed these acidic modified beta-1,2-glucans to be present. Cyclic beta-1,2-glucans from R. leguminosarum (9 strains) and of R. phaseoli (1 strain) had ring size distribution with degrees of polymerisation (DPs) of 19 and 20 as major ring sizes of which a minor part was glycerophosphorylated; beta-1,2-glucans of R. trifolii (3 strains) had ring sizes with DPs measuring 19-22 as prominent components which were largely unsubstituted, and R. meliloti (7 strains) had beta-1,2-glucans with ring size distributions extending to still higher DPs of 19-25 of which the major part appeared to be glycerophosphorylated.
Volman, Julia J.; Mensink, Ronald P.; Ramakers, Julian D.; de Winther, Menno P.; Carlsen, Harald; Blomhoff, Rune; Buurman, Wim A.; Plat, Jogchum
2010-01-01
Dietary components, like beta-glucans, can modulate the intestinal immune response. We previously showed that fecal water enriched with oat beta-glucan stimulated the cytokine-induced immune response of enterocytes. It is, however, unclear whether beta-glucans activate nuclear factor-kappaB
Antitumour and immunological activity of a beta 1----3/1----6 glucan from Glomerella cingulata.
Gomaa, K; Kraus, J; Rosskopf, F; Röper, H; Franz, G
1992-01-01
The in vivo antitumour activity of a beta 1----3/1----6 glucan from the fungus Glomerella cingulata was investigated in vivo. The glucan exhibited a strong inhibition of tumour growth of the allogeneic Sarcoma-180 as well as the syngeneic DBA/2-MC.SC-1 fibrosarcoma with inhibition ratios up to 100%. Against the hormone sensitive Noble-Nb-R prostate carcinoma the glucan alone showed a moderate antitumour effect, whereas in combination with diethylstilbestrol an almost complete regression of the tumour could be achieved. It could be demonstrated that a highly ordered structure of the glucan is not essential for the antitumour activity. Since the glucan expressed no direct cytotoxic effects, the immunomodulating activity was investigated in vitro in order to get an indication for a possible mode of action. In the lymphocyte transformation assay the glucan at a dose of 100 micrograms/ml caused a fourfold increase in the proliferation of murine spleen lymphocytes. Moreover, the glucan stimulated the phagocytosis of zymosan by bone marrow macrophages up to 100%. However, the glucan was not able to render macrophages cytotoxic against P-815 mastocytoma cells.
DEFF Research Database (Denmark)
Vester-Christensen, Malene Bech; Abou Hachem, Maher; Næsted, Henrik
2010-01-01
biosynthesis by trimming of intermediate branched alpha-glucan structures. Highly active barley LD is obtained by secretory expression during high cell-density fermentation of Pichia pastoris. The LD encoding gene fragment without signal peptide was subcloned in-frame with the Saccharomyces cerevisiae alpha...
Yang, Xufei; Wang, Xinlei; Zhang, Yuanhui; Lee, Jongmin; Su, Jingwei; Gates, Richard S
2013-10-01
Mitigation of bioaerosol emissions from concentrated animal feeding operations (CAFOs) demands knowledge of bioaerosol concentrations feeding into an end-of-pipe air treatment process. The aim of this preliminary study was to measure total endotoxin and (1 --> 3)-beta-glucan concentrations at the air exhaust of 18 commercial CAFOs and to examine their variability with animal operation type (swine farrowing, swine gestation, swine weaning, swine finishing, manure belt laying hen, and tom turkey) and season (cold, mild, and hot). The measured airborne concentrations of total endotoxin ranged from 98 to 23,157 endotoxin units (EU)/m3, and the airborne concentrations of total (1 --> 3)-beta-D-glucan ranged from 2.4 to 537.9 ng/m3. Animal operation type in this study had a significant effect on airborne concentrations of total endotoxin and (1 --> 3)-beta-D-glucan but no significant effect on their concentrations in total suspended particulate (TSP). Both endotoxin and (1 --> 3)-beta-D-glucan attained their highest airborne concentrations in visited tom turkey buildings. Comparatively, season had no significant effect on airborne concentrations of total endotoxin or (1 --> 3)-beta-D-glucan. Endotoxin and (1 --> 3)-beta-glucan concentrations in TSP dust appeared to increase as the weather became warmer, and this seasonal effect was significant in swine buildings. Elevated indoor temperatures in the hot season were considered to facilitate the growth and propagation of bacteria and fungi, thus leading to higher biocomponent concentrations in TSP.
Wu, Yu-Sheng; Liau, Shu-Yu; Huang, Cheng-Ting; Nan, Fan-Hua
2016-10-01
This study mainly evaluated the effects of orally administered beta 1,3/1,6-glucan and vitamin C on the nonspecific immune responses of white shrimp (Litopenaeus vannamei). In this study, we found that the white shrimp oral administration with 1 g/kg of beta 1,3/1,6-glucan effectively enhanced O2(-) production and phenoloxidase and superoxide dismutase activity. Shrimp were oral administration with 0.2 g/kg of vitamin C presented beneficial nonspecific immune responses and enzyme activity and also observed in the beta 1,3/1,6-glucan treatment groups. Consequently, we compared the alterations in the immune activity between the beta 1,3/1,6-glucan and vitamin C groups and the evidence illustrated that combination of beta 1,3/1,6-glucan and vitamin C presented an additive effect on inducing the nonspecific immune responses of white shrimp. Copyright © 2016 Elsevier Ltd. All rights reserved.
Exposure to biohazards in wood dust: bacteria, fungi, endotoxins, and (1-->3)-beta-D-glucans.
Alwis, K U; Mandryk, J; Hocking, A D
1999-09-01
Personal exposure to fungi, bacteria, endotoxin, and (1-->3)-beta-D-glucan was determined at different woodworking sites--logging sites, sawmills, woodchipping sites, and joineries. Exposure levels to fungi at logging sites and sawmills were in the range of 10(3)-10(4) cfu/m3, at the woodchipping mill, 10(3)-10(5) cfu/m3, and at joineries, 10(2)-10(4) cfu/m3. Although mean endotoxin levels were lower than the suggested threshold value of 20 ng/m3, some personal exposures at sawmills and a joinery exceeded the standard. The geometric mean personal (1-->3)-beta-D-glucan exposure level at the woodchipping mill was 2.32 ng/m3, at sawmills, 1.37 ng/m3, at logging sites, 2.02 ng/m3, and at joineries, 0.43 ng/m3. Highly significant associations were found between mean personal inhalable endotoxin exposures and Gram-negative bacteria levels (p 3)-beta-D-glucan exposures and fungi levels (p = 0.0003). The prevalence of cough, phlegm, chronic bronchitis, nasal symptoms, frequent headaches, and eye and throat irritations was significantly higher among woodworkers than controls. Dose-response relationships were found between personal exposures and work-related symptoms among joinery workers and sawmill and chip mill workers.
Rosch, Christiane; Taverne, Nico; Venema, Koen; Gruppen, Harry; Wells, Jerry M.; Schols, Henk A.
2017-01-01
Scope: This study simulates the fermentation process of barley β-glucan and sugar beet pectin in the human colon and monitors the degradation products formed. Additionally, immune effects of the degradation products were investigated. Methods and results: Immunostimulatory activity of
DEFF Research Database (Denmark)
Jacobsen, Susanne; Søndergaard, Ib; Møller, Birthe
2005-01-01
Analysis (PCA). Riso mutants R-13, R-29 high (I -> 3, 1 -> 4)-beta-glucan, low starch and R-1508 (high lysine, reduced starch), near isogeneic controls and normal lines and recombinants were studied. Based on proteome analysis results, six antimicrobial proteins were followed during endosperm development...... revealing pleiotropic gene effects in expression timing that supporting the gene classification. To verify that NIR spectroscopy data represents a physio-chemical fingerprint of the barley seed, physical and chemical spectral components were partially separated by Multiple Scatter Correction...... and their genetic classification ability verified. Wavelength bands with known water binding and (I -> 3, 1 -> 4)-beta-glucan assignments were successfully predicted by partial least squares regression giving insight into how NIR-data works in classification. Highly reproducible gene-specific, covariate...
Directory of Open Access Journals (Sweden)
Gordon D Ross
2007-06-01
Full Text Available Beta (1-3-D-glucans were identified almost 40 years ago as biological response modifiers that stimulated tumor rejection. In vitro studies have shown that beta-glucans bind to a lectin domain within complement receptor type 3 (CR3, or to, more recently described dectin-1 a beta-glucan specific receptor, acting mainly on phagocytic cells. In this study, we assessed the intracellular cytokine profiles of peripheral blood lymphocytes from mice bearing mammary tumors receiving i.v. anti-tumor mAbs combined or not with whole glucan particle suspension given orally (WGP, 400 microg every 24 hours. The proportions of T cells producing IL-4 and IFNgamma were determined by flow cytometry. The proportion of T cells producing IL-4 was significantly higher in tumor-bearing mice not receiving beta-glucan-enhanced therapy. Conversely, T cells from mice undergoing beta-glucan-enhanced therapy showed increased production of the Th1 cytokine IFNgamma. The switch from a Th2 to a Th1 response after WGP therapy was possibly mediated by intestinal mucosal macrophages releasing IL-12.
A feeding trial was performed to screen three barley genotypes containing different levels of '-glucan for their ability to influence growth, immune function, and disease resistance of rainbow trout. Three experimental diets were prepared by substituting each of three barely genotypes containing dif...
Singh, Surinder; Tripathi, Rajiv K; Lemaux, Peggy G; Buchanan, Bob B; Singh, Jaswinder
2017-07-18
Barley is the cornerstone of the malting and brewing industry. It is known that 250 quantitative trait loci (QTLs) of the grain are associated with 19 malting-quality phenotypes. However, only a few of the contributing genetic components have been identified. One of these, on chromosome 4H, contains a major malting QTL, QTL2, located near the telomeric region that accounts, respectively, for 28.9% and 37.6% of the variation in the β-glucan and extract fractions of malt. In the current study, we dissected the QTL2 region using an expression- and microsynteny-based approach. From a set of 22 expressed sequence tags expressed in seeds at the malting stage, we identified a candidate gene, TLP8 ( thaumatin-like protein 8 ), which was differentially expressed and influenced malting quality. Transcript abundance and protein profiles of TLP8 were studied in different malt and feed varieties using quantitative PCR, immunoblotting, and enzyme-linked immunosorbent assay (ELISA). The experiments demonstrated that TLP8 binds to insoluble (1, 3, 1, 4)-β-D glucan in grain extracts, thereby facilitating the removal of this undesirable polysaccharide during malting. Further, the binding of TLP8 to β-glucan was dependent on redox. These findings represent a stride forward in our understanding of the malting process and provide a foundation for future improvements in the final beer-making process.
BIOCHEMICAL COMPOSITION AND NUTRITIONAL EVALUATION OF BARLEY RIHANE (HORDEUM VULGARE L.).
Lahouar, Lamia; Ghrairi, Fatma; El Arem, Amira; Medimagh, Sana; El Felah, Mouledi; Salem, Hichem Ben; Achour, Lotfi
2017-01-01
Many experimental studies have suggested an important role for barley Rihane(BR)in the prevention of colon cancer and cardiovascular diseases. The objective of this study was to evaluate the physico-chemical properties and nutritional characterizations of BR compared to other varieties grown in Tunisia (Manel, Roho and Tej). Total, insoluble and soluble dietary fiber(β-glucan), total protein, ash and some minerals of BR and Tunisian barley varieties were determined. The results revealed that BR is good source of dietary fiber mainly β-glucan compared to the other varieties. This variety is a relatively rich source of phosphorous and potassium and it contains many important unsaturated fatty acids. BR has higher nutritional value than other varieties. Barley Rihane has significant nutritional characterizations compared to others Tunisian barleys varieties. Abbreviations: BR, Barley Rihane; LDL, low density lipoprotein; HDL, high density lipoprotein; AOM, azoxymethane; TBV, Tunisian barley varieties; TGW, thousand grain weight; SW, weight specific; TDF, total dietary fiber; IDF, insoluble dietary fiber; SDF, soluble dietary fiber; DM, Dry Matter.
Structural investigations of glucans from cultures of Glomerella cingulata Spaulding & von Schrenck.
Gomaa, K; Kraus, J; Franz, G; Röper, H
1991-09-18
Methylation analysis, enzymic digestion, n.m.r. spectroscopy, and Smith degradation showed that the major extracellular polysaccharide, isolated from cultures of the fungus Glomerella cingulata, was a (1----3)-beta-D-glucan with side chains of 1-4 (1----3)-linked beta-D-glucose residues attached to position 6. A (1----6)-beta-D-glucan was produced by the fungus in small proportions. Treatment of the (1----3,1----6)-beta-D-glucan (890,315) with greater than 0.05M NaOH at greater than 150 degrees, or Me2SO-H2O with a concentration of dimethyl sulfoxide of greater than 80%, irreversibly destroyed the highly ordered structure responsible for the high viscosity of aqueous solutions. The strong shift of the lambda max of aqueous solutions of Congo Red by the degraded glucan, the fact that the mol. wt. of the original glucan was approximately 4 times higher than that of the degraded polymer, and the suppression of the n.m.r. signals for C-3 indicated that the original glucan had a highly ordered structure, probably built up from single helices.
Energy Technology Data Exchange (ETDEWEB)
Nicholas C Carpita
2009-04-20
Five specific objectives of this project are to develop strategies to identify the genes that encode the catalytic components of "mixed-linkage" (1→3),(1→4)-beta-D-glucans in grasses, to determine the protein components of the synthase complex, and determine the biochemical mechanism of synthesis. We have used proteomic approaches to define intrinsic and extrinsic polypeptides of Golgi membranes that are associated with polysaccharide synthesis and trafficking. We were successful in producing recombinant catalytic domains of cellulose synthase genes and discovered that they dimerize upon concentration, indicating that two CesA proteins form the catalytic unit. We characterized a brittle stalk2 mutant as a defect in a COBRA-like protein that results in compromised lignin-cellulose interactions that decrease tissue flexibility. We used virus-induced gene silencing of barley cell wall polysaccharide synthesis by BSMV in an attempt to silence specific members of the cellulose synthase-like gene family. However, we unexpectedly found that regardless of the specificity of the target gene, whole gene interaction networks were silenced. We discovered the cause to be an antisense transcript of the cellulose synthase gene initiated small interfering RNAs that spread silencing to related genes.
Abdel-Haleem, Amal M H; Awad, R A
2015-10-01
The purpose of this paper is to investigate some quality attributes of low fat ice cream (LFIC) substituted with hulless barley flour (HBF) and barley ß-glucan (BBG). The methodology included in this paper is based on adding HBF (1, 2, 3 and 4 %) as a partial substitution of skim milk powder (SMP) and BBG (0.40 %) as a complete substitution of carboxy methyl cellulose (CMC). All mixes and resultant ice cream samples were evaluated for their physicochemical properties as well as the sensory quality attributes.The results indicated that substitution of SMP with HBF significantly increased total solids (TS), fat and crude fiber, while crude protein and ash significantly decreased in ice cream mixes. BBG exhibited the same manner of control. Specific gravity was gradually increased with adding HBFand BBG in the mixes and therefore the overrun percent was significantly changed in the resultant ice cream. Adding HBF in ice cream formula led to significant decrease in acidity with higher freezing point and the product showed higher ability to meltdown. BBG treatment showed the same trend of control. Values of flow time and viscosity significantly increased with increasing HBF in the ice cream mixes, but these values significantly decreased in BBG mix. The time required to freeze ice cream mixes was decreased with increasing the ratio of HBF but, increased in BBG treatment. The substitution of SMP with 1 and 2 % HBF significantly (P ≤ 0.05) enhanced sensory attributes of ice cream samples. While, BBG treatment achieved mild score and acceptability.
DEFF Research Database (Denmark)
Mikkelsen, Mette S.; Meier, Sebastian; Jensen, Morten G.
2017-01-01
-glucan/l, providing European Food Safety Authority (EFSA) and U.S. Food and Drug Administration (FDA) recommended amounts (3 g β-glucan/day) from three portions. TAF extracts of Lys5f and KVL408 grains reached extraordinary high concentrations of 8- 9 g β-glucan/l. The β-glucan molecular mass decreased with enzyme...... robustness in Lys5f and KVL408 raw materials favor these in a β-glucan rich extract with potential for EFSA and FDA health and Nutrition claims....
Czech Academy of Sciences Publication Activity Database
Cseh, A.; Kruppa, K.; Molnár, I.; Rakszegi, M.; Doležel, Jaroslav; Molnár-Láng, M.
2011-01-01
Roč. 54, č. 10 (2011), s. 795-804 ISSN 0831-2796 Institutional research plan: CEZ:AV0Z50380511 Keywords : wheat–barley chromosome translocation * β-d-glucan * centromere Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 1.653, year: 2011
Directory of Open Access Journals (Sweden)
Roberta M. de SÁ
2000-04-01
Full Text Available Com o crescente interesse em alimentos funcionais e nutracêuticos, a aveia (Avena sativa L. tem se destacado, devido ao seu teor de fibras alimentares e principalmente às beta-glucanas. As (1,3(1,4-beta-D-glucanas, fibras alimentares na maioria solúveis, atuam na redução do colesterol em indivíduos com hipercolesterolemia. Existem estudos para determinar as causas de variação do teor desta fibra em aveia, porém, pouco se sabe sobre a aveia cultivada no Brasil. O objetivo deste trabalho foi verificar se existem diferenças no conteúdo de beta-glucanas entre cultivares brasileiros e se há variação na porcentagem desta fibra devido ao ano de cultivo. Os cultivares IAC7, UFRGS14, UPF16 e UPF17 (3 amostras de cada, e ainda três amostras do cultivar IAC7 para cada ano de cultivo (97 e 98, foram analisados segundo os métodos da AACC (American Association of Cereal Chemists. Os teores médios (peso seco de beta-glucanas foram 6,50% (IAC7, 4,30% (UFRGS14, 3,51% (UPF16 e 3,78% (UPF17, com erro padrão de ±0,084 e coeficiente de variação de 7,89 %. Observou-se efeito significativo dos cultivares (p=0,03 e grande variabilidade entre as amostras (p=0,0001. O cultivar IAC7 apresentou média de beta-glucanas de 5,11% em 97 e 6,50 % em 98 (erro padrão ±0,14; CV=10,53% e observou-se efeito significativo do ano de cultivo.With the increasing interest in functional foods and nutraceuticals, oats (Avena sativa L. have received special attention because of their dietary fiber contents, and specially of their beta-glucans. The mostly soluble dietary fibers (1,3(1,4-beta-D-glucans, reduce serum cholesterol in individuals with hypercholesterolemia. There are studies about the causes of variation in the contents of this fiber in oats, however, very little is known about Brazilian cultivars. The objective of this work was to verify if there were differences in the beta-glucan contents among brazilian cultivars and if there was variation in the
Production of ethanol from winter barley by the EDGE (enhanced dry grind enzymatic process
Directory of Open Access Journals (Sweden)
Kurantz M
2010-04-01
Full Text Available Abstract Background US legislation requires the use of advanced biofuels to be made from non-food feedstocks. However, commercialization of lignocellulosic ethanol technology is more complex than expected and is therefore running behind schedule. This is creating a demand for non-food, but more easily converted, starch-based feedstocks other than corn that can fill the gap until the second generation technologies are commercially viable. Winter barley is such a feedstock but its mash has very high viscosity due to its high content of β-glucans. This fact, along with a lower starch content than corn, makes ethanol production at the commercial scale a real challenge. Results A new fermentation process for ethanol production from Thoroughbred, a winter barley variety with a high starch content, was developed. The new process was designated the EDGE (enhanced dry grind enzymatic process. In this process, in addition to the normal starch-converting enzymes, two accessory enzymes were used to solve the β-glucan problem. First, β-glucanases were used to hydrolyze the β-glucans to oligomeric fractions, thus significantly reducing the viscosity to allow good mixing for the distribution of the yeast and nutrients. Next, β-glucosidase was used to complete the β-glucan hydrolysis and to generate glucose, which was subsequently fermented in order to produce additional ethanol. While β-glucanases have been previously used to improve barley ethanol production by lowering viscosity, this is the first full report on the benefits of adding β-glucosidases to increase the ethanol yield. Conclusions In the EDGE process, 30% of total dry solids could be used to produce 15% v/v ethanol. Under optimum conditions an ethanol yield of 402 L/MT (dry basis or 2.17 gallons/53 lb bushel of barley with 15% moisture was achieved. The distillers dried grains with solubles (DDGS co-product had extremely low β-glucan (below 0.2% making it suitable for use in both ruminant
Kumari, J; Sahoo, P K
2006-02-01
This study investigated the effects of short and prolonged administration of a yeast beta-glucan on non-specific immune parameters, growth rate and the disease resistance of Asian catfish, Clarias batrachus. Fish fed with a basal diet (control) and test diet (basal diet supplemented with 0.1% glucan) for 1, 2 and 3 weeks were assayed for superoxide production, serum myeloperoxidase (MPO) content, natural haemagglutinin level, complement and lysozyme activities. Fish were weighed at weekly intervals and specific growth rate (SGR, % increase in body weight per day) was determined. After each week, fish were challenged with Aeromonas hydrophila to measure the level of protection. Results showed that glucan administration at 0.1% in feed, significantly (Pcomplement activity and SGR were not affected by the dietary supplementation of yeast glucan. As glucan feeding at 0.1% for 1 week is able to enhance the non-specific immunity and disease resistance of catfish efficiently, short-term feeding might be used in farmed catfish diets to enhance disease resistance.
Kuzmanoff, K. M.
1984-01-01
In plants, gravity stimulates differential growth in the upper and lower halves of horizontally oriented organs. Auxin regulation of cell wall loosening and elongation is the basis for most models of this phenomenon. Auxin treatment of pea stem tissue rapidly increases the activity of Golgi-localized Beta-1,4-glucan synthase, an enzyme involved in biosynthesis of wall xyloglucan which apparently constitutes the substrate for the wall loosening process. The primary objective is to determine if auxin induces de novo formation of Golgi glucan synthase and increases the level of this glucan synthase mRNA. This shall be accomplished by (a) preparation of a monoclonal antibody to the synthase, (b) isolation, and characterization of the glucan synthase, and (c) examination for cross reactivity between the antibody and translation products of auxin induced mRNAs in pea tissue. The antibody will also be used to localize the glucan synthase in upper and lower halves of pea stem tissue before, during and after the response to gravity.
Directory of Open Access Journals (Sweden)
KUSMIATI
2007-04-01
Full Text Available Production of β-glucan by Agrobacterium sp is influenced by the composition of nutrition in the fermentation media. Molases has been used successfully by others in the fermentation media of S. cerevisiae to increase the yield of -glucan, and similarly, uracil has been used in the fermentation media of Agrobacterium sp to increase the yield of -glucan. Investigations to increase the yield of -glucan by two strains of Agrobacterium sp, i.e. A1.5 (reference and B4.4 (local strain, have been carried out by addition of various combination of molases and uracil into fermentation media, i.e. 5%(v/v molase-0,05%(b/v uracil; 5% molase-0,025% uracil; 10% molase-0,05% uracil; and 10% molase-0,025% uracil. The β-1,3-glucan and β-1,2-glucan fractions were separated by extraction method. Beta-glucan concentration was determined as the glucose monomer using the phenol-sulphate spectrophotometric method at 490 nm. The protein content was determined by a modified Lowry-spectrophotometric method at 750 nm. The results showed that all combination of molases and uracil in the fermentation media of Agrobacterium sp A1.5 and B4.4 strains have increased both the dry-weight yield of β-glucan (crude and the β¬glucan content, with the highest was in a medium containing 10% molases-0,025% uracil combination. In the above medium, the A1.5 strain produced the highest β-glucan (7,5% with the lowest protein content ( 8,4% in the β-1,3-glucan fraction, while the β-glucan content in the β-1,2-glucan fraction were all lower than in the control media, while the protein content were all higher than in the control media. In the above media, the B4.4 strain produced the highest β-glucan, 7,2% in the β-1,3-glucan fraction, and 13,1% in β-1,2-glucan fraction, while the lowest protein content ( 8,4% was in the β-1,3-glucan fraction. In conclusion, fermentation media of Agrobacterium sp A1.5 strain or B4.4 strain containing molase and uracil combination have increased both
Water uptake in barley grain: Physiology; genetics and industrial applications.
Cu, Suong; Collins, Helen M; Betts, Natalie S; March, Timothy J; Janusz, Agnieszka; Stewart, Doug C; Skadhauge, Birgitte; Eglinton, Jason; Kyriacou, Bianca; Little, Alan; Burton, Rachel A; Fincher, Geoffrey B
2016-01-01
Water uptake by mature barley grains initiates germination and is the first stage in the malting process. Here we have investigated the effects of starchy endosperm cell wall thickness on water uptake, together with the effects of varying amounts of the wall polysaccharide, (1,3;1,4)-β-glucan. In the latter case, we examined mutant barley lines from a mutant library and transgenic barley lines in which the (1,3;1,4)-β-glucan synthase gene, HvCslF6, was down-regulated by RNA interference. Neither cell wall thickness nor the levels of grain (1,3;1,4)-β-glucan were significantly correlated with water uptake but are likely to influence modification during malting. However, when a barley mapping population was phenotyped for rate of water uptake into grain, quantitative trait locus (QTL) analysis identified specific regions of chromosomes 4H, 5H and 7H that accounted for approximately 17%, 18% and 11%, respectively, of the phenotypic variation. These data indicate that variation in water uptake rates by elite malting cultivars of barley is genetically controlled and a number of candidate genes that might control the trait were identified under the QTL. The genomics data raise the possibility that the genetic variation in water uptake rates might be exploited by breeders for the benefit of the malting and brewing industries. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.
Tosh, S M
2013-04-01
Oat and barley foods have been shown to reduce human glycaemic response, compared to similar wheat foods or a glucose control. The strength of the evidence supporting the hypothesis that the soluble fibre, mixed linkage β-glucan, reduces glycaemic response was evaluated. A search of the literature was conducted to find clinical trials with acute glycaemic response as an end point using oat or barley products. Of the 76 human studies identified, 34 met the inclusion and exclusion criteria. Dose response and ratio of β-glucan to available carbohydrate as predictors of glycaemic response were assessed. Meals provided 0.3-12.1 g oat or barley β-glucan, and reduced glycaemic response by an average of 48 ± 33 mmol · min/l compared to a suitable control. Regression analysis on 119 treatments indicated that change in glycaemic response (expressed as incremental area under the post-prandial blood-glucose curve) was greater for intact grains than for processed foods. For processed foods, glycaemic response was more strongly related to the β-glucan dose alone (r(2)=0.48, Pfoods containing 4 g of β-glucan, the linear model predicted a decrease in glycaemic response of 27 ± 3 mmol · min/l, and 76% of treatments significantly reduced glycaemic response. Thus, intact grains as well as a variety of processed oat and barley foods containing at least 4 g of β-glucan and 30-80 g available carbohydrate can significantly reduce post-prandial blood glucose.
Preparation, characterization, and biological properties of β-glucans
Directory of Open Access Journals (Sweden)
Sandeep Rahar
2011-01-01
Full Text Available β-Glucans are soluble fibers with physiological functions, such as, interference with absorption of sugars and reduction of serum lipid levels. β-glucans are found in different species, such as, Rhynchelytrum repens, Lentinus edodes, Grifola frondosa, Tremella mesenterica, Tremella aurantia, Zea may, Agaricus blazei, Phellinus baummi, Saccharomyces cerevisae (yeast, and Agaricus blazei murell (mushroom. Analysis of the fractions reveals the presence of arabinose, glucose, xylose, and traces of rhamnose and galactose. The presence of β-glucan in these fractions is confirmed by hydrolyzing the polymers with endo-β-glucanase from Bacillus subtilis, followed by high-performance liquid chromatography (HPLC analysis of the characteristic oligosaccharides produced. The 4 M KOH fractions from different tissues are subjected to gel permeation chromatography on Sepharose 4B, with separation of polysaccharides, with different degrees of polymerization, the highest molecular mass (above 2000 kDa being found in young leaves. The molecular mass of the leaf blade polymers is similar (250 kDa to that of the maize coleoptiles β-glucan used for comparison. The 4 M KOH fraction injected into rats with streptozotocin-induced diabetes has shown hypoglycemic activity, reducing blood sugar to normal levels for approximately 24 hours. This performance is better than that obtained with pure β-glucan from barley, which decreases blood sugar levels for about four hours. These results suggest that the activity of β-glucans is responsible for the use of this plant extract as a hypoglycemic drug in folk medicine.
Breeding cultivars of barley and mustard containing biochemical mutants
Energy Technology Data Exchange (ETDEWEB)
Oram, R N [Division of Plant industry, CSIRO, Canberra (Australia)
1990-01-01
Full text: The inactivation of dominant and co-dominant alleles is becoming increasingly important in changing the composition of seed carbohydrates, protein, oil, fibre and secondary products to suit modern food and feed technologies. In barley, breeding lines adapted to south-eastern Australian conditions have been developed containing a waxy endosperm from the Japanese variety 'Sumire Mochi', the high lysine gene lys from cv. 'Hiproly' of Ethiopia, and the induced high lysine mutant gene lys 3a from 'Risoe 1508'. The improved mutant lines yield 12-34% less than the highest yielding feed barley. The lys and lys 3a alleles suppress the formation of prolamins, the waxy allele inhibits the formation of amylose. It seems difficult to modify the background genotype to fully compensate for the reduction of major storage carbohydrate or protein compounds. However, waxy barleys have uses in some human foods and a premium can be paid to producers. The grain of the provisionally-patented waxy cultivar Wasiro is suitable for pearling. It contains 5% {beta}-glucan (soluble fibre) and therefore should be as effective as oat bran for reducing blood cholesterol. In Indian mustard (Brassica juncea), three cultivars differing in date of maturity, each containing the spontaneous mutant alleles for low erucic acid levels in the seed oil, have been developed to produce a high quality, mildly flavoured cooking/salad oil. The concentration of glucosinolates in the seed meal must be reduced to make it palatable and non-toxic to pigs and poultry. Three B. juncea lines were treated in up to four successive generations with gamma rays or EMS. 60,000 seed samples were analysed in subsequent generations. Two induced mutants with reduced glucosinolate concentrations are now available besides 4 naturally-occurring sources with only little reduced yields. Recombination may give a high-yielding low erucic acid and low glucosinolate variety of B. juncea. (author)
Tessari, Paolo; Lante, Anna
2017-03-17
Functional foods may be useful for people with diabetes. The soluble fibers beta glucans can modify starch digestion and improve postprandial glucose response. We analyzed the metabolic effects of a specifically designed 'functional' bread, low in starch, rich in fibers (7 g/100 g), with a beta glucan/starch ratio of (7.6:100, g/g), in people with type 2 diabetes mellitus. Methods : Clinical and metabolic data from two groups of age-, sex- and glycated hemoglobin-matched diabetic subjects, taking either the functional bread or regular white bread, over a roughly six-month observation period, were retrieved. Bread intake did not change during the trial. The functional bread reduced glycated hemoglobin by ~0.5% (absolute units) vs. pre-treatment values ( p = 0.028), and by ~0.6% vs. the control group ( p = 0.027). Post-prandial and mean plasma glucose was decreased in the treatment group too. Body weight, blood pressure and plasma lipids did not change. The acceptance of the functional bread was good in the majority of subjects, except for taste. A starch-restricted, fiber-rich functional bread, with an increased beta glucan/starch ratio, improved long term metabolic control, and may be indicated in the dietary treatment of type 2 diabetes.
Tessari, Paolo; Lante, Anna
2017-01-01
Design: Functional foods may be useful for people with diabetes. The soluble fibers beta glucans can modify starch digestion and improve postprandial glucose response. We analyzed the metabolic effects of a specifically designed ‘functional’ bread, low in starch, rich in fibers (7 g/100 g), with a beta glucan/starch ratio of (7.6:100, g/g), in people with type 2 diabetes mellitus. Methods: Clinical and metabolic data from two groups of age-, sex- and glycated hemoglobin-matched diabetic subjects, taking either the functional bread or regular white bread, over a roughly six-month observation period, were retrieved. Results: Bread intake did not change during the trial. The functional bread reduced glycated hemoglobin by ~0.5% (absolute units) vs. pre-treatment values (p = 0.028), and by ~0.6% vs. the control group (p = 0.027). Post-prandial and mean plasma glucose was decreased in the treatment group too. Body weight, blood pressure and plasma lipids did not change. The acceptance of the functional bread was good in the majority of subjects, except for taste. Conclusions: A starch-restricted, fiber-rich functional bread, with an increased beta glucan/starch ratio, improved long term metabolic control, and may be indicated in the dietary treatment of type 2 diabetes. PMID:28304350
Tischer, C.; Gehring, U.; Chen, C-M; Kerkhof, M.; Koppelman, G.; Sausenthaler, S.; Herbarth, O.; Schaaf, B.; Lehmann, I.; Kraemer, U.; Berdel, D.; von Berg, A.; Bauer, C. P.; Koletzko, S.; Wichmann, H-E; Brunekreef, B.; Heinrich, J.
For a long time, exposure to mould and dampness-derived microbial components was considered a risk factor for the development of respiratory diseases and symptoms. Some recent studies suggested that early childhood exposure to mould components, such as (1,3)-beta-D-glucan and extracellular
Badiee, Parisa; Alborzi, Abdolvahab; Karimi, Mahammad; Pourabbas, Bahman; Haddadi, Pedram; Mardaneh, Jalal; Moieni, Mahsa
2012-04-13
Limited specific data and investigations are available for invasive aspergillosis (IA) in pediatric patients. We evaluated the diagnostic potential of three noninvasive tests including the Platelia Aspergillus EIA kit for using galactomannan antigen, (1,3)-β-D-glucan Detection Reagent Kit, and nested-PCR for Aspergillus DNA in sera. We evaluated the diagnostic potential of three noninvasive tests including EIA for galactomannan antigen (Platelia Aspergillus), nested PCR assay for Aspergillus DNA and test for (1→3)-β-D-glucan (Glucatell assay Kit). All pediatric patients treated at the hematology/oncology unit who were at increased risk of developing invasive aspergillosis were enrolled. Clinical samples were examined for Aspergillus infections by mycological methods. Serial blood samples were collected twice weekly and evaluated by noninvasive tests. We analyzed 230 consecutive blood samples from 62 pediatric patients. The incidence rate of invasive aspergillosis in the patients was found to be 27.4%, and the etiologic agents were Aspergillus flavus, Aspergillus fumigatus, and Aspergillus spp. The sensitivity, specificity, positive and negative predictive values, and likelihood ratios for positive and negative results of galactomannan in patients with proven and probable IA were 90%, 92%, 81.8%, 96%, 11.25, and 0.1; for beta-D-glucan they were 50%, 46%, 26%, 70.6%, 0.9, 0.9; and for nested-PCR they were 80%, 96.2%, 88.9%, 92.6%, 21, and 0.2, respectively. The conventional methods are not able to detect IA, due to the lack of valid and proper sampling. Galactomannan and nested-PCR tests in serum, with enough accuracy and reliability, can serve as noninvasive methods for the detection of IA in pediatric patients. However, the beta-D-glucan test cannot serve as an efficient diagnostic tool in those with hematologic disorders.
Kim, Hyunsook; Turowski, Maciej; Anderson, W H Kerr; Young, Scott A; Kim, Yookyung; Yokoyama, Wallace
2011-07-27
We investigated in Syrian Golden hamsters the biological impact and its underlying mechanism of single whole grain breads supplemented with 2-3% hydroxypropyl methylcellulose (HPMC), a semisynthetic viscous soluble dietary fiber (SDF) as a substitute for gluten. Hamsters were fed high-fat diets supplemented with 48-65% (w/w) differently ground, freeze-dried single grain breads including whole grain wheat, barley, barley supplemented with HPMC, debranned oat, and oat supplemented with HPMC which were compared to a diet containing microcrystalline cellulose (control). All single grain breads significantly lowered plasma LDL-cholesterol concentrations compared to the control. Enrichment with HPMC further lowered plasma and hepatic cholesterol concentrations. Despite the reduced molecular weight of naturally occurring soluble (1--->3),(1--->4)-β-d-glucan (β-glucan) caused by the bread-making process, whole grain barley breads downregulated hepatic expression of CYP7A1 and HMG-CoAR genes that are responsible for bile acid and cholesterol synthesis, suggesting a possible role of bioactive compounds such as short-chain fatty acids and phenolic compounds from barley bread. Barley bread enriched with HPMC downregulated expression of ABCG5 gene. Taken together, it appears that distinctive modulation of synthesis and excretion of hepatic cholesterol and bile acid contributes to the cholesterol-lowering properties of whole grain barley breads and breads enriched with HPMC. These data suggests that alternative whole grain breads supplemented with HPMC may provide consumers with a staple food that can assist in cholesterol management.
International Nuclear Information System (INIS)
Pillai, Thulasi G.; Nair, C.K.K.; Uma Devi, P.
2013-01-01
Ganoderma lucidum (Fr) P. Karst, commonly known as Reishi in Japan and Ling Zhi in China, is well known for its medicinal properties. G. lucidum contains a number of components among which the polysaccharides, particularly beta-glucan, and triterpenoids are the major active components. Radioprotective effect of a beta glucan (BG) isolated from the mushroom G. lucidum against radiation induced damage was investigated taking mouse survival and chromosomal aberrations as end points. DNA repair enhancing property of BG was determined by comet assay in human peripheral blood leucocytes. Young Swiss albino mice were exposed to whole body γ-irradiation. For mouse survival study, BG was administered orally 5 min after 8 Gy radiation exposures and at 4 Gy exposure for chromosomal aberrations. BG at 500 ug/kg body wt produced 66% mouse survival at 30 days given post irradiation. In chromosomal aberrations significant reduction in number of aberrant cells and different types of aberrations was observed in BG administered group compared to RT along treated group. For DNA repair, the comet parameters were studied at 2 Gy γ-irradiation with 15 min intervals. The comet parameters were reduced to normal levels after 120 min of exposure. The DNA repairing ability of BG contributes to the post radio protective effect of BG. (author)
Barley grain for ruminants: A global treasure or tragedy
Directory of Open Access Journals (Sweden)
Nikkhah Akbar
2012-07-01
Full Text Available Abstract Barley grain (Hordeum vulgare L. is characterized by a thick fibrous coat, a high level of ß-glucans and simply-arranged starch granules. World production of barley is about 30 % of that of corn. In comparison with corn, barley has more protein, methionine, lysine, cysteine and tryptophan. For ruminants, barley is the third most readily degradable cereal behind oats and wheat. Due to its more rapid starch fermentation rate compared with corn, barley also provides a more synchronous release of energy and nitrogen, thereby improving microbial nutrient assimilation. As a result, feeding barley can reduce the need for feeding protected protein sources. However, this benefit is only realized if rumen acidity is maintained within an optimal range (e.g., > 5.8 to 6.0; below this range, microbial maintenance requirements and wastage increase. With a low pH, microbial endotoxines cause pro-inflammatory responses that can weaken immunity and shorten animal longevity. Thus, mismanagement in barley processing and feeding may make a tragedy from this treasure or pearl of cereal grains. Steam-rolling of barley may improve feed efficiency and post-rumen starch digestion. However, it is doubtful if such processing can improve milk production and feed intake. Due to the need to process barley less extensively than other cereals (as long as the pericarp is broken, consistent and global standards for feeding and processing barley could be feasibly established. In high-starch diets, barley feeding reduces the need for capacious small intestinal starch assimilation, subsequently reducing hindgut starch use and fecal nutrient loss. With its nutritional exclusivities underlined, barley use will be a factual art that can either matchlessly profit or harm rumen microbes, cattle production, farm economics and the environment.
DEFF Research Database (Denmark)
Cuesta-Seijo, Jose A.; Ruzanski, Christian; Krucewicz, Katarzyna
2017-01-01
The production of starch is essential for human nutrition and represents a major metabolic flux in the biosphere. The biosynthesis of starch in storage organs like barley endosperm operates via two main pathways using different substrates: starch synthases use ADP-glucose to produce amylose......,4-glucans using HvPho1 from G1P as the sole substrate. The structural properties of HvPho1 provide insights into the low affinity of HvPho1 for large polysaccharides like starch or amylopectin. Our results suggest that HvPho1 may play a role during the initiation of starch biosynthesis in barley....... and amylopectin, the two major components of starch, whereas starch phosphorylase (Pho1) uses glucose-1-phosphate (G1P), a precursor for ADP-glucose production, to produce α-1,4 glucans. The significance of the Pho1 pathway in starch biosynthesis has remained unclear. To elucidate the importance of barley Pho1...
Grain Composition and Functional Ingredients of Barley Varieties Created in Latvia
Directory of Open Access Journals (Sweden)
Šterna Vita
2015-09-01
Full Text Available Cereals, including barley, have been recognised as functional foods that provide beneficial effect on the health of the consumer and decrease the risk of various diseases. The aim of investigation was to determine the grain composition of barley varieties and perspective breeding lines bred in Latvia and to evaluate its functional ingredients. The results of analysis showed that protein content among varieties ranged from 106.6-146.8 g·kg-1, total dietary fibre 187.4-208.2 g·kg-1, β-glucans 42.8 g-49.4 g·kg-1, and amount of α-tocopherol 6.03-8.93 mg·kg-1. The sum of essential amino acids in barley grain samples was from 32.90 g·kg-1 to 38.71 g·kg-1. All varieties of hulled and hulless barley grain were found to be sources of protein with high biological value. Comparison of barley varieties bred in Latvia suggests that variety ‘Kornelija’ outperforms others in protein, dietary fibre and micronutrient content.
Directory of Open Access Journals (Sweden)
Yong K. Park
2003-12-01
Full Text Available Cogumelos comestíveis contêm importantes propriedades funcionais. Em particular, beta-glucanos, homo- e hetero-glucanos com ligações glicosídicas beta(1->3, beta(1->4 e beta(1->6, supostamente responsáveis por algumas propriedades benéficas à saúde humana, como atividade imunomodulatória, antioxidante, antiinflamatória e anticancerígena. Neste trabalho, a quantidade de beta-glucano presente em cogumelo Agaricus blazei Murill, coletados de três diferentes locais, foi analisada utilizando-se método enzimático. As amostras (em base seca foram tratadas com alfa-amilase, protease bacteriana e com glicoamilase fúngica. beta-glucano foi quantificado após hidrólise ácida e determinação da glicose liberada. Foi verificado que amostras de A. blazei Murill cultivadas em estufas apresentaram menor concentração de b-glucano (8,4±0,9 e 7,6±2,8g/100g quando comparado com amostras cultivadas em campo aberto (10,1±2,1g/100g. Observou-se ainda que, mesmo sendo cultivado em condições semelhantes, porém em locais diferentes, as amostras apresentaram diferenças significativas (7,6±2,8 e 8,4±0,9g/100g.Edible mushrooms contains a very interesting functional properties. Among them, the beta-glucans, polysaccharides with beta-1,3; b-1,4 and beta-1,6glucosidic linkages, they are responsible to a series of properties to human health, such as immunomodulatory, antioxidant, antiinflammatory and, antitumoral activities. In the present work, the Agaricus blazei Murill beta-glucan concentrations from three locations, were determined through the enzymatic method. Samples were treated with alpha-amylase, bacterial protease and fungal glucoamylase. beta-glucans were quantified after acid hydrolysis and, the glucose determined for spectrophotometric method. It was verified that samples cultivated inside stoves presented smaller beta-glucan concentration (8.4±0.9 and 7.6±2.8g/100g, when compared with samples cultivated in open field (10.1±2.1g/100
Directory of Open Access Journals (Sweden)
Chiraphon Chaikliang
2015-11-01
Full Text Available Background: β-glucan is dietary fiber, a structural polysaccharide, β-linked linear chains of D-glucose polymers with variable frequency of branches. β-glucan is isolated from different sources such as cell walls of baker’s yeast (Saccharomyces cerevisiae, cereals (oat and barley and various species of mushrooms. Among 8 mushrooms in the study, Schizophylum commune Fr and Auricularia auricula Judae had the highest in β-glucan contents and the cheapest cost of mushroom per content of β-glucan, respectively. Even the function of β-glucan on immune modulation has been known however no report on interaction between β-glucan and human gut microbiota. Gut microbiota is thought to have health effects by interaction with non-digestible component particular fermentable dietary fiber. It is important to correlate the specific groups of the microbial communities associated with β-glucan fermentation and the consequential SCFA profiles. β-glucan from mushroom may has potential prebiotic function similar to those from commercial yeast (Saccharomyces cerevisiae β-glucan. Objective: To evaluate on prebiotic properties of soluble β-glucans and oligo-β-glucans from Schizophylum commune Fr and Auricularia auricula Judae by fecal fermentation in batch culture. Methods: In vitro fecal fermentation in anaerobic batch cultures under simulated conditions similar to human colon with human faecal samples from three donors were performed. Comparison on 3 β-glucans and 2 oligo-β-glucans have been studied. Sample was taken at 0 h, 24 h and 48 h to analyze the numbers of bacterial changes by fluorescent in situ hybridization (FISH technique. Short chain fatty acids (SCFA were analyzed by HPLC. The prebiotic index (PI was calculated according to the change of 5 specific bacterial genus within 48 h fermentation. Results: Soluble β-glucan from Auricularia auricula Judae increased numbers of bifidobacteria and lactobacillus significantly (P<0.05. The PI of
Czech Academy of Sciences Publication Activity Database
Loukotová, Lenka; Kučka, Jan; Rabyk, Mariia; Höcherl, Anita; Venclíková, Kristýna; Janoušková, Olga; Páral, P.; Kolářová, V.; Heizer, T.; Šefc, L.; Štěpánek, Petr; Hrubý, Martin
2017-01-01
Roč. 268, 28 December (2017), s. 78-91 ISSN 0168-3659 R&D Projects: GA ČR(CZ) GA16-02870S; GA ČR(CZ) GA16-03156S; GA MZd(CZ) NV15-25781A; GA MŠk(CZ) 7AMB16FR042 Institutional support: RVO:61389013 Keywords : beta-glucan * polyoxazoline * multimodal cancer therapy Subject RIV: CF - Physical ; Theoretical Chemistry OBOR OECD: Physical chemistry Impact factor: 7.786, year: 2016
Liu, Nian; Couto, Ricardo; Seifried, Bernhard; Moquin, Paul; Delgado, Luis; Temelli, Feral
2018-04-01
The physicochemical properties of the oat beta-glucan powder (BG) and coenzyme Q10 (CoQ10)-loaded BG powder (L-BG) produced by the pressurized gas-expanded liquid (PGX) technology were studied. Helium ion microscope, differential scanning calorimeter, X-ray diffractometer, AutoSorb iQ and rheometer were used to determine the particle morphology, thermal properties, crystallinity, surface area and viscosity, respectively. Both BG (7.7μm) and L-BG (6.1μm) were produced as micrometer-scale particles, while CoQ10 nanoparticles (92nm) were adsorbed on the porous structure of L-BG. CoQ10 was successfully loaded onto BG using the PGX process via adsorptive precipitation mainly in its amorphous form. Viscosity of BG and L-BG solutions (0.15%, 0.2%, 0.3% w/v) displayed Newtonian behavior with increasing shear rate but decreased with temperature. Detailed characterization of the physicochemical properties of combination ingredients like L-BG will lead to the development of novel functional food and natural health product applications. Copyright © 2017 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Faezeh Tabesh
2014-01-01
Full Text Available Introduction. Oats are high in soluble fibers and effective in reducing the risk of cardiovascular diseases (CVD. We assessed the effects of beta-glucan from oat bran on serum nitric oxide (NO endothelial function in patients with hypercholesterolemia. Method. Sixty hypercholesterolemic patients were randomly divided to receive an experimental bread rich in beta-glucan from oat bran (intervention or bread rich in wheat fiber (control for four weeks. All subjects had the same diet for two-week baseline period and hypocaloric diet for four weeks of intervention. Serum NO concentration and flow-mediated dilation (FMD were determined before and after the experiment. Results. Mean age of the participants was 51.1 ± 9.3 years and 65% (n=39 were female. After intervention, serum NO concentration increased by 50.2 ± 19.8 μmol/lit in the intervention group (P=0.017, but no change was observed in the control group (17.5 ± 27.5 μmol/lit; P=0.530. No change of FMD was observed in the intervention (0.48 ± 0.78%; P=0.546 or in the control group (0.59 ± 0.92%; P=0.533. Conclusion. Consumption of oat bread for four weeks increases serum NO concentration but has no effect on FMD. Further studies are warranted in this regard.
Bagal-Kestwal, Dipali R; Kestwal, Rakesh Mohan; Hsieh, Wen-Ting; Chiang, Been-Huang
2014-01-01
Simple and fast photometric flow injection analysis system was developed for sensing of β-1,3-glucan from medicinal mushroom Ganoderma lucidum during fermentation. For this purpose, the chitosan-guar gum-silver nanoparticle-beta glucanase (Ch-GG-AgNPs-βG) beads and Ch-GG-AgNPs-GOD (glucose oxidase) beads were prepared. The bead packed mini-columns were then used to assemble a flow injection analysis (FIA) system for the detection of β-(1→3)-d-glucan biomarker or glucose. This colorimetric flow system can detect glucose and glucan with detection limits as low as 50ngmL(-1) and 100ngmL(-1) (S/N=3), respectively. The analysis time of this FIA was approximately 40s, which is faster than the previously reported glucan sensors. The glucose and glucan calibration curves were obtained in the range of 0.25-1.25μgmL(-1) (R(2)=0.988) and 0.2-1.0μgmL(-1)(R(2)=0.979), respectively. The applicability of the nano-bio-composite FIA sensor system for spiked and real β-(1→3)-d-glucan samples were tested, and the accuracy of the results were greater than 95%. Thus, the designed FIA provides a simple, interference free and rapid tool for monitoring glucose and β-glucan content, which can be used for various food samples with a little modification. Copyright © 2013 Elsevier B.V. All rights reserved.
Various roles of beta-glucan in invertebrates
Czech Academy of Sciences Publication Activity Database
Větvička, V.; Šíma, Petr
2017-01-01
Roč. 14, č. 1 (2017), s. 488-493 ISSN 1824-307X Institutional support: RVO:61388971 Keywords : invertebrates * glucan * receptors Subject RIV: EC - Immunology OBOR OECD: Immunology Impact factor: 0.824, year: 2016
Wu, Yu-Sheng; Tseng, Tzu-Yu; Nan, Fan-Hua
2016-07-01
This research aims to investigate the non-specific immune response of Taiwan abalone (Haliotis diversicolor supertexta) which was treated with the beta-1,3-1,6-glucan to be observed in the survival impact after the Vibrio alginolyticus infection. The non-specific immune and physiological response of superoxide anion radical (O2(-)), phenoloxidase (PO), phagocytic index (PI), phagocytic rate (PR) and lucigenin-chemiluminescence for reactive oxygen intermediates (ROIs) were enhanced via in-vitro experiment. In the in-vivo experiment, the observed data presented that the haemolymph lysate supernatant (HLS), superoxide dismutase (SOD), glutamate oxalacetate transaminase (GOT) and glutamate pyruvate transaminase (GPT) were not significant enhanced, but the total haemocyte count (THC), O2(-), PO, phagocytic index (PI), phagocytic ratio (PR) and other parameters of immune were significantly promoted after treated with beta-1,3-1,6-glucan. In the challenge experiment, the survival rates of abalone in the 40 and 80 μl/ml groups of beta-1,3-1,6-glucan were observed from 6.67% up to 33.33% and 36.67% after injection with Vibrio alginolyticus, respectively. Copyright © 2016 Elsevier Ltd. All rights reserved.
The structure of cell wall alpha-glucan from fission yeast
Grün, Christian H.; Hochstenbach, Frans; Humbel, Bruno M.; Verkleij, Arie J.; Sietsma, J. Hans; Klis, Frans M.; Kamerling, Johannis P.; Vliegenthart, Johannes F. G.
2005-01-01
Morphology and structural integrity of fungal cells depend on cell wall polysaccharides. The chemical structure and biosynthesis of two types of these polysaccharides, chitin and (1-->3)-beta-glucan, have been studied extensively, whereas little is known about alpha-glucan. Here we describe the
The structure of cell wall alpha-glucan from fission yeast.
Grün, C.H.; Hochstenbach, F.; Humbel, B.M.; Verkleij, A.J.; Sietsma, J.H.; Klis, F.M.; Kamerling, J.P.; Vliegenthart, J.F.G.
2005-01-01
Morphology and structural integrity of fungal cells depend on cell wall polysaccharides. The chemical structure and biosynthesis of two types of these polysaccharides, chitin and (1rarr3)-beta-glucan, have been studied extensively, whereas little is known about alpha-glucan. Here we describe the
DEFF Research Database (Denmark)
Andersen, Barbara Vad; Mielby, Line H.; Viemose, Ida
2017-01-01
apple-cherry fruit drinks with different levels of beta-glucans and different sweeteners, sucrose or Stevia rebaudiana. The aims were: 1) to study the hedonic sensory experience, 2) to study time and product effects on post-ingestive sensations and satisfaction, and 3) to study main drivers....... Satisfaction with sensory attributes was found to be the main driver of food satisfaction, while post-ingestive sensations drove satisfaction as well. While replacing sucrose with Stevia rebaudiana did not affect the hedonic and post-ingestive sensations, addition of beta glucan resulted in both positive...
Geophysical and Geotechnical Characterization of Beta-1,3/1,6-glucan Biopolymer treated Soil
Chang, I.; Cho, G.
2012-12-01
Bacteria or microbes in soil excrete hydrocarbon (e.g. polysaccharide) by-products which are called biopolymers. These biopolymers (or sometime biofilms) recently begun to make a mark on soil erosion control, aggregate stabilization, and drilling enhancement. However, the biological effect on soil behavior (e.g. bio-clogging or bio-cementation) has been poorly understood. In this study, the bio-cementation and bio-clogging effect induced by the existence of β-1,3/1,6-glucan biopolymers in soil were evaluated through a series of geophysical and geotechnical characterization tests in laboratory. According to the experimental test results, as the β-1,3/1,6-glucan content in soil increases, the compressive strength and shear wave velocity increase (i.e., bio-cementation) while the hydraulic conductivity decreases (i.e., bio-clogging) but the electrical conductivity increases due to the high electrical conductivity characteristic of β-1,3/1,6-glucan fibers. Coefficient of consolidation variation with the increases of β-1,3/1,6-glucan content in soil. SEM image of β-1,3/1,6-glucan treated soil. Fibers are form matices with soil particles.
DEFF Research Database (Denmark)
Mundy, John; Brandt, Anders; Fincher, Geoffrey B
1985-01-01
Polyclonal antibodies raised against barley (1-->3,1-->4)-beta-d-glucanase, alpha-amylase and carboxypeptidase were used to detect precursor polypeptides of these hydrolytic enzymes among the in vitro translation products of mRNA isolated from the scutellum and aleurone of germinating barley....... In the scutellum, mRNA encoding carboxypeptidase appeared to be relatively more abundant than that encoding alpha-amylase or (1-->3,1-->4)-beta-d-glucanase, while in the aleurone alpha-amylase and (1-->3,1-->4)-beta-d-glucanase mRNAs predominated. The apparent molecular weights of the precursors for (1......-->3,1-->4)-beta-d-glucanase, alpha-amylase, and carboxypeptidase were 33,000, 44,000, and 35,000, respectively. In each case these are slightly higher (1,500-5,000) than molecular weights of the mature enzymes. Molecular weights of precursors immunoprecipitated from aleurone and scutellum mRNA translation...
Richter, Josef; Závorková, Martina; Vetvicka, Vaclav; Liehneová, Ivana; Kral, Vlastimil; Rajnohova Dobiasova, Lucie
2018-06-19
The objective of this article is to evaluate the potential effects of beta-glucan and vitamin D supplementation in patients with diabetic retinopathy. We evaluated the levels of several parameters of inflammatory reactions (C-reactive protein [CRP], serum amyloid A [SAA], and interleukin- [IL-] 6), leptin, and vitamin D. Using a 3-month interval, we divided the patients into three groups: (1) supplemented with beta-glucan and vitamin D, (2) supplemented with vitamin D and placebo, and (3) supplemented with vitamin D alone. By this division, we aim not only to observe whether beta-glucan can increase the effects of vitamin D, but also to eliminate the potential effects of placebo. The doses of vitamin D corresponded to phototype, weight, age, and sex of the individual. Fifty-two diabetic retinopathy patients were selected for our study. We found significant vitamin D deficits in all cases, even after three months of supplementation with vitamin D. Significant changes in levels of CRP were observed in the beta-glucan-supplemented group; levels of SAA and IL-6 were not changed. Leptin levels were significantly lowered in the beta-glucan-supplemented group and increased in the other groups. More detailed studies and/or longer supplementation is necessary.
Fungal beta glucan protects radiation induced DNA damage in human lymphocytes.
Pillai, Thulasi G; Maurya, Dharmendra K; Salvi, Veena P; Janardhanan, Krishnankutty K; Nair, Cherupally K K
2014-02-01
Ganoderma lucidum (Ling Zhi), a basidiomycete white rot macrofungus has been used extensively for therapeutic use in China, Japan, Korea and other Asian countries for 2,000 years. The present study is an attempt to investigate its DNA protecting property in human lymphocytes. Beta glucan (BG) was isolated by standard procedure and the structure and composition were studied by infrared radiation (IR) and nuclear magnetic resonance (NMR) spectroscopy, gel filtration chromatography and paper chromatography. The radioprotective properties of BG isolated from the macro fungi Ganoderma lucidum was assessed by single cell gel electrophoresis (comet assay). Human lymphocytes were exposed to 0, 1, 2 and 4 Gy gamma radiation in the presence and absence of BG. The comet parameters were reduced by BG. The results indicate that the BG of G. lucidum possessed significant radioprotective activity with DNA repairing ability and antioxidant activity as the suggestive mechanism. The findings suggest the potential use of this mushroom for the prevention of radiation induced cellular damages.
Directory of Open Access Journals (Sweden)
Jae Gil Lee
2016-06-01
Full Text Available We investigated whether high-protein enteral nutrition with immune-modulating nutrients (IMHP enriched with β-glucan stimulates immune function in critically ill patients. In a randomized double-blind placebo-controlled study, 30 patients consumed one of three types of enteral nutrition: a control or IMHP with and without β-glucan. The IMHP with β-glucan group showed increases in natural killer (NK cell activities relative to the baseline, and greater increases were observed in NK cell activities relative to the control group after adjusting for age and gender. The IMHP groups with and without β-glucan had greater increases in serum prealbumin and decreases in high-sensitivity C-reactive protein (hs-CRP than the control group. The control group had a greater decrease in peripheral blood mononuclear cell (PBMC interleukin (IL-12 production than the IMHP with and without β-glucan groups. In all patients, the change (Δ in hs-CRP was correlated with Δ prealbumin and Δ PBMC IL-12, which were correlated with ΔNK cell activity and Δ prealbumin. This study showed beneficial effects of a combination treatment of β-glucan and IMHP on NK cell activity. Additionally, strong correlations among changes in NK cell activity, PBMC IL-12, and hs-CRP suggested that β-glucan could be an attractive candidate for stimulating protective immunity without enhanced inflammation (ClinicalTrials.gov: NCT02569203.
Extracted oat and barley β-glucans do not affect cholesterol metabolism in young healthy adults
DEFF Research Database (Denmark)
Ibrügger, Sabine; Kristensen, Mette Bredal; Poulsen, Malene Wibe
2013-01-01
for β-glucan functionality. This study investigates the effects of 3 different β-glucan sources, incorporated into a beverage and yogurt, on blood lipids and fecal endpoints. Fourteen participants completed this randomized, crossover, single-blinded study with four 3-wk periods: control and 3.3 g/d oat...
Naser, Mahmoud; Badran, Mohamed; Abouzied, Hanaa; Ali, Heba; Elbasyoni, Ibrahim
2018-05-04
In recent years, barley has attracted more interest as a food and feed source because of its high soluble dietary fiber and β-glucan content compared with other small grains. Twenty-five barley genotypes (20 imported genotypes and five check cultivars) were grown in three environments for two successive seasons: 2015/2016 and 2016/2017. The first environment was in El-Nubaria, Alexandria, Egypt during 2015/2016, while the second and third environments were in El-Bostan, Elbhera, Egypt during 2015/2016 and 2016/2017. The experiments were conducted in a randomized complete block design with the three replicates. The primary objectives of the current study were to evaluate the performance of 20 imported barley genotypes under several environmental conditions. The imported materials were superior to the local commercial cultivars for several traits, including grain yield. Therefore, the superior genotypes will be further evaluated and used in barley breeding programs. Our future work will focus on creating several crosses among the selected superior genotypes to improve yield and other important traits, while applying marker-assisted selection.
Khan, Salman; Hamula, Camille; Rana, Meenakshi; Sullivan, Timothy; Dunn, Dallas; Patel, Pinki; Mishkin, Aaron; Huprikar, Shirish
2017-10-01
We describe a case of a man with ectopic Cushing's syndrome, elevated serum beta-D-glucan, and respiratory cultures with Pseudomonas, Aspergillus, and a partially acid-fast organism. Our case highlights challenges in diagnosis and management of coinfection in an immunocompromised host.
β-1,3-glucan in developing cotton fibers
International Nuclear Information System (INIS)
Maltby, D.; Carpita, N.C.; Montezinos, D.; Kulow, C.; Delmer, D.P.
1979-01-01
Evidence is presented for the existence of a noncellulosic β-1,3-glucan in cotton fibers. The glucan can be isolated as distinct fractions of varying solubility. When fibers are homogenized rigorously in aqueous buffer, part of the total β-1,3-glucan is found as a soluble polymer in homogenates freed of cell walls. The proportion of total β-1,3-glucan which is found as the soluble polymer varies somewhat as a function of fiber age. The insoluble fraction of the BETA-1,3-glucan remains associated with the cell wall fraction. The glucan fraction which can be isolated as a soluble polymer in homogenates freed of cell walls is not associated with membranous material, and we propose that it represents glucan which is also extracellular but not tightly associated with the cell wall. Enzyme digestion studies indicate that all of the cotton fiber glucan is β-linked, and methylation analyses and enzyme studies both show that the predominant linkage in the glucan is 1 → 3. The possibility of some minor branching at C-6 can also be deduced from the methylation analyses. The timing of deposition of the β-1,3-glucan during fiber development coincides closely with the onset of secondary wall cellulose synthesis. Kinetic studies performed with ovules and fibers cultured in vitro show that incorporation of radioactivity from [ 14 C/glucose into β-1,3-glucan is linear with respect to time almost from the start of the labeling period; however, a lag is observed before incorporation into cellulose becomes linear with time, suggesting that these two different glucans are not polymerized directly from the same substrate pool. Pulse-chase experiments indicate that neither the β-1,3-glucan nor cellulose exhibits significant turnover after synthesis
Pielesz, Anna; Biniaś, Włodzimierz; Paluch, Jadwiga
2012-01-01
The formation of AGEs progressively increases with normal aging, even in the absence of disease (the pathogenesis of diabetes associated vascular disorders and neurodegenerative diseases, including Alzheimer's disease, Parkinson's disease). However, they are formed at accelerated rates in age-related diseases. The polysaccharides might play a role in wound healing, both internally and externally, and also that they could play a role against inflammation and may lead to the production of better medicines to be used as supplements in cancer treatment. The acid hydrolysis was studied with H2SO4 at 80% concentration to determine the most effective procedure for total hydrolysis of beta-glucan. The standard of beta-glucans acid hydrolysate were compared for commercial oat and oatmeal, mushrooms: Pleurotus ostreatus, Fungus and yeast Saccharomyces cerevisiae. The following materials and reagents were used in the examination: reference beta-(1 --> 3)-(1 --> 6)-glucan, oat and oatmeal, mushrooms: Pleurotus ostreatus, Fungus and yeast Saccharomyces cerevisiae. The Raman spectra of the sample solutions (beta-glucan acid hydrolysates) were recorded on a MAGNA-IR 860 with FT-Raman accessory. Sample was irradiated with a 1064 nm line of the T10-8S Nd spectra-physics model: YAG laser and scattered radiation were collected at 180 degrees, using 4 cm(-1) resolution. The polysaccharide was hydrolyzed into component monosaccharides with 80% H2SO4 at 0 degrees C for 30 minutes and monosaccharide derivatives were subjected to electrophoresis, as in a ealier authors study, on a strip of cellulose acetate membrane (CA-SYS-MINI Cellulose Acetate Systems) in 0.2 M Ca(OAc)2 (pH 7.5) at 10 mA, max. 240 V for 1.5 h. The strips were stained with 0.5% toluidine blue in 3% HOAc solution and then rinsed in distilled water and air-dried. A part of the hexoses (for example glucose) are converted, to products such as 5-hydroxymethylfurfural. Various coloured substances, through the Maillard
Beta-glucan bath promote wound healing in common carp (Cyprinus carpio L.)
DEFF Research Database (Denmark)
Przybylska, Dominika Alicja; Schmidt, Jacob; Nielsen, Michael Engelbrecht
β-glucans are well known for their ability to modulate the immune system. These polysaccharides, derived from fungi, plants and bacteria cell wall [1] potently trigger inflammatory response in infected host [2]. The effects of β-glucans depend on the origins, route of administration, molecular we...
Directory of Open Access Journals (Sweden)
Jenneke Leentjens
Full Text Available To prevent or combat infection, increasing the effectiveness of the immune response is highly desirable, especially in case of compromised immune system function. However, immunostimulatory therapies are scarce, expensive, and often have unwanted side-effects. β-glucans have been shown to exert immunostimulatory effects in vitro and in vivo in experimental animal models. Oral β-glucan is inexpensive and well-tolerated, and therefore may represent a promising immunostimulatory compound for human use.We performed a randomized open-label intervention pilot-study in 15 healthy male volunteers. Subjects were randomized to either the β -glucan (n = 10 or the control group (n = 5. Subjects in the β-glucan group ingested β-glucan 1000 mg once daily for 7 days. Blood was sampled at various time-points to determine β-glucan serum levels, perform ex vivo stimulation of leukocytes, and analyze microbicidal activity.β-glucan was barely detectable in serum of volunteers at all time-points. Furthermore, neither cytokine production nor microbicidal activity of leukocytes were affected by orally administered β-glucan.The present study does not support the use of oral β-glucan to enhance innate immune responses in humans.ClinicalTrials.gov NCT01727895.
Directory of Open Access Journals (Sweden)
Eduardo Caierão
2006-06-01
Full Text Available A cevada MN 716, lançada em 2004, é uma das cultivares recomendadas para cultivo com maior estabilidade de produção. Nos anos em que participou do ensaio para determinação de seu valor de cultivo e uso, apresentou excelente produtividade de grãos, com média superior a 3.000 kg ha-1, e desempenho equilibrado quanto à qualidade, com destaque para seu teor de beta-glucanas e índice enzimático. A cultivar constitui um avanço do melhoramento desse cereal no Brasil, aliando características de interesse do produtor e da indústria.Barley cultivar MN 716, released in 2004, is one of the most recomended cultivars, for its high stability. In the years that it was included in the agronomic and use value trial, the cultivar MN 716 showed high yield average, exceeding 3,000 kg ha-1, as well as excellent qualitative performance, mainly in relation to beta-glucans and enzyme index. The cultivar is a breeding achievement for this cereal in Brazil, and serves the interests of both producers and industrial sector.
Directory of Open Access Journals (Sweden)
Xiaojian Wu
2017-09-01
Full Text Available Grain weight and protein content will be reduced and increased, respectively, when barley is subjected to water stress after anthesis, consequently deteriorating the malt quality. However, such adverse impact of water stress differs greatly among barley genotypes. In this study, two Tibetan wild barley accessions and two cultivated varieties differing in water stress tolerance were used to investigate the genotypic difference in metabolic profiles during grain-filling stage under drought condition. Totally, 71 differently accumulated metabolites were identified, including organic acids, amino acids/amines, and sugars/sugar alcohols. Their relative contents were significantly affected by water stress for all genotypes and differed distinctly between the wild and cultivated barleys. The principal component analysis of metabolites indicated that the Tibetan wild barley XZ147 possessed a unique response to water stress. When subjected to water stress, the wild barley XZ147 showed the most increase of β-amylase activity among the four genotypes, as a result of its higher lysine content, less indole-3-acetic acid (IAA biosynthesis, more stable H2O2 homeostasis, and more up-regulation of BMY1 gene. On the other hand, XZ147 had the most reduction of β-glucan content under water stress than the other genotypes, which could be explained by the faster grain filling process and the less expression of β-glucan synthase gene GSL7. All these results indicated a great potential for XZ147 in barley breeding for improving water stress tolerance.
Role of the synthase domain of Ags1p in cell wall alpha-glucan biosynthesis in fission yeast
Vos, Alina; Dekker, Nick; Distel, Ben; Leunissen, Jack A. M.; Hochstenbach, Frans
2007-01-01
The cell wall is important for maintenance of the structural integrity and morphology of fungal cells. Besides beta-glucan and chitin, alpha-glucan is a major polysaccharide in the cell wall of many fungi. In the fission yeast Schizosaccharomyces pombe, cell wall alpha-glucan is an essential
Directory of Open Access Journals (Sweden)
Xin Chen
Full Text Available BACKGROUND: Hulless barley is attracting increasing attention due to its unique nutritional value and potential health benefits. However, the molecular biology of the barley grain development and nutrient storage are not well understood. Furthermore, the genetic potential of hulless barley has not been fully tapped for breeding. METHODOLOGY/PRINCIPAL FINDINGS: In the present study, we investigated the transcriptome features during hulless barley grain development. Using Illumina paired-end RNA-Sequencing, we generated two data sets of the developing grain transcriptomes from two hulless barley landraces. A total of 13.1 and 12.9 million paired-end reads with lengths of 90 bp were generated from the two varieties and were assembled to 48,863 and 45,788 unigenes, respectively. A combined dataset of 46,485 All-Unigenes were generated from two transcriptomes with an average length of 542 bp, and 36,278 among were annotated with gene descriptions, conserved protein domains or gene ontology terms. Furthermore, sequences and expression levels of genes related to the biosynthesis of storage reserve compounds (starch, protein, and β-glucan were analyzed, and their temporal and spatial patterns were deduced from the transcriptome data of cultivated barley Morex. CONCLUSIONS/SIGNIFICANCE: We established a sequences and functional annotation integrated database and examined the expression profiles of the developing grains of Tibetan hulless barley. The characterization of genes encoding storage proteins and enzymes of starch synthesis and (1-3;1-4-β-D-glucan synthesis provided an overview of changes in gene expression associated with grain nutrition and health properties. Furthermore, the characterization of these genes provides a gene reservoir, which helps in quality improvement of hulless barley.
Immunostimulatory properties and antitumor activities of glucans (Review)
Czech Academy of Sciences Publication Activity Database
Vannucci, Luca; Křižan, Jiří; Šíma, Petr; Stakheev, Dmitry; Čaja, Fabian; Rajsiglová, Lenka; Horák, Vratislav; Saieh, M.
2013-01-01
Roč. 43, č. 2 (2013), s. 357-364 ISSN 1019-6439 Institutional support: RVO:61388971 ; RVO:67985904 Keywords : beta-glucans * polysaccharides * immunity Subject RIV: EE - Microbiology, Virology; FD - Oncology ; Hematology (UZFG-Y) Impact factor: 2.773, year: 2013
Directory of Open Access Journals (Sweden)
Luiz C. GUTKOSKI
1999-12-01
Full Text Available A fibra alimentar é composta por celulose, hemiceluloses, gomas, pectinas e mucilagens sendo classificada em solúvel e insolúvel, quanto a sua solubilidade em água. As beta-glicanas são componentes da fibra alimentar solúvel presentes na aveia e sua importância é devido às propriedades funcionais e aos efeitos hipocolesterolêmicos e hipoglicêmicos apresentados. O presente trabalho tem como objetivo avaliar os teores de fibra alimentar solúvel, insolúvel e total e de beta-glicanas de cultivares de aveia recomendados pela Comissão Brasileira de Pesquisa de Aveia. Grãos de aveia (Avena sativa, L foram descascados, as cariopses moídas e as amostras acondicionadas e armazenadas à temperatura de -20° C. Para a análise de fibra alimentar foi adotada a metodologia da AOAC (1997. Entre os cultivares analisados, UPF 7, UPF 13, UPF 14 e UPF 16 apresentaram os maiores teores de fibra alimentar insolúvel. Os maiores teores de fibra alimentar solúvel foram verificados nos cultivares UFRGS 7, CTC 13, UPF 16 e CTC 2. O cultivar UPF 16 apresentou o maior teor de fibra alimentar total, seguido de UFRGS 7, CTC 13 e UFRGS 18. Para a determinação de beta-glicanas foi adotada a metodologia da AOAC (1997. Os maiores teores de beta-glicanas foram verificados nos cultivares UFRGS 7, UPF 14 e UFRGS 18.The dietary fiber is composed by cellulose, hemi-celluloses, gums, pectins, and mucilages, being classified as soluble or insoluble depending on its solubility in water. Beta-glucans are a fraction of the soluble dietary fiber, being important due to its functional properties and effects in reducing cholesterol and glucose. This work aimed at evaluating the levels of soluble, insoluble, and total dietary fiber, as well as the amount of beta-glucans, present in grains of oat cultivars recommended by the Brazilian Commission for Oat Research. Oat grains were hulled, the caryopses were ground and the samples packaged and stored at temperature of -20º
Structural comparison of arabinoxylans from two barley side-stream fractions.
Pitkänen, Leena; Tuomainen, Päivi; Virkki, Liisa; Aseyev, Vladimir; Tenkanen, Maija
2008-07-09
The structures of barley ( Hordeum vulgare) arabinoxylans isolated from two industrial side fractions, barley husks (BH) and barley fiber (BF), were characterized. Arabinoxylans were extracted with saturated barium hydroxide after enzymatic pretreatment. Barium hydroxide was selective toward arabinoxylans, and only a minor amount of glucose-containing material was coextracted. Acid methanolysis followed by gas chromatography, 1H NMR spectroscopy, and specific enzymatic treatments followed by anion exchange chromatography with pulse amperometric detection (HPAEC-PAD) revealed that the chemical structure of barley husk arabinoxylan (BHAX) clearly differed from that of barley fiber arabinoxylan (BFAX). BFAX was more branched, containing more beta-D-xylopyranosyl (beta-D-Xylp) residues carrying alpha-L-arabinofuranosyl (alpha-L-Araf) units at both O-2 and O-3 positions. BHAX, on the other hand, contained more 2-O-beta-D-Xyl p-alpha-L-Ara f substituents than BFAX. BHAX and BFAX also differed with respect to the hydrodynamic properties investigated with multidetector size exclusion chromatography. BFAX had a higher weight-average molar mass and larger hydrodynamic volume, the latter indicating less dense conformation than BHAX. Mn, Mw /Mn, Rh, and the Mark-Houwink a value were also determined for both arabinoxylans.
Beta-Glucans Improve Growth, Viability and Colonization of Probiotic Microorganisms
Directory of Open Access Journals (Sweden)
Daniela Fiocco
2012-05-01
Full Text Available Probiotics, prebiotics and synbiotics are frequently-used components for the elaboration of functional food. Currently, most of the commercialized probiotics are limited to a few strains of the genera Bifidobacteria, Lactobacillus and Streptococcus, most of which produce exopolysaccharides (EPS. This suggests that the beneficial properties of these microorganisms may be related to the biological activities of these biopolymers. In this work we report that a 2-substituted-(1,3-β-D-glucan of non-dairy bacterial origin has a prebiotic effect on three probiotic strains. Moreover, the presence of this β-D-glucan potentiates in vitro adhesion of the probiotic Lactobacillus plantarum WCFS1 to human intestinal epithelial cells.
DEFF Research Database (Denmark)
Knudsen, Knud Erik Bach
The objective of the current study was to investigate if lactose in diet would influence the degradation of mixed linked β(1–3;1–4)-D-glucan (β-glucan) in the small intestine. Β-glucan is an important cell wall (dietary fiber, DF) component of the endosperm of barley and oats. The digestibility...... of β-glucan in the small intestine from both cereals is among the highest of all DF components, but in one particular study with oat-based diets it was significantly lower than what was found in other studies. In this study whey protein containing lactose was used as protein supplement. Lactose...... is slowly digestible in the small intestine. To investigate if lactose could be causative for the lower digestibility of β-glucan in the study with whey protein, it was decided to quantify the content of lactose in the diets and to analyze for lactose in digesta samples from the small intestine (the small...
Verardo, Vito; Gómez-Caravaca, Ana Maria; Messia, Maria Cristina; Marconi, Emanuele; Caboni, Maria Fiorenza
2011-09-14
Barley byproducts obtained by air classification have been used to produce a different barley functional spaghetti, which were compared to different commercial whole semolina samples. Total, insoluble, and soluble fiber and β-glucan contents of the barley spaghetti were found to be greater than those of commercial samples. Furthermore, it was proved that barley spaghetti reached the FDA requirements, which could allow these pastas to deserve the health claims "good source of dietary fiber" and "may reduce the risk of heart disease". When the barley coarse fraction was used, a flavan-3-ols enrichment and an increase of antioxidant activity were reported, while commercial samples showed the absence of flavan-3-ols and a higher presence of phenolic acids and tannins. Whole semolina commercial spaghetti had a significantly higher content of phenolic acids than semolina spaghetti samples. Besides, it was observed that when vital gluten was added to the spaghetti formulation, phenolic compounds were blocked in the gluten network and were partially released during the cooking process.
Effect of electron beam-irradiation to b-glucan on its immunomodulating and antitumor activity
Energy Technology Data Exchange (ETDEWEB)
Jung, Yeon Hwan; Lee, Jung Lim; Yoo, Yung Choon [Konyand Univ., Daejeon (Korea, Republic of); Kim, Jae Hoon; Lee, Ju Woon [Korea Atomic Energy Research Institute, Daejeon (Korea, Republic of)
2010-07-01
In this study, in order investigated the effect of electron beam irradiation to b-glucan on its biological activities, we compared immunomodulating and antitumor activity between non-irradiated and electron beam-irradiated b-glucan. EB-glucan was irradiated by electron beam with 10, 30 and 50 kGy. Treatment with EB-glucan resulted in a slight increase of the proliferation of ConA-stimulated splenocytes, and the strongest activity was seen in 50 kGy-treated EB-glucan. EB-glucan teated with 50 kGy also showed increased secretion of cytokines such as IL-2 IFN-{gamma} and IL-6 from ConA-stimulated splenocytes. The activity of EB-glucan to enhance the proliferation of splenocytes and cytokine secretion from ConA-stimulated splenocytes was higher than that of NI-glucan. Furthermore, EB-glucan treated with 50 kGy showed higher activity to activate RAW 264.7 macrophages, comparing with that of NI-glucan. In experiments of antitumor activity, EB-glucan treated with 50 kGy prior to tumor inoculation inhibited an experimental lung metastasis produced by B16-BL6 melanoma cells in mice. But NI-glucan did show no effect. In addition, EB-glucan treated with 50 kGy induced a decrease a decrease of tumor growth in tumor-bearing mice. Collectivelt, these results indicates that electron beam irradiation {beta}-glucan leads its biological functions to enhance immunomodulating and antitumor activity.
Directory of Open Access Journals (Sweden)
Yoshihiko Ojiri
2015-04-01
Full Text Available Background: Fatigue is attributable to physical and psychological stress. Fatigue is also a common symptom which occurs in both sick and healthy individuals. Although its mechanism of cause is complex, fatigue from stress is known to affect the existing equilibrium of the immune system. However, nutrition, such as beta-1,3/1,6 glucan, has been reported to play an important role in regulating stress and fatigue states, via modulating a weakened immune system. In this study, a popular and healthy beverage in Okinawa, Japan, containing a soluble baker’s yeast in black koji vinegar (Moromisu, was provided to healthy subjects with a non-strenuous daily lifestyle. Results: By performing statistical analysis on the results of the Profile of Mood States (POMS survey, we observed that overall study results (n=14 demonstrated significant differences in fatigue and confusion in the POMS factors. Conclusions: In this study we confirmed that beta-1,3/1,6 glucan improved some of the factors related to stress and fatigue, as indicated by evaluation of POMS survey results.
Beta-Glucan induced immune modulation of wound healing in common carp (Cyprinus carpio)
Jiménez, Natalia Ivonne Vera; Nielsen, Michael Engelbrecht; Lindenstrøm, Thomas
2012-01-01
Immune modulators are compounds capable to interact with the immune system and to modify the host response. This interaction enhances non-specific defense mechanisms, improving health and promoting survival. β-glucans are glucose polysaccharides present in sea weed, bacteria, fungi and cereal but not in animals. β-glucans are commonly used as immune modulators, but the mechanisms through which the modulation is achieved remains to be understood. Wound healing and tissue regeneration are essen...
Hussain, Peerzada R.; Rather, Sarver A.; Suradkar, Prashant P.
2018-03-01
Oat β-D-glucan after extraction was degraded at doses of 3, 6, 9, 12 and 15 kGy. The average molecular weight decreased to 45 kDa at dose of 15 kGy from an initial value of 200 kDa in native sample. XRD analysis revealed no significant change in diffraction pattern of irradiated samples when compared with control, except a decrease in intensity of x-ray diffraction. The results of the antioxidant activity revealed decrease in EC50 values and corresponding increase in antioxidant activity of radiation degraded oat β-D-glucan. Results of the anticancer studies indicated that cytotoxicity of gamma irradiated oat β-D-glucan in cancer cell lines was highest against colo-205 and MCF7 cancer cells compared to T47D cell and no cytotoxicity was observed in normal cell lines at all concentrations used. Evaluation of hypoglycemic activity showed highest inhibition in α-glucosidase activity compared to α-amylase activity due to gamma irradiation of oat β-D-glucan. Comparison of the EC50 values of known standards and gamma irradiated oat beta-glucan samples indicates that radiation treatment significantly modified the biological activity of the beta-glucan samples. Therefore, it is suggested that gamma irradiation can be used for producing low molecular weight oat β-D-glucan; which can help in modifying the biological activities.
Barley starch bioengineering for high phosphate and amylose
DEFF Research Database (Denmark)
Blennow, Per Gunnar Andreas; Carciofi, Massimiliano; Shaik, Shahnoor Sultana
2011-01-01
Starch is a biological polymer that can be industrially produced in massive amounts in a very pure form. Cereals is the main source for starch production and any improvement of the starch fraction can have a tremendous impact in food and feed applications. Barley ranks number four among cereal...... crops and barley is a genetically very well characterized. Aiming at producing new starch qualities in the cereal system, we used RNAi and overexpression strategies to produce pure amylose and high-phosphate starch, respectively, using the barley kernel as a polymer factory. By simultaneous silencing...... of the three genes encoding the starch-branching enzymes SBEI, SBEIIa, and SBEIIb using a triple RNAi chimeric hairpin construct we generated a virtually amylopectin-free barley. The grains of the transgenic lines were shrunken and had a yield of around 80% of the control line. The starch granules were...
Park, Chang-Su; Yang, Hee-Jong; Kim, Dong-Ho; Kang, Dae-Ook; Kim, Min-Soo; Choi, Nack-Shick
2012-06-01
A new screening method for β-(1,3-1,6) glucan hydrolase was developed using a pure β-glucan from Aureobaisidum pullulans by zymography and an LB-agar plate. Paenibacillus sp. was screened as a producer a β-glucan hydrolase on the Trypan Blue-coupled β-glucan LB-agar plate and the activity of the enzyme was analyzed by SDS-β-glucan zymography. The β-glucan was not hydrolyzed by Bacillus spp. strains, which exhibit cellulolytic activity on CMC zymography. The gene, obtaining by shotgun cloning and encoding the β-glucan hydrolase of Paenibacillus sp. was sequenced.
Factors influencing beta-amylase activity in sorghum malt
CSIR Research Space (South Africa)
Taylor, JRN
1993-09-01
Full Text Available isozyme of pI approximately 4.4-4.5, unlike the many isozymes all of higher pI in barley. However, like barley, sorghum beta-amylase was more temperature-labile than its alpha-amylase. Beta-amylase activity in sorghum malt was increased by germination time...
Breeding cultivars of barley and mustard containing biochemical mutants
International Nuclear Information System (INIS)
Oram, R.N.
1990-01-01
Full text: The inactivation of dominant and co-dominant alleles is becoming increasingly important in changing the composition of seed carbohydrates, protein, oil, fibre and secondary products to suit modern food and feed technologies. In barley, breeding lines adapted to south-eastern Australian conditions have been developed containing a waxy endosperm from the Japanese variety 'Sumire Mochi', the high lysine gene lys from cv. 'Hiproly' of Ethiopia, and the induced high lysine mutant gene lys 3a from 'Risoe 1508'. The improved mutant lines yield 12-34% less than the highest yielding feed barley. The lys and lys 3a alleles suppress the formation of prolamins, the waxy allele inhibits the formation of amylose. It seems difficult to modify the background genotype to fully compensate for the reduction of major storage carbohydrate or protein compounds. However, waxy barleys have uses in some human foods and a premium can be paid to producers. The grain of the provisionally-patented waxy cultivar Wasiro is suitable for pearling. It contains 5% β-glucan (soluble fibre) and therefore should be as effective as oat bran for reducing blood cholesterol. In Indian mustard (Brassica juncea), three cultivars differing in date of maturity, each containing the spontaneous mutant alleles for low erucic acid levels in the seed oil, have been developed to produce a high quality, mildly flavoured cooking/salad oil. The concentration of glucosinolates in the seed meal must be reduced to make it palatable and non-toxic to pigs and poultry. Three B. juncea lines were treated in up to four successive generations with gamma rays or EMS. 60,000 seed samples were analysed in subsequent generations. Two induced mutants with reduced glucosinolate concentrations are now available besides 4 naturally-occurring sources with only little reduced yields. Recombination may give a high-yielding low erucic acid and low glucosinolate variety of B. juncea. (author)
High-throughput Agrobacterium-mediated barley transformation
Directory of Open Access Journals (Sweden)
Snape John W
2008-09-01
Full Text Available Abstract Background Plant transformation is an invaluable tool for basic plant research, as well as a useful technique for the direct improvement of commercial crops. Barley (Hordeum vulgare is the fourth most abundant cereal crop in the world. It also provides a useful model for the study of wheat, which has a larger and more complex genome. Most existing barley transformation methodologies are either complex or have low ( Results A robust, simple and reproducible barley transformation protocol has been developed that yields average transformation efficiencies of 25%. This protocol is based on the infection of immature barley embryos with Agrobacterium strain AGL1, carrying vectors from the pBract series that contain the hpt gene (conferring hygromycin resistance as a selectable marker. Results of large scale experiments utilising the luc (firefly luciferase gene as a reporter are described. The method presented here has been used to produce hundreds of independent, transgenic plant lines and we show that a large proportion of these lines contain single copies of the luc gene. Conclusion This protocol demonstrates significant improvements in both efficiency and ease of use over existing barley transformation methods. This opens up opportunities for the development of functional genomics resources in barley.
Beta-Glucan induced immune modulation of wound healing in common carp (Cyprinus carpio)
DEFF Research Database (Denmark)
Jiménez, Natalia Ivonne Vera
by hydrogen peroxide. To determine the effect of hydrogen peroxide release in fibroblast proliferation during wound healing, scratch-wounded CCB fibroblasts were stimulated with different doses of hydrogen peroxide and the wound closure was followed by image analysis. Fibroblast stimulation with low doses...... suitable for tissue regeneration or oxidative stress. To conclude, β-glucan treatment enhanced wound closure in carp, probably due to the enhancement of a localized inflammatory response. The wound healing modulatory effect of β-glucan seems to be orchestrated by the immune system, since no direct effect...
Directory of Open Access Journals (Sweden)
Ľubomír Mikuš
2013-02-01
Full Text Available Normal 0 21 false false false SK X-NONE X-NONE The brewer¢s yeast was used for preparation of concentrate with content of β-glucan. Hot water extraction (100°C, 5 hours and subsequently an alkaline extraction of sediment using 1 M NaOH at 90°C for 1 hour were used. β-glucan concentrate containing 59,15 % of β-glucan had good functional properties (water binding capacity 13,34 g water/1 g concentrate, fat binding capacity 6,86 g fat/1 g concentrate and indicated biological action too. At concentration of 2 mg/ml DMSO (dimethylsulfoxid was viability of murine L1210 leukemic cells reduced to 76.15 %. When observing the antioxidant activity it was identified, that the lipid peroxidation in linoleic acid samples was decreased during the presence of β-glucan concentrate. These results and good sensory properties like a bright colour and the pleasant taste and smell indicate, that prepared β-glucan concentrate has a potential to be used to improve the health – beneficial substances in the foods.doi:10.5219/258
Seniuk, Olga F; Gorovoj, Leontiy F; Beketova, Galina V; Savichuk, Hatalia O; Rytik, Petr G; Kucherov, Igor I; Prilutskay, Alla B; Prilutsky, Alexandr I
2011-01-01
The goal of this investigation was to comparatively study the efficiency of traditionally used anti-infective drugs and biopolymer complexes originated from the medicinal mushroom Fomes fomentarius (L.:Fr.) Fr.: 1) water-soluble melanin-glucan complex (MGC; -80% melanins and -20% beta-glucans) and 2) insoluble chitin-glucan-melanin complex (ChGMC; -70% chitin, -20% beta-glucans, and -10% melanins). Infectious materials (Helicobacter pylori, Candida albicans, and Herpes vulgaris I and HIV-1(zmb) were used in pure cultures of in vitro and in vivo models on experimental animals. Comparison studies of fungal biopolymers and effective modern antifungal, antibacterial, and antiviral drugs were used in in vitro models. The comparative clinical efficiency of ChGMC and of etiotropic pharmaceuticals in models of H. pylori, C. albicans, and H. vulgaris I infection contamination were studied. Using in vitro models, it was established that MGC completely depresses growth of C. albicans. MGC had an antimicrobial effect on H. pylori identical to erythromycin in all concentrations, and had a stronger action on this bacterium than other tested antibiotics. Tested MGC possesses simultaneously weak toxicity and high anti-HIV-1 activity in comparison with zidovudine (Retrovir). The obtained results show that CLUDDT therapy in Wistar rats with the application of ChGMC is, on average, 1.35-1.43 times as effective as a traditional one. Considering the absence of MGC and ChGMC toxic properties on blood cells even in very high concentrations, these complexes may be used as a source of biopolymers for the creation of essentially new agents for wide application in infectious pathology.
Boulos, Samy; Nyström, Laura
2017-11-01
The oxidation of cereal (1→3,1→4)-β-D-glucan can influence the health promoting and technological properties of this linear, soluble homopolysaccharide by introduction of new functional groups or chain scission. Apart from deliberate oxidative modifications, oxidation of β-glucan can already occur during processing and storage, which is mediated by hydroxyl radicals (HO•) formed by the Fenton reaction. We present four complementary sample preparation strategies to investigate oat and barley β-glucan oxidation products by hydrophilic interaction ultra-performance liquid chromatography-tandem mass spectrometry (UPLC-MS/MS), employing selective enzymatic digestion, graphitized carbon solid phase extraction (SPE), and functional group labeling techniques. The combination of these methods allows for detection of both lytic (C1, C3/4, C5) and non-lytic (C2, C4/3, C6) oxidation products resulting from HO•-attack at different glucose-carbons. By treating oxidized β-glucan with lichenase and β-glucosidase, only oxidized parts of the polymer remained in oligomeric form, which could be separated by SPE from the vast majority of non-oxidized glucose units. This allowed for the detection of oligomers with mid-chain glucuronic acids (C6) and carbonyls, as well as carbonyls at the non-reducing end from lytic C3/C4 oxidation. Neutral reducing ends were detected by reductive amination with anthranilic acid/amide as labeled glucose and cross-ring cleaved units (arabinose, erythrose) after enzyme treatment and SPE. New acidic chain termini were observed by carbodiimide-mediated amidation of carboxylic acids as anilides of gluconic, arabinonic, and erythronic acids. Hence, a full characterization of all types of oxidation products was possible by combining complementary sample preparation strategies. Differences in fine structure depending on source (oat vs. barley) translates to the ratio of observed oxidized oligomers, with in-depth analysis corroborating a random HO
Directory of Open Access Journals (Sweden)
A.C.C.F.F. De Paula
2005-06-01
Full Text Available ß-Glucans are soluble fibers with physiological functions, such as interference with absorption of sugars and reduction of serum lipid levels. The objective of the present study was to analyze the distribution of ß-glucans in different tissues of the African grass species Rhynchelytrum repens and also to evaluate their hypoglycemic activity. Leaf blades, sheaths, stems, and young leaves of R. repens were submitted to extraction with 4 M KOH. Analysis of the fractions revealed the presence of arabinose, glucose, xylose, and traces of rhamnose and galactose. The presence of ß-glucan in these fractions was confirmed by hydrolyzing the polymers with endo-ß-glucanase from Bacillus subtilis, followed by HPLC analysis of the characteristic oligosaccharides produced. The 4 M KOH fractions from different tissues were subjected to gel permeation chromatography on Sepharose 4B, with separation of polysaccharides with different degrees of polymerization, the highest molecular mass (above 2000 kDa being found in young leaves. The molecular mass of the leaf blade polymers was similar (250 kDa to that of maize coleoptile ß-glucan used for comparison. The 4 M KOH fraction injected into rats with streptozotocin-induced diabetes showed hypoglycemic activity, reducing blood sugar to normal levels for approximately 24 h. This performance was better than that obtained with pure ß-glucan from barley, which decreased blood sugar levels for about 4 h. These results suggest that the activity of ß-glucans from R. repens is responsible for the use of this plant extract as a hypoglycemic drug in folk medicine.
DEFF Research Database (Denmark)
Holme, Inger; Dionisio, Giuseppe; Madsen, Claus Krogh
2017-01-01
The phytase purple acid phosphatase (HvPAPhy_a) expressed during barley seed development was evaluated as transgene for overexpression in barley. The phytase was expressed constitutively driven by the cauliflower mosaic virus 35S-promoter, and the phytase activity was measured in the mature grains......, the green leaves and in the dry mature vegetative plant parts left after harvest of the grains. The T2-generation of HvPAPhy_a transformed barley showed phytase activity increases up to 19-fold (29 000 phytase units (FTU) per kg in mature grains). Moreover, also in green leaves and mature dry straw, phytase...... activities were increased significantly by 110-fold (52 000 FTU/kg) and 57-fold (51 000 FTU/kg), respectively. The HvPAPhy_a-transformed barley plants with high phytase activities possess triple potential utilities for the improvement of phosphate bioavailability. First of all, the utilization of the mature...
DEFF Research Database (Denmark)
Madsen, A. M.; Tendal, K.; Thilsing, T.
2013-01-01
occupational exposure to fungi, -glucan, and bacteria and contents of fungi, -glucan, and bacteria in nasal lavage (NAL) of greenhouse workers. We also studied whether contents of microorganisms in NAL were related to gender, time of the work week, and runny nose. NAL samples (n 135) were taken Monday morning....... The ratios of fungi in NAL between Thursday at noon and Monday morning were 14 (median value) for men and 3.5 for women. Gender had no effect on the exposure level but had a significant effect on the content of fungi, -glucan, and bacteria in NAL, with the highest contents in NAL of men. On Thursdays......, the median content of fungi in NAL samples of men without runny noses was 9408 cfu per NAL sample, whereas the same content for women was 595 cfu per NAL sample. Workers with runny noses had fewer fungi in NAL than workers without runny noses. A higher content of -glucan per fungal spore was found in NAL...
DEFF Research Database (Denmark)
Müller-Uri, Frieder; Cameron-Mills, Verena; Mundy, John
2002-01-01
The barley gene (Jip23) encoding a 23,000-Da protein of unknown function was isolated and shown to be induced by jasmonate methyl ester (MeJA) in leaves. 5'upstream Jip23 sequence was isolated and fused to the beta-glucuronidase gene (GUS), and this reporter was introduced by particle bombardment...
Directory of Open Access Journals (Sweden)
Hong Liang Wang
2017-07-01
Full Text Available Objective Two experiments were conducted to determine the content of digestible energy (DE and metabolizable energy (ME as well as the apparent ileal digestibility (AID and standardized ileal digestibility (SID of crude protein (CP and amino acids (AA in barley grains obtained from Australia, France or Canada. Methods In Exp. 1, 18 growing barrows (Duroc×Landrace×Yorkshire; 31.5±3.2 kg were individually placed in stainless-steel metabolism crates (1.4×0.7×0.6 m and randomly allotted to 1 of 3 test diets. In Exp. 2, eight crossbred pigs (30.9±1.8 kg were allotted to a replicate 3×4 Youden Square designed experiment with three periods and four diets. Two pigs received each diet during each test period. The diets included one nitrogen-free diet and three test diets. Results The relative amounts of gross energy (GE, CP, and all AA in the Canadian barley were higher than those in Australian and French barley while higher concentrations of neutral detergent fiber, acid detergent fiber, total dietary fiber, insoluble dietary fiber and β-glucan as well as lower concentrations of GE and ether extract were observed in the French barley compared with the other two barley sources. The DE and ME as well as the SID of histidine, isoleucine, leucine and phenylalanine in Canadian barley were higher (p<0.05 than those in French barley but did not differ from Australian barley. Conclusion Differences in the chemical composition, energy content and the SID and AID of AA were observed among barley sources obtained from three countries. The feeding value of barley from Canada and Australia was superior to barley obtained from France which is important information in developing feeding systems for growing pigs where imported grains are used.
Wang, Hong Liang; Shi, Meng; Xu, Xiao; Ma, Xiao Kang; Liu, Ling; Piao, Xiang Shu
2017-07-01
Two experiments were conducted to determine the content of digestible energy (DE) and metabolizable energy (ME) as well as the apparent ileal digestibility (AID) and standardized ileal digestibility (SID) of crude protein (CP) and amino acids (AA) in barley grains obtained from Australia, France or Canada. In Exp. 1, 18 growing barrows (Duroc×Landrace×Yorkshire; 31.5±3.2 kg) were individually placed in stainless-steel metabolism crates (1.4×0.7×0.6 m) and randomly allotted to 1 of 3 test diets. In Exp. 2, eight crossbred pigs (30.9±1.8 kg) were allotted to a replicate 3×4 Youden Square designed experiment with three periods and four diets. Two pigs received each diet during each test period. The diets included one nitrogen-free diet and three test diets. The relative amounts of gross energy (GE), CP, and all AA in the Canadian barley were higher than those in Australian and French barley while higher concentrations of neutral detergent fiber, acid detergent fiber, total dietary fiber, insoluble dietary fiber and β-glucan as well as lower concentrations of GE and ether extract were observed in the French barley compared with the other two barley sources. The DE and ME as well as the SID of histidine, isoleucine, leucine and phenylalanine in Canadian barley were higher (penergy content and the SID and AID of AA were observed among barley sources obtained from three countries. The feeding value of barley from Canada and Australia was superior to barley obtained from France which is important information in developing feeding systems for growing pigs where imported grains are used.
A high throughput colorimetric assay of β-1,3-D-glucans by Congo red dye.
Semedo, Magda C; Karmali, Amin; Fonseca, Luís
2015-02-01
Mushroom strains contain complex nutritional biomolecules with a wide spectrum of therapeutic and prophylactic properties. Among these compounds, β-d-glucans play an important role in immuno-modulating and anti-tumor activities. The present work involves a novel colorimetric assay method for β-1,3-d-glucans with a triple helix tertiary structure by using Congo red. The specific interaction that occurs between Congo red and β-1,3-d-glucan was detected by bathochromic shift from 488 to 516 nm (>20 nm) in UV-Vis spectrophotometer. A micro- and high throughput method based on a 96-well microtiter plate was devised which presents several advantages over the published methods since it requires only 1.51 μg of polysaccharides in samples, greater sensitivity, speed, assay of many samples and very cheap. β-D-Glucans of several mushrooms (i.e., Coriolus versicolor, Ganoderma lucidum, Pleurotus ostreatus, Ganoderma carnosum, Hericium erinaceus, Lentinula edodes, Inonotus obliquus, Auricularia auricular, Polyporus umbellatus, Cordyseps sinensis, Agaricus blazei, Poria cocos) were isolated by using a sequence of several extractions with cold and boiling water, acidic and alkaline conditions and quantified by this microtiter plate method. FTIR spectroscopy was used to study the structural features of β-1,3-D-glucans in these mushroom samples as well as the specific interaction of these polysaccharides with Congo red. The effect of NaOH on triple helix conformation of β-1,3-D-glucans was investigated in several mushroom species. Copyright © 2014 Elsevier B.V. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Apiwatanapiwat, Waraporn; Rugthaworn, Prapassorn [Japan International Research Center for Agricultural Sciences (JIRCAS), Tsukuba, Ibaraki (Japan). Post-Harvest Science and Technology Div.; Kasetsart Univ., Bangkok (Thailand). Nanotechnology and Biotechnology Div.; Murata, Yoshinori; Kosugi, Akihiko; Arai, Takamitsu; Mori, Yutaka [Japan International Research Center for Agricultural Sciences (JIRCAS), Tsukuba, Ibaraki (Japan). Post-Harvest Science and Technology Div.; Yamada, Ryosuke; Kondo, Akihiko [Kobe Univ. (Japan). Dept. of Chemical Science and Engineering
2011-04-15
In order to develop a method for producing fuel ethanol from cassava pulp using cell surface engineering (arming) technology, an arming yeast co-displaying {alpha}-amylase ({alpha}-AM), glucoamylase, endoglucanase, cellobiohydrase, and {beta}-glucosidase on the surface of the yeast cells was constructed. The novel yeast strain, possessing the activities of all enzymes, was able to produce ethanol directly from soluble starch, barley {beta}-glucan, and acid-treated Avicel. Cassava is a major crop in Southeast Asia and used mainly for starch production. In the starch manufacturing process, large amounts of solid wastes, called cassava pulp, are produced. The major components of cassava pulp are starch (approximately 60%) and cellulose fiber (approximately 30%). We attempted simultaneous saccharification and ethanol fermentation of cassava pulp with this arming yeast. During fermentation, ethanol concentration increased as the starch and cellulose fiber substrates contained in the cassava pulp decreased. The results clearly showed that the arming yeast was able to produce ethanol directly from cassava pulp without addition of any hydrolytic enzymes. (orig.)
Prebiotic and synbiotic effects on rats fed malted barley with selected bacteria strains
Directory of Open Access Journals (Sweden)
Yadong Zhong
2014-10-01
Full Text Available Background: Butyric acid, one of the key products formed when β-glucans are degraded by the microbiota in the colon, has been proposed to be important for colonic health. Glutamine bound to the fibre may have similar effects once it has been liberated from the fibre in the colon. Both β-glucans and glutamine are found in high amounts in malted barley. Lactobacillus rhamnosus together with malt has been shown to increase the formation of butyric acid further in rats. Objective: To investigate whether Lactobacillus rhamnosus 271, Lactobacillus paracasei 87002, Lactobacillus plantarum HEAL 9 and 19, and Bifidobacterium infantis CURE 21 affect the levels of short-chain fatty acids and glutamine in caecum and portal blood of rats fed barley malt. Design: The experimental diets were fed for 12 days. The daily dose of the probiotic strain was 1×109 colony forming units and the intake of fibre 0.82 g/day. Results: The malt mostly contained insoluble fibre polymers (93%, consisting of glucose and xylose (38–41 g/kg and some arabinose (21 g/kg. The fibre polysaccharides were quite resistant to fermentation in the rats, regardless of whether or not probiotics were added (25–30% were fermented. Caecal and portal levels of acetic acid decreased in the rats after the addition of L. plantarum HEAL 9 and L. rhamnosus 271, and also the levels of butyric acid. Viable counts of Lactobacillus, Bifidobacterium and Enterobacteriaceae were unaffected, while the caecal composition of Lactobacilli was influenced by the type of strain administrated. Portal levels of glutamine were unchanged, but glycine levels increased with L. plantarum HEAL 9 and 19 and phenylalanine with L. rhamnosus 271. Conclusions: Although the probiotic strains survived and reached the caecum, except B. infantis CURE 21, there were no effects on viable counts or in the fermentation of different fibre components, but the formation of some bacterial metabolites decreased. This may be due to
Gao, Chenfei; King, Michael L.; Fitzpatrick, Zachary L.; Wei, Wenqian; King, Jason F.; Wang, Mingming; Greenway, Frank L.; Finley, John W.; Burton, Jeffrey H.; Johnson, William D.; Keenan, Michael J.; Enright, Frederick M.; Martin, Roy J.; Zheng, Jolene
2016-01-01
Prowashonupana barley (PWB) is high in β-glucan with moderate content of resistant starch. PWB reduced intestinal fat deposition (IFD) in wild type Caenorhabditis elegans (C. elegans, N2), and in sir-2.1 or daf-16 null mutants, and sustained a surrogate marker of lifespan, pharyngeal pumping rate (PPR), in N2, sir-2.1, daf-16, or daf-16/daf-2 mutants. Hyperglycaemia (2% glucose) reversed or reduced the PWB effect on IFD in N2 or daf-16/daf-2 mutants with a sustained PPR. mRNA expression of cpt-1, cpt-2, ckr-1, and gcy-8 were dose-dependently reduced in N2 or daf-16 mutants, elevated in daf-16/daf-2 mutants with reduction in cpt-1, and unchanged in sir-2.1 mutants. mRNA expressions were increased by hyperglycaemia in N2 or daf-16/daf-2 mutants, while reduced in sir-2.1 or daf-16 mutants. The effects of PWB in the C. elegans model appeared to be primarily mediated via sir-2.1, daf-16, and daf-16/daf-2. These data suggest that PWB and β-glucans may benefit hyperglycaemia-impaired lipid metabolism. PMID:27721901
Nielsen, Morten M; Bozonnet, Sophie; Seo, Eun-Seong; Mótyán, János A; Andersen, Joakim M; Dilokpimol, Adiphol; Abou Hachem, Maher; Gyémánt, Gyöngyi; Naested, Henrik; Kandra, Lili; Sigurskjold, Bent W; Svensson, Birte
2009-08-18
Some polysaccharide processing enzymes possess secondary carbohydrate binding sites situated on the surface far from the active site. In barley alpha-amylase 1 (AMY1), two such sites, SBS1 and SBS2, are found on the catalytic (beta/alpha)(8)-barrel and the noncatalytic C-terminal domain, respectively. Site-directed mutagenesis of Trp(278) and Trp(279), stacking onto adjacent ligand glucosyl residues at SBS1, and of Tyr(380) and His(395), making numerous ligand contacts at SBS2, suggested that SBS1 and SBS2 act synergistically in degradation of starch granules. While SBS1 makes the major contribution to binding and hydrolysis of starch granules, SBS2 exhibits a higher affinity for the starch mimic beta-cyclodextrin. Compared to that of wild-type AMY1, the K(d) of starch granule binding by the SBS1 W278A, W279A, and W278A/W279A mutants thus increased 15-35 times; furthermore, the k(cat)/K(m) of W278A/W279A was 2%, whereas both affinity and activity for Y380A at SBS2 were 10% of the wild-type values. Dual site double and triple SBS1/SBS2 substitutions eliminated binding to starch granules, and the k(cat)/K(m) of W278A/W279A/Y380A AMY1 was only 0.4% of the wild-type value. Surface plasmon resonance analysis of mutants showed that beta-cyclodextrin binds to SBS2 and SBS1 with K(d,1) and K(d,2) values of 0.07 and 1.40 mM, respectively. A model that accounts for the observed synergy in starch hydrolysis, where SBS1 and SBS2 bind ordered and free alpha-glucan chains, respectively, thus targeting the enzyme to single alpha-glucan chains accessible for hydrolysis, is proposed. SBS1 and SBS2 also influence the kinetics of hydrolysis for amylose and maltooligosaccharides, the degree of multiple attack on amylose, and subsite binding energies.
Boonvitthya, Nassapat; Tanapong, Phatrapan; Kanngan, Patcharaporn; Burapatana, Vorakan; Chulalaksananukul, Warawut
2012-10-01
The glucan 1,3-beta-glucosidase A gene (exgA) from Aspergillus oryzae and fused to the Saccharomyces cerevisiae signal peptide (α-factor) was expressed under the control of either a constitutive (GAP) or an inducible (AOX1) promoter in Pichia pastoris. A 1.4-fold higher extracellular enzyme activity (2 U/ml) was obtained using the AOX1 inducible expression system than with the GAP constitutive promoter (1.4 U/ml). The purified recombinant ExgA enzyme, with a yield of 10 mg protein/l culture supernatant, was about 40 kDa by SDS-PAGE analysis with a specific activity of 289 U/mg protein. The enzyme was optimally active at 35 °C and pH 5.0 and displayed a K(M) and V(max) of 0.56 mM and 10,042 μmol/(min mg protein), respectively, with p-nitrophenyl-β-D-glucopyranoside as the substrate. Moreover, it was tolerant to glucose inhibition with a K(i) of 365 mM.
Gong, Lingxiao; Cao, Wenyan; Gao, Jie; Wang, Jing; Zhang, Huijuan; Sun, Baoguo; Yin, Meng
2018-04-01
The gut microbiota has recently become a new route for research at the intersection of diet and human health. The aim of this study was to investigate whether whole Tibetan hull-less barley (WHB) and refined Tibetan hull-less barley (RHB) caused differentiation of the fecal microbiota in vitro. The microbiota-accessible ingredients in the 2 barley samples were studied using an in vitro enzymatic digestion procedure. After in vitro digestion, insoluble dietary fiber, phenolic compounds, proteins, and β-glucans were 93.2%, 103.4%. 18.8%, and 10.2% higher provided by WHB flour as compared with RHB flour based on the same mass amount. However, due to the significantly higher content of insoluble dietary fiber, WHB digesta had lower percentage contents of fast fermentable substrates including dietary fiber and starch as compared with RHB digesta. The results of Next-generation sequencing of the bacterial 16SrRNA gene showed that both WHB and RHB fermentation had significantly promoted the growth of Bifidobacterium and inhibited the growth of pathogenic bacteria such as Dorea, Escherichia, Oscillopira, and Ruminococcus. Moreover, in response to WHB fermentation, the relative abundance of Bifidobacterium increased by 78.5% and 92.8% as compared with RHB and fructo-oligosaccharides (FOs). Both WHB and RHB are good sources of fermentable dietary fiber with the ability to yield high concentration of short chain fatty acids (SCFAs) as compared to FOs. However, the higher fraction of soluble fiber in RHB digesta increase higher amounts of SCFA compared with WHB digesta. Our findings shed light on the complex interactions of whole cereals with gut microbiota and the possible impact on host health. Until now, only few reports have regarded the impact of in vitro digestion in components of whole grain with complex food matrix. Moreover, our findings shed light on the complex interactions of whole cereals with gut microbiota and the possible impact on host health. © 2018
Directory of Open Access Journals (Sweden)
Vidyasagar Devaprasad Dedeepiya
2012-01-01
Full Text Available Beta Glucan food supplements have been reported to be of benefit in diabetes and hyperlipidemia. We report a pilot study of the effects of Nichi Glucan, 1, 3-1, 6 Beta Glucan food supplement, in lowering the blood glucose and lipid levels in three patients with noninsulin-dependent diabetes mellitus (NIDDM from India. These patients had increased blood glucose and lipid levels inspite of routine antidiabetic and lipid level lowering medications. Each of the participants took 1.5 g of Nichi Glucan per day with food for two months along with their routine medications. The relevant parameters to assess glycemic status and lipid levels were calculated at the baseline and at the end of two months. After two months of continuous consumption, in one patient, the HbA1c decreased from 9.1% to 7.8%, and the glycemic target of HbA1c <6.5% laid down by the International Diabetes Federation was reached in two patients. Lipid levels also decreased significantly. Based on our findings, Nichi Glucan food supplement can be considered along with routine medications in patients with Type II diabetes with hyperlipidemia. Further studies are needed to validate the results.
Holme, Inger Baeksted; Dionisio, Giuseppe; Madsen, Claus Krogh; Brinch-Pedersen, Henrik
2017-04-01
The phytase purple acid phosphatase (HvPAPhy_a) expressed during barley seed development was evaluated as transgene for overexpression in barley. The phytase was expressed constitutively driven by the cauliflower mosaic virus 35S-promoter, and the phytase activity was measured in the mature grains, the green leaves and in the dry mature vegetative plant parts left after harvest of the grains. The T 2 -generation of HvPAPhy_a transformed barley showed phytase activity increases up to 19-fold (29 000 phytase units (FTU) per kg in mature grains). Moreover, also in green leaves and mature dry straw, phytase activities were increased significantly by 110-fold (52 000 FTU/kg) and 57-fold (51 000 FTU/kg), respectively. The HvPAPhy_a-transformed barley plants with high phytase activities possess triple potential utilities for the improvement of phosphate bioavailability. First of all, the utilization of the mature grains as feed to increase the release of bio-available phosphate and minerals bound to the phytate of the grains; secondly, the utilization of the powdered straw either directly or phytase extracted hereof as a supplement to high phytate feed or food; and finally, the use of the stubble to be ploughed into the soil for mobilizing phytate-bound phosphate for plant growth. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.
Damiran, D; Yu, P
2011-10-01
To date, no study has been done of molecular structures in relation to nutrient degradation kinetics and intestinal availability in dairy cattle. The objectives of this study were to (1) reveal molecular structures of hulless barley affected by structural alteration using molecular spectroscopy (diffuse reflectance infrared Fourier transform) as a novel approach, and (2) quantify structure features on a molecular basis in relation to digestive kinetics and nutritive value in the rumen and intestine in cattle. The modeled feeds in this study were 4 types of hulless barley (HB) cultivars modified in starch traits: (a) normal starch cultivar, (b) zero-amylose waxy, (c) waxy, and (d) high-amylose. The molecular structural features were determined using diffuse reflectance infrared Fourier transform spectroscopy in the mid-infrared region (ca. 4,000-800 cm(-1)) of the electromagnetic spectrum. The items assessed included infrared intensity attributed to protein amide I (ca. 1,715-1,575 cm(-1)), amide II (ca. 1,575-1,490 cm(-1)), α-helix (ca. 1,648-1,660 cm(-1)), β-sheet (ca. 1,625-1,640 cm(-1)), and their ratio, β-glucan (ca. 1,445-1,400 cm(-1)), total carbohydrates (CHO; ca. 1,188-820 cm(-1)) and their 3 major peaks, structural carbohydrates (ca. 1,277-1,190 cm(-1)), and ratios of amide I to II and amide I to CHO. The results show that (1) the zero-amylose waxy was the greatest in amide I and II peak areas, as well as in the ratio of protein amide I to CHO among HB; (2) α-helix-to-β-sheet ratio differed among HB: the high-amylose was the greatest, the zero-amylose waxy and waxy were the intermediate, and the normal starch was the lowest; (3) HB were similar in β-glucan and CHO molecular structural makeup; (4) altered starch HB cultivars were similar to each other, but were different from the normal starch cultivar in protein molecular makeup; and (5) the rate and extent of rumen degradation of starch and protein were highly related to the molecular structural
Aghnoum, R.; Niks, R.E.
2011-01-01
Basal resistance of barley to powdery mildew is a quantitatively inherited trait that limits the growth and sporulation of barley powdery mildew pathogen by a non-hypersensitive mechanism of defense. Two experimental barley lines were developed with a very high (ErBgh) and low (EsBgh) level of basal
Zeng, Xingquan; Long, Hai; Wang, Zhuo; Zhao, Shancen; Tang, Yawei; Huang, Zhiyong; Wang, Yulin; Xu, Qijun; Mao, Likai; Deng, Guangbing; Yao, Xiaoming; Li, Xiangfeng; Bai, Lijun; Yuan, Hongjun; Pan, Zhifen; Liu, Renjian; Chen, Xin; WangMu, QiMei; Chen, Ming; Yu, Lili; Liang, Junjun; DunZhu, DaWa; Zheng, Yuan; Yu, Shuiyang; LuoBu, ZhaXi; Guang, Xuanmin; Li, Jiang; Deng, Cao; Hu, Wushu; Chen, Chunhai; TaBa, XiongNu; Gao, Liyun; Lv, Xiaodan; Abu, Yuval Ben; Fang, Xiaodong; Nevo, Eviatar; Yu, Maoqun; Wang, Jun; Tashi, Nyima
2015-01-27
The Tibetan hulless barley (Hordeum vulgare L. var. nudum), also called "Qingke" in Chinese and "Ne" in Tibetan, is the staple food for Tibetans and an important livestock feed in the Tibetan Plateau. The diploid nature and adaptation to diverse environments of the highland give it unique resources for genetic research and crop improvement. Here we produced a 3.89-Gb draft assembly of Tibetan hulless barley with 36,151 predicted protein-coding genes. Comparative analyses revealed the divergence times and synteny between barley and other representative Poaceae genomes. The expansion of the gene family related to stress responses was found in Tibetan hulless barley. Resequencing of 10 barley accessions uncovered high levels of genetic variation in Tibetan wild barley and genetic divergence between Tibetan and non-Tibetan barley genomes. Selective sweep analyses demonstrate adaptive correlations of genes under selection with extensive environmental variables. Our results not only construct a genomic framework for crop improvement but also provide evolutionary insights of highland adaptation of Tibetan hulless barley.
Yadav, S K; Luthra, Y P; Sood, D R; Aggarwal, N K
2000-01-01
Analysis of husked barleys for proanthocyanidins and malt quality attributes has shown that not a single variety is free of proanthocyanidins. The proanthocyanidins in barley grains varied from 3.85 to 4.94 mg/g as catechin equivalent. The concentration of proanthocyanidins decreased, while total soluble sugars, reducing sugars, diastatic power and beta-amylase activity increased during maltings as well as with exogenous gibberellic acid (GA3) application. Alfa 93 (two-row) and RD2560 (six-row) varieties appeared to be superior for malting and brewing purposes on the basis of proanthocyanidins, total phenols, diastatic power and beta-amylase activity. It is suggested that exogenous application of GA3 at 15 ppm may be useful for producing good quality malt from barley grains.
β-glucan extract from oat bran and its industrial importance
Ibrahim, M. N. G.; Selezneva, I. S.
2017-09-01
The β-Glucan exhibits a broad spectrum of biological activity, for example it is highly active against many chronic diseases such as diabetes millets, cancer and improper digestion. The β-Glucan is a polysaccharide of D-glucose. It has many different sources of extraction such as yeasts, cereals, fungus and some bacteria. The extraction of the β-Glucan has become so important in our days, because the β-Glucan is a natural substance which can be used in pharmaceutical products for prevention and treatment of many chronic diseases. As well, many food producers have interest to introduce the β-Glucan in many food products, like dairy, meat and bakery products. Taking into consideration the foregoing, we tried to isolate the β-Glucan from oat bran using the acid method of extraction. Some modifications were offered to increase the β-Glucan concentration in the final extract and increase the total extract yield. As a result, the extracts with two different concentrations 72 % and 90 % were obtained with the yields 3.14 % and 4.4 % respectively. It should be noted that the β-Glucan addition into food products can improve their quality and physical properties. Thus, the β-Glucan is now of great importance for maintaining the consumers health by functional food products.
Gangopadhyay, Nirupama; Hossain, Mohammad B; Rai, Dilip K; Brunton, Nigel P
2015-06-12
Oat and barely are cereal crops mainly used as animal feed and for the purposes of malting and brewing, respectively. Some studies have indicated that consumption of oat and barley rich foods may reduce the risk of some chronic diseases such as coronary heart disease, type II diabetes and cancer. Whilst there is no absolute consensus, some of these benefits may be linked to presence of compounds such as phenolics, vitamin E and β-glucan in these cereals. A number of benefits have also been linked to the lipid component (sterols, fatty acids) and the proteins and bioactive peptides in oats and barley. Since the available evidence is pointing toward the possible health benefits of oat and barley components, a number of authors have examined techniques for recovering them from their native sources. In the present review, we summarise and examine the range of conventional techniques that have been used for the purpose of extraction and detection of these bioactives. In addition, the recent advances in use of novel food processing technologies as a substitute to conventional processes for extraction of bioactives from oats and barley, has been discussed.
Directory of Open Access Journals (Sweden)
Nirupama Gangopadhyay
2015-06-01
Full Text Available Oat and barely are cereal crops mainly used as animal feed and for the purposes of malting and brewing, respectively. Some studies have indicated that consumption of oat and barley rich foods may reduce the risk of some chronic diseases such as coronary heart disease, type II diabetes and cancer. Whilst there is no absolute consensus, some of these benefits may be linked to presence of compounds such as phenolics, vitamin E and β-glucan in these cereals. A number of benefits have also been linked to the lipid component (sterols, fatty acids and the proteins and bioactive peptides in oats and barley. Since the available evidence is pointing toward the possible health benefits of oat and barley components, a number of authors have examined techniques for recovering them from their native sources. In the present review, we summarise and examine the range of conventional techniques that have been used for the purpose of extraction and detection of these bioactives. In addition, the recent advances in use of novel food processing technologies as a substitute to conventional processes for extraction of bioactives from oats and barley, has been discussed.
Directory of Open Access Journals (Sweden)
Jarmo Valaja
1997-12-01
Full Text Available The effects of variety, soil type and nitrogen (N fertilizer supply on the nutritive value of barley were studied with chemical analysis, in vitro digestibility and a growth experiment on 240 growing/finishing pigs (live-weight 25-95 kg. Twelve barley batches were formed from three varieties (two-rowed Kustaa and six-rowed Arra and Pokko grown on mould or clay soil and fertilized with either a low or normal level of N (43 or 71 kg N/ha to mould soil and 76.5 or 110 kg N/ha to clay soil. In the growth experiment all the diets contained similar amounts of barley and soya bean meal (845/120 g/kg. Variety Arra contained 21 g/kg more CP than did Pokko or Kustaa. The N fertilizer supply slightly increased the CP content of the barley samples (133 vs. 141 g/kg but decreased the amount of lysine in the protein (31 vs. 29 g/ 160g N. Regression equation showed that CP and β-glucan were positively and neutral detergen fibre content negatively related to the in vitro digestibility of N in barley samples. The content of CP and the in vitro digestibilities of dry matter and N were highest in var. Arra. The daily gain and feed conversion ratio (FCR of the pigs on Arra-based diets was better than that of those on Kustaa or Pokko (P
Directory of Open Access Journals (Sweden)
Pai-Feng Kao
2012-01-01
Full Text Available The major cell wall constituent of Ganoderma lucidum (G. lucidum is β-1,3-glucan. This study examined the polysaccharide from the residues of alkaline-extracted fruiting bodies using high-performance anion-exchange chromatography (HPAEC, and it employed nuclear magnetic resonance (NMR and mass spectrometry (MS to confirm the structures. We have successfully isolated low-molecular-weight β-1,3-glucan (LMG, in high yields, from the waste residue of extracted fruiting bodies of G. lucidum. The 3-(4,5-dimethylthiazol-2-yl-2,5-diphenyl tetrazolium bromide (MTT assay evaluated the capability of LMG to suppress H2O2-induced cell death in RAW264.7 cells, identifying that LMG protected cells from H2O2-induced damage. LMG treatment decreased H2O2-induced intracellular reactive oxygen species (ROS production. LMG also influenced sphingomyelinase (SMase activity, stimulated by cell death to induce ceramide formation, and then increase cell ROS production. Estimation of the activities of neutral and acid SMases in vitro showed that LMG suppressed the activities of both neutral and acid SMases in a concentration-dependent manner. These results suggest that LMG, a water-soluble β-1,3-glucan recycled from extracted residue of G. lucidum, possesses antioxidant capability against H2O2-induced cell death by attenuating intracellular ROS and inhibiting SMase activity.
Blandino, Massimo; Locatelli, Monica; Sovrani, Valentina; Coïsson, Jean Daniel; Rolle, Luca; Travaglia, Fabiano; Giacosa, Simone; Bordiga, Matteo; Scarpino, Valentina; Reyneri, Amedeo; Arlorio, Marco
2015-07-01
Two hulled barley varieties have been sequentially pearled for one to eight cycles, each with 5% removal. The derived fractions were analyzed for their bioactive compound content. The dietary fiber (DF) decreased from the external to the internal layers, whereas β-glucans showed an inverse trend. Deoxynivalenol contamination was concentrated in the outer layers. The total antioxidant activity (TAA) was higher in the 15-25% fractions, which were used to prepare bread. Five mixtures of refined wheat flour, with an increasing replacement of this pearled barley fraction, were compared with a control for the bioactive compound content, as well as for the rheological and physical bread properties. The inclusion of pearled fractions with up to a 10% substitution leads to a clear enhancement of the DF and TAA, with only minor detrimental effects on the physical parameters. Selected byproducts of barley pearling could be proposed as functional ingredients for bakery products rich in DF and TAA.
Defining Starch Binding by Glucan Phosphatases
DEFF Research Database (Denmark)
Auger, Kyle; Raththagala, Madushi; Wilkens, Casper
2015-01-01
Starch is a vital energy molecule in plants that has a wide variety of uses in industry, such as feedstock for biomaterial processing and biofuel production. Plants employ a three enzyme cyclic process utilizing kinases, amylases, and phosphatases to degrade starch in a diurnal manner. Starch...... is comprised of the branched glucan amylopectin and the more linear glucan amylose. Our lab has determined the first structures of these glucan phosphatases and we have defined their enzymatic action. Despite this progress, we lacked a means to quickly and efficiently quantify starch binding to glucan...
Directory of Open Access Journals (Sweden)
Schmelzer Wade
2011-08-01
Full Text Available Abstract Background Prior studies suggest soluble fibers may favorably affect glucose/insulin metabolism. Methods This prospective, randomized, placebo controlled, double blind, parallel group trial evaluated 50 generally healthy subjects without prior diagnosis of diabetes mellitus (44 completers, who were administered beverages containing placebo (control, lower dose (3 g/d, or higher dose (6 g/d reduced viscosity barley β-glucan (BBG extract. Subjects (68% women mean age 56 years, Body Mass Index (BMI 32 kg/m2 and baseline fasting plasma glucose 102 mg/dl were instructed to follow a weight-maintaining Therapeutic Lifestyle Changes (TLC diet and consumed three 11 oz study beverages daily with meals for 12 weeks. The four primary study endpoint measures were plasma glucose and insulin [each fasting and post-Oral Glucose Tolerance Testing (OGTT]. Results Compared to placebo, administration of 3 g/d BBG over 12 weeks significantly reduced glucose incremental Area Under the Curve (iAUC measures during OGTT and 6 g/d BBG over 12 weeks significantly reduced fasting insulin as well as the related homeostasis model assessment of insulin resistance (HOMA-IR. Beverages were generally well tolerated with no serious adverse experiences and no significant differences between groups for adverse experiences. Per protocol instruction, subjects maintained body weight. Conclusions These findings suggest 6 g/d BBG consumed in a beverage over 12 weeks may improve insulin sensitivity among hyperglycemic individuals with no prior diagnosis of diabetes mellitus, and who experience no change in body weight. Trial Registration ClinicalTrials.gov Identifier: NCT01375803.
High protein mutants of winter fodder barley induced by radiation and chemical mutagens
Energy Technology Data Exchange (ETDEWEB)
Yankulov, M.; Genchev, K.; Nikolov, Kh.
1982-01-01
Several induced mutants of winter fodder barley with higher rpotein content are described. These mutants were produced by treating seeds of cvs. Vogelsaenger Gold, Ager and 468 with gamma-rays, sodium azide and ethyl methanesulfonate (alone and in combinations) and with ethylene and formamide. The gamma-ray induced mutants of winter fodder barley have 1-4% higher protein content. The mutant line 109 has, besides high protein content (17,37%), 5.96 lysine per 100 g protein, but its endosperm is wrinkeled. Mutants produced by chemical mutagens have 6-7% higher protein content than the initial cultivars. All induced mutants have 85-95 cm high stems, i.e. they are by 10-20 cm shorter than the initial cultivars. Some of these mutants are now resistant to the diseases Helminthosporium gramineum and Ustilago nuda. The recommended mutants could be successfully used in breeding programs for producing of higher protein content and quality in winter fodder barley.
High protein mutants of winter fodder barley induced by radiation and chemical mutagens
International Nuclear Information System (INIS)
Yankulov, M.; Genchev, K.; Nikolov, Kh.
1982-01-01
Several induced mutants of winter fodder barley with higher rpotein content are described. These mutants were produced by treating seeds of cvs. Vogelsaenger Gold, Ager and 468 with gamma-rays, sodium azide and ethyl methanesulfonate (alone and in combinations) and with ethylene and formamide. The gamma-ray induced mutants of winter fodder barley have 1-4% higher protein content. The mutant line 109 has, besides high protein content (17,37%), 5.96 lysine per 100 g protein, but its endosperm is wrinkeled. Mutants produced by chemical mutagens have 6-7% higher protein content than the initial cultivars. All induced mutants have 85-95 cm high stems, i.e. they are by 10-20 cm shorter than the initial cultivars. Some of these mutants are now resistant to the diseases Helminthosporium gramineum and Ustilago nuda. The recommended mutants could be successfully used in breeding programs for producing of higher protein content and quality in winter fodder barley
Drying enhances immunoactivity of spent brewer's yeast cell wall β-D-glucans.
Liepins, Janis; Kovačova, Elena; Shvirksts, Karlis; Grube, Mara; Rapoport, Alexander; Kogan, Grigorij
2015-07-20
Due to immunological activity, microbial cell wall polysaccharides are defined as 'biological response modifiers' (BRM). Cell walls of spent brewer's yeast also have some BRM activity. However, up to date there is no consensus on the use of spent brewer's yeast D-glucan as specific BRM in humans or animals. The aim of this paper is to demonstrate the potential of spent brewer's yeast β-D-glucans as BRM, and drying as an efficient pretreatment to increase β-D-glucan's immunogenic activity. Our results revealed that drying does not change spent brewer's yeast biomass carbohydrate content as well as the chemical structure of purified β-D-glucan. However, drying increased purified β-D-glucan TNF-α induction activity in the murine macrophage model. We presume drying pretreatment enhances purity of extracted β-D-glucan. This is corroborated with FT-IR analyses of the β-D-glucan spectra. Based on our results, we suggest that dry spent brewer's yeast biomass can be used as a cheap source for high-quality β-D-glucan extraction. Drying in combination with carboxylmethylation (CM), endows spent brewer's yeast β-D-glucan with the immunoactivity similar or exceeding that of a well-characterized fungal BRM pleuran. Copyright © 2015 Elsevier B.V. All rights reserved.
Quantitative trait loci associated with the tocochromanol (vitamin E) pathway in barley
In this study, the Genome-Wide Association Studies approach was used to detect Quantitative Trait Loci associated with tocochromanol concentrations using a panel of 1,466 barley accessions. All major tocochromanol types- alpha-, beta-, delta-, gamma-tocopherol and tocotrienol- were assayed. We found...
Spatio-temporal profiling and degradation of alpha-amylase isozymes during barley seed germination
DEFF Research Database (Denmark)
Bak-Jensen, K.S.; Laugesen, Sabrina; Østergaard, Ole
2007-01-01
Ten genes from two multigene families encode barley alpha-amylases. To gain insight into the occurrence and fate of individual isoforms during seed germination, the alpha-amylase repertoire was mapped by using a proteomics approach consisting of 2D gel electrophoresis, western blotting, and mass...... increased during germination. Assessing the fragment minimum chain length by peptide mass fingerprinting suggested that alpha-amylase 2 ( gi vertical bar 4699831) initially was cleaved just prior to domain B that protrudes from the (beta alpha)(8)-barrel between beta-strand 3 and alpha-helix 3, followed...... essentially only full-length alpha-amylase forms. While only products of the above three genes appeared by germination also of 15 other barley cultivars, the cultivars had distinct repertoires of charge and molecular mass variant forms. These patterns appeared not to be correlated with malt quality....
Asare, Eric K; Jaiswal, Sarita; Maley, Jason; Båga, Monica; Sammynaiken, Ramaswami; Rossnagel, Brian G; Chibbar, Ravindra N
2011-05-11
The relationship between starch physical properties and enzymatic hydrolysis was determined using ten different hulless barley genotypes with variable carbohydrate composition. The ten barley genotypes included one normal starch (CDC McGwire), three increased amylose starches (SH99250, SH99073, and SB94893), and six waxy starches (CDC Alamo, CDC Fibar, CDC Candle, Waxy Betzes, CDC Rattan, and SB94912). Total starch concentration positively influenced thousand grain weight (TGW) (r(2) = 0.70, p starch concentration (r(2) = -0.80, p hydrolysis of pure starch (r(2) = -0.67, p starch concentration (r(2) = 0.46, p starch (RS) in meal and pure starch samples. The rate of starch hydrolysis was high in pure starch samples as compared to meal samples. Enzymatic hydrolysis rate both in meal and pure starch samples followed the order waxy > normal > increased amylose. Rapidly digestible starch (RDS) increased with a decrease in amylose concentration. Atomic force microscopy (AFM) analysis revealed a higher polydispersity index of amylose in CDC McGwire and increased amylose genotypes which could contribute to their reduced enzymatic hydrolysis, compared to waxy starch genotypes. Increased β-glucan and dietary fiber concentration also reduced the enzymatic hydrolysis of meal samples. An average linkage cluster analysis dendrogram revealed that variation in amylose concentration significantly (p starch concentration in meal and pure starch samples. RS is also associated with B-type granules (5-15 μm) and the amylopectin F-III (19-36 DP) fraction. In conclusion, the results suggest that barley genotype SH99250 with less decrease in grain weight in comparison to that of other increased amylose genotypes (SH99073 and SH94893) could be a promising genotype to develop cultivars with increased amylose grain starch without compromising grain weight and yield.
Molecular size estimation of plasma membrane β-glucan synthase from red beet root
International Nuclear Information System (INIS)
Sloan, M.E.; Eiberger, L.L.; Wasserman, B.P.
1986-01-01
Cellulose and cell wall β-D-glucans in higher plants are thought to be synthesized by the plasma membrane enzyme, β-glucan synthase. This enzyme has never been purified to homogeneity, hence its subunit composition is unknown. Partial purification of red beet root glucan synthase by glycerol density gradient centrifugation followed by SDS-PAGE yielded a highly enriched subunit of 68 kDa. Radiation inactivation of plasma membranes gave a molecular size the 450 kDa for the holoenzyme complex. This suggests that glucan synthase consists of 6 to 7 subunits and confirms electron microscope studies showing that glucan synthases exist as multi-subunit complexes embedded within the membrane
Effects of gamma irradiation on the physical and structural properties of β-glucan
International Nuclear Information System (INIS)
Byun, Eui-Hong; Kim, Jae-Hun; Sung, Nak-Yun; Choi, Jong-il; Lim, Seong-Taek; Kim, Kwang-Hoon; Yook, Hong-Sun; Byun, Myung-Woo; Lee, Ju-Woon
2008-01-01
This study was carried out to evaluate the effect of gamma irradiation on the physical and structural properties of β-glucan. β-Glucan solution (10%, w/v) was exposed to a cobalt-60 source (10, 30, and 50 kGy). Gel permeation chromatography data showed that the average molecular weight of irradiated β-glucan significantly decreased as the irradiation dose increased. In addition, gamma irradiation improved the solubility and decreased the viscosity of β-glucan by the radiolysis of the glycosidic bonds, and this effect was dependent upon the absorbed dose. Fourier transform infrared spectroscopy results showed that the functional groups of β-glucan were not significantly affected by gamma irradiation. Scanning electron microscopy results showed that the irradiated β-glucan was deformed into smaller granules. Therefore, gamma irradiation could be used in commercial processes as an effective method to resolve the physical problems involved in the use of β-glucan with high viscosity and low solubility
DEFF Research Database (Denmark)
Bagger Jørgensen, Rikke; Jensen, C. J.; Andersen, B.
1986-01-01
Callus was induced from hybrids between cultivated barley (Hordeum vulgare L. ssp. vulgare) and ten species of wild barley (Hordeum L.) as well as from one backcross line ((H. lechleri .times. H. vulgare) .times. H. vulgare). Successful callus induction and regeneration of plants were achieved from...... explants of young spikes on the barley medium J 25-8. The capacity for plant regeneration was dependent on the wild parental species. In particular, combinations with four related wild species, viz. H. jubatum, H. roshevitzii, H. lechleri, and H. procerum, regenerated high numbers of plants from calli....
International Nuclear Information System (INIS)
Okamura, S.; Matsuoka, K.; Nishimura, K.
1994-09-01
High beta experiments were performed in the low-aspect-ratio helical device CHS with the volume-averaged equilibrium beta up to 2.1 %. These values (highest for helical systems) are obtained for high density plasmas in low magnetic field heated with two tangential neutral beams. Confinement improvement given by means of turning off gas puffing helped significantly to make high betas. Magnetic fluctuations increased with increasing beta, but finally stopped to increase in the beta range > 1 %. The coherent modes appearing in the magnetic hill region showed strong dependence on the beta values. The dynamic poloidal field control was applied to suppress the outward plasma movement with the plasma pressure. Such an operation gave fixed boundary operations of high beta plasmas in helical systems. (author)
Liu, Yanfang; Tang, Qingjiu; Yang, Yan; Zhou, Shuai; Wu, Di; Tang, Chuanhong; Zhang, Zhong; Yan, Mengqiu; Feng, Jie; Zhang, Jing-Song
2017-01-01
Molecular weight (Mw) distributions of polysaccharides from the fruiting bodies of different Ganoderma lucidum strains and G. sinense were investigated and compared using high-pressure size exclusion chromatography/multiangle laser light scattering/refractive index analysis. Results showed that there were big differences in the Mw distributions and characteristics of polysaccharides from 2 species of Ganoderma. All tested G. lucidum materials exhibited similar polysaccharide distributions and similar characteristics for each fraction. The fraction with highest Mw (peak 1) was identified as β-(1→3)-linked D-glucan with (1→6)-β-D-glucopyranosyl side branches. G. sinense fruiting bodies did not include the β-D-glucan when compared with G. lucidum. A high-pressure size exclusion chromatography method was developed and applied to determine the amount of high-Mw β-D-glucan in G. lucidum fruiting bodies. Results indicated that there was no obvious relationship between β-D-glucan content and the genetic similarity of G. lucidum. The strain labeled "Longzhi no. 2" was determined to possess the largest amount of β-D-glucan: 8.2 mg/mL based on the dry weight of fruiting bodies. The β-D-glucan content in the hot water extract of Longzhi no. 2 reached 17.05%. For the "Hunong no. 1" strain, the β-D-glucan content in log-cultivated fruiting bodies was much higher than that in bag-cultivated ones. This method could be used to improve quality control of polysaccharides in G. lucidum.
Plants with elevated levels of glucan
Energy Technology Data Exchange (ETDEWEB)
Pauly, Markus; Kraemer, Florian J.; Hake, Sarah
2018-03-20
The present disclosure relates to mutations in licheninase genes encoding polypeptides with decreased licheninase activity, which when expressed in plants results in elevated levels of glucan in the plants. In particular, the disclosure relates to licheninase nucleic acids and polypeptides related to glucan accumulation in plants, plants with reduced expression of a licheninase nucleic acid, and methods related to the generation of plants with increased glucan content in the cell walls of leaf tissue.
Energy Technology Data Exchange (ETDEWEB)
Lacerda, Camila Maria de Sousa; Reis, Mariana Flister; Correa, Cristiane Rodrigues; Andrade, Antero S.R., E-mail: cmsl@cdtn.br, E-mail: antero@cdtn.br [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN/CNEM-MG), Belo Horizonte, MG (Brazil)
2013-07-01
Invasive fungal infections caused by Candida albicans, are recognized as a major cause of morbidity and mortality in immuno compromised individuals. Patients may not show obvious clinical signs or symptoms, making it difficult to detect its origin or new focus that developed through hematogenous spread. Nuclear medicine could contribute to an early diagnosis of fungal infections, since specific markers are available. The aim of this study was to develop, through SELEX technique (Systematic Evolution of Ligands by Exponential Enrichment), aptamers for beta glucan for subsequent labeling with {sup 99}mTc and evaluation of this radiopharmaceutical in the diagnosis of invasive fungal infections, scintigraphy. To obtain aptamers were performed 15 cycles of SELEX technique, using centrifugation as separation method of oligonuclotideos linked to the beta-glucan is not connected. The DNA bands were observed in all 15 cycles. The oligonucleotides obtained after cycles were cloned using the standard protocol kit-Topo TA vector (Invitrogen), and subjected to sequencing Megabase. Three aptamers for yeast cells were selected for this study. Further, other studies should be performed to assess the specificity and affinity thereof for later use in the diagnosis of fungal infections. (author)
International Nuclear Information System (INIS)
Lacerda, Camila Maria de Sousa; Reis, Mariana Flister; Correa, Cristiane Rodrigues; Andrade, Antero S.R.
2013-01-01
Invasive fungal infections caused by Candida albicans, are recognized as a major cause of morbidity and mortality in immuno compromised individuals. Patients may not show obvious clinical signs or symptoms, making it difficult to detect its origin or new focus that developed through hematogenous spread. Nuclear medicine could contribute to an early diagnosis of fungal infections, since specific markers are available. The aim of this study was to develop, through SELEX technique (Systematic Evolution of Ligands by Exponential Enrichment), aptamers for beta glucan for subsequent labeling with 99 mTc and evaluation of this radiopharmaceutical in the diagnosis of invasive fungal infections, scintigraphy. To obtain aptamers were performed 15 cycles of SELEX technique, using centrifugation as separation method of oligonuclotideos linked to the beta-glucan is not connected. The DNA bands were observed in all 15 cycles. The oligonucleotides obtained after cycles were cloned using the standard protocol kit-Topo TA vector (Invitrogen), and subjected to sequencing Megabase. Three aptamers for yeast cells were selected for this study. Further, other studies should be performed to assess the specificity and affinity thereof for later use in the diagnosis of fungal infections. (author)
McFarlin, Brian K; Carpenter, Katie C; Davidson, Tiffany; McFarlin, Meredith A
2013-09-01
Strenuous exercise, such as running a marathon, is known to suppress mucosal immunity for up to 24 hr, which can increase the risk of developing an upper respiratory tract infection (URTI) and reduced performance capacity (Allgrove JE, Geneen L, Latif S, Gleeson M. Influence of a fed or fasted state on the s-IgA response to prolonged cycling in active men and women. Int J Sport Nutr Exerc Metab. 2009;19(3):209-221; Barrett B, Locken K, Maberry R, Schwamman J, Brown R, Bobula J, Stauffacher EA. The Wisconsin Upper Respiratory Symptom Survey (WURSS): a new research instrument for assessing the common cold. J Fam Pract. 2002;51(3):265; Carpenter KC, Breslin WL, Davidson T, Adams A, McFarlin BK. Baker's yeast beta glucan supplementation increases monocytes and cytokines post-exercise: implications for infection risk? Br J Nutr. 2012;1-9). While many dietary interventions have been used to combat postexercise immune suppression, most have been ineffective. The key purpose of this study was to determine if baker's yeast β-glucan (BG) could positively affect the immune system of individuals undergoing intense exercise stress using two experiments. In the first (E1; N = 182 men and women), BG was compared to placebo supplementation for the incidence of URTI symptoms for 28 days postmarathon. In the second (E2; N = 60 men and women) changes in salivary immunoglobulin A (IgA) were evaluated after 50-min of strenuous cycling when participants had been supplemented for 10 days with either BG (250 mg/day) or placebo (rice flour). For E1, subjects reported URTI symptoms using a daily health log. For E2, saliva was collected prior to, immediately, and 2-hr postexercise using a salivette. Data for E1 and E2 were analyzed using separate analyses of variance (ANOVAs) with repeated measures (p flu symptom days postmarathon compared to placebo (p = .026). In E2, BG was associated with a 32% increase in salivary IgA (p = .048) at 2 hr after exercise compared to placebo. In summary
Glucan: mechanisms involved in its radioprotective effect
International Nuclear Information System (INIS)
Patchen, M.L.; D'Alesandro, M.M.; Brook, I.; Blakely, W.F.; MacVittie, T.J.
1987-01-01
It has generally been accepted that most biologically derived agents that are radioprotective in the hemopoietic-syndrome dose range (eg, endotoxin, Bacillus Calmette Guerin, Corynebacterium parvum, etc) exert their beneficial properties by enhancing hemopoietic recovery and hence, by regenerating the host's ability to resist life-threatening opportunistic infections. However, using glucan as a hemopoietic stimulant/radioprotectant, we have demonstrated that host resistance to opportunistic infection is enhanced in these mice even prior to the detection of significant hemopoietic regeneration. This early enhanced resistance to microbial invasion in glucan-treated irradiated mice could be correlated with enhanced and/or prolonged macrophage (but not granulocyte) function. These results suggest that early after irradiation glucan may mediate its radioprotection by enhancing resistance to microbial invasion via mechanisms not necessarily predicated on hemopoietic recovery. In addition, preliminary evidence suggests that glucan can also function as an effective free-radical scavenger. Because macrophages have been shown to selectively phagocytize and sequester glucan, the possibility that these specific cells may be protected by virtue of glucan's scavenging ability is also suggested
Directory of Open Access Journals (Sweden)
Weitberg Alan B
2008-09-01
Full Text Available Abstract β-(1,3/(1,6 D-glucan, a component of the fungal cell wall, has been shown to stimulate the immune system, enhance hematopoiesis, amplify killing of opsonized tumor cells and increase neutrophil chemotaxis and adhesion. In view of these attributes, the β-glucans should be studied for both their therapeutic efficacy in patients with cancer as well as an adjunctive therapy in patients receiving chemotherapy as a maneuver to limit suppression of hematopoiesis. In this study, twenty patients with advanced malignancies receiving chemotherapy were given a β-(1,3/(1,6 D-glucan preparation (MacroForce plus IP6, ImmuDyne, Inc. and monitored for tolerability and effect on hematopoiesis. Our results lead us to conclude that β-glucan is well-tolerated in cancer patients receiving chemotherapy, may have a beneficial effect on hematopoiesis in these patients and should be studied further, especially in patients with chronic lymphocytic leukemia and lymphoma.
Directory of Open Access Journals (Sweden)
majid kalantar
2016-04-01
Full Text Available Introduction Corn has been recently used for producing ethanol fuel in the major corn-producing countries such as the US and Brazil. Recent diversion of corn for biofuel production along with the increased world's demand for this feedstuff has resulted in unprecedented rise in feed cost for poultry worldwide. Alternative grains such as wheat and barley can be successfully replaced for corn in poultry diets. These cereal grains can locally grow in many parts of the world as they have remarkably lower water requirement than corn. Wheat and barley are generally used as major sources of energy in poultry diets. Though the major components of these grains are starch and proteins, they have considerable content of non-starch polysaccharides (NSPs, derived from the cell walls (Olukosi et al. 2007; Mirzaie et al. 2012. NSPs are generally considered as anti-nutritional factors (Jamroz et al. 2002. The content and structure of NSP polymers vary between different grains, which consequently affect their nutritive value (Olukosi et al. 2007.Wheat and barley are generally used as major sources of energy in poultry diets. The major components of these grains are starch and proteins, they have considerable content of non-starch polysaccharides (NSPs, derived from the cell walls. NSPs are generally considered as anti-nutritional factors. The content and structure of NSP polymers vary between different grains, which consequently affect their nutritive value. The major part of NSPs in barley comprises polymers of (1→3 (1→4-β- glucans which could impede growth factors and consequently carcass quality through lowering the rate and amount of available nutrients in the mucosal surface of the intestinal. Materials and Methods This experiment was conducted to evaluate the effect of corn and barley based diets supplemented with multi-enzyme on growth, carcass, pancreas enzyme activity and physiological characteristics of broilers. A total number of 375 one day old
Directory of Open Access Journals (Sweden)
Filip Pošćić
2016-06-01
Full Text Available The implications of metal nanoparticles (MeNPs are still unknown for many food crops. The purpose of this study was to evaluate the effects of cerium oxide (nCeO2 and titanium oxide (nTiO2 nanoparticles in soil at 0, 500 and 1000 mg·kg−1 on the nutritional parameters of barley (Hordeum vulgare L. kernels. Mineral nutrients, amylose, β-glucans, amino acid and crude protein (CP concentrations were measured in kernels. Whole flour samples were analyzed by ICP-AES/MS, HPLC and Elemental CHNS Analyzer. Results showed that Ce and Ti accumulation under MeNPs treatments did not differ from the control treatment. However, nCeO2 and nTiO2 had an impact on composition and nutritional quality of barley kernels in contrasting ways. Both MeNPs left β-glucans unaffected but reduced amylose content by approximately 21%. Most amino acids and CP increased. Among amino acids, lysine followed by proline saw the largest increase (51% and 37%, respectively. Potassium and S were both negatively impacted by MeNPs, while B was only affected by 500 mg nCeO2·kg−1. On the contrary Zn and Mn concentrations were improved by 500 mg nTiO2·kg−1, and Ca by both nTiO2 treatments. Generally, our findings demonstrated that kernels are negatively affected by nCeO2 while nTiO2 can potentially have beneficial effects. However, both MeNPs have the potential to negatively impact malt and feed production.
Directory of Open Access Journals (Sweden)
Harry J. Wichers
2010-08-01
Full Text Available An a-glucan was isolated from the culinary medicinal mushroom A. bisporus by hot water extraction, ethanol precipitation and DEAE-cellulose chromatography. The resulting material showed a single HMW peak excluded from a Sephadex G50 column that could completely be degraded by α-amylase treatment. After heating in 1% SDS a small additional peak of low MW eluted from the G50 column. The monosaccharide composition of the main peak was evaluated by HPLC, and was found to consist of a majority of glucose (97.6%, and a minor proportion of galactose (2.4%. Methylation analysis and degradation by a-amylase indicated the presence of an a-glucan with a main chain consisting of (1®4-linked units, substituted at O-6 by α-D-glucopyranose single-units in the relation 1:8. Mono- (13C-, 1H-NMR and bidimensional [1H (obs.,13C-HSQC] spectroscopy analysis confirmed the a-configuration of the Glcp residues by low frequency resonances of C-1 at d 100.6, 100.2, and 98.8 ppm and H-1 high field ones at d 5.06, 5.11, and 4.74 ppm. The DEPT-13C-NMR allowed assigning the non-substituted and O-substituted –CH2 signals at d 60.3/60.8 and 66.2 ppm, respectively. Other assignments were attributed to C-2, C-3, C-4, C-5 and C-6 of the non-reducing ends at d 71.8; 72.8; 70.0; 71.3 and 60.3/60.8 ppm, respectively. The minor proportion of galactose that was demonstrated was probably derived from a complex between the a-glucan and a low molecular weight galactan.
Phase behaviour of oat β-glucan/sodium caseinate mixtures varying in molecular weight.
Agbenorhevi, Jacob K; Kontogiorgos, Vassilis; Kasapis, Stefan
2013-05-01
The isothermal phase behaviour at 5 °C of mixtures of sodium caseinate and oat β-glucan isolates varying in molecular weight (MW) was investigated by means of phase diagram construction, rheometry, fluorescence microscopy and electrophoresis. Phase diagrams indicated that the compatibility of the β-glucan/sodium caseinate system increases as β-glucan MW decreases. Images of mixtures taken at various biopolymer concentrations revealed phase separated domains. Results also revealed that at the state of thermodynamic equilibrium, lower MW samples yielded considerable viscosity in the mixture. At equivalent hydrodynamic volume of β-glucan in the mixtures, samples varying in molecular weight exhibited similar flow behaviour. A deviation dependent on the protein concentration was observed for the high MW sample in the concentrated regime due to the size of β-glucan aggregates formed. Results demonstrate that by controlling the structural features of β-glucan in mixtures with sodium caseinate, informed manipulation of rheological properties in these systems can be achieved. Copyright © 2012 Elsevier Ltd. All rights reserved.
DEFF Research Database (Denmark)
Møller, Marie Sofie
Starch is the most abundant storage carbohydrate in cereal grains. It is composed primarily of amylopectin, a polymer of glucose in which α-1,4-linked glucan chains are branched with α-1,6-bonds. Enzymatic degradation of starch in germinating barley seeds involves an initial solubilisation, mainly...... in a hydrophobic cluster of LDI caused the most dramatic decreases in binding affinity. The LDI-L41G-V42D variant had close to 5×105-fold reduced affinity. The complex formation was independent of ionic strength, which was confirmed by the minor importance of two LDI arginines, Arg34 and Arg38, for the binding...
Cai, Qiu-Yan; Zhang, Xi-Zhou; Li, Ting-Xuan; Chen, Guang-Deng
2014-11-01
High P-efficiency (IS-22-30, IS-22-25) and low P-efficiency (IS-07-07) wild barley cultivars were chosen to evaluate characteristics of phosphorus uptake and utilization, and properties of phosphorus fractions in rhizosphere and non-rhizosphere in a pot experiment with 0 (CK) and 30 mg P · kg(-1) supplied as only Pi (KH2PO4), only Po (phytate) or Pi + Po (KH2PO4+ phytate). The results showed that dry matter and phosphorus accumulation of wild barley in the different treatments was ranked as Pi > Pi + Po > Po > CK. In addition, dry matter yield and phosphorus uptake of wild barley with high P-efficiency exhibited significantly greater than that with low P-efficiency. The concentration of soil available phosphorus was significantly different after application of different phosphorus sources, which was presented as Pi > Pi + Po > Po. The concentration of soil available phosphorus in high P-efficiency wild barley was significantly higher than that of low P-efficiency in the rhizosphere soil. There was a deficit in rhizosphere available phosphorus of high P-efficiency wild barley, especially in Pi and Pi+Po treatments. The inorganic phosphorus fractions increased with the increasing Pi treatment, and the concentrations of inorganic phosphorus fractions in soil were sorted as follows: Ca10-P > O-P > Fe-P > Al-P > Ca2-P > Ca8-P. The contents of Ca2-P and Ca8-P for high P-efficiency wild barley showed deficits in rhizosphere soil under each phosphorus source treatment. In addition, enrichment of Al-P and Fe-P was observed in Pi treatment in rhizosphere soil. The concentrations of organic phosphorus fractions in soil were sorted as follows: moderate labile organic phosphorus > moderate resistant, resistant organic phosphorus > labile organic phosphorus. The labile and moderate labile organic phosphorus enriched in rhizosphere soil and the greatest enrichment appeared in Pi treatment. Furthermore, the concentrations of moderate resistant organic phosphorus and resistant
Huang, Yi; Li, Ting-Xuan; Zhang, Xi-Zhou; Ji, Lin
2014-07-01
A pot experiment was conducted under low (125 mg x kg-1) and normal (250 mg x kg(-1)) nitrogen treatments. The nitrogen uptake and utilization efficiency of 22 barley cultivars were investigated, and the characteristics of dry matter production and nitrogen accumulation in barley were analyzed. The results showed that nitrogen uptake and utilization efficiency were different for barley under two nitrogen levels. The maximal values of grain yield, nitrogen utilization efficiency for grain and nitrogen harvest index were 2.87, 2.91 and 2.47 times as those of the lowest under the low nitrogen treatment. Grain yield and nitrogen utilization efficiency for grain and nitrogen harvest index of barley genotype with high nitrogen utilization efficiency were significantly greater than low nitrogen utilization efficiency, and the parameters of high nitrogen utilization efficiency genotype were 82.1%, 61.5% and 50.5% higher than low nitrogen utilization efficiency genotype under the low nitrogen treatment. Dry matter mass and nitrogen utilization of high nitrogen utilization efficiency was significantly higher than those of low nitrogen utilization efficiency. A peak of dry matter mass of high nitrogen utilization efficiency occurred during jointing to heading stage, while that of nitrogen accumulation appeared before jointing. Under the low nitrogen treatment, dry matter mass of DH61 and DH121+ was 34.4% and 38.3%, and nitrogen accumulation was 54. 8% and 58.0% higher than DH80, respectively. Dry matter mass and nitrogen accumulation seriously affected yield before jointing stage, and the contribution rates were 47.9% and 54.7% respectively under the low nitrogen treatment. The effect of dry matter and nitrogen accumulation on nitrogen utilization efficiency for grain was the largest during heading to mature stages, followed by sowing to jointing stages, with the contribution rate being 29.5% and 48.7%, 29.0% and 15.8%, respectively. In conclusion, barley genotype with high
Comparative proteomic analysis of aluminum tolerance in tibetan wild and cultivated barleys.
Directory of Open Access Journals (Sweden)
Huaxin Dai
Full Text Available Aluminum (Al toxicity is a major limiting factor for plant production in acid soils. Wild barley germplasm is rich in genetic diversity and may provide elite genes for crop Al tolerance improvement. The hydroponic-experiments were performed to compare proteomic and transcriptional characteristics of two contrasting Tibetan wild barley genotypes Al- resistant/tolerant XZ16 and Al-sensitive XZ61 as well as Al-resistant cv. Dayton. Results showed that XZ16 had less Al uptake and translocation than XZ61 and Dayton under Al stress. Thirty-five Al-tolerance/resistance-associated proteins were identified and categorized mainly in metabolism, energy, cell growth/division, protein biosynthesis, protein destination/storage, transporter, signal transduction, disease/defense, etc. Among them, 30 were mapped on barley genome, with 16 proteins being exclusively up-regulated by Al stress in XZ16, including 4 proteins (S-adenosylmethionine-synthase 3, ATP synthase beta subunit, triosephosphate isomerase, Bp2A specifically expressed in XZ16 but not Dayton. The findings highlighted the significance of specific-proteins associated with Al tolerance, and verified Tibetan wild barley as a novel genetic resource for Al tolerance.
Taste-active Components of Beers from Emmer Wheat (Triticum dicoccum Malt
Directory of Open Access Journals (Sweden)
Benedetti P.
2016-06-01
Full Text Available Emmer wheat (EW, Triticum dicoccum grows under adverse climatic and soil conditions in the hilly areas of Italy and other temperate regions. So far, EW has been used for pasta or bakery products. The malt obtained from EW was used to produce a light beer, a double malt beer, and beers with 50% (B50 and 30% (B30 EW malt combined with barley malt. These top-fermented beers showed a sweet, fruity, citrus character. The different sensory impact and chemical composition (betaglucans and flavanoids of the beers was related to the germinative energy of EW and the different proportions of malted EW and barley malt. The light beer combines the moderate alcohol (3% vol. with a good intake of natural antioxidants (total phenolic content, TPC, 85 mg l−1, whereas B50 showed a high TPC (109 mg l−1 and the highest beta-glucan content (27 mg l−1.
Zhang, Hua; Zhang, Jing; Fan, Ziluan; Zhou, Xintao; Geng, Lin; Wang, Zhenyu; Regenstein, Joe M; Xia, Zhiqiang
2017-07-28
The effects of sulfation of yeast glucans was optimized using response surface methodology. The degree of sulfation was evaluated from 0.11 to 0.75 using ion-chromatography. The structural characteristics of SYG (sulfation of yeast glucans) with a DS = 0.75 were determined using high-performance liquid chromatography/gel-permeation chromatography and finally by Fourier transform infrared spectrometry. The SYG had lower viscosity and greater solubility than the native yeast glucans, suggesting that the conformation of the SYG had significantly changed. The results also showed that SYG had a significantly greater antioxidant activity in vivo compared to native yeast glucans.
DEFF Research Database (Denmark)
Rasmussen, Peter Have; Knudsen, I.; Elmholt, S.
2002-01-01
the Hanes-Wolf transformation of the Michaelis-Menten equation. Soil samples from 6 to 13 cm depth were collected in the early spring as undisturbed blocks from 10 arable soils with different physico-chemical properties and cultivation history. Significant correlations were found between soil suppresiveness......The objective was to investigate the relationship between soil suppression of seedling blight of barley caused by Fusarium culmorum (W.G. Smith) Sacc. and the soil cellulolytic activity of beta-glucosidase, cellobiohydrolase and endocellulase. Disease suppression was investigated in bioassays...... with test soils mixed with sand, and barley seeds inoculated with F. culmorum. After 19 days, disease severity was evaluated on the barley seedlings. Soil cellulolytic activities were measured using 4-methylumbelliferyl-labelled fluorogenic substrates, and were expressed as V-max values obtained by using...
Transcriptome Sequencing in a Tibetan Barley Landrace with High Resistance to Powdery Mildew
Directory of Open Access Journals (Sweden)
Xing-Quan Zeng
2014-01-01
Full Text Available Hulless barley is an important cereal crop worldwide, especially in Tibet of China. However, this crop is usually susceptible to powdery mildew caused by Blumeria graminis f. sp. hordei. In this study, we aimed to understand the functions and pathways of genes involved in the disease resistance by transcriptome sequencing of a Tibetan barley landrace with high resistance to powdery mildew. A total of 831 significant differentially expressed genes were found in the infected seedlings, covering 19 functions. Either “cell,” “cell part,” and “extracellular region” in the cellular component category or “binding” and “catalytic” in the category of molecular function as well as “metabolic process” and “cellular process” in the biological process category together demonstrated that these functions may be involved in the resistance to powdery mildew of the hulless barley. In addition, 330 KEGG pathways were found using BLASTx with an E-value cut-off of <10−5. Among them, three pathways, namely, “photosynthesis,” “plant-pathogen interaction,” and “photosynthesis-antenna proteins” had significant matches in the database. Significant expressions of the three pathways were detected at 24 h, 48 h, and 96 h after infection, respectively. These results indicated a complex process of barley response to powdery mildew infection.
Tomasi, Ivan; Marconi, Ombretta; Sileoni, Valeria; Perretti, Giuseppe
2017-01-01
Beer wort β-glucans are high-molecular-weight non-starch polysaccharides of that are great interest to the brewing industries. Because glucans can increase the viscosity of the solutions and form gels, hazes, and precipitates, they are often related to poor lautering performance and beer filtration problems. In this work, a simple and suitable method was developed to determine and characterize β-glucans in beer wort using size exclusion chromatography coupled with a triple-detector array, which is composed of a light scatterer, a viscometer, and a refractive-index detector. The method performances are comparable to the commercial reference method as result from the statistical validation and enable one to obtain interesting parameters of β-glucan in beer wort, such as the molecular weight averages, fraction description, hydrodynamic radius, intrinsic viscosity, polydispersity and Mark-Houwink parameters. This characterization can be useful in brewing science to understand filtration problems, which are not always explained through conventional analysis. Copyright © 2016 Elsevier Ltd. All rights reserved.
6-O-Branched Oligo-β-glucan-Based Antifungal Glycoconjugate Vaccines.
Liao, Guochao; Zhou, Zhifang; Liao, Jun; Zu, Luning; Wu, Qiuye; Guo, Zhongwu
2016-02-12
With the rapid growth in fungal infections and drug-resistant fungal strains, antifungal vaccines have become an especially attractive strategy to tackle this important health problem. β-Glucans, a class of extracellular carbohydrate antigens abundantly and consistently expressed on fungal cell surfaces, are intriguing epitopes for antifungal vaccine development. β-Glucans have a conserved β-1,3-glucan backbone with sporadic β-1,3- or β-1,6-linked short glucans as branches at the 6-O-positions, and the branches may play a critical role in their immunologic functions. To study the immunologic properties of branched β-glucans and develop β-glucan-based antifungal vaccines, three branched β-glucan oligosaccharides with 6-O-linked β-1,6-tetraglucose, β-1,3-diglucose, and β-1,3-tetraglucose branches on a β-1,3-nonaglucan backbone, which mimic the structural epitopes of natural β-glucans, were synthesized and coupled with keyhole limpet hemocyanin (KLH) to form novel synthetic conjugate vaccines. These glycoconjugates were proved to elicit strong IgG antibody responses in mice. It was also discovered that the number, size, and structure of branches linked to the β-glucan backbone had a significant impact on the immunologic property. Moreover, antibodies induced by the synthetic oligosaccharide-KLH conjugates were able to recognize and bind to natural β-glucans and fungal cells. Most importantly, these conjugates elicited effective protection against systemic Candida albicans infection in mice. Thus, branched oligo-β-glucans were identified as functional epitopes for antifungal vaccine design and the corresponding protein conjugates as promising antifungal vaccine candidates.
Dimitroff, George; Little, Alan; Lahnstein, Jelle; Schwerdt, Julian G; Srivastava, Vaibhav; Bulone, Vincent; Burton, Rachel A; Fincher, Geoffrey B
2016-04-05
Cellulose synthase-like F6 (CslF6) genes encode polysaccharide synthases responsible for (1,3;1,4)-β-glucan biosynthesis in cereal grains. However, it is not clear how both (1,3)- and (1,4)-linkages are incorporated into a single polysaccharide chain and how the frequency and arrangement of the two linkage types that define the fine structure of the polysaccharide are controlled. Through transient expression in Nicotiana benthamiana leaves, two CSLF6 orthologs from different cereal species were shown to mediate the synthesis of (1,3;1,4)-β-glucans with very different fine structures. Chimeric cDNA constructs with interchanged sections of the barley and sorghum CslF6 genes were developed to identify regions of the synthase enzyme responsible for these differences. A single amino acid residue upstream of the TED motif in the catalytic region was shown to dramatically change the fine structure of the polysaccharide produced. The structural basis of this effect can be rationalized by reference to a homology model of the enzyme and appears to be related to the position and flexibility of the TED motif in the active site of the enzyme. The region and amino acid residue identified provide opportunities to manipulate the solubility of (1,3;1,4)-β-glucan in grains and vegetative tissues of the grasses and, in particular, to enhance the solubility of dietary fibers that are beneficial to human health.
Jang, Soo-Kyeong; Jeong, Hanseob; Kim, Ho-Yong; Choi, June-Ho; Kim, Jong-Hwa; Koo, Bon-Wook; Choi, In-Gyu
2017-07-01
The main purpose of this study was to investigate the glucan conversion rate after enzymatic hydrolysis depending on the treatment methods and conditions with changes in the chemical composition of treated solid fraction of Jabon Merah. The glucan conversion rate (17.4%) was not significantly improved after liquid hot water treatment (1st step) even though most of the hemicellulose was dissolved into liquid hydrolysate. Subsequently, dilute acid, organosolv, and peracetic acid treatment (2nd step) was conducted under various conditions to enhance glucan conversion. Among the 2nd step treatment, the glucan conversion rate of organosolv (max. 46.0%) and peracetic acid treatment (max. 65.9%) was increased remarkably through decomposition of acid-insoluble lignin (AIL). Finally, the glucan conversion rate and AIL content were highly correlated, which was revealed by the R-squared value (0.84), but inhibitory factors including cellulose crystallinity must be considered for advanced glucan conversion from highly recalcitrant biomasses, such as Jabon Merah. Copyright © 2017 Elsevier Ltd. All rights reserved.
International Nuclear Information System (INIS)
Dory, R.A.; Berger, D.P.; Charlton, L.A.; Hogan, J.T.; Munro, J.K.; Nelson, D.B.; Peng, Y.K.M.; Sigmar, D.J.; Strickler, D.J.
1978-01-01
MHD equilibrium, stability, and transport calculations are made to study the accessibility and behavior of ''high beta'' tokamak plasmas in the range β approximately 5 to 15 percent. For next generation devices, beta values of at least 8 percent appear to be accessible and stable if there is a conducting surface nearby
Winter barley mutants created in the Ukraine
International Nuclear Information System (INIS)
Zayats, O.M.
2001-01-01
Full text: Increasing fodder and protein production is one of the objectives of the development of agriculture in Ukraine. Higher productivity of fodder crops, due to new highly productive varieties, is the means to meet this aim. Winter barley is an important crop for fodder purposes. The climate of the Ukraine is favourable for growing this crop. The areas used for the growth of winter barley are however, small (500,000-550,000 ha) and there is a shortage of good quality varieties. The main aim of the work was therefore to create new varieties of highly productive winter barley, of good quality. The new varieties and mutation lines of winter barley were created under the influence of water solutions of N-nitroso-N-methylurea (NMH - 0,012, 0,005%), N-nitroso-N-ethylurea (NEH - 0,05; 0.025; 0,012%) ethyleneimine (EI - 0,02; 0,01; 0,005%) on winter barley seeds of the varieties of local and foreign selections. On the basis of many years of investigations (1984-94) the following mutations were described: hard-grained, winter-hardiness, earliness, middle-maturity, late-maturity, wide and large leaves, narrow leaves, multinodal, great number of leaves, great number of flowers, strong stem (lodging resistant), tallness, semi-dwarfness, dwarfness, and high productivity. Particularly valuable are mutants with high productivity of green bulk. Their potential yield is 70 t/ha. As a result of the work two varieties of winter barley 'Shyrokolysty' and 'Kormovy' were released into the State register of plant varieties of the Ukraine. The other valuable mutant genotypes are used in cross breeding programmes. (author)
Directory of Open Access Journals (Sweden)
Taiki Kobayashi
Full Text Available It has been believed that isoamylase (ISA-type α-glucan debranching enzymes (DBEs play crucial roles not only in α-glucan degradation but also in the biosynthesis by affecting the structure of glucans, although molecular basis on distinct roles of the individual DBEs has not fully understood. In an attempt to relate the roles of DBEs to their chain-length specificities, we analyzed the chain-length distribution of DBE enzymatic reaction products by using purified DBEs from various sources including rice, cyanobacteria, and bacteria. When DBEs were incubated with phytoglycogen, their chain-length specificities were divided into three groups. First, rice endosperm ISA3 (OsISA3 and Eschericia coli GlgX (EcoGlgX almost exclusively debranched chains having degree of polymerization (DP of 3 and 4. Second, OsISA1, Pseudomonas amyloderamosa ISA (PsaISA, and rice pullulanase (OsPUL could debranch a wide range of chains of DP≧3. Third, both cyanobacteria ISAs, Cyanothece ATCC 51142 ISA (CytISA and Synechococcus elongatus PCC7942 ISA (ScoISA, showed the intermediate chain-length preference, because they removed chains of mainly DP3-4 and DP3-6, respectively, while they could also react to chains of DP5-10 and 7-13 to some extent, respectively. In contrast, all these ISAs were reactive to various chains when incubated with amylopectin. In addition to a great variation in chain-length preferences among various ISAs, their activities greatly differed depending on a variety of glucans. Most strikingly, cyannobacteria ISAs could attack branch points of pullulan to a lesser extent although no such activity was found in OsISA1, OsISA3, EcoGlgX, and PsaISA. Thus, the present study shows the high possibility that varied chain-length specificities of ISA-type DBEs among sources and isozymes are responsible for their distinct functions in glucan metabolism.
The Swedish mutant barley collection
Energy Technology Data Exchange (ETDEWEB)
NONE
1989-07-01
Full text: The Swedish mutation research programme in barley began about 50 years ago and has mainly been carried out at Svaloev in co-operation with the institute of Genetics at the University of Lund. The collection has been produced from different Swedish high-yielding spring barley varieties, using the following mutagens: X-rays, neutrons, several organic chemical compounds such as ethyleneimine, several sulfonate derivatives and the inorganic chemical mutagen sodium azide. Nearly 10,000 barley mutants are stored in the Nordic Gene Bank and documented in databases developed by Udda Lundquist, Svaloev AB. The collection consists of the following nine categories with 94 different types of mutants: 1. Mutants with changes in the spike and spikelets; 2. Changes in culm length and culm composition; 3. Changes in growth types; 4. Physiological mutants; 5. Changes in awns; 6. Changes in seed size and shape; 7. Changes in leaf blades; 8. Changes in anthocyanin and colour; 9. Resistance to barley powdery mildew. Barley is one of the most thoroughly investigated crops in terms of induction of mutations and mutation genetics. So far, about half of the mutants stored at the Nordic Gene Bank, have been analysed genetically; They constitute, however, only a minority of the 94 different mutant types. The genetic analyses have given valuable insights into the mutation process but also into the genetic architecture of various characters. A number of mutants of two-row barley have been registered and commercially released. One of the earliest released, Mari, an early maturing, daylength neutral, straw stiff mutant, is still grown in Iceland. The Swedish mutation material has been used in Sweden, but also in other countries, such as Denmark, Germany, and USA, for various studies providing a better understanding of the barley genome. The collection will be immensely valuable for future molecular genetical analyses of clone mutant genes. (author)
The Swedish mutant barley collection
International Nuclear Information System (INIS)
1989-01-01
Full text: The Swedish mutation research programme in barley began about 50 years ago and has mainly been carried out at Svaloev in co-operation with the institute of Genetics at the University of Lund. The collection has been produced from different Swedish high-yielding spring barley varieties, using the following mutagens: X-rays, neutrons, several organic chemical compounds such as ethyleneimine, several sulfonate derivatives and the inorganic chemical mutagen sodium azide. Nearly 10,000 barley mutants are stored in the Nordic Gene Bank and documented in databases developed by Udda Lundquist, Svaloev AB. The collection consists of the following nine categories with 94 different types of mutants: 1. Mutants with changes in the spike and spikelets; 2. Changes in culm length and culm composition; 3. Changes in growth types; 4. Physiological mutants; 5. Changes in awns; 6. Changes in seed size and shape; 7. Changes in leaf blades; 8. Changes in anthocyanin and colour; 9. Resistance to barley powdery mildew. Barley is one of the most thoroughly investigated crops in terms of induction of mutations and mutation genetics. So far, about half of the mutants stored at the Nordic Gene Bank, have been analysed genetically; They constitute, however, only a minority of the 94 different mutant types. The genetic analyses have given valuable insights into the mutation process but also into the genetic architecture of various characters. A number of mutants of two-row barley have been registered and commercially released. One of the earliest released, Mari, an early maturing, daylength neutral, straw stiff mutant, is still grown in Iceland. The Swedish mutation material has been used in Sweden, but also in other countries, such as Denmark, Germany, and USA, for various studies providing a better understanding of the barley genome. The collection will be immensely valuable for future molecular genetical analyses of clone mutant genes. (author)
The breeding of new malting barley variety 'Yangpi No.2'
International Nuclear Information System (INIS)
Chen Xiulan; He Zhentian; Han Yuepeng; Wang Jinrong; Yang Hefeng
2005-01-01
'Yangpi No.2' barley pasted the examination of Jiangsu province in 2002, is the new spring two-rowed malting barley variety selected by which irradiation mutated the early-maturing of barley. The yield capacity of 'Yangpi No.2' barley is about 6750 kg/hm 2 , it had the characters of early-maturing, good agronomic characters, strong anti-adversity, high quality, and adapted well to everywhere in Jiangsu province. (authors)
Analysis of enzyme production by submerged culture of Aspergillus oryzae using whole barley.
Masuda, Susumu; Kikuchi, Kaori; Matsumoto, Yuko; Sugimoto, Toshikazu; Shoji, Hiroshi; Tanabe, Masayuki
2009-10-01
We have reported on high enzyme production by submerged culture of Aspergillus kawachii using barley with the husk (whole barley). To elucidate the mechanism underlying this high enzyme production, we performed a detailed analysis. Aspergillus oryzae RIB40 was submerged-cultured using whole barley and milled whole barley. Enzyme production was analyzed in terms of changes in medium components and gene expression levels. When whole barley was used, high production of glucoamylase and alpha-amylase and high gene expression levels of these enzymes were observed. Low ammonium concentrations were maintained with nitrate ion uptake continuing into the late stage using whole barley. These findings suggest that the sustainability of nitrogen metabolism is related to high enzyme production, and that a mechanism other than that associated with the conventional amylase expression system is involved in this relationship.
DEFF Research Database (Denmark)
Jach, G; Görnhardt, B; Mundy, J
1995-01-01
cDNAs encoding three proteins from barley (Hordeum vulgare), a class-II chitinase (CHI), a class-II beta-1,3-glucanase (GLU) and a Type-I ribosome-inactivating protein (RIP) were expressed in tobacco plants under the control of the CaMV 35S-promoter. High-level expression of the transferred genes...... was detected in the transgenic plants by Northern and Western blot analysis. The leader peptides in CHI and GLU led to accumulation of these proteins in the intercellular space of tobacco leaves. RIP, which is naturally deposited in the cytosol of barley endosperm cells, was expressed either in its original...... cytosolic form or fused to a plant secretion peptide (spRIP). Fungal infection assays revealed that expression of the individual genes in each case resulted in an increased protection against the soilborne fungal pathogen Rhizoctonia solani, which infects a range of plant species including tobacco...
Functional proteomics of barley and barley chloroplasts – strategies, methods and perspectives
DEFF Research Database (Denmark)
Petersen, Jørgen; Rogowska-Wrzesinska, Adelina; Jensen, Ole Nørregaard
2013-01-01
Barley (Hordeum vulgare) is an important cereal grain that is used in a range of products for animal and human consumption. Crop yield and seed quality has been optimized during decades by plant breeding programs supported by biotechnology and molecular biology techniques. The recently completed...... whole-genome sequencing of barley revealed approximately 26,100 open reading frames, which provides a foundation for detailed molecular studies of barley by functional genomics and proteomics approaches. Such studies will provide further insights into the mechanisms of, for example, drought and stress...... tolerance, micronutrient utilization, and photosynthesis in barley. In the present review we present the current state of proteomics research for investigations of barley chloroplasts, i.e., the organelle that contain the photosynthetic apparatus in the plant. We describe several different proteomics...
Brewing with fractionated barley
Donkelaar, van L.H.G.
2016-01-01
Brewing with fractionated barley
Beer is a globally consumed beverage, which is produced from malted barley, water, hops and yeast. In recent years, the use of unmalted barley and exogenous enzymes have become more popular because they enable simpler processing and reduced environmental
DEFF Research Database (Denmark)
Frandsen, T P; Lok, F; Mirgorodskaya, E
2000-01-01
in the transition state complex. Mass spectrometry of tryptic fragments assigned the 92-kD protein to a barley cDNA (GenBank accession no. U22450) that appears to encode an alpha-glucosidase. A corresponding sequence (HvAgl97; GenBank accession no. AF118226) was isolated from a genomic phage library using a c......High-isoelectric-point (pI) alpha-glucosidase was purified 7, 300-fold from an extract of barley (Hordeum vulgare) malt by ammonium sulfate fractionation, ion-exchange, and butyl-Sepharose chromatography. The enzyme had high activity toward maltose (k(cat) = 25 s(-1)), with an optimum at pH 4...
Variation in storage alpha-glucans of the Porphyridiales (Rhodophyta).
Shimonaga, Takahiro; Konishi, Mai; Oyama, Yasunori; Fujiwara, Shoko; Satoh, Aya; Fujita, Naoko; Colleoni, Christophe; Buléon, Alain; Putaux, Jean-Luc; Ball, Steven G; Yokoyama, Akiko; Hara, Yoshiaki; Nakamura, Yasunori; Tsuzuki, Mikio
2008-01-01
Storage glucans were analyzed in the Porphyridiales which include the most primitive and phylogenetically diverged species in the Rhodophyta, to understand early evolution of the glucan structure in the Rhodophyta. The storage glucans of both Galdieria sulphuraria and Cyanidium caldarium consisted of glycogen, while those of Rhodosorus marinus, Porphyridium purpureum, P. sordidum and Rhodella violacea could be defined as semi-amylopectin. X-ray diffraction analysis of the glucans demonstrated variation in the crystalline structure: the patterns in P. purpureum and R. violacea were of A- and B-types, respectively, while alpha-glucans of R. marinus and P. sordidum displayed structures with lower crystallinity. Electron microscopic observations indicated that the alpha-glucans of P. sordidum consisted of two kinds of granules; a minor component of more dense granules with crystalline leaflets and a major component of softer ones without crystalline structure. Gel permeation chromatography showed that all the species containing the semi-amylopectin-type glucans also contained amylose, although the relative amounts of this fraction were different depending on the species. Our results are consistent with two distinct evolution scenarios defined either by the independent acquisition of semi-crystalline starch-like structures in the different plant lineages or more probably by the loss of starch and reversion to glycogen synthesis in cyanidian algae growing in hot and acid environments.
Function and Biosynthesis of Cell Wall α-1,3-Glucan in Fungi
Directory of Open Access Journals (Sweden)
Akira Yoshimi
2017-11-01
Full Text Available Although α-1,3-glucan is a major cell wall polysaccharide in filamentous fungi, its biological functions remain unclear, except that it acts as a virulence factor in animal and plant pathogenic fungi: it conceals cell wall β-glucan on the fungal cell surface to circumvent recognition by hosts. However, cell wall α-1,3-glucan is also present in many of non-pathogenic fungi. Recently, the universal function of α-1,3-glucan as an aggregation factor has been demonstrated. Applications of fungi with modified cell wall α-1,3-glucan in the fermentation industry and of in vitro enzymatically-synthesized α-1,3-glucan in bio-plastics have been developed. This review focuses on the recent progress in our understanding of the biological functions and biosynthetic mechanism of cell wall α-1,3-glucan in fungi. We briefly consider the history of studies on α-1,3-glucan, overview its biological functions and biosynthesis, and finally consider the industrial applications of fungi deficient in α-1,3-glucan.
Kim, Juyoung; Lee, Seung Mi; Bae, In Young; Park, Hyuk-Gu; Gyu Lee, Hyeon; Lee, Suyong
2011-08-15
Extensive physiological and biological emphasis has been placed on pharmaceutical and medicinal uses of mushrooms containing β-glucans, but their incorporation into processed functional foods is quite limited. Thus, low-grade Lentinus edodes mushrooms were utilised to produce β-glucan-enriched materials (BGEMs), which were evaluated as a high-fibre and low-calorie substitute for wheat flour. The fractions obtained from Lentinus edodes mushrooms contained 514 g kg⁻¹ of (1-3)-β-glucans with (1-6)-β-linked side chains and the chemical structure was confirmed by ¹³C NMR and FTIR spectroscopy. Replacement of a portion of the wheat flour with BGEMs resulted in the solutions with lower values of pasting parameters and also caused significant changes in starch gelatinisation. When BGEMs were incorporated into cake formulations, batter viscosity increased with more shear-thinning behaviours and elastic properties improved. Overall, the cakes containing more BGEMs showed decreased volume and increased hardness while no significant differences were observed between the control and BGEM cakes containing 1 g of β-glucan per serving. As a wheat flour substitute, the BGEMs that were prepared from low-grade Lentinus edodes mushrooms, could be successfully used to produce cakes containing 1 g of β-glucan per serving with quality attributes similar to those of the control. Copyright © 2011 Society of Chemical Industry.
Kralj, S.; Geel-Schutten, G.H. van; Dondorff, M.M.G.; Kirsanovs, S.; Maarel, M.J.E.C. van der; Dijkhuizen, L.
2004-01-01
Members of the genera Streptococcus and Leuconostoc synthesize various α-glucans (dextran, alternan and mutan). In Lactobacillus, until now, the only glucosyltransferase (GTF) enzyme that has been characterized is gtfA of Lactobacillus reuteri 121, the first GTF enzyme synthesizing a glucan
Kralj, S.; Geel-Schutten, G.H. van; Dondorff, M.M.G.; Kirsanovs, S.; Maarel, M.J.E.C. van der; Dijkhuizen, L.
2004-01-01
Members of the genera Streptococcus and Leuconostoc synthesize various α-glucans (dextran, alternan and mutan). In Lactobacillus, until now, the only glucosyltransferase (GTF) enzyme that has been characterized is gtfA of Lactobacillus reuteri 121, the first GTF enzyme synthesizing a glucan
PRODUCTION OF RECOMBINANT HIGH pI-BARLEY α-GLUCOSIDASE
DEFF Research Database (Denmark)
Næsted, Henrik; Svensson, Birte
plantlet [1]. Recently, expression and characterization of the recombinant full length, fully functional barley high pI α-glucosidase in Pichia pastoris has been achieved. To enable production of recombinant protein in mg amounts, a transformant harbouring a clone encoding the N-terminally hexa histidine...... tagged recombinant form of the enzyme was propagated using a high cell-density fermentation procedure. This system resulted in successful expression under the highly sensitive methanol utilization phase conducting the fermentation process using a BiostatB 5 L reactor. The recombinant high pI α...... glycosylation of the recombinant α-glucosidase. The enzyme activity was highly stable during the 5 day long fermentation. Characterisation of the enzymatic properties confirmed the specific activity actually to be superior to that of the native enzyme purified from malt [2]. The kinetic parameters Km, Vmax...
Ferreira, G; Yang, Y; Teets, C L; Brooks, W S; Griffey, C A
2018-07-01
The objective of this study was to compare ruminal starch disappearance rates of hull-less barley, hulled barley, and corn grains. Five different genotypes were used for each of the 2 barley types. In addition, each of these genotypes was grown in 2 different locations and years, resulting 10 independent barley samples for each of the 2 barley grain types. Five different genotypes of corn grain were obtained from a commercial seed company. After being ground to pass through a 4-mm screen of a cutter mill, 3.6 g of each grain was placed into a porous bag, which was then incubated in the rumen of 2 ruminally cannulated cows for 0, 4, 8, 12, 24, and 48 h. Corn grains had greater instant ruminal starch disappearances than barley grains (22.4 and 8.2%, respectively). Instant ruminal starch disappearances did not differ between hulled and hull-less barley grains. Ruminal starch fractional disappearance rates were greatest for hulled barley grains, moderate for hull-less barley grains, and lowest for corn grains (15.3, 13.9, and 7.1%/h, respectively). Ruminal starch half-life was shortest for hulled and hull-less barley grains (4.4 h) and longest for corn grains (6.6 h). Ruminal starch half-life did not differ between hulled barley and hull-less barley grains. In conclusion, using a holistic experimental design and statistical analysis, this study showed that starch from hull-less barley grains has a ruminal half-life similar to that of hulled barley grains and shorter than that of corn grains. Copyright © 2018 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
Olive Mill Waste Enhances α-Glucan Content in the Edible Mushroom Pleurotus eryngii
Directory of Open Access Journals (Sweden)
Sharon Avni
2017-07-01
Full Text Available Mushroom polysaccharides are edible polymers that have numerous reported biological functions; the most common effects are attributed to β-glucans. In recent years, it became apparent that the less abundant α-glucans also possess potent effects in various health conditions. Here we explore several Pleurotus species for their total, β and α-glucan content. Pleurotus eryngii was found to have the highest total glucan concentrations and the highest α-glucans proportion. We also found that the stalks (stipe of the fruit body contained higher glucan content then the caps (pileus. Since mushrooms respond markedly to changes in environmental and growth conditions, we developed cultivation methods aiming to increase the levels of α and β-glucans. Using olive mill solid waste (OMSW from three-phase olive mills in the cultivation substrate. We were able to enrich the levels mainly of α-glucans. Maximal total glucan concentrations were enhanced up to twice when the growth substrate contained 80% of OMSW compared to no OMSW. Taking together this study demonstrate that Pleurotus eryngii can serve as a potential rich source of glucans for nutritional and medicinal applications and that glucan content in mushroom fruiting bodies can be further enriched by applying OMSW into the cultivation substrate.
High-resolution mapping of the barley Ryd3 locus controlling tolerance to BYDV
Lüpken, T.; Stein, N.; Perovic, D.; Habekuss, A.; Serfling, A.; Krämer, I.; Hähnel, U.; Steuernagel, B.; Scholz, U.; Ariyadasa, R.; Martis, M.; Mayer, K.; Niks, R.E.; Collins, N.C.; Friedt, W.; Ordon, F.
2014-01-01
Barley yellow dwarf disease (BYD) is transmitted by aphids and is caused by different strains of Barley yellow dwarf virus (BYDV) and Cereal yellow dwarf virus (CYDV). Economically it is one of the most important diseases of cereals worldwide. Besides chemical control of the vector, growing of
DEFF Research Database (Denmark)
Gerhards, R; Christensen, Svend
2003-01-01
with weed infestation levels higher than the economic weed threshold; a review of such work is provided. This paper presents a system for site-specific weed control in sugarbeet (Beta vulgaris L.), maize (Zea mays L.), winter wheat (Triticum aestivum L.) and winter barley (Hordeum vulgare L.), including...
Evaluation of barley (hordeum vulgare l.) germplasm for high forage production under salt stress
International Nuclear Information System (INIS)
Saleem, A.; Qurainy, F.A.; Akram, N.A.
2014-01-01
To explore high biomass producing salt tolerant cultivars of a potential forage crop barley (Hordeum vulgare L.), 30-day old plants of 105 different accessions from different origin were subjected to saline and non-saline (control) conditions for 45 days. Salinity stress (150 mM NaCl) markedly suppressed plant growth (shoot and/or root fresh and dry weights), chlorophyll pigments (a and b), internal CO/sub 2/ concentration, stomatal conductance, rate of transpiration and photosynthesis, while a considerable salt-induced increase was observed in all fluorescence related attributes including efficiency of photosystem-II (Fv/Fm), co-efficient of non-photochemical quenching (QN), photochemical quenching (QP), and non-photochemical quenching (NPQ) in all 105 accessions of barley. The response of all 105 barley accessions to salt stress varied significantly for all the morpho-physiological attributes determined in the present study. Overall, on the basis of shoot and root dry weights, accessions, 4050, 4053, 4056, 4163, 4228, 4229, 4244, 4245, 4290, 4414, 4415, 4427, 4452, Mahali, Jesto, 4165, 4229, 4249, 4405, 4409, 4426, 4456, and Giza 123 were found superior while accessions, 4245, 4158, 4166, 4246, 4406, 4423, 4441, 4442 4447, 4453 and 4458 inferior under saline conditions. (author)
Smiderle, F.; Sassaki, G.L.; Arkel, van J.; Lacomini, M.; Wichers, H.J.; Griensven, van L.J.L.D.
2010-01-01
An a-glucan was isolated from the culinary medicinal mushroom A. bisporus by hot water extraction, ethanol precipitation and DEAE-cellulose chromatography. The resulting material showed a single HMW peak excluded from a Sephadex G50 column that could completely be degraded by a-amylase treatment.
Nutritional and functional characterization of barley flaxseed based functional dry soup mix.
Kaur, Sumeet; Das, Madhusweta
2015-09-01
Barley flaxseed based functional dry soup mix (BFSM) was developed from whole barely flour (46.296%), roasted flaxseed powder (23.148%) and the seasoning (30.555%) comprising several flavoring compounds and anticaking agent, using simple processing technique. Developed BFSM was nutritious. On dry matter basis it contained: protein (14.31%), carbohydrate excluding crude fiber (54.70%), fat (8.70%), ash (17.45%) and crude fiber (4.84%). It was low glycemic soup, free of antinutritional risk and had calorific value of 319.77 kcal/100 g (wet or sample basis, sb) estimated from its composition. 100 g (sb) of BFSM contained 4.36 g β-glucans and 8.08 g total lipid of which 25.6% was ω-3 fatty acids. Different extracts of BFSM revealed the presence of total phenols (0.57-1.86 mg gallic acid equivalent/g, sb) with antioxidants equivalence of DPPH (20.69-39.07%) and FRAP (120-331 μm Fe (II)/g, sb).
Effect of electron beam-irradiation to b-glucan on its immunomodulating and antitumor activity
International Nuclear Information System (INIS)
Jung, Yeon Hwan; Lee, Jung Lim; Yoo, Yung Choon; Kim, Jae Hoon; Lee, Ju Woon
2010-01-01
In this study, in order investigated the effect of electron beam irradiation to b-glucan on its biological activities, we compared immunomodulating and antitumor activity between non-irradiated and electron beam-irradiated b-glucan. EB-glucan was irradiated by electron beam with 10, 30 and 50 kGy. Treatment with EB-glucan resulted in a slight increase of the proliferation of ConA-stimulated splenocytes, and the strongest activity was seen in 50 kGy-treated EB-glucan. EB-glucan teated with 50 kGy also showed increased secretion of cytokines such as IL-2 IFN-γ and IL-6 from ConA-stimulated splenocytes. The activity of EB-glucan to enhance the proliferation of splenocytes and cytokine secretion from ConA-stimulated splenocytes was higher than that of NI-glucan. Furthermore, EB-glucan treated with 50 kGy showed higher activity to activate RAW 264.7 macrophages, comparing with that of NI-glucan. In experiments of antitumor activity, EB-glucan treated with 50 kGy prior to tumor inoculation inhibited an experimental lung metastasis produced by B16-BL6 melanoma cells in mice. But NI-glucan did show no effect. In addition, EB-glucan treated with 50 kGy induced a decrease a decrease of tumor growth in tumor-bearing mice. Collectivelt, these results indicates that electron beam irradiation β-glucan leads its biological functions to enhance immunomodulating and antitumor activity
DEFF Research Database (Denmark)
D'Antuono, Alejandra L; Ott, Thomas; Krusell, Lene
2008-01-01
cDNA array technology was used to compare transcriptome profiles of Lotus japonicus roots inoculated with a Mesorhizobium loti wild-type and two mutant strains affected in cyclic beta(1-2) glucan synthesis (cgs) and in lipopolysaccharide synthesis (lpsbeta2). Expression of genes associated...... with the development of a fully functional nodule was significantly affected in plants inoculated with the cgs mutant. Array results also revealed that induction of marker genes for nodule development was delayed when plants were inoculated with the lpsbeta2 mutant. Quantitative real-time reverse......-transcriptase polymerase chain reaction was used to quantify gene expression of a subset of genes involved in plant defense response, redox metabolism, or genes that encode for nodulins. The majority of the genes analyzed in this study were more highly expressed in roots inoculated with the wild type compared with those...
Disease resistance of pacu Piaractus mesopotamicus (Holmberg, 1887 fed with β-glucan
Directory of Open Access Journals (Sweden)
JD Biller-Takahashi
Full Text Available Effects of β-glucan on innate immune responses and survival were studied in pacu experimentally infected with Aeromonas hydrophila. Fish fed diets containing 0, 0.1% and 1% β-glucan were injected with A. hydrophila. β-glucan enhanced fish survival in both treated groups (26.7% and 21.2% of the control, respectively. Leukocyte respiratory burst and alternative complement pathway activities were elevated after bacterial challenge regardless the β-glucan concentration. Lysozyme activity was higher after infection and showed a gradual increase as β-glucan concentration increased. A significant elevation in WBC count was observed either after bacterial challenge or by influence of β-glucan separately. The same response was observed in the number of thrombocytes, lymphocytes, eosinophils, LG-PAS positive cell and monocytes. It can be concluded that feeding pacu with β-glucan can increase protection against A. hydrophila, due to changes in non-specific immune responses.
Suppressing effects of glucan on micronuclei induced by Co60 in mice
International Nuclear Information System (INIS)
Chorvatovicova, D.
1991-01-01
The effects of glucan on the frequency of micronuclei in polychromatic erythrocytes of A/Ph mouse bone marrow induced by Co 60 irradiation were examined. Suppressing effect of three glucan derivatives was statistically significant (P 3 substituent (DS 0.89). Intraperitoneal application of glucan has to be done earlier than one hour after irradiation. The suppressive effects of glucans can be explained by their ability to trap OH radicals and so decrease the clastogenic effect of irradiation. The results may be useful for therapeutic application of glucan with radiation therapy. (orig.) [de
DEFF Research Database (Denmark)
Bønsager, Birgit Christine; Nielsen, Per K.; Abou Hachem, Maher
2005-01-01
The barley alpha-amylase/subtilisin inhibitor ( BASI) inhibits alpha-amylase 2 (AMY2) with subnanomolar affinity. The contribution of selected side chains of BASI to this high affinity is discerned in this study, and binding to other targets is investigated. Seven BASI residues along the AMY2-BASI...... interface and four residues in the putative protease-binding loop on the opposite side of the inhibitor were mutated. A total of 15 variants were compared with the wild type by monitoring the alpha-amylase and protease inhibitory activities using Blue Starch and azoalbumin, respectively, and the kinetics...
International Nuclear Information System (INIS)
Yang, Gang; Xu, Zhenjiang; Tian, Xiangli; Dong, Shuanglin; Peng, Mo
2015-01-01
β-glucan is a prebiotic well known for its beneficial outcomes on sea cucumber health through modifying the host intestinal microbiota. High-throughput sequencing techniques provide an opportunity for the identification and characterization of microbes. In this study, we investigated the intestinal microbial community composition, interaction among species, and intestinal immune genes in sea cucumber fed with diet supplemented with or without β-glucan supplementation. The results show that the intestinal dominant classes in the control group are Flavobacteriia, Gammaproteobacteria, and Alphaproteobacteria, whereas Alphaproteobacteria, Flavobacteriia, and Verrucomicrobiae are enriched in the β-glucan group. Dietary β-glucan supplementation promoted the proliferation of the family Rhodobacteraceae of the Alphaproteobacteria class and the family Verrucomicrobiaceae of the Verrucomicrobiae class and reduced the relative abundance of the family Flavobacteriaceae of Flavobacteria class. The ecological network analysis suggests that dietary β-glucan supplementation can alter the network interactions among different microbial functional groups by changing the microbial community composition and topological roles of the OTUs in the ecological network. Dietary β-glucan supplementation has a positive impact on immune responses of the intestine of sea cucumber by activating NF-κB signaling pathway, probably through modulating the balance of intestinal microbiota. - Highlights: • Dietary β-glucan supplementation increases the abundance of Rhodobacteraceae and Verrucomicrobiaceae in the intestine. • Dietary β-glucan supplementation changes the topological roles of OTUs in the ecological network. • Dietary β-glucan supplementation has a positive impact on the immune response of intestine of sea cucumber
Energy Technology Data Exchange (ETDEWEB)
Yang, Gang [The Key Laboratory of Mariculture, Ministry of Education, Fisheries College, Ocean University of China (China); Xu, Zhenjiang [Biofrontiers Institute, University of Colorado, Boulder, CO (United States); Tian, Xiangli, E-mail: xianglitian@ouc.edu.cn [The Key Laboratory of Mariculture, Ministry of Education, Fisheries College, Ocean University of China (China); Dong, Shuanglin [The Key Laboratory of Mariculture, Ministry of Education, Fisheries College, Ocean University of China (China); Peng, Mo [School of Animal Science and Technology, Jiangxi Agricultural University (China)
2015-02-27
β-glucan is a prebiotic well known for its beneficial outcomes on sea cucumber health through modifying the host intestinal microbiota. High-throughput sequencing techniques provide an opportunity for the identification and characterization of microbes. In this study, we investigated the intestinal microbial community composition, interaction among species, and intestinal immune genes in sea cucumber fed with diet supplemented with or without β-glucan supplementation. The results show that the intestinal dominant classes in the control group are Flavobacteriia, Gammaproteobacteria, and Alphaproteobacteria, whereas Alphaproteobacteria, Flavobacteriia, and Verrucomicrobiae are enriched in the β-glucan group. Dietary β-glucan supplementation promoted the proliferation of the family Rhodobacteraceae of the Alphaproteobacteria class and the family Verrucomicrobiaceae of the Verrucomicrobiae class and reduced the relative abundance of the family Flavobacteriaceae of Flavobacteria class. The ecological network analysis suggests that dietary β-glucan supplementation can alter the network interactions among different microbial functional groups by changing the microbial community composition and topological roles of the OTUs in the ecological network. Dietary β-glucan supplementation has a positive impact on immune responses of the intestine of sea cucumber by activating NF-κB signaling pathway, probably through modulating the balance of intestinal microbiota. - Highlights: • Dietary β-glucan supplementation increases the abundance of Rhodobacteraceae and Verrucomicrobiaceae in the intestine. • Dietary β-glucan supplementation changes the topological roles of OTUs in the ecological network. • Dietary β-glucan supplementation has a positive impact on the immune response of intestine of sea cucumber.
DEFF Research Database (Denmark)
Daneri-Castro, Sergio N.; Svensson, Birte; Roberts, Thomas H.
2016-01-01
germination. Lastly, the application of metabolomics to barley grain germination provides essential data on biochemical processes, including insights into the formation of compounds that contribute to malt quality. To maximize the benefits of the 'omics' revolution to the malting industry, there is a need......Germination of barley grain is central to the malting industry and is a valuable model for cereal grain germination. Our current understanding of the complexity of germination at the molecular level is facilitated by access to genomic, transcriptomic, proteomic and metabolomic data. Here we review...... of germination in the context of industrial malting. For transcriptomics, recent advances in sequencing the barley genome allow next-generation sequencing approaches to reveal novel effects of variety and environment on germination. For proteomics, selection of the source tissue(s) and the protein extraction...
Immune-enhancing activities of low molecular weight β-glucan depolymerized by gamma irradiation
Sung, Nak-Yun; Byun, Eui-Hong; Kwon, Sun-Kyu; Song, Beom-Seok; Choi, Jong-il; Kim, Jae-Hun; Byun, Myung-Woo; Yoo, Young-Choon; Kim, Mee-Ree; Lee, Ju-Woon
2009-07-01
β-glucans are structural cell wall polymers of many microorganisms and cereals which possess immunomodulatory properties and have been used in the food, cosmetic and medical industry. In our previous study, β-glucan was depolymerized by gamma irradiation and leads to improve the solubility and viscosity. This study was carried out to evaluate the functional properties, mainly immune-enhancing activities of low molecular weight β-glucan fragmented by gamma irradiation. The results showed that RAW 264.7 macrophage cell stimulation activities of irradiated β-glucan were higher than that of non-irradiated β-glucan. In addition, the oral administration of gamma-irradiated β-glucan significantly increased the proliferation and cytokine (IFN-γ and IL-2) release of spleen and Peyer's patch cells compared with non-irradiated β-glucan. In conclusion, gamma irradiation could be used as an effective method for the production of depolymerized β-glucan improved functional property such as immunomodulatory activity.
Immune-enhancing activities of low molecular weight β-glucan depolymerized by gamma irradiation
International Nuclear Information System (INIS)
Sung, Nak-Yun; Byun, Eui-Hong; Kwon, Sun-Kyu; Song, Beom-Seok; Choi, Jong-il; Kim, Jae-Hun; Byun, Myung-Woo; Yoo, Young-Choon; Kim, Mee-Ree; Lee, Ju-Woon
2009-01-01
β-glucans are structural cell wall polymers of many microorganisms and cereals which possess immunomodulatory properties and have been used in the food, cosmetic and medical industry. In our previous study, β-glucan was depolymerized by gamma irradiation and leads to improve the solubility and viscosity. This study was carried out to evaluate the functional properties, mainly immune-enhancing activities of low molecular weight β-glucan fragmented by gamma irradiation. The results showed that RAW 264.7 macrophage cell stimulation activities of irradiated β-glucan were higher than that of non-irradiated β-glucan. In addition, the oral administration of gamma-irradiated β-glucan significantly increased the proliferation and cytokine (IFN-γ and IL-2) release of spleen and Peyer's patch cells compared with non-irradiated β-glucan. In conclusion, gamma irradiation could be used as an effective method for the production of depolymerized β-glucan improved functional property such as immunomodulatory activity.
Keung, Hoi Yee; Li, Tsz Kai; Sham, Lok To; Cheung, Man Kit; Cheung, Peter Chi Keung; Kwan, Hoi Shan
2017-04-01
Bifidobacteria exert beneficial effects on hosts and are extensively used as probiotics. However, due to the genetic inaccessibility of these bacteria, little is known about their mechanisms of carbohydrate utilization and regulation. Bifidobacterium breve strain JCM1192 can grow on water-insoluble yeast ( Saccharomyces cerevisiae ) cell wall glucans (YCWG), which were recently considered as potential prebiotics. According to the results of 1 H nuclear magnetic resonance (NMR) spectrometry, the YCWG were composed of highly branched (1→3,1→6)-β-glucans and (1→4,1→6)-α-glucans. Although the YCWG were composed of 78.3% β-glucans and 21.7% α-glucans, only α-glucans were consumed by the B. breve strain. The ABC transporter ( malEFG1 ) and pullulanase ( aapA ) genes were transcriptionally upregulated in the metabolism of insoluble yeast glucans, suggesting their potential involvement in the process. A nonsense mutation identified in the gene encoding an ABC transporter ATP-binding protein (MalK) led to growth failure of an ethyl methanesulfonate-generated mutant with yeast glucans. Coculture of the wild-type strain and the mutant showed that this protein was responsible for the import of yeast glucans or their breakdown products, rather than the export of α-glucan-catabolizing enzymes. Further characterization of the carbohydrate utilization of the mutant and three of its revertants indicated that this mutation was pleiotropic: the mutant could not grow with maltose, glycogen, dextrin, raffinose, cellobiose, melibiose, or turanose. We propose that insoluble yeast α-glucans are hydrolyzed by extracellular pullulanase into maltose and/or maltooligosaccharides, which are then transported into the cell by the ABC transport system composed of MalEFG1 and MalK. The mechanism elucidated here will facilitate the development of B. breve and water-insoluble yeast glucans as novel synbiotics. IMPORTANCE In general, Bifidobacterium strains are genetically intractable
Characterization of recombinant high pI Barley α-Glucosidase
DEFF Research Database (Denmark)
Næsted, Henrik; Svensson, Birte
(MacGregor A.W.). Here we present the recent results of the expression and characterization of the recombinant full length barley high pI α-glucosidase in Pichia Pastoris. In order to facilitate in the range of mg protein yield, a clone representing an N-terminal hexa histidine tagged recombinant form...... of the enzyme was grown under high cell-density fermentation conditions. This approach enabled a successful protein expression profile under the highly sensitive methanol utilization phase of the fermentation procedure. The enzyme was purified using a four step purification strategy. Interestingly, the purified...... enzyme exhibits a higher molecular mass than expected from its primary sequence when applied on SDS-PAGE, indicating a possible post translational modification of the recombinant α-glucosidase. Preliminary enzyme kinetic analysis has demonstrated that the purified α-glucosidase is “fully” active when...
Energy Technology Data Exchange (ETDEWEB)
Papaspyridi, Lefki-Maria; Christakopoulos, Paul [BIOtechMASS Unit, Biotechnology Laboratory, School of Chemical Engineering, National Technical University of Athens, Athens (Greece); Katapodis, Petros [BIOtechMASS Unit, Biotechnology Laboratory, School of Chemical Engineering, National Technical University of Athens, Athens (Greece); Biotechnology Laboratory, Department of Biological Applications and Technologies, University of Ioannina, Ioannina (Greece); Gonou-Zagou, Zacharoula; Kapsanaki-Gotsi, Evangelia [Department of Ecology and Systematics, Faculty of Biology, National and Kapodistrian University of Athens, Athens (Greece)
2011-02-15
In this study we maximized biomass production by the basidiomycete Ganoderma australe ATHUM 4345, a species of pharmaceutical interest as it is a valuable source of nutraceuticals, including dietary fibers and glucans. We used the Biolog FF MicroPlate to screen 95 different carbon sources for growth monitoring. The pattern of substrate catabolism forms a substrate assimilation fingerprint, which is useful in selecting components for media optimization of maximum biomass production. Response surface methodology, based on the central composite design was applied to explore the optimum concentrations of carbon and nitrogen sources of culture medium in shake flask cultures. When the improved culture medium was tested in a 20-L stirred tank bioreactor, using 13.7 g/L glucose and 30.0 g/L yeast extract, high biomass yields (10.1{+-}0.4 g/L) and productivity of 0.09 g L{sup -1} h{sup -1} were obtained. The yield coefficients for total glucan and dietary fibers on biomass formed were 94.82{+-}6 and 341.15{+-}12.3 mg/g mycelium dry weight, respectively. (Copyright copyright 2011 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)
International Nuclear Information System (INIS)
Schmidt, W.E.; Ebel, J.
1987-01-01
Treatment of soybean tissues with elicitors results in the production of phytoalexins, one of a number of inducible plant defense reactions against microbial infections. The present study uses a β-1,3-[ 3 H] glucan elicitor fraction from Phytophthora megasperma f.sp. glycinea, a fungal pathogen of soybean, to identify putative elicitor targets in soybean tissues. Use of the radiolabeled elicitor disclosed saturable high-affinity elicitor binding site(s) in membrane fractions of soybean roots. Highest binding activity is associated with a plasma membrane-enriched fraction. The apparent K/sub d/ value for β-glucan elicitor binding is ≅ 0.2 x 10 -6 M and the maximum number of binding sites is 0.5 pmol per mg of protein. Competition studies the [ 3 H]glucan elicitor and a number of polysaccharides demonstrate that only polysaccharides of a branched β-glucan type effectively displace the radiolabeled ligand from membrane binding. Differential displacing activity of the glucans on P. megasperma elicitor binding corresponds closely to their respective ability to elicit phytoalexin production in a cotyledon bioassay
DEFF Research Database (Denmark)
Ton Nu, Mai Anh; Blaabjerg, Karoline; Labouriau, Rodrigo
2015-01-01
The aim of this study was to evaluate the effect of storage time, grain processing (whole vs. rolled) and the combination of phytase, xylanase, β-glucanase and protease on nitrogen (N) and phosphorus (P) solubility during high moisture airtight (HMA) storage of barley and triticale at various...... moisture levels (20, 23, 26 and 29% moisture) and to compare HMA storage of cereals with dry storage for 49 days. Dry stored barley and triticale (10 and 13% moisture, respectively) were kept in 10 L plastic buckets for 0 and 49 days. HMA stored cereals were kept in airtight bags (400 g per bag) at 15 °C......) in HMA storage at 29% moisture to a greater extent compared with dry storage (P levels increased P solubility (rolled barley, whole and rolled triticale) and N solubility (whole and rolled triticale) linearly and decreased Phytate P:Total P (rolled barley) linearly...
Construction of barley consensus map showing chromosomal ...
African Journals Online (AJOL)
In the past, it has been difficult to accurately determine the location of many types of barley molecular markers due to the lack of commonality between international barley linkage maps. In this study, a consensus map of barley was constructed from five different maps (OWB, VxHs, KxM, barley consensus 2 and barley ...
A drug-sensitive genetic network masks fungi from the immune system.
Directory of Open Access Journals (Sweden)
Robert T Wheeler
2006-04-01
Full Text Available Fungal pathogens can be recognized by the immune system via their beta-glucan, a potent proinflammatory molecule that is present at high levels but is predominantly buried beneath a mannoprotein coat and invisible to the host. To investigate the nature and significance of "masking" this molecule, we characterized the mechanism of masking and consequences of unmasking for immune recognition. We found that the underlying beta-glucan in the cell wall of Candida albicans is unmasked by subinhibitory doses of the antifungal drug caspofungin, causing the exposed fungi to elicit a stronger immune response. Using a library of bakers' yeast (Saccharomyces cerevisiae mutants, we uncovered a conserved genetic network that is required for concealing beta-glucan from the immune system and limiting the host response. Perturbation of parts of this network in the pathogen C. albicans caused unmasking of its beta-glucan, leading to increased beta-glucan receptor-dependent elicitation of key proinflammatory cytokines from primary mouse macrophages. By creating an anti-inflammatory barrier to mask beta-glucan, opportunistic fungi may promote commensal colonization and have an increased propensity for causing disease. Targeting the widely conserved gene network required for creating and maintaining this barrier may lead to novel broad-spectrum antimycotics.
High-throughput phenotyping to detect drought tolerance QTL in wild barley introgression lines
Honsdorf, Nora
2014-05-13
Drought is one of the most severe stresses, endangering crop yields worldwide. In order to select drought tolerant genotypes, access to exotic germplasm and efficient phenotyping protocols are needed. In this study the high-throughput phenotyping platform "The Plant Accelerator", Adelaide, Australia, was used to screen a set of 47 juvenile (six week old) wild barley introgression lines (S42ILs) for drought stress responses. The kinetics of growth development was evaluated under early drought stress and well watered treatments. High correlation (r = 0.98) between image based biomass estimates and actual biomass was demonstrated, and the suitability of the system to accurately and non-destructively estimate biomass was validated. Subsequently, quantitative trait loci (QTL) were located, which contributed to the genetic control of growth under drought stress. In total, 44 QTL for eleven out of 14 investigated traits were mapped, which for example controlled growth rate and water use efficiency. The correspondence of those QTL with QTL previously identified in field trials is shown. For instance, six out of eight QTL controlling plant height were also found in previous field and glasshouse studies with the same introgression lines. This indicates that phenotyping juvenile plants may assist in predicting adult plant performance. In addition, favorable wild barley alleles for growth and biomass parameters were detected, for instance, a QTL that increased biomass by approximately 36%. In particular, introgression line S42IL-121 revealed improved growth under drought stress compared to the control Scarlett. The introgression line showed a similar behavior in previous field experiments, indicating that S42IL-121 may be an attractive donor for breeding of drought tolerant barley cultivars. © 2014 Honsdorf et al.
High-throughput phenotyping to detect drought tolerance QTL in wild barley introgression lines.
Directory of Open Access Journals (Sweden)
Nora Honsdorf
Full Text Available Drought is one of the most severe stresses, endangering crop yields worldwide. In order to select drought tolerant genotypes, access to exotic germplasm and efficient phenotyping protocols are needed. In this study the high-throughput phenotyping platform "The Plant Accelerator", Adelaide, Australia, was used to screen a set of 47 juvenile (six week old wild barley introgression lines (S42ILs for drought stress responses. The kinetics of growth development was evaluated under early drought stress and well watered treatments. High correlation (r=0.98 between image based biomass estimates and actual biomass was demonstrated, and the suitability of the system to accurately and non-destructively estimate biomass was validated. Subsequently, quantitative trait loci (QTL were located, which contributed to the genetic control of growth under drought stress. In total, 44 QTL for eleven out of 14 investigated traits were mapped, which for example controlled growth rate and water use efficiency. The correspondence of those QTL with QTL previously identified in field trials is shown. For instance, six out of eight QTL controlling plant height were also found in previous field and glasshouse studies with the same introgression lines. This indicates that phenotyping juvenile plants may assist in predicting adult plant performance. In addition, favorable wild barley alleles for growth and biomass parameters were detected, for instance, a QTL that increased biomass by approximately 36%. In particular, introgression line S42IL-121 revealed improved growth under drought stress compared to the control Scarlett. The introgression line showed a similar behavior in previous field experiments, indicating that S42IL-121 may be an attractive donor for breeding of drought tolerant barley cultivars.
African Journals Online (AJOL)
p4208528
Abstract. Hulless barley contains more digestible nutrients than do whole barleys due to a lower content of indigestible fibre, but also contains a higher concentration of β-glucans. The chemical composition and apparent metabolisable energy (AME) of five cultivars (3, 7, 12, 15 and KC-31) of hulless barley were determined ...
Milton, Donald K.; Alwis, K. Udeni; Fisette, Leslie; Muilenberg, Michael
2001-01-01
(1→3)-β-d-Glucans have been recognized as a potential causative agent responsible for bioaerosol-induced respiratory symptoms observed in both indoor and occupational environments. A specific enzyme immunoassay was developed to quantify (1→6) branched, (1→3)-β-d-glucans in environmental samples. The assay was based on the use of a high-affinity receptor (galactosyl ceramide) specific for (1→3)-β-d-glucans as a capture reagent and a monoclonal antibody specific for fungal cell wall β-d-glucans...
Lowman, Douglas W; Greene, Rachel R; Bearden, Daniel W; Kruppa, Michael D; Pottier, Max; Monteiro, Mario A; Soldatov, Dmitriy V; Ensley, Harry E; Cheng, Shih-Chin; Netea, Mihai G; Williams, David L
2014-02-07
The innate immune system differentially recognizes Candida albicans yeast and hyphae. It is not clear how the innate immune system effectively discriminates between yeast and hyphal forms of C. albicans. Glucans are major components of the fungal cell wall and key fungal pathogen-associated molecular patterns. C. albicans yeast glucan has been characterized; however, little is known about glucan structure in C. albicans hyphae. Using an extraction procedure that minimizes degradation of the native structure, we extracted glucans from C. albicans hyphal cell walls. (1)H NMR data analysis revealed that, when compared with reference (1→3,1→6) β-linked glucans and C. albicans yeast glucan, hyphal glucan has a unique cyclical or "closed chain" structure that is not found in yeast glucan. GC/MS analyses showed a high abundance of 3- and 6-linked glucose units when compared with yeast β-glucan. In addition to the expected (1→3), (1→6), and 3,6 linkages, we also identified a 2,3 linkage that has not been reported previously in C. albicans. Hyphal glucan induced robust immune responses in human peripheral blood mononuclear cells and macrophages via a Dectin-1-dependent mechanism. In contrast, C. albicans yeast glucan was a much less potent stimulus. We also demonstrated the capacity of C. albicans hyphal glucan, but not yeast glucan, to induce IL-1β processing and secretion. This finding provides important evidence for understanding the immune discrimination between colonization and invasion at the mucosal level. When taken together, these data provide a structural basis for differential innate immune recognition of C. albicans yeast versus hyphae.
Localization of synthesis of β1,6-glucan in Saccharomyces cerevisiae
Montijn, R.C.; Vink, E.; Müller, W.H.; Verkleij, A.J.; Ende, H. van den; Henrissat, B.; Klis, F.M.
1999-01-01
β1,6-Glucan is a key component of the yeast cell wall, interconnecting cell wall proteins, β1,3-glucan, and chitin. It has been postulated that the synthesis of β1,6-glucan begins in the endoplasmic reticulum with the formation of protein-bound primer structures and that these primer structures are
Suppressing effects of glucan on micronuclei induced by Co sup 60 in mice
Energy Technology Data Exchange (ETDEWEB)
Chorvatovicova, D. (Slovak Academy of Sciences, Bratislava (Czechoslovakia). Inst. of Ecobiology)
1991-10-01
The effects of glucan on the frequency of micronuclei in polychromatic erythrocytes of A/Ph mouse bone marrow induced by Co{sup 60} irradiation were examined. Suppressing effect of three glucan derivatives was statistically significant (P<0.01) by intravenous application of glucan one hour after irradiation. The most expressive effect was obvious by K{sub 3} substituent (DS 0.89). Intraperitoneal application of glucan has to be done earlier than one hour after irradiation. The suppressive effects of glucans can be explained by their ability to trap OH radicals and so decrease the clastogenic effect of irradiation. The results may be useful for therapeutic application of glucan with radiation therapy. (orig.).
Association mapping of partitioning loci in barley
Directory of Open Access Journals (Sweden)
Mackay Ian J
2008-02-01
Full Text Available Abstract Background Association mapping, initially developed in human disease genetics, is now being applied to plant species. The model species Arabidopsis provided some of the first examples of association mapping in plants, identifying previously cloned flowering time genes, despite high population sub-structure. More recently, association genetics has been applied to barley, where breeding activity has resulted in a high degree of population sub-structure. A major genotypic division within barley is that between winter- and spring-sown varieties, which differ in their requirement for vernalization to promote subsequent flowering. To date, all attempts to validate association genetics in barley by identifying major flowering time loci that control vernalization requirement (VRN-H1 and VRN-H2 have failed. Here, we validate the use of association genetics in barley by identifying VRN-H1 and VRN-H2, despite their prominent role in determining population sub-structure. Results By taking barley as a typical inbreeding crop, and seasonal growth habit as a major partitioning phenotype, we develop an association mapping approach which successfully identifies VRN-H1 and VRN-H2, the underlying loci largely responsible for this agronomic division. We find a combination of Structured Association followed by Genomic Control to correct for population structure and inflation of the test statistic, resolved significant associations only with VRN-H1 and the VRN-H2 candidate genes, as well as two genes closely linked to VRN-H1 (HvCSFs1 and HvPHYC. Conclusion We show that, after employing appropriate statistical methods to correct for population sub-structure, the genome-wide partitioning effect of allelic status at VRN-H1 and VRN-H2 does not result in the high levels of spurious association expected to occur in highly structured samples. Furthermore, we demonstrate that both VRN-H1 and the candidate VRN-H2 genes can be identified using association mapping
Metzler-Zebeli, Barbara U; Zijlstra, Ruurd T; Mosenthin, Rainer; Gänzle, Michael G
2011-03-01
This study aimed to evaluate the effects of oat β-glucan in combination with low- and high-dietary calcium phosphate (CaP) content on gastrointestinal bacterial microbiota, prevalence of butyrate-production pathway genes and fermentation end-products in 32 weaned pigs allocated to four diets: a cornstarch-casein-based diet with low [65% of the calcium (Ca) and phosphorous (P) requirement] and high CaP content (125% and 115% of the Ca and P requirement, respectively); and low and high CaP diets supplemented with 8.95% of oat β-glucan concentrate. Pigs were slaughtered after 14 days, and digesta were collected for quantitative PCR analysis, and quantification of short-chain fatty acids and lactate. The high CaP content reduced gastric lactate and streptococci and propionate in the large intestine. Oat β-glucan distinctly raised gastric bacterial numbers, and colonic lactobacilli and bifidobacteria. Although not reflected by gene copies of butyrate-production pathway genes, oat β-glucan also increased gastric, caecal and colonic butyrate concentrations, which may be favourable for intestinal development in weaned pigs. Thus, a high CaP content negatively affected the intestinal abundance of certain fermentation end-products, whereas oat β-glucan generally enhanced bacterial numbers and activity. The results emphasize the importance of the stomach for bacterial metabolism of oat β-glucan in weaned pigs. © 2010 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.
Orally delivered β-glucans aggravate dextran sulfate sodium (DSS)-induced intestinal inflammation
Heinsbroek, Sigrid E. M.; Williams, David L.; Welting, Olaf; Meijer, Sybren L.; Gordon, Siamon; de Jonge, Wouter J.
2015-01-01
β-Glucans have beneficial health effects due to their immune modulatory properties. Oral administration of β-glucans affects tumour growth, microbial infection, sepsis, and wound healing. We hypothesized that pre-treatment with orally delivered soluble and particulate β-glucans could ameliorate the
DEFF Research Database (Denmark)
Nilsson, A.C.; Ostman, E.M.; Holst, Jens Juul
2008-01-01
Low-glycemic index (GI) foods and foods rich in whole grain are associated with reduced risk of type 2 diabetes and cardiovascular disease. We studied the effect of cereal-based bread evening meals (50 g available starch), varying in GI and content of indigestible carbohydrates, on glucose...... tolerance and related variables after a subsequent standardized breakfast in healthy subjects (n = 15). At breakfast, blood was sampled for 3 h for analysis of blood glucose, serum insulin, serum FFA, serum triacylglycerides, plasma glucagon, plasma gastric-inhibitory peptide, plasma glucagon-like peptide-1...... based bread (ordinary, high-amylose- or beta-glucan-rich genotypes) or an evening meal with white wheat flour bread (WWB) enriched with a mixture of barley fiber and resistant starch improved glucose tolerance at the subsequent breakfast compared with unsupplemented WWB (P
Accumulation of mixed linkage (1¿3) (1¿4)-ß-D-glucan during grain filling in barley
DEFF Research Database (Denmark)
Seefeldt, Helene Fast; Blennow, Per Gunnar Andreas; Jespersen, Birthe P Møller
2009-01-01
18% BG (w/w) dry matter 30 days after flowering (DAF), seemingly compensating for a decreased synthesis of starch. The spectral information of the barley flour was compared to pure BG spectra and partial least squares regression (PLS) models were constructed for calibration to BG content. Informative...... the normal control Cork were studied. The Cork and lys3a genotypes showed a linear BG accumulation throughout the grain filling to reach a maximum of approximately 6 and 4% BG (w/w) dry matter, respectively. However, lys5f mutant exhibited an exponential increase in BG synthesis to a maximum of approximately...
Osmoregulated periplasmic glucans synthesis gene family of Shigella flexneri
Osmoregulated periplasmic glucans (OPGs) of foodborne enteropathogen Shigella flexneri were characterized. OPGs were composed of 100 percent glucose with 2-linked glucose as the most abundant residue with terminal glucose, 2-linked and 2,6-linked glucose also present in high quantities. Most dominan...
Recent insight in α-glucan metabolism in probiotic bacteria
DEFF Research Database (Denmark)
Møller, Marie Sofie; Goh, Yong Jun; Viborg, Alexander Holm
2014-01-01
α-Glucans from bacterial exo-polysaccharides or diet, e.g., resistant starch, legumes and honey are abundant in the human gut and fermentation of resistant fractions of these α-glucans by probiotic lactobacilli and bifidobacteria impacts human health positively. The ability to degrade polymeric α...
Turbulence of high-beta plasma
International Nuclear Information System (INIS)
Khvesyuk, V.I.; Chirkov, A.Y.
1999-01-01
Principals of numerical modelling of turbulence in high-beta plasma (β > 0.1) are discussed. Creation of transport model for axial symmetric nonuniform confining magnetic field is considered. Numerical model of plasma turbulence in FRC is presented. The physical and mathematical models are formulated from nonuniform axial symmetric high-beta plasma. It is shown that influence of waves arise under this plasma conditions lead to chaotic motion of charged particles across magnetic field. (author)
Water-soluble low-molecular-weight -(1, 3–1, 6 D-Glucan inhibit cedar pollinosis
Directory of Open Access Journals (Sweden)
Tomoko Jippo
2015-02-01
Full Text Available Background: The incidence of allergic diseases such as allergic rhinitis, atopic dermatitis, asthma, and food allergies has increased in several countries. Mast cells have critical roles in various biologic processes related to allergic diseases. Mast cells express the high-affinity receptor for immunoglobulin (Ig E on their surface. The interaction of multivalent antigens with surface-bound IgE causes the secretion of granule-stored mediators, as well as the de novosynthesis of cytokines. Those mediators and cytokines proceed the allergic diseases. We investigated the effects of water-soluble, low-molecular-weight -(1, 3–1, 6 D-glucan isolated from Aureobasidium pullulans 1A1 strain black yeast (LMW--glucan on mast cell-mediated anaphylactic reactions. We reported that LMW--glucan dose-dependently inhibited the degranulation of mast cells. Furthermore, we found that orally administered LMW--glucan inhibited the IgE-mediated passive cutaneous anaphylaxis (PCA reaction in mice. Here, we examined if LMW--glucan had effects on Japanese cedar pollinosis. Findings: In a clinical study, a randomized, single-blind, placebo-controlled, parallel group study in 65 subjects (aged 2262 was performed. This study was undertaken 3 weeks before and until the end of the cedar pollen season. During the study, all subjects consumed one bottle of placebo or LMW--glucan daily and all subjects were required to record allergic symptoms in a diary. The LMW--glucan group had a significantly lower prevalence of sneezing, nose-blowing, tears, and hindrance to the activities of daily living than the placebo group. Conclusions: These results suggested that LMW--glucan could be an effective treatment for allergic diseases
Interaction between powdery mildew and barley with ¤mlo5¤ mildew resistance
DEFF Research Database (Denmark)
Lyngkjær, M.F.; Østergård, Hanne
1998-01-01
Powdery mildew infection of barley with the mlo5 barley powdery mildew resistance gene was examined, using near-isogenic barley lines, with and without mlo5 resistance, and two near-isogenic powdery mildew isolates, HL3/5 and GE3 with high (virulent) or low (avirulent) penetration efficiency...
β-Glucans: Relationships between Modification, Conformation and Functional Activities
Directory of Open Access Journals (Sweden)
Qiang Wang
2017-02-01
Full Text Available β-glucan is a type of polysaccharide which widely exists in bacteria, fungi, algae, and plants, and has been well known for its biological activities such as enhancing immunity, antitumor, antibacterial, antiviral, and wound healing activities. The conformation of β-glucan plays a crucial role on its biological activities. Therefore, β-glucans obtained from different sources, while sharing the same basic structures, often show different bioactivities. The basic structure and inter-molecular forces of polysaccharides can be changed by modification, which leads to the conformational transformation in solution that can directly affect bioactivity. In this review, we will first determine different ways to modify β-glucan molecules including physical methods, chemical methods, and biological methods, and then reveal the relationship of the flexible helix form of the molecule chain and the helix conformation to their bioactivities. Last, we summarize the scientific challenges to modifying β-glucan’s conformation and functional activity, and discuss its potential future development.
Fiber and nonstarch polysaccharide content and variation in common crops used in broiler diets.
Knudsen, Knud Erik Bach
2014-09-01
The current paper reviews content and variation in fiber and nonstarch polysaccharides (NSP) of common crops used in broiler diets. The cereal grain is a complex structure, and its cell walls (CW) differ in their composition and hence properties. Arabinoxylan (AX), mixed linkage (1→3; 1→4)-β-glucan (β-glucan), cellulose, and the noncarbohydrate component lignin are the predominant polymers in cereals. They occur in different proportions depending on the species and tissue type. Rye, triticale, wheat, corn, and sorghum are all rich in AX, whereas barley and oats contain a high level of β-glucan. The AX from rye, wheat, and triticale and β-glucan from barley and oats are to a large extent soluble, whereas the solubility of AX found in corn and sorghum is lower than the other cereals. The ratio of arabinose to xylose gives a crude indication of the AX structure, which varies between the endosperm, the aleurone and the outer grain layers as well as between the same tissues from different grains. Varietal differences in AX structure of the endosperm are also identified. From the analysis of the released oligomers after hydrolysis with a specific (1→3,1→4)-β-d-glucan hydrolase, it is found that the ratio of trisaccharides (degree of polymerization 3) and tetrasaccharides (degree of polymerization 4) varies depending on the source, being higher in barley than in oats but lower than in wheat. The molecular weight of β-glucan is higher than that of AX, and both polymers contribute to the viscosity of the extract. However, because AX molecules are more resistant to degradation than β-glucan, the use of AX rich grains in broiler diets is usually more problematic than those containing high concentrations of β-glucan. The cereal coproducts (brans and hulls) are concentrated sources of cellulose, lignin, and insoluble AX, but β-glucan can also be present mainly in rye and wheat brans. The CW composition of seeds and grains of protein crops and feedstuffs are
DEFF Research Database (Denmark)
Fukuda, Kenji; Jensen, Malene Hillerup; Aghajari, Nushin
2005-01-01
Recombinant barley alpha-amylase 1 (rAMY1) and 2 (rAMY2), despite 80% sequence identity, are produced in very different amounts of 1.1 and alpha loop 2 that interacts with domain B (beta-->alpha loop 3) protruding from the catalytic (beta/alpha)(8)-barrel. Most remarkably Pichia pastoris strain G...... residue. Moreover, the G to C substitution for the A42P mutation might have a positive impact on protein translation....
Study on the immuno stimulation of radiation degraded β-glucan in swiss mice
International Nuclear Information System (INIS)
Nguyen Thanh Long; Le Quang Luan
2015-01-01
The mixtures β-glucan extracted from the yeast cell wall were irradiated under gamma rays from a Co-60 source at doses of 100, 200 and 300 kGy in order to prepare water-soluble β-glucan. Yields of the water soluble β-glucan produced are 25.9, 49.1, 66.71%, and their molecular weights (Mw) are 30.5, 24.9 and 10.8 kDa, respectively. There are no any new peak in the IR spectra of the irradiated β-glucan samples, but the intensity ratio between the peaks at wavenumber of 1156 cm"-"1 (assigned to C-O-C bond) and of 1040 cm"-"1 (assigned to C-C bond) in glycosidic linkages was reduced with irradiation dose. These results revealed that gamma irradiation did not cause any change in the β-glucan structure except the scissions of glycosidic linkages. In this study, immuno stimulation of the irradiated β-glucan was also investigated for the Swiss mice. After 28 days supplying with the irradiated β-glucan, not only cellular indexes (white blood cell, neutrophils and lymphocytes counts), but also humoral immunity indexes (IgA and IgM) of the mice significantly increased and the highest effects was obtained for the mice supplied with the oligo β-glucan prepared by gamma irradiation at 200 kGy. Thus, the water soluble oligo β-glucan with Mw ~ 24.9 kDa prepared by gamma radiation much stimulated the natural immune system (non-specific immunity) in mice including both the cellular and humoral immunities. Particularly, the irradiated β-glucan is a very promising product for preparation of functional foods aiming at cancer prevention. (author)
Directory of Open Access Journals (Sweden)
Marie Hrušková
2016-01-01
Full Text Available Wheat flour substitution by barley one led to shortening of fermentation and leavening times (about 14–57% and 35–83%, respectively as well as to lessening of dough volumes (about 25–75%, based on lowered protein quality (Zeleny value. Addition of barley flour affected specific bread volume; diminishing for wheat-barley blends 70:30 and 50:50 reached 30% and 43%, respectively. Volume of bread prepared from wheat-barley blend 70:30 enhanced by dehulled hemp wholemeal was the highest within the tested tri-composites set, achieving 130% of wheat-barley control; other hemp products caused the parameter decrease (from 8 to 33%. Within a group of bakery products containing 50% of barley flour, hulled hemp wholemeal partially supressed negative effect of barley flour – specific bread volumes increased about ca 15%. Commercial fine hemp flour samples demonstrated a reversal influence – its addition resulted into lower buns size than wheat-barley control (about 3–34%. Between wheat flour and both groups of flour tri-composites, PCA confirmed differences in dough and bread technological quality. Specific bread volume could be predicted according to maturograph dough elasticity, dough or bread OTG volumes.
Study on Effect of Immune Stimulation of γ-Ray Irradiated β-Glucan on Tilapia
International Nuclear Information System (INIS)
Nguyen Ngoc Duy; Nguyen Quoc Hien; Dang Van Phu
2013-01-01
Low molecular weight β-glucan (LMWβG) and oligoβ-glucan solution were prepared by the hydrothermal steaming combination with γ-irradiation method. The efficiency of the degradation process was demonstrated by gel permeation chromatography (GPC) analysis of the average molecular weight (Mw) of β-glucan. Results showed that the Mw decreased with increasing steaming time, concentration of H 2 O 2 and doses. For LMWβG, Mw reduces from 296,600 Da to 44,400 Da when concentration of H 2 O 2 raises from 2.5% to 10% and for oligoβ-glucan Mw reduces to 7,100 Da at 16 kGy. Tilapia fish was fed with LMWβ and oligoβ-glucan of 100 ppm for 45 days, was challenged with Strep. Agalactidae bacterial to investigate immune stimulation. The results indicated that oligoβ-glucan has higher immune stimulation effect compared to LMWβG. The effect of oligoβ-glucan various concentrations of 50, 100, and 150 ppm was investigated. Results showed that survival rate was the highest for oligoβ-glucan of 150 ppm. (author)
Directory of Open Access Journals (Sweden)
Fulcher R Gary
2007-03-01
fibers. Thus, a practical dose of β-glucan can significantly lower serum lipids in a high-risk population and may improve colon health.
Effect of dietary supplements in American bullfrogs reared in low and high stocking densities
Directory of Open Access Journals (Sweden)
Jorgina Juliana Gradisse Freitas
2017-11-01
Full Text Available The aim of this study was to evaluate the effect of the probiotic Bacillus subtillis and beta-glucan from the fungus Agaricus blazei on survival, growth and immunological capacity in bullfrogs (Lithobates catesbeianus cultured in low and high stocking densities. Animals weighing 24.3 ± 2.38 g were randomly distributed into four treatments with four simultaneous replicates: D100: 100 frogs/m2 (control; D236: 236 frogs/m2; D236 + Prob.: 236 frogs/m2 supplemented with probiotic; and D236 + BG: 236 frogs/m2 supplemented with beta-glucan. The parameters evaluated were weight gain, survival, plasma corticosterone (CORT, phagocytic capacity (PC and phagocytic index (PI, at 24 h and 15 and 30 days. There is significant interaction between treatments and time for CORT levels. At 30 days, these values were very close for the D100 (control and D236 + BG groups. Meanwhile, no statistical differences were observed between treatments for PC and PI. These results indicate that beta-glucan reduced the effects of stress caused by high density in bullfrogs, but the probiotic did not reduce these effects. Both compounds are not efficient at increasing survival rates, weight gain and neither immune response of animals. Thus, the use of commercial food additives may not have the favorable impact desired by the farmer. Their use in aquaculture should be further studied in experiments involving a longer trial period and taking into account the cost of their use.
A fermentation process, which was designated the EDGE (enhanced dry grind enzymatic) process, has recently been developed for barley ethanol production. In the EDGE process, in addition to the enzymes normally required for starch hydrolysis, commercial Beta-glucanases were used to hydrolyze (1,3)(1,...
Structure and function of α-glucan debranching enzymes
DEFF Research Database (Denmark)
Møller, Marie Sofie; Henriksen, Anette; Svensson, Birte
2016-01-01
α-Glucan debranching enzymes hydrolyse α-1,6-linkages in starch/glycogen, thereby, playing a central role in energy metabolism in all living organisms. They belong to glycoside hydrolase families GH13 and GH57 and several of these enzymes are industrially important. Nine GH13 subfamilies include α......-glucan debranching enzymes; isoamylase and glycogen debranching enzymes (GH13_11); pullulanase type I/limit dextrinase (GH13_12–14); pullulan hydrolase (GH13_20); bifunctional glycogen debranching enzyme (GH13_25); oligo-1 and glucan-1,6-α-glucosidases (GH13_31); pullulanase type II (GH13_39); and α-amylase domains......_39 enzymes could represent a “missing link” between the strictly α-1,6-specific debranching enzymes and the enzymes with dual specificity and α-1,4-linkage preference....
Effect of purified oat β-glucan on fermentation of set-style yogurt mix.
Singh, Mukti; Kim, Sanghoon; Liu, Sean X
2012-08-01
Effect of oat β-glucan on the fermentation of set-style yogurt was investigated by incorporating 0%, 0.1%, 0.2%, 0.3%, 0.4%, and 0.5% of purified oat β-glucan into the yogurt mix. It was found that levels up to 0.3% resulted in yogurts with quality characteristics similar to the control yogurt. Higher levels of β-glucan however retarded the fermentation process with noticeable difference in the characteristics of the yogurt. Examination of the morphologies of yogurt with and without β-glucan revealed that β-glucan formed aggregates with casein micelle and did not form phase-separated domains. This research demonstrated that β-glucan could be added to yogurt up to 0.3%, which meets the nutrient guidelines, to have added nutritional benefits. Yogurt is known for its beneficial effects on human health and nutrition. Yogurt production and consumption is increasing in the United States every year. However, it is lacking in β-glucans, which are recognized for their nutritional importance as functional bioactive ingredients. The main objective was to develop and characterize low-fat yogurts with added β-glucan. This research demonstrated that β-glucan could be added to yogurt up to 0.3%, which meets the nutrient guidelines for added nutritional benefits, without affecting the characteristics of yogurt significantly. This study will benefit the dairy industry by generating new products offering healthy alternatives. Journal of Food Science © 2012 Institute of Food Technologists® No claim to original US government works.
Purification and characterization of recombinant high pI Barley α-Glucosidase
DEFF Research Database (Denmark)
Næsted, Henrik; Bojsen, Kirsten; Svensson, Birte
(MACGREGOR & sissons). recently expression and characterization of the recombinant full length and fully functional barley high pi α-glucosidase in pichia pastoris has been achieved. in order to facilitate protein yield in the mg range, a clone representing an n-terminal hexa histidine tagged recombinant...... form of the enzyme was grown under high cell-density fermentation conditions. this approach enabled a successful protein expression profile under the highly sensitive methanol utilization phase using a biotatb 5 l reactor for the fermentation procedure. the enzyme was purified from 3.5 liter α...... of the native enzyme indicates a possible post-translational glycosylation of the recombinant α-glucosidase. preliminary enzyme kinetic analysis has demonstrated that the purified α-glucosidase displayed high stability during the 5 day long fermenentation and exhibited a specific activity in the range...
High beta plasmas in the PBX tokamak
International Nuclear Information System (INIS)
Bol, K.; Buchenauer, D.; Chance, M.
1986-04-01
Bean-shaped configurations favorable for high β discharges have been investigated in the Princeton Beta Experiment (PBX) tokamak. Strongly indented bean-shaped plasmas have been successfully formed, and beta values of over 5% have been obtained with 5 MW of injected neutral beam power. These high beta discharges still lie in the first stability regime for ballooning modes, and MHD stability analysis implicates the external kink as responsible for the present β limit
Density Stress has Minimal Impacts on the Barley or Maize Seedling Transcriptome
Directory of Open Access Journals (Sweden)
Summer St. Pierre
2011-03-01
Full Text Available High planting density affects the morphology and productivity of many crop species. Our objectives were to examine the phenotypic and transcriptomic changes that occur during plant density stress in barley ( L. and maize ( L. seedlings. In maize and barley seedlings, density stress impacted several morphological traits. Gene expression profiles were examined in four barley and five maize genotypes grown at low and high plant densities. Only 221 barley and 35 maize genes exhibited differential expression in response to plant density stress. The majority of the gene expression changes were observed in a subset of the genotypes and reflected minor changes in the level of expression, indicating that the plant density stress imposed in this study did not result in major changes in gene expression. Also, little overlap was observed within barley or maize genotypes in gene expression during density stress, indicating that genotypic differences play a major role in the response to density stress. While it is clear that gene expression differences are involved in morphological changes induced by high plant densities, it is likely that many of these gene expression differences are subtle and restricted to particular tissues and developmental time.
Defining carbohydrate binding of glucan phosphatases via Affinity gel electrophoresis
DEFF Research Database (Denmark)
Auger, Kyle; Raththagala, Madushi; Wilkens, Casper
2016-01-01
was to determine a technique to measure carbohydrate binding quickly and efficiently. We established a protocol to reproducibly and quantitatively measure the binding of the enzymes to glucans utilizing Affinity Gel Electrophoresis (AGE). The results show that the various glucan phosphatases possess differing...
Cabib, Enrico; Blanco, Noelia; Arroyo, Javier
2012-04-01
Previous results suggested that the chitin ring present at the yeast mother-bud neck, which is linked specifically to the nonreducing ends of β(1-3)glucan, may help to suppress cell wall growth at the neck by competing with β(1-6)glucan and thereby with mannoproteins for their attachment to the same sites. Here we explored whether the linkage of chitin to β(1-3)glucan may also prevent the remodeling of this polysaccharide that would be necessary for cell wall growth. By a novel mild procedure, β(1-3)glucan was isolated from cell walls, solubilized by carboxymethylation, and fractionated by size exclusion chromatography, giving rise to a very high-molecular-weight peak and to highly polydisperse material. The latter material, soluble in alkali, may correspond to glucan being remodeled, whereas the large-size fraction would be the final cross-linked structural product. In fact, the β(1-3)glucan of buds, where growth occurs, is solubilized by alkali. A gas1 mutant with an expected defect in glucan elongation showed a large increase in the polydisperse fraction. By a procedure involving sodium hydroxide treatment, carboxymethylation, fractionation by affinity chromatography on wheat germ agglutinin-agarose, and fractionation by size chromatography on Sephacryl columns, it was shown that the β(1-3)glucan attached to chitin consists mostly of high-molecular-weight material. Therefore, it appears that linkage to chitin results in a polysaccharide that cannot be further remodeled and does not contribute to growth at the neck. In the course of these experiments, the new finding was made that part of the chitin forms a noncovalent complex with β(1-3)glucan.
Conserved Transcriptional Regulatory Programs Underlying Rice and Barley Germination
Lin, Li; Tian, Shulan; Kaeppler, Shawn; Liu, Zongrang; An, Yong-Qiang (Charles)
2014-01-01
Germination is a biological process important to plant development and agricultural production. Barley and rice diverged 50 million years ago, but share a similar germination process. To gain insight into the conservation of their underlying gene regulatory programs, we compared transcriptomes of barley and rice at start, middle and end points of germination, and revealed that germination regulated barley and rice genes (BRs) diverged significantly in expression patterns and/or protein sequences. However, BRs with higher protein sequence similarity tended to have more conserved expression patterns. We identified and characterized 316 sets of conserved barley and rice genes (cBRs) with high similarity in both protein sequences and expression patterns, and provided a comprehensive depiction of the transcriptional regulatory program conserved in barley and rice germination at gene, pathway and systems levels. The cBRs encoded proteins involved in a variety of biological pathways and had a wide range of expression patterns. The cBRs encoding key regulatory components in signaling pathways often had diverse expression patterns. Early germination up-regulation of cell wall metabolic pathway and peroxidases, and late germination up-regulation of chromatin structure and remodeling pathways were conserved in both barley and rice. Protein sequence and expression pattern of a gene change quickly if it is not subjected to a functional constraint. Preserving germination-regulated expression patterns and protein sequences of those cBRs for 50 million years strongly suggests that the cBRs are functionally significant and equivalent in germination, and contribute to the ancient characteristics of germination preserved in barley and rice. The functional significance and equivalence of the cBR genes predicted here can serve as a foundation to further characterize their biological functions and facilitate bridging rice and barley germination research with greater confidence. PMID
Kis, András; Tholt, Gergely; Ivanics, Milán; Várallyay, Éva; Jenes, Barnabás; Havelda, Zoltán
2016-04-01
Infection of Wheat dwarf virus (WDV) strains on barley results in dwarf disease, imposing severe economic losses on crop production. As the natural resistance resources against this virus are limited, it is imperative to elaborate a biotechnological approach that will provide effective and safe immunity to a wide range of WDV strains. Because vector insect-mediated WDV infection occurs during cool periods in nature, it is important to identify a technology which is effective at lower temperature. In this study, we designed artificial microRNAs (amiRNAs) using a barley miRNA precursor backbone, which target different conservative sequence elements of the WDV strains. Potential amiRNA sequences were selected to minimize the off-target effects and were tested in a transient sensor system in order to select the most effective constructs at low temperature. On the basis of the data obtained, a polycistronic amiRNA precursor construct (VirusBuster171) was built expressing three amiRNAs simultaneously. The construct was transformed into barley under the control of a constitutive promoter. The transgenic lines were kept at 12-15 °C to mimic autumn and spring conditions in which major WDV infection and accumulation take place. We were able to establish a stable barley transgenic line displaying resistance to insect-mediated WDV infection. Our study demonstrates that amiRNA technology can be an efficient tool for the introduction of highly efficient resistance in barley against a DNA virus belonging to the Geminiviridae family, and this resistance is effective at low temperature where the natural insect vector mediates the infection process. © 2015 BSPP and John Wiley & Sons Ltd.
Lifescience Database Archive (English)
Full Text Available m Vulgare Molecule: Beta-D-Glucan Glucohydrolase Isoenzyme Exo1; Chain: A; Synonym: Beta-D-Glucan Exohydrola...Beta-D-Glucan Glucohydrolase Structure V. 9 1005 2001 2-Domain Fold GB:AAD23382,4566505|EMBL; AF102868; AAD2
Li, Y L; McAllister, T A; Beauchemin, K A; He, M L; McKinnon, J J; Yang, W Z
2011-08-01
The objective of this study was to evaluate the effects of substituting wheat dried distillers grains with solubles (DDGS) for barley grain and barley silage on intake, digestibility, and ruminal fermentation in feedlot beef cattle. Eight ruminally cannulated Angus heifers (initial BW 455 ± 10.8 kg) were assigned to a replicated 4 × 4 Latin square design with 4 treatments: control, low (25%), medium (30%), and high (35%) wheat DDGS (DM basis). The diets consisted of barley silage, barley concentrate, and wheat DDGS in ratios of 15:85:0 (CON), 10:65:25 (25DDGS), 5:65:30 (30DDGS), and 0:65:35 (35DDGS; DM basis), respectively. The diets were formulated such that wheat DDGS was substituted for both barley grain and barley silage to evaluate whether wheat DDGS can be fed as a source of both energy (grain) and fiber in feedlot finishing diets. Intakes (kg/d) of DM and OM were not different, whereas those of CP, NDF, ADF, and ether extract (EE) were greater (P Ruminal pH and total VFA concentrations were not different (P > 0.15) between 25DDGS and CON diets. Replacing barley silage with increasing amounts of wheat DDGS (i.e., from 25DDGS to 35DDGS) linearly reduced (P ruminal pH tended (P=0.10) to linearly decrease, and ruminal pH status decreased with longer (P=0.04) duration of pH 0.19) ruminal VFA and NH(3)-N concentrations. Results indicated that wheat DDGS can be effectively used to replace both barley grain and silage at a moderate amount to meet energy and fiber requirements of finishing cattle. However, when silage content of the diet is low (ruminal pH status even though the rapidly fermentable starch content of the diet is considerably reduced. © 2011 American Society of Animal Science. All rights reserved.
The project of mutation breeding in barley (first report)
International Nuclear Information System (INIS)
2010-01-01
Barley is a second main crop with the production of 7 million tons per year and 3,5 million hectare cultivation area in Turkey. Because of wateer deficiency, cereals cultivated in Central Anatolian region. Barley is well adapted to dry farming system besides it is basic food for animal husbandry and main raw material for brewery industry. the main problems in barley production are drought disease epidemic and increasing salinity gradually. Main purposes of our project is to increase resistance and tolerence to this stress factors. In order to reach to our aim we have been using mutation breeding techniques and conventional breeding methods. This Project has been started with irradiation of barley seeds with different gamma ray doses. After that resistant and tolerant mutant has been selected most of these mutanys have resistance and tolerance to different disease and stress conditions. During the selection procedure, hydroponics and tissue culture techniques have been applied to improve the selection efficiency. Up to now, promising barley mutant lines 71 that have earliness (30 days) than parents and because of that reason that escape from drought period. Disease tests of our mutant lines have been conducted under controlled conditions and tolerant lines have been determined under the high the high epidemic conditions. Salt tolerance studies have been applied under hydroponics conditions and salt tolerant mutant have been determined under 180-200mMolNaCl concentration. All mutant lines are carried out to preliminary yield trials for their evaluation
DEFF Research Database (Denmark)
Khakimov, Bekzod; Rasmussen, Morten Arendt; Kannangara, Rubini Maya
2017-01-01
for ideal vegetable protein production and for augmented β-glucan production. Seeds from three barley lines (Bomi, lys3.a and lys5.f) were sampled eight times during grain filling and analysed for metabolites using gas chromatography-mass spectrometry (GC-MS). The lys3.a mutation disrupts a regulator gene...... their successful application to link genetic and environmental factors with the seed phenotype of unique and agro-economically important barley models for optimal vegetable protein and dietary fibre production......., causing an increase in proteins rich in the essential amino acid lysine, while lys5.f carries a mutation in an ADP-glucose transporter gene leading to a significant increase in production of mixed-linkage β-glucan at the expense of α-glucan. Unique metabolic patterns associated with the tricarboxylic acid...
A Candida biofilm-induced pathway for matrix glucan delivery: implications for drug resistance.
Directory of Open Access Journals (Sweden)
Heather T Taff
Full Text Available Extracellular polysaccharides are key constituents of the biofilm matrix of many microorganisms. One critical carbohydrate component of Candida albicans biofilms, β-1,3 glucan, has been linked to biofilm protection from antifungal agents. In this study, we identify three glucan modification enzymes that function to deliver glucan from the cell to the extracellular matrix. These enzymes include two predicted glucan transferases and an exo-glucanase, encoded by BGL2, PHR1, and XOG1, respectively. We show that the enzymes are crucial for both delivery of β-1,3 glucan to the biofilm matrix and for accumulation of mature matrix biomass. The enzymes do not appear to impact cell wall glucan content of biofilm cells, nor are they necessary for filamentation or biofilm formation. We demonstrate that mutants lacking these genes exhibit enhanced susceptibility to the commonly used antifungal, fluconazole, during biofilm growth only. Transcriptional analysis and biofilm phenotypes of strains with multiple mutations suggest that these enzymes act in a complementary fashion to distribute matrix downstream of the primary β-1,3 glucan synthase encoded by FKS1. Furthermore, our observations suggest that this matrix delivery pathway works independently from the C. albicans ZAP1 matrix formation regulatory pathway. These glucan modification enzymes appear to play a biofilm-specific role in mediating the delivery and organization of mature biofilm matrix. We propose that the discovery of inhibitors for these enzymes would provide promising anti-biofilm therapeutics.
International Nuclear Information System (INIS)
Baloch, A. W.; Balogh, M. J.; Baloch, M.; Baloch, I. A.
2016-01-01
The present experiment was carried out to estimate genetic diversity and genetic structure in cultivated and wild barley populations collected from Jordan which is considered as primary gene pool of barley. In a total, 94 cultivated barley accessions composed of 4 populations and 52 wild barley accessions consisted of 3 populations were used for genetic analysis using 7 Intron Splice Junction (ISJ) markers. The genetic diversity index (He) of cultivated barley ranged between 0.049 and 0.060; whereas that of wild barley populations ranged between 0.084 and 0.146, suggesting that wild resources of barley harbored greater genetic diversity than its domesticated counterpart, reflecting that barley domestication occurred with genetic bottleneck. Analysis of molecular variance showed high genetic variations among rather than within populations, referring that high genetic differentiation of barley populations caused by genetic and geographical separation of the populations in the harsh growing conditions of Fertile Crescent. Principal coordinate, clustering and structure analysis not only separated cultivated and wild barley, but also each single population, showing their genetic basis and original sample site. The obtained Results also revealed that there is lesser genetic communication between cultivated and wild barley under natural environments. The current findings can better be exploited for collection and utilization of plant germplasms. (author)
Radiosensitivities of cultured barley of different type (Hordeum vulgare)
International Nuclear Information System (INIS)
Wang Cailian; Shen Mei; Xu Gang; Zhao Kongnan
1990-01-01
The dormant seeds (with 13% moisture) of 47 barley varieties were irradiated with various doses (0-40 krad) of 137 Cs γ-rays. The radiosensitivities of naked barley was significantly higher than that of hulled barley. The sensitive coefficients of seedling height were 0.04945 and 0.03667 for naked barley and hulled barley, respectively. The radiosensitivity of four-row naked barley was significantly higher than that of two-row hulled barley and six-row hulled barley. 47 varieties studied could be divided into five types with different radiosensitivities, i.e. extreme resistant, resistant, intermediate, sensitive and extreme sensitive. It was also found that the dose-effect curves of cell nucleus volume had a peal at 30 krad
Characterization of ß-Glucans Isolated from Brewer’s Yeast and Dried by Different Methods
Directory of Open Access Journals (Sweden)
Vesna Zechner-Krpan
2010-01-01
Full Text Available Two different procedures have been used for isolation of water-insoluble ß-glucans from brewer’s yeast: alkaline-acidic isolation (AA and alkaline-acidic isolation with mannoprotein removal (AAM. The obtained ß-glucans were then dried by air-drying, lyophilization and combination of sonication and spray-drying. ß-Glucan preparations obtained by AA and AAM isolations had similar values of dry mass, total polysaccharides, proteins and organic elemental microanalysis. The mass fractions of ß-glucan in total polysaccharides were significantly affected by different isolation procedures. Fourier transform infrared (FTIR spectra of all preparations had the appearance typical for (1→3-ß-D-glucan. Lyophilization and especially air-drying caused a higher degree of agglomeration and changes in ß-glucan microstructure. Sonication followed by spray-drying resulted in minimal structural changes and negligible formation of agglomerates.
Lifescience Database Archive (English)
Full Text Available m Vulgare Molecule: Beta-D-Glucan Glucohydrolase Isoenzyme Exo1; Chain: A; Synonym: Beta-D-Glucan Exohydrola...Of A Plant Beta-D-Glucan Glucohydrolase Structure V. 9 1005 2001 2-Domain Fold GB:AAD23382,4566505|EMBL; AF1
Anti-glucan effects of propolis ethanol extract on Lactobacillus acidophillus
Directory of Open Access Journals (Sweden)
Ira Widjiastuti
2017-03-01
Full Text Available Background: In deep dentinal caries cases, bacteria mostly found are Lactobacillus acidophilus classified as gram positive bacteria and as facultative aerobes producing glucosyltransferase (GTF enzyme. GTF enzyme can alter sucrose into glucans. Glucan is sticky and insoluble in water. As a result, GTF enzyme can facilitate plaque formation and microorganism colonization on tooth surface. In addition, Lactobacillus acidophilus also can form acid leading to demineralization of organic and inorganic materials, resulting in dental caries. Multidrug-resistant phenomena, on the other hand, have led to the use of natural resources, one of which is propolis as an antimicrobial material and as a new anti-infective therapeutic strategy. Propolis is a resinous substances collected by worker bees (Apismellifera from barks and leaves of plants. Propolis has a complex chemical composition and biological properties, such as antibacterial, antiviral, antifungal, anti-inflammatory, and antitumor. Purpose: This research aimed to reveal anti-glucan effects of propolis ethanol extract generated from honey bee, Apis mellifera spp on Lactobacillus acidophilus bacteria. Method: Before antiglucan test was conducted, glucan-formation test was performed on Lactobacillus acidophilus bacteria using SDSpage. Meanwhile, anti-glucan adhesion test on Lactobacillus acidophilus bacteria was carried by culturing the bacteria at 37ºC temperature in a jar with 10% CO2. Test tubes were placed at an angle of 30º for 18 hours to review the attachment of bacteria at the glass surfaces. After the incubation, the culture of bacteria was vibrated using a mixer vortex for a few minutes, and then cultured in solid MRS A media. Bacteria grown were measured by using colony counter. Result: The ethanol extract of propolis with a concentration of 1.56% was the lowest concentration inhibiting the attachment of glucan to Lactobacillus acidophilus bacteria. Conclusion: The ethanol extract of
Identification of a Phytase Gene in Barley (Hordeum vulgare L.)
Dai, Fei; Qiu, Long; Ye, Lingzhen; Wu, Dezhi; Zhou, Meixue; Zhang, Guoping
2011-01-01
Background Endogenous phytase plays a crucial role in phytate degradation and is thus closely related to nutrient efficiency in barley products. The understanding of genetic information of phytase in barley can provide a useful tool for breeding new barley varieties with high phytase activity. Methodology/Principal Findings Quantitative trait loci (QTL) analysis for phytase activity was conducted using a doubled haploid population. Phytase protein was purified and identified by the LC-ESI MS/MS Shotgun method. Purple acid phosphatase (PAP) gene was sequenced and the position was compared with the QTL controlling phytase activity. A major QTL for phytase activity was mapped to chromosome 5 H in barley. The gene controlling phytase activity in the region was named as mqPhy. The gene HvPAP a was mapped to the same position as mqPhy, supporting the colinearity between HvPAP a and mqPhy. Conclusions/Significance It is the first report on QTLs for phytase activity and the results showed that HvPAP a, which shares a same position with the QTL, is a major phytase gene in barley grains. PMID:21533044
Directory of Open Access Journals (Sweden)
ali kargarirezapour
2013-08-01
Full Text Available Glucans derived from yeast cell wall are promising alternatives to antibiotics, as they have been shown to improve growth performance and stimulate the immune system of immature broilers. In this study we evaluated the effect of different levels of yeast beta-glucan (YBG on some blood parametrs of broiler chickens. In a factorial experiment based on completely randomized design (the first factor: YBG levels: 0, 0.04 and 0.08% of basal diet and sex as a second factor 144 day old chicks (72 male and 72 female were selected and allocated to different treatments (three replicates of each treatment. The overall experimental period was 34 days. At the end of study, two birds from each pen were randomly selected as a sample. The level of albumin, globulin, urea and total protein was measured on blood samples. Statistical analysis of the results showed that the YBG had no significant effect on albumin, globulin, urea and total protein level. But the amount of plasma albumin and total protein in female chicks was significantly higher than male chicks (p
Effects of β-glucan on colon anastomotic healing in rats given preoperative irradiation.
Seker, Ahmet; Deger, Kamuran Cumhur; Bostanci, Erdal Birol; Ozer, Ilter; Dalgic, Tahsin; Bilgihan, Ayse; Akmansu, Muge; Ekinci, Ozgur; Ercin, Ugur; Akoglu, Musa
2014-06-01
Radiation therapy is an essential therapeutic modality in the management of a wide variety of tumors. We aimed to investigate the short-term effects of pelvic irradiation on the healing of colon anastomoses and to determine the potential protective effects of β-glucan in this situation. Sixty Wistar albino rats were randomized into three experimental groups: a control group (n = 20), an irradiation (IR) group (n = 20), and an irradiation+β-glucan (IR+β-glucan) group (n = 20). Only segmental colonic resection and anastomosis were performed on the control group. The IR group underwent the same surgical procedure as the control group 5 days after pelvic irradiation. In the IR+β-glucan group, the same procedure was applied as in the IR group after β-glucan administration. The groups were subdivided into subgroups according to the date of euthanasia (third [n = 10] or seventh [n = 10] postoperative [PO] day), and anastomotic colonic segments were resected to evaluate bursting pressures and biochemical and histopathological parameters. Bursting pressure values were significantly lower in the IR group (p < .001). Malondialdehyde (MDA) levels were significantly higher in the IR group, whereas β-glucan significantly decreased MDA levels on the third PO day (p < .001). Granulation tissue formation scores were significantly lower in the IR+β-glucan group compared with the control group and the IR group (p < .001). The results of this study indicate that irradiation has negative effects on the early healing of colon anastomoses. The administration of β-glucan ameliorates these unfavorable effects by altering bursting pressures and biochemical parameters.
Occurrence of deoxynivalenol and zearalenone in brewing barley grains from Brazil.
Piacentini, Karim C; Rocha, L O; Savi, G D; Carnielli-Queiroz, L; Almeida, F G; Minella, E; Corrêa, B
2018-03-09
Barley (Hordeum vulgare L.) is an important cereal crop for food and represents one of the main ingredients in beer production. Considering the importance of barley and its derived products, the knowledge about the mycotoxin contamination in the barley production is essential in order to assess its safety. In this study, the levels of deoxynivalenol (DON) and zearalenone (ZEN) in brewing barley were determined using a LC-MS/MS method. A survey was conducted in 2015 to estimate the mycotoxin levels in these products (n = 76) from four crop regions in Brazil. The results showed high levels of DON and ZEN in the analyzed samples, with contamination levels of 94 and 73.6%, respectively. The mean levels of DON and ZEN ranged from 1700 to 7500 μg/kg and from 300 to 630 μg/kg, respectively. Barley samples from regions 1 and 2 presented higher levels of ZEN and DON, respectively, and those from region 4 presented lower levels of both. Co-occurrence of DON and ZEN was seen in the majority of the barley grain samples, and the mycotoxin content was above the maximum levels established by the Brazilian and European regulations.
Directory of Open Access Journals (Sweden)
Henky Manoppo
2010-06-01
Full Text Available The objective of this research was to evaluate the nonspecific immune response and resistance of Litopenaeus vannamei fed with nucleotide, β–glucan, and protagen diets. Shrimp juveniles with an average weight of 5.39±0.56 g were reared in glass aquaria at a density of 15 shrimps/aquarium. Shrimps were fed three times a day for four weeks at a feeding rate of 3%/bw/day. Treatment diets consisted of A: basal diet (without immunostimulant, B: β–glucan, C: protagen, and D: nucleotide, each with three replicates. At the end of feeding period, the shrimps were intramuscularly injected with Vibrio harveyi 0.1 x 106 cfu.shrimp-1. Total haemocyte count (THC of shrimp fed with nucleotide-diet was significantly different compared to that of control shrimp (p=0.01, but not different compared to shrimp fed with protagen-diet. PO activity also increased significantly in shrimp fed with nucleotide-diet (p=0.02. β–glucan diet could also increase THC and PO activity, but compared to the control, the increase was not significantly different. Overall, PO activity of shrimp fed with nucleotide, β–glucan, and protagen diets was high (>0.35. Oral administration of nucleotide, β–glucan, and protagen for four consecutive weeks significantly increased resistance of shrimp to disease (<0.01 where the highest resistance rate was observed on shrimp fed with nucleotide-diet. Growth of shrimp fed with nucleotide-diet was significantly different compared to that of control shrimp (p<0.01, as well as to β–glucan, and protagen-treated shrimp. As a conclusion, supplementation of nucleotide into shrimp pellet enhanced nonspecific immune response and growth performance better than β-glucan, and protagen.
Starch and Free Sugars during Kernel Development of Bomi Barley and its High-Lysine Mutant 1508
DEFF Research Database (Denmark)
Kreis, Michael
1978-01-01
At maturity the high-lysine barley (Hordeum vulgare L.) Ris0 mutants 1508, 527 and 29 kernels contained about 20% less starch and twice as much free sugars as the parent varieties Bomi and Carlsberg II. An enhanched effect on starch reduction and free sugar accumulation was observed during kernel...
DEFF Research Database (Denmark)
Rosenkilde, Anne Lind; Dionisio, Giuseppe; Holm, Preben Bach
2011-01-01
During germination of barley seeds, mobilization of protein is essential and cysteine proteases accounts for more than 90 % of the total proteolytic activity in the degradation of barley seed storage proteins. Cysteine proteases exist as pro-enzyme and is activated through reduction of the active...... site cysteines and by removal of the pro-domain. The complement of cysteine proteases is comprehensive and for detailed studies of the individual components of this complement, a fast and efficient eukaryotic expression platform is highly desirable. A cDNA clone of the barley key cysteine endoprotease...
Beta decay of highly charged ions
International Nuclear Information System (INIS)
Litvinov, Yuri A; Bosch, Fritz
2011-01-01
Beta decay of highly charged ions has attracted much attention in recent years. An obvious motivation for this research is that stellar nucleosynthesis proceeds at high temperatures where the involved atoms are highly ionized. Another important reason is addressing decays of well-defined quantum-mechanical systems, such as one-electron ions where all interactions with other electrons are excluded. The largest modifications of nuclear half-lives with respect to neutral atoms have been observed in beta decay of highly charged ions. These studies can be performed solely at ion storage rings and ion traps, because there high atomic charge states can be preserved for extended periods of time (up to several hours). Currently, all experimental results available in this field originate from experiments at the heavy-ion complex GSI in Darmstadt. There, the fragment separator facility FRS allows the production and separation of exotic, highly charged nuclides, which can then be stored and investigated in the storage ring facility ESR. In this review, we present and discuss in particular two-body beta decays, namely bound-state beta decay and orbital electron capture. Although we focus on experiments conducted at GSI, we will also attempt to provide general requirements common to any other experiment in this context. Finally, we address challenging but not yet performed experiments and we give prospects for the new radioactive beam facilities, such as FAIR in Darmstadt, IMP in Lanzhou and RIKEN in Wako.
Fungal growth during malting of barley
Directory of Open Access Journals (Sweden)
Kocić-Tanackov Sunčica D.
2005-01-01
Full Text Available Fungi were isolated and identified in two samples of winter two-row barley (SSK3 and SSK6 harvested in 2003, Kragujevac location, during micromalting. Fungi were isolated and identified in barley before the micromalting, after the 1st, 2nd and 3rd day of steeping, the first day and after the germination after kilning and after malt degermination. The total fungi count was followed in both barley samples, during the mentioned phases. The total count of fungi was also determined in the steeping water, and the isolation and identification was performed after the steeping process. Change of the total count of fungi during barley micromalting was exponentional. During barley micromalting nine fungi genera were isolated: Phoma, Alternaria, Fusarium aspergillus, Cladosporium, Geotrichum, Scopulariopsis, Aureobasidium and Mucor. The most frequent genera were: Phoma, Alternaria and Fusarium. In water for steeping, five genera were identified: Geotrichum, Fusarium, Phoma Cladosporium and Mucor. The most frequent genera was Phoma.
Shah, Asima; Gani, Adil; Ahmad, Mudasir; Ashwar, Bilal Ahmad; Masoodi, F A
2016-01-01
Three strains of probiotics Lactobacillus casei, Lactobacillus brevis, and Lactobacillus plantarum were encapsulated in β-glucan matrix using emulsion technique. Further the encapsulated cells were studied for their tolerance in simulated gastrointestinal conditions and its storage stability. The average encapsulation efficiency of β-glucan-probiotic beads was found to be 74.01%. The surface morphology of β-glucan containing bacteria was studied using SEM. The noteworthy absorptions in the FT-IR spectra between 1300-900 cm(-1) and 2918-2925 cm(-1) corresponds to the presence of bacteria into the glucan matrix. Also, the thermal stability of β-glucan was evaluated using Differential Scanning Calorimeter. The efficiency of β-glucan in protecting the surviability of probiotic cells under simulated gastrointestinal conditions was studied. Results revealed significant (p<0.05) improvement to tolerance when the encapsulated cells were subjected to stresses like low pH, heat treatment, simulated intestinal conditions and storage. Copyright © 2015 Elsevier B.V. All rights reserved.
Dinadayala, Premkumar; Lemassu, Anne; Granovski, Pierre; Cérantola, Stéphane; Winter, Nathalie; Daffé, Mamadou
2004-03-26
The attenuated strain of Mycobacterium bovis Bacille Calmette-Guérin (BCG), used worldwide to prevent tuberculosis and leprosy, is also clinically used as an immunotherapeutic agent against superficial bladder cancer. An anti-tumor polysaccharide has been isolated from the boiling water extract of the Tice substrain of BCG and tentatively characterized as consisting primarily of repeating units of 6-linked-glucosyl residues. Mycobacterium tuberculosis and other mycobacterial species produce a glycogen-like alpha-glucan composed of repeating units of 4-linked glucosyl residues substituted at some 6 positions by short oligoglucosyl units that also exhibits an anti-tumor activity. Therefore, the impression prevails that mycobacteria synthesize different types of anti-neoplastic glucans or, alternatively, the BCG substrains are singular in producing a unique type of glucan that may confer to them their immunotherapeutic property. The present study addresses this question through the comparative analysis of alpha-glucans purified from the extracellular materials and boiling water extracts of three vaccine substrains. The polysaccharides were purified, and their structural features were established by mono- and two-dimensional NMR spectroscopy and matrix-assisted laser desorption/ionization time-of-flight mass spectrometry of the enzymatic and chemical degradation products of the purified compounds. The glucans isolated by the two methods from the three substrains of BCG were shown to exhibit identical structural features shared with the glycogen-like alpha-glucan of M. tuberculosis and other mycobacteria. Incidentally, we observed an occasional release of dextrans from Sephadex columns that may explain the reported occurrence of 6-substituted alpha-glucans in mycobacteria.
Achieving high fusion reactivity in high poloidal beta discharges in TFTR
International Nuclear Information System (INIS)
Manuel, M.E.; Navratil, G.A.; Sabbagh, S.A.; Batha, S.; Bell, M.G.; Bell, R.; Budny, R.V.; Bush, C.E.; Cavallo, A.; Chance, M.S.; Cheng, C.Z.; Efthimion, P.C.; Fredrickson, E.D.; Fu, G.Y.; Hawryluk, R.J.; Janos, A.C.; Jassby, D.L.; Levinton, F.; Mikkelsen, D.R.; Manickam, J.; McCune, D.C.; McGuire, K.M.; Medley, S.S.; Mueller, D.; Nagayama, Y.; Owens, D.K.; Park, H.K.; Ramsey, A.T.; Stratton, B.C.; Synakowski, E.J.; Taylor, G.; Wieland, R.M.; Yamada, M.; Zarnstorff, M.C.: Zweben, S.; Kesner, J.; Marmar, E.; Snipes, J.; Terry, J.
1993-04-01
High poloidal beta discharges have been produced in TFTR that achieved high fusion reactivities at low plasma currents. By rapidly decreasing the plasma current just prior to high-power neutral beam injection, relatively peaked current profiles were created having high l i > 2, high Troyon-normalized beta, βN > 3, and high poloidal beta. β p ≥ 0.7 R/a. The global energy confinement time after the current ramp was comparable to supershots, and the combination of improved MHD stability and good confinement produced a new high εβ p high Q DD operating mode for TFTR. Without steady-state current profile control, as the pulse lengths of high βp discharges were extended, l i decreased, and the improved stability produced immediately after by the current ramp deteriorated. In four second, high εβ p discharges, the current profile broadened under the influence of bootstrap and beam-drive currents. When the calculated voltage throughout the plasma nearly vanished, MHD instabilities were observed with β N as low as 1.4. Ideal MHD stability calculations showed this lower beta limit to be consistent with theoretical expectations
DEFF Research Database (Denmark)
Nilsson, Anne C; Östman, Elin M; Knudsen, Knud Erik Bach
2010-01-01
, mean ± SD: 25.9 ± 3.2 y, BMI meals (50 g available starch) varying in content of indigestible carbohydrates. Each participant consumed all test meals in a random order on separate evenings. At a standardized breakfast following evening test meals......, the postprandial glucose response (incremental area under the curve, 0-120 min) was inversely related to plasma butyrate (r = -0.26; P meals composed of high-amylose barley kernels or high-ß-glucan barley kernels resulted in higher plasma butyrate...... concentrations the following morning compared with an evening meal with white wheat bread (P
Revisit to Ethiopian traditional barley-based food
Directory of Open Access Journals (Sweden)
Jemal Mohammed
2016-06-01
Full Text Available Barley is the number one food crop in the highland parts of North Eastern Ethiopia produced by subsistence farmers grown as landraces. Barley producers in Ethiopia have given it the name gebs ye ehil nigus, which means barley is the king of crops, due to its suitability for preparing many of the known Ethiopians traditional dishes. Various barley foods and drinks play an important role in the socioeconomic and cultural life of Ethiopians, but detailed descriptions related to their preparation and their socioeconomic and cultural roles are not well-recorded and documented like most of the Ethiopian cultural foods. Foods such as ingera, kita, dabo, kolo, genfo, beso, chuko, shamet, tihlo, kinch, and shorba are the most commonly known traditional Ethiopian barley-based foods. These products are prepared from either roasted whole grain, raw and roasted-milled grain, or cracked grain as main, side, ceremonial, and recuperating dishes. The various barley-based traditional foods have perceived qualities and health benefits by the consumers. For example, genfo is served to breast-feeding mothers with the belief that it enhances breast milk production and serves as a good substitute for breast milk. Beso is claimed to be a remedy for gastritis, while genfo and kinche are used to heal broken bones and fractures. Considering the Western consumers' trend on functional foods and health benefits of barley, Ethiopian traditional barley-based foods are worth studying as functional foods, which can be appealing to Western consumers.
Visual effects of β-glucans on wound healing in fish
DEFF Research Database (Denmark)
Schmidt, Jacob; Ljungqvist, Martin Georg; Ersbøll, Bjarne Kjær
2011-01-01
Introduction B-glucans are diverse polysaccharides that occur naturally in plants, fungi and bacteria. B-glucans have been shown to have an immunostimulatory effect1. In addition, B-glucans have been found to increase wound tensile strength and collagen synthesis2. This is likely to affect...... the filet quality3. With multispectral imaging we investigate the effect of adding B-glucans to the water during healing of open wounds in fish. Multispectral imaging is used in human diagnostic medicine for evaluating fx proriasis and chronic diabetic wounds, but has not yet been applied to wounds in fish....... Experimental set-up. The fish (common carp, Cyprinus carpio and rainbow trout, Oncorhynchus mykiss) were wounded with a biopsy punch (Miltex, York, USA), thus removing a cylinder of tissue. The resulting wound exposed the muscle. Fish were then kept for 14 days in either pure tap water or tap water...
Energy Technology Data Exchange (ETDEWEB)
Yanase, Shuhei; Yamada, Ryosuke; Ogino, Chiaki; Kondo, Akihiko [Kobe Univ. (Japan). Dept. of Chemical Science and Engineering; Hasunuma, Tomohisa; Tanaka, Tsutomu; Fukuda, Hideki [Kobe Univ. (Japan). Organization of Advanced Science and Technology
2010-09-15
To exploit cellulosic materials for fuel ethanol production, a microorganism capable of high temperature and simultaneous saccharification-fermentation has been required. However, a major drawback is the optimum temperature for the saccharification and fermentation. Most ethanol-fermenting microbes have an optimum temperature for ethanol fermentation ranging between 28 C and 37 C, while the activity of cellulolytic enzymes is highest at around 50 C and significantly decreases with a decrease in temperature. Therefore, in the present study, a thermotolerant yeast, Kluyveromyces marxianus, which has high growth and fermentation at elevated temperatures, was used as a producer of ethanol from cellulose. The strain was genetically engineered to display Trichoderma reesei endoglucanase and Aspergillus aculeatus {beta}-glucosidase on the cell surface, which successfully converts a cellulosic {beta}-glucan to ethanol directly at 48 C with a yield of 4.24 g/l from 10 g/l within 12 h. The yield (in grams of ethanol produced per gram of {beta}-glucan consumed) was 0.47 g/g, which corresponds to 92.2% of the theoretical yield. This indicates that high-temperature cellulose fermentation to ethanol can be efficiently accomplished using a recombinant K. marxianus strain displaying thermostable cellulolytic enzymes on the cell surface. (orig.)
High-throughput transcriptome analysis of barley (Hordeum vulgare) exposed to excessive boron.
Tombuloglu, Guzin; Tombuloglu, Huseyin; Sakcali, M Serdal; Unver, Turgay
2015-02-15
Boron (B) is an essential micronutrient for optimum plant growth. However, above certain threshold B is toxic and causes yield loss in agricultural lands. While a number of studies were conducted to understand B tolerance mechanism, a transcriptome-wide approach for B tolerant barley is performed here for the first time. A high-throughput RNA-Seq (cDNA) sequencing technology (Illumina) was used with barley (Hordeum vulgare), yielding 208 million clean reads. In total, 256,874 unigenes were generated and assigned to known peptide databases: Gene Ontology (GO) (99,043), Swiss-Prot (38,266), Clusters of Orthologous Groups (COG) (26,250), and the Kyoto Encyclopedia of Genes and Genomes (KEGG) (36,860), as determined by BLASTx search. According to the digital gene expression (DGE) analyses, 16% and 17% of the transcripts were found to be differentially regulated in root and leaf tissues, respectively. Most of them were involved in cell wall, stress response, membrane, protein kinase and transporter mechanisms. Some of the genes detected as highly expressed in root tissue are phospholipases, predicted divalent heavy-metal cation transporters, formin-like proteins and calmodulin/Ca(2+)-binding proteins. In addition, chitin-binding lectin precursor, ubiquitin carboxyl-terminal hydrolase, and serine/threonine-protein kinase AFC2 genes were indicated to be highly regulated in leaf tissue upon excess B treatment. Some pathways, such as the Ca(2+)-calmodulin system, are activated in response to B toxicity. The differential regulation of 10 transcripts was confirmed by qRT-PCR, revealing the tissue-specific responses against B toxicity and their putative function in B-tolerance mechanisms. Copyright © 2014. Published by Elsevier B.V.
Microarray Analysis of Late Response to Boron Toxicity in Barley (Hordeum vulgare L.) Leaves
Oz, M.T.; Yilmaz, R.; Eyidogan, F.; Graaff, de L.H.; Yucel, M.; Oktem, H.A.
2009-01-01
DNA microarrays, being high-density and high-throughput, allow quantitative analyses of thousands of genes and their expression patterns in parallel. In this study, Barley1 GereChip was used to investigate transcriptome changes associated with boron (B) toxicity in a sensitive barley cultivar
International Nuclear Information System (INIS)
Engvild, K.C.; Rasmussen, K.
2005-01-01
Barley mutants without root hairs or with short or reduced root hairs were isolated among M 2 seeds of 'Lux' barley (Hordeum vulgare L.) after acidified sodium azide mutagenesis. Root hair mutants are investigated intensively in Arabidopsis where about 40 genes are known. A few root hair mutants are known in maize, rice, barley and tomato. Many plants without root hairs grow quite well with good plant nutrition, and mutants have been used for investigations of uptake of strongly bound nutrients like phosphorus, iron, zinc and silicon. Seed of 'Lux' barley (Sejet Plant Breeding, Denmark) were soaked overnight, and then treated with 1.5-millimolarsodium azide in 0.1 molar sodium phosphate buffer, pH 3, for 2.5 hours according to the IAEA Manual on Mutation Breeding (2nd Ed.). After rinsing in tap water and air-drying, the M 2 seeds were sown in the field the same day. Spikes, 4-6 per M 1 plant, were harvested. The mutation frequency was similar to that obtained with other barley cultivars from which low-phytate mutants were isolated [5]. Seeds were germinated on black filter paper in tap water for 3 or 4 days before scoring for root hair mutants
Identification of a phytase gene in barley (Hordeum vulgare L..
Directory of Open Access Journals (Sweden)
Fei Dai
Full Text Available BACKGROUND: Endogenous phytase plays a crucial role in phytate degradation and is thus closely related to nutrient efficiency in barley products. The understanding of genetic information of phytase in barley can provide a useful tool for breeding new barley varieties with high phytase activity. METHODOLOGY/PRINCIPAL FINDINGS: Quantitative trait loci (QTL analysis for phytase activity was conducted using a doubled haploid population. Phytase protein was purified and identified by the LC-ESI MS/MS Shotgun method. Purple acid phosphatase (PAP gene was sequenced and the position was compared with the QTL controlling phytase activity. A major QTL for phytase activity was mapped to chromosome 5 H in barley. The gene controlling phytase activity in the region was named as mqPhy. The gene HvPAP a was mapped to the same position as mqPhy, supporting the colinearity between HvPAP a and mqPhy. CONCLUSIONS/SIGNIFICANCE: It is the first report on QTLs for phytase activity and the results showed that HvPAP a, which shares a same position with the QTL, is a major phytase gene in barley grains.
International Nuclear Information System (INIS)
Yu, P.
2007-01-01
Barley protein structure affects the barley quality, fermentation, and degradation behavior in both humans and animals among other factors such as protein matrix. Publications show various biological differences among barley varieties such as Valier and Harrington, which have significantly different degradation behaviors. The objectives of this study were to reveal the molecular structure of barley protein, comparing various varieties (Dolly, Valier, Harrington, LP955, AC Metcalfe, and Sisler), and quantify protein structure profiles using Gaussian and Lorentzian methods of multi-component peak modeling by using the ultra-spatially resolved synchrotron light sourced Fourier transform infrared microspectroscopy (SFTIRM). The items of the protein molecular structure revealed included protein structure α-helices, β-sheets, and others such as β-turns and random coils. The experiment was performed at the National Synchrotron Light Source in Brookhaven National Laboratory (BNL, US Department of Energy, NY). The results showed that with the SFTIRM, the molecular structure of barley protein could be revealed. Barley protein structures exhibited significant differences among the varieties in terms of proportion and ratio of model-fitted α-helices, β-sheets, and others. By using multi-component peaks modeling at protein amide I region of 1710-1576 cm -1 , the results show that barley protein consisted of approximately 18-34% of α-helices, 14-25% of β-sheets, and 44-69% others. AC Metcalfe, Sisler, and LP955 consisted of higher (P 0.05). The ratio of α-helices to others (0.3 to 1.0, P < 0.05) and that of β-sheets to others (0.2 to 0.8, P < 0.05) were different among the barley varieties. It needs to be pointed out that using a multi-peak modeling for protein structure analysis is only for making relative estimates and not exact determinations and only for the comparison purpose between varieties. The principal component analysis showed that protein amide I Fourier
Saccharification and fermentation of whole barley ground in the Szego mill
Energy Technology Data Exchange (ETDEWEB)
Wayman, M; Parekh, S R; Parekh, R S; Trass, O; Gandolfi, E
1988-11-01
Barley, after steeping in water, was ground with ease and efficiency in the Szego mill, and its starch was liquefied, saccharified and fermented to very high yields of ethanol. The Szego mill consists of vertical rollers with helical grooves which rotate within a fixed cylinder, resulting in very fine grinding and a somewhat flaky product. The steeped barley was ground to a fine paste. This was readily liquefied and saccharified by amylolytic enzymes (dual enzyme process), and the resulting sugars were fermented in 24 h by ordinary bakers' yeast Saccharomyces cerevisiae, resulting in over 450 l ethanol/t of barley. Still shorter time, 12 h, and the same high yield were achieved when liquefied barley starch was simultaneously saccharified by glucoamylase and fermented. Fermentation to ethanol by a glucoamylase-producing yeast S. diastaticus strain 164A (from Labatt Brewing Company) enabled the amount of this enzyme required for saccharification to be reduced to about one-half the normal quantity, but at some cost in slower fermentation and slightly lower ethanol yield.
The perspective crops for the bioregenerative human life support systems
Polonskiy, Vadim; Polonskaya, Janna
The perspective crops for the bioregenerative human life support systems V.I. Polonskiy, J.E. Polonskaya aKrasnoyarsk State Agrarian University, 660049, Krasnoyarsk, Russia In the nearest future the space missions will be too long. In this case it is necessary to provide the crew by vitamins, antioxidants, and water-soluble dietary fibers. These compounds will be produced by higher plants. There was not enough attention at present to increasing content of micronutrients in edible parts of crops candidates for CELSS. We suggested to add the new crops to this list. 1. Barley -is the best crop for including to food crops (wheat, rice, soybean). Many of the health effects of barley are connected to dietary fibers beta-glucan of barley grains. Bar-ley is the only seed from cereals including wheat with content of all eight tocopherols (vitamin E, important antioxidant). Barley grains contain much greater amounts of phenolic compounds (potential antioxidant activities) than other cereal grains. Considerable focus is on supplement-ing wheat-based breads with barley to introduce the inherent nutritional advantages of barley flour, currently only 20We have selected and tested during 5 generations two high productive barley lines -1-K-O and 25-K-O. Our investigations (special breeding program for improving grain quality of barley) are in progress. 2. Volatile crops. Young leaves and shoots of these crops are edible and have a piquant taste. A lot of organic volatile compounds, oils, vitamins, antioxidants are in their biomass. These micronutrients are useful for good appetite and health of the crew. We have investigated 11 species: basil (Ocimum basilicum), hyssop (Hyssopus officinalis), marjoram (Origanum majorana), sweet-Mary (Melissa officinalis), common thyme (Thymus vulgaris), creeping thyme (Thymus serpyllum), summer savory (Satureja hortensis), catnip (Nepeta cataria), rue (Ruta graveolens), coriander (Coriandrum Ativum), sulfurwort (Levisticum officinale). These
DEFF Research Database (Denmark)
Nielsen, Morten Munch; Bozonnet, Sophie; Seo, Eun-Seong
2009-01-01
Some polysaccharide processing enzymes possess secondary carbohydrate binding sites situated on the surface far from the active site. In barley alpha-amylase 1 (AMY1), two such sites, SBS1 and SBS2, are found on the catalytic (beta/alpha)8-barrel and the noncatalytic C-terminal domain, respective...
Physiological basis of barley yield under near optimal and stress conditions
Directory of Open Access Journals (Sweden)
Pržulj Novo
2004-01-01
Full Text Available Average barley yield fall below its potential due to incidence of stresses. Water stress is the main environmental factor limiting yield. The component a priori more sensitive to most stresses is the amount of radiation absorbed. The effect of stresses influence on the total amount of radiation absorbed by barley crop during its vegetation and the photosynthetic efficiency of radiation conversion. Growth inhibition is accompanied by reductions in leaf and cell wall extensibility. Grain yield under drought conditions is source limited. Supply of assimilates to the developing inflorescence plays a critical role in establishing final grain number and grain size. Grain weight is negatively affected by drought, high temperature, and any other factors that may reduce grain filling duration and grain filling rate. Awns and glaucousness confer better performance of barley under drought stress conditions. Barley responds with an increased accumulation of a number of proteins when subjected to different stress inducing cell dehydration. Screening techniques that are able to identify desirable genotypes based on the evaluation of physiological traits related to stress evasion and stress resistance maybe useful in breeding barley for resistance to stress, particularly drought stress. Crop management and breeding can reduce the incidence of stress on yield. The effect of these practices is sustained by an understanding of their physiology. In this paper the physiological basis of the processes determining barley yield and the incidence of stresses on photosynthetic metabolism that determine grain yield of barley is discussed. .
Yang, Y; Ferreira, G; Teets, C L; Corl, B A; Thomason, W E; Griffey, C A
2018-04-01
The objective of this study was to evaluate lactation performance, nutrient digestibility, and milk fatty acid composition of high-producing dairy cows consuming diets containing hulled or hull-less barley as the grain source when feeding low-forage (LF) or high-forage (HF) diets. Eight primiparous (610 ± 40 kg of body weight and 72 ± 14 d in milk) and 16 multiparous (650 ± 58 kg of body weight and 58 ± 16 d in milk) Holstein cows were randomly assigned to 1 of 4 diets in a replicated 4 × 4 Latin square design with a 2 × 2 factorial arrangement of treatments and 21-d periods. Cows were assigned to squares based on parity (1, 2, and ≥3) and days in milk. Diets were formulated to contain on a dry matter basis (1) 45% forage and hulled barley as the sole grain source, (2) 65% forage and hulled barley as the sole grain source, (3) 45% forage and hull-less barley as the sole grain source, and (4) 65% forage and hull-less barley as the sole grain source. Dry matter intake tended to be lower for the diet with 65% forage and hulled barley than for the rest of the diets (24.4 vs. 26.6 kg/d). Neither the type of barley nor the forage-to-concentrate ratio affected milk yield (41.7 kg/d). Barley type did not affect milk fat or protein concentrations. Feeding LF diets decreased milk fat concentration from 3.91% to 3.50%. This decrease was less than anticipated and resulted in a 7% decrease in milk fat yield relative to cows consuming HF diets (1.60 and 1.49 kg/d for HF and LF diets, respectively). Feeding LF diets increased the concentration of C18:1 trans-10 in milk fat, suggesting that feeding LF diets may have marginally altered rumen function. In conclusion, LF diets containing barley grains can marginally decrease milk fat concentration. Overall, and based on the conditions of this study, there is limited evidence to anticipate a dramatic or acute milk fat depression when feeding hull-less barley as the grain source in diets for high-producing dairy cows. Copyright
Kirjoranta, Satu; Tenkanen, Maija; Jouppila, Kirsi
2016-01-01
Brewer's spent grain (BSG), a by-product of malting of barley in the production of malt extract, was used as an ingredient in extruded barley-based snacks in order to improve the nutritional value of the snacks and widen the applications of this by-product in food sector. The effects of the extrusion parameters on the selected properties of the snacks were studied. Snacks with different ingredients including whole grain barley flour, BSG, whey protein isolate (WPI), barley starch and waxy corn starch were produced in 5 separate trials using a co-rotating twin-screw extruder. Extrusion parameters were water content of the mass (17-23 %), screw speed (200-500 rpm) and temperature of the last section and die (110-150 °C). Expansion, hardness and water content of the snacks were determined. Snacks containing barley flour and BSG (10 % of solids) had small expansion and high hardness. Addition of WPI (20 % of solids) increased expansion only slightly. Snacks with high expansion and small hardness were obtained when part of the barley flour was replaced with starch (barley or waxy corn). Yet, the highest expansion and the smallest hardness were achieved when barley flour was used with barley starch and WPI without BSG. Furthermore, expansion increased by increasing screw speed and decreasing water content of the mass in most of the trials. This study showed that BSG is a suitable material for extruded snacks rich in dietary fiber. Physical properties of the snacks could be improved by using barley or waxy corn starch and WPI.
Improvement of quinoa and barley through induced mutations and biotechnology
International Nuclear Information System (INIS)
Siles, A.Z.; Miranda, L.S.
2001-01-01
The main cropping problems in the Bolivian highlands are the long growing period of barley, high degree of environmental influence on the performance of quinoa, and low soil moisture at sowing time, leading to low germination rate and poor stands, and frost or chilling damages. The program aimed to establish protocols for induction of mutations with X rays and chemical mutagens (NaN 3 , MNH, EMS) in quinoa, barley, native forage species and forest plants and to obtain mutant lines, especially in barley and quinoa; and to establish callus regeneration in quinoa and micropropagation of kenua (Polilepis). The project is still in its study stages, hence further evaluations are needed before firm conclusions are drawn. (author)
SPRING BARLEY BREEDING FOR MALTING QUALITY
Directory of Open Access Journals (Sweden)
Alžbeta Žofajová
2010-05-01
Full Text Available The aim of this contribution is to illustrate the results of spring barley breeding for malting quality and point out an important position of variety in production of qualitative raw material for maltinq and beer industry as well as the system of evaluation the qualitative parameters of breeding materials and adaptation of barley breeding programms to the new requirements of malting and beer industry. As an example of the results obtained most recently description is made of the Ezer, Levan, Donaris, Sladar spring barley varieties with very good malting quality and effective resistance to powdery mildew. Cultivation of these varieties and malting barley production with reduced use of pesticidies is environmentally friedly alternative. doi:10.5219/50
Yu, Wenwen; Zou, Wei; Dhital, Sushil; Wu, Peng; Gidley, Michael J; Fox, Glen P; Gilbert, Robert G
2018-02-15
The conversion of barley starch to sugars is a complex enzymic process. Most previous work concerned the biotechnical aspect of in situ barley enzymes. However, the interactions among the macromolecular substrates and their effects on enzymic catalysis has been little examined. Here, we explore the mechanisms whereby interactions of protein and starch in barley flour affect the kinetics of enzymatic hydrolysis of starch in an in vitro system, using digestion rate data and structural analysis by confocal microscopy. The degradation kinetics of both uncooked barley flour and of purified starches are found to be two-step sequential processes. Barley proteins, especially the water-soluble component, are found to retard the digestion of starch degraded by α-amylase: the enzyme binds with water-insoluble protein and with starch granules, leading to reduced starch hydrolysis. These findings are of potential industrial value in both the brewing and food industries. Copyright © 2017 Elsevier Ltd. All rights reserved.
Glucan Particles for Macrophage Targeted Delivery of Nanoparticles
Directory of Open Access Journals (Sweden)
Ernesto R. Soto
2012-01-01
Full Text Available Glucan particles (GPs are hollow, porous 2–4 μm microspheres derived from the cell walls of Baker's yeast (Saccharomyces cerevisiae. The 1,3-β-glucan outer shell provides for receptor-mediated uptake by phagocytic cells expressing β-glucan receptors. GPs have been used for macrophage-targeted delivery of soluble payloads (DNA, siRNA, protein, and small molecules encapsulated inside the hollow GPs via core polyplex and layer-by-layer (LbL synthetic strategies. In this communication, we report the incorporation of nanoparticles as cores inside GPs (GP-NP or electrostatically bound to the surface of chemically derivatized GPs (NP-GP. GP nanoparticle formulations benefit from the drug encapsulation properties of NPs and the macrophage-targeting properties of GPs. GP nanoparticle formulations were synthesized using fluorescent anionic polystyrene nanoparticles allowing visualization and quantitation of NP binding and encapsulation. Mesoporous silica nanoparticles (MSNs containing the chemotherapeutic doxorubicin (Dox were bound to cationic GPs. Dox-MSN-GPs efficiently delivered Dox into GP phagocytic cells resulting in enhanced Dox-mediated growth arrest.
Ballooning stable high beta tokamak equilibria
International Nuclear Information System (INIS)
Tuda, Takashi; Azumi, Masafumi; Kurita, Gen-ichi; Takizuka, Tomonori; Takeda, Tatsuoki
1981-04-01
The second stable regime of ballooning modes is numerically studied by using the two-dimensional tokamak transport code with the ballooning stability code. Using the simple FCT heating scheme, we find that the plasma can locally enter this second stable regime. And we obtained equilibria with fairly high beta (β -- 23%) stable against ballooning modes in a whole plasma region, by taking into account of finite thermal diffusion due to unstable ballooning modes. These results show that a tokamak fusion reactor can operate in a high beta state, which is economically favourable. (author)
Byun, Eui-Baek; Jang, Beom-Su; Byun, Eui-Hong; Sung, Nak-Yun
2016-01-01
An effective method for activating macrophages and deriving a Th1 immune response could be used to improve the defenses of hosts. In this study, we investigated the immunomodulation effect and the related signaling mechanism of [Formula: see text]-(1,3)-glucan, isolated from the Agrobacterium species. Here, we found that [Formula: see text]-(1,3)-glucan predominantly induced the tumor necrosis factor (TNF)-[Formula: see text], interleukin (IL)-1[Formula: see text], IL-6, IL-12p70, and nitric oxide, which was dependent on mitogen-activated protein kinases (MAPK) and nuclear factor (NF)-[Formula: see text]B signaling. Additionally, [Formula: see text]-(1,3)-glucan treatment significantly up-regulated the expression of the co-stimulatory molecules CD80 and CD86, and also significantly increased the expression of iNOS and Dectin-1, which is a transmembrane protein that binds [Formula: see text]-glucan and associates with macrophage activation. Importantly, the splenic T cells co-cultured with [Formula: see text]-(1,3)-glucan-treated macrophages produced the a Th1 cytokine profile that includes high levels of IFN-[Formula: see text], but not IL-4 (Th2 cytokine), indicating that [Formula: see text]-(1,3)-glucan contributes to Th1 polarization of the immune response. Taken together, our results suggest that [Formula: see text]-(1,3)-glucan isolated from Agrobacterium species can induce macrophage activation through the MAPK and NF-[Formula: see text]B signaling pathway, as well as Th1 polarization.
Roles of Hydroxynitrile Glucosides in Barley
DEFF Research Database (Denmark)
Roelsgaard, Pernille Sølvhøj
on barley (Hordeum vulgare). Barley accumulates five hydroxynitrile glucosides, including one cyanogenic glucoside, in the epidermal cell layer. Cyanogenic glucosides are classically known as hydrogen cyanide-releasing defense compounds which act against generalist insects and herbivores. However...... is proposed. The results obtained in this Ph.D. study provide a unique insight demonstrating that hydroxynitrile glucosides play a far more complex role in barley defense against and susceptibility to Bgh than previously described. Future studies can build on the platforms established in this study to provide...
Determinants of house dust, endotoxin, and β-(1→3)-d-glucan in homes of Danish children
DEFF Research Database (Denmark)
Holst, Gitte Juel; Høst, Arne; Doekes, G
2015-01-01
Little is known about the geographic variation and determinants of bacterial endotoxin and β -(1,3)-d-glucan in Danish house dust. In a population of 317 children, we: (i) described loads and concentrations of floor dust, endotoxin, and β-(1→3)-d-glucan and (ii) their correlations and (iii......) assessed their determinants; (iv) Finally, we compared our findings with previous European studies. Bedroom floor dust was analyzed for endotoxin content by the kinetic limulus amoebocyte lysate assay and for β-(1→3)-d-glucan by the inhibition enzyme immunoassay. The parents answered questions regarding...... potential determinants. We found: geometric means (geometric standard deviations) 186 mg/m(2) (4.3) for dust; 5.46 × 10(3) EU/m(2) (8.0) and 31.1 × 10(3) EU/g (2.6) for endotoxin; and 142 μg/m(2) (14.3) and 0.71 × 10(3) μg/g (7.3) for β-(1→3)-d-glucan. High correlations (r > 0.75) were found between floor...
Structural insights into the {beta}-xylosidase from Trichoderma reesei
Energy Technology Data Exchange (ETDEWEB)
Rojas, Adriana L.; Fischer, Hannes; Polikarpov, Igor [Sao Paulo Univ. (USP), Sao Carlos, SP (Brazil). Inst. de Fisica; Eneiskaya, Elena V.; Kulminskaya, Anna A.; Shabalin, Konstantin A.; Neustroev, Kirill N.; Golubev, Alexander M. [Petersburg Nuclear Physics Inst., Moskow (Russian Federation); Craievich, Aldo Felix [Sao Paulo Univ. (USP), SP (Brazil). Inst. de Fisica
2005-07-01
Xylan is a major structural polysaccharide in plant cells, and is the second most abundant polysaccharide in nature, accounting for approximately one-third of all renewable organic carbon on earth. Xylan together with cellulose (1,4-{beta}-glucan) and lignin (a complex polyphenolic compound) make up the major polymeric constituents of plant cell walls, recently, there was a significant industrial interest in Xylan and its hydrolytic enzymatic complex, as a supplement in animal feed, for the manufacture of bread, food and drinks, textiles, bleaching of cellulose pulp, ethanol and xylitol production. (author)
Directory of Open Access Journals (Sweden)
Xiao-Qiang Han
Full Text Available A polysaccharide named GSP-2 with a molecular size of 32 kDa was isolated from the fruiting bodies of Ganoderma sinense. Its structure was well elucidated, by a combined utilization of chemical and spectroscopic techniques, to be a β-glucan with a backbone of (1→4- and (1→6-Glcp, bearing terminal- and (1→3-Glcp side-chains at O-3 position of (1→6-Glcp. Immunological assay exhibited that GSP-2 significantly induced the proliferation of BALB/c mice splenocytes with target on only B cells, and enhanced the production of several cytokines in human peripheral blood mononuclear cells and derived dendritic cells. Besides, the fluorescent labeled GSP-2 was phagocytosed by the RAW 264.7 cells and induced the nitric oxide secretion from the cells.
Effects of β-Glucan on the Release of Nitric Oxide by Macrophages Stimulated with Lipopolysaccharide
Directory of Open Access Journals (Sweden)
E. Y. Choi
2016-11-01
Full Text Available This research analyzed the effect of β-glucan that is expected to alleviate the production of the inflammatory mediator in macrophagocytes, which are processed by the lipopolysaccharide (LPS of Escherichia. The incubated layer was used for a nitric oxide (NO analysis. The DNA-binding activation of the small unit of nuclear factor-κB was measured using the enzyme-linked immunosorbent assay-based kit. In the RAW264.7 cells that were vitalized by Escherichia coli (E. coli LPS, the β-glucan inhibited both the combatant and rendering phases of the inducible NO synthase (iNOS-derived NO. β-Glucan increased the expression of the heme oxygenase-1 (HO-1 in the cells that were stimulated by E. coli LPS, and the HO-1 activation was inhibited by the tin protoporphyrin IX (SnPP. This shows that the NO production induced by LPS is related to the inhibition effect of β-glucan. The phosphorylation of c-Jun N-terminal kinases (JNK and the p38 induced by the LPS were not influenced by the β-glucan, and the inhibitory κB-α (IκB-α decomposition was not influenced either. Instead, β-glucan remarkably inhibited the phosphorylation of the signal transducer and activator of transcription-1 (STAT1 that was induced by the E. coli LPS. Overall, the β-glucan inhibited the production of NO in macrophagocytes that was vitalized by the E .coli LPS through the HO-1 induction and the STAT1 pathways inhibition in this research. As the host immune response control by β-glucan weakens the progress of the inflammatory disease, β-glucan can be used as an effective immunomodulator.
Mutation breeding in malting barley
Energy Technology Data Exchange (ETDEWEB)
Hiraki, Makoto; Sanada, Matsuyoshi
1984-03-01
The released varieties of malting barley through mutation breeding is more than ten in number, including foreign varieties. In Japan four varieties has been released so far. We started mutation breeding in 1956 together with cross breeding that we employed before. Until now, Gamma 4, Amagi Nijo 1 and Fuji Nijo 2 have been produced from the direct use of induced mutations and Nirasaki Nijo 8 from the indirect use of them. Mutation breeding has been used mainly in the partial improvement of agronomic characteristics since the selection for malting quality was very complicated. As the variety bred by induced mutation is usually equivalent to the original variety in malting quality, both this new variety and the original one could be cultivated in the same area without any problem on later malt production. Particularly when one farmer cultivates barley in an extensive acreage, he can harvest at the best time according to the different maturing time of each variety. From these points of view, mutation breeding is an efficient tool in malting barley breeding. Mutagens we have used so far are X-rays, ..gamma..-rays, neutron and chemicals such as dES. From our experience in selection, the low dose of radiation and chemical mutagens are more effective in selection of point mutation than the high dose of radiation which tends to produce many abnormal but few practical mutants. (author).
Barley yellow dwarf virus: Luteoviridae or Tombusviridae?
Miller, W Allen; Liu, Sijun; Beckett, Randy
2002-07-01
Summary Barley yellow dwarf virus (BYDV), the most economically important virus of small grains, features highly specialised relationships with its aphid vectors, a plethora of novel translation mechanisms mediated by long-distance RNA interactions, and an ambiguous taxonomic status. The structural and movement proteins of BYDV that confer aphid transmission and phloem-limitation properties resemble those of the Luteoviridae, the family in which BYDV is classified. In contrast, many genes and cis-acting signals involved in replication and gene expression most closely resemble those of the Tombusviridae. BYDV is in genus Luteovirus, family Luteoviridae. BYDV includes at least two serotypes or viruses: BYDV-PAV and BYDV-MAV. The former BYDV-RPV is now Cereal yellow dwarf virus-RPV (CYDV-RPV). CYDV is in genus Polerovirus, family Luteoviridae. Genus Luteovirus shares many features with family Tombusviridae. Physical properties: approximately 25 nm icosahedral (T = 3) virions. One major (22 kDa) and one minor (50-55 kDa) coat protein. 5.6-5.8 kb positive sense RNA genome with no 5'-cap and no poly(A) tail. Most grasses. Most important in oats, barley and wheat. Also infects maize and rice. Yellowing and dwarfing in barley, stunting in wheat; reddening, yellowing and blasting in oats. Some isolates cause leaf notching and curling. Key attractions: Model for the study of circulative transmission of aphid-transmitted viruses. Plethora of unusual translation mechanisms. Evidence of recombination in recent evolutionary history creates taxonomic ambiguity. Economically important virus of wheat, barley and oats, worldwide. Useful websites/meetings: International symposium: 'Barley Yellow Dwarf Disease: Recent Advances and Future Strategies', CIMMYT, El Batan, Mexico, 1-5 September 2002, http://www.cimmyt.cgiar.org/Research/wheat/Conf_BYD_02/invitation.htm http://www.cimmyt.org/Research/wheat/BYDVNEWS/htm/BYDVNEWS.htm Aphid transmission animation: http://www.ppws.vt.edu/~sforza/tmv/bydv_aph.html.
Sawtooth crashes at high beta on JET
Energy Technology Data Exchange (ETDEWEB)
Alper, B; Huysmans, G T.A.; Sips, A C.C. [Commission of the European Communities, Abingdon (United Kingdom). JET Joint Undertaking; Nave, M F.F. [Universidade Tecnica, Lisbon (Portugal). Inst. Superior Tecnico
1994-07-01
The sawtooth crashes on JET display features which depend on beta. The main observation is a transient bulging of flux surfaces (duration inferior to 30 microsec.), which is predominantly on the low field side and extends to larger radii as beta increases. This phenomenon reaches the plasma boundary when beta{sub N} exceeds 0.5 and in these cases is followed by an ELM within 50 microsec. These sawtooth/ELM events limit plasma performance. Modelling of mode coupling shows qualitative agreement between observations of the structure of the sawtooth precursor and the calculated internal kink mode at high beta. (authors). 6 refs., 5 figs.
Construction of a high beta plasma source
International Nuclear Information System (INIS)
Naraghi, M.; Torabi-Fard, A.
1976-02-01
A high beta plasma source has been designed and constructed. This source will serve as a means of developing and exercising different diagnostic techniques as required for ALVAND I, linear theta pinch experiment. Also, it will serve to acquaint the technicians with some of the techniques and safety rules of high voltage and capacitor discharge experiments. The operating parameters of the theta pinch and Z-pinch preionization is presented and the program of diagnostic measurements on the high beta plasma source is discussed
International Nuclear Information System (INIS)
Schriber, S.O.
1979-01-01
Accelerating structures for high-beta linacs that have been and are in use are reviewed in terms of their performance. Particular emphasis is given to room-temperature structures and the disk-and-washer structure. The disk-and-washer structure has many attractive features that are discussed for pulsed high-gradient linacs, for 100% duty-cycle medium-gradient linacs and for high-current linacs requiring maximal amounts of stored energy in the electric fields available to the beam
The Importance of Barley Varieties in terms of Production, Marketing and Processing
Directory of Open Access Journals (Sweden)
Rahmi Taşcı
2017-08-01
Full Text Available In this study, it is aimed to investigate the criteria affecting the marketing of barley in the stages of barley production, marketing and processing in Konya province. In the study; survey results were used which get from mixed feed (37 items and malt factory (1 item, traders (50 items purchasing and selling barley, and agricultural enterprises (107 items including barley production in agricultural activities operating in Konya province. It was determined that barley varieties were not an important criterion in the selling price, while the hectoliter and other plant species do not mix into barley are the main criteria considered by agricultural enterprises to affect the sale of barley. The most important criteria that traders keep in mind when buying barley is hectoliter of barley, which is followed by moisture, colour and foreign matter confusion rate of barley. The most important criteria that factories take into consideration when purchasing barley is determined as the moisture content of the barley, followed by the hectoliter of barley and the rate of foreign matter contamination. For the malt industry; Barley variety is a very important factor in the purchase criteria, followed by barley humidity and colour.
Genomic Regions Influencing Seminal Root Traits in Barley
Directory of Open Access Journals (Sweden)
Hannah Robinson
2016-03-01
Full Text Available Water availability is a major limiting factor for crop production, making drought adaptation and its many component traits a desirable attribute of plant cultivars. Previous studies in cereal crops indicate that root traits expressed at early plant developmental stages, such as seminal root angle and root number, are associated with water extraction at different depths. Here, we conducted the first study to map seminal root traits in barley ( L.. Using a recently developed high-throughput phenotyping method, a panel of 30 barley genotypes and a doubled-haploid (DH population (ND24260 × ‘Flagship’ comprising 330 lines genotyped with diversity array technology (DArT markers were evaluated for seminal root angle (deviation from vertical and root number under controlled environmental conditions. A high degree of phenotypic variation was observed in the panel of 30 genotypes: 13.5 to 82.2 and 3.6 to 6.9° for root angle and root number, respectively. A similar range was observed in the DH population: 16.4 to 70.5 and 3.6 to 6.5° for root angle and number, respectively. Seven quantitative trait loci (QTL for seminal root traits (root angle, two QTL; root number, five QTL were detected in the DH population. A major QTL influencing both root angle and root number (/ was positioned on chromosome 5HL. Across-species analysis identified 10 common genes underlying root trait QTL in barley, wheat ( L., and sorghum [ (L. Moench]. Here, we provide insight into seminal root phenotypes and provide a first look at the genetics controlling these traits in barley.
Amylolytic strains of Lactobacillus plantarum isolated from barley ...
African Journals Online (AJOL)
... naturally present in barley, and produced cell-bound and cell-free α-amylase at alkaline conditions. The two strains may be developed into starter cultures to facilitate the germination of barley and produce malt with a higher fermentable sugar content. Key words: Lactobacillus plantarum, starch hydrolysis, barley, malting ...
Implementation of biochemical screening to improve baking quality of barley
DEFF Research Database (Denmark)
Vincze, Éva; Dionisio, Giuseppe; Aaslo, Per
2011-01-01
Barley (Hordeum vulgare) has the potential to offer considerable human nutritional benefits, especially as supplement to wheat-based breads. Under current commercial baking conditions it is not possible to introduce more that 20% barley flour to the wheat bread without negative impact on the phys......Barley (Hordeum vulgare) has the potential to offer considerable human nutritional benefits, especially as supplement to wheat-based breads. Under current commercial baking conditions it is not possible to introduce more that 20% barley flour to the wheat bread without negative impact...... on the physical chemical properties of the bread products due to the poor baking properties of barley flour. As a consequence, the nutritional advantages of barley are not fully exploited. The inferior leavening and baking properties of barley can, in part, be attributed to the physical properties of the storage...... proteins. Changing the storage protein composition can lessen this problem. Our working hypothesis was that exploiting the substantial genetic variation within the gene pool for storage proteins could enable improving the baking qualities of barley flour. We characterised forty-nine barley cultivars...
DEFF Research Database (Denmark)
Ahmed, Ali Abdurehim
The genome of barley powdery mildew fungus (Blumeria graminis f. sp. hordei, Bgh) encodes around 500 Candidate Secreted Effector Proteins (CSEPs), which are believed to be delivered to the barley cells either to interfere with plant defence and/or promote nutrient uptake. So far, little is known...... about the function of many CSEPs in virulence and the identities of their host targets. In this PhD study, we investigated the function of nine CSEPs and found that CSEP0081, CSEP0105, CSEP0162 and CSEP0254 act as effectors by promoting the Bgh infection success. Independent silencing of these CSEPs...... proteins (sHsps), Hsp16.9 and Hsp17.5, were identified as interactors for both CSEP0105 and CSEP0162. These interactions were confirmed in planta by BiFC and co-localization studies. Small heat shock proteins are highly conserved ATP-independent chaperones that protect the cell from stress-induced protein...
Modulation of the immune response of porcine neutrophils by different β-glucan preparations
DEFF Research Database (Denmark)
Juul-Madsen, Helle Risdahl; Norup, Liselotte Rothmann; Lærke, Helle Nygaard
2010-01-01
β-glucans of bacterial and fungal origin are known immuno-modulators, but data in the literature also indicate that lichen and cereal-derived β-glucans may have immuno-modulatory functions. The aim of the current study was to test the effect of different sources of β-glucans on neutrophils in an ex......-vivo whole blood stimulation assay. Whole blood samples were either treated with curdlan, a linear β-(1 → 3)-D-glucan from the non-pathogenic Alcaligenes faecalis, lichenan, a mixed linked β-(1 → 3),(1 → 4)-D-glucan from Islandic moss (Cetraria islandica) or zymosan, prepared from yeast cell walls and being...... expression of Toll-like Receptor (TLR) 2 and 4, but not significantly on the signal regulatory protein SIRPα after a stimulation either alone or in combination with LPS. Thus, branching may appear to be important for the different effect, but an effect of impurities in the Zymosan preparation cannot be ruled...
Barley yellow dwarf virus in barley crops in Tunisia: prevalence and molecular characterization
Asma NAJAR; Imen HAMDI; Arvind VARSANI
2017-01-01
A field survey was conducted in Tunisia in the North-Eastern regions (Bizerte, CapBon and Zaghouan), the North-Western region (Kef) and the Central-Eastern region (Kairouan) during the 2011/2012 growing season, in order to determine the incidence and the geographic distribution of Barley yellow dwarf virus (BYDVs) in barley fields. Tissue blot immunoassays (TBIA) showed that BYDV was most common in Zaghouan (incidence 14%), Cap Bon (14%) and Bizerte (35%), in randomly collected samples from t...
A high density barley microsatellite consensus map with 775 SSR loci
Varshney, R.K.; Marcel, T.C.; Ramsay, L.; Russell, J.; Roder, M.S.; Stein, N.; Waugh, R.; Langridge, P.; Niks, R.E.; Graner, A.
2007-01-01
A microsatellite or simple sequence repeat (SSR) consensus map of barley was constructed by joining six independent genetic maps based on the mapping populations 'Igri x Franka', 'Steptoe x Morex', 'OWBRec x OWBDom', 'Lina x Canada Park', 'L94 x Vada' and 'SusPtrit x Vada'. Segregation data for
Βeta-glucans promote wound healing in common carp (Cyprinus carpio L.)
DEFF Research Database (Denmark)
Przybylska, Dominika Alicja; Schmidt, Jacob; Nielsen, Michael Engelbrecht
β-glucans are well known for their ability to modulate the immune system. These polysaccharides, derived from fungi, plants and bacteria cell wall [1] potently trigger inflammatory response in infected host [2]. The effects of β-glucans depend on the origins, route of administration, molecular we...
Yue, Rui-Qi; Dong, Cai-Xia; Chan, Chung-Lap; Ko, Chun-Hay; Cheung, Wing-Shing; Luo, Ke-Wang; Dai, Hui; Wong, Chun-Kwok; Leung, Ping-Chung; Han, Quan-Bin
2014-01-01
A polysaccharide named GSP-2 with a molecular size of 32 kDa was isolated from the fruiting bodies of Ganoderma sinense. Its structure was well elucidated, by a combined utilization of chemical and spectroscopic techniques, to be a β-glucan with a backbone of (1→4)– and (1→6)–Glcp, bearing terminal- and (1→3)–Glcp side-chains at O-3 position of (1→6)–Glcp. Immunological assay exhibited that GSP-2 significantly induced the proliferation of BALB/c mice splenocytes with target on only B cells, and enhanced the production of several cytokines in human peripheral blood mononuclear cells and derived dendritic cells. Besides, the fluorescent labeled GSP-2 was phagocytosed by the RAW 264.7 cells and induced the nitric oxide secretion from the cells. PMID:25014571
Directory of Open Access Journals (Sweden)
Masruroh Rahayu
2015-01-01
Full Text Available ackground and aims. One of many neurodegenerative diseases afflicting the elderly is Parkinson. Beta glucan from Saccharomyces cerevisae is very potential to be used as a regenerative therapy of Parkinson's disease. Beta glucan can increase the mobilization of hematopoietic stem cells (HSCs from the bone marrow into the damaged tissues. Hematopoietic stem cells (HSCs which have been mobilized can regenerate and differentiate into brain cells so that the symptoms of Parkinson would be reduced. This research aims to find out the effects of the addition of Saccharomyces cerevisae toward the number of brain cells in substantia nigra Parkinson’s rat model. Method. The research was experimental in vivo using the draft of randomized post test only controlled group design. There were five groups that become the sample in this research with 5 rats for each group, i.e. negative control group, positive control group, Treatment Group 1, 2 and 3 (Rotenone + Saccharomyces cerevisae 18 mg/kgBB, 36 mg/kgBB, 72 mg/kgBBfor 4 weeks. Variable measured in this study was the number of brain cells in substantia nigra. The results of this study showed that Treatment Group 3 (72 mg/kgBB was a group with the largest number of brain cells than the other treatment groups. Statistical data obtained showed that the average number of brain cells in negative control group was 192.00 cells; positive control amounted to 116.80 cells; Treatment 1 amounted to 135.40 cells; Treatment 2 amounted to 140.80 cells; and Treatment 3 amounted to 161.80 cells. Result. The result of ANOVA test showed a significant difference between groups (p< 0.05, while the correlation test result indicated a strong correlation between the dose of Saccharomyces cerevisae and the number of substantia nigra of rat’s brain cells (r = 0,818. Conclusion. From this research, it can be concluded that the addition of Saccharomyces cerevisae with a dose of 18mg/kgBB, 36mg/kgBBdan 72 mg/kgBB is able to increase
Sauer, W.C.; Cervantes, M.; He, J.M.M.; Schulze, H.
2003-01-01
Two metabolism experiments were carried out, to determine the effect of microbial phytase addition to barley-canola meal and barley-soybean meal diets on P and Ca balance in growing. pigs; In experiment 1, six barrows (29.6kg: initial LW) were fed a barley-canola meal diet, without or. with phytase
Lipid and sugar profiles of various barley cultivars (Hordeum vulgare
Directory of Open Access Journals (Sweden)
Pastor Kristian A.
2015-01-01
Full Text Available The lipid components and soluble sugars in flour samples of different cultivars of barley (Hordeum vulgare, involving winter malting barley, winter forage barley, spring barley, and hulless barley, were identified. Fatty acids were extracted from flour samples with n-hexane, and derivatized into volatile methyl esters, using TMSH (trimethylsulfonium hydroxide in methanol. Soluble sugars were extracted from defatted and dried samples of barley flour with 96% ethanol, and further derivatized into the corresponding trimethylsilyl (TMS oximes, using hydroxylamine hydrochloride solution and BSTFA (N,O-bis-(trimethylsilyl-trifluoroacetamide. The hexane and alcoholic extracts of barley cultivars were analyzed by GC-MS system. Lipid and sugar compositions were very similar in all barley cultivars. Therefore, multivariate analysis was applied to numerical values of automatically integrated areas of the identified fatty acid methyl esters and TMS oximes of soluble sugars. The application of hierarchical cluster analysis showed a great similarity between the investigated flour samples of barley cultivars, according to their fatty acid content (0.96. Also, significant, but somewhat less similarity was observed regarding the content of soluble sugars (0.70. These preliminary results indicate the possibility of distinguishing flour made of barley, regardless of the variety, from flours made of other cereal species, just by the analysis of the contents of fatty acids and soluble sugars.[Projekat Ministarstva nauke Republike Srbije, br. TR 31066
Directory of Open Access Journals (Sweden)
G. Kanagasabapathy
2013-01-01
Full Text Available Mushrooms have been used in folk medicine for thousands of years. In this study, the effect of β-glucan-rich extract of P. sajor-caju (GE on lipid lowering and antioxidant potential was assessed in C57BL/6J mice fed on a high-fat diet. Obesity was induced in C57BL/6J mice by feeding a high-fat diet. The control groups in this study were ND (for normal diet and HFD (for high-fat diet. The treated groups were ND240 (for normal diet (240 mg/kg b.w and HFD60, HFD120, and HFD240 (for high-fat diet, where the mice were administrated with three dosages of GE (60, 120, and 240 mg GE/kg b.w. Metformin (2 mg/kg b.w served as positive control. GE-treated groups showed significantly reduced body weight, serum lipid, and liver enzymes levels. GE also attenuated protein carbonyl and lipid hydroperoxide levels by increasing the enzymic antioxidants (SOD, CAT, and GPx activities in the mice. GE-treated groups induced the expression of hormone sensitive lipase (HSL and adipose triglyceride lipase (ATGL while downregulated the expression of peroxisome proliferator-activated receptor gamma (PPAR-γ, sterol regulatory binding protein-1c (SREBP-1c, and lipoprotein lipase (LPL. Hence, GE prevented weight gain in the mice by inducing lipolysis and may be valuable in the formulation of adjuvant therapy for obesity.
Genomic Regions Influencing Seminal Root Traits in Barley.
Robinson, Hannah; Hickey, Lee; Richard, Cecile; Mace, Emma; Kelly, Alison; Borrell, Andrew; Franckowiak, Jerome; Fox, Glen
2016-03-01
Water availability is a major limiting factor for crop production, making drought adaptation and its many component traits a desirable attribute of plant cultivars. Previous studies in cereal crops indicate that root traits expressed at early plant developmental stages, such as seminal root angle and root number, are associated with water extraction at different depths. Here, we conducted the first study to map seminal root traits in barley ( L.). Using a recently developed high-throughput phenotyping method, a panel of 30 barley genotypes and a doubled-haploid (DH) population (ND24260 × 'Flagship') comprising 330 lines genotyped with diversity array technology (DArT) markers were evaluated for seminal root angle (deviation from vertical) and root number under controlled environmental conditions. A high degree of phenotypic variation was observed in the panel of 30 genotypes: 13.5 to 82.2 and 3.6 to 6.9° for root angle and root number, respectively. A similar range was observed in the DH population: 16.4 to 70.5 and 3.6 to 6.5° for root angle and number, respectively. Seven quantitative trait loci (QTL) for seminal root traits (root angle, two QTL; root number, five QTL) were detected in the DH population. A major QTL influencing both root angle and root number (/) was positioned on chromosome 5HL. Across-species analysis identified 10 common genes underlying root trait QTL in barley, wheat ( L.), and sorghum [ (L.) Moench]. Here, we provide insight into seminal root phenotypes and provide a first look at the genetics controlling these traits in barley. Copyright © 2016 Crop Science Society of America.
Directory of Open Access Journals (Sweden)
AHMAD THONTOWI
2007-10-01
Full Text Available β-Glucan is one of the most abundant polysaccharides in yeast Saccharomyces cerevisiae cell wall. The aim of this research is to explore an alternative nitrogen sources for β-glucan production. S. cerevisiae were grown in fermentation medium with different nitrogen sources. Peptone 2%, glutamic acid 0,5%, urea 0,2%, and diammonium hydrogen phosphate (DAHP 0,02% were used for nitrogen source in the medium. A two liter air-lift fermentor was used in the fermentation process for 84 hours (T = 300C, pH 7, and 1.5 vvm for the aeration. During the fermentation, optical density, extraction of β-glucan, glucose and protein in hydrolisate cultured were determined. β-glucan production level is similar with the growth rate of yeast and followed by decreasing glucose and protein content in hydrolysis cultured. The highest and lowest β-glucan content were obtained from peptone (933.33 mg/L and glutamic acid (633.33 mg/L as a nitrogen source in cells cultured after fermentation completed respectively. Yeast cells cultured with urea and DAHP as a nitrogen source give the same content of β-glucan about 733.33 mg/L. β-glucan concentration produced in medium with urea was a higher than that produced using glutamic acid and DAHP as a nitrogen source. The result indicated that urea can be used as an alternative nitrogen source for the production of β-glucan. Urea is easily available and cheaper than peptone, glutamic acid and DAHP.
Background: The consumption of oats reduces plasma cholesterol, a major risk factor for heart disease. Oats, in addition to cholesterol lowering properties through its beta-glucan content, are a good source of several antioxidants including Avenanthramides (Avns), a unique group of polyphenols prese...
Directory of Open Access Journals (Sweden)
Matthew J. Elder
2017-07-01
Full Text Available Dectin-1/CLEC7A is a pattern recognition receptor that recognizes β-1,3 glucans, and its stimulation initiates signaling events characterized by the production of inflammatory cytokines from human dendritic cells (DCs required for antifungal immunity. β-glucans differ greatly in size, structure, and ability to activate effector immune responses from DC; as such, small particulate β-glucans are thought to be poor activators of innate immunity. We show that β-glucan particle size is a critical factor contributing to the secretion of cytokines from human DC; large β-glucan-stimulated DC generate significantly more IL-1β, IL-6, and IL-23 compared to those stimulated with the smaller β-glucans. In marked contrast, the secretion of TSLP and CCL22 were found to be insensitive to β-glucan particle size. Furthermore, we show that the capacity to induce phagocytosis, and the relative IL-1β production determined by β-glucan size, regulates the composition of the cytokine milieu generated from DC. This suggests that β-glucan particle size is critically important in orchestrating the nature of the immune response to fungi.
Comparative Studies on Callose Formation in Powdery Mildew Compatible and Incompatible Barley
DEFF Research Database (Denmark)
Skou, Jens-Peder; Jørgensen, Jørgen Helms; Lilholt, Ulla
1984-01-01
Callose formation in barley mutants, lines and varieties with different genes for resistance to powdery mildew in seven different loci was compared. Only barley with resistance genes in the ml-o locus showed so early a callose formation passing off at such a high rate that it prevented fungal...... penetration Ml-(La) resistant varieties and near-isogenic lines in 'Manchuria' with resistance genes in 5 other loci showed only a tendency to a larger callose formation than their susceptible counterparts after inoculation with avirulent as well as virulent powdery mildew. The callose formation in ml......-o resistant barley was independent of the powdery mildew culture applied. This supports the hypothesis set forth as to why the ml-o mutants are resistant against all known cultures or races of barley powdery mildew, and why this resistance may be more durable than other powdery mildew resistances...
Ferreira, Alexandre H P; Terra, Walter R; Ferreira, Clélia
2003-02-01
The midgut of the yellow mealworm, Tenebrio molitor L. (Coleoptera: Tenebrionidae) larvae has four beta-glycosidases. The properties of two of these enzymes (betaGly1 and betaGly2) have been described elsewhere. In this paper, the characterization of the other two glycosidases (betaGly3 and betaGly4) is described. BetaGly3 has one active site, hydrolyzes disaccharides, cellodextrins, synthetic substrates and beta-glucosides produced by plants. The enzyme is inhibited by amygdalin, cellotriose, cellotetraose and cellopentaose in high concentrations, probably due to transglycosylation. betaGly3 hydrolyzes beta 1,4-glycosidic linkages with a catalytic rate independent of the substrate polymerization degree (k(int)) of 11.9 s(-1). Its active site is formed by four subsites, where subsites +1 and -1 bind glucose residues with higher affinity than subsite +2. The main role of betaGly3 seems to be disaccharide hydrolysis. BetaGly4 is a beta-galactosidase, since it has highest activity against beta-galactosides. It can also hydrolyze fucosides, but not glucosides, and has Triton X-100 as a non-essential activator (K(a)=15 microM, pH 4.5). betaGly4 has two active sites that can hydrolyze p-nitrophenyl beta-galactoside (NPbetaGal). The one hydrolyzing NPbetaGal with more efficiency is also active against methylumbellipheryl beta-D-galactoside and lactose. The other active site hydrolyzes NPbetaFucoside and binds NPbetaGal weakly. BetaGly4 hydrolyzes hydrophobic substrates with high catalytical efficiency and is able to bind octyl-beta-thiogalactoside in its active site with high affinity. The betaGly4 physiological role is supposed to be the hydrolysis of galactolipids that are found in membranes from vegetal tissues. As the enzyme has a hydrophobic site where Triton X-100 can bind, it might be activated by membrane lipids, thus becoming fully active only at the surface of cell membranes.
Research on mutant barley population under biotic and abiotic stress condition
International Nuclear Information System (INIS)
Peskircioglu, H.; Tuyluer, I.; Sagel, Z.; Kunter, B.; Kantoglu, Y.
2009-01-01
Barley is one of the most important cereal with 8,5 million tons production, 3,5 million hectares of sowing area in Turkey which is also one of the gene centres of barley. Barley is grown in every regions of Turkey where climatic conditions are available for the crop. But barley is the predominant crop in the driest land areas throughout the Anatolian plateau. Winters on that plateau are especially severe. Summers are hot and dry with temperatures above 30 degree C. Annual precipitation averages about 300 to 400 millimeters and rains mainly in winter. Because of all of these prerequisite conditions, winter barley dominates in Turkey, which indirectly refers to water economy. According to the above mentioned reasons the objectives of this investigation were: 1) Improvement of drought resistance, loading resistance and high yielding barley varieties by mutation breeding in Central Anatolian Region. 2) Determination and selection of abiotic stress such as salt resistance In our barley mutation breeding programme under Central Anatolian conditions well adapted Tokak 157/37 variety has been used. We applied 250 Gy-300 Gy gamma ray doses . Selection began at M 2 generation. Agronomical characters including earliness, straw length, lodging resistance and disease resistance are monitored in the field and greenhouse. Mutant lines have been tested for salt resistance in the hydrophonic culture which contains 180 mMol and 220 mMol NaCl concentrations. Preliminary yield trial and advanced yield trial are started after M 4 generations. In M 6 generation, we had some desirable lines those are 25-30 days earlier than its parents, so these lines escape from drought period. Some lines that have grown in the hydrophonic cultures, contains 180mMol NaCl still surviving.
Characterization of Resistance to Cephus cinctus (Hymenoptera: Cephidae) in Barley Germplasm.
Varella, Andrea C; Talbert, Luther E; Achhami, Buddhi B; Blake, Nancy K; Hofland, Megan L; Sherman, Jamie D; Lamb, Peggy F; Reddy, Gadi V P; Weaver, David K
2018-04-02
Most barley cultivars have some degree of resistance to the wheat stem sawfly (WSS), Cephus cinctus Norton (Hymenoptera: Cephidae). Damage caused by WSS is currently observed in fields of barley grown in the Northern Great Plains, but the impact of WSS damage among cultivars due to genetic differences within the barley germplasm is not known. Specifically, little is known about the mechanisms underlying WSS resistance in barley. We characterized WSS resistance in a subset of the spring barley CAP (Coordinated Agricultural Project) germplasm panel containing 193 current and historically important breeding lines from six North American breeding programs. Panel lines were grown in WSS infested fields for two consecutive years. Lines were characterized for stem solidness, stem cutting, WSS infestation (antixenosis), larval mortality (antibiosis), and parasitism (indirect plant defense). Variation in resistance to WSS in barley was compared to observations made for solid-stemmed resistant and hollow-stemmed susceptible wheat lines. Results indicate that both antibiosis and antixenosis are involved in the resistance of barley to the WSS, but antibiosis seems to be more prevalent. Almost all of the barley lines had greater larval mortality than the hollow-stemmed wheat lines, and only a few barley lines had mortality as low as that observed in the solid-stemmed wheat line. Since barley lines lack solid stems, it is apparent that barley has a different form of antibiosis. Our results provide information for use of barley in rotation to control the WSS and may provide a basis for identification of new approaches for improving WSS resistance in wheat.
Beta activity measurements in high, variable gamma backgrounds
International Nuclear Information System (INIS)
Stanga, D.; Sandu, E.; Craciun, L.
1997-01-01
In many cases beta activity measurements must be performed in high and variable gamma backgrounds. In such instances it is necessary to use well-shielded detectors but this technique is limited to laboratory equipment and frequently insufficient. In order to perform in a simple manner beta activity measurements in high and variable backgrounds a software-aided counting technique have been developed and a counting system have been constructed. This technique combines the different counting techniques with traditional method of successive measurement of the sample and background. The counting system is based on a programmable multi-scaler which is endowed with appropriate software and allow all operations to be performed via keyboard in an interactive fashion. Two large - area proportional detectors were selected in order to have the same background and the same gamma response within 5%. A program has been developed for the counting data analysis and beta activity computing. The software-aided counting technique has been implemented for beta activity measurement in high and variable backgrounds. (authors)
Occurrence of barley leaf disease and control strategies in Denmark
DEFF Research Database (Denmark)
Jørgensen, Lise Nistrup; Ørum, Jens Erik; Heick, Thies Marten
Barley (Hordeum vulgare) is one of the major crops in Denmark and of special importance for malting and for pig feed. In 2016, the crop was grown covering a total area of 700,000 ha; approximately 25% of arable area in Denmark. To ensure high yield of around 60 dt ha-1, disease-tolerant cultivars...... have proven to be quite effective against all leaf diseases, aside from brown rust and mildew. Denmark has a national record system for pesticide usages. All farmers upload their fungicide use by crop, creating a good basis for assessing the differences in use pattern across different regions...... and fungicide treatments are required. Each year, barley cultivars are assessed for susceptibility towards leaf diseases in national observation plots. The most predominant fungal leaf diseases in Denmark are barley scald (Rhynchosporium secalis), net blotch (Pyrenophora teres), brown rust (Puccinia hordei...
Regeneration of the Barley Zygote in In Vitro Cultured Ovules
DEFF Research Database (Denmark)
Holme, Inger B; Brinch-Pedersen, Henrik; Lange, Mette
2010-01-01
In vitro cultures of zygotes and small embryos carry a lot of potential for studying plant embryogenesis and are also highly relevant for plant biotechnology. Several years ago we established an in vitro ovule culture technique for barley that allows the regeneration of plants from zygotes (Holm et...... culture ability in immature embryo culture i.e. Femina, Salome and Corniche. Barley spikes were emasculated and hand pollinated 3 days after emasculation. In barley, fertilization takes place one hour after pollination and ovules with fertilized egg cells could therefore be isolated one hour after...... pollination. Ovules were grown for 3 weeks on a culture medium where after embryos could be isolated and transferred to regeneration medium. An average of 1.2 green plantlets per ovule could be regenerated from 50 % of the isolated ovules. No genotypic differences were found on embryo induction...
Directory of Open Access Journals (Sweden)
Antonio Francioso
2017-05-01
Full Text Available A resveratrol/carboxymethylated glucan (CM-glucan combination is known to inhibit rhinovirus replication and expression of inflammatory mediators in nasal epithelia. The aim of this study was to develop an aerosol formulation containing an association of the two molecules which could reach the lower respiratory tract. Mass median aerodynamic diameter (MMAD of a resveratrol/CM-glucan combination was lower than that shown by resveratrol or CM-glucan alone (2.83 versus 3.28 and 2.96 µm, respectively. The resveratrol/CM-glucan association results in the finest and most monodispersed particles in comparison to the two single components. The association also evidenced lower values for all particle size distribution parameters, suggesting that the pharmacological synergy observed in previous studies may be accompanied by a pharmaceutical one. Moreover, we showed that the CM-glucan matrix did not exert an inhibitory effect on resveratrol nebulization, demonstrating the good suitability of these two molecules in association for simultaneous aerosol volatilization.
Simultaneous Detection of Barley Virus Diseases in Korea
Directory of Open Access Journals (Sweden)
Bong-Choon Lee
2017-12-01
Full Text Available Barley mild mosaic virus (BaMMV, Barley yellow mosaic virus (BaYMV and Barley yellow dwarf virus (BYDV have been identified as an important causative agents for an economically important disease of winter barley in Korea. In this study, a multiplex reverse transcription polymerase chain reaction (mRT-PCR method was used for the simultaneous detection. Three sets of virus-specific primers targeted to the capsid protein coding genes of BaMMV, BaYMV and BYDV were used to amplify fragments that were 594 bp, 461 bp, and 290 bp, respectively. Several sets of primers for each target virus were evaluated for their sensitivity and specificity by multiplex RT-PCR. The optimum primer concentrations and RT-PCR conditions were determined for the multiplex RT-PCR. The mRT-PCR assay was found to be a better and rapid virus diagnostic tool of specific barley diseases and potential for investigating the epidemiology of these viral diseases.
Sprouted barley for dairy cows: Nutritional composition and digestibility
A 4-unit dual-flow continuous culture fermentor system was used to assess the effect of supplementing 7-d sprouted barley or barley grain with an haylage or pasture diet on nutrient digestibility and methane output. Barley grain was sprouted in climate controlled growth chambers, to be used as part ...
COMPARISON OF THE FROST RESISTANCE OF BARLEY ...
African Journals Online (AJOL)
Preferred Customer
immediate recovery of the photosynthetic quantum yield after freezing. Landraces which showed the highest cold tolerance were found to acclimatize best. Key words/phrases: Barley, chlorophyll fluorescence, cold acclimation, Ethiopia, frost tolerance. INTRODUCTION. Barley (Hordeum vulgare L.) is a traditional crop.
Møller, Marie S; Goh, Yong Jun; Rasmussen, Kasper Bøwig; Cypryk, Wojciech; Celebioglu, Hasan Ufuk; Klaenhammer, Todd R; Svensson, Birte; Abou Hachem, Maher
2017-06-15
Of the few predicted extracellular glycan-active enzymes, glycoside hydrolase family 13 subfamily 14 (GH13_14) pullulanases are the most common in human gut lactobacilli. These enzymes share a unique modular organization, not observed in other bacteria, featuring a catalytic module, two starch binding modules, a domain of unknown function, and a C-terminal surface layer association protein (SLAP) domain. Here, we explore the specificity of a representative of this group of pullulanases, Lactobacillus acidophilus Pul13_14 ( La Pul13_14), and its role in branched α-glucan metabolism in the well-characterized Lactobacillus acidophilus NCFM, which is widely used as a probiotic. Growth experiments with L. acidophilus NCFM on starch-derived branched substrates revealed a preference for α-glucans with short branches of about two to three glucosyl moieties over amylopectin with longer branches. Cell-attached debranching activity was measurable in the presence of α-glucans but was repressed by glucose. The debranching activity is conferred exclusively by La Pul13_14 and is abolished in a mutant strain lacking a functional La Pul13_14 gene. Hydrolysis kinetics of recombinant La Pul13_14 confirmed the preference for short-branched α-glucan oligomers consistent with the growth data. Curiously, this enzyme displayed the highest catalytic efficiency and the lowest K m reported for a pullulanase. Inhibition kinetics revealed mixed inhibition by β-cyclodextrin, suggesting the presence of additional glucan binding sites besides the active site of the enzyme, which may contribute to the unprecedented substrate affinity. The enzyme also displays high thermostability and higher activity in the acidic pH range, reflecting adaptation to the physiologically challenging conditions in the human gut. IMPORTANCE Starch is one of the most abundant glycans in the human diet. Branched α-1,6-glucans in dietary starch and glycogen are nondegradable by human enzymes and constitute a
A change in radioresistance of barley under chronic irradiation
International Nuclear Information System (INIS)
Kal'chenko, V.A.; Shevchenko, V.A.; Fedotov, I.S.
1981-01-01
Mutation process and radioresistance of barley growing in an area with increased radiation background (beta radiation doss -0.6 R/day) have been analyzed. Experimental material is given with 250 kindred families where aberration level of chromosomes was analyzed in mitosis and meiosis during 4 years. It is shown that the first generations (M 1 -M 2 ) in experimental material demonstrate an increased level of structural mutations of chromosomes, while the subsequent generations (M 3 -M 4 ) demonstrate the level reduced to control. A higher radioresistance is observed in M 5 plants of chronically irradiated version as compared to nonirradiated version. It is suggested that increase in radioresistance results from the stimulation of repair systems with low doses of chronic irradiation as well as from the selection of a more radioresistant forms out of the population [ru
DEFF Research Database (Denmark)
Hjortshøj, Rasmus Lund; Ravnshøj, A.R.; Nyman, M.
2013-01-01
The ascomycete pathogen Ramularia collo-cygni causes Ramularia leaf spot (RLS) on barley. Although R. collo-cygni is considerd an emerging disease of barley, little is known about genetic diversity or population genetic structure of this pathogen. We applied a set of polymorphic AFLP (Amplified F...
Investigation of additives for preventing ash fouling and sintering during barley straw combustion
International Nuclear Information System (INIS)
Wang, Liang; Skreiberg, Øyvind; Becidan, Michael
2014-01-01
reduced the sintering tendency of the barley straw ash. Upon additive addition, high temperature melting potassium aluminium silicates formed in the barley straw ash as revealed by XRD and SEM-EDX analyses. Formation and presence of the refractory potassium aluminium silicates partly explain the improved sintering behaviors of the ash-additive mixtures. - Highlights: • Kaolin and zeolite 24 have high capacities to capture KCl. • KCl capturing efficiencies of kaolin and zeolite 24 decreased at a high temperature and with long reaction time. • Barley straw ash has a high sintering and melting tendency. • Addition of kaolin and zeolite 24A increased melting temperature of the barley straw ash. • High melting points K–Al-silicates formed in the barley straw ash upon additive addition
Extremely thermophilic microorganisms for biomass conversion: status and prospects.
Blumer-Schuette, Sara E; Kataeva, Irina; Westpheling, Janet; Adams, Michael Ww; Kelly, Robert M
2008-06-01
Many microorganisms that grow at elevated temperatures are able to utilize a variety of carbohydrates pertinent to the conversion of lignocellulosic biomass to bioenergy. The range of substrates utilized depends on growth temperature optimum and biotope. Hyperthermophilic marine archaea (T(opt)>or=80 degrees C) utilize alpha- and beta-linked glucans, such as starch, barley glucan, laminarin, and chitin, while hyperthermophilic marine bacteria (T(opt)>or=80 degrees C) utilize the same glucans as well as hemicellulose, such as xylans and mannans. However, none of these organisms are able to efficiently utilize crystalline cellulose. Among the thermophiles, this ability is limited to a few terrestrial bacteria with upper temperature limits for growth near 75 degrees C. Deconstruction of crystalline cellulose by these extreme thermophiles is achieved by 'free' primary cellulases, which are distinct from those typically associated with large multi-enzyme complexes known as cellulosomes. These primary cellulases also differ from the endoglucanases (referred to here as 'secondary cellulases') reported from marine hyperthermophiles that show only weak activity toward cellulose. Many extremely thermophilic enzymes implicated in the deconstruction of lignocellulose can be identified in genome sequences, and many more promising biocatalysts probably remain annotated as 'hypothetical proteins'. Characterization of these enzymes will require intensive effort but is likely to generate new opportunities for the use of renewable resources as biofuels.
Mizutani, Osamu; Shiina, Matsuko; Yoshimi, Akira; Sano, Motoaki; Watanabe, Takeshi; Yamagata, Youhei; Nakajima, Tasuku; Gomi, Katsuya; Abe, Keietsu
2016-09-01
Disruption of the kexB encoding a subtilisin-like processing protease in Aspergillus oryzae (ΔkexB) leads to substantial morphological defects when the cells are grown on Czapek-Dox agar plates. We previously found that the disruption of kexB causes a constitutive activation of the cell wall integrity pathway. To understand how the disruption of the kexB affects cell wall organization and components, we analyzed the cell wall of ΔkexB grown on the plates. The results revealed that both total N-acetylglucosamine content, which constitutes chitin, and chitin synthase activities were increased. Whereas total glucose content, which constitutes β-1,3-glucan and α-1,3-glucan, was decreased; this decrease was attributed to a remarkable decrease in α-1,3-glucan. Additionally, the β-1,3-glucan in the alkali-insoluble fraction of the ΔkexB showed a high degree of polymerization. These results suggested that the loss of α-1,3-glucan in the ΔkexB was compensated by increases in the chitin content and the average degree of β-1,3-glucan polymerization.
DEFF Research Database (Denmark)
Sambou, Tounkang; Dinadayala, Premkumar; Stadthagen, Gustavo
2008-01-01
Mycobacterium tuberculosis and other pathogenic mycobacterial species produce large amounts of a glycogen-like alpha-glucan that represents the major polysaccharide of their outermost capsular layer. To determine the role of the surface-exposed glucan in the physiology and virulence of these bact......Mycobacterium tuberculosis and other pathogenic mycobacterial species produce large amounts of a glycogen-like alpha-glucan that represents the major polysaccharide of their outermost capsular layer. To determine the role of the surface-exposed glucan in the physiology and virulence...... of these bacteria, orthologues of the glg genes involved in the biosynthesis of glycogen in Escherichia coli were identified in M. tuberculosis H37Rv and inactivated by allelic replacement. Biochemical analyses of the mutants and complemented strains indicated that the synthesis of glucan and glycogen involves...... the alpha-1,4-glucosyltransferases Rv3032 and GlgA (Rv1212c), the ADP-glucose pyrophosphorylase GlgC (Rv1213) and the branching enzyme GlgB (Rv1326c). Disruption of glgC reduced by half the glucan and glycogen contents of M. tuberculosis, whereas the inactivation of glgA and Rv3032 affected the production...
Identification of AFLP molecular linked to row- type gene in barley
International Nuclear Information System (INIS)
Sayed- Tabatabaei, B.E.
2005-01-01
Formation of the two-and six-rowed types in barley is predominantly controlled by alleles at a single locus (vrzl) which is located in long armn of chromosome 2H. This gene is a key character on the study of barley domestication and yield. Near-isogenic lines of barley were produced from crosses between Kanto Nakate Gold (tow-rowed) and Azumamugi (six-rowed). The selected lines were used for screening of AFLP polymorphic bands which are linked to vrs1 locus. After screening of a total of 1792 primer combination, five polymorphic bands were identified. A construction of high resolution map around the vrs1 locus was made using recombinant inbred lines. These markers can be used for a map-based cloning of the genes at the vrsl locus
A Genome Wide Association Study of arabinoxylan content in 2-row spring barley grain.
Directory of Open Access Journals (Sweden)
Ali Saleh Hassan
Full Text Available In barley endosperm arabinoxylan (AX is the second most abundant cell wall polysaccharide and in wheat it is the most abundant polysaccharide in the starchy endosperm walls of the grain. AX is one of the main contributors to grain dietary fibre content providing several health benefits including cholesterol and glucose lowering effects, and antioxidant activities. Due to its complex structural features, AX might also affect the downstream applications of barley grain in malting and brewing. Using a high pressure liquid chromatography (HPLC method we quantified AX amounts in mature grain in 128 spring 2-row barley accessions. Amounts ranged from ~ 5.2 μg/g to ~ 9 μg/g. We used this data for a Genome Wide Association Study (GWAS that revealed three significant quantitative trait loci (QTL associated with grain AX levels which passed a false discovery threshold (FDR and are located on two of the seven barley chromosomes. Regions underlying the QTLs were scanned for genes likely to be involved in AX biosynthesis or turnover, and strong candidates, including glycosyltransferases from the GT43 and GT61 families and glycoside hydrolases from the GH10 family, were identified. Phylogenetic trees of selected gene families were built based on protein translations and were used to examine the relationship of the barley candidate genes to those in other species. Our data reaffirms the roles of existing genes thought to contribute to AX content, and identifies novel QTL (and candidate genes associated with them potentially influencing the AX content of barley grain. One potential outcome of this work is the deployment of highly associated single nucleotide polymorphisms markers in breeding programs to guide the modification of AX abundance in barley grain.
Protein and Carbohydrate Accumulation in Normal and High-Lysine Barley in Spike Culture
DEFF Research Database (Denmark)
Mather, D.E; Giese, Nanna Henriette
1984-01-01
Spikes of barley cv. Bomi and high-lysine mutants Riso 1508 and Riso 56 were cultured on liquid media at varying N and sucrose levels. Bomi accumulated N in response to increasing N levels in the medium and a higher level was reached than in spikes of intact plants. The distribution of N in salt......-soluble, hordein, and non-protein N fractions appeared to be normal. Endosperm dry weight and starch were lower than in intact plants and declined at higher N levels. A linear relationship was observed between starch content and the concentration of sucrose in the endosperm water. Uptake of culture medium...
Genetic differentiation and geographical Relationship of Asian barley landraces using SSRs
Directory of Open Access Journals (Sweden)
Rehan Naeem
2011-01-01
Full Text Available Genetic diversity in 403 morphologically distinct landraces of barley (Hordeum vulgare L. subsp. vulgare originating from seven geographical zones of Asia was studied using simple sequence repeat (SSR markers from regions of medium to high recombination in the barley genome. The seven polymorphic SSR markers representing each of the chromosomes chosen for the study revealed a high level of allelic diversity among the landraces. Genetic richness was highest in those from India, followed by Pakistan while it was lowest for Uzbekistan and Turkmenistan. Out of the 50 alleles detected, 15 were unique to a geographic region. Genetic diversity was highest for landraces from Pakistan (0.70 ± 0.06 and lowest for those from Uzbekistan (0.18 ± 0.17. Likewise, polymorphic information content (PIC was highest for Pakistan (0.67 ± 0.06 and lowest for Uzbekistan (0.15 ± 0.17. Diversity among groups was 40% compared to 60% within groups. Principal component analysis clustered the barley landraces into three groups to predict their domestication patterns. In total 51.58% of the variation was explained by the first two principal components of the barley germplasm. Pakistan landraces were clustered separately from those of India, Iran, Nepal and Iraq, whereas those from Turkmenistan and Uzbekistan were clustered together into a separate group.
International Nuclear Information System (INIS)
El-Kashoury, M.M.A.; Abdel Fattah, S.M.; Ramadan, L.A.; El-Denshary, E.S.
2016-01-01
Clotting abnormalities are observed after exposure to ionizing radiation as well as in diabetes melittus. The objective of this study is to elucidate the role of yeast beta glucan (YBG) in the modulation of some biochemical variations observed in γ-irradiated, diabetic and diabeticγγ-irradiated rats. Gamma-irradiation was performed through the whole body exposure of rats to 6 Gy administered in four fractions of 1.5 Gy two times per week for two weeks. Diabetes was induced by a single intraperitoneal injection of streptozotocin (55 mg/kg body weight). YBG was given orally to male albino rats (1 g/kg body weight) for two weeks post irradiation and/or induction of diabetes. Animals were divided into 4 main groups: 1- control, 2- γ-irradiated, 3- diabetic and 4- diabetic-γ-irradiated rats. Each group was subdivided into 2 subgroups (a) untreated and (b) treated. The 3rd and 14th day, after the last dose of radiation in the irradiated groups and after the induction of diabetes in diabetic groups, were chosen to evaluate the effect of oral YBG in irradiated and/or diabetic rats. The results revealed that the body weight decreased significantly in irradiated, diabetic and diabetic–irradiated rats. The loss of weight was accompanied by a reduction in the pancreas weight. Glucose concentration was significantly increased in diabetic group at the two time intervals. It is worth noting that, radiation ameliorated blood glucose level in diabetic-γ-irradiated group. Radiation exposure and/or diabetes caused an oxidative stress manifested by a significant increase of malondialdhyde (MDA) accompanied by a significant decrease in glutathione (GSH) level. This oxidative stress caused disturbances in the measured clotting parameters by enhancing platelet aggregation (PA) induced by arachidonic acid and increased thrombin level as concluded from the significant shortening of prothrombin time (PT) and activated partial thromboplastin time (APTT). Also, exposure to radiation
High beta and confinement studies on TFTR
International Nuclear Information System (INIS)
Navratil, G.A.; Bhattacharjee, A.; Iacono, R.; Mauel, M.E.; Sabbagh, S.A.; Kesner, J.
1992-01-01
A new regime of high poloidal beta operation in TFTR was developed in the course of the first two years of this project (9/25/89 to 9/24/91). Our proposal to continue this successful collaboration between Columbia University and the Massachusetts Institute of Technology with the Princeton Plasma Physics Laboratory for a three year period (9/25/91 to 9/24/94) to continue to investigate improved confinement and tokamak performance in high poloidal beta plasmas in TFTR through the DT phase of operation was approved by the DOE and this is a report of our progress during the first 9 month budget period of the three year grant (9/25/91 to 6/24/92). During the approved three year project period we plan to (1) extend and apply the low current, high QDD discharges to the operation of TFTR using Deuterium and Tritium plasma; (2) continue the analysis and plan experiments on high poloidal beta phenomena in TFTR including: stability properties, enhanced global confinement, local transport, bootstrap current, and divertor formation; (3) plan and carry out experiments on TFTR which attempt to elevate the central q to values > 2 where entry to the second stability regime is predicted to occur; and (4) collaborate on high beta experiments using bean-shaped plasmas with a stabilizing conducting shell in PBX-M. In the seven month period covered by this report we have made progress in each of these four areas through the submission of 4 TFTR Experimental Proposals and the partial execution of 3 of these using a total of 4.5 run days during the August 1991 to February 1992 run
High voltage electric field effects on structure and biological characteristics of barley seeds
Energy Technology Data Exchange (ETDEWEB)
Khazaei, J. [Tehran Univ., Tehran (Iran, Islamic Republic of). Dept. of Agrotechnology, Univ. College of Abouraihan; Aliabadi, E. [Tehran Univ., Tehran (Iran, Islamic Republic of). Dept. of Crop Production Horticulture, Univ. College of Aburaihan; Shayegani, A.A. [Tehran Univ., Tehran (Iran, Islamic Republic of). Univ. College of Engineering
2010-07-01
Electric biostimulation of seeds is a pre-sowing treatment in which an electric field is applied to seeds to increase germination of non standard seeds. This paper reported on a study that examined the effects of AC electric field and exposure time on the structure and biological characteristics of barley seeds. The objective was to determine the potential to accelerate seed germination, plant growth and root development by the electric field strength and exposure time. Makooei cultivar barley seeds were used in this study. The effect of electric field strength (at 2, 4, 9, and 14 kV/m) and exposure time (at 15, 45, 80, and 150 min) on seed germination was studied along with height of seedling, length or root, height of stem, length of leaves, earliness, dry weight and wet weight of seedling. The treated seeds were stored for a month in a refrigerator at 5 degrees C prior to the germination experiments. The initial germination percent of the seed was 81 per cent. The treatment of barley seeds in an AC electric field had a positive effect on all investigated parameters. The germination percent of the treated seed increased to 94.5 per cent . The seeds exposed for long periods of time (45 to 150 min) showed better germination than the seeds exposed to lower exposure times. Dry and wet weights of seedling increased 143.4 per cent and 45.7 per cent, respectively.
Oligosaccharide binding to barley alpha-amylase 1
DEFF Research Database (Denmark)
Robert, X.; Haser, R.; Mori, H.
2005-01-01
Enzymatic subsite mapping earlier predicted 10 binding subsites in the active site substrate binding cleft of barley alpha-amylase isozymes. The three-dimensional structures of the oligosaccharide complexes with barley alpha-amylase isozyme 1 (AMY1) described here give for the first time a thorough...... in barley alpha-amylase isozyme 2 (AMY2), and the sugar binding modes are compared between the two isozymes. The "sugar tongs" surface binding site discovered in the AMY1-thio-DP4 complex is confirmed in the present work. A site that putatively serves as an entrance for the substrate to the active site...
Evaluation of Some Chemical Characteristics of barley Mutants induced by Gamma Irradiation
International Nuclear Information System (INIS)
Abdeldaiem, M.H.; Ali, H.G.M.
2011-01-01
This study aims to evaluate the antioxidant activity of acetonic extract from some barley mutations (P1, P2 and P3 varieties) induced by gamma irradiation as compared with local barley variety (Hordeum vulgare L.) as control. Barley samples were obtained from Plant Breeding Unit, Plant Research Department, Nuclear Research Centre, Atomic Energy Authority, Egypt. The measurements of the antioxidant activity using a radical scavenging capacity against 2,2-diphenyl-1-picrylhydrazyl (DPPH) and ?-carotene bleaching assay were assessed in the barley acetonic extract. Furthermore, amino acids composition of barley mutant samples was determined. The results indicated that the acetonic extract of barley varieties under investigation possess marked antioxidant and anti radical capacities. The data showed that the acetonic extract of barley mutant P1 possessed the higher antioxidant activity as compared with the antioxidant activities of acetonic extract from control and other barley mutant samples. Meanwhile, the flour of barley mutations under investigation contained trace elements of iron, copper and manganese. GC and mass analyses were used to identify the active compound of extract of control and mutant barley samples. The results illustrated that the main components of the control sample of barely extract was pentane, 3 methyl (47.73%) while gamma irradiation caused noticeable change in the relative percentage of some components of acetonic extract from barley mutant samples. Moreover, the results presented that changes were disappeared, and some compounds of the acetonic extract from mutant barley samples were appeared. Furthermore, the results exhibited that barley flour supplemented with wheat flour at 30% level produced acceptable cookies. Accordingly, the phenolic constituents of barley acetonic extract induced by gamma irradiation, especially samples of P1 mutant, may have a future role as ingredients in the development of functional foods.
Dinitrogen fixation estimates in Vetch-barley swards using {sup 15} N-methodology
Energy Technology Data Exchange (ETDEWEB)
Kurdali, F; Sharabi, N E [Atomic Energy Commission, P.O.Box 6091, Damascus, (Syrian Arab Republic)
1995-10-01
N 2- fixation in vetch (Vicia Sativa) grown alone and in mixture with barley (hordeum vulgare) in pots was evaluated using {sup 15} N isotope dilution method. Two harvests were made over the growing season. The proportion of the above-ground N, derived from atmospheric N 2 (% Ndfa) in mixed vetch was significantly higher than that of vetch in pure culture for the different harvests. However, this increase was not accompanied with the amount of N 2-fixation. On the other hand, no significant differences were observed in N-content or in N-derived from soil between barley grown in mixture and in monoculture, in spite of the difference in the number of plants between the tow cropping systems. These results indicate a high competing capacity of barley for soil nitrogen in mixed culture. Barley grown together with vetch had lower atom % 15 N excess than barley grown in mono-culture because it may have received some of their N from N-released by the legume in the second herbage but not in the first. Overall, results obtained from this experiment indicate the importance of mixed crops for forage production. Based on these results, further investigation must carried out in the field. 1 fig.
Effect of microwave freeze drying on quality and energy supply in drying of barley grass.
Cao, Xiaohuang; Zhang, Min; Mujumdar, Arun S; Zhong, Qifeng; Wang, Zhushang
2018-03-01
Young barley grass leaves are well-known for containing the antioxidant substances flavonoid and chlorophyll. However, low product quality and energy efficiency exist with respect to the dehydration of barley grass leaves. To improve energy supply and the quality of barley grass, microwave heating instead of contact heat was applied for the freeze drying of barley grass at a pilot scale at 1, 1.5 and 2 W g -1 , respectively; After drying, energy supply and quality parameters of color, moisture content, chlorophyll, flavonoids, odors of dried barley grass were determined to evaluate the feasibility of the study. Microwave freeze drying (MFD) allowed a low energy supply and high contents of chlorophyll and flavonoids. A lightness value of 60.0, a green value of -11.5 and an energy supply of 0.61 kW h -1 g -1 were observed in 1.5 W g -1 MFD; whereas drying time (7 h) decreased by 42% compared to contact heating. Maximum content of flavonoid and chlorophyll was 11.7 and 12.8 g kg -1 barley grass. Microwave heating leads to an odor change larger than that for contact heating observed for the freeze drying of barley grass. MFD retains chlorophyll and flavonoids, as well as colors and odors of samples, and also decreases energy consumption in the freeze drying of barley grass. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.
An Integrated Resource for Barley Linkage Map and Malting Quality QTL Alignment
Directory of Open Access Journals (Sweden)
Péter Szűcs
2009-07-01
Full Text Available Barley ( L. is an economically important model plant for genetics research. Barley is currently served by an increasingly comprehensive set of tools for genetic analysis that have recently been augmented by high-density genetic linkage maps built with gene-based single nucleotide polymorphisms (SNPs. These SNP-based maps need to be aligned with earlier generation maps, which were used for quantitative trait locus (QTL detection, by integrating multiple types of markers into a single map. A 2383 locus linkage map was developed using the Oregon Wolfe Barley (OWB Mapping Population to allow such alignments. The map is based on 1472 SNP, 722 DArT, and 189 prior markers which include morphological, simple sequence repeat (SSR, Restriction Fragment Length Polymorphism (RFLP, and sequence tagged site (STS loci. This new OWB map forms, therefore, a useful bridge between high-density SNP-only maps and prior QTL reports. The application of this bridge concept is shown using malting-quality QTLs from multiple mapping populations, as reported in the literature. This is the first step toward developing a Barley QTL Community Curation workbook for all types of QTLs and maps, on the GrainGenes website. The OWB-related resources are available at OWB Data and GrainGenes Tools (OWB-DGGT (.
Structural lability of Barley stripe mosaic virus virions.
Directory of Open Access Journals (Sweden)
Valentin V Makarov
Full Text Available Virions of Barley stripe mosaic virus (BSMV were neglected for more than thirty years after their basic properties were determined. In this paper, the physicochemical characteristics of BSMV virions and virion-derived viral capsid protein (CP were analyzed, namely, the absorption and intrinsic fluorescence spectra, circular dichroism spectra, differential scanning calorimetry curves, and size distributions by dynamic laser light scattering. The structural properties of BSMV virions proved to be intermediate between those of Tobacco mosaic virus (TMV, a well-characterized virus with rigid rod-shaped virions, and flexuous filamentous plant viruses. The BSMV virions were found to be considerably more labile than expected from their rod-like morphology and a distant sequence relation of the BSMV and TMV CPs. The circular dichroism spectra of BSMV CP subunits incorporated into the virions, but not subunits of free CP, demonstrated a significant proportion of beta-structure elements, which were proposed to be localized mostly in the protein regions exposed on the virion outer surface. These beta-structure elements likely formed during virion assembly can comprise the N- and C-terminal protein regions unstructured in the non-virion CP and can mediate inter-subunit interactions. Based on computer-assisted structure modeling, a model for BSMV CP subunit structural fold compliant with the available experimental data was proposed.
Endoproteolytic activity assay in malting barley
Directory of Open Access Journals (Sweden)
Blanca Gómez Guerrero
2013-12-01
Full Text Available Hydrolysis of barley proteins into peptides and amino acids is one of the most important processes during barley germination.The degradation of the endosperm stored proteins facilitates water and enzyme movements, enhances modification, liberates starch granules and increases soluble amino nitrogen. Protease activity is the result of the activities of a mixture of exo- and endo-proteases. The barley proteins are initially solubilized by endo-proteases and the further by exo-proteases. Four classes of endo-proteases have been described: serine-proteases, cysteine-proteases, aspartic-proteases and metallo-proteases. The objective of this work was to develop a rapid and colorimetric enzymatic assay to determine the endo-proteolytic activity of the four endo-protease classes using two different substrates: azo-gelatin and azo-casein. Optimum conditions for the assays such as: pH,reaction time and temperature and absorbance scale were determined. Azo-gelatin presented several difficulties in standardizing an “in solution” assay. On the other hand, azo-casein allowed standardization of the assay for the four enzyme classes to produce consistent results. The endo-proteoteolytic method developed was applied to determine the endo-protease activity in barley, malt and wort.
A food additive with prebiotic properties of an α-d-glucan from lactobacillus plantarum DM5.
Das, Deeplina; Baruah, Rwivoo; Goyal, Arun
2014-08-01
An α-d-glucan produced by Lactobacillus plantarum DM5 was explored for in vitro prebiotic activities. Glucan-DM5 demonstrated 21.6% solubility, 316.9% water holding capacity, 86.2% flocculation activity, 71.4% emulsification activity and a degradation temperature (Td) of 292.2°C. Glucan-DM5 exhibited lowest digestibility of 0.54% by artificial gastric juice, 0.21% by intestinal fluid and 0.32% by α-amylase whereas the standard prebiotic inulin, showed 25.23%, 5.97% and 19.13%, hydrolysis, respectively. Prebiotic activity assay of glucan-DM5 displayed increased growth of probiotic bacteria such as Bifidobacterium infantis and Lactobacillus acidophilus, but did not support the growth of non-probiotic bacteria such as Escherichia coli and Enterobacter aerogenes. The overall findings indicated that glucan from L. plantarum DM5 can serve as a potential prebiotic additive for food products. Copyright © 2014 Elsevier B.V. All rights reserved.
Effects of global MHD instability on operational high beta-regime in LHD
International Nuclear Information System (INIS)
Watanabe, K.Y.; Sakakibara, S.; Narushima, Y.; Funaba, H.; Narihara, K.; Tanaka, K.; Toi, K.; Ohdachi, S.; Kaneko, O.; Yamada, H.; Nakajima, N.; Yamada, I.; Kawahata, K.; Tokuzawa, T.; Komori, A.; Yamaguchi, T.; Suzuki, Y.; Cooper, W.A.; Murakami, S.
2005-01-01
In the Large Helical device (LHD), the operational highest averaged beta value has been expanded from 3.2% to 4% in last two years by increasing the heating capability and exploring a new magnetic configuration with a high aspect ratio. Although the MHD stability properties are considered to be unfavourable in the new high aspect configuration, the heating efficiency due to neutral beams and the transport properties are expected to be favourable in a high beta range. In order to make clear the effect of the global ideal MHD unstable mode on the operational regimes in helical systems, specially the beta gradients in the peripheral region and the beta value, the MHD analysis and the transport analysis are done in a high beta range up to 4% in LHD. In a high beta range of more than 3%, the maxima of the observed thermal pressure gradients in the peripheral region are marginally stable to a global ideal MHD instability. Though a gradual degradation of the local transport in the region has been observed as beta increases, a disruptive degradation of the local transport does not appear in the beta range up to 4%. (author)
New NS varieties of six-rowed winter barley
Directory of Open Access Journals (Sweden)
Pržulj Novo
2009-01-01
Full Text Available The paper describes the characteristics of several new NS varieties of winter six-rowed barley released in Serbia between 2004 and 2007. These are Somborac, Ozren, Javor, Novosadski 773, Sremac and Leotar. In the official variety trials in the country, all six of these varieties outyielded the check variety, and the margins were as follows: Somborac - 3.4%, Ozren - 5.0%, Javor - 7.3%, Novosadski 773 - 3.4%, Sremac - 7.4%, and Leotar - 7.2%. Yield levels in absolute terms depended on the variety as well as year. All six-rowed NS varieties headed earlier than the check and had better resistance to lodging than the check has. The test weight of the new varieties was 70.2-73.8 kg/hl and the 1000-grain weight 33.4-50.2 g. The cellulose content was 4.4-4.8%, the fat content 1.4%, and the protein content 13.3-14.6%. The high variability of the new NS varieties of winter six-rowed barley makes it possible to choose the most suitable genotype for each barley-growing area in the country. .
Dooijewaard, G.; Roossien, F.F.; Robillard, G.T.
1979-01-01
A rapid, high-yield procedure has been developed for the purification of HPr from the Escherichia coli phosphoenolpyruvate dependent phosphotransferase system. During this procedure, the protein copurifies with a 2500-dalton homopolysaccharide which we have identified as α1-6 glucan. The results of
Directory of Open Access Journals (Sweden)
Natcha Phantuwong
2017-12-01
Full Text Available Background: Research focusing on the improvement of the utilization of rice bran is increasing due to its nutritional properties. Several biological activities of rice bran hydrolysates and its constituents have been reported. Sang-yod rice, a local rice variety in Southern of Thailand, is a pigmented rice. Furthermore, its bran has high nutritive value and health beneficial components. Accordingly, there is growing interest in transforming this by-product into a functional food ingredient. Objective: To investigate the effect of enzymatic hydrolysis processes on the digestion of protein and β-glucan and evaluate anti-proinflammatory properties of selected hydrolysates on RAW 264.7 macrophage cells. Method: Sang-yod rice bran hydrolysates were obtained using a single or co-enzymatic hydrolysis process and sequential hydrolysis process using amyloglucosidase and protease G6. Effects of enzyme concentration (3-5% v/w and hydrolysis duration (30, 60, and 120 min on soluble protein and β-glucan contents of obtained rice bran hydrolysates were evaluated. The selected rice bran hydrolysates were evaluated for their cell viability and inhibition against NO and pro-inflammatory cytokines generation on RAW 264.7 mouse macrophage cell lines. Results: Protein content (0.59-3.37 % of the rice bran hydrolysates (RBHs was increased by increasing of enzyme concentration (3-5% v/w and hydrolysis time (60-120 min. However, the β-glucan content (0.88-4.63% of RBHs decreased with the increase of those parameters. The RBHs derived by the sequential process using 5% v/w enzyme concentration and 60 min hydrolysis time gave high protein (3.23% and high β-glucan (4.02% contents. The hydrolysates with high amount of protein and/or β-glucan contents demonstrated no cytotoxicity against RAW 264.7 cells at concentration range of 100-2,000 μg/ml. Additionally, they demonstrated NO inhibition and pro-inflammatory inhibition ranges of 49.09-71.63% and 9
Long-lived effects of administering β-glucans
Petit, Jules; Wiegertjes, Geert F.
2016-01-01
Over the past decades, it has become evident that immune-modulation of fish with β-glucans, using injection, dietary or even immersion routes of administration, has stimulating but presumed short-lived effects on both intestinal and systemic immunity and can increase protection against a
Effect of purified oat ß-glucan on fermentation of set-style yogurt mix
Effect of ß-glucan on the fermentation of set-style yogurt was investigated by incorporating 0, 0.1, 0.2, 0.3, 0.4, and 0.5% of ß-glucan into the yogurt mix. It was found that levels up to 0.3% resulted in yogurts with quality characteristics similar to the control yogurt. Higher levels of ß-gluca...
Diversity in boron toxicity tolerance of Australian barley (Hordeum vulgare L.) genotypes.
Hayes, Julie E; Pallotta, Margaret; Garcia, Melissa; Öz, Mehmet Tufan; Rongala, Jay; Sutton, Tim
2015-09-26
Boron (B) is an important micronutrient for plant growth, but is toxic when levels are too high. This commonly occurs in environments with alkaline soils and relatively low rainfall, including many of the cereal growing regions of southern Australia. Four major genetic loci controlling tolerance to high soil B have been identified in the landrace barley, Sahara 3771. Genes underlying two of the loci encode the B transporters HvBot1 and HvNIP2;1. We investigated sequence and expression level diversity in HvBot1 and HvNIP2;1 across barley germplasm, and identified five novel coding sequence alleles for HvBot1. Lines were identified containing either single or multiple copies of the Sahara HvBot1 allele. We established that only the tandemly duplicated Sahara allele conferred B tolerance, and this duplicated allele was found only in a set of nine lines accessioned in Australian collections as Sahara 3763-3771. HvNIP2;1 coding sequences were highly conserved across barley germplasm. We identified the likely causative SNP in the 5'UTR of Sahara HvNIP2;1, and propose that the creation of a small upstream open reading frame interferes with HvNIP2;1 translation in Sahara 3771. Similar to HvBot1, the tolerant HvNIP2;1 allele was unique to the Sahara barley accessions. We identified a new source of the 2H B tolerance allele controlling leaf symptom development, in the landrace Ethiopia 756. Ethiopia 756, as well as the cultivar Sloop Vic which carries both the 2H and HvBot1 B tolerance alleles derived from Sahara 3771, may be valuable as alternative parents in breeding programs targeted to high soil B environments. There is significant diversity in B toxicity tolerance among contemporary Australian barley varieties but this is not related to variation at any of the four known B tolerance loci, indicating that novel, as yet undiscovered, sources of tolerance exist.
Numerical models for high beta magnetohydrodynamic flow
International Nuclear Information System (INIS)
Brackbill, J.U.
1987-01-01
The fundamentals of numerical magnetohydrodynamics for highly conducting, high-beta plasmas are outlined. The discussions emphasize the physical properties of the flow, and how elementary concepts in numerical analysis can be applied to the construction of finite difference approximations that capture these features. The linear and nonlinear stability of explicit and implicit differencing in time is examined, the origin and effect of numerical diffusion in the calculation of convective transport is described, and a technique for maintaining solenoidality in the magnetic field is developed. Many of the points are illustrated by numerical examples. The techniques described are applicable to the time-dependent, high-beta flows normally encountered in magnetically confined plasmas, plasma switches, and space and astrophysical plasmas. 40 refs
Dietary β-glucan enhances the contents of complement component 3 and factor B in eggs of zebrafish.
Jiang, Chengyan; Wang, Peng; Li, Mengyang; Liu, Shousheng; Zhang, Shicui
2016-12-01
β-glucan has been shown to increase non-specific immunity and resistance against infections or pathogenic bacteria in several fish species, but no information is available regarding its trans-generational effects to date. Here we clearly demonstrated that β-glucan enhanced the contents of immune-relevant molecules C3 and Bf in eggs of zebrafish, and the embryos derived from β-1,3 glucan-treated zebrafish were more resistant to bacterial challenge than control embryos. Moreover, the transferred C3 and Bf were directly associated with the antimicrobial defense of early embryos. In addition, feeding female zebrafish with β-glucan had little detrimental effects on the number of spawned eggs and their embryonic development. Collectively, these data show for the first time that β-glucan can be safely used to promote the non-specific immunity in offspring of fishes. Copyright © 2016 Elsevier Ltd. All rights reserved.
Characterization of volatile aroma compounds in different brewing barley cultivars.
Dong, Liang; Hou, Yingmin; Li, Feng; Piao, Yongzhe; Zhang, Xiao; Zhang, Xiaoyu; Li, Cheng; Zhao, Changxin
2015-03-30
Beer is a popular alcoholic malt beverage resulting from fermentation of the aqueous extract of malted barley with hops. The aroma of brewing barley impacts the flavor of beer indirectly, because some flavor compounds or their precursors in beer come from the barley. The objectives of this research were to study volatile profiles and to characterize odor-active compounds of brewing barley in order to determine the variability of the aroma composition among different brewing barley cultivars. Forty-one volatiles comprising aldehydes, ketones, alcohols, organic acids, aromatic compounds and furans were identified using solid phase microextraction combined with gas chromatography/mass spectrometry, among which aldehydes, alcohols and ketones were quantitatively in greatest abundance. Quantitative measurements performed by means of solvent extraction and calculation of odor activity values revealed that acetaldehyde, 2-methylpropanal, 3-methylbutanal, 2-methylbutanal, hexanal, heptanal, octanal, nonanal, 3-methyl-1-butanol, cyclopentanol, 2,3-butanedione, 2,3-pentanedione, 2-heptanone, acetic acid, ethyl acetate, 2-pentylfuran and benzeneacetaldehyde, whose concentrations exceeded their odor thresholds, could be considered as odor-active compounds of brewing barley. Principal component analysis was employed to evaluate the differences among cultivars. The results demonstrated that the volatile profile based on the concentrations of aroma compounds enabled good differentiation of most barley cultivars. © 2014 Society of Chemical Industry.
International Nuclear Information System (INIS)
Yu Peiqiang
2012-01-01
Barley inherent structures are highly associated with nutrient utilization and availability in both humans and animals. Barley has different degradation kinetics compared with other cereal grains. It has a relatively higher degradation rate and extent, which often cause digestive disorder in the rumen. Therefore understanding barley inherent structure at cellular and molecular levels and processing-induced structure changes is important, because we can manipulate barley inherent structures and digestive behaviors. Several molecular spectroscopy techniques can be used to detect barley inherent structures at cellular and molecular levels. This article reviews several applications of the IR molecular spectral bioanalytical techniques - DRIFT, FT/IR-ATR and SR-IMS for barley chemistry, molecular structure and molecular nutrition research
γ-ray radiation decontamination of barley plant powder
International Nuclear Information System (INIS)
Zhao Xiaojun; Fu Junjie; Wang Zhiping; Zhang Guobin
2007-01-01
Radiation decontamination of barley plant powder by 60 Co γ-rays and the effect on its components were studied. Results showed that irradiation was very effective in killing the microorganisms in barley plant powder. The irradiation did not cause obvious changes of the major components of protein, total sugar, free amino acid, crude fiber, but 35% loss of vitamin E was observed after 10kGy irradiation. It is suggested that 7.5-10kGy irradiation is good enough for decontamination of the barley plant powder. (authors)
Classification and salt tolerance analysis of barley varieties
Katerji, N.; Hoorn, van J.W.; Hamdy, A.; Mastrorilli, M.; Fares, C.; Ceccarelli, S.; Grando, S.; Oweis, T.
2006-01-01
Six varieties of barley (Hordeum vulgare), five of which were provided by ICARDA, were tested in a green house experiment for their salt tolerance. Afterwards the ICARDA variety Melusine, selected from this experiment for its combination of high yield and salt tolerance, was compared in a lysimeter
Extracellular cell wall β(1,3)glucan is required to couple septation to actomyosin ring contraction
Muñoz, Javier; Cortés, Juan Carlos G.; Sipiczki, Matthias; Ramos, Mariona; Clemente-Ramos, José Angel; Moreno, M. Belén; Martins, Ivone M.; Pérez, Pilar
2013-01-01
Cytokinesis has been extensively studied in different models, but the role of the extracellular cell wall is less understood. Here we studied this process in fission yeast. The essential protein Bgs4 synthesizes the main cell wall β(1,3)glucan. We show that Bgs4-derived β(1,3)glucan is required for correct and stable actomyosin ring positioning in the cell middle, before the start of septum formation and anchorage to the cell wall. Consequently, β(1,3)glucan loss generated ring sliding, oblique positioned rings and septa, misdirected septum synthesis indicative of relaxed rings, and uncoupling between a fast ring and membrane ingression and slow septum synthesis, suggesting that cytokinesis can progress with defective septum pushing and/or ring pulling forces. Moreover, Bgs4-derived β(1,3)glucan is essential for secondary septum formation and correct primary septum completion. Therefore, our results show that extracellular β(1,3)glucan is required for cytokinesis to connect the cell wall with the plasma membrane and for contractile ring function, as proposed for the equivalent extracellular matrix in animal cells. PMID:24165938
Arabidopsis thaliana AMY3 Is a Unique Redox-regulated Chloroplastic α-Amylase
DEFF Research Database (Denmark)
Seung, David; Thalmann, Matthias; Sparla, Francesca
2013-01-01
α-Amylases are glucan hydrolases that cleave α-1,4-glucosidic bonds in starch. In vascular plants, α-amylases can be classified into three subfamilies. Arabidopsis has one member of each subfamily. Among them, only AtAMY3 is localized in the chloroplast. We expressed and purified AtAMY3 from...... to be dependent on a conserved aspartic acid residue (Asp666), identified as the catalytic nucleophile in other plant α-amylases such as the barley AMY1. AtAMY3 released small linear and branched glucans from Arabidopsis starch granules, and the proportion of branched glucans increased after the predigestion...
Structural characterization of a novel glucan from Achatina fulica and its antioxidant activity.
Liao, Ningbo; Chen, Shiguo; Ye, Xingqian; Zhong, Jianjun; Ye, Xuan; Yin, Xinzi; Tian, Jenny; Liu, Donghong
2014-03-19
A novel glucan designated AFPS-IB was purified from Achatina fulica (China white jade snail) by anion-exchange and gel-permeation chromatography. Chemical composition analysis indicated AFPS-IB was composed of glucose, fucose, rhamnose, mannose, and galactose in a molar ratio of 189:2:1:1:2 and with an average molecular weight of 128 kDa. Its structural characteristics were investigated by Fourier transform infrared spectroscopy (FTIR), high performance liquid chromatography (HPLC), gas chromatography mass spectrometry (GC-MS), methylation analysis, nuclear magnetic resonance (NMR) spectroscopy ((1)H,( 13)C, H-H COSY, HSQC, TOCSY, and NOESY), and atomic force microscopy (AFM). The glucan mainly consisted of a backbone of repeating (1→4)-α-d-glucose residues with (1→6)-β-d glucosyl branches at random points on the backbone glucose. Antioxidant studies revealed AFPS-IB showed significant DPPH (2,2-diphenyl-1-picrylhydrazyl) radical, superoxide anion (O2(-)) scavenging activities and high reduction potential. This study suggested that AFPS-IB could be a new source of dietary antioxidants.
DEFF Research Database (Denmark)
Christensen, Jesper Bjerg; Dionisio, Giuseppe; Poulsen, Hanne Damgaard
2014-01-01
.3. Solubilized and degraded proteins evaluated by biuret, SDS-PAGE, and differential proteomics revealed that pH 4.3 had the greatest impact on both solubilization and degradation. In order to boost proteolysis, the recombinant barley endoprotease B2 (rec-HvEP-B2) was included after 8 h using the pH 4.3 regime......Nonfermented soaking of barley feedstuff has been established as an in vitro procedure prior to the feeding of pigs as it can increase protein digestibility. In the current study, two feed cultivars of barley (Finlissa and Zephyr) were soaked in vitro either nonbuffered or buffered at pH 3.6 and 4....... Proteolysis evaluated by SDS-PAGE and differential proteomics confirmed a powerful effect of adding rec-HvEP-B2 to the soaked barley, regardless of the genotype. Our study addresses the use of rec-HvEP-B2 as an effective feed enzyme protease. HvEP-B2 has the potential to increase the digestibility of protein...
The course of protein synthesis during grain filling in normal and high lysine barley
International Nuclear Information System (INIS)
Giese, H.; Andersen, B.
1984-01-01
A study of the course of protein synthesis during grain filling in Bomi and the high lysine barleys Hily 82/3 and Risoe 56 showed that the four salt-soluble proteins, protein Z, β-amylase and the chymotrypsin inhibitors CI-1 and CI-2, are synthesized in greater amounts earlier in the high lysine lines than in Bomi. On the other hand, the hordeins are synthesized in greater amounts earlier during grain filling in Bomi than in Hily 82/3 and Risoe 56. There is no indication of a significant reduction of total protein synthesis in the high lysine lines compared with the standard lines Bomi and Pirrka. Hily 82/3 and Risoe 56 are very similar in protein composition in that they have a lower hordein content and higher levels, particularly of β-amylase and the chymotrypsin inhibitors, than Bomi. (author)
DEFF Research Database (Denmark)
Møller, Marie Sofie; Goh, Yong Jun; Rasmussen, Kasper Bøwig
2017-01-01
binding modules, a domain of unknown function, and a C-terminal surface layer association protein (SLAP) domain. Here we explore the specificity of a representative of this group of pullulanases, LaPul13_14 and its role in branched α-glucans metabolism in the well characterized Lactobacillus acidophilus...... in the presence of α-glucans but was repressed by glucose. The debranching activity is conferred exclusively by LaPul13_14 and is abolished in a mutant strain lacking a functional LaPul13_14 gene. Hydrolysis kinetics of recombinant LaPul13_14 confirmed the preference for short branched α-glucan oligomers....... Branched α-1,6-glucans in dietary starch and glycogen are non-degradable by human enzymes and constitute a metabolic resource for the gut microbiota. The role of health-beneficial lactobacilli prevalent in the human small intestine in starch metabolism remains unexplored in contrast to colonic bacterial...
High energy beta rays and vectors of Bilharzia and Fasciola
International Nuclear Information System (INIS)
Fletcher, J.J.; Akpa, T.C.; Dim, L.A.; Ogunsusi, R.
1988-01-01
Preliminary investigations of the effects of high energy beta rays on Lymnea natalensis, the snail vector of Schistosoma haematobium have been conducted. Results show that in both stream and tap water, about 70% of the snails die when irradiated for up to 18 hours using a 15m Ci Sr-90 beta source. The rest of the snails die without further irradiation in 24 hours. It may then be possible to control the vectors of Bilharzia and Fasciola by using both the direct and indirect effects of high energy betas. (author)
High energy beta rays and vectors of Bilharzia and Fasciola
Energy Technology Data Exchange (ETDEWEB)
Fletcher, J.J.; Akpa, T.C.; Dim, L.A.; Ogunsusi, R.
1988-01-01
Preliminary investigations of the effects of high energy beta rays on Lymnea natalensis, the snail vector of Schistosoma haematobium have been conducted. Results show that in both stream and tap water, about 70% of the snails die when irradiated for up to 18 hours using a 15m Ci Sr-90 beta source. The rest of the snails die without further irradiation in 24 hours. It may then be possible to control the vectors of Bilharzia and Fasciola by using both the direct and indirect effects of high energy betas.
Bushkin, G. Guy; Motari, Edwin; Magnelli, Paula; Gubbels, Marc-Jan; Dubey, Jitender P.; Miska, Katarzyna B.; Bullitt, Esther; Costello, Catherine E.; Robbins, Phillips W.; Samuelson, John
2012-01-01
ABSTRACT The walls of infectious pathogens, which are essential for transmission, pathogenesis, and diagnosis, contain sugar polymers that are defining structural features, e.g., β-1,3-glucan and chitin in fungi, chitin in Entamoeba cysts, β-1,3-GalNAc in Giardia cysts, and peptidoglycans in bacteria. The goal here was to determine in which of three walled forms of Toxoplasma gondii (oocyst, sporocyst, or tissue cyst) is β-1,3-glucan, the product of glucan synthases and glucan hydrolases predicted by whole-genome sequences of the parasite. The three most important discoveries were as follows. (i) β-1,3-glucan is present in oocyst walls of Toxoplasma and Eimeria (a chicken parasite that is a model for intestinal stages of Toxoplasma) but is absent from sporocyst and tissue cyst walls. (ii) Fibrils of β-1,3-glucan are part of a trabecular scaffold in the inner layer of the oocyst wall, which also includes a glucan hydrolase that has a novel glucan-binding domain. (iii) Echinocandins, which target the glucan synthase and kill fungi, arrest development of the Eimeria oocyst wall and prevent release of the parasites into the intestinal lumen. In summary, β-1,3-glucan, which can be targeted by drugs, is an important component of oocyst walls of Toxoplasma but is not a component of sporocyst and tissue cyst walls. PMID:23015739
Falcón-Villa, María R; Barrón-Hoyos, Jesús M; Cinco-Moroyoqui, Francisco J
2014-09-01
The beneficial effect of dietary fiber (DF) consumption has long been recognized. The global economy and open market trade policies have increased the availability of food products in Mexican markets, resulting in a wide variety of ready-to-eat commercial breakfast cereals classified as 'high fiber'. This research was aimed to evaluate the total dietary fiber contents, its fractions (soluble and insoluble) and β-glucan in 13 commercial 'high-fiber' breakfast cereals, as well as to evaluate their protein quality by rat bioassays. Commercial 'high-fiber' breakfast cereals had 7.42-39.82% insoluble dietary fiber, 2.53-12.85% soluble dietary fiber, and 0.45-4.96% β-glucan. These ready-to-eat commercial 'high-fiber' breakfast cereals differed significantly in their total dietary fiber, their soluble and insoluble DF fractions, and also in their β-glucan contents. When supplied as experimental diets, in 14-day rat feeding trials, the 'high-fiber' breakfast cereals showed an adverse effect on the % N digestibility but protein utilization, as measured as net protein ratio (NPR), was not significantly affected. The consumption of these commercial breakfast cereals, especially those made of oats as the basic ingredient, is highly recommended, since these products, being a concentrated source of dietary fiber, do not affect their protein quality.
Directory of Open Access Journals (Sweden)
Đukić Nevena H.
2014-01-01
Full Text Available In grain of ten genetically divergent oat cultivars (Merkur, Minor Abed, Flaming-Kurz, Nuptiele, Prode, Pellerva, Emperor, Astor, Osmo, Simo the variability β-glucan content were investigated. The different value of content of β-glucan was found. Among analyzed oat cultivars, the highest β- glucan contents had Pellerva (6.597%, while the least had Simo (2.971%. The contents of β-glucans were determined by ICC standard Method No 168. The value of β-glucans varied and indicated the differences and similarities between analysed cultivars. The degree of cultivar similarity was determined by dendrogram on which was discriminated two clusters of similar cultivars toward to contents of β-glucan . Within cluster 1, a small group of oats, are five cultivars with small distance (Merkur, Minor Abed, Flamings-Kurz, Nuptiele and Prode. The highest similarity in the range of 88 or the least distance in the range of 12. Within cluster 2 was four oat cultivars (Emperor, Astor, Osmo, Pellerva in which the least differences was between Emperor and Astor with average distance in range 27. Cluster 1 and cluster 2 differed with an average distance of 63. The cultivar Simo expressed the greatest distance to all analysed oat cultivars grouped in two clusters. [Projekat Ministarstva nauke Republike Srbije, br. TR 31092
Anti-tumor effects of (1→3)-β-d-glucan from Saccharomyces cerevisiae in S180 tumor-bearing mice.
Mo, Li; Chen, Yafei; Li, Wenjian; Guo, Shuai; Wang, Xuzhao; An, Hailong; Zhan, Yong
2017-02-01
(1→3)-β-d-Glucan from Saccharomyces cerevisiae is a typical polysaccharide with various biological effects and is considered a candidate for the prevention and treatment of cancer in vitro. Research into the function of (1→3)-β-d-glucan in tumor-bearing animals in vivo, however, is limited. Here, we investigated the effects of (1→3)-β-d-glucan from S. cerevisiae on S180 tumor-bearing mice and on the immunity of the tumor-bearing host. The molecular mechanisms underlying the observed effects were investigated. (1→3)-β-d-Glucan was shown to exert anti-tumor effects without toxicity in normal mouse cells. The volume and weight of S180 tumors decreased dramatically following treatment with (1→3)-β-d-glucan, and treatment with the polysaccharide was furthermore shown to increase the tumor inhibition rate in a dose-dependent manner. Spleen index, T lymphocyte subsets (CD 4 and CD 8 ), as well as interleukins (IL)-2, (IL-2, IL-6), and tumor necrosis factor-α were assayed to detect the immunoregulatory and anti-tumor effects after (1→3)-β-d-glucan intragastrical administration. (1→3)-β-d-Glucan was shown to significantly potentiate the mouse immune responses by, among other effects, decreasing the ratio of CD 4 to CD 8 . The expression levels of IL-2, IL-6, and TNF-α were also significantly increased by (1→3)-β-d-glucan. These results suggest that (1→3)-β-d-glucan enhances the host's immune function during the tumor inhibition process. S180 tumor cells treated with (1→3)-β-d-glucan also exhibited significant apoptotic characteristics. (1→3)-β-d-glucan increased the ratio of Bax to Bcl-2 at the translation level by up-regulating Bax expression and down-regulating Bcl-2 expression, resulting in the initiation of cell apoptosis in S180 tumor-bearing mice. Taken together, these results indicate that the anti-tumor effects exerted by (1→3)-β-d-glucan may be attributed to the polysaccharide's immunostimulating properties and apoptosis
Woo, Koan Sik; Kim, Hyun-Joo; Lee, Ji Hae; Ko, Jee Yeon; Lee, Byong Won; Lee, Byoung Kyu
2018-03-01
This study aimed to compare the phenolic compounds and antioxidant activity of barley at different proportion (0, 5, 10, 15, and 20%), and using different cooking methods. The grains used in this experiment are barley ( Hordeum vulgare L. cv. Huinchalssal) and Samkwang rice. The rice-barley mixture was cooked using general and high pressure cooking methods with and without fermented alcohol. The quality characteristics such as water binding capacity, pasting characteristic, water solubility, and swelling power of different proportions of barley were evaluated. The antioxidant characteristics evaluated are total polyphenol, flavonoid contents, 2,2-diphenyl-1-picrylhydrazyl (DPPH), and 2,2-azinobis(3-ethylbenothiazoline-6-sulphonic acid) (ABTS) diammonium salt radical scavenging activities. Results showed that peak [195.0~184.0 rapid visco units (RVU)], trough (130.0~116.2 RVU), final (252.0~221.8 RVU), and setback viscosity (57.0~37.5 RVU) decreased correspondingly with the increase in the amount of barley. Water binding capacity (187.31~136.01%) and swelling power (162.37~127.58%) decreased as amounts of barley increases, however the water solubility (5.35~6.89%) increased. Moreover, the total polyphenol and flavonoid, and the DPPH and ABTS radical scavenging activities contents increased as the amounts of barley in the mixture increases. This study generally aims to provide useful information for the manufacturing of processed products.
Lysine metabolism in antisense C-hordein barley grains
DEFF Research Database (Denmark)
Schmidt, Daiana; Rizzi, Vanessa; Gaziola, Salete A
2015-01-01
The grain proteins of barley are deficient in lysine and threonine due to their low concentrations in the major storage protein class, the hordeins, especially in the C-hordein subgroup. Previously produced antisense C-hordein transgenic barley lines have an improved amino acid composition, with ...
Fusarium infection and trichothecenes in barley and its comparison with wheat
Janssen, Esmee; Liu, C.; Fels, van der H.J.
2018-01-01
Barley is a small-grain cereal that can be infected by Fusarium spp. resulting in reduced quality and safety of harvested barley (products). Barley and other small-grain cereals are commonly studied together for Fusarium infection and related mycotoxin contamination, since the infection and its
Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen
2015-09-01
Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.
Simmons, Thomas J; Fry, Stephen C
2017-03-08
Mixed-linkage glucan∶xyloglucan endotransglucosylase (MXE) is one of the three activities of the recently characterised hetero-trans-β-glucanase (HTG), which among land plants is known only from Equisetum species. The biochemical details of the MXE reaction were incompletely understood - details that would promote understanding of MXE's role in vivo and enable its full technological exploitation. We investigated HTG's site of attack on one of its donor substrates, mixed-linkage (1→3),(1→4)-β-d-glucan (MLG), with radioactive oligosaccharides of xyloglucan as the acceptor substrate. Comparing three different MLG preparations, we showed that the enzyme favours those with a high content of cellotetraose blocks. The reaction products were analysed by enzymic digestion, thin-layer chromatography (TLC), high-pressure liquid chromatography (HPLC) and gel-permeation chromatography (GPC). Equisetum HTG consistently cleaved the MLG at the third consecutive β-(1→4)-bond following (towards the reducing terminus) a β-(1→3)-bond. It then formed a β-(1→4)-bond between the MLG and the non-reducing terminal glucose residue of the xyloglucan oligosaccharide, consistent with its xyloglucan endotransglucosylase/hydrolase subfamily membership. Using size-homogeneous barley MLG as the donor substrate, we showed that HTG does not favour any particular region of the MLG chain relative to the polysaccharide's reducing and non-reducing termini; rather, it selects its target cellotetraosyl unit stochastically along the MLG molecule. This work improves our understanding of how enzymes can exhibit promiscuous substrate specificities and provides the foundations to explore strategies for engineering novel substrate specificities into transglycanases. © 2017 The Author(s).
Structure and Composition of Protein Bodies from Wild-Type and High-Lysine Barley Endosperm
DEFF Research Database (Denmark)
Ingversen, J.
1975-01-01
Protein bodies were isolated from 13 and 28 day old endosperms of barley mutant 1508 and its wild type, Bomi barley. The fine structure of the isolated protein bodies was determined by electron microscopy, and the proteins present in the preparations characterized by amino-acid analysis and SDS......-polyacrylamidegel electrophoresis. Sections through pellets of isolated protein bodies from both the mutant and the wild type revealed protein body structures corresponding with those observed in sections through the intact starchy endosperms. The majority of the wild-type protein bodies was homogeneous spheres accompanied...... that the wild-type protein bodies contained large amounts of prolamines (the storage protein group which is soluble in 55 % isopropanol) and some glutelins (the storage proteins soluble in dilute alkali), whereas the mutant protein bodies have glutelin as the major component and little prolamines...
SPRING BARLEY BREEDING FOR MALTING QUALITY
Alžbeta Žofajová; Jozef Gubiš; Ľudovít Sleziak; Klára Križanová; Vratislav Psota
2010-01-01
The aim of this contribution is to illustrate the results of spring barley breeding for malting quality and point out an important position of variety in production of qualitative raw material for maltinq and beer industry as well as the system of evaluation the qualitative parameters of breeding materials and adaptation of barley breeding programms to the new requirements of malting and beer industry. As an example of the results obtained most recently descripti...
7 CFR 801.3 - Tolerances for barley pearlers.
2010-01-01
... 7 Agriculture 7 2010-01-01 2010-01-01 false Tolerances for barley pearlers. 801.3 Section 801.3 Agriculture Regulations of the Department of Agriculture (Continued) GRAIN INSPECTION, PACKERS AND STOCKYARD... FOR GRAIN INSPECTION EQUIPMENT § 801.3 Tolerances for barley pearlers. The maintenance tolerances for...
Films based on oxidized starch and cellulose from barley.
El Halal, Shanise Lisie Mello; Colussi, Rosana; Deon, Vinícius Gonçalves; Pinto, Vânia Zanella; Villanova, Franciene Almeida; Carreño, Neftali Lenin Villarreal; Dias, Alvaro Renato Guerra; Zavareze, Elessandra da Rosa
2015-11-20
Starch and cellulose fibers were isolated from grains and the husk from barley, respectively. Biodegradable films of native starch or oxidized starches and glycerol with different concentrations of cellulose fibers (0%, 10% and 20%) were prepared. The films were characterized by morphological, mechanical, barrier, and thermal properties. Cellulose fibers isolated from the barley husk were obtained with 75% purity and high crystallinity. The morphology of the films of the oxidized starches, regardless of the fiber addition, was more homogeneous as compared to the film of the native starch. The addition of cellulose fibers in the films increased the tensile strength and decreased elongation. The water vapor permeability of the film of oxidized starch with 20% of cellulose fibers was lower than the without fibers. However the films with cellulose fibers had the highest decomposition with the initial temperature and thermal stability. The oxidized starch and cellulose fibers from barley have a good potential for use in packaging. The addition of cellulose fibers in starch films can contribute to the development of films more resistant that can be applied in food systems to maintain its integrity. Copyright © 2015 Elsevier Ltd. All rights reserved.
Schnurbusch, Thorsten; Hayes, Julie; Hrmova, Maria; Baumann, Ute; Ramesh, Sunita A; Tyerman, Stephen D; Langridge, Peter; Sutton, Tim
2010-08-01
Boron (B) toxicity is a significant limitation to cereal crop production in a number of regions worldwide. Here we describe the cloning of a gene from barley (Hordeum vulgare), underlying the chromosome 6H B toxicity tolerance quantitative trait locus. It is the second B toxicity tolerance gene identified in barley. Previously, we identified the gene Bot1 that functions as an efflux transporter in B toxicity-tolerant barley to move B out of the plant. The gene identified in this work encodes HvNIP2;1, an aquaporin from the nodulin-26-like intrinsic protein (NIP) subfamily that was recently described as a silicon influx transporter in barley and rice (Oryza sativa). Here we show that a rice mutant for this gene also shows reduced B accumulation in leaf blades compared to wild type and that the mutant protein alters growth of yeast (Saccharomyces cerevisiae) under high B. HvNIP2;1 facilitates significant transport of B when expressed in Xenopus oocytes compared to controls and to another NIP (NOD26), and also in yeast plasma membranes that appear to have relatively high B permeability. We propose that tolerance to high soil B is mediated by reduced expression of HvNIP2;1 to limit B uptake, as well as by increased expression of Bot1 to remove B from roots and sensitive tissues. Together with Bot1, the multifunctional aquaporin HvNIP2;1 is an important determinant of B toxicity tolerance in barley.
Airborne fungal and bacterial components in PM1 dust from biofuel plants.
Madsen, Anne Mette; Schlünssen, Vivi; Olsen, Tina; Sigsgaard, Torben; Avci, Hediye
2009-10-01
Fungi grown in pure cultures produce DNA- or RNA-containing particles smaller than spore size ( 3)-beta-D-glucans. In the 29 PM(1) samples, cultivable fungi were found in six samples and with a median concentration below detection level. Using microscopy, fungal spores were identified in 22 samples. The components NAGase and (1 --> 3)-beta-D-glucans, which are mainly associated with fungi, were present in all PM(1) samples. Thermophilic actinomycetes were present in 23 of the 29 PM(1) samples [average = 739 colony-forming units (CFU) m(-3)]. Cultivable and 'total bacteria' were found in average concentrations of, respectively, 249 CFU m(-3) and 1.8 x 10(5) m(-3). DNA- and RNA-containing particles of different lengths were counted by microscopy and revealed a high concentration of particles with a length of 0.5-1.5 microm and only few particles >1.5 microm. The number of cultivable fungi and beta-glucan in the total dust correlated significantly with the number of DNA/RNA-containing particles with lengths of between 1.0 and 1.5 microm, with DNA/RNA-containing particles >1.5 microm, and with other fungal components in PM(1) dust. Airborne beta-glucan and NAGase were found in PM(1) samples where no cultivable fungi were present, and beta-glucan and NAGase were found in higher concentrations per fungal spore in PM(1) dust than in total dust. This indicates that fungal particles smaller than fungal spore size are present in the air at the plants. Furthermore, many bacteria, including actinomycetes, were present in PM(1) dust. Only 0.2% of the bacteria in PM(1) dust were cultivable.
PHYSIOLOGICAL AND AGROECOLOGICAL ASPECTS OF CADMIUM INTERACTIONS WITH BARLEY PLANTS: AN OVERVIEW
Directory of Open Access Journals (Sweden)
A VASSILEV
2003-07-01
Full Text Available This work is a review of author’s previous publications, unpublished results as well as available literature on barley responses to Cd contamination. The physiological backgrounds of the acute Cd toxicity in barley plants are briefly described. Some data characterizing the chronic Cd toxicity in barley have been also provided in relation to its possible use for seed production and Cd phytoextraction on Cd-contaminated agricultural soils. Information about the main physiological factors limiting growth of Cd-exposed barley plants and grain yield, seedling quality as well as Cd phytoextraction capacity of barley grown in Cd-contaminated soils is presented.
Characteristics of MHD stability of high beta plasmas in LHD
International Nuclear Information System (INIS)
Sato, M.; Nakajima, N.; Watanabe, K.Y.; Todo, Y.; Suzuki, Y.
2012-11-01
In order to understand characteristics of the MHD stability of high beta plasmas obtained in the LHD experiments, full MHD simulations have been performed for the first time. Since there is a magnetic hill in a plasma peripheral region, the ballooning modes extending into the plasma peripheral region with a chaotic magnetic field are destabilized. However, in the nonlinear phase, the core region comes under the in influence of the instabilities and the central pressure decreases. There is a tendency that modes are suppressed as the beta value and/or magnetic Reynolds number increase, which is consistent with a result that high beta plasmas enter the second stable region of the ideal ballooning modes as beta increases and remaining destabilized ballooning modes are considered to be resistive type. (author)
Osteocalcin protects pancreatic beta cell function and survival under high glucose conditions
Energy Technology Data Exchange (ETDEWEB)
Kover, Karen, E-mail: kkover@cmh.edu [Division of Endocrine/Diabetes, Children' s Mercy Hospital & Clinics, Kansas City, MO 64108 (United States); University of Missouri-Kansas City School of Medicine, Kansas City, MO 64108 (United States); Yan, Yun; Tong, Pei Ying; Watkins, Dara; Li, Xiaoyu [Division of Endocrine/Diabetes, Children' s Mercy Hospital & Clinics, Kansas City, MO 64108 (United States); University of Missouri-Kansas City School of Medicine, Kansas City, MO 64108 (United States); Tasch, James; Hager, Melissa [Kansas City University Medical Biosciences, Kansas City, MO (United States); Clements, Mark; Moore, Wayne V. [Division of Endocrine/Diabetes, Children' s Mercy Hospital & Clinics, Kansas City, MO 64108 (United States); University of Missouri-Kansas City School of Medicine, Kansas City, MO 64108 (United States)
2015-06-19
Diabetes is characterized by progressive beta cell dysfunction and loss due in part to oxidative stress that occurs from gluco/lipotoxicity. Treatments that directly protect beta cell function and survival in the diabetic milieu are of particular interest. A growing body of evidence suggests that osteocalcin, an abundant non-collagenous protein of bone, supports beta cell function and proliferation. Based on previous gene expression data by microarray, we hypothesized that osteocalcin protects beta cells from glucose-induced oxidative stress. To test our hypothesis we cultured isolated rat islets and INS-1E cells in the presence of normal, high, or high glucose ± osteocalcin for up to 72 h. Oxidative stress and viability/mitochondrial function were measured by H{sub 2}O{sub 2} assay and Alamar Blue assay, respectively. Caspase 3/7 activity was also measured as a marker of apoptosis. A functional test, glucose stimulated insulin release, was conducted and expression of genes/protein was measured by qRT-PCR/western blot/ELISA. Osteocalcin treatment significantly reduced high glucose-induced H{sub 2}O{sub 2} levels while maintaining viability/mitochondrial function. Osteocalcin also significantly improved glucose stimulated insulin secretion and insulin content in rat islets after 48 h of high glucose exposure compared to untreated islets. As expected sustained high glucose down-regulated gene/protein expression of INS1 and BCL2 while increasing TXNIP expression. Interestingly, osteocalcin treatment reversed the effects of high glucose on gene/protein expression. We conclude that osteocalcin can protect beta cells from the negative effects of glucose-induced oxidative stress, in part, by reducing TXNIP expression, thereby preserving beta cell function and survival. - Highlights: • Osteocalcin reduces glucose-induced oxidative stress in beta cells. • Osteocalcin preserves beta cell function and survival under stress conditions. • Osteocalcin reduces glucose
Osteocalcin protects pancreatic beta cell function and survival under high glucose conditions
International Nuclear Information System (INIS)
Kover, Karen; Yan, Yun; Tong, Pei Ying; Watkins, Dara; Li, Xiaoyu; Tasch, James; Hager, Melissa; Clements, Mark; Moore, Wayne V.
2015-01-01
Diabetes is characterized by progressive beta cell dysfunction and loss due in part to oxidative stress that occurs from gluco/lipotoxicity. Treatments that directly protect beta cell function and survival in the diabetic milieu are of particular interest. A growing body of evidence suggests that osteocalcin, an abundant non-collagenous protein of bone, supports beta cell function and proliferation. Based on previous gene expression data by microarray, we hypothesized that osteocalcin protects beta cells from glucose-induced oxidative stress. To test our hypothesis we cultured isolated rat islets and INS-1E cells in the presence of normal, high, or high glucose ± osteocalcin for up to 72 h. Oxidative stress and viability/mitochondrial function were measured by H 2 O 2 assay and Alamar Blue assay, respectively. Caspase 3/7 activity was also measured as a marker of apoptosis. A functional test, glucose stimulated insulin release, was conducted and expression of genes/protein was measured by qRT-PCR/western blot/ELISA. Osteocalcin treatment significantly reduced high glucose-induced H 2 O 2 levels while maintaining viability/mitochondrial function. Osteocalcin also significantly improved glucose stimulated insulin secretion and insulin content in rat islets after 48 h of high glucose exposure compared to untreated islets. As expected sustained high glucose down-regulated gene/protein expression of INS1 and BCL2 while increasing TXNIP expression. Interestingly, osteocalcin treatment reversed the effects of high glucose on gene/protein expression. We conclude that osteocalcin can protect beta cells from the negative effects of glucose-induced oxidative stress, in part, by reducing TXNIP expression, thereby preserving beta cell function and survival. - Highlights: • Osteocalcin reduces glucose-induced oxidative stress in beta cells. • Osteocalcin preserves beta cell function and survival under stress conditions. • Osteocalcin reduces glucose-induced TXNIP
Useful mutations in Iraqi black barley
International Nuclear Information System (INIS)
Ibrahim, I.F.
1989-01-01
Full text: Barley (Hordeum vulgare L.) is an important fodder crop in Iraq, with a cultivated area of about 1 392 375 ha and a total production of about 838500 t. The 2-row black barley ''LBB'' is the most desirable one in semi-arid zone in northern part of Iraq, because of its drought tolerance and high protein content. However, this cultivar is susceptible to powdery mildew, and lodges. Gamma rays and EMS were used to induce mutations in ''LBB'' and its hybrid with A rivat''. Nine mutants with improved lodging were selected during the first six generations. Five mutants INRC-BB-1, INRC-BB-3, INRC-BBR-4A, INRC-HB-552 and INRC-HB-553 were resistant to powdery mildew while 2 mutants INRC-BBH-1 and INRC-HBR-3 were moderately resistant. Two mutants INRC-BB-123 and INRC-HBR-3 were also resistant to drought under 350-400 mm rainfall. Three mutants INRC-BB-1, INRC-HBR-3 and INRC-HBR-88 exceeded their original variety in seed weight per spike and TKW. (author)
Spring Barley Yield Parameters after Lignite, Sodium Humate and Nitrogen Utilization
Directory of Open Access Journals (Sweden)
Kováčik Peter
2016-10-01
Full Text Available The existence of a small number of publications dealing with the impact of solid sodium humate and lignite on the quantity and quality of grown crops was the reason for establishing the field experiment. The objective of this experiment was to detect the impact of solid lignite and solid sodium humate on the quantity and quality of spring barley yield. These substances were applied into the soil either independently or along with nitrogen fertiliser. The next objective was to determine the impact of foliar application of sodium humate water solution applied either independently or along with nitrogen fertiliser on the quality and quantity of spring barley yield. The achieved results showed that the autumn application of solid lignite and the presowing application of solid sodium humate into the soil tended to decrease the yield of both grain and straw of spring barley, crude protein content in grain, proportion of the first-class grains and volume weight of grain, whereas the impact of humate was more negative. Lignite and sodium humate in the solid form should be used along with nitrogen fertiliser. The application of sodium humate in liquid form during the growth season of barley tended to increase the yield of both grain and straw. The joint application of nitrogen and liquid sodium humate during the growth season of barley increased the grain yield of barley significantly. A lower dose of nitrogen, applied during the growth season of barley (growth season BBCH 23, increased the grain yield of barley considerably more than a higher N dose, applied into the soil before barley sowing.
Molecular characterization of barley ( Hordeum vulgare L.) genome ...
African Journals Online (AJOL)
The present work aimed to select drought tolerant barley (Hordeum vulgare L.) cultivars through identification of stress genes responsible for drought tolerance. Several barley genotypes were tested for drought resistance using specific molecular markers, nine out of all the genotypes were chosen for this study; five out of ...
Foley, A E; Hristov, A N; Melgar, A; Ropp, J K; Etter, R P; Zaman, S; Hunt, C W; Huber, K; Price, W J
2006-11-01
The effect of type of grain (corn vs. barley) and amylopectin content of barley grain (normal vs. waxy) on ruminal fermentation, digestibility, and utilization of ruminal ammonia nitrogen for milk protein synthesis was studied in a replicated 3 x 3 Latin square design trial with 6 lactating dairy cows. The experimental treatments were (proportion of dietary dry matter): CORN, 40% corn grain, NBAR, 30% normal Baronesse barley:10% corn grain, and WBAR, 30% high-amylopectin (waxy) Baronesse barley:10% corn grain. All grains were steam-rolled and fed as part of a total mixed ration. The NBAR and WBAR diets resulted in increased ruminal ammonia concentrations compared with CORN (8.2, 7.4, and 5.6 mM, respectively), but other ruminal fermentation parameters were not affected. Ruminal digestibility of dietary nutrients and microbial protein synthesis in the rumen were also not affected by diet. Corn grain had greater in situ effective ruminal dry matter degradability (62.8%) than the barley grains (58.2 and 50.7%, respectively), and degradability of the normal barley starch was greater than that of the waxy barley (69.3 and 58.9%, respectively). A greater percentage of relative starch crystallinity was observed for the waxy compared with the normal barley grain. Total tract apparent digestibility of dry matter and organic matter were decreased by WBAR compared with CORN and NBAR. Total tract starch digestibility was greater and milk urea nitrogen content was lower for CORN compared with the 2 barley diets. In this study, the extent of processing of the grain component of the diet was most likely the factor that determined the diet responses. Minimal processing of barley grain (processing indexes of 79.2 to 87.9%) reduced its total tract digestibility of starch compared with steam-rolled corn (processing index of 58.8%). As a result of the increased ammonia concentration and reduced degradability of barley dry matter in the rumen, the utilization of ruminal ammonia
Directory of Open Access Journals (Sweden)
Ahmad M Alqudah
Full Text Available Heading time is a complex trait, and natural variation in photoperiod responses is a major factor controlling time to heading, adaptation and grain yield. In barley, previous heading time studies have been mainly conducted under field conditions to measure total days to heading. We followed a novel approach and studied the natural variation of time to heading in a world-wide spring barley collection (218 accessions, comprising of 95 photoperiod-sensitive (Ppd-H1 and 123 accessions with reduced photoperiod sensitivity (ppd-H1 to long-day (LD through dissecting pre-anthesis development into four major stages and sub-phases. The study was conducted under greenhouse (GH conditions (LD; 16/8 h; ∼20/∼16°C day/night. Genotyping was performed using a genome-wide high density 9K single nucleotide polymorphisms (SNPs chip which assayed 7842 SNPs. We used the barley physical map to identify candidate genes underlying genome-wide association scans (GWAS. GWAS for pre-anthesis stages/sub-phases in each photoperiod group provided great power for partitioning genetic effects on floral initiation and heading time. In addition to major genes known to regulate heading time under field conditions, several novel QTL with medium to high effects, including new QTL having major effects on developmental stages/sub-phases were found to be associated in this study. For example, highly associated SNPs tagged the physical regions around HvCO1 (barley CONSTANS1 and BFL (BARLEY FLORICAULA/LEAFY genes. Based upon our GWAS analysis, we propose a new genetic network model for each photoperiod group, which includes several newly identified genes, such as several HvCO-like genes, belonging to different heading time pathways in barley.
Fungal Distribution and Varieties Resistance to Kernel Discoloration in Korean Two-rowed Barley
Directory of Open Access Journals (Sweden)
Sang-Hyun Shin
2013-09-01
Full Text Available Barley kernel discoloration (KD leads to substantial loss in value through downgrading and discounting of malting barley. The objective of this research is to investigate fungal distribution and varieties resistance to KD in Korean two-rowed barley. Several fungal organisms including Alternaria spp., Fusarium spp., Aspergillus spp., Epicoccum spp. and Rhizopus spp. were isolated from Korean two-rowed barley representing KD. The symptoms of KD were brown and black discolorations of the lemma and palea. The most frequently detected fungal species was Alternaria spp. which exhibited 69.1% and 72.2% in 2011 and 2012, respectively. Epicoccum spp., Fusarium spp., and Aspergillus spp. were also detected. Fusarium spp., primary pathogen of barley head blight, were rarely occurred in the 2011 and their occurrence increased to 4.7% in 2012. Twenty cultivars of Korean two-rowed barely were evaluated to KD. The average percentage of KD was 8.0−36.0% in 2011 and 5.2−36.6% in 2012. Two cultivars (‘Sacheon 6’ and ‘Dajinbori’ showed KD of 6.2% to 8.8% and determined resistant, however ‘Samdobori’ and ‘Daeyeongbori’ demonstrating KD of 22.2−36.6% were highly susceptible. ‘Jinyangbori’, ‘Danwonbori’, ‘Sinhobori’ and ‘Kwangmaegbori’ showing KD of less than 15% were moderately resistant cultivar.
Detection of Ustilago nuda (Jensen Rostrup in winter barley seed
Directory of Open Access Journals (Sweden)
Ignjatov Maja
2011-01-01
Full Text Available Barley is one of the most important cereals grown in our agroecological conditions. The causal agent of loose smut on barley Ustilago nuda (Jensen Rostrup occurs frequently as varieties susceptible to this pathogen are present in the production. Disease symptoms are manifested on barley head (spike. Parasite is transmitted by seed (seedborne and stays in the embryo tissue of the infected kernel as dormant mycelium. Recommended method for detection of U. nuda is given by ISTA Rules (method 7-013. In tests, nine samples (weighing 120 g each of naturally infected barley seed (about 1000 seeds, depending on the absolute mass of seed were examined, observed and described using a Zeiss microscope with sub stage illumination with magnification range x 40 or higher. Mycelium of the fungus approximately 3 μ thick, golden brown in colour was detected and visible without a stain. The percentage of infected embryos in the examined samples of barley seeds ranged from 0.8% to 5.2%.
Long-term reconstitution of dry barley increased phosphorus digestibility in pigs
DEFF Research Database (Denmark)
Ton Nu, Mai Anh; Blaabjerg, Karoline; Poulsen, Hanne Damgaard
of reconstitution compared to dry stored barley on phosphorus (P) digestibility in pigs. Materials and Methods: Dry barley (13% moisture; phytate P, 1.7 g/kg DM) was rolled and stored directly or reconstituted with water to produce rolled barley with 35% moisture that was stored in air-tight conditions. After 49...
Barley fibre and wet distillers' solubles in the diet of growing cattle
Directory of Open Access Journals (Sweden)
T. ROOT
2008-12-01
Full Text Available Twenty-eight bulls were used in a 3 × 2 factorial design to study the effects of two by-products from the integrated starch-ethanol process, barley fibre and distillers' solubles, as supplements for grass silage. The animals were divided into five blocks and slaughtered when the average live weight (LW of each block reached 500 kg. The three energy supplements were barley (B, a mixture (1:1 on a dry matter (DM basis of barley and barley fibre (BF, and barley fibre (F, fed without (DS- or with (DS+ wet distillers' solubles (200 g kg-1 concentrate on DM basis. Concentrates were given at the rate of 95 g DM kg-1 LW0.6. Including barley fibre in the diet did not affect feed intake, but distillers' solubles tended to increase both silage and total DM intakes as well as amino acids absorbed in the intestine and energy intake. The protein balance in the rumen increased with the inclusion of barley fibre (P
Oligosaccharide and Substrate Binding in the Starch Debranching Enzyme Barley Limit Dextrinase
DEFF Research Database (Denmark)
Møller, Marie Sofie; Windahl, Michael Skovbo; Sim, Lyann
2015-01-01
Complete hydrolytic degradation of starch requires hydrolysis of both the α-1,4- and α-1,6-glucosidic bonds in amylopectin. Limit dextrinase (LD) is the only endogenous barley enzyme capable of hydrolyzing the α-1,6-glucosidic bond during seed germination, and impaired LD activity inevitably...... reduces the maltose and glucose yields from starch degradation. Crystal structures of barley LD and active-site mutants with natural substrates, products and substrate analogues were sought to better understand the facets of LD-substrate interactions that αconfine high activity of LD to branched...... starch synthesis....
Molecular characterization of barley 3H semi-dwarf genes.
Directory of Open Access Journals (Sweden)
Haobing Li
Full Text Available The barley chromosome 3H accommodates many semi-dwarfing genes. To characterize these genes, the two-rowed semi-dwarf Chinese barley landrace 'TX9425' was crossed with the Australian barley variety 'Franklin' to generate a doubled haploid (DH population, and major QTLs controlling plant height have been identified in our previous study. The major QTL derived from 'TX9425' was targeted to investigate the allelism of the semi-dwarf gene uzu in barley. Twelve sets of near-isogenic lines and a large NILF2 fine mapping population segregating only for the dwarfing gene from 'TX9425' were developed. The semi-dwarfing gene in 'TX9425' was located within a 2.8 cM region close to the centromere on chromosome 3H by fine mapping. Molecular cloning and sequence analyses showed that the 'TX9425'-derived allele contained a single nucleotide substitution from A to G at position 2612 of the HvBRI1 gene. This was apparently the same mutation as that reported in six-rowed uzu barley. Markers co-segregating with the QTL were developed from the sequence of the HvBRI1 gene and were validated in the 'TX9425'/'Franklin' DH population. The other major dwarfing QTL derived from the Franklin variety was distally located on chromosome 3HL and co-segregated with the sdw1 diagnostic marker hv20ox2. A third dwarfing gene, expressed only in winter-sown trials, was identified and located on chromosome 3HS. The effects and interactions of these dwarfing genes under different growing conditions are discussed. These results improve our understanding of the genetic mechanisms controlling semi-dwarf stature in barley and provide diagnostic markers for the selection of semi-dwarfness in barley breeding programs.
Directory of Open Access Journals (Sweden)
Ernesto R. Soto
2016-01-01
Full Text Available Glucan particles (GPs are hollow, porous 3–5 μm microspheres derived from the cell walls of Baker’s yeast (Saccharomyces cerevisiae. The 1,3-β-glucan outer shell provides for receptor-mediated uptake by phagocytic cells expressing β-glucan receptors. GPs have been used for macrophage-targeted delivery of a wide range of payloads (DNA, siRNA, protein, small molecules, and nanoparticles encapsulated inside the hollow GPs or bound to the surface of chemically derivatized GPs. Gallium nanoparticles have been proposed as an inhibitory agent against HIV infection. Here, macrophage targeting of gallium using GPs provides for more efficient delivery of gallium and inhibition of HIV infection in macrophages compared to free gallium nanoparticles.
Measurement of gross beta radioactivity in high-level liquid waste
International Nuclear Information System (INIS)
Lu Feng; Lin Cansheng; Zhang Xianzi; Chen Guoan; Zhang Chonghai
1992-01-01
Using beta plastic scintillation counter of low level background, gross beta radioactivity of twelve samples for high-level liquid waste is determined directly. Beta efficiency curves of plastic scintillation counter for four mass thickness are calibrated in advance. Determining gross beta radioactivity, gross efficiency of the scintillation counter for various energy beta ray is calculated via weighted mean method with the ratio of radioactivity for each nuclide. The ratio of radioactivity for nuclides which have gamma disintegration is determined in terms of the radioactivity measured by gamma spectrometer. The ratio of the radioactivity for 90 Sr which has purity beta disintegration is calculated in terms of half life time approximation. The ratio of the radioactivity for 147 Pm which also has purity disintegration is calculated by means of apparent cooling-time approximation. The uncertainty of results for the present work is about +-15%
Gangoiti, Joana; Pijning, Tjaard; Dijkhuizen, Lubbert
Transglucosidases belonging to the glycoside hydrolase (GH) family 70 are promising enzymatic tools for the synthesis of α-glucans with defined structures from renewable sucrose and starch substrates. Depending on the GH70 enzyme specificity, α-glucans with different structures and physicochemical
Directory of Open Access Journals (Sweden)
Wobus Ulrich
2009-01-01
Full Text Available Abstract Background Barley (Hordeum vulgare L. seed development is a highly regulated process with fine-tuned interaction of various tissues controlling distinct physiological events during prestorage, storage and dessication phase. As potential regulators involved within this process we studied 172 transcription factors and 204 kinases for their expression behaviour and anchored a subset of them to the barley linkage map to promote marker-assisted studies on barley grains. Results By a hierachical clustering of the expression profiles of 376 potential regulatory genes expressed in 37 different tissues, we found 50 regulators preferentially expressed in one of the three grain tissue fractions pericarp, endosperm and embryo during seed development. In addition, 27 regulators found to be expressed during both seed development and germination and 32 additional regulators are characteristically expressed in multiple tissues undergoing cell differentiation events during barley plant ontogeny. Another 96 regulators were, beside in the developing seed, ubiquitously expressed among all tissues of germinating seedlings as well as in reproductive tissues. SNP-marker development for those regulators resulted in anchoring 61 markers on the genetic linkage map of barley and the chromosomal assignment of another 12 loci by using wheat-barley addition lines. The SNP frequency ranged from 0.5 to 1.0 SNP/kb in the parents of the various mapping populations and was 2.3 SNP/kb over all eight lines tested. Exploration of macrosynteny to rice revealed that the chromosomal orders of the mapped putative regulatory factors were predominantly conserved during evolution. Conclusion We identified expression patterns of major transcription factors and signaling related genes expressed during barley ontogeny and further assigned possible functions based on likely orthologs functionally well characterized in model plant species. The combined linkage map and reference
Effects of Net Blotch ( Pyrenophora teres ) on Malt Barley Yield and ...
African Journals Online (AJOL)
Barley (Hordeum vulgare L.) production is constrained by diseases such as net blotch caused by Pyrenophora teres Drechsl. The objectives of this study were to assess the effects of net blotch disease on malt barley yield and grain quality under natural infection. Four malt barley varieties (Beka, HB 120, HB 52 and Holker), ...
Directory of Open Access Journals (Sweden)
Alfonso Soto-Sánchez
2015-09-01
Full Text Available Barley (Hordeum vulgare L., and its derivatives, ranks fourth in cereal production worldwide, and the Pleurotus species are among the most efficient types of lignocellulolytic white-rot fungi. The objective of this research study was to evaluate the degradation of barley straw and barley rootless with an inoculum of Pleurotus to improve their nutritional availability as a food source for ruminants. Two experiments were conducted; the first was to determine the effects of inoculation of Pleurotus sapidus (Schulzer Sacc. (PS in barley straw (BS, barley rootless (BR, and a 75% BS and 25% BR mixture (M. The second experiment was to evaluate the same substrates in vitro ruminal fermentation. Barley rootless had better organic matter (OM degradability than BS after 24 h incubation with PS. The protein content in BR was higher than in BS (P < 0.01. Enzyme activities had the highest concentration from the start of fermentation, and in vitro dry matter (DM degradability in BS and BR increased after 8 and 24 d fermentation, respectively (P < 0.05. Propionic acid concentration was enhanced after 16 d fermentation in BR (P < 0.5. The use of BS combined with BR exhibited better fermentation; this result provides relevant information for integrating BR with other substrates and improving the use of straw, which can be more nutritionally available for feeding ruminants.
Molecular phylogeography of domesticated barley traces expansion of agriculture in the Old World.
Saisho, Daisuke; Purugganan, Michael D
2007-11-01
Barley (Hordeum vulgare ssp. vulgare) was first cultivated 10,500 years ago in the Fertile Crescent and is one of the founder crops of Eurasian agriculture. Phylogeographic analysis of five nuclear loci and morphological assessment of two traits in >250 domesticated barley accessions reveal that landraces found in South and East Asia are genetically distinct from those in Europe and North Africa. A Bayesian population structure assessment method indicates that barley accessions are subdivided into six clusters and that barley landraces from 10 different geographical regions of Eurasia and North Africa show distinct patterns of distribution across these clusters. Using haplotype frequency data, it appears that the Europe/North Africa landraces are most similar to the Near East population (F ST = 0.15) as well as to wild barley (F ST = 0.11) and are strongly differentiated from all other Asian populations (F ST = 0.34-0.74). A neighbor-joining analysis using these F ST estimates also supports a division between European, North African, and Near East barley types from more easterly Asian accessions. There is also differentiation in the presence of a naked caryopsis and spikelet row number between eastern and western barley accessions. The data support the differential migration of barley from two domestication events that led to the origin of barley--one in the Fertile Crescent and another farther east, possibly at the eastern edge of the Iranian Plateau--with European and North African barley largely originating from the former and much of Asian barley arising from the latter. This suggests that cultural diffusion or independent innovation is responsible for the expansion of agriculture to areas of South and East Asia during the Neolithic revolution.
DEFF Research Database (Denmark)
Shetty, Radhakrishna; Zhuang, Shiwen; Olsen, Rasmus Lyngsø
2017-01-01
Barley sorting is an important step for selecting grain of required quality for malting prior to brewing. However, brewing with unmalted barley with added enzymes has been thoroughly proven, raising the question of whether traditional sorting for high quality malting-barley is still necessary. To...
DEFF Research Database (Denmark)
Kandra, L.; Abou Hachem, Maher; Gyemant, G.
2006-01-01
Subsite affinity maps of long substrate binding clefts in barley alpha-amylases, obtained using a series of maltooligosaccharides of degree of polymerization of 3-12, revealed unfavorable binding energies at the internal subsites -3 and -5 and at subsites -8 and +3/+4 defining these subsites...... as binding barriers. Barley a-amylase I mutants Y105A and T212Y at subsite -6 and +4 resulted in release or anchoring of bound substrate, thus modifying the affinities of other high-affinity subsites (-2 and +2) and barriers. The double mutant Y105A-T212Y displayed a hybrid subsite affinity profile......, converting barriers to binding areas. These findings highlight the dynamic binding energy distribution and the versatility of long maltooligosaccharide derivatives in mapping extended binding clefts in a-amylases....
Directory of Open Access Journals (Sweden)
David O. Yawson
2017-10-01
Full Text Available Currently, the UK has a high self-sufficiency rate in barley production. This paper assessed the effects of projected climate and land use changes on feed barley production and, consequently, on meat supply in the UK from the 2030s to the 2050s. Total barley production under projected land use and climate changes ranged from 4.6 million tons in the 2030s to 9.0 million tons in the 2050s. From these, the projected feed barley supply ranged from approximately 2.3 to 4.6 million tons from the 2030s to the 2050s, respectively. The results indicate that while UK spring barley production will thrive under, and benefit from climate change, total land area allocated to barley production will ultimately determine self-sufficiency. Without expansion in the area of land and/or further significant increases in yields, the UK may face large deficits in domestic feed barley production and, for that matter, meat supply in the future. Hence, agricultural and food security policy needs to consider, principally, the effect of agricultural land use change on key crops, such as barley. Even though the UK can import feed barley or meat to address the deficits observed in this study, the question that needs to be addressed is where all that import will come from.
Thao, Cao Phuong; Tien, Le Thi Thuy
2017-09-01
β - glucan is intracellular polysaccharide (IPS), extracted from Ganoderma lucidum mycelium that can enhance human immune respond. This study aimed to stimulate the production of β - glucan in G. lucidum mycelium through optimating the carbonhydrates and plant rowth regulators in submerged culture. The results showed that the stimulation or inhibition of IPS production as well as β - glucan biosynthesis could be adjusted depend on the type and concentration of carbonhydrates and plant growth regulators. The supplement of lactose 80 g/L and BA 1 mg/L in medium could cause the highest IPS production (644.478 mg/g DW) and β - glucan increased up to 0.15/DW, that raised twice as much as without plant growth regulators. Futhermore, the optimation of other environmental elements were figured out were completely dark and 150 rpm on rotary shaker. This result could be used as premise for production of β - glucan in pilot.
Kopp, M; Rouster, J; Fritig, B; Darvill, A; Albersheim, P
1989-05-01
A glucan preparation obtained from the mycelial walls of the fungus Phytophthora megasperma f.sp. glycinea and known as an elicitor of phytoalexins in soybean was shown to be a very efficient inducer of resistance against viruses in tobacco. The glucan preparation protected against mechanically transmitted viral infections on the upper and lower leaf surfaces. Whether the glucan preparation was applied by injection, inoculation, or spraying, it protected the plants if applied before, at the same time as, or not later than 8 hours after virus inoculation. At concentrations ranging from 0.1 to 10 micrograms per milliliter, the glucan preparation induced protection ranging from 50 to 100% against both symptom production (necrotic local lesions, necrotic rings, or systemic mosaic) and virus accumulation in all Nicotiana-virus combinations examined. However, no significant protection against some of the same viruses was observed in bean or turnip. The host plants successfully protected included N. tabacum (9 different cultivars), N. sylvestris, N. glutinosa, and N. clevelandii. The viruses belonged to several taxonomic groups including tobacco mosaic virus, alfalfa mosaic virus, and tomato black ring virus. The glucan preparation did not act directly on the virus and did not interfere with virus disassembly; rather, it appeared to induce changes in the host plant that prevented infections from being initiated or recently established infections from enlarging. The induced resistance does not depend on induction of pathogenesis-related proteins, the phenylpropanoid pathway, lignin-like substances, or callose-like materials. We believe the induced resistance results from a mechanism that has yet to be described.
Directory of Open Access Journals (Sweden)
Wobus Ulrich
2011-01-01
Full Text Available Abstract Background The increasingly narrow genetic background characteristic of modern crop germplasm presents a challenge for the breeding of cultivars that require adaptation to the anticipated change in climate. Thus, high priority research aims at the identification of relevant allelic variation present both in the crop itself as well as in its progenitors. This study is based on the characterization of genetic variation in barley, with a view to enhancing its response to terminal drought stress. Results The expression patterns of drought regulated genes were monitored during plant ontogeny, mapped and the location of these genes was incorporated into a comprehensive barley SNP linkage map. Haplotypes within a set of 17 starch biosynthesis/degradation genes were defined, and a particularly high level of haplotype variation was uncovered in the genes encoding sucrose synthase (types I and II and starch synthase. The ability of a panel of 50 barley accessions to maintain grain starch content under terminal drought conditions was explored. Conclusion The linkage/expression map is an informative resource in the context of characterizing the response of barley to drought stress. The high level of haplotype variation among starch biosynthesis/degradation genes in the progenitors of cultivated barley shows that domestication and breeding have greatly eroded their allelic diversity in current elite cultivars. Prospective association analysis based on core drought-regulated genes may simplify the process of identifying favourable alleles, and help to understand the genetic basis of the response to terminal drought.
Chromosome aberration assays in barley (Hordeum vulgare)
Energy Technology Data Exchange (ETDEWEB)
Constantin, M J [Univ. of Tennessee, Knoxville; Nilan, R A
1982-01-01
Barley is an exceellent organism for studies of induced chromosome aberrations because of its few (2n = 2x = 14) relatively large chromosomes. Root-tip and shoot-tip cells have been used extensively for the study of ionizing radiation-induced chromosome aberrations. The general procedures are well known, the technology is simple and easy to learn, and the assays are relatively quick and inexpensive. Both root tips and shoot tips can be used for the study of chemical mutagens as well as ionizing radiations. Pollen mother cells are well suited for studying the effects of mutagens on meiotic chromosomes. The literature review for the Gene-Tox Program reported on 61 chemicals tested for their effects on barley chromosomes. Of these, 90% were reported to be either positive or positive dose-related, while 7% were negative and 3% were questionable. Barley assays based on chromosomal aberrations are useful to detect the clastogenic potency of chemicals under laboratory conditions. Indications are that the data from barley can be used to corroborate data obtained from other organisms. Among the classes of chemicals assayed were: alcohols and phenols; alkaloids; epoxides; alkyl sulfates; amides and sulfonamides; aromatic amines; aryl halides; aziridines; alkenes; carbamates; hydroazides; nitroaromatics; nitrosamides; nitrosources; phenothiazines; and polycyclic aromatic hydrocarbons.
Induced mutations for disease resistance in wheat and barley
International Nuclear Information System (INIS)
Hanis, M.; Hanisova, A.; Knytl, V.; Cerny, J.; Benc, S.
1977-01-01
The induction of mutations in cultivars of wheat (Triticum aestivum), barley (Hordeum vulgare), and field beans (Phaseolus vulgaris) has been part of the breeding programme at the Plant Breeding Station at Stupice since 1960. A total of 26 cultivars or selections of winter wheat, 4 cultivars or selections of spring wheat, 2 cultivars of field beans, and 43 selections of spring barley have been treated since 1960. A total of 140 mutant lines of wheat and 37 mutant lines of barley with improved disease resistance of a race-specific type have been obtained. Several mutation programme derived cultivars have been registered in Czechoslovakia (''Diamant'', ''Ametyst'', ''Favorit'', ''Hana'', ''Rapid'', and ''Atlas'' in barley, and ''Alfa'' in field beans), but none of them is a mutation for disease resistance. A series of mutants have been used in crossing programmes. Approaches to improve the efficiency of mutation breeding for disease resistance are suggested. (author)
Application of proteomics to investigate barley-Fusarium graminearum interaction
DEFF Research Database (Denmark)
Yang, Fen
in plants under low N and iv) proteomes of uninfected plants were similar under two N levels. Correlation of level of proteolysis induced by the fungus with measurement of Fusarium-damaged kernels, fungal biomass and mycotoxin levels indicated that FHB was more severe in barley with low N. In Chapter 3......, the molecular mechanisms of barley defense to Fusarium graminearum at the early infection stage were studied. Antibodies against barley β-amylases were shown to be the markers for infection at proteome level and for selection of the time for proteome analysis before extensive degradation caused by the fungus...... the disease. Due to the advantages of gel-based proteomics that differentially expressed proteins involved in the interaction can be directly detected by comparing protein profiles displayed on 2-D gels, it is used as a tool for studying the barley- Fusarium graminearum interaction form three different...
Directory of Open Access Journals (Sweden)
Huangai Li
2016-09-01
Full Text Available In this study, we investigated the barley yellow mosaic virus (BaYMV, genus Bymovirus factor(s responsible for breaking eIF4E-mediated recessive resistance genes (rym4/5/6 in barley. Genome mapping analysis using chimeric infectious cDNA clones between rym5-breaking (JT10 and rym5-non-breaking (JK05 isolates indicated that genome-linked viral protein (VPg is the determinant protein for breaking the rym5 resistance. Likewise, VPg is also responsible for overcoming the resistances of rym4 and rym6 alleles. Mutational analysis identified that amino acids Ser-118, Thr-120 and His-142 in JT10 VPg are the most critical residues for overcoming rym5 resistance in protoplasts. Moreover, the rym5-non-breaking JK05 could accumulate in the rym5 protoplasts when eIF4E derived from a susceptible barley cultivar was expressed from the viral genome. Thus, the compatibility between VPg and host eIF4E determines the ability of BaYMV to infect barley plants.
Guo, Lihong; McLean, Jeffrey S.; Lux, Renate; He, Xuesong; Shi, Wenyuan
2015-01-01
Streptococcus mutans is considered the principal cariogenic bacterium for dental caries. Despite the recognition of their importance for cariogenesis, the possible coordination among S. mutans’ main virulence factors, including glucan production, acidogenicity and aciduricity, has been less well studied. In the present study, using S. mutans strains with surface-displayed pH-sensitive pHluorin, we revealed sucrose availability- and Gtf functionality-dependent proton accumulation on S. mutans surface. Consistent with this, using a pH-sensitive dye, we demonstrated that both in vivo cell-produced and in vitro enzymatically synthesized insoluble glucans displayed proton-concentrating ability. Global transcriptomics revealed proton accumulation triggers the up-regulation of genes encoding functions involved in acid tolerance response in a glucan-dependent manner. Our data suggested that this proton enrichment around S. mutans could pre-condition the bacterium for acid-stress. Consistent with this hypothesis, we found S. mutans strains defective in glucan production were more acid sensitive. Our study revealed for the first time that insoluble glucans is likely an essential factor linking acidogenicity with aciduricity. The coordination of these key virulence factors could provide new insights on how S. mutans may have become a major cariogenic pathogen. PMID:26657939
Detection of Ustilago nuda (Jensen) Rostrup in winter barley seed
Ignjatov Maja; Petrović Dragana; Vujaković Milka; Taški-Ajduković Ksenija; Nikolić Zorica; Jovičić Dušica
2011-01-01
Barley is one of the most important cereals grown in our agroecological conditions. The causal agent of loose smut on barley Ustilago nuda (Jensen) Rostrup occurs frequently as varieties susceptible to this pathogen are present in the production. Disease symptoms are manifested on barley head (spike). Parasite is transmitted by seed (seedborne) and stays in the embryo tissue of the infected kernel as dormant mycelium. Recommended method for detection of U. nuda is given by ISTA Rules (method ...
Slight respiratory irritation but not inflammation in mice exposed to (1→3-β-D-glucan aerosols
Directory of Open Access Journals (Sweden)
A. Korpi
2003-01-01
Full Text Available Airway irritation effects after single and repeated inhalation exposures to aerosols of β-glucan (grifolan were investigated in mice. In addition, the effects on serum total immunoglobulin E (IgE production and histopathological inflammation in the respiratory tract were studied. The β-glucan aerosols provoked slight sensory irritation in the airways, but the response was not concentration dependent at the levels studied. Slight pulmonary irritation was observed after repeated exposures. No effect was found on the serum total IgE levels, and no signs of inflammation were seen in the airways 6 h after the final exposure. The results suggest that, irrespective of previous fungal sensitization of the animals, inhaled β-glucan may cause symptoms of respiratory tract irritation but without apparent inflammation. Respiratory tract irritation reported after inhalation of fungi may not be entirely attributed to β-glucan.
The Preparation of Glucan-Fe3O4 Magnetic Nanoparticles and Its In Vivo Distribution in Mice
Directory of Open Access Journals (Sweden)
Fengdan Jin
2014-01-01
Full Text Available The glucan-Fe3O4 magnetic nanoparticles were prepared by hydrothermal method. The mixture of FeCl2 and glucan was stirred vigorously for half an hour under low temperature (15°C. KOH of 1 mol/L was dropwise added, slowly, into the solution until the pH to 12. Immediately, KNO3 was added and the temperature was raised to 75°C for an hour. All the processes of Fe3O4 crystal particles generation were under nitrogen. An atomic absorption spectrometry quantitative analysis method was built to determine the in vivo distribution of the glucan-Fe3O4 magnetic nanoparticles in mice. The diameter of glucan-Fe3O4 magnetic nanoparticles was about 25 nm and they were up taken by the liver primarily after intravenous administration via the tail.
Directory of Open Access Journals (Sweden)
Ganal Martin W
2006-01-01
Full Text Available Abstract Background The goal of our study was a systematic survey of the molecular diversity in barley genetic resources. To this end 953 cultivated barley accessions originating from all inhabited continents except Australia were genotyped with 48 SSR markers. Molecular diversity was evaluated with routine statistics (allelic richness, gene diversity, allele frequency, heterozygosity and unique alleles, Principal Coordinate Analysis (PCoA, and analysis of genome-wide linkage disequilibrium. Results A genotyping database for 953 cultivated barley accessions profiled with 48 SSR markers was established. The PCoA revealed structuring of the barley population with regard to (i geographical regions and (ii agronomic traits. Geographic origin contributed most to the observed molecular diversity. Genome-wide linkage disequilibrium (LD was estimated as squared correlation of allele frequencies (r2. The values of LD for barley were comparable to other plant species (conifers, poplar, maize. The pattern of intrachromosomal LD with distances between the genomic loci ranging from 1 to 150 cM revealed that in barley LD extended up to distances as long as 50 cM with r2 > 0.05, or up to 10 cM with r2 > 0.2. Few loci mapping to different chromosomes showed significant LD with r2 > 0.05. The number of loci in significant LD as well as the pattern of LD were clearly dependent on the population structure. The LD in the homogenous group of 207 European 2-rowed spring barleys compared to the highly structured worldwide barley population was increased in the number of loci pairs with r2 > 0.05 and had higher values of r2, although the percentage of intrachromosomal loci pairs in significant LD based on P 0.80 provided higher LD values as compared to 19 low polymorphic loci (PIC Conclusion A global population of cultivated barley accessions was highly structured. Clustering highlighted the accessions with the same geographic origin, as well as accessions possessing
Combining unmalted barley and pearling gives good quality brewing
Donkelaar, van Laura H.G.; Hageman, Jos A.; Oguz, Serhat; Noordman, Tom R.; Boom, Remko M.; Goot, van der Atze Jan
2016-01-01
Brewing with unmalted barley can reduce the use of raw materials, thereby increasing the efficiency of the brewing process. However, unmalted barley contains several undesired components for brewing and has a low enzymatic activity. Pearling, an abrasive milling method, has been proposed as a
INVITRO DIGESTIBILITY OF PROTEIN FROM BARLEY AND OTHER CEREALS
DEFF Research Database (Denmark)
Buchmann, N. B.
1979-01-01
An in vitro method for measuring barley protein digestibility is presented. Samples were first incubated with pepsin in HCl; pancreatin was then added concomitantly with a bacteriostatic borate buffer. After TCA-precipitation, soluble nitrogen was measured. The digestion was unaffected...... by accumulated free amino acids. There were no free amino acids following pepsin treatment, but the essential ones were well liberated by pancreatin. Results for barley grown in the field or in pots, and for decortified barley fractions agreed with true digestibility values determined with rats. Of these samples...... digestibility depended on the type of enzyme and on the enzyme-to-substrate ratio....
Directory of Open Access Journals (Sweden)
Waugh Robbie
2010-12-01
Full Text Available Abstract Background Because of its size, allohexaploid nature and high repeat content, the wheat genome has always been perceived as too complex for efficient molecular studies. We recently constructed the first physical map of a wheat chromosome (3B. However gene mapping is still laborious in wheat because of high redundancy between the three homoeologous genomes. In contrast, in the closely related diploid species, barley, numerous gene-based markers have been developed. This study aims at combining the unique genomic resources developed in wheat and barley to decipher the organisation of gene space on wheat chromosome 3B. Results Three dimensional pools of the minimal tiling path of wheat chromosome 3B physical map were hybridised to a barley Agilent 15K expression microarray. This led to the fine mapping of 738 barley orthologous genes on wheat chromosome 3B. In addition, comparative analyses revealed that 68% of the genes identified were syntenic between the wheat chromosome 3B and barley chromosome 3 H and 59% between wheat chromosome 3B and rice chromosome 1, together with some wheat-specific rearrangements. Finally, it indicated an increasing gradient of gene density from the centromere to the telomeres positively correlated with the number of genes clustered in islands on wheat chromosome 3B. Conclusion Our study shows that novel structural genomics resources now available in wheat and barley can be combined efficiently to overcome specific problems of genetic anchoring of physical contigs in wheat and to perform high-resolution comparative analyses with rice for deciphering the organisation of the wheat gene space.
Diemer, Silja K.; Svensson, Birte; Babol, Linnea N.; Cockburn, Darrell; Grijpstra, Pieter; Dijkhuizen, Lubbert; Folkenberg, Ditte M.; Garrigues, Christel; Ipsen, Richard H.
Interactions between milk proteins and alpha-glucans at pH 4.0-5.5 were investigated by use of surface plasmon resonance. The alpha-glucans were synthesised with glucansucrase enzymes from Lactobacillus reuteri strains ATCC-55730, 180, ML1 and 121. Variations in the molecular characteristics of the
ALTERATIONS IN BARLEY PROTEOME UPON FUNGAL INFECTION AND TRICYCLAZOLE TREATMENT
Directory of Open Access Journals (Sweden)
Manoj Kumar a,b
2017-04-01
Full Text Available The barley proteome was investigated upon fungal infection and subsequent treatment by tricyclazole (TCZ, which is known to have applications in spot blotch disease management in barley.Significantly enhanced chlorophyll content was recorded in TCZ treated plants. The disease severity was significantly reduced after TCZ application in pathogen inoculated plants by reducing the appressoria formation at infection site in barley leaves. Two-dimensional gel electrophoresis (2-DE revealed the expression profile of proteins from (I control plants (healthy barley leaves; application with sterile water,(II plants after foliar application of TCZ (100 µg/ml, (III plants inoculated with B. sorokiniana and (IV plants treated with TCZ (72 h after B. sorokiniana inoculation. A set of 33 proteins expressed differentially after TCZ treatment. Out of this 19 had known functions, while others were unknown or hypothetical proteins. These differentially expressed proteins were related to redox-activity and gene expression, electron transfer,cell division and chromosome partitioning, cell envelop biogenesis, energy metabolism and conversion, respiration and pathogenesis related functions in the barley plants. The study provides a platform and documents the proteins that might be involved in disease management in barley following TCZ application. It is expected that the study will provide boost in understanding proteome regulation upon fungal infection and subsequent anti-fungal treatment and will attract researchers for further validation leading to better pest management.
Dominguez, Eddie; Zarnowski, Robert; Sanchez, Hiram; Covelli, Antonio S; Westler, William M; Azadi, Parastoo; Nett, Jeniel; Mitchell, Aaron P; Andes, David R
2018-04-03
Candida biofilms resist the effects of available antifungal therapies. Prior studies with Candida albicans biofilms show that an extracellular matrix mannan-glucan complex (MGCx) contributes to antifungal sequestration, leading to drug resistance. Here we implement biochemical, pharmacological, and genetic approaches to explore a similar mechanism of resistance for the three most common clinically encountered non- albicans Candida species (NAC). Our findings reveal that each Candida species biofilm synthesizes a mannan-glucan complex and that the antifungal-protective function of this complex is conserved. Structural similarities extended primarily to the polysaccharide backbone (α-1,6-mannan and β-1,6-glucan). Surprisingly, biochemical analysis uncovered stark differences in the branching side chains of the MGCx among the species. Consistent with the structural analysis, similarities in the genetic control of MGCx production for each Candida species also appeared limited to the synthesis of the polysaccharide backbone. Each species appears to employ a unique subset of modification enzymes for MGCx synthesis, likely accounting for the observed side chain diversity. Our results argue for the conservation of matrix function among Candida spp. While biogenesis is preserved at the level of the mannan-glucan complex backbone, divergence emerges for construction of branching side chains. Thus, the MGCx backbone represents an ideal drug target for effective pan- Candida species biofilm therapy. IMPORTANCE Candida species, the most common fungal pathogens, frequently grow as a biofilm. These adherent communities tolerate extremely high concentrations of antifungal agents, due in large part, to a protective extracellular matrix. The present studies define the structural, functional, and genetic similarities and differences in the biofilm matrix from the four most common Candida species. Each species synthesizes an extracellular mannan-glucan complex (MGCx) which
Variation in the agronomic and morphological traits in spring barley
Directory of Open Access Journals (Sweden)
N. Dyulgerov
2017-12-01
Full Text Available Abstract. The study was conducted to examine the variation in the agronomic and morphological traits in spring barley. For this purpose, 22 lines from the ICARDA High Input Barley Program for favorable environment and 3 check varieties (Rihane-03, VMorales and Veslets were tested in an alpha-lattice design with two replications at the Institute of Agriculture – Karnobat, Bulgaria in 2014 and 2015 growing season. The traits days to heading, plant height, number of tillers per plant, flag leaf length, flag leaf width, spike length, awn length, peduncle length, spikelet number per spike, grain number per spike, grain weight per spike, 1000 grains weight, grain yield, powdery mildew (Erysiphe graminis f. sp. hordei, net blotch (Pyrenophora teres f. teres and stripe rust (Puccinia striiformis f. sp. hordei infection were studied. Significant differences between lines for all studied traits were found. The number of fertile tillers per plant was significantly positively correlated with grain yield. Lines expressed higher grain yields, shorter stem, better tolerance to net blotch and stripe rust than Bulgarian check variety Veslets were identified. These genotypes can, therefore, be used as parents for the improvement of spring barley.
Kazemi-Bonchenari, M; Salem, A Z M; López, S
2017-08-01
Chemical and physical treatments of barley grain increase ruminally resistant starch and can improve the rumen fermentation pattern. The objective of the present study was to evaluate the effects of chemical (addition of citric acid, CA) and physical (grinding to two different particle sizes, PS) treatment of barley grain on performance, rumen fermentation, microbial protein yield in the rumen and selected blood metabolites in growing calves. In all, 28 male Holstein calves (172±5.1 kg initial BW) were used in a complete randomised design with a factorial arrangement of 2 barley grain particle sizes×2 levels of citric acid. The diets were as follows: (i) small PS (average 1200 µm) barley grain soaked in water (no CA addition); (ii) small PS barley grain soaked in a CA solution (adding 20 g CA/kg barley); (iii) large PS (average 2400 µm) barley grain soaked in water (no citric acid addition) and (iv) large PS barley grain soaked in a citric acid solution (adding 20 g CA/kg barley). Barley grain was then incorporated at 35% in a total mixed ration and fed to the calves for 11 weeks. Feeding small PS barley decreased feed intake (P=0.02) and average daily weight gain (P=0.01). The addition of CA to barley grain did not affect intake but increased weight gain (P0.05). However, the molar proportion of propionate was increased (P=0.03) when barley was more finely ground, and that of acetate was increased (P=0.04) when CA was added to barley grain. The ruminal concentration of ammonia nitrogen was increased (Pgrain with citric acid increased fibre digestibility of total mixed rations, attenuated the decrease in ruminal pH, and improved weight gain and feed efficiency in male Holstein growing calves fed a high-cereal diet (550 g cereal grain/kg diet).
Ihlow, Alexander; Schweizer, Patrick; Seiffert, Udo
2008-01-23
To find candidate genes that potentially influence the susceptibility or resistance of crop plants to powdery mildew fungi, an assay system based on transient-induced gene silencing (TIGS) as well as transient over-expression in single epidermal cells of barley has been developed. However, this system relies on quantitative microscopic analysis of the barley/powdery mildew interaction and will only become a high-throughput tool of phenomics upon automation of the most time-consuming steps. We have developed a high-throughput screening system based on a motorized microscope which evaluates the specimens fully automatically. A large-scale double-blind verification of the system showed an excellent agreement of manual and automated analysis and proved the system to work dependably. Furthermore, in a series of bombardment experiments an RNAi construct targeting the Mlo gene was included, which is expected to phenocopy resistance mediated by recessive loss-of-function alleles such as mlo5. In most cases, the automated analysis system recorded a shift towards resistance upon RNAi of Mlo, thus providing proof of concept for its usefulness in detecting gene-target effects. Besides saving labor and enabling a screening of thousands of candidate genes, this system offers continuous operation of expensive laboratory equipment and provides a less subjective analysis as well as a complete and enduring documentation of the experimental raw data in terms of digital images. In general, it proves the concept of enabling available microscope hardware to handle challenging screening tasks fully automatically.
Directory of Open Access Journals (Sweden)
Samir Jawhara
Full Text Available Yeasts and their glycan components can have a beneficial or adverse effect on intestinal inflammation. Previous research has shown that the presence of Saccharomyces cerevisiae var. boulardii (Sb reduces intestinal inflammation and colonization by Candida albicans. The aim of this study was to identify dietary yeasts, which have comparable effects to the anti-C. albicans and anti-inflammatory properties of Sb and to assess the capabilities of yeast cell wall components to modulate intestinal inflammation. Mice received a single oral challenge of C. albicans and were then given 1.5% dextran-sulphate-sodium (DSS for 2 weeks followed by a 3-day restitution period. S. cerevisiae strains (Sb, Sc1 to Sc4, as well as mannoprotein (MP and β-glucan crude fractions prepared from Sc2 and highly purified β-glucans prepared from C. albicans were used in this curative model, starting 3 days after C. albicans challenge. Mice were assessed for the clinical, histological and inflammatory responses related to DSS administration. Strain Sc1-1 gave the same level of protection against C. albicans as Sb when assessed by mortality, clinical scores, colonization levels, reduction of TNFα and increase in IL-10 transcription. When Sc1-1 was compared with the other S. cerevisiae strains, the preparation process had a strong influence on biological activity. Interestingly, some S. cerevisiae strains dramatically increased mortality and clinical scores. Strain Sc4 and MP fraction favoured C. albicans colonization and inflammation, whereas β-glucan fraction was protective against both. Surprisingly, purified β-glucans from C. albicans had the same protective effect. Thus, some yeasts appear to be strong modulators of intestinal inflammation. These effects are dependent on the strain, species, preparation process and cell wall fraction. It was striking that β-glucan fractions or pure β-glucans from C. albicans displayed the most potent anti-inflammatory effect in the
Fungal Distribution and Varieties Resistance to Kernel Discoloration in Korean Two-rowed Barley
Sang-Hyun Shin; Eun-Jo Seo; Jae-Seong Choi; JungKwan Lee; Jong-Chul Park; Chun-Sik Kang
2013-01-01
Barley kernel discoloration (KD) leads to substantial loss in value through downgrading and discounting of malting barley. The objective of this research is to investigate fungal distribution and varieties resistance to KD in Korean two-rowed barley. Several fungal organisms including Alternaria spp., Fusarium spp., Aspergillus spp., Epicoccum spp. and Rhizopus spp. were isolated from Korean two-rowed barley representing KD. The symptoms of KD were brown and black discolorations o...
Stability Limits of High-Beta Plasmas in DIII-D
International Nuclear Information System (INIS)
Strait, E.J.
2005-01-01
Stability at high beta is an important requirement for a compact, economically attractive fusion reactor. DIII-D experiments have shown that ideal magnetohydrodynamic (MHD) theory is an accurate predictor of the ultimate stability limits for tokamaks, and the Troyon scaling law has provided a useful approximation of ideal stability limits for discharges with 'conventional' profiles. However, variation of the discharge shape, pressure profile, and current density profile can lead to ideal MHD beta limits that differ significantly from simple Troyon scaling. The need for profiles consistent with steady-state operation places an important additional constraint on plasma stability. Nonideal effects can also be important and must be taken into account. For example, neoclassical tearing modes (NTMs), resulting from plasma resistivity and the nonlinear effects of the bootstrap current, can become unstable at beta values well below the ideal MHD limit. DIII-D experiments are now entering a new era of unprecedented control over plasma stability, including suppression of NTMs by localized current drive at the island location, and direct feedback stabilization of kink modes with a resistive wall. The continuing development of physics understanding and control tools holds the potential for stable, steady-state fusion plasmas at high beta
Phosphorylated alpha(1 leads to 4) glucans as substrate for potato starch-branching enzyme I
International Nuclear Information System (INIS)
Vikso-Nielsen, A.; Blennow, A.; Nielsen, T.H.; Moller, B.L.
1998-01-01
The possible involvement of potato (Solanum tuberosum L.) starch-branching enzyme I (PSBE-I) in the in vivo synthesis of phosphorylated amylopectin was investigated in in vitro experiments with isolated PSBE-I using 33P-labeled phosphorylated and 3H end-labeled nonphosphorylated alpha(1 leads to 4) glucans as the substrates. From these radiolabeled substrates PSBE-I was shown to catalyze the formation of dual-labeled (3H/33P) phosphorylated branched polysaccharides with an average degree of polymerization of 80 to 85. The relatively high molecular mass indicated that the product was the result of multiple chain-transfer reactions. The presence of alpha(1 leads to 6) branch points was documented by isoamylase treatment and anion-exchange chromatography. Although the initial steps of the in vivo mechanism responsible for phosphorylation of potato starch remains elusive, the present study demonstrates that the enzyme machinery available in potato has the ability to incorporate phosphorylated alpha(1 leads to 4) glucans into neutral polysaccharides in an interchain catalytic reaction. Potato mini tubers synthesized phosphorylated starch from exogenously supplied 33PO4(3-) and [U-14C]Glc at rates 4 times higher than those previously obtained using tubers from fully grown potato plants. This system was more reproducible compared with soil-grown tubers and was therefore used for preparation of 33P-labeled phosphorylated alpha(1 leads to 4) glucan chains
Zhang, Silai; Sato, Hiroki; Ichinose, Sakurako; Tanaka, Mizuki; Miyazawa, Ken; Yoshimi, Akira; Abe, Keietsu; Shintani, Takahiro; Gomi, Katsuya
2017-07-01
We have previously reported that α-amylase (Taka-amylase A, TAA) activity disappears in the later stage of submerged Aspergillus oryzae culture as a result of TAA adsorption onto the cell wall. Chitin, one of the major components of the cell wall, was identified as a potential factor that facilitates TAA adsorption. However, TAA adsorption only occurred in the later stage of cultivation, although chitin was assumed to be sufficiently abundant in the cell wall regardless of the submerged culture period. This suggested the presence a factor that inhibits TAA adsorption to the cell wall in the early stage of cultivation. In the current study, we identified α-1,3-glucan as a potential inhibiting factor for TAA adsorption. We constructed single, double, and triple disruption mutants of three α-1,3-glucan synthase genes (agsA, agsB, and agsC) in A. oryzae. Growth characteristics and cell wall component analysis of these disruption strains showed that AgsB plays a major role in α-1,3-glucan synthesis. In the ΔagsB mutant, TAA was adsorbed onto the mycelium in all stages of cultivation (early and later), and the ΔagsB mutant cell walls had a significantly high capacity for TAA adsorption. Moreover, the α-1,3-glucan content of the cell wall prepared from the wild-type strain in the later stage of cultivation was markedly reduced compared with that in the early stage. These results suggest that α-1,3-glucan is a potential inhibiting factor for TAA adsorption onto the cell wall component, chitin, in the early stage of submerged culture in A. oryzae. Copyright © 2017 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.
Symbiont-derived beta-1,3-glucanases in a social insect: mutualism beyond nutrition
Directory of Open Access Journals (Sweden)
Rebeca B Rosengaus
2014-11-01
Full Text Available Termites have had a long co-evolutionary history with prokaryotic and eukaryotic gut microbes. Historically, the role of these anaerobic obligate symbionts has been attributed to the nutritional welfare of the host. We provide evidence that protozoa (and/or their associated bacteria colonizing the hindgut of the dampwood termite Zootermopsis angusticollis, synthesize multiple functional beta-1,3-glucanases, enzymes known for breaking down beta-1,3-glucans, the main component of fungal cell walls. These enzymes, we propose, may help in both digestion of ingested fungal hyphae and protection against invasion by fungal pathogens. This research points to an additional novel role for the mutualistic hindgut microbial consortia of termites, an association that may extend beyond ligno-cellulolytic activity and nitrogen fixation to include a reduction in the risks of mycosis at both the individual- and colony-levels while nesting in and feeding on microbial-rich decayed wood.
DEFF Research Database (Denmark)
Diemer, Silja Kej; Svensson, Birte; Babol, Linnéa N.
2012-01-01
Interactions between milk proteins and α-glucans at pH 4.0–5.5 were investigated by use of surface plasmon resonance. The α-glucans were synthesised with glucansucrase enzymes from Lactobacillus reuteri strains ATCC-55730, 180, ML1 and 121. Variations in the molecular characteristics of the α...
Sbg1 Is a Novel Regulator for the Localization of the β-Glucan Synthase Bgs1 in Fission Yeast.
Directory of Open Access Journals (Sweden)
Reshma Davidson
Full Text Available Glucan synthases synthesize glucans, complex polysaccharides that are the major components in fungal cell walls and division septa. Studying regulation of glucan synthases is important as they are essential for fungal cell survival and thus popular targets for anti-fungal drugs. Linear 1,3-β-glucan is the main component of primary septum and is synthesized by the conserved β-glucan synthase Bgs1 in fission yeast cytokinesis. It is known that Rho1 GTPase regulates Bgs1 catalytic activity and the F-BAR protein Cdc15 plays a role in Bgs1 delivery to the plasma membrane. Here we characterize a novel protein Sbg1 that is present in a complex with Bgs1 and regulates its protein levels and localization. Sbg1 is essential for contractile-ring constriction and septum formation during cytokinesis. Sbg1 and Bgs1 physically interact and are interdependent for localization to the plasma membrane. Bgs1 is less stable and/or mis-targeted to vacuoles in sbg1 mutants. Moreover, Sbg1 plays an earlier and more important role in Bgs1 trafficking and localization than Cdc15. Together, our data reveal a new mode of regulation for the essential β-glucan synthase Bgs1 by the novel protein Sbg1.
Ingestible roasted barley for contrast-enhanced photoacoustic imaging in animal and human subjects.
Wang, Depeng; Lee, Dong Hyeun; Huang, Haoyuan; Vu, Tri; Lim, Rachel Su Ann; Nyayapathi, Nikhila; Chitgupi, Upendra; Liu, Maggie; Geng, Jumin; Xia, Jun; Lovell, Jonathan F
2018-08-01
Photoacoustic computed tomography (PACT) is an emerging imaging modality. While many contrast agents have been developed for PACT, these typically cannot immediately be used in humans due to the lengthy regulatory process. We screened two hundred types of ingestible foodstuff samples for photoacoustic contrast with 1064 nm pulse laser excitation, and identified roasted barley as a promising candidate. Twenty brands of roasted barley were further screened to identify the one with the strongest contrast, presumably based on complex chemical modifications incurred during the roasting process. Individual roasted barley particles could be detected through 3.5 cm of chicken-breast tissue and through the whole hand of healthy human volunteers. With PACT, but not ultrasound imaging, a single grain of roasted barley was detected in a field of hundreds of non-roasted particles. Upon oral administration, roasted barley enabled imaging of the gut and peristalsis in mice. Prepared roasted barley tea could be detected through 2.5 cm chicken breast tissue. When barley tea was administered to humans, photoacoustic imaging visualized swallowing dynamics in healthy volunteers. Thus, roasted barley represents an edible foodstuff that should be considered for photoacoustic contrast imaging of swallowing and gut processes, with immediate potential for clinical translation. Copyright © 2018 Elsevier Ltd. All rights reserved.
Boron-toxicity tolerance in barley arising from efflux transporter amplification.
Sutton, Tim; Baumann, Ute; Hayes, Julie; Collins, Nicholas C; Shi, Bu-Jun; Schnurbusch, Thorsten; Hay, Alison; Mayo, Gwenda; Pallotta, Margaret; Tester, Mark; Langridge, Peter
2007-11-30
Both limiting and toxic soil concentrations of the essential micronutrient boron represent major limitations to crop production worldwide. We identified Bot1, a BOR1 ortholog, as the gene responsible for the superior boron-toxicity tolerance of the Algerian barley landrace Sahara 3771 (Sahara). Bot1 was located at the tolerance locus by high-resolution mapping. Compared to intolerant genotypes, Sahara contains about four times as many Bot1 gene copies, produces substantially more Bot1 transcript, and encodes a Bot1 protein with a higher capacity to provide tolerance in yeast. Bot1 transcript levels identified in barley tissues are consistent with a role in limiting the net entry of boron into the root and in the disposal of boron from leaves via hydathode guttation.
Ben Halima, Nihed; Ben Saad, Rania; Khemakhem, Bassem; Fendri, Imen; Abdelkafi, Slim
2015-01-01
Oat is a promising plant for the future. It is edible and beneficial thanks to its nutritional, medicinal and pharmaceutical uses and, hence, recognized to be useful for a healthier world. The assessment of the vital functions of oat components is important for industries requiring correct health labelling, valid during the shelf life of any product. Oil, enzymes and other biomolecules of nutraceutic or dietary usage from oats would be valorized for this purpose. Although oats have a unique and versatile composition including antioxidants and biomolecules indispensable for health, they are undervalued in comparison with other staple cereals such as wheat, barley and rice. Furthermore, oats, apart from maize, comprise a high oil content used for a wide range of beneficial purposes. In addition, they contain beta glucan that has proven to be very helpful in reducing blood cholesterol levels and other cardiovascular diseases risks. In fact, there is diversity in the composition and content of the beneficial oat components within their genotypes and the different environmental conditions and, thus, oats are amenable to be enhanced by agronomic practices and genetic approaches.
The use of (1-3) β-glucan along with itraconazole against canine refractory sporotrichosis.
Guterres, Karina Affeldt; de Matos, Caroline Bohnen; Osório, Luiza Da Gama; Schuch, Isabel Duarte; Cleff, Marlete Brum
2014-04-01
Sporotrichosis, caused by the Sporothrix schenckii fungal complex, is a zoonotic mycosis distributed worldwide. Itraconazole is the treatment of choice for domestic animals although some fungal isolates have shown resistance to this drug. The objective of this study was to report, for the first time, the use of (1-3) β-glucan along with itraconazole in the treatment of a canine with sporotrichosis caused by Sporothrix brasiliensis. The animal had ulcerated and crusted lesions, especially on the nasal planum. Clinical samples were collected for a complete blood count, cytological analysis of the lesion, and fungal culture. Based on the results of the laboratory examination, and after the fungal culture, antibiotic therapy and treatment with itraconazole were initiated. Two additional fungal cultures were performed, which were positive. After 7 months of the animal treatment with itraconazole, the S. brasiliensis culture was still positive, so that the itraconazole was associated with (1-3) β-glucan. After four weekly applications of glucan, the complete elimination of the fungus was observed based on the fungal culture negative results. The results show, therefore, that (1-3) β-glucan with itraconazole promoted the case resolution, and it may be considered a promising alternative for the treatment of sporotrichosis in cases of resistance to conventional therapy.
Analytic, High-beta Solutions of the Helical Grad-Shafranov Equation
International Nuclear Information System (INIS)
Smith, D.R.; Reiman, A.H.
2004-01-01
We present analytic, high-beta (β ∼ O(1)), helical equilibrium solutions for a class of helical axis configurations having large helical aspect ratio, with the helix assumed to be tightly wound. The solutions develop a narrow boundary layer of strongly compressed flux, similar to that previously found in high beta tokamak equilibrium solutions. The boundary layer is associated with a strong localized current which prevents the equilibrium from having zero net current
DEFF Research Database (Denmark)
Rieder, Anne; Grimmer, Stine; Aachmann, Finn L.
2013-01-01
Even if carbohydrate preparations from plant/fungal sources have a high degree of purity, observed immune-stimulation may be caused by minute sample contaminations. Using the example of different β-glucans we present a range of analytical tools crucial for validation of possible immune-stimulator...
Barley Transformation Using Agrobacterium-Mediated Techniques
Harwood, Wendy A.; Bartlett, Joanne G.; Alves, Silvia C.; Perry, Matthew; Smedley, Mark A.; Leyland, Nicola; Snape, John W.
Methods for the transformation of barley using Agrobacterium-mediated techniques have been available for the past 10 years. Agrobacterium offers a number of advantages over biolistic-mediated techniques in terms of efficiency and the quality of the transformed plants produced. This chapter describes a simple system for the transformation of barley based on the infection of immature embryos with Agrobacterium tumefaciens followed by the selection of transgenic tissue on media containing the antibiotic hygromycin. The method can lead to the production of large numbers of fertile, independent transgenic lines. It is therefore ideal for studies of gene function in a cereal crop system.
Leaf rust of cultivated barley: pathology and control.
Park, Robert F; Golegaonkar, Prashant G; Derevnina, Lida; Sandhu, Karanjeet S; Karaoglu, Haydar; Elmansour, Huda M; Dracatos, Peter M; Singh, Davinder
2015-01-01
Leaf rust of barley is caused by the macrocyclic, heteroecious rust pathogen Puccinia hordei, with aecia reported from selected species of the genera Ornithogalum, Leopoldia, and Dipcadi, and uredinia and telia occurring on Hordeum vulgare, H. vulgare ssp. spontaneum, Hordeum bulbosum, and Hordeum murinum, on which distinct parasitic specialization occurs. Although Puccinia hordei is sporadic in its occurrence, it is probably the most common and widely distributed rust disease of barley. Leaf rust has increased in importance in recent decades in temperate barley-growing regions, presumably because of more intensive agricultural practices. Although total crop loss does not occur, under epidemic conditions yield reductions of up to 62% have been reported in susceptible varieties. Leaf rust is primarily controlled by the use of resistant cultivars, and, to date, 21 seedling resistance genes and two adult plant resistance (APR) genes have been identified. Virulence has been detected for most seedling resistance genes but is unknown for the APR genes Rph20 and Rph23. Other potentially new sources of APR have been reported, and additivity has been described for some of these resistances. Approaches to achieving durable resistance to leaf rust in barley are discussed.
Schnurbusch, Thorsten; Hayes, Julie; Hrmova, Maria; Baumann, Ute; Ramesh, Sunita A.; Tyerman, Stephen D.; Langridge, Peter; Sutton, Tim
2010-01-01
Boron (B) toxicity is a significant limitation to cereal crop production in a number of regions worldwide. Here we describe the cloning of a gene from barley (Hordeum vulgare), underlying the chromosome 6H B toxicity tolerance quantitative trait locus. It is the second B toxicity tolerance gene identified in barley. Previously, we identified the gene Bot1 that functions as an efflux transporter in B toxicity-tolerant barley to move B out of the plant. The gene identified in this work encodes HvNIP2;1, an aquaporin from the nodulin-26-like intrinsic protein (NIP) subfamily that was recently described as a silicon influx transporter in barley and rice (Oryza sativa). Here we show that a rice mutant for this gene also shows reduced B accumulation in leaf blades compared to wild type and that the mutant protein alters growth of yeast (Saccharomyces cerevisiae) under high B. HvNIP2;1 facilitates significant transport of B when expressed in Xenopus oocytes compared to controls and to another NIP (NOD26), and also in yeast plasma membranes that appear to have relatively high B permeability. We propose that tolerance to high soil B is mediated by reduced expression of HvNIP2;1 to limit B uptake, as well as by increased expression of Bot1 to remove B from roots and sensitive tissues. Together with Bot1, the multifunctional aquaporin HvNIP2;1 is an important determinant of B toxicity tolerance in barley. PMID:20581256
DEFF Research Database (Denmark)
Radova, A.; Sebela, M.; Galuszka, P.
2001-01-01
This paper reports the first purification method developed for the isolation of an homogeneous polyamine oxidase (PAO) from etiolated barley seedlings. The crude enzyme preparation was obtained after initial precipitation of the extract with protamine sulphate and ammonium sulphate. The enzyme...... was further confirmed by measuring the fluorescence spectra, Barley PAO is an acidic protein (pI 5.4) containing 3% of neutral sugars: its molecular mass determined by SDS-PAGE was 56 kDa, whilst gel permeation chromatography revealed the higher value of 76 kDa. The N-terminal amino acid sequence of barley...... PAO shows a high degree of similarity to that of maize PAO and to several other flavoprotein oxidases. The polyamines spermine and spermidine were the only two substrates of the enzyme with K-m values 4 x 10(-5) and 3 x 10(-5) M and pH optima of 5.0 and 6.0, respectively. Barley polyamine oxidase...
Harrison Hong; David Sraer
2012-01-01
We provide a model for why high beta assets are more prone to speculative overpricing than low beta ones. When investors disagree about the common factor of cash-flows, high beta assets are more sensitive to this macro-disagreement and experience a greater divergence-of-opinion about their payoffs. Short-sales constraints for some investors such as retail mutual funds result in high beta assets being over-priced. When aggregate disagreement is low, expected return increases with beta due to r...
Aggressiveness of powdery mildew on 'ml-o'- resistant barley
International Nuclear Information System (INIS)
Andersen, Lars
1990-01-01
The ml-o genes in barley are important sources in breeding for resistance against the barley powdery mildew fungus (Erysiphe graminis). The resistance mechanism is a rapid formation of a large callose containing cell wall apposition at the site of the pathogen's infection attempt. This reduces the chances of infection to almost nil in all epidermal cells, except in the small subsidiary cells, in which appositions are rarely formed. Small mildew colonies from infections in subsidiary cells may be seen on the otherwise resistant leaf. This is described by the infection type 0/(4). Mildew isolate HL 3 selected by SCHWARZBACH has increased aggressiveness. No ml-o-virulent isolates are known. However, ml-o-resistant varieties when grown extensively in Europe, will introduce field selection for mildew pathotypes with aggressiveness or virulence to ml-o resistance. Studies on increased aggressiveness require new methods. The material comprises two powdery mildew isolates: GE 3 without ml-o aggressiveness and the aggressive HL 3/5; and two near-isogenic barley lines in Carlsberg II: Riso 5678(R) with the recessive mutant resistance gene ml-o5 and Riso 5678(S) with the wild-type gene for susceptibility. Latent period and disease efficiency show no significant differences between the two isolates on the susceptible barley line (S) but the isolates differ from each other on the resistant barley line
Analysis of the levels of endotoxin and β-d-glucan in the synovial fluid of hemodialysis patients.
Shiota, E; Maekawa, M; Kono, T
2001-12-01
Abstract We analyzed the levels of endotoxin and β-d-glucan, which possibly induce cytokine production, in the synovial fluid of patients on long-term hemodialysis and compared the results to those in patients with osteoarthritis and rheumatoid arthritis. We studied 42 knees in 42 hemodialysis patients, 21 in 21 osteoarthritis patients, and 26 in 26 rheumatoid arthritis patients. The mean ages were 60.7, 63.2, and 59.7 years, respectively. The duration of hemodialysis in the long-term hemodialysis group averaged 14.0 years. The concentrations of endotoxin and β-d-glucan in the synovial fluid of these three groups were measured. The concentration of endotoxin was the same in the three groups. However, the concentration of β-d-glucan was significantly higher in long-term hemodialysis patients. This finding suggests that β-d-glucan may have some relation to the pathogenesis of the synovitis which exists in the hydrarthrosis of long-term hemodialysis patients.
Jiang, Qian-Tao; Liu, Tao; Ma, Jian; Wei, Yu-Ming; Lu, Zhen-Xiang; Lan, Xiu-Jin; Dai, Shou-Fen; Zheng, You-Liang
2011-10-01
The pre-mRNA processing (Prp1) gene encodes a spliceosomal protein. It was firstly identified in fission yeast and plays a regular role during spliceosome activation and cell cycle. Plant Prp1 genes have only been identified from rice, Sorghum and Arabidopsis thaliana. In this study, we reported the identification and isolation of a novel Prp1 gene from barley, and further explored its expressional pattern by using real-time quantitative RTPCR, promoter prediction and analysis of microarray data. The putative barley Prp1 protein has a similar primary structure features to those of other known Prp1 protein in this family. The results of amino acid comparison indicated that Prp1 protein of barley and other plant species has a highly conserved 30 termnal region while their 50 sequences greatly varied. The results of expressional analysis revealed that the expression level of barley Prp1 gene is always stable in different vegetative tissues, except it is up-regulated at the mid- and late stages of seed development or under the condition of cold stress. This kind of expressional pattern for barley Prp1 is also supported by our results of comparison of microarray data from barley, rice and Arabidopsis. For the molecular mechanism of its expressional pattern, we conclude that the expression of Prp1 gene may be up-regulated by the increase of pre-mRNAs and not be constitutive or ubiquitous.
DEFF Research Database (Denmark)
Bousset, L.; Hovmøller, M.S.; Caffier, V.
2002-01-01
Aerial populations of Blumeria graminis f.sp. hordei were studied in two French and two Danish regions from 1991 to 1999, at a time of year when only winter barley was present. A high frequency of genotypes not able to grow on the spring-sown crop of the previous growing season (denoted 'spring......-avirulent') was observed in most years and regions. This frequency increased with increasing proportion of winter barley; it was highest in France and decreased in general over the 8-year period. Most of the spring-avirulent genotypes possessed the V-a22 virulence gene, matching a resistance that has never been present...... of the pathogen population in this system, demonstrated that selection solely due to host resistance genes, i.e. without assuming any cost of virulence, might lead to such results as those observed. The changes in frequency of spring-avirulent genotypes and the frequency of unnecessary virulence genes may...
Effect of supplementation with barley and calcium hydroxide on intake of Mediterranean shrubs
Directory of Open Access Journals (Sweden)
Dragan Skobic
2011-04-01
Full Text Available Maquis plant communities are one of the most varied vegetation types in the Mediterranean region and an important habitat for wild and domestic herbivores. Although the majority of these shrubs are nutritious, the secondary compounds are main impediments that reduce their forage value. In five experiments we determined the effect of supplementing goats with calcium hydroxide plus barley, and barley alone on intake of five dominant shrubs (Quercus ilex, Erica multiflora, Arbutus unedo, Viburnum tinus and Pistacia lentiscus of the Mediterranean maquis community. The combination of calcium hydroxide plus barley and barley alone increased utilization of all five investigated Mediterranean shrubs; therewith that intake of Arbutus unedo and Viburnum tinus was not statistically significant. Supplemented goats with calcium hydroxide plus barley or barley alone could be effective in controlling secondary compounds-rich Mediterranean shrubs where their abundance threatens biodiversity. This control can be facilitated by browsing dominant Mediterranean shrubs, which has been shown to be effective in managing Mediterranean maquis density. Calcium hydroxide and barley (energy enhance use of secondary compounds-containing plants, which may increase production of alternate forages and create a more diverse mix of plant species in the Mediterranean maquis plant community.
Production of eicosapentaenoic acid by mortierella spp on barley spent grain
CSIR Research Space (South Africa)
Jacobs, A
2006-02-01
Full Text Available fermentation, on barley spent grain, a by-product of the brewing industry and a food- grade waste. The substrate has a high protein content and a high fat content (21-25% and 9- 10% respectively on a dry basis). The enzymes used by the fungi to produce ω-3...
Prevention of Aflatoxin B1-Induced DNA Breaks by β-D-Glucan
Directory of Open Access Journals (Sweden)
Eduardo Madrigal-Bujaidar
2015-06-01
Full Text Available Aflatoxins are a group of naturally-occurring carcinogens that are known to contaminate different human and animal foodstuffs. Aflatoxin B1 (AFB1 is the most genotoxic hepatocarcinogenic compound of all of the aflatoxins. In this report, we explore the capacity of β-D-glucan (Glu to reduce the DNA damage induced by AFB1 in mouse hepatocytes. For this purpose, we applied the comet assay to groups of animals that were first administered Glu in three doses (100, 400 and 700 mg/kg bw, respectively and, 20 min later, 1.0 mg/kg of AFB1. Liver cells were obtained at 4, 10 and 16 h after the chemical administration and examined. The results showed no protection of the damage induced by AFB1 with the low dose of the polysaccharide, but they did reveal antigenotoxic activity exerted by the two high doses. In addition, we induced a co-crystallization between both compounds, determined their fusion points and analyzed the molecules by UV spectroscopy. The data suggested the formation of a supramolecular complex between AFB1 and β-D-glucan.
Barley seed proteomics from spots to structures
DEFF Research Database (Denmark)
Finnie, Christine; Svensson, Birte
2009-01-01
forms on 2D-gels. Specific protein families, including peroxidases and alpha-amylases have been subjected to in-depth analysis resulting in characterisation of different isozymes, post-translational. modifications and processing. A functional proteomics study focusing on the seed thioredoxin system has...... with information from rice and other cereals facilitate identification of barley proteins. Several hundred barley seed proteins are identified and lower abundance proteins including membrane proteins are now being analysed. In the present review we focus on variation in protein profiles of seed tissues during...
Variation in shoot tolerance mechanisms not related to ion toxicity in barley
Tilbrook, Joanne
2017-09-27
Soil salinity can severely reduce crop growth and yield. Many studies have investigated salinity tolerance mechanisms in cereals using phenotypes that are relatively easy to measure. The majority of these studies measured the accumulation of shoot Na+ and the effect this has on plant growth. However, plant growth is reduced immediately after exposure to NaCl before Na+ accumulates to toxic concentrations in the shoot. In this study, nondestructive and destructive measurements are used to evaluate the responses of 24 predominately Australian barley (Hordeum vulgare L.) lines at 0, 150 and 250mMNaCl. Considerable variation for shoot tolerance mechanisms not related to ion toxicity (shoot ion-independent tolerance) was found, withsome lines being able to maintain substantial growth rates under salt stress, whereas others stopped growing. Hordeum vulgare spp. spontaneum accessions and barley landraces predominantly had the best shoot ion independent tolerance, although two commercial cultivars, Fathom and Skiff, also had high tolerance. The tolerance of cv. Fathom may be caused by a recent introgression from H. vulgare L. spp. spontaneum. This study shows that the most salt-tolerant barley lines are those that contain both shoot ion-independent tolerance and the ability to exclude Na+ from the shoot (and thus maintain high K+: Na+ ratios).
Variation in shoot tolerance mechanisms not related to ion toxicity in barley
Tilbrook, Joanne; Schilling, Rhiannon K.; Berger, Bettina; Garcia, Alexandre F.; Trittermann, Christine; Coventry, Stewart; Rabie, Huwaida; Brien, Chris; Nguyen, Martin; Tester, Mark A.; Roy, Stuart J.
2017-01-01
Soil salinity can severely reduce crop growth and yield. Many studies have investigated salinity tolerance mechanisms in cereals using phenotypes that are relatively easy to measure. The majority of these studies measured the accumulation of shoot Na+ and the effect this has on plant growth. However, plant growth is reduced immediately after exposure to NaCl before Na+ accumulates to toxic concentrations in the shoot. In this study, nondestructive and destructive measurements are used to evaluate the responses of 24 predominately Australian barley (Hordeum vulgare L.) lines at 0, 150 and 250mMNaCl. Considerable variation for shoot tolerance mechanisms not related to ion toxicity (shoot ion-independent tolerance) was found, withsome lines being able to maintain substantial growth rates under salt stress, whereas others stopped growing. Hordeum vulgare spp. spontaneum accessions and barley landraces predominantly had the best shoot ion independent tolerance, although two commercial cultivars, Fathom and Skiff, also had high tolerance. The tolerance of cv. Fathom may be caused by a recent introgression from H. vulgare L. spp. spontaneum. This study shows that the most salt-tolerant barley lines are those that contain both shoot ion-independent tolerance and the ability to exclude Na+ from the shoot (and thus maintain high K+: Na+ ratios).
(GPx) activity in young barley seedlings enriched with selenium
African Journals Online (AJOL)
AJB_YOMI
2011-09-21
Sep 21, 2011 ... E-mail: guzx@njau.edu.cn. Tel/Fax: +86. 25 84396293. have been used for animal feeds and beer malts. Recently, young barley seedlings have been used as food material for people in Asian countries such as China,. Japan, and Korea. Young barley seedlings are rich in dietary fiber, chlorophyll, carotene ...
Probing interactions between B-glucan and bile salts at atomic detail by 1H-13C NMR assays
DEFF Research Database (Denmark)
Mikkelsen, Mette Skau; Cornali, Sofia Bolvig; Jensen, Morten G
2014-01-01
Polysaccharides are prospective hosts for the delivery and sequestration of bioactive guest molecules. Polysaccharides of dietary fiber, specifically cereal (1 → 3)(1 → 4)-β-glucans, play a role in lowering the blood plasma cholesterol level in humans. Direct host-guest interactions between β...... salts and β-glucans. Experiments are consistent with stronger interactions at pH 5.3 than at pH 6.5 in this in vitro assay. The changes in bile salt and β-glucan signals suggest a stabilization of bile salt micelles and concomitant conformational changes in β-glucans....
Effect of a barley-vegetable soup on plasma carotenoids and biomarkers of cardiovascular disease.
Bacchetti, Tiziana; Tullii, Domenico; Masciangelo, Simona; Gesuita, Rosaria; Skrami, Edlira; Brugè, Francesca; Silvestri, Sonia; Orlando, Patrick; Tiano, Luca; Ferretti, Gianna
2015-07-01
Functional foods that provide benefits beyond their traditional nutritional value have attracted much interest. Aim of the study was to evaluate the nutritional and the functional properties of a frozen ready-to-eat soup containing barley and pigmented vegetables. Both glycaemic index and the glyceamic load of ready-to-eat soup were evaluated in vivo. Moreover the bioavailability of carotenoids (lutein and beta-carotene) and the effect on lipid profile and lipid peroxidation were studied in 38 volunteers whose diet was supplemented for two weeks with a daily portion (250 g) of the ready-to-eat soup. Plasma levels of carotenoids (lutein and beta-carotene) and plasma total antioxidant capacity significantly increased after 2 weeks of treatment. Furthermore, we observed a decrease in the levels of lipids (total cholesterol and low density lipoprotein-cholesterol) and of markers of lipid peroxidation (oxidized low density lipoprotein and lipid hydroperoxides) in plasma of all subjects. The glyceamic index of the product was 36, therefore it could be considered a low glyceamic index food. An accurate selection of vegetable foods results in a palatable and healthy product that provides benefits on plasma lipids and lipid peroxidation (Protocol number 211525).
Silva, Viviam de Oliveira; Pereira, Luciano José; Murata, Ramiro Mendonça
2017-03-07
The aim of this study was to evaluate the effects of β-glucan on the expression of inflammatory mediators and metabolomic profile of oral cells [keratinocytes (OBA-9) and fibroblasts (HGF-1) in a dual-chamber model] infected by Aggregatibacter actinomycetemcomitans. The periodontopathogen was applied and allowed to cross the top layer of cells (OBA-9) to reach the bottom layer of cells (HGF-1) and induce the synthesis of immune factors and cytokines in the host cells. β-glucan (10 μg/mL or 20 μg/mL) were added, and the transcriptional factors and metabolites produced were quantified in the remaining cell layers and supernatant. The relative expression of interleukin (IL)-1-α and IL-18 genes in HGF-1 decreased with 10 μg/mL or 20 μg/mL of β-glucan, where as the expression of PTGS-2 decreased only with 10 μg/mL. The expression of IL-1-α increased with 20 μg/mL and that of IL-18 increased with 10 μg/mL in OBA-9; the expression of BCL 2, EP 300, and PTGS-2 decreased with the higher dose of β-glucan. The production of the metabolite 4-aminobutyric acid presented lower concentrations under 20 μg/mL, whereas the concentrations of 2-deoxytetronic acid NIST and oxalic acid decreased at both concentrations used. Acetophenone, benzoic acid, and pinitol presented reduced concentrations only when treated with 10 μg/mL of β-glucan. Treatment with β-glucans positively modulated the immune response and production of metabolites.
Institute of Scientific and Technical Information of China (English)
MA Tao; TU Yan; ZHANG Nai-feng; GUO Jiang-peng; DENG Kai-dong; ZHOU Yi; YUN Qiang; DIAO Qi-yu
2015-01-01
This study aimed to investigate the effects of dietary supplementation of yeastβ-glucan on the nutrient digestibility and serum proifles in pre-ruminant Holstein calves. Forty-two neonatal Holstein calves ((39.6±4.2) kg) were randomly al otted to six groups, and each was offered one of the fol owing diets:a basal diet (control) or the basal diet supplemented with 25, 50, 75, 100 or 200 mg of yeastβ-glucan kg–1 feed (dry matter basis). The basal diet consisted of a milk replacer and a starter feed. The trial lasted for 56 d. Two digestibility trials were conducted from d 14 to 20 and from d 42 to 48. Blood samples were col ected on d 0, 14, 28 and 42 for serum proifle analyses. On d 56, three calves from each group were slaughtered, and intestinal samples were col ected to assess the vil ous height, crypt depth and mucosal thickness. Although feed intake was not affected by dietary treatment (P>0.05), the average daily gain (ADG) and gain-to-feed ratios were higher (P0.05). Compared with the control group, supplementation of yeastβ-glucan decreased (P0.05). The supplementation of yeastβ-glucan stimu-lated the enzymatic activity of alkaline phosphatase (ALP) (P<0.05) compared with the control group. The lysozyme (LYZ) concentration increased quadratical y (P<0.05) with increasing yeastβ-glucan levels. The results suggested that dietary supplementation of yeastβ-glucan at 75 mg kg–1 feed improved nutrient digestibility, enhanced immunity by increasing the immunoglobulin concentration and stimulating ALP, and exerted no adverse effects on metabolism in pre-ruminant calves.
International Nuclear Information System (INIS)
Gustafsson, Aa.; Lundqvist, U.
1984-01-01
Three special cases of induced mutations in barley are discussed in this paper. They are denoted here as the Gunilla, the Pallas and the Mari cases, after the three named varieties to which the original mutants gave rise. The original mutants described represent just a small sample of the induced mutants, many of which have been tested in practice and have been further studied in basic genetics and evolutionary research. The three approved varieties have given rise to further recombination families, which also to some extent have been fused. Two of the mutant cases - Pallas and Mari - were directly useful in practice and officially approved. The third case involved a mutant of special appearance - a ''bushy type'' with an intense blue wax coating and with a supreme lodging resistance. The mutant was used in developing the Gunilla variety, which arose by recombination breeding. This variety has been highly satisfactory in further gene recombination work. A similar situation has prevailed with regard to the Pallas and Mari families arising after gene recombination, too. Up to now, the Gunilla, Pallas and Mari families include a long series of released and officially approved varieties. Several of them represent valuable agricultural contributions with wide areas of cultivation. These three mutants - with their recombination families - led to greatly increased straw stiffness and high grain production. Their phenotypic expression often corresponds to a dwarf or semidwarf description. One of the mutants - the Mari genotype - represents a group of genes and alleles which give rise to profound changes in the photoperiod (and partially also in the thermoperiod) behaviour. In fact, often even such small changes have a fundamental influence on adaptation and distribution. Data are presented analysing the property of lodging resistance with the background of plant, tiller and internode structure. A method of partial back-mutation was worked out in separating traits generally
Green Barley as an Ingredient in Pasta: Antioxidant Activity and Sensory Characteristics Evaluation
Directory of Open Access Journals (Sweden)
Ivanišová Eva
2018-03-01
Full Text Available The aims of the present study was to determine antioxidant activity, sensory properties as well as total polyphenol, flavonoid and chlorophyll content of raw and cooked pasta enriched by 1%, 3% and 5% addition of green barley powder. Results of antioxidant activity showed that increase of green barley addition increase antioxidant activity of pasta. The values in raw pasta obtained by DPPH ranged from 1.17 (control to 1.81 (5% addition mg TEAC/g DM, after cooking values ranged from 0.82 (control to 1.59 (5% addition mg TEAC/g DM. Similar tendency was signed by molybdenum reducing antioxidant power method. In enriched pasta was also found higher content of total polyphenol (0.19 in control raw sample and 1.81 mg GAE/g DM in pasta with 5 % of green barley addition; values of cooked pasta ranged from 0.10 in control sample to 0.73 mg GAE/g DM in pasta with 5 % of green barley addition as well as total flavonoid content (results of raw pasta were from 0.00 in control sample to 0.41 mg QE/g DM in pasta with 5% of green barley addition; values of cooked pasta were from 0.00 in control sample to 0.29 mg QE/g DM in variant with 5% green barley. Green barley also enriched pasta for chlorophyll with the best results in 5% addition. From prepared variants of enriched pasta the best overall acceptability was sign in 3% of green barley addition. Pastas enriched with plant-derived bioactive compounds such as green barley may confer health benefits to consumers.
Interactions of liposome carriers with infectious fungal hyphae reveals the role of β-glucans.
Chavan, Neelam L; Young, Joseph K; Drezek, Rebekah A; Lewis, Russell; Bikram, Malavosklish
2012-09-04
Relatively little is known about how liposomal formulations modulate drug delivery to fungal pathogens. We compared patterns of hyphal cell wall binding for empty rhodmine-labeled liposomes and the clinically available amphotericin B-containing liposomal formulation (AmBisome) in Aspergillus fumigatus and Candida albicans. Following 0.5 h of coincubation with A. fumigatus , empty liposomes concentrated primarily in fungal septae along at the surface of the cell wall, suggesting that liposome uptake is concentrated in areas of the cell wall where linear glucan is exposed on the cell surface, which was confirmed by aniline blue staining. Consistent with this hypothesis, pretreatment of liposomes with soluble linear glucan (laminarin) decreased liposome binding in both Aspergillus and Candida fungal hyphae, while growth of Aspergillus hyphae in the presence of an agent that increases fungal cell wall surface exposure of linear β-glucans without cell death (caspofungin) increased liposome uptake throughout the Aspergillus fungal cell wall. Increasing the polyethylene glycol (PEG) concentration in liposomes from 0 to 30% significantly increased fungal uptake of liposomes that was only modestly attenuated when fungal cells were incubated in serum concentrations ranging from 10 to 100%. The presence of β-glucans on the fungal hyphae cell walls of Aspergillus fumigatus is one of the factors responsible for mediating the binding of liposome carriers to the hyphae and could explain possible synergy reported between liposomal amphotericin B and echinocanins.
stability analysis of food barley genotypes in northern ethiopia
African Journals Online (AJOL)
ACSS
interaction and stability for barley grain yield and yield related traits in the growing ... that the environments were diverse; causing most of the variation in grain yield. ... component axes IPCA1, IPCA2 and IPCA3, which explained 58.06, 27.11 and ..... AMMI analysis of variance for grain yield (t ha-1) of food barley genotypes ...
High beta and second stability region transport and stability analysis
International Nuclear Information System (INIS)
1991-01-01
This document describes ideal and resistive MHD studies of high-beta plasmas and of the second stability region. Significant progress is reported on the resistive stability properties of high beta poloidal ''supershot'' discharges. For these studies initial profiles were taken from the TRANSP code which is used extensively to analyze experimental data. When an ad hoc method of removing the finite pressure stabilization of tearing modes is implemented it is shown that there is substantial agreement between MHD stability computation and experiment. In particular, the mode structures observed experimentally are consistent with the predictions of the resistive MHD model. We also report on resistive stability near the transition to the second region in TFTR. Tearing modes associated with a nearby infernal mode may explain the increase in MHD activity seen in high beta supershots and which impede the realization of Q∼1. We also report on a collaborative study with PPPL involving sawtooth stabilization with ICRF
Towards a more versatile alpha-glucan biosynthesis in plants
Kok-Jacon, G.A.; Qin, J.; Vincken, J.P.; Visser, R.G.F.
2003-01-01
Starch is an important storage polysaccharide in many plants. It is composed of densely packed alpha-glucans, consisting of 1,4- and 1,4,6-linked glucose residues. The starch polymers are used in many industrial applications. The biosynthetic machinery for assembling the granule has been manipulated
Hordein Variation in Wild (Hordeum Spontaneum) and Cultivated (H. Vulgare) Barley
DEFF Research Database (Denmark)
Doll, Hans; Brown, A. H. D.
1979-01-01
The storage protein hordein contains two major groups of polypeptides which are highly polymorphic in barley, and in its evolutionary progenitor Hordeum spontaneum Koch. Crosses between the two species showed that the complex electrophoretic phenotypes within the two groups of polypeptides are go...
Development and characterization of polymorphic EST based SSR markers in barley (Hordeum vulgare).
Jo, Won-Sam; Kim, Hye-Yeong; Kim, Kyung-Min
2017-08-01
In barley, breeding using good genetic characteristics can improve the quality or quantity of crop characters from one generation to the next generation. The development of effective molecular markers in barley is crucial for understanding and analyzing the diversity of useful alleles. In this study, we conducted genetic relationship analysis using expressed sequence tag-simple sequence repeat (EST-SSR) markers for barley identification and assessment of barley cultivar similarity. Seeds from 82 cultivars, including 31 each of naked and hulled barley from the Korea Seed and Variety Service and 20 of malting barley from the RDA-Genebank Information Center, were analyzed in this study. A cDNA library of the cultivar Gwanbori was constructed for use in analysis of genetic relationships, and 58 EST-SSR markers were developed and characterized. In total, 47 SSR markers were employed to analyze polymorphisms. A relationship dendrogram based on the polymorphism data was constructed to compare genetic diversity. We found that the polymorphism information content among the examined cultivars was 0.519, which indicates that there is low genetic diversity among Korean barley cultivars. The results obtained in this study may be useful in preventing redundant investment in new cultivars and in resolving disputes over seed patents. Our approach can be used by companies and government groups to develop different cultivars with distinguishable markers. In addition, the developed markers can be used for quantitative trait locus analysis to improve both the quantity and the quality of cultivated barley.
Hossain, Akbar; Teixeira da Silva, Jaime A.; Lozovskaya, Marina Viacheslavovna; Zvolinsky, Vacheslav Petrovich
2012-01-01
Heat stress, when combined with drought, is one of the major limitations to food production worldwide, especially in areas that use rainfed agriculture. As the world population continues to grow, and water resources for the crop production decline and temperature increases, so the development of heat- and drought-tolerant cultivars is an issue of global concern. In this context, four barley and two wheat genotypes were evaluated in south-eastern Russia to identify heat- and drought-tolerant genotypes for future breeding programmes by identifying suitable sowing times for specific genotypes. High temperature stress, when combined with drought during late sowing, decreased the days to visible awns, days to heading and days to ripe harvest, finally negatively affecting the growth and development of plants and resulting in a lower plant population m−2, tillers plant−1, plant height and dry matter production m−2. On the other hand, low temperature in combination with early sowing increased the number of days to germination, reduced seedling stand establishment and tillering capacity, finally affecting the growth and development of the crops. Compared to overall performance and optimum sowing date, barley genotypes ‘Zernograd.770’ and ‘Nutans’, and wheat genotype ‘Line4’ performed best in both late (high temperature with drought) and early (low temperature) stress conditions. PMID:23961209
(1→3)-β-D-Glucan Assay in Monitoring Response to Anti-Fungal Therapy in Fungal Endocarditis.
Slim, Jihad; Saling, Christopher; Szabela, Maria; Brown, Melinda; Johnson, Tamara; Goldfarb, Irvin
2017-03-01
A case is reported of Candida glabrata infective endocarditis (IE) treated without surgical intervention. The study aim was to: (i) briefly discuss the outcomes of other documented cases of fungal IE managed medically with fluconazole; (ii) discuss the (1→3)-β-D-glucan assay and its previously studied role in the diagnosis of invasive fungal infections; and (iii) examine a possible application of the (1→3)-β-D-glucan assay to monitor response to antifungal treatment in patients with Candida endocarditis. The serum Fungitell assay was used to trend (1→3)-β-D-glucan in a patient with Candida endocarditis to determine treatment effectiveness with fluconazole, to provide an appropriate end date for antifungal therapy, and to survey infection suppression while off treatment. The (1→03)-β-D-glucan assay began trending downwards at 197 days into treatment with oral fluconazole. After 16 months of therapy, fluconazole was stopped due to transaminitis. (1→3)-β-Dglucan levels were checked six weeks after the discontinuation of treatment and were negative. The patient has now been off therapy for 21 weeks with no signs of clinical disease, and values remain negative. The present case indicates that a trending (1→3)-β-D-glucan assay may have valuable application in monitoring treatment response and infection suppression for Candida endocarditis.
On the Demand for High-beta Stocks
DEFF Research Database (Denmark)
Christoffersen, Susan E. K.; Simutin, Mikhail
2017-01-01
Prior studies have documented that pension plan sponsors often monitor a fund’s performance relative to a benchmark. We use a first-difference approach to show that in an effort to beat benchmarks, fund managers controlling large pension assets tend to increase their exposure to high-beta stocks...
Directory of Open Access Journals (Sweden)
Stanca Michele A
2010-04-01
Full Text Available Abstract Background Epigenetic phenomena have been associated with the regulation of active and silent chromatin states achieved by modifications of chromatin structure through DNA methylation, and histone post-translational modifications. The latter is accomplished, in part, through the action of PcG (Polycomb group protein complexes which methylate nucleosomal histone tails at specific sites, ultimately leading to chromatin compaction and gene silencing. Different PcG complex variants operating during different developmental stages have been described in plants. In particular, the so-called FIE/MEA/FIS2 complex governs the expression of genes important in embryo and endosperm development in Arabidopsis. In our effort to understand the epigenetic mechanisms regulating seed development in barley (Hordeum vulgare, an agronomically important monocot plant cultivated for its endosperm, we set out to characterize the genes encoding barley PcG proteins. Results Four barley PcG gene homologues, named HvFIE, HvE(Z, HvSu(z12a, and HvSu(z12b were identified and structurally and phylogenetically characterized. The corresponding genes HvFIE, HvE(Z, HvSu(z12a, and HvSu(z12b were mapped onto barley chromosomes 7H, 4H, 2H and 5H, respectively. Expression analysis of the PcG genes revealed significant differences in gene expression among tissues and seed developmental stages and between barley cultivars with varying seed size. Furthermore, HvFIE and HvE(Z gene expression was responsive to the abiotic stress-related hormone abscisic acid (ABA known to be involved in seed maturation, dormancy and germination. Conclusion This study reports the first characterization of the PcG homologues, HvFIE, HvE(Z, HvSu(z12a and HvSu(z12b in barley. All genes co-localized with known chromosomal regions responsible for malting quality related traits, suggesting that they might be used for developing molecular markers to be applied in marker assisted selection. The Pc
Douxfils, Jessica; Fierro-Castro, Camino; Mandiki, S N M; Emile, Wakson; Tort, Lluis; Kestemont, Patrick
2017-04-01
Although β-glucans stimulating effects have already been demonstrated on the immune system of numerous animal species, available data remain relatively variable and more research should be done regarding the complexity of underlying mechanisms. In this context, the present study aimed to evaluate the stress and immune-related effects of dietary β-glucans (i.e. Macrogard ® ) by considering a number of influencing factors such as the dose (0, 0.1, 0.2 and 0.5% in food), feeding duration (15 versus 30 days), tissue (blood, kidney, spleen, gills) and infection status (healthy or infected). Blood parameters (lysozyme, ACH50 activities, leucocyte populations) and mRNA expression level of several immune- and stress-related genes (TFN-α1, IL-1β, IL10, COX-2, TGF-β, MC2R, HSP70) were measured. Our results suggest that spleen may be a highly responsive organ to dietary β-glucans both in healthy or infected fish, and that this organ may therefore significantly contribute to the immune reinforcement induced by such immunostimulatory diet. Our study further reveals that overdoses of β-glucans and/or prolonged medication can lead to a non-reactive physiological status and, consequently, to a poor immune response. All in all, the current data emphasizes the need for further extensive research in the field of dietary β-glucans as a preventive method for farmed fish protection. Copyright © 2017 Elsevier Ltd. All rights reserved.
Yang, Fang; Xiao, Dan; Han, Huaxin; Chen, Yuhuan; Li, Gang
2018-07-15
A novel amphiphilic polymeric drug carrier was synthesized through grafting polymerization of water-soluble 1,4-β-D-glucan from cotton cellulose tailored and polypropylene oxide (PPO), and then use thereof to synthesize graft copolymer 1,4-β-D-glucan-PPO-docetaxel (DTX). The products were characterized by FTIR, 1 H NMR, and 13 C NMR. The physicochemical characteristics of 1,4-β-D-glucan-PPO and 1,4-β-D-glucan-PPO-DTX such as molecular weight distribution (MWD), micro-morphology, size, critical micelle concentration (CMC), aggregation number of micelle (N), in vitro stability and drug pharmacokinetic study in vivo were investigated. The results reveal that the degree of polymerization (DP) of the water-soluble 1,4-β-D-glucan from cotton cellulose tailored is equal to 7; the 1,4-β-D-glucan-PPO surfactant possesses good surface activity while the adduct number of propylene oxide reaches appropriately to 20; the DTX is completely dispersed in water medium with 1,4-β-D-glucan-PPO-DTX micelle and the drug conjugated percent is up to 40.3%; In vitro study confirms that 1,4-β-D-glucan-PPO-DTX has the capacity for sustained drug release; In plasma, 1,4-β-D-glucan-PPO-DTX exhibits a significantly enhanced C max , AUC (0-t) and T 1/2 compared with DTX. These results demonstrate that 1,4-β-D-glucan-PPO has the potential to be used as a novel biocompatible biomaterial for drug delivery. Copyright © 2018 Elsevier B.V. All rights reserved.
Barley yellow dwarf virus in barley crops in Tunisia: prevalence and molecular characterization
Directory of Open Access Journals (Sweden)
Asma NAJAR
2017-05-01
Full Text Available A field survey was conducted in Tunisia in the North-Eastern regions (Bizerte, CapBon and Zaghouan, the North-Western region (Kef and the Central-Eastern region (Kairouan during the 2011/2012 growing season, in order to determine the incidence and the geographic distribution of Barley yellow dwarf virus (BYDVs in barley fields. Tissue blot immunoassays (TBIA showed that BYDV was most common in Zaghouan (incidence 14%, Cap Bon (14% and Bizerte (35%, in randomly collected samples from these three locations.Among the different BYDVs identified, BYDV-PAV (64% was the most common followed by BYDV-MAV (16% and CYDV-RPV (3%. The coat protein gene sequences of six isolates collected from different regions shared >98% pairwise similarity. In comparisons with other BYDV sequences from around the world, the Tunisian sequences shared greatest homology with isolates 109 and ASL1 from the United States of America and Germany (≈97%, and <90% with all other isolate sequences available in public databases.
Protective effect of yeast β-glucan on immune system of mice irradiated by carbon ions
International Nuclear Information System (INIS)
Wang Ying; Lu Dong; Wei Wei; Jing Xigang; Wang Jufang; Li Wenjian
2012-01-01
Abstract. To detect Yeast β-glucan's protective effect on mice's immune system after C ion beam radiation, mice were used as the test model. We observed the weight, hair color and behavior of mice everyday within a 7 d period of time after irradiation. Meanwhile, the content of white blood cell, on the 2nd and 7th day after irradiation was detected. We detected the thymus and spleen SOD, GSH-PX activity and MDA content of the mice on the 8th day. The results showed that yeast β-glucan could reduce the rapid weight loss of mice, increase white blood cell content, increase thymus and spleen SOD, GSH-PX activity, decrease MDA content of thymus and spleen. These results indicate that yeast 13-glucan can protect mice's immune system against C ion beam radiation damage. (authors)
Genes controlling seed dormancy and pre-harvest sprouting in a rice-wheat-barley comparison
DEFF Research Database (Denmark)
Li, Chengdao; Ni, Peixiang; Francki, Michael
2004-01-01
Pre-harvest sprouting results in significant economic loss for the grain industry around the world. Lack of adequate seed dormancy is the major reason for pre-harvest sprouting in the field under wet weather conditions. Although this trait is governed by multiple genes it is also highly heritable....... A major QTL controlling both pre-harvest sprouting and seed dormancy has been identified on the long arm of barley chromosome 5H, and it explains over 70% of the phenotypic variation. Comparative genomics approaches among barley, wheat and rice were used to identify candidate gene(s) controlling seed...... dormancy and hence one aspect of pre-harvest sprouting. The barley seed dormancy/pre-harvest sprouting QTL was located in a region that showed good synteny with the terminal end of the long arm of rice chromosome 3. The rice DNA sequences were annotated and a gene encoding GA20-oxidase was identified...
DEFF Research Database (Denmark)
Finnie, C.; Andersen, C.H.; Borch, J.
2002-01-01
14-3-3 proteins form a family of highly conserved proteins with central roles in many eukaryotic signalling networks. In plants, they bind to and activate the plasma membrane H+-ATPase, creating a binding site for the phytotoxin fusicoccin. Barley 14-3-3 transcripts accumulate in the epidermis upon...... inoculation with the powdery mildew fungus. We have isolated a cDNA encoding a plasma membrane H+-ATPase (HvHA1), which is also induced by powdery mildew attack. The C-terminal domain of this H+-ATPase interacts with 14-3-3 proteins in the yeast two-hybrid system. Inoculation with the powdery mildew fungus......, or treatment with fusicoccin, results in an increase in fusicoccin binding ability of barley leaf membranes. Overlay assays show a fungus-induced increase in binding of digoxygenin-labelled 14-3-3 protein to several proteins including a 100 kDa membrane protein, probably the plasma membrane H...
Purification and characterization of a novel lichenase from Bacillus licheniformis GZ-2.
Gao, Zhen
2016-01-01
A novel lichenase from Bacillus licheniformis GZ-2 was purified to homogeneity by two steps ion-exchange chromatography with a specific activity of 8231.3 U/mg. The purified enzyme showed as a single protein band with a molecular mass of 25 kDa. The optimum pH and temperature for the enzyme activity were 6.5 and 60 °C, respectively. The enzyme exhibited strict specificity for β-1,3-1,4-d-glucans. The kinetic parameters Km and Vmax were 5.11 mg/mL and 2097 µmol/Min/mg for lichenan and 7.42 mg/mL and 1440 µmol/Min/mg for barley β-glucan. Compared to most of the reported β-1,3-1,4-glucanases (lichenase), the activity of the purified enzyme for lichenan was much higher than that for barley β-glucan. The main products of β-glucan hydrolyzed by the lichenase were cellubiosyltriose (DP3) and cellutriosyltraose (DP4). The lichenase gene from B. licheniformis GZ-2 was cloned and sequenced. The open reading frame of gene gz-2 contained 642 bp coding for a 214 amino acid mature protein. The gene was cloned into an expression vector pET 28a and expressed in Escherichia coli BL21. The activity in cell lysate supernatant was 137.9 U/mg. © 2014 International Union of Biochemistry and Molecular Biology, Inc.
Reduction of deoxynivalenol in barley by treatment with aqueous sodium carbonate and heat.
Abramson, David; House, James D; Nyachoti, C Martin
2005-11-01
Naturally contaminated lots of Canadian barley containing either 18.4 or 4.3 microg/g deoxynivalenol (DON) were heated at 80 degrees C, with small amounts of water or 1 M sodium carbonate solution to study the rate of DON reduction. Samples were heated in sealed polypropylene containers for periods of up to 8 days. In the 18.4 microg/g DON barley, rapid reductions were observed: with no solutions added, DON declined to 14.7 microg/g after 1 day, and to 4.9 microg/g after 8 days solely due to heat; with water at 10 mL/100 g barley, DON levels reached 3.7 microg/g after 8 days; with 1 M sodium carbonate solution added at 10 mL/100 g barley, DON declined to 4.7 microg/g after 1 day, and to 0.4 microg/g after 8 days; with 20 mL/100 g barley, DON declined to 1.4 microg/g after 1 day and to near-zero levels after 8 days. In the 4.3 microg/g DON barley, more gradual reductions were evident: with no solutions added, DON declined to 2.9 microg/g after 8 days solely due to heat; with water at 10 mL/100 g barley, DON levels reached 2.3 microg/g after 8 days; with 1 M sodium carbonate solution added at 10 mL/100 g barley, DON declined to 2.7 microg/g after 1 day, and to near-zero levels after 8 days; with 20 mL/100 g barley, DON declined to 1.4 microg/g after 1 day and to near-zero levels after 3, 5 and 8 days.
International Nuclear Information System (INIS)
Dickinson, K.E.; Heald, S.L.; Jeffs, P.W.; Lefkowitz, R.J.; Caron, M.G.
1985-01-01
Para-(Bromoacetamidyl)benzylcarazolol (pBABC) was synthesized and found to be an extremely potent affinity label for beta-adrenergic receptors. Its interaction with mammalian (rabbit and hamster lung) and nonmammalian (turkey and frog erythrocyte) beta-adrenergic receptors was similar, displaying EC 50 values of 400-900 pM for inhibiting 125 I-cyanopindolol binding to these receptors. pBABC reduced the number of beta-adrenergic receptors in frog erythrocyte membranes, without any change in the affinity of the remaining sites for [ 125 I]iodocyanopindolol. pBABC has been radioiodinated. As assessed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis, this affinity probe specifically labeled the beta-adrenergic peptide of a purified preparation of hamster lung, with high efficiency (approximately 40%) and with a pharmacological specificity characteristic of an interaction at the beta 2-adrenergic receptor ligand-binding site. Comparison of the proteolyzed products derived from purified receptor labeled with [ 125 I]pBABC and with the photoaffinity agent [ 125 I]p-azidobenzylcarazolol suggested that covalent labeling of the beta-adrenergic receptor by these probes occurs at similar domains of the beta-adrenergic receptor
Autoradiographic study on moisture distribution in pearl-barley and in rice grain
International Nuclear Information System (INIS)
Sakharov, Eh.V.; Koz'mina, E.P.; Troitskaya, E.Ya
1975-01-01
The dependence of some structural details of the pearl-barley and rice endosperm on the internal moisture distribution is found. The general scheme of the study is shown. The curves of the local moisture distribution in the pearly-barley and rice kernel are plotted according to the radiography data. Moisture distribution over the whole section of the rice kernel is relatively constant at 85 deg C after ten minutes of moisture. Whereas moisture of pearl-barley kernel is only approaching the center of kernel by the time the moisture content increases to 1.5-2%. The slow moisture transfer in the pearl-barley kernel makes the cooking period three times longer as that of the rice
Radiosensitivity study of cultured barley (hordeum vulgare)
International Nuclear Information System (INIS)
Wang Cailian; Shen Mei; Xu Gang; Zhao Kongnan; Chen Qiufang
1991-07-01
For studying the radioactivity, forty seven varieties of dormant barley seeds were irradiated with various doses (0 ∼ 400 Gy) of 137 Cs γ-rays. The results showed that the dose-effects relations of seedling growth inhibition could be fitted by an equation of F(D) = 1 - (1 - e -a 1 D ) N , and the dose-effects of cell-nucleus, the frequency of root tip cell with chromosome aberations and peroxidase isoenzyme band could be expressed by a linear regression equation Y = A + B · X. The radioactivity of naked barley was much higher than of covered barley. According to different radiosensitivities the varieties studied could be divided into five types i.e. extreme resistant, resistant, intermediate, sensitive, and extreme sensitive. The results also showed that there was close relationship between the DNA content of cell-nucleus, peroxidase isoenzyme zymogram and radioactivity. The radiosensitivty was proportional to the DNA content. The volume of cell-nucleus varied inversly as D 50 of nucleus volume and no obvious correlation with the D 50 of seedling growth inhibition
[Biological contamination in office buildings related to ventilation/air conditioning system].
Bródka, Karolina; Sowiak, Małgorzata; Kozajda, Anna; Cyprowski, Marcin; Irena, Szadkowska-Stańczyk
2012-01-01
Indoor air is contaminated with microorganisms coming from both the atmospheric air and sources present in premises. The aim of this study was to analyze the concentrations of biological agents in office buildings, dependending on ventilation/air conditioning system and season. The study covered office buildings (different in the system of ventila-tion/air conditioning). Air samples for assessing the levels of inhalable dust, endotoxins and (1-->3)-beta-D-glucans, were taken at the selected stationary points of each building during summer and winter. The air was sampled for 6 h, using portable sets consisting of the GilAir 5 pump and the head filled with a filter of fiber glass. The samples for the presence of airborne bacteria and fungi were collected twice during the day using the impaction method. Average concentrations of inhalable dust, bacteria, fungi, endotoxins and (1-->3)-beta-D-glucans in office premises were 0.09 mg/m3, 6.00 x 10(2) cfu/m3, 4.59 x 10(1) cfu/m3, 0.42 ng/m3 and 3.91 ng/m3, respectively. Higher concentrations of the investigated agents were found in summer. In premises with air conditioning concentrations of airborne fungi, (1-->3)-beta-D-glucans and inhalable dust were significantly lower in winter. In summer the trend was reverse except for (1-->3)-beta-D-glucans. Concentrations of biological agents were affected by the season and the presence of air conditioning. Concentrations of inhalable dust, bacteria, fungi, endotoxins and (1-->3)-beta-D-glucans, observed inside the office buildings, were significantly higher in summer than in winter. The presence of the air conditioning system modified in various ways the levels of biological agents. Its influence was greater on the concentration of fungi and (1-->3)-beta-D-glucans than on that of bacteria and endotoxins.